WorldWideScience

Sample records for u6 promoter-driven shrna

  1. Hydrogen absorption properties of U6Mn and U6Ni

    International Nuclear Information System (INIS)

    Ito, H.; Yamawaki, M.; Yamamoto, T.

    1998-01-01

    The hydrogen absorption properties of U, U 6 Mn and U 6 Ni were investigated at hydrogen pressures below 10 5 Pa. The pressure-composition (P-C) isotherms of U, U 6 Mn and U 6 Ni were obtained and the amounts of absorbed hydrogen for U, U 6 Mn and U 6 Ni were determined to be 3, 16.6 and 16.0 for x in MH x , where M is U, U 6 Mn and U 6 Ni, respectively. The desorption plateau pressures at 573 K decreased in the order: U 6 Mn-H>U 6 Ni-H>U-H. In addition, the results for the amounts of absorbed hydrogen suggests the formation of ternary hydrides U 6 MnH 18 and U 6 NiH 14 . (orig.)

  2. Functional characterization of Pol III U6 promoters for gene knockdown and knockout in Plutella xylostella.

    Science.gov (United States)

    Huang, Yuping; Wang, Yajun; Zeng, Baosheng; Liu, Zhaoxia; Xu, Xuejiao; Meng, Qian; Huang, Yongping; Yang, Guang; Vasseur, Liette; Gurr, Geoff M; You, Minsheng

    2017-10-01

    RNA polymerase type III (Pol-III) promoters such as U6 are commonly used to express small RNAs, including short hairpin RNAs (shRNAs) and single guide RNAs (sgRNAs). Functional U6 promoters are widely used in CRISPR systems, and their characterization can facilitate genome editing of non-model organisms. In the present study, six U6 small nuclear RNA (snRNA) promoters containing two conserved elements of a proximal sequence element (PSEA) and a TATA box, were identified and characterized in the diamondback moth (Plutella xylostella) genome. Relative efficiency of the U6 promoters to express shRNA induced EGFP knockdown was tested in a P. xylostella cell line, revealing that the PxU6:3 promoter had the strongest expression effect. Further work with the PxU6:3 promoter showed its efficacy in EGFP knockout using CRISPR/Cas9 system in the cells. The expression plasmids with versatile Pxabd-A gene specific sgRNA driven by the PxU6:3 promoter, combined with Cas9 mRNA, could induce mutagenesis at specific genomic loci in vivo. The phenotypes induced by sgRNA expression plasmids were similar to those done in vitro transcription sgRNAs. A plasmid with two tandem arranged PxU6:3:sgRNA expression cassettes targeting Pxabd-A loci was generated, which caused a 28,856 bp fragment deletion, suggesting that the multi-sgRNA expression plasmid can be used for multi-targeting. Our work indicates that U6 snRNA promoters can be used for functional studies of genes with the approach of reverse genetics in P. xylostella. These essential promoters also provide valuable potential for CRISPR-derived gene drive as a tactic for population control in this globally significant pest. Copyright © 2017 Elsevier Ltd. All rights reserved.

  3. [Construction and identification of eukaryotic plasmid pGC-silencer-U6/Neo/GFP/ABCG2].

    Science.gov (United States)

    Yu, Yanping; Zhang, Song; Kong, Weijia

    2010-09-01

    To construct three short hairpin RNA (shRNA) interference expression plasmid vectors of human ABCG2 gene, to assay the expression of ABCG2 in a human nasopharyngeal carcinoma (NPC) cell line, CEN-2 cell line, and to detect the RNAi effect of shRNA. Targeting ABCG2 gene sequence, three plasmid expression vectors coding for shRNA and a control vector containing random DNA fragment were constructed. The recombinant plasmids were amplified in Ecoli. DH5 and then identified by restriction digestion, PCR and sequencing. The recombinant plasmids were transfected into CEN-2 cells. ABCG2 expression was assayed by real-time quantitative PCR and Western blot. The construction of pGC-silencer-U6/Neo/GFP/ABCG2 was succeed. The shRNA plasmids significantly down-regulated the ABCG2 expression in CEN-2 cells, at both mRNA level and protein level. Recombinant plasmid 1 had the strongest effect compared with plasmids 2 and 3 (P < 0.05), with an inhibition ratio of 75% at the mRNA level and 68% at the protein level. pGC-silencer-U6/Neo/GFP/ABCG2 has been successfully constructed and it can down-regulate ABCG2 expression after transfected into CEN-2 cells, which could help further studies of ABCG2 functions CEN-2 cell line and contribute to the NPC gene therapy.

  4. Construction of lentiviral shRNA expression vector targeting ...

    African Journals Online (AJOL)

    DNA oligo was cloned into lentiviral expression vector, and then polymerase chain reaction (PCR) and sequencing analyses were conducted to verify the constructs. The verified vectors were co-transfected into 293FT cells that could produce lentiviral. shRNA lentiviruses from the selected constructs were propagated and ...

  5. Construction of lentiviral shRNA expression vector targeting ...

    African Journals Online (AJOL)

    ajl yemi

    2011-10-26

    Oct 26, 2011 ... was then selected, while the titer of lentiviral packing PLD2-shRNA was 3.47 × 104 TU/ml and the virus was successfully ... MATERIALS AND METHODS .... such as: transfecting cells not only in mitotic active phase but also in ...

  6. High-field, high-T/sub c/ superconductivity in U6Fe and U6Co

    International Nuclear Information System (INIS)

    DeLong, L.E.; Hall, L.N.; Malik, S.K.; Crabtree, G.W.; Lwpl, W.; Gschneidner, K. A. Jr.

    1986-06-01

    Upper critical field data for U 6 Fe and U 6 Co are found to be markedly inconsistent with the weak coupling WHHM model. Nevertheless, excellent quantitative fits of H/sub c/ 2 vs T are obtained by using a modifiction of the WHHM model in which the orbital field is multiplied by a temperature-dependent enhancement factor

  7. U(6)-phonon model of nuclear collective motion

    International Nuclear Information System (INIS)

    Ganev, H.G.

    2015-01-01

    The U(6)-phonon model of nuclear collective motion with the semi-direct product structure [HW(21)]U(6) is obtained as a hydrodynamic (macroscopic) limit of the fully microscopic proton–neutron symplectic model (PNSM) with Sp(12, R) dynamical group. The phonon structure of the [HW(21)]U(6) model enables it to simultaneously include the giant monopole and quadrupole, as well as dipole resonances and their coupling to the low-lying collective states. The U(6) intrinsic structure of the [HW(21)]U(6) model, from the other side, gives a framework for the simultaneous shell-model interpretation of the ground state band and the other excited low-lying collective bands. It follows then that the states of the whole nuclear Hilbert space which can be put into one-to-one correspondence with those of a 21-dimensional oscillator with an intrinsic (base) U(6) structure. The latter can be determined in such a way that it is compatible with the proton–neutron structure of the nucleus. The macroscopic limit of the Sp(12, R) algebra, therefore, provides a rigorous mechanism for implementing the unified model ideas of coupling the valence particles to the core collective degrees of freedom within a fully microscopic framework without introducing redundant variables or violating the Pauli principle. (author)

  8. Elimination of proliferating cells from CNS grafts using a Ki67 promoter-driven thymidine kinase

    Directory of Open Access Journals (Sweden)

    Vannary Tieng

    2016-01-01

    Full Text Available Pluripotent stem cell (PSC-based cell therapy is an attractive concept for neurodegenerative diseases, but can lead to tumor formation. This is particularly relevant as proliferating neural precursors rather than postmitotic mature neurons need to be transplanted. Thus, safety mechanisms to eliminate proliferating cells are needed. Here, we propose a suicide gene approach, based on cell cycle-dependent promoter Ki67-driven expression of herpes simplex virus thymidine kinase (HSV-TK. We generated a PSC line expressing this construct and induced neural differentiation. In vitro, proliferating PSC and early neural precursor cells (NPC were killed by exposure to ganciclovir. In vivo, transplantation of PSC led to tumor formation, which was prevented by early ganciclovir treatment. Transplanted NPC did not lead to tumor formation and their survival and neural maturation were not affected by ganciclovir. In conclusion, the cell cycle promoter-driven suicide gene approach described in this study allows killing of proliferating undifferentiated precursor cells without expression of the suicide gene in mature neurons. This approach could also be of use for other stem cell-based therapies where the final target consists of postmitotic cells.

  9. Dmp1 Promoter-Driven Diphtheria Toxin Receptor Transgene Expression Directs Unforeseen Effects in Multiple Tissues

    Directory of Open Access Journals (Sweden)

    Ahmed Al-Jazzar

    2016-12-01

    Full Text Available Mice harbouring a dentin matrix protein 1 (Dmp1 promoter-driven human diphtheria toxin (DT receptor (HDTR transgene (Tg have recently been used to attain targeted ablation of osteocytes by diphtheria toxin (DT treatment in order to define osteocyte function. Use of these Tg mice has asserted mechano- and novel paracrine regulatory osteocyte functions. To explore osteocyte roles fully, we sought to confirm the selectivity of DT effects in these transgenic mice. However, our findings revealed incomplete DT-induced osteocyte ablation, prevalent HDTR misexpression, as well as more prominent histopathological DT-induced changes in multiple organs in Tg than in wild-type (WT littermate mice. Mechanistic evidence for DT action, via prominent regulation of phosphorylation status of elongation factor-2 (EF-2, was also found in many non-skeletal tissues in Tg mice; indicative of direct “off-target” DT action. Finally, very rapid deterioration in health and welfare status in response to DT treatment was observed in these Tg when compared to WT control mice. Together, these data lead us to conclude that alternative models for osteocyte ablation should be sought and caution be exercised when drawing conclusions from experiments using these Tg mice alone.

  10. Goat activin receptor type IIB knockdown by muscle specific promoter driven artificial microRNAs.

    Science.gov (United States)

    Patel, Amrutlal K; Shah, Ravi K; Patel, Utsav A; Tripathi, Ajai K; Joshi, Chaitanya G

    2014-10-10

    Activin receptor type IIB (ACVR2B) is a transmembrane receptor which mediates signaling of TGF beta superfamily ligands known to function in regulation of muscle mass, embryonic development and reproduction. ACVR2B antagonism has shown to enhance the muscle growth in several disease and transgenic models. Here, we show ACVR2B knockdown by RNA interference using muscle creatine kinase (MCK) promoter driven artificial microRNAs (amiRNAs). Among the various promoter elements tested, the ∼1.26 kb MCK promoter region showed maximum transcriptional activity in goat myoblasts cells. We observed up to 20% silencing in non-myogenic 293T cells and up to 32% silencing in myogenic goat myoblasts by MCK directed amiRNAs by transient transfection. Goat myoblasts stably integrated with MCK directed amiRNAs showed merely 8% silencing in proliferating myoblasts which was increased to 34% upon induction of differentiation at transcript level whereas up to 57% silencing at protein level. Knockdown of ACVR2B by 5'-UTR derived amiRNAs resulted in decreased SMAD2/3 signaling, increased expression of myogenic regulatory factors (MRFs) and enhanced proliferation and differentiation of myoblasts. Unexpectedly, knockdown of ACVR2B by 3'-UTR derived amiRNAs resulted in increased SMAD2/3 signaling, reduced expression of MRFs and suppression of myogenesis. Our study offers muscle specific knockdown of ACVR2B as a potential strategy to enhance muscle mass in the farm animal species. Copyright © 2014 Elsevier B.V. All rights reserved.

  11. Short Hairpin RNA (shRNA): Design, Delivery, and Assessment of Gene Knockdown

    Science.gov (United States)

    Moore, Chris B.; Guthrie, Elizabeth H.; Huang, Max Tze-Han; Taxman, Debra J.

    2013-01-01

    Shortly after the cellular mechanism of RNA interference (RNAi) was first described, scientists began using this powerful technique to study gene function. This included designing better methods for the successful delivery of small interfering RNAs (siRNAs) and short hairpin RNAs (shRNAs) into mammalian cells. While the simplest method for RNAi is the cytosolic delivery of siRNA oligonucleotides, this technique is limited to cells capable of transfection and is primarily utilized during transient in vitro studies. The introduction of shRNA into mammalian cells through infection with viral vectors allows for stable integration of shRNA and long-term knockdown of the targeted gene; however, several challenges exist with the implementation of this technology. Here we describe some well-tested protocols which should increase the chances of successful design, delivery, and assessment of gene knockdown by shRNA. We provide suggestions for designing shRNA targets and controls, a protocol for sequencing through the secondary structure of the shRNA hairpin structure, and protocols for packaging and delivery of shRNA lentiviral particles. Using real-time PCR and functional assays we demonstrate the successful knockdown of ASC, an inflammatory adaptor molecule. These studies demonstrate the practicality of including two shRNAs with different efficacies of knockdown to provide an additional level of control and to verify dose dependency of functional effects. Along with the methods described here, as new techniques and algorithms are designed in the future, shRNA is likely to include further promising application and continue to be a critical component of gene discovery. PMID:20387148

  12. Deep Sequencing Insights in Therapeutic shRNA Processing and siRNA Target Cleavage Precision.

    Science.gov (United States)

    Denise, Hubert; Moschos, Sterghios A; Sidders, Benjamin; Burden, Frances; Perkins, Hannah; Carter, Nikki; Stroud, Tim; Kennedy, Michael; Fancy, Sally-Ann; Lapthorn, Cris; Lavender, Helen; Kinloch, Ross; Suhy, David; Corbau, Romu

    2014-02-04

    TT-034 (PF-05095808) is a recombinant adeno-associated virus serotype 8 (AAV8) agent expressing three short hairpin RNA (shRNA) pro-drugs that target the hepatitis C virus (HCV) RNA genome. The cytosolic enzyme Dicer cleaves each shRNA into multiple, potentially active small interfering RNA (siRNA) drugs. Using next-generation sequencing (NGS) to identify and characterize active shRNAs maturation products, we observed that each TT-034-encoded shRNA could be processed into as many as 95 separate siRNA strands. Few of these appeared active as determined by Sanger 5' RNA Ligase-Mediated Rapid Amplification of cDNA Ends (5-RACE) and through synthetic shRNA and siRNA analogue studies. Moreover, NGS scrutiny applied on 5-RACE products (RACE-seq) suggested that synthetic siRNAs could direct cleavage in not one, but up to five separate positions on targeted RNA, in a sequence-dependent manner. These data support an on-target mechanism of action for TT-034 without cytotoxicity and question the accepted precision of substrate processing by the key RNA interference (RNAi) enzymes Dicer and siRNA-induced silencing complex (siRISC).Molecular Therapy-Nucleic Acids (2014) 3, e145; doi:10.1038/mtna.2013.73; published online 4 February 2014.

  13. Creating Transgenic shRNA Mice by Recombinase-Mediated Cassette Exchange

    Science.gov (United States)

    Premsrirut, Prem K.; Dow, Lukas E.; Park, Youngkyu; Hannon, Gregory J.; Lowe, Scott W.

    2014-01-01

    RNA interference (RNAi) enables sequence-specific, experimentally induced silencing of virtually any gene by tapping into innate regulatory mechanisms that are conserved among most eukaryotes. The principles that enable transgenic RNAi in cell lines can also be used to create transgenic animals, which express short-hairpin RNAs (shRNAs) in a regulated or tissue-specific fashion. However, RNAi in transgenic animals is somewhat more challenging than RNAi in cultured cells. The activities of promoters that are commonly used for shRNA expression in cell culture can vary enormously in different tissues, and founder lines also typically vary in transgene expression due to the effects of their single integration sites. There are many ways to produce mice carrying shRNA transgenes and the method described here uses recombinase-mediated cassette exchange (RMCE). RMCE permits insertion of the shRNA transgene into a well-characterized locus that gives reproducible and predictable expression in each founder and enhances the probability of potent expression in many cell types. This procedure is more involved and complex than simple pronuclear injection, but if even a few shRNA mice are envisioned, for example, to probe the functions of several genes, the effort of setting up the processes outlined below are well worthwhile. Note that when creating a transgenic mouse, one should take care to use the most potent shRNA possible. As a rule of thumb, the sequence chosen should provide >90% knockdown when introduced into cultured cells at single copy (e.g., on retroviral infection at a multiplicity of ≤0.3). PMID:24003198

  14. Timing characteristics of the VEhU-6 microchannel electron multipliers

    International Nuclear Information System (INIS)

    Bakhtizin, R.Z.; Yumaguzin, Yu.M.

    1982-01-01

    The VEhU-6 charnel electron multiplier timing characteristics are experimentally studied. Dependence of monoelectron pulse duration at the VEhU-6 output at different values of channel supply voltage is investigated. The VEhU-6 delay time is measured. Delay time increased from 10 to 30 ns with the increase of channel supply voltage from 2.8 to 3.2 kV (at approximately 10 5 pulse/s loading). Delay time increases with loading decrease

  15. Irradiation behavior of U 6Mn-Al dispersion fuel elements

    Science.gov (United States)

    Meyer, M. K.; Wiencek, T. C.; Hayes, S. L.; Hofman, G. L.

    2000-02-01

    Irradiation testing of U 6Mn-Al dispersion fuel miniplates was conducted in the Oak Ridge Research Reactor (ORR). Post-irradiation examination showed that U 6Mn in an unrestrained plate configuration performs similarly to U 6Fe under irradiation, forming extensive and interlinked fission gas bubbles at a fission density of approximately 3×10 27 m-3. Fuel plate failure occurs by fission gas pressure driven `pillowing' on continued irradiation.

  16. Intravitreal Injection of Ranibizumab and CTGF shRNA Improves Retinal Gene Expression and Microvessel Ultrastructure in a Rodent Model of Diabetes

    Directory of Open Access Journals (Sweden)

    Bojie Hu

    2014-01-01

    Full Text Available Therapeutic modalities targeting vascular endothelial growth factor (VEGF have been used to treat neovascularization and macular edema. However, anti-VEGF treatment alone may cause up-regulation of connective tissue growth factor (CTGF in the retina, increasing the risk of fibrosis and tractional retinal detachment. Therefore, in this study, we employ a novel dual-target intervention that involves intravitreal injection of the VEGF inhibitor ranibizumab and a transfection reagent-treated non-viral vector carrying anti-CTGF short hairpin RNA (shRNA driven by human RNA polymerase III promoter U6. The effects of the dual-target intervention on the expression of VEGF and CTGF and on microvessel ultrastructure were examined in retina of streptozocin-induced diabetic rats. CTGF was significantly up-regulated at week 8 after diabetic induction, whereas VEGF was not up-regulated until week 10. The high expression of both genes was maintained at week 12. Transmission electron microscopy also revealed progressive exacerbation of microvessel ultrastructure during the same period. In addition, ranibizumab significantly lowered VEGF but elevated CTGF mRNA, whereas CTGF shRNA significantly reduced the mRNA levels of both CTGF and VEGF in diabetic retinas. Importantly, dual-target intervention normalized the transcript levels of both target genes and ameliorated retinal microvessel ultrastructural damage better than either single-target intervention. These results suggest the advantages of dual-target over single-target interventions in diabetic retina and reveal a novel therapeutic modality for diabetic retinopathy.

  17. Usb1 controls U6 snRNP assembly through evolutionarily divergent cyclic phosphodiesterase activities.

    Science.gov (United States)

    Didychuk, Allison L; Montemayor, Eric J; Carrocci, Tucker J; DeLaitsch, Andrew T; Lucarelli, Stefani E; Westler, William M; Brow, David A; Hoskins, Aaron A; Butcher, Samuel E

    2017-09-08

    U6 small nuclear ribonucleoprotein (snRNP) biogenesis is essential for spliceosome assembly, but not well understood. Here, we report structures of the U6 RNA processing enzyme Usb1 from yeast and a substrate analog bound complex from humans. Unlike the human ortholog, we show that yeast Usb1 has cyclic phosphodiesterase activity that leaves a terminal 3' phosphate which prevents overprocessing. Usb1 processing of U6 RNA dramatically alters its affinity for cognate RNA-binding proteins. We reconstitute the post-transcriptional assembly of yeast U6 snRNP in vitro, which occurs through a complex series of handoffs involving 10 proteins (Lhp1, Prp24, Usb1 and Lsm2-8) and anti-cooperative interactions between Prp24 and Lhp1. We propose a model for U6 snRNP assembly that explains how evolutionarily divergent and seemingly antagonistic proteins cooperate to protect and chaperone the nascent snRNA during its journey to the spliceosome.The mechanism of U6 small nuclear ribonucleoprotein (snRNP) biogenesis is not well understood. Here the authors characterize the enzymatic activities and structures of yeast and human U6 RNA processing enzyme Usb1, reconstitute post-transcriptional assembly of yeast U6 snRNP in vitro, and propose a model for U6 snRNP assembly.

  18. Mitochondrial DNA transit between West Asia and North Africa inferred from U6 phylogeography

    Directory of Open Access Journals (Sweden)

    Larruga José M

    2003-10-01

    Full Text Available Abstract Background World-wide phylogeographic distribution of human complete mitochondrial DNA sequences suggested a West Asian origin for the autochthonous North African lineage U6. We report here a more detailed analysis of this lineage, unraveling successive expansions that affected not only Africa but neighboring regions such as the Near East, the Iberian Peninsula and the Canary Islands. Results Divergence times, geographic origin and expansions of the U6 mitochondrial DNA clade, have been deduced from the analysis of 14 complete U6 sequences, and 56 different haplotypes, characterized by hypervariable segment sequences and RFLPs. Conclusions The most probable origin of the proto-U6 lineage was the Near East. Around 30,000 years ago it spread to North Africa where it represents a signature of regional continuity. Subgroup U6a reflects the first African expansion from the Maghrib returning to the east in Paleolithic times. Derivative clade U6a1 signals a posterior movement from East Africa back to the Maghrib and the Near East. This migration coincides with the probable Afroasiatic linguistic expansion. U6b and U6c clades, restricted to West Africa, had more localized expansions. U6b probably reached the Iberian Peninsula during the Capsian diffusion in North Africa. Two autochthonous derivatives of these clades (U6b1 and U6c1 indicate the arrival of North African settlers to the Canarian Archipelago in prehistoric times, most probably due to the Saharan desiccation. The absence of these Canarian lineages nowadays in Africa suggests important demographic movements in the western area of this Continent.

  19. Suppression of IL-6 Gene by shRNA Augments Gemcitabine Chemosensitization in Pancreatic Adenocarcinoma Cells

    Directory of Open Access Journals (Sweden)

    Hai-Bo Xing

    2018-01-01

    Full Text Available Pancreatic adenocarcinoma has an exceedingly poor prognosis, accounting for five-year survival of less than 5%. Presently, improving the efficacy of pancreatic adenocarcinoma treatment has been the focus of medical researchers worldwide. Recently, it has been suggested that deregulation of interleukin- (IL- 6 is caused by a key gene involved in the beginning and development of pancreatic adenocarcinoma. Herein, we investigated whether suppression of IL-6 could augment gemcitabine sensitivity in the PANC-1 cells. We found considerably higher expression of IL-6 in pancreatic adenocarcinoma tissues than that in the adjacent nontumorous tissues. Suppression of IL-6 by shRNA resulted in apoptosis as well as inhibition of cell proliferation and tumorigenicity. In addition, suppression of IL-6 remarkably promoted antitumor effect of gemcitabine, indicating that the combination of shRNA targeting IL-6 with gemcitabine may provide a potential clinical approach for pancreatic cancer therapy.

