Validation of a same-day real-time PCR method for screening of meat and carcass swabs for Salmonella
DEFF Research Database (Denmark)
Löfström, Charlotta; Krause, Michael; Josefsen, Mathilde Hartmann
2009-01-01
of the published PCR methods for Salmonella have been validated in collaborative studies. This study describes a validation including comparative and collaborative trials, based on the recommendations from the Nordic organization for validation of alternative microbiological methods (NordVal) of a same-day, non....... Partly based on results obtained in this study, the method has obtained NordVal approval for analysis of Salmonella in meat and carcass swabs. The PCR method was transferred to a production laboratory and the performance was compared with the BAX Salmonella test on 39 pork samples artificially...... contaminated with Salmonella. There was no significant difference in the results obtained by the two methods. Conclusion: The real-time PCR method for detection of Salmonella in meat and carcass swabs was validated in comparative and collaborative trials according to NordVal recommendations. The PCR method...
Gianfranceschi, Monica Virginia; Rodriguez-Lazaro, David; Hernandez, Marta; González-García, Patricia; Comin, Damiano; Gattuso, Antonietta; Delibato, Elisabetta; Sonnessa, Michele; Pasquali, Frederique; Prencipe, Vincenza; Sreter-Lancz, Zuzsanna; Saiz-Abajo, María-José; Pérez-De-Juan, Javier; Butrón, Javier; Kozačinski, Lidija; Tomic, Danijela Horvatek; Zdolec, Nevijo; Johannessen, Gro S; Jakočiūnė, Džiuginta; Olsen, John Elmerdahl; De Santis, Paola; Lovari, Sarah; Bertasi, Barbara; Pavoni, Enrico; Paiusco, Antonella; De Cesare, Alessandra; Manfreda, Gerardo; De Medici, Dario
2014-08-01
The classical microbiological method for detection of Listeria monocytogenes requires around 7 days for final confirmation, and due to perishable nature of RTE food products, there is a clear need for an alternative methodology for detection of this pathogen. This study presents an international (at European level) ISO 16140-based validation trial of a non-proprietary real-time PCR-based methodology that can generate final results in the following day of the analysis. This methodology is based on an ISO compatible enrichment coupled to a bacterial DNA extraction and a consolidated real-time PCR assay. Twelve laboratories from six European countries participated in this trial, and soft cheese was selected as food model since it can represent a difficult matrix for the bacterial DNA extraction and real-time PCR amplification. The limit of detection observed was down to 10 CFU per 25 of sample, showing excellent concordance and accordance values between samples and laboratories (>75%). In addition, excellent values were obtained for relative accuracy, specificity and sensitivity (82.75%, 96.70% and 97.62%, respectively) when the results obtained for the real-time PCR-based methods were compared to those of the ISO 11290-1 standard method. An interesting observation was that the L. monocytogenes detection by the real-time PCR method was less affected in the presence of Listeria innocua in the contaminated samples, proving therefore to be more reliable than the reference method. The results of this international trial demonstrate that the evaluated real-time PCR-based method represents an excellent alterative to the ISO standard since it shows a higher performance as well as reduce the extent of the analytical process, and can be easily implemented routinely by the competent authorities and food industry laboratories. Copyright © 2014 Elsevier B.V. All rights reserved.
Development and validation of a Q-PCR based TCID50 method for human herpesvirus 6
Directory of Open Access Journals (Sweden)
Gustafsson Rasmus K L
2012-12-01
Full Text Available Abstract Background For titer assessment of human herpesvirus 6 (HHV-6, IFA targeting viral proteins or a TCID50 method with ocular inspection for CPE can be used. These methods rely on the subjective decision of the assessor, obstructing the ability to obtain unanimous results. Findings We have developed and validated an alternative TCID50 read-out approach where infection in the titration culture plate is assessed by viral DNA load change by quantitative PCR. A ten time increase in viral DNA load was determined as cut point for infection since that yielded a maximum correlation with viral protein expression (93%. The average intra-assay CV was 9% for quantitative PCR read-out of TCID50 compared to 45% for ocular inspection read-out of TCID50, 14% for IFA read-out of TCID50, and 43% for an infectious units approach using IFA. The average inter-assay CV for quantitative PCR read-out of TCID50 was 73%, compared to 66%, 25% and 77% for the ocular inspection read-out for TCID50, IFA read-out of TCID50 and infectious unit approaches respectively. Conclusions The quantitative PCR based read-out of TCID50 proved to be more robust and easier to interpret than traditional TCID50 assessment approaches for HHV-6, and therefore it might be considered as an alternative method.
Increased efficacy for in-house validation of real-time PCR GMO detection methods.
Scholtens, I M J; Kok, E J; Hougs, L; Molenaar, B; Thissen, J T N M; van der Voet, H
2010-03-01
To improve the efficacy of the in-house validation of GMO detection methods (DNA isolation and real-time PCR, polymerase chain reaction), a study was performed to gain insight in the contribution of the different steps of the GMO detection method to the repeatability and in-house reproducibility. In the present study, 19 methods for (GM) soy, maize canola and potato were validated in-house of which 14 on the basis of an 8-day validation scheme using eight different samples and five on the basis of a more concise validation protocol. In this way, data was obtained with respect to the detection limit, accuracy and precision. Also, decision limits were calculated for declaring non-conformance (>0.9%) with 95% reliability. In order to estimate the contribution of the different steps in the GMO analysis to the total variation variance components were estimated using REML (residual maximum likelihood method). From these components, relative standard deviations for repeatability and reproducibility (RSD(r) and RSD(R)) were calculated. The results showed that not only the PCR reaction but also the factors 'DNA isolation' and 'PCR day' are important factors for the total variance and should therefore be included in the in-house validation. It is proposed to use a statistical model to estimate these factors from a large dataset of initial validations so that for similar GMO methods in the future, only the PCR step needs to be validated. The resulting data are discussed in the light of agreed European criteria for qualified GMO detection methods.
Validation of a same-day real-time PCR method for screening of meat and carcass swabs for Salmonella
2009-01-01
Background One of the major sources of human Salmonella infections is meat. Therefore, efficient and rapid monitoring of Salmonella in the meat production chain is necessary. Validation of alternative methods is needed to prove that the performance is equal to established methods. Very few of the published PCR methods for Salmonella have been validated in collaborative studies. This study describes a validation including comparative and collaborative trials, based on the recommendations from the Nordic organization for validation of alternative microbiological methods (NordVal) of a same-day, non-commercial real-time PCR method for detection of Salmonella in meat and carcass swabs. Results The comparative trial was performed against a reference method (NMKL-71:5, 1999) using artificially and naturally contaminated samples (60 minced veal and pork meat samples, 60 poultry neck-skins, and 120 pig carcass swabs). The relative accuracy was 99%, relative detection level 100%, relative sensitivity 103% and relative specificity 100%. The collaborative trial included six laboratories testing minced meat, poultry neck-skins, and carcass swabs as un-inoculated samples and samples artificially contaminated with 1–10 CFU/25 g, and 10–100 CFU/25 g. Valid results were obtained from five of the laboratories and used for the statistical analysis. Apart from one of the non-inoculated samples being false positive with PCR for one of the laboratories, no false positive or false negative results were reported. Partly based on results obtained in this study, the method has obtained NordVal approval for analysis of Salmonella in meat and carcass swabs. The PCR method was transferred to a production laboratory and the performance was compared with the BAX Salmonella test on 39 pork samples artificially contaminated with Salmonella. There was no significant difference in the results obtained by the two methods. Conclusion The real-time PCR method for detection of Salmonella in meat
Mano, Junichi; Masubuchi, Tomoko; Hatano, Shuko; Futo, Satoshi; Koiwa, Tomohiro; Minegishi, Yasutaka; Noguchi, Akio; Kondo, Kazunari; Akiyama, Hiroshi; Teshima, Reiko; Kurashima, Takeyo; Takabatake, Reona; Kitta, Kazumi
2013-01-01
In this article, we report a novel real-time PCR-based analytical method for quantitation of the GM maize event LY038. We designed LY038-specific and maize endogenous reference DNA-specific PCR amplifications. After confirming the specificity and linearity of the LY038-specific PCR amplification, we determined the conversion factor required to calculate the weight-based content of GM organism (GMO) in a multilaboratory evaluation. Finally, in order to validate the developed method, an interlaboratory collaborative trial according to the internationally harmonized guidelines was performed with blind DNA samples containing LY038 at the mixing levels of 0, 0.5, 1.0, 5.0 and 10.0%. The precision of the method was evaluated as the RSD of reproducibility (RSDR), and the values obtained were all less than 25%. The limit of quantitation of the method was judged to be 0.5% based on the definition of ISO 24276 guideline. The results from the collaborative trial suggested that the developed quantitative method would be suitable for practical testing of LY038 maize.
DEFF Research Database (Denmark)
Löfström, Charlotta; Hoorfar, Jeffrey
2012-01-01
A comparative study of a 20-hr, non-commercial, open-formula PCR method and the standard culture-based method NMKL 187, for detection of Salmonella, was performed according to the validation protocol from the Nordic organization for validation of alternative microbiological methods (NordVal) on 81...
European validation of Real-Time PCR method for detection of Salmonella spp. in pork meat.
Delibato, Elisabetta; Rodriguez-Lazaro, David; Gianfranceschi, Monica; De Cesare, Alessandra; Comin, Damiano; Gattuso, Antonietta; Hernandez, Marta; Sonnessa, Michele; Pasquali, Frédérique; Sreter-Lancz, Zuzsanna; Saiz-Abajo, María-José; Pérez-De-Juan, Javier; Butrón, Javier; Prukner-Radovcic, Estella; Horvatek Tomic, Danijela; Johannessen, Gro S; Jakočiūnė, Džiuginta; Olsen, John E; Chemaly, Marianne; Le Gall, Francoise; González-García, Patricia; Lettini, Antonia Anna; Lukac, Maja; Quesne, Segolénè; Zampieron, Claudia; De Santis, Paola; Lovari, Sarah; Bertasi, Barbara; Pavoni, Enrico; Proroga, Yolande T R; Capuano, Federico; Manfreda, Gerardo; De Medici, Dario
2014-08-01
The classical microbiological method for detection of Salmonella spp. requires more than five days for final confirmation, and consequently there is a need for an alternative methodology for detection of this pathogen particularly in those food categories with a short shelf-life. This study presents an international (at European level) ISO 16140-based validation study of a non-proprietary Real-Time PCR-based method that can generate final results the day following sample analysis. It is based on an ISO compatible enrichment coupled to an easy and inexpensive DNA extraction and a consolidated Real-Time PCR assay. Thirteen laboratories from seven European Countries participated to this trial, and pork meat was selected as food model. The limit of detection observed was down to 10 CFU per 25 g of sample, showing excellent concordance and accordance values between samples and laboratories (100%). In addition, excellent values were obtained for relative accuracy, specificity and sensitivity (100%) when the results obtained for the Real-Time PCR-based methods were compared to those of the ISO 6579:2002 standard method. The results of this international trial demonstrate that the evaluated Real-Time PCR-based method represents an excellent alternative to the ISO standard. In fact, it shows an equal and solid performance as well as it reduces dramatically the extent of the analytical process, and can be easily implemented routinely by the Competent Authorities and Food Industry laboratories. Copyright © 2014 Elsevier B.V. All rights reserved.
DEFF Research Database (Denmark)
Krause, Michael; Josefsen, Mathilde Hartmann; Lund, Marianne
2006-01-01
, a faster, real-time PCR approach was validated in comparative and collaborative trials, based on recommendations from the Nordic system for validation of alternative microbiological methods (NordVal). The comparative real-time PCR trial was performed in comparison to two reference culture protocols...... fulfilled the NordVal validation criteria and has since been implemented at a major abattoir....
A standard curve based method for relative real time PCR data processing
Directory of Open Access Journals (Sweden)
Krause Andreas
2005-03-01
Full Text Available Abstract Background Currently real time PCR is the most precise method by which to measure gene expression. The method generates a large amount of raw numerical data and processing may notably influence final results. The data processing is based either on standard curves or on PCR efficiency assessment. At the moment, the PCR efficiency approach is preferred in relative PCR whilst the standard curve is often used for absolute PCR. However, there are no barriers to employ standard curves for relative PCR. This article provides an implementation of the standard curve method and discusses its advantages and limitations in relative real time PCR. Results We designed a procedure for data processing in relative real time PCR. The procedure completely avoids PCR efficiency assessment, minimizes operator involvement and provides a statistical assessment of intra-assay variation. The procedure includes the following steps. (I Noise is filtered from raw fluorescence readings by smoothing, baseline subtraction and amplitude normalization. (II The optimal threshold is selected automatically from regression parameters of the standard curve. (III Crossing points (CPs are derived directly from coordinates of points where the threshold line crosses fluorescence plots obtained after the noise filtering. (IV The means and their variances are calculated for CPs in PCR replicas. (V The final results are derived from the CPs' means. The CPs' variances are traced to results by the law of error propagation. A detailed description and analysis of this data processing is provided. The limitations associated with the use of parametric statistical methods and amplitude normalization are specifically analyzed and found fit to the routine laboratory practice. Different options are discussed for aggregation of data obtained from multiple reference genes. Conclusion A standard curve based procedure for PCR data processing has been compiled and validated. It illustrates that
Interlaboratory diagnostic accuracy of a Salmonella specific PCR-based method
DEFF Research Database (Denmark)
Malorny, B.; Hoorfar, Jeffrey; Hugas, M.
2003-01-01
A collaborative study involving four European laboratories was conducted to investigate the diagnostic accuracy of a Salmonella specific PCR-based method, which was evaluated within the European FOOD-PCR project (http://www.pcr.dk). Each laboratory analysed by the PCR a set of independent obtained...... presumably naturally contaminated samples and compared the results with the microbiological culture method. The PCR-based method comprised a preenrichment step in buffered peptone water followed by a thermal cell lysis using a closed tube resin-based method. Artificially contaminated minced beef and whole......-based diagnostic methods and is currently proposed as international standard document....
Myers, Michael J; Yancy, Haile F; Araneta, Michael; Armour, Jennifer; Derr, Janice; Hoostelaere, Lawrence A D; Farmer, Doris; Jackson, Falana; Kiessling, William M; Koch, Henry; Lin, Huahua; Liu, Yan; Mowlds, Gabrielle; Pinero, David; Riter, Ken L; Sedwick, John; Shen, Yuelian; Wetherington, June; Younkins, Ronsha
2006-01-01
A method trial was initiated to validate the use of a commercial DNA forensic kit to extract DNA from animal feed as part of a PCR-based method. Four different PCR primer pairs (one bovine pair, one porcine pair, one ovine primer pair, and one multispecies pair) were also evaluated. Each laboratory was required to analyze a total of 120 dairy feed samples either not fortified (control, true negative) or fortified with bovine meat and bone meal, porcine meat and bone meal (PMBM), or lamb meal. Feeds were fortified with the animal meals at a concentration of 0.1% (wt/wt). Ten laboratories participated in this trial, and each laboratory was required to evaluate two different primer pairs, i.e., each PCR primer pair was evaluated by five different laboratories. The method was considered to be validated for a given animal source when three or more laboratories achieved at least 97% accuracy (29 correct of 30 samples for 96.7% accuracy, rounded up to 97%) in detecting the fortified samples for that source. Using this criterion, the method was validated for the bovine primer because three laboratories met the criterion, with an average accuracy of 98.9%. The average false-positive rate was 3.0% in these laboratories. A fourth laboratory was 80% accurate in identifying the samples fortified with bovine meat and bone meal. A fifth laboratory was not able to consistently extract the DNA from the feed samples and did not achieve the criterion for accuracy for either the bovine or multispecies PCR primers. For the porcine primers, the method was validated, with four laboratories meeting the criterion for accuracy with an average accuracy of 99.2%. The fifth laboratory had a 93.3% accuracy outcome for the porcine primer. Collectively, these five laboratories had a 1.3% false-positive rate for the porcine primer. No laboratory was able to meet the criterion for accuracy with the ovine primers, most likely because of problems with the synthesis of the primer pair; none of the
Takabatake, Reona; Masubuchi, Tomoko; Futo, Satoshi; Minegishi, Yasutaka; Noguchi, Akio; Kondo, Kazunari; Teshima, Reiko; Kurashima, Takeyo; Mano, Junichi; Kitta, Kazumi
2014-01-01
A novel real-time PCR-based analytical method was developed for the event-specific quantification of a genetically modified (GM) maize event, MIR162. We first prepared a standard plasmid for MIR162 quantification. The conversion factor (Cf) required to calculate the genetically modified organism (GMO) amount was empirically determined for two real-time PCR instruments, the Applied Biosystems 7900HT (ABI7900) and the Applied Biosystems 7500 (ABI7500) for which the determined Cf values were 0.697 and 0.635, respectively. To validate the developed method, a blind test was carried out in an interlaboratory study. The trueness and precision were evaluated as the bias and reproducibility of relative standard deviation (RSDr). The determined biases were less than 25% and the RSDr values were less than 20% at all evaluated concentrations. These results suggested that the limit of quantitation of the method was 0.5%, and that the developed method would thus be suitable for practical analyses for the detection and quantification of MIR162.
Tendency for interlaboratory precision in the GMO analysis method based on real-time PCR.
Kodama, Takashi; Kurosawa, Yasunori; Kitta, Kazumi; Naito, Shigehiro
2010-01-01
The Horwitz curve estimates interlaboratory precision as a function only of concentration, and is frequently used as a method performance criterion in food analysis with chemical methods. The quantitative biochemical methods based on real-time PCR require an analogous criterion to progressively promote method validation. We analyzed the tendency of precision using a simplex real-time PCR technique in 53 collaborative studies of seven genetically modified (GM) crops. Reproducibility standard deviation (SR) and repeatability standard deviation (Sr) of the genetically modified organism (GMO) amount (%) was more or less independent of GM crops (i.e., maize, soybean, cotton, oilseed rape, potato, sugar beet, and rice) and evaluation procedure steps. Some studies evaluated whole steps consisting of DNA extraction and PCR quantitation, whereas others focused only on the PCR quantitation step by using DNA extraction solutions. Therefore, SR and Sr for GMO amount (%) are functions only of concentration similar to the Horwitz curve. We proposed S(R) = 0.1971C 0.8685 and S(r) = 0.1478C 0.8424, where C is the GMO amount (%). We also proposed a method performance index in GMO quantitative methods that is analogous to the Horwitz Ratio.
A rapid and direct real time PCR-based method for identification of Salmonella spp
DEFF Research Database (Denmark)
Rodriguez-Lazaro, D.; Hernández, Marta; Esteve, T.
2003-01-01
The aim of this work was the validation of a rapid, real-time PCR assay based on TaqMan((R)) technology for the unequivocal identification of Salmonella spp. to be used directly on an agar-grown colony. A real-time PCR system targeting at the Salmonella spp. invA gene was optimized and validated ...
Patel, Divya A.; Shih, Yang-Jen; Newton, Duane W.; Michael, Claire W.; Oeth, Paul A.; Kane, Michael D.; Opipari, Anthony W.; Ruffin, Mack T.; Kalikin, Linda M.; Kurnit, David M.
2010-01-01
Knowledge of the central role of high-risk human papillomavirus (HPV) in cervical carcinogenesis, coupled with an emerging need to monitor the efficacy of newly introduced HPV vaccines, warrant development and evaluation of type-specific, quantitative HPV detection methods. In the present study, a prototype PCR and mass spectroscopy (PCR-MS)-based method to detect and quantitate 13 high-risk HPV types is compared to the Hybrid Capture 2 High Risk HPV DNA test (HC2; Digene Corp., Gaithersburg, MD) in 199 cervical scraping samples and to DNA sequencing in 77 cervical tumor samples. High-risk HPV types were detected in 76/77 (98.7%) cervical tumor samples by PCR-MS. Degenerate and type-specific sequencing confirmed the types detected by PCR-MS. In 199 cervical scraping samples, all 13 HPV types were detected by PCR-MS. Eighteen (14.5%) of 124 cervical scraping samples that were positive for high-risk HPV by HC2 were negative by PCR-MS. In all these cases, degenerate DNA sequencing failed to detect any of the 13 high-risk HPV types. Nearly half (46.7%) of the 75 cervical scraping samples that were negative for high-risk HPV by the HC2 assay were positive by PCR-MS. Type-specific sequencing in a subset of these samples confirmed the HPV type detected by PCR-MS. Quantitative PCR-MS results demonstrated that 11/75 (14.7%) samples contained as much HPV copies/cell as HC2-positive samples. These findings suggest that this prototype PCR-MS assay performs at least as well as HC2 for HPV detection, while offering the additional, unique advantages of type-specific identification and quantitation. Further validation work is underway to define clinically meaningful HPV detection thresholds and to evaluate the potential clinical application of future generations of the PCR-MS assay. PMID:19410602
Patel, Divya A; Shih, Yang-Jen; Newton, Duane W; Michael, Claire W; Oeth, Paul A; Kane, Michael D; Opipari, Anthony W; Ruffin, Mack T; Kalikin, Linda M; Kurnit, David M
2009-09-01
Knowledge of the central role of high-risk human papillomavirus (HPV) in cervical carcinogenesis, coupled with an emerging need to monitor the efficacy of newly introduced HPV vaccines, warrant development and evaluation of type-specific, quantitative HPV detection methods. In the present study, a prototype PCR and mass spectroscopy (PCR-MS)-based method to detect and quantitate 13 high-risk HPV types is compared to the Hybrid Capture 2 High-Risk HPV DNA test (HC2; Digene Corp., Gaithersburg, MD) in 199 cervical scraping samples and to DNA sequencing in 77 cervical tumor samples. High-risk HPV types were detected in 76/77 (98.7%) cervical tumor samples by PCR-MS. Degenerate and type-specific sequencing confirmed the types detected by PCR-MS. In 199 cervical scraping samples, all 13 HPV types were detected by PCR-MS. Eighteen (14.5%) of 124 cervical scraping samples that were positive for high-risk HPV by HC2 were negative by PCR-MS. In all these cases, degenerate DNA sequencing failed to detect any of the 13 high-risk HPV types. Nearly half (46.7%) of the 75 cervical scraping samples that were negative for high-risk HPV by the HC2 assay were positive by PCR-MS. Type-specific sequencing in a subset of these samples confirmed the HPV type detected by PCR-MS. Quantitative PCR-MS results demonstrated that 11/75 (14.7%) samples contained as much HPV copies/cell as HC2-positive samples. These findings suggest that this prototype PCR-MS assay performs at least as well as HC2 for HPV detection, while offering the additional, unique advantages of type-specific identification and quantitation. Further validation work is underway to define clinically meaningful HPV detection thresholds and to evaluate the potential clinical application of future generations of the PCR-MS assay.
DEFF Research Database (Denmark)
Josefsen, Mathilde Hartmann; Cook, N.; D'Agostino, M.
2004-01-01
A PCR-based method for rapid detection of food-borne thermotolerant campylobacters was evaluated through a collaborative trial with 12 laboratories testing spiked carcass rinse samples. The method showed an interlaboratory diagnostic sensitivity of 96.7% and a diagnostic specificity of 100% for c......% for chicken samples, while these values were 94.2 and 83.3%, respectively, for pig samples....
Mehle, Nataša; Dobnik, David; Ravnikar, Maja; Pompe Novak, Maruša
2018-05-03
RNA viruses have a great potential for high genetic variability and rapid evolution that is generated by mutation and recombination under selection pressure. This is also the case of Potato virus Y (PVY), which comprises a high diversity of different recombinant and non-recombinant strains. Consequently, it is hard to develop reverse transcription real-time quantitative PCR (RT-qPCR) with the same amplification efficiencies for all PVY strains which would enable their equilibrate quantification; this is specially needed in mixed infections and other studies of pathogenesis. To achieve this, we initially transferred the PVY universal RT-qPCR assay to a reverse transcription droplet digital PCR (RT-ddPCR) format. RT-ddPCR is an absolute quantification method, where a calibration curve is not needed, and it is less prone to inhibitors. The RT-ddPCR developed and validated in this study achieved a dynamic range of quantification over five orders of magnitude, and in terms of its sensitivity, it was comparable to, or even better than, RT-qPCR. RT-ddPCR showed lower measurement variability. We have shown that RT-ddPCR can be used as a reference tool for the evaluation of different RT-qPCR assays. In addition, it can be used for quantification of RNA based on in-house reference materials that can then be used as calibrators in diagnostic laboratories.
PCR-based methods for the detection of L1014 kdr mutation in Anopheles culicifacies sensu lato
Singh, Om P; Bali, Prerna; Hemingway, Janet; Subbarao, Sarala K; Dash, Aditya P; Adak, Tridibes
2009-01-01
Background Anopheles culicifacies s.l., a major malaria vector in India, has developed widespread resistance to DDT and is becoming resistant to pyrethroids–the only insecticide class recommended for the impregnation of bed nets. Knock-down resistance due to a point mutation in the voltage gated sodium channel at L1014 residue (kdr) is a common mechanism of resistance to DDT and pyrethroids. The selection of this resistance may pose a serious threat to the success of the pyrethroid-impregnated bed net programme. This study reports the presence of kdr mutation (L1014F) in a field population of An. culicifacies s.l. and three new PCR-based methods for kdr genotyping. Methods The IIS4-IIS5 linker to IIS6 segments of the para type voltage gated sodium channel gene of DDT and pyrethroid resistant An. culicifacies s.l. population from the Surat district of India was sequenced. This revealed the presence of an A-to-T substitution at position 1014 leading to a leucine-phenylalanine mutation (L1014F) in a few individuals. Three molecular methods viz. Allele Specific PCR (AS-PCR), an Amplification Refractory Mutation System (ARMS) and Primer Introduced Restriction Analysis-PCR (PIRA-PCR) were developed and tested for kdr genotyping. The specificity of the three assays was validated following DNA sequencing of the samples genotyped. Results The genotyping of this An. culicifacies s.l. population by the three PCR based assays provided consistent result and were in agreement with DNA sequencing result. A low frequency of the kdr allele mostly in heterozygous condition was observed in the resistant population. Frequencies of the different genotypes were in Hardy-Weinberg equilibrium. Conclusion The Leu-Phe mutation, which generates the kdr phenotype in many insects, was detected in a pyrethroid and DDT resistant An. culicifacies s.l. population. Three PCR-based methods were developed for kdr genotyping. All the three assays were specific. The ARMS method was refractory to non
PCR-based methods for the detection of L1014 kdr mutation in Anopheles culicifacies sensu lato
Directory of Open Access Journals (Sweden)
Dash Aditya P
2009-07-01
Full Text Available Abstract Background Anopheles culicifacies s.l., a major malaria vector in India, has developed widespread resistance to DDT and is becoming resistant to pyrethroids–the only insecticide class recommended for the impregnation of bed nets. Knock-down resistance due to a point mutation in the voltage gated sodium channel at L1014 residue (kdr is a common mechanism of resistance to DDT and pyrethroids. The selection of this resistance may pose a serious threat to the success of the pyrethroid-impregnated bed net programme. This study reports the presence of kdr mutation (L1014F in a field population of An. culicifacies s.l. and three new PCR-based methods for kdr genotyping. Methods The IIS4-IIS5 linker to IIS6 segments of the para type voltage gated sodium channel gene of DDT and pyrethroid resistant An. culicifacies s.l. population from the Surat district of India was sequenced. This revealed the presence of an A-to-T substitution at position 1014 leading to a leucine-phenylalanine mutation (L1014F in a few individuals. Three molecular methods viz. Allele Specific PCR (AS-PCR, an Amplification Refractory Mutation System (ARMS and Primer Introduced Restriction Analysis-PCR (PIRA-PCR were developed and tested for kdr genotyping. The specificity of the three assays was validated following DNA sequencing of the samples genotyped. Results The genotyping of this An. culicifacies s.l. population by the three PCR based assays provided consistent result and were in agreement with DNA sequencing result. A low frequency of the kdr allele mostly in heterozygous condition was observed in the resistant population. Frequencies of the different genotypes were in Hardy-Weinberg equilibrium. Conclusion The Leu-Phe mutation, which generates the kdr phenotype in many insects, was detected in a pyrethroid and DDT resistant An. culicifacies s.l. population. Three PCR-based methods were developed for kdr genotyping. All the three assays were specific. The ARMS method
DEFF Research Database (Denmark)
Löfström, Charlotta; Hansen, F.; Mansdal, S.
2011-01-01
samples using a real-time PCR method. The protocol included incubation in buffered peptone water, centrifugation of an aliquot and a boiling procedure. The validation study included comparative and collaborative trials recommended by the Nordic Organization for Validation of Alternative Methods (NordVal......). The comparative trial was performed against a culture based reference method (NMKL187, 2007) and a previously NordVal approved PCR method with a semi-automated magnetic bead-based DNA extraction step using 122 artificially contaminated samples. The limit of detection (LOD50) was found to be 3.0, 3.2 and 3.4 CFU...
Multicenter validation of PCR-based method for detection of Salmonella in chicken and pig samples
DEFF Research Database (Denmark)
Malorny, B.; Cook, N.; D'Agostino, M.
2004-01-01
As part of a standardization project, an interlaboratory trial including 15 laboratories from 13 European countries was conducted to evaluate the performance of a noproprietary polymerase chain reaction (PCR)-based method for the detection of Salmonella on artificially contaminated chicken rinse...... or positive. Outlier results caused, for example, by gross departures from the experimental protocol, were omitted from the analysis. For both the chicken rinse and the pig swab samples, the diagnostic sensitivity was 100%, with 100% accordance (repeatability) and concordance (reproducibility). The diagnostic...... specificity was 80.1% (with 85.7% accordance and 67.5% concordance) for chicken rinse, and 91.7% (with 100% accordance and 83.3% concordance) for pig swab. Thus, the interlaboratory variation due to personnel, reagents, thermal cyclers, etc., did not affect the performance of the method, which...
Balachandran, Priya; Friberg, Maria; Vanlandingham, V; Kozak, K; Manolis, Amanda; Brevnov, Maxim; Crowley, Erin; Bird, Patrick; Goins, David; Furtado, Manohar R; Petrauskene, Olga V; Tebbs, Robert S; Charbonneau, Duane
2012-02-01
Reducing the risk of Salmonella contamination in pet food is critical for both companion animals and humans, and its importance is reflected by the substantial increase in the demand for pathogen testing. Accurate and rapid detection of foodborne pathogens improves food safety, protects the public health, and benefits food producers by assuring product quality while facilitating product release in a timely manner. Traditional culture-based methods for Salmonella screening are laborious and can take 5 to 7 days to obtain definitive results. In this study, we developed two methods for the detection of low levels of Salmonella in pet food using real-time PCR: (i) detection of Salmonella in 25 g of dried pet food in less than 14 h with an automated magnetic bead-based nucleic acid extraction method and (ii) detection of Salmonella in 375 g of composite dry pet food matrix in less than 24 h with a manual centrifugation-based nucleic acid preparation method. Both methods included a preclarification step using a novel protocol that removes food matrix-associated debris and PCR inhibitors and improves the sensitivity of detection. Validation studies revealed no significant differences between the two real-time PCR methods and the standard U.S. Food and Drug Administration Bacteriological Analytical Manual (chapter 5) culture confirmation method.
Ganger, Michael T; Dietz, Geoffrey D; Ewing, Sarah J
2017-12-01
qPCR has established itself as the technique of choice for the quantification of gene expression. Procedures for conducting qPCR have received significant attention; however, more rigorous approaches to the statistical analysis of qPCR data are needed. Here we develop a mathematical model, termed the Common Base Method, for analysis of qPCR data based on threshold cycle values (C q ) and efficiencies of reactions (E). The Common Base Method keeps all calculations in the logscale as long as possible by working with log 10 (E) ∙ C q , which we call the efficiency-weighted C q value; subsequent statistical analyses are then applied in the logscale. We show how efficiency-weighted C q values may be analyzed using a simple paired or unpaired experimental design and develop blocking methods to help reduce unexplained variation. The Common Base Method has several advantages. It allows for the incorporation of well-specific efficiencies and multiple reference genes. The method does not necessitate the pairing of samples that must be performed using traditional analysis methods in order to calculate relative expression ratios. Our method is also simple enough to be implemented in any spreadsheet or statistical software without additional scripts or proprietary components.
Establishment and in-house validation of stem-loop RT PCR method for MicroRNA398 expression analysis
Directory of Open Access Journals (Sweden)
Timotijević Gordana S.
2015-01-01
Full Text Available MicroRNAs (miRNAs belong to the class of small non-coding RNAs which have important roles throughout development as well as in plant response to diverse environmental stresses. Some of plant miRNAs are essential for regulation and maintenance of nutritive homeostasis when nutrients are in excess or shortage comparing to optimal concentration for certain plant species. Better understanding of miRNAs functions implies development of efficient technology for profiling their gene expression. We set out to establish validate the methodology for miRNA gene expression analysis in cucumber grown under suboptimal mineral nutrient regimes, including iron deficiency. Reverse transcription by “stem-loop” primers in combination with Real time PCR method is one of potential approaches for quantification of miRNA gene expression. In this paper we presented a method for “stem loop” primer design specific for miR398, as well as reaction optimization and determination of Real time PCR efficiency. Proving the accuracy of this method was imperative as “stem loop” RT which consider separate transcription of target and endogenous control. The method was verified by comparison of the obtained data with results of miR398 expression achieved using a commercial kit based on simultaneous conversion of all RNAs in cDNAs. [Projekat Ministarstva nauke Republike Srbije, br. 173005 i br. ON-173028
Blanchard, Philippe; Regnault, Julie; Schurr, Frank; Dubois, Eric; Ribière, Magali
2012-03-01
Chronic bee paralysis virus (CBPV) is responsible for chronic bee paralysis, an infectious and contagious disease in adult honey bees (Apis mellifera L.). A real-time RT-PCR assay to quantitate the CBPV load is now available. To propose this assay as a reference method, it was characterised further in an intra-laboratory study during which the reliability and the repeatability of results and the performance of the assay were confirmed. The qPCR assay alone and the whole quantitation method (from sample RNA extraction to analysis) were both assessed following the ISO/IEC 17025 standard and the recent XP U47-600 standard issued by the French Standards Institute. The performance of the qPCR assay and of the overall CBPV quantitation method were validated over a 6 log range from 10(2) to 10(8) with a detection limit of 50 and 100 CBPV RNA copies, respectively, and the protocol of the real-time RT-qPCR assay for CBPV quantitation was approved by the French Accreditation Committee. Copyright © 2011 Elsevier B.V. All rights reserved.
Evaluation of methods for oligonucleotide array data via quantitative real-time PCR.
Qin, Li-Xuan; Beyer, Richard P; Hudson, Francesca N; Linford, Nancy J; Morris, Daryl E; Kerr, Kathleen F
2006-01-17
There are currently many different methods for processing and summarizing probe-level data from Affymetrix oligonucleotide arrays. It is of great interest to validate these methods and identify those that are most effective. There is no single best way to do this validation, and a variety of approaches is needed. Moreover, gene expression data are collected to answer a variety of scientific questions, and the same method may not be best for all questions. Only a handful of validation studies have been done so far, most of which rely on spike-in datasets and focus on the question of detecting differential expression. Here we seek methods that excel at estimating relative expression. We evaluate methods by identifying those that give the strongest linear association between expression measurements by array and the "gold-standard" assay. Quantitative reverse-transcription polymerase chain reaction (qRT-PCR) is generally considered the "gold-standard" assay for measuring gene expression by biologists and is often used to confirm findings from microarray data. Here we use qRT-PCR measurements to validate methods for the components of processing oligo array data: background adjustment, normalization, mismatch adjustment, and probeset summary. An advantage of our approach over spike-in studies is that methods are validated on a real dataset that was collected to address a scientific question. We initially identify three of six popular methods that consistently produced the best agreement between oligo array and RT-PCR data for medium- and high-intensity genes. The three methods are generally known as MAS5, gcRMA, and the dChip mismatch mode. For medium- and high-intensity genes, we identified use of data from mismatch probes (as in MAS5 and dChip mismatch) and a sequence-based method of background adjustment (as in gcRMA) as the most important factors in methods' performances. However, we found poor reliability for methods using mismatch probes for low-intensity genes
Evaluation of methods for oligonucleotide array data via quantitative real-time PCR
Directory of Open Access Journals (Sweden)
Morris Daryl E
2006-01-01
Full Text Available Abstract Background There are currently many different methods for processing and summarizing probe-level data from Affymetrix oligonucleotide arrays. It is of great interest to validate these methods and identify those that are most effective. There is no single best way to do this validation, and a variety of approaches is needed. Moreover, gene expression data are collected to answer a variety of scientific questions, and the same method may not be best for all questions. Only a handful of validation studies have been done so far, most of which rely on spike-in datasets and focus on the question of detecting differential expression. Here we seek methods that excel at estimating relative expression. We evaluate methods by identifying those that give the strongest linear association between expression measurements by array and the "gold-standard" assay. Quantitative reverse-transcription polymerase chain reaction (qRT-PCR is generally considered the "gold-standard" assay for measuring gene expression by biologists and is often used to confirm findings from microarray data. Here we use qRT-PCR measurements to validate methods for the components of processing oligo array data: background adjustment, normalization, mismatch adjustment, and probeset summary. An advantage of our approach over spike-in studies is that methods are validated on a real dataset that was collected to address a scientific question. Results We initially identify three of six popular methods that consistently produced the best agreement between oligo array and RT-PCR data for medium- and high-intensity genes. The three methods are generally known as MAS5, gcRMA, and the dChip mismatch mode. For medium- and high-intensity genes, we identified use of data from mismatch probes (as in MAS5 and dChip mismatch and a sequence-based method of background adjustment (as in gcRMA as the most important factors in methods' performances. However, we found poor reliability for methods
Takabatake, Reona; Koiwa, Tomohiro; Kasahara, Masaki; Takashima, Kaori; Futo, Satoshi; Minegishi, Yasutaka; Akiyama, Hiroshi; Teshima, Reiko; Oguchi, Taichi; Mano, Junichi; Furui, Satoshi; Kitta, Kazumi
2011-01-01
To reduce the cost and time required to routinely perform the genetically modified organism (GMO) test, we developed a duplex quantitative real-time PCR method for a screening analysis simultaneously targeting an event-specific segment for GA21 and Cauliflower Mosaic Virus 35S promoter (P35S) segment [Oguchi et al., J. Food Hyg. Soc. Japan, 50, 117-125 (2009)]. To confirm the validity of the method, an interlaboratory collaborative study was conducted. In the collaborative study, conversion factors (Cfs), which are required to calculate the GMO amount (%), were first determined for two real-time PCR instruments, the ABI PRISM 7900HT and the ABI PRISM 7500. A blind test was then conducted. The limit of quantitation for both GA21 and P35S was estimated to be 0.5% or less. The trueness and precision were evaluated as the bias and reproducibility of the relative standard deviation (RSD(R)). The determined bias and RSD(R) were each less than 25%. We believe the developed method would be useful for the practical screening analysis of GM maize.
Ibrahim, Mohamed; Alaraidh, Ibrahim; Amid, Azura; Farouk, Abd-El Aziem; Bazaid, Salih; Greiner, Ralf; Alghunaim, Abdullah
2011-01-01
A collaborative trial study has been conducted for validation of an extraction method and a subsequent PCR for the detection of transgenic rice sold in Saudi Arabia. The tests were carried out in Saudi Arabia using Real-Time PCR and the positive samples were validated in another lab in Malaysia using PCR and agarose gel visualization. The samples were tested for the existence of the NOS Terminator. A total of 150 samples were tested out of which three samples tested positi...
Validation of qPCR Methods for the Detection of Mycobacterium in New World Animal Reservoirs.
Directory of Open Access Journals (Sweden)
Genevieve Housman
2015-11-01
Full Text Available Zoonotic pathogens that cause leprosy (Mycobacterium leprae and tuberculosis (Mycobacterium tuberculosis complex, MTBC continue to impact modern human populations. Therefore, methods able to survey mycobacterial infection in potential animal hosts are necessary for proper evaluation of human exposure threats. Here we tested for mycobacterial-specific single- and multi-copy loci using qPCR. In a trial study in which armadillos were artificially infected with M. leprae, these techniques were specific and sensitive to pathogen detection, while more traditional ELISAs were only specific. These assays were then employed in a case study to detect M. leprae as well as MTBC in wild marmosets. All marmosets were negative for M. leprae DNA, but 14 were positive for the mycobacterial rpoB gene assay. Targeted capture and sequencing of rpoB and other MTBC genes validated the presence of mycobacterial DNA in these samples and revealed that qPCR is useful for identifying mycobacterial-infected animal hosts.
Dreesen, Jos; Destouni, Aspasia; Kourlaba, Georgia; Degn, Birte; Mette, Wulf Christensen; Carvalho, Filipa; Moutou, Celine; Sengupta, Sioban; Dhanjal, Seema; Renwick, Pamela; Davies, Steven; Kanavakis, Emmanouel; Harton, Gary; Traeger-Synodinos, Joanne
2014-01-01
Preimplantation genetic diagnosis (PGD) for monogenic disorders currently involves polymerase chain reaction (PCR)-based methods, which must be robust, sensitive and highly accurate, precluding misdiagnosis. Twelve adverse misdiagnoses reported to the ESHRE PGD-Consortium are likely an underestimate. This retrospective study, involving six PGD centres, assessed the validity of PCR-based PGD through reanalysis of untransferred embryos from monogenic-PGD cycles. Data were collected on the genotype concordance at PGD and follow-up from 940 untransferred embryos, including details on the parameters of PGD cycles: category of monogenic disease, embryo morphology, embryo biopsy and genotype assay strategy. To determine the validity of PCR-based PGD, the sensitivity (Se), specificity (Sp) and diagnostic accuracy were calculated. Stratified analyses were also conducted to assess the influence of the parameters above on the validity of PCR-based PGD. The analysis of overall data showed that 93.7% of embryos had been correctly classified at the time of PGD, with Se of 99.2% and Sp of 80.9%. The stratified analyses found that diagnostic accuracy is statistically significantly higher when PGD is performed on two cells versus one cell (P=0.001). Se was significantly higher when multiplex protocols versus singleplex protocols were applied (P=0.005), as well as for PGD applied on cells from good compared with poor morphology embryos (P=0.032). Morphology, however, did not affect diagnostic accuracy. Multiplex PCR-based methods on one cell, are as robust as those on two cells regarding false negative rate, which is the most important criteria for clinical PGD applications. Overall, this study demonstrates the validity, robustness and high diagnostic value of PCR-based PGD. PMID:24301057
Ramírez, Juan Carlos; Cura, Carolina Inés; da Cruz Moreira, Otacilio; Lages-Silva, Eliane; Juiz, Natalia; Velázquez, Elsa; Ramírez, Juan David; Alberti, Anahí; Pavia, Paula; Flores-Chávez, María Delmans; Muñoz-Calderón, Arturo; Pérez-Morales, Deyanira; Santalla, José; Marcos da Matta Guedes, Paulo; Peneau, Julie; Marcet, Paula; Padilla, Carlos; Cruz-Robles, David; Valencia, Edward; Crisante, Gladys Elena; Greif, Gonzalo; Zulantay, Inés; Costales, Jaime Alfredo; Alvarez-Martínez, Miriam; Martínez, Norma Edith; Villarroel, Rodrigo; Villarroel, Sandro; Sánchez, Zunilda; Bisio, Margarita; Parrado, Rudy; Maria da Cunha Galvão, Lúcia; Jácome da Câmara, Antonia Cláudia; Espinoza, Bertha; Alarcón de Noya, Belkisyole; Puerta, Concepción; Riarte, Adelina; Diosque, Patricio; Sosa-Estani, Sergio; Guhl, Felipe; Ribeiro, Isabela; Aznar, Christine; Britto, Constança; Yadón, Zaida Estela; Schijman, Alejandro G
2015-09-01
An international study was performed by 26 experienced PCR laboratories from 14 countries to assess the performance of duplex quantitative real-time PCR (qPCR) strategies on the basis of TaqMan probes for detection and quantification of parasitic loads in peripheral blood samples from Chagas disease patients. Two methods were studied: Satellite DNA (SatDNA) qPCR and kinetoplastid DNA (kDNA) qPCR. Both methods included an internal amplification control. Reportable range, analytical sensitivity, limits of detection and quantification, and precision were estimated according to international guidelines. In addition, inclusivity and exclusivity were estimated with DNA from stocks representing the different Trypanosoma cruzi discrete typing units and Trypanosoma rangeli and Leishmania spp. Both methods were challenged against 156 blood samples provided by the participant laboratories, including samples from acute and chronic patients with varied clinical findings, infected by oral route or vectorial transmission. kDNA qPCR showed better analytical sensitivity than SatDNA qPCR with limits of detection of 0.23 and 0.70 parasite equivalents/mL, respectively. Analyses of clinical samples revealed a high concordance in terms of sensitivity and parasitic loads determined by both SatDNA and kDNA qPCRs. This effort is a major step toward international validation of qPCR methods for the quantification of T. cruzi DNA in human blood samples, aiming to provide an accurate surrogate biomarker for diagnosis and treatment monitoring for patients with Chagas disease. Copyright © 2015 American Society for Investigative Pathology and the Association for Molecular Pathology. Published by Elsevier Inc. All rights reserved.
Energy Technology Data Exchange (ETDEWEB)
Pilatti, Marcia M.; Andrade, Antero S.R. [Centro de Desenvolvimento da Tecnologia Nuclear (CDTN/CNEN-MG), Belo Horizonte, MG (Brazil)], e-mail: marciapilatti@yahoo.com.br, e-mail: antero@cdtn.br; Ferreira, Sidney A. [Universidade Federal de Minas Gerais (UFMG), Belo Horizonte, MG (Brazil). Dept. de Parasitologia], e-mail: saninoalmeida@gmail.com
2009-07-01
The sensitivity of the kDNA PCR-Hybridization assay, which uses radioactive DNA probes (labeled with {sup 32}P), was compared with three conventional PCR methods used for canine visceral leishmaniasis diagnosis. All PCR methods had two steps: a first amplification followed by hybridization or by a new amplification (nested or semi nested). Two methods (kDNA PCR-Hybridization and kDNA snPCR) used primers addressed to kinetoplast minicircles and the other two methods to the coding (LnPCR) and intergenic noncoding regions (ITS-1 nPCR) of the ribosomal rRNA genes. The comparison was accomplished in two groups of 23 infected dogs using samples collected by the conjunctival swab procedure. In the Group 1 the DNA was extracted from cotton swabs by phenol-chloroform and in Group 2 by boiling. The most efficient PCR methods in the Group 1 were those based on kDNA targets. The kDNA PCR-Hybridization was able to detect parasites in 22/23 dogs (95.6%) and in 40/46 samples (86.9%). The kDNA snPCR was positive for 21/23 dogs (91.3%) and for 40/46 samples (86.9%). The positivities of the kDNA based methods were significantly higher than the positivities verified for the methods based on ribosomal rRNA genes (p<0.05). In the Group 2 the kDNA PCR- Hybridization showed a better performance detecting parasites in 18/23 dogs (78.3%) and in 31/46 samples (67.4%), significantly higher than the other three methods (p<0.05). The higher sensitivity of the minicircle kDNA based assays reported by others was confirmed in this study and kDNA PCR-Hybridization showed the best sensitivity among the assays evaluated. (author)
International Nuclear Information System (INIS)
Pilatti, Marcia M.; Andrade, Antero S.R.; Ferreira, Sidney A.
2009-01-01
The sensitivity of the kDNA PCR-Hybridization assay, which uses radioactive DNA probes (labeled with 32 P), was compared with three conventional PCR methods used for canine visceral leishmaniasis diagnosis. All PCR methods had two steps: a first amplification followed by hybridization or by a new amplification (nested or semi nested). Two methods (kDNA PCR-Hybridization and kDNA snPCR) used primers addressed to kinetoplast minicircles and the other two methods to the coding (LnPCR) and intergenic noncoding regions (ITS-1 nPCR) of the ribosomal rRNA genes. The comparison was accomplished in two groups of 23 infected dogs using samples collected by the conjunctival swab procedure. In the Group 1 the DNA was extracted from cotton swabs by phenol-chloroform and in Group 2 by boiling. The most efficient PCR methods in the Group 1 were those based on kDNA targets. The kDNA PCR-Hybridization was able to detect parasites in 22/23 dogs (95.6%) and in 40/46 samples (86.9%). The kDNA snPCR was positive for 21/23 dogs (91.3%) and for 40/46 samples (86.9%). The positivities of the kDNA based methods were significantly higher than the positivities verified for the methods based on ribosomal rRNA genes (p<0.05). In the Group 2 the kDNA PCR- Hybridization showed a better performance detecting parasites in 18/23 dogs (78.3%) and in 31/46 samples (67.4%), significantly higher than the other three methods (p<0.05). The higher sensitivity of the minicircle kDNA based assays reported by others was confirmed in this study and kDNA PCR-Hybridization showed the best sensitivity among the assays evaluated. (author)
Directory of Open Access Journals (Sweden)
Jorge Evelio Ángel
2014-12-01
Full Text Available Citrus huanglongbing (HLB is the most destructive citrus disease. Two of the three known HLB-associated Candidatus Liberibacter species were recently found to be present in the Americas. In this study, eggs, nymphs and adults of Diaphorina citri Kuwayama (Hemiptera: Liviidae and suspect citrus plant materials were collected in 25 municipalities in the departments of Cundinamarca, Santander, Valle del Cauca, Meta and Quindio (Colombia. The detection sensitivity, specificity and assay performance of the 16S rDNA-based real-time PCR (qPCR were validated for the field survey of the disease in Colombia. The validation confirmed the reliability and robustness of the real-time PCR method for the detection of HLB bacteria in host citrus plant tissues and the vector D. citri. The diagnosis was performed for Candidatus Liberibacter asiaticus (Ca. L. asiaticus and for Candidatus Liberibacter americanus (Ca. L. americanus on 168 citrus plant material samples and 239 insect samples. Neither Ca. L. asiaticus nor Ca. L. americanus were detected in the host plants or insects vector, confirming the absence of the disease in the citrus-producing areas of Colombia.
Absolute quantification of DNA methylation using microfluidic chip-based digital PCR.
Wu, Zhenhua; Bai, Yanan; Cheng, Zule; Liu, Fangming; Wang, Ping; Yang, Dawei; Li, Gang; Jin, Qinghui; Mao, Hongju; Zhao, Jianlong
2017-10-15
Hypermethylation of CpG islands in the promoter region of many tumor suppressor genes downregulates their expression and in a result promotes tumorigenesis. Therefore, detection of DNA methylation status is a convenient diagnostic tool for cancer detection. Here, we reported a novel method for the integrative detection of methylation by the microfluidic chip-based digital PCR. This method relies on methylation-sensitive restriction enzyme HpaII, which cleaves the unmethylated DNA strands while keeping the methylated ones intact. After HpaII treatment, the DNA methylation level is determined quantitatively by the microfluidic chip-based digital PCR with the lower limit of detection equal to 0.52%. To validate the applicability of this method, promoter methylation of two tumor suppressor genes (PCDHGB6 and HOXA9) was tested in 10 samples of early stage lung adenocarcinoma and their adjacent non-tumorous tissues. The consistency was observed in the analysis of these samples using our method and a conventional bisulfite pyrosequencing. Combining high sensitivity and low cost, the microfluidic chip-based digital PCR method might provide a promising alternative for the detection of DNA methylation and early diagnosis of epigenetics-related diseases. Copyright © 2017 Elsevier B.V. All rights reserved.
Blood grouping based on PCR methods and agarose gel electrophoresis.
Sell, Ana Maria; Visentainer, Jeane Eliete Laguila
2015-01-01
The study of erythrocyte antigens continues to be an intense field of research, particularly after the development of molecular testing methods. More than 300 specificities have been described by the International Society for Blood Transfusion as belonging to 33 blood group systems. The polymerase chain reaction (PCR) is a central tool for red blood cells (RBC) genotyping. PCR and agarose gel electrophoresis are low cost, easy, and versatile in vitro methods for amplifying defined target DNA (RBC polymorphic region). Multiplex-PCR, AS-PCR (Specific Allele Polymerase Chain Reaction), and RFLP-PCR (Restriction Fragment Length Polymorphism-Polymerase Chain Reaction) techniques are usually to identify RBC polymorphisms. Furthermore, it is an easy methodology to implement. This chapter describes the PCR methodology and agarose gel electrophoresis to identify the polymorphisms of the Kell, Duffy, Kidd, and MNS blood group systems.
Naddaf, S R; Kishdehi, M; Siavashi, Mr
2011-01-01
The mainstay of diagnosis of relapsing fever (RF) is demonstration of the spirochetes in Giemsa-stained thick blood smears, but during non fever periods the bacteria are very scanty and rarely detected in blood smears by microscopy. This study is aimed to evaluate the sensitivity of different methods developed for detection of low-grade spirochetemia. Animal blood samples with low degrees of spirochetemia were tested with two PCRs and a nested PCR targeting flaB, GlpQ, and rrs genes. Also, a centrifuged-based enrichment method and Giemsa staining were performed on blood samples with various degrees of spirochetemia. The flaB-PCR and nested rrs-PCR turned positive with various degrees of spirochetemia including the blood samples that turned negative with dark-field microscopy. The GlpQ-PCR was positive as far as at least one spirochete was seen in 5-10 microscopic fields. The sensitivity of GlpQ-PCR increased when DNA from Buffy Coat Layer (BCL) was used as template. The centrifuged-based enrichment method turned positive with as low concentration as 50 bacteria/ml blood, while Giemsa thick staining detected bacteria with concentrations ≥ 25000 bacteria/ml. Centrifuged-based enrichment method appeared as much as 500-fold more sensitive than thick smears, which makes it even superior to some PCR assays. Due to simplicity and minimal laboratory requirements, this method can be considered a valuable tool for diagnosis of RF in rural health centers.
Complementary techniques: validation of gene expression data by quantitative real time PCR.
Provenzano, Maurizio; Mocellin, Simone
2007-01-01
Microarray technology can be considered the most powerful tool for screening gene expression profiles of biological samples. After data mining, results need to be validated with highly reliable biotechniques allowing for precise quantitation of transcriptional abundance of identified genes. Quantitative real time PCR (qrt-PCR) technology has recently reached a level of sensitivity, accuracy and practical ease that support its use as a routine bioinstrumentation for gene level measurement. Currently, qrt-PCR is considered by most experts the most appropriate method to confirm or confute microarray-generated data. The knowledge of the biochemical principles underlying qrt-PCR as well as some related technical issues must be beard in mind when using this biotechnology.
Directory of Open Access Journals (Sweden)
SR Naddaf
2011-06-01
Full Text Available Background: The mainstay of diagnosis of relapsing fever (RF is demonstration of the spirochetes in Giemsa-stained thick blood smears, but during non fever periods the bacteria are very scanty and rarely detected in blood smears by microscopy. This study is aimed to evaluate the sensitivity of different methods developed for detection of low-grade spirochetemia. Methods: Animal blood samples with low degrees of spirochetemia were tested with two PCRs and a nested PCR targeting flaB, GlpQ, and rrs genes. Also, a centrifuged-based enrichment method and Giemsa staining were performed on blood samples with various degrees of spirochetemia. Results: The flaB-PCR and nested rrs-PCR turned positive with various degrees of spirochetemia including the blood samples that turned negative with dark-field microscopy. The GlpQ-PCR was positive as far as at least one spirochete was seen in 5-10 microscopic fields. The sensitivity of GlpQ-PCR increased when DNA from Buffy Coat Layer (BCL was used as template. The centrifuged-based enrichment method turned positive with as low concentration as 50 bacteria/ml blood, while Giemsa thick staining detected bacteria with concentrations ≥ 25000 bacteria/ml. Conclusion: Centrifuged-based enrichment method appeared as much as 500-fold more sensitive than thick smears, which makes it even superior to some PCR assays. Due to simplicity and minimal laboratory requirements, this method can be considered a valuable tool for diagnosis of RF in rural health centers.
Directory of Open Access Journals (Sweden)
SR Naddaf
2011-06-01
Background: The mainstay of diagnosis of relapsing fever (RF is demonstration of the spirochetes in Giemsa-stained thick blood smears, but during non fever periods the bacteria are very scanty and rarely detected in blood smears by microscopy. This study is aimed to evaluate the sensitivity of different methods developed for detection of low-grade spirochetemia. Methods: Animal blood samples with low degrees of spirochetemia were tested with two PCRs and a nested PCR targeting flaB, GlpQ, and rrs genes. Also, a centrifuged-based enrichment method and Giemsa staining were performed on blood samples with various degrees of spirochetemia. Results: The flaB-PCR and nested rrs-PCR turned positive with various degrees of spirochetemia including the blood samples that turned negative with dark-field microscopy. The GlpQ-PCR was positive as far as at least one spirochete was seen in 5-10 microscopic fields. The sensitivity of GlpQ-PCR increased when DNA from Buffy Coat Layer (BCL was used as template. The centrifuged-based enrichment method turned positive with as low concentration as 50 bacteria/ml blood, while Giemsa thick staining detected bacteria with concentrations ≥ 25000 bacteria/ml. Conclusion: Centrifuged-based enrichment method appeared as much as 500-fold more sensitive than thick smears, which makes it even superior to some PCR assays. Due to simplicity and minimal laboratory requirements, this method can be considered a valuable tool for diagnosis of RF in rural health centers.
DNA decontamination methods for internal quality management in clinical PCR laboratories.
Wu, Yingping; Wu, Jianyong; Zhang, Zhihui; Cheng, Chen
2018-03-01
The polymerase chain reaction (PCR) technique, one of the most commonly applied methods in diagnostic and molecular biology, has a frustrating downside: the occurrence of false-positive signals due to contamination. In previous research, various DNA decontamination methods have been developed to overcome this limitation. Unfortunately, the use of random or poorly focused sampling methods for monitoring air and/or object surfaces leads to the incomplete elimination during decontamination procedures. We herein attempted to develop a novel DNA decontamination method (environmental surveillance, including surface and air sampling) and quality management program for clinical molecular diagnostic laboratories (or clinical PCR laboratories). Here, we performed a step-by-step evaluation of current DNA decontamination methods and developed an effective procedure for assessing the presence of decontaminating DNA via PCR analysis. Performing targeted environmental surveillance by sampling, which reached optimal performance over 2 weeks, and the decontamination process had been verified as reliable. Additionally, the process was validated to not affect PCR amplification efficiency based on a comparative study. In this study, effective guidelines for DNA decontamination were developed. The method employed ensured that surface DNA contamination could be effectively identified and eliminated. Furthermore, our study highlighted the importance of overall quality assurance and good clinical laboratory practices for preventing contamination, which are key factors for compliance with regulatory or accreditation requirements. Taken together, we provided the evidence that the presented scheme ranged from troubleshooting to the elimination of surface contamination, could serve as critical foundation for developing regular environmental surveillance guidelines for PCR laboratories. © 2017 Wiley Periodicals, Inc.
Validation of a quantitative Eimeria spp. PCR for fresh droppings of broiler chickens.
Peek, H W; Ter Veen, C; Dijkman, R; Landman, W J M
2017-12-01
A quantitative Polymerase Chain Reaction (qPCR) for the seven chicken Eimeria spp. was modified and validated for direct use on fresh droppings. The analytical specificity of the qPCR on droppings was 100%. Its analytical sensitivity (non-sporulated oocysts/g droppings) was 41 for E. acervulina, ≤2900 for E. brunetti, 710 for E. praecox, 1500 for E. necatrix, 190 for E. tenella, 640 for E. maxima, and 1100 for E. mitis. Field validation of the qPCR was done using droppings with non-sporulated oocysts from 19 broiler flocks. To reduce the number of qPCR tests five grams of each pooled sample (consisting of ten fresh droppings) per time point were blended into one mixed sample. Comparison of the oocysts per gram (OPG)-counting method with the qPCR using pooled samples (n = 1180) yielded a Pearson's correlation coefficient of 0.78 (95% CI: 0.76-0.80) and a Pearson's correlation coefficient of 0.76 (95% CI: 0.70-0.81) using mixed samples (n = 236). Comparison of the average of the OPG-counts of the five pooled samples with the mixed sample per time point (n = 236) showed a Pearson's correlation coefficient (R) of 0.94 (95% CI: 0.92-0.95) for the OPG-counting method and 0.87 (95% CI: 0.84-0.90) for the qPCR. This indicates that mixed samples are practically equivalent to the mean of five pooled samples. The good correlation between the OPG-counting method and the qPCR was further confirmed by the visual agreement between the total oocyst/g shedding patterns measured with both techniques in the 19 broiler flocks using the mixed samples.
DNA extraction methods for panbacterial and panfungal PCR detection in intraocular fluids.
Mazoteras, Paloma; Bispo, Paulo José Martins; Höfling-Lima, Ana Luisa; Casaroli-Marano, Ricardo P
2015-07-01
Three different methods of DNA extraction from intraocular fluids were compared with subsequent detection for bacterial and fungal DNA by universal PCR amplification. Three DNA extraction methods, from aqueous and vitreous humors, were evaluated to compare their relative efficiency. Bacterial (Gram positive and negative) and fungal strains were used in this study: Escherichia coli, Staphylococcus epidermidis and Candida albicans. The quality, quantification, and detection limit for DNA extraction and PCR amplification were analyzed. Validation procedures for 13 aqueous humor and 14 vitreous samples, from 20 patients with clinically suspected endophthalmitis were carried out. The column-based extraction method was the most time-effective, achieving DNA detection limits ≥10(2) and 10(3 )CFU/100 µL for bacteria and fungi, respectively. PCR amplification detected 100 fg, 1 pg and 10 pg of genomic DNA of E. coli, S. epidermidis and C. albicans respectively. PCR detected 90.0% of the causative agents from 27 intraocular samples collected from 20 patients with clinically suspected endophthalmitis, while standard microbiological techniques could detect only 60.0%. The most frequently found organisms were Streptococcus spp. in 38.9% (n = 7) of patients and Staphylococcus spp. found in 22.2% (n = 4). The column-based extraction method for very small inocula in small volume samples (50-100 µL) of aqueous and/or vitreous humors allowed PCR amplification in all samples with sufficient quality for subsequent sequencing and identification of the microorganism in the majority of them.
Targeted resequencing and variant validation using pxlence PCR assays
Directory of Open Access Journals (Sweden)
Frauke Coppieters
2016-01-01
Full Text Available The advent of next-generation sequencing technologies had a profound impact on molecular diagnostics. PCR is a popular method for target enrichment of disease gene panels. Using our proprietary primer-design pipeline, primerXL, we have created almost one million assays covering over 98% of the human exome. Here we describe the assay specification and both in silico and wet-lab validation of a selected set of 2294 assays using both next-generation sequencing and Sanger sequencing. Using a universal PCR protocol without optimization, these assays result in high coverage uniformity and limited non-specific coverage. In addition, data indicates a positive correlation between the predictive in silico specificity score and the amount of assay non-specific coverage.
Fu, Wei; Zhu, Pengyu; Wei, Shuang; Zhixin, Du; Wang, Chenguang; Wu, Xiyang; Li, Feiwu; Zhu, Shuifang
2017-04-01
Among all of the high-throughput detection methods, PCR-based methodologies are regarded as the most cost-efficient and feasible methodologies compared with the next-generation sequencing or ChIP-based methods. However, the PCR-based methods can only achieve multiplex detection up to 15-plex due to limitations imposed by the multiplex primer interactions. The detection throughput cannot meet the demands of high-throughput detection, such as SNP or gene expression analysis. Therefore, in our study, we have developed a new high-throughput PCR-based detection method, multiplex enrichment quantitative PCR (ME-qPCR), which is a combination of qPCR and nested PCR. The GMO content detection results in our study showed that ME-qPCR could achieve high-throughput detection up to 26-plex. Compared to the original qPCR, the Ct values of ME-qPCR were lower for the same group, which showed that ME-qPCR sensitivity is higher than the original qPCR. The absolute limit of detection for ME-qPCR could achieve levels as low as a single copy of the plant genome. Moreover, the specificity results showed that no cross-amplification occurred for irrelevant GMO events. After evaluation of all of the parameters, a practical evaluation was performed with different foods. The more stable amplification results, compared to qPCR, showed that ME-qPCR was suitable for GMO detection in foods. In conclusion, ME-qPCR achieved sensitive, high-throughput GMO detection in complex substrates, such as crops or food samples. In the future, ME-qPCR-based GMO content identification may positively impact SNP analysis or multiplex gene expression of food or agricultural samples. Graphical abstract For the first-step amplification, four primers (A, B, C, and D) have been added into the reaction volume. In this manner, four kinds of amplicons have been generated. All of these four amplicons could be regarded as the target of second-step PCR. For the second-step amplification, three parallels have been taken for
Model-Based Method for Sensor Validation
Vatan, Farrokh
2012-01-01
Fault detection, diagnosis, and prognosis are essential tasks in the operation of autonomous spacecraft, instruments, and in situ platforms. One of NASA s key mission requirements is robust state estimation. Sensing, using a wide range of sensors and sensor fusion approaches, plays a central role in robust state estimation, and there is a need to diagnose sensor failure as well as component failure. Sensor validation can be considered to be part of the larger effort of improving reliability and safety. The standard methods for solving the sensor validation problem are based on probabilistic analysis of the system, from which the method based on Bayesian networks is most popular. Therefore, these methods can only predict the most probable faulty sensors, which are subject to the initial probabilities defined for the failures. The method developed in this work is based on a model-based approach and provides the faulty sensors (if any), which can be logically inferred from the model of the system and the sensor readings (observations). The method is also more suitable for the systems when it is hard, or even impossible, to find the probability functions of the system. The method starts by a new mathematical description of the problem and develops a very efficient and systematic algorithm for its solution. The method builds on the concepts of analytical redundant relations (ARRs).
Gyawali, P; Sidhu, J P S; Ahmed, W; Jagals, P; Toze, S
2017-06-01
Accurate quantitative measurement of viable hookworm ova from environmental samples is the key to controlling hookworm re-infections in the endemic regions. In this study, the accuracy of three quantitative detection methods [culture-based, vital stain and propidium monoazide-quantitative polymerase chain reaction (PMA-qPCR)] was evaluated by enumerating 1,000 ± 50 Ancylostoma caninum ova in the laboratory. The culture-based method was able to quantify an average of 397 ± 59 viable hookworm ova. Similarly, vital stain and PMA-qPCR methods quantified 644 ± 87 and 587 ± 91 viable ova, respectively. The numbers of viable ova estimated by the culture-based method were significantly (P methods. Therefore, both PMA-qPCR and vital stain methods appear to be suitable for the quantitative detection of viable hookworm ova. However, PMA-qPCR would be preferable over the vital stain method in scenarios where ova speciation is needed.
Boogert, van den P.H.J.F.; Gent-Pelzer, van M.P.E.; Bonants, P.J.M.; Boer, de S.H.; Wander, J.G.N.; Lévesque, C.A.; Leeuwen, van G.C.M.; Baayen, R.P.
2005-01-01
Abstract PCR-based methods were developed for the detection and quantification of the potato pathogen Synchytrium endobioticum in soil extracts and in planta. PCR primers, based on the internal transcribed spacer region of the multi-copy gene rDNA were tested for specificity, sensitivity and
Directory of Open Access Journals (Sweden)
Tri Joko Raharjo
2017-07-01
Full Text Available Porcine adulteration in meatball samples were analyzed using real-time polymerase chain reaction (RT-PCR, based on the ND5 primer obtained by previous study. This work consisted of three stages which were annealing temperature optimization, method validation, and application. DNA template was extracted using phenol-CIAA (chloroform-iso amyl alcohol method. The optimum annealing temperature for ND5 primers (forward primer 5'-CATTCGCCTCACTCACATTAACC-3' and reverse primer 5'-AAGAGAGAGTTCTACGGTCTGTAG-3' was 58.0 °C, obtained after testing annealing at 50.5 to 59.5 °C gradient temperature with 5 °C interval. Melting curve analysis was done at 65.0 to 95.0 °C, with increasing temperature for 0.5 °C per 2 sec. Method was validated for its specificity, precision and limit of detection. RT-PCR method with ND5 primers produced 227 bp DNA fragment with 78.50 °C Tm value. From eight commercial meatball samples, one was detected containing porcine. The methods showed high specificity and precision, with experimentally determined limits for porcine were no less than 1%.
Directory of Open Access Journals (Sweden)
Mateusz G Adamski
Full Text Available Over the past decade rapid advances have occurred in the understanding of RNA expression and its regulation. Quantitative polymerase chain reactions (qPCR have become the gold standard for quantifying gene expression. Microfluidic next generation, high throughput qPCR now permits the detection of transcript copy number in thousands of reactions simultaneously, dramatically increasing the sensitivity over standard qPCR. Here we present a gene expression analysis method applicable to both standard polymerase chain reactions (qPCR and high throughput qPCR. This technique is adjusted to the input sample quantity (e.g., the number of cells and is independent of control gene expression. It is efficiency-corrected and with the use of a universal reference sample (commercial complementary DNA (cDNA permits the normalization of results between different batches and between different instruments--regardless of potential differences in transcript amplification efficiency. Modifications of the input quantity method include (1 the achievement of absolute quantification and (2 a non-efficiency corrected analysis. When compared to other commonly used algorithms the input quantity method proved to be valid. This method is of particular value for clinical studies of whole blood and circulating leukocytes where cell counts are readily available.
Vojkovska, H; Kubikova, I; Kralik, P
2015-03-01
Epidemiological data indicate that raw vegetables are associated with outbreaks of Listeria monocytogenes. Therefore, there is a demand for the availability of rapid and sensitive methods, such as PCR assays, for the detection and accurate discrimination of L. monocytogenes. However, the efficiency of PCR methods can be negatively affected by inhibitory compounds commonly found in vegetable matrices that may cause false-negative results. Therefore, the sample processing and DNA isolation steps must be carefully evaluated prior to the introduction of such methods into routine practice. In this study, we compared the ability of three column-based and four magnetic bead-based commercial DNA isolation kits to extract DNA of the model micro-organism L. monocytogenes from raw vegetables. The DNA isolation efficiency of all isolation kits was determined using a triplex real-time qPCR assay designed to specifically detect L. monocytogenes. The kit with best performance, the PowerSoil(™) Microbial DNA Isolation Kit, is suitable for the extraction of amplifiable DNA from L. monocytogenes cells in vegetable with efficiencies ranging between 29.6 and 70.3%. Coupled with the triplex real-time qPCR assay, this DNA isolation kit is applicable to the samples with bacterial loads of 10(3) bacterial cells per gram of L. monocytogenes. Several recent outbreaks of Listeria monocytogenes have been associated with the consumption of fruits and vegetables. Real-time PCR assays allow fast detection and accurate quantification of microbes. However, the success of real-time PCR is dependent on the success with which template DNA can be extracted. The results of this study suggest that the PowerSoil(™) Microbial DNA Isolation Kit can be used for the extraction of amplifiable DNA from L. monocytogenes cells in vegetable with efficiencies ranging between 29.6 and 70.3%. This method is applicable to samples with bacterial loads of 10(3) bacterial cells per gram of L. monocytogenes. © 2014
Directory of Open Access Journals (Sweden)
Bahman Navidshad
2012-02-01
Full Text Available The applications of conventional culture-dependent assays to quantify bacteria populations are limited by their dependence on the inconsistent success of the different culture-steps involved. In addition, some bacteria can be pathogenic or a source of endotoxins and pose a health risk to the researchers. Bacterial quantification based on the real-time PCR method can overcome the above-mentioned problems. However, the quantification of bacteria using this approach is commonly expressed as absolute quantities even though the composition of samples (like those of digesta can vary widely; thus, the final results may be affected if the samples are not properly homogenized, especially when multiple samples are to be pooled together before DNA extraction. The objective of this study was to determine the correlation coefficients between four different methods of expressing the output data of real-time PCR-based bacterial quantification. The four methods were: (i the common absolute method expressed as the cell number of specific bacteria per gram of digesta; (ii the Livak and Schmittgen, ΔΔCt method; (iii the Pfaffl equation; and (iv a simple relative method based on the ratio of cell number of specific bacteria to the total bacterial cells. Because of the effect on total bacteria population in the results obtained using ΔCt-based methods (ΔΔCt and Pfaffl, these methods lack the acceptable consistency to be used as valid and reliable methods in real-time PCR-based bacterial quantification studies. On the other hand, because of the variable compositions of digesta samples, a simple ratio of cell number of specific bacteria to the corresponding total bacterial cells of the same sample can be a more accurate method to quantify the population.
Lehle, Simon; Hildebrand, Dominic G.; Merz, Britta; Malak, Peter N.; Becker, Michael S.; Schmezer, Peter; Essmann, Frank; Schulze-Osthoff, Klaus; Rothfuss, Oliver
2014-01-01
DNA damage is tightly associated with various biological and pathological processes, such as aging and tumorigenesis. Although detection of DNA damage is attracting increasing attention, only a limited number of methods are available to quantify DNA lesions, and these techniques are tedious or only detect global DNA damage. In this study, we present a high-sensitivity long-run real-time PCR technique for DNA-damage quantification (LORD-Q) in both the mitochondrial and nuclear genome. While most conventional methods are of low-sensitivity or restricted to abundant mitochondrial DNA samples, we established a protocol that enables the accurate sequence-specific quantification of DNA damage in >3-kb probes for any mitochondrial or nuclear DNA sequence. In order to validate the sensitivity of this method, we compared LORD-Q with a previously published qPCR-based method and the standard single-cell gel electrophoresis assay, demonstrating a superior performance of LORD-Q. Exemplarily, we monitored induction of DNA damage and repair processes in human induced pluripotent stem cells and isogenic fibroblasts. Our results suggest that LORD-Q provides a sequence-specific and precise method to quantify DNA damage, thereby allowing the high-throughput assessment of DNA repair, genotoxicity screening and various other processes for a wide range of life science applications. PMID:24371283
Identification of circulating miRNA biomarkers based on global quantitative real-time PCR profiling
Directory of Open Access Journals (Sweden)
Kang Kang
2012-02-01
Full Text Available Abstract MicroRNAs (miRNAs are small noncoding RNAs (18-25 nucleotides that regulate gene expression at the post-transcriptional level. Recent studies have demonstrated the presence of miRNAs in the blood circulation. Deregulation of miRNAs in serum or plasma has been associated with many diseases including cancers and cardiovascular diseases, suggesting the possible use of miRNAs as diagnostic biomarkers. However, the detection of the small amount of miRNAs found in serum or plasma requires a method with high sensitivity and accuracy. Therefore, the current study describes polymerase chain reaction (PCR-based methods for measuring circulating miRNAs. Briefly, the procedure involves four major steps: (1 sample collection and preparation; (2 global miRNAs profiling using quantitative real-time PCR (qRT-PCR; (3 data normalization and analysis; and (4 selection and validation of miRNA biomarkers. In conclusion, qRT-PCR is a promising method for profiling of circulating miRNAs as biomarkers.
DEFF Research Database (Denmark)
Abdulmawjood, A.; Bulte, M.; Cook, N.
2003-01-01
As part of a major European research project, a diagnostic PCR assay, including an internal amplification control, was developed and validated in a collaborative trial for the detection of Escherichia coli O157. The assay is based on amplification of sequences of the rJbE O157 gene. The collabora...
Greenspoon, S A; Sykes, K L V; Ban, J D; Pollard, A; Baisden, M; Farr, M; Graham, N; Collins, B L; Green, M M; Christenson, C C
2006-12-20
Human genome, pharmaceutical and research laboratories have long enjoyed the application of robotics to performing repetitive laboratory tasks. However, the utilization of robotics in forensic laboratories for processing casework samples is relatively new and poses particular challenges. Since the quantity and quality (a mixture versus a single source sample, the level of degradation, the presence of PCR inhibitors) of the DNA contained within a casework sample is unknown, particular attention must be paid to procedural susceptibility to contamination, as well as DNA yield, especially as it pertains to samples with little biological material. The Virginia Department of Forensic Science (VDFS) has successfully automated forensic casework DNA extraction utilizing the DNA IQ(trade mark) System in conjunction with the Biomek 2000 Automation Workstation. Human DNA quantitation is also performed in a near complete automated fashion utilizing the AluQuant Human DNA Quantitation System and the Biomek 2000 Automation Workstation. Recently, the PCR setup for casework samples has been automated, employing the Biomek 2000 Automation Workstation and Normalization Wizard, Genetic Identity version, which utilizes the quantitation data, imported into the software, to create a customized automated method for DNA dilution, unique to that plate of DNA samples. The PCR Setup software method, used in conjunction with the Normalization Wizard method and written for the Biomek 2000, functions to mix the diluted DNA samples, transfer the PCR master mix, and transfer the diluted DNA samples to PCR amplification tubes. Once the process is complete, the DNA extracts, still on the deck of the robot in PCR amplification strip tubes, are transferred to pre-labeled 1.5 mL tubes for long-term storage using an automated method. The automation of these steps in the process of forensic DNA casework analysis has been accomplished by performing extensive optimization, validation and testing of the
Directory of Open Access Journals (Sweden)
Grazielle Cardoso da Graça
2012-08-01
Full Text Available In this study, PCR assays targeting different Leishmania heat-shock protein 70 gene (hsp70 regions, producing fragments ranging in size from 230-390 bp were developed and evaluated to determine their potential as a tool for the specific molecular diagnosis of cutaneous leishmaniasis (CL. A total of 70 Leishmania strains were analysed, including seven reference strains (RS and 63 previously typed strains. Analysis of the RS indicated a specific region of 234 bp in the hsp70 gene as a valid target that was highly sensitive for detection of Leishmania species DNA with capacity of distinguishing all analyzed species, after polymerase chain reaction-restriction fragment length polymorfism (PCR-RFLP. This PCR assay was compared with other PCR targets used for the molecular diagnosis of leishmaniasis: hsp70 (1400-bp region, internal transcribed spacer (ITS1 and glucose-6-phosphate dehydrogenase (G6pd. A good agreement among the methods was observed concerning the Leishmania species identification. Moreover, to evaluate the potential for molecular diagnosis, we compared the PCR targets hsp70-234 bp, ITS1, G6pd and mkDNA using a panel of 99 DNA samples from tissue fragments collected from patients with confirmed CL. Both PCR-hsp70-234 bp and PCR-ITS1 detected Leishmania DNA in more than 70% of the samples. However, using hsp70-234 bp PCR-RFLP, identification of all of the Leishmania species associated with CL in Brazil can be achieved employing a simpler and cheaper electrophoresis protocol.
Validation of a Real Time PCR for Classical Swine Fever Diagnosis
Directory of Open Access Journals (Sweden)
Natanael Lamas Dias
2014-01-01
Full Text Available The viral disease classical swine fever (CSF, caused by a Pestivirus, is one of the major causes of economic losses for pig farming. The aim of this work was to validate a RT-qPCR using Taqman for detection of CSF in swine tissues. The parameters for the validation followed the specifications of the Manual of Diagnostic Tests and Vaccines for Terrestrial Animals of the World Organization for Animal Health (OIE and the guide ABNT NBR ISO/IEC 17025:2005. The analysis of the 5′NTR region of CSF virus was performed in 145 samples from 29 infected pigs and in 240 samples from 80 pigs originated in the Brazilian CSF-free zone. The tissues tested were spleen, kidney, blood, tonsils, and lymph nodes. Sequencing of the positive samples for 5′NTR region was performed to evaluate the specificity of the RT-qPCR. Tests performed for the RT-qPCR validation demonstrated that the PCR assay was efficient in detecting RNA from CSF virus in all materials from different tissues of infected animals. Furthermore, RNA from CSF virus was not detected in samples of swine originated from the Brazilian CSF-free zone. Hence, it is concluded that RT-qPCR can be used as a complementary diagnostic for CSF.
