
Sample records for ucla engineering researchers

  1. UCLA accelerator research ampersand development. Progress report

    International Nuclear Information System (INIS)


    This report discusses work on advanced accelerators and beam dynamics at ANL, BNL, SLAC, UCLA and Pulse Sciences Incorporated. Discussed in this report are the following concepts: Wakefield acceleration studies; plasma lens research; high gradient rf cavities and beam dynamics studies at the Brookhaven accelerator test facility; rf pulse compression development; and buncher systems for high gradient accelerator and relativistic klystron applications

  2. UCLA accelerator research and development

    International Nuclear Information System (INIS)

    Cline, D.B.


    This progress report covers work supported by the above DOE grant over the period November 1, 1991 to July 31, 1992. The work is a program of experimental and theoretical studies in advanced particle accelerator research and development for high energy physics applications. The program features research at particle beam facilities in the United States and includes research on novel high power sources, novel focussing systems (e.g. plasma lens), beam monitors, novel high brightness, high current gun systems, and novel flavor factories in particular the φ Factory

  3. UCLA Particle Physics Research Group annual progress report

    International Nuclear Information System (INIS)

    Nefkens, B.M.K.


    The objectives, basic research programs, recent results and continuing activities of the UCLA Particle Physics Research Group are presented. The objectives of the research are to discover, to formulate, and to elucidate the physics laws that govern the elementary constituents of matter and to determine basic properties of particles. A synopsis of research carried out last year is given. The main body of this report is the account of the techniques used in our investigations, the results obtained, and the plans for continuing and new research

  4. Experimental and theoretical high energy physics research. [UCLA

    Energy Technology Data Exchange (ETDEWEB)

    Buchanan, Charles D.; Cline, David B.; Byers, N.; Ferrara, S.; Peccei, R.; Hauser, Jay; Muller, Thomas; Atac, Muzaffer; Slater, William; Cousins, Robert; Arisaka, Katsushi


    Progress in the various components of the UCLA High-Energy Physics Research program is summarized, including some representative figures and lists of resulting presentations and published papers. Principal efforts were directed at the following: (I) UCLA hadronization model, PEP4/9 e{sup +}e{sup {minus}} analysis, {bar P} decay; (II) ICARUS and astroparticle physics (physics goals, technical progress on electronics, data acquisition, and detector performance, long baseline neutrino beam from CERN to the Gran Sasso and ICARUS, future ICARUS program, and WIMP experiment with xenon), B physics with hadron beams and colliders, high-energy collider physics, and the {phi} factory project; (III) theoretical high-energy physics; (IV) H dibaryon search, search for K{sub L}{sup 0} {yields} {pi}{sup 0}{gamma}{gamma} and {pi}{sup 0}{nu}{bar {nu}}, and detector design and construction for the FNAL-KTeV project; (V) UCLA participation in the experiment CDF at Fermilab; and (VI) VLPC/scintillating fiber R D.

  5. UCLA Particle Physics Research Group annual progress report

    International Nuclear Information System (INIS)

    Nefkens, B.M.K.


    The objectives, basic research programs, recent results, and continuing activities of the UCLA Particle Physics Research Group are presented. The objectives of the research are to discover, to formulate, and to elucidate the physics laws that govern the elementary constituents of matter and to determine basic properties of particles. The research carried out by the Group last year may be divided into three separate programs: (1) baryon spectroscopy, (2) investigations of charge symmetry and isospin invariance, and (3) tests of time reversal invariance. The main body of this report is the account of the techniques used in our investigations, the results obtained, and the plans for continuing and new research. An update of the group bibliography is given at the end

  6. Experimental And Theoretical High Energy Physics Research At UCLA

    Energy Technology Data Exchange (ETDEWEB)

    Cousins, Robert D. [University of California Los Angeles


    This is the final report of the UCLA High Energy Physics DOE Grant No. DE-FG02- 91ER40662. This report covers the last grant project period, namely the three years beginning January 15, 2010, plus extensions through April 30, 2013. The report describes the broad range of our experimental research spanning direct dark matter detection searches using both liquid xenon (XENON) and liquid argon (DARKSIDE); present (ICARUS) and R&D for future (LBNE) neutrino physics; ultra-high-energy neutrino and cosmic ray detection (ANITA); and the highest-energy accelerator-based physics with the CMS experiment and CERN’s Large Hadron Collider. For our theory group, the report describes frontier activities including particle astrophysics and cosmology; neutrino physics; LHC interaction cross section calculations now feasible due to breakthroughs in theoretical techniques; and advances in the formal theory of supergravity.

  7. UCLA Particle and Nuclear Physics Research Group, 1993 progress report

    International Nuclear Information System (INIS)

    Nefkens, B.M.K.; Clajus, M.; Price, J.W.; Tippens, W.B.; White, D.B.


    The research programs of the UCLA Particle and Nuclear Physics Research Group, the research objectives, results of experiments, the continuing activities and new initiatives are presented. The primary goal of the research is to test the symmetries and invariances of particle/nuclear physics with special emphasis on investigating charge symmetry, isospin invariance, charge conjugation, and CP. Another important part of our work is baryon spectroscopy, which is the determination of the properties (mass, width, decay modes, etc.) of particles and resonances. We also measure some basic properties of light nuclei, for example the hadronic radii of 3 H and 3 He. Special attention is given to the eta meson, its production using photons, electrons, π ± , and protons, and its rare and not-so-rare decays. In Section 1, the physics motivation of our research is outlined. Section 2 provides a summary of the research projects. The status of each program is given in Section 3. We discuss the various experimental techniques used, the results obtained, and we outline the plans for the continuing and the new research. Details are presented of new research that is made possible by the use of the Crystal Ball Detector, a highly segmented NaI calorimeter and spectrometer with nearly 4π acceptance (it was built and used at SLAC and is to be moved to BNL). The appendix contains an update of the bibliography, conference participation, and group memos; it also indicates our share in the organization of conferences, and gives a listing of the colloquia and seminars presented by us

  8. Strengthening the fission reactor nuclear science and engineering program at UCLA. Final technical report

    International Nuclear Information System (INIS)

    Okrent, D.


    This is the final report on DOE Award No. DE-FG03-92ER75838 A000, a three year matching grant program with Pacific Gas and Electric Company (PG and E) to support strengthening of the fission reactor nuclear science and engineering program at UCLA. The program began on September 30, 1992. The program has enabled UCLA to use its strong existing background to train students in technological problems which simultaneously are of interest to the industry and of specific interest to PG and E. The program included undergraduate scholarships, graduate traineeships and distinguished lecturers. Four topics were selected for research the first year, with the benefit of active collaboration with personnel from PG and E. These topics remained the same during the second year of this program. During the third year, two topics ended with the departure o the students involved (reflux cooling in a PWR during a shutdown and erosion/corrosion of carbon steel piping). Two new topics (long-term risk and fuel relocation within the reactor vessel) were added; hence, the topics during the third year award were the following: reflux condensation and the effect of non-condensable gases; erosion/corrosion of carbon steel piping; use of artificial intelligence in severe accident diagnosis for PWRs (diagnosis of plant status during a PWR station blackout scenario); the influence on risk of organization and management quality; considerations of long term risk from the disposal of hazardous wastes; and a probabilistic treatment of fuel motion and fuel relocation within the reactor vessel during a severe core damage accident

  9. UCLA Intermediate Energy Nuclear and Particle Physics Research: Final Report

    Energy Technology Data Exchange (ETDEWEB)

    Nefkens, B M.K. [Principal Investigator, ed.; Goetz, J; Lapik, A; Korolija, M; Prakhov, S; Starostin, A [ed.


    This project covers the following research: (a) Investigations into the structure of the proton and neutron. This is done by investigating the different resonance states of nucleons with beams of tagged, polarized photons, linearly as well as circularly, incident on polarized hydrogen/deuterium targets and measuring the production of {pi}{sup 0}, 2{pi}{sup }0, 3{pi}{sup 0}, {eta} , {eta}', {omega}, etc. The principal detector is the Crystal Ball multiphoton spectrometer which has an acceptance of nearly 4 . It has been moved to the MAMI accelerator facility of the University of Mainz, Germany. We investigate the conversion of electromagnetic energy into mesonic matter and conversely. (b) We investigate the consequences of applying the "standard" symmetries of isospin, G-parity, charge conjugation, C, P, T, and chirality using rare and forbidden decays of light mesons such as the {eta} ,{eta}' and {omega}. We also investigate the consequences of these symmetries being slightly broken symmetries. We do this by studying selected meson decays using the Crystal Ball detector. (c) We determine the mass, or more precisely the mass difference of the three light quarks (which are inputs to Quantum Chromodynamics) by measuring the decay rate of specially selected {eta} and {eta}' decay modes, again we use the Crystal Ball. (d)We have started a new program to search for the 33 missing cascade baryons using the CLAS detector at the Thomas Jefferson Laboratory. Cascade resonances are very special: they have double strangeness and are quite narrow. This implies that they can be discovered by the missing mass technique in photoproduction reactions such as in {gamma}p{yields}{Xi}{sup}K{sup +}K{sup +}. The cascade program is of particular importance for the upgrade to 12 GeV of the CLAS detector and for design of the Hall D at JLab. (e) Finally, we are getting more involved in a new program to measure the hadronic matter form factor of complex nuclei, in particular

  10. Science and Engineering of the Environment of Los Angeles: A GK-12 Experiment at Developing Science Communications Skills in UCLA's Graduate Program (United States)

    Moldwin, M. B.; Hogue, T. S.; Nonacs, P.; Shope, R. E.; Daniel, J.


    Many science and research skills are taught by osmosis in graduate programs with the expectation that students will develop good communication skills (speaking, writing, and networking) by observing others, attending meetings, and self reflection. A new National Science Foundation Graduate Teaching Fellows in K- 12 Education (GK-12; program at UCLA (SEE-LA; ) attempts to make the development of good communication skills an explicit part of the graduate program of science and engineering students. SEE-LA places the graduate fellows in two pairs of middle and high schools within Los Angeles to act as scientists-in- residence. They are partnered with two master science teachers and spend two-days per week in the classroom. They are not student teachers, or teacher aides, but scientists who contribute their content expertise, excitement and experience with research, and new ideas for classroom activities and lessons that incorporate inquiry science. During the one-year fellowship, the graduate students also attend a year-long Preparing Future Faculty seminar that discusses many skills needed as they begin their academic or research careers. Students are also required to include a brief (two-page) summary of their research that their middle or high school students would be able to understand as part of their published thesis. Having students actively thinking about and communicating their science to a pre-college audience provides important science communication training and helps contribute to science education. University and local pre- college school partnerships provide an excellent opportunity to support the development of graduate student communication skills while also contributing significantly to the dissemination of sound science to K-12 teachers and students.

  11. Musica de la Frontera: Research Note on the UCLA Frontera Digital Archive (United States)

    Romero, Robert Chao


    The Frontera Digital Archive is an impressive and invaluable research tool for multidisciplinary scholars of Chicana/o studies and Latin American studies. The archive preserves rare Mexican vernacular musical recordings and provides convenient access to these recordings via Internet.

  12. Ice Engineering Research Area (United States)

    Federal Laboratory Consortium — Refrigerated Physical Modeling of Waterways in a Controlled EnvironmentThe Research Area in the Ice Engineering Facility at the Cold Regions Research and Engineering...

  13. Designing requirements engineering research

    NARCIS (Netherlands)

    Wieringa, Roelf J.; Heerkens, Johannes M.G.


    Engineering sciences study different topics than natural sciences, and utility is an essential factor in choosing engineering research problems. But despite these differences, research methods for the engineering sciences are no different than research methods for any other kind of science. At most

  14. Systems engineering research


    Sahraoui , Abd-El-Kader; Buede , Dennis ,; Sage , Andrew ,


    International audience; In this paper, we propose selected research topics that are believed central to progress and growth in the application of systems engineering (SE). As a professional activity, and as an intellectual activity, systems engineering has strong links to such associated disciplines as decision analysis, operation research, project management, quality management, and systems design. When focussing on systems engineering research, we should distinguish between subjects that ar...

  15. Teaching engineering design research

    DEFF Research Database (Denmark)

    Blessing, Lucienne; Andreasen, Mogens Myrup


    The importance og engineering design as an industrial activity, and the increasingly complex and dynamic context in which it takes place, has led to the wish to improve the effectiveness and efficiency of engineering design in practice as well as in education. Although attempts have been made...... to improve design for centuries, it was not until well in the second half of the 20th century that engineering design became a research topic (see pahl and Beitz (1996), Heymann (2004) for historical overviews). Engineering research, such as research into thermodynamics, mechanics and materials, has a much...... by PhD students. This has created the demand for a clear, efficient way of learning the crafmanship of doing design research, a demand which is in strong contrast to the state of design research in general. This article reflects the authors' efforts in running a summer school om engineering design...

  16. Empirical Research In Engineering Design

    DEFF Research Database (Denmark)

    Ahmed, Saeema


    Increasingly engineering design research involves the use of empirical studies that are conducted within an industrial environment [Ahmed, 2001; Court 1995; Hales 1987]. Research into the use of information by designers or understanding how engineers build up experience are examples of research...... of research issues. This paper describes case studies of empirical research carried out within industry in engineering design focusing upon information, knowledge and experience in engineering design. The paper describes the research methods employed, their suitability for the particular research aims...

  17. Engine Environment Research Facility (EERF) (United States)

    Federal Laboratory Consortium — Description: This facility supports research and development testing of the behavior of turbine engine lubricants, fuels and sensors in an actual engine environment....

  18. Materials Engineering Research Facility (MERF) (United States)

    Federal Laboratory Consortium — Argonne?s Materials Engineering Research Facility (MERF) enables engineers to develop manufacturing processes for producing advanced battery materials in sufficient...

  19. Global Journal of Engineering Research

    African Journals Online (AJOL)

    The Global Journal of Engineering Research is aimed at promoting research in all areas of Engineering Research including Mechanical, Civil, Electrical, Chemical, Electronics, Geological etc. Visit the Global Journal Series website here: ...

  20. Framework for systems engineering research

    CSIR Research Space (South Africa)

    Erasmus, L


    Full Text Available In this paper a framework is proposed to perform systems engineering research within South Africa. It is proposed that within the reference of the National Research Foundation (NRF) classification of research, systems engineering is a Field...

  1. Rotary engine research (United States)


    A development history is presented for NASA's 1983-1991 Rotary Engine Enablement Program, emphasizing the CFD approaches to various problems that were instituted from 1987 to the end of the program. In phase I, a test rig was built to intensively clarify and characterize the stratified-charge rotary engine concept. In phase II, a high pressure, electronically controlled fuel injection system was tested. In phase III, the testing of improved fuel injectors led to the achievement of the stipulated 5 hp/cu inch specific power goal. CFD-aided design of advanced rotor-pocket shapes led to additional performance improvements.

  2. Experimental Research of Engine Foundations

    Directory of Open Access Journals (Sweden)

    Violeta-Elena Chiţan


    Full Text Available This paper tries a compact presentation of experimental research of engine-foundations. The dynamic phenomena are so complex, that the vibrations cannot be estimated in the design stage. The design engineer of an engine foundation must foresee through a dynamic analysis of the vibrations, those measures that lead to the avoidance or limiting of the bad effects caused by the vibrations.

  3. Research advances in industrial engineering

    CERN Document Server


    This book provides discussions and the exchange of information on principles, strategies, models, techniques, methodologies and applications of industrial engineering. It communicates the latest developments and research activity on industrial engineering and is useful for all those interested in the technological challenges in the field.

  4. Engineering Multiphysics Research

    Directory of Open Access Journals (Sweden)

    Tom Eppes


    Full Text Available This paper describes an engineering undergraduate course that covers the methods and techniques of multiphysics modeling. Students become active participants in analysis and discovery by being challenged to solve a sequence of problems related to high priority technology areas. Projects range from power systems and thermal control of habitats to autonomous flight systems and harsh environment electronics. Working in a cooperative learning environment, teams encounter a series of assignments that build on existing skills while gradually expanding their knowledge and expertise in disciplines outside of their own. This project-based approach employs a scaffolding structure with assignments organized in progressively challenging modules supported by mentoring. Each project begins with a problem definition which requires consideration of factors and influences beyond a single discipline. Solution development then moves to setting material properties, boundary constraints and including the necessary physics engines. For many students, this is the first in depth exposure to problems with specialized terminologies, driving equations and limiting conditions. Lastly, solving and post processing are addressed exploring steady state, time-variant, frequency response, optimization and sensitivity methods. The paper discusses the teaching and learning strategies, course structure, outcome assessment and project examples.

  5. Tissue Engineering Research (United States)


    1996. J. Clinical Investigation 98:2436. Bestor, T. 2000. J. Clinical Invest. 105:409-411. Boden, S., T. Zdeblick, H. Sandhu, and S. Heim. 2000. Spine ...several areas of biomolecules research. Researchers in this group are studying the role of several proteins, including hedgehog and insulin, on the...or spine surgery or dental/craniofacial surgery. Dramatic osteoinduction resulted in acceleration of callus formation and maturation and decrease in

  6. Research | College of Engineering & Applied Science (United States)

    Engineering & Applied Science. Please explore this webpage to learn about research activities and Associate Dean for Research College of Engineering and Applied Sciences Director, Center for Sustainable magazine. College ofEngineering & Applied Science Academics About People Students Research Business

  7. Chemical engineering research

    International Nuclear Information System (INIS)



    Results of research are reported on hydrodynamics and mass transfer in three-phase fluidized beds. In hydrogen permeation-oxidation studies it was found that at 300 to 500 0 C, and 10-6 oxygen pressure, stainless steel oxidizes 40 to 50 percent of the permeating deuterium. Methods of preparing less than 10-μ sorbent particles were studied using erbium oxide. Adiabatic graphite oxidation studies demonstrated that burning rates are mass transfer controlled, and that the product gas temperature can be controlled by adjusting the recycle gas rate. Apparatus was assembled for evaluation of a perfusion-impactor to remove solid or liquid particles from gas streams. In studies of continuous chromatography the separation of Blue Dextran and CoCl 2 on Spandex G-10 resin was demonstrated

  8. Pedagogical Training and Research in Engineering Education (United States)

    Wankat, Phillip C.


    Ferment in engineering has focused increased attention on undergraduate engineering education, and has clarified the need for rigorous research in engineering education. This need has spawned the new research field of Engineering Education and greatly increased interest in earning Ph.D. degrees based on rigorous engineering education research.…

  9. Engineering research, development and technology

    International Nuclear Information System (INIS)


    The mission of the Engineering Research, Development, and Technology Program at Lawrence Livermore National Laboratory (LLNL) is to develop the technical staff, tools, and facilities needed to support current and future LLNL programs. The efforts are guided by a dual-benefit research and development strategy that supports Department of Energy missions, such as national security through nuclear deterrence and economic competitiveness through partnerships with U.S. industry. This annual report, organized by thrust area, describes the activities for the fiscal year 1993. The report provides timely summaries of objectives, methods, and results from nine thrust areas for this fiscal year: Computational Electronics and Electromagnetics; Computational Mechanics; Diagnostics and Microelectronics; Fabrication Technology; Materials Science and Engineering; Power Conversion Technologies; Nondestructive Evaluation; Remote Sensing, Imaging, and Signal Engineering; and Emerging Technologies. Separate abstracts were prepared for 47 papers in this report

  10. Molecularly Engineered Energy Materials, an Energy Frontier Research Center

    Energy Technology Data Exchange (ETDEWEB)

    Ozolins, Vidvuds [Univ. of California, Los Angeles, CA (United States). Materials Science and Engineering Dept.


    Molecularly Engineered Energy Materials (MEEM) was established as an interdisciplinary cutting-edge UCLA-based research center uniquely equipped to attack the challenge of rationally designing, synthesizing and testing revolutionary new energy materials. Our mission was to achieve transformational improvements in the performance of materials via controlling the nano-and mesoscale structure using selectively designed, earth-abundant, inexpensive molecular building blocks. MEEM has focused on materials that are inherently abundant, can be easily assembled from intelligently designed building blocks (molecules, nanoparticles), and have the potential to deliver transformative economic benefits in comparison with the current crystalline-and polycrystalline-based energy technologies. MEEM addressed basic science issues related to the fundamental mechanisms of carrier generation, energy conversion, as well as transport and storage of charge and mass in tunable, architectonically complex materials. Fundamental understanding of these processes will enable rational design, efficient synthesis and effective deployment of novel three-dimensional material architectures for energy applications. Three interrelated research directions were initially identified where these novel architectures hold great promise for high-reward research: solar energy generation, electrochemical energy storage, and materials for CO2 capture. Of these, the first two remained throughout the project performance period, while carbon capture was been phased out in consultation and with approval from BES program manager.

  11. Laser wakefields at UCLA and LLNL

    International Nuclear Information System (INIS)

    Mori, W.B.; Clayton, C.E.; Joshi, C.; Dawson, J.M.; Decker, C.B.; Marsh, K.; Katsouleas, T.; Darrow, C.B.; Wilks, S.C.


    The authors report on recent progress at UCLA and LLNL on the nonlinear laser wakefield scheme. They find advantages to operating in the limit where the laser pulse is narrow enough to expel all the plasma electrons from the focal region. A description of the experimental program for the new short pulse 10 TW laser facility at LLNL is also presented

  12. FY2012 Engineering Research & Technology Report

    Energy Technology Data Exchange (ETDEWEB)

    Lane, Monya


    This report documents engineering research, development, and technology advancements performed by LLNL during fiscal year 2012 in the following areas: computational engineering, engineering information systems, micro/nano-devices and structures, and measurement technologies.

  13. A framework for systems engineering research

    CSIR Research Space (South Africa)

    Erasmus, L


    Full Text Available This presentation discusses a framework which is proposed to perform systems engineering research within South Africa and the necessity for hybrid research methods in systems engineering....

  14. Journal of Civil Engineering Research and Practice

    African Journals Online (AJOL)

    The Journal of Civil Engineering Research and Practice aims to publish original research papers of high standard, containing material of significant contribution to civil engineering, with emphasis being placed on material that is applicable to the solution of practical problems.

  15. Small-Engine Research Laboratory (SERL) (United States)

    Federal Laboratory Consortium — Description: The Small-Engine Research Laboratory (SERL) is a facility designed to conduct experimental small-scale propulsion and power generation systems research....

  16. Feminist Methodologies and Engineering Education Research (United States)

    Beddoes, Kacey


    This paper introduces feminist methodologies in the context of engineering education research. It builds upon other recent methodology articles in engineering education journals and presents feminist research methodologies as a concrete engineering education setting in which to explore the connections between epistemology, methodology and theory.…

  17. Necessity for ethics in social engineering research

    CSIR Research Space (South Africa)

    Mouton, F


    Full Text Available Social engineering is deeply entrenched in the fields of both computer science and social psychology. Knowledge is required in both these disciplines to perform social engineering based research. Several ethical concerns and requirements need...

  18. Modern mechanical engineering research, development and education

    CERN Document Server


    This book covers modern subjects of mechanical engineering such as nanomechanics and nanotechnology, mechatronics and robotics, computational mechanics, biomechanics, alternative energies, sustainability as well as all aspects related with mechanical engineering education. The chapters help enhance the understanding of both the fundamentals of mechanical engineering and its application to the solution of problems in modern industry. This book is suitable for students, both in final undergraduate mechanical engineering courses or at the graduate level. It also serves as a useful reference for academics, mechanical engineering researchers, mechanical, materials and manufacturing engineers, professionals in related with mechanical engineering.

  19. Software Engineering Support of the Third Round of Scientific Grand Challenge Investigations: An Earth Modeling System Software Framework Strawman Design that Integrates Cactus and UCLA/UCB Distributed Data Broker (United States)

    Talbot, Bryan; Zhou, Shu-Jia; Higgins, Glenn


    One of the most significant challenges in large-scale climate modeling, as well as in high-performance computing in other scientific fields, is that of effectively integrating many software models from multiple contributors. A software framework facilitates the integration task. both in the development and runtime stages of the simulation. Effective software frameworks reduce the programming burden for the investigators, freeing them to focus more on the science and less on the parallel communication implementation, while maintaining high performance across numerous supercomputer and workstation architectures. This document proposes a strawman framework design for the climate community based on the integration of Cactus, from the relativistic physics community, and UCLA/UCB Distributed Data Broker (DDB) from the climate community. This design is the result of an extensive survey of climate models and frameworks in the climate community as well as frameworks from many other scientific communities. The design addresses fundamental development and runtime needs using Cactus, a framework with interfaces for FORTRAN and C-based languages, and high-performance model communication needs using DDB. This document also specifically explores object-oriented design issues in the context of climate modeling as well as climate modeling issues in terms of object-oriented design.

  20. PACS module image communication at UCLA

    International Nuclear Information System (INIS)

    Stewart, B.K.; Taira, R.K.; Cho, P.S.; Mankovich, N.J.


    The advent of the ACR-NEMA digital and communication standard for PACS implementation between imaging, storage and display devices may simplify the networking problems inherent to PACS in the future. However, since the ACR-NEMA interface has not been implemented in manufactured products, the components of a PACS at the present time use various network interface designs, requiring substantial effort in the area of hardware and software integration. Many communication systems are used for the PACS implementation in Pediatric Radiology at UCLA, including baseband, broadband, as well as various parallel-line interface protocols, e.g. GP-IB. A VAX 11/750 minicomputer serves as the host computer for the UCLA Pediatric Radiology PACS system. Communication between the many peripherals take place through the host computer, which acts as the central node. Several communication links have been established, primarily: host computer to other local computers, image processors, various peripherals (digitizers, storage media, etc.) and, of course, to the 512, 1024 and 2048 viewing stations

  1. Global Journal of Engineering Research: Editorial Policies

    African Journals Online (AJOL)

    Focus and Scope. The Global Journal of Engineering Research is aimed at promoting research in all areas of Engineering Research including Mechanical, Civil, Electrical, Chemical, Electronics, Geological etc. Section Policies. Articles. Checked Open Submissions, Checked Indexed, Checked Peer Reviewed. Publication ...

  2. Sandia National Laboratories: Research: Research Foundations: Engineering (United States)

    Foundations Bioscience Computing & Information Science Electromagnetics Engineering Science Geoscience Mexico Small Business Assistance Program Sandia Science & Technology Park Careers Community Library Events Careers View All Jobs Students & Postdocs Internships & Co-ops Fellowships

  3. Engineering Research in Irish Economic Development (United States)

    Kelly, John


    This article summarizes the main findings and recommendations of a report published in December 2010 by the Irish Academy of Engineering (IAE). The report, representing the views of a committee of distinguished Irish engineers from a wide range of disciplines, addresses the role of engineering research in Ireland's economic development and the…

  4. The UCLA Young Autism Project: A Reply to Gresham and Macmillan. (United States)

    Smith, Tristam; Lovass, O. Ivar


    Responds to "Autistic Recovery? An Analysis and Critique of the Empirical Evidence on the Early Intervention Project" (Gresham and MacMillan), which criticizes research showing the effectiveness of the UCLA Youth Autism Project program for children with autism. The article's misunderstandings are discussed and the program is explained. (CR)

  5. UCLA Translational Biomarker Development Program (UTBD)

    Energy Technology Data Exchange (ETDEWEB)

    Czernin, Johannes [Univ. of California, Los Angeles, CA (United States)


    The proposed UTBD program integrates the sciences of diagnostic nuclear medicine and (radio)chemistry with tumor biology and drug development. UTBD aims to translate new PET biomarkers for personalized medicine and to provide examples for the use of PET to determine pharmacokinetic (PK) and pharmacodynamic (PD) drug properties. The program builds on an existing partnership between the Ahmanson Translational Imaging Division (ATID) and the Crump Institute of Molecular Imaging (CIMI), the UCLA Department of Chemistry and the Division of Surgical Oncology. ATID provides the nuclear medicine training program, clinical and preclinical PET/CT scanners, biochemistry and biology labs for probe and drug development, radiochemistry labs, and two cyclotrons. CIMI provides DOE and NIH-funded training programs for radio-synthesis (START) and molecular imaging (SOMI). Other participating entities at UCLA are the Department of Chemistry and Biochemistry and the Division of Surgical Oncology. The first UTBD project focuses on deoxycytidine kinase, a rate-limiting enzyme in nucleotide metabolism, which is expressed in many cancers. Deoxycytidine kinase (dCK) positive tumors can be targeted uniquely by two distinct therapies: 1) nucleoside analog prodrugs such as gemcitabine (GEM) are activated by dCK to cytotoxic antimetabolites; 2) recently developed small molecule dCK inhibitors kill tumor cells by starving them of nucleotides required for DNA replication and repair. Since dCK-specific PET probes are now available, PET imaging of tumor dCK activity could improve the use of two different classes of drugs in a wide variety of cancers.

  6. Research Trends with Cross Tabulation Search Engine (United States)

    Yin, Chengjiu; Hirokawa, Sachio; Yau, Jane Yin-Kim; Hashimoto, Kiyota; Tabata, Yoshiyuki; Nakatoh, Tetsuya


    To help researchers in building a knowledge foundation of their research fields which could be a time-consuming process, the authors have developed a Cross Tabulation Search Engine (CTSE). Its purpose is to assist researchers in 1) conducting research surveys, 2) efficiently and effectively retrieving information (such as important researchers,…

  7. Fuel Combustion and Engine Performance | Transportation Research | NREL (United States)

    Fuel Combustion and Engine Performance Fuel Combustion and Engine Performance Photo of a gasoline emissions in advanced engine technologies. Photo by Dennis Schroeder, NREL NREL's combustion research and combustion and engine research activities include: Developing experimental and simulation research platforms

  8. Initial draft of CSE-UCLA evaluation model based on weighted product in order to optimize digital library services in computer college in Bali (United States)

    Divayana, D. G. H.; Adiarta, A.; Abadi, I. B. G. S.


    The aim of this research was to create initial design of CSE-UCLA evaluation model modified with Weighted Product in evaluating digital library service at Computer College in Bali. The method used in this research was developmental research method and developed by Borg and Gall model design. The results obtained from the research that conducted earlier this month was a rough sketch of Weighted Product based CSE-UCLA evaluation model that the design had been able to provide a general overview of the stages of weighted product based CSE-UCLA evaluation model used in order to optimize the digital library services at the Computer Colleges in Bali.

  9. Virtual Parts Engineering Research Center (United States)


    engineering 10 materials. High strength alloys , composites (polymer composites and metallic composites), and the like cannot merely be replaced by...ceramics, smart materials, shape memory alloys , super plastic materials and nano- structured materials may be more appropriate substitutes in a reverse...molding process using thermosetting Bakelite. For remanufacturing the part in small quantities, machining has been identified as the most economical

  10. A Bibliometric Analysis of Climate Engineering Research (United States)

    Belter, C. W.; Seidel, D. J.


    The past five years have seen a dramatic increase in the number of media and scientific publications on the topic of climate engineering, or geoengineering, and some scientists are increasingly calling for more research on climate engineering as a possible supplement to climate change mitigation and adaptation strategies. In this context, understanding the current state of climate engineering research can help inform policy discussions and guide future research directions. Bibliometric analysis - the quantitative analysis of publications - is particularly applicable to fields with large bodies of literature that are difficult to summarize by traditional review methods. The multidisciplinary nature of the published literature on climate engineering makes it an ideal candidate for bibliometric analysis. Publications on climate engineering are found to be relatively recent (more than half of all articles during 1988-2011 were published since 2008), include a higher than average percentage of non-research articles (30% compared with 8-15% in related scientific disciplines), and be predominately produced by countries located in the Northern Hemisphere and speaking English. The majority of this literature focuses on land-based methods of carbon sequestration, ocean iron fertilization, and solar radiation management and is produced with little collaboration among research groups. This study provides a summary of existing publications on climate engineering, a perspective on the scientific underpinnings of the global dialogue on climate engineering, and a baseline for quantitatively monitoring the development of climate engineering research in the future.

  11. Alternative Fuels DISI Engine Research ? Autoignition Metrics.

    Energy Technology Data Exchange (ETDEWEB)

    Sjoberg, Carl Magnus Goran [Sandia National Lab. (SNL-NM), Albuquerque, NM (United States); Vuilleumier, David [Sandia National Lab. (SNL-NM), Albuquerque, NM (United States)


    Improved engine efficiency is required to comply with future fuel economy standards. Alternative fuels have the potential to enable more efficient engines while addressing concerns about energy security. This project contributes to the science base needed by industry to develop highly efficient direct injection spark igniton (DISI) engines that also beneficially exploit the different properties of alternative fuels. Here, the emphasis is on quantifying autoignition behavior for a range of spark-ignited engine conditions, including directly injected boosted conditions. The efficiency of stoichiometrically operated spark ignition engines is often limited by fuel-oxidizer end-gas autoignition, which can result in engine knock. A fuel’s knock resistance is assessed empirically by the Research Octane Number (RON) and Motor Octane Number (MON) tests. By clarifying how these two tests relate to the autoignition behavior of conventional and alternative fuel formulations, fuel design guidelines for enhanced engine efficiency can be developed.

  12. Summaries of FY 1994 engineering research

    International Nuclear Information System (INIS)


    This report documents the Basic Energy Sciences Engineering Research Program for fiscal year 1994; it provides a summary of each of the program projects in addition to a brief program overview. The report is intended to provide staff of Congressional committees, other executive departments, and other DOE offices with substantive program information so as to facilitate governmental overview and coordination of Federal research programs. Of equal importance, its availability facilitates communication of program information to interested research engineers and scientists

  13. Summaries of FY 1994 engineering research

    Energy Technology Data Exchange (ETDEWEB)


    This report documents the Basic Energy Sciences Engineering Research Program for fiscal year 1994; it provides a summary of each of the program projects in addition to a brief program overview. The report is intended to provide staff of Congressional committees, other executive departments, and other DOE offices with substantive program information so as to facilitate governmental overview and coordination of Federal research programs. Of equal importance, its availability facilitates communication of program information to interested research engineers and scientists.

  14. Ten recommendations for software engineering in research. (United States)

    Hastings, Janna; Haug, Kenneth; Steinbeck, Christoph


    Research in the context of data-driven science requires a backbone of well-written software, but scientific researchers are typically not trained at length in software engineering, the principles for creating better software products. To address this gap, in particular for young researchers new to programming, we give ten recommendations to ensure the usability, sustainability and practicality of research software.

  15. Tracer research in process engineering

    International Nuclear Information System (INIS)

    Iller, E.


    The book is a review of modern applications of tracer techniques in chemical and process engineering studies. The next topics have been extensively presented: 1) media flow through apparatus; 2) the tracers in the study of media flow dynamics through apparatus; 3) mathematical interpretation of experimental data from impulse-response method; 4) the models of media flow through chemical reactors and apparatus; 5) radiotracers in mass transport study; 6) examples of practical applications of tracer methods in industrial objects. 84 refs, 96 figs, 31 tabs

  16. Research Collaborations | College of Engineering & Applied Science (United States)

    Electrical Engineering Instructional Laboratories Student Resources Industrial & Manufacturing Engineering Industrial & Manufacturing Engineering Academic Programs Industrial & Manufacturing Engineering Major Industrial & Manufacturing Engineering Minor Industrial & Manufacturing Engineering

  17. Mechanical Engineering Department engineering research: Annual report, FY 1986

    International Nuclear Information System (INIS)

    Denney, R.M.; Essary, K.L.; Genin, M.S.; Highstone, H.H.; Hymer, J.D.; Taft, S.O.


    This report provides information on the five areas of research interest in LLNL's Mechanical Engineering Department. In Computer Code Development, a solid geometric modeling program is described. In Dynamic Systems and Control, structure control and structure dynamics are discussed. Fabrication technology involves machine cutting, interferometry, and automated optical component manufacturing. Materials engineering reports on composite material research and measurement of molten metal surface properties. In Nondestructive Evaluation, NMR, CAT, and ultrasound machines are applied to manufacturing processes. A model for underground collapse is developed. Finally, an alternative heat exchanger is investigated for use in a fusion power plant. Separate abstracts were prepared for each of the 13 reports in this publication

  18. Detonation Engine Research Facility (DERF) (United States)

    Federal Laboratory Consortium — Description: This facility is configured to safely conduct experimental pressuregain combustion research. The DERF is capable of supporting up to 60,000 lbf thrust...

  19. Domain Engineering, A Software Engineering Discipline in Need of Research

    DEFF Research Database (Denmark)

    Bjørner, Dines


    . The aim of this paper is to advocate: that researchers study these development method components, and that universities focus their education on basing well-nigh any course on the use of formal techniques: Specification and verification, and that software engineers take heed: Start applying formal......, and these again seem more stable than software designs. Thus, almost like the universal laws of physics, it pays off to first develop theories of domains. But domain engineering, as in fact also requirements engineering, really is in need of thoroughly researched development principles, techniques and tools...... techniques. A brief example of describing stake-holder perspectives will be given - on the background of which we then proceed to survey the notions of domain intrinsics, domain support technologies, domain management & organisation, domain rules & regulations, domain human behaviour, etc. We show elsewhere...

  20. Electronics engineering research proposals for FY78

    International Nuclear Information System (INIS)

    Cleland, L.L.; Ekstrom, M.P.; Miller, E.K.


    Since most of the Electronics Engineering Research expenditures are in the Engineering Research Division (ERD), the two are inseparable when discussing plans. A reorganization of ERD aimed at further expanding LLL capabilities and being more responsive to LLL needs is now complete. Six discipline related groups constitute the research elements in ERD. Three groups remained unchanged, one group was modified slightly, two groups were added, and one group was dissolved. The technical activities of each of the six research-oriented groups within ERD are reported

  1. Biomedical engineering for health research and development. (United States)

    Zhang, X-Y


    Biomedical engineering is a new area of research in medicine and biology, providing new concepts and designs for the diagnosis, treatment and prevention of various diseases. There are several types of biomedical engineering, such as tissue, genetic, neural and stem cells, as well as chemical and clinical engineering for health care. Many electronic and magnetic methods and equipments are used for the biomedical engineering such as Computed Tomography (CT) scans, Magnetic Resonance Imaging (MRI) scans, Electroencephalography (EEG), Ultrasound and regenerative medicine and stem cell cultures, preparations of artificial cells and organs, such as pancreas, urinary bladders, liver cells, and fibroblasts cells of foreskin and others. The principle of tissue engineering is described with various types of cells used for tissue engineering purposes. The use of several medical devices and bionics are mentioned with scaffold, cells and tissue cultures and various materials are used for biomedical engineering. The use of biomedical engineering methods is very important for the human health, and research and development of diseases. The bioreactors and preparations of artificial cells or tissues and organs are described here.

  2. Reengineering Biomedical Translational Research with Engineering Ethics. (United States)

    Sunderland, Mary E; Nayak, Rahul Uday


    It is widely accepted that translational research practitioners need to acquire special skills and knowledge that will enable them to anticipate, analyze, and manage a range of ethical issues. While there is a small but growing literature that addresses the ethics of translational research, there is a dearth of scholarship regarding how this might apply to engineers. In this paper we examine engineers as key translators and argue that they are well positioned to ask transformative ethical questions. Asking engineers to both broaden and deepen their consideration of ethics in their work, however, requires a shift in the way ethics is often portrayed and perceived in science and engineering communities. Rather than interpreting ethics as a roadblock to the success of translational research, we suggest that engineers should be encouraged to ask questions about the socio-ethical dimensions of their work. This requires expanding the conceptual framework of engineering beyond its traditional focus on "how" and "what" questions to also include "why" and "who" questions to facilitate the gathering of normative, socially-situated information. Empowering engineers to ask "why" and "who" questions should spur the development of technologies and practices that contribute to improving health outcomes.

  3. FY08 Engineering Research and Technology Report

    Energy Technology Data Exchange (ETDEWEB)

    Minichino, C; McNichols, D


    This report summarizes the core research, development, and technology accomplishments in Lawrence Livermore National Laboratory's Engineering Directorate for FY2008. These efforts exemplify Engineering's more than 50-year history of developing and applying the technologies needed to support the Laboratory's national security missions. A partner in every major program and project at the Laboratory throughout its existence, Engineering has prepared for this role with a skilled workforce and technical resources developed through both internal and external venues. These accomplishments embody Engineering's mission: 'Enable program success today and ensure the Laboratory's vitality tomorrow.' Engineering's mission is carried out through basic research and technology development. Research is the vehicle for creating competencies that are cutting-edge, or require discovery-class groundwork to be fully understood. Our technology efforts are discipline-oriented, preparing research breakthroughs for broader application to a variety of Laboratory needs. The term commonly used for technology-based projects is 'reduction to practice.' As we pursue this two-pronged approach, an enormous range of technological capabilities result. This report combines our work in research and technology into one volume, organized into thematic technical areas: Engineering Modeling and Simulation; Measurement Technologies; Micro/Nano-Devices and Structures; Engineering Systems for Knowledge and Inference; and Energy Manipulation. Our investments in these areas serve not only known programmatic requirements of today and tomorrow, but also anticipate the breakthrough engineering innovations that will be needed in the future.

  4. 2016 Milwaukee Engineering Research Conference | College of Engineering & (United States)

    Biomedical Engineering Concentration on Ergonomics M.S. Program in Computer Science Interdisciplinary Concentration on Energy Doctoral Programs in Engineering Non-Degree Candidate Departments Biomedical Engineering Biomedical Engineering Industry Advisory Council Civil & Environmental Engineering Civil &

  5. Nanoscale Science, Engineering and Technology Research Directions

    Energy Technology Data Exchange (ETDEWEB)

    Lowndes, D. H.; Alivisatos, A. P.; Alper, M.; Averback, R. S.; Jacob Barhen, J.; Eastman, J. A.; Imre, D.; Lowndes, D. H.; McNulty, I.; Michalske, T. A.; Ho, K-M; Nozik, A. J.; Russell, T. P.; Valentin, R. A.; Welch, D. O.; Barhen, J.; Agnew, S. R.; Bellon, P.; Blair, J.; Boatner, L. A.; Braiman, Y.; Budai, J. D.; Crabtree, G. W.; Feldman, L. C.; Flynn, C. P.; Geohegan, D. B.; George, E. P.; Greenbaum, E.; Grigoropoulos, C.; Haynes, T. E.; Heberlein, J.; Hichman, J.; Holland, O. W.; Honda, S.; Horton, J. A.; Hu, M. Z.-C.; Jesson, D. E.; Joy, D. C.; Krauss, A.; Kwok, W.-K.; Larson, B. C.; Larson, D. J.; Likharev, K.; Liu, C. T.; Majumdar, A.; Maziasz, P. J.; Meldrum, A.; Miller, J. C.; Modine, F. A.; Pennycook, S. J.; Pharr, G. M.; Phillpot, S.; Price, D. L.; Protopopescu, V.; Poker, D. B.; Pui, D.; Ramsey, J. M.; Rao, N.; Reichl, L.; Roberto, J.; Saboungi, M-L; Simpson, M.; Strieffer, S.; Thundat, T.; Wambsganss, M.; Wendleken, J.; White, C. W.; Wilemski, G.; Withrow, S. P.; Wolf, D.; Zhu, J. H.; Zuhr, R. A.; Zunger, A.; Lowe, S.


    This report describes important future research directions in nanoscale science, engineering and technology. It was prepared in connection with an anticipated national research initiative on nanotechnology for the twenty-first century. The research directions described are not expected to be inclusive but illustrate the wide range of research opportunities and challenges that could be undertaken through the national laboratories and their major national scientific user facilities with the support of universities and industry.

  6. A Research Agenda for Security Engineering

    Directory of Open Access Journals (Sweden)

    Rich Goyette


    Full Text Available Despite nearly 30 years of research and application, the practice of information system security engineering has not yet begun to exhibit the traits of a rigorous scientific discipline. As cyberadversaries have become more mature, sophisticated, and disciplined in their tradecraft, the science of security engineering has not kept pace. The evidence of the erosion of our digital security – upon which society is increasingly dependent – appears in the news almost daily. In this article, we outline a research agenda designed to begin addressing this deficit and to move information system security engineering toward a mature engineering discipline. Our experience suggests that there are two key areas in which this movement should begin. First, a threat model that is actionable from the perspectives of risk management and security engineering should be developed. Second, a practical and relevant security-measurement framework should be developed to adequately inform security-engineering and risk-management processes. Advances in these areas will particularly benefit business/government risk assessors as well as security engineers performing security design work, leading to more accurate, meaningful, and quantitative risk analyses and more consistent and coherent security design decisions. Threat modelling and security measurement are challenging activities to get right – especially when they need to be applied in a general context. However, these are decisive starting points because they constitute the foundation of a scientific security-engineering practice. Addressing these challenges will require stronger and more coherent integration between the sub-disciplines of risk assessment and security engineering, including new tools to facilitate that integration. More generally, changes will be required in the way security engineering is both taught and practiced to take into account the holistic approach necessary from a mature, scientific

  7. Biomedical engineering frontier research and converging technologies

    CERN Document Server

    Jun, Ho-Wook; Shin, Jennifer; Lee, SangHoon


    This book provides readers with an integrative overview of the latest research and developments in the broad field of biomedical engineering. Each of the chapters offers a timely review written by leading biomedical engineers and aims at showing how the convergence of scientific and engineering fields with medicine has created a new basis for practically solving problems concerning human health, wellbeing and disease. While some of the latest frontiers of biomedicine, such as neuroscience and regenerative medicine, are becoming increasingly dependent on new ideas and tools from other disciplines, the paradigm shift caused by technological innovations in the fields of information science, nanotechnology, and robotics is opening new opportunities in healthcare, besides dramatically changing the ways we actually practice science. At the same time, a new generation of engineers, fluent in many different scientific “languages,” is creating entirely new fields of research that approach the “old” questions f...

  8. Electronics Engineering Research. Final report, FY 1979

    International Nuclear Information System (INIS)

    Weissenberger, S.


    Accomplishments in Electronics Engineering Research (EER) during FY79 spanned a broad range of technologies, from high-speed microelectronics to digital image enhancement; from underground probing with electromagnetic waves to detecting neutrons with a small solid-state device; and from computer systems to aid engineers, to software tools to aid programmers. This report describes the overall EER program and its objectives, summarizes progress made in FY79, and outlines plans for FY80

  9. Council of Energy Engineering Research. Final Report

    Energy Technology Data Exchange (ETDEWEB)

    Goldstein, Richard J.


    The Engineering Research Program, a component program of the DOE Office of Basic Energy Sciences (BES), was established in 1979 to aid in resolving the numerous engineering issues arising from efforts to meet U.S. energy needs. The major product of the program became part of the body of knowledge and data upon which the applied energy technologies are founded; the product is knowledge relevant to energy exploration, production, conversion and use.

  10. Aircraft Turbine Engine Control Research at NASA Glenn Research Center (United States)

    Garg, Sanjay


    This lecture will provide an overview of the aircraft turbine engine control research at NASA (National Aeronautics and Space Administration) Glenn Research Center (GRC). A brief introduction to the engine control problem is first provided with a description of the current state-of-the-art control law structure. A historical aspect of engine control development since the 1940s is then provided with a special emphasis on the contributions of GRC. The traditional engine control problem has been to provide a means to safely transition the engine from one steady-state operating point to another based on the pilot throttle inputs. With the increased emphasis on aircraft safety, enhanced performance and affordability, and the need to reduce the environmental impact of aircraft, there are many new challenges being faced by the designers of aircraft propulsion systems. The Controls and Dynamics Branch (CDB) at GRC is leading and participating in various projects in partnership with other organizations within GRC and across NASA, other government agencies, the U.S. aerospace industry, and academia to develop advanced propulsion controls and diagnostics technologies that will help meet the challenging goals of NASA programs under the Aeronautics Research Mission. The second part of the lecture provides an overview of the various CDB technology development activities in aircraft engine control and diagnostics, both current and some accomplished in the recent past. The motivation for each of the research efforts, the research approach, technical challenges and the key progress to date are summarized. The technologies to be discussed include system level engine control concepts, gas path diagnostics, active component control, and distributed engine control architecture. The lecture will end with a futuristic perspective of how the various current technology developments will lead to an Intelligent and Autonomous Propulsion System requiring none to very minimum pilot interface

  11. Mechanical Engineering Department engineering research: Annual report, FY 1986

    Energy Technology Data Exchange (ETDEWEB)

    Denney, R.M.; Essary, K.L.; Genin, M.S.; Highstone, H.H.; Hymer, J.D.; Taft, S.O. (eds.)