  20. A simple and robust vector-based shRNA expression system used for RNA interference.

    Science.gov (United States)

    Wang, Xue-jun; Li, Ying; Huang, Hai; Zhang, Xiu-juan; Xie, Pei-wen; Hu, Wei; Li, Dan-dan; Wang, Sheng-qi

    2013-01-01

    RNA interference (RNAi) mediated by small interfering RNAs (siRNAs) or short hairpin RNAs (shRNAs) has become a powerful genetic tool for conducting functional studies. Previously, vector-based shRNA-expression strategies capable of inducing RNAi in viable cells have been developed, however, these vector systems have some disadvantages, either because they were error-prone or cost prohibitive. In this report we described the development of a simple, robust shRNA expression system utilizing 1 long oligonucleotide or 2 short oligonucleotides for half the cost of conventional shRNA construction methods and with a >95% cloning success rate. The shRNA loop sequence and stem structure were also compared and carefully selected for better RNAi efficiency. Furthermore, an easier strategy was developed based on isocaudomers which permit rapid combination of the most efficient promoter-shRNA cassettes. Finally, using this method, the conservative target sites for hepatitis B virus (HBV) knockdown were systemically screened and HBV antigen expression shown to be successfully suppressed in the presence of connected multiple shRNAs both in vitro and in vivo. This novel design describes an inexpensive and effective way to clone and express single or multiple shRNAs from the same vector with the capacity for potent and effective silencing of target genes.

  1. A simple and robust vector-based shRNA expression system used for RNA interference.

    Directory of Open Access Journals (Sweden)

    Xue-jun Wang

    Full Text Available BACKGROUND: RNA interference (RNAi mediated by small interfering RNAs (siRNAs or short hairpin RNAs (shRNAs has become a powerful genetic tool for conducting functional studies. Previously, vector-based shRNA-expression strategies capable of inducing RNAi in viable cells have been developed, however, these vector systems have some disadvantages, either because they were error-prone or cost prohibitive. RESULTS: In this report we described the development of a simple, robust shRNA expression system utilizing 1 long oligonucleotide or 2 short oligonucleotides for half the cost of conventional shRNA construction methods and with a >95% cloning success rate. The shRNA loop sequence and stem structure were also compared and carefully selected for better RNAi efficiency. Furthermore, an easier strategy was developed based on isocaudomers which permit rapid combination of the most efficient promoter-shRNA cassettes. Finally, using this method, the conservative target sites for hepatitis B virus (HBV knockdown were systemically screened and HBV antigen expression shown to be successfully suppressed in the presence of connected multiple shRNAs both in vitro and in vivo. CONCLUSION: This novel design describes an inexpensive and effective way to clone and express single or multiple shRNAs from the same vector with the capacity for potent and effective silencing of target genes.

  2. Elastic-Plastic Behavior of U6Nb Under Ramp Wave Loading

    Science.gov (United States)

    Hayes, D. B.; Hall, C.; Hixson, R. S.

    2005-07-01

    Prior shock experiments on the alloy uranium-niobium-6 wt.% (U6Nb) were absent an elastic precursor when one was expected (A. K. Zurek, et. al., Journal de Physique IV, 10 (#9) p677-682). This was later explained as a consequence of shear stress relaxation from time-dependent twinning that prevented sufficient shear stress for plastic yielding. (D. B. Hayes, et. al., Shock Compression of Condensed Matter-2003, p1177, American Institute of Physics 2004) Pressure was ramped to 13 GPa in 150-ns on eight U6Nb specimens with thicknesses from 0.5 -- 1.1-mm and the back surface velocities were measured with laser interferometry. This pressure load produces a stress wave with sufficiently fast rise time so that, according to the prior work, twins do not have time to form. Four of the U6Nb specimens had been cold-rolled which increased the yield stress. Each velocity history was analyzed with a backward integration analysis to give the stress-strain response of the U6Nb. Comparison of these results with prior Hugoniot measurements shows that the U6Nb in the present experiments responds as an elastic-plastic material and the deduced yield strength of the baseline and of the cold-rolled material agree with static results.

  3. Symmetry breaking of u(6/2j+1) supersymmetric models

    International Nuclear Information System (INIS)

    Baake, M.; Reinicke, P.

    1985-09-01

    In this paper, we present the group theory of models with broken u(6/2j+1) supersymmetry described by the chain u(6/2j+1) contains usub(B)(6) x usub(F)(2j+1) contains usub(B)(6) x spsub(F)(2j+1) contains ... contains sosub(B)(3) x susub(F)(2) contains susub(B+F)(2) which has recently been suggested for application to nuclear physics. We present all invariants that are needed for the construction of the general Hamiltonian for this model. (orig.)

  4. Transfer in the light Hg isotopes and the U(6/12) models

    International Nuclear Information System (INIS)

    Vergnes, M.; Grafeuille, S.; Rotbard, G.

    1985-01-01

    It was suggested recently that the level schemes of the odd Hg isotopes with 193 200 Hg, 198 Hg, 196 Hg(p,d) 199 Hg, 197 Hg, 195 Hg. The comparison of the experimental spectroscopic factors with the ones computed using the U(6/12) model shows that, among the three nuclei studied, 195 Hg and 197 Hg can be considered as reasonably described. The agreement in this case with U(6/12) is better in the U(5) limit than in the O(6) limit

  5. AAV-based shRNA silencing of NF-κB ameliorates muscle pathologies in mdx mice.

    Science.gov (United States)

    Yang, Q; Tang, Y; Imbrogno, K; Lu, A; Proto, J D; Chen, A; Guo, F; Fu, F H; Huard, J; Wang, B

    2012-12-01

    Chronic inflammation, promoted by an upregulated NF-kappa B (NF-κB) pathway, has a key role in Duchenne muscular dystrophy (DMD) patients' pathogenesis. Blocking the NF-κB pathway has been shown to be a viable approach to diminish chronic inflammation and necrosis in the dystrophin-defective mdx mouse, a murine DMD model. In this study, we used the recombinant adeno-associated virus serotype 9 (AAV9) carrying an short hairpin RNA (shRNA) specifically targeting the messenger RNA of NF-κB/p65 (p65-shRNA), the major subunit of NF-κB associated with chronic inflammation in mdx mice. We examined whether i.m. AAV9-mediated delivery of p65-shRNA could decrease NF-κB activation, allowing for amelioration of muscle pathologies in 1- and 4-month-old mdx mice. At 1 month after treatment, NF-κB/p65 levels were significantly decreased by AAV gene transfer of p65-shRNA in the two ages of treatment groups, with necrosis significantly decreased compared with controls. Quantitative analysis revealed that central nucleation (CN) of the myofibers of p65-shRNA-treated 1-month-old mdx muscles was reduced from 67 to 34%, but the level of CN was not significantly decreased in treated 4-month-old mdx mice. Moreover, delivery of the p65-shRNA enhanced the capacity of myofiber regeneration in old mdx mice treated at 4 months of age when the dystrophic myofibers were most exhausted; however, such p65 silencing diminished the myofiber regeneration in young mdx mice treated at 1 month of age. Taken together, these findings demonstrate that the AAV-mediated delivery of p65-shRNA has the capacity to ameliorate muscle pathologies in mdx mice by selectively reducing NF-κB/p65 activity.

  6. PEMBUATAN SERBUK U-6Zr DENGAN PENGKAYAAN URANIUM 19,75 % UNTUK BAHAN BAKAR REAKTOR RISET

    Directory of Open Access Journals (Sweden)

    Masrukan Masrukan

    2016-03-01

    Full Text Available ABSTRAK PEMBUATAN SERBUK PADUAN U-6Zr DENGAN PENGKAYAAN URANIUM 19,75 % UNTUK BAHAN BAKAR REAKTOR RISET. Telah dilakukan pembuatan serbuk paduan U-6Zr dengan pengkayaan 19,75 % untuk bahan bakar reaktor riset. Pembuatan bahan bakar U-6Zr ini dalam rangka mencari bahan bakar baru yang mempunyai densitas tinggi untuk mengganti bahan bakar yang sudah ada U3Si2-Al. Tujuan dari percobaan ini untuk mengetahui sifat-sifat serbuk paduan U- 6Zr yang diperoleh dari proses hydriding-dehydriding sebagai kandidat bahan bakar reaktor riset. Serbuk yang diperoleh dari proses hydriding-dehydriding dikenai pengujian, diantaranya pungujian komposisi kimia, densitas, kandungan hidrogen, fasa dan sifat termal. Hasil pengujian komposisi kimia menunjukkan beberapa unsur seperti Al, Ca, Cu, dan Ni melebihi batas yang diijinkan dimana masing-masing unsur terdapat sebesar 202,21 ppm; 214,05 ppm; 61,25 ppm dan 134,53 ppm. Pada pengujian diperolah densitas serbuk U-6Zr sebesar 13,58 g/cm3 dan pada pengujian kandungan hidrogen sisa diperoleh kandungan hidrogen sebesar 0,16 %. Untuk pengujian fasa, diperoleh fasa αU dan δU, sedangkan pada pengujian sifat termal yakni transformasi temperatur terdapat dua puncak yakni puncak pertama terjadi pada temperatur 274 hingga 311 oC dan puncak kedua terjadi pada temperatur 493 hingga 527oC. Puncak pertama terjadi reaksi endotermik dengan menyerap panas sebesar ∆H = 6,23 cal/g tetapi tidak terbentuk fasa baru, sedangkan puncak kedua terjadi reaksi eksotermik dengan mengeluarkan panas sebesar ∆H = -9.34 cal/g dan terbentuk fasa αZr. Sementara itu, dari pengujian kapasitas panas pada temperatur 34 hingga 75 oC, terjadinya penurunan nilai kapasitas panas yang disertai dengan penyerapan panas. Pada temperatur yang lebih tinggi hingga temperatur 437oC nilai kapasitas panas menjadi lebih kecil disertai pengeluaran panas. Reaksi termokimia antara Zr dengan hidrogen sisa menunjukkan terbentuknya fasa αZr yang diindikasikan oleh reaksi

  7. U6 snRNA expression prevents toxicity in TDP-43-knockdown cells.

    Directory of Open Access Journals (Sweden)

    Masao Yahara

    Full Text Available Depletion of amyotrophic lateral sclerosis (ALS-associated transactivation response (TAR RNA/DNA-binding protein 43 kDa (TDP-43 alters splicing efficiency of multiple transcripts and results in neuronal cell death. TDP-43 depletion can also disturb expression levels of small nuclear RNAs (snRNAs as spliceosomal components. Despite this knowledge, the relationship between cell death and alteration of snRNA expression during TDP-43 depletion remains unclear. Here, we knocked down TDP-43 in murine neuroblastoma Neuro2A cells and found a time lag between efficient TDP-43 depletion and appearance of cell death, suggesting that several mechanisms mediate between these two events. The amount of U6 snRNA was significantly decreased during TDP-43 depletion prior to increase of cell death, whereas that of U1, U2, and U4 snRNAs was not. Downregulation of U6 snRNA led to cell death, whereas transient exogenous expression of U6 snRNA counteracted the effect of TDP-43 knockdown on cell death, and slightly decreased the mis-splicing rate of Dnajc5 and Sortilin 1 transcripts, which are assisted by TDP-43. These results suggest that regulation of the U6 snRNA expression level by TDP-43 is a key factor in the increase in cell death upon TDP-43 loss-of-function.

  8. All Small Nuclear RNAs (snRNAs) of the [U4/U6.U5] Tri-snRNP Localize to Nucleoli; Identification of the Nucleolar Localization Element of U6 snRNA

    Science.gov (United States)

    Gerbi, Susan A.; Lange, Thilo Sascha

    2002-01-01

    Previously, we showed that spliceosomal U6 small nuclear RNA (snRNA) transiently passes through the nucleolus. Herein, we report that all individual snRNAs of the [U4/U6.U5] tri-snRNP localize to nucleoli, demonstrated by fluorescence microscopy of nucleolar preparations after injection of fluorescein-labeled snRNA into Xenopus oocyte nuclei. Nucleolar localization of U6 is independent from [U4/U6] snRNP formation since sites of direct interaction of U6 snRNA with U4 snRNA are not nucleolar localization elements. Among all regions in U6, the only one required for nucleolar localization is its 3′ end, which associates with the La protein and subsequently during maturation of U6 is bound by Lsm proteins. This 3′-nucleolar localization element of U6 is both essential and sufficient for nucleolar localization and also required for localization to Cajal bodies. Conversion of the 3′ hydroxyl of U6 snRNA to a 3′ phosphate prevents association with the La protein but does not affect U6 localization to nucleoli or Cajal bodies. PMID:12221120

  9. [Selection and construction of cell line stably expressing survivin gene in lower level through eukaryotic plasmid vector of shRNA].

    Science.gov (United States)

    Wang, Wen-Xia; Sun, Shan-Zhen; Song, Ying

    2008-06-01

    To construct a short hairpin RNA(shRNA) interference expression plasmid vector of survivin gene, transfect tongue squamous cell carcinoma line Tca8113 which expressed survivin gene in a high level, and choose the cells whose survivin gene were suppressed significantly. Two pairs of oligonucleotide sequences specific for survivin gene were designed and synthesized, and cloned into pSilencer-2.1U6-neo plasmid. The recombinant plasmids (named PS1 and PS2) were amplified in Ecoli. DH5alpha was identified by restriction digestion, PCR and sequencing. The vectors were transfected into Tca8113 cells with lipofectamine 2000. After selection with G418, the stable cell clones were attained. Survivn expression was assayed with real-time quantitative PCR and Western blotting. SAS8.0 software package was used for Student t test. Two vectors were constructed successfully and stable cell clones with PS1 or PS2 plasmid were obtained. As compared with those of control, survivin expression of transfected cell with PS1 or PS2 in mRNA level was significantly suppressed (P<0.05). In protein level, only those of transfected cell with PS2 was significantly suppressed (P<0.01). The shRNA interference expression plasmid vectors of survivin gene are successfully constructed, and Tca8113 cells which express survivin gene in a stable lower level are attained, which enable us to carry out further research on gene therapy of oral squamous cell carcinoma. Supported by National Natural Science Foundation of China (Grant No.30572056).

  10. Bose-Fermi U(6/2j+1) supersymmetries and high-spin anomalies

    International Nuclear Information System (INIS)

    Morrison, I.; Jarvis, P.D.

    1985-01-01

    A supersymmetric extension of the interacting boson model (IBM) is constructed to describe high-spin anomalies in both even- and odd-mass spectra of the Hg, Pt region (190<=A<=200). Supergroup chains such as U(6/2j+1)containsOsp(6/2j+1)containsO(6)xSp(2j+1)... or U(6/2j+1)containsU(5/2j+1)xU(1)containsOsp(5/2j+1)... incorporate a single j-shell fermion in addition to the usual 's' and 'd' bosons (L=0 and L=2). The orthosympletic supergroup reflects the strong pairing force in the subspace of the fermion intruder level. The model agrees favourably with experiment and microscopic calculation. (orig.)

  11. Direct Cast U-6Nb – 2017 Progress on Cylindrical Castings

    Energy Technology Data Exchange (ETDEWEB)

    Aikin, Jr., Robert M. [Los Alamos National Lab. (LANL), Los Alamos, NM (United States)

    2017-10-04

    This report describes work to further develop a sound technical basis and best practices for mold design and process parameters for the Direct Casting of U-6wt%Nb components. One major challenge to the production of U-6Nb components is the propensity for niobium segregation during casting and solidification. This is especially true for cylindrical castings where the vertical side walls allow flotation of Nb resulting in severe inverse macrosegregation. In this work, a small (120 mm diameter by 180 mm tall) and large cylinder (250 mm diameter by 310 mm tall) are examined with a focus on reducing, or eliminating, niobium segregation. It is demonstrated that counter gravity casting (top-to-bottom solidification) can be used to minimize segregation in the small cylinder. Attempts to counter gravity cast the large cylinder were unsuccessful, in large part due to size limitations of the current furnace. A path forward for casting of the large cylinders is discussed.

  12. Therapeutic effects of lentivirus-mediated shRNA targeting of cyclin D1 in human gastric cancer

    International Nuclear Information System (INIS)

    Seo, Jin-Hee; Jeong, Eui-Suk; Choi, Yang-Kyu

    2014-01-01

    Gastric cancer is the second most common cause of cancer-related death in males and the fourth in females. Traditional treatment has poor prognosis because of recurrence and systemic side effects. Therefore, the development of new therapeutic strategies is an important issue. Lentivirus-mediated shRNA stably inhibits target genes and can efficiently transduce most cells. Since overexpressed cyclin D1 is closely related to human gastric cancer progression, inhibition of cyclin D1 using specific targeting could be an effective treatment method of human gastric cancer. The therapeutic effect of lentivirus-mediated shRNA targeting of cyclin D1 (ShCCND1) was analyzed both in vitro and in vivo experiments. In vitro, NCI-N87 cells with downregulation of cyclin D1 by ShCCND1 showed significant inhibition of cell proliferation, cell motility, and clonogenicity. Downregulation of cyclin D1 in NCI-N87 cells also resulted in significantly increased G1 arrest and apoptosis. In vivo, stable NCI-N87 cells expressing ShCCND1 were engrafted into nude mice. Then, the cancer-growth inhibition effect of lentivirus was confirmed. To assess lentivirus including ShCCND1 as a therapeutic agent, intratumoral injection was conducted. Tumor growth of the lentivirus-treated group was significantly inhibited compared to growth of the control group. These results are in accordance with the in vitro data and lend support to the mitotic figure count and apoptosis analysis of the tumor mass. The lentivirus-mediated ShCCND1 was constructed, which effectively inhibited growth of NCI-N87-derived cancer both in vitro and in vivo. The efficiency of shRNA knockdown and variation in the degree of inhibition is mediated by different shRNA sequences and cancer cell lines. These experimental results suggest the possibility of developing new gastric cancer therapies using lentivirus-mediated shRNA

  13. Normal and superconducting state properties of U6Fe at low temperatures and high magnetic fields

    International Nuclear Information System (INIS)

    DeLong, L.E.; Crabtree, G.W.; Hall, L.N.; Kierstead, H.; Aoki, H.; Dhar, S.K.; Gschneidner, K.A. Jr.; Junod, A.

    1985-01-01

    High purity U 6 Fe polycrystals with a resistance ratio rrr=9 at T=4 K are found to exhibit a record onset temperature (T 0 >4.0 K) to superconductivity for U materials. Our measured values of the electronic coefficient of heat capacity Csup(*)=(150+-3) mJ/mol.K 2 , the mean Debye temperature THETA(T->0)=116 K and the normalized jump in heat capacity at Tsub(c), ΔC/γsup(*)Tsub(c)=2.3+-0.1, are all in good agreement with previous work, and suggest that U 6 Fe is a strong-coupled superconductor. Resistive upper critical field measurements on high purity samples revealed a pronounced S-shaped curvature of Hsub(c2)(T) and evidence for anisotropy, similar to effects seen in UPt 3 , but not observed in lower purity U 6 Fe samples. We find Hsub(c2)(0)>10 T and transition widths ΔTsub(c)proportionalHsup(1/2) at moderate fields, followed by an abrupt increase in ΔTsub(c) for H>8 T. Our Hsub(c2) data cannot be explained by existing theoretical models. Preliminary heat capacity measurements in magnetic fields 0 6 Fe at T< or approx.110 K. (orig.)

  14. Elastic-Plastic Behavior of U6Nb under Ramp Wave Loading

    International Nuclear Information System (INIS)

    Hayes, D. B.; Gray, G. T. III; Hixson, R. S.; Hall, C. A.

    2006-01-01

    When uranium-niobium (6 wt.%) alloy is shock loaded, the expected elastic precursor is absent. A prior model attributed this absence to shear-induced twinning and the concomitant shear stress reduction that prevented the shocked material from reaching the plastic yield point. In the present study, carefully prepared U6Nb was subjected to shock loading to verify the adequacy of the prior model. Other samples were loaded with a ramp pressure pulse with strain rate large enough so that significant twinning would not occur during the experiment. Backward integration analyses of these latter experiments' back surface motion give stress-strain loading paths in U6Nb that suggest ordinary elastic-plastic flow. Some of the U6Nb was pre-strained by cold rolling in an effort to further ensure that twinning did not affect wave propagation. Shock and ramp loadings yielded similar results to the baseline material except, as expected, they are consistent with a higher yield stress and twinning shear stress threshold

  15. Quantitative Evaluation of Myostatin Gene in Stably Transfected Caprine Fibroblast Cells by Anti-Myostatin shRNA.

    Science.gov (United States)

    Jain, Sudhir Kumar; Jain, Hemlata; Kumar, Dharmendra; Bedekar, Megha Kadam; Pandey, Akhilesh Kumar; Sarkhel, Bikash Chandra

    2015-09-01

    Skeletal muscle is the major component of lean tissue that is used for consumption, and myostatin is a negative regulator of skeletal muscle growth. Downregulation of this gene therefore offers a strategy for developing superior animals with enhanced muscle growth. Knockdown of myostatin was achieved by RNA interference technology. The anti-myostatin shRNA were designed and stably transfected in caprine fibroblast cells. The reduced expression of target gene was achieved and measured in clonal fibroblast cells by real-time PCR. Two single-cell clones induced significant decrease of myostatin gene expression by 73.96 and 72.66 %, respectively (P < 0.05). To ensure the appropriate growth of transfected cell, seven media were tested. The best suited media was used for transfected fibroblast cell proliferation. The findings suggest that shRNA provides a novel potential tool for gene knockdown and these stably transfected cells can be used as the donor cells for animal cloning.

  16. Effect of quench rate on the mechanical properties of U-6 wt % Nb

    International Nuclear Information System (INIS)

    Eckelmeyer, K.H.

    1980-03-01

    U-6 wt % Nb conventionally is water quenched from 800 0 C in order to obtain a niobium supersaturated α'' structure having good corrosion resistance and high ductility (125% tensile elongation). The high cooling rate associated with the water quench, however, produces undesirable distortion and residual stress. This study was conducted to determine the extent to which the quench rate could be reduced (in order to minimize the distortion and residual stress problems) without sacrificing properties. The results indicate that quench rate can be reduced by as much as a factor of 10 without any loss of ductility, and that a factor of 100 reduction in quench rate (as is produced by air cooling) still produces material with moderate ductility (> 12% tensile elongation). The results also indicate that supersaturated α'' structures are produced at all of these quench rates. This suggests that these reductions in quench rate should not have drastic adverse effects on corrosion resistance. Hence, it should not be possible to substantially reduce the magnitudes of the distortion and residual stress problems while retaining appreciable ductility and corrosion resistance in U-6 wt % Nb

  17. Heterologous and endogenous U6 snRNA promoters enable CRISPR/Cas9 mediated genome editing in Aspergillus niger.

    Science.gov (United States)

    Zheng, Xiaomei; Zheng, Ping; Sun, Jibin; Kun, Zhang; Ma, Yanhe

    2018-01-01

    U6 promoters have been used for single guide RNA (sgRNA) transcription in the clustered regularly interspaced short palindromic repeats/CRISPR-associated protein (CRISPR/Cas9) genome editing system. However, no available U6 promoters have been identified in Aspergillus niger, which is an important industrial platform for organic acid and protein production. Two CRISPR/Cas9 systems established in A. niger have recourse to the RNA polymerase II promoter or in vitro transcription for sgRNA synthesis, but these approaches generally increase cloning efforts and genetic manipulation. The validation of functional RNA polymerase II promoters is therefore an urgent need for A. niger . Here, we developed a novel CRISPR/Cas9 system in A. niger for sgRNA expression, based on one endogenous U6 promoter and two heterologous U6 promoters. The three tested U6 promoters enabled sgRNA transcription and the disruption of the polyketide synthase albA gene in A. niger . Furthermore, this system enabled highly efficient gene insertion at the targeted genome loci in A. niger using donor DNAs with homologous arms as short as 40-bp. This study demonstrated that both heterologous and endogenous U6 promoters were functional for sgRNA expression in A. niger . Based on this result, a novel and simple CRISPR/Cas9 toolbox was established in A. niger, that will benefit future gene functional analysis and genome editing.