Validation of a real time PCR for classical Swine Fever diagnosis.
Dias, Natanael Lamas; Fonseca Júnior, Antônio Augusto; Oliveira, Anapolino Macedo; Sales, Erica Bravo; Alves, Bruna Rios Coelho; Dorella, Fernanda Alves; Camargos, Marcelo Fernandes
2014-01-01
The viral disease classical swine fever (CSF), caused by a Pestivirus, is one of the major causes of economic losses for pig farming. The aim of this work was to validate a RT-qPCR using Taqman for detection of CSF in swine tissues. The parameters for the validation followed the specifications of the Manual of Diagnostic Tests and Vaccines for Terrestrial Animals of the World Organization for Animal Health (OIE) and the guide ABNT NBR ISO/IEC 17025:2005. The analysis of the 5'NTR region of CSF virus was performed in 145 samples from 29 infected pigs and in 240 samples from 80 pigs originated in the Brazilian CSF-free zone. The tissues tested were spleen, kidney, blood, tonsils, and lymph nodes. Sequencing of the positive samples for 5'NTR region was performed to evaluate the specificity of the RT-qPCR. Tests performed for the RT-qPCR validation demonstrated that the PCR assay was efficient in detecting RNA from CSF virus in all materials from different tissues of infected animals. Furthermore, RNA from CSF virus was not detected in samples of swine originated from the Brazilian CSF-free zone. Hence, it is concluded that RT-qPCR can be used as a complementary diagnostic for CSF.
Validation of a Real Time PCR for Classical Swine Fever Diagnosis
Dias, Natanael Lamas; Fonseca Júnior, Antônio Augusto; Oliveira, Anapolino Macedo; Sales, Érica Bravo; Alves, Bruna Rios Coelho; Dorella, Fernanda Alves
2014-01-01
The viral disease classical swine fever (CSF), caused by a Pestivirus, is one of the major causes of economic losses for pig farming. The aim of this work was to validate a RT-qPCR using Taqman for detection of CSF in swine tissues. The parameters for the validation followed the specifications of the Manual of Diagnostic Tests and Vaccines for Terrestrial Animals of the World Organization for Animal Health (OIE) and the guide ABNT NBR ISO/IEC 17025:2005. The analysis of the 5′NTR region of CSF virus was performed in 145 samples from 29 infected pigs and in 240 samples from 80 pigs originated in the Brazilian CSF-free zone. The tissues tested were spleen, kidney, blood, tonsils, and lymph nodes. Sequencing of the positive samples for 5′NTR region was performed to evaluate the specificity of the RT-qPCR. Tests performed for the RT-qPCR validation demonstrated that the PCR assay was efficient in detecting RNA from CSF virus in all materials from different tissues of infected animals. Furthermore, RNA from CSF virus was not detected in samples of swine originated from the Brazilian CSF-free zone. Hence, it is concluded that RT-qPCR can be used as a complementary diagnostic for CSF. PMID:24818039
de Oliveira, Valéria Maia; Manfio, Gilson Paulo; da Costa Coutinho, Heitor Luiz; Keijzer-Wolters, Anneke Christina; van Elsas, Jan Dirk
2006-03-01
A direct molecular method for assessing the diversity of specific populations of rhizobia in soil, based on nested PCR amplification of 16S-23S ribosomal RNA gene (rDNA) intergenic spacer (IGS) sequences, was developed. Initial generic amplification of bacterial rDNA IGS sequences from soil DNA was followed by specific amplification of (1) sequences affiliated with Rhizobium leguminosarum "sensu lato" and (2) R. tropici. Using analysis of the amplified sequences in clone libraries obtained on the basis of soil DNA, this two-sided method was shown to be very specific for rhizobial subpopulations in soil. It was then further validated as a direct fingerprinting tool of the target rhizobia based on denaturing gradient gel electrophoresis (DGGE). The PCR-DGGE approach was applied to soils from fields in Brazil cultivated with common bean (Phaseolus vulgaris) under conventional or no-tillage practices. The community fingerprints obtained allowed the direct analysis of the respective rhizobial community structures in soil samples from the two contrasting agricultural practices. Data obtained with both primer sets revealed clustering of the community structures of the target rhizobial types along treatment. Moreover, the DGGE profiles obtained with the R. tropici primer set indicated that the abundance and diversity of these organisms were favoured under NT practices. These results suggest that the R. leguminosarum-as well as R. tropici-targeted IGS-based nested PCR and DGGE are useful tools for monitoring the effect of agricultural practices on these and related rhizobial subpopulations in soils.
Directory of Open Access Journals (Sweden)
Henry Perdigon
2004-06-01
Full Text Available One type of crime scene evidence commonly submitted for analysis is bloodstain on denim. However, chemicals (e.g., indigo used to produce denim materials may co-purify with DNA and hence, affect subsequent DNA analysis. The present study compared five methods (e.g., standard organic, organic with hydrogen peroxide (H2O2, modified FTA™, organic/Chelex®-Centricon®, and QIAamp® DNA Mini Kit-based procedures for the isolation of blood DNA from denim. A Short Tandem Repeat (STR-based analysis across two to nine STR markers, namely, HUMvWA, HUMTH01, D8S306, HUMFES/FPS, HUMDHFRP2, HUMF13A01, HUMFGA, HUMTPOX, and HUMCSF1PO, was used to evaluate successful amplification of blood DNA extracted from light indigo, dark indigo, indigo-sulfur, pure indigo, sulfur-top, and sulfur-bottom denim materials. The results of the present study support the utility of organic/Chelex®-Centricon® and QIAamp® Kit procedures in extracting PCR-amplifiable DNA from five different types of denim materials for STR analysis. Furthermore, a solid-based method using FTA™ classic cards was modified to provide a simple, rapid, safe, and cost-effective procedure for extracting blood DNA from light, dark indigo and pure indigo denim materials. However, DNA eluted from bloodstained sulfur-dyed denims (e.g., sulfur-top and sulfur-bottom using FTA™ procedure was not readily amplifiable.
Real-time PCR (qPCR) primer design using free online software.
Thornton, Brenda; Basu, Chhandak
2011-01-01
Real-time PCR (quantitative PCR or qPCR) has become the preferred method for validating results obtained from assays which measure gene expression profiles. The process uses reverse transcription polymerase chain reaction (RT-PCR), coupled with fluorescent chemistry, to measure variations in transcriptome levels between samples. The four most commonly used fluorescent chemistries are SYBR® Green dyes and TaqMan®, Molecular Beacon or Scorpion probes. SYBR® Green is very simple to use and cost efficient. As SYBR® Green dye binds to any double-stranded DNA product, its success depends greatly on proper primer design. Many types of online primer design software are available, which can be used free of charge to design desirable SYBR® Green-based qPCR primers. This laboratory exercise is intended for those who have a fundamental background in PCR. It addresses the basic fluorescent chemistries of real-time PCR, the basic rules and pitfalls of primer design, and provides a step-by-step protocol for designing SYBR® Green-based primers with free, online software. Copyright © 2010 Wiley Periodicals, Inc.
Real-Time PCR (qPCR) Primer Design Using Free Online Software
Thornton, Brenda; Basu, Chhandak
2011-01-01
Real-time PCR (quantitative PCR or qPCR) has become the preferred method for validating results obtained from assays which measure gene expression profiles. The process uses reverse transcription polymerase chain reaction (RT-PCR), coupled with fluorescent chemistry, to measure variations in transcriptome levels between samples. The four most…
Torriani, Sandra; Zapparoli, Giacomo; Dellaglio, Franco
1999-01-01
Two PCR-based methods, specific PCR and randomly amplified polymorphic DNA PCR (RAPD-PCR), were used for rapid and reliable differentiation of Lactobacillus delbrueckii subsp. bulgaricus and L. delbrueckii subsp. lactis. PCR with a single combination of primers which targeted the proline iminopeptidase (pepIP) gene of L. delbrueckii subsp. bulgaricus allowed amplification of genomic fragments specific for the two subspecies when either DNA from a single colony or cells extracted from dairy pr...
Kletzel, Morris; Huang, Wei; Olszewski, Marie; Khan, Sana
2013-01-01
Post-hematopoietic stem cell transplantation (HSCT) chimerism monitoring is important to assess relapse and therapeutic intervention. The purpose of our study is to compare two methods variable number tandem repeats (VNTR) vs. quantitative real- time polymerase chain reaction (qPCR) in terms of determining chimerism. 127 (peripheral blood n=112, bone marrow n=15) samples were simultaneously tested by VNTR using APO-B, D1S80, D1S111, D17S30, gene loci SRY and ZP3 and qPCR using 34 assays (CA001-CA034) that are designed to a bi-allelic insertion/deletion (indel) polymorphism in the human genome. Samples were separated in three subsets: total WBC, T-cell and Myeloid cells. Extraction of DNA was performed then quantified. We analyzed column statistics, paired t-test and regression analysis for both methods. There was complete correlation between the two methods. The simplicity and rapidity of the test results from the qPCR method is more efficient and accurate to assess chimerism.
Specific PCR-based detection of Alternaria helianthi
DEFF Research Database (Denmark)
Udayashankar, A.C.; Nayaka, S. Chandra; Archana, B.
2012-01-01
Alternaria helianthi is an important seed-borne pathogenic fungus responsible for blight disease in sunflower. The current detection methods, which are based on culture and morphological identification, are time-consuming, laborious and are not always reliable. A PCR-based diagnostic method...... tested. The detection limit of the PCR method was of 10 pg from template DNA. The primers could also detect the pathogen in infected sunflower seed. This species-specific PCR method provides a quick, simple, powerful and reliable alternative to conventional methods in the detection and identification...
Directory of Open Access Journals (Sweden)
S Farnia
2009-05-01
Full Text Available "nBackground: The aim was to compare three different methods (direct examination, culture and PCR methods for the diagnosis of Acanthamoeba keratitis (AK in corneal scrapes."nMethods: Twenty eight corneal scrapes and contact lenses were collected from keratitis patients and referred to the Department of Medical Parasitology and Mycology, School of Public Health, Tehran University of Medical Sciences. Corneal scrapes were divided in three parts for direct examination, culture on non-nutrient agar and PCR analysis. PCR analysis was also performed using a 18S rRNA gene primer pair (DF3 region. DF3 (Diagnostic fragment 3 is a region of the nuclear small subunit ribosomal RNA gene which is specific for detecting Acanthamoeba strains."nResults: Acanthamoeba was the causative agent of keratitis in 50% of the patients. Direct smear of all prepared corneal scrapes in AK patients was negative and culture was positive in only 14.3% of the isolates. PCR analysis was positive in 71.4% of AK patients. These three methods were negative in corneal scrapes of non-AK patients. The sensitivity and specificity of PCR technique for the detection of Acanthamoeba sp. were calculated as 71.4% and 100%, respectively."nConclusion: According to high sensitivity and specificity of PCR-based method, this study confirmed that PCR using 18S rRNA gene primers (DF3 region is more useful for detecting AK cases compare to culture and direct microscopy methods.
Demeke, Tigst; Jenkins, G Ronald
2010-03-01
Biotechnology-derived varieties of canola, cotton, corn and soybean are being grown in the USA, Canada and other predominantly grain exporting countries. Although the amount of farmland devoted to production of biotechnology-derived crops continues to increase, lingering concerns that unintended consequences may occur provide the EU and most grain-importing countries with justification to regulate these crops. Legislation in the EU requires traceability of grains/oilseeds, food and feed products, and labelling, when a threshold level of 0.9% w/w of genetically engineered trait is demonstrated to be present in an analytical sample. The GE content is routinely determined by quantitative PCR (qPCR) and plant genomic DNA provides the template for the initial steps in this process. A plethora of DNA extraction methods exist for qPCR applications. Implementing standardized methods for detection of genetically engineered traits is necessary to facilitate grain marketing. The International Organization for Standardization draft standard 21571 identifies detergent-based methods and commercially available kits that are widely used for DNA extraction, but also indicates that adaptations may be necessary depending upon the sample matrix. This review assesses advantages and disadvantages of various commercially available DNA extraction kits, as well as modifications to published cetyltrimethylammonium bromide methods. Inhibitors are a major obstacle for efficient amplification in qPCR. The types of PCR inhibitors and techniques to minimize inhibition are discussed. Finally, accurate quantification of DNA for applications in qPCR is not trivial. Many confounders contribute to differences in analytical measurements when a particular DNA quantification method is applied and different methods do not always provide concordant results on the same DNA sample. How these differences impact measurement uncertainty in qPCR is considered.
Directory of Open Access Journals (Sweden)
M Heydarnezhadi
2011-09-01
Full Text Available Background: The main goal of the present study was to develop a new sensitive and specific PCR based method for Identification of Cryptosporidium sp. using novel primers from 18S ribosomal RNA. Cryptosporidiosis in high-risk host groups particularly in neonates and immuno-compromised individuals may result in death. To the best of our knowledge this is the first study regarding develop a new PCR based method to diagnose the cryptosporidiosis in Iran.Methods: A total of 850 human fecal samples from patients clinically suspected to cryptosporidiosis and 100 healthy and diarrheic cattle stool specimens were collected. The simplified formol-ether concentration method was carried out for all samples. They were then examined microscopically by modified Ziehl-Neelsen staining method. Total DNA was extracted by QIA amp DNA stool mini kit was carried out by using designed primers.Results: Twenty nine cases of cryptosporidiosis infection in human and 30 samples from cattle microscopically were positive. The described primary and nested PCR method could detect all Cryptosporidium positive samples from human and cattle. Regards to suspected negative samples in primary PCR examination, the Nested PCR could approve two more positive results. Furthermore, Nested PCR analysis was able to detect one more case which was negative in both microscopically examination and primary PCR. Specificity of the test was 100%. Sensitivity of Nested PCR in comparison to our gold standard; microscopy after Ridley concentration modified ziehl-Neelsen, was 100 %.Conclusion: Our developed PCR based method by using new primers devised from 18S ribosomal RNA revealed the ability for identification of the Cryptosporidium species such as C. parvum and C. huminis with high specificity and sensitivity.
Gisbert Algaba, Ignacio; Geerts, Manon; Jennes, Malgorzata; Coucke, Wim; Opsteegh, Marieke; Cox, Eric; Dorny, Pierre; Dierick, Katelijne; De Craeye, Stéphane
2017-11-01
Toxoplasma gondii is a globally prevalent, zoonotic parasite of major importance to public health. Various indirect and direct methods can be used for the diagnosis of toxoplasmosis. Whereas serological tests are useful to prove contact with the parasite has occurred, the actual presence of the parasite in the tissues of a seropositive animal is not demonstrated. For this, a bioassay is still the reference method. As an alternative, various PCR methods have been developed, but due to the limited amount of sample that can be tested, combined with a low tissue cyst density, those have proved to be insufficiently sensitive. A major improvement of the sensitivity was achieved with magnetic capture-based DNA extraction. By combining the hybridization of specific, biotinylated probes with the capture of those probes with streptavidin-coated paramagnetic beads, T. gondii DNA can selectively be "fished out" from a large volume of meat lysate. Still, several studies showed an insufficient sensitivity compared with the mouse bioassay. Here we present a method that is more sensitive (99% limit of detection: 65.4 tachyzoites per 100g of meat), economical and reliable (ISO 17025 validated) by adding a non-competitive PCR inhibition control (co-capture of cellular r18S) and making the release of the target DNA from the streptavidin-coated paramagnetic beads UV-dependent. The presented results demonstrate the potential of the modified Magnetic Capture real time PCR as a full alternative to the mouse bioassay for the screening of various types of tissues and meat, with the additional advantage of being quantitative. Copyright © 2017 Australian Society for Parasitology. Published by Elsevier Ltd. All rights reserved.
OWL-based reasoning methods for validating archetypes.
Menárguez-Tortosa, Marcos; Fernández-Breis, Jesualdo Tomás
2013-04-01
Some modern Electronic Healthcare Record (EHR) architectures and standards are based on the dual model-based architecture, which defines two conceptual levels: reference model and archetype model. Such architectures represent EHR domain knowledge by means of archetypes, which are considered by many researchers to play a fundamental role for the achievement of semantic interoperability in healthcare. Consequently, formal methods for validating archetypes are necessary. In recent years, there has been an increasing interest in exploring how semantic web technologies in general, and ontologies in particular, can facilitate the representation and management of archetypes, including binding to terminologies, but no solution based on such technologies has been provided to date to validate archetypes. Our approach represents archetypes by means of OWL ontologies. This permits to combine the two levels of the dual model-based architecture in one modeling framework which can also integrate terminologies available in OWL format. The validation method consists of reasoning on those ontologies to find modeling errors in archetypes: incorrect restrictions over the reference model, non-conformant archetype specializations and inconsistent terminological bindings. The archetypes available in the repositories supported by the openEHR Foundation and the NHS Connecting for Health Program, which are the two largest publicly available ones, have been analyzed with our validation method. For such purpose, we have implemented a software tool called Archeck. Our results show that around 1/5 of archetype specializations contain modeling errors, the most common mistakes being related to coded terms and terminological bindings. The analysis of each repository reveals that different patterns of errors are found in both repositories. This result reinforces the need for making serious efforts in improving archetype design processes. Copyright © 2012 Elsevier Inc. All rights reserved.
Directory of Open Access Journals (Sweden)
Gadani F
2014-12-01
Full Text Available Analytical methods based on the polymerase chain reaction (PCR technology are increasingly used for the detection of deoxyribonucleic acid (DNA sequences associated with genetically modified organisms (GMOs. In the European Union and Switzerland, mandatory labeling of novel foods and food ingredients consisting of, or containing GMOs is required according to food regulations and is triggered by the presence of newly introduced foreign DNA sequences, or newly expressed proteins. In order to meet regulatory and consumer demand, numerous PCR-based methods have been developed which can detect, identify and quantify GMOs in agricultural crops, food and feed. Moreover, the determination of genetic identity allows for segregation and traceability (identity preservation throughout the supply chain of GM crops that have been enhanced with value-added quality traits. Prerequisites for GMO detection include a minimum amount of the target gene and prior knowledge of the type of genetic modification, such as virus or insect resistance traits, including controlling elements (promoters and terminators. Moreover, DNA extraction and purification is a critical step for the preparation of PCR-quality samples, particularly for processed agricultural crops such as tobacco. This paper reviews the state-of-the-art of PCR-based method development for the qualitative and quantitative determination and identification of GMOs, and includes a short summary of official and validated GMO detection methods.
PCR IN TRAUMATOLOGY AND ORTHOPAEDICS: METHOD DESCRIPTION AND APPLICABILITY
Directory of Open Access Journals (Sweden)
E. M. Polyakova
2014-01-01
Full Text Available Review brief presents description of polymerase chain reaction method (PCR and its most common variants. Three PCR-based lines of research, carried out in the traumatology and orthopaedics, include identifying a causative agents of the implant-associated infection after orthopaedic surgery; detection of antibiotic resistance genes and biofilm forming genes. It was shown that PCR can be used as additional method for detection of genetic disorders, significant for traumatology and orthopaedics, and for investigation of cartilage and bone regeneration.
Efficacy of a novel PCR- and microarray-based method in diagnosis of a prosthetic joint infection
2014-01-01
Background and purpose Polymerase chain reaction (PCR) methods enable detection and species identification of many pathogens. We assessed the efficacy of a new PCR and microarray-based platform for detection of bacteria in prosthetic joint infections (PJIs). Methods This prospective study involved 61 suspected PJIs in hip and knee prostheses and 20 negative controls. 142 samples were analyzed by Prove-it Bone and Joint assay. The laboratory staff conducting the Prove-it analysis were not aware of the results of microbiological culture and clinical findings. The results of the analysis were compared with diagnosis of PJIs defined according to the Musculoskeletal Infection Society (MSIS) criteria and with the results of microbiological culture. Results 38 of 61 suspected PJIs met the definition of PJI according to the MSIS criteria. Of the 38 patients, the PCR detected bacteria in 31 whereas bacterial culture was positive in 28 patients. 15 of the PJI patients were undergoing antimicrobial treatment as the samples for analysis were obtained. When antimicrobial treatment had lasted 4 days or more, PCR detected bacteria in 6 of the 9 patients, but positive cultures were noted in only 2 of the 9 patients. All PCR results for the controls were negative. Of the 61 suspected PJIs, there were false-positive PCR results in 6 cases. Interpretation The Prove-it assay was helpful in PJI diagnostics during ongoing antimicrobial treatment. Without preceding treatment with antimicrobials, PCR and microarray-based assay did not appear to give any additional information over culture. PMID:24564748
Venema, K.; Maathuis, A.J.H.
2003-01-01
A polymerase chain reaction (PCR)-based method was developed for the identification of isolates of Bifidobacterium at the species level. Using two Bifidobacterium-specific primers directed against the 16S ribosomal gene (Bif164 and Bif662), a PCR product was obtained from the type strains of 12
Development and validation of real-time PCR for rapid detection of Mecistocirrus digitatus.
Directory of Open Access Journals (Sweden)
Subhra Subhadra
Full Text Available Hematophagous activity of Mecistocirrus digitatus, which causes substantial blood and weight loss in large ruminants, is an emerging challenge due to the economic loss it brings to the livestock industry. Infected animals are treated with anthelmintic drugs, based on the identification of helminth species and the severity of infection; however, traditional methods such as microscopic identification and the counting of eggs for diagnosis and determination of level of infection are laborious, cumbersome and unreliable. To facilitate the detection of this parasite, a SYBR green-based real-time PCR was standardized and validated for the detection of M. digitatus infection in cattle and buffaloes. Oligonucleotides were designed to amplify partial Internal Transcribed Spacer (ITS-1 sequence of M. digitatus. The specificity of the primers was confirmed by non-amplification of DNA extracted from other commonly occurring gastrointestinal nematodes in ruminants. Plasmids were ligated with partial ITS-1 sequence of M. digitatus, serially diluted (hundred fold and used as standards in the real-time PCR assay. The quantification cycle (Cq values were plotted against the standard DNA concentration to produce a standard curve. The assay was sensitive enough to detect one plasmid containing the M. digitatus DNA. Clinical application of this assay was validated by testing the DNA extracted from the faeces of naturally infected cattle (n = 40 and buffaloes (n = 25. The results were compared with our standard curve to calculate the quantity of M. digitatus in each faecal sample. The Cq value of the assay depicted a strong linear relationship with faecal DNA content, with a regression coefficient of 0.984 and efficiency of 99%. This assay has noteworthy advantages over the conventional methods of diagnosis because it is more specific, sensitive and reliable.
Comparison of Nested-PCR technique and culture method in ...
African Journals Online (AJOL)
USER
2010-04-05
Apr 5, 2010 ... Full Length Research Paper. Comparison of ... The aim of the present study was to evaluate the diagnostic value of nested PCR in genitourinary ... method. Based on obtained results, the positivity rate of urine samples in this study was 5.0% by using culture and PCR methods and 2.5% for acid fast staining.
Vandenbussche, Frank; Lefebvre, David J; De Leeuw, Ilse; Van Borm, Steven; De Clercq, Kris
2017-08-01
The 3D and 5UTR real-time RT-PCR assays (RT-qPCR) from Callahan et al. (2002) and Reid et al. (2002) are commonly used reference methods for the detection of foot-and-mouth disease virus (FMDV). For an optimal detection of FMDV in clinical samples, it is advised to use both assays simultaneously (King et al., 2006). Recently, Vandenbussche et al. (2016) showed that the addition of 5'-tails to the FMDV-specific primers enhances the detection of FMDV in both the 3D and the 5UTR RT-qPCR assay. To validate the 3D and 5UTR RT-qPCR assays with 5'-tailed primers for diagnostic purposes, both assays were run in parallel in a triplex one-step RT-qPCR protocol with beta-actin as an internal control and synthetic RNA as an external control. We obtained low limits of detection and high linearity's, high repeatability and reproducibility, near 100% analytical specificity and >99% diagnostic accuracy for both assays. It was concluded that the 3D and 5UTR RT-qPCR assays with 5'-tailed primers are particularly suited for the detection of FMDV as well as to exclude the presence of FMDV. Copyright © 2017 Elsevier B.V. All rights reserved.
International Nuclear Information System (INIS)
Maria Lina R; Andi Yasmon
2011-01-01
There are many commercial ELISA and rapid test kits that have been used for blood screening; however, the kits can give false positive and negative results. Therefore, RT-PCR (Reverse Transcription Polymerase Chain Reaction) - Dot Blot Hybridization based on radioisotope 32 P (RDBR) method was developed in this research, to compare the method with the conventional RT-PCR and commercial ELISA Enzyme-Linked lmmunosorbent Assay) kit. This method is efficient for screening of large blood specimens and surveillance study. Eighty seven samples were used and serum of the samples were tested by ELISA to detect HIV-1. The HIV-l RNA genome was extracted from plasma samples and tested using the RT-PCR and RDBR methods. Of 87 samples that were tested, the rates of positive testing of the RT-PCR, the RDBR, and the ELISA were 71.26%, 74.71%, and 80.46%, respectively. The RDBR (a combination of RTPCR and dot blot hybridization) was more sensitive than conventional RT-PCR by showing 3.45% in increase number of positive specimens. The results showed that of 9 samples (10.34%) were negative RDBR and positive ELISA, while 4 samples (4.60%) were negative ELISA and positive RDBR. The two methods showed slightly difference in the results but further validation is still needed. However, RDBR has high potential as an alternative method for screening of blood in large quantities when compared to method of conventional RT-PCR and ELISA. (author)
Diagnosis of clinical samples spotted on FTA cards using PCR-based methods.
Jamjoom, Manal; Sultan, Amal H
2009-04-01
The broad clinical presentation of Leishmaniasis makes the diagnosis of current and past cases of this disease rather difficult. Differential diagnosis is important because diseases caused by other aetiologies and a clinical spectrum similar to that of leishmaniasis (e.g. leprosy, skin cancers and tuberculosis for CL; malaria and schistosomiasis for VL) are often present in endemic areas of endemicity. Presently, a variety of methods have been developed and tested to aid the identification and diagnosis of Leishmania. The advent of the PCR technology has opened new channels for the diagnosis of leishmaniasis in a variety of clinical materials. PCR is a simple, rapid procedure that has been adapted for diagnosis of leishmaniasis. A range of tools is currently available for the diagnosis and identification of leishmaniasis and Leishmania species, respectively. However, none of these diagnostic tools are examined and tested using samples spotted on FTA cards. Three different PCR-based approaches were examined including: kDNA minicircle, Leishmania 18S rRNA gene and PCR-RFLP of Intergenic region of ribosomal protein. PCR primers were designed that sit within the coding sequences of genes (relatively well conserved) but which amplify across the intervening intergenic sequence (relatively variable). These were used in PCR-RFLP on reference isolates of 10 of the most important Leishmania species: L. donovani, L. infantum, L. major & L. tropica. Digestion of PCR products with restriction enzymes produced species-specific restriction patterns allowed discrimination of reference isolates. The kDNA minicircle primers are highly sensitive in diagnosis of both bone marrow and skin smears from FTA cards. Leishmania 18S rRNA gene conserved region is sensitive in identification of bone marrow smear but less sensitive in diagnosing skin smears. The intergenic nested PCR-RFLP using P5 & P6 as well as P1 & P2 newly designed primers showed high level of reproducibility and sensitivity
A number of PCR-based methods for detecting human fecal material in environmental waters have been developed over the past decade, but these methods have rarely received independent comparative testing. Here, we evaluated ten of these methods (BacH, BacHum-UCD, B. thetaiotaomic...
Eugster, Albert; Murmann, Petra; Kaenzig, Andre; Breitenmoser, Alda
2014-10-01
In routine analysis screening methods based on real-time PCR (polymerase chain reaction) are most commonly used for the detection of genetically modified (GM) plant material in food and feed. Screening tests are based on sequences frequently used for GM development, allowing the detection of a large number of GMOs (genetically modified organisms). Here, we describe the development and validation of a tetraplex real-time PCR screening assay comprising detection systems for the regulatory genes Cauliflower Mosaic Virus 35S promoter, Agrobacterium tumefaciens nos terminator, Cauliflower Mosaic Virus 35S terminator and Figwort Mosaic Virus 34S promoter. Three of the four primer and probe combinations have already been published elsewhere, whereas primers and probe for the 35S terminator have been developed in-house. Adjustment of primer and probe concentrations revealed a high PCR sensitivity with insignificant physical cross-talk between the four detection channels. The sensitivity of each PCR-system is sufficient to detect a GMO concentration as low as 0.05% of the containing respective element. The specificity of the described tetraplex is high when tested on DNA from GM maize, soy, rapeseed and tomato. We also demonstrate the robustness of the system by inter-laboratory tests. In conclusion, this method provides a sensitive and reliable screening procedure for the detection of the most frequently used regulatory elements present in GM crops either authorised or unauthorised for food.
Development and validation of a real-time PCR assay for the detection of anguillid herpesvirus 1.
van Beurden, S J; Voorbergen-Laarman, M A; Roozenburg, I; van Tellingen, J; Haenen, O L M; Engelsma, M Y
2016-01-01
Anguillid herpesvirus 1 (AngHV1) causes a haemorrhagic disease with increased mortality in wild and farmed European eel, Anguilla anguilla (L.) and Japanese eel Anguilla japonica, Temminck & Schlegel). Detection of AngHV1 is currently based on virus isolation in cell culture, antibody-based typing assays or conventional PCR. We developed, optimized and concisely validated a diagnostic TaqMan probe based real-time PCR assay for the detection of AngHV1. The primers and probe target AngHV1 open reading frame 57, encoding the capsid protease and scaffold protein. Compared to conventional PCR, the developed real-time PCR is faster, less labour-intensive and has a reduced risk of cross-contamination. The real-time PCR assay was shown to be analytically sensitive and specific and has a high repeatability, efficiency and r(2) -value. The diagnostic performance of the assay was determined by testing 10% w/v organ suspensions and virus cultures from wild and farmed European eels from the Netherlands by conventional and real-time PCR. The developed real-time PCR assay is a useful tool for the rapid and sensitive detection of AngHV1 in 10% w/v organ suspensions from wild and farmed European eels. © 2015 John Wiley & Sons Ltd.
Bayesian risk-based decision method for model validation under uncertainty
International Nuclear Information System (INIS)
Jiang Xiaomo; Mahadevan, Sankaran
2007-01-01
This paper develops a decision-making methodology for computational model validation, considering the risk of using the current model, data support for the current model, and cost of acquiring new information to improve the model. A Bayesian decision theory-based method is developed for this purpose, using a likelihood ratio as the validation metric for model assessment. An expected risk or cost function is defined as a function of the decision costs, and the likelihood and prior of each hypothesis. The risk is minimized through correctly assigning experimental data to two decision regions based on the comparison of the likelihood ratio with a decision threshold. A Bayesian validation metric is derived based on the risk minimization criterion. Two types of validation tests are considered: pass/fail tests and system response value measurement tests. The methodology is illustrated for the validation of reliability prediction models in a tension bar and an engine blade subjected to high cycle fatigue. The proposed method can effectively integrate optimal experimental design into model validation to simultaneously reduce the cost and improve the accuracy of reliability model assessment
Validation of the DNATyper™15 PCR Genotyping System for Forensic Application
Directory of Open Access Journals (Sweden)
Jian Ye
2015-01-01
Full Text Available We describe the optimization and validation of the DNATyper™15 multiplex polymerase chain reaction (PCR genotyping system for autosomal short tandem repeat (STR amplification at 14 autosomal loci (D6S1043, D21S11, D7S820, CSF1PO, D2S1338, D3S1358, D13S317, D8S1179, D16S539, Penta E, D5S818, vWA, D18S51, and FGA and amelogenin, a sex-determining locus. Several DNATyper™15 assay variables were optimized, including hot start Taq polymerase concentration, Taq polymerase activation time, magnesium concentration, primer concentration, annealing temperature, reaction volume, and cycle number. The performance of the assay was validated with respect to species specificity, sensitivity to template concentration, stability, accuracy, influence of the DNA extraction methods, and the ability to genotype the mixture samples. The performance of the DNATyper™15 system on casework samples was compared with that of two widely used STR amplification kits, Identifiler™ (Applied Biosystems, Carlsbad, CA, USA and PowerPlex 16 ® (Promega, Madison, WI, USA. The conditions for PCR-based DNATyper™15 genotyping were optimized. Contamination from forensically relevant nonhuman DNA was not found to impact genotyping results, and full profiles were generated for all the reactions containing ≥ 0.125 ng of DNA template. No significant difference in performance was observed even after the DNATyper™15 assay components were subjected to 20 freeze-thaw cycles. The performances of DNATyper™15, Identifiler™, and PowerPlex 16 ® were comparable in terms of sensitivity and the ability to genotype the mixed samples and case-type samples, with the assays giving the same genotyping results for all the shared loci. The DNA extraction methods did not affect the performance of any of the systems. Our results demonstrate that the DNATyper™15 system is suitable for genotyping in both forensic DNA database work and case-type samples.
DEFF Research Database (Denmark)
D'Agostino, M.; Wagner, M.; Vazquez-Boland, J.A.
2004-01-01
the accordance (repeatability) and the concordance (reproducibility) were 99.4%. The assay was incorporated within a method for the detection of L. monocytogenes in raw milk, which involves 24 It of enrichment in half-Fraser broth followed by 16 h of enrichment in a medium that can be added directly into the PCR...
Torriani, S; Zapparoli, G; Dellaglio, F
1999-10-01
Two PCR-based methods, specific PCR and randomly amplified polymorphic DNA PCR (RAPD-PCR), were used for rapid and reliable differentiation of Lactobacillus delbrueckii subsp. bulgaricus and L. delbrueckii subsp. lactis. PCR with a single combination of primers which targeted the proline iminopeptidase (pepIP) gene of L. delbrueckii subsp. bulgaricus allowed amplification of genomic fragments specific for the two subspecies when either DNA from a single colony or cells extracted from dairy products were used. A numerical analysis of the RAPD-PCR patterns obtained with primer M13 gave results that were consistent with the results of specific PCR for all strains except L. delbrueckii subsp. delbrueckii LMG 6412(T), which clustered with L. delbrueckii subsp. lactis strains. In addition, RAPD-PCR performed with primer 1254 provided highly polymorphic profiles and thus was superior for distinguishing individual L. delbrueckii strains.
Torriani, Sandra; Zapparoli, Giacomo; Dellaglio, Franco
1999-01-01
Two PCR-based methods, specific PCR and randomly amplified polymorphic DNA PCR (RAPD-PCR), were used for rapid and reliable differentiation of Lactobacillus delbrueckii subsp. bulgaricus and L. delbrueckii subsp. lactis. PCR with a single combination of primers which targeted the proline iminopeptidase (pepIP) gene of L. delbrueckii subsp. bulgaricus allowed amplification of genomic fragments specific for the two subspecies when either DNA from a single colony or cells extracted from dairy products were used. A numerical analysis of the RAPD-PCR patterns obtained with primer M13 gave results that were consistent with the results of specific PCR for all strains except L. delbrueckii subsp. delbrueckii LMG 6412T, which clustered with L. delbrueckii subsp. lactis strains. In addition, RAPD-PCR performed with primer 1254 provided highly polymorphic profiles and thus was superior for distinguishing individual L. delbrueckii strains. PMID:10508059
RAPID DNA EXTRACTION AND PCR VALIDATION FOR DIRECT DETECTION OF Listeria monocytogenes IN RAW MILK
Directory of Open Access Journals (Sweden)
Edith Burbano
2006-05-01
Full Text Available Objective. The aim of this study was to validate a method for detecting L. monocytogenes in raw milk.Materials and methods. The extraction procedure carried out using a chaotropic agent like NaI, toreduce fat in the sample to 0.2% w/v, which is the lowest limit for detection in the Gerber method, toavoid the polymerization. The raw milk samples were analyzed by using the traditional gold standardmethod for L. monocytogenes. Detection PCR was done on the specificity of primers that recognize theListeria genus by amplifying a specific fragment of about 938bp of the 16S rDNA. Several primer setswere use: L1 (CTCCATAAAGGTGACCCT, U1 (CAGCMGCCGCGGTAATWC, LF (CAAACGTTAACAACGCAGTAand LR (TCCAGAGTGATCGATGTTAA that recognize the hlyA gene of L. monocytogenes, amplifying a 750bpfragment. Results. The DNA of 39 strains evidenced high specificity of the technique since all the strainsof L. monocytogenes amplified the fragments 938bp and 750bp, specifically for genus and species,respectively. The detection limit of the PCR was 101 CFU/ml. T he PCR reproducibility showed a Kappa of0.85; the specificity and sensitivity of 100% were found, predictive positive and negative values were of100% respectively. Conclusions. These results demonstrate that is possible to detect of Listeria spp. byusing any of the three methods since they share the same sensitivity and specificity. One hundred percentof the predictive value for PCR (alternative method provides high reliability, and allows the detection ofthe positive samples. The extraction procedure combined with a PCR method can reduce in 15 days thetime of identification of L. monocytogenes in raw milk. This PCR technique could be adapted and validatedto be use for other types of food such as poultry, meat products and cheeses
[A new method of processing quantitative PCR data].
Ke, Bing-Shen; Li, Guang-Yun; Chen, Shi-Min; Huang, Xiang-Yan; Chen, Ying-Jian; Xu, Jun
2003-05-01
Today standard PCR can't satisfy the need of biotechnique development and clinical research any more. After numerous dynamic research, PE company found there is a linear relation between initial template number and cycling time when the accumulating fluorescent product is detectable.Therefore,they developed a quantitative PCR technique to be used in PE7700 and PE5700. But the error of this technique is too great to satisfy the need of biotechnique development and clinical research. A better quantitative PCR technique is needed. The mathematical model submitted here is combined with the achievement of relative science,and based on the PCR principle and careful analysis of molecular relationship of main members in PCR reaction system. This model describes the function relation between product quantity or fluorescence intensity and initial template number and other reaction conditions, and can reflect the accumulating rule of PCR product molecule accurately. Accurate quantitative PCR analysis can be made use this function relation. Accumulated PCR product quantity can be obtained from initial template number. Using this model to do quantitative PCR analysis,result error is only related to the accuracy of fluorescence intensity or the instrument used. For an example, when the fluorescence intensity is accurate to 6 digits and the template size is between 100 to 1,000,000, the quantitative result accuracy will be more than 99%. The difference of result error is distinct using same condition,same instrument but different analysis method. Moreover,if the PCR quantitative analysis system is used to process data, it will get result 80 times of accuracy than using CT method.
Zhan, Fangfang; Zhou, Xiaoming
2012-12-01
Rotaviruses are double-stranded RNA viruses belonging to the family of enteric pathogens. It is a major cause of diarrhoeal disease in infants and young children worldwide. Consequently, rapid and accurate detection of rotaviruses is of great importance in controlling and preventing food- and waterborne diseases and outbreaks. Reverse transcription-polymerase chain reaction (RT-PCR) is a reliable method that possesses high specificity and sensitivity. It has been widely used to detection of viruses. Electrochemiluminescence (ECL) can be considered as an important and powerful tool in analytical and clinical application with high sensitivity, excellent specificity, and low cost. Here we have developed a method for the detection of rotavirus by combining in situ magnetic beads (MBs) based RT-PCR with ECL. RT of rotavirus RNA was carried out in a traditional way and the resulting cDNA was directly amplified on MBs. Forward primers were covalently bounded to MBs and reverse primers were labeled with tris-(2, 2'-bipyridyl) ruthenium (TBR). During the PCR cycling, the TBR labeled products were directly loaded and enriched on the surface of MBs. Then the MBs-TBR complexes could be analyzed by a magnetic ECL platform without any post-modification or post-incubation which avoid some laborious manual operations and achieve rapid yet sensitive detection. In this study, rotavirus from fecal specimens was successfully detected within 2 h, and the limit of detection was estimated to be 104copies/μL. This novel in situ MBs based RT-PCR with ECL detection method can be used for pathogen detection in food safety field and clinical diagnosis.
Validation of the multiplex PCR for identification of Brucella spp.
Directory of Open Access Journals (Sweden)
Lívia de Lima Orzil
2016-05-01
Full Text Available ABSTRACT: A multiplex PCR technique for detection of Brucella spp. in samples of bacterial suspension was validated as a complementary tool in the diagnosis of the disease. This technique allows the characterization of the agent without performing biochemical tests, which greatly reduces the time for a final diagnosis, and provides more security for the analyst by reducing the time of exposure to microorganisms. The validation was performed in accordance with the Manual of Diagnostic Tests from OIE (2008 and following the requirements present in the ABNT NBR ISO/IEC 17025:2005. The mPCR validated in this study identified the different species of Brucella ( Brucella abortus , B. suis , B. ovis e B. melitensis of bacterial suspension obtained from the slaughterhouse samples, as well as distinguished the biovars (1, 2 e 4; 3b, 5, 6 e 9 of B. abortus in grouped form and differentiated the field strains from vaccine strains, as a quick, useful and less expensive technique in diagnosis of brucellosis in Brazil.
Study of the Efficacy of Real Time-PCR Method for Amikacin Determination Using Microbial Assay
Directory of Open Access Journals (Sweden)
Farzaneh Lotfipour
2015-06-01
Full Text Available Purpose: Microbial assay is used to determine the potency of antibiotics and vitamins. In spite of its advantages like simplicity and easiness, and to reveal the slight changes in the molecules, the microbial assay suffers from significant limitations; these methods are of lower specificity, accuracy and sensitivity. The objective of the present study is to evaluate the efficacy of real time-PCR technique in comparison with turbidimetric method for microbial assay of amikacin. Methods: Microbial determination of amikacin by turbidimetric method was performed according to USP. Also amikacin concentrations were determined by microbial assay using taq-man quantitative PCR method. Standard curves in different concentration for both methods were plotted and method validation parameters of linearity, precision and accuracy were calculated using statistical procedures. Results: The RT-PCR method was linear in the wider concentration range (5.12 – 38.08 for RT-PCR versus 8.00 – 30.47 for turbidimetric method with a better correlation coefficient (0.976 for RT-PCR versus 0.958 for turbidimetric method. RT-PCR method with LOQ of 5.12 ng/ml was more sensitive than turbidimetric method with LOQ of 8.00 ng/ml and the former could detect and quantify low concentrations of amikacin. The results of accuracy and precision evaluation showed that the RT-PCR method was accurate and precise in all of the tested concentration. Conclusion: The RT-PCR method described here provided an accurate and precise technique for measurement of amikacin potency and it can be a candidate for microbial determination of the antibiotics with the same test organism.
Single tube genotyping of sickle cell anaemia using PCR-based SNP analysis.
Waterfall, C M; Cobb, B D
2001-12-01
Allele-specific amplification (ASA) is a generally applicable technique for the detection of known single nucleotide polymorphisms (SNPs), deletions, insertions and other sequence variations. Conventionally, two reactions are required to determine the zygosity of DNA in a two-allele system, along with significant upstream optimisation to define the specific test conditions. Here, we combine single tube bi-directional ASA with a 'matrix-based' optimisation strategy, speeding up the whole process in a reduced reaction set. We use sickle cell anaemia as our model SNP system, a genetic disease that is currently screened using ASA methods. Discriminatory conditions were rapidly optimised enabling the unambiguous identification of DNA from homozygous sickle cell patients (HbS/S), heterozygous carriers (HbA/S) or normal DNA in a single tube. Simple downstream mathematical analyses based on product yield across the optimisation set allow an insight into the important aspects of priming competition and component interactions in this competitive PCR. This strategy can be applied to any polymorphism, defining specific conditions using a multifactorial approach. The inherent simplicity and low cost of this PCR-based method validates bi-directional ASA as an effective tool in future clinical screening and pharmacogenomic research where more expensive fluorescence-based approaches may not be desirable.
SASqPCR: robust and rapid analysis of RT-qPCR data in SAS.
Directory of Open Access Journals (Sweden)
Daijun Ling
Full Text Available Reverse transcription quantitative real-time PCR (RT-qPCR is a key method for measurement of relative gene expression. Analysis of RT-qPCR data requires many iterative computations for data normalization and analytical optimization. Currently no computer program for RT-qPCR data analysis is suitable for analytical optimization and user-controllable customization based on data quality, experimental design as well as specific research aims. Here I introduce an all-in-one computer program, SASqPCR, for robust and rapid analysis of RT-qPCR data in SAS. This program has multiple macros for assessment of PCR efficiencies, validation of reference genes, optimization of data normalizers, normalization of confounding variations across samples, and statistical comparison of target gene expression in parallel samples. Users can simply change the macro variables to test various analytical strategies, optimize results and customize the analytical processes. In addition, it is highly automatic and functionally extendable. Thus users are the actual decision-makers controlling RT-qPCR data analyses. SASqPCR and its tutorial are freely available at http://code.google.com/p/sasqpcr/downloads/list.
Capillary-based integrated digital PCR in picoliter droplets.
Chen, Jinyu; Luo, Zhaofeng; Li, Lin; He, Jinlong; Li, Luoquan; Zhu, Jianwei; Wu, Ping; He, Liqun
2018-01-30
The droplet digital polymerase chain reaction (ddPCR) is becoming more and more popular in diagnostic applications in academia and industry. In commercially available ddPCR systems, after they have been made by a generator, the droplets have to be transferred manually to modules for amplification and detection. In practice, some of the droplets (∼10%) are lost during manual transfer, leading to underestimation of the targets. In addition, the droplets are also at risk of cross-contamination during transfer. By contrast, in labs, some chip-based ddPCRs have been demonstrated where droplets always run in channels. However, the droplets easily coalesce to large ones in chips due to wall wetting as well as thermal oscillation. The loss of droplets becomes serious when such ddPCRs are applied to absolutely quantify rare mutations, such as in early diagnostics in clinical research or when measuring biological diversity at the cell level. Here, we propose a capillary-based integrated ddPCR system that is used for the first time to realize absolute quantification in this way. In this system, a HPLC T-junction is used to generate droplets and a long HPLC capillary connects the generator with both a capillary-based thermocycler and a capillary-based cytometer. The performance of the system is validated by absolute quantification of a gene specific to lung cancer (LunX). The results show that this system has very good linearity (0.9988) at concentrations ranging from NTC to 2.4 × 10 -4 copies per μL. As compared to qPCR, the all-in-one scheme is superior both in terms of the detection limit and the smaller fold changes measurement. The system of ddPCR might provide a powerful approach for clinical or academic applications where rare events are mostly considered.
Krych, Łukasz; Kot, Witold; Bendtsen, Katja M B; Hansen, Axel K; Vogensen, Finn K; Nielsen, Dennis S
2018-01-01
The Dextran Sulfate Sodium (DSS) induced colitis mouse model is commonly used to investigate human inflammatory bowel disease (IBD). Nucleic acid extracts originating from these animals are often contaminated with DSS, which is a strong inhibitor of many enzymatic based molecular biology reactions including PCR and reverse-transcription (RT). Methods for removing DSS from nucleic acids extracts exist for RNA, but no effective protocol for DNA or cDNA is currently available. However, spermine has previously been shown to be an effective agent for counteracting DSS inhibition of polynucleotide kinase, which led to the hypothesis, that spermine could be used to counteract DSS inhibition of PCR and RT. We investigated the means of adding spermine in an adequate concentration to PCR based protocols (including qPCR, two-step RT-qPCR, and amplicon sequencing library preparation) to remove DSS inhibition. Within the range up to 0.01g/L, spermine can be added to PCR/qPCR or RT prophylactically without a significant reduction of reaction efficiency. Addition of spermine at the concentration of 0.08g/L can be used to recover qualitative PCR signal inhibited by DSS in concentrations up to 0.32g/L. For optimal quantitative analysis, the concentration of spermine requires fine adjustment. Hence, we present here a simple fluorometric based method for adjusting the concentration of spermine ensuring an optimal efficiency of the reaction exposed to an unknown concentration of DSS. In conclusion, we demonstrate a cost effective and easy method to counteract DSS inhibition in PCR and two-step RT-qPCR. Fixed or fine-tuned concentrations of spermine can be administered depending on the qualitative or quantitative character of the analysis. Copyright © 2017 Elsevier B.V. All rights reserved.
da Fonseca, Allex Jardim; Galvão, Renata Silva; Miranda, Angelica Espinosa; Ferreira, Luiz Carlos de Lima; Chen, Zigui
2016-05-01
To compare the diagnostic performance for HPV infection using three laboratorial techniques. Ninty-five cervicovaginal samples were randomly selected; each was tested for HPV DNA and genotypes using 3 methods in parallel: Multiplex-PCR, the Nested PCR followed by Sanger sequencing, and the Next_Gen Sequencing (NGS) with two assays (NGS-A1, NGS-A2). The study was approved by the Brazilian National IRB (CONEP protocol 16,800). The prevalence of HPV by the NGS assays was higher than that using the Multiplex-PCR (64.2% vs. 45.2%, respectively; P = 0.001) and the Nested-PCR (64.2% vs. 49.5%, respectively; P = 0.003). NGS also showed better performance in detecting high-risk HPV (HR-HPV) and HPV16. There was a weak interobservers agreement between the results of Multiplex-PCR and Nested-PCR in relation to NGS for the diagnosis of HPV infection, and a moderate correlation for HR-HPV detection. Both NGS assays showed a strong correlation for detection of HPVs (k = 0.86), HR-HPVs (k = 0.91), HPV16 (k = 0.92) and HPV18 (k = 0.91). NGS is more sensitive than the traditional Sanger sequencing and the Multiplex PCR to genotype HPVs, with promising ability to detect multiple infections, and may have the potential to establish an alternative method for the diagnosis and genotyping of HPV. © 2015 Wiley Periodicals, Inc.
Wang, Chao; Dong, Dong; Wang, Guangce; Zhang, Baoyu; Peng, Guang; Xu, Pu; Tang, Xiaorong
2009-09-01
An improved method of PCR in which the small segment of conchocelis is amplified directly without DNA extraction was used to amplify a RUBISCO intergenic spacer DNA fragment from nine species of red algal genus Porphyra (Bangiales, Rhodophyta), including Porphyra yezoensis (Jiangsu, China), P. haitanensis (Fujian, China), P. oligospermatangia (Qingdao, China), P. katadai (Qingdao, China), P. tenera (Qingdao, China), P. suborboculata (Fujian, China), P. pseudolinearis (Kogendo, Korea), P. linearis (Devon, England), and P. fallax (Seattle, USA). Standard PCR and the method developed here were both conducted using primers specific for the RUBISCO spacer region, after which the two PCR products were sequenced. The sequencing data of the amplicons obtained using both methods were identical, suggesting that the improved PCR method was functional. These findings indicate that the method developed here may be useful for the rapid identification of species of Porphyra in a germplasm bank. In addition, a phylogenetic tree was constructed using the RUBISCO spacer and partial rbcS sequence, and the results were in concordant with possible alternative phylogenies based on traditional morphological taxonomic characteristics, indicating that the RUBISCO spacer is a useful region for phylogenetic studies.
Validation of endogenous reference genes for qRT-PCR analysis of human visceral adipose samples.
Mehta, Rohini; Birerdinc, Aybike; Hossain, Noreen; Afendy, Arian; Chandhoke, Vikas; Younossi, Zobair; Baranova, Ancha
2010-05-21
Given the epidemic proportions of obesity worldwide and the concurrent prevalence of metabolic syndrome, there is an urgent need for better understanding the underlying mechanisms of metabolic syndrome, in particular, the gene expression differences which may participate in obesity, insulin resistance and the associated series of chronic liver conditions. Real-time PCR (qRT-PCR) is the standard method for studying changes in relative gene expression in different tissues and experimental conditions. However, variations in amount of starting material, enzymatic efficiency and presence of inhibitors can lead to quantification errors. Hence the need for accurate data normalization is vital. Among several known strategies for data normalization, the use of reference genes as an internal control is the most common approach. Recent studies have shown that both obesity and presence of insulin resistance influence an expression of commonly used reference genes in omental fat. In this study we validated candidate reference genes suitable for qRT-PCR profiling experiments using visceral adipose samples from obese and lean individuals. Cross-validation of expression stability of eight selected reference genes using three popular algorithms, GeNorm, NormFinder and BestKeeper found ACTB and RPII as most stable reference genes. We recommend ACTB and RPII as stable reference genes most suitable for gene expression studies of human visceral adipose tissue. The use of these genes as a reference pair may further enhance the robustness of qRT-PCR in this model system.
Validation of endogenous reference genes for qRT-PCR analysis of human visceral adipose samples
Directory of Open Access Journals (Sweden)
Afendy Arian
2010-05-01
Full Text Available Abstract Background Given the epidemic proportions of obesity worldwide and the concurrent prevalence of metabolic syndrome, there is an urgent need for better understanding the underlying mechanisms of metabolic syndrome, in particular, the gene expression differences which may participate in obesity, insulin resistance and the associated series of chronic liver conditions. Real-time PCR (qRT-PCR is the standard method for studying changes in relative gene expression in different tissues and experimental conditions. However, variations in amount of starting material, enzymatic efficiency and presence of inhibitors can lead to quantification errors. Hence the need for accurate data normalization is vital. Among several known strategies for data normalization, the use of reference genes as an internal control is the most common approach. Recent studies have shown that both obesity and presence of insulin resistance influence an expression of commonly used reference genes in omental fat. In this study we validated candidate reference genes suitable for qRT-PCR profiling experiments using visceral adipose samples from obese and lean individuals. Results Cross-validation of expression stability of eight selected reference genes using three popular algorithms, GeNorm, NormFinder and BestKeeper found ACTB and RPII as most stable reference genes. Conclusions We recommend ACTB and RPII as stable reference genes most suitable for gene expression studies of human visceral adipose tissue. The use of these genes as a reference pair may further enhance the robustness of qRT-PCR in this model system.
Directory of Open Access Journals (Sweden)
Lee Yeon-Su
2010-05-01
Full Text Available Abstract Background Reverse transcription quantitative real-time polymerase chain reaction (RT-qPCR is a powerful method for the analysis of gene expression. Target gene expression levels are usually normalized to a consistently expressed reference gene also known as internal standard, in the same sample. However, much effort has not been expended thus far in the search for reference genes suitable for the study of stomach cancer using RT-qPCR, although selection of optimal reference genes is critical for interpretation of results. Methods We assessed the suitability of six possible reference genes, beta-actin (ACTB, glyceraldehydes-3-phosphate dehydrogenase (GAPDH, hypoxanthine phosphoribosyl transferase 1 (HPRT1, beta-2-microglobulin (B2M, ribosomal subunit L29 (RPL29 and 18S ribosomal RNA (18S rRNA in 20 normal and tumor stomach tissue pairs of stomach cancer patients and 6 stomach cancer cell lines, by RT-qPCR. Employing expression stability analyses using NormFinder and geNorm algorithms we determined the order of performance of these reference genes and their variation values. Results This RT-qPCR study showed that there are statistically significant (p Conclusion This study validated RPL29 and RPL29-B2M as the best single reference genes and combination, for RT-qPCR analysis of 'all stomach tissues', and B2M and B2M-GAPDH as the best single reference gene and combination, for 'stomach cancer cell lines'. Use of these validated reference genes should provide more exact interpretation of differential gene expressions at transcription level in stomach cancer.
Fuzzy-logic based strategy for validation of multiplex methods: example with qualitative GMO assays.
Bellocchi, Gianni; Bertholet, Vincent; Hamels, Sandrine; Moens, W; Remacle, José; Van den Eede, Guy
2010-02-01
This paper illustrates the advantages that a fuzzy-based aggregation method could bring into the validation of a multiplex method for GMO detection (DualChip GMO kit, Eppendorf). Guidelines for validation of chemical, bio-chemical, pharmaceutical and genetic methods have been developed and ad hoc validation statistics are available and routinely used, for in-house and inter-laboratory testing, and decision-making. Fuzzy logic allows summarising the information obtained by independent validation statistics into one synthetic indicator of overall method performance. The microarray technology, introduced for simultaneous identification of multiple GMOs, poses specific validation issues (patterns of performance for a variety of GMOs at different concentrations). A fuzzy-based indicator for overall evaluation is illustrated in this paper, and applied to validation data for different genetically modified elements. Remarks were drawn on the analytical results. The fuzzy-logic based rules were shown to be applicable to improve interpretation of results and facilitate overall evaluation of the multiplex method.
DEFF Research Database (Denmark)
Andreassen, C N; Sørensen, Flemming Brandt; Overgaard
2004-01-01
only archival specimens are available. This study was conducted to validate protocols optimised for assessment of SNPs based on paraffin embedded, formalin fixed tissue samples.PATIENTS AND METHODS: In 137 breast cancer patients, three TGFB1 SNPs were assessed based on archival histological specimens...... precipitation).RESULTS: Assessment of SNPs based on archival histological material is encumbered by a number of obstacles and pitfalls. However, these can be widely overcome by careful optimisation of the methods used for sample selection, DNA extraction and PCR. Within 130 samples that fulfil the criteria...
Yang, Fan; Wang, Guoping; Xu, Wenxing; Hong, Ni
2017-09-01
Efficient recovery of high quality RNA is very important for successful RT-PCR detection of plant RNA viruses. High levels of polyphenols and polysaccharides in plant tissues can irreversibly bind to and/or co-precipitate with RNA, which influences RNA isolation. In this study, a silica spin column-based RNA isolation method was developed by using commercially available silica columns combined with the application of a tissue lysis solution, and binding and washing buffers with high concentration guanidinium thiocyanate (GuSCN, 50% w/v), which helps remove plant proteins, polysaccharides and polyphenolic compounds. The method was successfully used to extract high quality RNA from citrus (Citrus aurantifolia), grapevine (Vitis vinifera), peach (Prunus persica), pear (Pyrus spp.), taro (Colocosia esculenta) and tobacco (Nicotiana benthamiana) samples. The method was comparable to conventional CTAB method in RNA isolation efficiency, but it was more sample-adaptable and cost-effective than commercial kits. High quality RNA isolated using silica spin column-based method was successfully used for the RT-PCR and/or multiplex RT-PCR amplification of woody fruit tree viruses and a viroid. The study provided a useful tool for the detection and characterization of plant viruses. Copyright © 2017 Elsevier B.V. All rights reserved.
Huber, Ingrid; Block, Annette; Sebah, Daniela; Debode, Frédéric; Morisset, Dany; Grohmann, Lutz; Berben, Gilbert; Stebih, Dejan; Milavec, Mojca; Zel, Jana; Busch, Ulrich
2013-10-30
Worldwide, qualitative methods based on PCR are most commonly used as screening tools for genetically modified material in food and feed. However, the increasing number and diversity of genetically modified organisms (GMO) require effective methods for simultaneously detecting several genetic elements marking the presence of transgenic events. Herein we describe the development and validation of a pentaplex, as well as complementary triplex and duplex real-time PCR assays, for the detection of the most common screening elements found in commercialized GMOs: P-35S, T-nos, ctp2-cp4-epsps, bar, and pat. The use of these screening assays allows the coverage of many GMO events globally approved for commercialization. Each multiplex real-time PCR assay shows high specificity and sensitivity with an absolute limit of detection below 20 copies for the targeted sequences. We demonstrate by intra- and interlaboratory tests that the assays are robust as well as cost- and time-effective for GMO screening if applied in routine GMO analysis.
A novel PCR-based method to enumerate Salmonella in animal feed
DEFF Research Database (Denmark)
Löfström, Charlotta; Andersson, Gunnar; Häggblom, Per
2010-01-01
and pellets) only three gave results that differed between the PCR and MSRV methods. Ct values for naturally contaminated samples were higher compared to samples artificially contaminated with low numbers (approx. 2 CFU/25 g feed) of stressed Salmonella. To allow quantification of low numbers of Salmonella...
Cottenet, Geoffrey; Blancpain, Carine; Sonnard, Véronique; Chuah, Poh Fong
2013-08-01
Considering the increase of the total cultivated land area dedicated to genetically modified organisms (GMO), the consumers' perception toward GMO and the need to comply with various local GMO legislations, efficient and accurate analytical methods are needed for their detection and identification. Considered as the gold standard for GMO analysis, the real-time polymerase chain reaction (RTi-PCR) technology was optimised to produce a high-throughput GMO screening method. Based on simultaneous 24 multiplex RTi-PCR running on a ready-to-use 384-well plate, this new procedure allows the detection and identification of 47 targets on seven samples in duplicate. To comply with GMO analytical quality requirements, a negative and a positive control were analysed in parallel. In addition, an internal positive control was also included in each reaction well for the detection of potential PCR inhibition. Tested on non-GM materials, on different GM events and on proficiency test samples, the method offered high specificity and sensitivity with an absolute limit of detection between 1 and 16 copies depending on the target. Easy to use, fast and cost efficient, this multiplex approach fits the purpose of GMO testing laboratories.
The Use of Infrared Thermography as a Novel Approach for Real-Time Validation of PCR Thermocyclers
DEFF Research Database (Denmark)
Grønlund, Hugo Ahlm; Löfström, Charlotta; Helleskov, Jens Bue
2010-01-01
Validation of PCR thermocycler performance is crucial to obtain reliable results. In this study, infrared (IR) thermography was evaluated as a novel validation tool. After stabilisation, no significant difference in the temperatures recorded using thermography and a reference blockbased system wa...... was found. By employing IR thermography, information about the length of the time until temperature stabilisation in the sample could be obtained. This study shows the potential of using IR thermography for validation of thermocyclers.......Validation of PCR thermocycler performance is crucial to obtain reliable results. In this study, infrared (IR) thermography was evaluated as a novel validation tool. After stabilisation, no significant difference in the temperatures recorded using thermography and a reference blockbased system...
Park, Eunyoung; Lee, Cheonghoon; Bisesi, Michael; Lee, Jiyoung
2014-03-01
The disinfection efficiency of peracetic acid (PAA) was investigated on three microbial types using three different methods (filtration-based ATP (adenosine-triphosphate) bioluminescence, quantitative polymerase chain reaction (qPCR), culture-based method). Fecal indicator bacteria (Enterococcus faecium), virus indicator (male-specific (F(+)) coliphages (coliphages)), and protozoa disinfection surrogate (Bacillus subtilis spores (spores)) were tested. The mode of action for spore disinfection was visualized using scanning electron microscopy. The results indicated that PAA concentrations of 5 ppm (contact time: 5 min), 50 ppm (10 min), and 3,000 ppm (5 min) were needed to achieve 3-log reduction of E. faecium, coliphages, and spores, respectively. Scanning electron microscopy observation showed that PAA targets the external layers of spores. The lower reduction rates of tested microbes measured with qPCR suggest that qPCR may overestimate the surviving microbes. Collectively, PAA showed broad disinfection efficiency (susceptibility: E. faecium > coliphages > spores). For E. faecium and spores, ATP bioluminescence was substantially faster (∼5 min) than culture-based method (>24 h) and qPCR (2-3 h). This study suggests PAA as an effective alternative to inactivate broad types of microbial contaminants in water. Together with the use of rapid detection methods, this approach can be useful for urgent situations when timely response is needed for ensuring water quality.
Centelleghe, Cinzia; Beffagna, Giorgia; Zanetti, Rossella; Zappulli, Valentina; Di Guardo, Giovanni; Mazzariol, Sandro
2016-09-01
Cetacean Morbillivirus (CeMV) has been identified as the most pathogenic virus for cetaceans. Over the past three decades, this RNA virus has caused several outbreaks of lethal disease in odontocetes and mysticetes worldwide. Isolation and identification of CeMV RNA is very challenging in whales because of the poor preservation status frequently shown by tissues from stranded animals. Nested reverse transcription polymerase chain reaction (nested RT-PCR) is used instead of conventional RT-PCR when it is necessary to increase the sensitivity and the specificity of the reaction. This study describes a new nested RT-PCR technique useful to amplify small amounts of the cDNA copy of Cetacean morbillivirus (CeMV) when it is present in scant quantity in whales' biological specimens. This technique was used to analyze different tissues (lung, brain, spleen and other lymphoid tissues) from one under human care seal and seven cetaceans stranded along the Italian coastline between October 2011 and September 2015. A well-characterized, 200 base pair (bp) fragment of the dolphin Morbillivirus (DMV) haemagglutinin (H) gene, obtained by nested RT-PCR, was sequenced and used to confirm DMV positivity in all the eight marine mammals under study. In conclusion, this nested RT-PCR protocol can represent a sensitive detection method to identify CeMV-positive, poorly preserved tissue samples. Furthermore, this is also a rather inexpensive molecular technique, relatively easy to apply. Copyright © 2016 Elsevier B.V. All rights reserved.
Directory of Open Access Journals (Sweden)
Amanda eMartino
2012-01-01
Full Text Available A degenerate PCR-based method of whole-genome amplification, designed to work fluidly with 454 sequencing technology, was developed and tested for use on deep marine subsurface DNA samples. The method, which we have called Random Amplification Metagenomic PCR (RAMP, involves the use of specific primers from Roche 454 amplicon sequencing, modified by the addition of a degenerate region at the 3’ end. It utilizes a PCR reaction, which resulted in no amplification from blanks, even after 50 cycles of PCR. After efforts to optimize experimental conditions, the method was tested with DNA extracted from cultured E. coli cells, and genome coverage was estimated after sequencing on three different occasions. Coverage did not vary greatly with the different experimental conditions tested, and was around 62% with a sequencing effort equivalent to a theoretical genome coverage of 14.10X. The GC content of the sequenced amplification product was within 2% of the predicted values for this strain of E. coli. The method was also applied to DNA extracted from marine subsurface samples from ODP Leg 201 site 1229 (Peru Margin, and results of a taxonomic analysis revealed microbial communities dominated by Proteobacteria, Chloroflexi, Firmicutes, Euryarchaeota, and Crenarchaeota, among others. These results were similar to those obtained previously for those samples; however, variations in the proportions of taxa show that community analysis can be sensitive to both the amplification technique used and the method of assigning sequences to taxonomic groups. Overall, we find that RAMP represents a valid methodology for amplifying metagenomes from low biomass samples.
Comparative quantification of human intestinal bacteria based on cPCR and LDR/LCR.
Tang, Zhou-Rui; Li, Kai; Zhou, Yu-Xun; Xiao, Zhen-Xian; Xiao, Jun-Hua; Huang, Rui; Gu, Guo-Hao
2012-01-21
To establish a multiple detection method based on comparative polymerase chain reaction (cPCR) and ligase detection reaction (LDR)/ligase chain reaction (LCR) to quantify the intestinal bacterial components. Comparative quantification of 16S rDNAs from different intestinal bacterial components was used to quantify multiple intestinal bacteria. The 16S rDNAs of different bacteria were amplified simultaneously by cPCR. The LDR/LCR was examined to actualize the genotyping and quantification. Two beneficial (Bifidobacterium, Lactobacillus) and three conditionally pathogenic bacteria (Enterococcus, Enterobacterium and Eubacterium) were used in this detection. With cloned standard bacterial 16S rDNAs, standard curves were prepared to validate the quantitative relations between the ratio of original concentrations of two templates and the ratio of the fluorescence signals of their final ligation products. The internal controls were added to monitor the whole detection flow. The quantity ratio between two bacteria was tested. cPCR and LDR revealed obvious linear correlations with standard DNAs, but cPCR and LCR did not. In the sample test, the distributions of the quantity ratio between each two bacterial species were obtained. There were significant differences among these distributions in the total samples. But these distributions of quantity ratio of each two bacteria remained stable among groups divided by age or sex. The detection method in this study can be used to conduct multiple intestinal bacteria genotyping and quantification, and to monitor the human intestinal health status as well.
DEFF Research Database (Denmark)
Auricchio, Bruna; Anniballi, Fabrizio; Fiore, Alfonsina
2013-01-01
in terms of cost, time, labor, and supplies. Eleven botulinum toxin–producing clostridia strains and 25 samples (10 food, 13 clinical, and 2 environmental samples) naturally contaminated with botulinum toxin–producing clostridia were used to compare 4 DNA extraction procedures: Chelex® 100 matrix, Phenol......Sufficient quality and quantity of extracted DNA is critical to detecting and performing genotyping of Clostridium botulinum by means of PCR-based methods. An ideal extraction method has to optimize DNA yield, minimize DNA degradation, allow multiple samples to be extracted, and be efficient...
DEFF Research Database (Denmark)
El-Ali, Jamil; Perch-Nielsen, Ivan R.; Poulsen, Claus Riber
2004-01-01
We present a SU-8 based polymerase chain reaction (PCR) chip with integrated platinum thin film heaters and temperature sensor. The device is fabricated in SU-8 on a glass substrate. The use of SU-8 provides a simple microfabrication process for the PCR chamber, controllable surface properties......C/s, respectively, the performance of the chip is comparable with the best silicon micromachined PCR chips presented in the literature. The SU-8 chamber surface was found to be PCR compatible by amplification of yeast gene ribosomal protein S3 and Campylobacter gene cadF. The PCR compatibility of the chamber...
Single base pair mutation analysis by PNA directed PCR clamping
DEFF Research Database (Denmark)
Ørum, H.; Nielsen, P.E.; Egholm, M.
1993-01-01
A novel method that allows direct analysis of single base mutation by the polymerase chain reaction (PCR) is described. The method utilizes the finding that PNAs (peptide nucleic acids) recognize and bind to their complementary nucleic acid sequences with higher thermal stability and specificity...... allows selective amplification/suppression of target sequences that differ by only one base pair. Finally we show that PNAs can be designed in such a way that blockage can be accomplished when the PNA target sequence is located between the PCR primers....
A rapid method for screening arrayed plasmid cDNA library by PCR
International Nuclear Information System (INIS)
Hu Yingchun; Zhang Kaitai; Wu Dechang; Li Gang; Xiang Xiaoqiong
1999-01-01
Objective: To develop a PCR-based method for rapid and effective screening of arrayed plasmid cDNA library. Methods: The plasmid cDNA library was arrayed and screened by PCR with a particular set of primers. Results: Four positive clones were obtained through about one week. Conclusion: This method can be applied to screening not only normal cDNA clones, but also cDNA clones-containing small size fragments. This method offers significant advantages over traditional screening method in terms of sensitivity, specificity and efficiency
Opota, Onya; Brouillet, René; Greub, Gilbert; Jaton, Katia
2017-01-01
The advances in molecular biology of the last decades have dramatically improved the field of diagnostic bacteriology. In particular, PCR-based technologies have impacted the diagnosis of infections caused by obligate intracellular bacteria such as pathogens from the Chlamydiacae family. Here, we describe a real-time PCR-based method using the Taqman technology for the diagnosis of Chlamydia pneumoniae, Chlamydia psittaci, and Chlamydia abortus infection. The method presented here can be applied to various clinical samples and can be adapted on opened molecular diagnostic platforms.
Internal quality control of PCR-based genotyping methods
DEFF Research Database (Denmark)
Bladbjerg, Else-Marie; Gram, Jørgen; Jespersen, Jørgen
2002-01-01
Internal quality control programmes for genetic analyses are needed. We have focused on quality control aspects of selected polymorphism analyses used in thrombosis research. DNA was isolated from EDTA-blood (n = 500) and analysed for 18 polymorphisms by polymerase chain reaction (PCR), i...... because of positive reagent blanks (controls (Control of data handling revealed 0.1% reading mistakes and 0.5% entry mistakes. Based on our experiences, we propose an internal quality control programme......, electrophoresis (analytical factors), result reading and entry into a database (post-analytical factors). Furthermore, we evaluated a procedure for result confirmation. Isolated DNA was of good quality (42 micrograms/ml blood, A260/A280 ratio > 1.75, negative DNAsis tests). Occasionally, results were reanalysed...
Shibuta, K; Abe, M; Suzuki, T
1994-01-01
The K variant of human butyrylcholinesterase is caused by a G/A transition in the butyrylcholinesterase gene, which neither creates nor destroys any restriction site. In an attempt to detect the K variant both simply and rapidly, we developed a two step method of "PCR primer introduced restriction analysis" (PCR-PIRA). The first step was used to introduce a new Fun4HI site into the normal allele for a screening test, while the second step was performed to create a new MaeIII site on the variant allele for a specific test. This method thus enabled us to distinguish clearly the K variant from the normal allele, and also showed that the frequency of the K variant allele is 0.164 in the Japanese population. Images PMID:7966197
Validation of a 20-h real-time PCR method for screening of Salmonella in poultry faecal samples
DEFF Research Database (Denmark)
Löfström, Charlotta; Hansen, Flemming; Hoorfar, Jeffrey
2010-01-01
(NordVal). The comparative trial was performed against a reference method from the Nordic Committee on Food Analysis (NMKL187, 2007) using 132 artificially and naturally contaminated samples. The limit of detection (LOD50) was found to be 24 and 33 CFU/sample for the PCR and NMKL187 methods...
Mohamad, Nurhidayatul Asma; Mustafa, Shuhaimi; Khairil Mokhtar, Nur Fadhilah; El Sheikha, Aly Farag
2018-03-05
The pharmaceutical industry has boosted gelatin consumption worldwide. This is supported by the availability of cost-effective gelatin production from porcine by-products. However, cross-contamination of gelatin materials, where porcine gelatin was unintentionally included in the other animal sources of gelatin, has caused significant concerns about halal authenticity. The real-time polymerase chain reaction (PCR) has enabled a highly specific and sensitive animal species detection method in various food products. Hence, such a technique was employed in the present study to detect and quantify porcine DNA in gelatin using a molecular beacon probe, with differences in performance between mitochondrial (cytochrome b gene) and chromosomal DNA-(MPRE42 repetitive element) based porcine-specific PCR assays being compared. A higher sensitivity was observed in chromosomal DNA (MPRE-PCR assay), where this assay allows the detection of gelatin DNA at amounts as as low as 1 pg, whereas mitochondrial DNA (CBH-PCR assay) can only detect at levels down to 10 pg of gelatin DNA. When an analysis with commercial gelatin and gelatin capsule samples was conducted, the same result was observed, with a significantly more sensitive detection being provided by the repetitive element of chromosomal DNA. The present study has established highly sensitive DNA-based porcine detection systems derived from chromosomal DNA that are feasible for highly processed products such as gelatin and gelatin capsules containing a minute amount of DNA. This sensitive detection method can also be implemented to assist the halal authentication process of various food products available on the market. © 2018 Society of Chemical Industry. © 2018 Society of Chemical Industry.
Accurate quantification of supercoiled DNA by digital PCR
Dong, Lianhua; Yoo, Hee-Bong; Wang, Jing; Park, Sang-Ryoul
2016-01-01
Digital PCR (dPCR) as an enumeration-based quantification method is capable of quantifying the DNA copy number without the help of standards. However, it can generate false results when the PCR conditions are not optimized. A recent international comparison (CCQM P154) showed that most laboratories significantly underestimated the concentration of supercoiled plasmid DNA by dPCR. Mostly, supercoiled DNAs are linearized before dPCR to avoid such underestimations. The present study was conducted to overcome this problem. In the bilateral comparison, the National Institute of Metrology, China (NIM) optimized and applied dPCR for supercoiled DNA determination, whereas Korea Research Institute of Standards and Science (KRISS) prepared the unknown samples and quantified them by flow cytometry. In this study, several factors like selection of the PCR master mix, the fluorescent label, and the position of the primers were evaluated for quantifying supercoiled DNA by dPCR. This work confirmed that a 16S PCR master mix avoided poor amplification of the supercoiled DNA, whereas HEX labels on dPCR probe resulted in robust amplification curves. Optimizing the dPCR assay based on these two observations resulted in accurate quantification of supercoiled DNA without preanalytical linearization. This result was validated in close agreement (101~113%) with the result from flow cytometry. PMID:27063649
Collins, S; Jorgensen, F; Willis, C; Walker, J
2015-10-01
Culture remains the gold-standard for the enumeration of environmental Legionella. However, it has several drawbacks including long incubation and poor sensitivity, causing delays in response times to outbreaks of Legionnaires' disease. This study aimed to validate real-time PCR assays to quantify Legionella species (ssrA gene), Legionella pneumophila (mip gene) and Leg. pneumophila serogroup-1 (wzm gene) to support culture-based detection in a frontline public health laboratory. Each qPCR assay had 100% specificity, excellent sensitivity (5 GU/reaction) and reproducibility. Comparison of the assays to culture-based enumeration of Legionella from 200 environmental samples showed that they had a negative predictive value of 100%. Thirty eight samples were positive for Legionella species by culture and qPCR. One hundred samples were negative by both methods, whereas 62 samples were negative by culture but positive by qPCR. The average log10 increase between culture and qPCR for Legionella spp. and Leg. pneumophila was 0·72 (P = 0·0002) and 0·51 (P = 0·006), respectively. The qPCR assays can be conducted on the same 1 l water sample as culture thus can be used as a supplementary technique to screen out negative samples and allow more rapid indication of positive samples. The assay could prove informative in public health investigations to identify or rule out sources of Legionella as well as to specifically identify Leg. pneumophila serogroup 1 in a timely manner not possible with culture. © 2015 The Society for Applied Microbiology.
COMPARISON OF 16S rRNA-PCR-RFLP, LipL32-PCR AND OmpL1-PCR METHODS IN THE DIAGNOSIS OF LEPTOSPIROSIS
Directory of Open Access Journals (Sweden)
Tülin GÜVEN GÖKMEN
Full Text Available SUMMARY Leptospirosis is still one of the most important health problems in developing countries located in humid tropical and subtropical regions. Human infections are generally caused by exposure to water, soil or food contaminated with the urine of infected wild and domestic animals such as rodents and dogs. The clinical course of leptospirosis is variable and may be difficult to distinguish from many other infectious diseases. The dark-field microscopy (DFM, serology and nucleic acid amplification techniques are used to diagnose leptospirosis, however, a distinctive standard reference method is still lacking. Therefore, in this study, we aimed to determine the presence of Leptospira spp., to differentiate the pathogenic L. interrogans and the non-pathogenic L. biflexa, and also to determine the sensitivity and specificity values of molecular methods as an alternative to conventional ones. A total of 133 serum samples, from 47 humans and 86 cattle were evaluated by two conventional tests: the Microagglutination Test (MAT and the DFM, as well as three molecular methods, the 16S rRNA-PCR followed by Restriction Fragment Lenght Polymorphism (RFLP of the amplification products 16S rRNA-PCR-RFLP, LipL32-PCR and OmpL1-PCR. In this study, for L. interrogans, the specificity and sensitivity rates of the 16S rRNA-PCR and the LipL32-PCR were considered similar (100% versus 98.25% and 100% versus 98.68%, respectively. The OmpL1-PCR was able to classify L. interrogans into two intergroups, but this PCR was less sensitive (87.01% than the other two PCR methods. The 16S rRNA-PCR-RFLP could detect L. biflexa DNA, but LipL32-PCR and OmpL1-PCR could not. The 16S rRNA-PCR-RFLP provided an early and accurate diagnosis and was able to distinguish pathogenic and non-pathogenic Leptospira species, hence it may be used as an alternative method to the conventional gold standard techniques for the rapid disgnosis of leptospirosis.
PCR-based techniques for leprosy diagnosis: from the laboratory to the clinic.