    This report provides information on the five areas of research interest in LLNL's Mechanical Engineering Department. In Computer Code Development, a solid geometric modeling program is described. In Dynamic Systems and Control, structure control and structure dynamics are discussed. Fabrication technology involves machine cutting, interferometry, and automated optical component manufacturing. Materials engineering reports on composite material research and measurement of molten metal surface properties. In Nondestructive Evaluation, NMR, CAT, and ultrasound machines are applied to manufacturing processes. A model for underground collapse is developed. Finally, an alternative heat exchanger is investigated for use in a fusion power plant. Separate abstracts were prepared for each of the 13 reports in this publication. (JDH)

  12. Innovation and Research on Engineering Education

    DEFF Research Database (Denmark)

    de Graaff, Erik; Kolmos, Anette


    Our Western society depends strongly on continuous technological innovation. Engineers, the designers of the future technology need extensive competencies to face the challenge of dealing with ever increasing complexity. In some areas more than half the knowledge they learn in University is obsol......Our Western society depends strongly on continuous technological innovation. Engineers, the designers of the future technology need extensive competencies to face the challenge of dealing with ever increasing complexity. In some areas more than half the knowledge they learn in University...... is obsolete by the time the enter practice. Recognition of these issues has recently resulted in worldwide increase of attention for innovation of engineering education. This chapter presents a brief outline of the traditions in higher engineering education culminating in the stage of research and development...... in the last century. Next, the recent revival of engineering education research is described, contrasting the developments in the USA with Europe and the rest of the world. The efforts in the USA appear to follow Boyer’s concept scholarship of teaching, and aim for the establishment of engineering education...

  13. The progress of Requirements Engineering research

    Directory of Open Access Journals (Sweden)

    Michael Terstine


    Full Text Available This article is describes the path through the process of Requirements Engineering research and some lines are identified that can meet the needs of the emerging software and the complexity of today's problems. First is done a reviews to the state of the art of research in this area, with regard to technologies developed to address requirements specific tasks, such as elicitation, modeling and analysis. This review identified areas for further research. Subsequently, several strategies are described to implement and extend the results, in order to help shape the scope of future research. Finally, some topics for future research are proposed in order to address the Requirements Engineering needed to respond to emerging systems and the complexity of the same.

  14. Summaries of FY 1996 engineering research

    Energy Technology Data Exchange (ETDEWEB)



    This report documents the Basic Energy Sciences (BES) Engineering Research Program for fiscal year 1996; it provides a summary for each of the program projects in addition to a brief program overview. The report is intended to provide staff of Congressional committees, other executive departments, and other DOE offices with substantive program information so as to facilitate governmental overview and coordination of Federal research programs. Of equal importance, its availability facilitates communication of program information to interested research engineers and scientists. Each BES Division administers basic, mission oriented research programs in the area indicated by its title. The BES Engineering Research Program is one such program; it is administered by the Engineering and Geosciences Division of BES. In preparing this report the principal investigators were asked to submit summaries for their projects that were specifically applicable to fiscal year 1996. The summaries received have been edited if necessary, but the press for timely publication made it impractical to have the investigators review and approve the revised summaries prior to publication. For more information about a given project, it is suggested that the investigators be contacted directly.

  15. Using ethnographic methods in software engineering research

    DEFF Research Database (Denmark)

    Sharp, Helen, C.; Dittrich, Yvonne; De Souza, Cleidson


    This tutorial provides an overview of the role of ethnography in Software Engineering research. It describes the use of ethnographic methods as a means to provide an in-depth understanding of the socio-technological realities surrounding everyday software development practice. The knowledge gained......-depth discussion of methods for data collection and analysis used in ethnographic studies. It then describes how these methods can be and have been used by software engineering researchers to understand developers' work practices, to inform the development of processes, methods and tools and to evaluate...... can be used to improve processes, methods and tools as well as develop observed industrial practices. The tutorial begins with a brief historical account of ethnography in the fields of Software Engineering, CSCW, Information Systems and other related areas. This sets the stage for a more in...

  16. An initial bibliometric analysis and mapping of systems engineering research

    CSIR Research Space (South Africa)

    Oosthuizen, Rudolph


    Full Text Available Systems engineering is still a growing field that depends on continuous research to develop and mature. Research in systems engineering is difficult and the classic approaches for other engineering disciplines may not be sufficient. Additional...

  17. Engineering Education in Research-Intensive Universities (United States)

    Alpay, E.; Jones, M. E.


    The strengths and weaknesses of engineering education in research-intensive institutions are reported and key areas for developmental focus identified. The work is based on a questionnaire and session summaries used during a two-day international conference held at Imperial College London. The findings highlight several common concerns, such as…

  18. Engineering sciences research highlights. Fiscal year 1983

    International Nuclear Information System (INIS)

    Tucker, E.F.; Dobratz, B.


    The Laboratory's overall mission is sixfold. We are charged with developing nuclear warheads for defense, technology for arms control, and new concepts for defense against nuclear attack; with supporting programs for both nonnuclear defense and energy research and development; and with advancing our knowledge of science and technology so that we can respond to other national needs. Major programs in support of this mission involve nuclear weapons, energy, environmental science, and basic research. Specific areas of investigation include the design, development, and testing of nuclear weapons; nuclear safeguards and security; inertial and magnetic fusion and nuclear, solar, fossil, and geothermal energy; and basic research in physics, chemistry, mathematics, engineering, and the computer and life sciences. With the staff and facilities maintained for these and other programs, the Laboratory can respond to specific national needs in virtually all areas of the physical and life sciences. Within the Laboratory's organization, most technical research activities are carried out in three directorates: Engineering Sciences; Physics and Mathematics; and Chemistry, Earth and Life Sciences. The activities highlighted here are examples of unclassified work carried out in the seven divisions that made up the Engineering Sciences Directorate at the end of fiscal year 1983. Brief descriptions of these divisions' goals and capabilities and summaries of selected projects illustrate the diversity of talent, expertise, and facilities maintained within the Engineering Sciences Directorate

  19. NASA's engineering research centers and interdisciplinary education (United States)

    Johnston, Gordon I.


    A new program of interactive education between NASA and the academic community aims to improve research and education, provide long-term, stable funding, and support cross-disciplinary and multi-disciplinary research. The mission of NASA's Office of Aeronautics, Exploration and Technology (OAET) is discussed and it is pointed out that the OAET conducts about 10 percent of its total R&D program at U.S. universities. Other NASA university-based programs are listed including the Office of Commercial Programs Centers for the Commercial Development of Space (CCDS) and the National Space Grant program. The importance of university space engineering centers and the selection of the nine current centers are discussed. A detailed composite description is provided of the University Space Engineering Research Centers. Other specialized centers are described such as the Center for Space Construction, the Mars Mission Research Center, and the Center for Intelligent Robotic Systems for Space Exploration. Approaches to educational outreach are discussed.

  20. Global general pediatric surgery partnership: The UCLA-Mozambique experience. (United States)

    Amado, Vanda; Martins, Deborah B; Karan, Abraar; Johnson, Brittni; Shekherdimian, Shant; Miller, Lee T; Taela, Atanasio; DeUgarte, Daniel A


    There has been increasing recognition of the disparities in surgical care throughout the world. Increasingly, efforts are being made to improve local infrastructure and training of surgeons in low-income settings. The purpose of this study was to review the first 5-years of a global academic pediatric general surgery partnership between UCLA and the Eduardo Mondlane University in Maputo, Mozambique. A mixed-methods approach was utilized to perform an ongoing needs assessment. A retrospective review of admission and operative logbooks was performed. Partnership activities were summarized. The needs assessment identified several challenges including limited operative time, personnel, equipment, and resources. Review of logbooks identified a high frequency of burn admissions and colorectal procedures. Partnership activities focused on providing educational resources, on-site proctoring, training opportunities, and research collaboration. This study highlights the spectrum of disease and operative case volume of a referral center for general pediatric surgery in sub-Saharan Africa, and it provides a context for academic partnership activities to facilitate training and improve the quality of pediatric general surgical care in limited-resource settings. Level IV. Copyright © 2017 Elsevier Inc. All rights reserved.

  1. Evaluation of Research in Engineering Science in Norway

    DEFF Research Database (Denmark)

    Van Brussel, Hendrik Van Brussel; Lindberg, Bengt; Cederwall, Klas

    This report presents the conclusions of Panel 1: Construction engineering, Production and Operation. The Research Council of Norway (NFR) appointed three expert panels to evaluate Research in Engineering Science in Norway .......This report presents the conclusions of Panel 1: Construction engineering, Production and Operation. The Research Council of Norway (NFR) appointed three expert panels to evaluate Research in Engineering Science in Norway ....

  2. Federal Funding of Engineering Research and Development, 1980-1984. (United States)

    American Society of Mechanical Engineers, Washington, DC.

    Data on the sources, amounts, and trends of federal funding for engineering research and development (R&D) are presented for 1980-1984. Narrative highlights are provided for: the total federal funding obligations for engineering R&D, mechanical engineering, astronautical engineering, aeronautical engineering, chemical engineering, civil…

  3. Final Report: Performance Engineering Research Institute

    Energy Technology Data Exchange (ETDEWEB)

    Mellor-Crummey, John [Rice Univ., Houston, TX (United States)


    This document is a final report about the work performed for cooperative agreement DE-FC02-06ER25764, the Rice University effort of Performance Engineering Research Institute (PERI). PERI was an Enabling Technologies Institute of the Scientific Discovery through Advanced Computing (SciDAC-2) program supported by the Department of Energy's Office of Science Advanced Scientific Computing Research (ASCR) program. The PERI effort at Rice University focused on (1) research and development of tools for measurement and analysis of application program performance, and (2) engagement with SciDAC-2 application teams.

  4. Converging clinical and engineering research on neurorehabilitation

    CERN Document Server

    Torricelli, Diego; Pajaro, Marta


    Restoring human motor and cognitive function has been a fascinating research area during the last century. Interfacing the human nervous system with electro-mechanical rehabilitation machines is facing its crucial passage from research to clinical practice, enhancing the potentiality of therapists, clinicians and researchers to rehabilitate, diagnose and generate knowledge. The 2012 International Conference on Neurorehabilitation (ICNR2012, brings together researchers and students from the fields of Clinical Rehabilitation, Applied Neurophysiology and Biomedical Engineering, covering a wide range of research topics:   · Clinical Impact of Technology · Brain-Computer Interface in Rehabilitation · Neuromotor & Neurosensory modeling and processing · Biomechanics in Rehabilitation · Neural Prostheses in Rehabilitation · Neuro-Robotics in Rehabilitation · Neuromodulation   This Proceedings book includes general contributions from oral and poster sessions, as well as from special sess...

  5. Research Labs | College of Engineering & Applied Science (United States)

    Engineering Multimedia Software Laboratory Computer Science Nanotechnology for Sustainable Energy and Engineering Concentration on Ergonomics M.S. Program in Computer Science Interdisciplinary Concentration on Energy Doctoral Programs in Engineering Non-Degree Candidate Departments Biomedical Engineering

  6. Engineers are from Mars and educators are from Venus: Research ...

    African Journals Online (AJOL)

    ... are from Venus: Research supervision in engineering and educational collaboration. ... The projects usually entailed an interdisciplinary thesis that addressed an ... in chemical engineering, the work-readiness of civil engineering students, ...

  7. REFORMA/UCLA Mentor Program: A Mentoring Manual. (United States)

    Tauler, Sandra

    Although mentoring dates back to Greek mythology, the concept continues to thrive in today's society. Mentoring is a strategy that successful people have known about for centuries. The REFORMA/UCLA Mentor Program has made use of this strategy since its inception in November 1985 at the Graduate School of Library and Information Science at the…

  8. Summaries of FY 1997 engineering research

    Energy Technology Data Exchange (ETDEWEB)



    This report documents the Basic Energy Sciences (BES) Engineering Research Program for fiscal year 1997, it provides a summary for each of the program projects in addition to a brief program overview. The report is intended to provide staff of Congressional committees, other executive departments, and other DOE offices with substantive program information so as to facilitate governmental overview and coordination of Federal research programs. Of equal importance, its availability facilitates communication of program information to interested research engineers and scientists. The individual project summaries follow the program overview. The summaries are ordered alphabetically by name of institution; the table of contents lists all the institutions at which projects were sponsored in fiscal year 1997. Each project entry begins with an institutional-departmental heading. The names of investigators are listed immediately below the title. The funding level for fiscal year 1997 appears to the right of address. The summary description of the project completes the entry. A separate index of Principal Investigators includes phone number, fax number and e-main address, where available.

  9. Screening candidate systems engineers: a research design

    CSIR Research Space (South Africa)

    Goncalves, DP


    Full Text Available engineering screening methodology that could be used to screen potential systems engineers. According to their design, this can be achieved by defining a system engineering profile according to specific psychological attributes, and using this profile...

  10. Collaborative Engineering for Research and Development (United States)

    Davis, Jose M.; Keys, L. Ken; Chen, Injazz J.


    Research and development (R&D) organizations are being required to be relevant, to be more application-oriented, and to be partners in the strategic management of the business while meeting the same challenges as the rest of the organization, namely: (1) reduced time to market; (2) reduced cost; (3) improved quality; (4) increased reliability; and (5) increased focus on customer needs. Recent advances in computer technology and the Internet have created a new paradigm of collaborative engineering or collaborative product development (CPD), from which new types of relationships among researchers and their partners have emerged. Research into the applicability and benefits of CPD in a low/no production, R&D, and/or government environment is limited. In addition, the supply chain management (SCM) aspects of these relationships have not been studied. This paper presents research conducted at the NASA Glenn Research Center (GRC) investigating the applicability of CPD and SCM in an R&D organization. The study concentrates on the management and implementation of space research activities at GRC. Results indicate that although the organization is engaged in collaborative relationships that incorporate aspects of SCM, a number of areas, such as development of trust and information sharing merit special attention.

  11. 77 FR 14462 - Research, Engineering and Development Advisory Committee (United States)


    ... DEPARTMENT OF TRANSPORTATION Federal Aviation Administration Research, Engineering and Development....S.C. App. 2), notice is hereby given of a meeting of the FAA Research, Engineering and Development.... Name: Research, Engineering & Development Advisory Committee. Time and Date: April 18, 2012--9:30 a.m...

  12. 78 FR 47049 - Research, Engineering and Development Advisory Committee (United States)


    ... DEPARTMENT OF TRANSPORTATION Federal Aviation Administration Research, Engineering and Development...; 5 U.S.C. App. 2), notice is hereby given of a meeting of the FAA Research, Engineering and.... Name: Research, Engineering & Development Advisory Committee. Time and Date: September 18--8:30 a.m. to...

  13. 77 FR 54648 - Research, Engineering and Development Advisory Committee (United States)


    ... DEPARTMENT OF TRANSPORTATION Federal Aviation Administration Research, Engineering and Development....S.C. App. 2), notice is hereby given of a meeting of the FAA Research, Engineering and Development...: Research, Engineering & Development Advisory Committee. TIME AND DATE: September 26, 2012--9 a.m. to 4 p.m...

  14. 76 FR 12404 - Research, Engineering and Development Advisory Committee (United States)


    ... DEPARTMENT OF TRANSPORTATION Federal Aviation Administration Research, Engineering and Development....S.C. App. 2), notice is hereby given of a meeting of the FAA Research, Engineering and Development...: Research, Engineering & Development Advisory Committee. Time and Date: April 20, 2011--9:30 a.m. to 4 p.m...

  15. 75 FR 14243 - Research, Engineering And Development Advisory Committee (United States)


    ... DEPARTMENT OF TRANSPORTATION Federal Aviation Administration Research, Engineering And Development....S.C. App. 2), notice is hereby given of a meeting of the FAA Research, Engineering and Development...: Research, Engineering & Development Advisory Committee. Time and Date: April 21, 2010--9 a.m. to 5 p.m...

  16. 76 FR 44648 - Research, Engineering and Development Advisory Committee (United States)


    ... DEPARTMENT OF TRANSPORTATION Federal Aviation Administration Research, Engineering and Development....S.C. App. 2), notice is hereby given of a meeting of the FAA Research, Engineering and Development.... Name: Research, Engineering & Development Advisory Committee. Time and Date: September 21, 2011--9 a.m...

  17. 78 FR 16357 - Research, Engineering and Development Advisory Committee (United States)


    ... DEPARTMENT OF TRANSPORTATION Federal Aviation Administration Research, Engineering and Development... hereby given of a meeting of the FAA Research, Engineering and Development (R,E&D) Advisory Committee. Name: Research, Engineering & Development Advisory Committee. Time and Date: April 24--8:30 a.m. to 4...

  18. Research and development in power plant engineering

    International Nuclear Information System (INIS)

    Riedle, K.; Taud, R.


    Research and development are a bridge for visions that are escorted to a successful market introduction. Also in power plant engineering, research and development are a lever with which the product power plant, its technology and processes can be adapted to the quickly changing future market. In the overview given by this paper, therefore at first the development boosters and targets are outlined from the viewpoint of the market; then the available technology portfolio is addressed in a concise way. Targets for the development can be seen from the support programmes of the governments. Before a preview is given, some development topics from the point of view of the manufacturer are introduced. (orig.) [de

  19. Analysis of material removed from UCLA tokamaks Microtor and Macrotor

    International Nuclear Information System (INIS)

    Baer, D.R.; Thomas, M.T.; Taylor, R.J.


    This paper reports a first effort to examine the surface of the UCLA tokamaks, Microtor and Macrotor, by analyzing samples that have been exposed to plasma discharge and cleaning for long periods. The samples were sent to the Surface Science Section at the Pacific Northwest Laboratory (PNL). There, Auger electron spectrometry and sputter profile techniques were used to examine the samples, which had been handled in atmospheric conditions after being removed from the tokamak

  20. An overview of the NASA rotary engine research program (United States)

    Meng, P. R.; Hady, W. F.


    A brief overview and technical highlights of the research efforts and studies on rotary engines over the last several years at the NASA Lewis Research Center are presented. The test results obtained from turbocharged rotary engines and preliminary results from a high performance single rotor engine were discussed. Combustion modeling studies of the rotary engine and the use of a Laser Doppler Velocimeter to confirm the studies were examined. An in-house program in which a turbocharged rotary engine was installed in a Cessna Skymaster for ground test studies was reviewed. Details are presented on single rotor stratified charge rotary engine research efforts, both in-house and on contract.

  1. Researchers, other experts examine climate engineering issues

    International Nuclear Information System (INIS)

    Baum, R.


    The feasibility of deliberately engineering Earth's climate--and the social, economic, political, and ethical issues raised by such projects--were explored by two panels at the annual meeting of the American Association for the Advancement of Science (AAAS), held in late February in San Francisco. These projects include dispersal of sulfate particles in the stratosphere to reflect sunlight, fertilizing the southern oceans with iron to stimulate phytoplankton growth, and injecting ethane or propane into the stratosphere over Antarctica to counteract ozone-depleting chemical reactions. The feasibility of such projects was the focus of the first panel. Joyce E. Penner, of Lawrence Livermore National Laboratory, describes studies of natural and anthropogenic sulfate aerosols that suggest that these chemical species reduce the solar flux reaching the Earth's surface. The research indicates it might be possible to counteract greenhouse warming, at least in part, by injecting sulfate aerosols into the stratosphere. Should such an approach be used to counteract greenhouse warming? Should any climate engineering project be considered? These sorts of questions were the focus of the second panel

  2. Statistical Engineering in Air Traffic Management Research (United States)

    Wilson, Sara R.


    NASA is working to develop an integrated set of advanced technologies to enable efficient arrival operations in high-density terminal airspace for the Next Generation Air Transportation System. This integrated arrival solution is being validated and verified in laboratories and transitioned to a field prototype for an operational demonstration at a major U.S. airport. Within NASA, this is a collaborative effort between Ames and Langley Research Centers involving a multi-year iterative experimentation process. Designing and analyzing a series of sequential batch computer simulations and human-in-the-loop experiments across multiple facilities and simulation environments involves a number of statistical challenges. Experiments conducted in separate laboratories typically have different limitations and constraints, and can take different approaches with respect to the fundamental principles of statistical design of experiments. This often makes it difficult to compare results from multiple experiments and incorporate findings into the next experiment in the series. A statistical engineering approach is being employed within this project to support risk-informed decision making and maximize the knowledge gained within the available resources. This presentation describes a statistical engineering case study from NASA, highlights statistical challenges, and discusses areas where existing statistical methodology is adapted and extended.

  3. Armstrong Flight Research Center Research Technology and Engineering Report 2015 (United States)

    Voracek, David F.


    I am honored to endorse the 2015 Neil A. Armstrong Flight Research Center’s Research, Technology, and Engineering Report. The talented researchers, engineers, and scientists at Armstrong are continuing a long, rich legacy of creating innovative approaches to solving some of the difficult problems and challenges facing NASA and the aerospace community.Projects at NASA Armstrong advance technologies that will improve aerodynamic efficiency, increase fuel economy, reduce emissions and aircraft noise, and enable the integration of unmanned aircraft into the national airspace. The work represented in this report highlights the Center’s agility to develop technologies supporting each of NASA’s core missions and, more importantly, technologies that are preparing us for the future of aviation and space exploration.We are excited about our role in NASA’s mission to develop transformative aviation capabilities and open new markets for industry. One of our key strengths is the ability to rapidly move emerging techniques and technologies into flight evaluation so that we can quickly identify their strengths, shortcomings, and potential applications.This report presents a brief summary of the technology work of the Center. It also contains contact information for the associated technologists responsible for the work. Don’t hesitate to contact them for more information or for collaboration ideas.

  4. Research on a Scania 11 liter ethanol fueled bus engine

    Energy Technology Data Exchange (ETDEWEB)

    Egebaeck, K E; Pettersson, E


    This report presents research carried out on an alcohol fueled bus engine. The engine used was a six cylinder 11 liter compression ignition turbo-charged engine with an inter cooler. The research program included studies of the impact on the emissions when changing different engine components and different settings of the engine. A study of the impact on the engine performance and emissions when using different fuel compositions was also carried out. During the course of the work, the engine was equipped with oxidation catalysts of two different types, one of which was more efficient than the other concerning the oxidation of unburnt fuel related components. One of the main purposes of the research was to improve the emission characteristics of the engine by an optimization of the engine and its setting. The exhaust emissions were thoroughly characterized with respect to both regulated and unregulated emissions. 13 refs, figs, tabs

  5. Security Research on Engineering Database System

    Institute of Scientific and Technical Information of China (English)


    Engine engineering database system is an oriented C AD applied database management system that has the capability managing distributed data. The paper discusses the security issue of the engine engineering database management system (EDBMS). Through studying and analyzing the database security, to draw a series of securi ty rules, which reach B1, level security standard. Which includes discretionary access control (DAC), mandatory access control (MAC) and audit. The EDBMS implem ents functions of DAC, ...

  6. UPS fellowships support creative engineering research


    Crumbley, Liz


    A new $40,000 grant marks the 11th anniversary of support from the United Parcel Service (UPS) Foundation for doctoral fellowships in the Human Factors and Safety Engineering Graduate Program in the Grado Department of Industrial and Systems Engineering (ISE) in the College of Engineering.

  7. Human subject research for engineers a practical guide

    CERN Document Server

    de Winter, Joost C F


    This Brief introduces engineers to the main principles in ethics, research design, statistics, and publishing of human subject research. In recent years, engineering has become strongly connected to disciplines such as biology, medicine, and psychology. Often, engineers (and engineering students) are expected to perform human subject research. Typical human subject research topics conducted by engineers include human-computer interaction (e.g., evaluating the usability of software), exoskeletons, virtual reality, teleoperation, modelling of human behaviour and decision making (often within the framework of ‘big data’ research), product evaluation, biometrics, behavioural tracking (e.g., of work and travel patterns, or mobile phone use), transport and planning (e.g., an analysis of flows or safety issues), etc. Thus, it can be said that knowledge on how to do human subject research is indispensable for a substantial portion of engineers. Engineers are generally well trained in calculus and mechanics, but m...

  8. Engineering Research Division publication report, calendar year 1980

    International Nuclear Information System (INIS)

    Miller, E.K.; Livingston, P.L.; Rae, D.C.


    Each year the Engineering Research Division of the Electronics Engineering Department at Lawrence Livermore Laboratory has issued an internal report listing all formal publications produced by the Division during the calendar year. Abstracts of 1980 reports are presented

  9. Engineering Research Division report on reports: calendar year 1979

    International Nuclear Information System (INIS)

    Gardner, C.L.; Johnston, S.J.


    A bibliography of publications of members of the Engineering Research Division of the Electronics Engineering Department is presented for 1979. Abstracts for 148 publications are included, along with author and keywork indexes

  10. Update on Engine Combustion Research at Sandia National Laboratories

    International Nuclear Information System (INIS)

    Jay Keller; Gurpreet Singh


    The objectives of this paper are to describe the research efforts in diesel engine combustion at Sandia National Laboratories' Combustion Research Facility and to provide recent experimental results. We have four diesel engine experiments supported by the Department of Energy, Office of Heavy Vehicle Technologies: a one-cylinder version of a Cummins heavy-duty engine, a diesel simulation facility, a one-cylinder Caterpillar engine to evaluate combustion of alternative fuels, and a homogeneous-charge, compression ignition (HCCI) engine. Recent experimental results of diesel combustion research will be discussed and a description will be given of our HCCI experimental program and of our HCCI modeling work

  11. Annual report of Nuclear Engineering Research Laboratory, Faculty of Engineering, University of Tokyo, fiscal year 1995

    International Nuclear Information System (INIS)


    This is an annual report prepared on research education action, operation state of research instruments and others in FY 1995 at Nuclear Engineering Research Laboratory, Faculty of Engineering, University of Tokyo. The laboratory has four large instruments such as high speed neutron source reactor, 'Yayoi', electron linac, fundamentally experimental equipment for blanket design of nuclear fusion reactor, and heavy radiation research equipment (HIT), of which former two are used for cooperative research with universities in Japan, and the next blanket and the last HIT are also presented for cooperative researches in Faculty of Engineering and in University of Tokyo, respectively. FY 1995 was the beginning year of earnest discussion on future planning of this facility with concentrated effort. These four large research instruments are all in their active use. And, their further improvement is under preparation. In this report, the progress in FY 1995 on operation and management of the four large instruments are described at first, and on next, research actions, contents of theses for degree and graduation of students as well as research results of laboratory stuffs are summarized. These researches are constituted mainly using these large instruments in the facility, aiming at development of advanced and new field of atomic energy engineering and relates to nuclear reactor first wall engineering, nuclear reactor fuel cycle engineering, electromagnetic structure engineering, thermal-liquid engineering, mathematical information engineering, quantum beam engineering, new type reactor design and so on. (G.K.)

  12. Annual report of Nuclear Engineering Research Laboratory, Faculty of Engineering, University of Tokyo, fiscal year 1995

    Energy Technology Data Exchange (ETDEWEB)



    This is an annual report prepared on research education action, operation state of research instruments and others in FY 1995 at Nuclear Engineering Research Laboratory, Faculty of Engineering, University of Tokyo. The laboratory has four large instruments such as high speed neutron source reactor, `Yayoi`, electron linac, fundamentally experimental equipment for blanket design of nuclear fusion reactor, and heavy radiation research equipment (HIT), of which former two are used for cooperative research with universities in Japan, and the next blanket and the last HIT are also presented for cooperative researches in Faculty of Engineering and in University of Tokyo, respectively. FY 1995 was the beginning year of earnest discussion on future planning of this facility with concentrated effort. These four large research instruments are all in their active use. And, their further improvement is under preparation. In this report, the progress in FY 1995 on operation and management of the four large instruments are described at first, and on next, research actions, contents of theses for degree and graduation of students as well as research results of laboratory stuffs are summarized. These researches are constituted mainly using these large instruments in the facility, aiming at development of advanced and new field of atomic energy engineering and relates to nuclear reactor first wall engineering, nuclear reactor fuel cycle engineering, electromagnetic structure engineering, thermal-liquid engineering, mathematical information engineering, quantum beam engineering, new type reactor design and so on. (G.K.)

  13. The Benefits of Adding SETI to the University Curriculum and What We Have Learned from a SETI Course Recently Offered at UCLA (United States)

    Lesyna, Larry; Margot, Jean-Luc; Greenberg, Adam; Shinde, Akshay; Alladi, Yashaswi; Prasad MN, Srinivas; Bowman, Oliver; Fisher, Callum; Gyalay, Szilard; McKibbin, William; Miles, Brittany E.; Nguyen, Donald; Power, Conor; Ramani, Namrata; Raviprasad, Rashmi; Santana, Jesse


    We advocate for the inclusion of a full-term course entirely devoted to SETI in the university curriculum. SETI usually warrants only a few lectures in a traditional astronomy or astrobiology course. SETI’s rich interdisciplinary character serves astronomy students by introducing them to scientific and technological concepts that will aid them in their dissertation research or later in their careers. SETI is also an exciting topic that draws students from other disciplines and teaches them astronomical concepts that they might otherwise never encounter in their university studies. We have composed syllabi that illustrate the breadth and depth that SETI courses provide for advanced undergraduate or graduate students. The syllabi can also be used as a guide for an effective SETI course taught at a descriptive level.After a pilot course in 2015, UCLA formally offered a course titled "EPSS C179/279 - Search for Extraterrestrial Intelligence: Theory and Applications" in Spring 2016. The course was designed for advanced undergraduate students and graduate students in the science, technical, engineering, and mathematical fields. In 2016, 9 undergraduate students and 5 graduate students took the course. Students designed an observing sequence for the Arecibo and Green Bank telescopes, observed known planetary systems remotely, wrote a sophisticated and modular data processing pipeline, analyzed the data, and presented the results. In the process, they learned radio astronomy fundamentals, software development, signal processing, and statistics. The instructor believes that the students were eager to learn because of the engrossing nature of SETI. The students rated the course highly, in part because of the observing experience and the teamwork approach. The next offering will be in Spring 2017.See and

  14. Optimization of In-Cylinder Pressure Filter for Engine Research (United States)


    ARL-TR-8034 ● JUN 2017 US Army Research Laboratory Optimization of In-Cylinder Pressure Filter for Engine Research by Kenneth...Laboratory Optimization of In-Cylinder Pressure Filter for Engine Research by Kenneth S Kim, Michael T Szedlmayer, Kurt M Kruger, and Chol-Bum M...

  15. The Atlantic rift in Engineering Education Research Methodology

    DEFF Research Database (Denmark)

    de Graaff, Erik


    engineering. A revival of engineering education research started in the USA around the turn of the century. Building on the concept of ‘scholarship of teaching’, engineers were challenged to investigate their own role as educators. Since these researchers have their academic background mostly in engineering......In Europe educational research branched off from social sciences during the sixties of the last century. Combining theories and methods from pedagogy, sociology and psychology researchers explored the different fields of education, ranging from kindergarten till higher education including...... and science, they tend to aim for ‘rigorous research’ according to the natural sciences. Worldwide the engineering education community has recognized the need to blend both the social sciences research approach and rigorous research. This paper explores the variation in research methods used by researchers...

  16. Engineering Research, Development and Technology, FY95: Thrust area report

    Energy Technology Data Exchange (ETDEWEB)



    The mission of the Engineering Research, Development, and Technology Program at Lawrence Livermore National Laboratory (LLNL) is to develop the knowledge base, process technologies, specialized equipment, tools and facilities to support current and future LLNL programs. Engineering`s efforts are guided by a strategy that results in dual benefit: first, in support of Department of Energy missions, such as national security through nuclear deterrence; and second, in enhancing the nation`s economic competitiveness through their collaboration with US industry in pursuit of the most cost-effective engineering solutions to LLNL programs. To accomplish this mission, the Engineering Research, Development, and Technology Program has two important goals: (1) identify key technologies relevant to LLNL programs where they can establish unique competencies, and (2) conduct high-quality research and development to enhance their capabilities and establish themselves as the world leaders in these technologies. To focus Engineering`s efforts, technology thrust areas are identified and technical leaders are selected for each area. The thrust areas are comprised of integrated engineering activities, staffed by personnel from the nine electronics and mechanical engineering divisions, and from other LLNL organizations. This annual report, organized by thrust area, describes Engineering`s activities for fiscal year 1995. The report provides timely summaries of objectives methods, and key results from eight thrust areas: computational electronics and electromagnetics; computational mechanics; microtechnology; manufacturing technology; materials science and engineering; power conversion technologies; nondestructive evaluation; and information engineering.

  17. Experimental research on the Stirling engine (United States)

    Ishizaki, Y.; Tani, Y.; Haramura, N.


    Experiments on Stirling engines of the 50 KW class were conducted to clarify the characteristics of the engine and its problems. The problems involve durability of the high temperature heat exchanger which is exposed to high flame temperatures above 1600 C, thermal distortion and high temperature corrosion of the devices near combustion, and of the preheater.

  18. Process Systems Engineering Education: Learning by Research (United States)

    Abbas, A.; Alhammadi, H. Y.; Romagnoli, J. A.


    In this paper, we discuss our approach in teaching the final-year course Process Systems Engineering. Students are given ownership of the course by transferring to them the responsibility of learning. A project-based group environment stimulates learning while solving a real engineering problem. We discuss postgraduate student involvement and how…

  19. Journal of Civil Engineering Research and Practice

    African Journals Online (AJOL)

    CMAC-engine”, a blended scheme of Ant Colony Optimization (ACO) and Cost Minimization (CM) algorithms. The feasibility of CMAC-engine is numerically experimented by solving a standard 25-bar space truss in the field of structural engineering ...

  20. The Use of Web Search Engines in Information Science Research. (United States)

    Bar-Ilan, Judit


    Reviews the literature on the use of Web search engines in information science research, including: ways users interact with Web search engines; social aspects of searching; structure and dynamic nature of the Web; link analysis; other bibliometric applications; characterizing information on the Web; search engine evaluation and improvement; and…

  1. Engineer Research and Development Center's Materials Testing Center (MTC) (United States)

    Federal Laboratory Consortium — The Engineer Research and Development Center's Materials Testing Center (MTC) is committed to quality testing and inspection services that are delivered on time and...

  2. Data-driven engineering design research: Opportunities using open data

    DEFF Research Database (Denmark)

    Parraguez Ruiz, Pedro; Maier, Anja


    the already available and continuously growing body of open data sources to create opportunities for research in Engineering Design. Insights are illustrated by an examination of two examples: a study of open source software repositories and an analysis of open business registries in the cleantech industry....... We conclude with a discussion about the limitations, challenges and risks of using open data in Engineering Design research and practice.......Engineering Design research relies on quantitative and qualitative data to describe design-related phenomena and prescribe improvements for design practice. Given data availability, privacy requirements and other constraints, most empirical data used in Engineering Design research can be described...

  3. Environmental, Health, and Safety Research Needs for Engineered Nanoscale Materials

    National Research Council Canada - National Science Library

    Alderson, Norris; Alexander, Catherine; Merzbacher, Celia; Chernicoff, William; Middendorf, Paul; Beck, Nancy; Chow, Flora; Poster, Dianne; Danello, Mary Ann; Barrera, Enriqueta


    ...) research and information needs related to understanding and management of potential risks of engineered nanoscale materials that may be used, for example, in commercial or consumer products, medical...

  4. Engineering education research in European Journal of Engineering Education and Journal of Engineering Education: citation and reference discipline analysis (United States)

    Wankat, Phillip C.; Williams, Bill; Neto, Pedro


    The authors, citations and content of European Journal of Engineering Education (EJEE) and Journal of Engineering Education (JEE) in 1973 (JEE, 1975 EJEE), 1983, 1993, 2003, and available 2013 issues were analysed. Both journals transitioned from house organs to become engineering education research (EER) journals, although JEE transitioned first. In this process the number of citations rose, particularly of education and psychology sources; the percentage of research articles increased markedly as did the number of reference disciplines. The number of papers per issue, the number of single author papers, and the citations of science and engineering sources decreased. EJEE has a very broad geographic spread of authors while JEE authors are mainly US based. A 'silo' mentality where general engineering education researchers do not communicate with EER researchers in different engineering disciplines is evident. There is some danger that EER may develop into a silo that does not communicate with technically oriented engineering professors.

  5. International Conference on Research and Innovations in Mechanical Engineering

    CERN Document Server

    Singh, Paramjit; Singh, Harwinder; Brar, Gurinder


    This book comprises the proceedings of International Conference on Research and Innovations in Mechanical Engineering (ICRIME 2013) organized by Guru Nanak Dev Engineering College, Ludhiana with support from AICTE, TEQIP, DST and PTU, Jalandhar. This international conference served as a premier forum for communication of new advances and research results in the fields of mechanical engineering. The proceedings reflect the conference’s emphasis on strong methodological approaches and focus on applications within the domain of mechanical engineering. The contents of this volume aim to highlight new theoretical and experimental findings in the fields of mechanical engineering and closely related fields, including interdisciplinary fields such as robotics and mechatronics.

  6. Professional ethics in biomedical engineering practice and research. (United States)

    Monzon, Jorge E; Monzon-Wyngaard, Alvaro


    This paper discusses some guidelines for use with the accepted fundamental canons of ethics for engineers. We present some rules of practice and professional obligations emerging from these canons. Basic recommendations for engineers dissenting on ethical grounds are also presented. Ethical issues relating to Biomedical Engineering research are illustrated. We mention some cases that could be used to further understanding the ethical implications of biomedical engineering practice.

  7. Summary of Research 2001, Department of Mechanical Engineering, Graduate School of Engineering and Applied Sciences

    National Research Council Canada - National Science Library

    McNelley, Terry


    This report contains project summaries of the research projects in the Department of Mechanical Engineering A list of recent publications is also included, which consists of conference presentations...

  8. Strengthening engineering research and training in Africa

    International Development Research Centre (IDRC) Digital Library (Canada)

    Manfred Raffelsieper


    Aug 14, 2017 ... The engineering disciplines, in particular, could benefit from .... graduate education in Africa, with marked differences between ... particular attention to persistent structural barriers related to issues such as gender equality.

  9. SAPS simulation with GITM/UCLA-RCM coupled model (United States)

    Lu, Y.; Deng, Y.; Guo, J.; Zhang, D.; Wang, C. P.; Sheng, C.


    Abstract: SAPS simulation with GITM/UCLA-RCM coupled model Author: Yang Lu, Yue Deng, Jiapeng Guo, Donghe Zhang, Chih-Ping Wang, Cheng Sheng Ion velocity in the Sub Aurora region observed by Satellites in storm time often shows a significant westward component. The high speed westward stream is distinguished with convection pattern. These kind of events are called Sub Aurora Polarization Stream (SAPS). In March 17th 2013 storm, DMSP F18 satellite observed several SAPS cases when crossing Sub Aurora region. In this study, Global Ionosphere Thermosphere Model (GITM) has been coupled to UCLA-RCM model to simulate the impact of SAPS during March 2013 event on the ionosphere/thermosphere. The particle precipitation and electric field from RCM has been used to drive GITM. The conductance calculated from GITM has feedback to RCM to make the coupling to be self-consistent. The comparison of GITM simulations with different SAPS specifications will be conducted. The neutral wind from simulation will be compared with GOCE satellite. The comparison between runs with SAPS and without SAPS will separate the effect of SAPS from others and illustrate the impact on the TIDS/TADS propagating to both poleward and equatorward directions.


    Directory of Open Access Journals (Sweden)

    Siska Andriani


    Full Text Available tandar proses merupakan salah satu standar nasional yang mengatur perencanaan, pelaksanaan, penilaian, dan pengawasan proses pembelajaran. Pelaksanaan standar proses yang terjadi di lapangan belum terlihat keterlaksanaannya. Tujuan penelitian ini yaitu memperoleh deskripsi keterlaksanaan standar proses pada proses pembelajaran matematika menggunakan analisis CSE-UCLA di SMP Negeri Satu Atap Lerep. Penelitian ini merupakan penelitian kualitatif dengan pendekatan evaluatif. Sumber data utama adalah guru matematika. Teknik pengumpulan data menggunakan wawancara, observasi, dan dokumentasi. Keabsahan data yang digunakan dalam penelitian ini menggunakan uji credibility (triangulasi dan kecukupan bahan referensi, uji transferability, dan uji dependability.  Hasil penelitian menunjukkan bahwa proses pembelajaran matematika di SMP Negeri Satu Atap Lerep sudah mengikuti standar proses. Implementasi standar proses dengan analisis CSE-UCLA menunjukkan bahwa standar proses dilaksanakan melalui tahap  perencanaan, pengembangan, implementasi, hasil dan dampak. Dampak yang muncul pembelajaran yang terjadi tidak maksimal. Selain itu, banyak faktor yang mempengaruhi implementasi standar proses pada pembelajaran matematika di SMP Negeri Satu Atap Lerep. Faktor-faktor tersebut berupa faktor pendukung dan faktor penghambat.

  11. Journal of Civil Engineering Research and Practice: Submissions

    African Journals Online (AJOL)

    Author Guidelines. AIMS AND SCOPE The Journal of Civil Engineering Research and Practice aims to publish original research papers of high standard, containing material of broad interest and of significant contribution to civil engineering, with emphasis being placed on material that is applicable to the solution of ...

  12. Nuclear science and engineering education at a university research reactor

    International Nuclear Information System (INIS)

    Loveland, W.


    The role of an on-site irradiation facility in nuclear science and engineering education is examined. Using the example of a university research reactor, the use of such devices in laboratory instruction, public outreach programs, special instructional programs, research, etc. is discussed. Examples from the Oregon State University curriculum in nuclear chemistry, nuclear engineering and radiation health are given. (author) 1 tab

  13. Interdisciplinary Research for Engineering Skills Development Interdisciplinary Research for Engineering Skills Development

    Directory of Open Access Journals (Sweden)

    Angel E. González-Lizardo


    Full Text Available Este trabajo reporta los resultados de una experiencia interdisciplinaria de investigaciónpara estudiantes de ingeniería, en el Laboratorio de Ingeniería de Plasma (PEL por sussiglas en inglés de la Universidad Politécnica de Puerto Rico (UPPR. Los rasgos fuertes de esta experiencia y su relación con los resultados esperados por la Junta de Acreditación para Ingeniería y Tecnología (ABET por sus siglas en inglés son destacados, y una descripción cualitativa de los resultados en términos de la ejecución de los estudiantes durante la experiencia y después de ella. Se presenta un ejemplo de las diferentes actividades realizadas por un equipo de estudiantes subgraduados y su relación con los resultados esperados por ABET. La experiencia de investigación en el PEL provee a los estudiantes con una oportunidad única para practicar la ingeniería antes de su graduación, a través de problemas reales, innovación, colaboración con otras instituciones, y presentación de su trabajo a audiencias de científicos e ingenieros. This work reports the results of an ad hoc interdisciplinary research experience for undergraduate engineering students at the Plasma Engineering Laboratory (PEL of the Polytechnic University of Puerto Rico (PUPR. The strong features of this experience and their relationship with Accreditation Board for Engineering and Technology (ABET outcomes are pointed out, and a qualitative description of the results is discussed, in terms of the performance of the students during the experience and after it. An example of the different activities performed by a team of undergraduate students, and their relationship with the ABET outcomes is presented. The undergraduate research at the PEL provides the students with a unique opportunity to practice engineering before graduation through real life problems, innovation, collaboration with other institutions, and presentation of their work for engineering and scientific audiences.

  14. Trends of researches for fusion engineering research facility (FERF)

    International Nuclear Information System (INIS)

    Ozawa, Yasutomo; Enoto, Takeaki


    The role of a fusion neutron radiation test facility in the development of a scientific feasibility experimental reactor or demonstration fusion power reactor plant would be analogous to the role of the materials testing and experimental reactors in the development of fission power reactor. While the material testing fission reactor has been developed after successful operation of fission reactors, in the case of fusion reactor development it is desirable to realize the fusion engineering research facility (FERF) in-phase to the development of SFX and/or demonstration fusion power reactor plants. Here so called FERF in near future is the Controlled Thermonuclear Reactor which provides the high-intensity and high-energy neutron and plasma source whether the net power output is produced or not. From the point of direct attainment to SFX, we would like to emphasize that FEFE is the royal road leading to the goal of successful achievement of CTR program and could be useful for the experiment on impurity effects caused by neutron and plasma irradiations onto the wall material for SFX. Further, we rather suppose that hybrid FERF-fission assembly could be fairly and easily realizable in near future. (auth.)

  15. Development and Testing of UCLA's Electron Losses and Fields Investigation (ELFIN) Instrument Payload (United States)

    Wilkins, C.; Bingley, L.; Angelopoulos, V.; Caron, R.; Cruce, P. R.; Chung, M.; Rowe, K.; Runov, A.; Liu, J.; Tsai, E.


    UCLA's Electron Losses and Fields Investigation (ELFIN) is a 3U+ CubeSat mission designed to study relativistic particle precipitation in Earth's polar regions from Low Earth Orbit. Upon its 2018 launch, ELFIN will aim to address an important open question in Space Physics: Are Electromagnetic Ion-Cyclotron (EMIC) waves the dominant source of pitch-angle scattering of high-energy radiation belt charged particles into Earth's atmosphere during storms and substorms? Previous studies have indicated these scattering events occur frequently during storms and substorms, and ELFIN will be the first mission to study this process in-situ.Paramount to ELFIN's success is its instrument suite consisting of an Energetic Particle Detector (EPD) and a Fluxgate Magnetometer (FGM). The EPD is comprised of two collimated solid-state detector stacks which will measure the incident flux of energetic electrons from 50 keV to 4 MeV and ions from 50 keV to 300 keV. The FGM is a 3-axis magnetic field sensor which will capture the local magnetic field and its variations at frequencies up to 5 Hz. The ELFIN spacecraft spins perpendicular to the geomagnetic field to provide 16 pitch-angle particle data sectors per revolution. Together these factors provide the capability to address the nature of radiation belt particle precipitation by pitch-angle scattering during storms and substorms.ELFIN's instrument development has progressed into the late Engineering Model (EM) phase and will soon enter Flight Model (FM) development. The instrument suite is currently being tested and calibrated at UCLA using a variety of methods including the use of radioactive sources and applied magnetics to simulate orbit conditions during spin sectoring. We present the methods and test results from instrument calibration and performance validation.

  16. Researches on direct injection in internal-combustion engines (United States)

    Tuscher, Jean E


    These researches present a solution for reducing the fatigue of the Diesel engine by permitting the preservation of its components and, at the same time, raising its specific horsepower to a par with that of carburetor engines, while maintaining for the Diesel engine its perogative of burning heavy fuel under optimum economical conditions. The feeding of Diesel engines by injection pumps actuated by engine compression achieves the required high speeds of injection readily and permits rigorous control of the combustible charge introduced into each cylinder and of the peak pressure in the resultant cycle.

  17. Research regarding reverse engineering for aircraft components

    Directory of Open Access Journals (Sweden)

    Udroiu Razvan


    Full Text Available Reverse engineering is a useful technique used in manufacturing and design process of new components. In aerospace industry new components can be developed, based on existing components without technical Computer Aided Design (CAD data, in order to reduce the development cycle of new products. This paper proposes a methodology wherein the CAD model of turbine blade can be build using computer aided reverse engineering technique utilising a 5 axis Coordinate Measuring Machine (CMM. The proposed methodology uses a scanning strategy by features, followed by a design methodology for 3D modelling of complex shapes.

  18. Is Engineering Design Disappearing from Design Research?

    DEFF Research Database (Denmark)

    Andreasen, Mogens Myrup; Howard, Thomas J.


    Most systems and products need to be engineered during their design, based upon scientific insight into principles, mechanisms, materials and production pos-sibilities, leading to reliability, durability and value for the user. Despite the central importance and design’s crucial dependency...