  18. Expression of plasmid-based shRNA against the E1 and nsP1 genes effectively silenced Chikungunya virus replication.

    Directory of Open Access Journals (Sweden)

    Shirley Lam

    Full Text Available BACKGROUND: Chikungunya virus (CHIKV is a re-emerging alphavirus that causes chikungunya fever and persistent arthralgia in humans. Currently, there is no effective vaccine or antiviral against CHIKV infection. Therefore, this study evaluates whether RNA interference which targets at viral genomic level may be a novel antiviral strategy to inhibit the medically important CHIKV infection. METHODS: Plasmid-based small hairpin RNA (shRNA was investigated for its efficacy in inhibiting CHIKV replication. Three shRNAs designed against CHIKV Capsid, E1 and nsP1 genes were transfected to establish stable shRNA-expressing cell clones. Following infection of stable shRNA cells clones with CHIKV at M.O.I. 1, viral plaque assay, Western blotting and transmission electron microscopy were performed. The in vivo efficacy of shRNA against CHIKV replication was also evaluated in a suckling murine model of CHIKV infection. RESULTS: Cell clones expressing shRNAs against CHIKV E1 and nsP1 genes displayed significant inhibition of infectious CHIKV production, while shRNA Capsid demonstrated a modest inhibitory effect as compared to scrambled shRNA cell clones and non-transfected cell controls. Western blot analysis of CHIKV E2 protein expression and transmission electron microscopy of shRNA E1 and nsP1 cell clones collectively demonstrated similar inhibitory trends against CHIKV replication. shRNA E1 showed non cell-type specific anti-CHIKV effects and broad-spectrum silencing against different geographical strains of CHIKV. Furthermore, shRNA E1 clones did not exert any inhibition against Dengue virus and Sindbis virus replication, thus indicating the high specificity of shRNA against CHIKV replication. Moreover, no shRNA-resistant CHIKV mutant was generated after 50 passages of CHIKV in the stable cell clones. More importantly, strong and sustained anti-CHIKV protection was conferred in suckling mice pre-treated with shRNA E1. CONCLUSION: Taken together, these

  19. Hypoxia-response plasmid vector producing bcl-2 shRNA enhances the apoptotic cell death of mouse rectum carcinoma.

    Science.gov (United States)

    Fujioka, Takashi; Matsunaga, Naoya; Okazaki, Hiroyuki; Koyanagi, Satoru; Ohdo, Shigehiro

    2010-01-01

    Hypoxia-induced gene expression frequently occurs in malignant solid tumors because they often have hypoxic areas in which circulation is compromised due to structurally disorganized blood vessels. Hypoxia-response elements (HREs) are responsible for activating gene transcription in response to hypoxia. In this study, we constructed a hypoxia-response plasmid vector producing short hairpin RNA (shRNA) against B-cell leukemia/lymphoma-2 (bcl-2), an anti-apoptotic factor. The hypoxia-response promoter was made by inserting tandem repeats of HREs upstream of cytomegalovirus (CMV) promoter (HRE-CMV). HRE-CMV shbcl-2 vector consisted of bcl-2 shRNA under the control of HRE-CMV promoter. In hypoxic mouse rectum carcinoma cells (colon-26), the production of bcl-2 shRNA driven by HRE-CMV promoter was approximately 2-fold greater than that driven by CMV promoter. A single intratumoral (i.t.) injection of 40 microg HRE-CMV shbcl-2 to colon-26 tumor-bearing mice caused apoptotic cell death, and repetitive treatment with HRE-CMV shbcl-2 (40 microg/mouse, i.t.) also significantly suppressed the growth of colon-26 tumor cells implanted in mice. Apoptotic and anti-tumor effects were not observed in tumor-bearing mice treated with CMV shbcl-2. These results reveal the ability of HRE-CMV shbcl-2 vector to suppress the expression of bcl-2 in hypoxic tumor cells and suggest the usefulness of our constructed hypoxia-response plasmid vector to treat malignant tumors. [Supplementary Figures: available only at http://dx.doi.org/10.1254/jphs.10054FP].

  20. U6+ minerals and inorganic compounds: insights into an expanded structural hierarchy of crystal structures

    International Nuclear Information System (INIS)

    Burns, P.C.

    2005-01-01

    The crystal structures of uranyl minerals and inorganic uranyl compounds are important for understanding the genesis of U deposits, the interaction of U mine and mill tailings with the environment, transport of actinides in soils and the vadose zone, the performance of geological repositories for nuclear waste, and for the development of advanced materials with novel applications. Over the past decade, the number of inorganic uranyl compounds (including minerals) with known structures has more than doubled, and reconsideration of the structural hierarchy of uranyl compounds is warranted. Here, 368 inorganic crystal structures that contain essential U 6+ are considered (of which 89 are minerals). They are arranged on the basis of the topological details of their structural units, which are formed by the polymerization of polyhedra containing higher-valence cations. Overarching structural categories correspond to those based upon isolated polyhedra (8), finite clusters (43), chains (57), sheets (204), and frameworks (56) of polyhedra. Within these categories, structures are organized and compared upon the basis of either their graphical representations, or in the case of sheets involving sharing of edges of polyhedra, upon the topological arrangement of anions within the sheets. (author)

  1. Divorcing the Late Upper Palaeolithic demographic histories of mtDNA haplogroups M1 and U6 in Africa

    Directory of Open Access Journals (Sweden)

    Pennarun Erwan

    2012-12-01

    Full Text Available Abstract Background A Southwest Asian origin and dispersal to North Africa in the Early Upper Palaeolithic era has been inferred in previous studies for mtDNA haplogroups M1 and U6. Both haplogroups have been proposed to show similar geographic patterns and shared demographic histories. Results We report here 24 M1 and 33 U6 new complete mtDNA sequences that allow us to refine the existing phylogeny of these haplogroups. The resulting phylogenetic information was used to genotype a further 131 M1 and 91 U6 samples to determine the geographic spread of their sub-clades. No southwest Asian specific clades for M1 or U6 were discovered. U6 and M1 frequencies in North Africa, the Middle East and Europe do not follow similar patterns, and their sub-clade divisions do not appear to be compatible with their shared history reaching back to the Early Upper Palaeolithic. The Bayesian Skyline Plots testify to non-overlapping phases of expansion, and the haplogroups’ phylogenies suggest that there are U6 sub-clades that expanded earlier than those in M1. Some M1 and U6 sub-clades could be linked with certain events. For example, U6a1 and M1b, with their coalescent ages of ~20,000–22,000 years ago and earliest inferred expansion in northwest Africa, could coincide with the flourishing of the Iberomaurusian industry, whilst U6b and M1b1 appeared at the time of the Capsian culture. Conclusions Our high-resolution phylogenetic dissection of both haplogroups and coalescent time assessments suggest that the extant main branching pattern of both haplogroups arose and diversified in the mid-later Upper Palaeolithic, with some sub-clades concomitantly with the expansion of the Iberomaurusian industry. Carriers of these maternal lineages have been later absorbed into and diversified further during the spread of Afro-Asiatic languages in North and East Africa.

  2. Is TNF-a-targeted short hairpin RNA (shRNA) a novel potential therapeutic tool in psoriasis treatment?

    DEFF Research Database (Denmark)

    Stenderup, Karin; Jakobsen, Maria; Rosada, Cecilia

    2008-01-01

      TNF-α is a well known target in psoriasis treatment and biological treatments targeting TNF-a are already clinically used against psoriasis and psoriasis arthritis. Attention is however given to a novel therapeutic tool: RNA interference that controls gene silencing. This study investigates...... the efficiency of targeting TNF-a with specific short hairpin RNA (shRNA) and explores its potential in treating psoriasis. ShRNAs targeting human TNF-α mRNA were generated. Their efficiency in down-regulating TNF-a protein expression was evaluated using a Renilla luciferase screening-assay and a transient co...... TNF-a shRNA was used to transduce HEK293 cells and verify vector-derived TNF-a knockdown in vitro. In vivo, psoriasis skin was exposed to lentiviral TNF-a shRNAs by a single intra-dermal injection. Psoriasis skin for the in vivo study was obtained from psoriatic plaque skin biopsies that were...

  3. [Lentivirus-mediated shRNA silencing of LAMP2A inhibits the proliferation of multiple myeloma cells].

    Science.gov (United States)

    Li, Lixuan; Li, Jia

    2015-05-01

    To study the effects of lentivirus-mediated short hairpin RNA (shRNA) silencing of lysosome-associated membrane protein type 2A (LAMP2A) expression on the proliferation of multiple myeloma cells. The constructed shRNA lentiviral vector was applied to infect human multiple myeloma cell line MM.1S, and stable expression cell line was obtained by puromycin screening. Western blotting was used to verify the inhibitory effect on LAMP2A protein expression. MTT assay was conducted to detect the effect of knocked-down LAMP2A on MM.1S cell proliferation, and the anti-tumor potency of suberoylanilide hydroxamic acid (SAHA) against the obtained MM.1S LAMP2A(shRNA) stable cell line. Lactate assay was performed to observe the impact of low LAMP2A expression on cell glycolysis. The stable cell line with low LAMP2A expression were obtained with the constructed human LAMP2A-shRNA lentiviral vector. Down-regulation of LAMP2A expression significantly inhibited MM.1S cell proliferation and enhanced the anti-tumor activity of SAHA. Interestingly, decreased LAMP2A expression also inhibited MM.1S cell lactic acid secretion. Down-regulation of LAMP2A expression could inhibit cell proliferation in multiple myeloma cells.

  4. Development of HSPA1A promoter-driven luciferase reporter gene assays in human cells for assessing the oxidative damage induced by silver nanoparticles

    International Nuclear Information System (INIS)

    Xin, Lili; Wang, Jianshu; Zhang, Leshuai W.; Che, Bizhong; Dong, Guangzhu; Fan, Guoqiang; Cheng, Kaiming

    2016-01-01

    The exponential increase in the total number of engineered nanoparticles in consumer products requires novel tools for rapid and cost-effective toxicology screening. In order to assess the oxidative damage induced by nanoparticles, toxicity test systems based on a human HSPA1A promoter-driven luciferase reporter in HepG2, LO2, A549, and HBE cells were established. After treated with heat shock and a group of silver nanoparticles (AgNPs) with different primary particle sizes, the cell viability, oxidative damage, and luciferase activity were determined. The time-dependent Ag + ions release from AgNPs in cell medium was also evaluated. Our results showed that heat shock produced a strong time-dependent induction of relative luciferase activity in the four luciferase reporter cells. Surprisingly, at 4 h of recovery, the relative luciferase activity was > 98 × the control level in HepG2-luciferase cells. Exposure to different sizes of AgNPs resulted in activation of the HSPA1A promoter in a dose-dependent manner, even at low cytotoxic or non-cytotoxic doses. The smaller (5 nm) AgNPs were more potent in luciferase induction than the larger (50 and 75 nm) AgNPs. These results were generally in accordance with the oxidative damage indicated by malondialdehyde concentration, reactive oxygen species induction and glutathione depletion, and Ag + ions release in cell medium. Compared with the other three luciferase reporter cells, the luciferase signal in HepG2-luciferase cells is obviously more sensitive and stable. We conclude that the luciferase reporter cells, especially the HepG2-luciferase cells, could provide a valuable tool for rapid screening of the oxidative damage induced by AgNPs. - Highlights: • We established the stable HSPA1A promoter-driven luciferase reporter cells. • Silver nanoparticles induced dose-dependent increases in luciferase activity. • HSPA1A promoter activity is a sensitive and responsive indicator of oxidative stress. • HepG2-luciferase

  5. Delivery of a survivin promoter-driven antisense survivin-expressing plasmid DNA as a cancer therapeutic: a proof-of-concept study

    Directory of Open Access Journals (Sweden)

    Lin KY

    2016-05-01

    Full Text Available Kun-Yuan Lin,1 Siao Muk Cheng,2 Shing-Ling Tsai,2 Ju-Ya Tsai,1 Chun-Hui Lin,1 Chun Hei Antonio Cheung1,2 1Department of Pharmacology, College of Medicine, National Cheng Kung University, Tainan, Taiwan, ROC; 2Institute of Basic Medical Sciences, College of Medicine, National Cheng Kung University, Tainan, Taiwan, ROC Abstract: Survivin is a member of the inhibitor-of-apoptosis proteins family. It is overexpressed in many different cancer types but not in the differentiated normal tissue. In addition, overexpression of survivin promotes cancer cell survival and induces chemotherapeutic drug resistance, making it an attractive target for new anticancer interventions. Despite survivin being a promising molecular target for anticancer treatment, it is widely accepted that survivin is only a “semi-druggable” target. Therefore, it is important to develop a new strategy to target survivin for anticancer treatment. In this study, we constructed a novel survivin promoter-driven full-length antisense survivin (pSur/AS-Sur expression plasmid DNA. Promoter activity assay revealed that the activity of the survivin promoter of pSur/AS-Sur correlated with the endogenous expression of survivin at the transcriptional level in the transfected A549, MDA-MB-231, and PANC-1 cancer cells. Western blot analysis showed that liposomal delivery of pSur/AS-Sur successfully downregulated the expression of survivin in A549, MBA-MB-231, and PANC-1 cells in vitro. In addition, delivery of pSur/AS-Sur induced autophagy, caspase-dependent apoptosis, and caspase-independent apoptosis as indicated by the increased LC3B-II conversion, autophagosome formation, caspase-9/-3 and poly(ADP-ribose polymerase-1 cleavage, and apoptosis-inducing factor nuclear translocation in A549, MBA-MB-231, and PANC-1 cells. Importantly, liposomal delivery of pSur/AS-Sur was also capable of decreasing the proliferation of the survivin/MDR1 coexpressing multidrug-resistant KB-TAX50 cancer cells and

  6. Development of HSPA1A promoter-driven luciferase reporter gene assays in human cells for assessing the oxidative damage induced by silver nanoparticles

    Energy Technology Data Exchange (ETDEWEB)

    Xin, Lili, E-mail: llxin@suda.edu.cn [School of Public Health, Medical College of Soochow University, 199 Renai Road, Suzhou 215123, Jiangsu (China); Jiangsu Key Laboratory of Preventive and Translational Medicine for Geriatric Diseases, School of Public Health, Soochow University, Suzhou 215123 (China); Wang, Jianshu [Suzhou Center for Disease Prevention and Control, 72 Sanxiang Road, Suzhou, Jiangsu (China); Zhang, Leshuai W. [School of Radiation Medicine and Protection & School for Radiological and Interdisciplinary Sciences (RAD-X), Soochow University, 215123 (China); Che, Bizhong; Dong, Guangzhu [School of Public Health, Medical College of Soochow University, 199 Renai Road, Suzhou 215123, Jiangsu (China); Fan, Guoqiang; Cheng, Kaiming [Suzhou Industrial Park Centers for Disease Control and Prevention, 58 Suqian Road, Suzhou, Jiangsu (China)

    2016-08-01

    The exponential increase in the total number of engineered nanoparticles in consumer products requires novel tools for rapid and cost-effective toxicology screening. In order to assess the oxidative damage induced by nanoparticles, toxicity test systems based on a human HSPA1A promoter-driven luciferase reporter in HepG2, LO2, A549, and HBE cells were established. After treated with heat shock and a group of silver nanoparticles (AgNPs) with different primary particle sizes, the cell viability, oxidative damage, and luciferase activity were determined. The time-dependent Ag{sup +} ions release from AgNPs in cell medium was also evaluated. Our results showed that heat shock produced a strong time-dependent induction of relative luciferase activity in the four luciferase reporter cells. Surprisingly, at 4 h of recovery, the relative luciferase activity was > 98 × the control level in HepG2-luciferase cells. Exposure to different sizes of AgNPs resulted in activation of the HSPA1A promoter in a dose-dependent manner, even at low cytotoxic or non-cytotoxic doses. The smaller (5 nm) AgNPs were more potent in luciferase induction than the larger (50 and 75 nm) AgNPs. These results were generally in accordance with the oxidative damage indicated by malondialdehyde concentration, reactive oxygen species induction and glutathione depletion, and Ag{sup +} ions release in cell medium. Compared with the other three luciferase reporter cells, the luciferase signal in HepG2-luciferase cells is obviously more sensitive and stable. We conclude that the luciferase reporter cells, especially the HepG2-luciferase cells, could provide a valuable tool for rapid screening of the oxidative damage induced by AgNPs. - Highlights: • We established the stable HSPA1A promoter-driven luciferase reporter cells. • Silver nanoparticles induced dose-dependent increases in luciferase activity. • HSPA1A promoter activity is a sensitive and responsive indicator of oxidative stress. • HepG2

  7. P1 promoter-driven HNF4α isoforms are specifically repressed by β-catenin signaling in colorectal cancer cells.

    Science.gov (United States)

    Babeu, Jean-Philippe; Jones, Christine; Geha, Sameh; Carrier, Julie C; Boudreau, François

    2018-06-13

    HNF4α is a key nuclear receptor for regulating gene expression in the gut. While both P1 and P2 isoform classes of HNF4α are expressed in colonic epithelium, specific inhibition of P1 isoforms is commonly found in colorectal cancer. Previous studies have suggested that P1 and P2 isoforms may regulate different cellular functions. Despite these advances, it remains unclear whether these isoform classes are functionally divergent in the context of human biology. Here, the consequences of specific inhibition of P1 or P2 isoform expression was measured in a human colorectal cancer cell transcriptome. Results indicate that P1 isoforms were specifically associated with the control of cell metabolism while P2 isoforms globally supported aberrant oncogenic signalization, promoting cancer cell survival and progression. P1 promoter-driven isoform expression was found to be repressed by β-catenin, one of the earliest oncogenic pathways to be activated during colon tumorigenesis. These findings identify a novel cascade by which the expression of P1 isoforms are rapidly shut down in the early stages of colon tumorigenesis, allowing a change in HNF4α-dependent transcriptome thereby promoting colorectal cancer progression. © 2018. Published by The Company of Biologists Ltd.

  8. Permanent, lowered HLA class I expression using lentivirus vectors with shRNA constructs: Averting cytotoxicity by alloreactive T lymphocytes.

    Science.gov (United States)

    Haga, K; Lemp, N A; Logg, C R; Nagashima, J; Faure-Kumar, E; Gomez, G G; Kruse, C A; Mendez, R; Stripecke, R; Kasahara, N; Kasahara, N A; Cicciarelli, J C

    2006-12-01

    Transplantation of many tissues requires histocompatibility matching of human leukocyte antigens (HLA) to prevent graft rejection, to reduce the level of immunosuppression needed to maintain graft survival, and to minimize the risk of graft-versus-host disease, particularly in the case of bone marrow transplantation. However, recent advances in fields of gene delivery and genetic regulation technologies have opened the possibility of engineering grafts that display reduced levels of HLA expression. Suppression of HLA expression could help to overcome the limitations imposed by extensive HLA polymorphisms that restrict the availability of suitable donors, necessitate the maintenance of large donor registries, and complicate the logistics of procuring and delivering matched tissues and organs to the recipient. Accordingly, we investigated whether knockdown of HLA by RNA interference (RNAi), a ubiquitous regulatory system that can efficiently and selectively inhibit the expression of specific gene products, would enable allogeneic cells to evade immune recognition. For efficient and stable delivery of short hairpin-type RNAi constructs (shRNA), we employed lentivirus-based gene transfer vectors, which provide a delivery system that can achieve integration into genomic DNA, thereby permanently modifying transduced graft cells. Our results show that lentivirus-mediated delivery of shRNA targeting pan-Class I and allele-specific HLA can achieve efficient and dose-dependent reduction in surface expression of HLA in human cells, associated with enhanced resistance to alloreactive T lymphocyte-mediated cytotoxicity, while avoiding MHC-non-restricted killing. We hypothesize that RNAi-induced silencing of HLA expression has the potential to create histocompatibility-enhanced, and, eventually, perhaps "universally" compatible cellular grafts.

  9. Three new shRNA expression vectors targeting the CYP3A4 coding sequence to inhibit its expression

    Directory of Open Access Journals (Sweden)

    Siyun Xu

    2014-10-01

    Full Text Available RNA interference (RNAi is useful for selective gene silencing. Cytochrome P450 3A4 (CYP3A4, which metabolizes approximately 50% of drugs in clinical use, plays an important role in drug metabolism. In this study, we aimed to develop a short hairpin RNA (shRNA to modulate CYP3A4 expression. Three new shRNAs (S1, S2 and S3 were designed to target the coding sequence (CDS of CYP3A4, cloned into a shRNA expression vector, and tested in different cells. The mixture of three shRNAs produced optimal reduction (55% in CYP3A4 CDS-luciferase activity in both CHL and HEK293 cells. Endogenous CYP3A4 expression in HepG2 cells was decreased about 50% at both mRNA and protein level after transfection of the mixture of three shRNAs. In contrast, CYP3A5 gene expression was not altered by the shRNAs, supporting the selectivity of CYP3A4 shRNAs. In addition, HepG2 cells transfected with CYP3A4 shRNAs were less sensitive to Ginkgolic acids, whose toxic metabolites are produced by CYP3A4. These results demonstrate that vector-based shRNAs could modulate CYP3A4 expression in cells through their actions on CYP3A4 CDS, and CYP3A4 shRNAs may be utilized to define the role of CYP3A4 in drug metabolism and toxicity.

  10. An infinitely expandable cloning strategy plus repeat-proof PCR for working with multiple shRNA.

    Directory of Open Access Journals (Sweden)

    Glen John McIntyre

    Full Text Available Vector construction with restriction enzymes (REs typically involves the ligation of a digested donor fragment (insert to a reciprocally digested recipient fragment (vector backbone. Creating a suitable cloning plan becomes increasingly difficult for complex strategies requiring repeated insertions such as constructing multiple short hairpin RNA (shRNA expression vectors for RNA interference (RNAi studies. The problem lies in the reduced availability of suitable RE recognition sites with an increasing number of cloning events and or vector size. This report details a technically simple, directional cloning solution using REs with compatible cohesive ends that are repeatedly destroyed and simultaneously re-introduced with each round of cloning. Donor fragments can be made by PCR or sub-cloned from pre-existing vectors and inserted ad infinitum in any combination. The design incorporates several cloning cores in order to be compatible with as many donor sequences as possible. We show that joining sub-combinations made in parallel is more time-efficient than sequential construction (of one cassette at a time for any combination of 4 or more insertions. Screening for the successful construction of combinations using Taq polymerase based PCR became increasingly difficult with increasing number of repeated sequence elements. A Pfu polymerase based PCR was developed and successfully used to amplify combinations of up to eleven consecutive hairpin expression cassettes. The identified PCR conditions can be beneficial to others working with multiple shRNA or other repeated sequences, and the infinitely expandable cloning strategy serves as a general solution applicable to many cloning scenarios.

  11. Effects and mechanism of integrin-β1 gene expression inhibited by shRNA in invasion of pancreatic carcinoma PANC-1 cells.

    Science.gov (United States)

    Yu, Feng; Li, Hua; Bu, Xuefeng; Zhang, Yongjun

    2012-01-01

    To investigate the effects of integrin-β1 gene expression inhibited by shRNA on invasion of pancreatic carcinoma PANC-1 cells in vitro. The eukaryotic expression plasmid of short hairpin RNA (shRNA) targeting integrin-β1 gene (integrin-β1-shRNA) was constructed and transfected into PANC-1 cells. The expressions of integrin-β1 mRNA and protein were detected by real-time quantitative polymerase chain reaction (PCR) and western blot assay, respectively. The invasive ability of PANC-1 cells was observed with a transwell cell culture chamber and the expressions of MMP-2 and MMP-9 were assayed. Compared to the untransfected group, recombinant expression plasmid integrin-β1-shRNA resulted in reduction of integrin-β1 mRNA and protein by 78.58%±7.24% and 92.88%±3.18%, respectively and the average number of invading PANC-1 cells were decreased from 52±5 to 21±4 (pPANC-1 cells in vitro significantly.