Directory of Open Access Journals (Sweden)
Alejandra Nóbrega Martinez
2014-04-01
Full Text Available In leprosy, classic diagnostic tools based on bacillary counts and histopathology have been facing hurdles, especially in distinguishing latent infection from active disease and diagnosing paucibacillary clinical forms. Serological tests and IFN-gamma releasing assays (IGRA that employ humoral and cellular immune parameters, respectively, are also being used, but recent results indicate that quantitative PCR (qPCR is a key technique due to its higher sensitivity and specificity. In fact, advances concerning the structure and function of the Mycobacterium leprae genome led to the development of specific PCR-based gene amplification assays for leprosy diagnosis and monitoring of household contacts. Also, based on the validation of point-of-care technologies for M. tuberculosis DNA detection, it is clear that the same advantages of rapid DNA detection could be observed in respect to leprosy. So far, PCR has proven useful in the determination of transmission routes, M. leprae viability, and drug resistance in leprosy. However, PCR has been ascertained to be especially valuable in diagnosing difficult cases like pure neural leprosy (PNL, paucibacillary (PB, and patients with atypical clinical presentation and histopathological features compatible with leprosy. Also, the detection of M. leprae DNA in different samples of the household contacts of leprosy patients is very promising. Although a positive PCR result is not sufficient to establish a causal relationship with disease outcome, quantitation provided by qPCR is clearly capable of indicating increased risk of developing the disease and could alert clinicians to follow these contacts more closely or even define rules for chemoprophylaxis.
DEFF Research Database (Denmark)
Ornskov, D; Kolmos, B; Bendix Horn, P
2008-01-01
2005, all patients and healthcare personnel have been screened for MRSA colonisation, involving analysis of 300-400 samples daily. To deal with this number of samples, a PCR-based method customised for high-throughput analysis and a system for fast reporting of MRSA carrier status were developed. Swab...... samples were incubated overnight in a selective tryptone soya broth and were analysed by PCR the following day. Using this strategy, non-colonised individuals were identified within 24 h, while MRSA-positive samples were analysed further by traditional microbiological methods to determine the resistance...... pattern. This is a cost-effective approach, as the greatest expense in hospitals involves the isolation of patients of unknown MRSA status. The method was evaluated by testing 2194 clinical samples, with a sensitivity and specificity of 100% and 94%, respectively. The analytical sensitivity was 97...
Noguchi, Akio; Nakamura, Kosuke; Sakata, Kozue; Sato-Fukuda, Nozomi; Ishigaki, Takumi; Mano, Junichi; Takabatake, Reona; Kitta, Kazumi; Teshima, Reiko; Kondo, Kazunari; Nishimaki-Mogami, Tomoko
2016-04-19
A number of genetically modified (GM) maize events have been developed and approved worldwide for commercial cultivation. A screening method is needed to monitor GM maize approved for commercialization in countries that mandate the labeling of foods containing a specified threshold level of GM crops. In Japan, a screening method has been implemented to monitor approved GM maize since 2001. However, the screening method currently used in Japan is time-consuming and requires generation of a calibration curve and experimental conversion factor (C(f)) value. We developed a simple screening method that avoids the need for a calibration curve and C(f) value. In this method, ΔC(q) values between the target sequences and the endogenous gene are calculated using multiplex real-time PCR, and the ΔΔC(q) value between the analytical and control samples is used as the criterion for determining analytical samples in which the GM organism content is below the threshold level for labeling of GM crops. An interlaboratory study indicated that the method is applicable independently with at least two models of PCR instruments used in this study.
Zhu, Debin; Tang, Yabing; Xing, Da; Chen, Wei R
2008-05-15
A bio bar code assay based on oligonucleotide-modified gold nanoparticles (Au-NPs) provides a PCR-free method for quantitative detection of nucleic acid targets. However, the current bio bar code assay requires lengthy experimental procedures including the preparation and release of bar code DNA probes from the target-nanoparticle complex and immobilization and hybridization of the probes for quantification. Herein, we report a novel PCR-free electrochemiluminescence (ECL)-based bio bar code assay for the quantitative detection of genetically modified organism (GMO) from raw materials. It consists of tris-(2,2'-bipyridyl) ruthenium (TBR)-labeled bar code DNA, nucleic acid hybridization using Au-NPs and biotin-labeled probes, and selective capture of the hybridization complex by streptavidin-coated paramagnetic beads. The detection of target DNA is realized by direct measurement of ECL emission of TBR. It can quantitatively detect target nucleic acids with high speed and sensitivity. This method can be used to quantitatively detect GMO fragments from real GMO products.
Validation of the AmpFlSTR« SEfiler Plus(TM) PCR Amplification kit for forensic STR analysis
DEFF Research Database (Denmark)
Fredslund, Stine Frisk; Mogensen, Helle Smidt; Morling, Niels
2009-01-01
Validation of the AmpFlSTR« SEfiler Plus(TM) PCR Amplification kit with 29 and 30 PCR cycles for forensic STR analysis demonstrated that the kit had fewer artefacts than the AmpFlSTR« SGM Plus(TM) kit (28 PCR cycles). The SEfiler Plus kit was more sensitive and devoid of colour artefacts, but sho......, but showed more stutters, drop-ins, drop-outs and allelic imbalances...
Directory of Open Access Journals (Sweden)
Yogita Maheshwari
Full Text Available Droplet digital polymerase chain reaction (ddPCR is a method for performing digital PCR that is based on water-oil emulsion droplet technology. It is a unique approach to measure the absolute copy number of nucleic acid targets without the need of external standards. This study evaluated the applicability of ddPCR as a quantitative detection tool for the Spiroplasma citri, causal agent of citrus stubborn disease (CSD in citrus. Two sets of primers, SP1, based on the spiral in housekeeping gene, and a multicopy prophage gene, SpV1 ORF1, were used to evaluate ddPCR in comparison with real time (quantitative PCR (qPCR for S. citri detection in citrus tissues. Standard curve analyses on tenfold dilution series showed that both ddPCR and qPCR exhibited good linearity and efficiency. However, ddPCR had a tenfold greater sensitivity than qPCR and accurately quantified up to one copy of spiralin gene. Receiver operating characteristic analysis indicated that the ddPCR methodology was more robust for diagnosis of CSD and the area under the curve was significantly broader compared to qPCR. Field samples were used to validate ddPCR efficacy and demonstrated that it was equal or better than qPCR to detect S. citri infection in fruit columella due to a higher pathogen titer. The ddPCR assay detected both the S. citri spiralin and the SpV1 ORF1 targets quantitatively with high precision and accuracy compared to qPCR assay. The ddPCR was highly reproducible and repeatable for both the targets and showed higher resilience to PCR inhibitors in citrus tissue extract for the quantification of S. citri compare to qPCR.
Species Authentication of Common Meat Based on PCR Analysis of the Mitochondrial COI Gene.
Dai, Zhenyu; Qiao, Jiao; Yang, Siran; Hu, Shen; Zuo, Jingjing; Zhu, Weifeng; Huang, Chunhong
2015-07-01
Adulteration of meat products and costly animal-derived commodities with their inferior/cheaper counterparts is a grievous global problem. Species authentication is still technical challenging, especially to those deep processed products. The present study described the design of seven sets of species-specific primer based on a high heterozygous region of mitochondrial cytochrome c oxidase subunit I (COI) gene. These primers were proven to have high species specificity and no cross-reactions and unexpected products to different DNA source. Multiplex PCR assay was achieved for rapid and economical identification of four commonly consumed meats (pork, beef, chicken, and mutton). The conventional PCR assay was sensitive down to 0.001 ng of DNA template in the reactant. The developed method was also powerful in detecting as low as 0.1-mg adulterated pork (0.05 % in wt/wt) in an artificial counterfeited mutton. Validation test showed that the assay is specific, reproducible, and robust in commercial deep processed meats, leatherware, and feather commodities. This proposed method will be greatly beneficial to the consumers, food industry, leather, and feather commodity manufacture.
An Engineering Method of Civil Jet Requirements Validation Based on Requirements Project Principle
Wang, Yue; Gao, Dan; Mao, Xuming
2018-03-01
A method of requirements validation is developed and defined to meet the needs of civil jet requirements validation in product development. Based on requirements project principle, this method will not affect the conventional design elements, and can effectively connect the requirements with design. It realizes the modern civil jet development concept, which is “requirement is the origin, design is the basis”. So far, the method has been successfully applied in civil jet aircraft development in China. Taking takeoff field length as an example, the validation process and the validation method of the requirements are detailed introduced in the study, with the hope of providing the experiences to other civil jet product design.
Immunomagnetic nanoparticle based quantitative PCR for rapid detection of Salmonella
International Nuclear Information System (INIS)
Bakthavathsalam, Padmavathy; Rajendran, Vinoth Kumar; Saran, Uttara; Chatterjee, Suvro; Ali, Baquir Mohammed Jaffar
2013-01-01
We have developed a rapid and sensitive method for immunomagnetic separation (IMS) of Salmonella along with their real time detection via PCR. Silica-coated magnetic nanoparticles were functionalized with carboxy groups to which anti-Salmonella antibody raised against heat-inactivated whole cells of Salmonella were covalently attached. The immuno-captured target cells were detected in beverages like milk and lemon juice by multiplex PCR and real time PCR with a detection limit of 10 4 cfu.mL −1 and 10 3 cfu.mL −1 , respectively. We demonstrate that IMS can be used for selective concentration of target bacteria from beverages for subsequent use in PCR detection. PCR also enables differentiation of Salmonella typhi and Salmonella paratyphi A using a set of four specific primers. In addition, IMS—PCR can be used as a screening tool in the food and beverage industry for the detection of Salmonella within 3–4 h which compares favorably to the time of several days that is needed in case of conventional detection based on culture and biochemical methods. (author)
De Spiegelaere, Ward; Malatinkova, Eva; Lynch, Lindsay; Van Nieuwerburgh, Filip; Messiaen, Peter; O'Doherty, Una; Vandekerckhove, Linos
2014-06-01
Quantification of integrated proviral HIV DNA by repetitive-sampling Alu-HIV PCR is a candidate virological tool to monitor the HIV reservoir in patients. However, the experimental procedures and data analysis of the assay are complex and hinder its widespread use. Here, we provide an improved and simplified data analysis method by adopting binomial and Poisson statistics. A modified analysis method on the basis of Poisson statistics was used to analyze the binomial data of positive and negative reactions from a 42-replicate Alu-HIV PCR by use of dilutions of an integration standard and on samples of 57 HIV-infected patients. Results were compared with the quantitative output of the previously described Alu-HIV PCR method. Poisson-based quantification of the Alu-HIV PCR was linearly correlated with the standard dilution series, indicating that absolute quantification with the Poisson method is a valid alternative for data analysis of repetitive-sampling Alu-HIV PCR data. Quantitative outputs of patient samples assessed by the Poisson method correlated with the previously described Alu-HIV PCR analysis, indicating that this method is a valid alternative for quantifying integrated HIV DNA. Poisson-based analysis of the Alu-HIV PCR data enables absolute quantification without the need of a standard dilution curve. Implementation of the CI estimation permits improved qualitative analysis of the data and provides a statistical basis for the required minimal number of technical replicates. © 2014 The American Association for Clinical Chemistry.
A Generalized Pivotal Quantity Approach to Analytical Method Validation Based on Total Error.
Yang, Harry; Zhang, Jianchun
2015-01-01
The primary purpose of method validation is to demonstrate that the method is fit for its intended use. Traditionally, an analytical method is deemed valid if its performance characteristics such as accuracy and precision are shown to meet prespecified acceptance criteria. However, these acceptance criteria are not directly related to the method's intended purpose, which is usually a gurantee that a high percentage of the test results of future samples will be close to their true values. Alternate "fit for purpose" acceptance criteria based on the concept of total error have been increasingly used. Such criteria allow for assessing method validity, taking into account the relationship between accuracy and precision. Although several statistical test methods have been proposed in literature to test the "fit for purpose" hypothesis, the majority of the methods are not designed to protect the risk of accepting unsuitable methods, thus having the potential to cause uncontrolled consumer's risk. In this paper, we propose a test method based on generalized pivotal quantity inference. Through simulation studies, the performance of the method is compared to five existing approaches. The results show that both the new method and the method based on β-content tolerance interval with a confidence level of 90%, hereafter referred to as the β-content (0.9) method, control Type I error and thus consumer's risk, while the other existing methods do not. It is further demonstrated that the generalized pivotal quantity method is less conservative than the β-content (0.9) method when the analytical methods are biased, whereas it is more conservative when the analytical methods are unbiased. Therefore, selection of either the generalized pivotal quantity or β-content (0.9) method for an analytical method validation depends on the accuracy of the analytical method. It is also shown that the generalized pivotal quantity method has better asymptotic properties than all of the current
Jacchia, Sara; Nardini, Elena; Savini, Christian; Petrillo, Mauro; Angers-Loustau, Alexandre; Shim, Jung-Hyun; Trijatmiko, Kurniawan; Kreysa, Joachim; Mazzara, Marco
2015-02-18
In this study, we developed, optimized, and in-house validated a real-time PCR method for the event-specific detection and quantification of Golden Rice 2, a genetically modified rice with provitamin A in the grain. We optimized and evaluated the performance of the taxon (targeting rice Phospholipase D α2 gene)- and event (targeting the 3' insert-to-plant DNA junction)-specific assays that compose the method as independent modules, using haploid genome equivalents as unit of measurement. We verified the specificity of the two real-time PCR assays and determined their dynamic range, limit of quantification, limit of detection, and robustness. We also confirmed that the taxon-specific DNA sequence is present in single copy in the rice genome and verified its stability of amplification across 132 rice varieties. A relative quantification experiment evidenced the correct performance of the two assays when used in combination.
Molecular analysis of single oocyst of Eimeria by whole genome amplification (WGA) based nested PCR.
Wang, Yunzhou; Tao, Geru; Cui, Yujuan; Lv, Qiyao; Xie, Li; Li, Yuan; Suo, Xun; Qin, Yinghe; Xiao, Lihua; Liu, Xianyong
2014-09-01
PCR-based molecular tools are widely used for the identification and characterization of protozoa. Here we report the molecular analysis of Eimeria species using combined methods of whole genome amplification (WGA) and nested PCR. Single oocyst of Eimeria stiedai or Eimeriamedia was directly used for random amplification of the genomic DNA with either primer extension preamplification (PEP) or multiple displacement amplification (MDA), and then the WGA product was used as template in nested PCR with species-specific primers for ITS-1, 18S rDNA and 23S rDNA of E. stiedai and E. media. WGA-based PCR was successful for the amplification of these genes from single oocyst. For the species identification of single oocyst isolated from mixed E. stiedai or E. media, the results from WGA-based PCR were exactly in accordance with those from morphological identification, suggesting the availability of this method in molecular analysis of eimerian parasites at the single oocyst level. WGA-based PCR method can also be applied for the identification and genetic characterization of other protists. Copyright © 2014 Elsevier Inc. All rights reserved.
Rigotto, C; Sincero, T C M; Simões, C M O; Barardi, C R M
2005-01-01
We tested three PCR based methodologies to detect adenoviruses associated with cultivated oysters. Conventional-PCR, nested-PCR, and integrated cell culture-PCR (ICC/PCR) were first optimized using oysters seeded with know amounts of Adenovirus serotype 5 (Ad5). The maximum sensitivity for Ad5 detection was determined for each method, and then used to detect natural adenovirus contamination in oysters from three aquiculture farms in Florianopolis, Santa Catarina State, Brazil, over a period of 6 months. The results showed that the nested-PCR was more sensitive (limit of detection: 1.2 PFU/g of tissue) than conventional-PCR and ICC-PCR (limit of detection for both: 1.2 x 10(2)PFU/g of tissue) for detection of Ad5 in oyster extracts. Nested-PCR was able to detect 90% of Ad5 contamination in harvested oyster samples, while conventional-PCR was unable to detect Ad5 in any of the samples. The present work suggests that detection of human adenoviruses can be used as a tool to monitor the presence of human viruses in marine environments where shellfish grow, and that nested-PCR is the method of choice.
Lobanov, Vladislav A; Peckle, Maristela; Massard, Carlos L; Brad Scandrett, W; Gajadhar, Alvin A
2018-03-02
Equine piroplasmosis (EP) is an economically significant infection of horses and other equine species caused by the tick-borne protozoa Theileria equi and Babesia caballi. The long-term carrier state in infected animals makes importation of such subclinical cases a major risk factor for the introduction of EP into non-enzootic areas. Regulatory testing for EP relies on screening of equines by serological methods. The definitive diagnosis of EP infection in individual animals will benefit from the availability of sensitive direct detection methods, for example, when used as confirmatory assays for non-negative serological test results. The objectives of this study were to develop a real-time quantitative polymerase chain reaction (qPCR) assay for simultaneous detection of both agents of EP, perform comprehensive evaluation of its performance and assess the assay's utility for regulatory testing. We developed a duplex qPCR targeting the ema-1 gene of T. equi and the 18S rRNA gene of B. caballi and demonstrated that the assay has high analytical sensitivities for both piroplasm species. Validation of the duplex qPCR on samples from 362 competitive enzyme-linked immunosorbent assay (cELISA)-negative horses from Canada and the United States yielded no false-positive reactions. The assay's performance was further evaluated using samples collected from 430 horses of unknown EP status from a highly endemic area in Brazil. This set of samples was also tested by a single-target 18S rRNA qPCR for T. equi developed at the OIE reference laboratory for EP in Japan, and a previously published single-target 18S rRNA qPCR for B. caballi whose oligonucleotides we adopted for use in the duplex qPCR. Matching serum samples were tested for antibodies to these parasites using cELISA. By the duplex qPCR, T. equi-specific 18S rRNA qPCR and cELISA, infections with T. equi were detected in 87.9% (95% confidence interval, CI: 84.5-90.7%), 90.5% (95% CI: 87.3-92.3%) and 87.4% (95% CI: 84
Martino, Amanda J.; Rhodes, Matthew E.; Biddle, Jennifer F.; Brandt, Leah D.; Tomsho, Lynn P.; House, Christopher H.
2011-01-01
A degenerate polymerase chain reaction (PCR)-based method of whole-genome amplification, designed to work fluidly with 454 sequencing technology, was developed and tested for use on deep marine subsurface DNA samples. While optimized here for use with Roche 454 technology, the general framework presented may be applicable to other next generation sequencing systems as well (e.g., Illumina, Ion Torrent). The method, which we have called random amplification metagenomic PCR (RAMP), involves the use of specific primers from Roche 454 amplicon sequencing, modified by the addition of a degenerate region at the 3′ end. It utilizes a PCR reaction, which resulted in no amplification from blanks, even after 50 cycles of PCR. After efforts to optimize experimental conditions, the method was tested with DNA extracted from cultured E. coli cells, and genome coverage was estimated after sequencing on three different occasions. Coverage did not vary greatly with the different experimental conditions tested, and was around 62% with a sequencing effort equivalent to a theoretical genome coverage of 14.10×. The GC content of the sequenced amplification product was within 2% of the predicted values for this strain of E. coli. The method was also applied to DNA extracted from marine subsurface samples from ODP Leg 201 site 1229 (Peru Margin), and results of a taxonomic analysis revealed microbial communities dominated by Proteobacteria, Chloroflexi, Firmicutes, Euryarchaeota, and Crenarchaeota, among others. These results were similar to those obtained previously for those samples; however, variations in the proportions of taxa identified illustrates well the generally accepted view that community analysis is sensitive to both the amplification technique used and the method of assigning sequences to taxonomic groups. Overall, we find that RAMP represents a valid methodology for amplifying metagenomes from low-biomass samples. PMID:22319519
Mengtong Jin; Haiquan Liu; Wenshuo Sun; Qin Li; Zhaohuan Zhang; Jibing Li; Yingjie Pan; Yong Zhao
2015-01-01
Vibrio parahemolyticus is an important pathogen that leads to food illness associated seafood. Therefore, rapid and reliable methods to detect and quantify the total viable V. parahaemolyticus in seafood are needed. In this assay, a RNA-based real-time reverse-transcriptase PCR (RT-qPCR) without an enrichment step has been developed for detection and quantification of the total viable V. parahaemolyticus in shrimp. RNA standards with the target segments were synthesized in vitro with T7 RNA p...
Design and Validation of Real-Time PCR: Quantitative Diagnosis of Common Leishmania Species in Iran.
Fekri Soofi Abadi, Maryam; Dabiri, Shahriar; Fotouhi Ardakani, Reza; Fani Malaki, Lina; Amirpoor Rostami, Sahar; Ziasistani, Mahsa; Dabiri, Donya
2016-07-01
Design and validation of Real-time PCR on the protected gene region ITS2 to quantify the parasite load in common leishmania (L) species. Probe and primer were designed from the ITS2 region between the rRNA genes with minimum gene variation in three common leishmania species followed by a Real-time PCR using the Taq man probe method in the form of absolute quantification. A series of different concentrations of leishmania were analyzed. After the purified PCR product was successfully placed in a PTG19-T plasmid vector, specialized ITS2 region was cloned in this plasmid. In the last phase, the cloned gene was transferred to the Ecoli.Top10F bacteria. The standard plasmid was provided in 10(7) to 10(1) copies/rxn concentrations. The specification and clinical sensitivity of the data was analyzed using inter and intra scales. The probe and primer were designed using three species, including L. infantum, L. major, and L.tropica. Seven concentrations of purified parasite in culture media showed that the selected region for quantifying the parasite is suitable. Clinical and analytical specificity and sensitivity were both 100%, respectively. The Taq man method for the ITS2 region in leishmania is one the most sensitive diagnostic test for identifying the parasite load and is suggested as a tool for fast identification and quantification of species.
[Optimized application of nested PCR method for detection of malaria].
Yao-Guang, Z; Li, J; Zhen-Yu, W; Li, C
2017-04-28
Objective To optimize the application of the nested PCR method for the detection of malaria according to the working practice, so as to improve the efficiency of malaria detection. Methods Premixing solution of PCR, internal primers for further amplification and new designed primers that aimed at two Plasmodium ovale subspecies were employed to optimize the reaction system, reaction condition and specific primers of P . ovale on basis of routine nested PCR. Then the specificity and the sensitivity of the optimized method were analyzed. The positive blood samples and examination samples of malaria were detected by the routine nested PCR and the optimized method simultaneously, and the detection results were compared and analyzed. Results The optimized method showed good specificity, and its sensitivity could reach the pg to fg level. The two methods were used to detect the same positive malarial blood samples simultaneously, the results indicated that the PCR products of the two methods had no significant difference, but the non-specific amplification reduced obviously and the detection rates of P . ovale subspecies improved, as well as the total specificity also increased through the use of the optimized method. The actual detection results of 111 cases of malarial blood samples showed that the sensitivity and specificity of the routine nested PCR were 94.57% and 86.96%, respectively, and those of the optimized method were both 93.48%, and there was no statistically significant difference between the two methods in the sensitivity ( P > 0.05), but there was a statistically significant difference between the two methods in the specificity ( P PCR can improve the specificity without reducing the sensitivity on the basis of the routine nested PCR, it also can save the cost and increase the efficiency of malaria detection as less experiment links.
HLA-DQA1 typing in Danes by two polymerase chain reaction (PCR) based methods
DEFF Research Database (Denmark)
Cowland, J B; Madsen, H O; Morling, N
1995-01-01
(ASA) method, which together recognise eight alleles. In 146 unrelated Danish individuals, the HLA-DQA1 alleles were in Hardy-Weinberg equilibrium. For identity testing, the power of discrimination (PD) of HLA-DQA1 was 0.932 with the RDB method and 0.942 with the PCR-RFLP/ASA method. For paternity...
Altınel, Ahmet
2017-01-01
Complex vertebral malformation (CVM) is an inherited, autosomal recessive disorder of Holstein cattle. The aim of this study was to compare sensitivity, specificity, positive and negative predictive values, accuracy, and rapidity of allele-specific polymerase chain reaction (AS-PCR), created restriction-site PCR (CRS-PCR), and PCR with primer-introduced restriction analysis (PCR-PIRA), three methods used in identification of CVM carriers in a Holstein cattle population. In order to screen for the G>T mutation in the solute carrier family 35 member A3 (SLC35A3) gene, DNA sequencing as the gold standard method was used. The prevalence of carriers and the mutant allele frequency were 3.2% and 0.016, respectively, among Holstein cattle in the Thrace region of Turkey. Among the three methods, the fastest but least accurate was AS-PCR. Although the rapidity of CRS-PCR and PCR-PIRA were nearly equal, the accuracy of PCR-PIRA was higher than that of CRS-PCR. Therefore, among the three methods, PCR-PIRA appears to be the most efficacious for screening of mutant alleles when identifying CVM carriers in a Holstein cattle population. PMID:28927256
Detection of Fusarium verticillioides by PCR-ELISA based on FUM21 gene.
Omori, Aline Myuki; Ono, Elisabete Yurie Sataque; Bordini, Jaqueline Gozzi; Hirozawa, Melissa Tiemi; Fungaro, Maria Helena Pelegrinelli; Ono, Mario Augusto
2018-08-01
Fusarium verticillioides is a primary corn pathogen and fumonisin producer which is associated with toxic effects in humans and animals. The traditional methods for detection of fungal contamination based on morphological characteristics are time-consuming and show low sensitivity and specificity. Therefore, the objective of this study was to develop a PCR-ELISA based on the FUM21 gene for F. verticillioides detection. The DNA of the F. verticillioides, Fusarium sp., Aspergillus sp. and Penicillium sp. isolates was analyzed by conventional PCR and PCR-ELISA to determine the specificity. The PCR-ELISA was specific to F. verticillioides isolates, showed a 2.5 pg detection limit and was 100-fold more sensitive than conventional PCR. In corn samples inoculated with F. verticillioides conidia, the detection limit of the PCR-ELISA was 1 × 10 4 conidia/g and was also 100-fold more sensitive than conventional PCR. Naturally contaminated corn samples were analyzed by PCR-ELISA based on the FUM21 gene and PCR-ELISA absorbance values correlated positively (p PCR-ELISA developed in this study can be useful for F. verticillioides detection in corn samples. Copyright © 2018 Elsevier Ltd. All rights reserved.
Directory of Open Access Journals (Sweden)
Alejandro G Schijman
-95%, accuracy of 86.8-89.5% and kappa index of 0.7-0.8 compared to consensus PCR reports of the 16 good performing tests and 63-69%, 100%, 71.4-76.2% and 0.4-0.5, respectively compared to serodiagnosis. Method LbD2 used solvent extraction followed by Sybr-Green based Real time PCR targeted to Sat-DNA; method LbD3 used solvent DNA extraction followed by conventional PCR targeted to Sat-DNA. The third method (LbF1 used glass fiber column based DNA extraction followed by TaqMan Real Time PCR targeted to Sat-DNA (cruzi 1/cruzi 2 and cruzi 3 TaqMan probe and the fourth method (LbQ used solvent DNA extraction followed by conventional hot-start PCR targeted to kDNA (primer pairs 121/122. These four methods were further evaluated at the coordinating laboratory in a subset of human blood samples, confirming the performance obtained by the participating laboratories. CONCLUSION/SIGNIFICANCE: This study represents a first crucial step towards international validation of PCR procedures for detection of T. cruzi in human blood samples.
Directory of Open Access Journals (Sweden)
Kwang-Pyo Kim
2015-09-01
Full Text Available The goal of this study was to develop the Listeria species-specific PCR assays based on a house-keeping gene (lmo1634 encoding alcohol acetaldehyde dehydrogenase (Aad, previously designated as Listeria adhesion protein (LAP, and compare results with a label-free light scattering sensor, BARDOT (bacterial rapid detection using optical scattering technology. PCR primer sets targeting the lap genes from the species of Listeria sensu stricto were designed and tested with 47 Listeria and 8 non-Listeria strains. The resulting PCR primer sets detected either all species of Listeria sensu stricto or individual L. innocua, L. ivanovii and L. seeligeri, L. welshimeri, and L. marthii without producing any amplified products from other bacteria tested. The PCR assays with Listeria sensu stricto-specific primers also successfully detected all species of Listeria sensu stricto and/or Listeria innocua from mixed culture-inoculated food samples, and each bacterium in food was verified by using the light scattering sensor that generated unique scatter signature for each species of Listeria tested. The PCR assays based on the house-keeping gene aad (lap can be used for detection of either all species of Listeria sensu stricto or certain individual Listeria species in a mixture from food with a detection limit of about 104 CFU/mL.
Zhu, Debin; Tang, Yabing; Xing, Da; Chen, Wei R.
2018-01-01
Bio-barcode assay based on oligonucleotide-modified gold nanoparticles (Au-NPs) provides a PCR-free method for quantitative detection of nucleic acid targets. However, the current bio-barcode assay requires lengthy experimental procedures including the preparation and release of barcode DNA probes from the target-nanoparticle complex, and immobilization and hybridization of the probes for quantification. Herein, we report a novel PCR-free electrochemiluminescence (ECL)-based bio-barcode assay for the quantitative detection of genetically modified organism (GMO) from raw materials. It consists of tris-(2’2’-bipyridyl) ruthenium (TBR)-labele barcode DNA, nucleic acid hybridization using Au-NPs and biotin-labeled probes, and selective capture of the hybridization complex by streptavidin-coated paramagnetic beads. The detection of target DNA is realized by direct measurement of ECL emission of TBR. It can quantitatively detect target nucleic acids with high speed and sensitivity. This method can be used to quantitatively detect GMO fragments from real GMO products. PMID:18386909
A method for accurate detection of genomic microdeletions using real-time quantitative PCR
Directory of Open Access Journals (Sweden)
Bassett Anne S
2005-12-01
Full Text Available Abstract Background Quantitative Polymerase Chain Reaction (qPCR is a well-established method for quantifying levels of gene expression, but has not been routinely applied to the detection of constitutional copy number alterations of human genomic DNA. Microdeletions or microduplications of the human genome are associated with a variety of genetic disorders. Although, clinical laboratories routinely use fluorescence in situ hybridization (FISH to identify such cryptic genomic alterations, there remains a significant number of individuals in which constitutional genomic imbalance is suspected, based on clinical parameters, but cannot be readily detected using current cytogenetic techniques. Results In this study, a novel application for real-time qPCR is presented that can be used to reproducibly detect chromosomal microdeletions and microduplications. This approach was applied to DNA from a series of patient samples and controls to validate genomic copy number alteration at cytoband 22q11. The study group comprised 12 patients with clinical symptoms of chromosome 22q11 deletion syndrome (22q11DS, 1 patient trisomic for 22q11 and 4 normal controls. 6 of the patients (group 1 had known hemizygous deletions, as detected by standard diagnostic FISH, whilst the remaining 6 patients (group 2 were classified as 22q11DS negative using the clinical FISH assay. Screening of the patients and controls with a set of 10 real time qPCR primers, spanning the 22q11.2-deleted region and flanking sequence, confirmed the FISH assay results for all patients with 100% concordance. Moreover, this qPCR enabled a refinement of the region of deletion at 22q11. Analysis of DNA from chromosome 22 trisomic sample demonstrated genomic duplication within 22q11. Conclusion In this paper we present a qPCR approach for the detection of chromosomal microdeletions and microduplications. The strategic use of in silico modelling for qPCR primer design to avoid regions of repetitive
Gaviria, Marcela; Rivera, Vanessa; Muñoz-Cadavid, Cesar; Cano, Luz Elena; Naranjo, Tonny Williams
2015-01-01
Paracoccidioidomycosis is a systemic and endemic mycosis, restricted to tropical and subtropical areas of Latin America. The infection is caused by the thermal dimorphic fungus Paracoccidioides brasiliensis and Paracoccidioides lutzii. The diagnosis of paracoccidioidomycosis is usually performed by microscopic examination, culture and immunodiagnostic tests to respiratory specimens, body fluids and/or biopsies; however these methods require laboratory personnel with experience and several days to produce a result. In the present study, we have validated and evaluated a nested PCR assay targeting the gene encoding the Paracoccidioides gp43 membrane protein in 191 clinical samples: 115 samples from patients with proven infections other than paracoccidioidomycosis, 51 samples as negative controls, and 25 samples from patients diagnosed with paracoccidioidomycosis. Additionally, the specificity of the nested PCR assay was also evaluated using purified DNA isolated from cultures of different microorganisms (n=35) previously identified by culture and/or sequencing. The results showed that in our hands, this nested PCR assay for gp43 protein showed specificity and sensitivity rates of 100%. The optimized nested PCR conditions in our laboratory allowed detection down to 1fg of P. brasiliensis DNA. Copyright © 2015 Elsevier Editora Ltda. All rights reserved.
DNA extraction method for PCR in mycorrhizal fungi.
Manian, S; Sreenivasaprasad, S; Mills, P R
2001-10-01
To develop a simple and rapid DNA extraction protocol for PCR in mycorrhizal fungi. The protocol combines the application of rapid freezing and boiling cycles and passage of the extracts through DNA purification columns. PCR amplifiable DNA was obtained from a number of endo- and ecto-mycorrhizal fungi using minute quantities of spores and mycelium, respectively. DNA extracted following the method, was used to successfully amplify regions of interest from high as well as low copy number genes. The amplicons were suitable for further downstream applications such as sequencing and PCR-RFLPs. The protocol described is simple, short and facilitates rapid isolation of PCR amplifiable genomic DNA from a large number of fungal isolates in a single day. The method requires only minute quantities of starting material and is suitable for mycorrhizal fungi as well as a range of other fungi.
Development and validation of a real-time PCR for Chlamydia suis diagnosis in swine and humans.
Directory of Open Access Journals (Sweden)
Kristien De Puysseleyr
Full Text Available Pigs are the natural host for Chlamydia suis, a pathogen which is phylogenetically highly related to the human pathogen C. trachomatis. Chlamydia suis infections are generally treated with tetracyclines. In 1998, tetracyline resistant C. suis strains emerged on U.S. pig farms and they are currently present in the Belgian, Cypriote, German, Israeli, Italian and Swiss pig industry. Infections with tetracycline resistant C. suis strains are mainly associated with severe reproductive failure leading to marked economical loss. We developed a sensitive and specific TaqMan probe-based C. suis real-time PCR for examining clinical samples of both pigs and humans. The analytical sensitivity of the real-time PCR is 10 rDNA copies/reaction without cross-amplifying DNA of other Chlamydia species. The PCR was successfully validated using conjunctival, pharyngeal and stool samples of slaughterhouse employees, as well as porcine samples from two farms with evidence of reproductive failure and one farm without clinical disease. Chlamydia suis was only detected in diseased pigs and in the eyes of humans. Positive humans had no clinical complaints. PCR results were confirmed by culture in McCoy cells. In addition, Chlamydia suis isolates were also examined by the tet(C PCR, designed for demonstrating the tetracycline resistance gene tet(C. The tet(C gene was only present in porcine C. suis isolates.
Maas, Miriam; van Roon, Annika; Dam-Deisz, Cecile; Opsteegh, Marieke; Massolo, Alessandro; Deksne, Gunita; Teunis, Peter; van der Giessen, Joke
2016-10-30
A new method, based on a magnetic capture based DNA extraction followed by qPCR, was developed for the detection of the zoonotic parasite Echinococcus multilocularis in definitive hosts. Latent class analysis was used to compare this new method with the currently used phenol-chloroform DNA extraction followed by single tube nested PCR. In total, 60 red foxes and coyotes from three different locations were tested with both molecular methods and the sedimentation and counting technique (SCT) or intestinal scraping technique (IST). Though based on a limited number of samples, it could be established that the magnetic capture based DNA extraction followed by qPCR showed similar sensitivity and specificity as the currently used phenol-chloroform DNA extraction followed by single tube nested PCR. All methods have a high specificity as shown by Bayesian latent class analysis. Both molecular assays have higher sensitivities than the combined SCT and IST, though the uncertainties in sensitivity estimates were wide for all assays tested. The magnetic capture based DNA extraction followed by qPCR has the advantage of not requiring hazardous chemicals like the phenol-chloroform DNA extraction followed by single tube nested PCR. This supports the replacement of the phenol-chloroform DNA extraction followed by single tube nested PCR by the magnetic capture based DNA extraction followed by qPCR for molecular detection of E. multilocularis in definitive hosts. Copyright © 2016 Elsevier B.V. All rights reserved.
Alasaad, Samer; Soriguer, Ramón C; Abu-Madi, Marawan; El Behairy, Ahmed; Baños, Pablo Díez; Píriz, Ana; Fickel, Joerns; Zhu, Xing-Quan
2011-06-01
The present study aimed to establish a fluorescence-based polymerase chain reaction-linked single-strand conformation polymorphism (F-PCR-SSCP) assay for the identification of Fasciola spp. Based on the sequences of the second internal transcribed spacer (ITS-2) of the nuclear ribosomal DNA, we designed a set of genus-specific primers for the amplification of Fasciola ITS-2, with an estimated size of 140 bp. These primers were labelled by fluorescence dyes, and the PCR products were analyzed by capillary electrophoresis under non-denaturing conditions (F-PCR-SSCP). Capillary electrophoresis analysis of the fluorescence-labelled DNA fragments displayed three different peak profiles that allowed the accurate identification of Fasciola species: one single peak specific for either Fasciola hepatica or Fasciola gigantica and a doublet peak corresponding to the "intermediate" Fasciola. Validation of our novel method was performed using Fasciola specimens from different host animals from China, Spain, Nigeria, and Egypt. This F-PCR-SSCP assay provides a rapid, simple, and robust tool for the identification and differentiation between Fasciola spp.
A gradient-based method for segmenting FDG-PET images: methodology and validation
International Nuclear Information System (INIS)
Geets, Xavier; Lee, John A.; Gregoire, Vincent; Bol, Anne; Lonneux, Max
2007-01-01
A new gradient-based method for segmenting FDG-PET images is described and validated. The proposed method relies on the watershed transform and hierarchical cluster analysis. To allow a better estimation of the gradient intensity, iteratively reconstructed images were first denoised and deblurred with an edge-preserving filter and a constrained iterative deconvolution algorithm. Validation was first performed on computer-generated 3D phantoms containing spheres, then on a real cylindrical Lucite phantom containing spheres of different volumes ranging from 2.1 to 92.9 ml. Moreover, laryngeal tumours from seven patients were segmented on PET images acquired before laryngectomy by the gradient-based method and the thresholding method based on the source-to-background ratio developed by Daisne (Radiother Oncol 2003;69:247-50). For the spheres, the calculated volumes and radii were compared with the known values; for laryngeal tumours, the volumes were compared with the macroscopic specimens. Volume mismatches were also analysed. On computer-generated phantoms, the deconvolution algorithm decreased the mis-estimate of volumes and radii. For the Lucite phantom, the gradient-based method led to a slight underestimation of sphere volumes (by 10-20%), corresponding to negligible radius differences (0.5-1.1 mm); for laryngeal tumours, the segmented volumes by the gradient-based method agreed with those delineated on the macroscopic specimens, whereas the threshold-based method overestimated the true volume by 68% (p = 0.014). Lastly, macroscopic laryngeal specimens were totally encompassed by neither the threshold-based nor the gradient-based volumes. The gradient-based segmentation method applied on denoised and deblurred images proved to be more accurate than the source-to-background ratio method. (orig.)
Diagnostic PCR: validation and sample preparation are two sides of the same coin
DEFF Research Database (Denmark)
Hoorfar, Jeffrey; Wolffs, Petra; Radstrøm, Peter
2004-01-01
Increased use of powerful PCR technology for the routine detection of pathogens has focused attention on the need for international validation and preparation of official non-commercial guidelines. Bacteria of epidemiological importance should be the prime focus, although a "validation...... of quantitative reference DNA material and reagents, production of stringent protocols and tools for thermal cycler performance testing, uncomplicated sample preparation techniques, and extensive ring trials for assessment of the efficacy of selected matrix/pathogen detection protocols....
Advantages and limitations of quantitative PCR (Q-PCR)-based approaches in microbial ecology.
Smith, Cindy J; Osborn, A Mark
2009-01-01
Quantitative PCR (Q-PCR or real-time PCR) approaches are now widely applied in microbial ecology to quantify the abundance and expression of taxonomic and functional gene markers within the environment. Q-PCR-based analyses combine 'traditional' end-point detection PCR with fluorescent detection technologies to record the accumulation of amplicons in 'real time' during each cycle of the PCR amplification. By detection of amplicons during the early exponential phase of the PCR, this enables the quantification of gene (or transcript) numbers when these are proportional to the starting template concentration. When Q-PCR is coupled with a preceding reverse transcription reaction, it can be used to quantify gene expression (RT-Q-PCR). This review firstly addresses the theoretical and practical implementation of Q-PCR and RT-Q-PCR protocols in microbial ecology, highlighting key experimental considerations. Secondly, we review the applications of (RT)-Q-PCR analyses in environmental microbiology and evaluate the contribution and advances gained from such approaches. Finally, we conclude by offering future perspectives on the application of (RT)-Q-PCR in furthering understanding in microbial ecology, in particular, when coupled with other molecular approaches and more traditional investigations of environmental systems.
A Simple PCR Method for Rapid Genotype Analysis of Mycobacterium ulcerans
Stinear, Timothy; Davies, John K.; Jenkin, Grant A.; Portaels, Françoise; Ross, Bruce C.; OppEdIsano, Frances; Purcell, Maria; Hayman, John A.; Johnson, Paul D. R.
2000-01-01
Two high-copy-number insertion sequences, IS2404 and IS2606, were recently identified in Mycobacterium ulcerans and were shown by Southern hybridization to possess restriction fragment length polymorphism between strains from different geographic origins. We have designed a simple genotyping method that captures these differences by PCR amplification of the region between adjacent copies of IS2404 and IS2606. We have called this system 2426 PCR. The method is rapid, reproducible, sensitive, and specific for M. ulcerans, and it has confirmed previous studies suggesting a clonal population structure of M. ulcerans within a geographic region. M. ulcerans isolates from Australia, Papua New Guinea, Malaysia, Surinam, Mexico, Japan, China, and several countries in Africa were easily differentiated based on an array of 4 to 14 PCR products ranging in size from 200 to 900 bp. Numerical analysis of the banding patterns suggested a close evolutionary link between M. ulcerans isolates from Africa and southeast Asia. The application of 2426 PCR to total DNA, extracted directly from M. ulcerans-infected tissue specimens without culture, demonstrated the sensitivity and specificity of this method and confirmed for the first time that both animal and human isolates from areas of endemicity in southeast Australia have the same genotype. PMID:10747130
Shape based kinetic outlier detection in real-time PCR
Directory of Open Access Journals (Sweden)
D'Atri Mario
2010-04-01
Full Text Available Abstract Background Real-time PCR has recently become the technique of choice for absolute and relative nucleic acid quantification. The gold standard quantification method in real-time PCR assumes that the compared samples have similar PCR efficiency. However, many factors present in biological samples affect PCR kinetic, confounding quantification analysis. In this work we propose a new strategy to detect outlier samples, called SOD. Results Richards function was fitted on fluorescence readings to parameterize the amplification curves. There was not a significant correlation between calculated amplification parameters (plateau, slope and y-coordinate of the inflection point and the Log of input DNA demonstrating that this approach can be used to achieve a "fingerprint" for each amplification curve. To identify the outlier runs, the calculated parameters of each unknown sample were compared to those of the standard samples. When a significant underestimation of starting DNA molecules was found, due to the presence of biological inhibitors such as tannic acid, IgG or quercitin, SOD efficiently marked these amplification profiles as outliers. SOD was subsequently compared with KOD, the current approach based on PCR efficiency estimation. The data obtained showed that SOD was more sensitive than KOD, whereas SOD and KOD were equally specific. Conclusion Our results demonstrated, for the first time, that outlier detection can be based on amplification shape instead of PCR efficiency. SOD represents an improvement in real-time PCR analysis because it decreases the variance of data thus increasing the reliability of quantification.
Soejima, Mikiko; Tsuchiya, Yuji; Egashira, Kouichi; Kawano, Hiroyuki; Sagawa, Kimitaka; Koda, Yoshiro
2010-06-01
Anhaptoglobinemic patients run the risk of severe anaphylactic transfusion reaction because they produce serum haptoglobin (Hp) antibodies. Being homozygous for the Hp gene deletion (HP(del)) is the only known cause of congenital anhaptoglobinemia, and clinical diagnosis of HP(del) before transfusion is important to prevent anaphylactic shock. We recently developed a 5'-nuclease (TaqMan) real-time polymerase chain reaction (PCR) method. A SYBR Green I-based duplex real-time PCR assay using two forward primers and a common reverse primer followed by melting curve analysis was developed to determine HP(del) zygosity in a single tube. In addition, to obviate initial DNA extraction, we examined serially diluted blood samples as PCR templates. Allelic discrimination of HP(del) yielded optimal results at blood sample dilutions of 1:64 to 1:1024. The results from 2231 blood samples were fully concordant with those obtained by the TaqMan-based real-time PCR method. The detection rate of the HP(del) allele by the SYBR Green I-based method is comparable with that using the TaqMan-based method. This method is readily applicable due to its low initial cost and analyzability using economical real-time PCR machines and is suitable for high-throughput analysis as an alternative method for allelic discrimination of HP(del).
von Hertwig, Aline Morgan; Sant'Ana, Anderson S; Sartori, Daniele; da Silva, Josué José; Nascimento, Maristela S; Iamanaka, Beatriz Thie; Pelegrinelli Fungaro, Maria Helena; Taniwaki, Marta Hiromi
2018-05-01
Some species from Aspergillus section Nigri are morphologically very similar and altogether have been called A. niger aggregate. Although the species included in this group are morphologically very similar, they differ in their ability to produce mycotoxins and other metabolites and their taxonomical status has evolved continuously. Among them, A. niger and A. welwitschiae are ochratoxin A and fumonisin B 2 producers and their detection and/or identification is of crucial importance for food safety. The aim of this study was the development of a real-time PCR-based method for simultaneous discrimination of A. niger and A. welwitschiae from other species of the A. niger aggregate isolated from coffee beans. One primer pair and a hybridization probe specific for detection of A. niger and A. welwitschiae strains were designed based on the BenA gene sequences, and used in a Real-time PCR assay for the rapid discrimination between both these species from all others of the A. niger aggregate. The Real-time PCR assay was shown to be 100% efficient in discriminating the 73 isolates of A. niger/A. welwitschiae from the other A. niger aggregate species analyzed as a negative control. This result testifies to the use of this technique as a good tool in the rapid detection of these important toxigenic species. Copyright © 2018 Elsevier B.V. All rights reserved.
An enhanced method for sequence walking and paralog mining: TOPO® Vector-Ligation PCR
Directory of Open Access Journals (Sweden)
Davis Thomas M
2010-03-01
Full Text Available Abstract Background Although technological advances allow for the economical acquisition of whole genome sequences, many organisms' genomes remain unsequenced, and fully sequenced genomes may contain gaps. Researchers reliant upon partial genomic or heterologous sequence information require methods for obtaining unknown sequences from loci of interest. Various PCR based techniques are available for sequence walking - i.e., the acquisition of unknown DNA sequence adjacent to known sequence. Many such methods require rigid, elaborate protocols and/or impose narrowly confined options in the choice of restriction enzymes for necessary genomic digests. We describe a new method, TOPO® Vector-Ligation PCR (or TVL-PCR that innovatively integrates available tools and familiar concepts to offer advantages as a means of both targeted sequence walking and paralog mining. Findings TVL-PCR exploits the ligation efficiency of the pCR®4-TOPO® (Invitrogen, Carlsbad, California vector system to capture fragments of unknown sequence by creating chimeric molecules containing defined priming sites at both ends. Initially, restriction enzyme-digested genomic DNA is end-repaired to create 3' adenosine overhangs and is then ligated to pCR4-TOPO vectors. The ligation product pool is used directly as a template for nested PCR, using specific primers to target orthologous sequences, or degenerate primers to enable capture of paralogous gene family members. We demonstrated the efficacy of this method by capturing entire coding and partial promoter sequences of several strawberry Superman-like genes. Conclusions TVL-PCR is a convenient and efficient method for DNA sequence walking and paralog mining that is applicable to any organism for which relevant DNA sequence is available as a basis for primer design.
DEFF Research Database (Denmark)
Green, Tina Marie; de Stricker, Karin; Møller, Michael Boe
2009-01-01
Normalization of quantitative reverse transcription-PCR (Q-RT-PCR) data to appropriate tissue-specific reference genes is an essential part of interpreting the results. This study aimed to determine the most appropriate reference genes for normalizing gene expressions in lymphatic tissue...... was 0.93 (Pnormalization with the appropriate reference genes. Thus, we show that formalin-fixed, paraffin-embedded lymphoid samples are suitable for Q-RT-PCR when using thoroughly validated reference genes....
Energy Technology Data Exchange (ETDEWEB)
Brill, J.A.; Wiegel, J. [Univ. of Georgia, Athens, GA (United States)
1997-12-31
A set of molecular probes was devised to develop a method for screening for the presence of sequences homologous to three representative genes exclusively involved in endosporulation. Based on known gene sequences, degenerate PCR primers were designed against spo0A and ssp. Experimental conditions were devised under which homologs of both genes were consistently detected in endospore-forming bacteria, but not in asporogenic bacteria. The PCR amplification products and dpaA/B from Bacillus subtilis were used as hybridization probes for Southern blots. Identical conditions were used with the genomic DNA from endospore-forming and asporogenic bacteria. We therefore concluded that the probes specifically detect the targeted sporulation genes and we obtained no indication that genes homologous to ssp, spo0A and dpaA/B are present in asporogenic bacteria. Thus, this assay can potentially be used to detect spore-forming bacteria in various kinds of samples and to distinguish between bacteria containing sporulation genes and those who do not regardless of whether sporulation is observed or not. 43 refs., 3 figs., 1 tab.
Kim, Mi-Ra; Kwon, Kisung; Jung, Yoo-Kyung; Kang, Tae Sun
2018-07-30
Skates and rays are commercially important fish in South Korea, and among them, Beringraja pulchra has the highest economic value. However, the similar morphological traits among skates and rays are often exploited for seafood fraud. Here, we designed both Beringraja pulchra-specific and skate-universal primer sets, capable of detecting short sequences in the cytochrome oxidase subunit I gene, and developed highly sensitive and reliable quantitative real-time PCR (qPCR) assays to differentiate between Beringraja pulchra and other skate and ray species. AΔCq method based on differences in the amplification efficiency was developed, validated, and then used to confirm the presence of Beringraja pulchra in twenty-six commercial skate products. The averageΔCq value obtained for other skate species (18.94 ± 3.46) was significantly higher than that of Beringraja pulchra (1.18 ± 0.15). For on-site applications, we developed an ultra-fast qPCR assay, allowing for completion of the entire analytical procedure within 30 min. Copyright © 2018 Elsevier Ltd. All rights reserved.
Validation of a Smartphone Image-Based Dietary Assessment Method for Pregnant Women
Directory of Open Access Journals (Sweden)
Amy M. Ashman
2017-01-01
Full Text Available Image-based dietary records could lower participant burden associated with traditional prospective methods of dietary assessment. They have been used in children, adolescents and adults, but have not been evaluated in pregnant women. The current study evaluated relative validity of the DietBytes image-based dietary assessment method for assessing energy and nutrient intakes. Pregnant women collected image-based dietary records (via a smartphone application of all food, drinks and supplements consumed over three non-consecutive days. Intakes from the image-based method were compared to intakes collected from three 24-h recalls, taken on random days; once per week, in the weeks following the image-based record. Data were analyzed using nutrient analysis software. Agreement between methods was ascertained using Pearson correlations and Bland-Altman plots. Twenty-five women (27 recruited, one withdrew, one incomplete, median age 29 years, 15 primiparas, eight Aboriginal Australians, completed image-based records for analysis. Significant correlations between the two methods were observed for energy, macronutrients and fiber (r = 0.58–0.84, all p < 0.05, and for micronutrients both including (r = 0.47–0.94, all p < 0.05 and excluding (r = 0.40–0.85, all p < 0.05 supplements in the analysis. Bland-Altman plots confirmed acceptable agreement with no systematic bias. The DietBytes method demonstrated acceptable relative validity for assessment of nutrient intakes of pregnant women.
MR-based water content estimation in cartilage: design and validation of a method
DEFF Research Database (Denmark)
Shiguetomi Medina, Juan Manuel; Kristiansen, Maja Sophie; Ringgaard, Steffen
Purpose: Design and validation of an MR-based method that allows the calculation of the water content in cartilage tissue. Methods and Materials: Cartilage tissue T1 map based water content MR sequences were used on a 37 Celsius degree stable system. The T1 map intensity signal was analyzed on 6...... cartilage samples from living animals (pig) and on 8 gelatin samples which water content was already known. For the data analysis a T1 intensity signal map software analyzer used. Finally, the method was validated after measuring and comparing 3 more cartilage samples in a living animal (pig). The obtained...... map based water content sequences can provide information that, after being analyzed using a T1-map analysis software, can be interpreted as the water contained inside a cartilage tissue. The amount of water estimated using this method was similar to the one obtained at the dry-freeze procedure...
PCR-based detection of a rare linear DNA in cell culture
Directory of Open Access Journals (Sweden)
Saveliev Sergei V.
2002-01-01
Full Text Available The described method allows for detection of rare linear DNA fragments generated during genomic deletions. The predicted limit of the detection is one DNA molecule per 107 or more cells. The method is based on anchor PCR and involves gel separation of the linear DNA fragment and chromosomal DNA before amplification. The detailed chemical structure of the ends of the linear DNA can be defined with the use of additional PCR-based protocols. The method was applied to study the short-lived linear DNA generated during programmed genomic deletions in a ciliate. It can be useful in studies of spontaneous DNA deletions in cell culture or for tracking intracellular modifications at the ends of transfected DNA during gene therapy trials.
PCR-based detection of a rare linear DNA in cell culture.
Saveliev, Sergei V.
2002-11-11
The described method allows for detection of rare linear DNA fragments generated during genomic deletions. The predicted limit of the detection is one DNA molecule per 10(7) or more cells. The method is based on anchor PCR and involves gel separation of the linear DNA fragment and chromosomal DNA before amplification. The detailed chemical structure of the ends of the linear DNA can be defined with the use of additional PCR-based protocols. The method was applied to study the short-lived linear DNA generated during programmed genomic deletions in a ciliate. It can be useful in studies of spontaneous DNA deletions in cell culture or for tracking intracellular modifications at the ends of transfected DNA during gene therapy trials.
PCR-RFLP Method to Identify Salmonid Species of Economic Importance
Directory of Open Access Journals (Sweden)
Andreea Dudu
2011-05-01
Full Text Available The identification of different fish species by molecular methods has become necessary to avoid both the incorrect labelling of individuals involved in repopulation programmes and the commercial frauds on the fish market. Different fish species of great economical importance, like the salmonids, which are very much requested for their meat, can be identified using molecular techniques such as PCR-RFLP. The method is based on the amplification of a target region from the genome by PCR reaction followed by endonucleases digestion to detect the polymorphism of restriction fragments. In our study we analysed the following salmonid species from Romania: Salmo trutta fario, Salmo labrax, Salvelinus fontinalis, Onchorhynchus mykiss, Thymallus thymallus and Hucho hucho. In order to discriminate between the analysed species we amplified a fragment of mitochondrial genome comprising tRNAGlu/ cytochrome b/ tRNAThr/ tRNAPro/ D-loop/ tRNAPhe, followed by digestion with a specific restriction enzyme. The direct digestion of unpurified PCR products generated species-specific restriction patterns and proved to be a simple, reliable, inexpensive and fast method. Thus, it may be successfully utilized in specialized laboratories for the correct identification of the fish species for multiple purposes, including the traceability of fish food products.
Létant, Sonia E; Murphy, Gloria A; Alfaro, Teneile M; Avila, Julie R; Kane, Staci R; Raber, Ellen; Bunt, Thomas M; Shah, Sanjiv R
2011-09-01
In the event of a biothreat agent release, hundreds of samples would need to be rapidly processed to characterize the extent of contamination and determine the efficacy of remediation activities. Current biological agent identification and viability determination methods are both labor- and time-intensive such that turnaround time for confirmed results is typically several days. In order to alleviate this issue, automated, high-throughput sample processing methods were developed in which real-time PCR analysis is conducted on samples before and after incubation. The method, referred to as rapid-viability (RV)-PCR, uses the change in cycle threshold after incubation to detect the presence of live organisms. In this article, we report a novel RV-PCR method for detection of live, virulent Bacillus anthracis, in which the incubation time was reduced from 14 h to 9 h, bringing the total turnaround time for results below 15 h. The method incorporates a magnetic bead-based DNA extraction and purification step prior to PCR analysis, as well as specific real-time PCR assays for the B. anthracis chromosome and pXO1 and pXO2 plasmids. A single laboratory verification of the optimized method applied to the detection of virulent B. anthracis in environmental samples was conducted and showed a detection level of 10 to 99 CFU/sample with both manual and automated RV-PCR methods in the presence of various challenges. Experiments exploring the relationship between the incubation time and the limit of detection suggest that the method could be further shortened by an additional 2 to 3 h for relatively clean samples.
Development and validation of a quantitative PCR assay for Ichthyophonus spp.
White, Vanessa C; Morado, J Frank; Crosson, Lisa M; Vadopalas, Brent; Friedman, Carolyn S
2013-04-29
Members of the genus Ichthyophonus are trophically transmitted, cosmopolitan parasites that affect numerous fish species worldwide. A quantitative PCR (qPCR) assay specific for genus Ichthyophonus 18S ribosomal DNA was developed for parasite detection and surveillance. The new assay was tested for precision, repeatability, reproducibility, and both analytical sensitivity and specificity. Diagnostic sensitivity and specificity were estimated using tissue samples from a wild population of walleye pollock Theragra chalcogramma. Ichthyophonus sp. presence in tissue samples was determined by qPCR, conventional PCR (cPCR), and histology. Parasite prevalence estimates varied depending upon the detection method employed and tissue type tested. qPCR identified the greatest number of Ichthyophonus sp.-positive cases when applied to walleye pollock skeletal muscle. The qPCR assay proved sensitive and specific for Ichthyophonus spp. DNA, but like cPCR, is only a proxy for infection. When compared to cPCR, qPCR possesses added benefits of parasite DNA quantification and a 100-fold increase in analytical sensitivity. Because this novel assay is specific for known members of the genus, it is likely appropriate for detecting Ichthyophonus spp. DNA in various hosts from multiple regions. However, species-level identification and isotype variability would require DNA sequencing. In addition to distribution and prevalence applications, this assay could be modified and adapted for use with zooplankton or environmental samples. Such applications could aid in investigating alternate routes of transmission and life history strategies typical to members of the genus Ichthyophonus.
qPCR-based mitochondrial DNA quantification: Influence of template DNA fragmentation on accuracy
International Nuclear Information System (INIS)
Jackson, Christopher B.; Gallati, Sabina; Schaller, André
2012-01-01
Highlights: ► Serial qPCR accurately determines fragmentation state of any given DNA sample. ► Serial qPCR demonstrates different preservation of the nuclear and mitochondrial genome. ► Serial qPCR provides a diagnostic tool to validate the integrity of bioptic material. ► Serial qPCR excludes degradation-induced erroneous quantification. -- Abstract: Real-time PCR (qPCR) is the method of choice for quantification of mitochondrial DNA (mtDNA) by relative comparison of a nuclear to a mitochondrial locus. Quantitative abnormal mtDNA content is indicative of mitochondrial disorders and mostly confines in a tissue-specific manner. Thus handling of degradation-prone bioptic material is inevitable. We established a serial qPCR assay based on increasing amplicon size to measure degradation status of any DNA sample. Using this approach we can exclude erroneous mtDNA quantification due to degraded samples (e.g. long post-exicision time, autolytic processus, freeze–thaw cycles) and ensure abnormal DNA content measurements (e.g. depletion) in non-degraded patient material. By preparation of degraded DNA under controlled conditions using sonification and DNaseI digestion we show that erroneous quantification is due to the different preservation qualities of the nuclear and the mitochondrial genome. This disparate degradation of the two genomes results in over- or underestimation of mtDNA copy number in degraded samples. Moreover, as analysis of defined archival tissue would allow to precise the molecular pathomechanism of mitochondrial disorders presenting with abnormal mtDNA content, we compared fresh frozen (FF) with formalin-fixed paraffin-embedded (FFPE) skeletal muscle tissue of the same sample. By extrapolation of measured decay constants for nuclear DNA (λ nDNA ) and mtDNA (λ mtDNA ) we present an approach to possibly correct measurements in degraded samples in the future. To our knowledge this is the first time different degradation impact of the two
qPCR-based mitochondrial DNA quantification: Influence of template DNA fragmentation on accuracy
Energy Technology Data Exchange (ETDEWEB)
Jackson, Christopher B., E-mail: Christopher.jackson@insel.ch [Division of Human Genetics, Departements of Pediatrics and Clinical Research, Inselspital, University of Berne, Freiburgstrasse, CH-3010 Berne (Switzerland); Gallati, Sabina, E-mail: sabina.gallati@insel.ch [Division of Human Genetics, Departements of Pediatrics and Clinical Research, Inselspital, University of Berne, Freiburgstrasse, CH-3010 Berne (Switzerland); Schaller, Andre, E-mail: andre.schaller@insel.ch [Division of Human Genetics, Departements of Pediatrics and Clinical Research, Inselspital, University of Berne, Freiburgstrasse, CH-3010 Berne (Switzerland)
2012-07-06
Highlights: Black-Right-Pointing-Pointer Serial qPCR accurately determines fragmentation state of any given DNA sample. Black-Right-Pointing-Pointer Serial qPCR demonstrates different preservation of the nuclear and mitochondrial genome. Black-Right-Pointing-Pointer Serial qPCR provides a diagnostic tool to validate the integrity of bioptic material. Black-Right-Pointing-Pointer Serial qPCR excludes degradation-induced erroneous quantification. -- Abstract: Real-time PCR (qPCR) is the method of choice for quantification of mitochondrial DNA (mtDNA) by relative comparison of a nuclear to a mitochondrial locus. Quantitative abnormal mtDNA content is indicative of mitochondrial disorders and mostly confines in a tissue-specific manner. Thus handling of degradation-prone bioptic material is inevitable. We established a serial qPCR assay based on increasing amplicon size to measure degradation status of any DNA sample. Using this approach we can exclude erroneous mtDNA quantification due to degraded samples (e.g. long post-exicision time, autolytic processus, freeze-thaw cycles) and ensure abnormal DNA content measurements (e.g. depletion) in non-degraded patient material. By preparation of degraded DNA under controlled conditions using sonification and DNaseI digestion we show that erroneous quantification is due to the different preservation qualities of the nuclear and the mitochondrial genome. This disparate degradation of the two genomes results in over- or underestimation of mtDNA copy number in degraded samples. Moreover, as analysis of defined archival tissue would allow to precise the molecular pathomechanism of mitochondrial disorders presenting with abnormal mtDNA content, we compared fresh frozen (FF) with formalin-fixed paraffin-embedded (FFPE) skeletal muscle tissue of the same sample. By extrapolation of measured decay constants for nuclear DNA ({lambda}{sub nDNA}) and mtDNA ({lambda}{sub mtDNA}) we present an approach to possibly correct measurements in
Yamada, Kazuhiro; Ibata, Ami; Suzuki, Masahiro; Matsumoto, Masakado; Yamashita, Teruo; Minagawa, Hiroko; Kurane, Ryuichiro
2015-01-01
Campylobacter jejuni is responsible for the majority of Campylobacter infections. As the molecular epidemiological study of outbreaks, pulsed-field gel electrophoresis (PFGE) is performed in general. But PFGE has several problems. PCR binary typing (P-BIT) method is a typing method for Campylobacter spp. that was recently developed, and was reported to have a similar discriminatory power and stability to those of PFGE. We modified the P-BIT method from 18 monoplex PCRs to two multiplex PCR systems (mP-BIT). The same results were obtained from monoplex PCRs using original primers and multiplex PCR in the representative isolates. The mP-BIT can analyze 48 strains at a time by using 96-well PCR systems and can identify C. jejuni because mP-BIT includes C. jejuni marker. The typing of the isolates by the mP-BIT and PFGE demonstrated generally concordant results and the mP-BIT method (D = 0.980) has a similar discriminatory power to that of PFGE with SmaI digest (D = 0.975) or KpnI digest (D = 0.987) as with original article. The mP-BIT method is quick, simple and easy, and comes to be able to perform it at low cost by having become a multiplex PCR system. Therefore, the mP-BIT method with two multiplex PCR systems has high potential for a rapid first-line surveillance typing assay of C. jejuni and can be used for routine surveillance and outbreak investigations of C. jejuni in the future. Copyright © 2014 Japanese Society of Chemotherapy and The Japanese Association for Infectious Diseases. Published by Elsevier Ltd. All rights reserved.
Directory of Open Access Journals (Sweden)
Ming-An Tsai
2017-09-01
Full Text Available Cytokines are fundamental for a functioning immune system, and thus potentially serve as important indicators of animal health. Quantitation of mRNA using quantitative reverse transcription polymerase chain reaction (qRT-PCR is an established immunological technique. It is particularly suitable for detecting the expression of proteins against which monoclonal antibodies are not available. In this study, we developed a probe-based quantitative gene expression assay for immunological assessment of captive beluga whales (Delphinapterus leucas that is one of the most common cetacean species on display in aquariums worldwide. Six immunologically relevant genes (IL-2Rα, -4, -10, -12, TNFα, and IFNγ were selected for analysis, and two validated housekeeping genes (PGK1 and RPL4 with stable expression were used as reference genes. Sixteen blood samples were obtained from four animals with different health conditions and stored in RNAlater™ solution. These samples were used for RNA extraction followed by qRT-PCR analysis. Analysis of gene transcripts was performed by relative quantitation using the comparative Cq method with the integration of amplification efficiency and two reference genes. The expression levels of each gene in the samples from clinically healthy animals were normally distributed. Transcript outliers for IL-2Rα, IL-4, IL-12, TNFα, and IFNγ were noticed in four samples collected from two clinically unhealthy animals. This assay has the potential to identify immune system deviation from normal state, which is caused by health problems. Furthermore, knowing the immune status of captive cetaceans could help both trainers and veterinarians in implementing preventive approaches prior to disease onset.
Desingu, P A; Singh, S D; Dhama, K; Kumar, O R Vinodh; Singh, R; Singh, R K
2015-02-01
A rapid and accurate method of detection and differentiation of virulent and avirulent Newcastle disease virus (NDV) pathotypes was developed. The NDV detection was carried out for different domestic avian field isolates and pigeon paramyxo virus-1 (25 field isolates and 9 vaccine strains) by using APMV-I "fusion" (F) gene Class II specific external primer A and B (535bp), internal primer C and D (238bp) based reverses transcriptase PCR (RT-PCR). The internal degenerative reverse primer D is specific for F gene cleavage position of virulent strain of NDV. The nested RT-PCR products of avirulent strains showed two bands (535bp and 424bp) while virulent strains showed four bands (535bp, 424bp, 349bp and 238bp) on agar gel electrophoresis. This is the first report regarding development and use of degenerate primer based nested RT-PCR for accurate detection and differentiation of NDV pathotypes by demonstrating multiple PCR band patterns. Being a rapid, simple, and economical test, the developed method could serve as a valuable alternate diagnostic tool for characterizing NDV isolates and carrying out molecular epidemiological surveillance studies for this important pathogen of poultry. Copyright © 2014 Elsevier B.V. All rights reserved.
A PCR-based strategy for simple and rapid identification of rough presumptive Salmonella isolates
DEFF Research Database (Denmark)
Hoorfar, Jeffrey; Baggesen, Dorte Lau; Porting, P.H.
1999-01-01
The purpose of the present study was to investigate the application of ready-to-go Salmonella PCR tests, based on dry chemistry, for final identification of rough presumptive Salmonella isolates. The results were compared with two different biotyping methods performed at two different laboratories......, which did not result in any DNA band. A total of 32 out of the 36 rough presumptive isolates were positive in the PCR. All but one isolate were also identified as Salmonella by the two biochemical methods. All 80 Salmonella strains were also tested in the two multiplex serogroup tests based on PCR beads....... The sensitivity of the BAX Salmonella PCR test was assessed by testing a total of 80 Salmonella isolates, covering most serogroups, which correctly identified all the Salmonella strains by resulting in one 800-bp band in the sample tubes. The specificity of the PCR was assessed using 20 non-Salmonella strains...
Song, Kyung-Young; Hwang, Hyun Jin; Kim, Jeong Hee
2017-08-15
The aim of this study was to develop an ultra-fast molecular detection method for meat identification using convection Palm polymerase chain reaction (PCR). The mitochondrial cytochrome b (Cyt b) gene was used as a target gene. Amplicon size was designed to be different for beef, lamb, and pork. When these primer sets were used, each species-specific set specifically detected the target meat species in singleplex and multiplex modes in a 24min PCR run. The detection limit was 1pg of DNA for each meat species. The convection PCR method could detect as low as 1% of meat adulteration. The stability of the assay was confirmed using thermal processed meats. We also showed that direct PCR can be successfully performed with mixed meats and food samples. These results suggest that the developed assay may be useful in the authentication of meats and meat products in laboratory and rapid on-site applications. Copyright © 2017 Elsevier Ltd. All rights reserved.
Rapid detection of human fecal Eubacterium species and related genera by nested PCR method.
Kageyama, A; Benno, Y
2001-01-01
PCR procedures based on 16S rDNA gene sequence specific for seven Eubacterium spp. and Eggerthella lenta that predominate in the human intestinal tract were developed, and used for direct detection of these species in seven human feces samples. Three species of Eggerthella lenta, Eubacterium rectale, and Eubacterium eligens were detected from seven fecal samples. Eubacterium biforme was detected from six samples. It was reported that E. rectale, E. eligens, and E. biforme were difficult to detect by traditional culture method, but the nested PCR method is available for the detection of these species. This result shows that the nested PCR method utilizing a universal primer pair, followed by amplification with species-specific primers, would allow rapid detection of Eubacterium species in human feces.
Leach, L; Zhu, Y; Chaturvedi, S
2018-02-01
Candida auris is an emerging multidrug-resistant yeast causing invasive health care-associated infection with high mortality worldwide. Rapid identification of C. auris is of primary importance for the implementation of public health measures to control the spread of infection. To achieve these goals, we developed and validated a TaqMan-based real-time PCR assay targeting the internal transcribed spacer 2 ( ITS 2) region of the ribosomal gene. The assay was highly specific, reproducible, and sensitive, with the detection limit of 1 C. auris CFU/PCR. The performance of the C. auris real-time PCR assay was evaluated by using 623 surveillance samples, including 365 patient swabs and 258 environmental sponges. Real-time PCR yielded positive results from 49 swab and 58 sponge samples, with 89% and 100% clinical sensitivity with regard to their respective culture-positive results. The real-time PCR also detected C. auris DNA from 1% and 12% of swab and sponge samples with culture-negative results, indicating the presence of dead or culture-impaired C. auris The real-time PCR yielded results within 4 h of sample processing, compared to 4 to 14 days for culture, reducing turnaround time significantly. The new real-time PCR assay allows for accurate and rapid screening of C. auris and can increase effective control and prevention of this emerging multidrug-resistant fungal pathogen in health care facilities. Copyright © 2018 Leach et al.
A quantitative method to evaluate mesenchymal stem cell lipofection using real-time PCR.
Ribeiro, S C; Mendes, R; Madeira, C; Monteiro, G A; da Silva, C L; Cabral, J M S
2010-01-01
Genetic modification of human mesenchymal stem cells (MSC) is a powerful tool to improve the therapeutic utility of these cells and to increase the knowledge on their regulation mechanisms. In this context, strong efforts have been made recently to develop efficient nonviral gene delivery systems. Although several studies addressed this question most of them use the end product of a reporter gene instead of the DNA uptake quantification to test the transfection efficiency. In this study, we established a method based on quantitative real-time PCR (RT-PCR) to determine the intracellular plasmid DNA copy number in human MSC after lipofection. The procedure requires neither specific cell lysis nor DNA purification. The influence of cell number on the RT-PCR sensitivity was evaluated. The method showed good reproducibility, high sensitivity, and a wide linear range of 75-2.5 x 10⁶ plasmid DNA copies per cell. RT-PCR results were then compared with the percentage of transfected cells assessed by flow cytometry analysis, which showed that flow cytometry-based results are not always proportional to plasmid cellular uptake determined by RT-PCR. This work contributed for the establishment of a rapid quantitative assay to determine intracellular plasmid DNA in stem cells, which will be extremely beneficial for the optimization of gene delivery strategies. © 2010 American Institute of Chemical Engineers
Shimizu, Eri; Kato, Hisashi; Nakagawa, Yuki; Kodama, Takashi; Futo, Satoshi; Minegishi, Yasutaka; Watanabe, Takahiro; Akiyama, Hiroshi; Teshima, Reiko; Furui, Satoshi; Hino, Akihiro; Kitta, Kazumi
2008-07-23
A novel type of quantitative competitive polymerase chain reaction (QC-PCR) system for the detection and quantification of the Roundup Ready soybean (RRS) was developed. This system was designed based on the advantage of a fully validated real-time PCR method used for the quantification of RRS in Japan. A plasmid was constructed as a competitor plasmid for the detection and quantification of genetically modified soy, RRS. The plasmid contained the construct-specific sequence of RRS and the taxon-specific sequence of lectin1 (Le1), and both had 21 bp oligonucleotide insertion in the sequences. The plasmid DNA was used as a reference molecule instead of ground seeds, which enabled us to precisely and stably adjust the copy number of targets. The present study demonstrated that the novel plasmid-based QC-PCR method could be a simple and feasible alternative to the real-time PCR method used for the quantification of genetically modified organism contents.
Guglielmo, F; Bergemann, S E; Gonthier, P; Nicolotti, G; Garbelotto, M
2007-11-01
The goal of this research was the development of a PCR-based assay to identify important decay fungi from wood of hardwood tree species in northern temperate regions. Eleven taxon-specific primers were designed for PCR amplification of either nuclear or mitochondrial ribosomal DNA regions of Armillaria spp., Ganoderma spp., Hericium spp., Hypoxylon thouarsianum var. thouarsianum, Inonotus/Phellinus-group, Laetiporus spp., Perenniporia fraxinea, Pleurotus spp., Schizophyllum spp., Stereum spp. and Trametes spp. Multiplex PCR reactions were developed and optimized to detect fungal DNA and identify each taxon with a sensitivity of at least 1 pg of target DNA in the template. This assay correctly identified the agents of decay in 82% of tested wood samples. The development and optimization of multiplex PCRs allowed for reliable identification of wood rotting fungi directly from wood. Early detection of wood decay fungi is crucial for assessment of tree stability in urban landscapes. Furthermore, this method may prove useful for prediction of the severity and the evolution of decay in standing trees.
Directory of Open Access Journals (Sweden)
Eduardo Larriba
2015-04-01
Full Text Available Aim of study: Orchidaceaehas the largest number of species of any family in the plant kingdom. This family is subject to a high risk of extinction in natural environments, such as natural parks and protected areas. Recent studies have shown the prevalence of many species of orchids to be linked to fungal soil diversity, due to their myco-heterotrophic behaviour. Plant communities determine fungal soil diversity, and both generate optimal conditions for orchid development. Area of study: The work was carried out in n the two most important natural parks in Alicante (Font Roja and Sierra Mariola, in South-eastern of Spain. Material and Methods: We designed a molecular tool to monitor the presence of Russula spp. in soil and orchids roots, combined with phytosociological methods. Main results: Using a PCR-based method, we detected the presence in the soil and Limodorum abortivum orchid roots of the mycorrhizal fungi Russula spp. The species with highest coverage was Quercus rotundifolia in areas where the orchid was present. Research highlights: We present a useful tool based on PCR to detect the presence of Russula spp. in a natural environment. These results are consistent with those obtained in different studies that linked the presence of the mycorrhizal fungi Russula spp. in roots of the species Limodorum and the interaction between these fungal species and Quercus ilex trees in Mediterranean forest environments.
Probe-based real-time PCR method for multilocus melt typing of Xylella fastidiosa strains.
Brady, Jeff A; Faske, Jennifer B; Ator, Rebecca A; Castañeda-Gill, Jessica M; Mitchell, Forrest L
2012-04-01
Epidemiological studies of Pierce's disease (PD) can be confounded by a lack of taxonomic detail on the bacterial causative agent, Xylella fastidiosa (Xf). PD in grape is caused by strains of Xylella fastidiosa subsp. fastidiosa, but is not caused by other subspecies of Xf that typically colonize plants other than grape. Detection assays using ELISA and qPCR are effective at detecting and quantifying Xf presence or absence, but offer no information on Xf subspecies or strain identity. Surveying insects or host plants for Xf by current ELISA or qPCR methods provides only presence/absence and quantity information for any and all Xf subspecies, potentially leading to false assessments of disease threat. This study uses a series of adjacent-hybridizing DNA melt analysis probes that are capable of efficiently discriminating Xf subspecies and strain relationships in rapid real-time PCR reactions. Copyright © 2012 Elsevier B.V. All rights reserved.
Validation of reference genes for RT-qPCR analysis in Herbaspirillum seropedicae.
Pessoa, Daniella Duarte Villarinho; Vidal, Marcia Soares; Baldani, José Ivo; Simoes-Araujo, Jean Luiz
2016-08-01
The RT-qPCR technique needs a validated set of reference genes for ensuring the consistency of the results from the gene expression. Expression stabilities for 9 genes from Herbaspirillum seropedicae, strain HRC54, grown with different carbon sources were calculated using geNorm and NormFinder, and the gene rpoA showed the best stability values. Copyright © 2016 Elsevier B.V. All rights reserved.
Peed, Lindsay A; Nietch, Christopher T; Kelty, Catherine A; Meckes, Mark; Mooney, Thomas; Sivaganesan, Mano; Shanks, Orin C
2011-07-01
Diffuse sources of human fecal pollution allow for the direct discharge of waste into receiving waters with minimal or no treatment. Traditional culture-based methods are commonly used to characterize fecal pollution in ambient waters, however these methods do not discern between human and other animal sources of fecal pollution making it difficult to identify diffuse pollution sources. Human-associated quantitative real-time PCR (qPCR) methods in combination with low-order headwatershed sampling, precipitation information, and high-resolution geographic information system land use data can be useful for identifying diffuse source of human fecal pollution in receiving waters. To test this assertion, this study monitored nine headwatersheds over a two-year period potentially impacted by faulty septic systems and leaky sanitary sewer lines. Human fecal pollution was measured using three different human-associated qPCR methods and a positive significant correlation was seen between abundance of human-associated genetic markers and septic systems following wet weather events. In contrast, a negative correlation was observed with sanitary sewer line densities suggesting septic systems are the predominant diffuse source of human fecal pollution in the study area. These results demonstrate the advantages of combining water sampling, climate information, land-use computer-based modeling, and molecular biology disciplines to better characterize diffuse sources of human fecal pollution in environmental waters.
Lager, Malin; Mernelius, Sara; Löfgren, Sture; Söderman, Jan
2016-01-01
Healthcare-associated infections caused by Escherichia coli and antibiotic resistance due to extended-spectrum beta-lactamase (ESBL) production constitute a threat against patient safety. To identify, track, and control outbreaks and to detect emerging virulent clones, typing tools of sufficient discriminatory power that generate reproducible and unambiguous data are needed. A probe based real-time PCR method targeting multiple single nucleotide polymorphisms (SNP) was developed. The method was based on the multi locus sequence typing scheme of Institute Pasteur and by adaptation of previously described typing assays. An 8 SNP-panel that reached a Simpson's diversity index of 0.95 was established, based on analysis of sporadic E. coli cases (ESBL n = 27 and non-ESBL n = 53). This multi-SNP assay was used to identify the sequence type 131 (ST131) complex according to the Achtman's multi locus sequence typing scheme. However, it did not fully discriminate within the complex but provided a diagnostic signature that outperformed a previously described detection assay. Pulsed-field gel electrophoresis typing of isolates from a presumed outbreak (n = 22) identified two outbreaks (ST127 and ST131) and three different non-outbreak-related isolates. Multi-SNP typing generated congruent data except for one non-outbreak-related ST131 isolate. We consider multi-SNP real-time PCR typing an accessible primary generic E. coli typing tool for rapid and uniform type identification.