  19. Recent Approaches in Tooth Engineering Research

    Czech Academy of Sciences Publication Activity Database

    Švandová, Eva; Veselá, Barbora; Křivánek, J.; Hampl, A.; Matalová, Eva


    Roč. 60, Suppl 1 (2014), s. 21-29 ISSN 0015-5500 R&D Projects: GA ČR GAP304/11/1418; GA MZd(CZ) NT11420 Institutional support: RVO:67985904 Keywords : engineering * tooth * stem cells * culture techniques Subject RIV: EA - Cell Biology Impact factor: 1.000, year: 2014

  20. Status of Research in Biomedical Engineering 1968. (United States)

    National Inst. of General Medical Sciences (NIH), Bethesda, MD.

    This status report is divided into eight sections. The first four represent the classical engineering or building aspects of bioengineering and deal with biomedical instrumentation, prosthetics, man-machine systems and computer and information systems. The next three sections are related to the scientific, intellectual and academic influence of…

  1. Off reactor testings. Technological engineering applicative research

    International Nuclear Information System (INIS)

    Doca, Cezar


    By the end of year 2000 over 400 nuclear electro-power units were operating world wide, summing up a 350,000 MW total capacity, with a total production of 2,300 TWh, representing 16% of the world's electricity production. Other 36 units, totalizing 28,000 MW, were in construction, while a manifest orientation towards nuclear power development was observed in principal Asian countries like China, India, Japan and Korea. In the same world's trend one find also Romania, the Cernavoda NPP Unit 1 generating electrical energy into the national system beginning with 2 December 1996. Recently, the commercial contract was completed for finishing the Cernavoda NPP Unit 2 and launching it into operation by the end of year 2004. An important role in developing the activity of research and technological engineering, as technical support for manufacturing the CANDU type nuclear fuel and supplying with equipment the Cernavoda units, was played by the Division 7 TAR of the INR Pitesti. Qualification testings were conducted for: - off-reactor CANDU type nuclear fuel; - FARE tools, pressure regulators, explosion proof panels; channel shutting, as well as functional testing for spare pushing facility as a first step in the frame of the qualification tests for the charging/discharging machine (MID) 4 and 5 endings. Testing facilities are described, as well as high pressure hot/cool loops, measuring chains, all of them fulfilling the requirements of quality assurance. The nuclear fuel off-reactor tests were carried out to determine: strength; endurance; impact, pressure fall and wear resistance. For Cernavoda NPP equipment testings were carried out for: the explosion proof panels, pressure regulators, behaviour to vibration and wear of the steam generation tubings, effects of vibration upon different electronic component, channel shutting (for Cernavoda Unit 2), MID operating at 300 and 500 cycles. A number of R and D programs were conducted in the frame of division 7 TAR of INR

  2. Recent reflectometry results from the UCLA plasma diagnostics group

    International Nuclear Information System (INIS)

    Gilmore, M.; Doyle, E.J.; Kubota, S.; Nguyen, X.V.; Peebles, W.A.; Rhodes, T.L.; Zeng, L.


    The UCLA Plasma Diagnostics Group has an active ongoing reflectometry program. The program is threefold, including 1) profile and 2) fluctuation measurements on fusion devices (DIII-D, NSTX, and others), and 3) basic reflectometry studies in linear and laboratory plasmas that seek to develop new measurement capabilities and increase the physics understanding of reflectometry. Recent results on the DIII-D tokamak include progress toward the implementation of FM reflectometry as a standard density profile diagnostic, and correlation length measurements in QDB discharges that indicate a very different scaling than normally observed in L-mode plasmas. The first reflectometry measurements in a spherical torus (ST) have also been obtained on NSTX. Profiles in NSTX show good agreement with those of Thomson scattering. Finally, in a linear device, a local magnetic field strength measurement based on O-X correlation reflectometry has been demonstrated to proof of principle level, and correlation lengths measured by reflectometry are in good agreement with probes. (author)

  3. Thrust Area Report, Engineering Research, Development and Technology

    Energy Technology Data Exchange (ETDEWEB)

    Langland, R. T.


    The mission of the Engineering Research, Development, and Technology Program at Lawrence Livermore National Laboratory (LLNL) is to develop the knowledge base, process technologies, specialized equipment, tools and facilities to support current and future LLNL programs. Engineering`s efforts are guided by a strategy that results in dual benefit: first, in support of Department of Energy missions, such as national security through nuclear deterrence; and second, in enhancing the nation`s economic competitiveness through our collaboration with U.S. industry in pursuit of the most cost- effective engineering solutions to LLNL programs. To accomplish this mission, the Engineering Research, Development, and Technology Program has two important goals: (1) identify key technologies relevant to LLNL programs where we can establish unique competencies, and (2) conduct high-quality research and development to enhance our capabilities and establish ourselves as the world leaders in these technologies. To focus Engineering`s efforts technology {ital thrust areas} are identified and technical leaders are selected for each area. The thrust areas are comprised of integrated engineering activities, staffed by personnel from the nine electronics and mechanical engineering divisions, and from other LLNL organizations. This annual report, organized by thrust area, describes Engineering`s activities for fiscal year 1996. The report provides timely summaries of objectives, methods, and key results from eight thrust areas: Computational Electronics and Electromagnetics; Computational Mechanics; Microtechnology; Manufacturing Technology; Materials Science and Engineering; Power Conversion Technologies; Nondestructive Evaluation; and Information Engineering. Readers desiring more information are encouraged to contact the individual thrust area leaders or authors. 198 refs., 206 figs., 16 tabs.


    Directory of Open Access Journals (Sweden)

    Adam Majczak


    Full Text Available The article presents the tests results of the prototype design of hydraulically assisted injector, that is designed for gas supply into diesel engines. The construction of the injector allows for it positioning in the glow plug socket, so that the gas is injected directly into the combustion chamber. The cycle analysis of the four-cylinder Andoria ADCR engine with a capacity of 2.6 dm3 for different crankshaft rotational speeds allowed to determine the necessary time for fuel injection. Because of that, it was possible to determine the required mass flow rate of the injector, for replacing as much of the original fuel by gaseous fuel. To ensure a high value of flow inside the injector, supply pressure equal to 1 MPa was applied. High gas supply pressure requires high value of valve opening forces. For this purpose a injector with hydraulic control system, using a liquid under pressure for the opening process was designed. On the basis of air pressure measurements in the flow line after the injector, the analysis of opening and closing of the valve was made. Measurements of outflow mass of the injector were also carried out. The results showed that the designed injector meets the requirements necessary to supply ADCR engine by the CNG fuel.

  5. Research Skills Enhancement in Future Mechanical Engineers

    Directory of Open Access Journals (Sweden)

    Jorge Lino Alves


    Full Text Available Nowadays, the Web is a common tool for students searching information about the subjects taught in the different university courses. Although this is a good tool for the first rapid knowledge, a deeper study is usually demanded.

    After many years of teaching a course about ceramic and composite materials in the Integrated Master in Mechanical Engineering of Faculty of Engineering of University of Porto, Portugal, the authors used the Bologna reformulation of the mechanical engineering course to introduce new teaching methodologies based on a project based learning methodology.

    One of the main innovations is a practical work that comprises the study of a recent ceramic scientific paper, using all the actual available tools, elaboration of a scientific report, work presentation and participation in a debate.

    With this innovative teaching method the enrolment of the students was enhanced with a better knowledge about the ceramics subject and the skills related with the CDIO competences.

    This paper presents the reasons for this implementation and explains the teaching methodology adopted as well as the changes obtained in the students’ final results.

  6. Biomedical engineering: A platform for research and innovation in ultrasound (United States)

    Holland, Christy K.


    An undergraduate or graduate degree in biomedical engineering prepares students to solve problems at the interface between engineering and medicine. Biomedical engineering encompasses evolving areas such as advanced medical imaging for diagnosis and treatment of disease, tissue engineering for designing and manufacturing biological implants for damaged or diseased tissues and organs, and bioinformatics for determining which genes play a major role in health and disease. Biomedical engineering academic programs produce graduates with the ability to pursue successful careers in the biomedical device industry or to obtain advanced degrees leading to careers in biomedical engineering research, medicine, law or business. Biomedical engineering majors take courses in biology, anatomy, physics, chemistry, engineering, mathematics and medical product design and value life-long learning. Students learn to work effectively in interdisciplinary teams comprised of individuals with diverse social, cultural and technical backgrounds. Biomedical engineering is becoming increasingly important in imaging and image-guided research. Some examples of innovative ultrasound technology under development are ultrasound devices to accelerate the dissolution of blood clots, advanced surgical instruments with ultrasound guidance and ultrasound contrast agents for targeted drug delivery. Biomedical engineering is a great career choice for technically minded individuals who endeavor to work on applied problems that are medically relevant.

  7. Undergraduate research internships to support exploratory research in transportation engineering : project final report, Sept. 2008. (United States)


    The Case Western Reserve University Department of Civil Engineering is in the process of expanding its teaching and research activities, Transportation Engineering as part of its initiative in the overall area of Infrastructure Performance and Reliab...

  8. 2007 Plant Metabolic Engineering Gordon Conference and Graduate Research Seminar

    Energy Technology Data Exchange (ETDEWEB)

    Erich Grotewold


    Plant Metabolic Engineering is an emerging field that integrates a diverse range of disciplines including plant genetics, genomics, biochemistry, chemistry and cell biology. The Gordon-Kenan Graduate Research Seminar (GRS) in Plant Metabolic Engineering was initiated to provide a unique opportunity for future researcher leaders to present their work in this field. It also creates an environment allowing for peer-review and critical assessment of work without the intimidation usually associated with the presence of senior investigators. The GRS immediately precedes the Plant Metabolic Engineering Gordon Research Conference and will be for and by graduate students and post-docs, with the assistance of the organizers listed.

  9. Natural Sciences and Engineering Research Council | IDRC ...

    International Development Research Centre (IDRC) Digital Library (Canada)

    ca/index_eng.asp. International Research Initiative on Adaptation to Climate Change. The International Research Initiative on Adaptation to Climate Change aims to help vulnerable populations in Canada and in developing countries adapt to ...

  10. FOSER - Future of Software Engineering Research (United States)

    Networking and Information Technology Research and Development, Executive Office of the President — The 2010 Report of the Presidents Council of Advisors on Science and Technology PCAST, entitled ?Designing a Digital Future: Federally Funded Research and...

  11. Artificial Sight Basic Research, Biomedical Engineering, and Clinical Advances

    CERN Document Server

    Humayun, Mark S; Chader, Gerald; Greenbaum, Elias


    Artificial sight is a frontier area of modern ophthalmology combining the multidisciplinary skills of surgical ophthalmology, biomedical engineering, biological physics, and psychophysical testing. Many scientific, engineering, and surgical challenges must be surmounted before widespread practical applications can be realized. The goal of Artificial Sight is to summarize the state-of-the-art research in this exciting area, and to describe some of the current approaches and initiatives that may help patients in a clinical setting. The Editors are active researchers in the fields of artificial sight, biomedical engineering and biological physics. They have received numerous professional awards and recognition for their work. The artificial sight team at the Doheny Eye Institute, led by Dr. Mark Humayun, is a world leader in this area of biomedical engineering and clinical research. Key Features Introduces and assesses the state of the art for a broad audience of biomedical engineers, biophysicists, and clinical...

  12. FY10 Engineering Innovations, Research and Technology Report

    Energy Technology Data Exchange (ETDEWEB)

    Lane, M A; Aceves, S M; Paulson, C N; Candy, J V; Bennett, C V; Carlisle, K; Chen, D C; White, D A; Bernier, J V; Puso, M A; Weisgraber, T H; Corey, B; Lin, J I; Wheeler, E K; Conway, A M; Kuntz, J D; Spadaccini, C M; Dehlinger, D A; Kotovsky, J; Nikolic, R; Mariella, R P; Foudray, A K; Tang, V; Guidry, B L; Ng, B M; Lemmond, T D; Chen, B Y; Meyers, C A; Houck, T L


    This report summarizes key research, development, and technology advancements in Lawrence Livermore National Laboratory's Engineering Directorate for FY2010. These efforts exemplify Engineering's nearly 60-year history of developing and applying the technology innovations needed for the Laboratory's national security missions, and embody Engineering's mission to ''Enable program success today and ensure the Laboratory's vitality tomorrow.'' Leading off the report is a section featuring compelling engineering innovations. These innovations range from advanced hydrogen storage that enables clean vehicles, to new nuclear material detection technologies, to a landmine detection system using ultra-wideband ground-penetrating radar. Many have been recognized with R&D Magazine's prestigious R&D 100 Award; all are examples of the forward-looking application of innovative engineering to pressing national problems and challenging customer requirements. Engineering's capability development strategy includes both fundamental research and technology development. Engineering research creates the competencies of the future where discovery-class groundwork is required. Our technology development (or reduction to practice) efforts enable many of the research breakthroughs across the Laboratory to translate from the world of basic research to the national security missions of the Laboratory. This portfolio approach produces new and advanced technological capabilities, and is a unique component of the value proposition of the Lawrence Livermore Laboratory. The balance of the report highlights this work in research and technology, organized into thematic technical areas: Computational Engineering; Micro/Nano-Devices and Structures; Measurement Technologies; Engineering Systems for Knowledge Discovery; and Energy Manipulation. Our investments in these areas serve not only known programmatic requirements of today and tomorrow, but

  13. Development of a Taxonomy of Keywords for Engineering Education Research (United States)

    Finelli, Cynthia J.; Borrego, Maura; Rasoulifar, Golnoosh


    The diversity of engineering education research provides an opportunity for cross-fertilisation of ideas and creativity, but it also can result in fragmentation of the field and duplication of effort. One solution is to establish a standardised taxonomy of engineering education terms to map the field and communicate and connect research…

  14. Case Study Research in Software Engineering Guidelines and Examples

    CERN Document Server

    Runeson, Per; Rainer, Austen; Regnell, Bjorn


    Based on their own experiences of in-depth case studies of software projects in international corporations, in this book the authors present detailed practical guidelines on the preparation, conduct, design and reporting of case studies of software engineering.  This is the first software engineering specific book on the case study research method.

  15. Center for Alternative Fuels Research Program | College of Engineering & (United States)

    Electrical Engineering Instructional Laboratories Student Resources Industrial & Manufacturing Engineering Industrial & Manufacturing Engineering Academic Programs Industrial & Manufacturing Engineering Major Industrial & Manufacturing Engineering Minor Industrial & Manufacturing Engineering

  16. An Engineering Degree Does Not (Necessarily) an Engineer Make: Career Decision Making among Undergraduate Engineering Majors. Research Brief (United States)

    Lichtenstein, Gary; Loshbaugh, Heidi G.; Claar, Brittany; Chen, Helen L.; Jackson, Kristyn; Sheppard, Sheri


    This paper explores the career-related decision making of seniors enrolled in undergraduate engineering programs at two nationally recognized institutions. This strand of the Academic Pathways Study (APS) research revealed that many engineering students were undecided about their career plans, even late into their senior years and that many were…

  17. Thermometric consideration for RF and microwave research in food engineering. (United States)

    Ofoli, R Y


    A review of thermometric methods for the processing of food materials at RF and microwave frequencies is presented. Some areas of needed food engineering research are discussed, as well as factors of importance in the selection of temperature monitoring systems.

  18. 76 FR 37085 - Applications for New Awards; Rehabilitation Engineering Research Centers (RERCs) (United States)


    ... DEPARTMENT OF EDUCATION Applications for New Awards; Rehabilitation Engineering Research Centers...)--Disability and Rehabilitation Research Projects and Centers Program--Rehabilitation Engineering Research... (Rehabilitation Act). Rehabilitation Engineering Research Centers Program (RERCs) The purpose of the RERC program...

  19. Energy engineering: Student-researcher collaboration

    DEFF Research Database (Denmark)

    Leban, Krisztina Monika; Ritchie, Ewen; Beckowska, Patrycja Maria


    This article reports on cooperation methods between researchers and students at different levels. Levels included in this work are BSc, MSc and PhD student levels. At Aalborg University, Department of Energy Technology education and research are closely linked. The relationship between student...

  20. Summaries of FY 1995 engineering research

    Energy Technology Data Exchange (ETDEWEB)



    The individual engineering project summaries follow the program overview. The summaries are ordered alphabetically by name of institution and so the table of contents lists all the institutions at which projects were sponsored in fiscal year 1995. Each project entry begins with an institutional-departmental heading. The names of investigators are listed immediately below the title. The funding level for fiscal year 1995 appears to the right of title; it is followed by the budget activity number. These numbers categorize the projects for budgetary purposes and the categories are described in the budget number index. A separate index of Principal Investigators includes phone number, fax number and e-mail address, where available. The fiscal year in which either the project began or was renewed and the anticipated duration in years are indicated respectively by the first two and last digits of the sequence directly below the budget activity number. The summary description of the project completes the entry.

  1. Tissue Engineering Organs for Space Biology Research (United States)

    Vandenburgh, H. H.; Shansky, J.; DelTatto, M.; Lee, P.; Meir, J.


    Long-term manned space flight requires a better understanding of skeletal muscle atrophy resulting from microgravity. Atrophy most likely results from changes at both the systemic level (e.g. decreased circulating growth hormone, increased circulating glucocorticoids) and locally (e.g. decreased myofiber resting tension). Differentiated skeletal myofibers in tissue culture have provided a model system over the last decade for gaining a better understanding of the interactions of exogenous growth factors, endogenous growth factors, and muscle fiber tension in regulating protein turnover rates and muscle cell growth. Tissue engineering these cells into three dimensional bioartificial muscle (BAM) constructs has allowed us to extend their use to Space flight studies for the potential future development of countermeasures.

  2. Research directions in computer engineering. Report of a workshop

    Energy Technology Data Exchange (ETDEWEB)

    Freeman, H


    The results of a workshop held in November 1981 in Washington, DC, to outline research directions for computer engineering are reported upon. The purpose of the workshop was to provide guidance to government research funding agencies, as well as to universities and industry, as to the directions which computer engineering research should take for the next five to ten years. A select group of computer engineers was assembled, drawn from all over the United States and with expertise in virtually every aspect of today's computer technology. Industrial organisations and universities were represented in roughly equal numbers. The panel proceeded to provide a sharper definition of computer engineering than had been in popular use previously, to identify the social and national needs which provide the basis for encouraging research, to probe for obstacles to research and seek means of overcoming them and to delineate high-priority areas in which computer engineering research should be fostered. These included experimental software engineering, architectures in support of programming style, computer graphics, pattern recognition. VLSI design tools, machine intelligence, programmable automation, architectures for speech and signal processing, computer architecture and robotics. 13 references.

  3. Final Report UCLA-Thermochemical Storage with Anhydrous Ammonia

    Energy Technology Data Exchange (ETDEWEB)

    Lavine, Adrienne [Univ. of California, Los Angeles, CA (United States)


    In ammonia-based thermochemical energy storage (TCES), ammonia is dissociated endothermically as it absorbs solar energy during the daytime. When energy is required, the reverse reaction releases energy to heat a working fluid such as steam, to produce electricity. Ammonia-based TCES has great advantages of simplicity, low cost reactants, and a strong industrial base in the conventional ammonia industry. The concept has been demonstrated over three decades of research at Australian National University, achieving a 24-hour demonstration of a complete system. At the start of this project, three challenges were identified that would have to be addressed to show that the system is technically and economically viable for incorporation into a CSP plant with an advanced, high temperature power block. All three of these challenges have now been addressed: 1. The ammonia synthesis reaction had not, to our knowledge, been carried out at temperatures consistent with modern power blocks (i.e., ~650°C). The technical feasibility of operating a reactor under high-temperature, near-equilibrium conditions was an unknown, and was therefore a technical risk. The project has successfully demonstrated steam heating to 650°C and energy recovery to steam at the 5 kWt level. 2. The ammonia system has a relatively low enthalpy of reaction combined with gas phase reactants. This is not a direct disadvantage since the reactants themselves are low cost. The challenge lies in storing the required volume of reactants cost effectively. Therefore, a second key goal was to show, through techno-economic analysis, that underground storage technologies can be used to store the energy-rich gas at a cost that is consistent with the SunShot cost goal. We have identified two promising technologies for gas storage: storage in salt caverns has an estimated cost of 1(USD)/kWht and storage in drilled shafts could be on the order of 7(USD)/kWht. Together these two options answer the technical challenge

  4. Research and Exploration for Operational Research Education in Industry and Engineering Subject (United States)

    Wu, Yu-hua; Wang, Feng-ming; Du, Gang


    On the basic of exploring the relationship of industry engineering and operational research technique, the thesis analyzes the location and utility of the operational research education in the whole industry engineering subject education. It brings forward the system design about operational research and relative class among industry engineering…

  5. Review of research on simulation engineering in FY2007

    International Nuclear Information System (INIS)


    Research on simulation engineering for nuclear applications, based on the plan for meeting the mid-term goal of the Japan Atomic Energy Agency', has been performed at Center for Computational Science and e-Systems, Japan Atomic Energy Agency (CCSE/JAEA). CCSE established the committee consisting outside experts and authorities which does research evaluation and advices for the assistance of the research and development. This report summarizes the result of the evaluation by the committee on the research on simulation engineering performed at CCSE/JAEA in FY2007. (author)

  6. Review of research on simulation engineering in FY2008

    International Nuclear Information System (INIS)


    Research on simulation engineering for nuclear applications, based on 'the plan for meeting the mid-term goal of the Japan Atomic Energy Agency', has been performed at Center for Computational Science and e-Systems, Japan Atomic Energy Agency (CCSE/JAEA). CCSE established the committee consisting outside experts and authorities which does research evaluation and advices for the assistance of the research and development. This report summarizes the result of the evaluation by the committee on the research on simulation engineering performed at CCSE/JAEA in FY2008. (author)

  7. Review of research on simulation engineering in FY2009

    International Nuclear Information System (INIS)


    Research on simulation engineering for nuclear applications, based on 'the plan for meeting the mid-term goal of the Japan Atomic Energy Agency', has been performed at Center for Computational Science and e-Systems, Japan Atomic Energy Agency (CCSE/JAEA). CCSE established the committee consisting outside experts and authorities which does research evaluation and advices for the assistance of the research and development. This report summarizes results of the evaluation by the committee on the followings. (1) Research and development on simulation engineering performed at CCSE/JAEA in FY2009. (2) Research and development on simulation engineering performed at CCSE/JAEA in the period of the midterm plan (October 1st, 2005 - March 31st, 2010). (author)

  8. Chemical Engineering Division research highlights, 1977

    Energy Technology Data Exchange (ETDEWEB)



    Separate abstracts are included for sections with information on lithium/metal sulfide batteries; electrochemical energy development; advanced fuel cell development; utilization of coal; magnetohydrodynamics technology; LMFBR and GCFR support work; fuel cycle studies; fusion reactor research; solar energy development; and basic energy science.

  9. Chemical Engineering Division research highlights, 1979

    Energy Technology Data Exchange (ETDEWEB)

    Burris, L.; Webster, D. S.; Barney, D. L.; Cafasso, F. A.; Steindler, M. J.


    In 1979, CEN conducted research and development in the following areas: (1) high-temperature, rechargeable lithium/iron sulfide batteries for electric vehicles and electric utility load leveling; (2) ambient-temperature batteries - improved lead-acid, nickel/zinc, and nickel/iron - for electric vehicles; (3) molten carbonate fuel cells for use by electric utilities; (4) coal technology - mainly fluidized-bed combustion of coal in the presence of SO/sub 2/ sorbent of limestone; (5) heat- and seed- recovery technology for open-cycle magnetohydrodynamic systems; (6) solar energy collectors and thermal energy storage; (7) fast breeder reactor chemistry research - chemical support of reactor safety studies, chemistry of irradiated fuels, and sodium technology; (8) fuel cycle technology - reprocessing of nuclear fuels, management of nuclear wastes, geologic migration studies, and proof-of-breeding studies for the Light Water Breeder Reactor; (9) magnetic fusion research - lithium processing technology and materials research; and (10) basic energy sciences - homogeneous catalysis, thermodynamics of inorganic and organic materials, environmental chemistry, electrochemistry, and physical properties of salt vapors. Separate abstracts were prepared for each of these areas.

  10. Global Journal of Engineering Research: Advanced Search

    African Journals Online (AJOL)

    Search tips: Search terms are case-insensitive; Common words are ignored; By default only articles containing all terms in the query are returned (i.e., AND is implied); Combine multiple words with OR to find articles containing either term; e.g., education OR research; Use parentheses to create more complex queries; e.g., ...

  11. Impacting Society through Engineering Design Research

    DEFF Research Database (Denmark)

    Howard, Thomas J.


    Following the recent ICED11 conference in Copenhagen, Thomas Howard, ICED11 Assistant Chair and Ass. Professor at DTU has written a reflection on design research and design practice, suggesting that in addition to benefiting society through the improved understanding of methods of and approaches...... to design, the academic design community should through design practice produce empowering products which address societal needs unbound by the necessity for profit....

  12. Engineering education research: Impacts of an international network of female engineers on the persistence of Liberian undergraduate women studying engineering (United States)

    Rimer, Sara; Reddivari, Sahithya; Cotel, Aline


    As international efforts to educate and empower women continue to rise, engineering educators are in a unique position to be a part of these efforts by encouraging and supporting women across the world at the university level through STEM education and outreach. For the past two years, the University of Michigan has been a part of a grassroots effort to encourage and support the persistence of engineering female students at University of Liberia. This effort has led to the implementation of a leadership camp this past August for Liberian engineering undergraduate women, meant to: (i) to empower engineering students with the skills, support, and inspiration necessary to become successful and well-rounded engineering professionals in a global engineering market; and (ii) to strengthen the community of Liberian female engineers by building cross-cultural partnerships among students resulting in a international network of women engineers. This session will present qualitative research findings on the impact of this grassroots effort on Liberian female students? persistence in engineering, and the future directions of this work.

  13. Research and development of turbofan engine for supersonic aircraft. Choonsokukiyo turbofan engine no kenkyu kaihatsu

    Energy Technology Data Exchange (ETDEWEB)

    Yashima, S [Ishikawajima-Harima Heavy Industries Co. Ltd., Tokyo (Japan)


    This paper described the researched results of the demonstrator of a turbofan engine for supersonic aircraft (IHI-17). A turbofan engine with an afterburner was experimentally fabricated and various engine tests have been carried out since 1988. Although the engine size is small, the fighter engine specifications were applied to its design and the prior or simultaneous research on each component was carried out. As a result, the system integration technique by which an engine was assembled by integrating each component could be established. New materials and new manufacturing techniques such as turbine blades of single crystal, turbine disks of powder metallurgy and deep chemical milling for a duct were developed to use for the long term engine test and the prospect to commercialization could be obtained. The following techniques have been established and the results satisfying target specifications could be achieved: the three dimensional aerodynamic design of compressor and turbine, the adoption of air blast fuel atomizer to suppress the smoke generation, an afterburner of spray bar system and the mounting type FADEC (full authority digital electronic control) to control the engine with the afterburner. 4 refs., 15 figs., 4 tabs.

  14. Not so Global: A Bibliometric Look at Engineering Education Research (United States)

    Williams, Bill; Wankat, Phillip C.; Neto, Pedro


    It has been suggested that Engineering Education Research (EER) is going global. If this were the case we would assume that the research of EER scholars in different parts of the globe would be informed by literature describing prior work within and beyond their home country/region. The authors set out to test this hypothesis by applying citation…

  15. Developing Research Skills for Civil Engineers: A Library Contribution. (United States)

    Bruce, C. S.; Brameld, G. H.


    A library instruction program has been instituted in civil engineering at the Queensland University of Technology (Australia) in an effort to improve the research skills of fourth year students working on research projects. Students with extended library instruction were found to have better information-seeking behavior than others. (Author/MSE)


    DEFF Research Database (Denmark)

    Darlington, Mansur; Howard, Thomas J.; Ball, Alex


    of research data and of the barriers to and opportunities for their re-use. The work reported here characterizes engineering design and manufacture research data and explores the context of their development and current management. Insights from the work have resulted in the authors proposing a number of new...

  17. Office of Research Support | College of Engineering & Applied Science (United States)

    Professor and Associate Dean for Research College of Engineering and Applied Sciences Director, Center for Academics Admission Student Life Research Schools & Colleges Libraries Athletics Centers & ; Applied Science Powerful Ideas. Proven Results. Search for: Go This site All UWM Search Site Menu Skip to

  18. Engineering research, development and technology: Thrust area report FY 91

    International Nuclear Information System (INIS)


    The mission of the Engineering Research, Development, and Technology Program at Lawrence, Livermore National Laboratory (LLNL) is to develop the technical staff and the technology needed to support current and future LLNL programs. To accomplish this mission, the Engineering Research, Development, and Technology Program has two important goals: (1) to identify key technologies and (2) conduct high quality work to enhance our capabilities in these key technologies. To help focus our efforts, we identify technology thrust areas and select technical leaders for each area. The thrust areas are integrated engineering activities and, rather than being based on individual disciplines, they are staffed by personnel from Electronics Engineering, Mechanical Engineering, and other LLNL organizations, as appropriate. The thrust area leaders are expected to establish strong links to LLNL program leaders and to industry; to use outside and inside experts to review the quality and direction of the work; to use university contacts to supplement and complement their efforts; and to be certain that we are not duplicating the work of others. The thrust area leader is also responsible for carrying out the work that follows from the Engineering Research, Development, and Technology Program so that the results can be applied as early as possible to the needs of LLNL programs. This annual report, organized by thrust area, describes activities conducted within the Program for the fiscal year, 1991. Its intent is to provide timely summaries of objectives, theories, methods, and results

  19. Reliability and validity of the Danish version of the UCLA Loneliness Scale

    DEFF Research Database (Denmark)

    Lasgaard, Mathias


    The objective of this study was to examine the psychometric properties of a Danish version of the UCLA Loneliness Scale (UCLA). The 20-item scale was completed along with other measures in a national youth probability sample of 379 8th grade students aged 13-17. The scale showed high internal con....... The results, highly comparable to the original version of the scale, indicate that the Danish version of UCLA is a reliable and valid measure of loneliness....... consistency, and correlations between UCLA and measures of emotional loneliness, social loneliness, self-esteem, depression, extraversion, and neuroticism supported the convergent and discriminant validity of the scale. Exploratory factor analysis supported a unidimensional structure of the measure...

  20. Annual report of Nuclear Engineering Research Laboratory, Faculty of Engineering, University of Tokyo, fiscal year 1996

    International Nuclear Information System (INIS)


    This report summarizes research and educational activities, operation status of the research facilities of the Nuclear Engineering Research Laboratory, Faculty of Engineering, University of Tokyo on fiscal year 1996. This facility has four major research facilities such as fast neutron source reactor 'Yayoi', electron Linac, fundamental experiment facility for nuclear fusion reactor blanket design and high fluence irradiation facility(HIT). Education and research activities are conducted in a wide fields of nuclear engineering using these facilities. The former two facilities are available for various studies by universities all over Japan, facility for nuclear fusion reactor blanket design is utilized for research within the Faculty of Engineering and HIT is used for the research within the University of Tokyo. The facility established a plan to reorganized into a nation wide research collaboration center in fiscal year 1995 and after further discussion of a future program it is decided to hold 'Nuclear energy symposium' periodically after fiscal year 1997 as a part of the activity for appealing the research results to the public. (G.K.)

  1. General aviation internal combustion engine research programs at NASA-Lewis Research Center (United States)

    Willis, E. A.


    An update is presented of non-turbine general aviation engine programs underway at the NASA-Lewis Research Center in Cleveland, Ohio. The program encompasses conventional, lightweight diesel and rotary engines. Its three major thrusts are: (a) reduced SFC's; (b) improved fuels tolerance; and (c) reducing emissions. Current and planned future programs in such areas as lean operation, improved fuel management, advanced cooling techniques and advanced engine concepts, are described. These are expected to lay the technology base, by the mid to late 1980's, for engines whose life cycle fuel costs are 30 to 50% lower than today's conventional engines.

  2. Global network on engineering education research and expertise in PBL

    DEFF Research Database (Denmark)

    Enemark, Stig; Kolmos, Anette; Moesby, Egon


    in order to facilitate better access to and co-operation within the PBL area. One of the absolute important tasks for UCPBL is to provide evidence for the effectiveness of PBL worldwide. Thus, there is a special attempt to establish links between engineering education researchers in this field....... This involves considerations concerning what is engineering education research – and how do we promote research based staff and educational development.......The UCPBL Centre for Problem Based Learning is based at Aalborg University, Denmark, known world-wide for its successful educational approach based on problem oriented project work. Due to more than 30 years of experience in utilizing PBL-learning principles in Engineering Education, an increasing...

  3. Engineering Design Thinking and Information Gathering. Final Report. Research in Engineering and Technology Education (United States)

    Mentzer, Nathan


    The objective of this research was to explore the relationship between information access and design solution quality of high school students presented with an engineering design problem. This objective is encompassed in the research question driving this inquiry: How does information access impact the design process? This question has emerged in…

  4. Systems Engineering Research Needs and Workforce Development Assessment (United States)


    research cluster had no single research center as the most interested in it, but had a high uniformity in the distribution of research centers...all our engagements. • Lack of trust among major organizations, particularly between acquisition and contractors , inhibits capability. • Concern...from a policy culture to an incentive culture Mission Engineering Management, Culture and Agility IC DoD - 2 tension building the optimized

  5. Armstrong Flight Research Center Research Technology and Engineering 2017 (United States)

    Voracek, David F. (Editor)


    I am delighted to present this report of accomplishments at NASA's Armstrong Flight Research Center. Our dedicated innovators possess a wealth of performance, safety, and technical capabilities spanning a wide variety of research areas involving aircraft, electronic sensors, instrumentation, environmental and earth science, celestial observations, and much more. They not only perform tasks necessary to safely and successfully accomplish Armstrong's flight research and test missions but also support NASA missions across the entire Agency. Armstrong's project teams have successfully accomplished many of the nation's most complex flight research projects by crafting creative solutions that advance emerging technologies from concept development and experimental formulation to final testing. We are developing and refining technologies for ultra-efficient aircraft, electric propulsion vehicles, a low boom flight demonstrator, air launch systems, and experimental x-planes, to name a few. Additionally, with our unique location and airborne research laboratories, we are testing and validating new research concepts. Summaries of each project highlighting key results and benefits of the effort are provided in the following pages. Technology areas for the projects include electric propulsion, vehicle efficiency, supersonics, space and hypersonics, autonomous systems, flight and ground experimental test technologies, and much more. Additional technical information is available in the appendix, as well as contact information for the Principal Investigator of each project. I am proud of the work we do here at Armstrong and am pleased to share these details with you. We welcome opportunities for partnership and collaboration, so please contact us to learn more about these cutting-edge innovations and how they might align with your needs.

  6. Relativistic electron diffraction at the UCLA Pegasus photoinjector laboratory

    Energy Technology Data Exchange (ETDEWEB)

    Musumeci, P. [UCLA Department of Physics and Astronomy, 475 Portola Plaza, Los Angeles, CA 90095-1547 (United States)], E-mail:; Moody, J.T.; Scoby, C.M. [UCLA Department of Physics and Astronomy, 475 Portola Plaza, Los Angeles, CA 90095-1547 (United States)


    Electron diffraction holds the promise to yield real-time resolution of atomic motion in an easily accessible environment like a university laboratory at a fraction of the cost of fourth-generation X-ray sources. Currently the limit in time-resolution for conventional electron diffraction is set by how short an electron pulse can be made. A very promising solution to maintain the highest possible beam intensity without excessive pulse broadening from space charge effects is to increase the electron energy to the MeV level where relativistic effects significantly reduce the space charge forces. Rf photoinjectors can in principle deliver up to 10{sup 7}-10{sup 8} electrons packed in bunches of {approx}100-fs length, allowing an unprecedented time resolution and enabling the study of irreversible phenomena by single-shot diffraction patterns. The use of rf photoinjectors as sources for ultrafast electron diffraction has been recently at the center of various theoretical and experimental studies. The UCLA Pegasus laboratory, commissioned in early 2007 as an advanced photoinjector facility, is the only operating system in the country, which has recently demonstrated electron diffraction using a relativistic beam from an rf photoinjector. Due to the use of a state-of-the-art ultrashort photoinjector driver laser system, the beam has been measured to be sub-100-fs long, at least a factor of 5 better than what measured in previous relativistic electron diffraction setups. Moreover, diffraction patterns from various metal targets (titanium and aluminum) have been obtained using the Pegasus beam. One of the main laboratory goals in the near future is to fully develop the rf photoinjector-based ultrafast electron diffraction technique with particular attention to the optimization of the working point of the photoinjector in a low-charge ultrashort pulse regime, and to the development of suitable beam diagnostics.

  7. Relativistic electron diffraction at the UCLA Pegasus photoinjector laboratory

    International Nuclear Information System (INIS)

    Musumeci, P.; Moody, J.T.; Scoby, C.M.


    Electron diffraction holds the promise to yield real-time resolution of atomic motion in an easily accessible environment like a university laboratory at a fraction of the cost of fourth-generation X-ray sources. Currently the limit in time-resolution for conventional electron diffraction is set by how short an electron pulse can be made. A very promising solution to maintain the highest possible beam intensity without excessive pulse broadening from space charge effects is to increase the electron energy to the MeV level where relativistic effects significantly reduce the space charge forces. Rf photoinjectors can in principle deliver up to 10 7 -10 8 electrons packed in bunches of ∼100-fs length, allowing an unprecedented time resolution and enabling the study of irreversible phenomena by single-shot diffraction patterns. The use of rf photoinjectors as sources for ultrafast electron diffraction has been recently at the center of various theoretical and experimental studies. The UCLA Pegasus laboratory, commissioned in early 2007 as an advanced photoinjector facility, is the only operating system in the country, which has recently demonstrated electron diffraction using a relativistic beam from an rf photoinjector. Due to the use of a state-of-the-art ultrashort photoinjector driver laser system, the beam has been measured to be sub-100-fs long, at least a factor of 5 better than what measured in previous relativistic electron diffraction setups. Moreover, diffraction patterns from various metal targets (titanium and aluminum) have been obtained using the Pegasus beam. One of the main laboratory goals in the near future is to fully develop the rf photoinjector-based ultrafast electron diffraction technique with particular attention to the optimization of the working point of the photoinjector in a low-charge ultrashort pulse regime, and to the development of suitable beam diagnostics

  8. Relativistic electron diffraction at the UCLA Pegasus photoinjector laboratory. (United States)

    Musumeci, P; Moody, J T; Scoby, C M


    Electron diffraction holds the promise to yield real-time resolution of atomic motion in an easily accessible environment like a university laboratory at a fraction of the cost of fourth-generation X-ray sources. Currently the limit in time-resolution for conventional electron diffraction is set by how short an electron pulse can be made. A very promising solution to maintain the highest possible beam intensity without excessive pulse broadening from space charge effects is to increase the electron energy to the MeV level where relativistic effects significantly reduce the space charge forces. Rf photoinjectors can in principle deliver up to 10(7)-10(8) electrons packed in bunches of approximately 100-fs length, allowing an unprecedented time resolution and enabling the study of irreversible phenomena by single-shot diffraction patterns. The use of rf photoinjectors as sources for ultrafast electron diffraction has been recently at the center of various theoretical and experimental studies. The UCLA Pegasus laboratory, commissioned in early 2007 as an advanced photoinjector facility, is the only operating system in the country, which has recently demonstrated electron diffraction using a relativistic beam from an rf photoinjector. Due to the use of a state-of-the-art ultrashort photoinjector driver laser system, the beam has been measured to be sub-100-fs long, at least a factor of 5 better than what measured in previous relativistic electron diffraction setups. Moreover, diffraction patterns from various metal targets (titanium and aluminum) have been obtained using the Pegasus beam. One of the main laboratory goals in the near future is to fully develop the rf photoinjector-based ultrafast electron diffraction technique with particular attention to the optimization of the working point of the photoinjector in a low-charge ultrashort pulse regime, and to the development of suitable beam diagnostics.

  9. 34 CFR 350.34 - Which Rehabilitation Engineering Research Centers must have an advisory committee? (United States)


    ... 34 Education 2 2010-07-01 2010-07-01 false Which Rehabilitation Engineering Research Centers must... Engineering Research Centers Does the Secretary Assist? § 350.34 Which Rehabilitation Engineering Research Centers must have an advisory committee? A Rehabilitation Engineering Research Center conducting research...

  10. International cooperation for promotion of nuclear science and engineering research

    International Nuclear Information System (INIS)

    Shibata, Toshikazu; Sugiyama, Kazusuke; Nakazawa, Masaharu; Katoh, Toshio; Kimura, Itsuro.


    For promotion of nuclear science and engineering research, examinations were made on the possibilities and necessary measures to extend joint research at international level. The present article is a summary of the reports of investigations performed during FY 1986 through 1991 by the Special Committee of the AESJ for Feasibility Study on International Cooperation for Promotion of Nuclear Science and Engineering Research, under contract with Science and Technology Agency of Japan. Background information was collected on the present status of scientific research facilities in US, European and Asian countries on one hand, and on the expectations and prospects of Japanese scientists on the other hand. Based on the analysis of these data, some measures necessary to expand the international cooperation were proposed. It was emphasized that international joint research on a reciprocal basis would be effective in order to strengthen the technological basis of peaceful uses of nuclear energy. Problems to be solved for the new development were also discussed. (author)

  11. Not so global: a bibliometric look at engineering education research (United States)

    Williams, Bill; Wankat, Phillip C.; Neto, Pedro


    It has been suggested that Engineering Education Research (EER) is going global. If this were the case we would assume that the research of EER scholars in different parts of the globe would be informed by literature describing prior work within and beyond their home country/region. The authors set out to test this hypothesis by applying citation analysis to research presented in four publication venues: the annual conferences organised by ASEE (American Society of Engineering Education) and SEFI (European Society of Engineering Education) and two archival journals published by these two societies: Journal of Engineering Education (JEE) and European Journal of Engineering Education (EJEE). Our findings from the analysis of 4321 publications show that citations in ASEE conferences are dominated by sources with US affiliations, whereas the SEFI data show that while US sources are frequently cited, European and other authors are also well represented. With regard to the journals JEE and EJEE, a similar pattern is observed. These results suggest that, in citation terms, European EER is relatively global but US EER is not. The authors conclude by suggesting that if the EER community is to aspire to quality scholarship, there needs to be debate around how such issues can be tackled.

  12. Engineering research, development and technology. Thrust area report, FY93

    Energy Technology Data Exchange (ETDEWEB)


    The mission of the Engineering Research, Development, and Technology Program at Lawrence Livermore National Laboratory (LLNL) is to develop the technical staff, tools, and facilities needed to support current and future LLNL programs. The efforts are guided by a dual-benefit research and development strategy that supports Department of Energy missions, such as national security through nuclear deterrence and economic competitiveness through partnerships with U.S. industry. This annual report, organized by thrust area, describes the activities for the fiscal year 1993. The report provides timely summaries of objectives, methods, and results from nine thrust areas for this fiscal year: Computational Electronics and Electromagnetics; Computational Mechanics; Diagnostics and Microelectronics; Fabrication Technology; Materials Science and Engineering; Power Conversion Technologies; Nondestructive Evaluation; Remote Sensing, Imaging, and Signal Engineering; and Emerging Technologies. Separate abstracts were prepared for 47 papers in this report.

  13. Electronic battlespace facility for research, develoment and engineering

    NARCIS (Netherlands)

    Jense, Hans; Kuijpers, N.H.L.; Elias, R.J.D.


    In order to support its research, development and engineering activities in the area of distributed simulation for training and command & control, TNO Physics and Electronics Laboratory has developed (and continues to enhance) an Electronic Battlespace Facility (EBF). This paper presents an overview

  14. Directions in engineering research: an assessment of opportunities and needs

    National Research Council Canada - National Science Library

    National Research Council Staff; Commission on Engineering and Technical Systems; Division on Engineering and Physical Sciences; National Research Council


    ... Commission on Engineering and Technical Systems National Research Council Washington, D.C. NATIONAL ACADEMY PRESS Washington, D.C. 1987 i Copyrightthe cannot be not from book, paper however, version for formatting, original authoritative the typesetting-specific the as from created publication files XML from other this and of recomposed styles, v...

  15. Call for expressions of interest: Strengthening engineering research ...

    International Development Research Centre (IDRC) Digital Library (Canada)



    Aug 14, 2017 ... significant are the many structural barriers that pertain to the overall ... professional engineering organizations in supporting the ... and research-based solutions in the Global South, IDRC is uniquely .... to engage in the project throughout its duration through: student internships, equipment-sharing,.

  16. 77 FR 3240 - Board on Coastal Engineering Research (United States)


    ... broad policy guidance and review of plans and fund requirements for the conduct of research and... objectives of the Chief of Engineers. Proposed Agenda: On Tuesday, February 7, the Executive Session is... Board, discussion of the Board functions and responsibilities, and ways to enhance the value of the...

  17. Systems Engineering Applications for Small Business Innovative Research (SBIR) Projects (United States)


    Engineering processes within the SBIR community. Information was collected from multiple organizations throughout the SBIR community to support this research...Force by Program Executive Officers, Technolgy Directorates, Air Logistics Centers and Test Centers. SBIR projects are developed in three phases...found to be associated with SBIR projects and varied among organizations. Thus it became essential to conduct interviews to gather the information

  18. Plant cell engineering: current research, application and future prospects

    International Nuclear Information System (INIS)

    Wang Xunqing; Liu Luxiang


    This paper reviewed the current status of basic research in plant cell engineering, highlighted the application of embryo culture, double haploid (DH) technology, protoplast culture and somatic hybridization, somaclonal variation, rapid propagation, and bio-products production of plant-origin, and t he prospects. (authors)

  19. ChE Undergraduate Research Projects in Biomedical Engineering. (United States)

    Stroeve, Pieter


    Describes an undergraduate research program in biomedical engineering at the State University of New York at Buffalo. Includes goals and faculty comments on the program. Indicates that 58 percent of projects conducted between 1976 and 1980 have been presented at meetings or published. (SK)

  20. Molecular research and genetic engineering of resistance to ...

    African Journals Online (AJOL)

    This paper reviews the recent research progress on genetic methods of resistance, the status and existing problems, traditional breeding, the main resistance mechanism, molecular markers and genetic engineering of resistance genes. It is hoped that new breeding methods and new varieties resistant to Verticillium wilt will ...

  1. Strengthening engineering research and training in Africa | IDRC ...

    International Development Research Centre (IDRC) Digital Library (Canada)

    to develop mutually beneficial research and training activities. ... to inform how national or regional engineering systems operate in sub-Saharan Africa, ... developing networks and partnerships that have the potential for scaling-up activities ... from the collaborating institution in the case of Stream 1), in English or in French.

  2. NTRCI Legacy Engine Research and Development Project Final Technical Report

    Energy Technology Data Exchange (ETDEWEB)

    Smith-Holbert, Connie [National Transportation Research Center, Inc., Knoxville, TN (United States); Petrolino, Joseph [National Transportation Research Center, Inc., Knoxville, TN (United States); Watkins, Bart [Power Source Technologies Inc., Corvallis, OR (United States); Irick, David [Power Source Technologies Inc., Corvallis, OR (United States)


    The Legacy engine is a completely new design, transitional diesel engine, replacing the reciprocating engine with a rotary engine. The Legacy engine offers significant advances over conventional internal combustion engines in 1) power to weight ratio; 2) multiple fuel acceptance; 3) fuel economy; and 4) environmental compliance. These advances are achieved through a combination of innovative design geometry, rotary motion, aspiration simplicity, and manufacturing/part simplicity. The key technical challenge to the Legacy engine's commercialization, and the focus of this project, was the development of a viable roton tip seal. The PST concept for the roton tip seal was developed into a manufacturable design. The design was evaluated using a custom designed and fabricated seal test fixture and further refined. This design was incorporated into the GEN2.5A prototype and tested for achievable compression pressure. The Decision Point at the end of Phase 1 of the project (described below) was to further optimize the existing tip seal design. Enhancements to the tip seal design were incorporated into the GEN2.5B prototype and tested and evaluated using the iterative research strategy described below. Compression pressures adequate for compression ignition of diesel fuel were achieved, although not consistently in all combustion volumes. The variation in compression pressures was characterized versus design features. As the roton tip seal performance was improved, results pointed toward inadequate performance of the housing side seals. Enhancement of the housing side seal system was accomplished using a custom designed side seal test fixture. The design enhancements developed with the test fixture were also incorporated into the GEN2.5B prototype and tested and evaluated using the iterative research strategy described below. Finally, to simplify the requirements for the roton tip seals and to enhance the introduction and combustion of fuel, a flush-mount fuel injector

  3. Current and Future Research Directions in Requirements Engineering (United States)

    Cheng, Betty H. C.; Atlee, Joanne M.