  12. The influence of survivin shRNA on the cell cycle and the invasion of SW480 cells of colorectal carcinoma

    Directory of Open Access Journals (Sweden)

    Yu Jin

    2008-07-01

    Full Text Available Abstract Background The objective was to understand the influence of Survivin plasmid with short hairpin RNA (shRNA on the cell cycle, invasion, and the silencing effect of Survivin gene in the SW480 cell of colorectal carcinoma. Methods A eukaryotic expression vector, PGCH1/Survivin shRNA, a segment sequence of Survivin as target, was created and transfected into colorectal carcinoma cell line SW480 by the non-lipid method. The influence on the Survivin protein was analyzed by Western blotting, while the cell cycle, cell apoptosis were analyzed by flow cytometry, and invasion of the cell was analyzed by Transwell's chamber method. Results After the transfection of PGCH1/Survivin shRNA, the expression of Survivin protein in SW480 cells was dramatically decreased by 60.68%, in which the cells were stopped at G2/M phase, even though no apoptosis was detected. The number of transmembranous cells of the experimental group, negative control group, and blank control group were 14.46 ± 2.11, 25.12 ± 8.37, and 25.86 ± 7.45, respectively (P 0.05. Conclusion Survivin shRNA could significantly reduce the expression of Survivin protein and invasion of SW480 cells. Changes in cell cycle were observed, but no apoptosis was induced.

  13. Low-temperature heat-capacity study of the U6X (XequivalentMn, Fe, Co, Ni) compounds

    International Nuclear Information System (INIS)

    Yang, K.N.; Maple, M.B.; DeLong, L.E.; Huber, J.G.; Junod, A.

    1989-01-01

    Measurements of the superconducting- and normal-state heat capacity of U 6 X (XequivalentMn, Fe, Co, Ni) compounds have been performed over a temperature range 1 Kapprox. 6 X compounds have strong renormalizations of the free-carrier effective mass m/sup */ in the range 10m/sub e/approx. 6 X heat capacities suggest the presence of high densities of low-energy excitations of undetermined nature. The results are analyzed in terms of models appropriate to heavy-fermion liquids, and anisotropic or strong-coupled superconductors. The U 6 X compounds form a link between relatively low-m/sup */, high-transition-temperature A15 compounds and the more extreme examples of heavy-fermion superconductors such as UBe/sub 13/, UPt 3 , and CeCuSi 2 for which m/sup */∼10 2 m/sub e/. .AE

  14. Assembly and dynamics of the U4/U6 di-snRNP by single-molecule FRET

    Science.gov (United States)

    Hardin, John W.; Warnasooriya, Chandani; Kondo, Yasushi; Nagai, Kiyoshi; Rueda, David

    2015-01-01

    In large ribonucleoprotein machines, such as ribosomes and spliceosomes, RNA functions as an assembly scaffold as well as a critical catalytic component. Protein binding to the RNA scaffold can induce structural changes, which in turn modulate subsequent binding of other components. The spliceosomal U4/U6 di-snRNP contains extensively base paired U4 and U6 snRNAs, Snu13, Prp31, Prp3 and Prp4, seven Sm and seven LSm proteins. We have studied successive binding of all protein components to the snRNA duplex during di-snRNP assembly by electrophoretic mobility shift assay and accompanying conformational changes in the U4/U6 RNA 3-way junction by single-molecule FRET. Stems I and II of the duplex were found to co-axially stack in free RNA and function as a rigid scaffold during the entire assembly, but the U4 snRNA 5′ stem-loop adopts alternative orientations each stabilized by Prp31 and Prp3/4 binding accounting for altered Prp3/4 binding affinities in presence of Prp31. PMID:26503251

  15. Mpn1, Mutated in Poikiloderma with Neutropenia Protein 1, Is a Conserved 3′-to-5′ RNA Exonuclease Processing U6 Small Nuclear RNA

    Directory of Open Access Journals (Sweden)

    Vadim Shchepachev

    2012-10-01

    Full Text Available Clericuzio-type poikiloderma with neutropenia (PN is a rare genodermatosis associated with mutations in the C16orf57 gene, which codes for the uncharacterized protein hMpn1. We show here that, in both fission yeasts and humans, Mpn1 processes the spliceosomal U6 small nuclear RNA (snRNA posttranscriptionally. In Mpn1-deficient cells, U6 molecules carry 3′ end polyuridine tails that are longer than those in normal cells and lack a terminal 2′,3′ cyclic phosphate group. In mpn1Δ yeast cells, U6 snRNA and U4/U6 di-small nuclear RNA protein complex levels are diminished, leading to precursor messenger RNA splicing defects, which are reverted by expression of either yeast or human Mpn1 and by overexpression of U6. Recombinant hMpn1 is a 3′-to-5′ RNA exonuclease that removes uridines from U6 3′ ends, generating terminal 2′,3′ cyclic phosphates in vitro. Finally, U6 degradation rates increase in mpn1Δ yeasts and in lymphoblasts established from individuals affected by PN. Our data indicate that Mpn1 promotes U6 stability through 3′ end posttranscriptional processing and implicate altered U6 metabolism as a potential mechanism for PN pathogenesis.

  16. Downregulation of mouse CCR3 by lentiviral shRNA inhibits proliferation and induces apoptosis of mouse eosinophils.

    Science.gov (United States)

    Zhu, Xin-Hua; Liao, Bing; Xu, Yi; Liu, Ke; Huang, Yun; Huang, Quan-Long; Liu, Yue-Hui

    2017-02-01

    RNA interference has been considered as an effective gene silencing method in basic and preclinical investigations. The aims of the present study were to construct a lentiviral vector expressing a short hairpin RNA (shRNA) targeting the murine CC chemokine receptor 3 (mCCR3), and to investigate its effects on the proliferation and apoptosis of mouse eosinophils. A recombinant lentiviral vector expressing four fragments of mouse CCR3 shRNA (pLVX‑mCCR3‑1+2+3+4‑shRNA) was constructed using subcloning techniques. This novel lentivirus was then packaged into 293T cells by co‑transduction with plasmids, including Baculo p35, pCMV R8.2 and VSV. The interference effects of the vector were verified using polymerase chain reaction (PCR) and western blot analyses. The effects of the interference on the proliferation and apoptosis of mouse eosinophils were investigated using 3‑(4,5‑dimethylthiazol‑2‑yl)‑5‑(3‑carboxymethoxyphenyl)‑2‑(4‑sulfophenyl)‑2H‑tetrazolium and terminal deoxynucleotidyl transferase dUTP nick end labeling methods, respectively. The results of the PCR and western blot analyses confirmed that the novel recombinant vector, pLVX‑mCCR3‑1+2+3+4‑shRNA, had high efficiency in inhibiting the mRNA and protein expression levels of mCCR3 in mouse eosinophils. The downregulation of mCCR3 significantly inhibited proliferation of the eosinophils. Furthermore, the present study found that the downregulation of mCCR3 significantly promoted apoptosis of the eosinophils. Therefore, the downregulation of mCCR3 led to the inhibition of proliferation and induction of apoptosis in mouse eosinophils. The predominant characteristics of allergic rhinitis are eosinophil infiltration and release of inflammatory mediators, which appear in a variety of clinical manifestations. The results of the present study indicate that mCCR3 silencing may serve as a putative approach for the treatment of allergic rhinitis.

  17. A genome-wide shRNA screen identifies GAS1 as a novel melanoma metastasis suppressor gene.

    Science.gov (United States)

    Gobeil, Stephane; Zhu, Xiaochun; Doillon, Charles J; Green, Michael R

    2008-11-01

    Metastasis suppressor genes inhibit one or more steps required for metastasis without affecting primary tumor formation. Due to the complexity of the metastatic process, the development of experimental approaches for identifying genes involved in metastasis prevention has been challenging. Here we describe a genome-wide RNAi screening strategy to identify candidate metastasis suppressor genes. Following expression in weakly metastatic B16-F0 mouse melanoma cells, shRNAs were selected based upon enhanced satellite colony formation in a three-dimensional cell culture system and confirmed in a mouse experimental metastasis assay. Using this approach we discovered 22 genes whose knockdown increased metastasis without affecting primary tumor growth. We focused on one of these genes, Gas1 (Growth arrest-specific 1), because we found that it was substantially down-regulated in highly metastatic B16-F10 melanoma cells, which contributed to the high metastatic potential of this mouse cell line. We further demonstrated that Gas1 has all the expected properties of a melanoma tumor suppressor including: suppression of metastasis in a spontaneous metastasis assay, promotion of apoptosis following dissemination of cells to secondary sites, and frequent down-regulation in human melanoma metastasis-derived cell lines and metastatic tumor samples. Thus, we developed a genome-wide shRNA screening strategy that enables the discovery of new metastasis suppressor genes.

  18. Mild hydrothermal crystal growth of new uranium(IV) fluorides, Na3.13Mg1.43U6F30 and Na2.50Mn1.75U6F30: Structures, optical and magnetic properties

    Science.gov (United States)

    Yeon, Jeongho; Smith, Mark D.; Tapp, Joshua; Möller, Angela; zur Loye, Hans-Conrad

    2016-04-01

    Two new uranium(IV) fluorides, Na3.13Mg1.43U6F30 (1) and Na2.50Mn1.75U6F30 (2), were synthesized through an in situ mild hydrothermal route, and were structurally characterized by single crystal X-ray diffraction. The compounds exhibit complex crystal structures composed of corner- or edge-shared UF9 and MF6 (M=Mg, Mn) polyhedra, forming hexagonal channels in the three-dimensional framework, in which ordered or disordered divalent metal and sodium atoms reside. The large hexagonal voids contain the nearly regular M(II)F6 octahedra and sodium ions, whereas the small hexagonal cavities include M(II) and sodium ions on a mixed-occupied site. Magnetic susceptibility measurements yielded effective magnetic moments of 8.36 and 11.6 μB for 1 and 2, respectively, confirming the presence and oxidation states of U(IV) and Mn(II). The large negative Weiss constants indicate the spin gap between a triplet and a singlet state in the U(IV). Magnetization data as a function of applied fields revealed that 2 exhibits paramagnetic behavior due to the nonmagnetic singlet ground state of U(IV) at low temperature. UV-vis diffuse reflectance and X-ray photoelectron spectroscopy data were also analyzed.

  19. α-Fetoprotein promoter-driven Cre/LoxP-switched RNA interference for hepatocellular carcinoma tissue-specific target therapy.

    Directory of Open Access Journals (Sweden)

    Yuan-Fei Peng

    Full Text Available RNA interference (RNAi has recently emerged as a potential treatment modality for hepatocellular carcinoma (HCC therapy, but the lack of cellular targets and sustained efficacy limits its application. The purpose of this study is to develop an HCC tissue-specific RNAi system and investigate its possibility for HCC treatment.Two different HCC-specific RNAi systems in which therapeutic miRNA or shRNA against target gene (Beclin 1 was directly or indirectly driven by alpha-fetoprotein promoter (AFP-miRNA and AFP-Cre/LoxP-shRNA were constructed. Human HCC cell lines (HepG2, Hep3B and HCCLM3 and non-HCC cell lines (L-02, Hela and SW1116 were infected with the systems. The effectiveness and tissue-specificity of the systems were examined by Q-PCR and western blot analysis. The efficacy of the systems was further tested in mouse model of HCC by intravenous or intratumoral administration. The feasibility of the system for HCC treatment was evaluated by applying the system as adjuvant therapy to enhance sorafenib treatment. An AFP-Cre/LoxP-shRNA system targeting Atg5 gene (AFP-Cre/LoxP-shRNA-Atg5 was constructed and its efficacy in sensitizing HCC cells (MHCC97L/PLC to sorafenib treatment was examined by apoptosis assay in vitro and tumorigenesis assay in vivo.The AFP-miRNA system could silence target gene (Beclin 1 but required a high titer which was lethal to target cells. The AFP-Cre/LoxP-shRNA system could efficiently knockdown target gene while maintain high HCC specificity. Intratumoral injection of the AFP-Cre/LoxP-shRNA system could efficiently silence target gene (Beclin 1 in vivo while intravenous administration could not. The AFP-Cre/LoxP-shRNA system target Atg5 gene could significantly sensitize MHCC97L/PLC cells to sorafenib-induced apoptosis in vitro and tumor growth suppression in vivo.An efficient HCC tissue-specific RNAi system (AFP-Cre/LoxP-shRNA was successfully established. The system provides a usable tool for HCC-specific RNAi

  20. A comparison of the metallurgical behaviour of dispersion fuels with uranium silicides and U6Fe as dispersants

    International Nuclear Information System (INIS)

    Nazare, S.

    1984-01-01

    In the past few years metallurgical studies have been carried out to develop fuel dispersions with U-densities up to 7.0 Mg U m -3 . Uranium silicides have been considered to be the prime candidates as dispersants; U 6 Fe being a potential alternative on account of its higher U-density. The objective of this paper is to compare the metallurgical behaviour of these two material combinations with regard to the following aspects: (1) preparation of the compounds U 3 Si, U 3 Si 2 and U 6 Fe; (2) powder metallurgical processing to miniature fuel element plates; (3) reaction behaviour under equilibrium conditions in the relevant portions of the ternary U-Si-Al and U-Fe-Al systems; (4) dimensional stability of the fuel plates after prolonged thermal treatment; (5) thermochemical behaviour of fuel plates at temperatures near the melting point of the cladding. Based on this data, the possible advantages of each fuel combination are discussed. (author)

  1. Development of U6Fe-Al dispersions for the use of LEU in research and test reactors

    International Nuclear Information System (INIS)

    Nazare, S.

    1983-01-01

    For some time now, efforts are being made to develop fuel dispersions that would permit the use of low (approx. 20% 235-U) enriched uranium (LEU) instead of the currently used highly (approx. 93% 235-U) enriched uranium (HEU) in research and test reactors. Since penalties in the performance of the reactor have to be avoided, the 235-U content in the dispersion has at least to be retained at current levels. On account of their high U-densities, the major development effort has been focussed on the uranium silicides (U 3 Si, U 3 Si(Al), and U 3 Si 2 -based dispersions). With silicides as dispersants, it is possible to fabricate fuel element plates with U-densities in the dispersion of about 6.0 gU/cm 3 . In comparison to the silicides, the U 6 Fe-phase offers several advantages namely: higher U-density (approx. 17.0 gU/cm 3 ); relative ease of formation compared to U 3 Si; possible advantages with regard to reprocessing of the spent fuel due to the absence of silicon. The studies outlined here were performed with a view to investigating the preparation, reaction behavior and dimensional stability after heat treatment of U 6 Fe-Al dispersions

  2. Development of U6Fe-Al dispersions for the use of LEU in research and test reactors

    International Nuclear Information System (INIS)

    Nazare, S.

    1983-01-01

    For some time now, efforts are being made to develop fuel dispersions that would permit the use of low (∼ 20% 235-U) enriched uranium (LEU) instead of the currently used highly (∼ 93% 235-U) enriched uranium (HEU) in research and test reactors. Since penalties in the performance of the reactor have to be avoided, the 235-U content in the dispersion has at least to be retained at current levels. On account of their high U-densities, the major development effort has been focussed on the uranium silicides [U 3 Si, U 3 Si(Al), and U 3 Si 2 - based dispersions. With silicides as dispersants, it is possible to fabricate fuel element plates with U-densities in the dispersion of about 6.0 g U/cm 3 . In comparison to the silicides, the U 6 Fe-phase offers several advantages namely: - higher U-density (∼ 17.0 g U/cm 3 ); - relative ease of formation compared to U 3 Si; - possible advantages with regard to reprocessing of the spent fuel due to the absence of silicon. The studies outlined here were therefore performed with a view to investigating the preparation, reaction behaviour and dimensional stability after heat treatment of U 6 Fe-Al dispersions

  3. Efficient and nontoxic biological response carrier delivering TNF-α shRNA for gene silencing in a murine model of rheumatoid arthritis

    Directory of Open Access Journals (Sweden)

    Jialin Song

    2016-08-01

    Full Text Available Small interfering RNA (siRNA is an effective and specific method for silencing genes. However, an efficient and nontoxic carrier is needed to deliver the siRNA into the target cells. Tumor necrosis factor α (TNF-α plays a central role in the occurrence and progression of rheumatoid arthritis. In this study, we pre-synthetized a degradable cationic polymer (PDAPEI from 2,6-pyridinedicarboxaldehyde and low molecular weight polyethyleneimine (PEI, Mw=1.8 kDa as a gene vector for the delivery of TNF-α shRNA. The PDAPEI/pDNA complex showed a suitable particle size and stable zeta potential for transfection. In vitro study of the PDAPEI/pDNA complex revealed a lower cytotoxicity and higher transfection efficiency when transfecting TNF-α shRNA to macrophages by significantly down-regulating the expression of TNF-α. Moreover, the complex was extremely efficient in decreasing the severity of arthritis in mice with collagen-induced arthritis (CIA. PDAPEI delivered TNF-α shRNA has great potential in the treatment of rheumatoid arthritis.

  4. Filaggrin silencing by shRNA directly impairs the skin barrier function of normal human epidermal keratinocytes and then induces an immune response

    Energy Technology Data Exchange (ETDEWEB)

    Dang, N.N. [Department of Dermatology, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China); College of Life Science, Shandong Normal University, Jinan, Shandong Province (China); Pang, S.G. [Department of Endocrinology, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China); Song, H.Y. [Department of Dermatology, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China); An, L.G. [College of Life Science, Shandong Normal University, Jinan, Shandong Province (China); Ma, X.L. [Central Laboratory, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China)

    2014-11-14

    The objective of this study was to investigate whether a single defect in skin barrier function simulated by filaggrin silencing could induce Th2-predominant inflammation. Filaggrin gene expression was silenced in cultured normal human epidermal keratinocytes (NHEKs) using small hairpin RNA (shRNA, GTTGGCTCAAGCATATTATTT). The efficacy of silencing was confirmed by polymerase chain reaction (PCR) and Western blotting. Filaggrin-silenced cells (LV group), shRNA control cells (NC group), and noninfected cells (Blank group) were evaluated. The expression of cornified cell envelope-related proteins, including cytokeratin (CK)-5, -10, -14, loricrin, involucrin, and transglutaminase (TGM)-1, was detected by Western blotting. Interleukins (IL)-2, IL-4, IL-5, IL-12p70, IL-13, and interferon-gamma (IFN-γ) were detected by enzyme-linked immunosorbent assay (ELISA). After filaggrin was successfully silenced by shRNA, the expressions of CK-5, -10, -14, involucrin, and TGM-1 in NHEKs were significantly downregulated compared to the Blank and NC groups (P<0.05 or P<0.01); only loricrin expression was markedly upregulated (P<0.01). Filaggrin silencing also resulted in significant increases of IL-2, IL-4, IL-5, and IL-13 (P<0.05 or P<0.01), and significant decreases of IL-12p70 and IFN-γ (P<0.01) compared with cells in the Blank and NC groups. Filaggrin silencing impaired normal skin barrier function mainly by targeting the cornified cell envelope. The immune response after filaggrin silencing was characterized by Th2 cells, mainly because of the inhibition of IFN-γ expression. Lack of filaggrin may directly impair skin barrier function and then further induce the immune response.

  5. Hypoxia-inducible bidirectional shRNA expression vector delivery using PEI/chitosan-TBA copolymers for colorectal Cancer gene therapy.

    Science.gov (United States)

    Javan, Bita; Atyabi, Fatemeh; Shahbazi, Majid

    2018-04-12

    This investigation was conducted to construct a hypoxia/colorectal dual-specific bidirectional short hairpin RNA (shRNA) expression vector and to transfect it into the colon cancer cell line HT-29 with PEI/chitosan-TBA nanoparticles for the simultaneous knock down of β-catenin and Bcl-2 under hypoxia. To construct a pRNA-bipHRE-CEA vector, the carcinoma embryonic antigen (CEA) promoter designed in two directions and the vascular endothelial growth factor (VEGF) enhancer were inserted between two promoters for hypoxic cancer specific gene expression. To confirm the therapeutic effect of the dual-specific vector, β-catenin and Bcl-2 shRNAs were inserted downstream of each promoter. The physicochemical properties, the cytotoxicity, and the transfection efficiency of these PEI/chitosan-TBA nanoparticles were investigated. In addition, the antitumor effects of the designed vector on the expression of β-catenin and Bcl-2, cell cycle distribution, and apoptosis were investigated in vitro. The silencing effect of the hypoxia-response shRNA expression vector was relatively low (18%-25%) under normoxia, whereas it was significantly increased to approximately 50%-60% in the HT-29 cell line. Moreover, the cancer cells showed significant G0/G1 arrest and increased apoptosis due to gene silencing under hypoxia. Furthermore, MTS assay, fluorescence microscopy images, and flow cytometry analyses confirmed that the PEI/chitosan-TBA blend system provided effective transfection with low cytotoxicity. This novel hypoxia-responsive shRNA expression vector may be useful for RNA interference (RNAi)-based cancer gene therapy in hypoxic colorectal tumors. Moreover, the PEI/chitosan-TBA copolymer might be a promising gene carrier for use in gene transfer in vivo. Copyright © 2017. Published by Elsevier Inc.

  6. Suppression of human breast tumors in NOD/SCID mice by CD44 shRNA gene therapy combined with doxorubicin treatment

    Directory of Open Access Journals (Sweden)

    Pham PV

    2012-05-01

    Full Text Available Phuc Van Pham1, Ngoc Bich Vu1, Thuy Thanh Duong1, Tam Thanh Nguyen1, Nhung Hai Truong1, Nhan Lu Chinh Phan1, Tue Gia Vuong1, Viet Quoc Pham1, Hoang Minh Nguyen1, Kha The Nguyen1, Nhung Thi Nguyen1, Khue Gia Nguyen1, Lam Tan Khat1, Dong Van Le2, Kiet Dinh Truong1, Ngoc Kim Phan11Laboratory of Stem Cell Research and Application, University of Science, Vietnam National University, HCM City, 2Military Medical University, Ha Noi, VietnamBackground: Breast cancer stem cells with a CD44+CD24- phenotype are the origin of breast tumors. Strong CD44 expression in this population indicates its important role in maintaining the stem cell phenotype. Previous studies show that CD44 down-regulation causes CD44+CD24- breast cancer stem cells to differentiate into non-stem cells that are sensitive to antitumor drugs and lose many characteristics of the original cells. In this study, we determined tumor suppression in non-obese severe combined immunodeficiency mice using CD44 shRNA therapy combined with doxorubicin treatment.Methods: Tumor-bearing non-obese severe combined immunodeficiency mice were established by injection of CD44+CD24- cells. To track CD44+CD24- cells, green fluorescence protein was stably transduced using a lentiviral vector prior to injection into mice. The amount of CD44 shRNA lentiviral vector used for transduction was based on CD44 down-regulation by in vitro CD44 shRNA transduction. Mice were treated with direct injection of CD44 shRNA lentiviral vector into tumors followed by doxorubicin administration after 48 hours. The effect was evaluated by changes in the size and weight of tumors compared with that of the control.Results: The combination of CD44 down-regulation and doxorubicin strongly suppressed tumor growth with significant differences in tumor sizes and weights compared with that of CD44 down-regulation or doxorubicin treatment alone. In the combination of CD44 down-regulation and doxorubicin group, the tumor weight was

  7. In vivo targeting of ADAM9 gene expression using lentivirus-delivered shRNA suppresses prostate cancer growth by regulating REG4 dependent cell cycle progression.

    Directory of Open Access Journals (Sweden)

    Che-Ming Liu

    Full Text Available Cancer cells respond to stress by activating a variety of survival signaling pathways. A disintegrin and metalloproteinase (ADAM 9 is upregulated during cancer progression and hormone therapy, functioning in part through an increase in reactive oxygen species. Here, we present in vitro and in vivo evidence that therapeutic targeting of ADAM9 gene expression by lentivirus-delivered small hairpin RNA (shRNA significantly inhibited proliferation of human prostate cancer cell lines and blocked tumor growth in a murine model of prostate cancer bone metastasis. Cell cycle studies confirmed an increase in the G1-phase and decrease in the S-phase population of cancer cells under starvation stress conditions, which correlated with elevated intracellular superoxide levels. Microarray data showed significantly decreased levels of regenerating islet-derived family member 4 (REG4 expression in prostate cancer cells with knockdown of ADAM9 gene expression. This REG4 downregulation also resulted in induction of expression of p21(Cip1/WAF1, which negatively regulates cyclin D1 and blocks the G1/S transition. Our data reveal a novel molecular mechanism of ADAM9 in the regulation of prostate cancer cell proliferation, and suggests a combined modality of ADAM9 shRNA gene therapy and cytotoxic agents for hormone refractory and bone metastatic prostate cancer.