Zhu, Pengyu; Tian, Wenying; Cheng, Nan; Huang, Kunlun; Luo, Yunbo; Xu, Wentao
2016-08-01
Sensor-based detection methods have inspired the idea that chemical or physical signals could be converted to nucleic acid signals to be quantitatively detected using a combination of appropriate detection tools. To achieve ultra-sensitive and absolute quantitative detection of mercury ion (Hg(2+)), we have combined a mispairing biosensor for Hg(2+) and emulsion PCR. The parameters that might influence the biosensor step, such as the duration of isothermal amplification and the concentration of the sensor oligonucleotide, have been firstly optimized in our study to achieve the most efficient biosensor detection. The evaluation results of secondary structures between the biosensors with different number of T-Hg-T structures achieved by Circular Dichroism have indicated that the secondary hairpin structure would be varied according to the change of number of T-Hg-T structures, which could influence the quantitative detection results. Further optimization of number of T-Hg-T within the biosensor sequences showed that 5 T-Hg-T structures could generate the most efficient amplification. After the above optimizations, the emulsion PCR has been employed to achieve the absolute quantitation of nucleic acid signals. The final results have shown that the limit of quantitation (LOQ) in our study was as low as 40fmol, and the limit of detection (LOD) was 10fmol. The practical detection tests showed that the quantitative results were stable and accurate for all substrates. In conclusion, by combining a mispairing biosensor with emulsion PCR, we developed a flexible and stable quantitative "turn-on" detection method with ultra-sensitivity that can detect trace amounts Hg(2+) within different substrates. Copyright © 2016 Elsevier B.V. All rights reserved.
Real-Time PCR-Based Quantitation Method for the Genetically Modified Soybean Line GTS 40-3-2.
Kitta, Kazumi; Takabatake, Reona; Mano, Junichi
2016-01-01
This chapter describes a real-time PCR-based method for quantitation of the relative amount of genetically modified (GM) soybean line GTS 40-3-2 [Roundup Ready(®) soybean (RRS)] contained in a batch. The method targets a taxon-specific soybean gene (lectin gene, Le1) and the specific DNA construct junction region between the Petunia hybrida chloroplast transit peptide sequence and the Agrobacterium 5-enolpyruvylshikimate-3-phosphate synthase gene (epsps) sequence present in GTS 40-3-2. The method employs plasmid pMulSL2 as a reference material in order to quantify the relative amount of GTS 40-3-2 in soybean samples using a conversion factor (Cf) equal to the ratio of the RRS-specific DNA to the taxon-specific DNA in representative genuine GTS 40-3-2 seeds.
Bahrdt, C; Krech, A B; Wurz, A; Wulff, D
2010-03-01
For years, an increasing number and diversity of genetically modified plants has been grown on a commercial scale. The need for detection and identification of these genetically modified organisms (GMOs) calls for broad and at the same time flexible high throughput testing methods. Here we describe the development and validation of a hexaplex real-time polymerase chain reaction (PCR) screening assay covering more than 100 approved GMOs containing at least one of the GMO targets of the assay. The assay comprises detection systems for Cauliflower Mosaic Virus 35S promoter, Agrobacterium tumefaciens NOS terminator, Figwort Mosaic Virus 34S promoter and two construct-specific sequences present in novel genetically modified soybean and maize that lack common screening elements. Additionally a detection system for an internal positive control (IPC) indicating the presence or absence of PCR inhibiting substances was included. The six real-time PCR systems were allocated to five detection channels showing no significant crosstalk between the detection channels. As part of an extensive validation, a limit of detection (LOD(abs)) GMOs in processed and unprocessed food, feed and seed samples with high efficiency.
Wilkes, Rebecca Penrose; Kania, Stephen A; Tsai, Yun-Long; Lee, Pei-Yu Alison; Chang, Hsiu-Hui; Ma, Li-Juan; Chang, Hsiao-Fen Grace; Wang, Hwa-Tang Thomas
2015-07-01
Feline immunodeficiency virus (FIV) is an important infectious agent of cats. Clinical syndromes resulting from FIV infection include immunodeficiency, opportunistic infections, and neoplasia. In our study, a 5' long terminal repeat/gag region-based reverse transcription insulated isothermal polymerase chain reaction (RT-iiPCR) was developed to amplify all known FIV strains to facilitate point-of-need FIV diagnosis. The RT-iiPCR method was applied in a point-of-need PCR detection platform--a field-deployable device capable of generating automatically interpreted RT-iiPCR results from nucleic acids within 1 hr. Limit of detection 95% of FIV RT-iiPCR was calculated to be 95 copies standard in vitro transcription RNA per reaction. Endpoint dilution studies with serial dilutions of an ATCC FIV type strain showed that the sensitivity of lyophilized FIV RT-iiPCR reagent was comparable to that of a reference nested PCR. The established reaction did not amplify any nontargeted feline pathogens, including Felid herpesvirus 1, feline coronavirus, Feline calicivirus, Feline leukemia virus, Mycoplasma haemofelis, and Chlamydophila felis. Based on analysis of 76 clinical samples (including blood and bone marrow) with the FIV RT-iiPCR, test sensitivity was 97.78% (44/45), specificity was 100.00% (31/31), and agreement was 98.65% (75/76), determined against a reference nested-PCR assay. A kappa value of 0.97 indicated excellent correlation between these 2 methods. The lyophilized FIV RT-iiPCR reagent, deployed on a user-friendly portable device, has potential utility for rapid and easy point-of-need detection of FIV in cats. © 2015 The Author(s).
Directory of Open Access Journals (Sweden)
Lu Jia
2011-10-01
Full Text Available Abstract Background Although a variety of methods and expensive kits are available, molecular cloning can be a time-consuming and frustrating process. Results Here we report a highly simplified, reliable, and efficient PCR-based cloning technique to insert any DNA fragment into a plasmid vector or into a gene (cDNA in a vector at any desired position. With this method, the vector and insert are PCR amplified separately, with only 18 cycles, using a high fidelity DNA polymerase. The amplified insert has the ends with ~16-base overlapping with the ends of the amplified vector. After DpnI digestion of the mixture of the amplified vector and insert to eliminate the DNA templates used in PCR reactions, the mixture is directly transformed into competent E. coli cells to obtain the desired clones. This technique has many advantages over other cloning methods. First, it does not need gel purification of the PCR product or linearized vector. Second, there is no need of any cloning kit or specialized enzyme for cloning. Furthermore, with reduced number of PCR cycles, it also decreases the chance of random mutations. In addition, this method is highly effective and reproducible. Finally, since this cloning method is also sequence independent, we demonstrated that it can be used for chimera construction, insertion, and multiple mutations spanning a stretch of DNA up to 120 bp. Conclusion Our FastCloning technique provides a very simple, effective, reliable, and versatile tool for molecular cloning, chimera construction, insertion of any DNA sequences of interest and also for multiple mutations in a short stretch of a cDNA.
Standardization of diagnostic PCR for the detection of foodborne pathogens
DEFF Research Database (Denmark)
Malorny, B.; Tassios, P.T.; Radstrom, P.
2003-01-01
In vitro amplification of nucleic acids using the polymerase chain reaction (PCR) has become, since its discovery in the 1980s, a powerful diagnostic tool for the analysis of microbial infections as well as for the analysis of microorganisms in food samples. However, despite its potential, PCR has...... neither gained wide acceptance in routine diagnostics nor been widely incorporated in standardized methods. Lack of validation and standard protocols, as well as variable quality of reagents and equipment, influence the efficient dissemination of PCR methodology from expert research laboratories to end......-user laboratories. Moreover, the food industry understandably requires and expects officially approved standards. Recognizing this, in 1999, the European Commission approved the research project, FOOD-PCR (http://www.PCR.dk), which aims to validate and standardize the use of diagnostic PCR for the detection...
Rapid diagnosis of sepsis with TaqMan-Based multiplex real-time PCR.
Liu, Chang-Feng; Shi, Xin-Ping; Chen, Yun; Jin, Ye; Zhang, Bing
2018-02-01
The survival rate of septic patients mainly depends on a rapid and reliable diagnosis. A rapid, broad range, specific and sensitive quantitative diagnostic test is the urgent need. Thus, we developed a TaqMan-Based Multiplex real-time PCR assays to identify bloodstream pathogens within a few hours. Primers and TaqMan probes were designed to be complementary to conserved regions in the 16S rDNA gene of different kinds of bacteria. To evaluate accurately, sensitively, and specifically, the known bacteria samples (Standard strains, whole blood samples) are determined by TaqMan-Based Multiplex real-time PCR. In addition, 30 blood samples taken from patients with clinical symptoms of sepsis were tested by TaqMan-Based Multiplex real-time PCR and blood culture. The mean frequency of positive for Multiplex real-time PCR was 96% at a concentration of 100 CFU/mL, and it was 100% at a concentration greater than 1000 CFU/mL. All the known blood samples and Standard strains were detected positively by TaqMan-Based Multiplex PCR, no PCR products were detected when DNAs from other bacterium were used in the multiplex assay. Among the 30 patients with clinical symptoms of sepsis, 18 patients were confirmed positive by Multiplex real-time PCR and seven patients were confirmed positive by blood culture. TaqMan-Based Multiplex real-time PCR assay with highly sensitivity, specificity and broad detection range, is a rapid and accurate method in the detection of bacterial pathogens of sepsis and should have a promising usage in the diagnosis of sepsis. © 2017 Wiley Periodicals, Inc.
Wiegers, Ann L
2003-07-01
Third-party accreditation is a valuable tool to demonstrate a laboratory's competence to conduct testing. Accreditation, internationally and in the United States, has been discussed previously. However, accreditation is only I part of establishing data credibility. A validated test method is the first component of a valid measurement system. Validation is defined as confirmation by examination and the provision of objective evidence that the particular requirements for a specific intended use are fulfilled. The international and national standard ISO/IEC 17025 recognizes the importance of validated methods and requires that laboratory-developed methods or methods adopted by the laboratory be appropriate for the intended use. Validated methods are therefore required and their use agreed to by the client (i.e., end users of the test results such as veterinarians, animal health programs, and owners). ISO/IEC 17025 also requires that the introduction of methods developed by the laboratory for its own use be a planned activity conducted by qualified personnel with adequate resources. This article discusses considerations and recommendations for the conduct of veterinary diagnostic test method development, validation, evaluation, approval, and transfer to the user laboratory in the ISO/IEC 17025 environment. These recommendations are based on those of nationally and internationally accepted standards and guidelines, as well as those of reputable and experienced technical bodies. They are also based on the author's experience in the evaluation of method development and transfer projects, validation data, and the implementation of quality management systems in the area of method development.
Directory of Open Access Journals (Sweden)
Roberto Viau
2017-02-01
Full Text Available Molecular typing using repetitive sequenced-based PCR (rep-PCR and hsp60 sequencing were applied to a collection of diverse Enterobacter cloacae complex isolates. To determine the most practical method for reference laboratories, we analyzed 71 E. cloacae complex isolates from sporadic and outbreak occurrences originating from 4 geographic areas. While rep-PCR was more discriminating, hsp60 sequencing provided a broader and a more objective geographical tracking method similar to multilocus sequence typing (MLST. In addition, we suggest that MLST may have higher discriminative power compared to hsp60 sequencing, although rep-PCR remains the most discriminative method for local outbreak investigations. In addition, rep-PCR can be an effective and inexpensive method for local outbreak investigation.
Directory of Open Access Journals (Sweden)
Mojtaba Tahmoorespur
2016-04-01
Full Text Available Introduction Butyrivibrio fibrisolvens strains are presently recognized as the major butyrate-producing bacteria found in the rumen and digestive track of many animals and also in the human gut. In this study we reported the development of two DNA based techniques, quantitative competitive (QC PCR and absolute based Real-Time PCR, for enumerating Butyrivibrio fibrisolvens strains. Despite the recent introduction of real-time PCR method for the rapid quantification of the target DNA sequences, use of quantitative competitive PCR (QC-PCR technique continues to play an important role in nucleic acid quantification since it is more cost effective. The procedure relies on the co-amplification of the sequence of interest with a serially diluted synthetic DNA fragment of the known concentration (competitor, using the single set primers. A real-time polymerase chain reaction is a laboratory technique of molecular biology based on the polymerase chain reaction (PCR. It monitors the amplification of a targeted DNA molecule during the PCR. Materials and Methods At first reported species-specific primers targeting the 16S rDNA region of the bacterium Butyrivibrio fibrisolvens were used for amplifying a 213 bp fragment. A DNA competitor differing by 50 bp in length from the 213 bp fragment was constructed and cloned into pTZ57R/T vector. The competitor was quantified by NanoDrop spectrophotometer and serially diluted and co-amplified by PCR with total extracted DNA from rumen fluid samples. PCR products were quantified by photographing agarose gels and analyzed with Image J software and the amount of amplified target DNA was log plotted against the amount of amplified competitor. Coefficient of determination (R2 was used as a criterion of methodology precision. For developing the Real-time PCR technique, the 213 bp fragment was amplified and cloned into pTZ57R/T was used to draw a standard curve. Results and Discussion The specific primers of Butyrivibrio
Dobnik, David; Demšar, Tina; Huber, Ingrid; Gerdes, Lars; Broeders, Sylvia; Roosens, Nancy; Debode, Frederic; Berben, Gilbert; Žel, Jana
2018-01-01
Digital PCR (dPCR), as a new technology in the field of genetically modified (GM) organism (GMO) testing, enables determination of absolute target copy numbers. The purpose of our study was to test the transferability of methods designed for quantitative PCR (qPCR) to dPCR and to carry out an inter-laboratory comparison of the performance of two different dPCR platforms when determining the absolute GM copy numbers and GM copy number ratio in reference materials certified for GM content in mass fraction. Overall results in terms of measured GM% were within acceptable variation limits for both tested dPCR systems. However, the determined absolute copy numbers for individual genes or events showed higher variability between laboratories in one third of the cases, most possibly due to variability in the technical work, droplet size variability, and analysis of the raw data. GMO quantification with dPCR and qPCR was comparable. As methods originally designed for qPCR performed well in dPCR systems, already validated qPCR assays can most generally be used for dPCR technology with the purpose of GMO detection. Graphical abstract The output of three different PCR-based platforms was assessed in an inter-laboratory comparison.
Inverse PCR-based method for isolating novel SINEs from genome.
Han, Yawei; Chen, Liping; Guan, Lihong; He, Shunping
2014-04-01
Short interspersed elements (SINEs) are moderately repetitive DNA sequences in eukaryotic genomes. Although eukaryotic genomes contain numerous SINEs copy, it is very difficult and laborious to isolate and identify them by the reported methods. In this study, the inverse PCR was successfully applied to isolate SINEs from Opsariichthys bidens genome in Eastern Asian Cyprinid. A group of SINEs derived from tRNA(Ala) molecular had been identified, which were named Opsar according to Opsariichthys. SINEs characteristics were exhibited in Opsar, which contained a tRNA(Ala)-derived region at the 5' end, a tRNA-unrelated region, and AT-rich region at the 3' end. The tRNA-derived region of Opsar shared 76 % sequence similarity with tRNA(Ala) gene. This result indicated that Opsar could derive from the inactive or pseudogene of tRNA(Ala). The reliability of method was tested by obtaining C-SINE, Ct-SINE, and M-SINEs from Ctenopharyngodon idellus, Megalobrama amblycephala, and Cyprinus carpio genomes. This method is simpler than the previously reported, which successfully omitted many steps, such as preparation of probes, construction of genomic libraries, and hybridization.
Khalafalla, Abdelmalik I; Al-Busada, Khalid A; El-Sabagh, Ibrahim M
2015-07-07
Pox and pox-like diseases of camels are a group of exanthematous skin conditions that have become increasingly important economically. Three distinct viruses may cause them: camelpox virus (CMLV), camel parapox virus (CPPV) and camelus dromedary papilloma virus (CdPV). These diseases are often difficult to differentiate based on clinical presentation in disease outbreaks. Molecular methods such as PCR targeting species-specific genes have been developed and used to identify these diseases, but not simultaneously in a single tube. Recently, multiplex PCR has gained reputation as a convenient diagnostic method with cost-and timesaving benefits. In the present communication, we describe the development, optimization and validation of a multiplex PCR assay able to detect simultaneously the genome of the three viruses in one single test allowing for rapid and efficient molecular diagnosis. The assay was developed based on the evaluation and combination of published and new primer sets and was validated with viral genomic DNA extracted from known virus strains (n = 14) and DNA extracted from homogenized clinical skin specimens (n = 86). The assay detects correctly the target pathogens by amplification of targeted genes, even in case of co-infection. The method showed high sensitivity, and the specificity was confirmed by PCR-product sequencing. This assay provide rapid, sensitive and specific method for identifying three important viruses in specimens collected from dromedary camels with varying clinical presentations.
International Nuclear Information System (INIS)
Yilmaz, R.; Cabi, E.; Dogan, M.
2014-01-01
RAPD-PCR (Random Amplified Polymorphic DNA Polymerase Chain Reaction) and Post PCR (Polymerase Chain Reaction) Melting Curve Analysis (MCA) have been used to investigate the pattern of genetic variation among some species in the genera Eremopyrum (Ledeb.) Jaub. and Spach and Agropyron Gaertner (Poaceae). Thirteen primers have been used in the study based on the RAPD-PCR and MCA analyses. Each species produced a distinct pattern of DNA fragments which have been used as a measure of the degree of relationship between species by means of using the RAPD-PCR results with three primers selected for identifying the genetic similarities. Polymorphic melting profiles have been obtained with Post PCR MCA method using three primers. Genetic similarities are calculated for all the species studied with RAPD-PCR and MCA methods, the dendrograms are obtained with the MVSP (Multi Variate Statistical Package) software using UPGMA (Unweighted Pair Group Method with Arithmetic Averages) and Jaccard's Coefficient. Polymorphism between 18 populations of Eremopyrum and 6 Agropyron populations and within the species are determined by using RAPD-PCR and Post PCR melting curve analysis (MCA) respectively. (author)
A MIQE-compliant real-time PCR assay for Aspergillus detection.
Directory of Open Access Journals (Sweden)
Gemma L Johnson
Full Text Available The polymerase chain reaction (PCR is widely used as a diagnostic tool in clinical laboratories and is particularly effective for detecting and identifying infectious agents for which routine culture and microscopy methods are inadequate. Invasive fungal disease (IFD is a major cause of morbidity and mortality in immunosuppressed patients, and optimal diagnostic criteria are contentious. Although PCR-based methods have long been used for the diagnosis of invasive aspergillosis (IA, variable performance in clinical practice has limited their value. This shortcoming is a consequence of differing sample selection, collection and preparation protocols coupled with a lack of standardisation of the PCR itself. Furthermore, it has become clear that the performance of PCR-based assays in general is compromised by the inadequacy of experimental controls, insufficient optimisation of assay performance as well as lack of transparency in reporting experimental details. The recently published "Minimum Information for the publication of real-time Quantitative PCR Experiments" (MIQE guidelines provide a blueprint for good PCR assay design and unambiguous reporting of experimental detail and results. We report the first real-time quantitative PCR (qPCR assay targeting Aspergillus species that has been designed, optimised and validated in strict compliance with the MIQE guidelines. The hydrolysis probe-based assay, designed to target the 18S rRNA DNA sequence of Aspergillus species, has an efficiency of 100% (range 95-107%, a dynamic range of at least six orders of magnitude and limits of quantification and detection of 6 and 0.6 Aspergillus fumigatus genomes, respectively. It does not amplify Candida, Scedosporium, Fusarium or Rhizopus species and its clinical sensitivity is demonstrated in histological material from proven IA cases, as well as concordant PCR and galactomannan data in matched broncho-alveolar lavage and blood samples. The robustness
Directory of Open Access Journals (Sweden)
Raquel M. Fernández
2013-01-01
Full Text Available Preimplantation genetic diagnosis (PGD of single gene disorders, combined with HLA matching (PGD-HLA, has emerged as a tool for couples at risk of transmitting a genetic disease to select unaffected embryos of an HLA tissue type compatible with that of an existing affected child. Here, we present a novel one-step multiplex PCR to genotype a spectrum of STRs to simultaneously perform HLA typing and PGD for -thalassemia. This method is being routinely used for PGD-HLA cycles in our department, with a genotyping success rate of 100%. As an example, we present the first successful PGD-HLA typing in Spain, which resulted in the birth of a boy and subsequent successful HSC transplantation to his affected brother, who is doing well 4 years following transplantation. The advantage of our method is that it involves only a round of single PCR for multiple markers amplification (up to 10 markers within the HLA and 6 markers at the -globin loci. This strategy has allowed us to considerably reduce the optimization of the PCR method for each specific PGD-HLA family as well as the time to obtain molecular results in each cycle.
MR-based Water Content Estimation in Cartilage: Design and Validation of a Method
DEFF Research Database (Denmark)
Shiguetomi Medina, Juan Manuel; Kristiansen, Maja Sofie; Ringgaard, Steffen
2012-01-01
Objective Design and validation of an MR-based method that allows the calculation of the water content in cartilage tissue. Material and Methods We modified and adapted to cartilage tissue T1 map based water content MR sequences commonly used in the neurology field. Using a 37 Celsius degree stable...... was costumed and programmed. Finally, we validated the method after measuring and comparing 3 more cartilage samples in a living animal (pig). The obtained data was analyzed and the water content calculated. Then, the same samples were freeze-dried (this technique allows to take out all the water that a tissue...... contains) and we measured the water they contained. Results We could reproduce twice the 37 Celsius degree system and could perform the measurements in a similar way. We found that the MR T1 map based water content sequences can provide information that, after being analyzed with a special software, can...
Woo, Nain; Kim, Su-Kang; Sun, Yucheng; Kang, Seong Ho
2018-01-01
Human apolipoprotein E (ApoE) is associated with high cholesterol levels, coronary artery disease, and especially Alzheimer's disease. In this study, we developed an ApoE genotyping and one-step multiplex polymerase chain reaction (PCR) based-capillary electrophoresis (CE) method for the enhanced diagnosis of Alzheimer's. The primer mixture of ApoE genes enabled the performance of direct one-step multiplex PCR from whole blood without DNA purification. The combination of direct ApoE genotyping and one-step multiplex PCR minimized the risk of DNA loss or contamination due to the process of DNA purification. All amplified PCR products with different DNA lengths (112-, 253-, 308-, 444-, and 514-bp DNA) of the ApoE genes were analyzed within 2min by an extended voltage programming (VP)-based CE under the optimal conditions. The extended VP-based CE method was at least 120-180 times faster than conventional slab gel electrophoresis methods In particular, all amplified DNA fragments were detected in less than 10 PCR cycles using a laser-induced fluorescence detector. The detection limits of the ApoE genes were 6.4-62.0pM, which were approximately 100-100,000 times more sensitive than previous Alzheimer's diagnosis methods In addition, the combined one-step multiplex PCR and extended VP-based CE method was also successfully applied to the analysis of ApoE genotypes in Alzheimer's patients and normal samples and confirmed the distribution probability of allele frequencies. This combination of direct one-step multiplex PCR and an extended VP-based CE method should increase the diagnostic reliability of Alzheimer's with high sensitivity and short analysis time even with direct use of whole blood. Copyright © 2017 Elsevier B.V. All rights reserved.
de Oliveira, VM; Manfio, GP; Coutinho, HLD; Keijzer-Wolters, AC; van Elsas, JD
A direct molecular method for assessing the diversity of specific populations of rhizobia in soil, based on nested PCR amplification of 16S-23S ribosomal RNA gene (rDNA) intergenic spacer (IGS) sequences, was developed. Initial generic amplification of bacterial rDNA IGS sequences from soil DNA was
Oliveira, de V.M.; Manfio, G.P.; Coutinho, H.L.D.; Keijzer-Wolters, A.C.; Elsas, van J.D.
2006-01-01
A direct molecular method for assessing the diversity of specific populations of rhizobia in soil, based on nested PCR amplification of 16S-23S ribosomal RNA gene (rDNA) intergenic spacer (IGS) sequences, was developed. Initial generic amplification of bacterial rDNA IGS sequences from soil DNA was
International Nuclear Information System (INIS)
Huang, S-H; Tsai, M-H; Lin, C-W; Yang, T-C; Chuang, P-H; Tsai, I-S; Lu, H-C; Wan Lei; Lin, Y-J; Lai, C-H
2008-01-01
Virus isolation and antibody detection are routinely used for diagnosis of Japanese encephalitis virus (JEV) infection, but the low level of transient viremia in some JE patients makes JEV isolation from clinical and surveillance samples very difficult. We describe the use of gold nanoparticle-based RT-PCR and real-time quantitative RT-PCR assays for detection of JEV from its RNA genome. We tested the effect of gold nanoparticles on four different PCR systems, including conventional PCR, reverse-transcription PCR (RT-PCR), and SYBR green real-time PCR and RT-PCR assays for diagnosis in the acute phase of JEV infection. Gold nanoparticles increased the amplification yield of the PCR product and shortened the PCR time compared to the conventional reaction. In addition, nanogold-based real-time RT-PCR showed a linear relationship between Ct and template amount using ten-fold dilutions of JEV. The nanogold-based RT-PCR and real-time quantitative RT-PCR assays were able to detect low levels (1-10 000 copies) of the JEV RNA genomes extracted from culture medium or whole blood, providing early diagnostic tools for the detection of low-level viremia in the acute-phase infection. The assays described here were simple, sensitive, and rapid approaches for detection and quantitation of JEV in tissue cultured samples as well as clinical samples
Usefulness of in-house PCR methods for hepatitis B virus DNA detection.
Portilho, Moyra Machado; Baptista, Marcia Leite; da Silva, Messias; de Sousa, Paulo Sérgio Fonseca; Lewis-Ximenez, Lia Laura; Lampe, Elisabeth; Villar, Livia Melo
2015-10-01
The aim of the present study was to evaluate the performance of three in-house PCR techniques for HBV DNA detection and compare it with commercial quantitative methods to evaluate the usefulness of in-house methods for HBV diagnosis. Three panels of HBsAg reactive sera samples were evaluated: (i) 50 samples were examined using three methods for in-house qualitative PCR and the Cobas Amplicor HBV Monitor Assay; (ii) 87 samples were assayed using in-house semi-nested PCR and the Cobas TaqMan HBV test; (iii) 11 serial samples obtained from 2 HBV-infected individuals were assayed using the Cobas Amplicor HBV test and semi-nested PCR. In panel I, HBV DNA was detected in 44 samples using the Cobas Amplicor HBV test, 42 samples using semi-nested PCR (90% concordance with Cobas Amplicor), 22 samples using PCR for the core gene (63.6% concordance) and 29 samples using single-round PCR for the pre-S/S gene (75% concordance). In panel II, HBV DNA was quantified in 78 of the 87 HBsAg reactive samples using Cobas TaqMan but 52 samples using semi-nested PCR (67.8% concordance). HBV DNA was detected in serial samples until the 17th and 26th week after first donation using in-house semi-nested PCR and the Cobas Amplicor HBV test, respectively. In-house semi-nested PCR presented adequate concordance with commercial methods as an alternative method for HBV molecular diagnosis in low-resource settings. Copyright © 2015 Elsevier B.V. All rights reserved.
Directory of Open Access Journals (Sweden)
Charlotte Nejad
2018-01-01
Full Text Available MicroRNA (miRNA detection by reverse transcription (RT quantitative real-time PCR (RT-qPCR is the most popular method currently used to measure miRNA expression. Although the majority of miRNA families are constituted of several 3′-end length variants (“isomiRs”, little attention has been paid to their differential detection by RT-qPCR. However, recent evidence indicates that 3′-end miRNA isoforms can exhibit 3′-length specific regulatory functions, underlining the need to develop strategies to differentiate 3′-isomiRs by RT-qPCR approaches. We demonstrate here that polyadenylation-based RT-qPCR strategies targeted to 20–21 nt isoforms amplify entire miRNA families, but that primers targeted to >22 nt isoforms were specific to >21 nt isoforms. Based on this observation, we developed a simple method to increase selectivity of polyadenylation-based RT-qPCR assays toward shorter isoforms, and demonstrate its capacity to help distinguish short RNAs from longer ones, using synthetic RNAs and biological samples with altered isomiR stoichiometry. Our approach can be adapted to many polyadenylation-based RT-qPCR technologies already exiting, providing a convenient way to distinguish long and short 3′-isomiRs.
Directory of Open Access Journals (Sweden)
Tian-Min Qiao
2016-10-01
Full Text Available Eucalyptus dieback disease, caused by Cylindrocladium scoparium, has occurred in last few years in large Eucalyptus planting areas in China and other countries. Rapid, simple, and reliable diagnostic techniques are desired for the early detection of Eucalyptus dieback of C. scoparium prior to formulation of efficient control plan. For this purpose, three PCR-based methods of nested PCR, multiplex PCR, loop-mediated isothermal amplification (LAMP were developed for detection of C. scoparium based on factor 1-alpha (tef1 and beta-tubulin gene in this study. All of the three methods showed highly specific to C. scoparium. The sensitivities of the nested PCR and LAMP were much higher than the multiplex PCR. The sensitivity of multiplex PCR was also higher than regular PCR. C. scoparium could be detected within 60 min from infected Eucalyptus plants by LAMP, while at least 2 h was needed by the rest two methods. Using different Eucalyptus tissues as samples for C. scoparium detection, all of the three PCR-based methods showed much better detection results than regular PCR. Base on the results from this study, we concluded that any of the three PCR-based methods could be used as diagnostic technology for the development of efficient strategies of Eucalyptus dieback disease control. Particularly, LAMP was the most practical method in field application because of its one-step and rapid reaction, simple operation, single-tube utilization, and simple visualization of amplification products.
Qiao, Tian-Min; Zhang, Jing; Li, Shu-Jiang; Han, Shan; Zhu, Tian-Hui
2016-01-01
Eucalyptus dieback disease, caused by Cylindrocladium scoparium, has occurred in last few years in large Eucalyptus planting areas in China and other countries. Rapid, simple, and reliable diagnostic techniques are desired for the early detection of Eucalyptus dieback of C. scoparium prior to formulation of efficient control plan. For this purpose, three PCR-based methods of nested PCR, multiplex PCR, loop-mediated isothermal amplification (LAMP) were developed for detection of C. scoparium based on factor 1-alpha (tef1) and beta-tubulin gene in this study. All of the three methods showed highly specific to C. scoparium. The sensitivities of the nested PCR and LAMP were much higher than the multiplex PCR. The sensitivity of multiplex PCR was also higher than regular PCR. C. scoparium could be detected within 60 min from infected Eucalyptus plants by LAMP, while at least 2 h was needed by the rest two methods. Using different Eucalyptus tissues as samples for C. scoparium detection, all of the three PCR-based methods showed much better detection results than regular PCR. Base on the results from this study, we concluded that any of the three PCR-based methods could be used as diagnostic technology for the development of efficient strategies of Eucalyptus dieback disease control. Particularly, LAMP was the most practical method in field application because of its one-step and rapid reaction, simple operation, single-tube utilization, and simple visualization of amplification products. PMID:27721691
Qiao, Tian-Min; Zhang, Jing; Li, Shu-Jiang; Han, Shan; Zhu, Tian-Hui
2016-10-01
Eucalyptus dieback disease, caused by Cylindrocladium scoparium , has occurred in last few years in large Eucalyptus planting areas in China and other countries. Rapid, simple, and reliable diagnostic techniques are desired for the early detection of Eucalyptus dieback of C. scoparium prior to formulation of efficient control plan. For this purpose, three PCR-based methods of nested PCR, multiplex PCR, loop-mediated isothermal amplification (LAMP) were developed for detection of C. scoparium based on factor 1-alpha (tef1) and beta-tubulin gene in this study. All of the three methods showed highly specific to C. scoparium . The sensitivities of the nested PCR and LAMP were much higher than the multiplex PCR. The sensitivity of multiplex PCR was also higher than regular PCR. C. scoparium could be detected within 60 min from infected Eucalyptus plants by LAMP, while at least 2 h was needed by the rest two methods. Using different Eucalyptus tissues as samples for C. scoparium detection, all of the three PCR-based methods showed much better detection results than regular PCR. Base on the results from this study, we concluded that any of the three PCR-based methods could be used as diagnostic technology for the development of efficient strategies of Eucalyptus dieback disease control. Particularly, LAMP was the most practical method in field application because of its one-step and rapid reaction, simple operation, single-tube utilization, and simple visualization of amplification products.
Takabatake, Reona; Masubuchi, Tomoko; Futo, Satoshi; Minegishi, Yasutaka; Noguchi, Akio; Kondo, Kazunari; Teshima, Reiko; Kurashima, Takeyo; Mano, Junichi; Kitta, Kazumi
2016-01-01
A novel real-time PCR-based analytical method was developed for the event-specific quantification of a genetically modified (GM) maize, 3272. We first attempted to obtain genome DNA from this maize using a DNeasy Plant Maxi kit and a DNeasy Plant Mini kit, which have been widely utilized in our previous studies, but DNA extraction yields from 3272 were markedly lower than those from non-GM maize seeds. However, lowering of DNA extraction yields was not observed with GM quicker or Genomic-tip 20/G. We chose GM quicker for evaluation of the quantitative method. We prepared a standard plasmid for 3272 quantification. The conversion factor (Cf), which is required to calculate the amount of a genetically modified organism (GMO), was experimentally determined for two real-time PCR instruments, the Applied Biosystems 7900HT (the ABI 7900) and the Applied Biosystems 7500 (the ABI7500). The determined Cf values were 0.60 and 0.59 for the ABI 7900 and the ABI 7500, respectively. To evaluate the developed method, a blind test was conducted as part of an interlaboratory study. The trueness and precision were evaluated as the bias and reproducibility of the relative standard deviation (RSDr). The determined values were similar to those in our previous validation studies. The limit of quantitation for the method was estimated to be 0.5% or less, and we concluded that the developed method would be suitable and practical for detection and quantification of 3272.
Iida, Takao; Mizuno, Yukie; Kaizaki, Yasuharu
2017-10-27
Mutations in RAS and BRAF are predictors of the efficacy of anti-epidermal growth factor receptor (EGFR) therapy in patients with metastatic colorectal cancer (mCRC). Therefore, simple, rapid, cost-effective methods to detect these mutations in the clinical setting are greatly needed. In the present study, we evaluated BNA Real-time PCR Mutation Detection Kit Extended RAS (BNA Real-time PCR), a real-time PCR method that uses bridged nucleic acid clamping technology to rapidly detect mutations in RAS exons 2-4 and BRAF exon 15. Genomic DNA was extracted from 54 formalin-fixed paraffin-embedded (FFPE) tissue samples obtained from mCRC patients. Among the 54 FFPE samples, BNA Real-time PCR detected 21 RAS mutations (38.9%) and 5 BRAF mutations (9.3%), and the reference assay (KRAS Mutation Detection Kit and MEBGEN™ RASKET KIT) detected 22 RAS mutations (40.7%). The concordance rate of detected RAS mutations between the BNA Real-time PCR assay and the reference assays was 98.2% (53/54). The BNA Real-time PCR assay proved to be a more simple, rapid, and cost-effective method for detecting KRAS and RAS mutations compared with existing assays. These findings suggest that BNA Real-time PCR is a valuable tool for predicting the efficacy of early anti-EGFR therapy in mCRC patients. Copyright © 2017 Elsevier B.V. All rights reserved.
Devonshire, Alison S; O'Sullivan, Denise M; Honeyborne, Isobella; Jones, Gerwyn; Karczmarczyk, Maria; Pavšič, Jernej; Gutteridge, Alice; Milavec, Mojca; Mendoza, Pablo; Schimmel, Heinz; Van Heuverswyn, Fran; Gorton, Rebecca; Cirillo, Daniela Maria; Borroni, Emanuele; Harris, Kathryn; Barnard, Marinus; Heydenrych, Anthenette; Ndusilo, Norah; Wallis, Carole L; Pillay, Keshree; Barry, Thomas; Reddington, Kate; Richter, Elvira; Mozioğlu, Erkan; Akyürek, Sema; Yalçınkaya, Burhanettin; Akgoz, Muslum; Žel, Jana; Foy, Carole A; McHugh, Timothy D; Huggett, Jim F
2016-08-03
Real-time PCR (qPCR) based methods, such as the Xpert MTB/RIF, are increasingly being used to diagnose tuberculosis (TB). While qualitative methods are adequate for diagnosis, the therapeutic monitoring of TB patients requires quantitative methods currently performed using smear microscopy. The potential use of quantitative molecular measurements for therapeutic monitoring has been investigated but findings have been variable and inconclusive. The lack of an adequate reference method and reference materials is a barrier to understanding the source of such disagreement. Digital PCR (dPCR) offers the potential for an accurate method for quantification of specific DNA sequences in reference materials which can be used to evaluate quantitative molecular methods for TB treatment monitoring. To assess a novel approach for the development of quality assurance materials we used dPCR to quantify specific DNA sequences in a range of prototype reference materials and evaluated accuracy between different laboratories and instruments. The materials were then also used to evaluate the quantitative performance of qPCR and Xpert MTB/RIF in eight clinical testing laboratories. dPCR was found to provide results in good agreement with the other methods tested and to be highly reproducible between laboratories without calibration even when using different instruments. When the reference materials were analysed with qPCR and Xpert MTB/RIF by clinical laboratories, all laboratories were able to correctly rank the reference materials according to concentration, however there was a marked difference in the measured magnitude. TB is a disease where the quantification of the pathogen could lead to better patient management and qPCR methods offer the potential to rapidly perform such analysis. However, our findings suggest that when precisely characterised materials are used to evaluate qPCR methods, the measurement result variation is too high to determine whether molecular quantification
Surveillance of Campylobacter ssp. in broiler flocks by PCR on boot sock samples
DEFF Research Database (Denmark)
Nordentoft, Steen; Lund, Marianne; Hald, Birthe
on sampling with one pair of boot sock was established. Samples were collected by the farmer app. 10 days before slaughter and send to laboratory for analysis. To detect Campylobacter ssp. in these fecal samples, a PCR based method was established and validated. The assay was developed as a genus specific...
Diagnosis of Giardia infections by PCR-based methods in children of an endemic area
Directory of Open Access Journals (Sweden)
EB David
2011-01-01
Full Text Available The present study was designed to estimate the prevalence of Giardia infection in preschool- and school-aged children living in an endemic area. Fecal samples from 573 children were processed by zinc sulfate centrifugal flotation, centrifugal sedimentation (using a commercial device for fecal concentration - TF-Test kit® and polymerase chain reaction (PCR-based methods. Of the stool samples assessed, 277 (48.3% were positive for intestinal parasites and/or commensal protozoa. Centrifugal flotation presented the highest diagnostic sensitivity for Giardia infections. The kappa index revealed that both coproparasitological techniques closely agreed on the Giardia diagnosis (86% versus satisfactory (72% and poor (35% concordances for commensal protozoan and helminth infections, respectively. Concerning Giardia molecular diagnosis, from the 71 microscopy-positive samples, specific amplification of gdh and tpi fragments was noted in 68 (95.7% and 64 (90% samples, respectively. Amplification of gdh and tpi genes was observed, respectively, in 95.7% and 90% of microscopy-positive Giardia samples. For 144 microscopy-negative samples, gdh and tpi gene amplification products were obtained from 8.3% and 35.9% samples, respectively. The agreement between these genes was about 40%. The centrifuge-flotation based method was the most suitable means of Giardia diagnosis assessed in the present study by combining accuracy and low cost.
Teng, Xiaolu; Zhang, Zan; He, Guiling; Yang, Liwen; Li, Fei
2012-01-01
Quantitative real-time polymerase chain reaction (qPCR) is an efficient and widely used technique to monitor gene expression. Housekeeping genes (HKGs) are often empirically selected as the reference genes for data normalization. However, the suitability of HKGs used as the reference genes has been seldom validated. Here, six HKGs were chosen (actin A3, actin A1, GAPDH, G3PDH, E2F, rp49) in four lepidopteran insects Bombyx mori L. (Lepidoptera: Bombycidae), Plutella xylostella L. (Plutellidae), Chilo suppressalis Walker (Crambidae), and Spodoptera exigua Hübner (Noctuidae) to study their expression stability. The algorithms of geNorm, NormFinder, stability index, and ΔCt analysis were used to evaluate these HKGs. Across different developmental stages, actin A1 was the most stable in P. xylostella and C. suppressalis, but it was the least stable in B. mori and S. exigua. Rp49 and GAPDH were the most stable in B. mori and S. exigua, respectively. In different tissues, GAPDH, E2F, and Rp49 were the most stable in B. mori, S. exigua, and C. suppressalis, respectively. The relative abundances of Siwi genes estimated by 2(-ΔΔCt) method were tested with different HKGs as the reference gene, proving the importance of internal controls in qPCR data analysis. The results not only presented a list of suitable reference genes in four lepidopteran insects, but also proved that the expression stabilities of HKGs were different among evolutionarily close species. There was no single universal reference gene that could be used in all situations. It is indispensable to validate the expression of HKGs before using them as the internal control in qPCR.
2014-01-01
Background Yersiniosis is a zoonotic disease reported worldwide. Culture and PCR based protocols are the most common used methods for detection of pathogenic Yersinia species in animal samples. PCR sensitivity could be increased by an initial enrichment step. This step is particularly useful in surveillance programs, where PCR is applied to samples from asymptomatic animals. The aim of this study was to evaluate the improvement in pathogenic Yersinia species detection using a suitable enrichment method prior to the real time PCR (rtPCR). Nine different enrichment protocols were evaluated including six different broth mediums (CASO, ITC, PSB, PBS, PBSMSB and PBSSSB). Results The analysis of variance showed significant differences in Yersinia detection by rtPCR according to the enrichment protocol used. These differences were higher for Y. pseudotuberculosis than for Y. enterocolitica. In general, samples incubated at lower temperatures yielded the highest detection rates. The best results were obtained with PBSMSB and PBS2. Application of PBSMSB protocol to free-ranging wild board samples improved the detection of Y. enterocolitica by 21.2% when compared with direct rtPCR. Y. pseudotuberculosis detection was improved by 10.6% when results obtained by direct rtPCR and by PBSMSB enrichment before rtPCR were analyzed in combination. Conclusions The data obtained in the present study indicate a difference in Yersinia detection by rtPCR related to the enrichment protocol used, being PBSMSB enrichment during 15 days at 4°C and PBS during 7 days at 4°C the most efficient. The use of direct rtPCR in combination with PBSMSB enrichment prior to rtPCR resulted in an improvement in the detection rates of pathogenic Yersinia in wild boar and could be useful for application in other animal samples. PMID:25168886
Optimization of a 12-hour TaqMan PCR-based method for detection of Salmonella bacteria in meat
DEFF Research Database (Denmark)
Josefsen, Mathilde Hartmann; Krause, Michael; Hansen, F.
2007-01-01
no positive effects and resulted in decreased reproducibility. Increasing the amount of PCR template DNA from 5 to 20 mu l improved the threshold cycle value by approximately 2. The improved 12-h PCR method was successfully compared to a reference culture method with 100 minced meat and poultry samples...... the highest number of salmonellae. When analyzing minced meat samples, positive effects of increasing the initial sampling volume from 1 to 5 ml and increasing the amount of paramagnetic particles to 90 mu l were observed. However, washing the pellet and eluting the DNA in reduced volumes (25 and 50 mu l) had...
PCR-based detection of gene transfer vectors: application to gene doping surveillance.
Perez, Irene C; Le Guiner, Caroline; Ni, Weiyi; Lyles, Jennifer; Moullier, Philippe; Snyder, Richard O
2013-12-01
Athletes who illicitly use drugs to enhance their athletic performance are at risk of being banned from sports competitions. Consequently, some athletes may seek new doping methods that they expect to be capable of circumventing detection. With advances in gene transfer vector design and therapeutic gene transfer, and demonstrations of safety and therapeutic benefit in humans, there is an increased probability of the pursuit of gene doping by athletes. In anticipation of the potential for gene doping, assays have been established to directly detect complementary DNA of genes that are top candidates for use in doping, as well as vector control elements. The development of molecular assays that are capable of exposing gene doping in sports can serve as a deterrent and may also identify athletes who have illicitly used gene transfer for performance enhancement. PCR-based methods to detect foreign DNA with high reliability, sensitivity, and specificity include TaqMan real-time PCR, nested PCR, and internal threshold control PCR.
Post; White; Aul; Zavoral; Wadowsky; Zhang; Preston; Ehrlich
1996-06-01
Background: Conventional simplex polymerase chain reaction (PCR)-based assays are limited in that they only provide for the detection of a single infectious agent. Many clinical diseases, however, present in a nonspecific, or syndromic, fashion, thereby necessitating the simultaneous assessment of multiple pathogens. Panel-based molecular diagnostic testing can be accomplished by the development of multiplex PCR-based assays, which can detect, individually or severally, different pathogens that are associated with syndromic illness. As part of a larger program of panel development, an assay that can simultaneously detect Haemophilus influenzae, Streptococcus pneumoniae, and Moraxella catarrhalis was developed. These organisms were chosen as they are the most common bacterial pathogens associated with both the acute and chronic forms of otitis media; they are also responsible for a high percentage of sinus infections in both children and adults. In addition, H. influenzae and S. pneumoniae are commonly associated with septic meningitits. Methods and Results: Multiple individual PCR-based assays were developed for each of the three target organisms which were then evaluated for sensitivity and specificity. Utilizing the simplex assays that met our designated performance criteria, a matrix style approach was used to develop a duplex H. influenzae-S. pneumoniae assay. The duplex assay was then used as a single component in the development of a triplex assay, wherein the various M. catarrhalis primer-probe sets were tested for compatibility with the existing assay. A single-step PCR protocol, with species-specific primers for each of the three target organisms and a liquid hybridization-gel retardation amplimer detection system, was developed, which amplifies and then discriminates among each of the amplification products according to size. This assay is able to detect all three organisms in a specific manner, either individually or severally. Dilutional experiments
A Component-Based Modeling and Validation Method for PLC Systems
Directory of Open Access Journals (Sweden)
Rui Wang
2014-05-01
Full Text Available Programmable logic controllers (PLCs are complex embedded systems that are widely used in industry. This paper presents a component-based modeling and validation method for PLC systems using the behavior-interaction-priority (BIP framework. We designed a general system architecture and a component library for a type of device control system. The control software and hardware of the environment were all modeled as BIP components. System requirements were formalized as monitors. Simulation was carried out to validate the system model. A realistic example from industry of the gates control system was employed to illustrate our strategies. We found a couple of design errors during the simulation, which helped us to improve the dependability of the original systems. The results of experiment demonstrated the effectiveness of our approach.
A PCR procedure for the detection of Giardia intestinalis cysts and Escherichia coli in lettuce.
Ramirez-Martinez, M L; Olmos-Ortiz, L M; Barajas-Mendiola, M A; Giono Cerezo, S; Avila, E E; Cuellar-Mata, P
2015-06-01
Giardia intestinalis is a pathogen associated with foodborne outbreaks and Escherichia coli is commonly used as a marker of faecal contamination. Implementation of routine identification methods of G. intestinalis is difficult for the analysis of vegetables and the microbiological detection of E. coli requires several days. This study proposes a PCR-based assay for the detection of E. coli and G. intestinalis cysts using crude DNA isolated from artificially contaminated lettuce. The G. intestinalis and E. coli PCR assays targeted the β-giardin and uidA genes, respectively, and were 100% specific. Forty lettuces from local markets were analysed by both PCR and light microscopy and no cysts were detected, the calculated detection limit was 20 cysts per gram of lettuce; however, by PCR, E. coli was detected in eight of ten randomly selected samples of lettuce. These data highlight the need to validate procedures for routine quality assurance. These PCR-based assays can be employed as alternative methods for the detection of G. intestinalis and E. coli and have the potential to allow for the automation and simultaneous detection of protozoa and bacterial pathogens in multiple samples. Significance and impact of the study: There are few studies for Giardia intestinalis detection in food because methods for its identification are difficult for routine implementation. Here, we developed a PCR-based method as an alternative to the direct observation of cysts in lettuce by light microscopy. Additionally, Escherichia coli was detected by PCR and the sanitary quality of lettuce was evaluated using molecular and standard microbiological methods. Using PCR, the detection probability of Giardia cysts inoculated onto samples of lettuce was improved compared to light microscopy, with the advantage of easy automation. These methods may be employed to perform timely and affordable detection of foodborne pathogens. © 2015 The Society for Applied Microbiology.
Directory of Open Access Journals (Sweden)
Elhamnia, F.
2010-07-01
Full Text Available Mycoplasma synoviae (MS is an important avian pathogen that can cause both respiratory disease and joint inflammation synovitis in poultry, inducing economic losses to the Iranian chicken industry especially breeder farms. The aim of this study was to use the MS specific PCR and culture methods in order to detect of M. synoviae from breeder farms where located in Tehran province. A total of 475 samples including choanal cleft, trachea, ovary and /or joint cavities from 23 broiler breeder farms of Tehran area were collected. Samples were cultured in PPLO broth media supplemented for MS isolation. The bacteria DNAs were extracted by phenol/chloroform method. Specific published primers amplify a 207 bp region of the 16S rRNA gene of MS were used for PCR method. Out of 475 samples, 146 cultures were shown positive and typical Mycoplasma colonies, 85 samples were also identified MS based on agglutination test with specific MS antiserum and the PCR method. A total of 122 samples, a band with 207 bp was shown as MS specific PCR product in electrophoresis. In addition to these 85 samples that were positives in both culture and PCR, 37 samples that had not grown in Mycoplasma media were positive in MS specific PCR. A total of 292 samples were negatives in both culture and PCR methods. 122 positive samples out of 475 samples (25.7% were belonged to 7 breeder farms (30.4%. On conclusions, the MS infection of broiler breeder farms of Tehran area was confirmed truly. From the results, as the PCR method reduces the time consuming, an effectiveness and efficient for detection of M. synoviae infection of chicken breeder. It is then suggested that the PCR method could be an alternative method for culturing.
Validation of RNAi by real time PCR
DEFF Research Database (Denmark)
Josefsen, Knud; Lee, Ying Chiu
2011-01-01
Real time PCR is the analytic tool of choice for quantification of gene expression, while RNAi is concerned with downregulation of gene expression. Together, they constitute a powerful approach in any loss of function studies of selective genes. We illustrate here the use of real time PCR to verify...
Isaksson, Mats; Hagström, Åsa; Armua-Fernandez, Maria Teresa; Wahlström, Helene; Ågren, Erik Olof; Miller, Andrea; Holmberg, Anders; Lukacs, Morten; Casulli, Adriano; Deplazes, Peter; Juremalm, Mikael
2014-12-19
Following the first finding of Echinococcus multilocularis in Sweden in 2011, 2985 red foxes (Vulpes vulpes) were analysed by the segmental sedimentation and counting technique. This is a labour intensive method and requires handling of the whole carcass of the fox, resulting in a costly analysis. In an effort to reduce the cost of labour and sample handling, an alternative method has been developed. The method is sensitive and partially automated for detection of E. multilocularis in faecal samples. The method has been used in the Swedish E. multilocularis monitoring program for 2012-2013 on more than 2000 faecal samples. We describe a new semi-automated magnetic capture probe DNA extraction method and real time hydrolysis probe polymerase chain reaction assay (MC-PCR) for the detection of E. multilocularis DNA in faecal samples from red fox. The diagnostic sensitivity was determined by validating the new method against the sedimentation and counting technique in fox samples collected in Switzerland where E. multilocularis is highly endemic. Of 177 foxes analysed by the sedimentation and counting technique, E. multilocularis was detected in 93 animals. Eighty-two (88%, 95% C.I 79.8-93.9) of these were positive in the MC-PCR. In foxes with more than 100 worms, the MC-PCR was positive in 44 out of 46 (95.7%) cases. The two MC-PCR negative samples originated from foxes with only immature E. multilocularis worms. In foxes with 100 worms or less, (n = 47), 38 (80.9%) were positive in the MC-PCR. The diagnostic specificity of the MC-PCR was evaluated using fox scats collected within the Swedish screening. Of 2158 samples analysed, two were positive. This implies that the specificity is at least 99.9% (C.I. = 99.7-100). The MC-PCR proved to have a high sensitivity and a very high specificity. The test is partially automated but also possible to perform manually if desired. The test is well suited for nationwide E. multilocularis surveillance programs where sampling
Herrero, Beatriz; Lago, Fátima C; Vieites, Juan M; Espiñeira, Montserrat
2012-01-01
Judged by quality and taste, the European sole (Solea solea) is considered one of the finest flatfish and is, thus, of considerable commercial value. In the present work, a specific fast real-time PCR was developed for the authentication of S. solea, i.e. to distinguish it from other related species and avoid substitution of this species, either deliberately or unintentionally. The method is based on a species-specific set of primers and MGB Taqman probe which amplifies a 116-bp fragment of the internal transcribed spacer 1 (ITS 1) ribosomal DNA region. This assay combines the high specificity and sensitivity of real-time PCR with the rapidity of the fast mode, allowing the detection of S. solea in a short period of time. The present methodology was validated for application to all types of manufactured products for the presence of S. solea, with successful results. Subsequently, the method was applied to 40 commercial samples to determine whether correct labeling had been employed in the market. It was demonstrated that the assay is a useful tool in monitoring and verifying food labeling regulations.
Same-day PCR testing of Salmonella in meat: from research to routine application at slaughterhouses
DEFF Research Database (Denmark)
Hoorfar, Jeffrey; Löfström, Charlotta; Josefsen, Mathilde Hartmann
2011-01-01
Development of a rapid PCR technique is described, which enables slaughterhouses to apply same-day testing for Salmonella in carcasses and fresh meat. The technique is based on a shortened pre-enrichment time and 1-h DNA purification using paramagnetic beads (or an easy-to-use boiling method) fol......) followed by Salmonella detection by real-time PCR. Final protocols have been approved for meat testing (fresh meat and carcass swabs) by the Nordval validation organization for Nordic countries....
Phage-Mediated Immuno-PCR for Ultrasensitive Detection of Cry1Ac Protein Based on Nanobody.
Liu, Yuanyuan; Jiang, Dongjian; Lu, Xin; Wang, Wei; Xu, Yang; He, Qinghua
2016-10-11
The widespread use of Cry proteins in transgenic plants for insect control has raised concerns about the environment and food safety in the public. An effective detection method for introduced Cry proteins is of significance for environmental risk assessment and product quality control. This paper describes a novel phage mediated immuno-PCR (iPCR) for the ultrasensitive determination of Cry proteins based on nanobodies. Three nanobodies against Cry1Ac protein were obtained from a naı̈ve phage displayed nanobody library without animal immunization process and were applied to the iPCR assay for Cry1Ac. The phage-mediated iPCR for Cry1Ac based on nanobodies showed a dynamic range of 0.001-100 ng/mL and a limit detection of 0.1 pg/mL. Specific measurement of this established method was performed by testing cross-reativity of other Cry1Ac analogues, and the result showed negligible cross-reactivity with other test Cry proteins (Cry1Ab, Cry1F, Cry3B). Furthermore, the phage-mediated iPCR based on nanobody should be easily applicable to the detection of many other Cry proteins.
The PCR-Based Diagnosis of Central Nervous System Tuberculosis: Up to Date
Directory of Open Access Journals (Sweden)
Teruyuki Takahashi
2012-01-01
Full Text Available Central nervous system (CNS tuberculosis, particularly tuberculous meningitis (TBM, is the severest form of Mycobacterium tuberculosis (M.Tb infection, causing death or severe neurological defects in more than half of those affected, in spite of recent advancements in available anti-tuberculosis treatment. The definitive diagnosis of CNS tuberculosis depends upon the detection of M.Tb bacilli in the cerebrospinal fluid (CSF. At present, the diagnosis of CNS tuberculosis remains a complex issue because the most widely used conventional “gold standard” based on bacteriological detection methods, such as direct smear and culture identification, cannot rapidly detect M.Tb in CSF specimens with sufficient sensitivity in the acute phase of TBM. Recently, instead of the conventional “gold standard”, the various molecular-based methods including nucleic acid amplification (NAA assay technique, particularly polymerase chain reaction (PCR assay, has emerged as a promising new method for the diagnosis of CNS tuberculosis because of its rapidity, sensitivity and specificity. In addition, the innovation of nested PCR assay technique is worthy of note given its contribution to improve the diagnosis of CNS tuberculosis. In this review, an overview of recent progress of the NAA methods, mainly highlighting the PCR assay technique, was presented.
Directory of Open Access Journals (Sweden)
Maryam AlTamimi
2017-01-01
Full Text Available Dissemination of carbapenem resistance via Enterobacteriaceae, particularly among Klebsiella pneumoniae and Escherichia coli, is a major public health concern. Rapid methods for determining antimicrobial susceptibility are important to ensure adequate and appropriate use of antimicrobial agents and to limit the spread of these bacteria. In the current study, we compared the rapidity, sensitivity and specificity of traditional methods and molecular-based Xpert Carba-R PCR assay to identify sixty isolates, (26 E. coli and 34 K. pneumoniae. The specificity of MicroScan was 100% while sensitivity to ertapenem (ERT, imipenem (IMI, and meropenem (MER was 93%, 68.9%, and 55.17%, respectively. For the modified Hodge test, the specificity was 96.77% and sensitivity was 89.65%. Although some results of phenotypic assays matched with the definite PCR identification, some results were misleading. Out of the 29 positive PCR samples, three samples of K. pneumoniae were negative for the MHT and one E. coli sample was MHT positive but negative for the PCR. Nine samples were positive for the PCR but were determined as carbapenem sensitive by MicroScan. While MicroScan and MHT requires several hours and multi-steps to obtain results, Xpert Carba-R PCR assay takes less than an hour. Therefore, we recommend using Gene xpert Carba-R assay for the optimal carbapenemnase detection with reducing material, manpower and cost. Also it is important to know the type of carbapenemase is present.
New miRNA labeling method for bead-based quantification
Directory of Open Access Journals (Sweden)
Lanfranchi Gerolamo
2010-06-01
Full Text Available Abstract Background microRNAs (miRNAs are small single-stranded non-coding RNAs that act as crucial regulators of gene expression. Different methods have been developed for miRNA expression profiling in order to better understand gene regulation in normal and pathological conditions. miRNAs expression values obtained from large scale methodologies such as microarrays still need a validation step with alternative technologies. Results Here we have applied with an innovative approach, the Luminex® xMAP™ technology validate expression data of differentially expressed miRNAs obtained from high throughput arrays. We have developed a novel labeling system of small RNA molecules (below 200 nt, optimizing the sensitive cloning method for miRNAs, termed miRNA amplification profiling (mRAP. The Luminex expression patterns of three miRNAs (miR-23a, miR-27a and miR-199a in seven different cell lines have been validated by TaqMan miRNA assay. In all cases, bead-based meas were confirmed by the data obtained by TaqMan and microarray technologies. Conclusions We demonstrate that the measure of individual miRNA by the bead-based method is feasible, high speed, sensitive and low cost. The Luminex® xMAP™ technology also provides flexibility, since the central reaction can be scaled up with additional miRNA capturing beads, allowing validation of many differentially expressed miRNAs obtained from microarrays in a single experiment. We propose this technology as an alternative method to qRT-PCR for validating miRNAs expression data obtained with high-throughput technologies.
PCR Based Microbial Monitor for Analysis of Recycled Water Aboard the ISSA: Issues and Prospects
Cassell, Gail H.; Lefkowitz, Elliot J.; Glass, John I.
1995-01-01
The monitoring of spacecraft life support systems for the presence of health threatening microorganisms is paramount for crew well being and successful completion of missions. Development of technology to monitor spacecraft recycled water based on detection and identification of the genetic material of contaminating microorganisms and viruses would be a substantial improvement over current NASA plans to monitor recycled water samples that call for the use of conventional microbiology techniques which are slow, insensitive, and labor intensive. The union of the molecular biology techniques of DNA probe hybridization and polymerase chain reaction (PCR) offers a powerful method for the detection, identification, and quantification of microorganisms and viruses. This technology is theoretically capable of assaying samples in as little as two hours with specificity and sensitivity unmatched by any other method. A major advance in probe-hybridization/PCR has come about in a technology called TaqMan(TM), which was invented by Perkin Elmer. Instrumentation using TaqMan concepts is evolving towards devices that could meet NASA's needs of size, low power use, and simplicity of operation. The chemistry and molecular biology needed to utilize these probe-hybridization/PCR instruments must evolve in parallel with the hardware. The following issues of chemistry and biology must be addressed in developing a monitor: Early in the development of a PCR-based microbial monitor it will be necessary to decide how many and which organisms does the system need the capacity to detect. We propose a set of 17 different tests that would detect groups of bacteria and fungus, as well as specific eukaryotic parasites and viruses; In order to use the great sensitivity of PCR it will be necessary to concentrate water samples using filtration. If a lower limit of detection of 1 microorganism per 100 ml is required then the microbes in a 100 ml sample must be concentrated into a volume that can be
Detection of 22 common leukemic fusion genes using a single-step multiplex qRT-PCR-based assay.
Lyu, Xiaodong; Wang, Xianwei; Zhang, Lina; Chen, Zhenzhu; Zhao, Yu; Hu, Jieying; Fan, Ruihua; Song, Yongping
2017-07-25
Fusion genes generated from chromosomal translocation play an important role in hematological malignancies. Detection of fusion genes currently employ use of either conventional RT-PCR methods or fluorescent in situ hybridization (FISH), where both methods involve tedious methodologies and require prior characterization of chromosomal translocation events as determined by cytogenetic analysis. In this study, we describe a real-time quantitative reverse transcription PCR (qRT-PCR)-based multi-fusion gene screening method with the capacity to detect 22 fusion genes commonly found in leukemia. This method does not require pre-characterization of gene translocation events, thereby facilitating immediate diagnosis and therapeutic management. We performed fluorescent qRT-PCR (F-qRT-PCR) using a commercially-available multi-fusion gene detection kit on a patient cohort of 345 individuals comprising 108 cases diagnosed with acute myeloid leukemia (AML) for initial evaluation; remaining patients within the cohort were assayed for confirmatory diagnosis. Results obtained by F-qRT-PCR were compared alongside patient analysis by cytogenetic characterization. Gene translocations detected by F-qRT-PCR in AML cases were diagnosed in 69.4% of the patient cohort, which was comparatively similar to 68.5% as diagnosed by cytogenetic analysis, thereby demonstrating 99.1% concordance. Overall gene fusion was detected in 53.7% of the overall patient population by F-qRT-PCR, 52.9% by cytogenetic prediction in leukemia, and 9.1% in non-leukemia patients by both methods. The overall concordance rate was calculated to be 99.0%. Fusion genes were detected by F-qRT-PCR in 97.3% of patients with CML, followed by 69.4% with AML, 33.3% with acute lymphoblastic leukemia (ALL), 9.1% with myelodysplastic syndromes (MDS), and 0% with chronic lymphocytic leukemia (CLL). We describe the use of a F-qRT-PCR-based multi-fusion gene screening method as an efficient one-step diagnostic procedure as an
Directory of Open Access Journals (Sweden)
Alam A
2002-01-01
Full Text Available Gonococcal infection remains still a major cause of morbidity among sexually active individuals. Diagnosis of the infection in a female case is more difficult than that in a male. This was a prospective study among 269 female commercial sex workers (CSWs to screen them for gonococcal infection, comparing the rapid method of identification of gonococci by polymerase chain reaction (PCR with the selective culture method. A total of 92 (34.2% CSWs were identified positive for Neisseria gonorrhoeae by combination of the two methods. The PCR method identified 87 of the specimens to harbour cppB gene of N. gonorrhoeae, whereas culture method identified 83 specimens showing colonies of gonococci. Taking into consideration of the total positive cases (92, the PCR method showed a sensitivity of 94.57%, whereas sensitivity of culture method was 90.22%. The selective culture method appears to be the most applicable in the identification of gonococci from clinical specimens, particularly in the less resourceful countries like Bangladesh.
Directory of Open Access Journals (Sweden)
Iveta Svobodová
Full Text Available Detection and characterization of circulating cell-free fetal DNA (cffDNA from maternal circulation requires an extremely sensitive and precise method due to very low cffDNA concentration. In our study, droplet digital PCR (ddPCR was implemented for fetal RHD genotyping from maternal plasma to compare this new quantification alternative with real-time PCR (qPCR as a golden standard for quantitative analysis of cffDNA. In the first stage of study, a DNA quantification standard was used. Clinical samples, including 10 non-pregnant and 35 pregnant women, were analyzed as a next step. Both methods' performance parameters-standard curve linearity, detection limit and measurement precision-were evaluated. ddPCR in comparison with qPCR has demonstrated sufficient sensitivity for analysing of cffDNA and determination of fetal RhD status from maternal circulation, results of both methods strongly correlated. Despite the more demanding workflow, ddPCR was found to be slightly more precise technology, as evaluated using quantitative standard. Regarding the clinical samples, the precision of both methods equalized with decreasing concentrations of tested DNA samples. In case of cffDNA with very low concentrations, variance parameters of both techniques were comparable. Detected levels of fetal cfDNA in maternal plasma were slightly higher than expected and correlated significantly with gestational age as measured by both methods (ddPCR r = 0.459; qPCR r = 0.438.
Sensitive detection of novel Indian isolate of BTV 21 using ns1 gene based real-time PCR assay
Directory of Open Access Journals (Sweden)
Gaya Prasad
2013-06-01
Full Text Available Aim: The study was conducted to develop ns1 gene based sensitive real-time RT-PCR assay for diagnosis of India isolates of bluetongue virus (BTV. Materials and Methods: The BTV serotype 21 isolate (KMNO7 was isolated from Andhra Pradesh and propagated in BHK-21 cell line in our laboratory. The Nucleic acid (dsRNA of virus was extracted using Trizol method and cDNA was prepared using a standard protocol. The cDNA was allowed to ns1 gene based group specific PCR to confirm the isolate as BTV. The viral RNA was diluted 10 folds and the detection limit of ns1 gene based RT-PCR was determined. Finally the tenfold diluted viral RNA was subjected to real-time RT-PCR using ns1 gene primer and Taq man probe to standardized the reaction and determine the detection limit. Results: The ns1 gene based group specific PCR showed a single 366bp amplicon in agarose gel electrophoresis confirmed the sample as BTV. The ns1 gene RT-PCR using tenfold diluted viral RNA showed the detection limit of 70.0 fg in 1%agarose gel electrophoresis. The ns1 gene based real time RT-PCR was successfully standardized and the detection limit was found to be 7.0 fg. Conclusion: The ns1 gene based real-time RT-PCR was successfully standardized and it was found to be 10 times more sensitive than conventional RT-PCR. Key words: bluetongue, BTV21, RT-PCR, Real time RT-PCR, ns1 gene [Vet World 2013; 6(8.000: 554-557
Validation of the DNATyper™15 PCR Genotyping System for Forensic Application
Jian Ye; Chengtao Jiang; Xingchun Zhao; Le Wang; Caixia Li; Anquan Ji; Li Yuan; Jing Sun; Shuaifeng Chen
2015-01-01
We describe the optimization and validation of the DNATyper™15 multiplex polymerase chain reaction (PCR) genotyping system for autosomal short tandem repeat (STR) amplification at 14 autosomal loci (D6S1043, D21S11, D7S820, CSF1PO, D2S1338, D3S1358, D13S317, D8S1179, D16S539, Penta E, D5S818, vWA, D18S51, and FGA) and amelogenin, a sex-determining locus. Several DNATyper™15 assay variables were optimized, including hot start Taq polymerase concentration, Taq polymerase activation time, magne...
Utility of PCR, Culture, and Antigen Detection Methods for Diagnosis of Legionellosis.
Chen, Derrick J; Procop, Gary W; Vogel, Sherilynn; Yen-Lieberman, Belinda; Richter, Sandra S
2015-11-01
The goal of this retrospective study was to evaluate the performance of different diagnostic tests for Legionnaires' disease in a clinical setting where Legionella pneumophila PCR had been introduced. Electronic medical records at the Cleveland Clinic were searched for Legionella urinary antigen (UAG), culture, and PCR tests ordered from March 2010 through December 2013. For cases where two or more test methods were performed and at least one was positive, the medical record was reviewed for relevant clinical and epidemiologic factors. Excluding repeat testing on a given patient, 19,912 tests were ordered (12,569 UAG, 3,747 cultures, and 3,596 PCR) with 378 positive results. The positivity rate for each method was 0.4% for culture, 0.8% for PCR, and 2.7% for UAG. For 37 patients, at least two test methods were performed with at least one positive result: 10 (27%) cases were positive by all three methods, 16 (43%) were positive by two methods, and 11 (30%) were positive by one method only. For the 32 patients with medical records available, clinical presentation was consistent with proven or probable Legionella infection in 84% of the cases. For those cases, the sensitivities of culture, PCR, and UAG were 50%, 92%, and 96%, respectively. The specificities were 100% for culture and 99.9% for PCR and UAG. Copyright © 2015, American Society for Microbiology. All Rights Reserved.
Study the Three Extraction Methods for HBV DNA to Use in PCR
Directory of Open Access Journals (Sweden)
N. Sheikh
2004-07-01
Full Text Available Diagnosis of Hepatitis B is important because of the its high prevalence. Recently PCR method , has found greater interest among different diagnostic methods. Several reports emphasis on some false negative results in those laboratories using PCR. The aim of this study was to compare three different procedures for HBV DNA extraction. A total 30 serum samples received from Shariati hospital. Sera was taken from patients having chronic Hepatitis with HBs antigen positive and HBe antigen negative. The sensitivity of guanidium hydrochloride method for extracting the HBV DNA from serum were evaluated and compared with phenol–chloroform and boiling methods. Diagnostic PCR kit was obtained from Cynagene contained taq polymerase, reaction mixture, dNTP, and buffer for reaction. A 353 bp product were amplified by amplification program provided in used PCR protocol. The comparison of results indicated that procedure was successful for amplification of the designed products from Hepatitis B in sera. Number of positive results were 16,19,23 and number of negative result were 14,11,7 for the boiling, phenol-chloroform and guanidium-hydrochloride extraction methods respectively.PCR method is the fastest diagnosis method and the most accurate procedure to identify Hepatitis B. Guanidium hydrochloride method was the most successful procedure studied in this survey for viruses.
Directory of Open Access Journals (Sweden)
Huiling Qiu
Full Text Available DNA vector-encoded Tough Decoy (TuD miRNA inhibitor is attracting increased attention due to its high efficiency in miRNA suppression. The current methods used to construct TuD vectors are based on synthesizing long oligonucleotides (~90 mer, which have been costly and problematic because of mutations during synthesis. In this study, we report a PCR-based method for the generation of double Tough Decoy (dTuD vector in which only two sets of shorter oligonucleotides (< 60 mer were used. Different approaches were employed to test the inhibitory potency of dTuDs. We demonstrated that dTuD is the most efficient method in miRNA inhibition in vitro and in vivo. Using this method, a mini dTuD library against 88 human miRNAs was constructed and used for a high-throughput screening (HTS of AP-1 pathway-related miRNAs. Seven miRNAs (miR-18b-5p, -101-3p, -148b-3p, -130b-3p, -186-3p, -187-3p and -1324 were identified as candidates involved in AP-1 pathway regulation. This novel method allows for an accurate and cost-effective generation of dTuD miRNA inhibitor, providing a powerful tool for efficient miRNA suppression in vitro and in vivo.
Nested PCR and RFLP analysis based on the 16S rRNA gene
Current phytoplasma detection and identification method is primarily based on nested PCR followed by restriction fragment length polymorphism analysis and gel electrophoresis. This method can potentially detect and differentiate all phytoplasmas including those previously not described. The present ...
Tsukahara, Keita; Takabatake, Reona; Masubuchi, Tomoko; Futo, Satoshi; Minegishi, Yasutaka; Noguchi, Akio; Kondo, Kazunari; Nishimaki-Mogami, Tomoko; Kurashima, Takeyo; Mano, Junichi; Kitta, Kazumi
2016-01-01
A real-time PCR-based analytical method was developed for the event-specific quantification of a genetically modified (GM) soybean event, MON87701. First, a standard plasmid for MON87701 quantification was constructed. The conversion factor (C f ) required to calculate the amount of genetically modified organism (GMO) was experimentally determined for a real-time PCR instrument. The determined C f for the real-time PCR instrument was 1.24. For the evaluation of the developed method, a blind test was carried out in an inter-laboratory trial. The trueness and precision were evaluated as the bias and reproducibility of relative standard deviation (RSDr), respectively. The determined biases and the RSDr values were less than 30 and 13%, respectively, at all evaluated concentrations. The limit of quantitation of the method was 0.5%, and the developed method would thus be applicable for practical analyses for the detection and quantification of MON87701.
Gattuso, Antonietta; Gianfranceschi, Monica Virginia; Sonnessa, Michele; Delibato, Elisabetta; Marchesan, Massimo; Hernandez, Marta; De Medici, Dario; Rodriguez-Lazaro, David
2014-08-01
The aim of this study was to optimize a Real-Time PCR protocol for a rapid detection of Listeria monocytogenes in pork meat, using reduced volumes of primary selective enrichment broth and times of incubation to decrease the cost and time for analysis. Forty-five samples of pork meat were artificially contaminated with two different levels of L. monocytogenes (1-10 CFU per sample and 10-100 CFU per sample), homogenized in three different volumes of Half Fraser Broth (1:3; 1:5 and 1:10) and incubated at 30°C ± 1°C for 5h, 8h and 24h. The detection was conducted in parallel by Real-Time PCR and the ISO standard 11290-1 methods. L. monocytogenes was detected in all the samples after 24h by Real-Time PCR method, also using reduced volumes of Half Fraser Broth. This represents a clear advantage as the time to final detection and the inherent costs were significantly reduced compared to the ISO reference method. All samples artificially contaminated were correctly detected also after 8 of incubation at 30°C ± 1°C in Half Fraser Broth and 24h in Fraser Broth at 37°C ± 1°C using cultural method. Copyright © 2014 Elsevier B.V. All rights reserved.
Molecular typing of uropathogenic E. coli strains by the ERIC-PCR method.
Ardakani, Maryam Afkhami; Ranjbar, Reza
2016-04-01
Escherichia coli (E. coli) is the most common cause of urinary infections in hospitals. The aim of this study was to evaluate the ERIC-PCR method for molecular typing of uropathogenic E. coli strains isolated from hospitalized patients. In a cross sectional study, 98 E. coli samples were collected from urine samples taken from patients admitted to Baqiyatallah Hospital from June 2014 to January 2015. The disk agar diffusion method was used to determine antibiotic sensitivity. DNA proliferation based on repetitive intergenic consensus was used to classify the E. coli strains. The products of proliferation were electrophoresed on 1.5% agarose gel, and their dendrograms were drawn. The data were analyzed by online Insillico software. The method used in this research proliferated numerous bands (4-17 bands), ranging from 100 to 3000 base pairs. The detected strains were classified into six clusters (E1-E6) with 70% similarity between them. In this study, uropathogenic E. coli strains belonged to different genotypic clusters. It was found that ERIC-PCR had good differentiation power for molecular typing of uropathogenic E. coli strains isolated from the patients in the study.
PCR-Based Seamless Genome Editing with High Efficiency and Fidelity in Escherichia coli
DEFF Research Database (Denmark)
Liu, Yilan; Yang, Maohua; Yan, Daojiang
2016-01-01
Efficiency and fidelity are the key obstacles for genome editing toolboxes. In the present study, a PCR-based tandem repeat assisted genome editing (TRAGE) method with high efficiency and fidelity was developed. The design of TRAGE is based on the mechanism of repair of spontaneous double...... for seamlessly deleting, substituting and inserting targeted genes using PCR products. The effects of different manipulations including sucrose addition time, subculture times in LB with sucrose and stages of inoculation on the efficiency were investigated. With our recommended procedure, seamless excision...... of cat-sacB cassette can be realized in 48 h efficiently. We believe that the developed method has great potential for seamless genome editing in E. coli....
A method of knowledge base verification and validation for nuclear power plants expert systems
International Nuclear Information System (INIS)
Kwon, Il Won
1996-02-01
The adoption of expert systems mainly as operator supporting systems is becoming increasingly popular as the control algorithms of system become more and more sophisticated and complicated. As a result of this popularity, a large number of expert systems are developed. The nature of expert systems, however, requires that they be verified and validated carefully and that detailed methodologies for their development be devised. Therefore, it is widely noted that assuring the reliability of expert systems is very important, especially in nuclear industry, and it is also recognized that the process of verification and validation is an essential part of reliability assurance for these systems. Research and practices have produced numerous methods for expert system verification and validation (V and V) that suggest traditional software and system approaches to V and V. However, many approaches and methods for expert system V and V are partial, unreliable, and not uniform. The purpose of this paper is to present a new approach to expert system V and V, based on Petri nets, providing a uniform model. We devise and suggest an automated tool, called COKEP (Checker Of Knowledge base using Extended Petri net), for checking incorrectness, inconsistency, and incompleteness in a knowledge base. We also suggest heuristic analysis for validation process to show that the reasoning path is correct
Identification and validation of reference genes for quantitative RT-PCR normalization in wheat
Directory of Open Access Journals (Sweden)
Porceddu Enrico
2009-02-01
Full Text Available Abstract Background Usually the reference genes used in gene expression analysis have been chosen for their known or suspected housekeeping roles, however the variation observed in most of them hinders their effective use. The assessed lack of validated reference genes emphasizes the importance of a systematic study for their identification. For selecting candidate reference genes we have developed a simple in silico method based on the data publicly available in the wheat databases Unigene and TIGR. Results The expression stability of 32 genes was assessed by qRT-PCR using a set of cDNAs from 24 different plant samples, which included different tissues, developmental stages and temperature stresses. The selected sequences included 12 well-known HKGs representing different functional classes and 20 genes novel with reference to the normalization issue. The expression stability of the 32 candidate genes was tested by the computer programs geNorm and NormFinder using five different data-sets. Some discrepancies were detected in the ranking of the candidate reference genes, but there was substantial agreement between the groups of genes with the most and least stable expression. Three new identified reference genes appear more effective than the well-known and frequently used HKGs to normalize gene expression in wheat. Finally, the expression study of a gene encoding a PDI-like protein showed that its correct evaluation relies on the adoption of suitable normalization genes and can be negatively affected by the use of traditional HKGs with unstable expression, such as actin and α-tubulin. Conclusion The present research represents the first wide screening aimed to the identification of reference genes and of the corresponding primer pairs specifically designed for gene expression studies in wheat, in particular for qRT-PCR analyses. Several of the new identified reference genes outperformed the traditional HKGs in terms of expression stability
Directory of Open Access Journals (Sweden)
Karolina Stojowska
Full Text Available We have designed a new ddLMS PCR (double digestion Ligation Mediated Suppression PCR method based on restriction site polymorphism upstream from the specific target sequence for the simultaneous identification and differentiation of bacterial strains. The ddLMS PCR combines a simple PCR used for species or genus identification and the LM PCR strategy for strain differentiation. The bacterial identification is confirmed in the form of the PCR product(s, while the length of the PCR product makes it possible to differentiate between bacterial strains. If there is a single copy of the target sequence within genomic DNA, one specific PCR product is created (simplex ddLMS PCR, whereas for multiple copies of the gene the fingerprinting patterns can be obtained (multiplex ddLMS PCR. The described ddLMS PCR method is designed for rapid and specific strain differentiation in medical and microbiological studies. In comparison to other LM PCR it has substantial advantages: enables specific species' DNA-typing without the need for pure bacterial culture selection, is not sensitive to contamination with other cells or genomic DNA, and gives univocal "band-based" results, which are easy to interpret. The utility of ddLMS PCR was shown for Acinetobacter calcoaceticus-baumannii (Acb complex, the genetically closely related and phenotypically similar species and also important nosocomial pathogens, for which currently, there are no recommended methods for screening, typing and identification. In this article two models are proposed: 3' recA-ddLMS PCR-MaeII/RsaI for Acb complex interspecific typing and 5' rrn-ddLMS PCR-HindIII/ApaI for Acinetobacter baumannii intraspecific typing. ddLMS PCR allows not only for DNA-typing but also for confirmation of species in one reaction. Also, practical guidelines for designing a diagnostic test based on ddLMS PCR for genotyping different species of bacteria are provided.