    In this paper, we review current requirements engineering (RE) research and identify future research directions suggested by emerging software needs. First, we overview the state of the art in RE research. The research is considered with respect to technologies developed to address specific requirements tasks, such as elicitation, modeling, and analysis. Such a review enables us to identify mature areas of research, as well as areas that warrant further investigation. Next, we review several strategies for performing and extending RE research results, to help delineate the scope of future research directions. Finally, we highlight what we consider to be the “hot” current and future research topics, which aim to address RE needs for emerging systems of the future.

  4. Towards a portal and search engine to facilitate academic and research collaboration in engineering and education (United States)

    Bonilla Villarreal, Isaura Nathaly

    While international academic and research collaborations are of great importance at this time, it is not easy to find researchers in the engineering field that publish in languages other than English. Because of this disconnect, there exists a need for a portal to find Who's Who in Engineering Education in the Americas. The objective of this thesis is to built an object-oriented architecture for this proposed portal. The Unified Modeling Language (UML) model developed in this thesis incorporates the basic structure of a social network for academic purposes. Reverse engineering of three social networks portals yielded important aspects of their structures that have been incorporated in the proposed UML model. Furthermore, the present work includes a pattern for academic social networks..

  5. Use of university research reactors to teach control engineering

    International Nuclear Information System (INIS)

    Bernard, J.A.


    University research reactors (URRs) have provided generations of students with the opportunity to receive instruction and do hands-on work in reactor dynamics, neutron scattering, health physics, and neutron activation analysis. Given that many URRs are currently converting to programmable control systems, the opportunity now exists to provide a similar learning experience to those studying systems control engineering. That possibility is examined here with emphasis on the need for the inclusion of experiment in control engineering curricula, the type of activities that could be performed, and safety considerations

  6. Research on the User Interest Modeling of Personalized Search Engine

    Institute of Scientific and Technical Information of China (English)

    LI Zhengwei; XIA Shixiong; NIU Qiang; XIA Zhanguo


    At present, how to enable Search Engine to construct user personal interest model initially, master user's personalized information timely and provide personalized services accurately have become the hotspot in the research of Search Engine area.Aiming at the problems of user model's construction and combining techniques of manual customization modeling and automatic analytical modeling, a User Interest Model (UIM) is proposed in the paper. On the basis of it, the corresponding establishment and update algorithms of User Interest Profile (UIP) are presented subsequently. Simulation tests proved that the UIM proposed and corresponding algorithms could enhance the retrieval precision effectively and have superior adaptability.

  7. Japan Atomic Energy Research Institute, Reactor Engineering Division annual report

    International Nuclear Information System (INIS)


    Research activities in the Division of Reactor Engineering in fiscal 1978 are described. Works of the Division are development of multi-purpose Very High Temperature Gas Cooled Reactor, fusion reactor engineering, and development of Liquid Metal Fast Breeder Reactor for Power Reactor and Nuclear Fuel Development Corporation. Contents of the report are nuclear data and group constants, theoretical method and code development, integral experiment and analysis, shielding, reactor and nuclear instrumentation, dynamics analysis and control method development, fusion reactor technology, and Committees on Reactor Physics and in Decommissioning of Nuclear Facilities. (author)

  8. Annual report of the CTR Blanket Engineering research facility in 1996

    International Nuclear Information System (INIS)


    This is an annual report of the studies on Controlled Thermo-nuclear Reactor (CTR) Blanket Engineering which have been carried out in the Faculty of Engineering, the University of Tokyo, in FY 1996. This research facility on the CTR Blanket Engineering is located in the Nuclear Engineering Research Laboratory, the Tokai-mura branch of the Faculty of Engineering. (J.P.N.)

  9. Annual report of the CTR Blanket Engineering research facility in 1992

    International Nuclear Information System (INIS)


    This is an annual report of the studies on Controlled Thermo-nuclear Reactor (CTR) Blanket Engineering which have been carried out in the Faculty of Engineering, the University of Tokyo, in FY 1992. This research facility on the CTR Blanket Engineering is located in the Nuclear Engineering Research Laboratory, the Tokai-mura branch of the Faculty of Engineering. (J.P.N.)

  10. Annual report of the CTR Blanket Engineering research facility in 1994

    International Nuclear Information System (INIS)


    This is an annual report of the studies on Controlled Thermo-nuclear Reactor(CTR) Blanket Engineering which have been carried out in the Faculty of Engineering, the University of Tokyo, in FY 1994. This research facility on the CTR Blanket Engineering is located in the Nuclear Engineering Research Laboratory, the Tokai-mura branch of the Faculty of Engineering. (author)

  11. Annual report of the CTR blanket engineering research facility in 1993

    International Nuclear Information System (INIS)


    This is an annual report of the studies on Controlled Thermo-nuclear Reactor (CTR) Blanket Engineering which have been carried out in the Faculty of Engineering, the University of Tokyo, in FY 1993. This research facility on the CTR Blanket Engineering is located in the Nuclear Engineering Research Laboratory, the Tokai-mura branch of the Faculty of Engineering. (author)

  12. Active learning about research methodology in engineering education

    DEFF Research Database (Denmark)

    Lystbæk, Christian Tang

    Research methodology and theory of science have become important teaching subjects en engineering education as well as in higher education in general. This is rooted in the transition to a knowledge society. Today, it is argued by many that we are well on the way to an era beyond modernity...... of science if often not favored subjects by engineering students, who tend to find the subjects abstract. Thus, the students are often very engaged in the subjects, nor are textbooks or teaching very engaging. This poster asks how we can promote active learning in research methodology and theory of science...... and the sort of industrial economy that came with it. Whatever else the new era brings – the globalization of risks, environmental problems, new technologies, etc. – knowledge and the ability to seek, produce, apply and transform knowledge is of huge importance. However, research methodology and theory...

  13. UCLA intermediate energy nuclear physics and relativistic heavy ion physics. Annual report, February 1, 1983-January 31, 1984

    International Nuclear Information System (INIS)


    In this contract year the UCLA Intermediate Energy Group has continued to pursue a general set of problems in intermediate energy physics using new research tools and theoretical insights. Our program to study N-N scattering and proton-light nucleus scattering has been enhanced by a new polarized target facility (both hydrogen and deuterium) at the High Resolution Spectrometer (HRS) of the Los Alamos Meson Physics Facility (LAMPF). This facility has been constructed by our group in collaboration with physicists from KEK, LAMPF and the University of Minnesota; and the first set of experiments studying polarized beam-polarized target scattering at the HRS were completed this summer and early fall. The HRS mode of operation has led to some unique design features which are described. At the Bevalac, a new beam line spectrometer will be constructed for us during this year and next to significantly enhance our capability to study subthreshold k + , k - and anti p production in relativistic heavy ion collisions and to search for fractionally charged particles. During this period a proposal is being prepared for a very large acceptance spectrometer and its associated beam line which will be used to detect dilepton pairs produced in relativistic heavy ion collisions. In concert with these experimental projects, theoretical advances in the understanding of new data from the HRS, particularly spin transfer data, have been made by the UCLA group and are described

  14. Research on the Fault Coefficient in Complex Electrical Engineering

    Directory of Open Access Journals (Sweden)

    Yi Sun


    Full Text Available Fault detection and isolation in a complex system are research hotspots and frontier problems in the reliability engineering field. Fault identification can be regarded as a procedure of excavating key characteristics from massive failure data, then classifying and identifying fault samples. In this paper, based on the fundamental of feature extraction about the fault coefficient, we will discuss the fault coefficient feature in complex electrical engineering in detail. For general fault types in a complex power system, even if there is a strong white Gaussian stochastic interference, the fault coefficient feature is still accurate and reliable. The results about comparative analysis of noise influence will also demonstrate the strong anti-interference ability and great redundancy of the fault coefficient feature in complex electrical engineering.

  15. Research and development related to the services engineering

    International Nuclear Information System (INIS)

    Rembado, J. L.


    In the present paper it is clarified what is understood by the expression R and D, Research and Development in the Servicie Engineering's which support the nuclear power plants exploitation, being more appropriated to talk about Innovation and Technological Development. In this paper it is analysed the need to have an innovation as per the marketing needs and to have a technological development to maintain an independence to let us to keep and increase the company's activity. It is described how the Services Engineering's with technological development turn to equipment suppliers which can be supplied to the nuclear sector as well as to other industrial sectors. Finally, it is described the innovation and technological development evolution, the technological polities objectives and the action lines of Tecnatom, S. A. as a Services Engineering's. (Author)

  16. Nuclear science and engineering education at a university research reactor

    International Nuclear Information System (INIS)

    Loveland, W.


    The research and teaching operations of the Nuclear Chemistry Division of the Dept. of Chemistry and the Dept. of Nuclear Engineering are housed at the Oregon State University Radiation Center. This facility which includes a 1.1 MW TRIGA reactor was used for 53 classes from a number of different academic departments last year. About one-half of these classes used the reactor and ∼25% of the reactor's 45 hour week was devoted to teaching. Descriptions will be given of reactor-oriented instructional programs in nuclear engineering, radiation health and nuclear chemistry. In nuclear chemistry, classes in (a) nuclear chemistry for nuclear engineers, (b) radiotracer methods, (c) elementary and advanced activation analysis, and (d) advanced nuclear instrumentation will be described in detail. The use of the facility to promote general nuclear literacy among college students, high school and grade school students and the general population will also be covered

  17. Research reactor usage at the Idaho National Engineering Laboratory in support of university research and education

    International Nuclear Information System (INIS)

    Woodall, D.M.; Dolan, T.J.; Stephens, A.G.


    The Idaho National Engineering Laboratory is a US Department of Energy laboratory which has a substantial history of research and development in nuclear reactor technologies. There are a number of available nuclear reactor facilities which have been incorporated into the research and training needs of university nuclear engineering programs. This paper addresses the utilization of the Advanced Reactivity Measurement Facility (ARMF) and the Coupled Fast Reactivity Measurement Facility (CFRMF) for thesis and dissertation research in the PhD program in Nuclear Science and Engineering by the University of Idaho and Idaho State University. Other reactors at the INEL are also being used by various members of the academic community for thesis and dissertation research, as well as for research to advance the state of knowledge in innovative nuclear technologies, with the EBR-II facility playing an essential role in liquid metal breeder reactor research. 3 refs

  18. NASA Space Engineering Research Center for VLSI systems design (United States)


    This annual review reports the center's activities and findings on very large scale integration (VLSI) systems design for 1990, including project status, financial support, publications, the NASA Space Engineering Research Center (SERC) Symposium on VLSI Design, research results, and outreach programs. Processor chips completed or under development are listed. Research results summarized include a design technique to harden complementary metal oxide semiconductors (CMOS) memory circuits against single event upset (SEU); improved circuit design procedures; and advances in computer aided design (CAD), communications, computer architectures, and reliability design. Also described is a high school teacher program that exposes teachers to the fundamentals of digital logic design.

  19. Towards Multi-Method Research Approach in Empirical Software Engineering (United States)

    Mandić, Vladimir; Markkula, Jouni; Oivo, Markku

    This paper presents results of a literature analysis on Empirical Research Approaches in Software Engineering (SE). The analysis explores reasons why traditional methods, such as statistical hypothesis testing and experiment replication are weakly utilized in the field of SE. It appears that basic assumptions and preconditions of the traditional methods are contradicting the actual situation in the SE. Furthermore, we have identified main issues that should be considered by the researcher when selecting the research approach. In virtue of reasons for weak utilization of traditional methods we propose stronger use of Multi-Method approach with Pragmatism as the philosophical standpoint.

  20. Experimental researches about the influence of the additives for engine oils upon the work of the engine

    International Nuclear Information System (INIS)

    Dimitrovski, Mile; Mucevski, Kiril


    In this paper an attempt to get some cognitions about the influence of the additives for engine oils upon the working parameters of the internal combustion engines is made. During the experimental researches the changes of the basic parameters which determine the work of the engine, such as: the pressure of compression, the noise, the vibrations, the friction of the engine mechanism, the internal cleanliness of the engine and similar, were observed. It was conclude that the use of additives into the engine oil resulted with smoother work of the engine and cleaner exhausted as well. (Author)

  1. Engineering and Statistical Research Institute contract reports to May, 1983

    Energy Technology Data Exchange (ETDEWEB)

    Thuns, A; Morrison, B A


    The purpose of this publication is to provide information on certain Canadian agricultural research contracts which are completed, published and available for loan. These contracts reports are documentation of research contracted out to non-federal government agencies, universities or individuals. Reports on contracts under the control of the Engineering and Statistical Research Institute are written by the contractor, and are reviewed by the scientific authority. Some reports date back to 1973, when the initial contracting program began. The first program was called DREAM (Development, Research, and Evaluation in Agricultural Mechanization). In 1977-78, projects under the Energy in Agriculture program were added. This was the beginning of the AERD (Agricultural Enginering Research and Development) program. In 1981, energy research had expanded and came under a separate progam called ERDAF (Energy Research and Development in Agriculture and Food). The remaining contract work stayed with the AERD program. This publication lists only contracts completed having final reports, and available contract reports with separate listings sorted by contract file number, title, author or subject.

  2. Eighteenth annual risk reduction engineering laboratory research symposium

    International Nuclear Information System (INIS)



    The Eighteenth Annual Risk Reduction Engineering Laboratory Research Symposium was held in Cincinnati, Ohio, April 14-16, 1992. The purpose of this Symposium was to present the latest significant research findings from ongoing and recently completed projects funded by the Risk Reduction Engineering Laboratory (RREL). These Proceedings are organized into two sections. Sessions A and B, which contain extended abstracts of the paper presentations. A list of poster displays is also included. Subjects include remedial action, treatment, and control technologies for waste disposal, landfill liner and cover systems, underground storage tanks, and demonstration and development of innovative/alternative treatment technologies for hazardous waste. Alternative technology subjects include thermal destruction of hazardous wastes, field evaluations, existing treatment options, emerging treatment processes, waste minimization, and biosystems for hazardous waste destruction

  3. Research in Biomaterials and Tissue Engineering: Achievements and perspectives. (United States)

    Ventre, Maurizio; Causa, Filippo; Netti, Paolo A; Pietrabissa, Riccardo


    Research on biomaterials and related subjects has been active in Italy. Starting from the very first examples of biomaterials and biomedical devices, Italian researchers have always provided valuable scientific contributions. This trend has steadily increased. To provide a rough estimate of this, it is sufficient to search PubMed, a free search engine accessing primarily the MEDLINE database of references and abstracts on life sciences and biomedical topics, with the keywords "biomaterials" or "tissue engineering" and sort the results by affiliation. Again, even though this is a crude estimate, the results speak for themselves, as Italy is the third European country, in terms of publications, with an astonishing 3,700 products in the last decade.

  4. Biomedical engineering education in developing countries: research synthesis. (United States)

    Douglas, Tania S


    Biomedical engineering (BME) contributes to development through improving human health. This paper examines BME education to address the needs of developing countries. Components of different BME programs described in the literature are synthesized to represent what has been proposed or implemented for the production of graduates able to address health problems in a manner suited to the local environment in which they occur. Published research on BME education is reviewed with reference to problem context, interventions and their mechanisms, and intended outcomes.

  5. Collaboration in Research and Engineering for Advanced Technology.

    Energy Technology Data Exchange (ETDEWEB)

    Vrieling, P. Douglas [Sandia National Lab. (SNL-CA), Livermore, CA (United States)


    SNL/CA proposes the Collaboration in Research and Engineering for Advanced Technology and Education (CREATE) facility to support customer-driven national security mission requirements while demonstrating a fiscally responsible approach to cost-control. SNL/CA realizes that due to the current backlog of capital projects in NNSA that following the normal Line Item process to procure capital funding is unlikely and therefore SNL/CA will be looking at all options including Alternative Financing.

  6. FY2011 Engineering Innovations, Research, and Technology Report

    Energy Technology Data Exchange (ETDEWEB)

    Hamilton, Kip [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States); Martz, Harry E. [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States); Poyneer, Lisa A. [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States); Shusteff, Maxim [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States); Spadaccini, Christopher M. [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States); Hopkins, Jonathan B. [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States); Bernier, Joel V. [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States); King, Michael J. [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States); Puso, Michael A. [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States); Weisgraber, Todd H. [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States); Goldstein, Noah C. [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States); Sales, Ana Paula De Oliveira [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States); Dehlinger, Dietrich A. [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States); Kotovsky, Jack [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States); Kuntz, Joshua D. [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States); Voss, Lars F. [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States); Wheeler, Elizabeth K. [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States); Chang, John T. [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States); Lehman, Sean K. [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States); Vernon, Stephen P. [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States); Tang, Vincent [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States)


    This report summarizes key research, development, and technology advancements in Lawrence Livermore National Laboratory’s Engineering Directorate for FY2011. These efforts exemplify Engineering’s nearly 60-year history of developing and applying the technology innovations needed for the Laboratory’s national security missions, and embody Engineering’s mission to “Enable program success today and ensure the Laboratory’s vitality tomorrow.

  7. Applying Qualitative Research Methods to Narrative Knowledge Engineering


    O'Neill, Brian; Riedl, Mark


    We propose a methodology for knowledge engineering for narrative intelligence systems, based on techniques used to elicit themes in qualitative methods research. Our methodology uses coding techniques to identify actions in natural language corpora, and uses these actions to create planning operators and procedural knowledge, such as scripts. In an iterative process, coders create a taxonomy of codes relevant to the corpus, and apply those codes to each element of that corpus. These codes can...

  8. Compilation of contract research for the Materials Engineering Branch, Division of Engineering: Annual report for FY 1987

    International Nuclear Information System (INIS)


    This compilation of annual reports by contractors to the Materials Engineering Branch of the NRC Office of Research concentrates on achievements in safety research for the primary system of commercial light water power reactors, particularly with regard to reactor vessels, primary system piping, steam generators, nondestructive examination of primary components, and in safety research for decommissioning and decontamination, on-site storage, and engineered safety features. This report, covering research conducted during Fiscal Year 1987 is the sixth volume of the series of NUREG-0975, ''Compilation of Contractor Research for the Materials Engineering Branch, Division of Engineering.''

  9. Trends in aeropropulsion research and their impact on engineering education (United States)

    Povinelli, Louis A.; Reichert, Bruce A.; Glassman, Arthur J.


    This presentation is concerned with the trends in aeropropulsion both in the U.S. and abroad and the impact of these trends on the educational process in our universities. In this paper, we shall outline the new directions for research which may be of interest to educators in the aeropropulsion field. Awareness of new emphases, such as emission reductions, noise control, maneuverability, speed, etc., will have a great impact on engineering educators responsible for restructuring courses in propulsion. The information presented herein will also provide some background material for possible consideration in the future development of propulsion courses. In describing aeropropulsion, we are concerned primarily with air-breathing propulsion; however many observations apply equally as well to rocket engine systems. Aeropropulsion research needs are primarily motivated by technologies required for advanced vehicle systems and frequently driven by external requirements such as economic competitiveness, environmental concern and national security. In this presentation, vehicle based research is first described, followed by a discussion of discipline and multidiscipline research necessary to implement the vehicle-focused programs. The importance of collaboration in research and the training of future researchers concludes this presentation.

  10. Characterizing interdisciplinarity of researchers and research topics using web search engines. (United States)

    Sayama, Hiroki; Akaishi, Jin


    Researchers' networks have been subject to active modeling and analysis. Earlier literature mostly focused on citation or co-authorship networks reconstructed from annotated scientific publication databases, which have several limitations. Recently, general-purpose web search engines have also been utilized to collect information about social networks. Here we reconstructed, using web search engines, a network representing the relatedness of researchers to their peers as well as to various research topics. Relatedness between researchers and research topics was characterized by visibility boost-increase of a researcher's visibility by focusing on a particular topic. It was observed that researchers who had high visibility boosts by the same research topic tended to be close to each other in their network. We calculated correlations between visibility boosts by research topics and researchers' interdisciplinarity at the individual level (diversity of topics related to the researcher) and at the social level (his/her centrality in the researchers' network). We found that visibility boosts by certain research topics were positively correlated with researchers' individual-level interdisciplinarity despite their negative correlations with the general popularity of researchers. It was also found that visibility boosts by network-related topics had positive correlations with researchers' social-level interdisciplinarity. Research topics' correlations with researchers' individual- and social-level interdisciplinarities were found to be nearly independent from each other. These findings suggest that the notion of "interdisciplinarity" of a researcher should be understood as a multi-dimensional concept that should be evaluated using multiple assessment means.

  11. Present status of high temperature engineering test and research, 1994

    International Nuclear Information System (INIS)


    High temperature gas-cooled reactors have excellent features such as the generation of high temperature close to 1000degC, very high inherent safety and high fuel burnup. By the advanced basic research under high temperature irradiation condition, the creation of various new technologies which become the momentum of future technical innovation can be expected. The construction of the high temperature engineering test reactor (HTTR) was decided in 1987, which aims at the thermal output of 30 MW and the coolant temperature at reactor exit of 950degC. The initial criticality is scheduled in 1998. Japan Atomic Energy Research Institute has advanced the high temperature engineering test and research, and plans the safety verifying test of the HTTR, the test of connecting heat utilization plants and so on. In this report, mainly the results obtained for one year from May, 1993 are summarized. The outline of the high temperature engineering test and development of the HTTR technologies are reported. (K.I.)

  12. NASA-HBCU Space Science and Engineering Research Forum Proceedings

    International Nuclear Information System (INIS)

    Sanders, Y.D.; Freeman, Y.B.; George, M.C.


    The proceedings of the Historically Black Colleges and Universities (HBCU) forum are presented. A wide range of research topics from plant science to space science and related academic areas was covered. The sessions were divided into the following subject areas: Life science; Mathematical modeling, image processing, pattern recognition, and algorithms; Microgravity processing, space utilization and application; Physical science and chemistry; Research and training programs; Space science (astronomy, planetary science, asteroids, moon); Space technology (engineering, structures and systems for application in space); Space technology (physics of materials and systems for space applications); and Technology (materials, techniques, measurements)

  13. The role of chemical engineering in medicinal research including Alzheimer's. (United States)

    Kontogeorgis, Georgios M


    Various disciplines of chemical engineering, especially thermodynamics and kinetics, play an important role in medicinal research and this has been particularly recognized during the last 10-15 years (von Stockar and van der Wielen, J Biotechnol 59:25, 1997; Prausnitz, Fluid Phase Equilib 53:439, 1989; Prausnitz, Pure Appl Chem 79:1435, 2007; Dey and Prausnitz, Ind Eng Chem Res 50:3, 2011; Prausnitz, J Chem Thermodynamics 35:21, 2003; Tsivintzelis et al. AIChE J 55:756, 2009). It is expected that during the twenty-first century chemical engineering and especially thermodynamics can contribute as significantly to the life sciences development as it has been done with the oil and gas and chemical sectors in the twentieth century. Moreover, it has during the recent years recognized that thermodynamics can help in understanding diseases like human cataract, sickle-cell anemia, Creuzfeldt-Jacob ("mad cow" disease), and Alzheimer's which are connected to "protein aggregation." Several articles in the Perspectives section of prominent chemical engineering journals have addressed this issue (Hall, AIChE J 54:1956, 2008; Vekilov, AIChE J 54:2508, 2008). This work reviews recent applications of thermodynamics (and other areas of chemical engineering) first in drug development and then in the understanding of the mechanism of Alzheimer's and similar diseases.

  14. The preliminary research for biosynthetic engineering by radiation fusion technology

    Energy Technology Data Exchange (ETDEWEB)

    Roh, Chang Hyun; Jung, U Hee; Park, Hae Ran [KAERI, Daejeon (Korea, Republic of)


    The purpose of this project is to elucidate the solution to the production of bioactive substance using biotransformation process from core technology of biosynthetic engineering by radiation fusion technology. And, this strategy will provide core technology for development of drugs as new concept and category. Research scopes and contents of project include 1) The development of mutant for biosynthetic engineering by radiation fusion technology 2) The development of host for biosynthetic engineering by radiation fusion technology 3) The preliminary study for biosynthetic engineering of isoflavone by radiation fusion technology. The results are as follows. Isoflavone compounds(daidzein, hydroxylated isoflavone) were analyzed by GC-MS. The study of radiation doses and p-NCA high-throughput screening for mutant development were elucidated. And, it was carried out the study of radiation doses for host development. Furthermore, the study of redox partner and construction of recombinant strain for region-specific hydroxylation(P450, redox partner). In addition, the biological effect of 6,7,4'-trihydroxyisoflavone as an anti-obesity agent was elucidated in this study.

  15. From biomedical-engineering research to clinical application and industrialization (United States)

    Taguchi, Tetsushi; Aoyagi, Takao


    The rising costs and aging of the population due to a low birth rate negatively affect the healthcare system in Japan. In 2011, the Council for Science and Technology Policy released the 4th Japan's Science and Technology Basic Policy Report from 2011 to 2015. This report includes two major innovations, 'Life Innovation' and 'Green Innovation', to promote economic growth. Biomedical engineering research is part of 'Life Innovation' and its outcomes are required to maintain people's mental and physical health. It has already resulted in numerous biomedical products, and new ones should be developed using nanotechnology-based concepts. The combination of accumulated knowledge and experience, and 'nanoarchitechtonics' will result in novel, well-designed functional biomaterials. This focus issue contains three reviews and 19 original papers on various biomedical topics, including biomaterials, drug-delivery systems, tissue engineering and diagnostics. We hope that it demonstrates the importance of collaboration among scientists, engineers and clinicians, and will contribute to the further development of biomedical engineering.

  16. Data Sharing in Interpretive Engineering Education Research: Challenges and Opportunities from a Research Quality Perspective (United States)

    Walther, Joachim; Sochacka, Nicola W.; Pawley, Alice L.


    This article explores challenges and opportunities associated with sharing qualitative data in engineering education research. This exploration is theoretically informed by an existing framework of interpretive research quality with a focus on the concept of Communicative Validation. Drawing on practice anecdotes from the authors' work, the…

  17. Investigational research on eco-smart engines; Eco-smart engine no chosa kenkyu

    Energy Technology Data Exchange (ETDEWEB)



    The paper investigated the trend of research on eco-smart engines into which optimization function of engine performance, high environmental-adaptability, etc. are integrated. The investigation was made in Japan and abroad on technologies of combustion, structure/material, control, design/analysis, systematization, etc. In case of Japan, specifications were established for three types of engines, subsonic, supersonic and hypersonic aircraft, and the research subjects to fulfil the specifications were extracted. In case of the U.S. and Europe, the survey was made of combustion, materials, noise, design concept, control, etc. Important subjects are selected in priority order. Namely, for the enhancement of efficiency, the following were taken up: three-dimensional fiber-reinforced large-size light-weight structure application technology, heat-resistant advanced-material structure damage-tolerant design technology, pseudo-vesicular structure transpiration cooling technology, etc. For the reduction of NOx emission, the paper took up technologies of environmentally optimization combustion, AI combustion control, and non-cooling combustor liner application. For the noise reduction, technologies of new inclination hole orientation noise absorbing structure material application, super noise control, and innovative CFD utilization low noise aerodynamics. Moreover, the results of fiscal 1997 were outlined to indicate the research in the next fiscal year. 14 figs., 10 tabs.

  18. NATO Advanced Research Workshop on Molecular Engineering for Advanced Materials

    CERN Document Server

    Schaumburg, Kjeld


    An important aspect of molecular engineering is the `property directed' synthesis of large molecules and molecular assemblies. Synthetic expertise has advanced to a state which allows the assembly of supramolecules containing thousands of atoms using a `construction kit' of molecular building blocks. Expansion in the field is driven by the appearance of new building blocks and by an improved understanding of the rules for joining them in the design of nanometer-sized devices. Another aspect is the transition from supramolecules to materials. At present no single molecule (however large) has been demonstrated to function as a device, but this appears to be only a matter of time. In all of this research, which has a strongly multidisciplinary character, both existing and yet to be developed analytical techniques are and will remain indispensable. All this and more is discussed in Molecular Engineering for Advanced Materials, which provides a masterly and up to date summary of one of the most challenging researc...

  19. Engineering Research Division report on reports calendar year 1978

    International Nuclear Information System (INIS)

    Lorton, M.E.


    Each year the Engineering Research Division of the Electronics Engineering Department has issued an internal report listing of all formal publications produced by the division during the calendar year. The report for 1978 is being issued in two sections (the second section has been expanded from the former format due to a change in collection of information implemented during the calendar year 1978). The first section (covering January 1978 through June 1978) lists the titles, report numbers, authors, dates, an author index, and, when applicable, conferences or journals to which the paper was submitted. The second section (covering July 1978 through December 1978) provides, in addition to the above information, abstracts for each paper, and an appendix with keywords. Future publication reports will include abstracts and a keyword appendix for all reports. It is expected that the new format will make the publication report a more useful document

  20. Social and ethical dimensions of nanoscale science and engineering research. (United States)

    Sweeney, Aldrin E


    Continuing advances in human ability to manipulate matter at the atomic and molecular levels (i.e. nanoscale science and engineering) offer many previously unimagined possibilities for scientific discovery and technological development. Paralleling these advances in the various science and engineering sub-disciplines is the increasing realization that a number of associated social, ethical, environmental, economic and legal dimensions also need to be explored. An important component of such exploration entails the identification and analysis of the ways in which current and prospective researchers in these fields conceptualize these dimensions of their work. Within the context of a National Science Foundation funded Research Experiences for Undergraduates (REU) program in nanomaterials processing and characterization at the University of Central Florida (2002-2004), here I present for discussion (i) details of a "nanotechnology ethics" seminar series developed specifically for students participating in the program, and (ii) an analysis of students' and participating research faculty's perspectives concerning social and ethical issues associated with nanotechnology research. I conclude with a brief discussion of implications presented by these issues for general scientific literacy and public science education policy.

  1. Compilation of contract research for the Materials Engineering Branch, Division of Engineering

    International Nuclear Information System (INIS)


    This compilation of annual reports for FY 1990 by contractors to the Materials Engineering Branch of the Nuclear Regulatory Commission Office of Research concentrates on achievements in safety research for the primary system of commercial light water power reactors, particularly with regard to reactor vessels, primary system piping, steam generators, and nondestructive examination of primary system components. Separate abstracts have been prepared for each of the reports which are divided into the following categories: (1) vessel and piping fracture mechanics (including irradiation embrittlement); (2) pressure vessel surveillance dosimetry; (3) steam generators, aging, and environmental cracking; and (4) nondestructive examination techniques

  2. An Engineering Research Program for High School Science Teachers: Year Two Changes and Results (United States)

    DeJong, Brian P.; Yelamarthi, Kumar; Kaya, Tolga


    The research experiences for teachers program at Central Michigan University was initiated to team in-service and pre-service teachers with undergraduate engineering students and engineering faculty, in an engineering research setting. During the six-week program, teachers learn engineering concepts and develop high-school instructional material…

  3. UCLA1 aptamer inhibition of human immunodeficiency virus type 1 subtype C primary isolates in macrophages and selection of resistance

    CSIR Research Space (South Africa)

    Mufhandu, Hazel T


    Full Text Available isolates in monocyte-derived macrophages (MDMs). Of 4 macrophage-tropic isolates tested, 3 were inhibited by UCLA1 in the low nanomolar range (IC80 <29 nM). One isolate that showed reduced susceptibility (<50 nM) to UCLA1 contained mutations in the a5 helix...

  4. Peer review, basic research, and engineering: Defining a role for QA professionals in basic research environments

    Energy Technology Data Exchange (ETDEWEB)

    Bodnarczuk, M.


    Within the context of doing basic research, this paper seeks to answer four major questions: (1) What is the authority structure of science. (2) What is peer review. (3) Where is the interface between basic physics research and standard engineering. and (4) Given the conclusions to the first three questions, what is the role of the QA professional in a basic research environment like Fermilab. 23 refs.

  5. Eco-innovation: The opportunities for engineering design research

    DEFF Research Database (Denmark)

    O'Hare, Jamie Alexander; McAloone, Tim C.


    Eco-innovation is an approach that has the potential to deliver step change improvements in the environmental performance of products, but the uptake by industry to date has been disappointing. The paper presents a selective review of the academic literature, choosing examples of research that gi...... a flavour of the key trends and interesting topics that are emerging from the eco-innovation body of knowledge. We conclude by suggesting 10 areas where we see potential for the engineering design research community to contribute to the advancement of eco-innovation.......Eco-innovation is an approach that has the potential to deliver step change improvements in the environmental performance of products, but the uptake by industry to date has been disappointing. The paper presents a selective review of the academic literature, choosing examples of research that give...

  6. Nuclear engineering aspects of glioma BNCT research in Italy

    International Nuclear Information System (INIS)

    Curzio, G.; Mazzini, M.


    A research project on Boron Neutron Capture Therapy (BNCZ) of gliomas has been set up in Italy, with the participation of Departments of Oncology and Mechanical and Nuclear Construction (DCMN) of the University of Pisa, as well as the Neuroscience and Physics Departments of the Universities of Roma. The specific objective of DCMN Research Unit is the study of the physical-engineering aspects related to BNCT. The paper outlines the research lines in progress at DCMN: Monte Carlo calculations of neutron dose distribution for BNCT treatment planning; measurements of neutron fluxes, spectra and doses by neutron detectors specifically set up; design of modifications to the nuclear reactors of ENEA Casaccia Center. In particular, the paper emphasizes the most original contributions on dosimetric aspects, both from informatic and experimental points of view.(author)

  7. Graduate nuclear engineering programmes motivate educational and research activities

    International Nuclear Information System (INIS)

    Mavko, B.


    Some fifteen years ago the University of Ljubljana, Faculty for Mathematics and Physics together with the national research organisation the J. Stefan jointly established a Graduate programme of Nuclear Engineering. From the onset, the programme focused on nuclear technology, nuclear safety, and reactor physics and environment protection. Over the years this graduate programme has became the focal point of nuclear related, research and educational activities in Slovenia. It has grown into a meeting ground for recognised national and distinguished foreign educators and experienced professionals from the industry. In conjunction with an important national project, supported by the Slovenian government, entitled 'Jung Researcher' it also enhances the knowledge transfer to the next generation. Since the programme was introduced, the interest for this programme has been steadily growing. Accordingly, a number of PhD and MS degrees in NE have been awarded. The graduates of this programme have encountered very good job opportunities in nuclear as well as in non-nuclear sector. (author)

  8. Annual report of Nuclear Engineering Research Laboratory, Faculty of Engineering, University of Tokyo, fiscal year 1994

    International Nuclear Information System (INIS)


    This annual report is the summary of the research and education activities, the state of operating research facilities and others in fiscal year 1994 in this Research Laboratory. In this Research Laboratory, there are four main installations, namely the fast neutron source reactor 'Yayoi', the electron linear accelerator, the basic experiment facility for the design of nuclear fusion reactor blanket and the heavy irradiation research facility. The former two are put to the joint utilization by all Japanese universities, the blanket is to that within Faculty of Engineering, and the HIT is to that within this university. The fast neutron science research facility, the installation of which was approved in 1993 as the ancillary equipment of the Yayoi, has been put to the joint utilization for all Japan, and achieved good results. In this report, the management and operation of these main installations, research activities, the publication of research papers,graduation and degree theses, the publication of research papers, graduation and degree theses, the events in the Laboratory for one year, the list of the visitors to the Laboratory, the list of the records of official trips to foreign countries and others, and the list of UTNL reports are described. (K.I.)

  9. Integrating Global Hydrology Into Graduate Engineering Education and Research (United States)

    Griffis, V. W.


    Worldwide, polluted water affects the health of 1.2 billion people and contributes to the death of 15 million children under five every year. In addition poor environmental quality contributes to 25 per cent of all preventable ill health in the world. To address some of these problems, at the 2002 World Summit on Sustainable Development, the world community set the goal of halving, by the year 2015, the proportion of people without access to safe drinking water and basic sanitation. Solving sanitation and water resource management problems in any part of the world presents an interdisciplinary, complex challenge. However, when we attempt to solve these problems in an international context, our technical approaches must be tempered with cultural sensitivity and extraordinary management strategies. To meet this challenge, Michigan Tech has developed a unique global partnership with the U.S. Peace Corps to address our acknowledgement of the importance of placing engineering solutions in a global context. The program has graduated 30 students. Program enrollment is now over 30 and over 20 countries have hosted our students. The objective of this presentation is to demonstrate how this unique partnership can be integrated with graduate engineering education and research and also show how such a program may attract a more diverse student population into engineering. All graduate students enrolled in our Master's International Program in Civil and Environmental Engineering must complete specific coursework requirements before departing for their international experience. In CE5993 (Field Engineering in the Developing World) students learn to apply concepts of sustainable development and appropriate technology in the developing world. In FW5770 (Rural Community Development Planning and Analysis) students learn how one involves a community in the decision making process. A common theme in both courses is the role of woman in successful development projects. Technical

  10. Annual cooperative research report of Nuclear Engineering Research Laboratory, Faculty of Engineering, University of Tokyo, fiscal year 1995

    Energy Technology Data Exchange (ETDEWEB)



    This is FY 1995 annual report of research results of the Yayoi research group and the high speed neutron science group as well as the cooperative application research results of reactor `Yayoi` application, related to reactor `Yayoi` and of accelerator Linac. The reactor was also operated smoothly in FY 1995, and its application and related research reached to 25 themes. The research using Linac reduced apparently to 7 themes from 14 in FY 1994, which showed apparent reduction because of integration of the cooperative research theme but showed more results in general. in particular, it was a wonderful result to success the formation of sub-pico second pulsed beam in world wide area. The Yayoi research group reported 13 researches which was two more than these in last fiscal year, all of which were the most advanced discussions in the field related to nuclear engineering. The high speed neutron science group started in FY 1993 aiming at construction of new research field on application of the high speed neutron as a quantum beam with excellent nuclear transfer and transmittance, to manifestation and control of new material function and design and creation of intelligent material. In FY 1995, the group began his full scale operation and reported on 8 themes. (G.K.)

  11. Annual cooperative research report of Nuclear Engineering Research Laboratory, Faculty of Engineering, University of Tokyo, fiscal year 1995

    International Nuclear Information System (INIS)


    This is FY 1995 annual report of research results of the Yayoi research group and the high speed neutron science group as well as the cooperative application research results of reactor 'Yayoi' application, related to reactor 'Yayoi' and of accelerator Linac. The reactor was also operated smoothly in FY 1995, and its application and related research reached to 25 themes. The research using Linac reduced apparently to 7 themes from 14 in FY 1994, which showed apparent reduction because of integration of the cooperative research theme but showed more results in general. in particular, it was a wonderful result to success the formation of sub-pico second pulsed beam in world wide area. The Yayoi research group reported 13 researches which was two more than these in last fiscal year, all of which were the most advanced discussions in the field related to nuclear engineering. The high speed neutron science group started in FY 1993 aiming at construction of new research field on application of the high speed neutron as a quantum beam with excellent nuclear transfer and transmittance, to manifestation and control of new material function and design and creation of intelligent material. In FY 1995, the group began his full scale operation and reported on 8 themes. (G.K.)

  12. Toward ethical norms and institutions for climate engineering research

    International Nuclear Information System (INIS)

    Morrow, David R; Kopp, Robert E; Oppenheimer, Michael


    Climate engineering (CE), the intentional modification of the climate in order to reduce the effects of increasing greenhouse gas concentrations, is sometimes touted as a potential response to climate change. Increasing interest in the topic has led to proposals for empirical tests of hypothesized CE techniques, which raise serious ethical concerns. We propose three ethical guidelines for CE researchers, derived from the ethics literature on research with human and animal subjects, applicable in the event that CE research progresses beyond computer modeling. The Principle of Respect requires that the scientific community secure the global public's consent, voiced through their governmental representatives, before beginning any empirical research. The Principle of Beneficence and Justice requires that researchers strive for a favorable risk-benefit ratio and a fair distribution of risks and anticipated benefits, all while protecting the basic rights of affected individuals. Finally, the Minimization Principle requires that researchers minimize the extent and intensity of each experiment by ensuring that no experiments last longer, cover a greater geographical extent, or have a greater impact on the climate, ecosystem, or human welfare than is necessary to test the specific hypotheses in question. Field experiments that might affect humans or ecosystems in significant ways should not proceed until a full discussion of the ethics of CE research occurs and appropriate institutions for regulating such experiments are established.

  13. Toward ethical norms and institutions for climate engineering research (United States)

    Morrow, David R.; Kopp, Robert E.; Oppenheimer, Michael


    Climate engineering (CE), the intentional modification of the climate in order to reduce the effects of increasing greenhouse gas concentrations, is sometimes touted as a potential response to climate change. Increasing interest in the topic has led to proposals for empirical tests of hypothesized CE techniques, which raise serious ethical concerns. We propose three ethical guidelines for CE researchers, derived from the ethics literature on research with human and animal subjects, applicable in the event that CE research progresses beyond computer modeling. The Principle of Respect requires that the scientific community secure the global public's consent, voiced through their governmental representatives, before beginning any empirical research. The Principle of Beneficence and Justice requires that researchers strive for a favorable risk-benefit ratio and a fair distribution of risks and anticipated benefits, all while protecting the basic rights of affected individuals. Finally, the Minimization Principle requires that researchers minimize the extent and intensity of each experiment by ensuring that no experiments last longer, cover a greater geographical extent, or have a greater impact on the climate, ecosystem, or human welfare than is necessary to test the specific hypotheses in question. Field experiments that might affect humans or ecosystems in significant ways should not proceed until a full discussion of the ethics of CE research occurs and appropriate institutions for regulating such experiments are established.

  14. Enabling Arctic Research Through Science and Engineering Partnerships (United States)

    Kendall, E. A.; Valentic, T. A.; Stehle, R. H.


    Under an Arctic Research Support and Logistics contract from NSF (GEO/PLR), SRI International, as part of the CH2M HILL Polar Services (CPS) program, forms partnerships with Arctic research teams to provide data transfer, remote operations, and safety/operations communications. This teamwork is integral to the success of real-time science results and often allows for unmanned operations which are both cost-effective and safer. The CPS program utilizes a variety of communications networks, services and technologies to support researchers and instruments throughout the Arctic, including Iridium, VSAT, Inmarsat BGAN, HughesNet, TeleGreenland, radios, and personal locator beacons. Program-wide IT and communications limitations are due to the broad categories of bandwidth, availability, and power. At these sites it is essential to conserve bandwidth and power through using efficient software, coding and scheduling techniques. There are interesting new products and services on the horizon that the program may be able to take advantage of in the future such as Iridium NEXT, Inmarsat Xpress, and Omnispace mobile satellite services. Additionally, there are engineering and computer software opportunities to develop more efficient products. We will present an overview of science/engineering partnerships formed by the CPS program, discuss current limitations and identify future technological possibilities that could further advance Arctic science goals.

  15. 77 FR 25739 - Notice of Inventory Completion: Fowler Museum at UCLA, Los Angeles, CA (United States)


    ... objects are 1 awl, 1 bone tool, 2 obsidian biface fragments, 9 bags of obsidian debitage, 4 stone metate fragments, 4 bags of animal bone, 1 obsidian hydration sample, and 5 bags of organic flotation residue. The... artifacts and obsidian hydration dating. The Fowler Museum at UCLA has determined the human remains and...

  16. Occupational Analysis: Hospital Radiologic Technologist. The UCLA Allied Health Professions Project. (United States)

    Reeder, Glenn D.; And Others

    In an effort to meet the growing demand for skilled radiologic technologists and other supportive personnel educated through the associate degree level, a national survey was conducted as part of the UCLA Allied Health Professions Project to determine the tasks performed by personnel in the field and lay the groundwork for development of…

  17. Organic Rankine cycle - review and research directions in engine applications (United States)

    Panesar, Angad


    Waste heat to power conversion using Organic Rankine Cycles (ORC) is expected to play an important role in CO2 reductions from diesel engines. Firstly, a review of automotive ORCs is presented focusing on the pure working fluids, thermal architectures and expanders. The discussion includes, but is not limited to: R245fa, ethanol and water as fluids; series, parallel and cascade as architectures; dry saturated, superheated and supercritical as expansion conditions; and scroll, radial turbine and piston as expansion machines. Secondly, research direction in versatile expander and holistic architecture (NOx + CO2) are proposed. Benefits of using the proposed unconventional approaches are quantified using Ricardo Wave and Aspen HYSYS for diesel engine and ORC modelling. Results indicate that, the implementation of versatile piston expander tolerant to two-phase and using cyclopentane can potentially increase the highway drive cycle power by 8%. Furthermore, holistic architecture offering complete utilisation of charge air and exhaust recirculation heat increased the performance noticeably to 5% of engine power at the design point condition.

  18. Research and engineering assessment of biological solubilization of phosphate

    Energy Technology Data Exchange (ETDEWEB)

    Rogers, R.D.; McIlwain, M.E.; Losinski, S.J.; Taylor, D.D.


    This research and engineering assessment examined a microbial phosphate solubilization process as a method of recovering phosphate from phosphorus containing ore compared to the existing wet acid and electric arc methods. A total of 860 microbial isolates, collected from a range of natural environments were tested for their ability to solubilize phosphate from rock phosphate. A bacterium (Pseudomonas cepacia) was selected for extensive characterization and evaluation of the mechanism of phosphate solubilization and of process engineering parameters necessary to recover phosphate from rock phosphate. These studies found that concentration of hydrogen ion and production of organic acids arising from oxidation of the carbon source facilitated microbial solubilization of both pure chemical insoluble phosphate compounds and phosphate rock. Genetic studies found that phosphate solubilization was linked to an enzyme system (glucose dehydrogenase). Process-related studies found that a critical solids density of 1% by weight (ore to liquid) was necessary for optimal solubilization. An engineering analysis evaluated the cost and energy requirements for a 2 million ton per year sized plant, whose size was selected to be comparable to existing wet acid plants.

  19. β Style Free-Piston Stirling Engine Control System Research

    Directory of Open Access Journals (Sweden)

    Xu Jian


    Full Text Available For the Free-Piston Stirling Engines (FPSE control system, a three -phase bridge circuit is reused as the system output about rectifier and start inverter. When FPSE system is in the power stage, the double closed loop control strategy and optimization algorithm of PI control parameters is adopted to ensure the highest system transmission efficiency under the requirements of the system output power and guarantee the stability of the running system. The simulation results prove the effectiveness of the above research content.

  20. Nuclear Explosion Monitoring Research and Engineering Program - Strategic Plan

    Energy Technology Data Exchange (ETDEWEB)

    Casey, Leslie A. [DOE/NNSA


    The Department of Energy (DOE)/National Nuclear Security Administration (NNSA) Nuclear Explosion Monitoring Research and Engineering (NEM R&E) Program is dedicated to providing knowledge, technical expertise, and products to US agencies responsible for monitoring nuclear explosions in all environments and is successful in turning scientific breakthroughs into tools for use by operational monitoring agencies. To effectively address the rapidly evolving state of affairs, the NNSA NEM R&E program is structured around three program elements described within this strategic plan: Integration of New Monitoring Assets, Advanced Event Characterization, and Next-Generation Monitoring Systems. How the Program fits into the National effort and historical accomplishments are also addressed.

  1. Remote operations in a Fusion Engineering Research Facility (FERF)

    International Nuclear Information System (INIS)

    Doggett, J.N.


    The proposed Fusion Engineering Research Facility (FERF) has been designed for the test and evaluation of materials that will be exposed to the hostile radiation environment created by fusion reactors. Because the FERF itself must create a very hostile radiation environment, extensive remote handling procedures will be required as part of its routine operations as well as for both scheduled and unscheduled maintenance. This report analyzes the remote-handling implications of a vertical- rather than horizontal-orientation of the FERF magnet, describes the specific remote-handling facilities of the proposed FERF installation and compares the FERF remote-handling system with several other existing and proposed facilities. (U.S.)