  8. Influence of Expression Plasmid of Connective Tissue Growth Factor and Tissue Inhibitor of Metalloproteinase-1 shRNA on Hepatic Precancerous Fibrosis in Rats.

    Science.gov (United States)

    Zhang, Qun; Shu, Fu-Li; Jiang, Yu-Feng; Huang, Xin-En

    2015-01-01

    In this study, influence caused by expression plasmids of connective tissue growth factor (CTGF) and tissue inhibitor of metalloproteinase-1 (TIMP-1) short hairpin RNA (shRNA) on mRNA expression of CTGF,TIMP-1,procol-α1 and PCIII in hepatic tissue with hepatic fibrosis, a precancerous condition, in rats is analyzed. To screen and construct shRNA expression plasimid which effectively interferes RNA targets of CTGF and TIMP-1 in rats. 50 cleaning Wistar male rats are allocated randomly at 5 different groups after precancerous fibrosis models and then injection of shRNA expression plasimids. Plasmid psiRNA-GFP-Com (CTGF and TIMP-1 included), psiRNA-GFP-CTGF, psiRNA-GFP-TIMP-1 and psiRNA- DUO-GFPzeo of blank plasmid are injected at group A, B, C and D, respectively, and as model control group that none plasimid is injected at group E. In 2 weeks after last injection, to hepatic tissue at different groups, protein expression of CTGF, TIMP-1, procol-α1and PC III is tested by immunohistochemical method and,mRNA expression of CTGF,TIMP-1,procol-α1 and PCIII is measured by real-time PCR. One-way ANOVA is used to comparison between-groups. Compared with model group, there is no obvious difference of mRNA expression among CTGF,TIMP-1,procol-α1,PC III and of protein expression among CTGF, TIMP-1, procol-α1, PC III in hepatic tissue at group injected with blank plasmid. Expression quantity of mRNA of CTGF, TIMP-1, procol-α1 and PCIII at group A, B and C decreases, protein expression of CTGF, TIMP-1, procol-α1, PC III in hepatic tissue is lower, where the inhibition of combination RNA interference group (group A) on procol-α1 mRNA transcription and procol-α1 protein expression is superior to that of single interference group (group B and C) (P<0.01 or P<0.05). RNA interference on CTGF and/or TIMP-1 is obviously a inhibiting factor for mRNA and protein expression of CTGF, TIMP-1, procol-α1 and PCIII. Combination RNA interference on genes of CTGF and TIMP-1 is superior

  9. Direct dissolution of g-level U metal and U-6 % Zr alloy bits by TBP-nitric acid adduct and in situ extraction at ambient pressures

    International Nuclear Information System (INIS)

    Shekhar Kumar; Bijendra Kumar; Gelatar, J.K.; Pranay Kumar Sinha; Alok Kumar Mishra; Kamachi Mudali, U.

    2016-01-01

    A study on direct dissolution of g-level metallic U and U-6 % Zr alloy bits by TBP-nitric acid adduct followed by in situ extraction at ambient pressures under batch and dynamic conditions was performed. The product organic solution was adjusted to 30 % TBP in dodecane and from it, U(VI) could be stripped quantitatively with 0.01 N nitric acid. Experimental results of the study are presented in this paper. (author)

  10. Conditional RNA interference achieved by Oct-1 POU/rtTA fusion protein activator and a modified TRE-mouse U6 promoter

    International Nuclear Information System (INIS)

    Fei Zhaoliang; Chen Zheng; Wang Zhugang; Fei Jian

    2007-01-01

    RNA interference (RNAi) is a powerful technique and is widely used to down-regulate expression of specific genes in cultured cells and in vivo. In this paper, we report our development of a new tetracycline-inducible RNAi expression using a modified TRE-mouse U6 promoter in which the distal sequence element (DSE) was replaced by the tetracycline-responsive element (TRE). The modified TRE-mouse U6 promoter can be activated by a Tet-on version tetracycline-regulated artificial activator rTetOct which was constructed by fusing the rtTA DNA binding domain with the Oct-1 POU activation domain. This rTetOct/TRE-U6 system was successfully applied to conditionally and reversibly down-regulate the expression of endogenous p53 gene in MCF7 cells, and the expression of β-defensin gene (mBin1b) either transiently expressed in COS7 cells or stably expressed in CHO cells

  11. Stimulation of Pol III-dependent 5S rRNA and U6 snRNA gene expression by AP-1 transcription factors.

    Science.gov (United States)

    Ahuja, Richa; Kumar, Vijay

    2017-07-01

    RNA polymerase III transcribes structurally diverse group of essential noncoding RNAs including 5S ribosomal RNA (5SrRNA) and U6 snRNA. These noncoding RNAs are involved in RNA processing and ribosome biogenesis, thus, coupling Pol III activity to the rate of protein synthesis, cell growth, and proliferation. Even though a few Pol II-associated transcription factors have been reported to participate in Pol III-dependent transcription, its activation by activator protein 1 (AP-1) factors, c-Fos and c-Jun, has remained unexplored. Here, we show that c-Fos and c-Jun bind to specific sites in the regulatory regions of 5S rRNA (type I) and U6 snRNA (type III) gene promoters and stimulate their transcription. Our chromatin immunoprecipitation studies suggested that endogenous AP-1 factors bind to their cognate promoter elements during the G1/S transition of cell cycle apparently synchronous with Pol III transcriptional activity. Furthermore, the interaction of c-Jun with histone acetyltransferase p300 promoted the recruitment of p300/CBP complex on the promoters and facilitated the occupancy of Pol III transcriptional machinery via histone acetylation and chromatin remodeling. The findings of our study, together, suggest that AP-1 factors are novel regulators of Pol III-driven 5S rRNA and U6 snRNA expression with a potential role in cell proliferation. © 2017 Federation of European Biochemical Societies.

  12. Kinome-wide shRNA Screen Identifies the Receptor Tyrosine Kinase AXL as a Key Regulator for Mesenchymal Glioblastoma Stem-like Cells

    Directory of Open Access Journals (Sweden)

    Peng Cheng

    2015-05-01

    Full Text Available Glioblastoma is a highly lethal cancer for which novel therapeutics are urgently needed. Two distinct subtypes of glioblastoma stem-like cells (GSCs were recently identified: mesenchymal (MES and proneural (PN. To identify mechanisms to target the more aggressive MES GSCs, we combined transcriptomic expression analysis and kinome-wide short hairpin RNA screening of MES and PN GSCs. In comparison to PN GSCs, we found significant upregulation and phosphorylation of the receptor tyrosine kinase AXL in MES GSCs. Knockdown of AXL significantly decreased MES GSC self-renewal capacity in vitro and inhibited the growth of glioblastoma patient-derived xenografts. Moreover, inhibition of AXL with shRNA or pharmacologic inhibitors also increased cell death significantly more in MES GSCs. Clinically, AXL expression was elevated in the MES GBM subtype and significantly correlated with poor prognosis in multiple cancers. In conclusion, we identified AXL as a potential molecular target for novel approaches to treat glioblastoma and other solid cancers.

  13. Novel HIV-1 knockdown targets identified by an enriched kinases/phosphatases shRNA library using a long-term iterative screen in Jurkat T-cells.

    Directory of Open Access Journals (Sweden)

    Sylvie Rato

    2010-02-01

    Full Text Available HIV-1 is a complex retrovirus that uses host machinery to promote its replication. Understanding cellular proteins involved in the multistep process of HIV-1 infection may result in the discovery of more adapted and effective therapeutic targets. Kinases and phosphatases are a druggable class of proteins critically involved in regulation of signal pathways of eukaryotic cells. Here, we focused on the discovery of kinases and phosphatases that are essential for HIV-1 replication but dispensable for cell viability. We performed an iterative screen in Jurkat T-cells with a short-hairpin-RNA (shRNA library highly enriched for human kinases and phosphatases. We identified 14 new proteins essential for HIV-1 replication that do not affect cell viability. These proteins are described to be involved in MAPK, JNK and ERK pathways, vesicular traffic and DNA repair. Moreover, we show that the proteins under study are important in an early step of HIV-1 infection before viral integration, whereas some of them affect viral transcription/translation. This study brings new insights for the complex interplay of HIV-1/host cell and opens new possibilities for antiviral strategies.

  14. In vivo knockdown of antisense non-coding mitochondrial RNAs by a lentiviral-encoded shRNA inhibits melanoma tumor growth and lung colonization.

    Science.gov (United States)

    Varas-Godoy, Manuel; Lladser, Alvaro; Farfan, Nicole; Villota, Claudio; Villegas, Jaime; Tapia, Julio C; Burzio, Luis O; Burzio, Veronica A; Valenzuela, Pablo D T

    2018-01-01

    The family of non-coding mitochondrial RNAs (ncmtRNA) is differentially expressed according to proliferative status. Normal proliferating cells express sense (SncmtRNA) and antisense ncmtRNAs (ASncmtRNAs), whereas tumor cells express SncmtRNA and downregulate ASncmtRNAs. Knockdown of ASncmtRNAs with oligonucleotides induces apoptotic cell death of tumor cells, leaving normal cells unaffected, suggesting a potential application for developing a novel cancer therapy. In this study, we knocked down the ASncmtRNAs in melanoma cell lines with a lentiviral-encoded shRNA approach. Transduction with lentiviral constructs targeted to the ASncmtRNAs induced apoptosis in murine B16F10 and human A375 melanoma cells in vitro and significantly retarded B16F10 primary tumor growth in vivo. Moreover, the treatment drastically reduced the number of lung metastatic foci in a tail vein injection assay, compared to controls. These results provide additional proof of concept to the knockdown of ncmtRNAs for cancer therapy and validate lentiviral-shRNA vectors for gene therapy. © 2017 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  15. Anti-cancer effect of oncolytic adenovirus-armed shRNA targeting MYCN gene on doxorubicin-resistant neuroblastoma cells.

    Science.gov (United States)

    Li, Yuan; Zhuo, Baobiao; Yin, Yiyu; Han, Tao; Li, Shixian; Li, Zhengwei; Wang, Jian

    2017-09-09

    Chemotherapy is one of the few effective choices for patients with neuroblastoma. However, the development of muti-drug resistance (MDR) to chemotherapy is a major obstacle to the effective treatment of advanced or recurrent neuroblastoma. The muti-drug resistance-associated protein (MRP), which encodes a transmembrane glycoprotein, is a key regulator of MDR. The expression of MRP is a close correlation with MYCN oncogene in neuroblastoma. We have recently shown ZD55-shMYCN (oncolytic virus armed with shRNA against MYCN) can down-regulate MYCN to inhibit tumor cells proliferation and induce apoptosis in neuroblastoma. Here we further report ZD55-shMYCN re-sensitized doxorubicin-resistant cells to doxorubicin (as shown by reduced proliferation, increased apoptosis, and inhibited cell migration), and reduced the in vivo growth rate of neuroblastoma xenografts by down-regulation of MRP expression. Sequential therapy with doxorubicin did not affect the replication of ZD55-shMYCN in doxorubicin-resistant neuroblastoma cells, but decreased the expression of Bcl-2, Bcl-X L , MMP-1. Thus, this synergistic effect of ZD55-shMYCN in combination with doxorubicin provides a novel therapy strategy for doxorubicin-resistant neuroblastoma, and is a promising approach for further clinical development. Copyright © 2017 Elsevier Inc. All rights reserved.

  16. RNA interference-based therapeutics for human immunodeficiency virus HIV-1 treatment: synthetic siRNA or vector-based shRNA?

    Science.gov (United States)

    Subramanya, Sandesh; Kim, Sang-Soo; Manjunath, N; Shankar, Premlata

    2010-02-01

    Despite the clinical benefits of highly active antiretroviral therapy (HAART), the prospect of life-long antiretroviral treatment poses significant problems, which has spurred interest in developing new drugs and strategies to treat HIV infection and eliminate persistent viral reservoirs. RNAi has emerged as a therapeutic possibility for HIV. We discuss progress in overcoming hurdles to translating transient and stable RNAi enabling technologies to clinical application for HIV; covering the past 2 - 3 years. HIV inhibition can be achieved by transfection of chemically or enzymatically synthesized siRNAs or by DNA-based vector systems expressing short hairpin RNAs (shRNAs) that are processed intracellularly into siRNA. We compare these approaches, focusing on technical and safety issues that will guide the choice of strategy for clinical use. Introduction of synthetic siRNA into cells or its stable endogenous production using vector-driven shRNA have been shown to suppress HIV replication in vitro and, in some instances, in vivo. Each method has advantages and limitations in terms of ease of delivery, duration of silencing, emergence of escape mutants and potential toxicity. Both appear to have potential as future therapeutics for HIV, once the technical and safety issues of each approach are overcome.

  17. Development of a near-net-shape casting technology for the U-6Nb alloy. Part 1: Materials characterization, experiment design, and model construction

    International Nuclear Information System (INIS)

    Taylor, M.J.; Keeney, J.A.; Wendel, M.W.; Demint, A.L.

    1997-01-01

    The Oak Ridge Y-12 Plant (Y-12) is conducting highly coupled experimental and numerical studies to develop the technology needed to produce near-net-shape (NNS)-cast uranium-6 wt% niobium (U-6Nb) components which have a controlled carbon content. Current activities are focused on defining mechanical and metallurgical properties of cast material; experimental studies to define NNS casting, carbide particle flotation, and immersion-quench physics; and developing the numerical models needed to support the optimized design of NNS components. This paper summarizes the material characterization, experiment design, and model development activities

  18. MEDICIS(ASTEC-V2) sensitivity calculations for investigation of the crust formation in VB-U5 and VB-U6 VULCANO tests

    International Nuclear Information System (INIS)

    Stefanova, A.; Grudev, P.; Gencheva, R.

    2011-01-01

    This paper presents the results from sensitivity calculations made with MEDICIS(ASTECv2) for investigation of the crust formation during the Molten Corium-Concrete Interaction(MCCI) in VB-U5 and VB-U6 VULCANO tests. All calculations are made with MEDICIS computer code. The main goal of these analyses is to assess how the assumptions for crust formation or not formation influence over the concrete ablation. Three calculations have been done for each one of the experiments with different crust thickness and lock of crust formation at the bottom, side and upper surface. (authors)

  19. Virus-mediated shRNA knockdown of prodynorphin in the rat nucleus accumbens attenuates depression-like behavior and cocaine locomotor sensitization.

    Science.gov (United States)

    Cohen, Ami; Whitfield, Timothy W; Kreifeldt, Max; Koebel, Pascale; Kieffer, Brigitte L; Contet, Candice; George, Olivier; Koob, George F

    2014-01-01

    Dynorphins, endogenous opioid peptides that arise from the precursor protein prodynorphin (Pdyn), are hypothesized to be involved in the regulation of mood states and the neuroplasticity associated with addiction. The current study tested the hypothesis that dynorphin in the nucleus accumbens (NAcc) mediates such effects. More specifically, we examined whether knockdown of Pdyn within the NAcc in rats would alter the expression of depressive-like and anxiety-like behavior, as well as cocaine locomotor sensitization. Wistar rats were injected with adeno-associated viral (AAV) vectors encoding either a Pdyn-specific short hairpin RNA (AAV-shPdyn) or a scrambled shRNA (AAV-shScr) as control. Four weeks later, rats were tested for anxiety-like behavior in the elevated plus maze test and depressive-like behavior in the forced swim test (FST). Finally, rats received one daily injection of saline or cocaine (20 mg/kg, i.p.), followed by assessment of locomotion for 4 consecutive days. Following 3 days of abstinence, the rats completed 2 additional daily cocaine/saline locomotor trials. Pdyn knockdown in the NAcc led to a significant reduction in depressive-like behavior in the FST, but had no effect on anxiety-like behavior in the elevated plus maze. Pdyn knockdown did not alter baseline locomotor behavior, the locomotor response to acute cocaine, or the initial sensitization of the locomotor response to cocaine over the first 4 cocaine treatment days. However, following 3 days abstinence the locomotor response to the cocaine challenge returned to their original levels in the AAV-shPdyn rats while remaining heightened in the AAV-shScr rats. These results suggest that dynorphin in a very specific area of the nucleus accumbens contributes to depressive-like states and may be involved in neuroadaptations in the NAcc that contribute to the development of cocaine addiction as a persistent and lasting condition.

  20. Virus-mediated shRNA knockdown of prodynorphin in the rat nucleus accumbens attenuates depression-like behavior and cocaine locomotor sensitization.

    Directory of Open Access Journals (Sweden)

    Ami Cohen

    Full Text Available Dynorphins, endogenous opioid peptides that arise from the precursor protein prodynorphin (Pdyn, are hypothesized to be involved in the regulation of mood states and the neuroplasticity associated with addiction. The current study tested the hypothesis that dynorphin in the nucleus accumbens (NAcc mediates such effects. More specifically, we examined whether knockdown of Pdyn within the NAcc in rats would alter the expression of depressive-like and anxiety-like behavior, as well as cocaine locomotor sensitization. Wistar rats were injected with adeno-associated viral (AAV vectors encoding either a Pdyn-specific short hairpin RNA (AAV-shPdyn or a scrambled shRNA (AAV-shScr as control. Four weeks later, rats were tested for anxiety-like behavior in the elevated plus maze test and depressive-like behavior in the forced swim test (FST. Finally, rats received one daily injection of saline or cocaine (20 mg/kg, i.p., followed by assessment of locomotion for 4 consecutive days. Following 3 days of abstinence, the rats completed 2 additional daily cocaine/saline locomotor trials. Pdyn knockdown in the NAcc led to a significant reduction in depressive-like behavior in the FST, but had no effect on anxiety-like behavior in the elevated plus maze. Pdyn knockdown did not alter baseline locomotor behavior, the locomotor response to acute cocaine, or the initial sensitization of the locomotor response to cocaine over the first 4 cocaine treatment days. However, following 3 days abstinence the locomotor response to the cocaine challenge returned to their original levels in the AAV-shPdyn rats while remaining heightened in the AAV-shScr rats. These results suggest that dynorphin in a very specific area of the nucleus accumbens contributes to depressive-like states and may be involved in neuroadaptations in the NAcc that contribute to the development of cocaine addiction as a persistent and lasting condition.

  1. Energy Level Statistics of SO(5) Limit of Super-symmetry U(6/4) in Interacting Boson-Fermion Model

    International Nuclear Information System (INIS)

    Bai Hongbo; Zhang Jinfu; Zhou Xianrong

    2005-01-01

    We study the energy level statistics of the SO(5) limit of super-symmetry U(6/4) in odd-A nucleus using the interacting boson-fermion model. The nearest neighbor spacing distribution (NSD) and the spectral rigidity (Δ 3 ) are investigated, and the factors that affect the properties of level statistics are also discussed. The results show that the boson number N is a dominant factor. If N is small, both the interaction strengths of subgroups SO B (5) and SO BF (5) and the spin play important roles in the energy level statistics, however, along with the increase of N, the statistics distribution would tend to be in Poisson form.

  2. Lentiviral transgenic microRNA-based shRNA suppressed mouse cytochromosome P450 3A (CYP3A expression in a dose-dependent and inheritable manner.

    Directory of Open Access Journals (Sweden)

    Yong Wang

    Full Text Available Cytochomosome P450 enzymes (CYP are heme-containing monooxygenases responsible for oxidative metabolism of many exogenous and endogenous compounds including drugs. The species difference of CYP limits the extent to which data obtained from animals can be translated to humans in pharmacodynamics or pharmacokinetics studies. Transgenic expression of human CYP in animals lacking or with largely reduced endogenous CYP counterparts is recognized as an ideal strategy to correct CYP species difference. CYP3A is the most abundant CYP subfamily both in human and mammals. In this study, we designed a microRNA-based shRNA (miR-shRNA simultaneously targeting four members of mouse CYP3A subfamily (CYP3A11, CYP3A16, CYP3A41 and CYP3A44, and transgenic mice expressing the designed miR-shRNA were generated by lentiviral transgenesis. Results showed that the CYP3A expression level in transgenic mice was markedly reduced compared to that in wild type or unrelated miR-shRNA transgenic mice, and was inversely correlated to the miR-shRNA expression level. The CYP3A expression levels in transgenic offspring of different generations were also remarkably lower compared to those of controls, and moreover the inhibition rate of CYP3A expression remained comparable over generations. The ratio of the targeted CYP3A transcriptional levels was comparable between knockdown and control mice of the same gender as detected by RT-PCR DGGE analysis. These data suggested that transgenic miR-shRNA suppressed CYP3A expression in a dose-dependent and inheritable manner, and transcriptional levels of the targeted CYP3As were suppressed to a similar extent. The observed knockdown efficacy was further confirmed by enzymatic activity analysis, and data showed that CYP3A activities in transgenic mice were markedly reduced compared to those in wild-type or unrelated miR-shRNA transgenic controls (1.11±0.71 vs 5.85±1.74, 5.9±2.4; P<0.01. This work laid down a foundation to further knock

  3. An image-based, dual fluorescence reporter assay to evaluate the efficacy of shRNA for gene silencing at the single-cell level [v1; ref status: indexed, http://f1000r.es/2tt

    Directory of Open Access Journals (Sweden)

    Shin-ichiro Kojima

    2014-02-01

    Full Text Available RNA interference (RNAi is widely used to suppress gene expression in a specific manner. The efficacy of RNAi is mainly dependent on the sequence of small interfering RNA (siRNA in relation to the target mRNA. Although several algorithms have been developed for the design of siRNA, it is still difficult to choose a really effective siRNA from among multiple candidates. In this article, we report the development of an image-based, quantitative, ratiometric fluorescence reporter assay to evaluate the efficacy of RNAi at the single-cell level. Two fluorescence reporter constructs are used. One expresses the candidate small hairpin RNA (shRNA together with an enhanced green fluorescent protein (EGFP; the other expresses a 19-nt target sequence inserted into a cassette expressing a red fluorescent protein (either DsRed or mCherry. Effectiveness of the candidate shRNA is evaluated as the extent to which it knocks down expression of the red fluorescent protein. Thus, the red-to-green fluorescence intensity ratio (appropriately normalized to controls is used as the read-out for quantifying the siRNA efficacy at the individual cell level. We tested this dual fluorescence assay and compared predictions to actual endogenous knockdown levels for three different genes (vimentin, lamin A/C and Arp3 and twenty different shRNAs. For each of the genes, our assay successfully predicted the target sequences for effective RNAi. To further facilitate testing of RNAi efficacy, we developed a negative selection marker (ccdB method for construction of shRNA and red fluorescent reporter plasmids that allowed us to purify these plasmids directly from transformed bacteria without the need for colony selection and DNA sequencing verification.

  4. An image-based, dual fluorescence reporter assay to evaluate the efficacy of shRNA for gene silencing at the single-cell level [v2; ref status: indexed, http://f1000r.es/39j

    Directory of Open Access Journals (Sweden)

    Shin-ichiro Kojima

    2014-05-01

    Full Text Available RNA interference (RNAi is widely used to suppress gene expression in a specific manner. The efficacy of RNAi is mainly dependent on the sequence of small interfering RNA (siRNA in relation to the target mRNA. Although several algorithms have been developed for the design of siRNA, it is still difficult to choose a really effective siRNA from among multiple candidates. In this article, we report the development of an image-based, quantitative, ratiometric fluorescence reporter assay to evaluate the efficacy of RNAi at the single-cell level. Two fluorescence reporter constructs are used. One expresses the candidate small hairpin RNA (shRNA together with an enhanced green fluorescent protein (EGFP; the other expresses a 19-nt target sequence inserted into a cassette expressing a red fluorescent protein (either DsRed or mCherry. Effectiveness of the candidate shRNA is evaluated as the extent to which it knocks down expression of the red fluorescent protein. Thus, the red-to-green fluorescence intensity ratio (appropriately normalized to controls is used as the read-out for quantifying the siRNA efficacy at the individual cell level. We tested this dual fluorescence assay and compared predictions to actual endogenous knockdown levels for three different genes (vimentin, lamin A/C and Arp3 and twenty different shRNAs. For each of the genes, our assay successfully predicted the target sequences for effective RNAi. To further facilitate testing of RNAi efficacy, we developed a negative selection marker (ccdB method for construction of shRNA and red fluorescent reporter plasmids that allowed us to purify these plasmids directly from transformed bacteria without the need for colony selection and DNA sequencing verification.