Stojowska, Karolina; Krawczyk, Beata
2014-01-01
We have designed a new ddLMS PCR (double digestion Ligation Mediated Suppression PCR) method based on restriction site polymorphism upstream from the specific target sequence for the simultaneous identification and differentiation of bacterial strains. The ddLMS PCR combines a simple PCR used for species or genus identification and the LM PCR strategy for strain differentiation. The bacterial identification is confirmed in the form of the PCR product(s), while the length of the PCR product makes it possible to differentiate between bacterial strains. If there is a single copy of the target sequence within genomic DNA, one specific PCR product is created (simplex ddLMS PCR), whereas for multiple copies of the gene the fingerprinting patterns can be obtained (multiplex ddLMS PCR). The described ddLMS PCR method is designed for rapid and specific strain differentiation in medical and microbiological studies. In comparison to other LM PCR it has substantial advantages: enables specific species' DNA-typing without the need for pure bacterial culture selection, is not sensitive to contamination with other cells or genomic DNA, and gives univocal "band-based" results, which are easy to interpret. The utility of ddLMS PCR was shown for Acinetobacter calcoaceticus-baumannii (Acb) complex, the genetically closely related and phenotypically similar species and also important nosocomial pathogens, for which currently, there are no recommended methods for screening, typing and identification. In this article two models are proposed: 3' recA-ddLMS PCR-MaeII/RsaI for Acb complex interspecific typing and 5' rrn-ddLMS PCR-HindIII/ApaI for Acinetobacter baumannii intraspecific typing. ddLMS PCR allows not only for DNA-typing but also for confirmation of species in one reaction. Also, practical guidelines for designing a diagnostic test based on ddLMS PCR for genotyping different species of bacteria are provided.
Srůtková, Dagmar; Spanova, Alena; Spano, Miroslav; Dráb, Vladimír; Schwarzer, Martin; Kozaková, Hana; Rittich, Bohuslav
2011-10-01
Bifidobacterium longum is considered to play an important role in health maintenance of the human gastrointestinal tract. Probiotic properties of bifidobacterial isolates are strictly strain-dependent and reliable methods for the identification and discrimination of this species at both subspecies and strain levels are thus required. Differentiation between B. longum ssp. longum and B. longum ssp. infantis is difficult due to high genomic similarities. In this study, four molecular-biological methods (species- and subspecies-specific PCRs, random amplified polymorphic DNA (RAPD) method using 5 primers, repetitive sequence-based (rep)-PCR with BOXA1R and (GTG)(5) primers and amplified ribosomal DNA restriction analysis (ARDRA)) and biochemical analysis, were compared for the classification of 30 B. longum strains (28 isolates and 2 collection strains) on subspecies level. Strains originally isolated from the faeces of breast-fed healthy infants (25) and healthy adults (3) showed a high degree of genetic homogeneity by PCR with subspecies-specific primers and rep-PCR. When analysed by RAPD, the strains formed many separate clusters without any potential for subspecies discrimination. These methods together with arabionose/melezitose fermentation analysis clearly differentiated only the collection strains into B. longum ssp. longum and B. longum ssp. infantis at the subspecies level. On the other hand, ARDRA analysis differentiated the strains into the B. longum/infantis subspecies using the cleavage analysis of genus-specific amplicon with just one enzyme, Sau3AI. According to our results the majority of the strains belong to the B. longum ssp. infantis (75%). Therefore we suggest ARDRA using Sau3AI restriction enzyme as the first method of choice for distinguishing between B. longum ssp. longum and B. longum ssp. infantis. Copyright © 2011 Elsevier B.V. All rights reserved.
Directory of Open Access Journals (Sweden)
CHENG Fang
2013-04-01
Full Text Available Real-time PCR technique has been widely used in quantitative GMO detection in recent years.The accuracy of GMOs quantification based on the real-time PCR methods is still a difficult problem,especially for the quantification of high processed samples.To develop the suitable and accurate real-time PCR system for high processed GM samples,we made ameliorations to several real-time PCR parameters,including re-designed shorter target DNA fragment,similar lengths of amplified endogenous and exogenous gene targets,similar GC contents and melting temperatures of PCR primers and TaqMan probes.Also,one Heat-Treatment Processing Model (HTPM was established using soybean flour samples containing GM soybean GTS 40-3-2 to validate the effectiveness of the improved real-time PCR system.Tested results showed that the quantitative bias of GM content in heat processed samples were lowered using the new PCR system.The improved duplex real-time PCR was further validated using processed foods derived from GM soybean,and more accurate GM content values in these foods was also achieved.These results demonstrated that the improved duplex real-time PCR would be quite suitable in quantitative detection of high processed food products.
Zhang, Shutao; Chen, Chun; Xie, Tingna; Ye, Sudan
2017-01-01
The selection of stable reference genes is a critical step for the accurate quantification of gene expression. To identify and validate the reference genes in Pandora neoaphidis-an obligate aphid pathogenic fungus-the expression of 13classical candidate reference genes were evaluated by quantitative real-time reverse transcriptase polymerase chain reaction(qPCR) at four developmental stages (conidia, conidia with germ tubes, short hyphae and elongated hyphae). Four statistical algorithms, including geNorm, NormFinder, BestKeeper and Delta Ct method were used to rank putative reference genes according to their expression stability and indicate the best reference gene or combination of reference genes for accurate normalization. The analysis of comprehensive ranking revealed that ACT1and 18Swas the most stably expressed genes throughout the developmental stages. To further validate the suitability of the reference genes identified in this study, the expression of cell division control protein 25 (CDC25) and Chitinase 1(CHI1) genes were used to further confirm the validated candidate reference genes. Our study presented the first systematic study of reference gene(s) selection for P. neoaphidis study and provided guidelines to obtain more accurate qPCR results for future developmental efforts.
Screening DNA chip and event-specific multiplex PCR detection methods for biotech crops.
Lee, Seong-Hun
2014-11-01
There are about 80 biotech crop events that have been approved by safety assessment in Korea. They have been controlled by genetically modified organism (GMO) and living modified organism (LMO) labeling systems. The DNA-based detection method has been used as an efficient scientific management tool. Recently, the multiplex polymerase chain reaction (PCR) and DNA chip have been developed as simultaneous detection methods for several biotech crops' events. The event-specific multiplex PCR method was developed to detect five biotech maize events: MIR604, Event 3272, LY 038, MON 88017 and DAS-59122-7. The specificity was confirmed and the sensitivity was 0.5%. The screening DNA chip was developed from four endogenous genes of soybean, maize, cotton and canola respectively along with two regulatory elements and seven genes: P35S, tNOS, pat, bar, epsps1, epsps2, pmi, cry1Ac and cry3B. The specificity was confirmed and the sensitivity was 0.5% for four crops' 12 events: one soybean, six maize, three cotton and two canola events. The multiplex PCR and DNA chip can be available for screening, gene-specific and event-specific analysis of biotech crops as efficient detection methods by saving on workload and time. © 2014 Society of Chemical Industry. © 2014 Society of Chemical Industry.
A Nested-Splicing by Overlap Extension PCR Improves Specificity of this Standard Method.
Karkhane, Ali Asghar; Yakhchali, Bagher; Rastgar Jazii, Ferdous; Bambai, Bijan; Aminzadeh, Saeed; Rahimi, Fatemeh
2015-06-01
Splicing by overlap extension (SOE) PCR is used to create mutation in the coding sequence of an enzyme in order to study the role of specific residues in protein's structure and function. We introduced a nested-SOE-PCR (N -SOE-PCR) in order to increase the specificity and generating mutations in a gene by SOE-PCR. Genomic DNA from Bacillus thermocatenulatus was extracted. Nested PCR was used to amplify B. thermocatenulatus lipase gene variants, namely wild type and mutant, using gene specific and mutagenic specific primers, followed by cloning in a suitable vector. Briefly in N-SOE-PCR method, instead of two pairs of primers, three pairs of primers are used to amplify a mutagenic fragment. Moreover, the first and second PCR products are slightly longer than PCR products in a conventional SOE. PCR products obtained from the first round of PCR are used for the second PCR by applying the nested and mutated primers. Following to the purification of the amplified fragments, they will be subject of the further purification and will be used as template to perform the third round of PCR using gene specific primers. In the end, the products will be cloned into a suitable vector for subsequent application. In comparison to the conventional SOE-PCR, the improved method (i.e. N-SOE-PCR) increases the yield and specificity of the products. In addition, the proposed method shows a large reduction in the non-specific products. By applying two more primers in the conventional SOE, the specificity of the method will be improved. This would be in part due to annealing of the primers further inside the amplicon that increases both the efficiency and a better attachment of the primers. Positioning of the primer far from both ends of an amplicon leads to an enhanced binding as well as increased affinity in the third round of amplification in SOE.
Apostol, Izydor; Kelner, Drew; Jiang, Xinzhao Grace; Huang, Gang; Wypych, Jette; Zhang, Xin; Gastwirt, Jessica; Chen, Kenneth; Fodor, Szilan; Hapuarachchi, Suminda; Meriage, Dave; Ye, Frank; Poppe, Leszek; Szpankowski, Wojciech
2012-12-01
To predict precision and other performance characteristics of chromatographic purity methods, which represent the most widely used form of analysis in the biopharmaceutical industry. We have conducted a comprehensive survey of purity methods, and show that all performance characteristics fall within narrow measurement ranges. This observation was used to develop a model called Uncertainty Based on Current Information (UBCI), which expresses these performance characteristics as a function of the signal and noise levels, hardware specifications, and software settings. We applied the UCBI model to assess the uncertainty of purity measurements, and compared the results to those from conventional qualification. We demonstrated that the UBCI model is suitable to dynamically assess method performance characteristics, based on information extracted from individual chromatograms. The model provides an opportunity for streamlining qualification and validation studies by implementing a "live validation" of test results utilizing UBCI as a concurrent assessment of measurement uncertainty. Therefore, UBCI can potentially mitigate the challenges associated with laborious conventional method validation and facilitates the introduction of more advanced analytical technologies during the method lifecycle.
Proposal for Requirement Validation Criteria and Method Based on Actor Interaction
Hattori, Noboru; Yamamoto, Shuichiro; Ajisaka, Tsuneo; Kitani, Tsuyoshi
We propose requirement validation criteria and a method based on the interaction between actors in an information system. We focus on the cyclical transitions of one actor's situation against another and clarify observable stimuli and responses based on these transitions. Both actors' situations can be listed in a state transition table, which describes the observable stimuli or responses they send or receive. Examination of the interaction between both actors in the state transition tables enables us to detect missing or defective observable stimuli or responses. Typically, this method can be applied to the examination of the interaction between a resource managed by the information system and its user. As a case study, we analyzed 332 requirement defect reports of an actual system development project in Japan. We found that there were a certain amount of defects regarding missing or defective stimuli and responses, which can be detected using our proposed method if this method is used in the requirement definition phase. This means that we can reach a more complete requirement definition with our proposed method.
Jacobs, D E; Zhu, X; Gasser, R B; Chilton, N B
1997-11-01
Genomic DNA was extracted from ascaridoid nematodes collected from dogs, foxes and cats. A region spanning the second internal transcribed spacer (ITS-2) of the ribosomal DNA of each sample was amplified by PCR. Representative ITS-2 products for each nematode species (Toxocara canis, Toxocara cati and Toxascaris leonina) were sequenced. Restriction sites were identified for use as genetic markers in a PCR-linked RFLP assay. The three species could be differentiated from each other and from other ascaridoids that may be found in human tissues by use of two endonucleases, HinfI and RsaI. Primers were designed to unique regions of the ITS-2 sequences of the three species for use in diagnostic PCR procedures and primer sets evaluated against panels of homologous and heterologous DNA samples. Results suggest that both methods are good candidates for further development for the detection and/or identification of ascaridoid larvae in human tissues.
Arbitrarily primed PCR- A rapid and simple method for typing of leptospiral serovars
Directory of Open Access Journals (Sweden)
Ramadass P
2002-01-01
Full Text Available PURPOSE: To investigate the use of arbitrarily primed polymerase chain reaction (AP-PCR for typing of leptospiral serovars. METHODS: AP-PCR was adopted for identification of laboratory strains of leptospires and leptospiral cultures at serovar level. A primer of 12 bp was used for amplifying DNA of 13 laboratory strains of leptospires as well as culture pellets of leptospires. RESULTS: Each serovar produced distinct DNA fingerprint which was characteristic for each serovar. These patterns were used for typing of 81 serum culture samples obtained from human leptospiral cases. Of these samples, 39 could be typed based on AP-PCR fingerprints belonging to serovars autumnalis, pomona, canicola, javanica, icterohaemorrhagiae, patoc and pyrogenes. These results were confirmed by RAPD fingerprinting of the DNA samples of the respective leptospiral serovars after culturing -FNx01them in EMJH media. One of the important findings of this work was that straight culture sample could be used for AP-PCR assay, without purification of DNA. By having more number of AP-PCR reference fingerprints, more serovars could be typed. CONCLUSIONS: AP-PCR technique provides great potential for simple and rapid identification of leptospires at serovar level, which could be useful in molecular epidemiological studies of leptospirosis.
Motamedi, Marjan; Mirhendi, Hossein; Zomorodian, Kamiar; Khodadadi, Hossein; Kharazi, Mahboobeh; Ghasemi, Zeinab; Shidfar, Mohammad Reza; Makimura, Koichi
2017-10-01
Following our previous report on evaluation of the beta tubulin real-time PCR for detection of dermatophytosis, this study aimed to compare the real-time PCR assay with conventional methods for the clinical assessment of its diagnostic performance. Samples from a total of 853 patients with suspected dermatophyte lesions were subjected to direct examination (all samples), culture (499 samples) and real-time PCR (all samples). Fungal DNA was extracted directly from clinical samples using a conical steel bullet, followed by purification with a commercial kit and subjected to the Taq-Man probe-based real-time PCR. The study showed that among the 499 specimens for which all three methods were used, 156 (31.2%), 128 (25.6%) and 205 (41.0%) were found to be positive by direct microscopy, culture and real-time PCR respectively. Real-time PCR significantly increased the detection rate of dermatophytes compared with microscopy (288 vs 229) with 87% concordance between the two methods. The sensitivity, specificity, positive predictive value, and negative predictive value of the real-time PCR was 87.5%, 85%, 66.5% and 95.2% respectively. Although real-time PCR performed better on skin than on nail samples, it should not yet fully replace conventional diagnosis. © 2017 Blackwell Verlag GmbH.
Saingam, Prakit; Li, Bo; Yan, Tao
2018-06-01
DNA-based molecular detection of microbial pathogens in complex environments is still plagued by sensitivity, specificity and robustness issues. We propose to address these issues by viewing them as inadvertent consequences of requiring specific and adequate amplification (SAA) of target DNA molecules by current PCR methods. Using the invA gene of Salmonella as the model system, we investigated if next generation sequencing (NGS) can be used to directly detect target sequences in false-negative PCR reaction (PCR-NGS) in order to remove the SAA requirement from PCR. False-negative PCR and qPCR reactions were first created using serial dilutions of laboratory-prepared Salmonella genomic DNA and then analyzed directly by NGS. Target invA sequences were detected in all false-negative PCR and qPCR reactions, which lowered the method detection limits near the theoretical minimum of single gene copy detection. The capability of the PCR-NGS approach in correcting false negativity was further tested and confirmed under more environmentally relevant conditions using Salmonella-spiked stream water and sediment samples. Finally, the PCR-NGS approach was applied to ten urban stream water samples and detected invA sequences in eight samples that would be otherwise deemed Salmonella negative. Analysis of the non-target sequences in the false-negative reactions helped to identify primer dime-like short sequences as the main cause of the false negativity. Together, the results demonstrated that the PCR-NGS approach can significantly improve method sensitivity, correct false-negative detections, and enable sequence-based analysis for failure diagnostics in complex environmental samples. Copyright © 2018 Elsevier B.V. All rights reserved.
PCR-RFLP diagnostic method for identifying Globodera species in Slovenia
Directory of Open Access Journals (Sweden)
Sasa ŠIRCA
2011-01-01
Full Text Available Species identification within the genus Globodera is based on the morphological and morphometrical characters of the cysts and second stage juveniles, and these are included in the majority of identification keys. Morphometrical methods are fast and can be applied to most of samples but they demand a trained and experienced specialist. Furthermore, some morphometrical characters may overlap between populations and beetwen species, leading to inaccurate identification. To confirm and complement the morphometrical identification of Globodera species molecular methods have been developed. Sequences of the internal transcribed spacer regions ITS1 and ITS2 of the rDNA gene cluster proved to be useful for identifying nematode species identification. A PCR-RFLP molecular method was used to identify Globodera rostochiensis, G. pallida, G. tabacum and G. achilleae. Globodera rostochiensis, G. pallida, G. tabacum and G. achilleae can be distinguished with PCR-RFLP analysis of the rDNA ITS fragment using five restriction enzymes. The RFLP patterns of G. rostochiensis, G. tabacum and G. achilleae were species-specific, while those of G. pallida varied. South American populations of G. pallida differed from other populations as their RFLP patterns were demonstrated to be distinct by in silico restriction of the ITS sequences deposited at NCBI.
Verloock, Leen; Joseph, Wout; Gati, Azeddine; Varsier, Nadège; Flach, Björn; Wiart, Joe; Martens, Luc
2013-06-01
An experimental validation of a low-cost method for extrapolation and estimation of the maximal electromagnetic-field exposure from long-term evolution (LTE) radio base station installations are presented. No knowledge on downlink band occupation or service characteristics is required for the low-cost method. The method is applicable in situ. It only requires a basic spectrum analyser with appropriate field probes without the need of expensive dedicated LTE decoders. The method is validated both in laboratory and in situ, for a single-input single-output antenna LTE system and a 2×2 multiple-input multiple-output system, with low deviations in comparison with signals measured using dedicated LTE decoders.
A novel mean-centering method for normalizing microRNA expression from high-throughput RT-qPCR data
Directory of Open Access Journals (Sweden)
Wylie Dennis
2011-12-01
Full Text Available Abstract Background Normalization is critical for accurate gene expression analysis. A significant challenge in the quantitation of gene expression from biofluids samples is the inability to quantify RNA concentration prior to analysis, underscoring the need for robust normalization tools for this sample type. In this investigation, we evaluated various methods of normalization to determine the optimal approach for quantifying microRNA (miRNA expression from biofluids and tissue samples when using the TaqMan® Megaplex™ high-throughput RT-qPCR platform with low RNA inputs. Findings We compared seven normalization methods in the analysis of variation of miRNA expression from biofluid and tissue samples. We developed a novel variant of the common mean-centering normalization strategy, herein referred to as mean-centering restricted (MCR normalization, which is adapted to the TaqMan Megaplex RT-qPCR platform, but is likely applicable to other high-throughput RT-qPCR-based platforms. Our results indicate that MCR normalization performs comparable to or better than both standard mean-centering and other normalization methods. We also propose an extension of this method to be used when migrating biomarker signatures from Megaplex to singleplex RT-qPCR platforms, based on the identification of a small number of normalizer miRNAs that closely track the mean of expressed miRNAs. Conclusions We developed the MCR method for normalizing miRNA expression from biofluids samples when using the TaqMan Megaplex RT-qPCR platform. Our results suggest that normalization based on the mean of all fully observed (fully detected miRNAs minimizes technical variance in normalized expression values, and that a small number of normalizer miRNAs can be selected when migrating from Megaplex to singleplex assays. In our study, we find that normalization methods that focus on a restricted set of miRNAs tend to perform better than methods that focus on all miRNAs, including
Nucleic acid extraction, oligonucleotide probes and PCR methods
International Nuclear Information System (INIS)
Zhongtang Yu; Forster, R.J.
2005-01-01
Complex microbiomes of rumen and gastrointestinal tracts. Bacteria, fungi and protozoa, present in rumen and gastrointestinal (GI) tracts, interact with feed, with each other, and with their host animals, resulting in a complex symbiotic microbiota of distinctive composition and structure. Such microbiota is dynamic and highly responsive to a variety of biotic and abiotic factors, such as diet, feed additives, age, health and physiological status of the host animal, geographical locations, season and feeding regimen (reviewed in Ref. [39]). This symbiotic microbiota has been the focus of microbial research for over half a century in search for improved ruminant nutrition. Before the advent of molecular biology techniques, microorganisms in rumen and GI tracts, as in other habitats, were studied with cultivation-based techniques, which only allows for the isolation and characterization of a limited number of readily culturable species. As estimated, there are more than 400 species of bacteria and up to 100 species of protozoa and fungi inhabiting rumen and GI tracts. In human GI tracts, as much as 60% of these members cannot be isolated on agar plates and, thus, remain unknown. In ruminants, although it is not known, the culturable species of the microbiota are probably in the same range. Even among the culturable species, probably only some of them have been isolated and described. The application of cultivation-independent, more sensitive and accurate molecular techniques to the study of ruminal and GI microorganisms provided an alternative to directly examining the diversity and the community structure of ruminal and GI microbiota on the basis of genotypes, instead of phenotypes. Both polymerase chain reaction (PCR)-based methods, such as denaturing gradient gel electrophoresis (DGGE), ribosomal intergenic spacer analysis, terminal restriction fragment length polymorphism, cloning and sequencing of PCR amplicons and amplified 16S ribosomal DNA restriction
Directory of Open Access Journals (Sweden)
Miller Nicola
2007-11-01
Full Text Available Abstract Background Real-time quantitative PCR (RQ-PCR forms the basis of many breast cancer biomarker studies and novel prognostic assays, paving the way towards personalised cancer treatments. Normalisation of relative RQ-PCR data is required to control for non-biological variation introduced during sample preparation. Endogenous control (EC genes, used in this context, should ideally be expressed constitutively and uniformly across treatments in all test samples. Despite widespread recognition that the accuracy of the normalised data is largely dependent on the reliability of the EC, there are no reports of the systematic validation of genes commonly used for this purpose in the analysis of gene expression by RQ-PCR in primary breast cancer tissues. The aim of this study was to identify the most suitable endogenous control genes for RQ-PCR analysis of primary breast tissue from a panel of eleven candidates in current use. Oestrogen receptor alpha (ESR1 was used a target gene to compare the effect of choice of EC on the estimate of gene quantity. Results The expression and validity of candidate ECs (GAPDH, TFRC, ABL, PPIA, HPRT1, RPLP0, B2M, GUSB, MRPL19, PUM1 and PSMC4 was determined in 6 benign and 21 malignant primary breast cancer tissues. Gene expression data was analysed using two different statistical models. MRPL19 and PPIA were identified as the most stable and reliable EC genes, while GUSB, RPLP0 and ABL were least stable. There was a highly significant difference in variance between ECs. ESR1 expression was appreciably higher in malignant compared to benign tissues and there was a significant effect of EC on the magnitude of the error associated with the relative quantity of ESR1. Conclusion We have validated two endogenous control genes, MRPL19 and PPIA, for RQ-PCR analysis of gene expression in primary breast tissue. Of the genes in current use in this field, the above combination offers increased accuracy and resolution in the
Principal component reconstruction (PCR) for cine CBCT with motion learning from 2D fluoroscopy.
Gao, Hao; Zhang, Yawei; Ren, Lei; Yin, Fang-Fang
2018-01-01
This work aims to generate cine CT images (i.e., 4D images with high-temporal resolution) based on a novel principal component reconstruction (PCR) technique with motion learning from 2D fluoroscopic training images. In the proposed PCR method, the matrix factorization is utilized as an explicit low-rank regularization of 4D images that are represented as a product of spatial principal components and temporal motion coefficients. The key hypothesis of PCR is that temporal coefficients from 4D images can be reasonably approximated by temporal coefficients learned from 2D fluoroscopic training projections. For this purpose, we can acquire fluoroscopic training projections for a few breathing periods at fixed gantry angles that are free from geometric distortion due to gantry rotation, that is, fluoroscopy-based motion learning. Such training projections can provide an effective characterization of the breathing motion. The temporal coefficients can be extracted from these training projections and used as priors for PCR, even though principal components from training projections are certainly not the same for these 4D images to be reconstructed. For this purpose, training data are synchronized with reconstruction data using identical real-time breathing position intervals for projection binning. In terms of image reconstruction, with a priori temporal coefficients, the data fidelity for PCR changes from nonlinear to linear, and consequently, the PCR method is robust and can be solved efficiently. PCR is formulated as a convex optimization problem with the sum of linear data fidelity with respect to spatial principal components and spatiotemporal total variation regularization imposed on 4D image phases. The solution algorithm of PCR is developed based on alternating direction method of multipliers. The implementation is fully parallelized on GPU with NVIDIA CUDA toolbox and each reconstruction takes about a few minutes. The proposed PCR method is validated and
DNA microarray-based PCR ribotyping of Clostridium difficile.
Schneeberg, Alexander; Ehricht, Ralf; Slickers, Peter; Baier, Vico; Neubauer, Heinrich; Zimmermann, Stefan; Rabold, Denise; Lübke-Becker, Antina; Seyboldt, Christian
2015-02-01
This study presents a DNA microarray-based assay for fast and simple PCR ribotyping of Clostridium difficile strains. Hybridization probes were designed to query the modularly structured intergenic spacer region (ISR), which is also the template for conventional and PCR ribotyping with subsequent capillary gel electrophoresis (seq-PCR) ribotyping. The probes were derived from sequences available in GenBank as well as from theoretical ISR module combinations. A database of reference hybridization patterns was set up from a collection of 142 well-characterized C. difficile isolates representing 48 seq-PCR ribotypes. The reference hybridization patterns calculated by the arithmetic mean were compared using a similarity matrix analysis. The 48 investigated seq-PCR ribotypes revealed 27 array profiles that were clearly distinguishable. The most frequent human-pathogenic ribotypes 001, 014/020, 027, and 078/126 were discriminated by the microarray. C. difficile strains related to 078/126 (033, 045/FLI01, 078, 126, 126/FLI01, 413, 413/FLI01, 598, 620, 652, and 660) and 014/020 (014, 020, and 449) showed similar hybridization patterns, confirming their genetic relatedness, which was previously reported. A panel of 50 C. difficile field isolates was tested by seq-PCR ribotyping and the DNA microarray-based assay in parallel. Taking into account that the current version of the microarray does not discriminate some closely related seq-PCR ribotypes, all isolates were typed correctly. Moreover, seq-PCR ribotypes without reference profiles available in the database (ribotype 009 and 5 new types) were correctly recognized as new ribotypes, confirming the performance and expansion potential of the microarray. Copyright © 2015, American Society for Microbiology. All Rights Reserved.
An Evidence-Based Approach to Detection by DASI-ELISA and RT-PCR in Dormant Period
Directory of Open Access Journals (Sweden)
Antonio Olmos
2008-01-01
Full Text Available An evidence-based approach, such as those developed in clinical and veterinary medicine, was applied to the detection of Plum pox virus (PPV during the dormant period. A standardized methodology was used for the calculation of parameters of the operational capacity of DASI-ELISA and RT-PCR in wintertime. These methods are routinely handled to test the sanitary status of plants in national or international trading and in those cases concerning export-import of plant materials. Diagnosis often has to be performed during the dormant period, when plant material is commercialized. Some guidelines to interpret diagnostic results of wintertime are provided in an attempt to minimize risks associated with the methods and over-reliance on the binary outcome of a single assay. In order to evaluate if a complementary test increased the confidence of PPV diagnosis when discordant results between DASI-ELISA and RT-PCR are obtained, NASBA-FH also was included. Likelihood ratios of each method were estimated based on the sensitivity and specificity obtained in wintertime. Subsequently, a Bayesian approach was performed to calculate post-test probability of PPV infection in spring. Results of evidence-based approach show that different PPV prevalences require different screening tests. Thus, at very low PPV prevalence levels DASI-ELISA should be used as the election method, whilst at the highest PPV prevalence levels RT-PCR should be performed. NASBA-FH could be used at medium prevalences to clarify discordances between DASI-ELISA and RT-PCR.
Directory of Open Access Journals (Sweden)
Fatemeh Dehghan
2014-11-01
Full Text Available Background: Detection of bacterial contamination in drinking water by culture method is a time and cost consuming method and spends a few days depending on contamination degree. However, the people use the tap water during that time. Molecular methods are rapid and sensitive. In this study a rapid Multiplex PCR method was used for rapid analysis both coliform bacteria and E.coli, and probable detection of VBNC bacteria in drinking water, the experiments were performed in bacteriological lab of water and Wastewater Corporation in Markazi province. Material and Methods:Amplification of a fragment from each of lacZ and uidA genes in a Multiplex PCR was used for detection of coliforms. Eight samples was taken from Arak drinking water system including 36 samples of wells, 41 samples of water distribution network and 3 samples from water storages were examined by amplification of lacZ and uidA genes in a Multiplex PCR. Equivalently, the MPN test was applied as a standard method for all samples for comparison of results. Standard bacteria, pure bacteria isolated from positive MPN and CRM were examined by PCR and MPN method. Results: The result of most samples water network, water storages, and water well were same in both MPN and PCR method .The results of standard bacteria and pure cultures of bacteria isolated from positive MPN and CRM confirmed the PCR method. Five samples were positive in PCR but negative in MPN method. Duration time of PCR was decreased about 105 min by changing the PCR program and electrophoreses factors. Conclusion: The Multiplex PCR can detect coliform bacteria and E.coli synchronous in drinking water.
PCR melting profile (PCR MP - a new tool for differentiation of Candida albicans strains
Directory of Open Access Journals (Sweden)
Nowak Magdalena
2009-11-01
Full Text Available Abstract Background We have previously reported the use of PCR Melting Profile (PCR MP technique based on using low denaturation temperatures during ligation mediated PCR (LM PCR for bacterial strain differentiation. The aim of the current study was to evaluate this method for intra-species differentiation of Candida albicans strains. Methods In total 123 Candida albicans strains (including 7 reference, 11 clinical unrelated, and 105 isolates from patients of two hospitals in Poland were examined using three genotyping methods: PCR MP, macrorestriction analysis of the chromosomal DNA by pulsed-field gel electrophoresis (REA-PFGE and RAPD techniques. Results The genotyping results of the PCR MP were compared with results from REA-PFGE and RAPD techniques giving 27, 26 and 25 unique types, respectively. The results showed that the PCR MP technique has at least the same discriminatory power as REA-PFGE and RAPD. Conclusion Data presented here show for the first time the evaluation of PCR MP technique for candidial strains differentiation and we propose that this can be used as a relatively simple and cheap technique for epidemiological studies in short period of time in hospital.
McMahon, Tanis C; Blais, Burton W; Wong, Alex; Carrillo, Catherine D
2017-01-01
Foodborne illness attributed to enterohemorrhagic E. coli (EHEC), a highly pathogenic subset of Shiga toxin-producing E. coli (STEC), is increasingly recognized as a significant public health issue. Current microbiological methods for identification of EHEC in foods often use PCR-based approaches to screen enrichment broth cultures for characteristic gene markers [i.e., Shiga toxin ( stx ) and intimin ( eae )]. However, false positives arise when complex food matrices, such as beef, contain mixtures of eae -negative STEC and eae -positive E. coli , but no EHEC with both markers in a single cell. To reduce false-positive detection of EHEC in food enrichment samples, a Multiplexed, Single Intact Cell droplet digital PCR (MuSIC ddPCR) assay capable of detecting the co-occurrence of the stx and eae genes in a single bacterial cell was developed. This method requires: (1) dispersal of intact bacteria into droplets; (2) release of genomic DNA (gDNA) by heat lysis; and (3) amplification and detection of genetic targets ( stx and eae ) using standard TaqMan chemistries with ddPCR. Performance of the method was tested with panels of EHEC and non-target E. coli . By determining the linkage (i.e., the proportion of droplets in which stx and eae targets were both amplified), samples containing EHEC (typically greater than 20% linkage) could be distinguished from samples containing mixtures of eae -negative STEC and eae -positive E. coli (0-2% linkage). The use of intact cells was necessary as this linkage was not observed with gDNA extracts. EHEC could be accurately identified in enrichment broth cultures containing excess amounts of background E. coli and in enrichment cultures derived from ground beef/pork and leafy-green produce samples. To our knowledge, this is the first report of dual-target detection in single bacterial cells using ddPCR. The application of MuSIC ddPCR to enrichment-culture screening would reduce false-positives, thereby improving the cost, speed, and
Skarzyńska, Agnieszka; Pawełkowicz, Magdalena; PlÄ der, Wojciech; Przybecki, Zbigniew
2016-09-01
Real-time quantitative polymerase chain reaction is consider as the most reliable method for gene expression studies. However, the expression of target gene could be misinterpreted due to improper normalization. Therefore, the crucial step for analysing of qPCR data is selection of suitable reference genes, which should be validated experimentally. In order to choice the gene with stable expression in the designed experiment, we performed reference gene expression analysis. In this study genes described in the literature and novel genes predicted as control genes, based on the in silico analysis of transcriptome data were used. Analysis with geNorm and NormFinder algorithms allow to create the ranking of candidate genes and indicate the best reference for flower morphogenesis study. According to the results, genes CACS and CYCL were characterised the most stable expression, but the least suitable genes were TUA and EF.
Duarte, Margarida Dias; Barros, Sílvia Carla; Henriques, Ana Margarida; Fagulha, Maria Teresa; Ramos, Fernanda; Luís, Tiago; Fevereiro, Miguel
2014-02-01
The myxoma virus (MYXV) causes severe infections in European rabbits that may reach mortality rates up to 100% depending on the viral strain. The typical symptoms and lesions induced by the virus are usually enough to permit the correct clinical diagnosis. However, in peracute forms the infection may be accompanied by unspecific symptoms. Sudden death may also occur without evident clinical signs of myxomatosis. Likewise, a clinical diagnosis of atypical forms of myxomatosis (amyxomatous) is often complicated and delayed due to the scarceness of skin lesions. As the disease control often depends on an early and unequivocal diagnosis of MYXV, laboratorial methods play a relevant role in the confirmation of MYXV infection. This study describes the development and validation of a novel, high accurate real time polymerase chain reaction assay (rtPCR) for the detection of MYXV. Primers were designed to amplify a 125-bp within the gene M000.5L/R, which is duplicated in the termini of the genome and is unique among Leporipoxvirus. The assay was negative for SFV and other poxviruses and was able to detect 2.6 copies of MYXV DNA proving the effectiveness, specificity and sensitivity of this diagnosis tool. The rtPCR has been applied successfully in INIAV laboratory for routine diagnosis of myxomatosis since 2005. Copyright © 2013 Elsevier B.V. All rights reserved.
Directory of Open Access Journals (Sweden)
Yifan Zhai
Full Text Available To accurately evaluate gene expression levels and obtain more accurate quantitative real-time RT-PCR (qRT-PCR data, normalization relative to reliable reference gene(s is required. Drosophila suzukii, is an invasive fruit pest native to East Asia, and recently invaded Europe and North America, the stability of its reference genes have not been previously investigated. In this study, ten candidate reference genes (RPL18, RPS3, AK, EF-1β, TBP, NADH, HSP22, GAPDH, Actin, α-Tubulin, were evaluated for their suitability as normalization genes under different biotic (developmental stage, tissue and population, and abiotic (photoperiod, temperature conditions. The three statistical approaches (geNorm, NormFinder and BestKeeper and one web-based comprehensive tool (RefFinder were used to normalize analysis of the ten candidate reference genes identified α-Tubulin, TBP and AK as the most stable candidates, while HSP22 and Actin showed the lowest expression stability. We used three most stable genes (α-Tubulin, TBP and AK and one unstably expressed gene to analyze the expression of P-glycoprotein in abamectin-resistant and sensitive strains, and the results were similar to reference genes α-Tubulin, TBP and AK, which show good stability, while the result of HSP22 has a certain bias. The three validated reference genes can be widely used for quantification of target gene expression with qRT-PCR technology in D.suzukii.
Parboosing, Raveen; Siyaca, Ntombizandile; Moodley, Pravikrishnen
2016-01-01
Background Poor quality dried blood spot (DBS) specimens are usually rejected by virology laboratories, affecting early infant diagnosis of HIV. The practice of combining two incompletely-filled DBS in one specimen preparation tube during pre-analytical specimen processing (i.e., the two-spot method) has been implemented to reduce the number of specimens being rejected for insufficient volume. Objectives This study analysed laboratory data to describe the quality of DBS specimens and the use of the two-spot method over a one-year period, then validated the two-spot method against the standard (one-spot) method. Methods Data on HIV-1 PCR test requests submitted in 2014 to the Department of Virology at Inkosi Albert Luthuli Central Hospital in KwaZulu-Natal province, South Africa were analysed to describe reasons for specimen rejection, as well as results of the two-spot method. The accuracy, lower limit of detection and precision of the two-spot method were assessed. Results Of the 88 481 specimens received, 3.7% were rejected for pre-analytical problems. Of those, 48.9% were rejected as a result of insufficient specimen volume. Two health facilities had significantly more specimen rejections than other facilities. The two-spot method prevented 10 504 specimen rejections. The Pearson correlation coefficient comparing the standard to the two-spot method was 0.997. Conclusions The two-spot method was comparable with the standard method of pre-analytical specimen processing. Two health facilities were identified for targeted retraining on specimen quality. The two-spot method of DBS specimen processing can be used as an adjunct to retraining, to reduce the number of specimens rejected and improve linkage to care. PMID:28879108
Yang, Qi; Franco, Christopher M M; Zhang, Wei
2015-10-01
Experiments were designed to validate the two common DNA extraction protocols (CTAB-based method and DNeasy Blood & Tissue Kit) used to effectively recover actinobacterial DNA from sponge samples in order to study the sponge-associated actinobacterial diversity. This was done by artificially spiking sponge samples with actinobacteria (spores, mycelia and a combination of the two). Our results demonstrated that both DNA extraction methods were effective in obtaining DNA from the sponge samples as well as the sponge samples spiked with different amounts of actinobacteria. However, it was noted that in the presence of the sponge, the bacterial 16S rRNA gene could not be amplified unless the combined DNA template was diluted. To test the hypothesis that the extracted sponge DNA contained inhibitors, dilutions of the DNA extracts were tested for six sponge species representing five orders. The results suggested that the inhibitors were co-extracted with the sponge DNA, and a high dilution of this DNA was required for the successful PCR amplification for most of the samples. The optimized PCR conditions, including primer selection, PCR reaction system and program optimization, further improved the PCR performance. However, no single PCR condition was found to be suitable for the diverse sponge samples using various primer sets. These results highlight for the first time that the DNA extraction methods used are effective in obtaining actinobacterial DNA and that the presence of inhibitors in the sponge DNA requires high dilution coupled with fine tuning of the PCR conditions to achieve success in the study of sponge-associated actinobacterial diversity.
International Nuclear Information System (INIS)
Verloock, L.; Joseph, W.; Gati, A.; Varsier, N.; Flach, B.; Wiart, J.; Martens, L.
2013-01-01
An experimental validation of a low-cost method for extrapolation and estimation of the maximal electromagnetic-field exposure from long-term evolution (LTE) radio base station installations are presented. No knowledge on down-link band occupation or service characteristics is required for the low-cost method. The method is applicable in situ. It only requires a basic spectrum analyser with appropriate field probes without the need of expensive dedicated LTE decoders. The method is validated both in laboratory and in situ, for a single-input single-output antenna LTE system and a 2x2 multiple-input multiple-output system, with low deviations in comparison with signals measured using dedicated LTE decoders. (authors)
Govender, Kerusha; Parboosing, Raveen; Siyaca, Ntombizandile; Moodley, Pravikrishnen
2016-01-01
Poor quality dried blood spot (DBS) specimens are usually rejected by virology laboratories, affecting early infant diagnosis of HIV. The practice of combining two incompletely-filled DBS in one specimen preparation tube during pre-analytical specimen processing (i.e., the two-spot method) has been implemented to reduce the number of specimens being rejected for insufficient volume. This study analysed laboratory data to describe the quality of DBS specimens and the use of the two-spot method over a one-year period, then validated the two-spot method against the standard (one-spot) method. Data on HIV-1 PCR test requests submitted in 2014 to the Department of Virology at Inkosi Albert Luthuli Central Hospital in KwaZulu-Natal province, South Africa were analysed to describe reasons for specimen rejection, as well as results of the two-spot method. The accuracy, lower limit of detection and precision of the two-spot method were assessed. Of the 88 481 specimens received, 3.7% were rejected for pre-analytical problems. Of those, 48.9% were rejected as a result of insufficient specimen volume. Two health facilities had significantly more specimen rejections than other facilities. The two-spot method prevented 10 504 specimen rejections. The Pearson correlation coefficient comparing the standard to the two-spot method was 0.997. The two-spot method was comparable with the standard method of pre-analytical specimen processing. Two health facilities were identified for targeted retraining on specimen quality. The two-spot method of DBS specimen processing can be used as an adjunct to retraining, to reduce the number of specimens rejected and improve linkage to care.
Sommer, D; Enderlein, D; Antakli, A; Schönenbrücher, H; Slaghuis, J; Redmann, T; Lierz, M
2012-01-01
The efficiency of two commercial PCR methods based on real-time technology, the foodproof® Salmonella detection system and the BAX® PCR Assay Salmonella system was compared to standardized culture methods (EN ISO 6579:2002 - Annex D) for the detection of Salmonella spp. in poultry samples. Four sample matrices (feed, dust, boot swabs, feces) obtained directly from poultry flocks, as well as artificially spiked samples of the same matrices, were used. All samples were tested for Salmonella spp. using culture methods first as the gold standard. In addition samples spiked with Salmonella Enteridis were tested to evaluate the sensitivity of both PCR methods. Furthermore all methods were evaluated in an annual ring-trial of the National Salmonella Reference Laboratory of Germany. Salmonella detection in the matrices feed, dust and boot swabs were comparable in both PCR systems whereas the results from feces differed markedly. The quality, especially the freshness, of the fecal samples had an influence on the sensitivity of the real-time PCR and the results of the culture methods. In fresh fecal samples an initial spiking level of 100cfu/25g Salmonella Enteritidis was detected. Two-days-dried fecal samples allowed the detection of 14cfu/25g. Both real- time PCR protocols appear to be suitable for the detection of Salmonella spp. in all four matrices. The foodproof® system detected eight samples more to be positive compared to the BAX® system, but had a potential false positive result in one case. In 7-days-dried samples none of the methods was able to detect Salmonella likely through letal cell damage. In general the advantage of PCR analyses over the culture method is the reduction of working time from 4-5 days to only 2 days. However, especially for the analysis of fecal samples official validation should be conducted according to the requirement of EN ISO6579:2002 - Annex D.
RUCS: Rapid identification of PCR primers for unique core sequences
DEFF Research Database (Denmark)
Thomsen, Martin Christen Frølund; Hasman, Henrik; Westh, Henrik
2017-01-01
Designing PCR primers to target a specific selection of whole genome sequenced strains can be a long, arduous, and sometimes impractical task. Such tasks would benefit greatly from an automated tool to both identify unique targets, and to validate the vast number of potential primer pairs...... for the targets in silico . Here we present RUCS, a program that will find PCR primer pairs and probes for the unique core sequences of a positive genome dataset complement to a negative genome dataset. The resulting primer pairs and probes are in addition to simple selection also validated through a complex...... in silico PCR simulation. We compared our method, which identifies the unique core sequences, against an existing tool called ssGeneFinder, and found that our method was 6.5-20 times more sensitive. We used RUCS to design primer pairs that would target a set of genomes known to contain the mcr-1 colistin...
International Nuclear Information System (INIS)
Rho, Hyun-Wook; Lee, Byoung-Chan; Choi, Eun-Seok; Choi, Il-Ju; Lee, Yeon-Su; Goh, Sung-Ho
2010-01-01
Reverse transcription quantitative real-time polymerase chain reaction (RT-qPCR) is a powerful method for the analysis of gene expression. Target gene expression levels are usually normalized to a consistently expressed reference gene also known as internal standard, in the same sample. However, much effort has not been expended thus far in the search for reference genes suitable for the study of stomach cancer using RT-qPCR, although selection of optimal reference genes is critical for interpretation of results. We assessed the suitability of six possible reference genes, beta-actin (ACTB), glyceraldehydes-3-phosphate dehydrogenase (GAPDH), hypoxanthine phosphoribosyl transferase 1 (HPRT1), beta-2-microglobulin (B2M), ribosomal subunit L29 (RPL29) and 18S ribosomal RNA (18S rRNA) in 20 normal and tumor stomach tissue pairs of stomach cancer patients and 6 stomach cancer cell lines, by RT-qPCR. Employing expression stability analyses using NormFinder and geNorm algorithms we determined the order of performance of these reference genes and their variation values. This RT-qPCR study showed that there are statistically significant (p < 0.05) differences in the expression levels of HPRT1 and 18S rRNA in 'normal-' versus 'tumor stomach tissues'. The stability analyses by geNorm suggest B2M-GAPDH, as best reference gene combination for 'stomach cancer cell lines'; RPL29-HPRT1, for 'all stomach tissues'; and ACTB-18S rRNA, for 'all stomach cell lines and tissues'. NormFinder also identified B2M as the best reference gene for 'stomach cancer cell lines', RPL29-B2M for 'all stomach tissues', and 18S rRNA-ACTB for 'all stomach cell lines and tissues'. The comparisons of normalized expression of the target gene, GPNMB, showed different interpretation of target gene expression depend on best single reference gene or combination. This study validated RPL29 and RPL29-B2M as the best single reference
Muraosa, Yasunori; Toyotome, Takahito; Yahiro, Maki; Watanabe, Akira; Shikanai-Yasuda, Maria Aparecida; Kamei, Katsuhiko
2016-05-01
We developed new cycling probe-based real-time PCR and nested real-time PCR assays for the detection of Histoplasma capsulatum that were designed to detect the gene encoding N-acetylated α-linked acidic dipeptidase (NAALADase), which we previously identified as an H. capsulatum antigen reacting with sera from patients with histoplasmosis. Both assays specifically detected the DNAs of all H. capsulatum strains but not those of other fungi or human DNA. The limited of detection (LOD) of the real-time PCR assay was 10 DNA copies when using 10-fold serial dilutions of the standard plasmid DNA and 50 DNA copies when using human serum spiked with standard plasmid DNA. The nested real-time PCR improved the LOD to 5 DNA copies when using human serum spiked with standard plasmid DNA, which represents a 10-fold higher than that observed with the real-time PCR assay. To assess the ability of the two assays to diagnose histoplasmosis, we analyzed a small number of clinical specimens collected from five patients with histoplasmosis, such as sera (n = 4), formalin-fixed paraffin-embedded (FFPE) tissue (n = 4), and bronchoalveolar lavage fluid (BALF) (n = 1). Although clinical sensitivity of the real-time PCR assay was insufficiently sensitive (33%), the nested real-time PCR assay increased the clinical sensitivity (77%), suggesting it has a potential to be a useful method for detecting H. capsulatum DNA in clinical specimens. © The Author 2015. Published by Oxford University Press on behalf of The International Society for Human and Animal Mycology. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.
Validation of internal dosimetry protocols based on stochastic method
International Nuclear Information System (INIS)
Mendes, Bruno M.; Fonseca, Telma C.F.; Almeida, Iassudara G.; Trindade, Bruno M.; Campos, Tarcisio P.R.
2015-01-01
Computational phantoms adapted to Monte Carlo codes have been applied successfully in radiation dosimetry fields. NRI research group has been developing Internal Dosimetry Protocols - IDPs, addressing distinct methodologies, software and computational human-simulators, to perform internal dosimetry, especially for new radiopharmaceuticals. Validation of the IDPs is critical to ensure the reliability of the simulations results. Inter comparisons of data from literature with those produced by our IDPs is a suitable method for validation. The aim of this study was to validate the IDPs following such inter comparison procedure. The Golem phantom has been reconfigured to run on MCNP5. The specific absorbed fractions (SAF) for photon at 30, 100 and 1000 keV energies were simulated based on the IDPs and compared with reference values (RV) published by Zankl and Petoussi-Henss, 1998. The SAF average differences from RV and those obtained in IDP simulations was 2.3 %. The SAF largest differences were found in situations involving low energy photons at 30 keV. The Adrenals and thyroid, i.e. the lowest mass organs, had the highest SAF discrepancies towards RV as 7.2 % and 3.8 %, respectively. The statistic differences of SAF applying our IDPs from reference values were considered acceptable at the 30, 100 and 1000 keV spectra. We believe that the main reason for the discrepancies in IDPs run, found in lower masses organs, was due to our source definition methodology. Improvements of source spatial distribution in the voxels may provide outputs more consistent with reference values for lower masses organs. (author)
Validation of internal dosimetry protocols based on stochastic method
Energy Technology Data Exchange (ETDEWEB)
Mendes, Bruno M.; Fonseca, Telma C.F., E-mail: bmm@cdtn.br [Centro de Desenvolvimento da Tecnologia Nuclear (CDTN/CNEN-MG), Belo Horizonte, MG (Brazil); Almeida, Iassudara G.; Trindade, Bruno M.; Campos, Tarcisio P.R., E-mail: tprcampos@yahoo.com.br [Universidade Federal de Minas Gerais (DEN/UFMG), Belo Horizonte, MG (Brazil). Departamento de Engenharia Nuclear
2015-07-01
Computational phantoms adapted to Monte Carlo codes have been applied successfully in radiation dosimetry fields. NRI research group has been developing Internal Dosimetry Protocols - IDPs, addressing distinct methodologies, software and computational human-simulators, to perform internal dosimetry, especially for new radiopharmaceuticals. Validation of the IDPs is critical to ensure the reliability of the simulations results. Inter comparisons of data from literature with those produced by our IDPs is a suitable method for validation. The aim of this study was to validate the IDPs following such inter comparison procedure. The Golem phantom has been reconfigured to run on MCNP5. The specific absorbed fractions (SAF) for photon at 30, 100 and 1000 keV energies were simulated based on the IDPs and compared with reference values (RV) published by Zankl and Petoussi-Henss, 1998. The SAF average differences from RV and those obtained in IDP simulations was 2.3 %. The SAF largest differences were found in situations involving low energy photons at 30 keV. The Adrenals and thyroid, i.e. the lowest mass organs, had the highest SAF discrepancies towards RV as 7.2 % and 3.8 %, respectively. The statistic differences of SAF applying our IDPs from reference values were considered acceptable at the 30, 100 and 1000 keV spectra. We believe that the main reason for the discrepancies in IDPs run, found in lower masses organs, was due to our source definition methodology. Improvements of source spatial distribution in the voxels may provide outputs more consistent with reference values for lower masses organs. (author)
Fisk-based criteria to support validation of detection methods for drinking water and air.
Energy Technology Data Exchange (ETDEWEB)
MacDonell, M.; Bhattacharyya, M.; Finster, M.; Williams, M.; Picel, K.; Chang, Y.-S.; Peterson, J.; Adeshina, F.; Sonich-Mullin, C.; Environmental Science Division; EPA
2009-02-18
This report was prepared to support the validation of analytical methods for threat contaminants under the U.S. Environmental Protection Agency (EPA) National Homeland Security Research Center (NHSRC) program. It is designed to serve as a resource for certain applications of benchmark and fate information for homeland security threat contaminants. The report identifies risk-based criteria from existing health benchmarks for drinking water and air for potential use as validation targets. The focus is on benchmarks for chronic public exposures. The priority sources are standard EPA concentration limits for drinking water and air, along with oral and inhalation toxicity values. Many contaminants identified as homeland security threats to drinking water or air would convert to other chemicals within minutes to hours of being released. For this reason, a fate analysis has been performed to identify potential transformation products and removal half-lives in air and water so appropriate forms can be targeted for detection over time. The risk-based criteria presented in this report to frame method validation are expected to be lower than actual operational targets based on realistic exposures following a release. Note that many target criteria provided in this report are taken from available benchmarks without assessing the underlying toxicological details. That is, although the relevance of the chemical form and analogues are evaluated, the toxicological interpretations and extrapolations conducted by the authoring organizations are not. It is also important to emphasize that such targets in the current analysis are not health-based advisory levels to guide homeland security responses. This integrated evaluation of chronic public benchmarks and contaminant fate has identified more than 200 risk-based criteria as method validation targets across numerous contaminants and fate products in drinking water and air combined. The gap in directly applicable values is
Directory of Open Access Journals (Sweden)
Shutao Zhang
Full Text Available The selection of stable reference genes is a critical step for the accurate quantification of gene expression. To identify and validate the reference genes in Pandora neoaphidis-an obligate aphid pathogenic fungus-the expression of 13classical candidate reference genes were evaluated by quantitative real-time reverse transcriptase polymerase chain reaction(qPCR at four developmental stages (conidia, conidia with germ tubes, short hyphae and elongated hyphae. Four statistical algorithms, including geNorm, NormFinder, BestKeeper and Delta Ct method were used to rank putative reference genes according to their expression stability and indicate the best reference gene or combination of reference genes for accurate normalization. The analysis of comprehensive ranking revealed that ACT1and 18Swas the most stably expressed genes throughout the developmental stages. To further validate the suitability of the reference genes identified in this study, the expression of cell division control protein 25 (CDC25 and Chitinase 1(CHI1 genes were used to further confirm the validated candidate reference genes. Our study presented the first systematic study of reference gene(s selection for P. neoaphidis study and provided guidelines to obtain more accurate qPCR results for future developmental efforts.
Directory of Open Access Journals (Sweden)
Ravid Rivka
2008-05-01
Full Text Available Abstract Background Studies of gene expression in post mortem human brain can contribute to understanding of the pathophysiology of neurodegenerative diseases, including Alzheimer's disease (AD, Parkinson's disease (PD and dementia with Lewy bodies (DLB. Quantitative real-time PCR (RT qPCR is often used to analyse gene expression. The validity of results obtained using RT qPCR is reliant on accurate data normalization. Reference genes are generally used to normalize RT qPCR data. Given that expression of some commonly used reference genes is altered in certain conditions, this study aimed to establish which reference genes were stably expressed in post mortem brain tissue from individuals with AD, PD or DLB. Results The present study investigated the expression stability of 8 candidate reference genes, (ubiquitin C [UBC], tyrosine-3-monooxygenase [YWHAZ], RNA polymerase II polypeptide [RP II], hydroxymethylbilane synthase [HMBS], TATA box binding protein [TBP], β-2-microglobulin [B2M], glyceraldehyde-3-phosphate dehydrogenase [GAPDH], and succinate dehydrogenase complex-subunit A, [SDHA] in cerebellum and medial temporal gyrus of 6 AD, 6 PD, 6 DLB subjects, along with 5 matched controls using RT qPCR (TaqMan® Gene Expression Assays. Gene expression stability was analysed using geNorm to rank the candidate genes in order of decreasing stability in each disease group. The optimal number of genes recommended for accurate data normalization in each disease state was determined by pairwise variation analysis. Conclusion This study identified validated sets of mRNAs which would be appropriate for the normalization of RT qPCR data when studying gene expression in brain tissue of AD, PD, DLB and control subjects.
Directory of Open Access Journals (Sweden)
Tatiana Rochat
2017-09-01
Full Text Available Flavobacterium psychrophilum is a devastating bacterial pathogen of salmonids reared in freshwater worldwide. So far, serological diversity between isolates has been described but the underlying molecular factors remain unknown. By combining complete genome sequence analysis and the serotyping method proposed by Lorenzen and Olesen (1997 for a set of 34 strains, we identified key molecular determinants of the serotypes. This knowledge allowed us to develop a robust multiplex PCR-based serotyping scheme, which was applied to 244 bacterial isolates. The results revealed a striking association between PCR-serotype and fish host species and illustrate the use of this approach as a simple and cost-effective method for the determination of F. psychrophilum serogroups. PCR-based serotyping could be a useful tool in a range of applications such as disease surveillance, selection of salmonids for bacterial coldwater disease resistance and future vaccine formulation.
Ueno, Tomohiro; Niimi, Hideki; Yoneda, Noriko; Yoneda, Satoshi; Mori, Masashi; Tabata, Homare; Minami, Hiroshi; Saito, Shigeru; Kitajima, Isao
2015-01-01
Intra-amniotic infection has long been recognized as the leading cause of preterm delivery. Microbial culture is the gold standard for the detection of intra-amniotic infection, but several days are required, and many bacterial species in the amniotic fluid are difficult to cultivate. We developed a novel nested-PCR-based assay for detecting Mycoplasma, Ureaplasma, other bacteria and fungi in amniotic fluid samples within three hours of sample collection. To detect prokaryotes, eukaryote-made thermostable DNA polymerase, which is free from bacterial DNA contamination, is used in combination with bacterial universal primers. In contrast, to detect eukaryotes, conventional bacterially-made thermostable DNA polymerase is used in combination with fungal universal primers. To assess the validity of the PCR assay, we compared the PCR and conventional culture results using 300 amniotic fluid samples. Based on the detection level (positive and negative), 93.3% (280/300) of Mycoplasma, 94.3% (283/300) of Ureaplasma, 89.3% (268/300) of other bacteria and 99.7% (299/300) of fungi matched the culture results. Meanwhile, concerning the detection of bacteria other than Mycoplasma and Ureaplasma, 228 samples were negative according to the PCR method, 98.2% (224/228) of which were also negative based on the culture method. Employing the devised primer sets, mixed amniotic fluid infections of Mycoplasma, Ureaplasma and/or other bacteria could be clearly distinguished. In addition, we also attempted to compare the relative abundance in 28 amniotic fluid samples with mixed infection, and judged dominance by comparing the Ct values of quantitative real-time PCR. We developed a novel PCR assay for the rapid detection of Mycoplasma, Ureaplasma, other bacteria and fungi in amniotic fluid samples. This assay can also be applied to accurately diagnose the absence of bacteria in samples. We believe that this assay will positively contribute to the treatment of intra-amniotic infection and
Multiplex PCR-based assay for detection of Bordetella pertussis in nasopharyngeal swab specimens.
Wadowsky, R M; Michaels, R H; Libert, T; Kingsley, L A; Ehrlich, G D
1996-11-01
A multiplex PCR-based assay was developed for the detection of Bordetella pertussis in nasopharyngeal swab specimens. The assay simultaneously amplified two separate DNA targets (153 and 203 bp) within a B. pertussis repetitive element and a 438-bp target within the beta-actin gene of human DNA (PCR amplification control). PCR products were detected by a sensitive and specific liquid hybridization gel retardation assay. A total of 496 paired nasopharyngeal swab specimens were tested by both the PCR-based assay and culture. Although 30 (6%) of the specimens inhibited the amplification of the beta-actin target, in all 29 specimens studied, the inhibition disappeared on repeat testing or was easily overcome with a 1:8 dilution or less of specimen digest. Of the 495 specimen pairs yielding a final evaluable result by the PCR-based assay, 19.0% were positive by the PCR-based assay, whereas 13.9% were positive by culture (P < 0.0001). After resolving the PCR-positive, culture-negative results by testing an additional aliquot from these specimens by the multiplex PCR-based assay, the PCR-based assay had a sensitivity and specificity of 98.9 and 99.7%, respectively, compared with values of 73.4 and 100%, respectively, for culture. In comparison with patients with culture-confirmed pertussis, those with PCR-positive, culture-negative results were older and more likely to have had prolonged cough, immunization with pertussis vaccine, or treatment with erythromycin. This multiplex PCR-based assay is substantially more sensitive than culture and identifies specimens that contain inhibitors of PCR.
Tice, George; Andaloro, Bridget; White, H Kirk; Bolton, Lance; Wang, Siqun; Davis, Eugene; Wallace, Morgan
2009-01-01
In 2006, DuPont Qualicon introduced the BAX system Q7 instrument for use with its assays. To demonstrate the equivalence of the new and old instruments, a validation study was conducted using the BAX system PCR Assay for Salmonella, AOAC Official Method 2003.09, on three food types. The foods were simultaneously analyzed with the BAX system Q7 instrument and either the U.S. Food and Drug Administration Bacteriological Analytical Manual or the U.S. Department of Agriculture-Food Safety and Inspection Service Microbiology Laboratory Guidebook reference method for detecting Salmonella. Comparable performance between the BAX system and the reference methods was observed. Of the 75 paired samples analyzed, 39 samples were positive by both the BAX system and reference methods, and 36 samples were negative by both the BAX system and reference methods, demonstrating 100% correlation. Inclusivity and exclusivity for the BAX system Q7 instrument were also established by testing 50 Salmonella strains and 20 non-Salmonella isolates. All Salmonella strains returned positive results, and all non-Salmonella isolates returned a negative response.
DEFF Research Database (Denmark)
Fachmann, Mette Sofie Rousing; Josefsen, Mathilde Hasseldam; Hoorfar, Jeffrey
2015-01-01
bacterial cells in two validated real-time PCR assays for Campylobacter and Salmonella. The five best performing (based on: limit of detection (LOD), maximum fluorescence, shape of amplification curves, and amplification efficiency) were subsequently applied to meat and fecal samples. The VeriQuest q......PCR master mix performed best for both meat and fecal samples (LODs of 102 and 104 CFU ml-1 in the purest and crudest DNA extractions, respectively) compared with Tth (LOD=102 -103 and 105 -106 CFU ml-1 ). AmpliTaqGold and HotMasterTaq both performed well (LOD=102 -104 CFU ml-1 ) with meat samples and poorly...... (LOD=103 -106 CFU ml-1 /not detected) with fecal samples. CONCLUSIONS: Applying the VeriQuest qPCR master mix in the two tested real-time PCR assays could allow for simpler sample preparation and thus a reduction in cost. SIGNIFICANCE AND IMPACT OF STUDY: This work exemplifies a cost-effective strategy...
Smiljanic, M; Kaase, M; Ahmad-Nejad, P; Ghebremedhin, B
2017-07-10
Carbapenemase-producing gram-negative bacteria are increasing globally and have been associated with outbreaks in hospital settings. Thus, the accurate detection of these bacteria in infections is mandatory for administering the adequate therapy and infection control measures. This study aimed to establish and evaluate a multiplex real-time PCR assay for the simultaneous detection of carbapenemase gene variants in gram-negative rods and to compare the performance with a commercial RT-PCR assay (Check-Direct CPE). 116 carbapenem-resistant Enterobacteriaceae, Pseudomonas aeruginosa and Acinetobacter baumannii isolates were genotyped for carbapenemase genes by PCR and sequencing. The defined isolates were used for the validation of the in-house RT-PCR by use of designed primer pairs and probes. Among the carbapenem-resistant isolates the genes bla KPC , bla VIM , bla NDM or bla OXA were detected. Both RT-PCR assays detected all bla KPC , bla VIM and bla NDM in the isolates. The in-house RT-PCR detected 53 of 67 (79.0%) whereas the commercial assay detected only 29 (43.3%) of the OXA genes. The in-house sufficiently distinguished the most prevalent OXA types (23-like and 48-like) in the melting curve analysis and direct detection of the genes from positive blood culture vials. The Check-Direct CPE and the in-house RT-PCR assay detected the carbapenem resistance from solid culture isolates. Moreover, the in-house assay enabled the identification of carbapenemase genes directly from positive blood-culture vials. However, we observed insufficient detection of various OXA genes in both assays. Nevertheless, the in-house RT-PCR detected the majority of the OXA type genes in Enterobacteriaceae and A. baumannii.
Murphy, Helen R; Lee, Seulgi; da Silva, Alexandre J
2017-07-01
Cyclospora cayetanensis is a protozoan parasite that causes human diarrheal disease associated with the consumption of fresh produce or water contaminated with C. cayetanensis oocysts. In the United States, foodborne outbreaks of cyclosporiasis have been linked to various types of imported fresh produce, including cilantro and raspberries. An improved method was developed for identification of C. cayetanensis in produce at the U.S. Food and Drug Administration. The method relies on a 0.1% Alconox produce wash solution for efficient recovery of oocysts, a commercial kit for DNA template preparation, and an optimized TaqMan real-time PCR assay with an internal amplification control for molecular detection of the parasite. A single laboratory validation study was performed to assess the method's performance and compare the optimized TaqMan real-time PCR assay and a reference nested PCR assay by examining 128 samples. The samples consisted of 25 g of cilantro or 50 g of raspberries seeded with 0, 5, 10, or 200 C. cayetanensis oocysts. Detection rates for cilantro seeded with 5 and 10 oocysts were 50.0 and 87.5%, respectively, with the real-time PCR assay and 43.7 and 94.8%, respectively, with the nested PCR assay. Detection rates for raspberries seeded with 5 and 10 oocysts were 25.0 and 75.0%, respectively, with the real-time PCR assay and 18.8 and 68.8%, respectively, with the nested PCR assay. All unseeded samples were negative, and all samples seeded with 200 oocysts were positive. Detection rates using the two PCR methods were statistically similar, but the real-time PCR assay is less laborious and less prone to amplicon contamination and allows monitoring of amplification and analysis of results, making it more attractive to diagnostic testing laboratories. The improved sample preparation steps and the TaqMan real-time PCR assay provide a robust, streamlined, and rapid analytical procedure for surveillance, outbreak response, and regulatory testing of foods for
A survey of tools for the analysis of quantitative PCR (qPCR) data.
Pabinger, Stephan; Rödiger, Stefan; Kriegner, Albert; Vierlinger, Klemens; Weinhäusel, Andreas
2014-09-01
Real-time quantitative polymerase-chain-reaction (qPCR) is a standard technique in most laboratories used for various applications in basic research. Analysis of qPCR data is a crucial part of the entire experiment, which has led to the development of a plethora of methods. The released tools either cover specific parts of the workflow or provide complete analysis solutions. Here, we surveyed 27 open-access software packages and tools for the analysis of qPCR data. The survey includes 8 Microsoft Windows, 5 web-based, 9 R-based and 5 tools from other platforms. Reviewed packages and tools support the analysis of different qPCR applications, such as RNA quantification, DNA methylation, genotyping, identification of copy number variations, and digital PCR. We report an overview of the functionality, features and specific requirements of the individual software tools, such as data exchange formats, availability of a graphical user interface, included procedures for graphical data presentation, and offered statistical methods. In addition, we provide an overview about quantification strategies, and report various applications of qPCR. Our comprehensive survey showed that most tools use their own file format and only a fraction of the currently existing tools support the standardized data exchange format RDML. To allow a more streamlined and comparable analysis of qPCR data, more vendors and tools need to adapt the standardized format to encourage the exchange of data between instrument software, analysis tools, and researchers.
Wang, Li-Ping; Lei, Kun
2016-12-01
Since 2009, Aureococcus anophagefferens has caused brown tide to occur recurrently in Qinhuangdao coastal area, China. Because the algal cells of A. anophagefferens are so tiny (~3 µm) that it is very hard to identify exactly under a microscope for natural water samples, it is very urgent to develop a method for efficient and continuous monitoring. Here specific primers and Taqman probe are designed to develop a real-time quantitative PCR (qPCR) method for identification and quantification continually. The algal community and cell abundance of A. anophagefferens in the study area (E 119°20'-119°50' and N 39°30'-39°50') from April to October in 2013 are detected by pyrosequencing, and are used to validate the specification and precision of qPCR method for natural samples. Both pyrosequencing and qPCR shows that the targeted cells are present only in May, June and July, and the cell abundance are July > June > May. Although there are various algal species including dinoflagellata, diatom, Cryptomonadales, Chrysophyceae and Chlorophyta living in the natural seawater simultaneously, no disturbance happens to qPCR method. This qPCR method could detect as few as 10 targeted cells, indicating it is able to detect the algal cells at pre-bloom levels. Therefore, qPCR with Taqman probe provides a powerful and sensitive method to monitor the brown tide continually in Qinhuangdao coastal area, China. The results provide a necessary technology support for forecasting the brown tide initiation, in China.
Fu, Wei; Xie, Wen; Zhang, Zhuo; Wang, Shaoli; Wu, Qingjun; Liu, Yong; Zhou, Xiaomao; Zhou, Xuguo; Zhang, Youjun
2013-01-01
Abstract: Quantitative real-time PCR (qRT-PCR), a primary tool in gene expression analysis, requires an appropriate normalization strategy to control for variation among samples. The best option is to compare the mRNA level of a target gene with that of reference gene(s) whose expression level is stable across various experimental conditions. In this study, expression profiles of eight candidate reference genes from the diamondback moth, Plutella xylostella, were evaluated under diverse experimental conditions. RefFinder, a web-based analysis tool, integrates four major computational programs including geNorm, Normfinder, BestKeeper, and the comparative ΔCt method to comprehensively rank the tested candidate genes. Elongation factor 1 (EF1) was the most suited reference gene for the biotic factors (development stage, tissue, and strain). In contrast, although appropriate reference gene(s) do exist for several abiotic factors (temperature, photoperiod, insecticide, and mechanical injury), we were not able to identify a single universal reference gene. Nevertheless, a suite of candidate reference genes were specifically recommended for selected experimental conditions. Our finding is the first step toward establishing a standardized qRT-PCR analysis of this agriculturally important insect pest. PMID:23983612
Cankar, Katarina; Stebih, Dejan; Dreo, Tanja; Zel, Jana; Gruden, Kristina
2006-08-14
Real-time PCR is the technique of choice for nucleic acid quantification. In the field of detection of genetically modified organisms (GMOs) quantification of biotech products may be required to fulfil legislative requirements. However, successful quantification depends crucially on the quality of the sample DNA analyzed. Methods for GMO detection are generally validated on certified reference materials that are in the form of powdered grain material, while detection in routine laboratories must be performed on a wide variety of sample matrixes. Due to food processing, the DNA in sample matrixes can be present in low amounts and also degraded. In addition, molecules of plant origin or from other sources that affect PCR amplification of samples will influence the reliability of the quantification. Further, the wide variety of sample matrixes presents a challenge for detection laboratories. The extraction method must ensure high yield and quality of the DNA obtained and must be carefully selected, since even components of DNA extraction solutions can influence PCR reactions. GMO quantification is based on a standard curve, therefore similarity of PCR efficiency for the sample and standard reference material is a prerequisite for exact quantification. Little information on the performance of real-time PCR on samples of different matrixes is available. Five commonly used DNA extraction techniques were compared and their suitability for quantitative analysis was assessed. The effect of sample matrix on nucleic acid quantification was assessed by comparing 4 maize and 4 soybean matrixes. In addition 205 maize and soybean samples from routine analysis were analyzed for PCR efficiency to assess variability of PCR performance within each sample matrix. Together with the amount of DNA needed for reliable quantification, PCR efficiency is the crucial parameter determining the reliability of quantitative results, therefore it was chosen as the primary criterion by which to
Typing of Y chromosome SNPs with multiplex PCR methods
DEFF Research Database (Denmark)
Sanchez Sanchez, Juan Jose; Børsting, Claus; Morling, Niels
2005-01-01
We describe a method for the simultaneous typing of Y-chromosome single nucleotide polymorphism (SNP) markers by means of multiplex polymerase chain reaction (PCR) strategies that allow the detection of 35 Y chromosome SNPs on 25 amplicons from 100 to 200 pg of chromosomal deoxyribonucleic acid...... factors for the creation of larger SNP typing PCR multiplexes include careful selection of primers for the primary amplification and the SBE reaction, use of DNA primers with homogenous composition, and balancing the primer concentrations for both the amplification and the SBE reactions....
Directory of Open Access Journals (Sweden)
Meng Sun
Full Text Available The pink stem borer, Sesamia inferens, which is endemic in China and other parts of Asia, is a major pest of rice and causes significant yield loss in this host plant. Very few studies have addressed gene expression in S. inferens. Quantitative real-time PCR (qRT-PCR is currently the most accurate and sensitive method for gene expression analysis. In qRT-PCR, data are normalized using reference genes, which help control for internal differences and reduce error between samples. In this study, seven candidate reference genes, 18S ribosomal RNA (18S rRNA, elongation factor 1 (EF1, glyceraldehyde-3-phosphate dehydrogenase (GAPDH, ribosomal protein S13 (RPS13, ribosomal protein S20 (RPS20, tubulin (TUB, and β-actin (ACTB were evaluated for their suitability in normalizing gene expression under different experimental conditions. The results indicated that three genes (RPS13, RPS20, and EF1 were optimal for normalizing gene expression in different insect tissues (head, epidermis, fat body, foregut, midgut, hindgut, Malpighian tubules, haemocytes, and salivary glands. 18S rRNA, EF1, and GAPDH were best for normalizing expression with respect to developmental stages and sex (egg masses; first, second, third, fourth, fifth, and sixth instar larvae; male and female pupae; and one-day-old male and female adults. 18S rRNA, RPS20, and TUB were optimal for fifth instars exposed to different temperatures (-8, -6, -4, -2, 0, and 27°C. To validate this recommendation, the expression profile of a target gene heat shock protein 83 gene (hsp83 was investigated, and results showed the selection was necessary and effective. In conclusion, this study describes reference gene sets that can be used to accurately measure gene expression in S. inferens.
Sun, Meng; Lu, Ming-Xing; Tang, Xiao-Tian; Du, Yu-Zhou
2015-01-01
The pink stem borer, Sesamia inferens, which is endemic in China and other parts of Asia, is a major pest of rice and causes significant yield loss in this host plant. Very few studies have addressed gene expression in S. inferens. Quantitative real-time PCR (qRT-PCR) is currently the most accurate and sensitive method for gene expression analysis. In qRT-PCR, data are normalized using reference genes, which help control for internal differences and reduce error between samples. In this study, seven candidate reference genes, 18S ribosomal RNA (18S rRNA), elongation factor 1 (EF1), glyceraldehyde-3-phosphate dehydrogenase (GAPDH), ribosomal protein S13 (RPS13), ribosomal protein S20 (RPS20), tubulin (TUB), and β-actin (ACTB) were evaluated for their suitability in normalizing gene expression under different experimental conditions. The results indicated that three genes (RPS13, RPS20, and EF1) were optimal for normalizing gene expression in different insect tissues (head, epidermis, fat body, foregut, midgut, hindgut, Malpighian tubules, haemocytes, and salivary glands). 18S rRNA, EF1, and GAPDH were best for normalizing expression with respect to developmental stages and sex (egg masses; first, second, third, fourth, fifth, and sixth instar larvae; male and female pupae; and one-day-old male and female adults). 18S rRNA, RPS20, and TUB were optimal for fifth instars exposed to different temperatures (-8, -6, -4, -2, 0, and 27°C). To validate this recommendation, the expression profile of a target gene heat shock protein 83 gene (hsp83) was investigated, and results showed the selection was necessary and effective. In conclusion, this study describes reference gene sets that can be used to accurately measure gene expression in S. inferens.
Wu, Qingqing; Xiang, Shengnan; Wang, Wenjun; Zhao, Jinyan; Xia, Jinhua; Zhen, Yueran; Liu, Bang
2018-05-01
Various detection methods have been developed to date for identification of animal species. New techniques based on PCR approach have raised the hope of developing better identification methods, which can overcome the limitations of the existing methods. PCR-based methods used the mitochondrial DNA (mtDNA) as well as nuclear DNA sequences. In this study, by targeting nuclear DNA, multiplex PCR and real-time PCR methods were developed to assist with qualitative and quantitative analysis. The multiplex PCR was found to simultaneously and effectively distinguish four species (fox, dog, mink, and rabbit) ingredients by the different sizes of electrophoretic bands: 480, 317, 220, and 209 bp. Real-time fluorescent PCR's amplification profiles and standard curves showed good quantitative measurement responses and linearity, as indicated by good repeatability and coefficient of determination R 2 > 0.99. The quantitative results of quaternary DNA mixtures including mink, fox, dog, and rabbit DNA are in line with our expectations: R.D. (relative deviation) varied between 1.98 and 12.23% and R.S.D. (relative standard deviation) varied between 3.06 and 11.51%, both of which are well within the acceptance criterion of ≤ 25%. Combining the two methods is suitable for the rapid identification and accurate quantification of fox-, dog-, mink-, and rabbit-derived ingredients in the animal products.
Validity evidence based on test content.
Sireci, Stephen; Faulkner-Bond, Molly
2014-01-01
Validity evidence based on test content is one of the five forms of validity evidence stipulated in the Standards for Educational and Psychological Testing developed by the American Educational Research Association, American Psychological Association, and National Council on Measurement in Education. In this paper, we describe the logic and theory underlying such evidence and describe traditional and modern methods for gathering and analyzing content validity data. A comprehensive review of the literature and of the aforementioned Standards is presented. For educational tests and other assessments targeting knowledge and skill possessed by examinees, validity evidence based on test content is necessary for building a validity argument to support the use of a test for a particular purpose. By following the methods described in this article, practitioners have a wide arsenal of tools available for determining how well the content of an assessment is congruent with and appropriate for the specific testing purposes.
Aparecida de Oliveira, Maria; Abeid Ribeiro, Eliana Guimarães; Morato Bergamini, Alzira Maria; Pereira De Martinis, Elaine Cristina
2010-02-01
Modern lifestyle markedly changed eating habits worldwide, with an increasing demand for ready-to-eat foods, such as minimally processed fruits and leafy greens. Packaging and storage conditions of those products may favor the growth of psychrotrophic bacteria, including the pathogen Listeria monocytogenes. In this work, minimally processed leafy vegetables samples (n = 162) from retail market from Ribeirão Preto, São Paulo, Brazil, were tested for the presence or absence of Listeria spp. by the immunoassay Listeria Rapid Test, Oxoid. Two L. monocytogenes positive and six artificially contaminated samples of minimally processed leafy vegetables were evaluated by the Most Probable Number (MPN) with detection by classical culture method and also culture method combined with real-time PCR (RTi-PCR) for 16S rRNA genes of L. monocytogenes. Positive MPN enrichment tubes were analyzed by RTi-PCR with primers specific for L. monocytogenes using the commercial preparation ABSOLUTE QPCR SYBR Green Mix (ABgene, UK). Real-time PCR assay presented good exclusivity and inclusivity results and no statistical significant difference was found in comparison with the conventional culture method (p < 0.05). Moreover, RTi-PCR was fast and easy to perform, with MPN results obtained in ca. 48 h for RTi-PCR in comparison to 7 days for conventional method.
Method validation for strobilurin fungicides in cereals and fruit
DEFF Research Database (Denmark)
Christensen, Hanne Bjerre; Granby, Kit
2001-01-01
Strobilurins are a new class of fungicides that are active against a broad spectrum of fungi. In the present work a GC method for analysis of strobilurin fungicides was validated. The method was based on extraction with ethyl acetate/cyclohexane, clean-up by gel permeation chromatography (GPC......) and determination of the content by gas chromatography (GC) with electron capture (EC-), nitrogen/phosphorous (NP-), and mass spectrometric (MS-) detection. Three strobilurins, azoxystrobin, kresoxim-methyl and trifloxystrobin were validated on three matrices, wheat, apple and grapes. The validation was based...