  2. Japan Atomic Energy Research Institute, Reactor Engineering Division annual report

    International Nuclear Information System (INIS)


    Research activities in the Division of Reactor Engineering in fiscal 1980 are described. The work of the Division is closely related to development of multipurpose Very High Temperature Gas Cooled Reactor and fusion reactor, and development of Liquid Metal Fast Breeder Reactor carried out by Power Reactor and Nuclear Fuel Development Corporation. Contents of the report are achievements in fields such as nuclear data and group constants, theoretical method and code development, integral experiment and analysis, shielding, reactor and nuclear instrumentation, reactor control and diagnosis, and fusion reactor technology, and activities of the Committee on Reactor Physics. (author)


    Directory of Open Access Journals (Sweden)

    H. Dastkhan


    Full Text Available

    ENGLISH ABSTRACT: Industrial engineering is an engineering discipline which, because of its multi-disciplinary nature, has played an important role in the development and optimization of different systems at macro and micro levels. In this paper, the results of a research to study the position and trend of Industrial Engineering research in recent years are described. The data from a sample of 7 114 IE-related articles from international journals during the last 27 years were used for the analysis. The results showed that the development of IE in many countries has a strong correlation with their industrial and economic development. However, IE research topics are spreading in other management and engineering departments and so there is a need to redefine the discipline and its specific areas of interest. According to the prediction made using time series analysis, the most favorite fields of IE research in future will be on subjects related to information technology, intelligent systems, optimization, quality, and supply chain management.

    AFRIKAANSE OPSOMMING: Bedryfsingenieurswese is 'n ingenieursdissipline wat vanweë die multi-dissiplinêre aard daarvan 'n belangrike rol gespeel het in die optimisering van verskillende sisteme op makroen mikrovlak. Hierdie artikel hou die resultate voor van 'n navorsingsprojek wat onderneem is om die posisie en rigting van Bedryfsingenieursnavorsing in onlangse jare te bepaal. Die data van 'n monster van 7 114 Bedryfsingenieursverwante artikels wat verskyn het in internasionale joernale oor die afgelope 27 jaar is gebruik vir die ontleding. Die resultate toon dat die groei van Bedryfsingenieurswese in verskeie lande sterk korreleer met industriële en ekonomiese ontwikkeling. Tog blyk dit dat die navorsingsonderwerpe van Bedryfsingenieurswese sprei na ander bestuurs- en ingenieursdepartemente en dus bestaan daar ‘n nodigheid om die dissipline en die spesifieke belangstellingsvelde te herdefinieer

  4. Semiotic Engineering Methods for Scientific Research in HCI

    CERN Document Server

    Sieckenius de Souza, Clarisse


    Semiotic engineering was originally proposed as a semiotic approach to designing user interface languages. Over the years, with research done at the Department of Informatics of the Pontifical Catholic University of Rio de Janeiro, it evolved into a semiotic theory of human-computer interaction (HCI). It views HCI as computer-mediated communication between designers and users at interaction time. The system speaks for its designers in various types of conversations specified at design time. These conversations communicate the designers' understanding of who the users are, what they know the us

  5. Engaging Students in Space Research: Young Engineers and Scientists 2008 (United States)

    Boice, D. C.; Asbell, H. E.; Reiff, P. H.


    Young Engineers and Scientists (YES) is a community partnership between Southwest Research Institute (SwRI), and local high schools in San Antonio, Texas (USA) during the past 16 years. The YES program provides talented high school juniors and seniors a bridge between classroom instruction and real world, research experiences in physical sciences (including space science) and engineering. YES consists of an intensive three-week summer workshop held at SwRI and a collegial mentorship where students complete individual research projects under the guidance of their professional mentors during the academic year. During the summer workshop, students experience the research environment first-hand; develop skills and acquire tools for solving scientific problems, attend mini-courses and seminars on electronics, computers and the Internet, careers, science ethics, and other topics; and select individual research projects to be completed during the academic year. At the end of the school year, students publicly present and display their work, acknowledging their accomplishments and spreading career awareness to other students and teachers. YES has developed a website for topics in space science from the perspective of high school students, including NASA's Magnetospheric Multiscale Mission (MMS) ( Student evaluations indicate the effectiveness of YES on their academic preparation and choice of college majors. Over the past 16 years, all YES graduates have entered college, several have worked for SwRI, one business has started, and three scientific publications have resulted. Acknowledgements. We acknowledge funding and support from the NASA MMS Mission, Texas Space Grant Consortium, Northside Independent School District, SwRI, and several local charitable foundations.

  6. Development and validation of Australian aphasia rehabilitation best practice statements using the RAND/UCLA appropriateness method. (United States)

    Power, Emma; Thomas, Emma; Worrall, Linda; Rose, Miranda; Togher, Leanne; Nickels, Lyndsey; Hersh, Deborah; Godecke, Erin; O'Halloran, Robyn; Lamont, Sue; O'Connor, Claire; Clarke, Kim


    To develop and validate a national set of best practice statements for use in post-stroke aphasia rehabilitation. Literature review and statement validation using the RAND/UCLA Appropriateness Method (RAM). A national Community of Practice of over 250 speech pathologists, researchers, consumers and policymakers developed a framework consisting of eight areas of care in aphasia rehabilitation. This framework provided the structure for the development of a care pathway containing aphasia rehabilitation best practice statements. Nine speech pathologists with expertise in aphasia rehabilitation participated in two rounds of RAND/UCLA appropriateness ratings of the statements. Panellists consisted of researchers, service managers, clinicians and policymakers. Statements that achieved a high level of agreement and an overall median score of 7-9 on a nine-point scale were rated as 'appropriate'. 74 best practice statements were extracted from the literature and rated across eight areas of care (eg, receiving the right referrals, providing intervention). At the end of Round 1, 71 of the 74 statements were rated as appropriate, no statements were rated as inappropriate, and three statements were rated as uncertain. All 74 statements were then rated again in the face-to-face second round. 16 statements were added through splitting existing items or adding new statements. Seven statements were deleted leaving 83 statements. Agreement was reached for 82 of the final 83 statements. This national set of 82 best practice statements across eight care areas for the rehabilitation of people with aphasia is the first to be validated by an expert panel. These statements form a crucial component of the Australian Aphasia Rehabilitation Pathway (AARP) ( and provide the basis for more consistent implementation of evidence-based practice in stroke rehabilitation. Published by the BMJ Publishing Group Limited. For permission to use (where not already

  7. Development and validation of Australian aphasia rehabilitation best practice statements using the RAND/UCLA appropriateness method (United States)

    Power, Emma; Thomas, Emma; Worrall, Linda; Rose, Miranda; Togher, Leanne; Nickels, Lyndsey; Hersh, Deborah; Godecke, Erin; O'Halloran, Robyn; Lamont, Sue; O'Connor, Claire; Clarke, Kim


    Objectives To develop and validate a national set of best practice statements for use in post-stroke aphasia rehabilitation. Design Literature review and statement validation using the RAND/UCLA Appropriateness Method (RAM). Participants A national Community of Practice of over 250 speech pathologists, researchers, consumers and policymakers developed a framework consisting of eight areas of care in aphasia rehabilitation. This framework provided the structure for the development of a care pathway containing aphasia rehabilitation best practice statements. Nine speech pathologists with expertise in aphasia rehabilitation participated in two rounds of RAND/UCLA appropriateness ratings of the statements. Panellists consisted of researchers, service managers, clinicians and policymakers. Main outcome measures Statements that achieved a high level of agreement and an overall median score of 7–9 on a nine-point scale were rated as ‘appropriate’. Results 74 best practice statements were extracted from the literature and rated across eight areas of care (eg, receiving the right referrals, providing intervention). At the end of Round 1, 71 of the 74 statements were rated as appropriate, no statements were rated as inappropriate, and three statements were rated as uncertain. All 74 statements were then rated again in the face-to-face second round. 16 statements were added through splitting existing items or adding new statements. Seven statements were deleted leaving 83 statements. Agreement was reached for 82 of the final 83 statements. Conclusions This national set of 82 best practice statements across eight care areas for the rehabilitation of people with aphasia is the first to be validated by an expert panel. These statements form a crucial component of the Australian Aphasia Rehabilitation Pathway (AARP) ( and provide the basis for more consistent implementation of evidence-based practice in stroke rehabilitation. PMID:26137883

  8. Compilation of contract research for the Materials Engineering Branch, Division of Engineering: Annual report for FY 1988

    International Nuclear Information System (INIS)


    This compilation of annual reports by contractors to the Materials Engineering Branch of the NRC Office of Research concentrates on achievements in safety research for the primary system of commercial light water power reactors, particularly with regard to reactor vessels, primary system piping, steam generators, nondestructive examination of primary components, and in safety research for decommissioning and decontamination, on-site storage and engineered safety features. The Materials Engineering Branch assembles abbreviated reports from all the branch contractors and publishes them in a single annual report as soon after the end of the year as possible so that the information developed throughout the year can be promptly used in the safety-regulatory process. This report, covering research conducted during Fiscal Year 1988 is the seventh volume of the series of NUREG-0975, ''Compilation of Contractor Research for the Materials Engineering Branch, Division of Engineering.'' Individual projects are processed separately for the data bases

  9. 34 CFR 350.33 - What cooperation requirements must a Rehabilitation Engineering Research Center meet? (United States)


    ... Rehabilitation Engineering Research Center meet? A Rehabilitation Engineering Research Center— (a) Shall... 34 Education 2 2010-07-01 2010-07-01 false What cooperation requirements must a Rehabilitation Engineering Research Center meet? 350.33 Section 350.33 Education Regulations of the Offices of the Department...

  10. 34 CFR 350.30 - What requirements must a Rehabilitation Engineering Research Center meet? (United States)


    ... 34 Education 2 2010-07-01 2010-07-01 false What requirements must a Rehabilitation Engineering... DISABILITY AND REHABILITATION RESEARCH PROJECTS AND CENTERS PROGRAM What Rehabilitation Engineering Research Centers Does the Secretary Assist? § 350.30 What requirements must a Rehabilitation Engineering Research...

  11. 34 CFR 350.31 - What collaboration must a Rehabilitation Engineering Research Center engage in? (United States)


    ... 34 Education 2 2010-07-01 2010-07-01 false What collaboration must a Rehabilitation Engineering... DISABILITY AND REHABILITATION RESEARCH PROJECTS AND CENTERS PROGRAM What Rehabilitation Engineering Research Centers Does the Secretary Assist? § 350.31 What collaboration must a Rehabilitation Engineering Research...

  12. 75 FR 48411 - Research, Engineering and Development Advisory Committee; Notice of Meeting (United States)


    ... DEPARTMENT OF TRANSPORTATION Federal Aviation Administration Research, Engineering and Development.... 2), notice is hereby given of a meeting of the FAA Research, Engineering and Development (R, E&D) Advisory Committee. Name: Research, Engineering & Development Advisory Committee. Time and Date: September...

  13. Aircraft Engine Noise Research and Testing at the NASA Glenn Research Center (United States)

    Elliott, Dave


    The presentation will begin with a brief introduction to the NASA Glenn Research Center as well as an overview of how aircraft engine noise research fits within the organization. Some of the NASA programs and projects with noise content will be covered along with the associated goals of aircraft noise reduction. Topics covered within the noise research being presented will include noise prediction versus experimental results, along with engine fan, jet, and core noise. Details of the acoustic research conducted at NASA Glenn will include the test facilities available, recent test hardware, and data acquisition and analysis methods. Lastly some of the actual noise reduction methods investigated along with their results will be shown.

  14. Development of a Gas-Fed Pulse Detonation Research Engine (United States)

    Litchford, Ron J.; Hutt, John (Technical Monitor)


    In response to the growing need for empirical data on pulse detonation engine performance and operation, NASA Marshall Space Flight Center has developed and placed into operation a low-cost gas-fed pulse detonation research engine. The guiding design strategy was to achieve a simple and flexible research apparatus, which was inexpensive to build and operate. As such, the engine was designed to operate as a heat sink device, and testing was limited to burst-mode operation with run durations of a few seconds. Wherever possible, maximum use was made of standard off-the-shelf industrial or automotive components. The 5-cm diameter primary tube is about 90-cm long and has been outfitted with a multitude of sensor and optical ports. The primary tube is fed by a coaxial injector through an initiator tube, which is inserted directly into the injector head face. Four auxiliary coaxial injectors are also integrated into the injector head assembly. All propellant flow is controlled with industrial solenoid valves. An automotive electronic ignition system was adapted for use, and spark plugs are mounted in both tubes so that a variety of ignition schemes can be examined. A microprocessor-based fiber-optic engine control system was developed to provide precise control over valve and ignition timing. Initial shakedown testing with hydrogen/oxygen mixtures verified the need for Schelkin spirals in both the initiator and primary tubes to ensure rapid development of the detonation wave. Measured pressure wave time-of-flight indicated detonation velocities of 2.4 km/sec and 2.2 km/sec in the initiator and primary tubes, respectively. These values implied a fuel-lean mixture corresponding to an H2 volume fraction near 0.5. The axial distribution for the detonation velocity was found to be essentially constant along the primary tube. Time-resolved thrust profiles were also acquired for both underfilled and overfilled tube conditions. These profiles are consistent with previous time

  15. Compilation of contract research for the Materials Engineering Branch, Division of Engineering Technology. Annual report for FY 1985. Volume 4

    International Nuclear Information System (INIS)


    The compilation of annual reports by contractors to the Materials Engineering Branch of the NRC Office of Research, concentrates on achievements in safety research for the primary system of commercial light water power reactors, particularly with regard to reactor vessels, primary system piping, steam generators and for non-destructive examination of primary system components. This report, covering research conducted during Fiscal Year 1985, is the fourth volume of the series of NUREG-0975, Compilation of Contractor Research for the Materials Engineering Branch, Division of Engineering Technology

  16. Compilation of contract research for the Materials Engineering Branch, Division of Engineering Technology. Annual report for FY 1984. Volume 3

    International Nuclear Information System (INIS)


    This compilation of annual reports by contractors to the Materials Engineering Branch of the NRC Office of Research, concentrates on achievments in safety research for the primary system of commercial light water power reactors, particularly with regard to reactor vessels, primary system piping, steam generators and for non-destructive examination of primary system components. This report, covering research conducted during Fiscal Year 1984, is the third volume of the series of NUREG-0975, compilation of Contractor Research for the Materials Engineering Branch, Division of Engineering Technology

  17. Tsinghua-Johns Hopkins Joint Center for Biomedical Engineering Research: scientific and cultural exchange in undergraduate engineering. (United States)

    Wisneski, Andrew D; Huang, Lixia; Hong, Bo; Wang, Xiaoqin


    A model for an international undergraduate biomedical engineering research exchange program is outlined. In 2008, the Johns Hopkins University in collaboration with Tsinghua University in Beijing, China established the Tsinghua-Johns Hopkins Joint Center for Biomedical Engineering Research. Undergraduate biomedical engineering students from both universities are offered the opportunity to participate in research at the overseas institution. Programs such as these will not only provide research experiences for undergraduates but valuable cultural exchange and enrichment as well. Currently, strict course scheduling and rigorous curricula in most biomedical engineering programs may present obstacles for students to partake in study abroad opportunities. Universities are encouraged to harbor abroad opportunities for undergraduate engineering students, for which this particular program can serve as a model.

  18. I'm Graduating This Year! So What IS an Engineer Anyway? Research Brief (United States)

    Matusovich, Holly; Streveler, Ruth; Miller, Ron; Olds, Barbara


    It is often assumed that graduating engineering students readily envision what it means to be an engineer and what type of work they will be doing as engineers in the future. How can one know if this is true? This research begins to answer these questions by aiming to understand undergraduate engineering students' perceptions of themselves as…

  19. Studies on engineering technologies in the Mizunami Underground Research Laboratory. FY 2007 (Contract research)

    International Nuclear Information System (INIS)

    Noda, Masaru; Suyama, Yasuhiro; Nobuto, Jun; Ijiri, Yuji; Mikake, Shinichiro; Matsui, Hiroya


    The Mizunami Underground Research Laboratory (MIU) of the Japan Atomic Energy Agency is a major site for geoscientific research to advance the scientific and technological basis for geological disposal of high-level radioactive waste in crystalline rock. Studies on relevant engineering technologies in the MIU consist of a) research on design and construction technology for very deep underground applications, and b) research on engineering technology as a basis of geological disposal. In the Second Phase of the MIU project (the construction phase), engineering studies have focused on research into design and construction technologies for deep underground. The main subjects in the study of very deep underground structures consist of the following: 'Demonstration of the design methodology', 'Demonstration of existing and supplementary excavation methods', 'Demonstration of countermeasures during excavation' and 'Demonstration of safe construction'. In the FY 2007 studies, identification and evaluation of the subjects for study of engineering technologies in the construction phase were carried out to optimize future research work. Specific studies included: validation of the existing design methodology based on data obtained during construction; validation of existing and supplementary rock excavation methods for very deep shafts; estimation of rock stability under high differential water pressures, methodology on long-term maintenance of underground excavations and risk management systems for construction of underground structures have been performed. Based on these studies, future research focused on the four subject areas, which are 'Demonstration of the design methodology', 'Demonstration of existing and supplementary excavation methods', 'Demonstration of countermeasures during excavation' and 'Demonstration of safe construction', has been identified. The design methodology in the first phase of the MIU Project (surface-based investigation phase) was verified to

  20. Young Engineers & Scientists (YES) - Engaging Teachers in Space Research (United States)

    Boice, D. C.; Reiff, P. H.


    The Young Engineers and Scientists (YES) Program is a community partnership between Southwest Research Institute (SwRI) and local high schools in San Antonio. It provides talented high school juniors and seniors a bridge between classroom instruction and real world, research experiences in physical sciences, information sciences, and engineering. YES consists of two parts: 1) An intensive three-week summer workshop held at SwRI where students experience the research environment first-hand; develop skills and acquire tools for solving scientific problems, attend mini-courses and seminars on electronics, C++ programming, the Internet, careers, science ethics, social impact of technology, and other topics; and select their individual research project with their mentor (SwRI staff member) to be completed during the academic year; and 2) A collegial mentorship where students complete individual research projects under the guidance of their mentors and teachers during the academic year and earn honors credit. At the end of the school year, students publicly present and display their work, acknowledging their accomplishments and spreading career awareness to other students and teachers. YES has been highly successful during the past nineteen (19) years. A total of 258 students have completed or are currently enrolled in YES. Of these students, 38% are females and 57% are ethnic minorities, reflecting the local diversity of the San Antonio area. All YES graduates have entered college, several work or have worked for SwRI, two businesses have formed, and three scientific publications have resulted. Sixteen (16) teacher participants have attended the YES workshop and have developed classroom materials based on their experiences in research at SwRI in the past three (3) years. In recognition of its excellence, YES received the Celebrate Success in 1996 and the Outstanding Campus Partner-of-the-Year Award in 2005, both from Northside Independent School District (San Antonio

  1. F3 turbofan engine. Overview of research and development

    Energy Technology Data Exchange (ETDEWEB)

    Kozu, Masao


    The development of XF3-30 Turbofan Engine (static propulsion 1670 kgf), to be equipped in the next exercise plane (XT-4) of the Air Self-Defense Force, was launched in FY 1975 and completed in FY 1985 in terms of certificate testing. This engine is the second national product after the first J3 in Japan. During the development work, technical gaps are avoided as far as possible while also noting cost control in mass production. Important items, felt during the development work for smoothly proceeding with the plan and early achieving the target, include optimum decision of low-fuel consumption rate, complete testing, careful study on the interface, long-term test run for detecting problems, frank attitude to accept facts, incentive of persons in charge and cooperation of related people. This report describes an outline of the plan from research to development, except for technical details that will be reported separately. (20 refs, 4 figs, 6 tabs, 5 photos)

  2. Teaching ethics to engineers - a research-based perspective (United States)

    Bowden, Peter


    This paper describes research underpinning a course, developed in Australia, on ethics for engineers. The methodology used, that of identifying the principal ethical issues facing the discipline and designing the course around these issues, would be applicable to other disciplines and in other countries. The course was based on the assumption that identifying the major ethical issues in the discipline, and subsequently presenting and analysing them in the classroom, would provide the future professional with knowledge of the ethical problems that they were likely to face on graduation. The student has then to be given the skills and knowledge to combat these concerns, should he/she wish to. These findings feed into several components of the course, such as the development of a code of ethics, the role of a professional society or industry association and the role of ethical theory The sources employed to identify the issues were surveys of the literature and about 30 case studies, in Australia and overseas. The issues thus identified were then put before a sample of engineering managers to assess the relevance to the profession.

  3. Researching new social (political movements as protagonists of social engineering

    Directory of Open Access Journals (Sweden)

    Šuvaković Uroš V.


    Full Text Available The article is a retrospective of the theoretical research of the sociologist Slobodan Antonic dedicated to evolution and strengthening of two important social (political movements: radical-feminist and -LGBT. Contesting the scientific-methodological basis of theories that 'explain' them, the author emphasizes the importance of the neoliberal ideological platform on which these theories and derived movements are based. At the same time, numerous dangers that social engineering for which their members plead for are pointed out. Regardless the radical changes of social consciousness, social values and power relations in the contemporary society for which these movements plead for, they actually represent pro-systematic movements that help in preservation of neoliberal capitalism with their demands.

  4. Machine learning, medical diagnosis, and biomedical engineering research - commentary. (United States)

    Foster, Kenneth R; Koprowski, Robert; Skufca, Joseph D


    A large number of papers are appearing in the biomedical engineering literature that describe the use of machine learning techniques to develop classifiers for detection or diagnosis of disease. However, the usefulness of this approach in developing clinically validated diagnostic techniques so far has been limited and the methods are prone to overfitting and other problems which may not be immediately apparent to the investigators. This commentary is intended to help sensitize investigators as well as readers and reviewers of papers to some potential pitfalls in the development of classifiers, and suggests steps that researchers can take to help avoid these problems. Building classifiers should be viewed not simply as an add-on statistical analysis, but as part and parcel of the experimental process. Validation of classifiers for diagnostic applications should be considered as part of a much larger process of establishing the clinical validity of the diagnostic technique.

  5. Assessment report of research and development activities. Activity: 'Nuclear science and engineering research' (Interim report)

    International Nuclear Information System (INIS)


    Japan Atomic Energy Agency (hereinafter referred to as 'JAEA') consults an assessment committee, 'Evaluation Committee of Research Activities for Nuclear Science and Engineering' (hereinafter referred to as 'Committee') for interim assessment of 'Nuclear Science and Engineering,' in accordance with 'General Guideline for the Evaluation of Government Research and Development (R and D) Activities' by Cabinet Office, Government of Japan, 'Guideline for Evaluation of R and D in Ministry of Education, Culture, Sports, Science and Technology' and 'Regulation on Conduct for Evaluation of R and D Activities' by the JAEA. In response to the JAEA's request, the Committee assessed the research program of the Nuclear Science and Engineering Directorate (hereinafter referred to as 'NSED') and Center for Computational Science and e-Systems (hereinafter referred to as 'CCSE') during the period of about four years from September 2008 to September 2012. The Committee evaluated the management and research activities of the NSED and the CCSE based on explanatory documents prepared by the NSED and the CCSE, and oral presentations with questions-and-answers by unit managers etc. A CD-ROM is attached as an appendix. (J.P.N.)


    The mission of the Risk Reduction Engineering Laboratory is to advance the understanding, development and application of engineering solutions for the prevention or reduction of risks from environmental contamination. This mission is accomplished through basic and applied researc...

  7. Education and research in biomedical engineering of the Budapest University of Technology and Economics. (United States)

    Benyó, Z


    Biomedical Engineering is a relatively new interdisciplinary science. This review paper presents the biomedical engineering activity, which is carried out at the Budapest University of Technology and Economics (BUTE) and its partner institutions. In the first parts the main goals and the curriculum of the Biomedical Engineering Education Program is presented. The second part of the paper summarizes the most important biomedical engineering researches most of them carried out in the Biomedical Engineering Laboratory of BUTE.

  8. Courseware Engineering Outlined: An Overview of Some Research Issues. (United States)

    De Diana, Italo; van Schaik, Paul


    Defines courseware engineering (CE) and discusses how it differs from software engineering. Topics addressed include the goals of courseware engineering; a classification of tasks; costs; aspects of knowledge representation; the structure of knowledge in CE; processes in knowledge acquisition; and knowledge base validation. (Contains 48…

  9. Engineering Education Research in "European Journal of Engineering Education" and "Journal of Engineering Education": Citation and Reference Discipline Analysis (United States)

    Wankat, Phillip C.; Williams, Bill; Neto, Pedro


    The authors, citations and content of "European Journal of Engineering Education" ("EJEE") and "Journal of Engineering Education" ("JEE") in 1973 ("JEE," 1975 "EJEE"), 1983, 1993, 2003, and available 2013 issues were analysed. Both journals transitioned from house organs to become…

  10. Researching primary engineering education: UK perspectives, an exploratory study (United States)

    Clark, Robin; Andrews, Jane


    This paper draws attention to the findings of an exploratory study that critically identified and analysed relevant perceptions of elementary level engineering education within the UK. Utilising an approach based upon grounded theory methodology, 30 participants including teachers, representatives of government bodies and non-profit providers of primary level engineering initiatives were interviewed. Three main concepts were identified during the analysis of findings, each relevant to primary engineering education. These were pedagogic issues, exposure to engineering within the curriculum and children's interest. The paper concludes that the opportunity to make a real difference to children's education by stimulating their engineering imagination suggests this subject area is of particular value.

  11. Status report on research on advanced fundamental engineering in 1999

    International Nuclear Information System (INIS)


    JNC (Japan Nuclear Cycle Development Institute) has been promoting the cooperative research program on advanced fundamental engineering with the Japanese Universities. It is the 5th year of this program on 1999. JNC has been calling for the research themes of utilizing the equipment and facilities of JNC, which must be the leading research for the JNC projects. The expert committee has selected the issues from the applications of the universities; This report includes the list of the researches and individual summaries implemented in 1999, in which total 49 issues are categorized in the three fields, these are, fast breeder reactor, nuclear fuel cycle, and environment technology. The 26 issues are included in the field of fast breeder reactor. Topics in this area are neutron beam technology to measure voids, laser technology to detect failed fuel, ultra-sonic velocity meter to estimate passive cooling characteristics, behavior of sodium coolant in accidents, physics on TRU fuel, and mechanical and/or chemical characteristics on irradiated solid metals, ceramics and liquids. The 9 issues are included in the field of nuclear fuel cycle. Topics in this area are chemical erosion of material, computerized simulation on actinide by molecular orbit model, chemical stability on advanced reprocessing, laser technology to measure fuel particles, decomposition of fluoride oil, advanced dose evaluation. The 9 issues are included in the field of environment technology. Topics in this area are behavior of underground water, radioactivity ecology of plants, biochemical activities of microbes in deep bedrock. The individual report describes the title, related personnel, its time schedule, objectives, facilities, status, and references in the prearranged format. (Tanaka, T.)

  12. Ethical Issues in Engineering Models: An Operations Researcher?s Reflections


    Kleijnen, J.


    This article starts with an overview of the author?s personal involvement?as an Operations Research consultant?in several engineering case-studies that may raise ethical questions; e.g., case-studies on nuclear waste, water management, sustainable ecology, military tactics, and animal welfare. All these case studies employ computer simulation models. In general, models are meant to solve practical problems, which may have ethical implications for the various stakeholders; namely, the modelers...

  13. Crowd science and engineering: concept and research framework

    Directory of Open Access Journals (Sweden)

    Yueting Chai


    Full Text Available Purpose – The synthetic application and interaction of/between the internet, Internet of Things, cloud computing, big data, Industry 4.0 and other new patterns and new technologies shall breed future Web-based industrial operation system and social operation management patterns, manifesting as a crowd cyber eco-system composed of multiple interconnected intelligent agents (enterprises, individuals and governmental agencies and its dynamic behaviors. This paper aims to explore the basic principles and laws of such a system and its behavior. Design/methodology/approach – The authors propose the concepts of crowd science and engineering (CSE and expound its main content, thus forming a research framework of theories and methodologies of crowd science. Findings – CSE is expected to substantially promote the formation and development of crowd science and thus lay a foundation for the advancement of Web-based industrial operation system and social operation management patterns. Originality/value – This paper is the first one to propose the concepts of CSE, which lights the beacon for the future research in this area.

  14. A comparative study of gold UCLA-type and CAD/CAM titanium implant abutments (United States)

    Park, Ji-Man; Lee, Jai-Bong; Heo, Seong-Joo


    PURPOSE The aim of this study was to evaluate the interface accuracy of computer-assisted designed and manufactured (CAD/CAM) titanium abutments and implant fixture compared to gold-cast UCLA abutments. MATERIALS AND METHODS An external connection implant system (Mark III, n=10) and an internal connection implant system (Replace Select, n=10) were used, 5 of each group were connected to milled titanium abutment and the rest were connected to the gold-cast UCLA abutments. The implant fixture and abutment were tightened to torque of 35 Ncm using a digital torque gauge, and initial detorque values were measured 10 minutes after tightening. To mimic the mastication, a cyclic loading was applied at 14 Hz for one million cycles, with the stress amplitude range being within 0 N to 100 N. After the cyclic loading, detorque values were measured again. The fixture-abutment gaps were measured under a microscope and recorded with an accuracy of ±0.1 µm at 50 points. RESULTS Initial detorque values of milled abutment were significantly higher than those of cast abutment (P.05). After cyclic loading, detorque values of cast abutment increased, but those of milled abutment decreased (Pabutment group and the cast abutment group after cyclic loading. CONCLUSION In conclusion, CAD/CAM milled titanium abutment can be fabricated with sufficient accuracy to permit screw joint stability between abutment and fixture comparable to that of the traditional gold cast UCLA abutment. PMID:24605206

  15. MHD PbLi experiments in MaPLE loop at UCLA

    International Nuclear Information System (INIS)

    Courtessole, C.; Smolentsev, S.; Sketchley, T.; Abdou, M.


    Highlights: • The paper overviews the MaPLE facility at UCLA: one-of-a-few PbLi MHD loop in the world. • We present the progress achieved in development and testing of high-temperature PbLi flow diagnostics. • The most important MHD experiments carried out since the first loop operation in 2011 are summarized. - Abstract: Experiments on magnetohydrodynamic (MHD) flows are critical to understanding complex flow phenomena in ducts of liquid metal blankets, in particular those that utilize eutectic alloy lead–lithium as breeder/coolant, such as self-cooled, dual-coolant and helium-cooled lead–lithium blanket concepts. The primary goal of MHD experiments at UCLA using the liquid metal flow facility called MaPLE (Magnetohydrodynamic PbLi Experiment) is to address important MHD effects, heat transfer and flow materials interactions in blanket-relevant conditions. The paper overviews the one-of-a-kind MaPLE loop at UCLA and presents recent experimental activities, including the development and testing of high-temperature PbLi flow diagnostics and experiments that have been performed since the first loop operation in 2011. We also discuss MaPLE upgrades, which need to be done to substantially expand the experimental capabilities towards a new class of MHD flow phenomena that includes buoyancy effects.

  16. MHD PbLi experiments in MaPLE loop at UCLA

    Energy Technology Data Exchange (ETDEWEB)

    Courtessole, C., E-mail:; Smolentsev, S.; Sketchley, T.; Abdou, M.


    Highlights: • The paper overviews the MaPLE facility at UCLA: one-of-a-few PbLi MHD loop in the world. • We present the progress achieved in development and testing of high-temperature PbLi flow diagnostics. • The most important MHD experiments carried out since the first loop operation in 2011 are summarized. - Abstract: Experiments on magnetohydrodynamic (MHD) flows are critical to understanding complex flow phenomena in ducts of liquid metal blankets, in particular those that utilize eutectic alloy lead–lithium as breeder/coolant, such as self-cooled, dual-coolant and helium-cooled lead–lithium blanket concepts. The primary goal of MHD experiments at UCLA using the liquid metal flow facility called MaPLE (Magnetohydrodynamic PbLi Experiment) is to address important MHD effects, heat transfer and flow materials interactions in blanket-relevant conditions. The paper overviews the one-of-a-kind MaPLE loop at UCLA and presents recent experimental activities, including the development and testing of high-temperature PbLi flow diagnostics and experiments that have been performed since the first loop operation in 2011. We also discuss MaPLE upgrades, which need to be done to substantially expand the experimental capabilities towards a new class of MHD flow phenomena that includes buoyancy effects.

  17. A systematic literature review of resilience engineering: Research areas and a research agenda proposal

    International Nuclear Information System (INIS)

    Righi, Angela Weber; Saurin, Tarcisio Abreu; Wachs, Priscila


    Resilience engineering (RE) has been advocated as a new safety management paradigm, compatible with the nature of complex socio-technical systems. This study aims to identify the research areas and to propose a research agenda for RE, based on a systematic literature review that encompasses 237 studies from 2006 to 2014. Six research areas are identified: theory of RE; identification and classification of resilience; safety management tools; analysis of accidents; risk assessment; and training. The area “theory of RE” accounted for 52% of the studies, and it indicates that research has emphasized the description of how resilient performance occurs. The proposal for a research agenda is focused on: refining key constructs; positioning RE in relation to other theories; exploring other research strategies in addition to case-based studies; investigating barriers for implementing RE; and balancing the importance on describing and understanding resilience with the emphasis on the design of resilient systems, and the evaluation of these designs. - Highlights: • Six research areas on RE are identified. • A research agenda for RE is proposed. • RE research is mostly descriptive and based on case studies. • Design science is suggested as a research strategy for RE. • Five domains account for 75% of the reviewed studies

  18. Main research activities at the Institute of Energy Process Engineering Research Centre Juelich Germany

    International Nuclear Information System (INIS)

    Achenbach, E.


    This report summarizes four lectures been held during the author's seven-week stay at the Department of High Temperature Engineering in the period from February 2nd to March 23rd in 1995 under the JAERI foreign researcher inviting program. Though the Institute of Energy Process Engineering(IEV) in the Research Centre Juelich(KFA), has recently changed the subject of research from nuclear technology of high-temperature gas-cooled reactors(HTGRs) to fuel cell technology, there are many common items of research. In particular, the following topics presented in the lectures are of mutual interest: 1)Methane-steam reforming used at JAERI as HTGR heat utilization system and applied at KFA to internal reforming in the high temperature Solid Oxide Fuel Cell(SOFC), 2)Technology and modeling of high temperature electrolysis at JAERI as the inverse process of the SOFC developed at KFA, 3)Flow simulation of branched systems treated at JAERI for the development of high temperature heat exchangers and performed at KFA with respect to the SOFC manifold system, 4)Fundamental aspects of heat and mass transfer. The report should help to create a basis of discussing the above mentioned problems and to stimulate the research work at JAERI. (author)

  19. Final priority; National Institute on Disability and Rehabilitation Research--Rehabilitation Engineering Research Centers. Final priority. (United States)


    The Assistant Secretary for Special Education and Rehabilitative Services announces a priority under the Disability and Rehabilitation Research Projects and Centers Program administered by the National Institute on Disability and Rehabilitation Research (NIDRR). Specifically, we announce a priority for a Rehabilitation Engineering Research Center (RERC) on Improving the Accessibility, Usability, and Performance of Technology for Individuals who are Deaf or Hard of Hearing. The Assistant Secretary may use this priority for competitions in fiscal year (FY) 2014 and later years. We take this action to focus research attention on an area of national need. We intend the priority to contribute to improving the accessibility, usability, and performance of technology for individuals who are deaf or hard of hearing.

  20. Evaluation of stability of interface between CCM (Co-Cr-Mo) UCLA abutment and external hex implant. (United States)

    Yoon, Ki-Joon; Park, Young-Bum; Choi, Hyunmin; Cho, Youngsung; Lee, Jae-Hoon; Lee, Keun-Woo


    The purpose of this study is to evaluate the stability of interface between Co-Cr-Mo (CCM) UCLA abutment and external hex implant. Sixteen external hex implant fixtures were assigned to two groups (CCM and Gold group) and were embedded in molds using clear acrylic resin. Screw-retained prostheses were constructed using CCM UCLA abutment and Gold UCLA abutment. The external implant fixture and screw-retained prostheses were connected using abutment screws. After the abutments were tightened to 30 Ncm torque, 5 kg thermocyclic functional loading was applied by chewing simulator. A target of 1.0 × 10 6 cycles was applied. After cyclic loading, removal torque values were recorded using a driving torque tester, and the interface between implant fixture and abutment was evaluated by scanning electronic microscope (SEM). The means and standard deviations (SD) between the CCM and Gold groups were analyzed with independent t-test at the significance level of 0.05. Fractures of crowns, abutments, abutment screws, and fixtures and loosening of abutment screws were not observed after thermocyclic loading. There were no statistically significant differences at the recorded removal torque values between CCM and Gold groups ( P >.05). SEM analysis revealed that remarkable wear patterns were observed at the abutment interface only for Gold UCLA abutments. Those patterns were not observed for other specimens. Within the limit of this study, CCM UCLA abutment has no statistically significant difference in the stability of interface with external hex implant, compared with Gold UCLA abutment.

  1. A Unified Checklist for Observational and Experimental Research in Software Engineering (Version 1)

    NARCIS (Netherlands)

    Wieringa, Roelf J.


    Current checklists for empirical software engineering cover either experimental research or case study research but ignore the many commonalities that exist across all kinds of empirical research. Identifying these commonalities, and explaining why they exist, would enhance our understanding of

  2. Crash Injury Research and Engineering Network (CIREN) - CIREN data files (United States)

    Department of Transportation — The CIREN process combines prospective data collection with professional multidisciplinary analysis of medical and engineering evidence to determine injury causation...

  3. Summary of entire research achievements of creative engineering research program on nuclear fuel cycle

    International Nuclear Information System (INIS)

    Takenaka, Shingo; Ikegami, Tetsuo


    Creative Engineering Research Program on Nuclear Fuel Cycle (former In-house Innovative Research Encouraging Program) was implemented from FY 2001 to FY 2007 in order to support such in-house researches that create innovative new concepts and aim technical break-through. Totally 37 applications have been received and 14 research themes have been accepted and been performed in this program. As for the research achievements of the 14 research themes, first author papers accepted by scientific journals and by science councils were 47 and 32, respectively, and oral presentations at scientific societies were 99. Furthermore, interpretive articles for scientific journals, requested lectures, patents, and prize winnings were 13, 30, 8, and 3, respectively. Consequently, it can be evaluated that the research achievements resulted from this program are generally in high level and that the expectations, at the starting point of this program, to activate the innovative research activities have been accomplished. In this report, the final reports of the 14 research themes together with the outline of this program are included. (author)

  4. UCLA program in reactor studies: The ARIES tokamak reactor study

    International Nuclear Information System (INIS)


    The ARIES research program is a multi-institutional effort to develop several visions of tokamak reactors with enhanced economic, safety, and environmental features. The aims are to determine the potential economics, safety, and environmental features of a range of possible tokamak reactors, and to identify physics and technology areas with the highest leverage for achieving the best tokamak reactor. Four ARIES visions are currently planned for the ARIES program. The ARIES-1 design is a DT-burning reactor based on ''modest'' extrapolations from the present tokamak physics database and relies on either existing technology or technology for which trends are already in place, often in programs outside fusion. ARIES-2 and ARIES-4 are DT-burning reactors which will employ potential advances in physics. The ARIES-2 and ARIES-4 designs employ the same plasma core but have two distinct fusion power core designs; ARIES-2 utilize the lithium as the coolant and breeder and vanadium alloys as the structural material while ARIES-4 utilizes helium is the coolant, solid tritium breeders, and SiC composite as the structural material. Lastly, the ARIES-3 is a conceptual D- 3 He reactor. During the period Dec. 1, 1990 to Nov. 31, 1991, most of the ARIES activity has been directed toward completing the technical work for the ARIES-3 design and documenting the results and findings. We have also completed the documentation for the ARIES-1 design and presented the results in various meetings and conferences. During the last quarter, we have initiated the scoping phase for ARIES-2 and ARIES-4 designs

  5. Centre for Engineering Research Inc. - 1995 annual report

    International Nuclear Information System (INIS)

    Rubuliak, S.; Bridges, L.


    Highlights of some of C-FER's research projects in the energy industry were presented. Accomplishments in 1995 were underscored by tangible results creating value through engineering innovation, realizing strategic advantages, and enhancing system safety and reliability. Among the projects described was the success of the first field test of an AQWANOT (trademark) prototype for downhole separation of water and oil. The test demonstrated the feasibility of combining hydrocyclones and a modified multi-stream downhole pump for simultaneous oil production, downhole water separation and same-well reinjection of 'produced' water. The technology has potential in offshore prospects, as well as for natural gas producers. C-FER's software entitled PIRAMID (pipeline risk analysis for maintenance and inspection decisions) quantifies the impact of in-line inspections on the probability of line failure due to metal loss by corrosion and uses the information to optimize tool selection, defect repair criteria and inspection intervals. C-FER's special environments laboratory (SEL), a facility for tests requiring safe containment of toxic and flammable gases and explosions, was described. A financial summary of the company's operations was included. tabs., figs

  6. Glass-based integrated optical splitters: engineering oriented research (United States)

    Hao, Yinlei; Zheng, Weiwei; Yang, Jianyi; Jiang, Xiaoqing; Wang, Minghua


    Optical splitter is one of most typical device heavily demanded in implementation of Fiber To The Home (FTTH) system. Due to its compatibility with optical fibers, low propagation loss, flexibility, and most distinguishingly, potentially costeffectiveness, glass-based integrated optical splitters made by ion-exchange technology promise to be very attractive in application of optical communication networks. Aiming at integrated optical splitters applied in optical communication network, glass ion-exchange waveguide process is developed, which includes two steps: thermal salts ion-exchange and field-assisted ion-diffusion. By this process, high performance optical splitters are fabricated in specially melted glass substrate. Main performance parameters of these splitters, including maximum insertion loss (IL), polarization dependence loss (PDL), and IL uniformity are all in accordance with corresponding specifications in generic requirements for optic branching components (GR-1209-CORE). In this paper, glass based integrated optical splitters manufacturing is demonstrated, after which, engineering-oriented research work results on glass-based optical splitter are presented.

  7. Ethical issues in engineering models: an operations researcher's reflections. (United States)

    Kleijnen, J


    This article starts with an overview of the author's personal involvement--as an Operations Research consultant--in several engineering case-studies that may raise ethical questions; e.g., case-studies on nuclear waste, water management, sustainable ecology, military tactics, and animal welfare. All these case studies employ computer simulation models. In general, models are meant to solve practical problems, which may have ethical implications for the various stakeholders; namely, the modelers, the clients, and the public at large. The article further presents an overview of codes of ethics in a variety of disciples. It discusses the role of mathematical models, focusing on the validation of these models' assumptions. Documentation of these model assumptions needs special attention. Some ethical norms and values may be quantified through the model's multiple performance measures, which might be optimized. The uncertainty about the validity of the model leads to risk or uncertainty analysis and to a search for robust models. Ethical questions may be pressing in military models, including war games. However, computer games and the related experimental economics may also provide a special tool to study ethical issues. Finally, the article briefly discusses whistleblowing. Its many references to publications and websites enable further study of ethical issues in modeling.

  8. Research on application of knowledge engineering to nuclear power stations

    International Nuclear Information System (INIS)

    Umeda, Takeo; Kiyohashi, Satoshi


    Recently, the research on the software and hardware regarding knowledge engineering has been advanced eagerly. Especially the applicability of expert systems is high. When expert systems are introduced into nuclear power stations, it is necessary to make the plan for introduction based on the detailed knowledge on the works in nuclear power stations, and to improve the system repeatedly by adopting the opinion and request of those in charge upon the trial use. Tohoku Electric Power Co. was able to develop the expert system of practically usable scale 'Supporting system for deciding fuel movement procedure'. The survey and analysis of the works in nuclear power stations, the selection of the system to be developed and so on are reported. In No. 1 plant of Onagawa Nuclear Power Station of BWR type, up to 1/3 of the fuel is replaced at the time of the regular inspection. Some fuel must be taken to outside for ensuring the working space. The works of deciding fuel movement procedure, the development of the system and its evaluation are described. (K.I.)

  9. Biomedical Engineering Bionanosystems Research at Louisiana Tech University

    Energy Technology Data Exchange (ETDEWEB)

    Palmer, James; Lvov, Yuri; Hegab, Hisham; Snow, Dale; Wilson, Chester; McDonald, John; Walker, Lynn; Pratt, Jon; Davis, Despina; Agarwal, Mangilal; DeCoster, Mark; Feng, June; Que, Long; O' Neal, Chad; Guilbeau, Eric; Zivanovic, Sandra; Dobbins, Tabbetha; Gold, Scott; Mainardi, Daniela; Gowda, Shathabish; Napper, Stan


    The nature of this project is to equip and support research in nanoengineered systems for biomedical, bioenvironmental, and bioenergy applications. Funds provided by the Department of Energy (DoE) under this Congressional Directive were used to support two ongoing research projects at Louisiana Tech University in biomedical, bioenvironmental, and bioenergy applications. Two major projects (Enzyme Immobilization for Large Scale Reactors to Reduce Cellulosic Ethanol Costs, and Nanocatalysts for Coal and Biomass Conversion to Diesel Fuel) and to fund three to five additional seed projects were funded using the project budget. The project funds also allowed the purchase and repair of sophisticated research equipment that will support continued research in these areas for many years to come. Project funds also supported faculty, graduate students, and undergraduate students, contributing to the development of a technically sophisticated work force in the region and the State. Descriptions of the technical accomplishments for each funded project are provided. Biofuels are an important part of the solution for sustainable transportation fuel and energy production for the future. Unfortunately, the country's appetite for fuel cannot be satisfied with traditional sugar crops such as sugar cane or corn. Emerging technologies are allowing cellulosic biomass (wood, grass, stalks, etc.) to also be converted into ethanol. Cellulosic ethanol does not compete with food production and it has the potential to decrease greenhouse gas (GHG) emissions by 86% versus current fossil fuels (current techniques for corn ethanol only reduce greenhouse gases by 19%). Because of these advantages, the federal government has made cellulosic ethanol a high priority. The Energy Independence and Security Act of 2007 (EISA) requires a minimum production of at least 16 billion gallons of cellulosic ethanol by 2022. Indeed, the Obama administration has signaled an ambitious commitment of achieving

  10. Report of the Science and Engineering Research Council, 1 April 1993 - 31 March 1994

    International Nuclear Information System (INIS)


    This final Annual Report of the Science and Engineering Research Council (SERC) covers the work of the organization for 1993-1994 and explains the structures and missions of the organizations which replace it. SERC funds and supports United Kingdom research programs covering many aspects of science and engineering. Its work will be split between the new Engineering and Physical Sciences Research Council, the Particle Physics and Astronomy Research Council, the Biotechnology and Biological Sciences Research Council and the Natural Environment Research Council. Research achievements and training initiatives are reported for each of SERC's current Boards. (UK)

  11. Research and Education Program for Underrepresented Minority Engineering Students in the JIAFS (United States)

    Whitesides, John L.


    This paper is a final report on Research and Education Program for Underrepresented Minority Engineering Students in the JIAFS (Joint Institute for Advancement of Flight Sciences). The objectives of the program were to conduct research at the NASA Langley Research Center and to increase the number of underrepresented minorities in aerospace engineering.

  12. Report of the research results with University of Tokyo Nuclear Engineering Research Laboratory's facilities in fiscal 1975

    International Nuclear Information System (INIS)


    Results of the research works by educational institutions using fast neutron source reactor 'Yayoi' etc. of Nuclear Engineering Research Laboratory in fiscal 1975 are reported in individual summaries. Fields of research are the following: shielding benchmark experiment, research on medical irradiation, irradiation experiments, experiments by small research groups, fast neutron streaming experiment, and so on. (Mori, K.)