  5. A theory of piezoelectric, elastic, and dielectric properties of the KH2PO4 family crystals under the strain u6. Phase transition and the piezoelectric effect in the KH2PO4 crystal

    International Nuclear Information System (INIS)

    Levits'kij, R.R.; Lyisnij, B.M.

    2003-01-01

    In order to study the dielectric, piezoelectric and elastic properties of ferroelectrics and antiferroelectrics of the KH 2 PO 4 family, we consider an extended proton tunneling model that takes into account the shear strain u 6 . In the four-particle cluster approximation for the short-range interactions and the mean field approximation for the long-range interaction we calculate the transverse components of the dielectric susceptibility tensor of the KH 2 PO 4 family ferroelectrics

  6. Enhanced functional recombinant factor VII production by HEK 293 cells stably transfected with VKORC1 where the gamma-carboxylase inhibitor calumenin is stably suppressed by shRNA transfection.

    Science.gov (United States)

    Wajih, Nadeem; Owen, John; Wallin, Reidar

    2008-01-01

    Recombinant members of the vitamin K-dependent protein family (factors IX and VII and protein C) have become important pharmaceuticals in treatment of bleeding disorders and sepsis. However, because the in vivo gamma-carboxylation system in stable cell lines used for transfection has a limited capacity of post translational gamma-carboxylation, the recovery of fully gamma-carboxylated and functional proteins is low. In this work we have engineered recombinant factor VII producing HEK 293 cells to stably overexpress VKORC1, the reduced vitamin K gamma-carboxylase cofactor and in addition stably silenced the gamma-carboxylase inhibitory protein calumenin. Stable cell lines transfected with only a factor VII cDNA had a 9% production of functional recombinant factor VII. On the other hand, these recombinant factor VII producing cells when engineered to overexpress VKORC1 and having calumenin stably suppressed more than 80% by shRNA expression, produced 68% functional factor VII. The technology presented should be applicable to all vertebrae members of the vitamin K-dependent protein family and should lower the production cost of the clinically used factors VII, IX and protein C.

  7. Interference RNA (RNAi)-based silencing of endogenous thrombopoietin receptor (Mpl) in Dami cells resulted in decreased hNUDC-mediated megakaryocyte proliferation and differentiation

    International Nuclear Information System (INIS)

    Pang, Shi-Feng; Li, Xiao-Kun; Zhang, Qiang; Yang, Fang; Xu, Peilin

    2009-01-01

    Recently our laboratory reported evidence showing that hNUDC acts as an additional cytokine for thrombopoietin receptor (Mpl). Previously known as the human homolog of a fungal nuclear migration protein, hNUDC plays a critical role in megakaryocyte differentiation and maturation. Here we sought to further clarify the hNUDC-Mpl ligand-receptor relationship by utilizing interference RNA (RNAi) to knockdown Mpl expression in a megakaryocyte cell line. We created U6 promoter driven constructs to express short hairpin RNAs (shRNA) with affinity for different sites on Mpl mRNA. By including Mpl-EGFP fusion protein in these constructs, we were able to effectively screen the shRNA that was most efficient in inhibiting Mpl mRNA expression. This shRNA was subsequently transferred into a lentivirus vector and transduced into Dami cells, a cell line which constitutively expresses endogenous Mpl. This lentiviral vector was also designed to simultaneously express EGFP to monitor transfection efficiency. Our results show that lentivirus can be used to effectively deliver shRNAs into Dami cells and cause specific inhibition of Mpl protein expression after transduction. Furthermore, we show the functional effects of shRNA-mediated Mpl silencing by demonstrating reduced hNUDC stimulated megakaryocyte proliferation and differentiation. Thus, the use of a RNAi knockdown strategy has allowed us to pinpoint the connection of hNUDC with Mpl in the regulation of megakaryocyte maturation.

  8. A time course study demonstrating mRNA, microRNA, 18S rRNA, and U6 snRNA changes to estimate PMI in deceased rat's spleen.

    Science.gov (United States)

    Lv, Ye-hui; Ma, Kai-jun; Zhang, Heng; He, Meng; Zhang, Ping; Shen, Yi-wen; Jiang, Nan; Ma, Duan; Chen, Long

    2014-09-01

    Determining the postmortem interval (PMI) is important in criminal, civil, and forensic cases. We examined the feasibility of using the transcript abundances of mRNAs, 18S rRNA, U6 snRNA, and microRNAs as a means to estimate the PMI. We removed spleen tissues from rats at different PMIs under 4°C or 25°C and examined gene transcript abundances in these samples by RT-qPCR. Using the algorithm geNorm, we found that microRNAs to be appropriate control markers because they were less affected by PMI and temperature. We also characterized relationships between observed PMI and the transcript levels of the above-mentioned RNAs. GAPDH1 and ACTB1 fluctuated slightly like cubic curves, while GAPDH2 and ACTB2 decreased rapidly. 18S rRNA transcript level exhibited a parabolic-like trend at 25°C and exponential growth at 4°C, while U6 transcript level exhibited exponential decay at 25°C and a parabolic-like trend at 4°C. Following validation, we conclude that GAPDH2, ACTB2, and 18S rRNA are suitable makers in the accurate determination of PMI. © 2014 American Academy of Forensic Sciences.

  9. Short-term cytotoxic effects and long-term instability of RNAi delivered using lentiviral vectors

    Directory of Open Access Journals (Sweden)

    Kruithof Egbert KO

    2004-08-01

    Full Text Available Abstract Background RNA interference (RNAi can potently reduce target gene expression in mammalian cells and is in wide use for loss-of-function studies. Several recent reports have demonstrated that short double-stranded RNAs (dsRNAs, used to mediate RNAi, can also induce an interferon-based response resulting in changes in the expression of many interferon-responsive genes. Off-target gene silencing has also been described, bringing into question the validity of certain RNAi-based approaches for studying gene function. We have targeted the plasminogen activator inhibitor-2 (PAI-2 or SERPINB2 mRNA using lentiviral vectors for delivery of U6 promoter-driven PAI-2-targeted short hairpin RNA (shRNA expression. PAI-2 is reported to have anti-apoptotic activity, thus reduction of endogenous expression may be expected to make cells more sensitive to programmed cell death. Results As expected, we encountered a cytotoxic phenotype when targeting the PAI-2 mRNA with vector-derived shRNA. However, this predicted phenotype was a potent non-specific effect of shRNA expression, as functional overexpression of the target protein failed to rescue the phenotype. By decreasing the shRNA length or modifying its sequence we maintained PAI-2 silencing and reduced, but did not eliminate, cytotoxicity. ShRNA of 21 complementary nucleotides (21 mers or more increased expression of the oligoadenylate synthase-1 (OAS1 interferon-responsive gene. 19 mer shRNA had no effect on OAS1 expression but long-term selective pressure on cell growth was observed. By lowering lentiviral vector titre we were able to reduce both expression of shRNA and induction of OAS1, without a major impact on the efficacy of gene silencing. Conclusions Our data demonstrate a rapid cytotoxic effect of shRNAs expressed in human tumor cell lines. There appears to be a cut-off of 21 complementary nucleotides below which there is no interferon response while target gene silencing is maintained

  10. Partially-reflected water-moderated square-piteched U(6.90)O2 fuel rod lattices with 0.67 fuel to water volume ratio (0.800 CM Pitch)

    Energy Technology Data Exchange (ETDEWEB)

    Harms, Gary A. [Sandia National Lab. (SNL-NM), Albuquerque, NM (United States)

    2015-09-01

    The US Department of Energy (DOE) Nuclear Energy Research Initiative funded the design and construction of the Seven Percent Critical Experiment (7uPCX) at Sandia National Laboratories. The start-up of the experiment facility and the execution of the experiments described here were funded by the DOE Nuclear Criticality Safety Program. The 7uPCX is designed to investigate critical systems with fuel for light water reactors in the enrichment range above 5% 235U. The 7uPCX assembly is a water-moderated and -reflected array of aluminum-clad square-pitched U(6.90%)O2 fuel rods.

  11. Stable shRNA Silencing of Lactate Dehydrogenase A (LDHA) in Human MDA-MB-231 Breast Cancer Cells Fails to Alter Lactic Acid Production, Glycolytic Activity, ATP or Survival.

    Science.gov (United States)

    Mack, Nzinga; Mazzio, Elizabeth A; Bauer, David; Flores-Rozas, Hernan; Soliman, Karam F A

    2017-03-01

    In the US, African Americans have a high death rate from triple-negative breast cancer (TNBC), characterized by lack of hormone receptors (ER, PR, HER2/ERRB2) which are otherwise valuable targets of chemotherapy. There is a need to identify novel targets that negatively impact TNBC tumorigenesis. TNBCs release an abundance of lactic acid, under normoxic, hypoxic and hyperoxic conditions; this referred to as the Warburg effect. Accumulated lactic acid sustains peri-cellular acidity which propels metastatic invasion and malignant aggressive transformation. The source of lactic acid is believed to be via conversion of pyruvate by lactate dehydrogenase (LDH) in the last step of glycolysis, with most studies focusing on the LDHA isoform. In this study, LDHA was silenced using long-term MISSION® shRNA lentivirus in human breast cancer MDA-MB-231 cells. Down-regulation of LDHA transcription and protein expression was confirmed by western blot, immunocytochemistry and qPCR. A number of parameters were measured in fully viable vector controls versus knock-down (KD) clones, including levels of lactic acid produced, glucose consumed, ATP and basic metabolic rates. The data show that lentivirus V-165 generated a knock-down clone most effective in reducing both gene and protein levels to less than 1% of vector controls. Stable KD showed absolutely no changes in cell viability, lactic acid production, ATP, glucose consumption or basic metabolic rate. Given the complete absence of impact on any observed parameter by LDH-A KD and this being somewhat contrary to findings in the literature, further analysis was required to determine why. Whole-transcriptome analytic profile on MDA-MB-231 for LDH subtypes using Agilent Human Genome 4×44k microarrays, where the data show the following component breakdown. Transcripts: 30.47 % LDHA, 69.36% LDHB, 0.12% LDHC and 0.05% LDHD. These findings underscore the importance of alternative isoforms of LDH in cancer cells to produce lactic acid

  12. Sorption study of U+6 in Brazilian soils

    International Nuclear Information System (INIS)

    Junior, Antonio P.; Wasserman, Maria A.V.; Mantovano, Jose L.; Carvalho, Leonel M.; Perez, Daniel V.

    2015-01-01

    The uranium mining is one of the main activities of the nuclear fuel cycle that can contribute to the increased exposure to radioactive materials and is one of the main routes of contamination of soil by natural radionuclides. This study investigated the sorption of uranium in brazilian soils, through sorption isotherms performed in batch. In this study, two types of soils were selected: Ferralsols Red and Nitosol. The adjustment of the experimental data to the kinetic models were evaluated by two approaches: the traditional, based on the coefficient of determination (R 2 ); and the theoretical and informative, based on Corrected Akaike Information Criteria (AIC C ). The coefficient of determination (R 2 ), revealed that, although empirical, both the kinetic model, Freundlich and Langmuir, describes satisfactorily the experimental data, showing R 2 values higher than 0.9, while the partition constant model was not suitable for describe these sorption data. The AICC model analysis showed that the Langmuir model fit the U sorption curve well for Ferralsols Red, while the Freundlich model fits better to Nitosol. This study has highlighted the role of organic matter on the sorption of uranium in highly weathered soils, rich in oxyhydroxides and low activity clays. The Kd values reported in this study differ from those recommended by the United States Environmental Protection Agency, therefore must be considered as reference values for highly weathered soils, since it refers to Brazilian pedoenvironmental conditions. The low Kd values obtained in this study allowed to evaluate the high vulnerability of highly weathered soils to uranium contamination. (author)

  13. Fluorescence of UO22+ in different acidic media containing cationic and anionic impurities. Application to the elaboration of a very sensitive dosing method of Uranium in solution by fluorimetry and to the study of the kinetics of U-6 reduction by Iron

    International Nuclear Information System (INIS)

    Belkadi, L.

    1990-09-01

    The use of the fluorimetric analysis method in phosphoric medium proved that this method is very sensitive for detecting Uranium traces (10 E-10 M). The dosing can be carried out after a simple calibration of the device and without calling for the addition techniques. The interference of most organic matters is eliminated by the 337 nm exciting radiation. The inhibition of the fluorescence induced by anions and cations is generally resolved by a simple dilution. The nitrates that have a harmful effect on the Uranium fluorescence have been eliminated by successive evaporations. This method, as it has been improved in this work, is applied to the study of U-6 reduction by metallic Iron and Fe-2 in orthophosphoric acid medium in case the absorption spectrophotometry becomes inoperative. 37 figs., 14 tabs., 50 refs. (author)

  14. Mianningite, (□,Pb,Ce,Na) (U"4"+,Mn,U"6"+) Fe"3"+_2(Ti,Fe"3"+)_1_8O_3_8, a new member of the crichtonite group from Maoniuping REE deposit, Mianning county, southwest Sichuan, China

    International Nuclear Information System (INIS)

    Ge, Xiangkun; Fan, Guang; Chen, Zhangru; Ai, Yujie; Li, Guowu

    2017-01-01

    Mianningite (IMA 2014-072), ideally (□,Pb,Ce,Na)(U"4"+,Mn,U"6"+) Fe"3"+_2(Ti,Fe"3"+)_1_8O_3_8, is a new member of the crichtonite group from the Maoniuping REE deposit, Mianning county, Sichuan province, China. It was found in fractures of lamprophyre veins and in the contact between lamprophyre and a later quartz-alkali feldspar syenite dyke with REE mineralization, and is named after its type locality. Associated minerals are microcline, albite, quartz, iron-rich phlogopite, augite, muscovite, calcite, baryte, fluorite, epidote, pyrite, magnetite, hematite, galena, hydroxylapatite, titanite, ilmenite, rutile, garnet-group minerals, zircon, allanite-(Ce), monazite-(Ce), bastnaesite-(Ce), parisite-(Ce), maoniupingite-(Ce), thorite, pyrochlore-group minerals and chlorite. Mianningite occurs as opaque subhedral to euhedral tabular crystals, up to 1-2 mm in size, black in color and streak, and with a submetallic luster. Mianningite is brittle, with a conchoidal fracture. Its average micro-indentation hardness is 83.8 kg/mm"2 (load 0.2 kg), which is equivalent to ∝6 on the Mohs hardness scale. Its measured and calculated densities are 4.62 (8) g/cm"3 and 4.77 g/cm"3, respectively. Under reflected light, mianningite is grayish white, with no internal reflections. It appears isotropic and exhibits neither bireflectance nor pleochroism. The empirical formula, calculated on the basis of 38 O atoms per formula unit (apfu), is [□_0_._3_2_2(Pb_0_._2_1_5Ba_0_._0_3_7Sr_0_._0_3_6Ca_0_._0_1_0)_Σ_0_._2_9_8(Ce_0_._1_2_8La_0_._0_7_7Nd_0_._0_1_2)_Σ_0_._2_1_7 (Na_0_._1_2_7K_0_._0_3_6)_Σ_0_._1_6_3]_Σ_0_1_._0_0_0(U"4"+_0_._4_4_7Mn_0_0_._2_9_3U"6 "+_0_._1_1_2Y_0_._0_9_1Zr_0_._0_2_3Th_0_._0_1_1)_Σ_0_._9_7_7(Fe"3"+_1_._2_2_4Fe"2"+_0_._2_4_3Mg_0_._0_2_3P_0_._0_0_8Si_0_._0_0_6 □_0_._4_9_6)_Σ_2_._0_0_0(Ti_1_2_._4_6_4Fe"3"+_5_._2_9_2V"5"+_0_._1_1_8Nb_0_._0_8_3Al_0_._0_2_6Cr"3"+_0_._0_1_7)_Σ_1_8_._0_0_0O_3_8. Mianningite is trigonal, belongs to the space group R anti 3, and has

  15. Experimental determination of growth rate effect on U 6+ and Mg 2+ partitioning between aragonite and fluid at elevated U 6+ concentration

    Science.gov (United States)

    Gabitov, R. I.; Gaetani, G. A.; Watson, E. B.; Cohen, A. L.; Ehrlich, H. L.

    2008-08-01

    Results are reported from an experimental study in which the partitioning of U and Mg between aragonite and an aqueous solution were determined as a function of crystal growth rate. Crystals, identified as aragonite by X-ray diffractometry and micro-Raman spectroscopy, were grown by diffusion of CO 2 from an ammonium carbonate source into a calcium-bearing solution at temperatures of 22 and 53 °C. Hemispherical bundles (spherulites) of aragonite crystals were produced, the growth rates of which decreased monotonically from the spherulite interiors to the edges and thus provide the opportunity to examine the influence of growth rate on crystal composition. Element concentration ratios were measured using electron microprobe (EMP) and fluid composition was determined by inductively coupled plasma-mass spectrometry (ICP-MS) and atomic absorption (AA). Growth rates were determined directly by addition of a Dy spike to the fluid during the experiment that was subsequently located in an experimentally precipitated spherulite using secondary ion mass spectrometry (SIMS). At 22 °C both U/Ca and Mg/Ca partition coefficients exhibited a strong growth rate dependence when crystal growth rates were low, and became independent of growth rate when crystal growth rates were high. The U/Ca ratios in aragonite increase between 22 and 53 °C; in contrast Mg/Ca ratios show inverse dependence on temperature.

  16. Cold inducible promoter driven Cre-lox system proved to be highly efficient for marker gene excision in transgenic barley.

    Science.gov (United States)

    Éva, Csaba; Téglás, Flóra; Zelenyánszki, Helga; Tamás, Cecília; Juhász, Angéla; Mészáros, Klára; Tamás, László

    2018-01-10

    A Cre-lox based auto-excision strategy has been adapted for barley, capable of cre and selectable marker gene (SMG) removal. The cold inducible wheat promoter called wcs120 was utilised for driving Cre expression. The binary vector was carrying the transgene (uidA) and a so called 'recombination cassette' flanked by the lox sequences. This part included both the recombinase gene and the SMG (bar) under the control of a constitutive promoter. T 0 , T 1 and T 2 transgenic plants were subjected to low temperature (at 4°C, 10°C and 12°C) at different developmental stages to induce recombination. The presence of uidA, cre, and bar genes and recombination footprints were studied by PCR and DNA sequencing, while cre transcription was followed by qRT-PCR. These analyses indicated that, cold treatment of the germinating seeds (4°C for 3days) followed by plant growing at higher temperature (24°C) has been the most efficient (90-100%), and this treatment lead to heritable changes in the genome. Thermal separation of Cre accumulation (at low temperature) from Cre enzyme activity (at higher temperature) could have prevented the premature excision of its own encoding gene, and lead to high expression level thereby increasing recombination frequency. Copyright © 2017 Elsevier B.V. All rights reserved.

  17. An AAV promoter-driven neuropeptide Y gene delivery system using Sendai virosomes for neurons and rat brain.

    Science.gov (United States)

    Wu, P; de Fiebre, C M; Millard, W J; King, M A; Wang, S; Bryant, S O; Gao, Y P; Martin, E J; Meyer, E M

    1996-03-01

    An adeno-associated virus (AAV)-derived construct (pJDT95npy) containing rat neuropeptide Y (NPY) cDNA inserted downstream of endogenous AAV promoters was used to investigate AAV-driven NPY expression in postmitotic neurons in vitro and in the brain. NPY mRNA was expressed in NT2/N and rat brain primary neuronal cultures after transfection. There was a corresponding increase in the number of neurons staining for NPY-like immunoreactivity and an increase in NPY release during depolarization in the primary cultures. Injections of Sendai-virosome encapsulated pJDT95npy into neocortex increased NPY-like immunoreactivity in neurons but not glia indicating that the latter cell type did not have the translational, post-translational or storage capacity to accumulate the peptide. Injections into the rat hypothalamic para-ventricular nucleus increased body weight and food intake for 21 days, though NPY-like immunoreactivity remained elevated for at least 50 days. These studies demonstrate that AAV-derived constructs may be useful for delivering genes into post-mitotic neurons, and that Sendai virosomes are effective for delivering these constructs in vivo.

  18. High efficiency of targeted mutagenesis in arabidopsis via meiotic promoter-driven expression of Cas9 endonuclease

    KAUST Repository

    Eid, Ayman; Ali, Zahir; Mahfouz, Magdy M.

    2016-01-01

    of eukaryotic genomes, including plants; however, CRISPR/Cas9 efficiency varies considerably in different plant tissues and species. In Arabidopsis, the generation of homozygous or bi-allelic mutants in the first (T1) generation is inefficient. Here, we used

  19. High efficiency of targeted mutagenesis in arabidopsis via meiotic promoter-driven expression of Cas9 endonuclease

    KAUST Repository

    Eid, Ayman

    2016-05-28

    Key message: The use of a meiosis I-specific promoter increased the efficiency of targeted mutagenesis and will facilitate the manipulation of homologous recombination. Abstract: The CRISPR/Cas9 system has been harnessed for targeted engineering of eukaryotic genomes, including plants; however, CRISPR/Cas9 efficiency varies considerably in different plant tissues and species. In Arabidopsis, the generation of homozygous or bi-allelic mutants in the first (T1) generation is inefficient. Here, we used specific promoters to drive the expression of Cas9 during meiosis to maximize the efficiency of recovering heritable mutants in T1 plants. Our data reveal that the use of a promoter active in meiosis I resulted in high-efficiency (28 %) recovery of targeted mutants in the T1 generation. Moreover, this method enabled efficient simultaneous targeting of three genes for mutagenesis. Taken together, our results show that the use of meiosis-specific promoters will improve methods for functional genomic analysis and studying the molecular underpinnings of homologous recombination. © 2016, Springer-Verlag Berlin Heidelberg.

  20. GFAP promoter driven transgenic expression of PDGFB in the mouse brain leads to glioblastoma in a Trp53 null background

    NARCIS (Netherlands)

    Hede, Sanna-Maria; Hansson, Inga; Afink, Gijs B.; Eriksson, Anna; Nazarenko, Inga; Andrae, Johanna; Genove, Guillem; Westermark, Bengt; Nistér, Monica

    2009-01-01

    Glioblastomas are the most common and malignant astrocytic brain tumors in human adults. The tumor suppressor gene TP53 is commonly mutated and/or lost in astrocytic brain tumors and the TP53 alterations are often found in combination with excessive growth factor signaling via PDGF/PDGFRalpha. Here,

  1. RNA polymerase II mediated transcription from the polymerase III promoters in short hairpin RNA expression vector

    International Nuclear Information System (INIS)

    Rumi, Mohammad; Ishihara, Shunji; Aziz, Monowar; Kazumori, Hideaki; Ishimura, Norihisa; Yuki, Takafumi; Kadota, Chikara; Kadowaki, Yasunori; Kinoshita, Yoshikazu

    2006-01-01

    RNA polymerase III promoters of human ribonuclease P RNA component H1, human U6, and mouse U6 small nuclear RNA genes are commonly used in short hairpin RNA (shRNA) expression vectors due their precise initiation and termination sites. During transient transfection of shRNA vectors, we observed that H1 or U6 promoters also express longer transcripts enough to express several reporter genes including firefly luciferase, green fluorescent protein EGFP, and red fluorescent protein JRed. Expression of such longer transcripts was augmented by upstream RNA polymerase II enhancers and completely inhibited by downstream polyA signal sequences. Moreover, the transcription of firefly luciferase from human H1 promoter was sensitive to RNA polymerase II inhibitor α-amanitin. Our findings suggest that commonly used polymerase III promoters in shRNA vectors are also prone to RNA polymerase II mediated transcription, which may have negative impacts on their targeted use

  2. Silencing effect of shRNA expression vectors with stem length of 21 ...

    African Journals Online (AJOL)

    Then, the recombinant plasmids were transfected into mouse embryonic fibroblast with lipofection and injected into leg muscle of mouse. The mRNA expression level of the green fluorescent protein gene was checked by real-time quantitative polymerase chain reaction (RT-PCR). The silencing effect of the 29 bp shRNA ...