Directory of Open Access Journals (Sweden)
Wang Wei
2011-03-01
Full Text Available Abstract Background Reverse transcription PCR (RT-PCR and real time RT-PCR (rRT-PCR have been indispensable methods for influenza surveillance, especially for determination of avian influenza. The movement of testing beyond reference lab introduced the need of quality control, including the implementation of an evaluation system for validating personal training and sample proficiency testing. Methods We developed a panel with lysates of seasonal influenza virus (H1N1, H3N2 and B, serials of diluted H5N1 virus lysates, and in-vitro transcribed H5 hemaglutinin (HA and an artificial gene RNAs for RT-PCR and rRT-PCR quality control assessment. The validations of stability and reproducibility were performed on the panel. Additionally, the panel was implemented to assess the detection capability of Chinese human avian influenza networks. Results The panel has relatively high stability and good reproducibility demonstrated by kappa's tests. In the implementation of panel on Chinese human avian influenza networks, the results suggested that there were a relatively low number of discrepancies for both concise and reproducibility in Chinese avian influenza virus net works. Conclusions A quality control panel of RT-PCR and real-time RT-PCR for avian influenza A (H5N1 surveillance network was developed. An availably statistical data, which are used to assess the detection capability of networks on avian influenza virus (H5N1, can be obtained relatively easily through implementation of the panel on networks.
Stachelska, M A
2017-09-26
The aim of the present study was to establish a rapid and accurate real-time PCR method to detect pathogenic Yersinia enterocolitica in pork. Yersinia enterocolitica is considered to be a crucial zoonosis, which can provoke diseases both in humans and animals. The classical culture methods designated to detect Y. enterocolitica species in food matrices are often very time-consuming. The chromosomal locus _tag CH49_3099 gene, that appears in pathogenic Y. enterocolitica strains, was applied as DNA target for the 5' nuclease PCR protocol. The probe was labelled at the 5' end with the fluorescent reporter dye (FAM) and at the 3' end with the quencher dye (TAMRA). The real-time PCR cycling parameters included 41 cycles. A Ct value which reached a value higher than 40 constituted a negative result. The developed for the needs of this study qualitative real-time PCR method appeared to give very specific and reliable results. The detection rate of locus _tag CH49_3099 - positive Y. enterocolitica in 150 pig tonsils was 85 % and 32 % with PCR and culture methods, respectively. Both the Real-time PCR results and culture method results were obtained from material that was enriched during overnight incubation. The subject of the study were also raw pork meat samples. Among 80 samples examined, 7 ones were positive when real-time PCR was applied, and 6 ones were positive when classical culture method was applied. The application of molecular techniques based on the analysis of DNA sequences such as the Real-time PCR enables to detect this pathogenic bacteria very rapidly and with higher specificity, sensitivity and reliability in comparison to classical culture methods.
Directory of Open Access Journals (Sweden)
M.V. Resende
2011-06-01
Full Text Available The objective of the present study was to determine the sperm enrichment with X-bearing spermatozoa, after one centrifugation in a Percoll or OptiPrep continuous density gradient, using quantitative real-time polymerase chain reaction (qPCR of sperm DNA and resultant in vitro-produced bovine embryos by PCR. Frozen/thawed sperm was layered on density gradients and the tubes were centrifuged. Supernatants were gently aspirated and the sperm recovered from the bottom of the tubes. Cleavage and blastocyst rates were determined through in vitro production of embryos and PCR was performed to identify the embryos' genetic sex. A difference in blastocyst rate was found in the Percoll treatment compared to OptiPrep (P<0.05. The percentage of female embryos in the Percoll and OptiPrep groups was 62.0% and 47.1%, respectively. These results were confirmed by qPCR of spermatozoa DNA and underestimation was seen only in the Percoll group. It was possible to sexing sperm using simple approach.
Directory of Open Access Journals (Sweden)
Macarena Parra
Full Text Available The International Space Station (ISS National Laboratory is dedicated to studying the effects of space on life and physical systems, and to developing new science and technologies for space exploration. A key aspect of achieving these goals is to operate the ISS National Lab more like an Earth-based laboratory, conducting complex end-to-end experimentation, not limited to simple microgravity exposure. Towards that end NASA developed a novel suite of molecular biology laboratory tools, reagents, and methods, named WetLab-2, uniquely designed to operate in microgravity, and to process biological samples for real-time gene expression analysis on-orbit. This includes a novel fluidic RNA Sample Preparation Module and fluid transfer devices, all-in-one lyophilized PCR assays, centrifuge, and a real-time PCR thermal cycler. Here we describe the results from the WetLab-2 validation experiments conducted in microgravity during ISS increment 47/SPX-8. Specifically, quantitative PCR was performed on a concentration series of DNA calibration standards, and Reverse Transcriptase-quantitative PCR was conducted on RNA extracted and purified on-orbit from frozen Escherichia coli and mouse liver tissue. Cycle threshold (Ct values and PCR efficiencies obtained on-orbit from DNA standards were similar to Earth (1 g controls. Also, on-orbit multiplex analysis of gene expression from bacterial cells and mammalian tissue RNA samples was successfully conducted in about 3 h, with data transmitted within 2 h of experiment completion. Thermal cycling in microgravity resulted in the trapping of gas bubbles inside septa cap assay tubes, causing small but measurable increases in Ct curve noise and variability. Bubble formation was successfully suppressed in a rapid follow-up on-orbit experiment using standard caps to pressurize PCR tubes and reduce gas release during heating cycles. The WetLab-2 facility now provides a novel operational on-orbit research capability for
DEFF Research Database (Denmark)
Schmidt, Gunilla Veslemøy; Mellerup, Anders; Christiansen, Lasse Engbo
2015-01-01
The aim of this article was to define the sampling level and method combination that captures antibiotic resistance at pig herd level utilizing qPCR antibiotic resistance gene quantification and culture-based quantification of antibiotic resistant coliform indicator bacteria. Fourteen qPCR assays...... for commonly detected antibiotic resistance genes were developed, and used to quantify antibiotic resistance genes in total DNA from swine fecal samples that were obtained using different sampling and pooling methods. In parallel, the number of antibiotic resistant coliform indicator bacteria was determined...... in the same swine fecal samples. The results showed that the qPCR assays were capable of detecting differences in antibiotic resistance levels in individual animals that the coliform bacteria colony forming units (CFU) could not. Also, the qPCR assays more accurately quantified antibiotic resistance genes...
Rasmussen Hellberg, Rosalee S; Morrissey, Michael T; Hanner, Robert H
2010-09-01
The purpose of this study was to develop a species-specific multiplex polymerase chain reaction (PCR) method that allows for the detection of salmon species substitution on the commercial market. Species-specific primers and TaqMan® probes were developed based on a comprehensive collection of mitochondrial 5' cytochrome c oxidase subunit I (COI) deoxyribonucleic acid (DNA) "barcode" sequences. Primers and probes were combined into multiplex assays and tested for specificity against 112 reference samples representing 25 species. Sensitivity and linearity tests were conducted using 10-fold serial dilutions of target DNA (single-species samples) and DNA admixtures containing the target species at levels of 10%, 1.0%, and 0.1% mixed with a secondary species. The specificity tests showed positive signals for the target DNA in both real-time and conventional PCR systems. Nonspecific amplification in both systems was minimal; however, false positives were detected at low levels (1.2% to 8.3%) in conventional PCR. Detection levels were similar for admixtures and single-species samples based on a 30 PCR cycle cut-off, with limits of 0.25 to 2.5 ng (1% to 10%) in conventional PCR and 0.05 to 5.0 ng (0.1% to 10%) in real-time PCR. A small-scale test with food samples showed promising results, with species identification possible even in heavily processed food items. Overall, this study presents a rapid, specific, and sensitive method for salmon species identification that can be applied to mixed-species and heavily processed samples in either conventional or real-time PCR formats. This study provides a newly developed method for salmon and trout species identification that will assist both industry and regulatory agencies in the detection and prevention of species substitution. This multiplex PCR method allows for rapid, high-throughput species identification even in heavily processed and mixed-species samples. An inter-laboratory study is currently being carried out to
Directory of Open Access Journals (Sweden)
Jacinta Gimeno
Full Text Available Switchgrass (Panicum virgatum has received a lot of attention as a forage and bioenergy crop during the past few years. Gene expression studies are in progress to improve new traits and develop new cultivars. Quantitative real time PCR (qRT-PCR has emerged as an important technique to study gene expression analysis. For accurate and reliable results, normalization of data with reference genes is essential. In this work, we evaluate the stability of expression of genes to use as reference for qRT-PCR in the grass P. virgatum. Eleven candidate reference genes, including eEF-1α, UBQ6, ACT12, TUB6, eIF-4a, GAPDH, SAMDC, TUA6, CYP5, U2AF, and FTSH4, were validated for qRT-PCR normalization in different plant tissues and under different stress conditions. The expression stability of these genes was verified by the use of two distinct algorithms, geNorm and NormFinder. Differences were observed after comparison of the ranking of the candidate reference genes identified by both programs but eEF-1α, eIF-4a, CYP5 and U2AF are ranked as the most stable genes in the samples sets under study. Both programs discard the use of SAMDC and TUA6 for normalization. Validation of the reference genes proposed by geNorm and NormFinder were performed by normalization of transcript abundance of a group of target genes in different samples. Results show similar expression patterns when the best reference genes selected by both programs were used but differences were detected in the transcript abundance of the target genes. Based on the above research, we recommend the use of different statistical algorithms to identify the best reference genes for expression data normalization. The best genes selected in this study will help to improve the quality of gene expression data in a wide variety of samples in switchgrass.
Directory of Open Access Journals (Sweden)
Gilad Oren
2005-03-01
Full Text Available Abstract Background Outbreaks with mass mortality among common carp Cyprinus carpio carpio and koi Cyprinus carpio koi have occurred worldwide since 1998. The herpes-like virus isolated from diseased fish is different from Herpesvirus cyprini and channel catfish virus and was accordingly designated koi herpesvirus (KHV. Diagnosis of KHV infection based on viral isolation and current PCR assays has a limited sensitivity and therefore new tools for the diagnosis of KHV infections are necessary. Results A robust and sensitive PCR assay based on a defined gene sequence of KHV was developed to improve the diagnosis of KHV infection. From a KHV genomic library, a hypothetical thymidine kinase gene (TK was identified, subcloned and expressed as a recombinant protein. Preliminary characterization of the recombinant TK showed that it has a kinase activity using dTTP but not dCTP as a substrate. A PCR assay based on primers selected from the defined DNA sequence of the TK gene was developed and resulted in a 409 bp amplified fragment. The TK based PCR assay did not amplify the DNAs of other fish herpesviruses such as Herpesvirus cyprini (CHV and the channel catfish virus (CCV. The TK based PCR assay was specific for the detection of KHV and was able to detect as little as 10 fentograms of KHV DNA corresponding to 30 virions. The TK based PCR was compared to previously described PCR assays and to viral culture in diseased fish and was shown to be the most sensitive method of diagnosis of KHV infection. Conclusion The TK based PCR assay developed in this work was shown to be specific for the detection of KHV. The TK based PCR assay was more sensitive for the detection of KHV than previously described PCR assays; it was as sensitive as virus isolation which is the golden standard method for KHV diagnosis and was able to detect as little as 10 fentograms of KHV DNA corresponding to 30 virions.
An SSP-PCR method for the rapid detection of disease-associated alleles HLA-A*29 and HLA-B*51.
Amstutz, U; Schaerer, D; Andrey, G; Wirthmueller, U; Largiadèr, C R
2018-05-15
HLA-A*29 and HLA-B*51 are associated with birdshot uveitis and Behçet's disease, respectively, and are used as a diagnostic criterion in patients with suspected disease, requiring their detection in diagnostic laboratories. While commercial tests for individual HLA alleles are available for other disease-associated HLA variants, no similar allele-specific assays are available for HLA-A*29 and -B*51. Here, we report SSP-PCR methods for the detection of HLA-A*29 and -B*51 using a single PCR reaction per allele. The assays were tested in 30 and 32 previously HLA-typed samples, respectively, representing >97% of HLA-A alleles and >93% of HLA-B alleles in a European population. A concordance of 100% was observed with previous typing results, validating these methods for use in a diagnostic or research context. This article is protected by copyright. All rights reserved. This article is protected by copyright. All rights reserved.
Sun, Meng; Lu, Ming-Xing; Tang, Xiao-Tian; Du, Yu-Zhou
2015-01-01
The pink stem borer, Sesamia inferens, which is endemic in China and other parts of Asia, is a major pest of rice and causes significant yield loss in this host plant. Very few studies have addressed gene expression in S. inferens. Quantitative real-time PCR (qRT-PCR) is currently the most accurate and sensitive method for gene expression analysis. In qRT-PCR, data are normalized using reference genes, which help control for internal differences and reduce error between samples. In this study...
International Nuclear Information System (INIS)
Zapparoli, Giada V; Jorissen, Robert N; Hewitt, Chelsee A; McBean, Michelle; Westerman, David A; Dobrovic, Alexander
2013-01-01
The JAK2 V617F mutation is the most frequent somatic change in myeloproliferative neoplasms, making it an important tumour-specific marker for diagnostic purposes and for the detection of minimal residual disease. Sensitive quantitative assays are required for both applications, particularly for the monitoring of minimal residual disease, which requires not only high sensitivity but also very high specificity. We developed a highly sensitive probe-free quantitative mutant-allele detection method, Quantitative Threefold Allele-Specific PCR (QuanTAS-PCR), that is performed in a closed-tube system, thus eliminating the manipulation of PCR products. QuantTAS-PCR uses a threefold approach to ensure allele-specific amplification of the mutant sequence: (i) a mutant allele-specific primer, (ii) a 3′dideoxy blocker to suppress false-positive amplification from the wild-type template and (iii) a PCR specificity enhancer, also to suppress false-positive amplification from the wild-type template. Mutant alleles were quantified relative to exon 9 of JAK2. We showed that the addition of the 3′dideoxy blocker suppressed but did not eliminate false-positive amplification from the wild-type template. However, the addition of the PCR specificity enhancer near eliminated false-positive amplification from the wild-type allele. Further discrimination between true and false positives was enabled by using the quantification cycle (Cq) value of a single mutant template as a cut-off point, thus enabling robust distinction between true and false positives. As 10,000 JAK2 templates were used per replicate, the assay had a sensitivity of 1/10 -4 per replicate. Greater sensitivity could be reached by increasing the number of replicates analysed. Variation in replicates when low mutant-allele templates were present necessitated the use of a statistics-based approach to estimate the load of mutant JAK2 copies. QuanTAS-PCR showed comparable quantitative results when validated against a
Jansen, GJ; Wildeboer-Veloo, ACM; Tonk, RHJ; Franks, AH; Welling, G
An automated microscopy-based method using fluorescently labelled 16S rRNA-targeted oligonucleotide probes directed against the predominant groups of intestinal bacteria was developed and validated. The method makes use of the Leica 600HR. image analysis system, a Kodak MegaPlus camera model 1.4 and
RT-PCR Protocols - Methods in Molecular Biology
Directory of Open Access Journals (Sweden)
Manuela Monti
2011-03-01
Full Text Available “The first record I have of it, is when I made a computer file which I usually did whenever I had an idea, that would have been on the Monday when I got back, and I called it Chain Reaction.POL, meaning polymerase. That was the identifier for it and later I called the thing the Polymerase Chain Reaction, which a lot of people thought was a dumb name for it, but it stuck, and it became PCR”. With these words the Nobel prize winner, Kary Mullis, explains how he named the PCR: one of the most important techniques ever invented and currently used in molecular biology. This book “RT-PCR Protocols” covers a wide range of aspects important for the setting of a PCR experiment for both beginners and advanced users. In my opinion the book is very well structured in three different sections. The first one describes the different technologies now available, like competitive RT-PCR, nested RT-PCR or RT-PCR for cloning. An important part regards the usage of PCR in single cell mouse embryos, stressing how important...........
Fernandes-Monteiro, Alice G; Trindade, Gisela F; Yamamura, Anna M Y; Moreira, Otacilio C; de Paula, Vanessa S; Duarte, Ana Cláudia M; Britto, Constança; Lima, Sheila Maria B
2015-01-01
The development and production of viral vaccines, in general, involve several steps that need the monitoring of viral load throughout the entire process. Applying a 2-step quantitative reverse transcription real time PCR assay (RT-qPCR), viral load can be measured and monitored in a few hours. In this context, the development, standardization and validation of a RT-qPCR test to quickly and efficiently quantify yellow fever virus (YFV) in all stages of vaccine production are extremely important. To serve this purpose we used a plasmid construction containing the NS5 region from 17DD YFV to generate the standard curve and to evaluate parameters such as linearity, precision and specificity against other flavivirus. Furthermore, we defined the limits of detection as 25 copies/reaction, and quantification as 100 copies/reaction for the test. To ensure the quality of the method, reference controls were established in order to avoid false negative results. The qRT-PCR technique based on the use of TaqMan probes herein standardized proved to be effective for determining yellow fever viral load both in vivo and in vitro, thus becoming a very important tool to assure the quality control for vaccine production and evaluation of viremia after vaccination or YF disease.
Shin, Saeam; Kim, Juwon; Kim, Yoonjung; Cho, Sun-Mi; Lee, Kyung-A
2017-10-26
EGFR mutation is an emerging biomarker for treatment selection in non-small-cell lung cancer (NSCLC) patients. However, optimal mutation detection is hindered by complications associated with the biopsy procedure, tumor heterogeneity and limited sensitivity of test methodology. In this study, we evaluated the diagnostic utility of real-time PCR using malignant pleural effusion samples. A total of 77 pleural fluid samples from 77 NSCLC patients were tested using the cobas EGFR mutation test (Roche Molecular Systems). Pleural fluid was centrifuged, and separated cell pellets and supernatants were tested in parallel. Results were compared with Sanger sequencing and/or peptide nucleic acid (PNA)-mediated PCR clamping of matched tumor tissue or pleural fluid samples. All samples showed valid real-time PCR results in one or more DNA samples extracted from cell pellets and supernatants. Compared with other molecular methods, the sensitivity of real-time PCR method was 100%. Concordance rate of real-time PCR and Sanger sequencing plus PNA-mediated PCR clamping was 98.7%. We have confirmed that real-time PCR using pleural fluid had a high concordance rate compared to conventional methods, with no failed samples. Our data demonstrated that the parallel real-time PCR testing using supernatant and cell pellet could offer reliable and robust surrogate strategy when tissue is not available.
Komaki-Yasuda, Kanako; Vincent, Jeanne Perpétue; Nakatsu, Masami; Kato, Yasuyuki; Ohmagari, Norio
2018-01-01
A microscopy-based diagnosis is the gold standard for the detection and identification of malaria parasites in a patient’s blood. However, the detection of cases involving a low number of parasites and the differentiation of species sometimes requires a skilled microscopist. Although PCR-based diagnostic methods are already known to be very powerful tools, the time required to apply such methods is still much longer in comparison to traditional microscopic observation. Thus, improvements to PCR systems are sought to facilitate the more rapid and accurate detection of human malaria parasites Plasmodium falciparum, P. vivax, P. ovale, and P. malariae, as well as P. knowlesi, which is a simian malaria parasite that is currently widely distributed in Southeast Asia. A nested PCR that targets the small subunit ribosomal RNA genes of malaria parasites was performed using a “fast PCR enzyme”. In the first PCR, universal primers for all parasite species were used. In the second PCR, inner-specific primers, which targeted sequences from P. falciparum, P. vivax, P. ovale, P. malariae, and P. knowlesi, were used. The PCR reaction time was reduced with the use of the “fast PCR enzyme”, with only 65 minutes required to perform the first and second PCRs. The specific primers only reacted with the sequences of their targeted parasite species and never cross-reacted with sequences from other species under the defined PCR conditions. The diagnoses of 36 clinical samples that were obtained using this new PCR system were highly consistent with the microscopic diagnoses. PMID:29370297
Directory of Open Access Journals (Sweden)
Kanako Komaki-Yasuda
Full Text Available A microscopy-based diagnosis is the gold standard for the detection and identification of malaria parasites in a patient's blood. However, the detection of cases involving a low number of parasites and the differentiation of species sometimes requires a skilled microscopist. Although PCR-based diagnostic methods are already known to be very powerful tools, the time required to apply such methods is still much longer in comparison to traditional microscopic observation. Thus, improvements to PCR systems are sought to facilitate the more rapid and accurate detection of human malaria parasites Plasmodium falciparum, P. vivax, P. ovale, and P. malariae, as well as P. knowlesi, which is a simian malaria parasite that is currently widely distributed in Southeast Asia. A nested PCR that targets the small subunit ribosomal RNA genes of malaria parasites was performed using a "fast PCR enzyme". In the first PCR, universal primers for all parasite species were used. In the second PCR, inner-specific primers, which targeted sequences from P. falciparum, P. vivax, P. ovale, P. malariae, and P. knowlesi, were used. The PCR reaction time was reduced with the use of the "fast PCR enzyme", with only 65 minutes required to perform the first and second PCRs. The specific primers only reacted with the sequences of their targeted parasite species and never cross-reacted with sequences from other species under the defined PCR conditions. The diagnoses of 36 clinical samples that were obtained using this new PCR system were highly consistent with the microscopic diagnoses.
Luo, Xiao-Feng; Jiao, Jian-Hua; Zhang, Wen-Yue; Pu, Han-Ming; Qu, Bao-Jin; Yang, Bing-Ya; Hou, Min; Ji, Min-Jun
2016-07-07
To investigate clarithromycin resistance positions 2142, 2143 and 2144 of the 23SrRNA gene in Helicobacter pylori (H. pylori) by nested-allele specific primer-polymerase chain reaction (nested-ASP-PCR). The gastric tissue and saliva samples from 99 patients with positive results of the rapid urease test (RUT) were collected. The nested-ASP-PCR method was carried out with the external primers and inner allele-specific primers corresponding to the reference strain and clinical strains. Thirty gastric tissue and saliva samples were tested to determine the sensitivity of nested-ASP-PCR and ASP-PCR methods. Then, clarithromycin resistance was detected for 99 clinical samples by using different methods, including nested-ASP-PCR, bacterial culture and disk diffusion. The nested-ASP-PCR method was successfully established to test the resistance mutation points 2142, 2143 and 2144 of the 23SrRNA gene of H. pylori. Among 30 samples of gastric tissue and saliva, the H. pylori detection rate of nested-ASP-PCR was 90% and 83.33%, while the detection rate of ASP-PCR was just 63% and 56.67%. Especially in the saliva samples, nested-ASP-PCR showed much higher sensitivity in H. pylori detection and resistance mutation rates than ASP-PCR. In the 99 RUT-positive gastric tissue and saliva samples, the H. pylori-positive detection rate by nested-ASP-PCR was 87 (87.88%) and 67 (67.68%), in which there were 30 wild-type and 57 mutated strains in gastric tissue and 22 wild-type and 45 mutated strains in saliva. Genotype analysis showed that three-points mixed mutations were quite common, but different resistant strains were present in gastric mucosa and saliva. Compared to the high sensitivity shown by nested-ASP-PCR, the positive detection of bacterial culture with gastric tissue samples was 50 cases, in which only 26 drug-resistant strains were found through analyzing minimum inhibitory zone of clarithromycin. The nested-ASP-PCR assay showed higher detection sensitivity than ASP-PCR and
Internal quality control of PCR-based genotyping methods in research studies and patient diagnostics
DEFF Research Database (Denmark)
Bladbjerg, Else-Marie; Gram, Jørgen; Jespersen, Jørgen
2002-01-01
Genetic analyses are increasingly integrated in the clinical laboratory, and internal quality control programmes are needed. We have focused on quality control aspects of selected polymorphism analyses used in thrombosis research. DNA was isolated from EDTA-blood (n = 500) by ammonium acetate....... Control of data handling revealed 0.1% reading mistakes and 0.5% entry mistakes. Based on our experiences we propose an internal quality control programme for widely used PCR-based haemostasis polymorphism analyses.......-isolation (pre-analytical factors), DNA-amplification, digestion with restriction enzymes, electrophoresis (analytical factors), result reading and entry into a database (post-analytical factors). Furthermore, we evaluated a procedure for result confirmation. Isolated DNA was of good quality (42 microg/ml blood...
Directory of Open Access Journals (Sweden)
Izabela Ruduś
Full Text Available Molecular studies of primary and secondary dormancy in Avena fatua L., a serious weed of cereal and other crops, are intended to reveal the species-specific details of underlying molecular mechanisms which in turn may be useable in weed management. Among others, quantitative real-time PCR (RT-qPCR data of comparative gene expression analysis may give some insight into the involvement of particular wild oat genes in dormancy release, maintenance or induction by unfavorable conditions. To assure obtaining biologically significant results using this method, the expression stability of selected candidate reference genes in different data subsets was evaluated using four statistical algorithms i.e. geNorm, NormFinder, Best Keeper and ΔCt method. Although some discrepancies in their ranking outputs were noticed, evidently two ubiquitin-conjugating enzyme homologs, AfUBC1 and AfUBC2, as well as one homolog of glyceraldehyde 3-phosphate dehydrogenase AfGAPDH1 and TATA-binding protein AfTBP2 appeared as more stably expressed than AfEF1a (translation elongation factor 1α, AfGAPDH2 or the least stable α-tubulin homolog AfTUA1 in caryopses and seedlings of A. fatua. Gene expression analysis of a dormancy-related wild oat transcription factor VIVIPAROUS1 (AfVP1 allowed for a validation of candidate reference genes performance. Based on the obtained results it can be recommended that the normalization factor calculated as a geometric mean of Cq values of AfUBC1, AfUBC2 and AfGAPDH1 would be optimal for RT-qPCR results normalization in the experiments comprising A. fatua caryopses of different dormancy status.
Ruduś, Izabela; Kępczyński, Jan
2018-01-01
Molecular studies of primary and secondary dormancy in Avena fatua L., a serious weed of cereal and other crops, are intended to reveal the species-specific details of underlying molecular mechanisms which in turn may be useable in weed management. Among others, quantitative real-time PCR (RT-qPCR) data of comparative gene expression analysis may give some insight into the involvement of particular wild oat genes in dormancy release, maintenance or induction by unfavorable conditions. To assure obtaining biologically significant results using this method, the expression stability of selected candidate reference genes in different data subsets was evaluated using four statistical algorithms i.e. geNorm, NormFinder, Best Keeper and ΔCt method. Although some discrepancies in their ranking outputs were noticed, evidently two ubiquitin-conjugating enzyme homologs, AfUBC1 and AfUBC2, as well as one homolog of glyceraldehyde 3-phosphate dehydrogenase AfGAPDH1 and TATA-binding protein AfTBP2 appeared as more stably expressed than AfEF1a (translation elongation factor 1α), AfGAPDH2 or the least stable α-tubulin homolog AfTUA1 in caryopses and seedlings of A. fatua. Gene expression analysis of a dormancy-related wild oat transcription factor VIVIPAROUS1 (AfVP1) allowed for a validation of candidate reference genes performance. Based on the obtained results it can be recommended that the normalization factor calculated as a geometric mean of Cq values of AfUBC1, AfUBC2 and AfGAPDH1 would be optimal for RT-qPCR results normalization in the experiments comprising A. fatua caryopses of different dormancy status.
Presently there is no established cell line or small animal model that allows for the detection of infectious human norovirus. Current methods based on RT-PCR and RT-qPCR detect both infectious and non-infectious virus and thus the conclusions that may be drawn regarding the publ...
Directory of Open Access Journals (Sweden)
David Metzgar
Full Text Available In 2007, the Centers for Disease Control and Prevention (CDC reported that Human adenovirus type 14 (HAdV-14 infected 106 military personnel and was responsible for the death of one U.S. soldier at Lackland Air Force Base in Texas. Identification of the responsible adenovirus, which had not previously been seen in North America and for which rapid diagnostic tools were unavailable, required retrospective analysis at reference laboratories. Initial quarantine measures were also reliant on relatively slow traditional PCR analysis at other locations. To address this problem, we developed a real-time PCR assay that detects a 225 base pair sequence in the HAdV-14a hexon gene. Fifty-one oropharyngeal swab specimens from the Naval Health Research Center, San Diego, CA and Advanced Diagnostic Laboratory, Lackland AFB, TX were used to validate the new assay. The described assay detected eight of eight and 19 of 19 confirmed HAdV-14a clinical isolates in two separate cohorts from respiratory disease outbreaks. The real-time PCR assay had a wide dynamic range, detecting from 10(2 to 10(7 copies of genomic DNA per reaction. The assay did not cross-react with other adenoviruses, influenza, respiratory syncytial virus, or common respiratory tract bacteria. The described assay is easy to use, sensitive and specific for HAdV-14a in clinical throat swab specimens, and very rapid since turnaround time is less than four hours to obtain an answer.
A multiplex PCR method for rapid identification of Brachionus rotifers.
Vasileiadou, Kalliopi; Papakostas, Spiros; Triantafyllidis, Alexander; Kappas, Ilias; Abatzopoulos, Theodore J
2009-01-01
Cryptic species are increasingly being recognized in many organisms. In Brachionus rotifers, many morphologically similar yet genetically distinct species/biotypes have been described. A number of Brachionus cryptic species have been recognized among hatchery strains. In this study, we present a simple, one-step genetic method to detect the presence of those Brachionus sp. rotifers that have been found in hatcheries. With the proposed technique, each of the B. plicatilis sensu stricto, B. ibericus, Brachionus sp. Nevada, Brachionus sp. Austria, Brachionus sp. Manjavacas, and Brachionus sp. Cayman species and/or biotypes can be identified with polymerase chain reaction (PCR) analysis. Based on 233 cytochrome c oxidase subunit I sequences, we reviewed all the available cryptic Brachionus sp. genetic polymorphisms, and we designed six nested primers. With these primers, a specific amplicon of distinct size is produced for every one of the involved species/biotypes. Two highly sensitive protocols were developed for using the primers. Many of the primers can be combined in the same PCR. The proposed method has been found to be an effective and practical tool to investigate the presence of the above six cryptic species/biotypes in both individual and communal (bulk) rotifer deoxyribonucleic acid extractions from hatcheries. With this technique, hatchery managers could easily determine their rotifer composition at the level of cryptic species and monitor their cultures more efficiently.
DEFF Research Database (Denmark)
Woudstra, C.; Skarin, H.; Anniballi, F.
2013-01-01
Two real-time PCR arrays based on the GeneDisc® cycler platform (Pall-GeneDisc Technologies) were evaluated in a multicenter collaborative trial for their capacity to specifically detect and discriminate Clostridium botulinum types C, D and their mosaic variants C-D and D-C that are associated wi...
DEFF Research Database (Denmark)
Ottesen, A M; Garn, I D; Aksglaede, L
2007-01-01
Due to the high prevalence and variable phenotype of patients with Klinefelter syndrome, there is a need for a robust and rapid screening method allowing early diagnosis. Here, we report on the development and detailed clinical validation of a quantitative real-time PCR (qPCR)-based method...... of the copy number assessment of the androgen receptor (AR) gene, located to Xq11.2-q12. We analysed samples from 50 individuals, including a healthy male and female controls and patients with Klinefelter syndrome (47,XXY; 48,XXXY) (n = 28), mosaicisms (46,XX/47,XXY/48XXYY; 45,X/46,XY) (n = 3), other sex......-gene expression. The XIST-expression based assay was correct in only 29/36 samples (81%). Our findings demonstrated that the AR-qPCR technique is a simple and reliable screening method for diagnosis of patients with Klinefelter syndrome or other chromosomal disorders involving an aberrant number of X-chromosomes....
DEFF Research Database (Denmark)
Schmidt, Gunilla Veslemøy; Mellerup, Anders; Christiansen, Lasse Engbo
2015-01-01
The aim of this article was to define the sampling level and method combination that captures antibiotic resistance at pig herd level utilizing qPCR antibiotic resistance gene quantification and culture-based quantification of antibiotic resistant coliform indicator bacteria. Fourteen qPCR assays...... for commonly detected antibiotic resistance genes were developed, and used to quantify antibiotic resistance genes in total DNA from swine fecal samples that were obtained using different sampling and pooling methods. In parallel, the number of antibiotic resistant coliform indicator bacteria was determined...... when comparing individual sampling and pooling methods. qPCR on pooled samples was found to be a good representative for the general resistance level in a pig herd compared to the coliform CFU counts. It had significantly reduced relative standard deviations compared to coliform CFU counts in the same...
Colony-PCR Is a Rapid Method for DNA Amplification of Hyphomycetes
Directory of Open Access Journals (Sweden)
Georg Walch
2016-04-01
Full Text Available Fungal pure cultures identified with both classical morphological methods and through barcoding sequences are a basic requirement for reliable reference sequences in public databases. Improved techniques for an accelerated DNA barcode reference library construction will result in considerably improved sequence databases covering a wider taxonomic range. Fast, cheap, and reliable methods for obtaining DNA sequences from fungal isolates are, therefore, a valuable tool for the scientific community. Direct colony PCR was already successfully established for yeasts, but has not been evaluated for a wide range of anamorphic soil fungi up to now, and a direct amplification protocol for hyphomycetes without tissue pre-treatment has not been published so far. Here, we present a colony PCR technique directly from fungal hyphae without previous DNA extraction or other prior manipulation. Seven hundred eighty-eight fungal strains from 48 genera were tested with a success rate of 86%. PCR success varied considerably: DNA of fungi belonging to the genera Cladosporium, Geomyces, Fusarium, and Mortierella could be amplified with high success. DNA of soil-borne yeasts was always successfully amplified. Absidia, Mucor, Trichoderma, and Penicillium isolates had noticeably lower PCR success.
DEFF Research Database (Denmark)
Søndergaard, Mette Sofie Rousing; Löfström, Charlotta; Al-Habib, Zahra Fares Sayer
DNA extractions and intermediate or bad with the crude extractions, while TaKaRa ExTaq HS only performed well with the purest extractions of fecal samples and intermediate with semi-automated magnetic beads based extracted fecal samples. In conclusion, our data shows that exchanging the DNA polymerase......Diagnostic analyses of foodborne pathogens are increasingly based on molecular methods such as PCR, which can improve the sensitivity and reduce the analysis time. The core of PCR is the enzyme performing the reaction: the DNA polymerase. Changing the polymerase can influence the sensitivity...... commercially available polymerases and four master mixes in two validated PCR assays, for Campylobacter and Salmonella, respectively, to develop more sensitive, robust and cost effective assays. The polymerases were screened on purified DNA and the five best performing, for each PCR assay, were then applied...
Carvalho, G M L; Rêgo, F D; Tanure, A; Silva, A C P; Dias, T A; Paz, G F; Andrade Filho, J D
2017-07-01
PCR-based identification of vertebrate host bloodmeals has been performed on several vectors species with success. In the present study, we used a previously published PCR protocol followed by DNA sequencing based on primers designed from multiple alignments of the mitochondrial cytochrome b gene used to identify avian and mammalian hosts of various hematophagous vectors. The amplification of a fragment encoding a 359 bp sequence of the Cyt b gene yielded recognized amplification products in 192 female sand flies (53%), from a total of 362 females analyzed. In the study area of Casa Branca, Brazil, blood-engorged female sand flies such as Lutzomyia longipalpis (Lutz & Neiva, 1912), Migonemyia migonei (França, 1924), and Nyssomyia whitmani (Antunes & Coutinho, 1939) were analyzed for bloodmeal sources. The PCR-based method identified human, dog, chicken, and domestic rat blood sources. © The Authors 2017. Published by Oxford University Press on behalf of Entomological Society of America. All rights reserved. For Permissions, please email: journals.permissions@oup.com.
Directory of Open Access Journals (Sweden)
Jeni Vuong
Full Text Available Neisseria meningitidis (Nm, Haemophilus influenzae (Hi, and Streptococcus pneumoniae (Sp are the lead causes of bacterial meningitis. Detection of these pathogens from clinical specimens using traditional real-time PCR (rt-PCR requires DNA extraction to remove the PCR inhibitors prior to testing, which is time consuming and labor intensive. In this study, five species-specific (Nm-sodC and -ctrA, Hi-hpd#1 and -hpd#3 and Sp-lytA and six serogroup-specific rt-PCR tests (A, B, C, W, X, Y targeting Nm capsular genes were evaluated in the two direct rt-PCR methods using PerfeCTa and 5x Omni that do not require DNA extraction. The sensitivity and specify of the two direct rt-PCR methods were compared to TaqMan traditional rt-PCR, the current standard rt-PCR method for the detection of meningitis pathogens. The LLD for all 11 rt-PCR tests ranged from 6,227 to 272,229 CFU/ml for TaqMan, 1,824-135,982 for 5x Omni, and 168-6,836 CFU/ml for PerfeCTa. The diagnostic sensitivity using TaqMan ranged from 89.2%-99.6%, except for NmB-csb, which was 69.7%. For 5x Omni, the sensitivity varied from 67.1% to 99.8%, with three tests below 90%. The sensitivity of these tests using PerfeCTa varied from 89.4% to 99.8%. The specificity ranges of the 11 tests were 98.0-99.9%, 97.5-99.9%, and 92.9-99.9% for TaqMan, 5x Omni, and PerfeCTa, respectively. PerfeCTa direct rt-PCR demonstrated similar or better sensitivity compared to 5x Omni direct rt-PCR or TaqMan traditional rt-PCR. Since the direct rt-PCR method does not require DNA extraction, it reduces the time and cost for processing CSF specimens, increases testing throughput, decreases the risk of cross-contamination, and conserves precious CSF. The direct rt-PCR method will be beneficial to laboratories with high testing volume.
Kassam-Adams, Nancy; Marsac, Meghan L; Kohser, Kristen L; Kenardy, Justin A; March, Sonja; Winston, Flaura K
2015-04-15
The advent of eHealth interventions to address psychological concerns and health behaviors has created new opportunities, including the ability to optimize the effectiveness of intervention activities and then deliver these activities consistently to a large number of individuals in need. Given that eHealth interventions grounded in a well-delineated theoretical model for change are more likely to be effective and that eHealth interventions can be costly to develop, assuring the match of final intervention content and activities to the underlying model is a key step. We propose to apply the concept of "content validity" as a crucial checkpoint to evaluate the extent to which proposed intervention activities in an eHealth intervention program are valid (eg, relevant and likely to be effective) for the specific mechanism of change that each is intended to target and the intended target population for the intervention. The aims of this paper are to define content validity as it applies to model-based eHealth intervention development, to present a feasible method for assessing content validity in this context, and to describe the implementation of this new method during the development of a Web-based intervention for children. We designed a practical 5-step method for assessing content validity in eHealth interventions that includes defining key intervention targets, delineating intervention activity-target pairings, identifying experts and using a survey tool to gather expert ratings of the relevance of each activity to its intended target, its likely effectiveness in achieving the intended target, and its appropriateness with a specific intended audience, and then using quantitative and qualitative results to identify intervention activities that may need modification. We applied this method during our development of the Coping Coach Web-based intervention for school-age children. In the evaluation of Coping Coach content validity, 15 experts from five countries
Cross-Validation of Survival Bump Hunting by Recursive Peeling Methods.
Dazard, Jean-Eudes; Choe, Michael; LeBlanc, Michael; Rao, J Sunil
2014-08-01
We introduce a survival/risk bump hunting framework to build a bump hunting model with a possibly censored time-to-event type of response and to validate model estimates. First, we describe the use of adequate survival peeling criteria to build a survival/risk bump hunting model based on recursive peeling methods. Our method called "Patient Recursive Survival Peeling" is a rule-induction method that makes use of specific peeling criteria such as hazard ratio or log-rank statistics. Second, to validate our model estimates and improve survival prediction accuracy, we describe a resampling-based validation technique specifically designed for the joint task of decision rule making by recursive peeling (i.e. decision-box) and survival estimation. This alternative technique, called "combined" cross-validation is done by combining test samples over the cross-validation loops, a design allowing for bump hunting by recursive peeling in a survival setting. We provide empirical results showing the importance of cross-validation and replication.
[A Duplex PCR Method for Detection of Babesia caballi and Theileria equi].
Zhang, Yang; Zhang, Yu-ting; Wang, Zhen-bao; Bolati; Li, Hai; Bayinchahan
2015-04-01
To develop a duplex PCR assay for detection of Babesia caballi and Theileria equi. Two pairs of primers were designed according to the BC48 gene of B. caballi and 18 s rRNA gene of T. equi, and a duplex PCR assay was developed by the optimization of reaction conditions. The specificity, sensitivity and reliability of the method were tested. The horse blood samples of suspected cases were collected from Yili region, and detected by the duplex PCR, microspopy, conventional PCR, and fluorescence quantitative PCR, and the results were compared. Using the duplex PCR assay, the specific fragments of 155 bp and 280 bp were amplified from DNA samples of B. caballi and T. equi, respectively. No specific fragment was amplified from DNA samples of B. bigemina, Theilerdia annulata, Theilerdia sergenti, Toxoplasma gondii, Neospora caninum, and Trypanosoma evansi. The limit of detection was 4.85 x 10(5) copies/L for B. caballi DNA and 4.85 x 10(4) copies/µl for T. equi DNA, respectively. Among the 24 blood samples, 11 were found B. caballi-positive by the duplex PCR assay, and 18 were T. equi-positive. The coincidence rate of microscopy, conventional PCR, and fluorescence quantitative PCR with duplex PCR was 91.7% (22/24), 95.8% (23/24), and 95.8% (23/24), respectively. A duplex PCR assay for simultaneous detection of B. caballi and T. equi is established.
Takabatake, Reona; Akiyama, Hiroshi; Sakata, Kozue; Onishi, Mari; Koiwa, Tomohiro; Futo, Satoshi; Minegishi, Yasutaka; Teshima, Reiko; Mano, Junichi; Furui, Satoshi; Kitta, Kazumi
2011-01-01
A novel real-time PCR-based analytical method was developed for the event-specific quantification of a genetically modified (GM) soybean event; A2704-12. During the plant transformation, DNA fragments derived from pUC19 plasmid were integrated in A2704-12, and the region was found to be A2704-12 specific. The pUC19-derived DNA sequences were used as primers for the specific detection of A2704-12. We first tried to construct a standard plasmid for A2704-12 quantification using pUC19. However, non-specific signals appeared with both qualitative and quantitative PCR analyses using the specific primers with pUC19 as a template, and we then constructed a plasmid using pBR322. The conversion factor (C(f)), which is required to calculate the amount of the genetically modified organism (GMO), was experimentally determined with two real-time PCR instruments, the Applied Biosystems 7900HT and the Applied Biosystems 7500. The determined C(f) values were both 0.98. The quantitative method was evaluated by means of blind tests in multi-laboratory trials using the two real-time PCR instruments. The limit of quantitation for the method was estimated to be 0.1%. The trueness and precision were evaluated as the bias and reproducibility of relative standard deviation (RSD(R)), and the determined bias and RSD(R) values for the method were each less than 20%. These results suggest that the developed method would be suitable for practical analyses for the detection and quantification of A2704-12.
A novel method for detection of dioxins. Exonuclease protection mediated PCR assay
Energy Technology Data Exchange (ETDEWEB)
Xu, S.Q.; Sun, X.; Li, F.; Li, B.S. [Huazhong Univ. of Science and Technology, Wuhan, HB (China). Tongji Medical College
2004-09-15
The aromatic hydrocarbon receptor (AhR) is a ligand-actived transcription factor that mediates many of the biologic and toxicologic effects of dioxin-like chemicals (DLCs), such as 2,3,7,8- tetrachlorodibenzo-p-dioxin (TCDD). Numerous AhR-based bioassays for identification and detection of DLCs have been developed in vitro. Such as the chemical-activated luciferase gene expression (CALUX), ethoxyresolufin-O-deethylase (EROD) activity are sometimes represented as the next best system when compared with whole body or in vivo systems. However, cell systems can be affected by the toxic chemical itself during the assay, thus confusing problems couldn't be avoided in the assay. Incorporation of metabolism in cell systems with uncertain consequences prolongs assay complexity and time. Thus these drawbacks limit the utility of cell systems for screening purposes. Most cell-free bioassays require radioactivity, such as the gel retardation of AhR binding (GRAB) assay, or antibody of AhR or ligand, which are unfeasible for some laboratories. Here a cell-free bioanalysis method, Exonuclease Protection Mediated PCR (EPM-PCR) bioassay, was established for detection of AhR ligands based on the binding of the dioxin:AhR complex to the specific DNA. EPM-PCR can provide indirect detection of ligands by quantification of the specific AhR-binding DNA, no necessary of any DNA labeling and sophisticated equipments. This new bioassay not only has the higher sensitivity and specificity, but it is rapid and easy to perform.
Aase, Audun; Hajdusek, Ondrej; Øines, Øivind; Quarsten, Hanne; Wilhelmsson, Peter; Herstad, Tove K; Kjelland, Vivian; Sima, Radek; Jalovecka, Marie; Lindgren, Per-Eric; Aaberge, Ingeborg S
2016-01-01
A modified microscopy protocol (the LM-method) was used to demonstrate what was interpreted as Borrelia spirochetes and later also Babesia sp., in peripheral blood from patients. The method gained much publicity, but was not validated prior to publication, which became the purpose of this study using appropriate scientific methodology, including a control group. Blood from 21 patients previously interpreted as positive for Borrelia and/or Babesia infection by the LM-method and 41 healthy controls without known history of tick bite were collected, blinded and analysed for these pathogens by microscopy in two laboratories by the LM-method and conventional method, respectively, by PCR methods in five laboratories and by serology in one laboratory. Microscopy by the LM-method identified structures claimed to be Borrelia- and/or Babesia in 66% of the blood samples of the patient group and in 85% in the healthy control group. Microscopy by the conventional method for Babesia only did not identify Babesia in any samples. PCR analysis detected Borrelia DNA in one sample of the patient group and in eight samples of the control group; whereas Babesia DNA was not detected in any of the blood samples using molecular methods. The structures interpreted as Borrelia and Babesia by the LM-method could not be verified by PCR. The method was, thus, falsified. This study underlines the importance of doing proper test validation before new or modified assays are introduced.
Bisset, S A; Knight, J S; Bouchet, C L G
2014-02-24
A multiplex PCR-based method was developed to overcome the limitations of microscopic examination as a means of identifying individual infective larvae from the wide range of strongylid parasite species commonly encountered in sheep in mixed sheep-cattle grazing situations in New Zealand. The strategy employed targets unique species-specific sequence markers in the second internal transcribed spacer (ITS-2) region of ribosomal DNA of the nematodes and utilises individual larval lysates as reaction templates. The basic assay involves two sets of reactions designed to target the ten strongylid species most often encountered in ovine faecal cultures under New Zealand conditions (viz. Haemonchus contortus, Teladorsagia circumcincta, Trichostrongylus axei, Trichostrongylus colubriformis, Trichostrongylus vitrinus, Cooperia curticei, Cooperia oncophora, Nematodirus spathiger, Chabertia ovina, and Oesophagostomum venulosum). Five species-specific primers, together with a pair of "generic" (conserved) primers, are used in each of the reactions. Two products are generally amplified, one by the generic primer pair regardless of species (providing a positive PCR control) and the other (whose size is indicative of the species present) by the appropriate species-specific primer in combination with one or other of the generic primers. If necessary, any larvae not identified by these reactions can subsequently be tested using primers designed specifically to detect those species less frequently encountered in ovine faecal cultures (viz. Ostertagia ostertagi, Ostertagia leptospicularis, Cooperia punctata, Nematodirus filicollis, and Bunostomum trigonocephalum). Results of assays undertaken on >5500 nematode larvae cultured from lambs on 16 different farms distributed throughout New Zealand indicated that positive identifications were initially obtained for 92.8% of them, while a further 4.4% of reactions gave a generic but no visible specific product and 2.8% gave no discernible
Directory of Open Access Journals (Sweden)
Bárbara Angulo
Full Text Available The objective of this study is to compare two EGFR testing methodologies (a commercial real-time PCR kit and a specific EGFR mutant immunohistochemistry, with direct sequencing and to investigate the limit of detection (LOD of both PCR-based methods. We identified EGFR mutations in 21 (16% of the 136 tumours analyzed by direct sequencing. Interestingly, the Therascreen EGFR Mutation Test kit was able to characterize as wild-type one tumour that could not be analyzed by direct sequencing of the PCR product. We then compared the LOD of the kit and that of direct sequencing using the available mutant tumours. The kit was able to detect the presence of a mutation in a 1% dilution of the total DNA in nine of the 18 tumours (50%, which tested positive with the real-time quantitative PCR method. In all cases, EGFR mutation was identified at a dilution of 5%. Where the mutant DNA represented 30% of the total DNA, sequencing was able to detect mutations in 12 out of 19 cases (63%. Additional experiments with genetically defined standards (EGFR ΔE746-A750/+ and EGFR L858R/+ yielded similar results. Immunohistochemistry (IHC staining with exon 19-specific antibody was seen in eight out of nine cases with E746-A750del detected by direct sequencing. Neither of the two tumours with complex deletions were positive. Of the five L858R-mutated tumours detected by the PCR methods, only two were positive for the exon 21-specific antibody. The specificity was 100% for both antibodies. The LOD of the real-time PCR method was lower than that of direct sequencing. The mutation specific IHC produced excellent specificity.
2014-01-01
Background Gene expression analysis using quantitative reverse transcription PCR (qRT-PCR) is a robust method wherein the expression levels of target genes are normalised using internal control genes, known as reference genes, to derive changes in gene expression levels. Although reference genes have recently been suggested for olive tissues, combined/independent analysis on different cultivars has not yet been tested. Therefore, an assessment of reference genes was required to validate the recent findings and select stably expressed genes across different olive cultivars. Results A total of eight candidate reference genes [glyceraldehyde 3-phosphate dehydrogenase (GAPDH), serine/threonine-protein phosphatase catalytic subunit (PP2A), elongation factor 1 alpha (EF1-alpha), polyubiquitin (OUB2), aquaporin tonoplast intrinsic protein (TIP2), tubulin alpha (TUBA), 60S ribosomal protein L18-3 (60S RBP L18-3) and polypyrimidine tract-binding protein homolog 3 (PTB)] were chosen based on their stability in olive tissues as well as in other plants. Expression stability was examined by qRT-PCR across 12 biological samples, representing mesocarp tissues at various developmental stages in three different olive cultivars, Barnea, Frantoio and Picual, independently and together during the 2009 season with two software programs, GeNorm and BestKeeper. Both software packages identified GAPDH, EF1-alpha and PP2A as the three most stable reference genes across the three cultivars and in the cultivar, Barnea. GAPDH, EF1-alpha and 60S RBP L18-3 were found to be most stable reference genes in the cultivar Frantoio while 60S RBP L18-3, OUB2 and PP2A were found to be most stable reference genes in the cultivar Picual. Conclusions The analyses of expression stability of reference genes using qRT-PCR revealed that GAPDH, EF1-alpha, PP2A, 60S RBP L18-3 and OUB2 are suitable reference genes for expression analysis in developing Olea europaea mesocarp tissues, displaying the highest level
Suñén, Ester; Casas, Nerea; Moreno, Belén; Zigorraga, Carmen
2004-03-01
The detection of hepatitis A virus in shellfish by reverse transcription-nested polymerase chain reaction (RT-nested PCR) is hampered mainly by low levels of virus contamination and PCR inhibitors in shellfish. In this study, we focused on getting a rapid and sensitive processing procedure for the detection of HAV by RT-nested PCR in clam samples (Tapes spp.). Two previously developed processing methods for virus concentration in shellfish have been improved upon and compared. The first method involves acid adsorption, elution, polyethylene glycol (PEG) precipitation, chloroform extraction and PEG precipitation. The second method is based on elution with a glycine buffer at pH 10, chloroform extraction and concentration by ultracentrifugation. Final clam concentrates were processed by RNA extraction or immunomagnetic capture of viruses (IMC) before the RT-nested PCR reaction. Both methods of sample processing combined with the RNA extraction from the concentrates were very efficient when they were assayed in seeded and naturally contaminated samples. The results show that the first method was more effective in removal inhibitors and the second was simpler and faster. The IMC of HAV from clam concentrates processed by method 1 was revealed to be a very effective method of simultaneously removing residual PCR inhibitors and of concentrating the virus.
Collier, Jackie L; Fitzgerald, Sean P; Hice, Lyndie A; Frisk, Michael G; McElroy, Anne E
2014-01-01
Winter flounder (Pseudopleuronectes americanus) once supported robust commercial and recreational fisheries in the New York (USA) region, but since the 1990s populations have been in decline. Available data show that settlement of young-of-the-year winter flounder has not declined as sharply as adult abundance, suggesting that juveniles are experiencing higher mortality following settlement. The recent increase of blue crab (Callinectes sapidus) abundance in the New York region raises the possibility that new sources of predation may be contributing to juvenile winter flounder mortality. To investigate this possibility we developed and validated a method to specifically detect winter flounder mitochondrial control region DNA sequences in the gut contents of blue crabs. A survey of 55 crabs collected from Shinnecock Bay (along the south shore of Long Island, New York) in July, August, and September of 2011 showed that 12 of 42 blue crabs (28.6%) from which PCR-amplifiable DNA was recovered had consumed winter flounder in the wild, empirically supporting the trophic link between these species that has been widely speculated to exist. This technique overcomes difficulties with visual identification of the often unrecognizable gut contents of decapod crustaceans, and modifications of this approach offer valuable tools to more broadly address their feeding habits on a wide variety of species.
Validation of the performance of a GMO multiplex screening assay based on microarray detection
Leimanis, S.; Hamels, S.; Naze, F.; Mbongolo, G.; Sneyers, M.; Hochegger, R.; Broll, H.; Roth, L.; Dallmann, K.; Micsinai, A.; Dijk, van J.P.; Kok, E.J.
2008-01-01
A new screening method for the detection and identification of GMO, based on the use of multiplex PCR followed by microarray, has been developed and is presented. The technology is based on the identification of quite ubiquitous GMO genetic target elements first amplified by PCR, followed by direct
A rapid PCR-based approach for molecular identification of filamentous fungi.
Chen, Yuanyuan; Prior, Bernard A; Shi, Guiyang; Wang, Zhengxiang
2011-08-01
In this study, a novel rapid and efficient DNA extraction method based on alkaline lysis, which can deal with a large number of filamentous fungal isolates in the same batch, was established. The filamentous fungal genomic DNA required only 20 min to prepare and can be directly used as a template for PCR amplification. The amplified internal transcribed spacer regions were easy to identify by analysis. The extracted DNA also can be used to amplify other protein-coding genes for fungal identification. This method can be used for rapid systematic identification of filamentous fungal isolates.
Application of PCR-DGGE method for identification of nematode communities in pepper growing soil
Nguyen, Thi Phuong; Ha, Duy Ngo; Nguyen, Huu Hung; Duong, Duc Hieu
2017-01-01
Soil nematodes play an important role in indication for assessing soil environments and ecosystems. Previous studies of nematode community analyses based on molecular identification have shown to be useful for assessing soil environments. Here we applied PCR-DGGE method for molecular analysis of five soil nematode communities (designed as S1 to S5) collected from four provinces in Southeastern Vietnam (Binh Duong, Ba Ria Vung Tau, Binh Phuoc and Dong Nai) based on SSU gene. By sequencing DNA ...
Polymerase chain reaction methods (PCR in agrobiotechnology
Directory of Open Access Journals (Sweden)
Taški-Ajduković Ksenija
2006-01-01
Full Text Available The agricultural biotechnology applies polymerase chain reaction (PCR technology at numerous steps throughout product development. The major uses of PCR technology during product development include gene discovery and cloning, vector construction, transformant identification, screening and characterization as well as seed quality control. Commodity and food companies as well as testing laboratories rely on PCR technology to verify the presence or absence of genetically modification (GM in a product or to quantify the amount of GM material present in the product. This article describes the fundamental elements of PCR analysis and its application to the testing of grains and highlights some of areas to which attention must be paid in order to produce reliable test results. The article also discuses issues related to the analysis of different matrixes and the effect they may have on the accuracy of the PCR analytical results.
Bergmann, I; Mundt, K; Sontag, M; Baumstark, I; Nettmann, E; Klocke, M
2010-03-01
Quantitative real-time PCR (Q-PCR) is commonly applied for the detection of certain microorganisms in environmental samples. However, some environments, like biomass-degrading biogas fermenters, are enriched with PCR-interfering substances. To study the impact of the DNA extraction protocol on the results of Q-PCR-based analysis of the methane-producing archaeal community in biogas fermenters, nine different protocols with varying cell disruption and DNA purification approaches were tested. Differences in the quantities of the isolated DNA and the purity parameters were found, with the best cell lysis efficiencies being obtained by a combined lysozyme/SDS-based lysis. When DNA was purified by sephacryl columns, the amount of DNA decreased by one log cycle but PCR inhibitors were eliminated sufficiently. In the case of detection of methanogenic Archaea, the chosen DNA isolation protocol strongly influenced the Q-PCR-based determination of 16S rDNA copy numbers. For example, with protocols including mechanical cell disruption, the 16S rDNA of Methanobacteriales were predominantly amplified (81-90% of the total 16S rDNA copy numbers), followed by the 16S rDNA of Methanomicrobiales (9-18%). In contrast, when a lysozyme/SDS-based cell lysis was applied, the 16S rDNA copy numbers determined for these two orders were the opposite (Methanomicrobiales 82-95%, Methanobacteriales 4-18%). In extreme cases, the DNA isolation method led to discrimination of some groups of methanogens (e.g. members of the Methanosaetaceae). In conclusion, for extraction of high amounts of microbial DNA with high purity from samples of biogas plants, a combined lysozyme/SDS-based cell lysis followed by a purification step with sephacryl columns is recommended. Copyright 2010 Elsevier GmbH. All rights reserved.
Validation of a photography-based goniometry method for measuring joint range of motion.
Blonna, Davide; Zarkadas, Peter C; Fitzsimmons, James S; O'Driscoll, Shawn W
2012-01-01
A critical component of evaluating the outcomes after surgery to restore lost elbow motion is the range of motion (ROM) of the elbow. This study examined if digital photography-based goniometry is as accurate and reliable as clinical goniometry for measuring elbow ROM. Instrument validity and reliability for photography-based goniometry were evaluated for a consecutive series of 50 elbow contractures by 4 observers with different levels of elbow experience. Goniometric ROM measurements were taken with the elbows in full extension and full flexion directly in the clinic (once) and from digital photographs (twice in a blinded random manner). Instrument validity for photography-based goniometry was extremely high (intraclass correlation coefficient: extension = 0.98, flexion = 0.96). For extension and flexion measurements by the expert surgeon, systematic error was negligible (0° and 1°, respectively). Limits of agreement were 7° (95% confidence interval [CI], 5° to 9°) and -7° (95% CI, -5° to -9°) for extension and 8° (95% CI, 6° to 10°) and -7° (95% CI, -5° to -9°) for flexion. Interobserver reliability for photography-based goniometry was better than that for clinical goniometry. The least experienced observer's photographic goniometry measurements were closer to the reference measurements than the clinical goniometry measurements. Photography-based goniometry is accurate and reliable for measuring elbow ROM. The photography-based method relied less on observer expertise than clinical goniometry. This validates an objective measure of patient outcome without requiring doctor-patient contact at a tertiary care center, where most contracture surgeries are done. Copyright © 2012 Journal of Shoulder and Elbow Surgery Board of Trustees. Published by Mosby, Inc. All rights reserved.
Simultaneous Detection of Ricin and Abrin DNA by Real-Time PCR (qPCR
Directory of Open Access Journals (Sweden)
Roman Wölfel
2012-08-01
Full Text Available Ricin and abrin are two of the most potent plant toxins known and may be easily obtained in high yield from the seeds using rather simple technology. As a result, both toxins are potent and available toxins for criminal or terrorist acts. However, as the production of highly purified ricin or abrin requires sophisticated equipment and knowledge, it may be more likely that crude extracts would be used by non-governmental perpetrators. Remaining plant-specific nucleic acids in these extracts allow the application of a real-time PCR (qPCR assay for the detection and identification of abrin or ricin genomic material. Therefore, we have developed a duplex real-time PCR assays for simultaneous detection of ricin and abrin DNA based on the OmniMix HS bead PCR reagent mixture. Novel primers and hybridization probes were designed for detection on a SmartCycler instrument by using 5′-nuclease technology. The assay was thoroughly optimized and validated in terms of analytical sensitivity. Evaluation of the assay sensitivity by probit analysis demonstrated a 95% probability of detection at 3 genomes per reaction for ricin DNA and 1.2 genomes per reaction for abrin DNA. The suitability of the assays was exemplified by detection of ricin and abrin contaminations in a food matrix.
Amini, F; Kachuei, R; Noorbakhsh, F; Imani Fooladi, A A
2015-06-01
The aim of this study was the detection of Aspergillus species and Mycobacterium tuberculosis together in bronchoalveolar lavage (BAL) using of multiplex PCR. In this study, from September 2012 until June 2013, 100 bronchoalveolar lavage (BAL) specimens were collected from patients suspected of tuberculosis (TB). After the direct and culture test, multiplex PCR were utilized in order to diagnose Aspergillus species and M. tuberculosis. Phenol-chloroform manual method was used in order to extract DNA from these microorganisms. Aspergillus specific primers, M. tuberculosis designed primers and beta actin primers were used for multiplex PCR. In this study, by multiplex PCR method, Aspergillus species were identified in 12 samples (12%), positive samples in direct and culture test were respectively 11% and 10%. Sensitivity and specificity of this method in comparison to direct test were respectively 100% and 98.8%, also sensitivity and specificity of this method in comparison to culture test were respectively 100% and 97.7%. In this assay, M. tuberculosis was identified in 8 samples (8%). Mycobacterium-positive samples in molecular method, direct and culture test were respectively 6%, 5% and 7%. Sensitivity and specificity of PCR method in comparison to direct test were 80% and 97.8% also sensitivity and specificity of this method in comparison to culture test was 71.4% and 98.9%. In the present study, multiplex PCR method had higher sensitivity than direct and culture test in order to identify and detect Aspergillus, also this method had lower sensitivity for identification of M. tuberculosis, suggesting that the method of DNA extraction was not suitable. Copyright © 2015 Elsevier Masson SAS. All rights reserved.
Outcome on EPIZONE Extension on VER/ VNN: Diagnostics, proficiency test and qRT-PCR validation
DEFF Research Database (Denmark)
Bigarré, Laurent; Panzarin, Valentina; Baud, Marine
2012-01-01
1 is to bring valuable genetic information on the second genome component of a given isolate. ANSES has developed new DNA probes targeting RNA1 with the goal of detecting all genotypes of nodaviruses. The aim of the project is thus: - To organize, conduct and report an inter-laboratory proficiency...... test for detection of aquatic nodaviruses by real time RT-PCR targeting RNA1 and RNA2, respectively. - To test a newly developed real-time RT-PCR targeting RNA1: sensitivity, specificity, range of detection and genetic information provided by sequencing the PCR product. Materials & methods Primers...... to be extracted by each partner. In the meantime, ANSES produced and distributed RNA extracted from healthy or infected fish (2 genogroups), or cell culture; one sample from cell culture had to be serially diluted to test the sensitivity of each method in partners’ hands. Samples were tested in duplicates...
Directory of Open Access Journals (Sweden)
Yi-Ting Chiu
2017-05-01
Full Text Available Harmful cyanobacteria have been an important concern for drinking water quality for quite some time, as they may produce cyanotoxins and odorants. Microcystis and Cylindrospermopsis are two common harmful cyanobacterial genera detected in freshwater lakes and reservoirs, with microcystins (MCs and cylindrospermopsin (CYN as their important metabolites, respectively. In this study, two sets of duplex qPCR systems were developed, one for quantifying potentially-toxigenic Microcystis and Microcystis, and the other one for cylindrospermopsin-producing cyanobacteria and Cylindrospermopsis. The duplex qPCR systems were developed and validated in the laboratory by using 338 samples collected from 29 reservoirs in Taiwan and her offshore islands. Results show that cell numbers of Microcystis and Cylindorspermopsis enumerated with microscopy, and MCs and CYN concentrations measured with the enzyme-linked immuno-sorbent assay method, correlated well with their corresponding gene copies determined with the qPCR systems (range of coefficients of determination R2 = 0.392−0.740. The developed qPCR approach may serve as a useful tool for the water industry to diagnose the presence of harmful cyanobacteria and the potential presence of cyanotoxins in source waters.
Chiu, Yi-Ting; Chen, Yi-Hsuan; Wang, Ting-Shaun; Yen, Hung-Kai; Lin, Tsair-Fuh
2017-05-20
Harmful cyanobacteria have been an important concern for drinking water quality for quite some time, as they may produce cyanotoxins and odorants. Microcystis and Cylindrospermopsis are two common harmful cyanobacterial genera detected in freshwater lakes and reservoirs, with microcystins (MCs) and cylindrospermopsin (CYN) as their important metabolites, respectively. In this study, two sets of duplex qPCR systems were developed, one for quantifying potentially-toxigenic Microcystis and Microcystis , and the other one for cylindrospermopsin-producing cyanobacteria and Cylindrospermopsis . The duplex qPCR systems were developed and validated in the laboratory by using 338 samples collected from 29 reservoirs in Taiwan and her offshore islands. Results show that cell numbers of Microcystis and Cylindorspermopsis enumerated with microscopy, and MCs and CYN concentrations measured with the enzyme-linked immuno-sorbent assay method, correlated well with their corresponding gene copies determined with the qPCR systems (range of coefficients of determination R² = 0.392-0.740). The developed qPCR approach may serve as a useful tool for the water industry to diagnose the presence of harmful cyanobacteria and the potential presence of cyanotoxins in source waters.
Mano, Junichi; Hatano, Shuko; Nagatomi, Yasuaki; Futo, Satoshi; Takabatake, Reona; Kitta, Kazumi
2018-03-01
Current genetically modified organism (GMO) detection methods allow for sensitive detection. However, a further increase in sensitivity will enable more efficient testing for large grain samples and reliable testing for processed foods. In this study, we investigated real-time PCR-based GMO detection methods using a large amount of DNA template. We selected target sequences that are commonly introduced into many kinds of GM crops, i.e., 35S promoter and nopaline synthase (NOS) terminator. This makes the newly developed method applicable to a wide range of GMOs, including some unauthorized ones. The estimated LOD of the new method was 0.005% of GM maize events; to the best of our knowledge, this method is the most sensitive among the GM maize detection methods for which the LOD was evaluated in terms of GMO content. A 10-fold increase in the DNA amount as compared with the amount used under common testing conditions gave an approximately 10-fold reduction in the LOD without PCR inhibition. Our method is applicable to various analytical samples, including processed foods. The use of other primers and fluorescence probes would permit highly sensitive detection of various recombinant DNA sequences besides the 35S promoter and NOS terminator.
Rapid Methods to Distinguish Heterodera schachtii from Heterodera glycines Using PCR Technique
Directory of Open Access Journals (Sweden)
Hyoung Rai Ko
2017-09-01
Full Text Available The purpose of this study was to develop rapid methods for distinguishing between Heterodera schachtii and H. glycines detected from chinese cabbage fields of highland in Gangwon, Korea. To do this, we performed PCR-RFLP and PCR with the primers set developed in this study for GC147, GC408 and PM001 population, H. schachtii, and YS224, DA142 and BC115 population, H. glycines. Eight restriction enzymes generated RFLP profiles of mtDNA COI region for populations of H. schachtii and H. glycines, repectively. As a result, treatment of two restriction enzymes, RsaI and HinfI, were allowed to distinguish H. schachtii from H. glycines based on the differences of DNA band patterns. The primer set, #JBS1, #JBG1 and #JB3R, amplified specific fragments with 277 and 339 bp of H. schachtii, 339 bp of H. glycines, respectively, while it did not amplify fragments from three root-knot nematodes and two root-lesion nematodes. Thus, the primer set developed in this study could be a good method, which is used to distinguish between H. schachtii and H. glycines.
Yamashita, S; Nakagawa, H; Sakaguchi, T; Arima, T-H; Kikoku, Y
2018-01-01
Heat-resistant fungi occur sporadically and are a continuing problem for the food and beverage industry. The genus Talaromyces, as a typical fungus, is capable of producing the heat-resistant ascospores responsible for the spoilage of processed food products. Isocitrate lyase, a signature enzyme of the glyoxylate cycle, is required for the metabolism of non-fermentable carbon compounds, like acetate and ethanol. Here, species-specific primer sets for detection and identification of DNA derived from Talaromyces macrosporus and Talaromyces trachyspermus were designed based on the nucleotide sequences of their isocitrate lyase genes. Polymerase chain reaction (PCR) using a species-specific primer set amplified products specific to T. macrosporus and T. trachyspermus. Other fungal species, such as Byssochlamys fulva and Hamigera striata, which cause food spoilage, were not detected using the Talaromyces-specific primer sets. The detection limit for each species-specific primer set was determined as being 50 pg of template DNA, without using a nested PCR method. The specificity of each species-specific primer set was maintained in the presence of 1,000-fold amounts of genomic DNA from other fungi. The method also detected fungal DNA extracted from blueberry inoculated with T. macrosporus. This PCR method provides a quick, simple, powerful and reliable way to detect T. macrosporus and T. trachyspermus. Polymerase chain reaction (PCR)-based detection is rapid, convenient and sensitive compared with traditional methods of detecting heat-resistant fungi. In this study, a PCR-based method was developed for the detection and identification of amplification products from Talaromyces macrosporus and Talaromyces trachyspermus using primer sets that target the isocitrate lyase gene. This method could be used for the on-site detection of T. macrosporus and T. trachyspermus in the near future, and will be helpful in the safety control of raw materials and in food and beverage
An Evidence-Based Approach to Plum Pox Virus Detection by DASI-ELISA and RT-PCR in Dormant Period
Directory of Open Access Journals (Sweden)
Antonio Olmos
2008-01-01
Full Text Available An evidence-based approach, such as those developed in clinical and veterinary medicine, was applied to the detection of Plum pox virus (PPV during the dormant period. A standardized methodology was used for the calculation of parameters of the operational capacity of DASI-ELISA and RT-PCR in wintertime. These methods are routinely handled to test the sanitary status of plants in national or international trading and in those cases concerning export-import of plant materials. Diagnosis often has to be performed during the dormant period, when plant material is commercialized. Some guidelines to interpret diagnostic results of wintertime are provided in an attempt to minimize risks associated with the methods and over-reliance on the binary outcome of a single assay. In order to evaluate if a complementary test increased the confidence of PPV diagnosis when discordant results between DASI-ELISA and RT-PCR are obtained, NASBA-FH also was included. Likelihood ratios of each method were estimated based on the sensitivity and specificity obtained in wintertime. Subsequently, a Bayesian approach was performed to calculate post-test probability of PPV infection in spring. Results of evidence-based approach show that different PPV prevalences require different screening tests. Thus, at very low PPV prevalence levels DASI-ELISA should be used as the election method, whilst at the highest PPV prevalence levels RT-PCR should be performed. NASBA-FH could be used at medium prevalences to clarify discordances between DASIELISA and RT-PCR.
Analytical difficulties facing today's regulatory laboratories: issues in method validation.
MacNeil, James D
2012-08-01
The challenges facing analytical laboratories today are not unlike those faced in the past, although both the degree of complexity and the rate of change have increased. Challenges such as development and maintenance of expertise, maintenance and up-dating of equipment, and the introduction of new test methods have always been familiar themes for analytical laboratories, but international guidelines for laboratories involved in the import and export testing of food require management of such changes in a context which includes quality assurance, accreditation, and method validation considerations. Decisions as to when a change in a method requires re-validation of the method or on the design of a validation scheme for a complex multi-residue method require a well-considered strategy, based on a current knowledge of international guidance documents and regulatory requirements, as well the laboratory's quality system requirements. Validation demonstrates that a method is 'fit for purpose', so the requirement for validation should be assessed in terms of the intended use of a method and, in the case of change or modification of a method, whether that change or modification may affect a previously validated performance characteristic. In general, method validation involves method scope, calibration-related parameters, method precision, and recovery. Any method change which may affect method scope or any performance parameters will require re-validation. Some typical situations involving change in methods are discussed and a decision process proposed for selection of appropriate validation measures. © 2012 John Wiley & Sons, Ltd.
Directory of Open Access Journals (Sweden)
Emma R Travis
Full Text Available Advances in the diagnosis of Mycobacterium bovis infection in wildlife hosts may benefit the development of sustainable approaches to the management of bovine tuberculosis in cattle. In the present study, three laboratories from two different countries participated in a validation trial to evaluate the reliability and reproducibility of a real time PCR assay in the detection and quantification of M. bovis from environmental samples. The sample panels consisted of negative badger faeces spiked with a dilution series of M. bovis BCG Pasteur and of field samples of faeces from badgers of unknown infection status taken from badger latrines in areas with high and low incidence of bovine TB (bTB in cattle. Samples were tested with a previously optimised methodology. The experimental design involved rigorous testing which highlighted a number of potential pitfalls in the analysis of environmental samples using real time PCR. Despite minor variation between operators and laboratories, the validation study demonstrated good concordance between the three laboratories: on the spiked panels, the test showed high levels of agreement in terms of positive/negative detection, with high specificity (100% and high sensitivity (97% at levels of 10(5 cells g(-1 and above. Quantitative analysis of the data revealed low variability in recovery of BCG cells between laboratories and operators. On the field samples, the test showed high reproducibility both in terms of positive/negative detection and in the number of cells detected, despite low numbers of samples identified as positive by any laboratory. Use of a parallel PCR inhibition control assay revealed negligible PCR-interfering chemicals co-extracted with the DNA. This is the first example of a multi-laboratory validation of a real time PCR assay for the detection of mycobacteria in environmental samples. Field studies are now required to determine how best to apply the assay for population-level b
A web-based adaptive tutor to teach PCR primer design
van Seters, Janneke R.; Wellink, Joan; Tramper, Johannes; Goedhart, Martin J.; Ossevoort, Miriam A.
2012-01-01
When students have varying prior knowledge, personalized instruction is desirable. One way to personalize instruction is by using adaptive e-learning to offer training of varying complexity. In this study, we developed a web-based adaptive tutor to teach PCR primer design: the PCR Tutor. We used
A Web-based Adaptive Tutor to Teach PCR Primer Design
Seters, van J.R.; Wellink, J.; Tramper, J.; Goedhart, M.J.; Ossevoort, M.A.
2012-01-01
When students have varying prior knowledge, personalized instruction is desirable. One way to personalize instruction is by using adaptive e-learning to offer training of varying complexity. In this study, we developed a web-based adaptive tutor to teach PCR primer design: the PCR Tutor. We used
MWCNT-Fe{sub 3}O{sub 4}-based immuno-PCR for the early screening of nasopharyngeal carcinoma
Energy Technology Data Exchange (ETDEWEB)
Chia-Ching, Liu [Institute of Biomedical Engineering, College of Medicine and College of Engineering, National Taiwan University, Taipei 100, Taiwan (China); Subramaniam, Sadhasivam [Department of Microbial Biotechnology, Bharathiar University, Coimbatore 641 046 (India); Sivasubramanian, Savitha [Department of Biotechnology, Sree Sastha Institute of Engineering and Technology, Chennai (India); Feng-Huei, Lin, E-mail: double@ntu.edu.tw [Institute of Biomedical Engineering, College of Medicine and College of Engineering, National Taiwan University, Taipei 100, Taiwan (China); Division of Biomedical Engineering and Nanomedicine Research, National Health Research Institutes, Miaoli 350, Taiwan (China)
2016-04-01
Nasopharyngeal carcinoma (NPC) is the most prevalent form of malignancy in southeast China and its development is meticulously related to EBV pathogenesis. The current screening techniques are unsatisfactory in terms of the sensitivity and hence most of the NPC patients are diagnosed at an advanced stage. Herein, we report the multi-walled carbon nanotubes (MWCNTs) combined with iron oxide nanoparticles as a sensing surface for the early screening of nasopharyngeal carcinoma (NPC) by immuno-PCR (iPCR). The MWCNT-Fe{sub 3}O{sub 4} nanocomposite was characterized by Fourier transform infrared spectra (FTIR), Raman spectra, X-ray diffraction (XRD) and high-resolution transmission electron microscopy (HR-TEM). The characterization techniques had confirmed the successful formation of MWCNT-Fe{sub 3}O{sub 4} nanocomposites. The MWCNT-Fe{sub 3}O{sub 4}-based iPCR was effectively tested for the quantification of anti-EBV antibodies in human serum and the limit of detection (LOD) was compared with ELISA. The limit of detection by iPCR was valid until 1:10,000,000 fold dilution of NPC{sup +ve} human serum, whereas ELISA can detect the anti-EBV antibodies in human serum up to 1:100,000 fold dilution. The MWCNT-Fe{sub 3}O{sub 4} offers an excellent surface area for the antigen-antibody binding and hence greater sensitivity was achieved. - Highlights: • MWCNT-Fe{sub 3}O{sub 4} nanocomposite offers more surface area and effortless separation • The iPCR offers an exceptional LOD, which is significantly higher than the other analytical techniques reported • LOD of anti-EBV abs by ELISA was significant only until 1:100000 fold dilution • The proposed iPCR design could be extremely useful for the population-based screening.
The Value of Qualitative Methods in Social Validity Research
Leko, Melinda M.
2014-01-01
One quality indicator of intervention research is the extent to which the intervention has a high degree of social validity, or practicality. In this study, I drew on Wolf's framework for social validity and used qualitative methods to ascertain five middle schoolteachers' perceptions of the social validity of System 44®--a phonics-based reading…
In silico prediction and qPCR validation of novel sRNAs in Propionibacterium acnes KPA171202
Directory of Open Access Journals (Sweden)
Praveen P. Balgir
2016-06-01
Full Text Available Propionibacterium acnes is an anaerobic, Gram-positive, opportunistic pathogen known to be involved in a wide variety of diseases ranging from mild acne to prostate cancer. Bacterial small non-coding RNAs are novel regulators of gene expression and are known to be involved in, virulence, pathogenesis, stress tolerance and adaptation to environmental changes in bacteria. The present study was undertaken keeping in view the lack of predicted sRNAs of P. acnes KPA171202 in databases. This report represents the first attempt to identify sRNAs in P. acnes KPA171202. A total of eight potential candidate sRNAs were predicted using SIPHT, one was found to have a Rfam homolog and seven were novel. Out of these seven predicted sRNAs, five were validated by reverse transcriptase-polymerase chain reaction (RT-PCR and sequencing. The expression of these sRNAs was quantified in different growth phases by qPCR (quantitative PCR. They were found to be expressed in both exponential and stationary stages of growth but with maximum expression in stationary phase which points to a regulatory role for them. Further investigation of their targets and regulatory functions is in progress.
Jia, Xianbo; Lin, Xinjian; Chen, Jichen
2017-11-02
Current genome walking methods are very time consuming, and many produce non-specific amplification products. To amplify the flanking sequences that are adjacent to Tn5 transposon insertion sites in Serratia marcescens FZSF02, we developed a genome walking method based on TAIL-PCR. This PCR method added a 20-cycle linear amplification step before the exponential amplification step to increase the concentration of the target sequences. Products of the linear amplification and the exponential amplification were diluted 100-fold to decrease the concentration of the templates that cause non-specific amplification. Fast DNA polymerase with a high extension speed was used in this method, and an amplification program was used to rapidly amplify long specific sequences. With this linear and exponential TAIL-PCR (LETAIL-PCR), we successfully obtained products larger than 2 kb from Tn5 transposon insertion mutant strains within 3 h. This method can be widely used in genome walking studies to amplify unknown sequences that are adjacent to known sequences.