  13. Research on the Undergraduate Financial Engineering Education in China (United States)

    Ma, Haiyong; Zhang, Weiwei


    The rapid development of modern economy has put forward higher requirements for financial engineering education. This paper analyzes the status and problems in undergraduate financial engineering education in china, such as indistinct training objective, rigid curriculum structure, and superficial teaching methods, etc. and puts forward…

  14. Research and Practice of Active Learning in Engineering Education

    NARCIS (Netherlands)

    Graaf, de Erik; Saunders-Smits, Gillian; Nieweg, Michael


    Since 2001, the international network Active Learning in Engineering education (ALE) organized a series of international workshops on innovation of engineering education. The papers in this book are selected to reflect the state of the art, based on contributions to the 2005 ALE workshop in Holland.

  15. The Future for Industrial Engineers: Education and Research Opportunities (United States)

    Mummolo, Giovanni


    EU graduation and the recruitment of industrial engineers (IEs) have been investigated. An increasing demand is observed for graduates in almost all industrial engineering (IE) subjects. The labour market in the EU is evolving towards the service sector even if manufacturing still represents a significant share of both IE employment and gross…

  16. NREL Fuels and Engines Research: Maximizing Vehicle Efficiency and (United States)

    chemistry, conversion, and combustion to the evaluation of advanced fuels in actual engines and vehicles . With fuel chemistry, our scientific discoveries start out small. We use quantum mechanical modeling to explore how fuels with varying chemistry interact with engine and vehicle design. At our Fuel Combustion

  17. Design of a high-performance rotary stratified-charge research aircraft engine (United States)

    Jones, C.; Mount, R. E.


    The power section for an advanced rotary stratified-charge general aviation engine has been designed under contract to NASA. The single-rotor research engine of 40 cubic-inches displacement (RCI-40), now being procured for test initiation this summer, is targeted for 320 T.O. horse-power in a two-rotor production engine. The research engine is designed for operating on jet-fuel, gasoline or diesel fuel and will be used to explore applicable advanced technologies and to optimize high output performance variables. Design of major components of the engine is described in this paper.

  18. A review of internal combustion engine combustion chamber process studies at NASA Lewis Research Center (United States)

    Schock, H. J.


    The performance of internal combustion stratified-charge engines is highly dependent on the in-cylinder fuel-air mixing processes occurring in these engines. Current research concerning the in-cylinder airflow characteristics of rotary and piston engines is presented. Results showing the output of multidimensional models, laser velocimetry measurements and the application of a holographic optical element are described. Models which simulate the four-stroke cycle and seal dynamics of rotary engines are also discussed.

  19. Compilation of contract research for the Chemical Engineering Branch, Division of Engineering Technology. Annual report for FY 1985

    International Nuclear Information System (INIS)


    This compilation of annual research reports by the contractors to the Chemical Engineering Branch, DET, is published to disseminate information from ongoing programs and covers research conducted during fiscal year 1985. The programs covered in this document include research on: (1) engineered safety feature (ESF) system effectiveness in terms of fission product retention under severe accident conditions; (2) effectiveness and safety aspects of selected decontamination methods; (3) decontamination impacts on solidification and waste disposal; (4) evaluation of nuclear facility decommissioning projects and concepts, and (5) operational schemes to prevent or mitigate the effects of hydrogen combustion during LWR accidents

  20. Compilation of contract research for the Materials Engineering Branch, Division of Engineering Technology. Annual report for FY 1982

    International Nuclear Information System (INIS)


    This report presents summaries of the research work performed during Fiscal Year 1982 by laboratories and organizations under contracts administered by the NRC's Materials Engineering Branch, Office of Nuclear Regulatory Research. The contractor reports are organized into the major areas of concern to Primary System Integrity: Vessel and Piping Fracture Mechanics; Pressure Vessel Surveillance Dosimetry; Steam Generators and Environmental Cracking; and Nondestructive Examination

  1. Research on the Development and Enlightenment of Urban Environmental Engineering (United States)

    Tian, Mingjing; Li, Guanglou; Zhang, Lu; Shou, Youping; Li, Yajuan; Ye, Wei; Xu, Jing


    In recent years, under the promotion of reform and opening up, China's economic development has greatly accelerated, urbanization is also gradually accelerated. In the process of urbanization, there are many problems. The development of environmental engineering is one of the most important points. While building our living environment; we should also pay attention to the implementation of sustainable development strategies. First of all, This paper describes basic situation of environmental engineering, and finally provided some measures to promote the strengthening of China's environmental engineering

  2. Software Engineering Research/Developer Collaborations (C104) (United States)

    Shell, Elaine; Shull, Forrest


    The goal of this collaboration was to produce Flight Software Branch (FSB) process standards for software inspections which could be used across three new missions within the FSB. The standard was developed by Dr. Forrest Shull (Fraunhofer Center for Experimental Software Engineering, Maryland) using the Perspective-Based Inspection approach, (PBI research has been funded by SARP) , then tested on a pilot Branch project. Because the short time scale of the collaboration ruled out a quantitative evaluation, it would be decided whether the standard was suitable for roll-out to other Branch projects based on a qualitative measure: whether the standard received high ratings from Branch personnel as to usability and overall satisfaction. The project used for piloting the Perspective-Based Inspection approach was a multi-mission framework designed for reuse. This was a good choice because key representatives from the three new missions would be involved in the inspections. The perspective-based approach was applied to produce inspection procedures tailored for the specific quality needs of the branch. The technical information to do so was largely drawn through a series of interviews with Branch personnel. The framework team used the procedures to review requirements. The inspections were useful for indicating that a restructuring of the requirements document was needed, which led to changes in the development project plan. The standard was sent out to other Branch personnel for review. Branch personnel were very positive. However, important changes were identified because the perspective of Attitude Control System (ACS) developers had not been adequately represented, a result of the specific personnel interviewed. The net result is that with some further work to incorporate the ACS perspective, and in synchrony with the roll out of independent Branch standards, the PBI approach will be implemented in the FSB. Also, the project intends to continue its collaboration with

  3. NASA Systems Engineering Research Consortium: Defining the Path to Elegance in Systems (United States)

    Watson, Michael D.; Farrington, Phillip A.


    The NASA Systems Engineering Research Consortium was formed at the end of 2010 to study the approaches to producing elegant systems on a consistent basis. This has been a transformative study looking at the engineering and organizational basis of systems engineering. The consortium has engaged in a variety of research topics to determine the path to elegant systems. In the second year of the consortium, a systems engineering framework emerged which structured the approach to systems engineering and guided our research. This led in the third year to set of systems engineering postulates that the consortium is continuing to refine. The consortium has conducted several research projects that have contributed significantly to the understanding of systems engineering. The consortium has surveyed the application of the NASA 17 systems engineering processes, explored the physics and statistics of systems integration, and considered organizational aspects of systems engineering discipline integration. The systems integration methods have included system exergy analysis, Akaike Information Criteria (AIC), State Variable Analysis, Multidisciplinary Coupling Analysis (MCA), Multidisciplinary Design Optimization (MDO), System Cost Modelling, System Robustness, and Value Modelling. Organizational studies have included the variability of processes in change evaluations, margin management within the organization, information theory of board structures, social categorization of unintended consequences, and initial looks at applying cognitive science to systems engineering. Consortium members have also studied the bidirectional influence of policy and law with systems engineering.

  4. Global Journal of Engineering Research - Vol 14, No 1 (2015)

    African Journals Online (AJOL)

    Compressive and flexural strength of cement mortar stabilized with raffia palm fruit ... Effect of compactive effort on strength indices of laterite treated with calcium ... Engineering properties of scoria concrete as a construction material · EMAIL ...

  5. Engineering Cardiac Muscle Tissue: A Maturating Field of Research. (United States)

    Weinberger, Florian; Mannhardt, Ingra; Eschenhagen, Thomas


    Twenty years after the initial description of a tissue engineered construct, 3-dimensional human cardiac tissues of different kinds are now generated routinely in many laboratories. Advances in stem cell biology and engineering allow for the generation of constructs that come close to recapitulating the complex structure of heart muscle and might, therefore, be amenable to industrial (eg, drug screening) and clinical (eg, cardiac repair) applications. Whether the more physiological structure of 3-dimensional constructs provides a relevant advantage over standard 2-dimensional cell culture has yet to be shown in head-to-head-comparisons. The present article gives an overview on current strategies of cardiac tissue engineering with a focus on different hydrogel methods and discusses perspectives and challenges for necessary steps toward the real-life application of cardiac tissue engineering for disease modeling, drug development, and cardiac repair. © 2017 American Heart Association, Inc.

  6. Electrical engineering research support for FDOT Traffic Statistics Office (United States)


    The aim of this project was to provide electrical engineering support for the telemetered traffic monitoring sites (TTMSs) operated by the Statistics Office of the Florida Department of Transportation. This project was a continuation of project BD-54...

  7. Research on the NPP human factors engineering operating experience review

    International Nuclear Information System (INIS)

    Ren Xiangchen; Miao Hongxing; Ning Zhonghe


    This paper addresses the importance of the human factors engineering (HFE) for the design of nuclear power plant (NPP), especially for the design of human-machine interface in the NPP. It also summarizes the scope and content of the NPP HFE. The function, scope, content and process of the NPP human factors engineering operating experience review (OER) are mainly focused on, and significantly discussed. Finally, it briefly introduces the situation of the studies on the OER in China. (authors)

  8. Engineered nanomaterials: toward effective safety management in research laboratories. (United States)

    Groso, Amela; Petri-Fink, Alke; Rothen-Rutishauser, Barbara; Hofmann, Heinrich; Meyer, Thierry


    It is still unknown which types of nanomaterials and associated doses represent an actual danger to humans and environment. Meanwhile, there is consensus on applying the precautionary principle to these novel materials until more information is available. To deal with the rapid evolution of research, including the fast turnover of collaborators, a user-friendly and easy-to-apply risk assessment tool offering adequate preventive and protective measures has to be provided. Based on new information concerning the hazards of engineered nanomaterials, we improved a previously developed risk assessment tool by following a simple scheme to gain in efficiency. In the first step, using a logical decision tree, one of the three hazard levels, from H1 to H3, is assigned to the nanomaterial. Using a combination of decision trees and matrices, the second step links the hazard with the emission and exposure potential to assign one of the three nanorisk levels (Nano 3 highest risk; Nano 1 lowest risk) to the activity. These operations are repeated at each process step, leading to the laboratory classification. The third step provides detailed preventive and protective measures for the determined level of nanorisk. We developed an adapted simple and intuitive method for nanomaterial risk management in research laboratories. It allows classifying the nanoactivities into three levels, additionally proposing concrete preventive and protective measures and associated actions. This method is a valuable tool for all the participants in nanomaterial safety. The users experience an essential learning opportunity and increase their safety awareness. Laboratory managers have a reliable tool to obtain an overview of the operations involving nanomaterials in their laboratories; this is essential, as they are responsible for the employee safety, but are sometimes unaware of the works performed. Bringing this risk to a three-band scale (like other types of risks such as biological, radiation

  9. Paper in architecture: Research by design, engineering and prototyping

    Directory of Open Access Journals (Sweden)

    Jerzy F. Latka


    in terms of architecture, its material properties were researched on a micro, meso and macro level. This research of the possible applications of paper in architecture was informed by two main research questions: What is paper and to what extent can it be used in architecture? What is the most suitable way to use paper in emergency architecture? To answer the first research question, fundamental and material research on paper and paper products had to be conducted. The composition of the material, production methods and properties of paper were researched. Then paper products with the potential to be used in architecture were examined. The history of the development of paper and its influence on civilisation helped the author gain a better understanding of the nature of this material, which we encounter in our lives every day. Research on objects for everyday use, furniture, pavilions and architecture realised in the last 150 years allowed the author to distinguish various types of paper design and paper architecture. Analysis of realised buildings in which paper products were used as structural elements and parts of the building envelope resulted in a wide array of possible solutions. Structural systems, types of connections between the various elements, impregnation methods and the functionalities and lifespan of different types of buildings were systematised. The knowledge thus collected allowed the author to conduct a further exploration of paper architecture in the form of designs and prototypes. To answer the second research question, the analysed case studies were translated into designs and prototypes of emergency shelters. During the research-by-design, engineering and prototyping phases, more than a dozen prototypes were built. The prototypes differed in terms of structural systems, used materials, connections between structural elements, impregnation methods, functionality and types of building. The three versions of the Transportable Emergency Cardboard

  10. Evidências de validade da Escala Brasileira de Solidão UCLA

    Directory of Open Access Journals (Sweden)

    Sabrina Martins Barroso


    Full Text Available RESUMO Objetivo Este trabalho investigou as evidências de validade da Escala de Solidão UCLA para aplicação na população brasileira. Métodos Foram seguidas as fases: (1 autorização do autor e do Comitê de Ética; (2 tradução e retrotradução; (3 adaptação semântica; (4 validação. Utilizou-se para análise dos dados análise descritiva, fatorial exploratória, alpha de Cronbach, Kappa, teste de esfericidade de Barlett, teste Kaiser-Meyer-Olkin e correlação de Pearson. Para a adaptação, a escala foi submetida a especialistas e a um grupo focal com 8 participantes para adaptação semântica e a um estudo piloto com 126 participantes para adaptação transcultural. Da validação, participaram 818 pessoas, entre 20 e 87 anos, que responderam a duas versões da UCLA, ao Questionário de Saúde do Paciente, à Escala de Percepção de Suporte Social e a um questionário elaborado pelos autores. Resultados A escala mostrou dois fatores, que explicaram 56% da variância e alpha de 0,94. Conclusões A Escala de Solidão UCLA-BR indicou evidências de validade de construto e discriminante, além de boa fidedignidade, podendo ser utilizada para avaliação da solidão na população brasileira.

  11. The Contribution of Qualitative Research Towards the Issues Affecting Female Undergraduate Engineering Students (United States)

    Duggan, Louise Maria


    This article explores the use of qualitative research methods towards our understanding of the issues affecting female undergraduate engineers. As outlined in this article female engineering students face many challenges during their undergraduate studies. Qualitative research methods provide an opportunity to gain a deeper understanding of the…

  12. Overview of the CTR blanket engineering research program at the University of Tokyo

    International Nuclear Information System (INIS)

    Nakazawa, Masaharu; Madarame, Haruki; Takahashi, Yoichi; Takagi, Toshiyuki


    A small overview has been given on the fusion reactor blanket engineering research program at the University of Tokyo as an introduction to the following articles, especially in its history, organization, experimental facilities and ten years research activity. (orig.)

  13. Research on LQR optimal control method of active engine mount (United States)

    Huan, Xie; Yu, Duan


    In this paper, the LQR control method is applied to the active mount of the engine, and a six-cylinder engine excitation model is established. Through the joint simulation of AMESim and MATLAB, the vibration isolation performance of the active mount system and the passive mount system is analyzed. Excited by the multi-engine operation, the simulation results of the vertical displacement, acceleration and dynamic deflection of the vehicle body show that the vibration isolation capability of the active mount system is superior to that of the passive mount system. It shows that compared with the passive mount, LQR active mount can greatly improve the vibration isolation performance, which proves the feasibility and effectiveness of the LQR control method.

  14. [Research progress of genetic engineering on medicinal plants]. (United States)

    Teng, Zhong-qiu; Shen, Ye


    The application of genetic engineering technology in modern agriculture shows its outstanding role in dealing with food shortage. Traditional medicinal plant cultivation and collection have also faced with challenges, such as lack of resources, deterioration of environment, germplasm of recession and a series of problems. Genetic engineering can be used to improve the disease resistance, insect resistance, herbicides resistant ability of medicinal plant, also can improve the medicinal plant yield and increase the content of active substances in medicinal plants. Thus, the potent biotechnology can play an important role in protection and large area planting of medicinal plants. In the development of medicinal plant genetic engineering, the safety of transgenic medicinal plants should also be paid attention to. A set of scientific safety evaluation and judgment standard which is suitable for transgenic medicinal plants should be established based on the recognition of the particularity of medicinal plants.

  15. Research and development of turbo engines in HYPR project. Choonsoku yusokiyo suishin system no kenkyu kaihatsu ni okeru turbo kei engine no shisaku

    Energy Technology Data Exchange (ETDEWEB)

    Watanabe, Y; Itahara, H; Kohara, S [Ishikawajima-Harima Heavy Industries, Co. Ltd., Tokyo (Japan)


    The present paper outlined the project which aimed at developing a combined cycle engine by a combination of turbojet engine operable from the takeoff or landing to Mach 3 and ramjet engine operable from Mach 2.5 to 5. The outline included the test result report of a prototypical engine which was the main subject of project. Upon conceptual research on the engine to comply with the future supersonic passenger plane, a variable cycle engine jointly equipped with a mixer/ejector noise lowering device was applied as a turbojet engine to lower the noise. The prototypical turbojet engine which was a target engine subscaled to about 1/10 in thrust aimed at demonstrating the total system performance of the turbojet engine which structured a combined cycle engine. Prior to testing the above prototype, the core engine was singly tested (in Phase 1) with a confirmed good result in firing and startup characteristics. 4 refs., 9 figs., 3 tabs.

  16. Biomedical engineering - A means to add new dimension to medicine and research (United States)

    Doerr, D. F.


    Biomedical engineering is an evolving science that seeks to insert technically oriented and trained personnel to assist medical professionals in solving technological problems in the pursuit of innovations in the delivery of health care. Consequently, engineering solutions are brought to bear on problems that previously were outside the training of physicians and beyond the understanding or appreciation of the conventionally educated electrical or mechanical engineers. This physician/scientist/engineer team has a capability to extend medicine and research far beyond the capability of a single entity operating alone. How biomedical engineering has added a new dimension to medical science at the Kennedy Space Center is described.

  17. Software Engineering Research/Developer Collaborations in 2005 (United States)

    Pressburger, Tom


    In CY 2005, three collaborations between software engineering technology providers and NASA software development personnel deployed three software engineering technologies on NASA development projects (a different technology on each project). The main purposes were to benefit the projects, infuse the technologies if beneficial into NASA, and give feedback to the technology providers to improve the technologies. Each collaboration project produced a final report. Section 2 of this report summarizes each project, drawing from the final reports and communications with the software developers and technology providers. Section 3 indicates paths to further infusion of the technologies into NASA practice. Section 4 summarizes some technology transfer lessons learned. Also included is an acronym list.

  18. Solar Climate Engineering and Intellectual Property : Toward a Research Commons

    NARCIS (Netherlands)

    Reynolds, Jesse|info:eu-repo/dai/nl/363244638; Contreras, Jorge L; Sarnoff, Joshua D


    Climate change is one of the greatest challenges confronting society today. Solar climate engineering (SCE) has the potential to reduce climate risks substantially. This controversial technology would make the earth more reflective in order to counteract global warming. The science of SCE is still

  19. Software engineering technology innovation: Turning research results into industrial success

    NARCIS (Netherlands)

    Punter, H.T.; Krikhaar, R.L.; Bril, R.J.


    This paper deals with the innovation of software engineering technologies. These technologies are methods and tools for conducting software development and maintenance. We consider innovation as a process consisting of two phases, being technology creation and technology transfer. In this paper, we

  20. Climate engineering research : A precautionary response to climate change?

    NARCIS (Netherlands)

    Reynolds, J.L.; Fleurke, F.M.


    In the face of dire forecasts for anthropogenic climate change, climate engineering is increasingly discussed as a possible additional set of responses to reduce climate change’s threat. These proposals have been controversial, in part because they – like climate change itself – pose uncertain risks

  1. Linking Civil Engineering Education And Research With Industry (Session Keynote)

    DEFF Research Database (Denmark)

    Virdi, Kuldeep

    Linking engineering education with industry has been a basic aim of educators almost from the beginning of modern degree programmes. In the USA, reference is often made to ‘co-operative education’, where students spend periods in industry within the duration of their stay in a university. Indeed...

  2. Researches on Preliminary Chemical Reactions in Spark-Ignition Engines (United States)


    compression type, without ignition, the resulting preliminary reactions being detectable and meas- urable thermometrically . Contents I. Influence of Preliminary...thoroughly insulated be- tween the carburettor and the engine, by aluminium foil and asbestos. -I -I " I" I ’I il i~ " !, I I 1𔃻I I’ ) To enable the

  3. Biomedical Engineering: A Compendium of Research Training Programs. (United States)

    National Inst. of General Medical Sciences (NIH), Bethesda, MD.

    This document was prepared to provide a comprehensive view of the programs in biomedical engineering in existence in 1969. These programs are supported by the National Institute of General Medical Sciences and are located at 18 universities. This compendium provides information as to the intent and content of these programs from data provided by…

  4. Research on Building Education & Workforce Capacity in Systems Engineering (United States)


    engineered a hybrid vehicle (mail truck) with an electric motor capable of regenerative braking . At other institutions, student teams worked...SPRDE- SE/PSE Competency Model into lower (definitional) or higher (development, deployment) categories of analysis (Sage, 2000, p. 166). For the...entire set of matched responses, statistically significant increases were recorded for all categories of competencies combined, and for categories B

  5. Software engineering technology innovation - Turning research results into industrial success

    NARCIS (Netherlands)

    Punter, T.; Krikhaar, R.L.; Bril, R.J.


    This paper deals with the innovation of software engineering technologies. These technologies are methods and tools for conducting software development and maintenance. We consider innovation as a process consisting of two phases, being technology creation and technology transfer. In this paper, we

  6. Annual report of Nuclear Engineering Research Laboratory, University of Tokyo in fiscal 1991

    International Nuclear Information System (INIS)


    In this annual report, the activities of education and research, the state of operation of research facilities and others in Nuclear Engineering Research Laboratory, University of Tokyo in fiscal year 1991 are summarized. In this Laboratory, there are four large research facilities, that is, the fast neutron source reactor 'Yayoi', the electron beam linac, the nuclear fusion reactor blanket experiment facility and the heavy irradiation research facility. Those are used for carrying out education and research in the wide fields of nuclear engineering, and are offered also for joint utilization. The results of the research by using respective research facilities were summarized in separate reports. In this annual report, the course of the management and operation of respective research facilities is described, and the research activities, the theses for doctorate and graduation theses of the teachers, personnel and graduate students in the Laboratory are summarized. In the research, those on first wall engineering for fusion reactors, fuel cycle engineering, electromagnetic structure engineering, AI and robotics, quantum beam engineering, new type reactor design and so on are included. (K.I.)

  7. Leveraging lean principles in creating a comprehensive quality program: The UCLA health readmission reduction initiative. (United States)

    Afsar-Manesh, Nasim; Lonowski, Sarah; Namavar, Aram A


    UCLA Health embarked to transform care by integrating lean methodology in a key clinical project, Readmission Reduction Initiative (RRI). The first step focused on assembling a leadership team to articulate system-wide priorities for quality improvement. The lean principle of creating a culture of change and accountability was established by: 1) engaging stakeholders, 2) managing the process with performance accountability, and, 3) delivering patient-centered care. The RRI utilized three major lean principles: 1) A3, 2) root cause analyses, 3) value stream mapping. Baseline readmission rate at UCLA from 9/2010-12/2011 illustrated a mean of 12.1%. After the start of the RRI program, for the period of 1/2012-6/2013, the readmission rate decreased to 11.3% (p<0.05). To impact readmissions, solutions must evolve from smaller service- and location-based interventions into strategies with broader approach. As elucidated, a systematic clinical approach grounded in lean methodologies is a viable solution to this complex problem. Copyright © 2017 Elsevier Inc. All rights reserved.

  8. UCLA's outreach program of science education in the Los Angeles schools. (United States)

    Palacio-Cayetano, J; Kanowith-Klein, S; Stevens, R


    The UCLA School of Medicine's Interactive Multi-media Exercises (IMMEX) Project began its outreach into pre-college education in the Los Angeles area in 1993. The project provides a model in which software and technology are effectively intertwined with teaching, learning, and assessment (of both students' and teachers' performances) in the classroom. The project has evolved into a special collaboration between the medical school and Los Angeles teachers. UCLA faculty and staff work with science teachers and administrators from elementary, middle, and high schools. The program benefits ethnically and racially diverse groups of students in schools ranging from the inner city to the suburbs. The project's primary goal is to use technology to increase students' achievement and interest in science, including medicine, and thus move more students into the medical school pipeline. Evaluations from outside project evaluators (West Ed) as well as from teachers and IMMEX staff show that the project has already had a significant effect on teachers' professional development, classroom practice, and students' achievement in the Los Angeles area.

  9. Software Engineering Researchers' Attitudes on Case Studies and Experiments: an Exploratory Survey


    Tofan, Dan; Galster, Matthias; Avgeriou, Paris; Weyns, Danny


    Background: Case studies and experiments are research methods frequently applied in empirical software engineering. Experiments are well-­understood and their value as an empirical method is recognized. On the other hand, there seem to be different opinions on what constitutes a case study, and about the value of case studies as a thorough research method. Aim: We aim at exploring the attitudes of software engineering researchers on case studies and experiments. Furthermore, we investigate ho...

  10. Research report 1987-1989: Environmental Quality Laboratory and Environmental Engineering Science, W. M. Keck Laboratories


    Brooks, Norman H.


    This research biennial report for 1987-89 covers the activities of both the Environmental Engineering Science program and the Environmental Quality Laboratory for the period October 1987-November 1989. Environmental Engineering Science is the degree-granting academic program housed in the Keck Laboratories, with associated research projects. The Environmental Quality Laboratory is a research center focusing on large scale problems of environmental quality and natural resources. All the facult...

  11. Annual report of the Science and Engineering Research Council 1992-1993

    International Nuclear Information System (INIS)


    Details of expenditure and reports of the activities of the four Boards which operate as the Science and Engineering Research Council are given. These are the Astronomical and Planetry Science Board, the Engineering Board, the Nuclear Physics Board and the Science Board. There is also a report on the optical physics and optoelectronic research supported by the Council. Committee membership, studentship, fellowships research grants and administration details are reported. (UK)

  12. Software Engineering Research/Developer Collaborations in 2004 (C104) (United States)

    Pressburger, Tom; Markosian, Lawrance


    In 2004, six collaborations between software engineering technology providers and NASA software development personnel deployed a total of five software engineering technologies (for references, see Section 7.2) on the NASA projects. The main purposes were to benefit the projects, infuse the technologies if beneficial into NASA, and give feedback to the technology providers to improve the technologies. Each collaboration project produced a final report (for references, see Section 7.1). Section 2 of this report summarizes each project, drawing from the final reports and communications with the software developers and technology providers. Section 3 indicates paths to further infusion of the technologies into NASA practice. Section 4 summarizes some technology transfer lessons learned. Section 6 lists the acronyms used in this report.

  13. Research Technology (ASTP) Rocket Based Combined Cycle (RBCC) Engine (United States)


    Pictured is an artist's concept of the Rocket Based Combined Cycle (RBCC) launch. The RBCC's overall objective is to provide a technology test bed to investigate critical technologies associated with opperational usage of these engines. The program will focus on near term technologies that can be leveraged to ultimately serve as the near term basis for Two Stage to Orbit (TSTO) air breathing propulsions systems and ultimately a Single Stage To Orbit (SSTO) air breathing propulsion system.

  14. High temperature engineering research facilities and experiments in China

    International Nuclear Information System (INIS)

    Xu, Yuanhui; Liu, Meisheng; Yao, Huizhong; Ju, Huaiming


    June 14, 1995, the construction of a pebble bed type high temperature gas-cooled reactor (HTGR) started in China. It is a test reactor with 10 MW thermal power output (termed HTR- 10). The test reactor is located on the site of Institute of Nuclear Energy Technology (INET) of Tsinghua University in the northwest suburb of Beijing, about 40 km away from the city. Design of the HTR-10 test reactor represents the features of HTR-Modular design: 'side-by-side' arrangement, spherical fuel elements with 'multi-pass' loading scheme, completely passive decay heat removal, reactor shutdown systems in the side reflector, etc. However, in the HTR-10 design some modifications from the HTR-Module were made to satisfy Chinese conditions. For example, the steam generator is composed of a number of modular helical tubes with small diameter, pulse pneumatic discharging apparatus are used in the fuel handling system and step motor driving control rods are designed. These modifications would cause some uncertainty in our design. It is necessary to do engineering experiments to prove these new or modified ideas. Therefore, a program of engineering experiments for HTR-10 key technologies is being conducted at INET. The main aims of these engineering experiments are to verify the designed characteristics and performance of the components and systems, to feedback on design and to obtain operational experiences. Those engineering experiments are depressurization test of the hot gas duct at room temperature and operating pressure, performance test of the hot gas duct at operating helium temperature and pressure, performance test of the pulse pneumatic fuel handling system, test of the control rods driving apparatus, two phase flow stability test for the once through steam generator and cross mixture test at the bottom of the reactor core

  15. Global Journal of Engineering Research - Vol 6, No 2 (2007)

    African Journals Online (AJOL)

    The effect of spark-plug location on Nox and VOC emissions in a single cylinder two-store Si engine using blend fuel · EMAIL FREE FULL TEXT EMAIL FREE FULL TEXT DOWNLOAD FULL TEXT DOWNLOAD FULL TEXT. F I Abam, A Kuhe, M I Ofem, 79-82. ...

  16. Listing of engineering research contract reports under the DREAM, AERD and ERDAF programs of the Research Branch, 1973-1988

    Energy Technology Data Exchange (ETDEWEB)

    Morrison, B A; Thuns, A; Feldman, M


    To supplement in-house investigations, Agriculture Canada contracted out research in a number of programs including three which supported engineering work. This document lists the contracts awarded under the programs and provides reference citations of the contract reports. Reports are grouped by file number, scientific authority, author or contractor, and subject, and a subject index is also included. The three programs are: Development, Research and Evaluation in Agricultural Mechanization (DREAM), Agricultural Engineering Research and Development Program (AERD), and Energy Research and Development in Agriculture and Food (ERDAF). AERD, which replaced DREAM, has been terminated, but the ERDAF program is still continuing as of the date of this document.

  17. Hybrid rocket engine research program at Ryerson University

    Energy Technology Data Exchange (ETDEWEB)

    Karpynczyk, J.; Greatrix, D.R. [Ryerson Polytechnic Univ., Toronto, ON (Canada). Dept. of Aerospace Engineering


    Hybrid rocket engines (HREs) are a combination of solid and liquid propellant rocket engine designs. A solid fuel grain is located in the main combustion chamber and nozzle aft, while a stored liquid or gaseous oxidizer source supplies the required oxygen content through a throttle valve, for combustion downstream in the main chamber. HREs have drawn significant interest in certain flight applications, as they can be advantageous in terms of cost, ease and safety in storage, controllability in flight, and availability of propellant constituents. Key factors that will lead to further practical usage of HREs for flight applications are their predictability and reproducibility of operational performance. This paper presented information on studies being conducted at Ryerson University aimed at analyzing and testing the performance of HREs. It discussed and illustrated the conventional HRE and analyzed engine performance considerations such as the fuel regression rate, mass flux about the fuel surface, burning rate, and zero transformation parameter. Other factors relating to HRE performance that were presented included induced forward and aft oxidizer flow swirl effects as a means for augmenting the fuel regression rate, stoichiometric grain length issues, and feed system stability. Last, the paper presented a simplified schematic diagram of a proposed thrust/test stand for HRE test firings. 2 refs., 3 figs.

  18. Aero-methods and engineering research and development

    Energy Technology Data Exchange (ETDEWEB)

    Peterson, R K


    There is presently a sharp, ongoing increase in the volume of work being conducted throughout the country associated with the development of natural gas fields as well as the resulting accelerated development of major gas trunklines. Aero-methods have presently found wide application in the engineering and planning of equipment for such projects. Success has been obtained by the increased quantity and quality of the available engineering information: The ''Giprospetsgaz'' Institute is using aerial photography as the basis for selecting pipeline routes and to more accurately determine the equipment requirements along proposed trunklines such as for compressors, gas transfer stations, electrical power substations, worker settlements, water and transport infrastructure and communications. These requirements are the most important factors in reducing capital operating expenditures. The greatest savings, in economic terms, can be achieved by avoiding sparsely settled or uninhabited areas as much as possible. Similiarly, aerial photography coupled with computer application aids in the solution of engineering problems. Third-generation computers are recommended for this process.

  19. CRISPR Genome Engineering for Human Pluripotent Stem Cell Research. (United States)

    Chaterji, Somali; Ahn, Eun Hyun; Kim, Deok-Ho


    The emergence of targeted and efficient genome editing technologies, such as repurposed bacterial programmable nucleases (e.g., CRISPR-Cas systems), has abetted the development of cell engineering approaches. Lessons learned from the development of RNA-interference (RNA-i) therapies can spur the translation of genome editing, such as those enabling the translation of human pluripotent stem cell engineering. In this review, we discuss the opportunities and the challenges of repurposing bacterial nucleases for genome editing, while appreciating their roles, primarily at the epigenomic granularity. First, we discuss the evolution of high-precision, genome editing technologies, highlighting CRISPR-Cas9. They exist in the form of programmable nucleases, engineered with sequence-specific localizing domains, and with the ability to revolutionize human stem cell technologies through precision targeting with greater on-target activities. Next, we highlight the major challenges that need to be met prior to bench-to-bedside translation, often learning from the path-to-clinic of complementary technologies, such as RNA-i. Finally, we suggest potential bioinformatics developments and CRISPR delivery vehicles that can be deployed to circumvent some of the challenges confronting genome editing technologies en route to the clinic.

  20. Impact of Commercial Search Engines and International Databases on Engineering Teaching and Research (United States)

    Chanson, Hubert


    For the last three decades, the engineering higher education and professional environments have been completely transformed by the "electronic/digital information revolution" that has included the introduction of personal computer, the development of email and world wide web, and broadband Internet connections at home. Herein the writer compares…

  1. Building Infrastructure for Preservation and Publication of Earthquake Engineering Research Data

    Directory of Open Access Journals (Sweden)

    Stanislav Pejša


    Full Text Available The objective of this paper is to showcase the progress of the earthquake engineering community during a decade-long effort supported by the National Science Foundation in the George E. Brown Jr., Network for Earthquake Engineering Simulation (NEES. During the four years that NEES network operations have been headquartered at Purdue University, the NEEScomm management team has facilitated an unprecedented cultural change in the ways research is performed in earthquake engineering. NEES has not only played a major role in advancing the cyberinfrastructure required for transformative engineering research, but NEES research outcomes are making an impact by contributing to safer structures throughout the USA and abroad. This paper reflects on some of the developments and initiatives that helped instil change in the ways that the earthquake engineering and tsunami community share and reuse data and collaborate in general.

  2. General aviation internal-combustion engine research programs at NASA-Lewis Research Center (United States)

    Willis, E. A.


    An update is presented of non-turbine general aviation engine programs. The program encompasses conventional, lightweight diesel and rotary engines. It's three major thrusts are: (1) reduced SFC's; (2) improved fuels tolerance; and (3) reduced emissions. Current and planned future programs in such areas as lean operation, improved fuel management, advanced cooling techniques and advanced engine concepts, are described. These are expected to lay the technology base, by the mid to latter 1980's, for engines whose life cycle fuel costs are 30 to 50% lower than today's conventional engines.

  3. Developing engineering students' research and technology assessment abilities

    NARCIS (Netherlands)

    Vries, de M.J.; Stroeken, J.H.M.


    This article describes research done among M. Eng. students in several faculties of the Eindhoven University of Technology into their abilities to integrate nontechnical (social) elements in the research that led to their M. Eng. theses. It was found that these students often lacked research skills

  4. Supporting collaboration in interdisciplinary research of water–energy–food nexus by means of ontology engineering

    Directory of Open Access Journals (Sweden)

    Terukazu Kumazawa


    The introduction of ontology engineering approach will enable us to share a common language and a common theoretical basis. But the development of the new method based on ontology engineering is necessary. For example, knowledge structuring according to each perspective of researchers and simple figure accompanied with a reasoned argument in the background are the directions of tool development.

  5. Research on Five Stakeholders & Five Relationships of Higher Engineering Education in China


    Guangshe Jia; Chengbin Xiao


    With the development of globalization, higher engineering education has been on the rise which includes five Stakeholders and five relationships. This paper will discuss five relations of higher engineering education: teaching, research and social services, professional education and humanity education, ability education and knowledge education, theoretical teaching and practical teaching, development of education and development of national and regional economy. Among them, teaching, researc...

  6. The Use of Motivation Theory in Engineering Education Research: A Systematic Review of Literature (United States)

    Brown, Philip R.; McCord, Rachel E.; Matusovich, Holly M.; Kajfez, Rachel L.


    Motivation is frequently studied in the context of engineering education. However, the use of the term motivation can be inconsistent, both in how clearly it is defined and in how it is implemented in research designs and practice. This systematic literature review investigates the use of motivation across recent engineering education…

  7. FY2011 Annual Progress Report for Advanced Combustion Engine Research and Development

    Energy Technology Data Exchange (ETDEWEB)



    Annual Progress Report for the Advanced Combustion Engine Research and Development (R&D) subprogram supporting the mission of the Vehicle Technologies Program by removing the critical technical barriers to commercialization of advanced internal combustion engines (ICEs) for passenger and commercial vehicles that meet future federal emissions regulations.

  8. How authors did it - a methodological analysis of recent engineering education research papers in the European Journal of Engineering Education (United States)

    Malmi, Lauri; Adawi, Tom; Curmi, Ronald; de Graaff, Erik; Duffy, Gavin; Kautz, Christian; Kinnunen, Päivi; Williams, Bill


    We investigated research processes applied in recent publications in the European Journal of Engineering Education (EJEE), exploring how papers link to theoretical work and how research processes have been designed and reported. We analysed all 155 papers published in EJEE in 2009, 2010 and 2013, classifying the papers using a taxonomy of research processes in engineering education research (EER) (Malmi et al. 2012). The majority of the papers presented either empirical work (59%) or were case reports (27%). Our main findings are as follows: (1) EJEE papers build moderately on a wide selection of theoretical work; (2) a great majority of papers have a clear research strategy, but data analysis methods are mostly simple descriptive statistics or simple/undocumented qualitative research methods; and (3) there are significant shortcomings in reporting research questions, methodology and limitations of studies. Our findings are consistent with and extend analyses of EER papers in other publishing venues; they help to build a clearer picture of the research currently published in EJEE and allow us to make recommendations for consideration by the editorial team of the journal. Our employed procedure also provides a framework that can be applied to monitor future global evolution of this and other EER journals.

  9. Visualization techniques in diesel engine research. Diesel Engine kenkyu ni okeru kashika gijutsu

    Energy Technology Data Exchange (ETDEWEB)

    Komori, M.; Tsujimura, K. (New ACE., Tsukuba (Japan))


    In order to grasp the phenomena actually occurring in the combustion chamber for improving the combustion and for reducing the exhaust gas emission of the diesel engines, the visualization techniques are becoming to be essential and indispensable. The authors have observed the spray and combustion, when proceeding the combustion improvement by the high pressure injection, and then have performed the image processing and simulation calculation based on them. The high pressure injection devices used for the experiment are the intensifier type and accumulator type which can generate the injection pressure more than 200MPa, and both of them are the electronic controlled hydraulic drive type, and are driven separately from the engine. Since it was found that the analysis of high pressure injection by the hologram is limited in the conditions, as for the spray, the spray analysis was performed by the transmitted light attenuation method and laser sheet method. As for the combustion, the engine for observing the combustion was trially made, and then the combustion state was observed by the high speed photograph. Furthermore, the flame temperature analysis by the image processing using the combustion photograph and the analysis of flow and turbulence of the flame were carried out. 9 refs., 16 figs.

  10. Technology research and development

    International Nuclear Information System (INIS)

    Haas, G.M.; Abdov, M.A.; Baker, C.C.; Beuligmann, R.F.


    The U.S. Dept. of Energy discusses the new program plan, the parameters of which are a broad scientific and technology knowledge base, an attractive plasma configuration to be determined, and other issues concerning uncertainty as to what constitutes attractive fusion options to be determined in the future, and increased collaboration. Tables show changing directions in magnetic fusion energy, two examples of boundary condition impacts on long-term technology development, and priority classes of the latter. The Argonne National Laboratory comments on the relationship between science, technology and the engineering aspects of the fusion program. UCLA remarks on the role of fusion technology in the fusion program plan, particularly on results from the recent studies of FINESSE. General Dynamics offers commentary on the issues of a reduced budget, and new emphasis on science which creates an image of the program. A table illustrates technology research and development in the program plan from an industrial perspective

  11. A review of internal combustion engine combustion chamber process studies at NASA Lewis Research Center (United States)

    Schock, H. J.


    The performance of internal combustion stratified-charge engines is highly dependent on the in-cylinder fuel-air mixing processes occurring in these engines. Current research concerning the in-cylinder airflow characteristics of rotary and piston engines is presented. Results showing the output of multidimensional models, laser velocimetry measurements and the application of a holographic optical element are described. Models which simulate the four-stroke cycle and seal dynamics of rotary engines are also discussed. Previously announced in STAR as N84-24999

  12. Research and assessment of competitiveness of large engineering complexes

    Directory of Open Access Journals (Sweden)

    Krivorotov V.V.


    Full Text Available The urgency of the problem of ensuring the competitiveness of manufacturing and high-tech sectors is shown. Substantiated the decisive role of the large industrial complexes in the formation of the results of the national economy; the author’s interpretation of the concept of “industrial complex” with regard to current economic systems. Current approaches to assessing the competitiveness of enterprises and industrial complexes are analyzed; showing their main advantages and disadvantages. Provides scientific-methodological approach to the study and management of competitiveness of a large industrial complex; the description of its main units is provided. As a Central element of the scientific methodology approach proposed the methodology for assessing the competitiveness of a large industrial complex based on the Pattern-method; a modular system of indicators of competitiveness is developed and its adaptation to a large engineering complexes is made. Using the developed methodology the competitiveness of one of the largest engineering complexes of the group of companies Uralelectrotyazhmash, which is the leading enterprises in electrotechnical industry of Russia is assessed. The evaluation identified the main problems and bottlenecks in the development of these enterprises, and their comparison with leading competitors is provided. According to the results of the study the main conclusions and recommendations are formed.

  13. Research of Simulation in Character Animation Based on Physics Engine

    Directory of Open Access Journals (Sweden)

    Yang Yu


    Full Text Available Computer 3D character animation essentially is a product, which is combined with computer graphics and robotics, physics, mathematics, and the arts. It is based on computer hardware and graphics algorithms and related sciences rapidly developed new technologies. At present, the mainstream character animation technology is based on the artificial production of key technologies and capture frames based on the motion capture device technology. 3D character animation is widely used not only in the production of film, animation, and other commercial areas but also in virtual reality, computer-aided education, flight simulation, engineering simulation, military simulation, and other fields. In this paper, we try to study physics based character animation to solve these problems such as poor real-time interaction that appears in the character, low utilization rate, and complex production. The paper deeply studied the kinematics, dynamics technology, and production technology based on the motion data. At the same time, it analyzed ODE, PhysX, Bullet, and other variety of mainstream physics engines and studied OBB hierarchy bounding box tree, AABB hierarchical tree, and other collision detection algorithms. Finally, character animation based on ODE is implemented, which is simulation of the motion and collision process of a tricycle.

  14. Annual report of Nuclear Engineering Research Laboratory, University of Tokyo in fiscal 1989

    International Nuclear Information System (INIS)


    This report summerizes the research and educational activities at the Nuclear Engineering Research Laboratory, Faculty of Engineering, University of Tokyo. The Laboratory holds four main facilities, which are Yayoi reactor, an electron accelerator, fusion blanket research facility, and heavy ion irradiation research facility. And they are open to the researchers both inside and outside the University. The application of the facilities are described. The activities and achievements of the Laboratory staffs, and theses for graduate, master, and doctor degrees are also summerized. (J.P.N.)

  15. The impact of information technology on research in science and engineering

    Energy Technology Data Exchange (ETDEWEB)

    Morell, J.A.


    There is little research on the impact of information technology (IT) on how research is carried out by scientists and engineers. This paper draws on other bodies of writings which indirectly shed light on this question. Included are: the role of calculation in research, scientific productivity, the philosophical underpinnings of science and technology, systems analysis, and the use of computer aided design in engineering. A model is developed which helps identify the types of impact that IT may have on social system and epistemological aspects of research. Factors are hypothesized which may explain why IT may have particular effects in any given research endeavor.

  16. Summaries of the Idaho National Engineering Laboratory Radioecology and Ecology Program research projects

    International Nuclear Information System (INIS)

    Markham, O.D.


    This report provides summaries of individual research projects conducted by the Idaho National Engineering Laboratory Radioecology and Ecology Program. Summaries include projects in various stages, from those that are just beginning, to projects that are in the final publication stage

  17. [Research Conducted at the Institute for Computer Applications in Science and Engineering (United States)


    This report summarizes research conducted at the Institute for Computer Applications in Science and Engineering in applied mathematics, fluid mechanics, and computer science during the period 1 Oct. 1996 - 31 Mar. 1997.

  18. Research in progress at the Institute for Computer Applications in Science and Engineering (United States)


    This report summarizes research conducted at the Institute for Computer Applications in Science and Engineering in applied mathematics, numerical analysis, and computer science during the period April 1, 1987 through October 1, 1987.

  19. Research on the actual condition on the licensed chief engineers of radiation

    International Nuclear Information System (INIS)


    A research on the actual condition on the licensed chief engineers of radiation was performed on October, 1975. Question cards were sent to 2915 facilities in Japan, and answers came back from 2850 facilities. Answers report the size of each facility, number of employee, number of chief engineers in charge, age of chief engineers, appointment authority, responsibility, improvement of working condition of chief engineer, and assistant officer for chief engineer. The number of worker is 62,456 in 2,769 facilities. The number of chief engineer in charge is 3,286 containing 579 doctor and/or dentist. The age of chief in 80 percent facilities is above 31. System of management of radiation safety was also investigated. (Kato, T.)

  20. Frontiers in chemical engineering: research needs and opportunities

    National Research Council Canada - National Science Library

    National Research Council Staff; Commission on Physical Sciences, Mathematics, and Applications; Division on Engineering and Physical Sciences; National Research Council


    ...: Research Needs and Opportunities Board on Chemical Sciences and Technology Commission on Physical Sciences, Mathematics, and Resources National Research Council NATIONAL ACADEMY PRESS Washington, D.C. 1988 i Copyrighttrue Please breaks inserted. are Page files. accidentally typesetting been have may original from the errors not typographic original ret...

  1. Repurposing digital methods: The research affordances of platforms and engines

    NARCIS (Netherlands)

    Weltevrede, E.J.T.


    Digital research is often understood as data-driven. Yet the ways in which data are already informed by specific analytical assumptions and inscriptions of the media in which they originate, circulate, or are being used is often neglected. The thesis intervenes in such focus on digital research in

  2. Systems Engineering-Based Tool for Identifying Critical Research Systems (United States)

    Abbott, Rodman P.; Stracener, Jerrell


    This study investigates the relationship between the designated research project system independent variables of Labor, Travel, Equipment, and Contract total annual costs and the dependent variables of both the associated matching research project total annual academic publication output and thesis/dissertation number output. The Mahalanobis…

  3. 78 FR 48659 - Board on Coastal Engineering Research (United States)


    ... Hurricane Sandy Rebuilding Task Force and Hurricane Sandy Coastal Projects Performance Evaluation Study... Station, 3909 Halls Ferry Road, Vicksburg, MS 39180-6199, phone 601-634-2513, or [email protected] fund requirements for the conduct of research and development of research projects in consonance with...

  4. Operational safety related human engineering research in Finland

    International Nuclear Information System (INIS)

    Haapanen, P.; Wahlstroem, B.


    Human errors contribute considerably to the total risk of the nuclear power plants as was clearly demonstrated at the TMI-accident in 1979. This fact was recognized early in Finland and a comprehensive research program was established in the second half of the 1970s. This paper gives a short description of some research projects in this program. (author)

  5. Science Teachers' Misconceptions in Science and Engineering Distinctions: Reflections on Modern Research Examples (United States)

    Antink-Meyer, Allison; Meyer, Daniel Z.