  3. shRNA screening identifies JMJD1C as being required for leukemia maintenance

    DEFF Research Database (Denmark)

    Sroczynska, Patrycja; Cruickshank, V Adam; Bukowski, John-Paul

    2014-01-01

    Epigenetic regulatory mechanisms are implicated in the pathogenesis of acute myeloid and lymphoid leukemia (AML and ALL). Recent progress suggests that proteins involved in epigenetic control are amenable to drug intervention, but little is known about the cancer-specific dependency on epigenetic...... candidate drug targets identified in these screens was Jmjd1c. Depletion of Jmjd1c impairs growth and colony formation of mouse MLL-AF9 cells in vitro, as well as establishment of leukemia after transplantation. Depletion of JMJD1C impairs expansion and colony formation of human leukemic cell lines......, with the strongest effect observed in the MLL-rearranged ALL cell line, SEM. In both mouse and human leukemic cells, the growth defect upon JMJD1C depletion appears to be primarily due to increased apoptosis, which implicates JMJD1C as a potential therapeutic target in leukemia....

  4. Apolipoprotein B knockdown by AAV-delivered shRNA lowers plasma cholesterol in mice

    NARCIS (Netherlands)

    Koornneef, Annemart; Maczuga, Piotr; van Logtenstein, Richard; Borel, Florie; Blits, Bas; Ritsema, Tita; van Deventer, Sander; Petry, Harald; Konstantinova, Pavlina

    2011-01-01

    Serum low-density lipoprotein cholesterol (LDL-C) levels are proportionate to the risk of atherosclerotic cardiovascular disease. In order to reduce serum total cholesterol and LDL-C levels in mice, RNA interference (RNAi) was used to inhibit expression of the structural protein of LDL-C,

  5. Silencing effect of shRNA expression vectors with stem length of 21 ...

    African Journals Online (AJOL)

    AJL

    2011-02-14

    Feb 14, 2011 ... construct itself or its delivery vehicle (Rao et al., 2009). Through choosing ... Cell culture, transfection and intramuscular injection. MEFs were isolated ..... A system for stable expression of ... Adv. Drug Deliv. Rev. 61: 746-759.

  6. An empirical method for calculating thermodynamic parameters for U(6) phases, applications to performance assessment calculations

    International Nuclear Information System (INIS)

    Ewing, R.C.; Chen, F.; Clark, S.B.

    2002-01-01

    Uranyl minerals form by oxidation and alteration of uraninite, UO 2+x , and the UO 2 in used nuclear fuels. The thermodynamic database for these phases is extremely limited. However, the Gibbs free energies and enthalpies for uranyl phases may be estimated based on a method that sums polyhedral contributions. The molar contributions of the structural components to Δ f G m 0 and Δ f H m 0 are derived by multiple regression using the thermodynamic data of phases for which the crystal structures are known. In comparison with experimentally determined values, the average residuals associated with the predicted Δ f G m 0 and Δ f H m 0 for the uranyl phases used in the model are 0.08 and 0.10%, respectively. There is also good agreement between the predicted mineral stability relations and field occurrences, thus providing confidence in this method for the estimation of Δ f G m 0 and Δ f H m 0 of the U(VI) phases. This approach provides a means of generating estimated thermodynamic data for performance assessment calcination and a basic for making bounding calcination of phase stabilities and solubilities. (author)

  7. Influence of silencing the MC4R gene by lentivirusmediated RNA ...

    African Journals Online (AJOL)

    Melanocortin receptor 4 (MC4R) is a key element in the mechanisms used to regulate both aspects of keeping the balance between energy uptake and energy expenditure. MC4R was knocked down by lentivirus-mediated shRNA expressing plasmids, which were controlled by the U6 promoter in bovine fibroblast cells, and ...

  8. Stable RNA interference of ErbB-2 gene synergistic with epirubicin suppresses breast cancer growth in vitro and in vivo

    International Nuclear Information System (INIS)

    Hu Xiaoqu; Su Fengxi; Qin Li; Jia Weijuan; Gong Chang; Yu Fengyan; Guo Jujiang; Song Erwei

    2006-01-01

    Overexpression of human epidermal growth factor receptor-2 (Her2, ErbB-2) contributes to the progression and metastasis of breast cancer, implying that Her2 gene is a suitable target of RNA interference (RNAi) for breast cancer therapy. Here, we employed plasmid-mediated expression of 2 different Her2-shRNAs (pU6-Her2shRNAs) efficiently silenced the target gene expression on Her2 expressing SKBR-3 breast cancer cells in both mRNA and protein levels. Consequently, pU6-Her2shRNA increased apoptosis and reduced proliferation of SKBR-3 cells assayed by TUNEL and MTT, respectively. In vivo, intra-tumor injection of pU6-Her2shRNA inhibited the growth of SKBR-3 tumors inoculated subcutaneously in nude mice. Furthermore, pU6-Her2shRNA synergized the tumor suppression effect of epirubicin to SKBR-3 cells in vitro and implanted subcutaneously in nude mice. Therefore, we concluded that stable silencing of Her2 gene expression with plasmid expressing shRNA may hold great promise as a novel therapy for Her2 expressing breast cancers alone or in combination with anthracycline chemotherapy

  9. CMV-Promoter Driven Codon-Optimized Expression Alters the Assembly Type and Morphology of a Reconstituted HERV-K(HML-2

    Directory of Open Access Journals (Sweden)

    Oliver Hohn

    2014-11-01

    Full Text Available The HERV-K(HML-2 family contains the most recently integrated and best preserved endogenized proviral sequences in the human genome. All known elements have nevertheless been subjected to mutations or deletions that render expressed particles non-infectious. Moreover, these post-insertional mutations hamper the analysis of the general biological properties of this ancient virus family. The expression of consensus sequences and sequences of elements with reverted post-insertional mutations has therefore been very instrumental in overcoming this limitation. We investigated the particle morphology of a recently reconstituted HERV-K113 element termed oriHERV-K113 using thin-section electron microscopy (EM and could demonstrate that strong overexpression by substitution of the 5'LTR for a CMV promoter and partial codon optimization altered the virus assembly type and morphology. This included a conversion from the regular C-type to an A-type morphology with a mass of cytoplasmic immature cores tethered to the cell membrane and the membranes of vesicles. Overexpression permitted the release and maturation of virions but reduced the envelope content. A weaker boost of virus expression by Staufen-1 was not sufficient to induce these morphological alterations.

  10. CMV-promoter driven codon-optimized expression alters the assembly type and morphology of a reconstituted HERV-K(HML-2).

    Science.gov (United States)

    Hohn, Oliver; Hanke, Kirsten; Lausch, Veronika; Zimmermann, Anja; Mostafa, Saeed; Bannert, Norbert

    2014-11-11

    The HERV-K(HML-2) family contains the most recently integrated and best preserved endogenized proviral sequences in the human genome. All known elements have nevertheless been subjected to mutations or deletions that render expressed particles non-infectious. Moreover, these post-insertional mutations hamper the analysis of the general biological properties of this ancient virus family. The expression of consensus sequences and sequences of elements with reverted post-insertional mutations has therefore been very instrumental in overcoming this limitation. We investigated the particle morphology of a recently reconstituted HERV-K113 element termed oriHERV-K113 using thin-section electron microscopy (EM) and could demonstrate that strong overexpression by substitution of the 5'LTR for a CMV promoter and partial codon optimization altered the virus assembly type and morphology. This included a conversion from the regular C-type to an A-type morphology with a mass of cytoplasmic immature cores tethered to the cell membrane and the membranes of vesicles. Overexpression permitted the release and maturation of virions but reduced the envelope content. A weaker boost of virus expression by Staufen-1 was not sufficient to induce these morphological alterations.

  11. A novel genetic tool for metabolic optimization of Corynebacterium glutamicum: efficient and repetitive chromosomal integration of synthetic promoter-driven expression libraries

    DEFF Research Database (Denmark)

    Shen, Jing; Chen, Jun; Jensen, Peter Ruhdal

    2017-01-01

    readily could integrate into the attB site in this strain providing expression of the corresponding integrase. Subsequent expression of the Cre recombinase promoted recombination between the modified loxP sites, resulting in a strain only retaining the target insertions and an attB site. To simplify...... the procedure, non-replicating circular expression units for the phage integrase and the Cre recombinase were used. As a showcase, we used the tool to construct a battery of strains simultaneously expressing the two reporter genes, lacZ (encoding β-galactosidase) and gusA (encoding β...

  12. Subtype-specific promoter-driven action potential imaging for precise disease modelling and drug testing in hiPSC-derived cardiomyocytes

    NARCIS (Netherlands)

    Chen, Zhifen; Xian, Wenying; Bellin, Milena; Dorn, Tatjana; Tian, Qinghai; Goedel, Alexander; Dreizehnter, Lisa; Schneider, Christine M.; Ward-van Oostwaard, Dorien; Ng, Judy King Man; Hinkel, Rabea; Pane, Luna Simona; Mummery, Christine L.; Lipp, Peter; Moretti, Alessandra; Laugwitz, Karl-Ludwig; Sinnecker, Daniel

    2016-01-01

    AIMS: Cardiomyocytes (CMs) generated from human induced pluripotent stem cells (hiPSCs) are increasingly used in disease modelling and drug evaluation. However, they are typically a heterogeneous mix of ventricular-, atrial-, and nodal-like cells based on action potentials (APs) and gene expression.

  13. Efficient construction of an inverted minimal H1 promoter driven siRNA expression cassette: facilitation of promoter and siRNA sequence exchange.

    Directory of Open Access Journals (Sweden)

    Hoorig Nassanian

    2007-08-01

    Full Text Available RNA interference (RNAi, mediated by small interfering RNA (siRNA, is an effective method used to silence gene expression at the post-transcriptional level. Upon introduction into target cells, siRNAs incorporate into the RNA-induced silencing complex (RISC. The antisense strand of the siRNA duplex then "guides" the RISC to the homologous mRNA, leading to target degradation and gene silencing. In recent years, various vector-based siRNA expression systems have been developed which utilize opposing polymerase III promoters to independently drive expression of the sense and antisense strands of the siRNA duplex from the same template.We show here the use of a ligase chain reaction (LCR to develop a new vector system called pInv-H1 in which a DNA sequence encoding a specific siRNA is placed between two inverted minimal human H1 promoters (approximately 100 bp each. Expression of functional siRNAs from this construct has led to efficient silencing of both reporter and endogenous genes. Furthermore, the inverted H1 promoter-siRNA expression cassette was used to generate a retrovirus vector capable of transducing and silencing expression of the targeted protein by>80% in target cells.The unique design of this construct allows for the efficient exchange of siRNA sequences by the directional cloning of short oligonucleotides via asymmetric restriction sites. This provides a convenient way to test the functionality of different siRNA sequences. Delivery of the siRNA cassette by retroviral transduction suggests that a single copy of the siRNA expression cassette efficiently knocks down gene expression at the protein level. We note that this vector system can potentially be used to generate a random siRNA library. The flexibility of the ligase chain reaction suggests that additional control elements can easily be introduced into this siRNA expression cassette.

  14. ShRNA en tratamiento in vivo: perspectiva terapéutica en la enfermedad de Alzheimer

    Directory of Open Access Journals (Sweden)

    Kenneth Kosik

    2005-03-01

    Full Text Available Las enfermedades neurodegenerativas son un problema creciente en la población senil, con más de 20 millones de personas afectadas por la enfermedad de Alzheimer (EA esporádica en el mundo y más de 5.000 portadores de EA familiar sólo en el departamento de Antioquia.

  15. The effect of quench rate on the microstructure, mechanical properties, and corrosion behavior of U-6 Wt Pct Nb

    International Nuclear Information System (INIS)

    Eckelmeyer, K.H.; Romiy, A.D.; Weirick, L.J.

    1984-01-01

    The effect of cooling rate on microstructure, mechanical behavior, corrosion resistance, and subsequent age hardenability is discussed. Cooling rates in excess of 20 Ks -1 cause the parent γ-phase to transform martensitically to a niobium supersaturated variant of the α-phase. This phase exhibits low hardness and strength, high ductility, good corrosion resistance, and age hardenability. As cooling rate decreases from 10 Ks -1 to 0.2 Ks -1 , microstructural changes (consistent with spinodal decomposition) occur to an increasing extent. These changes produce increases in hardness and strength and decreases in ductility, corrosion resistance, and age hardenability. At cooling rates less than 0.2 Ks -1 the parent phase undergoes cellular decomposition to a coarse two-phase lamellar microstructure which exhibits intermediate strength and ductility, reduced corrosion resistance, and no age hardenability. An analysis of the cooling rates indicates that fully martensitic microstructures can be obtained in plates as thick as 50 mm

  16. TEM investigation of U6+ and Re7+ reduction by Desulfovibrio desulfuricans, a sulfate-reducing bacterium

    International Nuclear Information System (INIS)

    XU, HUIFANG; BARTON, LARRY L.; CHOUDHURY, KEKA; ZHANG, PENGCHU; WANG, YIFENG

    2000-01-01

    Uranium and its fission product Tc in aerobic environment will be in the forms of UO 2 2+ and TcO 4 - . Reduced forms of tetravalent U and Tc are sparingly soluble. As determined by transmission electron microscopy, the reduction of uranyl acetate by immobilized cells of Desulfovibrio desulfuricans results in the production of black uraninite nanocrystals precipitated outside the cell. Some nanocrystals are associated with outer membranes of the cell as revealed from cross sections of these metabolic active sulfate-reducing bacteria. The nanocrystals have an average diameter of 5 nm and have anhedral shape. The reduction of Re 7+ by cells of Desulfovibrio desulfuricans is fast in media containing H 2 an electron donor, and slow in media containing lactic acid. It is proposed that the cytochrome in these cells has an important role in the reduction of uranyl and Re 7+ is (a chemical analogue for Tc 7+ ) through transferring an electron from molecular hydrogen or lactic acid to the oxyions of UO 2 2+ and TcO 4 -

  17. Expression of CPEB, GAPDH and U6snRNA in cervical and ovarian tissue during cancer development

    DEFF Research Database (Denmark)

    Hansen, Christina Neigaard; Ketabi, Zohreh; Rosenstierne, Maiken Worsøe

    2009-01-01

    Persistent infection with high-risk human papillomavirus (HPV) and expression of the proteins E6 and E7 is a prerequisite for development of cervical cancer. The distal non-coding part of E6/E7 messengers from several HPV types is able to downregulate synthesis of a reporter gene through mechanisms...

  18. In vivo kinetics of U4/U6.U5 tri-snRNP formation in Cajal bodies

    Czech Academy of Sciences Publication Activity Database

    Novotný, Ivan; Blažíková, Michaela; Staněk, David; Heřman, P.; Malínský, Jan

    2011-01-01

    Roč. 22, č. 4 (2011), s. 513-523 ISSN 1059-1524 R&D Projects: GA ČR GA204/07/0133; GA AV ČR KAN200520801 Institutional research plan: CEZ:AV0Z50520514; CEZ:AV0Z50390512; CEZ:AV0Z50390703 Keywords : small nuclear ribonucleoprotein * body components * dynamics Subject RIV: EB - Genetics ; Molecular Biology Impact factor : 4.942, year: 2011

  19. Alteration of a recombinant protein N-glycan structure in silkworms by partial suppression of N-acetylglucosaminidase gene expression.

    Science.gov (United States)

    Kato, Tatsuya; Kikuta, Kotaro; Kanematsu, Ayumi; Kondo, Sachiko; Yagi, Hirokazu; Kato, Koichi; Park, Enoch Y

    2017-09-01

    To synthesize complex type N-glycans in silkworms, shRNAs against the fused lobe from Bombyx mori (BmFDL), which codes N-acetylglucosaminidase (GlcNAcase) in the Golgi, was expressed by recombinant B. mori nucleopolyhedrovirus (BmNPV) in silkworm larvae. Expression was under the control of the actin promoter of B. mori or the U6-2 and i.e.-2 promoters from Orgyia pseudotsugata multiple nucleopolyhedrovirus (OpMNPV). The reduction of specific GlcNAcase activity was observed in Bm5 cells and silkworm larvae using the U6-2 promoter. In silkworm larvae, the partial suppression of BmFDL gene expression was observed. When shRNA against BmFDL was expressed under the control of U6-2 promoter, the Man 3 GlcNAc(Fuc)GlcNAc structure appeared in a main N-glycans of recombinant human IgG. These results suggested that the control of BmFDL expression by its shRNA in silkworms caused the modification of its N-glycan synthetic pathway, which may lead to the alteration of N-glycans in the expressed recombinant proteins. Suppression of BmFDL gene expression by shRNA is not sufficient to synthesize complex N-glycans in silkworm larvae but can modify the N-glycan synthetic pathway.

  20. Towards RNAi based therapy of liver diseases : diversity and complexity of shRNA and miRNA processing and functions

    NARCIS (Netherlands)

    Maczuga, Piotr

    2013-01-01

    Familial hypercholesterolemia (FH) is a genetic disorder characterized by high levels of low density lipoprotein cholesterol (LDL-C) and increasing the risk of cardio vascular diseases. FH and many other liver diseases can possibly be treated with RNA interference (RNAi). RNAi is a natural process

  1. Blocking hepatic metastases of colon cancer cells using an shRNA against Rac1 delivered by activatable cell-penetrating peptide.

    Science.gov (United States)

    Bao, Ying; Guo, Huihui; Lu, Yongliang; Feng, Wenming; Sun, Xinrong; Tang, Chengwu; Wang, Xiang; Shen, Mo

    2016-11-22

    Hepatic metastasis is one of the critical progressions of colon cancer. Blocking this process is key to prolonging survival time in cancer patients. Studies on activatable cell-penetrating peptides (dtACPPs) have demonstrated their potential as gene carriers. It showed high tumor cell-targeting specificity and transfection efficiency and low cytotoxicity in the in vitro settings of drug delivery. However, using this system to silence target genes to inhibit metastasis in colorectal cancer cells has not been widely reported and requires further investigation. In this study, we observed that expression of Rac1, a key molecule for cytoskeletal reorganization, was higher in hepatic metastatic tumor tissue compared with prime colon cancer tissue and that patients with high Rac1-expressing colon cancer showed shorter survival time. Base on these findings, we created dtACPP-PEG-DGL (dtACPPD)/shRac1 nanoparticles and demonstrated that they downregulated Rac1 expression in colon cancer cells. Moreover, we observed inhibitory effects on migration, invasion and adhesion in HCT116 colorectal cancer cells in vitro, and our results showed that Rac1 regulated colon cancer cell matrix adhesion through the regulation of cytofilament dynamics. Moreover, mechanically, repression of Rac1 inhibiting cells migration and invasion by enhancing cell to cell adhesion and reducing cell to extracellular matrix adhesion. Furthermore, when atCDPPD/shRac1 nanoparticles were administered intravenously to a HCT116 xenograft model, significant tumor metastasis to the liver was inhibited. Our results suggest that atCDPP/shRac1 nanoparticles may enable the blockade of hepatic metastasis in colon cancer.

  2. Silencing of the hTERT gene by shRNA inhibits colon cancer SW480 cell growth in vitro and in vivo.

    Directory of Open Access Journals (Sweden)

    Ai-Qun Liu

    Full Text Available Human telomerase reverse transcriptase (hTERT is the key enzyme responsible for synthesizing and maintaining the telomeres on the ends of chromosomes, and it is essential for cell proliferation. This has made hTERT a focus of oncology research and an attractive target for anticancer drug development. In this study, we designed a small interfering RNA (siRNA targeting the catalytic subunit of hTERT and tested its effects on the growth of telomerase-positive human colon carcinoma SW480 cells in vitro, as well as on the tumorigenicity of these cells in nude mice. Transient and stable transfection of hTERT siRNA into colon cancer SW480 cells suppressed hTERT expression, reduced telomerase activity and inhibited cell growth and proliferation. Knocking down hTERT expression in SW480 tumors xenografted into nude mice significantly slowed tumor growth and promoted tumor cell apoptosis. Our results suggest that hTERT is involved in carcinogenesis of human colon carcinoma, and they highlight the therapeutic potential of a hTERT knock-down approach.

  3. Gene Electrotransfer of Plasmid with Tissue Specific Promoter Encoding shRNA against Endoglin Exerts Antitumor Efficacy against Murine TS/A Tumors by Vascular Targeted Effects.

    Directory of Open Access Journals (Sweden)

    Monika Stimac

    Full Text Available Vascular targeted therapies, targeting specific endothelial cell markers, are promising approaches for the treatment of cancer. One of the targets is endoglin, transforming growth factor-β (TGF-β co-receptor, which mediates proliferation, differentiation and migration of endothelial cells forming neovasculature. However, its specific, safe and long-lasting targeting remains the challenge. Therefore, in our study we evaluated the transfection efficacy, vascular targeted effects and therapeutic potential of the plasmid silencing endoglin with the tissue specific promoter, specific for endothelial cells marker endothelin-1 (ET (TS plasmid, in comparison to the plasmid with constitutive promoter (CON plasmid, in vitro and in vivo. Tissue specificity of TS plasmid was demonstrated in vitro on several cell lines, and its antiangiogenic efficacy was demonstrated by reducing tube formation of 2H11 endothelial cells. In vivo, on a murine mammary TS/A tumor model, we demonstrated good antitumor effect of gene electrotransfer (GET of either of both plasmids in treatment of smaller tumors still in avascular phase of growth, as well as on bigger tumors, already well vascularized. In support to the observations on predominantly vascular targeted effects of endoglin, histological analysis has demonstrated an increase in necrosis and a decrease in the number of blood vessels in therapeutic groups. A significant antitumor effect was observed in tumors in avascular and vascular phase of growth, possibly due to both, the antiangiogenic and the vascular disrupting effect. Furthermore, the study indicates on the potential use of TS plasmid in cancer gene therapy since the same efficacy as of CON plasmid was determined.

  4. Gene Electrotransfer of Plasmid with Tissue Specific Promoter Encoding shRNA against Endoglin Exerts Antitumor Efficacy against Murine TS/A Tumors by Vascular Targeted Effects.

    Science.gov (United States)

    Stimac, Monika; Dolinsek, Tanja; Lampreht, Ursa; Cemazar, Maja; Sersa, Gregor

    2015-01-01

    Vascular targeted therapies, targeting specific endothelial cell markers, are promising approaches for the treatment of cancer. One of the targets is endoglin, transforming growth factor-β (TGF-β) co-receptor, which mediates proliferation, differentiation and migration of endothelial cells forming neovasculature. However, its specific, safe and long-lasting targeting remains the challenge. Therefore, in our study we evaluated the transfection efficacy, vascular targeted effects and therapeutic potential of the plasmid silencing endoglin with the tissue specific promoter, specific for endothelial cells marker endothelin-1 (ET) (TS plasmid), in comparison to the plasmid with constitutive promoter (CON plasmid), in vitro and in vivo. Tissue specificity of TS plasmid was demonstrated in vitro on several cell lines, and its antiangiogenic efficacy was demonstrated by reducing tube formation of 2H11 endothelial cells. In vivo, on a murine mammary TS/A tumor model, we demonstrated good antitumor effect of gene electrotransfer (GET) of either of both plasmids in treatment of smaller tumors still in avascular phase of growth, as well as on bigger tumors, already well vascularized. In support to the observations on predominantly vascular targeted effects of endoglin, histological analysis has demonstrated an increase in necrosis and a decrease in the number of blood vessels in therapeutic groups. A significant antitumor effect was observed in tumors in avascular and vascular phase of growth, possibly due to both, the antiangiogenic and the vascular disrupting effect. Furthermore, the study indicates on the potential use of TS plasmid in cancer gene therapy since the same efficacy as of CON plasmid was determined.