Mauger, Florence; Kernaleguen, Magali; Lallemand, Céline; Kristensen, Vessela N; Deleuze, Jean-François; Tost, Jörg
2018-05-01
The detection of specific DNA methylation patterns bears great promise as biomarker for personalized management of cancer patients. Co-amplification at lower denaturation temperature-PCR (COLD-PCR) assays are sensitive methods, but have previously only been able to analyze loss of DNA methylation. Enhanced (E)-ice-COLD-PCR reactions starting from 2 ng of bisulfite-converted DNA were developed to analyze methylation patterns in two promoters with locked nucleic acid (LNA) probes blocking amplification of unmethylated CpGs. The enrichment of methylated molecules was compared to quantitative (q)PCR and quantified using serial dilutions. E-ice-COLD-PCR allowed the multiplexed enrichment and quantification of methylated DNA. Assays were validated in primary breast cancer specimens and circulating cell-free DNA from cancer patients. E-ice-COLD-PCR could prove a useful tool in the context of DNA methylation analysis for personalized medicine.
Directory of Open Access Journals (Sweden)
Žel Jana
2006-08-01
Full Text Available Abstract Background Real-time PCR is the technique of choice for nucleic acid quantification. In the field of detection of genetically modified organisms (GMOs quantification of biotech products may be required to fulfil legislative requirements. However, successful quantification depends crucially on the quality of the sample DNA analyzed. Methods for GMO detection are generally validated on certified reference materials that are in the form of powdered grain material, while detection in routine laboratories must be performed on a wide variety of sample matrixes. Due to food processing, the DNA in sample matrixes can be present in low amounts and also degraded. In addition, molecules of plant origin or from other sources that affect PCR amplification of samples will influence the reliability of the quantification. Further, the wide variety of sample matrixes presents a challenge for detection laboratories. The extraction method must ensure high yield and quality of the DNA obtained and must be carefully selected, since even components of DNA extraction solutions can influence PCR reactions. GMO quantification is based on a standard curve, therefore similarity of PCR efficiency for the sample and standard reference material is a prerequisite for exact quantification. Little information on the performance of real-time PCR on samples of different matrixes is available. Results Five commonly used DNA extraction techniques were compared and their suitability for quantitative analysis was assessed. The effect of sample matrix on nucleic acid quantification was assessed by comparing 4 maize and 4 soybean matrixes. In addition 205 maize and soybean samples from routine analysis were analyzed for PCR efficiency to assess variability of PCR performance within each sample matrix. Together with the amount of DNA needed for reliable quantification, PCR efficiency is the crucial parameter determining the reliability of quantitative results, therefore it was
Cankar, Katarina; Štebih, Dejan; Dreo, Tanja; Žel, Jana; Gruden, Kristina
2006-01-01
Background Real-time PCR is the technique of choice for nucleic acid quantification. In the field of detection of genetically modified organisms (GMOs) quantification of biotech products may be required to fulfil legislative requirements. However, successful quantification depends crucially on the quality of the sample DNA analyzed. Methods for GMO detection are generally validated on certified reference materials that are in the form of powdered grain material, while detection in routine laboratories must be performed on a wide variety of sample matrixes. Due to food processing, the DNA in sample matrixes can be present in low amounts and also degraded. In addition, molecules of plant origin or from other sources that affect PCR amplification of samples will influence the reliability of the quantification. Further, the wide variety of sample matrixes presents a challenge for detection laboratories. The extraction method must ensure high yield and quality of the DNA obtained and must be carefully selected, since even components of DNA extraction solutions can influence PCR reactions. GMO quantification is based on a standard curve, therefore similarity of PCR efficiency for the sample and standard reference material is a prerequisite for exact quantification. Little information on the performance of real-time PCR on samples of different matrixes is available. Results Five commonly used DNA extraction techniques were compared and their suitability for quantitative analysis was assessed. The effect of sample matrix on nucleic acid quantification was assessed by comparing 4 maize and 4 soybean matrixes. In addition 205 maize and soybean samples from routine analysis were analyzed for PCR efficiency to assess variability of PCR performance within each sample matrix. Together with the amount of DNA needed for reliable quantification, PCR efficiency is the crucial parameter determining the reliability of quantitative results, therefore it was chosen as the primary
Directory of Open Access Journals (Sweden)
Markus Spiliotis
Full Text Available Inverse fusion PCR cloning (IFPC is an easy, PCR based three-step cloning method that allows the seamless and directional insertion of PCR products into virtually all plasmids, this with a free choice of the insertion site. The PCR-derived inserts contain a vector-complementary 5'-end that allows a fusion with the vector by an overlap extension PCR, and the resulting amplified insert-vector fusions are then circularized by ligation prior transformation. A minimal amount of starting material is needed and experimental steps are reduced. Untreated circular plasmid, or alternatively bacteria containing the plasmid, can be used as templates for the insertion, and clean-up of the insert fragment is not urgently required. The whole cloning procedure can be performed within a minimal hands-on time and results in the generation of hundreds to ten-thousands of positive colonies, with a minimal background.
Review: Diagnostic accuracy of PCR-based detection tests for Helicobacter Pylori in stool samples.
Khadangi, Fatemeh; Yassi, Maryam; Kerachian, Mohammad Amin
2017-12-01
Although different methods have been established to detect Helicobacter pylori (H. pylori) infection, identifying infected patients is an ongoing challenge. The aim of this meta-analysis was to provide pooled diagnostic accuracy measures for stool PCR test in the diagnosis of H. pylori infection. In this study, a systematic review and meta-analysis were carried out on various sources, including MEDLINE, Web of Sciences, and the Cochrane Library from April 1, 1999, to May 1, 2016. This meta-analysis adheres to the guidelines provided by the Preferred Reporting Items for Systematic Reviews and Meta-Analyses report (PRISMA Statement). The clinical value of DNA stool PCR test was based on the pooled false positive, false negative, true positive, and true negative of different genes. Twenty-six of 328 studies identified met the eligibility criteria. Stool PCR test had a performance of 71% (95% CI: 68-73) sensitivity, 96% (95% CI: 94-97) specificity, and 65.6 (95% CI: 30.2-142.5) diagnostic odds ratio (DOR) in diagnosis of H. pylori. The DOR of genes which showed the highest performance of stool PCR tests was as follows: 23S rRNA 152.5 (95% CI: 55.5-418.9), 16S rRNA 67.9 (95%CI: 6.4-714.3), and glmM 68.1 (95%CI: 20.1-231.7). The sensitivity and specificity of stool PCR test are relatively in the same spectrum of other diagnostic methods for the detection of H. pylori infection. In descending order of significance, the most diagnostic candidate genes using PCR detection were 23S rRNA, 16S rRNA, and glmM. PCR for 23S rRNA gene which has the highest performance could be applicable to detect H. pylori infection. © 2017 John Wiley & Sons Ltd.
An external standard method for quantification of human cytomegalovirus by PCR
International Nuclear Information System (INIS)
Rongsen, Shen; Liren, Ma; Fengqi, Zhou; Qingliang, Luo
1997-01-01
An external standard method for PCR quantification of HCMV was reported. [α- 32 P]dATP was used as a tracer. 32 P-labelled specific amplification product was separated by agarose gel electrophoresis. A gel piece containing the specific product band was excised and counted in a plastic scintillation counter. Distribution of [α- 32 P]dATP in the electrophoretic gel plate and effect of separation between the 32 P-labelled specific product and free [α- 32 P]dATP were observed. A standard curve for quantification of HCMV by PCR was established and detective results of quality control templets were presented. The external standard method and the electrophoresis separation effect were appraised. The results showed that the method could be used for relative quantification of HCMV. (author)
Energy Technology Data Exchange (ETDEWEB)
Ferreira, Aline Leandra C.; Ferreira, Sidney A.; Carregal, Virginia M.; Andrade, Antero Silva R., E-mail: antero@cdtn.br [Centro de Desenvolvimento da Tecnologia Nuclear (CDTN/CNEN-MG), Belo Horizonte, MG (Brazil). Lab. de Radiobiologia; Melo, Maria N., E-mail: melo@icb.ufmg.br [Departamento de Parasitologia. Instituto de Ciencias Biologicas. Universidade Federal de Minas Gerais, Belo Horizonte, MG (Brazil)
2011-07-01
Leishmania (Leishmania) chagasi is responsible for visceral leishmaniasis (VL) in Brazil and the dog is the main domestic reservoir. Disease control is based on the elimination of infected animals and the use of a sensitive and specific diagnostic test is necessary. The Brazilian VL control program emphasizes serologic surveys, mainly using the enzyme-linked immunosorbent assay (ELISA) and the immunofluorescence antibody test (IFAT), followed by the elimination of the seropositive dogs. However, these techniques present limitations in terms of sensitivity and specificity. The Polymerase Chain Reaction (PCR) associated to hybridization with DNA probes labeled with {sup 32}P has been recognized as a valuable tool for Leishmania identification. In this study, the sensitivity of kDNA PCR hybridization method was compared with three other molecular methods: Internal Transcribed Spacer 1 Nested PCR (ITS-1nPCR), Leishmania nested PCR (LnPCR) and Seminested kDNA PCR (kDNA snPCR). The comparison was performed in different clinical specimens: conjunctival swab, skin, blood and bone marrow. A group of thirty symptomatic dogs, positive in the parasitological and serological tests, was used. When. The techniques targeting kDNA mini-circles (kDNA snPCR and KDNA PCR-hybridization) showed the worst result for blood samples. The KDNA-PCR hybridization showed the best sensitivity for conjunctival swab. By comparing the samples on the basis of positivity obtained by the sum of all methods, the blood showed the worst outcome (71/120).The bone marrow showed the highest positivity (106/120), followed by conjunctival swab (100/120) and skin (89/120). Since the bone marrow samples are unsuitable for routine epidemiological surveys, the conjunctival swab was recommended because it allows high sensitivity, especially when associated with kDNA PCR hybridization method, and is a noninvasive sampling method. (author)
International Nuclear Information System (INIS)
Ferreira, Aline Leandra C.; Ferreira, Sidney A.; Carregal, Virginia M.; Andrade, Antero Silva R.
2011-01-01
Leishmania (Leishmania) chagasi is responsible for visceral leishmaniasis (VL) in Brazil and the dog is the main domestic reservoir. Disease control is based on the elimination of infected animals and the use of a sensitive and specific diagnostic test is necessary. The Brazilian VL control program emphasizes serologic surveys, mainly using the enzyme-linked immunosorbent assay (ELISA) and the immunofluorescence antibody test (IFAT), followed by the elimination of the seropositive dogs. However, these techniques present limitations in terms of sensitivity and specificity. The Polymerase Chain Reaction (PCR) associated to hybridization with DNA probes labeled with 32 P has been recognized as a valuable tool for Leishmania identification. In this study, the sensitivity of kDNA PCR hybridization method was compared with three other molecular methods: Internal Transcribed Spacer 1 Nested PCR (ITS-1nPCR), Leishmania nested PCR (LnPCR) and Seminested kDNA PCR (kDNA snPCR). The comparison was performed in different clinical specimens: conjunctival swab, skin, blood and bone marrow. A group of thirty symptomatic dogs, positive in the parasitological and serological tests, was used. When. The techniques targeting kDNA mini-circles (kDNA snPCR and KDNA PCR-hybridization) showed the worst result for blood samples. The KDNA-PCR hybridization showed the best sensitivity for conjunctival swab. By comparing the samples on the basis of positivity obtained by the sum of all methods, the blood showed the worst outcome (71/120).The bone marrow showed the highest positivity (106/120), followed by conjunctival swab (100/120) and skin (89/120). Since the bone marrow samples are unsuitable for routine epidemiological surveys, the conjunctival swab was recommended because it allows high sensitivity, especially when associated with kDNA PCR hybridization method, and is a noninvasive sampling method. (author)
Rapid detection of food-borne Salmonella contamination using IMBs-qPCR method based on pagC gene
Directory of Open Access Journals (Sweden)
Jiashun Wang
Full Text Available Abstract Detection of Salmonella is very important to minimize the food safety risk. In this study, the recombinant PagC protein and PagC antibody were prepared and coupled with immunomagnetic beads (IMBs to capture Salmonella cells from pork and milk samples. And then the SYBR Green qualitative PCR was developed to detect the pathogenic Salmonella. The results showed that the PagC polyclonal antiserum is of good specificity and the capture rate of 0.1 mg IMBs for Salmonella tended to be stable at the range of 70-74% corresponding to the concentrations between 101 and 104 CFU/mL. The method developed demonstrated high specificity for the positive Salmonella samples when compared to non-specific DNA samples, such as Escherichia coli, Staphylococcus aureus, Yersinia enterocolitica, and Yersinia pseudotuberculosis. The limit of detection of this assay was 18 CFU/mL. Detection and quantitative enumeration of Salmonella in samples of pork or milk shows good recoveries of 54.34% and 52.07%. In conclusion, the polyclonal antibody of recombinant PagC protein is effective to capture Salmonella from detected samples. The developed pagC antibody IMBs-qPCR method showed efficiency, sensitivity and specificity for 30 Salmonella detection, enabling detection within 10 h, which is a promising rapid method to detect Salmonella in emergency.
Directory of Open Access Journals (Sweden)
J. Wang
2013-10-01
Full Text Available Psathyrostachys huashanica Keng is an endangered species that is endemic to China, which provides an important gene pool for wheat improvement. We developed a quick and reliable PCR-based diagnostic assay to accurately and efficiently detect P. huashanica DNA sequences from introgression lines, which was based on a species-specific marker derived from genomic DNA. The 900-bp PCR-amplified band used as a P. huashanica-specific RAPD marker was tested with 21 different plant species and was converted into a sequence-characterized amplified region (SCAR marker by cloning and sequencing the selected fragments (pHs11. This SCAR marker, which was designated as RHS23, could clearly distinguish the presence of P. huashanica DNA repetitive sequences in wheat-P. huashanica derivative lines. The specificity of the marker was validated using 21 different plant species and a complete set of wheat-P. huashanica disomic addition lines (1Ns–7Ns, 2n=44=22II. This specific sequence targeted the Ns genome of P. huashanica and it was present in all the seven P. huashanica chromosomes. Therefore, this SCAR marker is specific for P. huashanica chromosomes and may be used in the identification of alien repetitive sequences in large gene pools. This diagnostic PCR assay for screening the target genetic material may play a key role in marker-assisted selective breeding programs.
New multiplex PCR methods for rapid screening of genetically modified organisms in foods.
Datukishvili, Nelly; Kutateladze, Tamara; Gabriadze, Inga; Bitskinashvili, Kakha; Vishnepolsky, Boris
2015-01-01
We present novel multiplex PCR methods for rapid and reliable screening of genetically modified organisms (GMOs). New designed PCR primers targeting four frequently used GMO specific sequences permitted identification of new DNA markers, in particular 141 bp fragment of cauliflower mosaic virus (CaMV) 35S promoter, 224 bp fragment of Agrobacterium tumefaciens nopaline synthase (NOS) terminator, 256 bp fragment of 5-enolppyruvylshikimate-phosphate synthase (epsps) gene and 258 bp fragment of Cry1Ab delta-endotoxin (cry1Ab) gene for GMO screening. The certified reference materials containing Roundup Ready soybean (RRS) and maize MON 810 were applied for the development and optimization of uniplex and multiplex PCR systems. Evaluation of amplification products by agarose gel electrophoresis using negative and positive controls confirmed high specificity and sensitivity at 0.1% GMO for both RRS and MON 810. The fourplex PCR was developed and optimized that allows simultaneous detection of three common transgenic elements, such as: CaMV 35S promoter, NOS terminator, epsps gene together with soybean-specific lectin gene. The triplex PCR developed enables simultaneous identification of transgenic elements, such as: 35S promoter and cry1Ab gene together with maize zein gene. The analysis of different processed foods demonstrated that multiplex PCR methods developed in this study are useful for accurate and fast screening of GM food products.
New multiplex PCR methods for rapid screening of genetically modified organisms in foods
Directory of Open Access Journals (Sweden)
Nelly eDatukishvili
2015-07-01
Full Text Available We present novel multiplex PCR methods for rapid and reliable screening of genetically modified organisms (GMOs. New designed PCR primers targeting four frequently used GMO specific sequences permitted identification of new DNA markers, in particular 141 bp fragment of cauliflower mosaic virus (CaMV 35S promoter, 224 bp fragment of Agrobacterium tumefaciens nopaline synthase (NOS terminator, 256 bp fragment of 5-enolppyruvylshikimate-phosphate synthase (epsps gene and 258 bp fragment of Cry1Ab delta-endotoxin (cry1Ab gene for GMO screening. The certified reference materials containing Roundup Ready soybean (RRS and maize MON 810 were applied for the development and optimization of uniplex and multiplex PCR systems. Evaluation of amplification products by agarose gel electrophoresis using negative and positive controls confirmed high specificity and sensitivity at 0.1% GMO for both RRS and MON 810. The fourplex PCR was developed and optimized that allows simultaneous detection of three common transgenic elements, such as: CaMV 35S promoter, NOS terminator, epsps gene together with soybean-specific lectin gene. The triplex PCR developed enables simultaneous identification of transgenic elements, such as: 35S promoter and cry1Ab gene together with maize zein gene. The analysis of different processed foods demonstrated that multiplex PCR methods developed in this study are useful for accurate and fast screening of GM food products.
Directory of Open Access Journals (Sweden)
Roohollah Dorostkar
2015-06-01
Full Text Available Abstract Background: In 1970, human papillomavirus (HPV was introduced as the main etiologic factor of cervical carcinoma. Since there is no possibility of detecting the virus and its subtypes using serological methods and cell culture, the molecular methods such as PCR have particular importance in accurate, early and definite diagnosis of the virus. So, in this research, our goal is to use a proprietary PCR assay based on L1 gene of human papillomavirus for molecular recognition of HPV and to evaluate its prevalence in patient samples. Materials and Methods: In this experimental study, after collecting of samples from malignant cervical lesions, the viral DNA was extracted from paraffin blocks of 50 clinical samples and PCR was done by specific primers for L1 gene of human papillomavirus in all samples. After the analysis of PCR products by 2% agarose gel electrophoresis, sensitivity and specificity of the test were also evaluated. Results: Among 50 patient samples, 33 cases were confirmed to be positive for HPV infection and 17 cases were negative, showing high frequency of HPV in this patient population (about 66%. The results of specificity assay were positive for papilloma samples and sensitivity of the assay was 20 copies of recombinant construct containing L1 per reaction. Conclusion: This study showed that PCR by specific primers for L1 gene of human papilloma virus is a proper and accurate method for detection of this virus and the results confirm the previous reports of correlation between HPV and cervical carcinoma.
Directory of Open Access Journals (Sweden)
Tharangamala Samarakoon
2013-01-01
Full Text Available Premise of the study: PCR amplification of DNA extracted from plants is sometimes difficult due to the presence of inhibitory compounds. An effective method to overcome the inhibitory effect of compounds that contaminate DNA from difficult plant specimens is needed. Methods and Results: The effectiveness of a PCR additive reagent containing trehalose, bovine serum albumin (BSA, and polysorbate-20 (Tween-20 (TBT-PAR was tested. PCR of DNA extracted from fresh, silica-dried, and herbarium leaf material of species of Achariaceae, Asteraceae, Lacistemataceae, and Samydaceae that failed using standard techniques were successful with the addition of TBT-PAR. Conclusions: The addition of TBT-PAR during routine PCR is an effective method to improve amplification of DNA extracted from herbarium specimens or plants that are known to contain PCR inhibitors.
International Nuclear Information System (INIS)
Ferreira, Aline Leandra C.; Carregal, Virginia M.; Leite, Rodrigo S.; Ferreira, Sidney A.; Andrade, Antero Silva R.; Melo, Maria N.
2013-01-01
Visceral leishmaniasis (VL) in Brazil is caused by Leishmania infantum and dogs are considered the main domestic reservoirs of this parasite. The VL control program in Brazil emphasizes the use of serological surveys, followed by elimination of seropositive dogs. However, serologic tests have limitations in terms of sensitivity and specificity. Molecular methods such as PCR (Polymerase Chain Reaction) associated with hybridization using 32 P radiolabeled DNA probes (kDNA PCR hybridization) are useful tools in this scenario, since they are more specific and sensitive than conventional methods. A variety of samples can be employed with PCR; however non-invasive procedures are the most adequate. One of main obstacles for implementation of PCR in the canine visceral leishmaniasis (CVL) diagnosis is the lack of standardization. Few studies up to the moment compared the effectiveness of the different PCR methods and clinical samples available. The objective of this study was to compare the kDNA PCR hybridization and the Internal Transcribed Spacer 1 nested PCR (ITS1 nPCR) methods and four types of clinical samples for the diagnosis of CVL in dogs with and without clinical signs of the disease. The methods were compared using samples of conjunctival swab (SC), bone marrow (BM), skin (S) and peripheral blood (PB). A group of 60 mongrel dogs, all positive in serological and parasitological tests, were equally divided in two groups: S (with clinical signs) and A (without clinical signs). The frequencies of positive results for the kDNA PCR hybridization in the S group were: CS 97% (29/30), BM 83 % (25/30), S 63% (19/30) and PB 4 7% (14/30). By the same method the following results were obtained in the A group: CS 70% (21/30), BM 63% (19/30), S 57% (17/30) and PB 17% (5/30). The ITS1 nPCR allowed the following positivities for the S group: CS 83% (25/30), BM 97% (29/30), S 83% (25/30) and PB 70% (21/30). For the A group the following results were obtained: CS and BM 83% (25
Energy Technology Data Exchange (ETDEWEB)
Ferreira, Aline Leandra C.; Carregal, Virginia M.; Leite, Rodrigo S.; Ferreira, Sidney A.; Andrade, Antero Silva R., E-mail: alineleandra@hotmail.com, E-mail: streptos@hotmail.com, E-mail: rleite2005@gmail.com, E-mail: vidasnino@yahoo.com.br, E-mail: antero@cdtn.br [Centro de Desenvolvimento da Tecnologia Nuclear (CDTN/CNEN-MG), Belo Horizonte, MG (Brazil). Lab. de Radiobiologia; Melo, Maria N., E-mail: melo@icb.ufmg.br [Universidade Federal de Minas Gerais (UFMG), Belo Horizonte, MG (Brazil). Dept. de Parasitologia
2013-07-01
Visceral leishmaniasis (VL) in Brazil is caused by Leishmania infantum and dogs are considered the main domestic reservoirs of this parasite. The VL control program in Brazil emphasizes the use of serological surveys, followed by elimination of seropositive dogs. However, serologic tests have limitations in terms of sensitivity and specificity. Molecular methods such as PCR (Polymerase Chain Reaction) associated with hybridization using {sup 32}P radiolabeled DNA probes (kDNA PCR hybridization) are useful tools in this scenario, since they are more specific and sensitive than conventional methods. A variety of samples can be employed with PCR; however non-invasive procedures are the most adequate. One of main obstacles for implementation of PCR in the canine visceral leishmaniasis (CVL) diagnosis is the lack of standardization. Few studies up to the moment compared the effectiveness of the different PCR methods and clinical samples available. The objective of this study was to compare the kDNA PCR hybridization and the Internal Transcribed Spacer 1 nested PCR (ITS1 nPCR) methods and four types of clinical samples for the diagnosis of CVL in dogs with and without clinical signs of the disease. The methods were compared using samples of conjunctival swab (SC), bone marrow (BM), skin (S) and peripheral blood (PB). A group of 60 mongrel dogs, all positive in serological and parasitological tests, were equally divided in two groups: S (with clinical signs) and A (without clinical signs). The frequencies of positive results for the kDNA PCR hybridization in the S group were: CS 97% (29/30), BM 83 % (25/30), S 63% (19/30) and PB 4 7% (14/30). By the same method the following results were obtained in the A group: CS 70% (21/30), BM 63% (19/30), S 57% (17/30) and PB 17% (5/30). The ITS1 nPCR allowed the following positivities for the S group: CS 83% (25/30), BM 97% (29/30), S 83% (25/30) and PB 70% (21/30). For the A group the following results were obtained: CS and BM 83
Viability qPCR, a new tool for Legionella risk management.
Lizana, X; López, A; Benito, S; Agustí, G; Ríos, M; Piqué, N; Marqués, A M; Codony, F
2017-11-01
Viability quantitative Polymerase Chain Reaction (v-qPCR) is a recent analytical approach for only detecting live microorganisms by DNA amplification-based methods This approach is based on the use of a reagent that irreversibly fixes dead cells DNA. In this study, we evaluate the utility of v-qPCR versus culture method for Legionellosis risk management. The present study was performed using 116 real samples. Water samples were simultaneously analysed by culture, v-qPCR and qPCR methods. Results were compared by means of a non-parametric test. In 11.6% of samples using both methods (culture method and v-qPCR) results were positive, in 50.0% of samples both methods gave rise to negative results. As expected, equivalence between methods was not observed in all cases, as in 32.1% of samples positive results were obtained by v-qPCR and all of them gave rise to negative results by culture. Only in 6.3% of samples, with very low Legionella levels, was culture positive and v-qPCR negative. In 3.5% of samples, overgrowth of other bacteria did not allow performing the culture. When comparing both methods, significant differences between culture and v-qPCR were in the samples belonging to the cooling towers-evaporative condensers group. The v-qPCR method detected greater presence and obtained higher concentrations of Legionella spp. (p<0.001). Otherwise, no significant differences between methods were found in the rest of the groups. The v-qPCR method can be used as a quick tool to evaluate Legionellosis risk, especially in cooling towers-evaporative condensers, where this technique can detect higher levels than culture. The combined interpretation of PCR results along with the ratio of live cells is proposed as a tool for understanding the sample context and estimating the Legionellosis risk potential according to 4 levels of hierarchy. Copyright © 2017 Elsevier GmbH. All rights reserved.
Willi, Barbara; Meli, Marina L; Lüthy, Ruedi; Honegger, Hanspeter; Wengi, Nicole; Hoelzle, Ludwig E; Reusch, Claudia E; Lutz, Hans; Hofmann-Lehmann, Regina
2009-12-01
Hemotropic mycoplasmas (hemoplasmas) are the causative agents of infectious anemia in several mammalian species. Their zoonotic potential has recently been substantiated by the identification of a feline hemoplasma isolate in an immunocompromised human patient. Although species-specific diagnostic molecular methods have been developed, their application as screening tools is limited due to the species diversity of hemoplasmas. The goals of this study were to develop a universal hemoplasma screening assay with broad specificity based on the SYBR green PCR principle, to compare the assay with hemoplasma-specific TaqMan PCR, and to analyze potential tick vectors and human blood samples to address the zoonotic potential. The newly developed PCR assay based on the 16S rRNA gene amplified feline, canine, bovine, porcine, camelid, and murine hemoplasmas, as well as Mycoplasma penetrans and Mycoplasma pneumoniae. The lower detection limit for feline and canine hemoplasmas was 1 to 10 copies/PCR. The assay exhibited 98.2% diagnostic sensitivity and 92.1% diagnostic specificity for feline hemoplasmas. All 1,950 Ixodes ticks were PCR negative, suggesting that Ixodes ticks are not relevant vectors for the above-mentioned hemoplasma species in Switzerland. None of the 414 blood samples derived from anemic or immunocompromised human patients revealed a clear positive result. The SYBR green PCR assay described here is a suitable tool to screen for known and so-far-undiscovered hemoplasma species. Positive results should be confirmed by specific TaqMan PCR or sequencing.
A Web-Based Adaptive Tutor to Teach PCR Primer Design
van Seters, Janneke R.; Wellink, Joan; Tramper, Johannes; Goedhart, Martin J.; Ossevoort, Miriam A.
2012-01-01
When students have varying prior knowledge, personalized instruction is desirable. One way to personalize instruction is by using adaptive e-learning to offer training of varying complexity. In this study, we developed a web-based adaptive tutor to teach PCR primer design: the PCR Tutor. We used part of the Taxonomy of Educational Objectives (the…
Directory of Open Access Journals (Sweden)
Serena Joaquín
2009-06-01
Full Text Available Abstract Background Studies of gene expression in experimental cerebral ischaemia models can contribute to understanding the pathophysiology of brain ischaemia and to identifying prognostic markers and potential therapeutic targets. The normalization of relative qRT-PCR data using a suitable reference gene is a crucial prerequisite for obtaining reliable conclusions. No validated housekeeping genes have been reported for the relative quantification of the mRNA expression profile activated in in-vitro ischaemic conditions, whereas for the in-vivo model different reference genes have been used. The present study aims to determine the expression stability of ten housekeeping genes (Gapdh, β2m, Hprt, Ppia, Rpl13a, Oaz1, 18S rRNA, Gusb, Ywhaz and Sdha to establish their suitability as control genes for in-vitro and in-vivo cerebral ischaemia models. Results The expression stability of the candidate reference genes was evaluated using the 2-ΔC'T method and ANOVA followed by Dunnett's test. For the in-vitro model using primary cultures of rat astrocytes, all genes analysed except for Rpl13a and Sdha were found to have significantly different levels of mRNA expression. These different levels were also found in the case of the in-vivo model of pMCAO in rats except for Hprt, Sdha and Ywhaz mRNA, where the expression did not vary. Sdha and Ywhaz were identified by geNorm and NormFinder as the two most stable genes. Conclusion We have validated endogenous control genes for qRT-PCR analysis of gene expression in in-vitro and in-vivo cerebral ischaemia models. For normalization purposes, Rpl13a and Sdha are found to be the most suitable genes for the in-vitro model and Sdha and Ywhaz for the in-vivo model. Genes previously used as housekeeping genes for the in-vivo model in the literature were not validated as good control genes in the present study, showing the need for careful evaluation for each new experimental setup.
Directory of Open Access Journals (Sweden)
Helena Lage Ferreira
2009-08-01
Full Text Available Avian metapneumovirus (AMPV belongs to Metapneumovirus genus of Paramyxoviridae family. Virus isolation, serology, and detection of genomic RNA are used as diagnostic methods for AMPV. The aim of the present study was to compare the detection of six subgroup A AMPV isolates (AMPV/A viral RNA by using different conventional and real time RT-PCR methods. Two new RT-PCR tests and two real time RT-PCR tests, both detecting fusion (F gene and nucleocapsid (N gene were compared with an established test for the attachment (G gene. All the RT-PCR tested assays were able to detect the AMPV/A. The lower detection limits were observed using the N-, F- based RRT-PCR and F-based conventional RT-PCR (10(0.3 to 10¹ TCID50 mL-1. The present study suggests that the conventional F-based RT-PCR presented similar detection limit when compared to N- and F-based RRT-PCR and they can be successfully used for AMPV/A detection.O metapneumovírus aviário (AMPV pertence ao gênero Metapneumovirus, família Paramyxoviridae. Isolamento viral, sorologia e detecção do RNA genômico são atualmente as técnicas utilizadas para o diagnóstico desse agente. O objetivo do presente estudo foi comparar a detecção de RNA viral de seis isolados de AMPV, subtipo A (AMPV/A, utilizando diferentes métodos de RT-PCR convencional e real time RT-PCR (RRT-PCR. Duas novas técnicas de RT-PCR convencional e duas técnicas de RRT-PCR, ambas para a detecção dos genes da nucleoproteína (N e da proteína de fusão (F, foram comparadas com um RT-PCR previamente estabelecido para a detecção do AMPV (gene da glicoproteína -G. Todos esses métodos foram capazes de detectar os isolados AMPV/A. As técnicas RRT-PCR (genes F e N mostraram os menores limites de detecção (10(0.3 to 10¹ TCID50 mL-1. Os resultados sugerem que as técnicas RT-PCR convencional (gene F e as técnicas de RRT-PCR (gene F e N desenvolvidas no presente estudo podem ser utilizadas com sucesso para a detecção do
Frequency of Chlamydia trachomatis in genital specimens: kerman city, PCR method
Directory of Open Access Journals (Sweden)
Khalili M
2008-06-01
Full Text Available Background: Chlamydia trachomatis (CT is an obligate intracellular bacterium that causes genital disease and the most common sexually transmitted infection in the world. The most frequent risk factors associated with chlamydial infection are related to sexual behavior, multiple partners, and inconsistent condom use. Presenting primarily as urtheritis in men and cervicitis in women, CT a major cause of chronic pelvic inflammatory disease and subsequent infertility in women, eye and lung infection in newborns and other manifestations. Identification of CT-infected patients may prevent its spread and thereby reduce the high morbidity associated with CT infections. Polymerase chain reaction (PCR is a sensitive and specific method for the detection of small quantity of bacterial DNA in clinical samples. The aim of this study was to determine the frequency of C. trachomatis by PCR in genital samples from patients in the city of Kerman.Methods: A total of 130 genital samples including 64 endocervical and 66 urethral swab samples were collected by physicians. Nucleic acid was extracted from each sample using a commercial DNA extraction kit. PCR primers specific for a conserved region of the C. trachomatis omp2 gene, encoding an outer membrane protein, were used for amplification. Results: A total of 9.2% (6.25% of cervicitis and 12.1% of urethritis of the samples were found positive for CT using this PCR method. Conclusions: The present study shows a high prevalence of CT infection, especially in men with urethritis. Such patients should be referred to genitourinary clinics for treatment and partner notification. Given its worldwide prevalence, further CT studies on more populations are needed to assess potential public health implications of these infections.
McMahon, Tanis C.; Blais, Burton W.; Wong, Alex; Carrillo, Catherine D.
2017-01-01
Foodborne illness attributed to enterohemorrhagic E. coli (EHEC), a highly pathogenic subset of Shiga toxin-producing E. coli (STEC), is increasingly recognized as a significant public health issue. Current microbiological methods for identification of EHEC in foods often use PCR-based approaches to screen enrichment broth cultures for characteristic gene markers [i.e., Shiga toxin (stx) and intimin (eae)]. However, false positives arise when complex food matrices, such as beef, contain mixtu...
Universal DNA-based methods for assessing the diet of grazing livestock and wildlife from feces.
Pegard, Anthony; Miquel, Christian; Valentini, Alice; Coissac, Eric; Bouvier, Frédéric; François, Dominique; Taberlet, Pierre; Engel, Erwan; Pompanon, François
2009-07-08
Because of the demand for controlling livestock diets, two methods that characterize the DNA of plants present in feces were developed. After DNA extraction from fecal samples, a short fragment of the chloroplastic trnL intron was amplified by PCR using a universal primer pair for plants. The first method generates a signature that is the electrophoretic migration pattern of the PCR product. The second method consists of sequencing several hundred DNA fragments from the PCR product through pyrosequencing. These methods were validated with a blind analysis of feces from concentrate- and pasture-fed lambs. The signature method allowed differentiation of the two diets and confirmed the presence of concentrate in one of them. The pyrosequencing method allowed the identification of up to 25 taxa in a diet. These methods are complementary to the chemical methods already used. They could be applied to the control of diets and the study of food preferences.
Validation of NAA Method for Urban Particulate Matter
International Nuclear Information System (INIS)
Woro Yatu Niken Syahfitri; Muhayatun; Diah Dwiana Lestiani; Natalia Adventini
2009-01-01
Nuclear analytical techniques have been applied in many countries for determination of environmental pollutant. Method of NAA (neutron activation analysis) representing one of nuclear analytical technique of that has low detection limits, high specificity, high precision, and accuracy for large majority of naturally occurring elements, and ability of non-destructive and simultaneous determination of multi-elemental, and can handle small sample size (< 1 mg). To ensure quality and reliability of the method, validation are needed to be done. A standard reference material, SRM NIST 1648 Urban Particulate Matter, has been used to validate NAA method. Accuracy and precision test were used as validation parameters. Particulate matter were validated for 18 elements: Ti, I, V, Br, Mn, Na, K, Cl, Cu, Al, As, Fe, Co, Zn, Ag, La, Cr, and Sm,. The result showed that the percent relative standard deviation of the measured elemental concentrations are found to be within ranged from 2 to 14,8% for most of the elements analyzed whereas Hor rat value in range 0,3-1,3. Accuracy test results showed that relative bias ranged from -11,1 to 3,6%. Based on validation results, it can be stated that NAA method is reliable for characterization particulate matter and other similar matrix samples to support air quality monitoring. (author)
Comparison of three mycobacterial DNA extraction methods from extrapulmonary samples for PCR assay
Directory of Open Access Journals (Sweden)
Khandaker Shadia
2012-01-01
Full Text Available Sensitivity of the molecular diagnostic tests of extrapulmonary tuberculosis largely depends upon the efficiency of DNA extraction methods. The objective of our study was to compare three methods of extracting DNA of Mycobacterium tuberculosis for testing by polymerase chain reaction. All three methods; heating, heating with sonication and addition of lysis buffer with heating and sonication were implicated on 20 extrapulmonary samples. PCR positivity was 2 (10%, 4 (20% and 7 (35% in the samples extracted by heating, heat+sonication and heat+sonication+lysis buffer method respectively. Of the extraction methods evaluated, maximum PCR positive results were achieved by combined heat, sonication and lysis buffer method which can be applied in routine clinical practice. Ibrahim Med. Coll. J. 2012; 6(1: 9-11
Detection of Mycoplasma synoviae in clinical samples by VlhA-PCR method
Directory of Open Access Journals (Sweden)
H Ansari
2010-02-01
Full Text Available As one of the major pathogens of avian species, Mycoplasma Synoviae causes significant economic losses to the poultry industry. The main purpose of this study was to detect Mycoplasma Synoviae in clinical samples using the VlhA-PCR method. For serological screening test, 373 serum samples were collected from 25 breeder farms and rapid serum agglutination test conducted which revealed that 143 samples equivalent to 19 breeder farms were positive. For VlhA-PCR assay, 20 of the previously mentioned breeder farms were selected and sterile swab were collected from the palatine cleft, trachea, air sacs and lungs. Three swabs from 3 birds were placed in a test tube containing 1 ml of PBS and transferred to the laboratory for PCR test. Specific primers for VIhA gene were employed in this study. The PCR product from specific primers showed 350-400 bp for all field isolated on electrophoresis gel in 8 farms. VlhA-PCR with high sensitivity could be employed in definitive diagnosis of Mycoplasma Synoviae infection in the laboratory.
Directory of Open Access Journals (Sweden)
M Fallah
2012-09-01
Full Text Available Background: Metronidazole is drug of choice recommended by WHO for treatment of trichomoniasis, however, some reports claims drug resistance in Trichomonas vaginalis isolates recently. The objective of this study was to determine the minimum lethal concentration (MLC of metronidazole in resistant and sensitive strains, as well as genetic patterns of these stains by PCR method. Methods: From February 2006 to March 2007, in a cross sectional study, clinical and wet mount examination of vaginal smear along with culture were performed on 683 women attending to public and private outpatient clinics in Hamadan. Trichomoniasis marked based on major clinical symptoms. Diagnosis confirmed using wet mount microscopically and culture in Diamond medium. A serial concentration of metronidazole was provided and all isolated Trichomonas strains (resistant and sensitive tested by standard method. Finally, all sensitive and resistant strains examined by PCR technique. Results: Only 15/683, (2.2% of patients clinically diagnosed trichomonal vaginitis were positive for T. vaginalis by wet smear and culture. The minimum lethal concentration (MLC for clinically sensitive isolates was 25 µg/ml; however, this concentration for resistant isolates was 200 µg/ml after 24 h and 100 µg/ml after 50 h. The results of PCR examination of DNA from sensitive and resistant isolates had same pattern. The lanes appeared by two primers were 98 bp and 261 bp for both clinically sensitive and resistant strains. Conclusion: Resistance to metronidazole in T. vaginalis has not relation to genetic variations and might be related to some physiologic pathways of organism.
A proline racemase based PCR for identification of Trypanosoma vivax in cattle blood.
Directory of Open Access Journals (Sweden)
Regassa Fikru
Full Text Available A study was conducted to develop a Trypanosoma vivax (T. vivax specific PCR based on the T. vivax proline racemase (TvPRAC gene. Forward and reverse primers were designed that bind at 764-783 bp and 983-1002 bp of the gene. To assess its specificity, TvPRAC PCR was conducted on DNA extracted from different haemotropic pathogens: T. vivax from Nigeria, Ethiopia and Venezuela, T. congolense Savannah type, T. brucei brucei, T. evansi, T. equiperdum, T. theileri, Theileria parva, Anaplasma marginale, Babesia bovis and Babesia bigemina and from bovine, goat, mouse, camel and human blood. The analytical sensitivity of the TvPRAC PCR was compared with that of the ITS-1 PCR and the 18S PCR-RFLP on a dilution series of T. vivax DNA in water. The diagnostic performance of the three PCRs was compared on 411 Ethiopian bovine blood specimens collected in a former study. TvPRAC PCR proved to be fully specific for T. vivax, irrespective of its geographical origin. Its analytical sensitivity was lower than that of ITS-1 PCR. On these bovine specimens, TvPRAC PCR detected 8.3% T. vivax infections while ITS-1 PCR and 18S PCR-RFLP detected respectively 22.6 and 6.1% T. vivax infections. The study demonstrates that a proline racemase based PCR could be used, preferably in combination with ITS-1 PCR, as a species-specific diagnostic test for T. vivax infections worldwide.
Directory of Open Access Journals (Sweden)
Julia Lambret-Frotté
Full Text Available Employing reference genes to normalize the data generated with quantitative PCR (qPCR can increase the accuracy and reliability of this method. Previous results have shown that no single housekeeping gene can be universally applied to all experiments. Thus, the identification of a suitable reference gene represents a critical step of any qPCR analysis. Setaria viridis has recently been proposed as a model system for the study of Panicoid grasses, a crop family of major agronomic importance. Therefore, this paper aims to identify suitable S. viridis reference genes that can enhance the analysis of gene expression in this novel model plant. The first aim of this study was the identification of a suitable RNA extraction method that could retrieve a high quality and yield of RNA. After this, two distinct algorithms were used to assess the gene expression of fifteen different candidate genes in eighteen different samples, which were divided into two major datasets, the developmental and the leaf gradient. The best-ranked pair of reference genes from the developmental dataset included genes that encoded a phosphoglucomutase and a folylpolyglutamate synthase; genes that encoded a cullin and the same phosphoglucomutase as above were the most stable genes in the leaf gradient dataset. Additionally, the expression pattern of two target genes, a SvAP3/PI MADS-box transcription factor and the carbon-fixation enzyme PEPC, were assessed to illustrate the reliability of the chosen reference genes. This study has shown that novel reference genes may perform better than traditional housekeeping genes, a phenomenon which has been previously reported. These results illustrate the importance of carefully validating reference gene candidates for each experimental set before employing them as universal standards. Additionally, the robustness of the expression of the target genes may increase the utility of S. viridis as a model for Panicoid grasses.
Dijkman, R; Feberwee, A; Landman, W J M
2017-08-01
A quantitative PCR (qPCR) able to differentiate between field Mycoplasma synoviae and MS-H vaccine strain was developed, validated and evaluated. It was developed using nucleotide differences in the obg gene. Analytical specificity and sensitivity assessed using DNA from 194 M. synoviae field samples, three different batches of MS-H vaccine and from 43 samples representing four other avian Mycoplasma species proved to be 100%. The detection limit for field M. synoviae and MS-H vaccine strain was 10 2-3 and 10 2 colony-forming units PCR equivalents/g trachea mucus, respectively. The qPCR was able to detect both, field M. synoviae and MS-H vaccine strain in ratios of 1:100 determined both using spiked and field samples. One hundred and twenty samples from M. synoviae-infected non-vaccinated birds, 110 samples from M. synoviae-vaccinated birds from a bird experiment and 224 samples from M. synoviae negative (serology and PCR) birds were used to determine the relative sensitivity and specificity using a previously described M. synoviae PCR as reference. The relative sensitivity and specificity for field M. synoviae were 95.0% and 99.6%, respectively, and 94.6% and 100% for the MS-H-live vaccine, respectively. Field validation and confirmation by multi locus sequence typing revealed that the qPCR correctly distinguished between MS-H and field M. synoviae. Evaluation of the differentiating M. synoviae qPCR in three commercial flocks suggested transmission of MS-H-live vaccine from vaccinated to non-vaccinated flocks at the same farm. Furthermore, it showed evidence for the colonization with field M. synoviae in MS-H-vaccinated flocks.
Validation of kinetics similarity in qPCR
Czech Academy of Sciences Publication Activity Database
Bar, T.; Kubista, Mikael; Tichopád, Aleš
2012-01-01
Roč. 40, č. 4 (2012), s. 1395-1406 ISSN 0305-1048 R&D Projects: GA ČR GAP303/10/1338; GA ČR GA301/09/1752 Institutional research plan: CEZ:AV0Z50520701 Keywords : REAL-TIME PCR * POLYMERASE-CHAIN-REACTION * SYBR-GREEN-I Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 8.278, year: 2012
Directory of Open Access Journals (Sweden)
Junan Ren
Full Text Available Meat adulteration is a worldwide concern. In this paper, a new droplet digital PCR (ddPCR method was developed for the quantitative determination of the presence of chicken in sheep and goat meat products. Meanwhile, a constant (multiplication factor was introduced to transform the ratio of copy numbers to the proportion of meats. The presented ddPCR method was also proved to be more accurate (showing bias of less than 9% in the range from 5% to 80% than real-time PCR, which has been widely used in this determination. The method exhibited good repeatability and stability in different thermal treatments and at ultra-high pressure. The relative standard deviation (RSD values of 5% chicken content was less than 5.4% for ultra-high pressure or heat treatment. Moreover, we confirmed that different parts of meat had no effect on quantification accuracy of the ddPCR method. In contrast to real-time PCR, we examined the performance of ddPCR as a more precise, sensitive and stable analytical strategy to overcome potential problems of discrepancies in amplification efficiency discrepancy and to obtain the copy numbers directly without standard curves. The method and strategy developed in this study can be applied to quantify the presence and to confirm the absence of adulterants not only to sheep but also to other kinds of meat and meat products.
Directory of Open Access Journals (Sweden)
Koppel Juraj
2007-12-01
Full Text Available Abstract Background Fluorescent data obtained from real-time PCR must be processed by some method of data analysis to obtain the relative quantity of target mRNA. The method chosen for data analysis can strongly influence results of the quantification. Results To compare the performance of six techniques which are currently used for analysing fluorescent data in real-time PCR relative quantification, we quantified four cytokine transcripts (IL-1β, IL-6 TNF-α, and GM-CSF in an in vivo model of colonic inflammation. Accuracy of the methods was tested by quantification on samples with known relative amounts of target mRNAs. Reproducibility of the methods was estimated by the determination of the intra-assay and inter-assay variability. Cytokine expression normalized to the expression of three reference genes (ACTB, HPRT, SDHA was then determined using the six methods for data analysis. The best results were obtained with the relative standard curve method, comparative Ct method and with DART-PCR, LinRegPCR and Liu & Saint exponential methods when average amplification efficiency was used. The use of individual amplification efficiencies in DART-PCR, LinRegPCR and Liu & Saint exponential methods significantly impaired the results. The sigmoid curve-fitting (SCF method produced medium performance; the results indicate that the use of appropriate type of fluorescence data and in some instances manual selection of the number of amplification cycles included in the analysis is necessary when the SCF method is applied. We also compared amplification efficiencies (E and found that although the E values determined by different methods of analysis were not identical, all the methods were capable to identify two genes whose E values significantly differed from other genes. Conclusion Our results show that all the tested methods can provide quantitative values reflecting the amounts of measured mRNA in samples, but they differ in their accuracy and
Directory of Open Access Journals (Sweden)
Zhao Dawei
2016-01-01
Full Text Available In recent years, a significant number of large-scale solar photovoltaic (PV plants have been put into operation or been under planning around the world. The model accuracy of solar PV plant is the key factor to investigate the mutual influences between solar PV plants and a power grid. However, this problem has not been well solved, especially in how to apply the real measurements to validate the models of the solar PV plants. Taking fast-responding generator method as an example, this paper presents a model validation methodology for solar PV plant via the hybrid data dynamic simulation. First, the implementation scheme of hybrid data dynamic simulation suitable for DIgSILENT PowerFactory software is proposed, and then an analysis model of solar PV plant integration based on IEEE 9 system is established. At last, model validation of solar PV plant is achieved by employing hybrid data dynamic simulation. The results illustrate the effectiveness of the proposed method in solar PV plant model validation.
A Ribeiroia spp. (Class: Trematoda) - Specific PCR-based diagnostic
Reinitz, David M.; Yoshino, T.P.; Cole, Rebecca A.
2007-01-01
Increased reporting of amphibian malformations in North America has been noted with concern in light of reports that amphibian numbers and species are declining worldwide. Ribeiroia ondatrae has been shown to cause a variety of types of malformations in amphibians. However, little is known about the prevalence of R. ondatrae in North America. To aid in conducting field studies of Ribeiroia spp., we have developed a polymerase chain reaction (PCR)-based diagnostic. Herein, we describe the development of an accurate, rapid, simple, and cost-effective diagnostic for detection of Ribeiroia spp. infection in snails (Planorbella trivolvis). Candidate oligonucleotide primers for PCR were designed via DNA sequence analyses of multiple ribosomal internal transcribed spacer-2 regions from Ribeiroia spp. and Echinostoma spp. Comparison of consensus sequences determined from both genera identified areas of sequence potentially unique to Ribeiroia spp. The PCR reliably produced a diagnostic 290-base pair (bp) product in the presence of a wide concentration range of snail or frog DNA. Sensitivity was examined with DNA extracted from single R. ondatrae cercaria. The single-tube PCR could routinely detect less than 1 cercariae equivalent, because DNA isolated from a single cercaria could be diluted at least 1:50 and still yield a positive result via gel electrophoresis. An even more sensitive nested PCR also was developed that routinely detected 100 fg of the 290-bp fragment. The assay did not detect furcocercous cercariae of certain Schistosomatidae, Echinostoma sp., or Sphaeridiotrema globulus nor adults of Clinostomum sp. or Cyathocotyle bushiensis. Field testing of 137 P. trivolvis identified 3 positives with no overt environmental cross-reactivity, and results concurred with microscopic examinations in all cases. ?? American Society of Parasitologists 2007.
Bovine Papillomavirus in Brazil: Detection of Coinfection of Unusual Types by a PCR-RFLP Method
Directory of Open Access Journals (Sweden)
R. F. Carvalho
2013-01-01
Full Text Available Bovine papillomavirus (BPV is recognized as a causal agent of benign and malignant tumors in cattle. Thirteen types of BPV are currently characterized and classified into three distinct genera, associated with different pathological outcomes. The described BPV types as well as other putative ones have been demonstrated by molecular biology methods, mainly by the employment of degenerated PCR primers. Specifically, divergences in the nucleotide sequence of the L1 gene are useful for the identification and classification of new papillomavirus types. On the present work, a method based on the PCR-RFLP technique and DNA sequencing was evaluated as a screening tool, allowing for the detection of two relatively rare types of BPV in lesions samples from a six-year-old Holstein dairy cow, chronically affected with cutaneous papillomatosis. These findings point to the dissemination of BPVs with unclear pathogenic potential, since two relatively rare, new described BPV types, which were first characterized in Japan, were also detected in Brazil.
[Application of rapid PCR to authenticate medicinal snakes].
Chen, Kang; Jiang, Chao; Yuan, Yuan; Huang, Lu-Qi; Li, Man
2014-10-01
To obtained an accurate, rapid and efficient method for authenticate medicinal snakes listed in Chinese Pharmacopoeia (Zaocysd humnades, Bungarus multicinctus, Agkistrodon acutus), a rapid PCR method for authenticate snakes and its adulterants was established based on the classic molecular authentication methods. DNA was extracted by alkaline lysis and the specific primers were amplified by two-steps PCR amplification method. The denatured and annealing temperature and cycle numbers were optimized. When 100 x SYBR Green I was added in the PCR product, strong green fluorescence was visualized under 365 nm UV whereas adulterants without. The whole process can complete in 30-45 minutes. The established method provides the technical support for authentication of the snakes on field.
Selecting and validating reference genes for quantitative real-time PCR in Plutella xylostella (L.).
You, Yanchun; Xie, Miao; Vasseur, Liette; You, Minsheng
2018-05-01
Gene expression analysis provides important clues regarding gene functions, and quantitative real-time PCR (qRT-PCR) is a widely used method in gene expression studies. Reference genes are essential for normalizing and accurately assessing gene expression. In the present study, 16 candidate reference genes (ACTB, CyPA, EF1-α, GAPDH, HSP90, NDPk, RPL13a, RPL18, RPL19, RPL32, RPL4, RPL8, RPS13, RPS4, α-TUB, and β-TUB) from Plutella xylostella were selected to evaluate gene expression stability across different experimental conditions using five statistical algorithms (geNorm, NormFinder, Delta Ct, BestKeeper, and RefFinder). The results suggest that different reference genes or combinations of reference genes are suitable for normalization in gene expression studies of P. xylostella according to the different developmental stages, strains, tissues, and insecticide treatments. Based on the given experimental sets, the most stable reference genes were RPS4 across different developmental stages, RPL8 across different strains and tissues, and EF1-α across different insecticide treatments. A comprehensive and systematic assessment of potential reference genes for gene expression normalization is essential for post-genomic functional research in P. xylostella, a notorious pest with worldwide distribution and a high capacity to adapt and develop resistance to insecticides.
Hussain, Musaddeq
2015-11-10
Chinese hamster ovary (CHO) cells are the host cell of choice for manufacturing of monoclonal antibody (mAb) drugs in the biopharmaceutical industry. Host cell DNA is an impurity of such manufacturing process and must be controlled and monitored in order to ensure drug purity and safety. A conventional method for quantification of host residual DNA in drug requires extraction of DNA from the mAb drug substance with subsequent quantification of the extracted DNA using real-time PCR (qPCR). Here we report a method where the DNA extraction step is eliminated prior to qPCR. In this method, which we have named 'direct resDNA qPCR', the mAb drug substance is digested with a protease called KAPA in a 96-well PCR plate, the protease in the digest is then denatured at high temperature, qPCR reagents are added to the resultant reaction wells in the plate along with standards and controls in other wells of the same plate, and the plate subjected to qPCR for analysis of residual host DNA in the samples. This direct resDNA qPCR method for CHO is sensitive to 5.0fg of DNA with high precision and accuracy and has a wide linear range of determination. The method has been successfully tested with four mAbs drug, two IgG1 and two IgG4. Both the purified drug substance as well as a number of process intermediate samples, e.g., bioreactor harvest, Protein A column eluate and ion-exchange column eluates were tested. This method simplifies the residual DNA quantification protocol, reduces time of analysis and leads to increased assay sensitivity and development of automated high-throughput methods. Copyright © 2015 Elsevier B.V. All rights reserved.
Thongdee, Pimwan; Chaijaroenkul, Wanna; Kuesap, Jiraporn; Na-Bangchang, Kesara
2014-08-01
Microscopy is considered as the gold standard for malaria diagnosis although its wide application is limited by the requirement of highly experienced microscopists. PCR and serological tests provide efficient diagnostic performance and have been applied for malaria diagnosis and research. The aim of this study was to investigate the diagnostic performance of nested PCR and a recently developed an ELISA-based new rapid diagnosis test (RDT), NovaLisa test kit, for diagnosis of malaria infection, using microscopic method as the gold standard. The performance of nested-PCR as a malaria diagnostic tool is excellent with respect to its high accuracy, sensitivity, specificity, and ability to discriminate Plasmodium species. The sensitivity and specificity of nested-PCR compared with the microscopic method for detection of Plasmodium falciparum, Plasmodium vivax, and P. falciparum/P. vivax mixed infection were 71.4 vs 100%, 100 vs 98.7%, and 100 vs 95.0%, respectively. The sensitivity and specificity of the ELISA-based NovaLisa test kit compared with the microscopic method for detection of Plasmodium genus were 89.0 vs 91.6%, respectively. NovaLisa test kit provided comparable diagnostic performance. Its relatively low cost, simplicity, and rapidity enables large scale field application.
Directory of Open Access Journals (Sweden)
Thrush Anthony
2010-01-01
Full Text Available Abstract Background Perennial ryegrass (Lolium perenne L. is an important pasture and turf crop. Biotechniques such as gene expression studies are being employed to improve traits in this temperate grass. Quantitative reverse transcription-polymerase chain reaction (qRT-PCR is among the best methods available for determining changes in gene expression. Before analysis of target gene expression, it is essential to select an appropriate normalisation strategy to control for non-specific variation between samples. Reference genes that have stable expression at different biological and physiological states can be effectively used for normalisation; however, their expression stability must be validated before use. Results Existing Serial Analysis of Gene Expression data were queried to identify six moderately expressed genes that had relatively stable gene expression throughout the year. These six candidate reference genes (eukaryotic elongation factor 1 alpha, eEF1A; TAT-binding protein homolog 1, TBP-1; eukaryotic translation initiation factor 4 alpha, eIF4A; YT521-B-like protein family protein, YT521-B; histone 3, H3; ubiquitin-conjugating enzyme, E2 were validated for qRT-PCR normalisation in 442 diverse perennial ryegrass (Lolium perenne L. samples sourced from field- and laboratory-grown plants under a wide range of experimental conditions. Eukaryotic EF1A is encoded by members of a multigene family exhibiting differential expression and necessitated the expression analysis of different eEF1A encoding genes; a highly expressed eEF1A (h, a moderately, but stably expressed eEF1A (s, and combined expression of multigene eEF1A (m. NormFinder identified eEF1A (s and YT521-B as the best combination of two genes for normalisation of gene expression data in perennial ryegrass following different defoliation management in the field. Conclusions This study is unique in the magnitude of samples tested with the inclusion of numerous field-grown samples
Analytical models approximating individual processes: a validation method.
Favier, C; Degallier, N; Menkès, C E
2010-12-01
Upscaling population models from fine to coarse resolutions, in space, time and/or level of description, allows the derivation of fast and tractable models based on a thorough knowledge of individual processes. The validity of such approximations is generally tested only on a limited range of parameter sets. A more general validation test, over a range of parameters, is proposed; this would estimate the error induced by the approximation, using the original model's stochastic variability as a reference. This method is illustrated by three examples taken from the field of epidemics transmitted by vectors that bite in a temporally cyclical pattern, that illustrate the use of the method: to estimate if an approximation over- or under-fits the original model; to invalidate an approximation; to rank possible approximations for their qualities. As a result, the application of the validation method to this field emphasizes the need to account for the vectors' biology in epidemic prediction models and to validate these against finer scale models. Copyright © 2010 Elsevier Inc. All rights reserved.
Detection and Identification of Free-living Amoeba from Environmental Water in Taiwan by PCR Method
Tsai, H. F.; Hsu, B. M.; Huang, K. H.; She, C. Y.; Kao, P. M.; Shen, S. M.; Tseng, S. F.; Chen, J. S.
2012-04-01
Acanthamoeba, Naegleria, Balamuthia and Hartmannella all belong to free-living amoebae that are present ubiquitously in the environment including water, soil, and air. Free-living amoebae are parasites which can infect humans and can lead to serious illness and even death. The aim of this study is to investigate the presence of free-living amoebae in aquatic environment in Taiwan, and to compare the differences between Acanthamoeba and Naegleria in diverse cultivation methods and conditions. In this study, we used molecular method by PCR amplification with specific primers to analyze the occurrence of free-living amoebae. We collected 176 samples from environmental water including drinking water treatment plants, stream water, and hot spring recreational areas in Taiwan. Based on the results of PCR, 43 water samples (24.4%) were detected positive for free-living amoebae. The most common Acanthamoeba genotype isolated from samples including T2, T4, T5, T12, and T15. N. australiensis and N. lovaniensis were also identified by molecular biology techniques. Furthermore, we found that both Acanthamoeba and Naegleria can be cultured by PYG in 30° C, but not all free-living amoebae can be isolated and enriched by using storage-cultivation method. Because of the widespread presence of Acanthamoeba and Naegleria in aquatic environments, the water quality and safety of aquatic environments should be more conscious in Taiwan and worldwide. Keywords: free-living amoebae; Acanthamoeba; Naegleria; Balamuthia; Hartmannella; PCR
Directory of Open Access Journals (Sweden)
Tomasz Kulik
2012-12-01
Full Text Available We identified a species level of the fungal cultures isolated from selected crop seeds using traditional method and BIO-PCR. The use of BIO-PCR did not correspond completely to the morphological analyses. Both methods showed increased infection with F. poae in winter wheat seed sample originated from north Poland. Fungal culture No 40 (isolated from faba bean and identified with traditional method as mixed culture with F. culmorum and F. graminearum did not produce expected product after PCR reaction with species specific primers OPT18F470, OPT18R470. However, the use of additional primers Fc01F, Fc01R allowed for reliable identification of F. culmorum in the culture.
EPA Method 1615 measures enteroviruses and noroviruses present in environmental and drinking waters. The viral ribonucleic acid (RNA) from water sample concentrates is extracted and tested for enterovirus and norovirus RNA using reverse transcription-quantitative PCR (RT-qPCR). V...
A mutant screening method by critical annealing temperature-PCR for site-directed mutagenesis.
Liu, Ying; Wu, Ting; Song, Jian; Chen, Xuelian; Zhang, Yu; Wan, Yu
2013-03-11
Distinguishing desired mutants from parental templates and undesired mutants is a problem not well solved in Quikchange™ mutagenesis. Although Dpn I digestion can eliminate methylated parental (WT) DNA, the efficiency is not satisfying due to the existence of hemi-methylated DNA in the PCR products, which is resistant to Dpn I. The present study designed a novel critical annealing temperature (T(c))-PCR to replace Dpn I digestion for more perfect mutant distinguishing, in which part-overlapping primers containing mutation(s) were used to reduce initial concentration of template DNA in mutagenic PCR. A T(c)-PCR with the same mutagenic primers was performed without Dpn I digestion. The T(c) for each pair of the primers was identified by gradient PCR. The relationship between PCR-identified T(c) and T(m) of the primers was analyzed and modeled with correlation and regression. Gradient PCR identified a T(c) for each of 14 tested mutagenic primers, which could discriminate mismatched parental molecules and undesired mutants from desired mutants. The PCR-identified T(c) was correlated to the primer's T(m) (r = 0.804, P<0.0001). Thus, in practical applications, the T(c) can be easily calculated with a regression equation, T(c)= 48.81 + 0.253*T(m). The new protocol introduced a novel T(c)-PCR method for mutant screening which can more efficiently and accurately select against parental molecules and undesired mutations in mutagenic sequence segments.
Evaluation of PCR methods for detection of Brucella strains from culture and tissues.
Çiftci, Alper; İça, Tuba; Savaşan, Serap; Sareyyüpoğlu, Barış; Akan, Mehmet; Diker, Kadir Serdar
2017-04-01
The genus Brucella causes significant economic losses due to infertility, abortion, stillbirth or weak calves, and neonatal mortality in livestock. Brucellosis is still a zoonosis of public health importance worldwide. The study was aimed to optimize and evaluate PCR assays used for the diagnosis of Brucella infections. For this aim, several primers and PCR protocols were performed and compared with Brucella cultures and biological material inoculated with Brucella. In PCR assays, genus- or species-specific oligonucleotide primers derived from 16S rRNA sequences (F4/R2, Ba148/928, IS711, BruP6-P7) and OMPs (JPF/JPR, 31ter/sd) of Brucella were used. All primers except for BruP6-P7 detected the DNA from reference Brucella strains and field isolates. In spiked blood, milk, and semen samples, F4-R2 primer-oriented PCR assays detected minimal numbers of Brucella. In spiked serum and fetal stomach content, Ba148/928 primer-oriented PCR assays detected minimal numbers of Brucella. Field samples collected from sheep and cattle were examined by bacteriological methods and optimized PCR assays. Overall, sensitivity of PCR assays was found superior to conventional bacteriological isolation. Brucella DNA was detected in 35.1, 1.1, 24.8, 5.0, and 8.0% of aborted fetus, blood, milk, semen, and serum samples by PCR assays, respectively. In conclusion, PCR assay in optimized conditions was found to be valuable in sensitive and specific detection of Brucella infections of animals.
Kim, Jaai; Lim, Juntaek; Lee, Changsoo
2013-12-01
Quantitative real-time PCR (qPCR) has been widely used in recent environmental microbial ecology studies as a tool for detecting and quantifying microorganisms of interest, which aids in better understandings of the complexity of wastewater microbial communities. Although qPCR can be used to provide more specific and accurate quantification than other molecular techniques, it does have limitations that must be considered when applying it in practice. This article reviews the principle of qPCR quantification and its applications to microbial ecology studies in various wastewater treatment environments. Here we also address several limitations of qPCR-based approaches that can affect the validity of quantification data: template nucleic acid quality, nucleic acid extraction efficiency, specificity of group-specific primers and probes, amplification of nonviable DNA, gene copy number variation, and limited number of sequences in the database. Even with such limitations, qPCR is reportedly among the best methods for quantitatively investigating environmental microbial communities. The application of qPCR is and will continue to be increasingly common in studies of wastewater treatment systems. To obtain reliable analyses, however, the limitations that have often been overlooked must be carefully considered when interpreting the results. Copyright © 2013 Elsevier Inc. All rights reserved.
Fu, Wei; Zhu, Pengyu; Wang, Chenguang; Huang, Kunlun; Du, Zhixin; Tian, Wenying; Wang, Qin; Wang, Huiyu; Xu, Wentao; Zhu, Shuifang
2015-08-04
Digital PCR has developed rapidly since it was first reported in the 1990 s. It was recently reported that an improved method facilitated the detection of genetically modified organisms (GMOs). However, to use this improved method, the samples must be pretreated, which could introduce inaccuracy into the results. In our study, we explored a pretreatment-free digital PCR detection method for the screening for GMOs. We chose the CaMV35s promoter and the NOS terminator as the templates in our assay. To determine the specificity of our method, 9 events of GMOs were collected, including MON810, MON863, TC1507, MIR604, MIR162, GA21, T25, NK603 and Bt176. Moreover, the sensitivity, intra-laboratory and inter-laboratory reproducibility of our detection method were assessed. The results showed that the limit of detection of our method was 0.1%, which was lower than the labeling threshold level of the EU. The specificity and stability among the 9 events were consistent, respectively. The intra-laboratory and inter-laboratory reproducibility were both good. Finally, the perfect fitness for the detection of eight double-blind samples indicated the good practicability of our method. In conclusion, the method in our study would allow more sensitive, specific and stable screening detection of the GMO content of international trading products.
Development of PCR method for diagnosing of honey bee American Foulbrood disease
Directory of Open Access Journals (Sweden)
Modirrousta, H.
2012-06-01
Full Text Available American foulbrood (AFB disease is caused by the sporeforming bacterium Paenibacillus larvae larvae. Traditional diagnosis is based on culture technique is time and laboratory work consuming. In this study with standard strain, PCR was developed by specific primers and PCR products were electrophoresed on 0.8 % agarose gel. The PCR primers were selected on the basis of the 16S rRNA gene and amplify a 700-bp amplicon. Detection limits were determined for suspensions of bacteria and spores and also honey and larvae experimentally contaminated. The lowest number of bacteria and spores that were able to detect were respectively 28, 33, 330 and 243 cfu /ml. This PCR technique can be used to identification of the presence of Paenibacillus larvae larvae spores in honey samples, brood samples or on the colonies that grow on medium.
High performance of a new PCR-based urine assay for HPV-DNA detection and genotyping.
Tanzi, Elisabetta; Bianchi, Silvia; Fasolo, Maria Michela; Frati, Elena R; Mazza, Francesca; Martinelli, Marianna; Colzani, Daniela; Beretta, Rosangela; Zappa, Alessandra; Orlando, Giovanna
2013-01-01
Human papillomavirus (HPV) testing has been proposed as a means of replacing or supporting conventional cervical screening (Pap test). However, both methods require the collection of cervical samples. Urine sample is easier and more acceptable to collect and could be helpful in facilitating cervical cancer screening. The aim of this study was to evaluate the sensitivity and specificity of urine testing compared to conventional cervical smear testing using a PCR-based method with a new, designed specifically primer set. Paired cervical and first voided urine samples collected from 107 women infected with HIV were subjected to HPV-DNA detection and genotyping using a PCR-based assay and a restriction fragment length polymorphism method. Sensitivity, specificity, Positive Predictive Value (PPV), and Negative Predictive Value (NPV) were calculated using the McNemar's test for differences. Concordance between tests was assessed using the Cohen's unweighted Kappa (k). HPV DNA was detected in 64.5% (95% CI: 55.1-73.1%) of both cytobrush and urine samples. High concordance rates of HPV-DNA detection (k = 0.96; 95% CI: 0.90-1.0) and of high risk-clade and low-risk genotyping in paired samples (k = 0.80; 95% CI: 0.67-0.92 and k = 0.74; 95% CI: 0.60-0.88, respectively) were observed. HPV-DNA detection in urine versus cervix testing revealed a sensitivity of 98.6% (95% CI: 93.1-99.9%) and a specificity of 97.4% (95% CI: 87.7-99.9%), with a very high NPV (97.4%; 95% CI: 87.7-99.9%). The PCR-based assay utilized in this study proved highly sensitive and specific for HPV-DNA detection and genotyping in urine samples. These data suggest that a urine-based assay would be a suitable and effective tool for epidemiological surveillance and, most of all, screening programs. Copyright © 2012 Wiley Periodicals, Inc.
Validation of a Salmonella loop-mediated isothermal amplification assay in animal food.
Domesle, Kelly J; Yang, Qianru; Hammack, Thomas S; Ge, Beilei
2018-01-02
Loop-mediated isothermal amplification (LAMP) has emerged as a promising alternative to PCR for pathogen detection in food testing and clinical diagnostics. This study aimed to validate a Salmonella LAMP method run on both turbidimetry (LAMP I) and fluorescence (LAMP II) platforms in representative animal food commodities. The U.S. Food and Drug Administration (FDA)'s culture-based Bacteriological Analytical Manual (BAM) method was used as the reference method and a real-time quantitative PCR (qPCR) assay was also performed. The method comparison study followed the FDA's microbiological methods validation guidelines, which align well with those from the AOAC International and ISO. Both LAMP assays were 100% specific among 300 strains (247 Salmonella of 185 serovars and 53 non-Salmonella) tested. The detection limits ranged from 1.3 to 28 cells for six Salmonella strains of various serovars. Six commodities consisting of four animal feed items (cattle feed, chicken feed, horse feed, and swine feed) and two pet food items (dry cat food and dry dog food) all yielded satisfactory results. Compared to the BAM method, the relative levels of detection (RLODs) for LAMP I ranged from 0.317 to 1 with a combined value of 0.610, while those for LAMP II ranged from 0.394 to 1.152 with a combined value of 0.783, which all fell within the acceptability limit (2.5) for an unpaired study. This also suggests that LAMP was more sensitive than the BAM method at detecting low-level Salmonella contamination in animal food and results were available 3days sooner. The performance of LAMP on both platforms was comparable to that of qPCR but notably faster, particularly LAMP II. Given the importance of Salmonella in animal food safety, the LAMP assays validated in this study holds great promise as a rapid, reliable, and robust method for routine screening of Salmonella in these commodities. Published by Elsevier B.V.
Inoue, Hiroaki; Takama, Tomoko; Yoshizaki, Miwa; Agata, Kunio
2015-01-01
We detected Legionella species in 111 bath water samples and 95 cooling tower water samples by using a combination of conventional plate culture, quantitative polymerase chain reaction (qPCR) and qPCR combined with ethidium monoazide treatment (EMA-qPCR) methods. In the case of bath water samples, Legionella spp. were detected in 30 samples by plate culture, in 85 samples by qPCR, and in 49 samples by EMA-qPCR. Of 81 samples determined to be Legionella-negative by plate culture, 56 and 23 samples were positive by qPCR and EMA-qPCR, respectively. Therefore, EMA treatment decreased the number of Legionella-positive bath water samples detected by qPCR. In contrast, EMA treatment had no effect on cooling tower water samples. We therefore expect that EMA-qPCR is a useful method for the rapid detection of viable Legionella spp. from bath water samples.
Moving beyond Traditional Methods of Survey Validation
Maul, Andrew
2017-01-01
In his focus article, "Rethinking Traditional Methods of Survey Validation," published in this issue of "Measurement: Interdisciplinary Research and Perspectives," Andrew Maul wrote that it is commonly believed that self-report, survey-based instruments can be used to measure a wide range of psychological attributes, such as…
Kim, Min Jung; Hwang, Kyung Hwan; Lee, Young-Seok; Park, Jae-Yoon; Kook, Joong-Ki
2011-03-01
The aim of this study was to develop Prevotella intermedia-specific PCR primers based on the P. intermedia-specific DNA probe. The P. intermedia-specific DNA probe was screened by inverted dot blot hybridization and confirmed by Southern blot hybridization. The nucleotide sequences of the species-specific DNA probes were determined using a chain termination method. Southern blot analysis showed that the DNA probe, Pig27, detected only the genomic DNA of P. intermedia strains. PCR showed that the PCR primers, Pin-F1/Pin-R1, had species-specificity for P. intermedia. The detection limits of the PCR primer sets were 0.4pg of the purified genomic DNA of P. intermedia ATCC 49046. These results suggest that the PCR primers, Pin-F1/Pin-R1, could be useful in the detection of P. intermedia as well as in the development of a PCR kit in epidemiological studies related to periodontal diseases. Crown Copyright © 2010. Published by Elsevier B.V. All rights reserved.
Directory of Open Access Journals (Sweden)
Hilde A E Geraedts
Full Text Available Regular physical activity is essential for older adults to stay healthy and independent. However, daily physical activity is generally low among older adults and mainly consists of activities such as standing and shuffling around indoors. Accurate measurement of this low-energy expenditure daily physical activity is crucial for stimulation of activity. The objective of this study was to assess the validity of a necklace-worn sensor-based method for detecting time-on-legs and daily life mobility related postures in older adults. In addition user opinion about the practical use of the sensor was evaluated. Twenty frail and non-frail older adults performed a standardized and free movement protocol in their own home. Results of the sensor-based method were compared to video observation. Sensitivity, specificity and overall agreement of sensor outcomes compared to video observation were calculated. Mobility was assessed based on time-on-legs. Further assessment included the categories standing, sitting, walking and lying. Time-on-legs based sensitivity, specificity and percentage agreement were good to excellent and comparable to laboratory outcomes in other studies. Category-based sensitivity, specificity and overall agreement were moderate to excellent. The necklace-worn sensor is considered an acceptable valid instrument for assessing home-based physical activity based upon time-on-legs in frail and non-frail older adults, but category-based assessment of gait and postures could be further developed.
Directory of Open Access Journals (Sweden)
Erin P Price
Full Text Available The bacterium Burkholderia pseudomallei causes melioidosis, a rare but serious illness that can be fatal if untreated or misdiagnosed. Species-specific PCR assays provide a technically simple method for differentiating B. pseudomallei from near-neighbor species. However, substantial genetic diversity and high levels of recombination within this species reduce the likelihood that molecular signatures will differentiate all B. pseudomallei from other Burkholderiaceae. Currently available molecular assays for B. pseudomallei detection lack rigorous validation across large in silico datasets and isolate collections to test for specificity, and none have been subjected to stringent quality control criteria (accuracy, precision, selectivity, limit of quantitation (LoQ, limit of detection (LoD, linearity, ruggedness and robustness to determine their suitability for environmental, clinical or forensic investigations. In this study, we developed two novel B. pseudomallei specific assays, 122018 and 266152, using a dual-probe approach to differentiate B. pseudomallei from B. thailandensis, B. oklahomensis and B. thailandensis-like species; other species failed to amplify. Species specificity was validated across a large DNA panel (>2,300 samples comprising Burkholderia spp. and non-Burkholderia bacterial and fungal species of clinical and environmental relevance. Comparison of assay specificity to two previously published B. pseudomallei-specific assays, BurkDiff and TTS1, demonstrated comparable performance of all assays, providing between 99.7 and 100% specificity against our isolate panel. Last, we subjected 122018 and 266152 to rigorous quality control analyses, thus providing quantitative limits of assay performance. Using B. pseudomallei as a model, our study provides a framework for comprehensive quantitative validation of molecular assays and provides additional, highly validated B. pseudomallei assays for the scientific research community.
A rapid minor groove binder PCR method for distinguishing the vaccine strain Brucella abortus 104M.
Nan, Wenlong; Qin, Lide; Wang, Yong; Zhang, Yueyong; Tan, Pengfei; Chen, Yuqi; Mao, Kairong; Chen, Yiping
2018-01-24
Brucellosis is a widespread zoonotic disease caused by Gram-negative Brucella bacteria. Immunisation with attenuated vaccine is an effective method of prevention, but it can interfere with diagnosis. Live, attenuated Brucella abortus strain 104M has been used for the prevention of human brucellosis in China since 1965. However, at present, no fast and reliable method exists that can distinguish this strain from field strains. Single nucleotide polymorphism (SNP)-based assays offer a new approach for such discrimination. SNP-based minor groove binder (MGB) and Cycleave assays have been used for rapid identification of four Brucella vaccine strains (B. abortus strains S19, A19 and RB51, and B. melitensis Rev1). The main objective of this study was to develop a PCR assay for rapid and specific detection of strain 104M. We developed a SNP-based MGB PCR assay that could successfully distinguish strain 104M from 18 representative strains of Brucella (B. abortus biovars 1, 2, 3, 4, 5, 6, 7 and 9, B. melitensis biovars 1, 2 and 3, B. suis biovars 1, 2, 3 and 4, B. canis, B. neotomae, and B. ovis), four Brucella vaccine strains (A19, S19, S2, M5), and 55 Brucella clinical field strains. The assay gave a negative reaction with four non-Brucella species (Escherichia coli, Pasteurella multocida, Streptococcus suis and Pseudomonas aeruginosa). The minimum sensitivity of the assay, evaluated using 10-fold dilutions of chromosomal DNA, was 220 fg for the 104M strain and 76 fg for the single non-104M Brucella strain tested (B. abortus A19). The assay was also reproducible (intra- and inter-assay coefficients of variation = 0.006-0.022 and 0.012-0.044, respectively). A SNP-based MGB PCR assay was developed that could straightforwardly and unambiguously distinguish B. abortus vaccine strain 104M from non-104M Brucella strains. Compared to the classical isolation and identification approaches of bacteriology, this real-time PCR assay has substantial advantages in terms of
Chander, Vishal; Chakravarti, Soumendu; Gupta, Vikas; Nandi, Sukdeb; Singh, Mithilesh; Badasara, Surendra Kumar; Sharma, Chhavi; Mittal, Mitesh; Dandapat, S; Gupta, V K
2016-12-01
Canine parvovirus-2 antigenic variants (CPV-2a, CPV-2b and CPV-2c) ubiquitously distributed worldwide in canine population causes severe fatal gastroenteritis. Antigenic typing of CPV-2 remains a prime focus of research groups worldwide in understanding the disease epidemiology and virus evolution. The present study was thus envisioned to provide a simple sequencing independent, rapid, robust, specific, user-friendly technique for detecting and typing of presently circulating CPV-2 antigenic variants. ARMS-PCR strategy was employed using specific primers for CPV-2a, CPV-2b and CPV-2c to differentiate these antigenic types. ARMS-PCR was initially optimized with reference positive controls in two steps; where first reaction was used to differentiate CPV-2a from CPV-2b/CPV-2c. The second reaction was carried out with CPV-2c specific primers to confirm the presence of CPV-2c. Initial validation of the ARMS-PCR was carried out with 24 sequenced samples and the results were matched with the sequencing results. ARMS-PCR technique was further used to screen and type 90 suspected clinical samples. Randomly selected 15 suspected clinical samples that were typed with this technique were sequenced. The results of ARMS-PCR and the sequencing matched exactly with each other. The developed technique has a potential to become a sequencing independent method for simultaneous detection and typing of CPV-2 antigenic variants in veterinary disease diagnostic laboratories globally. Copyright © 2016 Elsevier B.V. All rights reserved.