    The aim of this exploratory study was to learn about the misconceptions that may arise for elementary and high school science teachers in their reflections on science and engineering practice. Using readings and videos of real science and engineering work, teachers' reflections were used to uncover the underpinnings of their understandings. This knowledge ultimately provides information about supporting professional development (PD) for science teachers' knowledge of engineering. Six science teachers (two elementary and four high school teachers) participated in the study as part of an online PD experience. Cunningham and Carlsen's (Journal of Science Teacher Education 25:197-210, 2014) relative emphases of science and engineering practices were used to frame the design of PD activities and the analyses of teachers' views. Analyses suggest misconceptions within the eight practices of science and engineering from the US Next Generation Science Standards in four areas. These are that: (1) the nature of the practices in both science and engineering research is determined by the long-term implications of the research regardless of the nature of the immediate work, (2) engineering and science are hierarchical, (3) creativity is inappropriate, and (4) research outcomes cannot be processes. We discuss the nature of these understandings among participants and the implications for engineering education PD for science teachers.

  6. Annual report of Nuclear Engineering Research Laboratory, University of Tokyo in fiscal 1990

    International Nuclear Information System (INIS)


    In this annual report, the activities of research and education and the state of operation of the research facilities in this Laboratory in fiscal year 1990 are summarized. There are four large research facilities in this Laboratory, that is, the fast neutron source reactor 'Yayoi', the electron beam linear accelerator, the nuclear fusion reactor blanket experiment device and the heavy ion irradiation research facility. Those are used to execute research and education in the wide fields of atomic energy engineering, and put to the common utilization by universities in whole Japan. The results of the research with these facilities have been reported in the separate reports. The research aims at developing the most advanced and new fields in nuclear reactor engineering, and includes the engineering of the first wall and the fuel cycle for nuclear fusion reactors, electromagnetic structure engineering, AI and robotics, quantum beam engineering, the design of new type reactors, the basic process of radiochemistry and so on. The report on the course of the large scale facilities, research activities, the publication of research, education and the events in the Laboratory in the year are described. (K.I.)

  7. Construction and initial operation of MHD PbLi facility at UCLA

    International Nuclear Information System (INIS)

    Kunugi, T.; Yokomine, T.; Ueki, Y.; Smolentsev, S.; Li, F.-C.; Sketchley, T.; Abdou, M.A.; Yuki, K.


    We review current accomplishments in Task 1-3 'Flow Control and Thermofluid Modeling' of the Japan-US 'TITAN' collaboration program. Our task focuses on experimental activities and also computer modeling of magnetohydrodynamic flows and heat and mass transfer of electrically conducting fluids under conditions relevant to fusion blankets. Since our task started, major efforts were taken to design, construct and test a new magnetohydrodynamic lead-lithium (PbLi) loop at UCLA, to accumulate the PbLi handling technology, and to develop a high-temperature ultrasonic Doppler velocimetry and a differential-pressure measurement system for PbLi flows. In the present paper, the loop construction, the electromagnetic pump performance test, our on-going experiments with the constructed loop are described. (author)

  8. Emittance studies of the BNL/SLAC/UCLA 1.6 cell photocathode rf gun

    International Nuclear Information System (INIS)

    Palmer, D.T.; Miller, R.H.; Wang, X.J.


    The symmetrized 1.6 cell S-band photocathode gun developed by the BNL/SLAC/UCLA collaboration is in operation at the Brookhaven Accelerator Test Facility (ATF). A novel emittance compensation solenoid magnet has also been designed, built and is in operation at the ATF. These two subsystems form an emittance compensated photoinjector used for beam dynamics, advanced acceleration and free electron laser experiments at the ATF. The highest acceleration field achieved on the copper cathode is 150 MV/m, and the guns normal operating field is 130 MV/m. The maximum rf pulse length is 3 micros. The transverse emittance of the photoelectron beam were measured for various injection parameters. The 1 nC emittance results are presented along with electron bunch length measurements that indicated that at above the 400 pC, space charge bunch lengthening is occurring. The thermal emittance, ε o , of the copper cathode has been measured

  9. UCLA's Molecular Screening Shared Resource: enhancing small molecule discovery with functional genomics and new technology. (United States)

    Damoiseaux, Robert


    The Molecular Screening Shared Resource (MSSR) offers a comprehensive range of leading-edge high throughput screening (HTS) services including drug discovery, chemical and functional genomics, and novel methods for nano and environmental toxicology. The MSSR is an open access environment with investigators from UCLA as well as from the entire globe. Industrial clients are equally welcome as are non-profit entities. The MSSR is a fee-for-service entity and does not retain intellectual property. In conjunction with the Center for Environmental Implications of Nanotechnology, the MSSR is unique in its dedicated and ongoing efforts towards high throughput toxicity testing of nanomaterials. In addition, the MSSR engages in technology development eliminating bottlenecks from the HTS workflow and enabling novel assays and readouts currently not available.

  10. Vision screening of abused and neglected children by the UCLA Mobile Eye Clinic. (United States)

    Yoo, R; Logani, S; Mahat, M; Wheeler, N C; Lee, D A


    The purpose of our study was to present descriptive findings of ocular abnormalities in vision screening examinations of abused and neglected children. We compared the prevalence and the nature of eye diseases and refractive error between abused and neglected boys staying at the Hathaway Home, a residential facility for abused children, and boys from neighboring Boys and Girls clubs. The children in the study received vision screening examinations through the UCLA Mobile Eye Clinic following a standard format. Clinical data were analyzed by chi-square test. The children with a history of abuse demonstrated significantly higher prevalence of myopia, astigmatism, and external eye disorders. Our study suggests that children with a history of abuse may be at higher risk for visual impairment. These visual impairments may be the long-term sequelae of child abuse.

  11. Photocathode driven linac at UCLA for FEL and plasma wakefield acceleration experiments

    International Nuclear Information System (INIS)

    Hartman, S.; Aghamir, F.; Barletta, W.; Cline, D.; Dodd, J.; Katsouleas, T.; Kolonko, J.; Park, S.; Pellegrini, C.; Rosenzweig, J.; Smolin, J.; Terrien, J.; Davis, J.; Hairapetian, G.; Joshi, C.; Luhmann, N. Jr.; McDermott, D.


    The UCLA compact 20-MeV/c electron linear accelerator is designed to produce a single electron bunch with a peak current of 200 A, an rms energy spread of 0.2% or less, and a short 1.2 picosecond rms pulse duration. The linac is also designed to minimize emittance growth down the beamline so as to obtain emittances of the order of 8πmm-mrad in the experimental region. The linac will feed two beamlines, the first will run straight into the undulator for FEL experiments while the second will be used for diagnostics, longitudinal bunch compression, and other electron beam experiments. Here the authors describe the considerations put into the design of the accelerating structures and the transport to the experimental areas

  12. Tissue engineering and regenerative medicine in applied research: a year in review of 2014. (United States)

    Lin, Xunxun; Huang, Jia; Shi, Yuan; Liu, Wei


    Tissue engineering and regenerative medicine (TERM) remains to be one of the fastest growing fields, which covers a wide scope of topics of both basic and applied biological researches. This overview article summarized the advancements in applied researches of TERM area, including stem cell-mediated tissue regeneration, material science, and TERM clinical trial. These achievements demonstrated the great potential of clinical regenerative therapy of tissue/organ disease or defect through stem cells and tissue engineering approaches.

  13. Research prototype of remote controlled engineering vehicle system for CBRN threat. Phase 2

    International Nuclear Information System (INIS)

    Uemura, Keisuke; Naruse, Masahiro; Shigematsu, Kosuke; Morishita, Masahiro


    This research was triggered by the nuclear accident that successively happened after the Great East Japan Earthquake. The project focuses on the Remote Controlled Engineering Vehicle System that can be used for multi purposes such as debris/obstacle clearing operation, various reconnaissance operation, under CBRN threat. In this report, we describe research prototype of remote controlled engineering vehicle system for CBRN threat (phase 2). (author)

  14. [The Engineering and Technical Services Directorate at the Glenn Research Center (United States)

    Moon, James


    My name is James Moon and I am a senior at Tennessee State University where my major is Aeronautical and Industrial Technology with a concentration in industrial electronics. I am currently serving my internship in the Engineering and Technical Services Directorate at the Glenn Research Center (GRC). The Engineering and Technical Service Directorate provides the services and infrastructure for the Glenn Research Center to take research concepts to reality. They provide a full range of integrated services including engineering, advanced prototyping and testing, facility management, and information technology for NASA, industry, and academia. Engineering and Technical Services contains the core knowledge in Information Technology (IT). This includes data systems and analysis, inter and intranet based systems design and data security. Including the design and development of embedded real-time s o h a r e applications for flight and supporting ground systems, Engineering and Technical Services provide a wide range of IT services and products specific to the Glenn Research Center research and engineering community. In the 7000 Directorate I work directly in the 7611 organization. This organization is known as the Aviation Environments Technical Branch. My mentor is Vincent Satterwhite who is also the Branch Chief of the Aviation Environments Technical Branch. In this branch, I serve as the Assistant program manager of the Engineering Technology Program. The Engineering Technology Program (ETP) is one of three components of the High School L.E.R.C.I.P. This is an Agency-sponsored, eight-week research-based apprenticeship program designed to attract traditionally underrepresented high school students that demonstrate an aptitude for and interest in mathematics, science, engineering, and technology.

  15. Review of Heavy-Duty Engine Combustion Research at Sandia National Laboratories

    International Nuclear Information System (INIS)

    Robert W. Carling; Gurpreet Singh


    The objectives of this paper are to describe the research efforts in diesel engine combustion at Sandia National Laboratories' Combustion Research Facility and to provide recent experimental results. We have four diesel engine experiments supported by the Department of Energy, Office of Heavy Vehicle Technologies: a one-cylinder version of a Cummins heavy-duty engine, a diesel simulation facility, a one-cylinder Caterpillar engine to evaluate combustion of alternative fuels, and a homogeneous-charge, compression-ignition (HCCI) engine facility is under development. Recent experimental results to be discussed are: the effects of injection timing and diluent addition on late-combustion soot burnout, diesel-spray ignition and premixed-burn behavior, a comparison of the combustion characteristics of M85 (a mixture of 85% methanol and 15% gasoline) and DF2 (No.2 diesel reference fuel), and a description of our HCCI experimental program and modeling work

  16. Research into operational parameters of diesel engines running on RME biodiesel

    Directory of Open Access Journals (Sweden)

    S. Lebedevas


    Full Text Available The results of motor experimental researches on operational parameters of diesel engines F2L511 and A41 are presented in the publication. Change of harmful emission of exhaust gases was determined and evaluated, fuel economy and thrust characteristics of diesel engines running on RME biodiesel compared to diesel fuel. The influence of technical condition of fuel injection aggregates was evaluated for parameters of harmful emission of diesel engines running on biodiesel by simulation of setback of fuel injection in alowable range of technical conditions – the coking of nozzles of fuel injector. The complex improvement of all ecological parameters was evaluated by optimisation of fuel injection phase of diesel engines running on RME biodiesel. Objectives and aspects of further researches on indicator process of diesel engines were determined.

  17. Project LASER: Learning about science, engineering, and research (United States)


    The number of American students entering science and engineering careers and their ranking in comparison with other countries is on the decline. This decline has alarmed Congress which, in 1987, established a Task Force on Women, Minorities, and the Handicapped in Science and Technology to define the problem and find solutions. If left unchanged, the task force has warned that the prospects for maintaining an advanced industrial society will diminish. NASA is supportive of the six goals outlined by the task force, which are paraphrase herein, and is carefully assessing its education programs to identify those offering the greatest potential for achieving the task force objectives with a reasonable range of resources. A major initiative is under way on behalf of NASA at its Marshall Space Flight Center, where highly effective features of several NASA education programs along with innovations are being integrated into a comprehensive pilot program. This program, dubbed Project LASER, is discussed.

  18. Research Update: Phonon engineering of nanocrystalline silicon thermoelectrics

    Directory of Open Access Journals (Sweden)

    Junichiro Shiomi


    Full Text Available Nanocrystalline silicon thermoelectrics can be a solution to improve the cost-effectiveness of thermoelectric technology from both material and integration viewpoints. While their figure-of-merit is still developing, recent advances in theoretical/numerical calculations, property measurements, and structural synthesis/fabrication have opened up possibilities to develop the materials based on fundamental physics of phonon transport. Here, this is demonstrated by reviewing a series of works on nanocrystalline silicon materials using calculations of multiscale phonon transport, measurements of interfacial heat conduction, and synthesis from nanoparticles. Integration of these approaches allows us to engineer phonon transport to improve the thermoelectric performance by introducing local silicon-oxide structures.

  19. Engineering Status of the Fusion Ignition Research Experiment (FIRE)

    International Nuclear Information System (INIS)

    Heitzenroeder, Philip J.; Meade, Dale; Thome, Richard J.


    FIRE is a compact, high field tokamak being studied as an option for the next step in the US magnetic fusion energy program. FIRE's programmatic mission is to attain, explore, understand, and optimize alpha-dominated plasmas to provide the knowledge necessary for the design of attractive magnetic fusion energy systems. This study began in 1999 with broad participation of the US fusion community, including several industrial participants. The design under development has a major radius of 2 m, a minor radius of 0.525 m, a field on axis of 10T and capability to operate at 12T with upgrades to power supplies. Toroidal and poloidal field magnets are inertially cooled with liquid nitrogen. An important goal for FIRE is a total project cost in the $1B range. This paper presents an overview of the engineering details which were developed during the FIRE preconceptual design study in FY99 and 00

  20. The UCLA Multimodal Connectivity Database: A web-based platform for brain connectivity matrix sharing and analysis

    Directory of Open Access Journals (Sweden)

    Jesse A. Brown


    Full Text Available Brain connectomics research has rapidly expanded using functional MRI (fMRI and diffusion-weighted MRI (dwMRI. A common product of these varied analyses is a connectivity matrix (CM. A CM stores the connection strength between any two regions (nodes in a brain network. This format is useful for several reasons: 1 it is highly distilled, with minimal data size and complexity, 2 graph theory can be applied to characterize the network’s topology, and 3 it retains sufficient information to capture individual differences such as age, gender, intelligence quotient, or disease state. Here we introduce the UCLA Multimodal Connectivity Database (, an openly available website for brain network analysis and data sharing. The site is a repository for researchers to publicly share CMs derived from their data. The site also allows users to select any CM shared by another user, compute graph theoretical metrics on the site, visualize a report of results, or download the raw CM. To date, users have contributed over 2000 individual CMs, spanning different imaging modalities (fMRI, dwMRI and disorders (Alzheimer’s, autism, Attention Deficit Hyperactive Disorder. To demonstrate the site’s functionality, whole brain functional and structural connectivity matrices are derived from 60 subjects’ (ages 26-45 resting state fMRI (rs-fMRI and dwMRI data and uploaded to the site. The site is utilized to derive graph theory global and regional measures for the rs-fMRI and dwMRI networks. Global and nodal graph theoretical measures between functional and structural networks exhibit low correspondence. This example demonstrates how this tool can enhance the comparability of brain networks from different imaging modalities and studies. The existence of this connectivity-based repository should foster broader data sharing and enable larger-scale meta analyses comparing networks across imaging modality, age group, and disease state.

  1. Report 1986/1987. Department of Nuclear Engineering and Applied Research

    International Nuclear Information System (INIS)


    The objective of the Department of Applied Research is to carry out research on fields of physics, materials sciences, chemistry and engineering. Some branches of research can be mentioned: high Tc superconductors, hydrogen storage in metallic hydrides, extractive metallurgy of strategic minerals and others. In the first case, both the Development Division and the Thermodynamics group in the Metallurgy Division, have actively participated [es

  2. Three Dimensions of Learning: Experiential Activity for Engineering Innovation Education and Research (United States)

    Killen, Catherine P.


    This paper outlines a novel approach to engineering education research that provides three dimensions of learning through an experiential class activity. A simulated decision activity brought current research into the classroom, explored the effect of experiential activity on learning outcomes and contributed to the research on innovation decision…

  3. Some research advances in computer graphics that will enhance applications to engineering design (United States)

    Allan, J. J., III


    Research in man/machine interactions and graphics hardware/software that will enhance applications to engineering design was described. Research aspects of executive systems, command languages, and networking used in the computer applications laboratory are mentioned. Finally, a few areas where little or no research is being done were identified.

  4. Cognitive Mapping Techniques: Implications for Research in Engineering and Technology Education (United States)

    Dixon, Raymond A.; Lammi, Matthew


    The primary goal of this paper is to present the theoretical basis and application of two types of cognitive maps, concept map and mind map, and explain how they can be used by educational researchers in engineering design research. Cognitive mapping techniques can be useful to researchers as they study students' problem solving strategies…

  5. Progress in research and regulatory development by the Materials Engineering Branch, RES Engineering Division

    International Nuclear Information System (INIS)

    Serpan, C.Z. Jr.


    Much activity has been underway In NRC this past year on definition of aging Issues for nuclear power plants that will be applicable to the regulatory considerations of applications for license renewals following the Initial 40-year operating period. The Materials Engineering Branch has been reviewing its program to assure that aging Issues are prominent, and to identify regulatory documents that will have to be validated or revised to provide a proper basis for license renewal safety evaluation. A report on the branch plan for aging and needs for extended life review is under preparation and should be available early in 1988

  6. Annual report of Nuclear Engineering Research Laboratory, University of Tokyo in fiscal 1992

    International Nuclear Information System (INIS)


    In this annual report, the activities of education and research, the state of operation of research facilities and others in Nuclear Engineering Research Laboratory, University of Tokyo in fiscal year 1992 are summarized. In this Laboratory, there are four large research facilities, that are, the fast neutron source reactor 'Yayoi', the electron beam linac, the nuclear fusion reactor blanket experiment facility and the heavy irradiation research facility. Those are used for carrying out education and research in the wide fields of nuclear engineering, and are offered also for joint utilization. The results of research by using respective research facilities have been summarized in separate reports. The course of the management and operation of each research facility is described, and the research activities, the theses for doctorate and graduation these of teachers, personnel and graduate students in the Laboratory are summarized. (J.P.N.)

  7. Experiences with project-oriented research in graduate engineering education

    International Nuclear Information System (INIS)

    Miley, G.H.


    Two examples of project-oriented research that involve the conceptual design of fusion systems are described. One of these projects involved close collaboration with workers in a national laboratory while the second was formally organized as a cooperative effort with two other laboratories. An important educational aspect of such research is that the students are involved in a design team composed of both students and professionals facing a realistic problem. In retrospect, it appears that both students and faculty profited from the experience. Several students have taken jobs in related areas, and additional research has resulted at the University from new insight gained during the projects

  8. Physical chemistry research for engineering and applied sciences

    CERN Document Server

    Pearce, Eli M; Pethrick, Richard A; Zaikov, Gennady E


    PrefaceRegularity of Oxidation of Waste Fibrous and Film Materials of Polyethylene and Polypropylene: A Research Note; M. V. Bazunova, S. V. Kolesov, R. F. Tukhvatullin, E. I. Kulish, G. E. ZaikovA Research Note on Creation of ?arbon-Polymer Nanocomposites with Polyethylene as a Binder; Sergei V. Kolesov, Marina V. Bazunova, Elena I. Kulish, Denis R. Valiev, and Gennady E. ZaikovA Research Note on the Influence of Hybrid Antioxidants Ichphans on the Structure of Liposome Lipid Bilayer; E. Yu. Parshina, L. Ya. Gendel', and A. B. RubinDynamically Vulcanized Thermoelastoplastics Based on Butadien

  9. Cross-Cultural Communication Training for Students in Multidisciplinary Research Area of Biomedical Engineering

    Directory of Open Access Journals (Sweden)

    Shigehiro Hashimoto


    Full Text Available Biomedical Engineering makes multidisciplinary research area, which includes biology, medicine, engineering and others. Communication training is important for students, who have a potential to develop Biomedical Engineering. Communication is not easy in a multidisciplinary research area, because each area has its own background of thinking. Because each nation has its own background of culture, on the other hand, international communication is not easy, either. A cross-cultural student program has been designed for communication training in the multidisciplinary research area. Students from a variety of backgrounds of research area and culture have joined in the program: mechanical engineering, material science, environmental engineering, science of nursing, dentist, pharmacy, electronics, and so on. The program works well for communication training in the multidisciplinary research area of biomedical engineering. Foreign language and digital data give students chance to study several things: how to make communication precisely, how to quote previous data. The experience in the program helps students not only understand new idea in the laboratory visit, but also make a presentation in the international research conference. The program relates to author's several experiences: the student internship abroad, the cross-cultural student camp, multi PhD theses, various affiliations, and the creation of the interdisciplinary department.

  10. The rehabilitation engineering research center for the advancement of cognitive technologies. (United States)

    Heyn, Patricia Cristine; Cassidy, Joy Lucille; Bodine, Cathy


    Barring few exceptions, allied health professionals, engineers, manufacturers of assistive technologies (ATs), and consumer product manufacturers have developed few technologies for individuals with cognitive impairments (CIs). In 2004, the National Institute on Disability Rehabilitation Research (NIDRR) recognized the need to support research in this emergent field. They funded the first Rehabilitation Engineering Research Center for the Advancement of Cognitive Technologies (RERC-ACT). The RERC-ACT has since designed and evaluated existing and emerging technologies through rigorous research, improving upon existing AT devices, and creating new technologies for individuals with CIs. The RERC-ACT has contributed to the development and testing of AT products that assist persons with CIs to actively engage in tasks of daily living at home, school, work, and in the community. This article highlights the RERC-ACT's engineering development and research projects and discusses how current research may impact the quality of life for an aging population. © The Author(s) 2014.

  11. The Effects Of Gender, Engineering Identification, and Engineering Program Expectancy On Engineering Career Intentions: Applying Hierarchical Linear Modeling (HLM) In Engineering Education Research (United States)

    Tendhar, Chosang; Paretti, Marie C.; Jones, Brett D.


    This study had three purposes and four hypotheses were tested. Three purposes: (1) To use hierarchical linear modeling (HLM) to investigate whether students' perceptions of their engineering career intentions changed over time; (2) To use HLM to test the effects of gender, engineering identification (the degree to which an individual values a…

  12. Applying Web-Based Tools for Research, Engineering, and Operations (United States)

    Ivancic, William D.


    Personnel in the NASA Glenn Research Center Network and Architectures branch have performed a variety of research related to space-based sensor webs, network centric operations, security and delay tolerant networking (DTN). Quality documentation and communications, real-time monitoring and information dissemination are critical in order to perform quality research while maintaining low cost and utilizing multiple remote systems. This has been accomplished using a variety of Internet technologies often operating simultaneously. This paper describes important features of various technologies and provides a number of real-world examples of how combining Internet technologies can enable a virtual team to act efficiently as one unit to perform advanced research in operational systems. Finally, real and potential abuses of power and manipulation of information and information access is addressed.

  13. DREW-UCLA Breast Cancer Research and Training Program: Molecular/Cellular Pathogenesis Model (United States)


    RHS1764-9209568) were designed corresponding to nucleotides 575 to 595 of the coding region (gccctggccgtgctagacaat) of Homo sapiens ERBB2 transcript...variant 1, mRNA sequence (NM_004448, NCBI database), and 2896 to 2917 of the coding region (gctgaactggtgtatgcagatt) of Homo sapiens ERBB2, transcript...responsible for alanine transport. Springer Apoptosis (2007) 12:593–612 599 * T ra n sp o rt V el o ci ty (n m o l/m g p ro te in /m in ) 0.0 0.5 1.0

  14. MaTech - the BMFT ''new materials'' materials research program - 1994 annual report about new materials for innovative information technology, energy technology, traffic engineering, medical engineering and production engineering applications, and about general materials research and new fields

    International Nuclear Information System (INIS)

    Lillack, D.; Gilbert, I.; Runte, S.


    This annual report gives a survey of projects supported within the framework of the Matfo and Ma-Tech programs. These projects focus on research into materials for innovative: 1. information technology, 2. energy technology, 3. traffic engineering, 4. medical engineering, and 5. production engineering applications and on 6. general materials research and new fields. The descriptions of individual projects indicate project goals and work schedules, names of important sub-contractors, and total costs and the funds contributed by BMFT. Information added in an annex includes inter alia a list of publications, lectures, contracts, or patents resulting from project activities in the year 1994. (MM) [de

  15. Organizational Influences on Interdisciplinary Interactions during Research and Design of Large-Scale Complex Engineered Systems (United States)

    McGowan, Anna-Maria R.; Seifert, Colleen M.; Papalambros, Panos Y.


    The design of large-scale complex engineered systems (LaCES) such as an aircraft is inherently interdisciplinary. Multiple engineering disciplines, drawing from a team of hundreds to thousands of engineers and scientists, are woven together throughout the research, development, and systems engineering processes to realize one system. Though research and development (R&D) is typically focused in single disciplines, the interdependencies involved in LaCES require interdisciplinary R&D efforts. This study investigates the interdisciplinary interactions that take place during the R&D and early conceptual design phases in the design of LaCES. Our theoretical framework is informed by both engineering practices and social science research on complex organizations. This paper provides preliminary perspective on some of the organizational influences on interdisciplinary interactions based on organization theory (specifically sensemaking), data from a survey of LaCES experts, and the authors experience in the research and design. The analysis reveals couplings between the engineered system and the organization that creates it. Survey respondents noted the importance of interdisciplinary interactions and their significant benefit to the engineered system, such as innovation and problem mitigation. Substantial obstacles to interdisciplinarity are uncovered beyond engineering that include communication and organizational challenges. Addressing these challenges may ultimately foster greater efficiencies in the design and development of LaCES and improved system performance by assisting with the collective integration of interdependent knowledge bases early in the R&D effort. This research suggests that organizational and human dynamics heavily influence and even constrain the engineering effort for large-scale complex systems.

  16. Research program of the high temperature engineering test reactor for upgrading the HTGR technology

    International Nuclear Information System (INIS)

    Kunitomi, Kazuhiko; Tachibana, Yukio; Takeda, Takeshi; Saikusa, Akio; Sawa, Kazuhiro


    The High Temperature Engineering Test Reactor (HTTR) is a graphite-moderated and helium-cooled reactor with an outlet power of 30 MW and outlet coolant temperature of 950degC, and its first criticality will be attained at the end of 1997. In the HTTR, researches establishing and upgrading the technology basis necessary for an HTGR and innovative basic researches for a high temperature engineering will be conducted. A research program of the HTTR for upgrading the technology basis for the HTGR was determined considering realization of future generation commercial HTGRs. This paper describes a research program of the HTTR. (author)

  17. National research council report and its impact on nuclear engineering education at the University of Michigan

    International Nuclear Information System (INIS)

    Martin, W.R.


    A recent report by the National Research Council raised a number of important issues that will have an impact on nuclear engineering departments across the country. The report has been reviewed in the context of its relevance to the Department of Nuclear Engineering at the University of Michigan (UM), and some observations and conclusions have been drawn. This paper focuses on those portions of Ref. 1 concerning undergraduate and graduate curricula, research facilities and laboratories, faculty research interests, and funding for research and graduate student support because these topics have a direct impact on current and future directions for the department

  18. UCSD's Institute of Engineering in Medicine: fostering collaboration through research and education. (United States)

    Chien, Shu


    The University of California, San Diego (UCSD) was established in 1961 as a new research university that emphasizes innovation, excellence, and interdisciplinary research and education. It has a School of Medicine (SOM) and the Jacobs School of Engineering (JSOE) in close proximity, and both schools have national rankings among the top 15. In 1991, with the support of the Whitaker Foundation, the Whitaker Institute of Biomedical Engineering was formed to foster collaborations in research and education. In 2008, the university extended the collaboration further by establishing the Institute of Engineering in Medicine (IEM), with the mission of accelerating the discoveries of novel science and technology to enhance health care through teamwork between engineering and medicine, and facilitating the translation of innovative technologies for delivery to the public through clinical application and commercialization.

  19. CAD, 3D modeling, engineering analysis, and prototype experimentation industrial and research applications

    CERN Document Server

    Zheng Li, Jeremy


    This succinct book focuses on computer aided design (CAD), 3-D modeling, and engineering analysis and the ways they can be applied effectively in research and industrial sectors including aerospace, defense, automotive, and consumer products. These efficient tools, deployed for R&D in the laboratory and the field, perform efficiently three-dimensional modeling of finished products, render complex geometrical product designs, facilitate structural analysis and optimal product design, produce graphic and engineering drawings, and generate production documentation. Written with an eye toward green energy installations and novel manufacturing facilities, this concise volume enables scientific researchers and engineering professionals to learn design techniques, control existing and complex issues, proficiently use CAD tools, visualize technical fundamentals, and gain analytic and technical skills. This book also: ·       Equips practitioners and researchers to handle powerful tools for engineering desi...

  20. Stratified charge rotary engine - Internal flow studies at the MSU engine research laboratory (United States)

    Hamady, F.; Kosterman, J.; Chouinard, E.; Somerton, C.; Schock, H.; Chun, K.; Hicks, Y.


    High-speed visualization and laser Doppler velocimetry (LDV) systems consisting of a 40-watt copper vapor laser, mirrors, cylindrical lenses, a high speed camera, a synchronization timing system, and a particle generator were developed for the study of the fuel spray-air mixing flow characteristics within the combustion chamber of a motored rotary engine. The laser beam is focused down to a sheet approximately 1 mm thick, passing through the combustion chamber and illuminates smoke particles entrained in the intake air. The light scattered off the particles is recorded by a high speed rotating prism camera. Movies are made showing the air flow within the combustion chamber. The results of a movie showing the development of a high-speed (100 Hz) high-pressure (68.94 MPa, 10,000 psi) fuel jet are also discussed. The visualization system is synchronized so that a pulse generated by the camera triggers the laser's thyratron.

  1. PERSPECTIVE: Translational neural engineering: multiple perspectives on bringing benchtop research into the clinical domain (United States)

    Rousche, Patrick; Schneeweis, David M.; Perreault, Eric J.; Jensen, Winnie


    A half-day forum to address a wide range of issues related to translational neural engineering was conducted at the annual meeting of the Biomedical Engineering Society. Successful practitioners of translational neural engineering from academics, clinical medicine and industry were invited to share a diversity of perspectives and experiences on the translational process. The forum was targeted towards traditional academic researchers who may be interested in the expanded funding opportunities available for translational research that emphasizes product commercialization and clinical implementation. The seminar was funded by the NIH with support from the Rehabilitation Institute of Chicago. We report here a summary of the speaker viewpoints with particular focus on extracting successful strategies for engaging in or conducting translational neural engineering research. Daryl Kipke, PhD, (Department of Biomedical Engineering at the University of Michigan) and Molly Shoichet, PhD, (Department of Chemical Engineering at the University of Toronto) gave details of their extensive experience with product commercialization while holding primary appointments in academic departments. They both encouraged strong clinical input at very early stages of research. Neurosurgeon Fady Charbel, MD, (Department of Neurosurgery at the University of Illinois at Chicago) discussed his role in product commercialization as a clinician. Todd Kuiken, MD, PhD, (Director of the Neural Engineering for Artificial Limbs at the Rehabilitation Institute of Chicago, affiliated with Northwestern University) also a clinician, described a model of translational engineering that emphasized the development of clinically relevant technology, without a strong commercialization imperative. The clinicians emphasized the importance of communicating effectively with engineers. Representing commercial neural engineering was Doug Sheffield, PhD, (Director of New Technology at Vertis Neuroscience, Inc.) who

  2. Translational neural engineering: multiple perspectives on bringing benchtop research into the clinical domain. (United States)

    Rousche, Patrick; Schneeweis, David M; Perreault, Eric J; Jensen, Winnie


    A half-day forum to address a wide range of issues related to translational neural engineering was conducted at the annual meeting of the Biomedical Engineering Society. Successful practitioners of translational neural engineering from academics, clinical medicine and industry were invited to share a diversity of perspectives and experiences on the translational process. The forum was targeted towards traditional academic researchers who may be interested in the expanded funding opportunities available for translational research that emphasizes product commercialization and clinical implementation. The seminar was funded by the NIH with support from the Rehabilitation Institute of Chicago. We report here a summary of the speaker viewpoints with particular focus on extracting successful strategies for engaging in or conducting translational neural engineering research. Daryl Kipke, PhD, (Department of Biomedical Engineering at the University of Michigan) and Molly Shoichet, PhD, (Department of Chemical Engineering at the University of Toronto) gave details of their extensive experience with product commercialization while holding primary appointments in academic departments. They both encouraged strong clinical input at very early stages of research. Neurosurgeon Fady Charbel, MD, (Department of Neurosurgery at the University of Illinois at Chicago) discussed his role in product commercialization as a clinician. Todd Kuiken, MD, PhD, (Director of the Neural Engineering for Artificial Limbs at the Rehabilitation Institute of Chicago, affiliated with Northwestern University) also a clinician, described a model of translational engineering that emphasized the development of clinically relevant technology, without a strong commercialization imperative. The clinicians emphasized the importance of communicating effectively with engineers. Representing commercial neural engineering was Doug Sheffield, PhD, (Director of New Technology at Vertis Neuroscience, Inc.) who

  3. Some observations in university participation in nuclear engineering research

    International Nuclear Information System (INIS)

    Eickhoff, K.G.; Hill, K.M.


    A general discussion is presented on the kinds of problem which with suitable co-ordination would form appropriate topics for university research. R and D work can be done in-house, or with an industrial contractor, or with a university or polytechnic. The criteria are examined. Involvement by universities and polytechnics, and topics and location, are considered further. (U.K.)

  4. 76 FR 37084 - Board on Coastal Engineering Research (United States)


    ...: Federal, State, Local, and Private Perspectives; Developments in Asset Management Systems; Future Navigation Needs; Systems Approach to Risk and Lifecycle Management of Coastal Navigation Infrastructure; and Research and Development Needs and Plans. There will be an optional field trip boat Tuesday evening. On...

  5. Journal of Civil Engineering Research and Practice: Advanced Search

    African Journals Online (AJOL)

    Search tips: Search terms are case-insensitive; Common words are ignored; By default only articles containing all terms in the query are returned (i.e., AND is implied); Combine multiple words with OR to find articles containing either term; e.g., education OR research; Use parentheses to create more complex queries; e.g., ...

  6. Research Centers & Consortia | College of Engineering & Applied Science (United States)

    Academics Admission Student Life Research Schools & Colleges Libraries Athletics Centers & ; Applied Science Powerful Ideas. Proven Results. Search for: Go This site All UWM Search Site Menu Skip to content Academics Undergraduate Programs Majors Minors Integrated Bachelor/Master Degree Applied Computing

  7. Orbiter Entry Aerothermodynamics Practical Engineering and Applied Research (United States)

    Campbell, Charles H.


    The contents include: 1) Organization of the Orbiter Entry Aeroheating Working Group; 2) Overview of the Principal RTF Aeroheating Tools Utilized for Tile Damage Assessment; 3) Description of the Integrated Tile Damage Assessment Team Analyses Process; 4) Space Shuttle Flight Support Process; and 5) JSC Applied Aerosciences and CFD Branch Applied Research Interests.

  8. Compilation of reports from research supported by the Materials Engineering Branch, Division of Engineering: 1965--1990

    International Nuclear Information System (INIS)

    Hiser, A.L.


    Since 1965, the Materials Engineering Branch, Division of Engineering, of the Nuclear Regulatory Commission's Office of Nuclear Regulatory Research, and its predecessors dating back to the Atomic Energy Commission (AEC), has sponsored research programs concerning the integrity of the primary system pressure boundary of light water reactors. The components of concern in these research programs have included the reactor pressure vessel (RPV), steam generators, and the piping. These research programs have covered a broad range of topics, including fracture mechanics analysis and experimental work for RPV and piping applications, inspection method development and qualification, and evaluation of irradiation effects to RPV steels. This report provides as complete a listing as practical of formal technical reports submitted to the NRC by the investigators working on these research programs. This listing includes topical, final and progress reports, and is segmented by topic area. In many cases a report will cover several topics (such as in the case of progress reports of multi-faceted programs), but is listed under only one topic. Therefore, in searching for reports on a specific topic, other related topic areas should be checked also

  9. Report of the research results with University of Tokyo, Nuclear Engineering Research Laboratory's Facilities in fiscal 1989

    International Nuclear Information System (INIS)


    This is the report of the results of research carried out by the common utilization of the reactor 'Yayoi' and an electron accelerator in the Nuclear Engineering Research Laboratory in fiscal year 1989. In fiscal year 1989, the research themes using the reactor Yayoi or related to it were 15, and those using the linear accelerator reached 12, thus the common utilization attracted the strong interest of users. The Yayoi has been operated satisfactorily without trouble. The results of the research carried out by the common utilization of the Yayoi and a linac and the reports of 12 Yayoi research meetings in fiscal year 1989 are collected. (J.P.N.)

  10. Compilation of contract research for the Materials Engineering Branch, Division of Engineering Technology. Annual report for FY 1983. Vol.2

    International Nuclear Information System (INIS)


    This report presents summaries of the research work performed during Fiscal Year 1983 by laboratories and organizations under contracts administered by the NRC's Materials Engineering Branch, Office of Nuclear Regulatory Research. Each contractor has written a more complete and detailed annual report of their work which can be obtained by writing to NRC. The contractor reports are organized into the major areas of concern to Primary System Integrity, which is the main focus for the branch's research. These areas are: Vessel and Piping Fracture Mechanics; Pressure Vesel Surveillance Dosimetry; Steam Generators, Aging, and Environmental Cracking; and Non-Destructive Examination. The research programs reported provide information on the overall program objectives, a more limited scope of work for FY 1983, a technical description of the year's work, and a brief forecast of the plans for continuing work

  11. The librarian as research informationist: a case study. (United States)

    Federer, Lisa


    How can an embedded research informationist add value to the scientific output of research teams? The University of California-Los Angeles (UCLA) Louise M. Darling Biomedical Library is an academic health sciences library serving the clinical, educational, and research needs of the UCLA community. A grant from the National Library of Medicine funded a librarian to join a UCLA research team as an informationist. The informationist meets regularly with the research team and provides guidance related to data management, preservation, and other information-related issues. Early results suggest that the informationist's involvement has influenced the team's data gathering, storage, and curation methods. The UCLA Library has also changed the librarian's title to research informationist to reflect the new activities that she performs. The research informationist role provides an opportunity for librarians to become effective members of research teams and improve research output.

  12. Establishing the Research Agenda for Increasing the Representation of Women in Engineering and Computing. (United States)

    Buse, Kathleen; Hill, Catherine; Benson, Kathleen


    While there is an extensive body of research on gender equity in engineering and computing, there have been few efforts to glean insight from a dialog among experts. To encourage collaboration and to develop a shared vision of the future research agenda, a 2 day workshop of 50 scholars who work on the topic of gender in engineering and computing was held at a rural conference center. The structure of the conference and the location allowed for time to reflect, dialog, and to craft an innovative research agenda aimed at increasing the representation of women in engineering and computing. This paper has been written by the conference organizers and details the ideas and recommendations from the scholars. The result is an innovative, collaborative approach to future research that focuses on identifying effective interventions. The new approach includes the creation of partnerships with stakeholders including businesses, government agencies, non-profits and academic institutions to allow a broader voice in setting research priorities. Researchers recommend incorporating multiple disciplines and methodologies, while expanding the use of data analytics, merging and mining existing databases and creating new datasets. The future research agenda is detailed and includes studies focused on socio-cultural interventions particularly on career choice, within undergraduate and graduate programs, and for women in professional careers. The outcome is a vision for future research that can be shared with researchers, practitioners and other stakeholders that will lead to gender equity in the engineering and computing professions.

  13. Incorrect results in software engineering experiments: How to improve research practices


    Jørgensen, Magne; Dybå, Tore; Liestøl, Knut; Sjøberg, Dag


    Context The trustworthiness of research results is a growing concern in many empirical disciplines. Aim The goals of this paper are to assess how much the trustworthiness of results reported in software engineering experiments is affected by researcher and publication bias, given typical statistical power and significance levels, and to suggest improved research practices. Method First, we conducted a small-scale survey to document the presence of researcher and publication biases in software...

  14. The early career researcher's toolkit:translating tissue engineering, regenerative medicine and cell therapy products


    Rafiq, Qasim A.; Ortega, Ilida; Jenkins, Stuart I.; Wilson, Samantha L.; Patel, Asha K.; Barnes, Amanda L.; Adams, Christopher F.; Delcassian, Derfogail; Smith, David


    Although the importance of translation for the development of tissue engineering, regenerative medicine and cell-based therapies is widely recognized, the process of translation is less well understood. This is particularly the case among some early career researchers who may not appreciate the intricacies of translational research or make decisions early in development which later hinders effective translation. Based on our own research and experiences as early career researchers involved in...

  15. Materials Science and Engineering-1989 Publications (Naval Research Laboratory) (United States)


    Antamanide J.H. Konnert, P. D’Antonio, J.M. Cowley, and Analog. Crystal Structure of A. Higgs , H-J. Ou Perhydrosymmetric antamanide, Ultramicroscopy, 30, 371...Paired Boson Superconductor" Molecular Beam Epitaxy" W. Jin, S.D. Mahanti, A.K. Rajagopal A. Christou, N. Flevaris, A. Georgakilas, Solid State...33(3), 347-358 Si(100)" "Neutron Scattering from Fermion and S.M. Prokes, W.F. Tseng, A- Christou Boson Superconductors" Materials Research Society

  16. Magnetohydrodynamic research in fusion blanket engineering and metallurgical processing

    International Nuclear Information System (INIS)

    Tokuhiro, A.


    A review of recent research activities in liquid metal magnetohydrodynamics (LM-MHDs) is presented in this article. Two major reserach areas are discussed. The first topic involves the thermomechanical design issues in a proposed tokamak fusion reactor. The primary concerns are in the magneto-thermal-hydraulic performance of a self-cooled liquid metal blanket. The second topic involves the application of MHD in material processing in the metallurgical and semiconductor industries. The two representative applications are electromagnetic stirring (EMS) of continuously cast steel and the Czochralski (CZ) method of crystal growth in the presence of a magnetic field. (author) 24 figs., 10 tabs., 136 refs

  17. The research on teaching reformation of photoelectric information science and engineering specialty experiments (United States)

    Zhu, Zheng; Yang, Fan; Zhang, Yang; Geng, Tao; Li, Yuxiang


    This paper introduced the idea of teaching reformation of photoelectric information science and engineering specialty experiments. The teaching reformation of specialty experiments was analyzed from many aspects, such as construction of specialized laboratory, experimental methods, experiment content, experiment assessing mechanism, and so on. The teaching of specialty experiments was composed of four levels experiments: basic experiments, comprehensive and designing experiments, innovative research experiments and engineering experiments which are aiming at enterprise production. Scientific research achievements and advanced technology on photoelectric technology were brought into the teaching of specialty experiments, which will develop the students' scientific research ability and make them to be the talent suitable for photoelectric industry.

  18. Current Status and Issues of Nuclear Engineering Research and Educational Facilities in Universities

    International Nuclear Information System (INIS)


    It is important to discuss about nuclear engineering research and educational facilities in universities after new educational foundation. 12 universities investigated issues and a countermeasure of them. The results of a questionnaire survey, issues and countermeasure are shown in this paper. The questionnaire on the future nuclear researches, development of education, project, maintenance of nuclear and radioactive facilities and accelerator, control of uranium in subcritical test facilities, use of new corporation facilities, the fixed number of student, number of graduate, student experiments, themes of experiments and researches, the state of educational facilities are carried out. The results of questionnaire were summarized as followings: the fixed number of student (B/M/D) on nuclear engineering, exercise of reactor, education, themes, educational and research facilities, significance of nuclear engineering education in university and proposal. (S.Y.)

  19. Challenges and Opportunities for Establishing Design as a Research Discipline in Civil and Environmental Engineering

    DEFF Research Database (Denmark)

    Thompson, Mary Kathryn


    faculty, research and education communities, conferences, and journals. However, design remains an emerging sub-discipline in civil and environmental engineering – practiced, valued, and taught but not subject to rigorous academic research. This paper presents some of the challenges associated...... with the establishment of design as a research discipline within civil and environmental engineering, some of the benefits and opportunities that will come from that establishment, and some evidence for the fact that this process has already begun.......There are a number of fields including architecture, industrial design, and urban planning and design, where design is the discipline upon which all research and teaching activities are based. In other fields such as aerospace and mechanical engineering, design is a sub-discipline with its own...

  20. Research and development strategy and maintenance engineering to strengthen the basis of ageing management

    International Nuclear Information System (INIS)

    Sekimura, Naoto


    The major research and development fields for ageing management of complex systems such as nuclear power plants are categorized into the following 4 items; 1) research and development of technologies for inspection, evaluation and repair in the components and materials, 2) engineering information systems, 3) development of codes and standards and 4) synthesized maintenance engineering. The 'synthesized maintenance engineering' field includes methodologies for optimum combination for inspection, maintenance actions and cost, definition of importance of components for maintenance, and performance indicates of a power plant system. Studying and learning these systematic approaches is also indicated in the Road Map as one of the important issues for collaboration of industries, regulatory bodies and universities to keep leading engineers and to improve regulatory systems. (author)

  1. Thermonuclear Power Engineering: 60 Years of Research. What Comes Next? (United States)

    Strelkov, V. S.


    This paper summarizes results of more than half a century of research of high-temperature plasmas heated to a temperature of more than 100 million degrees (104 eV) and magnetically insulated from the walls. The energy of light-element fusion can be used for electric power generation or as a source of fissionable fuel production (development of a fusion neutron source—FNS). The main results of studies of tokamak plasmas which were obtained in the Soviet Union with the greatest degree of thermal plasma isolation among all other types of devices are presented. As a result, research programs of other countries were redirected to tokamaks. Later, on the basis of the analysis of numerous experiments, the international fusion community gradually came to an opinion that it is possible to build a tokamak (ITER) with Q > 1 (where Q is the ratio of the fusion power to the external power injected into the plasma). The ITER program objective is to achieve Q = 1-10 for a discharge time of up to 1000 s. The implementation of this goal does not solve the problem of a steadystate operation. The solution to this problem is a reliable first wall and current generation. This is a task of the next fusion power plant construction stage, called DEMO. Comparison of DEMO and FNS parameters shows that, at this development stage, the operating parameters and conditions of these devices are identical.

  2. Tour Guide Robots: An Integrated Research and Design Platform to Prepare Engineering and Technology Students (United States)

    Yelamarthi, Kumar


    Many interesting research and design questions occur at the intersections of traditional disciplines, yet most coursework and research programs for undergraduate engineering students are focused on one discipline. This leads to underutilization of the potential in better preparing students through multidisciplinary projects. Identifying this…

  3. Research on Channel Strategies of Modern Agricultural Engineering Demonstration Sites in Guangzhou


    Wen-guang Liang; Chun Xie; Qian-qian Pang


    The research discusses the channel structure of modern agricultural engineering demonstration sites in Guangzhou. It analyzes the strategies of channel competition, personnel combination, transportation combination and terminal network construction. Enterprises adapt different marketing channel strategies on the basis of the type of the market. The research has made certain achievement and has certain guiding significance.

  4. A Triangular Approach to Integrate Research, Education and Practice in Higher Engineering Education (United States)

    Heikkinen, Eetu-Pekka; Jaako, Juha; Hiltunen, Jukka


    Separate approaches in engineering education, research and practice are not very useful when preparing students for working life; instead, integration of education, research and industrial practices is needed. A triangular approach (TA) as a method to accomplish this integration and as a method to provide students with integrated expertise is…

  5. A Systematic Review of Research on the Flipped Learning Method in Engineering Education (United States)

    Karabulut-Ilgu, Aliye; Jaramillo Cherrez, Nadia; Jahren, Charles T.


    The purpose of this article is to describe the current state of knowledge and practice in the flipped learning approach in engineering education and to provide guidance for practitioners by critically appraising and summarizing existing research. This article is a qualitative synthesis of quantitative and qualitative research investigating the…

  6. Report for Working Group 1: Design Research in Civil and Environmental Engineering

    DEFF Research Database (Denmark)

    Thompson, Mary Kathryn; Paradisi, Irene


    The first 2013 DCEE working group meeting focused on issues associated with design research in civil and environmental engineering. It addressed some of the motivation for establishing design as a research discipline in CEE and some of the challenges and outstanding questions about how to do so....

  7. Effects of Brief Integrated Information Literacy Education Sessions on Undergraduate Engineering Students' Interdisciplinary Research (United States)

    Talikka, Marja; Soukka, Risto; Eskelinen, Harri


    Engineering students often conduct information searches without sufficient consideration of the context of their research topic. This article discusses how development of a new information literacy (IL) mindset through instruction in integrated IL education affects students' understanding of research problems and formulation of information search…

  8. An Evaluation of a Course That Introduces Undergraduate Students to Authentic Aerospace Engineering Research (United States)

    Mena, Irene B.; Schmitz, Sven; McLaughlin, Dennis


    This paper describes the implementation and assessment of an aerospace engineering course in which undergraduate students worked on research projects with graduate research mentors. The course was created using the principles from cooperative learning and project-based learning, and consisted of students working in small groups on a complex,…

  9. Engineering Research and Development and Technology thrust area report FY92

    Energy Technology Data Exchange (ETDEWEB)

    Langland, R.T.; Minichino, C. [eds.


    The mission of the Engineering Research, Development, and Technology Program at Lawrence Livermore National Laboratory (LLNL) is to develop the technical staff and the technology needed to support current and future LLNL programs. To accomplish this mission, the Engineering Research, Development, and Technology Program has two important goals: (1) to identify key technologies and (2) to conduct high-quality work to enhance our capabilities in these key technologies. To help focus our efforts, we identify technology thrust areas and select technical leaders for each area. The thrust areas are integrated engineering activities and, rather than being based on individual disciplines, they are staffed by personnel from Electronics Engineering, Mechanical Engineering, and other LLNL organizations, as appropriate. The thrust area leaders are expected to establish strong links to LLNL program leaders and to industry; to use outside and inside experts to review the quality and direction of the work; to use university contacts to supplement and complement their efforts; and to be certain that we are not duplicating the work of others. This annual report, organized by thrust area, describes activities conducted within the Program for the fiscal year 1992. Its intent is to provide timely summaries of objectives, theories, methods, and results. The nine thrust areas for this fiscal year are: Computational Electronics and Electromagnetics; Computational Mechanics; Diagnostics and Microelectronics; Emerging Technologies; Fabrication Technology; Materials Science and Engineering; Microwave and Pulsed Power; Nondestructive Evaluation; and Remote Sensing and Imaging, and Signal Engineering.

  10. Engineering Research and Development and Technology thrust area report FY92

    International Nuclear Information System (INIS)

    Langland, R.T.; Minichino, C.


    The mission of the Engineering Research, Development, and Technology Program at Lawrence Livermore National Laboratory (LLNL) is to develop the technical staff and the technology needed to support current and future LLNL programs. To accomplish this mission, the Engineering Research, Development, and Technology Program has two important goals: (1) to identify key technologies and (2) to conduct high-quality work to enhance our capabilities in these key technologies. To help focus our efforts, we identify technology thrust areas and select technical leaders for each area. The thrust areas are integrated engineering activities and, rather than being based on individual disciplines, they are staffed by personnel from Electronics Engineering, Mechanical Engineering, and other LLNL organizations, as appropriate. The thrust area leaders are expected to establish strong links to LLNL program leaders and to industry; to use outside and inside experts to review the quality and direction of the work; to use university contacts to supplement and complement their efforts; and to be certain that we are not duplicating the work of others. This annual report, organized by thrust area, describes activities conducted within the Program for the fiscal year 1992. Its intent is to provide timely summaries of objectives, theories, methods, and results. The nine thrust areas for this fiscal year are: Computational Electronics and Electromagnetics; Computational Mechanics; Diagnostics and Microelectronics; Emerging Technologies; Fabrication Technology; Materials Science and Engineering; Microwave and Pulsed Power; Nondestructive Evaluation; and Remote Sensing and Imaging, and Signal Engineering

  11. Research on cylinder processes of gasoline homogenous charge compression ignition (HCCI) engine (United States)

    Cofaru, Corneliu


    This paper is designed to develop a HCCI engine starting from a spark ignition engine platform. The engine test was a single cylinder, four strokes provided with carburetor. The results of experimental research on this version were used as a baseline for the next phase of the work. After that, the engine was modified for a HCCI configuration, the carburetor was replaced by a direct fuel injection system in order to control precisely the fuel mass per cycle taking into account the measured intake air-mass. To ensure that the air - fuel mixture auto ignite, the compression ratio was increased from 9.7 to 11.5. The combustion process in HCCI regime is governed by chemical kinetics of mixture of air-fuel, rein ducted or trapped exhaust gases and fresh charge. To modify the quantities of trapped burnt gases, the exchange gas system was changed from fixed timing to variable valve timing. To analyze the processes taking place in the HCCI engine and synthesizing a control system, a model of the system which takes into account the engine configuration and operational parameters are needed. The cylinder processes were simulated on virtual model. The experimental research works were focused on determining the parameters which control the combustion timing of HCCI engine to obtain the best energetic and ecologic parameters.

  12. Academic Identity Reconstruction: The Transition of Engineering Academics to Engineering Education Researchers (United States)

    Gardner, Anne; Willey, Keith


    The field of research (FoR) that an academic participates in is both a manifestation of, and a contributor to the development of their identity. When an academic changes that FoR the question then arises as to how they reconcile this change with their identity. This paper uses the identity-trajectory framework to analyse the discourse of 19…

  13. Various aspects of research of the SI engine with an additional expansion process

    Directory of Open Access Journals (Sweden)

    Noga Marcin


    Full Text Available The paper presents an analysis of the results of the both experimental results and theoretical works on the SI engine with additional expansion of exhaust gases, also known as five-stroke engine. The engine like this was constructed at Cracow University of Technology as a retrofitted in-line four cylinder engine in which outer cylinders (1st and 4th work as fired cylinders and inner cylinders (2nd and 3rd work as volume for the additional expansion. The aim of development of such an engine is to gain higher energy recovery ratio of the combusted fuel through the second expansion of exhaust in a separate cylinder. The operating parameters of the engine in various versions were analyzed: as naturally aspirated, supercharged using a turbocharger with a waste-gate valve and a turbocharger with variable nozzle turbine. Selected results of the indicating measurements of the engine with special emphasis on the indicated thermal efficiency were presented. The results pointed out the directions of further optimization of the engine. These results are all the more important, because according to the author’s knowledge, the research on the real object of this type are carried out in only one science center in the world besides Cracow University of Technology.

  14. Gas core nuclear thermal rocket engine research and development in the former USSR

    International Nuclear Information System (INIS)

    Koehlinger, M.W.; Bennett, R.G.; Motloch, C.G.; Gurfink, M.M.


    Beginning in 1957 and continuing into the mid 1970s, the USSR conducted an extensive investigation into the use of both solid and gas core nuclear thermal rocket engines for space missions. During this time the scientific and engineering. problems associated with the development of a solid core engine were resolved. At the same time research was undertaken on a gas core engine, and some of the basic engineering problems associated with the concept were investigated. At the conclusion of the program, the basic principles of the solid core concept were established. However, a prototype solid core engine was not built because no established mission required such an engine. For the gas core concept, some of the basic physical processes involved were studied both theoretically and experimentally. However, no simple method of conducting proof-of-principle tests in a neutron flux was devised. This report focuses primarily on the development of the. gas core concept in the former USSR. A variety of gas core engine system parameters and designs are presented, along with a summary discussion of the basic physical principles and limitations involved in their design. The parallel development of the solid core concept is briefly described to provide an overall perspective of the magnitude of the nuclear thermal propulsion program and a technical comparison with the gas core concept

  15. FY2009 Annual Progress Report for Advanced Combustion Engine Research and Development

    Energy Technology Data Exchange (ETDEWEB)



    Fiscal Year 2009 Annual Progress Report for the Advanced Combustion Engine Research and Development (R&D) subprogram. The Advanced Combustion Engine R&D subprogram supports the mission of the VTP program by removing the critical technical barriers to commercialization of advanced internal combustion engines (ICEs) for passenger and commercial vehicles that meet future Federal emissions regulations. Dramatically improving the efficiency of ICEs and enabling their introduction in conventional as well as hybrid electric vehicles is the most promising and cost-effective approach to increasing vehicle fuel economy over the next 30 years.

  16. The laboratory test rig with miniature jet engine to research aviation fuels combustion process

    Directory of Open Access Journals (Sweden)

    Gawron Bartosz


    Full Text Available This article presents laboratory test rig with a miniature turbojet engine (MiniJETRig – Miniature Jet Engine Test Rig, that was built in the Air Force Institute of Technology. The test rig has been developed for research and development works aimed at modelling and investigating processes and phenomena occurring in full scale jet engines. In the article construction of a test rig is described, with a brief discussion on the functionality of each of its main components. Additionally examples of measurement results obtained during the realization of the initial tests have been included, presenting the capabilities of the test rig.

  17. Contributions of university nuclear engineering departments to the national research agenda

    International Nuclear Information System (INIS)

    Peddicord, K.L.


    The history and character of university nuclear engineering departments have enabled them to play unique roles in higher education and to make valuable contributions in numerous important research fields. Nuclear engineering programs have several distinguishing and noteworthy characteristics. These characteristics include quality, diversity, and effectiveness. However, the continued viability of these programs is in question, and the importance of these programs may only be recognized after the capability has been lost. To recover this capability may well prove to be an impossibility

  18. Requirements Engineering as Creative Problem Solving: A Research Agenda for Idea Finding


    Maiden, N.; Jones, S.; Karlsen, I. K.; Neill, R.; Zachos, K.; Milne, A.


    This vision paper frames requirements engineering as a creative problem solving process. Its purpose is to enable requirements researchers and practitioners to recruit relevant theories, models, techniques and tools from creative problem solving to understand and support requirements processes more effectively. It uses 4 drivers to motivate the case for requirements engineering as a creative problem solving process. It then maps established requirements activities onto one of the longest-esta...

  19. Illuminating Engineering Research Institute Annual Report 1967. A Review of Project Activities and a Roundup of IERI Research Interests. (United States)

    Illuminating Engineering Research Inst., New York, NY.

    Presented in this report are the Illuminating Engineering Research Institute's fundamental scientific concepts in a new frame of realism while relating them to an up-to-date accounting of the search for new basic knowledge. In addition to being an annual accounting, it is also intended to provide orientation. Its presented in dramatic and…

  20. Potentials of research and development in power plant engineering

    International Nuclear Information System (INIS)

    Hlubek, W.


    Sufficient and socially compatible energy supply continues to be a vital prerequisite of the welfare of mankind, and for combatting poverty, the population explosion, and environmental disruption. This fact and the most probably unavoidable growth of the global population to 10 or even 12 billion people by the year 2100 will cause the demand for energy to further increase, and to reach something between 16 and 24 billion tonnes of coal equivalents per annum already by the year 2020. Such a demand can be met only by enhancing the conversion of primary energy into useful energy, which can be achieved only by high technology allowing best possible efficiency at justifiable cost and lowest possible environmental impact. This is the guideline setting the topical and long-term major goal of future energy technology activities, and thus of research and development activities. (orig./UA) [de

  1. Research and development needs for ITER engineering design

    International Nuclear Information System (INIS)

    Flanagan, C.; Alikaev, V.; Baker, C.


    In the series of documents that summarize the results of the Conceptual Design Activities (CDA) for the International Thermonuclear Experimental Reactor (ITER), this document describes the research and development (R and D) plans for 1991 - 1995. Part A describes the physics R and D, part B the technology R and D. The Physics R and D needs are presented in terms of task descriptions of an ITER-related R and D programme for 1991/1992 and beyond, while diagnostics R and D needs, although covered in Appendix A, are described in Part B. In Chapter II of Part A, ''ITER-related Physics R and D Needs for 91/92 and Beyond'', the following tasks are described as most crucial: (1) demonstration that (i) operation with a cold divertor plasma is possible, (ii) the peak heat flux onto the divertor plate can be kept below about 10 MW per square meter, (iii) and helium exhaust conditions allow a fractional burnup of about 3 percent or more; (2) a characterisation of disruptions that allows to specify their consequences for the plasma-facing-components, and that provides evidence that the number of disruptions expected allows acceptable plasma-facing-component lifetimes; (3) demonstration that steady-state operation in an enhanced-confinement regime and satisfactory plasma purity is possible, and provision of energy confinement scaling allowing the prediction of ITER performance; and (4) ensurance that the presence of a fast ion population does not jeopardize plasma performance in ITER. Part B, ''ITER Technology Research and Development Needs'', describes planning R and D for magnets, containment structure, assembly and maintenance, current drive and heating, plasma facing components, blanket, fuel cycle, structural materials, and diagnostics. A table of key milestones for Technology R and D is included, as well as cost estimates. Figs and tabs

  2. Are we studying what matters? Health priorities and NIH-funded biomedical engineering research. (United States)

    Rubin, Jessica B; Paltiel, A David; Saltzman, W Mark


    With the founding of the National Institute of Biomedical Imaging and Bioengineering (NIBIB) in 1999, the National Institutes of Health (NIH) made explicit its dedication to expanding research in biomedical engineering. Ten years later, we sought to examine how closely federal funding for biomedical engineering aligns with U.S. health priorities. Using a publicly accessible database of research projects funded by the NIH in 2008, we identified 641 grants focused on biomedical engineering, 48% of which targeted specific diseases. Overall, we found that these disease-specific NIH-funded biomedical engineering research projects align with national health priorities, as quantified by three commonly utilized measures of disease burden: cause of death, disability-adjusted survival losses, and expenditures. However, we also found some illnesses (e.g., cancer and heart disease) for which the number of research projects funded deviated from our expectations, given their disease burden. Our findings suggest several possibilities for future studies that would serve to further inform the allocation of limited research dollars within the field of biomedical engineering.

  3. Report of the research results with University of Tokyo, Nuclear Engineering Research laboratory's Facilities in fiscal 1992

    International Nuclear Information System (INIS)


    This publication summarizes the results of the joint utilization of the research 'Yayoi' and the electron beam accelerator in the Nuclear Engineering Research Laboratory, University of Tokyo, in the fiscal year 1992. The Yayoi was operated smoothly through the year, and the number of research themes, for which the reactor Yayoi was jointly utilized and the related themes reached 23 cases. The research themes of the linac count up to 17, after its reconstruction to be twin-linac. In this publication, in addition to the utilization reports, also the 16 reports of Yayoi Study Meetings held in fiscal year 1992 are collected. (J.P.N.)

  4. PREFACE: 1st International Conference on Mechanical Engineering Research 2011 (ICMER2011) (United States)

    Abu Bakar, Rosli


    The year 2010 represented a significant milestone in the history of the Mechanical Engineering community with the organization of the first and second national level conferences (National Conference in Mechanical Engineering for Research, 1st and 2nd NCMER) at Universiti Malaysia Pahang on 26-27 May and 3-4 December 2010. The conferences attracted a large number of delegates from different premier academic and research institutions in the country to participate and share their research experiences at the conference. The International Conference on Mechanical Engineering Research (ICMER 2011) followed on from the first and second conferences due to good support from researchers. The ICMER 2011 is a good platform for researchers and postgraduate students to present their latest finding in research. The conference covers a wide range of topics including the internal combustion engine, machining processes, heat and mass transfer, fuel, biomechanical analysis, aerodynamic analysis, thermal comfort, computational techniques, design and simulation, automotive transmission, optimization techniques, hybrid electric vehicles, engine vibration, heat exchangers, finite element analysis, computational fluid dynamics, green energy, vehicle dynamics renewable energy, combustion, design, product development, advanced experimentation techniques, to name but a few. The international conference has helped to bridge the gap between researchers working at different institutions and in different countries to share their knowledge and has helped to motivate young scientists with their research. This has also given some clear direction for further research from the deliberations of the conference. Several people have contributed in different ways to the success of the conference. We thank the keynote speakers and all authors of the contributed papers, for the cooperation rendered to us in the publication of the CD conference proceedings. In particular, we would like to place on record our

  5. Applying system engineering methods to site characterization research for nuclear waste repositories

    International Nuclear Information System (INIS)

    Woods, T.W.


    Nuclear research and engineering projects can benefit from the use of system engineering methods. This paper is brief overview illustrating how system engineering methods could be applied in structuring a site characterization effort for a candidate nuclear waste repository. System engineering is simply an orderly process that has been widely used to transform a recognized need into a fully defined system. Such a system may be physical or abstract, natural or man-made, hardware or procedural, as is appropriate to the system's need or objective. It is a way of mentally visualizing all the constituent elements and their relationships necessary to fulfill a need, and doing so compliant with all constraining requirements attendant to that need. Such a system approach provides completeness, order, clarity, and direction. Admittedly, system engineering can be burdensome and inappropriate for those project objectives having simple and familiar solutions that are easily held and controlled mentally. However, some type of documented and structured approach is needed for those objectives that dictate extensive, unique, or complex programs, and/or creation of state-of-the-art machines and facilities. System engineering methods have been used extensively and successfully in these cases. The scientific methods has served well in ordering countless technical undertakings that address a specific question. Similarly, conventional construction and engineering job methods will continue to be quite adequate to organize routine building projects. Nuclear waste repository site characterization projects involve multiple complex research questions and regulatory requirements that interface with each other and with advanced engineering and subsurface construction techniques. There is little doubt that system engineering is an appropriate orchestrating process to structure such diverse elements into a cohesive, well defied project

  6. The early career researcher's toolkit: translating tissue engineering, regenerative medicine and cell therapy products. (United States)

    Rafiq, Qasim A; Ortega, Ilida; Jenkins, Stuart I; Wilson, Samantha L; Patel, Asha K; Barnes, Amanda L; Adams, Christopher F; Delcassian, Derfogail; Smith, David


    Although the importance of translation for the development of tissue engineering, regenerative medicine and cell-based therapies is widely recognized, the process of translation is less well understood. This is particularly the case among some early career researchers who may not appreciate the intricacies of translational research or make decisions early in development which later hinders effective translation. Based on our own research and experiences as early career researchers involved in tissue engineering and regenerative medicine translation, we discuss common pitfalls associated with translational research, providing practical solutions and important considerations which will aid process and product development. Suggestions range from effective project management, consideration of key manufacturing, clinical and regulatory matters and means of exploiting research for successful commercialization.

  7. Challenges and Difficulties to Teaching Engineering to Generation Z: a case research

    Directory of Open Access Journals (Sweden)

    Suamit Correia Barreiro


    Full Text Available Many people from generation Z are at the beginning of their academic activities. This generation has peculiar characteristics that might be a challenge in the labor market. Thus, instructors have a great role in their preparation. However, professors might face difficulties dealing with their specific characteristics. The research aims to carry out a general survey to enable an understanding of the greater challenges and difficulties in teaching the subject of engineering to the students of Generation Z. The research method used was a case study at a University with 20 instructors from the Faculty of Engineering. The analysis revealed a great challenge in relating theoretical concepts with practical concepts. The research also showed a probable tendency of using more exhibition methods, and the low knowledge about generation Z by most instructors. This study seeks to contribute to the teaching-learning process of engineering.

  8. Experimental Research in Operation Management in Engine Room by using Language Sentiment/Opinion Analysis

    Directory of Open Access Journals (Sweden)

    Dimitris Papachristos


    Full Text Available The paper argues for the necessity of a combination MMR methods (questionnaire, interview and sentiment/opinion techniques to personal satisfaction analysis at the maritime and training education and proposes a generic, but practical research approach for this purpose. The proposed approach concerns the personal satisfaction evaluation of Engine Room simulator systems and combines the speech recording (sentiment/opinion analysis for measuring emotional user responses with usability testing (SUS tool. The experimental procedure presented here is a primary effort to research the emotion analysis (satisfaction of the users-students in Engine Room Simulators. Finally, the ultimate goal of this research is to find and test the critical factors that influence the educational practice and user’s satisfaction of Engine Room Simulator Systems and the ability to conduct full-time system control by the marine crew.

  9. 11th International Conference on Software Engineering Research, Management and Applications

    CERN Document Server


    The purpose of the 11th International Conference on Software Engineering Research, Management and Applications (SERA 2013) held on August 7 - 9, 2012 in Prague, Czech Republic was to bring together scientists, engineers, computer users, and students to share their experiences and exchange new ideas and research results about all aspects (theory, applications and tools) of Software Engineering Research, Management and Applications, and to discuss the practical challenges encountered along the way and the solutions adopted to solve them.   The conference organizers selected 17 outstanding papers from those papers accepted for presentation at the conference in order to publish them in this volume.  The papers were chosen based on review scores submitted by members of the program committee, and further rigorous rounds of review.

  10. The history and evolution of optically accessible research engines and their impact on our understanding of engine combustion

    Energy Technology Data Exchange (ETDEWEB)

    Miles, Paul C. [Sandia National Lab. (SNL-CA), Livermore, CA (United States)


    The development and application of optically accessible engines to further our understanding of in-cylinder combustion processes is reviewed, spanning early efforts in simplified engines to the more recent development of high-pressure, high-speed engines that retain the geometric complexities of modern production engines. Limitations of these engines with respect to the reproduction of realistic metal test engine characteristics and performance are identified, as well as methods that have been used to overcome these limitations. Finally, the role of the work performed in these engines on clarifying the fundamental physical processes governing the combustion process and on laying the foundation for predictive engine simulation is summarized.

  11. Karlsruhe Nuclear Research Center, Institute of Neutron Physics and Reactor Engineering. Progress report on research and development work in 1993

    International Nuclear Information System (INIS)


    The Institute of Neutron Physics and Reactor Engineering is concerned with research work in the field of nuclear engineering related to the safety of thermal reactors as well as with specific problems of fusion reactor technology. Under the project of nuclear safety research, the Institute works on concepts designed to drastically improve reactor safety. Apart from that, methods to estimate and minimize the radiological consequences of reactor accidents are developed. Under the fusion technology project, the Institute deals with neutron physics and technological questions of the breeding blanket. Basic research covers technico-physical questions of the interaction between light ion radiation of a high energy density and matter. In addition and to a small extent, questions of employing hydrogen in the transport area are studied. (orig.) [de

  12. Recent trends in superalloys research for critical aero-engine components

    Energy Technology Data Exchange (ETDEWEB)

    Remy, Luc [Mine ParisTech, CNRS UMR 7633, 91 - Evry (France). Centre des Materiaux; Guedou, Jean-Yves [Snecma Safran Group, Moissy-Cramayel (France). Materials and Processes Dept.


    This paper is a brief survey of common research activity on superalloys for aero-engines between Snecma and Mines ParisTech Centre des Materiaux during recent years. First in disks applications, the development of new powder metallurgy superalloys is shown. Then grain boundary engineering is investigated in a wrought superalloy. Secondly, design oriented research on single crystals blades is shown: a damage model for low cycle fatigue is used for life prediction when cracks initiated at casting pores. The methodology developed for assessing coating life is illustrated for thermal barrier coating deposited on AMI single crystal superalloy. (orig.)

  13. Engineering research and development for the Elise Heavy Ion Induction Accelerator

    International Nuclear Information System (INIS)

    Reginato, L.; Peters, C.


    The Fusion Energy Research engineering team has been conducting Research and Development Associated with the Construction (RDAC) of the Elise accelerator since the approval of Key Decision one (KD1 is start of construction). The engineering design effort has worked in close cooperation with the physics design staff to achieve all parameters of the Elise accelerator. The design included the 2 MV injector, matching section, combiner, induction cells, electric/magnetic quadrupoles, alignment system and controls. All major designs and some hardware testing will be discussed

  14. Engineering research and development for the Elise heavy ion induction accelerator

    International Nuclear Information System (INIS)

    Reginato, L.; Peters, C.


    The fusion energy research engineering team has been conducting research and development associated with the construction of the Elise accelerator since the approval of key decision 1 (this is the start of construction). The engineering design effort has worked in close cooperation with the physics design staff to achieve all parameters of the Elise accelerator. The design included the 2 MV injector, matching section, combiner, induction cells, electric-magnetic quadrupoles, alignment system and controls. All major designs and some hardware testing will be discussed. (orig.)

  15. 9th International Conference on Software Engineering Research, Management and Applications(SERA 2011)

    CERN Document Server

    Software Engineering Research, Management and Applications 2011


    The purpose of the 9th International Conference on Software Engineering Research, Management and Applications(SERA 2011) held on August 10-12, 2011 in Baltimore, Maryland was to bring together scientists, engineers, computer users, and students to share their experiences and exchange new ideas and research results about all aspects (theory, applications and tools) of computer and information sciences, and to discuss the practical challenges encountered along the way and the solutions adopted to solve them.   The conference organizers selected 12 outstanding papers from SERA 2011, all of which you will find in this volume of Springer’s Studies in Computational Intelligence.


    Directory of Open Access Journals (Sweden)

    Viktor M. Fedoseyev


    Full Text Available Introduction: questions of integration of mathematical with engineering training in educational process of higher education institution are explored. The existing technologies of the integrated training are analyzed, and the project-oriented direction is distinguished. Research involving students as an organisational and methodical form of training bachelors of the technical speciali sations is discussed. Materials and Methods: results of article are based on researches of tendencies of development of technical and mathematical education, works on the theory and methodology of pedagogical integration, methodology of mathematics and technical science. Methods of historical and pedagogical research, analytical, a method of mathematical modeling were used. Results: the main content of the paper is to make discussion of experience in developing and using integrated educational tasks in real educational process. Discussion is based on a specific technological assignment including a number of mathematical tasks used as a subject of research for students. In the assignment a special place is allocated to the questions reflecting the interplay of a technical task with a mathematical method of research highlighting the objective significance of mathematics as a method to solve engineering problems. Discussion and Conclusions: the paper gives reasons to conditions for using research work with students as an organisational and methodical form of integrated training in mathematics. In realisation of educational technology it is logical to apply the method of projects. It is necessary to formulate a task as an engineering project: to set an engineering objective of research, to formulate specifications; to differentiate between engineering and mathematical tasks of the project, to make actual interrelations between them; the mathematical part of the project has to be a body of research; assessment of the project must be carried out not only accounting for

  17. Wavelet-based blind identification of the UCLA Factor building using ambient and earthquake responses

    International Nuclear Information System (INIS)

    Hazra, B; Narasimhan, S


    Blind source separation using second-order blind identification (SOBI) has been successfully applied to the problem of output-only identification, popularly known as ambient system identification. In this paper, the basic principles of SOBI for the static mixtures case is extended using the stationary wavelet transform (SWT) in order to improve the separability of sources, thereby improving the quality of identification. Whereas SOBI operates on the covariance matrices constructed directly from measurements, the method presented in this paper, known as the wavelet-based modified cross-correlation method, operates on multiple covariance matrices constructed from the correlation of the responses. The SWT is selected because of its time-invariance property, which means that the transform of a time-shifted signal can be obtained as a shifted version of the transform of the original signal. This important property is exploited in the construction of several time-lagged covariance matrices. The issue of non-stationary sources is addressed through the formation of several time-shifted, windowed covariance matrices. Modal identification results are presented for the UCLA Factor building using ambient vibration data and for recorded responses from the Parkfield earthquake, and compared with published results for this building. Additionally, the effect of sensor density on the identification results is also investigated

  18. Microscopic evaluation of implant platform adaptation with UCLA-type abutments: in vitro study

    Directory of Open Access Journals (Sweden)

    Vinícius Anéas RODRIGUES

    Full Text Available Abstract Introduction The fit between abutment and implant is crucial to determine the longevity of implant-supported prostheses and the maintenance of peri-implant bones. Objective To evaluate the vertical misfit between different abutments in order to provide information to assist abutment selection. Material and method UCLA components (N=40 with anti-rotational system were divided as follows: components usinated in titanium (n=10 and plastic components cast proportionally in titanium (n=10, nickel-chromium-titanium-molybdenum (n=10 and nickel-chromium (n=10 alloys. All components were submitted to stereomicroscope analysis and were randomly selected for characterization by SEM. Result Data were analyzed using mean and standard deviation and subjected to ANOVA-one way, where the groups proved to statistically different (p=<0.05, followed by Tukey’s test. Conclusion The selection of material influences the value of vertical misfit. The group machined in Ti showed the lowest value while the group cast in Ni Cr showed the highest value of vertical misfit.

  19. Construction and initial operation of MHD PbLi facility at UCLA

    Energy Technology Data Exchange (ETDEWEB)

    Smolentsev, S., E-mail:; Li, F.-C.; Morley, N.; Ueki, Y.; Abdou, M.; Sketchley, T.


    Highlights: • New MHD PbLi loop has been constructed and tested at UCLA. • Pressure diagnostics system has been developed and successfully tested. • Ultrasound Doppler velocimeter is tested as velocity diagnostics. • Experiments on pressure drop reduction have been performed. • Experiments on MHD flow in a duct with SiC flow channel insert are underway. -- Abstract: A magnetohydrodynamic flow facility MaPLE (Magnetohydrodynamic PbLi Experiment) that utilizes molten eutectic alloy lead–lithium (PbLi) as working fluid has been constructed and tested at University of California, Los Angeles. The loop operation parameters are: maximum magnetic field 1.8 T, PbLi temperature up to 350 °C, maximum PbLi flow rate with/without a magnetic field 15/50 l/min, maximum pressure head 0.15 MPa. The paper describes the loop itself and its major components, basic operation procedures, experience of handling PbLi, initial loop testing, flow diagnostics and current and near-future experiments. The obtained test results of the loop and its components have demonstrated that the new facility is fully functioning and ready for experimental studies of magnetohydrodynamic, heat and mass transfer phenomena in PbLi flows and also can be used in mock up testing in conditions relevant to fusion applications.

  20. The UCLA/SLAC Ultra-High Gradient Cerenkov Wakefield Accelerator Experiment

    CERN Document Server

    Thompson, Matthew C; Hogan, Mark; Ischebeck, Rasmus; Muggli, Patric; Rosenzweig, James E; Scott, A; Siemann, Robert; Travish, Gil; Walz, Dieter; Yoder, Rodney


    An experiment is planned to study the performance of dielectric Cerenkov wakefield accelerating structures at extremely high gradients in the GV/m range. This new UCLA/SLAC collaboration will take advantage of the unique SLAC FFTB electron beam and its demonstrated ultra-short pulse lengths and high currents (e.g., sz = 20 μm at Q = 3 nC). The electron beam will be focused down and sent through varying lengths of fused silica capillary tubing with two different sizes: ID = 200 μm / OD = 325 μm and ID = 100 μm / OD = 325 μm. The pulse length of the electron beam will be varied in order to alter the accelerating gradient and probe the breakdown threshold of the dielectric structures. In addition to breakdown studies, we plan to collect and measure coherent Cerenkov radiation emitted from the capillary tube to gain information about the strength of the accelerating fields. Status and progress on the experiment are reported.

  1. Investigating plasma-rotation methods for the Space-Plasma Physics Campaign at UCLA's BAPSF. (United States)

    Finnegan, S. M.; Koepke, M. E.; Reynolds, E. W.


    In D'Angelo et al., JGR 79, 4747 (1974), rigid-body ExB plasma flow was inferred from parabolic floating-potential profiles produced by a spiral ionizing surface. Here, taking a different approach, we report effects on barium-ion azimuthal-flow profiles using either a non-emissive or emissive spiral end-electrode in the WVU Q-machine. Neither electrode produced a radially-parabolic space-potential profile. The emissive spiral, however, generated controllable, radially-parabolic structure in the floating potential, consistent with a second population of electrons having a radially-parabolic parallel-energy profile. Laser-induced-fluorescence measurements of spatially resolved, azimuthal-velocity distribution functions show that, for a given flow profile, the diamagnetic drift of hot (>>0.2eV) ions overwhelms the ExB-drift contribution. Our experiments constitute a first attempt at producing controllable, rigid-body, ExB plasma flow for future experiments on the LArge-Plasma-Device (LAPD), as part of the Space-Plasma Physics Campaign (at UCLA's BAPSF).

  2. Towards a mature measurement environment: Creating a software engineering research environment (United States)

    Basili, Victor R.


    Software engineering researchers are building tools, defining methods, and models; however, there are problems with the nature and style of the research. The research is typically bottom-up, done in isolation so the pieces cannot be easily logically or physically integrated. A great deal of the research is essentially the packaging of a particular piece of technology with little indication of how the work would be integrated with other prices of research. The research is not aimed at solving the real problems of software engineering, i.e., the development and maintenance of quality systems in a productive manner. The research results are not evaluated or analyzed via experimentation or refined and tailored to the application environment. Thus, it cannot be easily transferred into practice. Because of these limitations we have not been able to understand the components of the discipline as a coherent whole and the relationships between various models of the process and product. What is needed is a top down experimental, evolutionary framework in which research can be focused, logically and physically integrated to produce quality software productively, and evaluated and tailored to the application environment. This implies the need for experimentation, which in turn implies the need for a laboratory that is associated with the artifact we are studying. This laboratory can only exist in an environment where software is being built, i.e., as part of a real software development and maintenance organization. Thus, we propose that Software Engineering Laboratory (SEL) type activities exist in all organizations to support software engineering research. We describe the SEL from a researcher's point of view, and discuss the corporate and government benefits of the SEL. The discussion focuses on the benefits to the research community.

  3. Engineering and Ecological Constraction and Mechanization, National Research University Moscow State University of Civil Engineering

    Directory of Open Access Journals (Sweden)

    Владимир Александрович Величкин


    Full Text Available The noise in the construction of an important factor. It can interfere with the transmission of information through communication channels, especially if the signals of low power and information to be transmitted over a long distance. Thus, the noise would be a great hindrance in the field of automation facilities, where no transmission of information on large and small distance not oboytis.Analiticheskoe study durations of noise emissions rather difficult. Rice was an approximate distribution of the duration of the intervals between the moments of crossing the zero level noise. Later, it has been proposed as solutions to approximate sufficiently high urovney.Pervye experimental data on the distribution of time intervals between zeros in normal noise were obtained by Campbell [1] .Nedavno published his research Bletekier [2], we obtain the distribution of noise emission duration, passed through a filter with a band transmittance 440 -10 250 MCPA levels from 0 to 1.69 .In this article made a complete study and results are provided.

  4. NRC's geotechnical engineering research needs for the high-level waste repository program

    International Nuclear Information System (INIS)

    Gupta, D.C.; Philip, J.; Lorig, L.J.; Chowdhury, A.H.


    To develop the capability for independently assessing the US Department of Energy's (DOE's) geologic repository design within a limited time, the US Nuclear Regulatory Commission (NRC) staff needs to perform certain research well before receiving the license application. The NRC staff is using a number of factors to identify the areas that it needs to research. The staff assigns priorities to the needed research based on programmatic considerations and the significance of the work. In the geotechnical engineering field, the staff is conducting research in the following three areas: response of the repository to repeated strong ground motion, rock-mass sealing, and coupled thermo-hydro-mechanical interactions. In this paper, the NRC staff also presents the areas of additional research needed in the geotechnical engineering field

  5. Knowledge translation in rehabilitation engineering research and development: a knowledge ecosystem framework. (United States)

    Chau, Tom; Moghimi, Saba; Popovic, Milos R


    Rehabilitation engineering is concerned with technology innovations and technology-mediated treatments for the improvement of quality of care and quality of life of individuals with disability. Unlike many other fields of health research, the knowledge translation (KT) cycle of rehabilitation engineering research and development (R&D) is often considered incomplete until a technology product or technology-facilitated therapy is available to target clientele. As such, the KT journey of rehabilitation engineering R&D is extremely challenging, necessarily involving knowledge exchange among numerous players across multiple sectors. In this article, we draw on recent literature about the knowledge trichotomy in technology-based rehabilitation R&D and propose a knowledge ecosystem to frame the rehabilitation engineering KT process from need to product. Identifying the principal process of the ecosystem as one of knowledge flow, we elucidate the roles of repository and networked knowledge, identify key consumers and producers in a trinity of communities of practice, and draw on knowledge management literature to describe different knowledge flows. The article concludes with instantiations of this knowledge ecosystem for 2 local rehabilitation engineering research-development-commercialization endeavors. Copyright © 2013 American Congress of Rehabilitation Medicine. Published by Elsevier Inc. All rights reserved.

  6. Research Capabilities Directed to all Electric Engineering Teachers, from an Alternative Energy Model

    Directory of Open Access Journals (Sweden)

    Víctor Hugo Ordóñez Navea


    Full Text Available The purpose of this work was to contemplate research capabilities directed to all electric engineering teachers from an alternative energy model intro the explanation of a semiconductor in the National Training Program in Electricity. Some authors, such as. Vidal (2016, Atencio (2014 y Camilo (2012 point out to technological applications with semiconductor electrical devices. In this way; a diagnostic phase is presented, held on this field research as a descriptive type about: a how to identify the necessities of alternative energies, and b The research competences in the alternatives energies of researcher from a solar cell model, to boost and innovate the academic praxis and technologic ingenuity. Themselves was applied a survey for a group of 15 teachers in the National Program of Formation in electricity to diagnose the deficiencies in the research area of alternatives energies. The process of data analysis was carried out through descriptive statistic. Later the conclusions are presented the need to generate strategies for stimulate and propose exploration of alternatives energies to the development of research competences directed to the teachers of electrical engineering for develop the research competences in the enforcement of the teachers exercise for the electric engineering, from an alternative energy model and boost the technologic research in the renewal energies field.

  7. The outline report of advanced basic engineering research in the fiscal year 1998

    Energy Technology Data Exchange (ETDEWEB)



    The JNC has initiated the cooperation with universities and research institutes for advanced basic engineering on 1995. The number of research cooperation theme is increasing and satisfactorily improving in the forth year, 1998. The objective of this program is to promote the advanced basic engineering research with universities and research institutes in relation with the JNC's projects. The facilities and equipment of the JNC are mainly provided to the cooperation. The JNC has settled the research cooperation themes. The universities and research institute have applied to the themes with their issues, working plans and personnel. The JNC has selected the issues and personnel, and put into practice the cooperation with accepting guest staffs and/or research fellows from the universities. This report summarizes the results of the advanced basic engineering research cooperation executed in the fiscal year, 1998. The total number of issues is 34 for the 29 themes; those are categorized in to two groups. The one is related to the fast breeder reactor technologies and the other is on the environmental technologies. The 12 issues are finished in the fiscal year, 1998, in which the 9 issues are for the fast breeder reactor technologies and the 3 issues are for the environmental technologies. The themes/the issues, the host group, host key persons, university side key persons, a form of cooperation are summarized in the tables. The summary reports of research activities by the all cooperators are presented under the particular format. Those describe the total schedule, a form of cooperation, the research objective, the outline of research contents, main facilities for using, research status, research results, future schedules and bibliographies relevant to the research cooperation. The 25 tables and 158 figures are included. (Y. Tanaka)

  8. The outline report of advanced basic engineering research in the fiscal year 1998

    Energy Technology Data Exchange (ETDEWEB)



    The JNC has initiated the cooperation with universities and research institutes for advanced basic engineering on 1995. The number of research cooperation theme is increasing and satisfactorily improving in the forth year, 1998. The objective of this program is to promote the advanced basic engineering research with universities and research institutes in relation with the JNC's projects. The facilities and equipment of the JNC are mainly provided to the cooperation. The JNC has settled the research cooperation themes. The universities and research institute have applied to the themes with their issues, working plans and personnel. The JNC has selected the issues and personnel, and put into practice the cooperation with accepting guest staffs and/or research fellows from the universities. This report summarizes the results of the advanced basic engineering research cooperation executed in the fiscal year, 1998. The total number of issues is 34 for the 29 themes; those are categorized in to two groups. The one is related to the fast breeder reactor technologies and the other is on the environmental technologies. The 12 issues are finished in the fiscal year, 1998, in which the 9 issues are for the fast breeder reactor technologies and the 3 issues are for the environmental technologies. The themes/the issues, the host group, host key persons, university side key persons, a form of cooperation are summarized in the tables. The summary reports of research activities by the all cooperators are presented under the particular format. Those describe the total schedule, a form of cooperation, the research objective, the outline of research contents, main facilities for using, research status, research results, future schedules and bibliographies relevant to the research cooperation. The 25 tables and 158 figures are included. (Y. Tanaka)

  9. On founding of the science and technology intelligence (STI) research system for the grand engineering research organization

    International Nuclear Information System (INIS)

    Li Zhimin; Tang Yong; Shi Yi; Wang Yirong


    This article discusses the science and technology intelligence (STI) research system for grand engineering research organization, and pose that this system should be composed of five elements of research category, research form, service patterns , quality control and fruit evaluation and precession with ability, and describes its definition, connotation and function for each element. research category includes strategy intelligence, technology route and develop trend, technology detail; research form has dynamic track, investigation and analysis, consult study; service patterns involve demand or induction service, independence or mutual action service; quality control and fruit evaluation should be conducted by a group of technologist and intelligence expert; precession with ability should be an organized system with good configuration and learning ability. (authors)

  10. Proceedings of the specialist research meeting on scientific and engineering researches of unstable nuclei and on their nuclear methodology (3)

    International Nuclear Information System (INIS)

    Kawade, K.; Taniguchi, A.; Yamada, S.


    New research fields with the use of radioactive ion beams are now rapidly developing by virtue of recent progress in radioactive beam accelerators. The scientific and engineering researches on unstable nuclei far from stability are getting particular interests aiming at the full use of their radiation. In the circumstance many laboratories report utilizations and researches of the RI beam, the Tohoku University's renewal plan of the cyclotron and the short-lived nuclear beam facility at KEK have started. To discuss these new subjects on the scientific and engineering researches of unstable nuclei and on their nuclear methodology, the third specialist meeting was held at the KUR on February 16 and 17, 1998. Several noticeable and wide scope works on the method of RI-beam generation and on the new development of nuclear methodology have been reported, such as fundamental researches with laser, new isotope searchings and researches of nuclear structures with ISOL, in-beam nuclear spectroscopies through the deep-inelastic collision. In this meeting, especially, fundamental support-researches are reported, which are precise measurements of absolute disintegration rates, a gamma peak analysis method, evaluations of fundamental nuclear data, measurements of beta detector response functions for reducing Q values and precise measurement of high energy gamma intensities up to 11 MeV. The 14 papers are indexed individually. (J.P.N.)

  11. Outline of scientific and research activities of the Faculty of Nuclear Science and Physical Engineering

    International Nuclear Information System (INIS)

    Loncar, G.


    A survey is presented of scientific and research activities carried out in the departments of the Faculty of Nuclear Science and Physical Engineering of the Czech Technical University in Prague. The first section lists the principal results achieved in the course of the 6th Five-Year Plan in Physical Electronics, Solid State Engineering, Materials Structure and Properties, Nuclear Physics, Theory and Technology of Nuclear Reactors, Dosimetry and Application of Ionizing Radiation and Nuclear Chemistry. The second part gives a summary of scientific and research work carried out in the Faculty of Nuclear Science and Physical Engineering in the 7th Five-Year Plan in all branches of science represented. The Faculty's achievements in international scientific cooperation are assessed. (author)

  12. [Metrology research on biomedical engineering publications from China in recent years]. (United States)

    Yu, Lu; Su, Juan; Wang, Ying; Sha, Xianzheng


    The present paper is to evaluate the scientific research level and development trends of biomedical engineering in China using metrology analysis on Chinese biomedical engineering scientific literatures. Pubmed is used to search the biomedical engineering publications in recent 5 years which are indexed by Science Citation Index, and the number and cited times of these publications and the impact factor of the journals are analyzed. The results show that comparing with the world, although the number of the publication in China has increased in recent 5 years, there is still much room for improvement. Among Chinese mainland, Hongkong and Taiwan, Chinese mainland maintains the obvious advantage in this subject, but Hongkong has the highest average cited number. Shanghai and Beijing have better research ability than other areas in Chinese mainland.

  13. The Need for Cyber-Informed Engineering Expertise for Nuclear Research Reactors

    Energy Technology Data Exchange (ETDEWEB)

    Anderson, Robert Stephen [Idaho National Laboratory


    Engineering disciplines may not currently understand or fully embrace cyber security aspects as they apply towards analysis, design, operation, and maintenance of nuclear research reactors. Research reactors include a wide range of diverse co-located facilities and designs necessary to meet specific operational research objectives. Because of the nature of research reactors (reduced thermal energy and fission product inventory), hazards and risks may not have received the same scrutiny as normally associated with power reactors. Similarly, security may not have been emphasized either. However, the lack of sound cybersecurity defenses may lead to both safety and security impacts. Risk management methodologies may not contain the foundational assumptions required to address the intelligent adversary’s capabilities in malevolent cyber attacks. Although most research reactors are old and may not have the same digital footprint as newer facilities, any digital instrument and control function must be considered as a potential attack platform that can lead to sabotage or theft of nuclear material, especially for some research reactors that store highly enriched uranium. This paper will provide a discussion about the need for cyber-informed engineering practices that include the entire engineering lifecycle. Cyber-informed engineering as referenced in this paper is the inclusion of cybersecurity aspects into the engineering process. A discussion will consider several attributes of this process evaluating the long-term goal of developing additional cyber safety basis analysis and trust principles. With a culture of free information sharing exchanges, and potentially a lack of security expertise, new risk analysis and design methodologies need to be developed to address this rapidly evolving (cyber) threatscape.

  14. Research pressure instrumentation for NASA Space Shuttle main engine, modification no. 6 (United States)

    Anderson, P. J.; Johnson, R. L.


    Research concerning the utilization of silicon piezoresistive strain sensing technology for space shuttle main engine applications is reported. The following specific topics were addressed: (1) transducer design and materials, (2) silicon piezoresistor characterization at cryogenic temperatures, (3) chip mounting characterization, and (4) frequency response optimization.

  15. Research pressure instrumentation for NASA Space Shuttle main engine, modification no. 5 (United States)

    Anderson, P. J.; Nussbaum, P.; Gustafson, G.


    Research concerning the development of pressure instrumentation for the space shuttle main engine is reported. The following specific topics were addressed: (1) transducer design and materials, (2) silicon piezoresistor characterization at cryogenic temperatures, (3) chip mounting characterization, and (4) frequency response optimization.

  16. Title list of selected Soviet reports in the fields of nuclear research and nuclear engineering. 9

    International Nuclear Information System (INIS)

    Schumann, G.; Sube, R.


    140 titles of reports issued by Soviet institutes (KFTI, EFI, IAE, IFVE, ITEF, NIIAR, NIIEFA, FEI, RI, SFTI) in the fields of nuclear research and nuclear engineering have been arranged according to the INIS subject scope. The reports are available on a loan basis from ZfK Rossendorf, Information Department, Dresden

  17. Title list of selected Soviet reports in the fields of nuclear research and nuclear engineering. 7

    International Nuclear Information System (INIS)

    Schumann, G.; Sube, R.


    139 titles of reports issued by Soviet institutes (KFTI, EFI, IAE, IFVE, ITEF, NIIAR, NIIEFA, FEI, RI, SFTI) in the fields of nuclear research and nuclear engineering have been arranged according to the INIS subject scope. The reports are available on a loan basis from ZfK Rossendorf, Information Department, Dresden

  18. Title list of selected Soviet reports in the fields of nuclear research and nuclear engineering. 13

    International Nuclear Information System (INIS)

    Schumann, G.; Sube, R.


    136 titles of reports issued by Soviet institutes (KFTI, EFI, IAE, IFVE, ITEF, NIIAR, NIIEFA, FEI, RI, SFTI) in the fields of nuclear research and nuclear engineering have been arranged according to the INIS subject scope. The reports are available on a loan basis from ZfK Rossendorf, Information Department, Dresden

  19. Development of Chemical Engineering Course Methods Using Action Research: Case Study (United States)

    Virkki-Hatakka, Terhi; Tuunila, Ritva; Nurkka, Niina


    This paper reports on the systematic development of a teaching methodology for two chemical engineering courses. The aim was to improve the quality of teaching to achieve expected learning outcomes more effectively. The development was carried out over a period of several years based on an action research methodology with data systematically…

  20. Use of Research-Based Instructional Strategies in Core Chemical Engineering Courses (United States)

    Prince, Michael; Borrego, Maura; Henderson, Charles; Cutler, Stephanie; Froyd, Jeff


    Traditional lecturing remains the most prevalent mode of instruction despite overwhelming research showing the increased effectiveness of many alternate instructional strategies. This study examines chemical engineering instructors' awareness and use of 12 such instructional strategies. The study also examines how chemical engineering…