Robinson, S; Follo, M; Haenel, D; Mauler, M; Stallmann, D; Tewari, M; Duerschmied, D; Peter, K; Bode, C; Ahrens, I; Hortmann, M
2018-04-15
micro-RNAs have shown promise as potential biomarkers for acute myocardial infarction and ischemia-reperfusion injury (I/R). Most recently droplet digital polymerase chain reaction (ddPCR) has been introduced as a more reliable and reproducible method for detecting micro-RNAs. We aimed to demonstrate the improved technical performance and diagnostic potential of ddPCR by measuring micro-RNAs in ST-elevation myocardial infarction (STEMI). A dilution series was performed in duplicate on synthetic Caenorrhabditis elegans-miR-39, comparing quantitative real-time PCR (qRT-PCR) and ddPCR. We used ddPCR and qRT-PCR to quantify the serum levels of miR-21, miR-208a and miR-499 between STEMI patients (n=24) and stable coronary artery disease (CAD) patients (n=20). In STEMI, I/R injury was assessed via measurement of ST-segment resolution. In the dilution series, ddPCR demonstrated superior coefficient of variation (12.1%vs.32.9%) and limit of detection (0.9325 vs.2.425copies/μl). In the patient cohort, ddPCR demonstrated greater differences in miR-21 levels (2190.5 vs. 484.7copies/μl; p=0.0004 for ddPCR and 136.4 vs. 122.8copies/μl; p=0.2273 for qRT-PCR) and in miR-208a (0 vs. 24.1copies/μl, p=0.0013 for ddPCR and 0 vs. 0copies/μl, p=0.0032 for qRT-PCR), with similar differences observed in miR-499 levels (9.4 vs. 81.5copies/μl, pPCR). ddPCR also more accurately defined STEMI for all miRNAs (area under the curve (AUC) of 0.8021/0.7740/0.9063 for miR-21/208a/499 with ddPCR vs. AUC of 0.6083/0.6917/0.8417 with qRT-PCR). However, there was no association between miR-21/208a/499 levels and ischemia-reperfusion injury. ddPCR demonstrates superiority in both technical performance and diagnostic potential compared to qRT-PCR. Ultimately, this supports its use as a diagnostic method for quantifying micro-RNAs, particularly in large multi-center trials. Copyright © 2017 Elsevier B.V. All rights reserved.
Teng, Xiaolu; Zhang, Zan; He, Guiling; Yang, Liwen; Li, Fei
2012-01-01
Quantitative real-time polymerase chain reaction (qPCR) is an efficient and widely used technique to monitor gene expression. Housekeeping genes (HKGs) are often empirically selected as the reference genes for data normalization. However, the suitability of HKGs used as the reference genes has been seldom validated. Here, six HKGs were chosen (actin A3, actin A1, GAPDH, G3PDH, E2F, rp49) in four lepidopteran insects Bombyx mori L. (Lepidoptera: Bombycidae), Plutella xylostella L. (Plutellidae...
PCR specific for Actinobacillus pleuropneumoniae serotype 3
DEFF Research Database (Denmark)
Zhou, L.; Jones, S.C.P.; Angen, Øystein
2008-01-01
, but the method has liminations, for example, cross-reactions between serotypes 3, 6, and 8. This study describes the development of a serotype 3-specific PCR, based on the capsule locus, which can be used in a multiplex format with the organism's specific gene apxIV. The PCR test was evaluated on 266 strains...
Real-time PCR evaluation of Strongylus vulgaris in horses on farms in Denmark and Central Kentucky.
Nielsen, M K; Olsen, S N; Lyons, E T; Monrad, J; Thamsborg, S M
2012-12-21
Strongyle parasites are ubiquitous in grazing horses, and the large strongyle Strongylus vulgaris is considered the most pathogenic helminth parasite of horses. Recent investigations have suggested an association between occurrence of this parasite and usage of selective therapy based on regular fecal egg counts. The established diagnostic method for S. vulgaris involves larval culture and subsequent morphological identification of third stage larvae under the microscope. Recently, a real-time PCR assay was developed and validated for the detection and semi-quantification of S. vulgaris eggs in equine fecal samples. The purposes of the present study were (a) to determine the presence of S. vulgaris by real-time PCR in Danish and American horses on farms using vastly different anthelmintic treatment regimens and (b) to evaluate the association between larval culture results and the PCR. A total of 991 horses representing 53 different horse farms in Denmark and Central Kentucky were studied. Fresh fecal samples were collected from all horses, and strongyle eggs retrieved for DNA extraction and subsequent real-time PCR analysis. Individual larval cultures were performed on the Danish part of the data set (663 horses on 42 farms). On the Danish farms, the S. vulgaris PCR prevalence was found to be 9.2% on farms not basing parasite control on fecal egg counts, and 14.1% on farms using selective therapy. No horses were PCR positive in the American part of the study (328 horses on 11 farms). Kappa-values indicated a moderate agreement between PCR and larval culture results, while McNemar tests revealed no statistical difference between the paired proportions. Significant associations were found between PCR cycle of threshold (Ct) value groups and larval culture counts. Results indicate that both diagnostic methods can be useful for determining the occurrence of S. vulgaris on horse farms, but that they both are affected by potential sources of error. The PCR results
Falchieri, Marco; Brown, Paul A; Catelli, Elena; Naylor, Clive J
2012-12-01
Using reverse genetics, an avian metapneumovirus (AMPV) was modified for use as a positive control for validating all stages of a popular established RT-nested PCR, used in the detection of the two major AMPV subtypes (A and B). Resultant amplicons were of increased size and clearly distinguishable from those arising from unmodified virus, thus allowing false positive bands, due to control virus contamination of test samples, to be identified readily. Absorption of the control virus onto filter paper and subsequent microwave irradiation removed all infectivity while its function as an efficient RT-nested-PCR template was unaffected. Identical amplicons were produced after storage for one year. The modified virus is likely to have application as an internal standard as well as in real time methods. Additions to AMPV of RNA from other RNA viruses, including hazardous examples such HIV and influenza, are likely to yield similar safe RT-PCR controls. Copyright © 2012 Elsevier B.V. All rights reserved.
Directory of Open Access Journals (Sweden)
Touseef Hussain
2018-05-01
Full Text Available Phytophthora infestans (mont de Bary is a pathogen of great concern across the globe, and accurate detection is an important component in responding to the outbreaks of potential disease. Although the molecular diagnostic protocol used in regulatory programs has been evaluated but till date methods implying direct comparison has rarely used. In this study, a known area soil samples from potato fields where light blight appear every year (both A1 and A2 mating type was assayed by soil bait method, PCR assay detection and quantification of the inoculums. Suspected disease symptoms appeared on bait tubers were further confirmed by rapid PCR, inoculums were quantified through Real Time PCR, which confirms presence of P. infestans. These diagnostic methods can be highly correlated with one another. Potato tuber baiting increased the sensitivity of the assay compared with direct extraction of DNA from tuber and soil samples. Our study determines diagnostic sensitivity and specificity of the assays to determine the performance of each method. Overall, molecular techniques based on different types of PCR amplification and Real-time PCR can lead to high throughput, faster and more accurate detection method which can be used in quarantine programmes in potato industry and diagnostic laboratory.
Becker, Sören L; Müller, Ivan; Mertens, Pascal; Herrmann, Mathias; Zondie, Leyli; Beyleveld, Lindsey; Gerber, Markus; du Randt, Rosa; Pühse, Uwe; Walter, Cheryl; Utzinger, Jürg
2017-10-01
Stool-based rapid diagnostic tests (RDTs) for pathogenic intestinal protozoa (e.g. Cryptosporidium spp. and Giardia intestinalis) allow for prompt diagnosis and treatment in resource-constrained settings. Such RDTs can improve individual patient management and facilitate population-based screening programmes in areas without microbiological laboratories for confirmatory testing. However, RDTs are difficult to interpret in case of 'trace' results with faint test band intensities and little is known about whether such ambiguous results might indicate 'true' infections. In a longitudinal study conducted in poor neighbourhoods of Port Elizabeth, South Africa, a total of 1428 stool samples from two cohorts of schoolchildren were examined on the spot for Cryptosporidium spp. and G. intestinalis using an RDT (Crypto/Giardia DuoStrip; Coris BioConcept). Overall, 121 samples were positive for G. intestinalis and the RDT suggested presence of cryptosporidiosis in 22 samples. After a storage period of 9-10 months in cohort 1 and 2-3 months in cohort 2, samples were subjected to multiplex PCR (BD Max™ Enteric Parasite Panel, Becton Dickinson). Ninety-three percent (112/121) of RDT-positive samples for G. intestinalis were confirmed by PCR, with a correlation between RDT test band intensity and quantitative pathogen load present in the sample. For Cryptosporidium spp., all positive RDTs had faintly visible lines and these were negative on PCR. The performance of the BD Max™ PCR was nearly identical in both cohorts, despite the prolonged storage at disrupted cold chain conditions in cohort 1. The Crypto/Giardia DuoStrip warrants further validation in communities with a high incidence of diarrhoea. Copyright © 2017 Elsevier B.V. All rights reserved.
Halal authenticity of gelatin using species-specific PCR.
Shabani, Hessam; Mehdizadeh, Mehrangiz; Mousavi, Seyed Mohammad; Dezfouli, Ehsan Ansari; Solgi, Tara; Khodaverdi, Mahdi; Rabiei, Maryam; Rastegar, Hossein; Alebouyeh, Mahmoud
2015-10-01
Consumption of food products derived from porcine sources is strictly prohibited in Islam. Gelatin, mostly derived from bovine and porcine sources, has many applications in the food and pharmaceutical industries. To ensure that food products comply with halal regulations, development of valid and reliable analytical methods is very much required. In this study, a species-specific polymerase chain reaction (PCR) assay using conserved regions of mitochondrial DNA (cytochrome b gene) was performed to evaluate the halal authenticity of gelatin. After isolation of DNA from gelatin powders with known origin, conventional PCR using species-specific primers was carried out on the extracted DNA. The amplified expected PCR products of 212 and 271 bp were observed for porcine and bovine gelatin, respectively. The sensitivity of the method was tested on binary gelatin mixtures containing 0.1%, 1%, 10%, and 100% (w/w) of porcine gelatin within bovine gelatin and vice versa. Although most of the DNA is degraded due to the severe processing steps of gelatin production, the minimum level of 0.1% w/w of both porcine and bovine gelatin was detected. Moreover, eight food products labeled as containing bovine gelatin and eight capsule shells were subjected to PCR examination. The results showed that all samples contained bovine gelatin, and the absence of porcine gelatin was verified. This method of species authenticity is very useful to verify whether gelatin and gelatin-containing food products are derived from halal ingredients. Copyright © 2015 Elsevier Ltd. All rights reserved.
Cloke, Jonathan; Crowley, Erin; Bird, Patrick; Bastin, Ben; Flannery, Jonathan; Agin, James; Goins, David; Clark, Dorn; Radcliff, Roy; Wickstrand, Nina; Kauppinen, Mikko
2015-01-01
The Thermo Scientific™ SureTect™ Escherichia coli O157:H7 Assay is a new real-time PCR assay which has been validated through the AOAC Research Institute (RI) Performance Tested Methods(SM) program for raw beef and produce matrixes. This validation study specifically validated the assay with 375 g 1:4 and 1:5 ratios of raw ground beef and raw beef trim in comparison to the U.S. Department of Agriculture, Food Safety Inspection Service, Microbiology Laboratory Guidebook (USDS-FSIS/MLG) reference method and 25 g bagged spinach and fresh apple juice at a ratio of 1:10, in comparison to the reference method detailed in the International Organization for Standardization 16654:2001 reference method. For raw beef matrixes, the validation of both 1:4 and 1:5 allows user flexibility with the enrichment protocol, although which of these two ratios chosen by the laboratory should be based on specific test requirements. All matrixes were analyzed by Thermo Fisher Scientific, Microbiology Division, Vantaa, Finland, and Q Laboratories Inc, Cincinnati, Ohio, in the method developer study. Two of the matrixes (raw ground beef at both 1:4 and 1:5 ratios) and bagged spinach were additionally analyzed in the AOAC-RI controlled independent laboratory study, which was conducted by Marshfield Food Safety, Marshfield, Wisconsin. Using probability of detection statistical analysis, no significant difference was demonstrated by the SureTect kit in comparison to the USDA FSIS reference method for raw beef matrixes, or with the ISO reference method for matrixes of bagged spinach and apple juice. Inclusivity and exclusivity testing was conducted with 58 E. coli O157:H7 and 54 non-E. coli O157:H7 isolates, respectively, which demonstrated that the SureTect assay was able to detect all isolates of E. coli O157:H7 analyzed. In addition, all but one of the nontarget isolates were correctly interpreted as negative by the SureTect Software. The single isolate giving a positive result was an E
Dobhal, Shefali; Olson, Jennifer D; Arif, Mohammad; Garcia Suarez, Johnny A; Ochoa-Corona, Francisco M
2016-06-01
Rose rosette disease is a disorder associated with infection by Rose rosette virus (RRV), a pathogen of roses that causes devastating effects on most garden cultivated varieties, and the wild invasive rose especially Rosa multiflora. Reliable and sensitive detection of this disease in early phases is needed to implement proper control measures. This study assesses a single primer-set based detection method for RRV and demonstrates its application in three different chemistries: Endpoint RT-PCR, TaqMan-quantitative RT-PCR (RT-qPCR) and SYBR Green RT-qPCR with High Resolution Melting analyses. A primer set (RRV2F/2R) was designed from consensus sequences of the nucleocapsid protein gene p3 located in the RNA 3 region of RRV. The specificity of primer set RRV2F/2R was validated in silico against published GenBank sequences and in-vitro against infected plant samples and an exclusivity panel of near-neighbor and other viruses that commonly infect Rosa spp. The developed assay is sensitive with a detection limit of 1fg from infected plant tissue. Thirty rose samples from 8 different states of the United States were tested using the developed methods. The developed methods are sensitive and reliable, and can be used by diagnostic laboratories for routine testing and disease management decisions. Copyright © 2016 Elsevier B.V. All rights reserved.
Use of real-time PCR to evaluate two DNA extraction methods from food
Directory of Open Access Journals (Sweden)
Maria Regina Branquinho
2012-03-01
Full Text Available The DNA extraction is a critical step in Genetically Modified Organisms analysis based on real-time PCR. In this study, the CTAB and DNeasy methods provided good quality and quantity of DNA from the texturized soy protein, infant formula, and soy milk samples. Concerning the Certified Reference Material consisting of 5% Roundup Ready® soybean, neither method yielded DNA of good quality. However, the dilution test applied in the CTAB extracts showed no interference of inhibitory substances. The PCR efficiencies of lectin target amplification were not statistically different, and the coefficients of correlation (R² demonstrated high degree of correlation between the copy numbers and the threshold cycle (Ct values. ANOVA showed suitable adjustment of the regression and absence of significant linear deviations. The efficiencies of the p35S amplification were not statistically different, and all R² values using DNeasy extracts were above 0.98 with no significant linear deviations. Two out of three R² values using CTAB extracts were lower than 0.98, corresponding to lower degree of correlation, and the lack-of-fit test showed significant linear deviation in one run. The comparative analysis of the Ct values for the p35S and lectin targets demonstrated no statistical significant differences between the analytical curves of each target.
Methods for microbial DNA extraction from soil for PCR amplification
Directory of Open Access Journals (Sweden)
Yeates C
1998-01-01
Full Text Available Amplification of DNA from soil is often inhibited by co-purified contaminants. A rapid, inexpensive, large-scale DNA extraction method involving minimal purification has been developed that is applicable to various soil types (1. DNA is also suitable for PCR amplification using various DNA targets. DNA was extracted from 100g of soil using direct lysis with glass beads and SDS followed by potassium acetate precipitation, polyethylene glycol precipitation, phenol extraction and isopropanol precipitation. This method was compared to other DNA extraction methods with regard to DNA purity and size.
Directory of Open Access Journals (Sweden)
Fabrícia Gimenes
Full Text Available Sexually transmitted diseases (STDs may impair sperm parameters and functions thereby promoting male infertility. To date limited molecular studies were conducted to evaluate the frequency and type of such infections in semen Thus, we aimed at conceiving and validating a multiplex PCR (M-PCR assay for the simultaneous detection of the following STD pathogens in semen: Chlamydia trachomatis, Neisseria gonorrhoeae, Mycoplasma genitalium, Trichomonas vaginalis, Herpes virus simplex (HSV -1 and -2, and Treponema pallidum; We also investigated the potential usefulness of this M-PCR assay in screening programs for semen pathogens. In addition, we aimed: to detect human Papillomavirus (HPV and genotypes by single PCR (sPCR in the same semen samples; to determine the prevalence of the seven STDs, HPV and co-infections; to assess the possibility that these infections affect semen parameters and thus fertility. The overall validation parameters of M-PCR were extremely high including agreement (99.2%, sensitivity (100.00%, specificity (99.70%, positive (96.40% and negative predictive values (100.00% and accuracy (99.80%. The prevalence of STDs was very high (55.3%. Furthermore, associations were observed between STDs and changes in semen parameters, highlighting the importance of STD detection in semen. Thus, this M-PCR assay has great potential for application in semen screening programs for pathogens in infertility and STD clinics and in sperm banks.
Cao, Yiping; Sivaganesan, Mano; Kelty, Catherine A; Wang, Dan; Boehm, Alexandria B; Griffith, John F; Weisberg, Stephen B; Shanks, Orin C
2018-01-01
Human fecal pollution of recreational waters remains a public health concern worldwide. As a result, there is a growing interest in the application of human-associated fecal source identification quantitative real-time PCR (qPCR) technologies for water quality research and management. However, there are currently no standardized approaches for field implementation and interpretation of qPCR data. In this study, a standardized HF183/BacR287 qPCR method was combined with a water sampling strategy and a novel Bayesian weighted average approach to establish a human fecal contamination score (HFS) that can be used to prioritize sampling sites for remediation based on measured human waste levels. The HFS was then used to investigate 975 study design scenarios utilizing different combinations of sites with varying sampling intensities (daily to once per week) and number of qPCR replicates per sample (2-14 replicates). Findings demonstrate that site prioritization with HFS is feasible and that both sampling intensity and number of qPCR replicates influence reliability of HFS estimates. The novel data analysis strategy presented here provides a prescribed approach for the implementation and interpretation of human-associated HF183/BacR287 qPCR data with the goal of site prioritization based on human fecal pollution levels. In addition, information is provided for future users to customize study designs for optimal HFS performance. Published by Elsevier Ltd.
DEFF Research Database (Denmark)
Yi, Sun; Dhumpa, Raghuram; Bang, Dang Duong
2011-01-01
of RNA extract in the liquid phase with sequence-specific nested PCR on the solid phase. A simple ultraviolet cross-linking method was used to immobilize the DNA probes over an unmodified glass surface, which makes solid-phase PCR a convenient possibility for AIV screening. The testing of 33 avian fecal....... In this article, a DNA microarray-based solid-phase polymerase chain reaction (PCR) approach has been developed for rapid detection of influenza virus type A and for simultaneous identification of pathogenic virus subtypes H5 and H7. This solid-phase RT-PCR method combined reverse-transcription amplification...
Directory of Open Access Journals (Sweden)
Wang Zhen
2011-11-01
Full Text Available Abstract Background The advent of genomics-based technologies has revolutionized many fields of biological enquiry. However, chromosome walking or flanking sequence cloning is still a necessary and important procedure to determining gene structure. Such methods are used to identify T-DNA insertion sites and so are especially relevant for organisms where large T-DNA insertion libraries have been created, such as rice and Arabidopsis. The currently available methods for flanking sequence cloning, including the popular TAIL-PCR technique, are relatively laborious and slow. Results Here, we report a simple and effective fusion primer and nested integrated PCR method (FPNI-PCR for the identification and cloning of unknown genomic regions flanked known sequences. In brief, a set of universal primers was designed that consisted of various 15-16 base arbitrary degenerate oligonucleotides. These arbitrary degenerate primers were fused to the 3' end of an adaptor oligonucleotide which provided a known sequence without degenerate nucleotides, thereby forming the fusion primers (FPs. These fusion primers are employed in the first step of an integrated nested PCR strategy which defines the overall FPNI-PCR protocol. In order to demonstrate the efficacy of this novel strategy, we have successfully used it to isolate multiple genomic sequences namely, 21 orthologs of genes in various species of Rosaceace, 4 MYB genes of Rosa rugosa, 3 promoters of transcription factors of Petunia hybrida, and 4 flanking sequences of T-DNA insertion sites in transgenic tobacco lines and 6 specific genes from sequenced genome of rice and Arabidopsis. Conclusions The successful amplification of target products through FPNI-PCR verified that this novel strategy is an effective, low cost and simple procedure. Furthermore, FPNI-PCR represents a more sensitive, rapid and accurate technique than the established TAIL-PCR and hiTAIL-PCR procedures.
Canine distemper virus detection by different methods of One-Step RT-qPCR
Directory of Open Access Journals (Sweden)
Claudia de Camargo Tozato
2016-01-01
Full Text Available ABSTRACT: Three commercial kits of One-Step RT-qPCR were evaluated for the molecular diagnosis of Canine Distemper Virus. Using the kit that showed better performance, two systems of Real-time RT-PCR (RT-qPCR assays were tested and compared for analytical sensitivity to Canine Distemper Virus RNA detection: a One-Step RT-qPCR (system A and a One-Step RT-qPCR combined with NESTED-qPCR (system B. Limits of detection for both systems were determined using a serial dilution of Canine Distemper Virus synthetic RNA or a positive urine sample. In addition, the same urine sample was tested using samples with prior centrifugation or ultracentrifugation. Commercial kits of One-Step RT-qPCR assays detected canine distemper virus RNA in 10 (100% urine samples from symptomatic animals tested. The One-Step RT-qPCR kit that showed better results was used to evaluate the analytical sensitivity of the A and B systems. Limit of detection using synthetic RNA for the system A was 11 RNA copies µL-1 and 110 RNA copies µl-1 for first round System B. The second round of the NESTED-qPCR for System B had a limit of detection of 11 copies µl-1. Relationship between Ct values and RNA concentration was linear. The RNA extracted from the urine dilutions was detected in dilutions of 10-3 and10-2 by System A and B respectively. Urine centrifugation increased the analytical sensitivity of the test and proved to be useful for routine diagnostics. The One-Step RT-qPCR is a fast, sensitive and specific method for canine distemper routine diagnosis and research projects that require sensitive and quantitative methodology.
Methodology for testing and validating knowledge bases
Krishnamurthy, C.; Padalkar, S.; Sztipanovits, J.; Purves, B. R.
1987-01-01
A test and validation toolset developed for artificial intelligence programs is described. The basic premises of this method are: (1) knowledge bases have a strongly declarative character and represent mostly structural information about different domains, (2) the conditions for integrity, consistency, and correctness can be transformed into structural properties of knowledge bases, and (3) structural information and structural properties can be uniformly represented by graphs and checked by graph algorithms. The interactive test and validation environment have been implemented on a SUN workstation.
Croville, Guillaume; Foret, Charlotte; Heuillard, Pauline; Senet, Alexis; Delpont, Mattias; Mouahid, Mohammed; Ducatez, Mariette F; Kichou, Faouzi; Guerin, Jean-Luc
2018-06-01
Respiratory syndromes (RS) are among the most significant pathological conditions in edible birds and are caused by complex coactions of pathogens and environmental factors. In poultry, low pathogenic avian influenza A viruses, metapneumoviruses, infectious bronchitis virus, infectious laryngotracheitis virus, Mycoplasma spp. Escherichia coli and/or Ornithobacterium rhinotracheale in turkeys are considered as key co-infectious agents of RS. Aspergillus sp., Pasteurella multocida, Avibacterium paragallinarum or Chlamydia psittaci may also be involved in respiratory outbreaks. An innovative quantitative PCR method, based on a nanofluidic technology, has the ability to screen up to 96 samples with 96 pathogen-specific PCR primers, at the same time, in one run of real-time quantitative PCR. This platform was used for the screening of avian respiratory pathogens: 15 respiratory agents, including viruses, bacteria and fungi potentially associated with respiratory infections of poultry, were targeted. Primers were designed and validated for SYBR green real-time quantitative PCR and subsequently validated on the Biomark high throughput PCR nanofluidic platform (Fluidigm©, San Francisco, CA, USA). As a clinical assessment, tracheal swabs were sampled from turkeys showing RS and submitted to this panel assay. Beside systematic detection of E. coli, avian metapneumovirus, Mycoplasma gallisepticum and Mycoplasma synoviae were frequently detected, with distinctive co-infection patterns between French and Moroccan flocks. This proof-of-concept study illustrates the potential of such panel assays for unveiling respiratory co-infection profiles in poultry.
Real-Time PCR in Clinical Microbiology: Applications for Routine Laboratory Testing
Espy, M. J.; Uhl, J. R.; Sloan, L. M.; Buckwalter, S. P.; Jones, M. F.; Vetter, E. A.; Yao, J. D. C.; Wengenack, N. L.; Rosenblatt, J. E.; Cockerill, F. R.; Smith, T. F.
2006-01-01
Real-time PCR has revolutionized the way clinical microbiology laboratories diagnose many human microbial infections. This testing method combines PCR chemistry with fluorescent probe detection of amplified product in the same reaction vessel. In general, both PCR and amplified product detection are completed in an hour or less, which is considerably faster than conventional PCR detection methods. Real-time PCR assays provide sensitivity and specificity equivalent to that of conventional PCR combined with Southern blot analysis, and since amplification and detection steps are performed in the same closed vessel, the risk of releasing amplified nucleic acids into the environment is negligible. The combination of excellent sensitivity and specificity, low contamination risk, and speed has made real-time PCR technology an appealing alternative to culture- or immunoassay-based testing methods for diagnosing many infectious diseases. This review focuses on the application of real-time PCR in the clinical microbiology laboratory. PMID:16418529
Han, Yang; Hou, Shao-Yang; Ji, Shang-Zhi; Cheng, Juan; Zhang, Meng-Yue; He, Li-Juan; Ye, Xiang-Zhong; Li, Yi-Min; Zhang, Yi-Xuan
2017-11-15
A novel method, real-time reverse transcription PCR (real-time RT-PCR) coupled with probe-melting curve analysis, has been established to detect two kinds of samples within one fluorescence channel. Besides a conventional TaqMan probe, this method employs another specially designed melting-probe with a 5' terminus modification which meets the same label with the same fluorescent group. By using an asymmetric PCR method, the melting-probe is able to detect an extra sample in the melting stage effectively while it almost has little influence on the amplification detection. Thus, this method allows the availability of united employment of both amplification stage and melting stage for detecting samples in one reaction. The further demonstration by simultaneous detection of human immunodeficiency virus (HIV) and hepatitis C virus (HCV) in one channel as a model system is presented in this essay. The sensitivity of detection by real-time RT-PCR coupled with probe-melting analysis was proved to be equal to that detected by conventional real-time RT-PCR. Because real-time RT-PCR coupled with probe-melting analysis can double the detection throughputs within one fluorescence channel, it is expected to be a good solution for the problem of low-throughput in current real-time PCR. Copyright © 2017 Elsevier Inc. All rights reserved.
Directory of Open Access Journals (Sweden)
Rumian Zhong
2015-01-01
Full Text Available A two-step response surface method for multiscale finite element model (FEM updating and validation is presented with respect to Guanhe Bridge, a composite cable-stayed bridge in the National Highway number G15, in China. Firstly, the state equations of both multiscale and single-scale FEM are established based on the basic equation in structural dynamic mechanics to update the multiscale coupling parameters and structural parameters. Secondly, based on the measured data from the structural health monitoring (SHM system, a Monte Carlo simulation is employed to analyze the uncertainty quantification and transmission, where the uncertainties of the multiscale FEM and measured data were considered. The results indicate that the relative errors between the calculated and measured frequencies are less than 2%, and the overlap ratio indexes of each modal frequency are larger than 80% without the average absolute value of relative errors. These demonstrate that the proposed method can be applied to validate the multiscale FEM, and the validated FEM can reflect the current conditions of the real bridge; thus it can be used as the basis for bridge health monitoring, damage prognosis (DP, and safety prognosis (SP.
Day, J B; Basavanna, U
2015-01-01
To develop a rapid detection procedure for Listeria monocytogenes in infant formula and lettuce using a macrophage-based enrichment protocol and real-time PCR. A macrophage cell culture system was employed for the isolation and enrichment of L. monocytogenes from infant formula and lettuce for subsequent identification using real-time PCR. Macrophage monolayers were exposed to infant formula and lettuce contaminated with a serial dilution series of L. monocytogenes. As few as approx. 10 CFU ml(-1) or g(-1) of L. monocytogenes were detected in infant formula and lettuce after 16 h postinfection by real-time PCR. Internal positive PCR controls were utilized to eliminate the possibility of false-negative results. Co-inoculation with Listeria innocua did not reduce the L. monocytogenes detection sensitivity. Intracellular L. monocytogenes could also be isolated on Listeria selective media from infected macrophage lysates for subsequent confirmation. The detection method is highly sensitive and specific for L. monocytogenes in infant formula and lettuce and establishes a rapid identification time of 20 and 48 h for presumptive and confirmatory identification, respectively. The method is a promising alternative to many currently used q-PCR detection methods which employ traditional selective media for enrichment of contaminated food samples. Macrophage enrichment of L. monocytogenes eliminates PCR inhibitory food elements and contaminating food microflora which produce cleaner samples that increase the rapidity and sensitivity of detection. Published 2014. This article is a U.S. Government work and is in the public domain in the USA.
Qin, T; Zhou, H; Ren, H; Shi, W; Jin, H; Jiang, X; Xu, Y; Zhou, M; Li, J; Wang, J; Shao, Z; Xu, X
2016-07-01
Legionnaires' disease (LD) is a globally distributed systemic infectious disease. The burden of LD in many regions is still unclear, especially in Asian countries including China. A survey of Legionella infection using real-time PCR and nested sequence-based typing (SBT) was performed in two hospitals in Shanghai, China. A total of 265 bronchoalveolar lavage fluid (BALF) specimens were collected from hospital A between January 2012 and December 2013, and 359 sputum specimens were collected from hospital B throughout 2012. A total of 71 specimens were positive for Legionella according to real-time PCR focusing on the 5S rRNA gene. Seventy of these specimens were identified as Legionella pneumophila as a result of real-time PCR amplification of the dotA gene. Results of nested SBT revealed high genetic polymorphism in these L. pneumophila and ST1 was the predominant sequence type. These data revealed that the burden of LD in China is much greater than that recognized previously, and real-time PCR may be a suitable monitoring technology for LD in large sample surveys in regions lacking the economic and technical resources to perform other methods, such as urinary antigen tests and culture methods.
Directory of Open Access Journals (Sweden)
Hanan R Shehata
Full Text Available Food adulteration and feed contamination are significant issues in the food/feed industry, especially for meat products. Reliable techniques are needed to monitor these issues. Droplet Digital PCR (ddPCR assays were developed and evaluated for detection and quantification of bovine, porcine, chicken and turkey DNA in food and feed samples. The ddPCR methods were designed based on mitochondrial DNA sequences and integrated with an artificial recombinant plasmid DNA to control variabilities in PCR procedures. The specificity of the ddPCR assays was confirmed by testing both target species and additional 18 non-target species. Linear regression established a detection range between 79 and 33200 copies of the target molecule from 0.26 to 176 pg of fresh animal tissue DNA with a coefficient of determination (R2 of 0.997-0.999. The quantification ranges of the methods for testing fortified heat-processed food and feed samples were 0.05-3.0% (wt/wt for the bovine and turkey targets, and 0.01-1.0% (wt/wt for pork and chicken targets. Our methods demonstrated acceptable repeatability and reproducibility for the analytical process for food and feed samples. Internal validation of the PCR process was monitored using a control chart for 74 consecutive ddPCR runs for quantifying bovine DNA. A matrix effect was observed while establishing calibration curves with the matrix type under testing, and the inclusion of an internal control in DNA extraction provides a useful means to overcome this effect. DNA degradation caused by heating, sonication or Taq I restriction enzyme digestion was found to reduce ddPCR readings by as much as 4.5 fold. The results illustrated the applicability of the methods to quantify meat species in food and feed samples without the need for a standard curve, and to potentially support enforcement activities for food authentication and feed control. Standard reference materials matching typical manufacturing processes are needed for
USFDA-GUIDELINE BASED VALIDATION OF TESTING METHOD FOR RIFAMPICIN IN INDONESIAN SERUM SPECIMEN
Directory of Open Access Journals (Sweden)
Tri Joko Raharjo
2010-06-01
Full Text Available Regarding a new regulation from Indonesia FDA (Badan POM-RI, all new non patent drugs should show bioequivalence with the originator drug prior to registration. Bioequivalence testing (BE-testing has to be performed to the people that represented of population to which the drug to be administrated. BE testing need a valid bio-analytical method for certain drug target and group of population. This research report specific validation of bio-analysis of Rifampicin in Indonesian serum specimen in order to be used for BE testing. The extraction was performed using acetonitrile while the chromatographic separation was accomplished on a RP 18 column (250 × 4.6 mm i.d., 5 µm, with a mobile phase composed of KH2PO4 10 mM-Acetonitrile (40:60, v/v and UV detection was set at 333 nm. The method shown specificity compared to blank serum specimen with retention time of rifampicin at 2.1 min. Lower limit of quantification (LLOQ was 0.06 µg/mL with dynamic range up to 20 µg/mL (R>0.990. Precision of the method was very good with coefficient of variance (CV 0.58; 7.40 and 5.56% for concentration at 0.06, 5, 15 µg/mL, respectively. Accuracies of the method were 3.22; 1.94; 1.90% for concentration 0.06, 5 and 15 µg/mL respectively. The average recoveries were 97.82, 95.50 and 97.31% for concentration of rifampicin 1, 5 and 5 µg/mL, respectively. The method was also shown reliable result on stability test on freezing-thawing, short-term and long-term stability as well as post preparation stability. Validation result shown that the method was ready to be used for Rifampicin BE testing with Indonesian subject. Keywords: Rifampicin, Validation, USFDA-Guideline
Galeano, Esteban; Vasconcelos, Tarcísio Sales; Ramiro, Daniel Alves; De Martin, Valentina de Fátima; Carrer, Helaine
2014-07-22
Teak (Tectona grandis L.f.) is currently the preferred choice of the timber trade for fabrication of woody products due to its extraordinary qualities and is widely grown around the world. Gene expression studies are essential to explore wood formation of vascular plants, and quantitative real-time reverse transcription PCR (qRT-PCR) is a sensitive technique employed for quantifying gene expression levels. One or more appropriate reference genes are crucial to accurately compare mRNA transcripts through different tissues/organs and experimental conditions. Despite being the focus of some genetic studies, a lack of molecular information has hindered genetic exploration of teak. To date, qRT-PCR reference genes have not been identified and validated for teak. Identification and cloning of nine commonly used qRT-PCR reference genes from teak, including ribosomal protein 60s (rp60s), clathrin adaptor complexes medium subunit family (Cac), actin (Act), histone 3 (His3), sand family (Sand), β-Tubulin (Β-Tub), ubiquitin (Ubq), elongation factor 1-α (Ef-1α), and glyceraldehyde-3-phosphate dehydrogenase (GAPDH). Expression profiles of these genes were evaluated by qRT-PCR in six tissue and organ samples (leaf, flower, seedling, root, stem and branch secondary xylem) of teak. Appropriate gene cloning and sequencing, primer specificity and amplification efficiency was verified for each gene. Their stability as reference genes was validated by NormFinder, BestKeeper, geNorm and Delta Ct programs. Results obtained from all programs showed that TgUbq and TgEf-1α are the most stable genes to use as qRT-PCR reference genes and TgAct is the most unstable gene in teak. The relative expression of the teak cinnamyl alcohol dehydrogenase (TgCAD) gene in lignified tissues at different ages was assessed by qRT-PCR, using TgUbq and TgEf-1α as internal controls. These analyses exposed a consistent expression pattern with both reference genes. This study proposes a first broad
A TaqMan real-time PCR-based assay for the identification of Fasciola spp.
Alasaad, Samer; Soriguer, Ramón C; Abu-Madi, Marawan; El Behairy, Ahmed; Jowers, Michael J; Baños, Pablo Díez; Píriz, Ana; Fickel, Joerns; Zhu, Xing-Quan
2011-06-30
Real time quantitative PCR (qPCR) is one of the key technologies of the post-genome era, with clear advantages compared to normal end-point PCR. In this paper, we report the first qPCR-based assay for the identification of Fasciola spp. Based on sequences of the second internal transcribed spacers (ITS-2) of the ribosomal rRNA gene, we used a set of genus-specific primers for Fasciola ITS-2 amplification, and we designed species-specific internal TaqMan probes to identify F. hepatica and F. gigantica, as well as the hybrid 'intermediate'Fasciola. These primers and probes were used for the highly specific, sensitive, and simple identification of Fasciola species collected from different animal host from China, Spain, Niger and Egypt. The novel qPCR-based technique for the identification of Fasciola spp. may provide a useful tool for the epidemiological investigation of Fasciola infection, including their intermediate snail hosts. Copyright © 2011 Elsevier B.V. All rights reserved.
Mathematical analysis of the real time array PCR (RTA PCR) process
Dijksman, Johan Frederik; Pierik, A.
2012-01-01
Real time array PCR (RTA PCR) is a recently developed biochemical technique that measures amplification curves (like with quantitative real time Polymerase Chain Reaction (qRT PCR)) of a multitude of different templates in a sample. It combines two different methods in order to profit from the
Technical aspects and recommendations for single-cell qPCR.
Ståhlberg, Anders; Kubista, Mikael
2018-02-01
Single cells are basic physiological and biological units that can function individually as well as in groups in tissues and organs. It is central to identify, characterize and profile single cells at molecular level to be able to distinguish different kinds, to understand their functions and determine how they interact with each other. During the last decade several technologies for single-cell profiling have been developed and used in various applications, revealing many novel findings. Quantitative PCR (qPCR) is one of the most developed methods for single-cell profiling that can be used to interrogate several analytes, including DNA, RNA and protein. Single-cell qPCR has the potential to become routine methodology but the technique is still challenging, as it involves several experimental steps and few molecules are handled. Here, we discuss technical aspects and provide recommendation for single-cell qPCR analysis. The workflow includes experimental design, sample preparation, single-cell collection, direct lysis, reverse transcription, preamplification, qPCR and data analysis. Detailed reporting and sharing of experimental details and data will promote further development and make validation studies possible. Efforts aiming to standardize single-cell qPCR open up means to move single-cell analysis from specialized research settings to standard research laboratories. Copyright © 2017 Elsevier Ltd. All rights reserved.
DEFF Research Database (Denmark)
Nielsen, Morten Thrane; Nielsen, Jakob Blæsbjerg; Anyaogu, Dianna Chinyere
2013-01-01
was transferred in a two step procedure to an expression platform in A. nidulans. The individual cluster fragments were generated by PCR and assembled via efficient USER fusion prior to ransformation and integration via re-iterative gene targeting. A total of 13 open reading frames contained in 25 kb of DNA were...... of solid methodology for genetic manipulation of most species severely hampers pathway haracterization. Here we present a simple PCR based approach for heterologous reconstitution of intact gene clusters. Specifically, the putative gene cluster responsible for geodin production from Aspergillus terreus...... successfully transferred between the two species enabling geodin synthesis in A. nidulans. Subsequently, functions of three genes in the cluster were validated by genetic and chemical analyses. Specifically, ATEG_08451 (gedC) encodes a polyketide synthase, ATEG_08453 (gedR) encodes a transcription factor...
Molecular Quantification of Zooplankton Gut Content: The Case For qPCR
Frischer, M. E.; Walters, T. L.; Gibson, D. M.; Nejstgaard, J. C.; Troedsson, C.
2016-02-01
The ability to obtain information about feeding selectivity and rates in situ for zooplankton is vital for understanding the mechanisms structuring marine ecosystems. However, directly estimating feeding selection and rates of zooplankton, without bias, associated with culturing conditions has been notoriously difficult. A potential approach for addressing this problem is to target prey-specific DNA as a marker for prey ingestion and selection. In this study we report the development of a differential length amplification quantitative PCR (dla-qPCR) assay targeting the 18S rRNA gene to validate the use of a DNA-based approach to quantify consumption of specific plankton prey by the pelagic tunicate (doliolid) Dolioletta gegenbauri. Compared to copepods and other marine animals, the digestion of prey genomic DNA inside the gut of doliolids is low. This method minimizes potential underestimations, and therefore allows prey DNA to be used as an effective indicator of prey consumption. We also present an initial application of a qPCR-assay to estimate consumption of specific prey species on the southeastern continental shelf of the U.S., where doliolids stochastically bloom in response to upwelling events. Estimated feeding rates, based on qPCR, were in the same range as those estimated from clearance rates in laboratory feeding studies. In the field, consumption of specific prey, including the centric diatom Thalassiosira spp. was detected in the gut of wild caught D. gegenbauri at the levels consistent with their abundance in the water column at the time of collection. Thus, both experimental and field investigations support the hypothesis that a qPCR approach will be useful for the quantitative investigation of the in situ diet of D. gegenbauri without introduced bias' associated with cultivation.
Li, Dan; Tong, Tiezheng; Zeng, Siyu; Lin, Yiwen; Wu, Shuxu; He, Miao
2014-02-01
The detection of viable bacteria in wastewater treatment plants (WWTPs) is very important for public health, as WWTPs are a medium with a high potential for waterborne disease transmission. The aim of this study was to use propidium monoazide (PMA) combined with the quantitative polymerase chain reaction (PMA-qPCR) to selectively detect and quantify viable bacteria cells in full-scale WWTPs in China. PMA was added to the concentrated WWTP samples at a final concentration of 100 micromol/L and the samples were incubated in the dark for 5 min, and then lighted for 4 min prior to DNA extraction and qPCR with specific primers for Escherichia coli and Enterococci, respectively. The results showed that PMA treatment removed more than 99% of DNA from non-viable cells in all the WWTP samples, while matrices in sludge samples markedly reduced the effectiveness of PMA treatment. Compared to qPCR, PMA-qPCR results were similar and highly linearly correlated to those obtained by culture assay, indicating that DNA from non-viable cells present in WWTP samples can be eliminated by PMA treatment, and that PMA-qPCR is a reliable method for detection of viable bacteria in environmental samples. This study demonstrated that PMA-qPCR is a rapid and selective detection method for viable bacteria in WWTP samples, and that WWTPs have an obvious function in removing both viable and non-viable bacteria. The results proved that PMA-qPCR is a promising detection method that has a high potential for application as a complementary method to the standard culture-based method in the future.
Lee, Adria D; Cassiday, Pamela K; Pawloski, Lucia C; Tatti, Kathleen M; Martin, Monte D; Briere, Elizabeth C; Tondella, M Lucia; Martin, Stacey W
2018-01-01
The appropriate use of clinically accurate diagnostic tests is essential for the detection of pertussis, a poorly controlled vaccine-preventable disease. The purpose of this study was to estimate the sensitivity and specificity of different diagnostic criteria including culture, multi-target polymerase chain reaction (PCR), anti-pertussis toxin IgG (IgG-PT) serology, and the use of a clinical case definition. An additional objective was to describe the optimal timing of specimen collection for the various tests. Clinical specimens were collected from patients with cough illness at seven locations across the United States between 2007 and 2011. Nasopharyngeal and blood specimens were collected from each patient during the enrollment visit. Patients who had been coughing for ≤ 2 weeks were asked to return in 2-4 weeks for collection of a second, convalescent blood specimen. Sensitivity and specificity of each diagnostic test were estimated using three methods-pertussis culture as the "gold standard," composite reference standard analysis (CRS), and latent class analysis (LCA). Overall, 868 patients were enrolled and 13.6% were B. pertussis positive by at least one diagnostic test. In a sample of 545 participants with non-missing data on all four diagnostic criteria, culture was 64.0% sensitive, PCR was 90.6% sensitive, and both were 100% specific by LCA. CRS and LCA methods increased the sensitivity estimates for convalescent serology and the clinical case definition over the culture-based estimates. Culture and PCR were most sensitive when performed during the first two weeks of cough; serology was optimally sensitive after the second week of cough. Timing of specimen collection in relation to onset of illness should be considered when ordering diagnostic tests for pertussis. Consideration should be given to including IgG-PT serology as a confirmatory test in the Council of State and Territorial Epidemiologists (CSTE) case definition for pertussis.
Li, Xiuying; Yang, Qiwei; Bai, Jinping; Xuan, Yali; Wang, Yimin
2015-01-01
Normalization to a reference gene is the method of choice for quantitative reverse transcription-PCR (RT-qPCR) analysis. The stability of reference genes is critical for accurate experimental results and conclusions. We have evaluated the expression stability of eight commonly used reference genes found in four different human mesenchymal stem cells (MSC). Using geNorm, NormFinder and BestKeeper algorithms, we show that beta-2-microglobulin and peptidyl-prolylisomerase A were the optimal reference genes for normalizing RT-qPCR data obtained from MSC, whereas the TATA box binding protein was not suitable due to its extensive variability in expression. Our findings emphasize the significance of validating reference genes for qPCR analyses. We offer a short list of reference genes to use for normalization and recommend some commercially-available software programs as a rapid approach to validate reference genes. We also demonstrate that the two reference genes, β-actin and glyceraldehyde-3-phosphate dehydrogenase, are frequently used are not always successful in many cases.
Directory of Open Access Journals (Sweden)
Maurice Marcel Sandeu
Full Text Available BACKGROUND: An accurate method for detecting malaria parasites in the mosquito's vector remains an essential component in the vector control. The Enzyme linked immunosorbent assay specific for circumsporozoite protein (ELISA-CSP is the gold standard method for the detection of malaria parasites in the vector even if it presents some limitations. Here, we optimized multiplex real-time PCR assays to accurately detect minor populations in mixed infection with multiple Plasmodium species in the African malaria vectors Anopheles gambiae and Anopheles funestus. METHODS: Complementary TaqMan-based real-time PCR assays that detect Plasmodium species using specific primers and probes were first evaluated on artificial mixtures of different targets inserted in plasmid constructs. The assays were further validated in comparison with the ELISA-CSP on 200 field caught Anopheles gambiae and Anopheles funestus mosquitoes collected in two localities in southern Benin. RESULTS: The validation of the duplex real-time PCR assays on the plasmid mixtures demonstrated robust specificity and sensitivity for detecting distinct targets. Using a panel of mosquito specimen, the real-time PCR showed a relatively high sensitivity (88.6% and specificity (98%, compared to ELISA-CSP as the referent standard. The agreement between both methods was "excellent" (κ=0.8, P<0.05. The relative quantification of Plasmodium DNA between the two Anopheles species analyzed showed no significant difference (P=0, 2. All infected mosquito samples contained Plasmodium falciparum DNA and mixed infections with P. malariae and/or P. ovale were observed in 18.6% and 13.6% of An. gambiae and An. funestus respectively. Plasmodium vivax was found in none of the mosquito samples analyzed. CONCLUSION: This study presents an optimized method for detecting the four Plasmodium species in the African malaria vectors. The study highlights substantial discordance with traditional ELISA-CSP pointing out the
Estimating misclassification error: a closer look at cross-validation based methods
Directory of Open Access Journals (Sweden)
Ounpraseuth Songthip
2012-11-01
Full Text Available Abstract Background To estimate a classifier’s error in predicting future observations, bootstrap methods have been proposed as reduced-variation alternatives to traditional cross-validation (CV methods based on sampling without replacement. Monte Carlo (MC simulation studies aimed at estimating the true misclassification error conditional on the training set are commonly used to compare CV methods. We conducted an MC simulation study to compare a new method of bootstrap CV (BCV to k-fold CV for estimating clasification error. Findings For the low-dimensional conditions simulated, the modest positive bias of k-fold CV contrasted sharply with the substantial negative bias of the new BCV method. This behavior was corroborated using a real-world dataset of prognostic gene-expression profiles in breast cancer patients. Our simulation results demonstrate some extreme characteristics of variance and bias that can occur due to a fault in the design of CV exercises aimed at estimating the true conditional error of a classifier, and that appear not to have been fully appreciated in previous studies. Although CV is a sound practice for estimating a classifier’s generalization error, using CV to estimate the fixed misclassification error of a trained classifier conditional on the training set is problematic. While MC simulation of this estimation exercise can correctly represent the average bias of a classifier, it will overstate the between-run variance of the bias. Conclusions We recommend k-fold CV over the new BCV method for estimating a classifier’s generalization error. The extreme negative bias of BCV is too high a price to pay for its reduced variance.
Li, P; Jia, J W; Jiang, L X; Zhu, H; Bai, L; Wang, J B; Tang, X M; Pan, A H
2012-04-27
To ensure the implementation of genetically modified organism (GMO)-labeling regulations, an event-specific detection method was developed based on the junction sequence of an exogenous integrant in the transgenic carnation variety Moonlite. The 5'-transgene integration sequence was isolated by thermal asymmetric interlaced PCR. Based upon the 5'-transgene integration sequence, the event-specific primers and TaqMan probe were designed to amplify the fragments, which spanned the exogenous DNA and carnation genomic DNA. Qualitative and quantitative PCR assays were developed employing the designed primers and probe. The detection limit of the qualitative PCR assay was 0.05% for Moonlite in 100 ng total carnation genomic DNA, corresponding to about 79 copies of the carnation haploid genome; the limit of detection and quantification of the quantitative PCR assay were estimated to be 38 and 190 copies of haploid carnation genomic DNA, respectively. Carnation samples with different contents of genetically modified components were quantified and the bias between the observed and true values of three samples were lower than the acceptance criterion (GMO detection method. These results indicated that these event-specific methods would be useful for the identification and quantification of the GMO carnation Moonlite.
Kakumanu, Madhavi L; Ponnusamy, Loganathan; Sutton, Haley T; Meshnick, Steven R; Nicholson, William L; Apperson, Charles S
2016-04-01
A novel nested PCR assay was developed to detectRickettsiaspp. in ticks and tissue samples from humans and laboratory animals. Primers were designed for the nested run to amplify a variable region of the 23S-5S intergenic spacer (IGS) ofRickettsiaspp. The newly designed primers were evaluated using genomic DNA from 11Rickettsiaspecies belonging to the spotted fever, typhus, and ancestral groups and, in parallel, compared to otherRickettsia-specific PCR targets (ompA,gltA, and the 17-kDa protein gene). The new 23S-5S IGS nested PCR assay amplified all 11Rickettsiaspp., but the assays employing other PCR targets did not. The novel nested assay was sensitive enough to detect one copy of a cloned 23S-5S IGS fragment from "CandidatusRickettsia amblyommii." Subsequently, the detection efficiency of the 23S-5S IGS nested assay was compared to those of the other three assays using genomic DNA extracted from 40 adultDermacentor variabilisticks. The nested 23S-5S IGS assay detectedRickettsiaDNA in 45% of the ticks, while the amplification rates of the other three assays ranged between 5 and 20%. The novel PCR assay was validated using clinical samples from humans and laboratory animals that were known to be infected with pathogenic species ofRickettsia The nested 23S-5S IGS PCR assay was coupled with reverse line blot hybridization with species-specific probes for high-throughput detection and simultaneous identification of the species ofRickettsiain the ticks. "CandidatusRickettsia amblyommii,"R. montanensis,R. felis, andR. belliiwere frequently identified species, along with some potentially novelRickettsiastrains that were closely related toR. belliiandR. conorii. Copyright © 2016 Kakumanu et al.
Kakumanu, Madhavi L.; Ponnusamy, Loganathan; Sutton, Haley T.; Meshnick, Steven R.; Nicholson, William L.
2016-01-01
A novel nested PCR assay was developed to detect Rickettsia spp. in ticks and tissue samples from humans and laboratory animals. Primers were designed for the nested run to amplify a variable region of the 23S-5S intergenic spacer (IGS) of Rickettsia spp. The newly designed primers were evaluated using genomic DNA from 11 Rickettsia species belonging to the spotted fever, typhus, and ancestral groups and, in parallel, compared to other Rickettsia-specific PCR targets (ompA, gltA, and the 17-kDa protein gene). The new 23S-5S IGS nested PCR assay amplified all 11 Rickettsia spp., but the assays employing other PCR targets did not. The novel nested assay was sensitive enough to detect one copy of a cloned 23S-5S IGS fragment from “Candidatus Rickettsia amblyommii.” Subsequently, the detection efficiency of the 23S-5S IGS nested assay was compared to those of the other three assays using genomic DNA extracted from 40 adult Dermacentor variabilis ticks. The nested 23S-5S IGS assay detected Rickettsia DNA in 45% of the ticks, while the amplification rates of the other three assays ranged between 5 and 20%. The novel PCR assay was validated using clinical samples from humans and laboratory animals that were known to be infected with pathogenic species of Rickettsia. The nested 23S-5S IGS PCR assay was coupled with reverse line blot hybridization with species-specific probes for high-throughput detection and simultaneous identification of the species of Rickettsia in the ticks. “Candidatus Rickettsia amblyommii,” R. montanensis, R. felis, and R. bellii were frequently identified species, along with some potentially novel Rickettsia strains that were closely related to R. bellii and R. conorii. PMID:26818674
Jarvi, Susan I.; Schultz, Jeffrey J.; Atkinson, Carter T.
2002-01-01
Several polymerase chain reaction (PCR)-based methods have recently been developed for diagnosing malarial infections in both birds and reptiles, but a critical evaluation of their sensitivity in experimentally-infected hosts has not been done. This study compares the sensitivity of several PCR-based methods for diagnosing avian malaria (Plasmodium relictum) in captive Hawaiian honeycreepers using microscopy and a recently developed immunoblotting technique. Sequential blood samples were collected over periods of up to 4.4 yr after experimental infection and rechallenge to determine both the duration and detectability of chronic infections. Two new nested PCR approaches for detecting circulating parasites based on P. relictum 18S rRNA genes and the thrombospondin-related anonymous protein (TRAP) gene are described. The blood smear and the PCR tests were less sensitive than serological methods for detecting chronic malarial infections. Individually, none of the diagnostic methods was 100% accurate in detecting subpatent infections, although serological methods were significantly more sensitive (97%) than either nested PCR (61–84%) or microscopy (27%). Circulating parasites in chronically infected birds either disappear completely from circulation or to drop to intensities below detectability by nested PCR. Thus, the use of PCR as a sole means of detection of circulating parasites may significantly underestimate true prevalence.
Directory of Open Access Journals (Sweden)
Zahra Gharibi
2017-10-01
Full Text Available Objective: To evaluate Entamoeba spp. diagnosis in patients with inflammatory diarrhea by staining, copro-antigen ELISA and multiplex PCR methods. Methods: In this descriptive cross-sectional survey, 200 stool samples were randomly collected during 2015–2016. The stool samples were evaluated microscopically for the presence of the parasite using direct and formalin-ether concentration and trichrome staining methods. Then, the stool samples were examined by copro-antigen ELISA (Biomerica Company and multiplex PCR methods. Results: Of 200 samples, 17, 29 and 23 cases were positive for Entamoeba species by the staining, copro-antigen ELISA and multiplex PCR methods, respectively. Of 23 positive samples in multiplex PCR test, 13 and 10 samples were positive for Entamoeba dispar (E. dispar and Entamoeba histolytica (E. histolytica, respectively. Conclusions: Our finding indicated a relatively high prevalence of Entamoeba species in patients with inflammatory diarrhea in Ahvaz city. Due to the complications of E. histolytica/ dispar infection, the health authorities of the city must pay more attention to control and prevent the transmission of E. histolytica/dispar to individuals.
Directory of Open Access Journals (Sweden)
Yong Huang
Full Text Available Porcine circovirus type 2 (PCV2 has emerged as one of the most important pathogens affecting swine production globally. Preclinical identification of PCV2 is very important for effective prophylaxis of PCV2-associated diseases. In this study, we developed an ultrasensitive nanoparticle DNA probe-based PCR assay (UNDP-PCR for PCV2 detection. Magnetic microparticles coated with PCV2 specific DNA probes were used to enrich PCV2 DNA from samples, then gold nanoparticles coated with PCV2 specific oligonucleotides were added to form a sandwich nucleic acid-complex. After the complex was formed, the oligonucleotides were released and characterized by PCR. This assay exhibited about 500-fold more sensitive than conventional PCR, with a detection limit of 2 copies of purified PCV2 genomic DNA and 10 viral copies of PCV2 in serum. The assay has a wide detection range for all of PCV2 genotypes with reliable reproducibility. No cross-reactivity was observed from the samples of other related viruses including porcine circovirus type 1, porcine parvovirus, porcine pseudorabies virus, porcine reproductive and respiratory syndrome virus and classical swine fever virus. The positive detection rate of PCV2 specific UNDP-PCR in 40 preclinical field samples was 27.5%, which appeared greater than that by conventional and real-time PCR and appeared application potency in evaluation of the viral loads levels of preclinical infection samples. The UNDP-PCR assay reported here can reliably rule out false negative results from antibody-based assays, provide a nucleic acid extraction free, specific, ultrasensitive, economic and rapid diagnosis method for preclinical PCV2 infection in field, which may help prevent large-scale outbreaks.
Koc, A Nedret; Atalay, Mustafa A; Inci, Melek; Sariguzel, Fatma M; Sav, Hafize
2017-05-01
Dermatophyte species, isolation and identification in clinical samples are still difficult and take a long time. The identification and molecular epidemiology of dermatophytes commonly isolated in a clinical laboratory in Turkey by repetitive sequence-based PCR (rep-PCR) were assessed by comparing the results with those of reference identification. A total of 44 dermatophytes isolated from various clinical specimens of 20 patients with superficial mycoses in Kayseri and 24 patients in Hatay were studied. The identification of dermatophyte isolates was based on the reference identification and rep-PCR using the DiversiLab System (BioMerieux). The genotyping of dermatophyte isolates from different patients was determined by rep-PCR. In the identification of dermatophyte isolates, agreement between rep-PCR and conventional methods was 87.8 % ( 36 of 41). The dermatophyte strains belonged to four clones (A -D) which were determined by the use of rep-PCR. The dermatophyte strains in Clone B, D showed identical patterns with respect to the region. In conclusion, rep-PCR appears to be useful for evaluation of the identification and clonal relationships between Trichophyton rubrum species complex and Trichophyton mentagrophytes species complex isolates. The similarity and diversity of these isolates may be assessed according to different regions by rep-PCR. © 2017 Blackwell Verlag GmbH.
Clinical Assessment of a Nocardia PCR-Based Assay for Diagnosis of Nocardiosis.
Rouzaud, Claire; Rodriguez-Nava, Véronica; Catherinot, Emilie; Méchaï, Frédéric; Bergeron, Emmanuelle; Farfour, Eric; Scemla, Anne; Poirée, Sylvain; Delavaud, Christophe; Mathieu, Daniel; Durupt, Stéphane; Larosa, Fabrice; Lengelé, Jean-Philippe; Christophe, Jean-Louis; Suarez, Felipe; Lortholary, Olivier; Lebeaux, David
2018-06-01
The diagnosis of nocardiosis, a severe opportunistic infection, is challenging. We assessed the specificity and sensitivity of a 16S rRNA Nocardia PCR-based assay performed on clinical samples. In this multicenter study (January 2014 to April 2015), patients who were admitted to three hospitals and had an underlying condition favoring nocardiosis, clinical and radiological signs consistent with nocardiosis, and a Nocardia PCR assay result for a clinical sample were included. Patients were classified as negative control (NC) (negative Nocardia culture results and proven alternative diagnosis or improvement at 6 months without anti- Nocardia treatment), positive control (PC) (positive Nocardia culture results), or probable nocardiosis (positive Nocardia PCR results, negative Nocardia culture results, and no alternative diagnosis). Sixty-eight patients were included; 47 were classified as NC, 8 as PC, and 13 as probable nocardiosis. PCR results were negative for 35/47 NC patients (74%). For the 12 NC patients with positive PCR results, the PCR assay had been performed with respiratory samples. These NC patients had chronic bronchopulmonary disease more frequently than did the NC patients with negative PCR results (8/12 patients [67%] versus 11/35 patients [31%]; P = 0.044). PCR results were positive for 7/8 PC patients (88%). There were 13 cases of probable nocardiosis, diagnosed solely using the PCR results; 9 of those patients (69%) had lung involvement (consolidation or nodule). Nocardia PCR testing had a specificity of 74% and a sensitivity of 88% for the diagnosis of nocardiosis. Nocardia PCR testing may be helpful for the diagnosis of nocardiosis in immunocompromised patients but interpretation of PCR results from respiratory samples is difficult, because the PCR assay may also detect colonization. Copyright © 2018 American Society for Microbiology.
Partial and Full PCR-Based Reverse Genetics Strategy for Influenza Viruses
Chen, Hongjun; Ye, Jianqiang; Xu, Kemin; Angel, Matthew; Shao, Hongxia; Ferrero, Andrea; Sutton, Troy; Perez, Daniel R.
2012-01-01
Since 1999, plasmid-based reverse genetics (RG) systems have revolutionized the way influenza viruses are studied. However, it is not unusual to encounter cloning difficulties for one or more influenza genes while attempting to recover virus de novo. To overcome some of these shortcomings we sought to develop partial or full plasmid-free RG systems. The influenza gene of choice is assembled into a RG competent unit by virtue of overlapping PCR reactions containing a cDNA copy of the viral gene segment under the control of RNA polymerase I promoter (pol1) and termination (t1) signals – herein referred to as Flu PCR amplicons. Transfection of tissue culture cells with either HA or NA Flu PCR amplicons and 7 plasmids encoding the remaining influenza RG units, resulted in efficient virus rescue. Likewise, transfections including both HA and NA Flu PCR amplicons and 6 RG plasmids also resulted in efficient virus rescue. In addition, influenza viruses were recovered from a full set of Flu PCR amplicons without the use of plasmids. PMID:23029501
Detection of virulence genes in Uropathogenic E. coli (UPEC strains by Multiplex-PCR method
Directory of Open Access Journals (Sweden)
Javad Mohammadi
2017-06-01
Full Text Available Background & Objectives: Urinary tract infection caused by E. coli is one of the most common illnesses in all age groups worldwide. Presence of virulence genes is a key factor in bacterial pathogens in uroepithelial cells. The present study was performed to detect iha, iroN, ompT genes in the Uropathogenic E.coli isolates from clinical samples using multiplex-PCR method in Kerman. Materials & Methods: In this descriptive cross-sectional study, 200 samples of patients with urinary tract infections in Kerman hospitals were collected. After biochemical and microbiological tests, all strains were tested with regard to the presence of iha, iroN, and ompT genes using multiplex-PCR method. Results: The results of Multiplex-PCR showed that all specimens had one, two, or three virulence genes simultaneously. The highest and lowest frequency distribution of genes was related to iha (56.7% and iroN (20% respectively. Conclusion: According to the prevalence of urinary tract infection in the community and distribution of resistance and virulence factors, the fast and accurate detection of the strains and virulence genes is necessary
Jaroenlak, Pattana; Sanguanrut, Piyachat; Williams, Bryony A. P.; Stentiford, Grant D.; Flegel, Timothy W.; Sritunyalucksana, Kallaya
2016-01-01
Hepatopancreatic microsporidiosis (HPM) caused by Enterocytozoon hepatopenaei (EHP) is an important disease of cultivated shrimp. Heavy infections may lead to retarded growth and unprofitable harvests. Existing PCR detection methods target the EHP small subunit ribosomal RNA (SSU rRNA) gene (SSU-PCR). However, we discovered that they can give false positive test results due to cross reactivity of the SSU-PCR primers with DNA from closely related microsporidia that infect other aquatic organisms. This is problematic for investigating and monitoring EHP infection pathways. To overcome this problem, a sensitive and specific nested PCR method was developed for detection of the spore wall protein (SWP) gene of EHP (SWP-PCR). The new SWP-PCR method did not produce false positive results from closely related microsporidia. The first PCR step of the SWP-PCR method was 100 times (104 plasmid copies per reaction vial) more sensitive than that of the existing SSU-PCR method (106 copies) but sensitivity was equal for both in the nested step (10 copies). Since the hepatopancreas of cultivated shrimp is not currently known to be infected with microsporidia other than EHP, the SSU-PCR methods are still valid for analyzing hepatopancreatic samples despite the lower sensitivity than the SWP-PCR method. However, due to its greater specificity and sensitivity, we recommend that the SWP-PCR method be used to screen for EHP in feces, feed and environmental samples for potential EHP carriers. PMID:27832178
Jaroenlak, Pattana; Sanguanrut, Piyachat; Williams, Bryony A P; Stentiford, Grant D; Flegel, Timothy W; Sritunyalucksana, Kallaya; Itsathitphaisarn, Ornchuma
2016-01-01
Hepatopancreatic microsporidiosis (HPM) caused by Enterocytozoon hepatopenaei (EHP) is an important disease of cultivated shrimp. Heavy infections may lead to retarded growth and unprofitable harvests. Existing PCR detection methods target the EHP small subunit ribosomal RNA (SSU rRNA) gene (SSU-PCR). However, we discovered that they can give false positive test results due to cross reactivity of the SSU-PCR primers with DNA from closely related microsporidia that infect other aquatic organisms. This is problematic for investigating and monitoring EHP infection pathways. To overcome this problem, a sensitive and specific nested PCR method was developed for detection of the spore wall protein (SWP) gene of EHP (SWP-PCR). The new SWP-PCR method did not produce false positive results from closely related microsporidia. The first PCR step of the SWP-PCR method was 100 times (104 plasmid copies per reaction vial) more sensitive than that of the existing SSU-PCR method (106 copies) but sensitivity was equal for both in the nested step (10 copies). Since the hepatopancreas of cultivated shrimp is not currently known to be infected with microsporidia other than EHP, the SSU-PCR methods are still valid for analyzing hepatopancreatic samples despite the lower sensitivity than the SWP-PCR method. However, due to its greater specificity and sensitivity, we recommend that the SWP-PCR method be used to screen for EHP in feces, feed and environmental samples for potential EHP carriers.
Peng, Linda X; Wallace, Morgan; Andaloro, Bridget; Fallon, Dawn; Fleck, Lois; Delduco, Dan; Tice, George
2011-01-01
The BAX System PCR assay for Salmonella detection in foods was previously validated as AOAC Research Institute (RI) Performance Tested Method (PTM) 100201. New studies were conducted on beef and produce using the same media and protocol currently approved for the BAX System PCR assay for E. coli O157:H7 multiplex (MP). Additionally, soy protein isolate was tested for matrix extension using the U.S. Food and Drug Administration-Bacteriological Analytical Manual (FDA-BAM) enrichment protocols. The studies compared the BAX System method to the U.S. Department of Agriculture culture method for detecting Salmonella in beef and the FDA-BAM culture method for detecting Salmonella in produce and soy protein isolate. Method comparison studies on low-level inoculates showed that the BAX System assay for Salmonella performed as well as or better than the reference method for detecting Salmonella in beef and produce in 8-24 h enrichment when the BAX System E. coli O157:H7 MP media was used, and soy protein isolate in 20 h enrichment with lactose broth followed by 3 h regrowth in brain heart infusion broth. An inclusivity panel of 104 Salmonella strains with diverse serotypes was tested by the BAX System using the proprietary BAX System media and returned all positive results. Ruggedness factors involved in the enrichment phase were also evaluated by testing outside the specified parameters, and none of the factors examined affected the performance of the assay.
Directory of Open Access Journals (Sweden)
Jinting Li
2017-05-01
Full Text Available Real-time quantitative polymerase chain reaction (RT-qPCR is a sensitive technique for gene expression studies. However, choosing the appropriate reference gene is essential to obtain reliable results for RT-qPCR assays. In the present work, the expression of eight candidate reference genes, EF1-α (elongation factor 1-α, GAPDH (glyceraldehyde 3-phosphate dehydrogenase, UBC (ubiquitin-conjugating enzyme, UBQ (polyubiquitin, ACT (actin, β-TUB (β-tubulin, APT1 (adenine phosphoribosyltransferase 1, and 18S rRNA (18S ribosomal RNA, was evaluated in Achyranthes bidentata samples using two algorithms, geNorm and NormFinder. The samples were classified into groups according to developmental stages, various tissues, stresses (cold, heat, drought, NaCl, and hormone treatments (MeJA, IBA, SA. Suitable combination of reference genes for RT-qPCR normalization should be applied according to different experimental conditions. In this study, EF1-α, UBC, and ACT genes were verified as the suitable reference genes across all tested samples. To validate the suitability of the reference genes, we evaluated the relative expression of CAS, which is a gene that may be involved in phytosterol synthesis. Our results provide the foundation for gene expression analysis in A. bidentata and other species of Amaranthaceae.
Galactomannan and Real-Time PCR in the diagnosis of invasive Aspergillosis: preliminary data
Directory of Open Access Journals (Sweden)
Cristina Pedrotti
2014-03-01
Full Text Available The diagnosis of invasive aspergillosis is notoriously difficult. The standard culture-based methods have shown considerable limitations in performance. For this reason, non-culture methods have been increasingly employed for the diagnosis of invasive aspergillosis, and, among them, the methods based on Real-Time polymerase chain reaction (RT-PCR. In this study we assess the contribution in lowering diagnosis errors provided by the RT-PCR method when run alongside other methods. We analyzed 23 biological samples, 14 serum samples, and 9 bronchoalveolar lavage samples (BAL from 10 immunocompromised patients who were selected according to EORTC/MSG criteria (European Organization for Research and Treatment of Cancer/Mycoses Study Group. On the serum sample we searched the galactomannan (GM (Platelia Aspergillus® and the fungal genome (MycAssayTMAspergillus; the BAL samples were subjected also to the culture tests. In 11 serum samples the results showed concordance between GM and RT–PCR tests, while in 3 samples we report discordance: 2 results were GM positive and RT-PCR negative, and 1 results GM negative and RT-PCR indeterminate. In 5 BAL samples the results showed concordance between the two methods, while 4 were GM positive and RT-PCR negative. The data, although still preliminary, suggest an increased accuracy in the diagnosis of suspected invasive aspergillosis when employing both RT-PCR and GM tests given that the RT-PCR test eliminates the false positive results of the GM test. The PCR methods require, however, further applications of this type of diagnostic because of the severe limit given by the lack of standardization.
Scollo, Francesco; Egea, Leticia A; Gentile, Alessandra; La Malfa, Stefano; Dorado, Gabriel; Hernandez, Pilar
2016-12-15
Olive oil is considered a premium product for its nutritional value and health benefits, and the ability to define its origin and varietal composition is a key step towards ensuring the traceability of the product. However, isolating the DNA from such a matrix is a difficult task. In this study, the quality and quantity of olive oil DNA, isolated using four different DNA isolation protocols, was evaluated using the qRT-PCR and ddPCR techniques. The results indicate that CTAB-based extraction methods were the best for unfiltered oil, while Nucleo Spin-based extraction protocols showed greater overall reproducibility. The use of both qRT-PCR and ddPCR led to the absolute quantification of the DNA copy number. The results clearly demonstrate the importance of the choice of DNA-isolation protocol, which should take into consideration the qualitative aspects of DNA and the evaluation of the amplified DNA copy number. Copyright © 2016 Elsevier Ltd. All rights reserved.
ABO Blood Group Genotyping by Real-time PCR in Kazakh Population
Directory of Open Access Journals (Sweden)
Pavel Tarlykov
2014-12-01
Full Text Available Introduction. ABO blood group genotyping is a new technology in hematology that helps prevent adverse transfusion reactions in patients. Identification of antigens on the surface of red blood cells is based on serology; however, genotyping employs a different strategy and is aimed directly at genes that determine the surface proteins. ABO blood group genotyping by real-time PCR has several crucial advantages over other PCR-based techniques, such as high rapidity and reliability of analysis. The purpose of this study was to examine nucleotide substitutions differences by blood types using a PCR-based method on Kazakh blood donors.Methods. The study was approved by the Ethics Committee of the National Center for Biotechnology. Venous blood samples from 369 healthy Kazakh blood donors, whose blood types had been determined by serological methods, were collected after obtaining informed consent. The phenotypes of the samples included blood group A (n = 99, B (n = 93, O (n = 132, and AB (n = 45. Genomic DNA was extracted using a salting-out method. PCR products of ABO gene were sequenced on an ABI 3730xl DNA analyzer (Applied Biosystems. The resulting nucleotide sequences were compared and aligned against reference sequence NM_020469.2. Real-time PCR analysis was performed on CFX96 Touch™ Real-Time PCR Detection System (BioRad.Results. Direct sequencing of ABO gene in 369 samples revealed that the vast majority of nucleotide substitutions that change the ABO phenotype were limited to exons 6 and 7 of the ABO gene at positions 261, 467, 657, 796, 803, 930 and 1,060. However, genotyping of only three of them (261, 796 and 803 resulted in identification of major ABO genotypes in the Kazakh population. As a result, TaqMan probe based real-time PCR assay for the specific detection of genotypes 261, 796 and 803 was developed. The assay did not take into account several other mutations that may affect the determination of blood group, because they have a
Fredlund, Elisabeth; Gidlund, Ann; Olsen, Monica; Börjesson, Thomas; Spliid, Niels Henrik Hytte; Simonsson, Magnus
2008-04-01
Identification of Fusarium species by traditional methods requires specific skill and experience and there is an increased interest for new molecular methods for identification and quantification of Fusarium from food and feed samples. Real-time PCR with probe technology (Taqman) can be used for the identification and quantification of several species of Fusarium from cereal grain samples. There are several critical steps that need to be considered when establishing a real-time PCR-based method for DNA quantification, including extraction of DNA from the samples. In this study, several DNA extraction methods were evaluated, including the DNeasy Plant Mini Spin Columns (Qiagen), the Bio robot EZ1 (Qiagen) with the DNeasy Blood and Tissue Kit (Qiagen), and the Fast-DNA Spin Kit for Soil (Qbiogene). Parameters such as DNA quality and stability, PCR inhibitors, and PCR efficiency were investigated. Our results showed that all methods gave good PCR efficiency (above 90%) and DNA stability whereas the DNeasy Plant Mini Spin Columns in combination with sonication gave the best results with respect to Fusarium DNA yield. The modified DNeasy Plant Mini Spin protocol was used to analyse 31 wheat samples for the presence of F. graminearum and F. culmorum. The DNA level of F. graminearum could be correlated to the level of DON (r(2) = 0.9) and ZEN (r(2) = 0.6) whereas no correlation was found between F. culmorum and DON/ZEA. This shows that F. graminearum and not F. culmorum, was the main producer of DON in Swedish wheat during 2006.
Quantum dots for a high-throughput Pfu polymerase based multi-round polymerase chain reaction (PCR).
Sang, Fuming; Zhang, Zhizhou; Yuan, Lin; Liu, Deli
2018-02-26
Multi-round PCR is an important technique for obtaining enough target DNA from rare DNA resources, and is commonly used in many fields including forensic science, ancient DNA analysis and cancer research. However, multi-round PCR is often aborted, largely due to the accumulation of non-specific amplification during repeated amplifications. Here, we developed a Pfu polymerase based multi-round PCR technique assisted by quantum dots (QDs). Different PCR assays, DNA polymerases (Pfu and Taq), DNA sizes and GC amounts were compared in this study. In the presence of QDs, PCR specificity could be retained even in the ninth-round amplification. Moreover, the longer and more complex the targets were, the earlier the abortion happened in multi-round PCR. However, no obvious enhancement of specificity was found in multi-round PCR using Taq DNA polymerase. Significantly, the fidelity of Pfu polymerase based multi-round PCR was not sacrificed in the presence of QDs. Besides, pre-incubation at 50 °C for an hour had no impact on multi-round PCR performance, which further authenticated the hot start effect of QDs modulated in multi-round PCR. The findings of this study demonstrated that a cost-effective and promising multi-round PCR technique for large-scale and high-throughput sample analysis could be established with high specificity, sensibility and accuracy.
Vital, Pierangeli G; Van Ha, Nguyen Thi; Tuyet, Le Thi Hong; Widmer, Kenneth W
2017-02-01
Surface water samples in Vietnam were collected from the Saigon River, rural and suburban canals, and urban runoff canals in Ho Chi Minh City, Vietnam, and were processed to enumerate Escherichia coli. Quantification was done through membrane filtration and quantitative real-time polymerase chain reaction (PCR). Mean log colony-forming unit (CFU)/100 ml E. coli counts in the dry season for river/suburban canals and urban canals were log 2.8 and 3.7, respectively, using a membrane filtration method, while using Taqman quantitative real-time PCR they were log 2.4 and 2.8 for river/suburban canals and urban canals, respectively. For the wet season, data determined by the membrane filtration method in river/suburban canals and urban canals samples had mean counts of log 3.7 and 4.1, respectively. While mean log CFU/100 ml counts in the wet season using quantitative PCR were log 3 and 2, respectively. Additionally, the urban canal samples were significantly lower than those determined by conventional culture methods for the wet season. These results show that while quantitative real-time PCR can be used to determine levels of fecal indicator bacteria in surface waters, there are some limitations to its application and it may be impacted by sources of runoff based on surveyed samples.
Masago, Katsuhiro; Fujita, Shiro; Hata, Akito; Okuda, Chiyuki; Yoshizumi, Yuko; Kaji, Reiko; Katakami, Nobuyuki; Hirata, Yukio; Yatabe, Yasushi
2018-03-01
The aim of this study was to compare the accuracy of the QuantStudio 3D Digital polymerase chain reaction (dPCR) system and a PCR-based next generation sequencing (NGS) system for detecting a secondary mutation in the epidermal growth factor receptor (EGFR) gene T790M in non-small cell lung cancer (NSCLC) patients previously diagnosed with EGFR-activating mutations. Twenty-five patients with NSCLC previously treated with EGFR-TKIs were examined. The patients were treated daily with either erlotinib or gefitinib. New biopsies, followed by DNA sequencing on an Ion Torrent systems using the Ion Torrent AmpliSeq Cancer Hotspot Panel and dPCR were performed. A comparison of NGS, sensitive PCR, and dPCR revealed that the sensitivities of NGS and dPCR were similar in this study. As well, T790M was detected in as low as about 5% of mutant allelic frequencies, which represented 5% of the total reads on site mapped reads in NGS and greater than 5% of the dPCR reads, which represented mutant and wild type copies. The strategy in which NGS sequencing is followed by revealed acquired mutation with dPCR may be a reasonable one. We demonstrated the utility of combining NGS and dPCR as a tool for monitoring T790M. NGS and dPCR with formalin-fixed paraffin-embedded (FFPE) specimens might become a standard genomic test for exploring acquired resistance to targeted molecular medicines. © 2018 Japanese Society of Pathology and John Wiley & Sons Australia, Ltd.
Ferreira, HL; Spilki, FR; dos Santos, MMAB; de Almeida, RS; Arns, CW
2009-01-01
Avian metapneumovirus (AMPV) belongs to Metapneumovirus genus of Paramyxoviridae family. Virus isolation, serology, and detection of genomic RNA are used as diagnostic methods for AMPV. The aim of the present study was to compare the detection of six subgroup A AMPV isolates (AMPV/A) viral RNA by using different conventional and real time RT-PCR methods. Two new RT-PCR tests and two real time RT-PCR tests, both detecting fusion (F) gene and nucleocapsid (N) gene were compared with an establis...