  5. Adenovirally delivered shRNA strongly inhibits Na+-Ca2+ exchanger expression but does not prevent contraction of neonatal cardiomyocytes.

    Science.gov (United States)

    Hurtado, Cecilia; Ander, Bradley P; Maddaford, Thane G; Lukas, Anton; Hryshko, Larry V; Pierce, Grant N

    2005-04-01

    The cardiac Na(+)-Ca(2+) exchanger (NCX1) is the main mechanism for Ca(2+) efflux in the heart and is thought to serve an essential role in cardiac excitation-contraction (E-C) coupling. The demonstration that an NCX1 gene knock-out is embryonic lethal provides further support for this essential role. However, a recent report employing the Cre/loxP technique for cardiac specific knock-out of NCX1 has revealed that cardiac function is remarkably preserved in these mice, which survived to adulthood. This controversy highlights the necessity for further investigation of NCX1 function in the heart. In this study, we report on a novel approach for depletion of NCX1 in postnatal rat myocytes that utilizes RNA interference (RNAi), administered with high efficiency via adenoviral transfection. Depletion of NCX1 was confirmed by immunocytochemical detection, Western blots and radioisotopic assays of Na(+)-Ca(2+) exchange activity. Exchanger expression was inhibited by up to approximately 94%. Surprisingly, spontaneous beating of these cardiomyocytes was still maintained, although at a lower frequency. Electrical stimulation could elicit a normal beating rhythm, although NCX depleted cells exhibited a depressed Ca(2+) transient amplitude, a depressed rate of Ca(2+) rise and decline, elevated diastolic [Ca(2+)], and shorter action potentials. We also observed a compensatory increase in sarcolemmal Ca(2+) pump expression. Our data support an important, though non-essential, role for the NCX1 in E-C coupling in these neonatal heart cells. Furthermore, this approach provides a valuable means for assessing the role of NCX1 and could be utilized to examine other cardiac proteins in physiological and pathological studies.

  6. 17 CFR 259.206 - Form U-6B-2, for notification of security issues exempt under section 6(b) of the Act.

    Science.gov (United States)

    2010-04-01

    ... of security issues exempt under section 6(b) of the Act. 259.206 Section 259.206 Commodity and... security issues exempt under section 6(b) of the Act. This form shall be filed pursuant to section 6(b) of the Act as the certificate of notification of the issue, sale, renewal, or guaranty of securities...

  7. A Significant Increase of RNAi Efficiency in Human Cells by the CMV Enhancer with a tRNAlys Promoter

    Directory of Open Access Journals (Sweden)

    Ma Weiwei

    2009-01-01

    Full Text Available RNA interference (RNAi is the process of mRNA degradation induced by double-stranded RNA in a sequence-specific manner. Different types of promoters, such as U6, H1, tRNA, and CMV, have been used to control the inhibitory effect of RNAi expression vectors. In the present study, we constructed two shRNA expression vectors, respectively, controlled by tRNAlys and CMV enhancer-tRNAlys promoters. Compared to the vectors with tRNAlys or U6 promoter, the vector with a CMV enhancer-tRNAlys promoter silenced pokemon more efficiently on both the mRNA and the protein levels. Meanwhile, the silencing of pokemon inhibited the proliferation of MCF7 cells, but the induction of apoptosis of MCF7 cells was not observed. We conclude that the CMV enhancer-tRNAlys promoter may be a powerful tool in driving intracellular expression of shRNA which can efficiently silence targeted gene.

  8. A Significant Increase of RNAi Efficiency in Human Cells by the CMV Enhancer with a tRNAlys Promoter

    Science.gov (United States)

    Weiwei, Ma; Zhenhua, Xie; Feng, Liu; Hang, Ning; Yuyang, Jiang

    2009-01-01

    RNA interference (RNAi) is the process of mRNA degradation induced by double-stranded RNA in a sequence-specific manner. Different types of promoters, such as U6, H1, tRNA, and CMV, have been used to control the inhibitory effect of RNAi expression vectors. In the present study, we constructed two shRNA expression vectors, respectively, controlled by tRNAlys and CMV enhancer-tRNAlys promoters. Compared to the vectors with tRNAlys or U6 promoter, the vector with a CMV enhancer-tRNAlys promoter silenced pokemon more efficiently on both the mRNA and the protein levels. Meanwhile, the silencing of pokemon inhibited the proliferation of MCF7 cells, but the induction of apoptosis of MCF7 cells was not observed. We conclude that the CMV enhancer-tRNAlys promoter may be a powerful tool in driving intracellular expression of shRNA which can efficiently silence targeted gene. PMID:19859553

  9. HBV-Specific shRNA is Capable of Reducing the Formation of Hepatitis B Virus Covalently Closed Circular DNA, but has No Effect on Established Covalently Closed Circular DNA in vitro

    OpenAIRE

    Starkey, Jason L.; Chiari, Estelle F.; Isom, Harriet C.

    2009-01-01

    Hepatitis B virus (HBV) covalently closed circular DNA (CCC DNA) is the source of HBV transcripts and persistence in chronically infected patients. The novel aspect of this study was to determine the effect of RNA interference (RNAi) on HBV CCC DNA when administered prior to establishment of HBV replication or during chronic HBV infection. HBV replication was initiated in HepG2 cells by transduction with HBV baculovirus. Subculture of HBV expressing HepG2 cells at 10 days post-transduction ge...

  10. Study of sorption mechanisms of europium(3) and uranium(6) ions on clays : impact of silicates; Etude des mecanismes de retention des ions U(6) et Eu(3) sur les argiles: influence des silicates

    Energy Technology Data Exchange (ETDEWEB)

    Kowal-Fouchard, A

    2002-11-01

    Bentonite clay has been selected as a potential buffer or backfill material in a number of disposal programmes for high level waste. In order to enhance the thermodynamic database of sorption phenomena at the solid-water interface, we have investigated sorption mechanisms of europium(III) and uranium(VI) ions onto montmorillonite and bentonite. Thermodynamic data were obtained for different ions concentrations, different background electrolytes and different ionic strengths. The structural identification of the surface complexes and sorption sites was carried out using two spectroscopies, XPS and TRLIFS, while sorption edges were performed using batch experiments. However, clays are complex minerals and in order to understand these sorption mechanisms we have studied europium(III) and uranium(VI) retention on a silica and an alumina because these solids are often considered as basic components of clays. The comparison of structural results shows that europium ions are significantly sorbed on permanently charged sites of clay until pH 7. But this ion is also sorbed on {identical_to}SiOH and {identical_to}AlOH sites of montmorillonite at pH higher than 6. Uranyl ions sorption on montmorillonite is mainly explained by retention of three complexes on {identical_to}SiOH sites. Moreover, we have shown that nitrate ions and dissolved silicates affect on uranium(VI) sorption mechanisms onto alumina. Nevertheless, uranyl ions sorption on montmorillonite and bentonite only decreases with increasing carbonate concentration. Finally, all the sorption edges were then modeled using these results and a surface complexation model (2 pK and constant capacitance models). (author)

  11. Human maternal heritage in Andalusia (Spain): its composition reveals high internal complexity and distinctive influences of mtDNA haplogroups U6 and L in the western and eastern side of region.

    Science.gov (United States)

    Hernández, Candela L; Reales, Guillermo; Dugoujon, Jean-Michel; Novelletto, Andrea; Rodríguez, Juan Nicolás; Cuesta, Pedro; Calderón, Rosario

    2014-01-24

    The archeology and history of the ancient Mediterranean have shown that this sea has been a permeable obstacle to human migration. Multiple cultural exchanges around the Mediterranean have taken place with presumably population admixtures. A gravitational territory of those migrations has been the Iberian Peninsula. Here we present a comprehensive analysis of the maternal gene pool, by means of control region sequencing and PCR-RFLP typing, of autochthonous Andalusians originating from the coastal provinces of Huelva and Granada, located respectively in the west and the east of the region. The mtDNA haplogroup composition of these two southern Spanish populations has revealed a wide spectrum of haplogroups from different geographical origins. The registered frequencies of Eurasian markers, together with the high incidence and diversification of African maternal lineages (15% of the total mitochondrial variability) among Huelva Andalusians when compared to its eastwards relatives of Granada and other Iberian populations, constitute relevant findings unknown up-to-date on the characteristics of mtDNA within Andalusia that testifies a female population substructure. Therefore, Andalusia must not be considered a single, unique population. The maternal legacy among Andalusians reflects distinctive local histories, pointing out the role of the westernmost territory of Peninsular Spain as a noticeable recipient of multiple and diverse human migrations. The obtained results underline the necessity of further research on genetic relationships in both sides of the western Mediterranean, using carefully collected samples from autochthonous individuals. Many studies have focused on recent North African gene flow towards Iberia, yet scientific attention should be now directed to thoroughly study the introduction of European genes in northwest Africa across the sea, in order to determine its magnitude, timescale and methods, and to compare them to those terrestrial movements from eastern Africa and southwestern Asia.

  12. Production of cloned pigs with targeted attenuation of gene expression.

    Directory of Open Access Journals (Sweden)

    Vilceu Bordignon

    Full Text Available The objective of this study was to demonstrate that RNA interference (RNAi and somatic cell nuclear transfer (SCNT technologies can be used to attenuate the expression of specific genes in tissues of swine, a large animal species. Apolipoprotein E (apoE, a secreted glycoprotein known for its major role in lipid and lipoprotein metabolism and transport, was selected as the target gene for this study. Three synthetic small interfering RNAs (siRNA targeting the porcine apoE mRNA were tested in porcine granulosa cells in primary culture and reduced apoE mRNA abundance ranging from 45-82% compared to control cells. The most effective sequence was selected for cloning into a short hairpin RNA (shRNA expression vector under the control of RNA polymerase III (U6 promoter. Stably transfected fetal porcine fibroblast cells were generated and used to produce embryos with in vitro matured porcine oocytes, which were then transferred into the uterus of surrogate gilts. Seven live and one stillborn piglet were born from three gilts that became pregnant. Integration of the shRNA expression vector into the genome of clone piglets was confirmed by PCR and expression of the GFP transgene linked to the expression vector. Analysis showed that apoE protein levels in the liver and plasma of the clone pigs bearing the shRNA expression vector targeting the apoE mRNA was significantly reduced compared to control pigs cloned from non-transfected fibroblasts of the same cell line. These results demonstrate the feasibility of applying RNAi and SCNT technologies for introducing stable genetic modifications in somatic cells for eventual attenuation of gene expression in vivo in large animal species.

  13. Lentviral-mediated RNAi to inhibit target gene expression of the porcine integrin αv subunit, the FMDV receptor, and against FMDV infection in PK-15 cells

    Directory of Open Access Journals (Sweden)

    Lin Tong

    2011-09-01

    Full Text Available Abstract Background shRNA targeting the integrin αv subunit, which is the foot-and-mouth disease virus (FMDV receptor, plays a key role in virus attachment to susceptible cells. We constructed a RNAi lentiviral vector, iαv pLenti6/BLOCK -iT™, which expressed siRNA targeting the FMDV receptor, the porcine integrin αv subunit, on PK-15 cells. We also produced a lentiviral stock, established an iαv-PK-15 cell line, evaluated the gene silencing efficiency of mRNA using real-time qRT-PCR, integrand αv expression by indirect immunofluorescence assay (IIF and cell enzyme linked immunosorbent assays (cell ELISA, and investigated the in vivo inhibitory effect of shRNA on FMDV replication in PK-15 cells. Results Our results indicated successful establishment of the iαv U6 RNAi entry vector and the iαv pLenti6/BLOCK -iT expression vector. The functional titer of obtained virus was 1.0 × 106 TU/mL. To compare with the control and mock group, the iαv-PK-15 group αv mRNA expression rate in group was reduced by 89.5%, whilst IIF and cell ELISA clearly indicated suppression in the experimental group. Thus, iαv-PK-15 cells could reduce virus growth by more than three-fold and there was a > 99% reduction in virus titer when cells were challenged with 102 TCID50 of FMDV. Conclusions Iαv-PK-15 cells were demonstrated as a cell model for anti-FMDV potency testing, and this study suggests that shRNA could be a viable therapeutic approach for controlling the severity of FMD infection and spread.

  14. [Construction of lentiviral mediated CyPA siRNA and its functions in non-small cell lung cancer].

    Science.gov (United States)

    FENG, Yan-ming; WU, Yi-ming; TU, Xin-ming; XU, Zheng-shun; WU, Wei-dong

    2010-02-01

    To construct a lentiviral-vector-mediated CyPA small interference RNA (siRNA) and study its function in non-small cell lung cancer. First, four target sequences were selected according to CyPA mRNA sequence, the complementary DNA contained both sense and antisense oligonucleotides were designed, synthesized and cloned into the pGCL-GFP vector, which contained U6 promoter and green fluorescent protein (GFP). The resulting lentiviral vector containing CyPA shRNA was named Lv-shCyPA, and it was confirmed by PCR and sequencing. Next, it was cotransfected by Lipofectamine 2000 along with pHelper1.0 and pHelper 2.0 into 293T cells to package lentivirus particles. At the same time, the packed virus infected non-small cell lung cancer cell (A549), the level of CyPA protein at 5 d after infection was detected by Western Blot to screen the target of CyPA. A549 were infected with Lv-shCyPA and grown as xenografts in severe combined immunodeficient mice. Cell cycle and apoptosis were measured by FCM. It was confirmed by PCR and DNA sequencing that lentiviral-vector-mediated CyPA siRNA (Lv-shCyPA) producing CyPA shRNA was constructed successfully. The titer of concentrated virus were 1 x 10(7) TU/ml. Flow cytometric analysis demonstrated G2-M phase (11.40% +/- 0.68%) was decreased relatively in A549/LvshCyPA compared with control groups (14.52% +/- 1.19%) (Ppathways may lead to new targeted therapies for non-small cell lung cancer.

  15. High-throughput screening of effective siRNAs using luciferase-linked chimeric mRNA.

    Directory of Open Access Journals (Sweden)

    Shen Pang

    Full Text Available The use of siRNAs to knock down gene expression can potentially be an approach to treat various diseases. To avoid siRNA toxicity the less transcriptionally active H1 pol III promoter, rather than the U6 promoter, was proposed for siRNA expression. To identify highly efficacious siRNA sequences, extensive screening is required, since current computer programs may not render ideal results. Here, we used CCR5 gene silencing as a model to investigate a rapid and efficient screening approach. We constructed a chimeric luciferase-CCR5 gene for high-throughput screening of siRNA libraries. After screening approximately 900 shRNA clones, 12 siRNA sequences were identified. Sequence analysis demonstrated that most (11 of the 12 sequences of these siRNAs did not match those identified by available siRNA prediction algorithms. Significant inhibition of CCR5 in a T-lymphocyte cell line and primary T cells by these identified siRNAs was confirmed using the siRNA lentiviral vectors to infect these cells. The inhibition of CCR5 expression significantly protected cells from R5 HIV-1JRCSF infection. These results indicated that the high-throughput screening method allows efficient identification of siRNA sequences to inhibit the target genes at low levels of expression.

  16. Genetically engineered rat gliomas: PDGF-driven tumor initiation and progression in tv-a transgenic rats recreate key features of human brain cancer.

    Directory of Open Access Journals (Sweden)

    Nina P Connolly

    Full Text Available Previously rodent preclinical research in gliomas frequently involved implantation of cell lines such as C6 and 9L into the rat brain. More recently, mouse models have taken over, the genetic manipulability of the mouse allowing the creation of genetically accurate models outweighed the disadvantage of its smaller brain size that limited time allowed for tumor progression. Here we illustrate a method that allows glioma formation in the rat using the replication competent avian-like sarcoma (RCAS virus / tumor virus receptor-A (tv-a transgenic system of post-natal cell type-specific gene transfer. The RCAS/tv-a model has emerged as a particularly versatile and accurate modeling technology by enabling spatial, temporal, and cell type-specific control of individual gene transformations and providing de novo formed glial tumors with distinct molecular subtypes mirroring human GBM. Nestin promoter-driven tv-a (Ntv-a transgenic Sprague-Dawley rat founder lines were created and RCAS PDGFA and p53 shRNA constructs were used to initiate intracranial brain tumor formation. Tumor formation and progression were confirmed and visualized by magnetic resonance imaging (MRI and spectroscopy. The tumors were analyzed using histopathological and immunofluorescent techniques. All experimental animals developed large, heterogeneous brain tumors that closely resembled human GBM. Median survival was 92 days from tumor initiation and 62 days from the first point of tumor visualization on MRI. Each tumor-bearing animal showed time dependent evidence of malignant progression to high-grade glioma by MRI and neurological examination. Post-mortem tumor analysis demonstrated the presence of several key characteristics of human GBM, including high levels of tumor cell proliferation, pseudopalisading necrosis, microvascular proliferation, invasion of tumor cells into surrounding tissues, peri-tumoral reactive astrogliosis, lymphocyte infiltration, presence of numerous tumor

  17. HIV-1 resistance conferred by siRNA cosuppression of CXCR4 and CCR5 coreceptors by a bispecific lentiviral vector

    Directory of Open Access Journals (Sweden)

    Akkina Ramesh

    2005-01-01

    Full Text Available Abstract Background RNA interference (RNAi mediated by small interfering RNAs (siRNAs has proved to be a highly effective gene silencing mechanism with great potential for HIV/AIDS gene therapy. Previous work with siRNAs against cellular coreceptors CXCR4 and CCR5 had shown that down regulation of these surface molecules could prevent HIV-1 entry and confer viral resistance. Since monospecific siRNAs targeting individual coreceptors are inadequate in protecting against both T cell tropic (X4 and monocyte tropic (R5 viral strains simultaneously, bispecific constructs with dual specificity are required. For effective long range therapy, the bispecific constructs need to be stably transduced into HIV-1 target cells via integrating viral vectors. Results To achieve this goal, lentiviral vectors incorporating both CXCR4 and CCR5 siRNAs of short hairpin design were constructed. The CXCR4 siRNA was driven by a U6 promoter whereas the CCR5 siRNA was driven by an H1 promoter. A CMV promoter driven EGFP reporter gene is also incorporated in the bispecific construct. High efficiency transduction into coreceptor expressing Magi and Ghost cell lines with a concomitant down regulation of respective coreceptors was achieved with lentiviral vectors. When the siRNA expressing transduced cells were challenged with X4 and R5 tropic HIV-1, they demonstrated marked viral resistance. HIV-1 resistance was also observed in bispecific lentiviral vector transduced primary PBMCs. Conclusions Both CXCR4 and CCR5 coreceptors could be simultaneously targeted for down regulation by a single combinatorial lentiviral vector incorporating respective anti-coreceptor siRNAs. Stable down regulation of both the coreceptors protects cells against infection by both X4 and R5 tropic HIV-1. Stable down regulation of cellular molecules that aid in HIV-1 infection will be an effective strategy for long range HIV gene therapy.

  18. Construction of permanently inducible miRNA-based expression vectors using site-specific recombinases

    Directory of Open Access Journals (Sweden)

    Garwick-Coppens Sara E

    2011-11-01

    Full Text Available Abstract Background RNA interference (RNAi is a conserved gene silencing mechanism mediated by small inhibitory microRNAs (miRNAs. Promoter-driven miRNA expression vectors have emerged as important tools for delivering natural or artificially designed miRNAs to eukaryotic cells and organisms. Such systems can be used to query the normal or pathogenic functions of natural miRNAs or messenger RNAs, or to therapeutically silence disease genes. Results As with any molecular cloning procedure, building miRNA-based expression constructs requires a time investment and some molecular biology skills. To improve efficiency and accelerate the construction process, we developed a method to rapidly generate miRNA expression vectors using recombinases instead of more traditional cut-and-paste molecular cloning techniques. In addition to streamlining the construction process, our cloning strategy provides vectors with added versatility. In our system, miRNAs can be constitutively expressed from the U6 promoter, or inducibly expressed by Cre recombinase. We also engineered a built-in mechanism to destroy the vector with Flp recombinase, if desired. Finally, to further simplify the construction process, we developed a software package that automates the prediction and design of optimal miRNA sequences using our system. Conclusions We designed and tested a modular system to rapidly clone miRNA expression cassettes. Our strategy reduces the hands-on time required to successfully generate effective constructs, and can be implemented in labs with minimal molecular cloning expertise. This versatile system provides options that permit constitutive or inducible miRNA expression, depending upon the needs of the end user. As such, it has utility for basic or translational applications.

  19. Targeting Werner syndrome protein sensitizes U-2 OS osteosarcoma cells to selenium-induced DNA damage response and necrotic death

    DEFF Research Database (Denmark)

    Cheng, Wen-Hsing; Wu, Ryan T Y; Wu, Min

    2012-01-01

    to MSeA-induced necrotic death. Co-treatment with the ataxia-telangiectasia mutated (ATM) kinase inhibitor KU55933 desensitized the control shRNA cells, but not WRN shRNA cells, to MSeA treatment. WRN did not affect MSeA-induced ATM phosphorylation on Ser-1981 or H2A.X phosphorylation on Ser-139...

  20. Mouse Model of Human Breast Cancer Initiated by a Fusion Oncogene

    National Research Council Canada - National Science Library

    Orkin, Stuart H

    2006-01-01

    .... When TN is activated in mammary glands by whey acidic protein (WAP) promoter-driven Ore, all female mice exhibit extensive lobuloalveolar hyperplasia and develop multifocal mammary tumors as early as 4-month of age...

  1. Establishment and Evaluation of Stable Cell Lines Inhibiting Foot-and-Mouth Disease Virus by RNA Interference

    Directory of Open Access Journals (Sweden)

    Yuan-xing Gu

    2014-01-01

    Full Text Available RNA interference (RNAi has been proved to be a powerful tool for foot-and-mouth disease virus FMDV inhibition in vitro and in vivo. We established five stable baby hamster kidney 21 cell lines (BHK-21 containing five short hairpin RNAs (shRNAs expression plasmids (p3D1shRNA, p3D2shRNA, p3D3shRNA, p3D4shRNA, and p3D5shRNA targeting 3D gene of FMDV. Immunofluorescent assay, virus titration, and real-time quantitative reverse transcription polymerase chain reaction (Q-RT-PCR were conducted to detect the effect of shRNAs on FMDV replication. After challenged with FMDV of O/CHA/99, two cell lines (p3D1shRNA and p3D4shRNA showed a significant reduction in the synthesis of viral protein and RNA, accompanied by a sharp decrease in viral yield, and the inhibition could last for at least thirty passages. We developed an efficient procedure for the establishment and evaluation of stable cell lines for anti-FMDV research based on RNAi technology, which can be a candidate method for anti-FMDV research.

  2. Bcl-2 silencing attenuates hypoxia-induced apoptosis resistance in pulmonary microvascular endothelial cells.

    Science.gov (United States)

    Cao, Yongmei; Jiang, Zhen; Zeng, Zhen; Liu, Yujing; Gu, Yuchun; Ji, Yingying; Zhao, Yupeng; Li, Yingchuan

    2016-01-01

    Pulmonary arterial hypertension (PAH) is a life-threatening disorder that ultimately causes heart failure. While the underlying causes of this condition are not well understood, previous studies suggest that the anti-apoptotic nature of pulmonary microvascular endothelial cells (PMVECs) in hypoxic environments contributes to PAH pathogenesis. In this study, we focus on the contribution of Bcl-2 and hypoxia response element (HRE) to apoptosis-resistant endothelial cells and investigate the mechanism. PMVECs obtained from either normal rats or apoptosis-resistant PMVECs obtained from PAH rats were transduced with recombinant lentiviral vectors carrying either Bcl-2-shRNA or HRE combined Bcl-2-shRNA, and then cultured these cells for 24 h under hypoxic (5% O2) or normoxic (21% O2) conditions. In normal PMVECs, Bcl-2-shRNA or HRE combined with Bcl-2-shRNA transduction successfully decreased Bcl-2 expression, while increasing apoptosis as well as caspase-3 and P53 expression in a normoxic environment. In a hypoxic environment, the effects of Bcl-2-shRNA treatment on cell apoptosis, and on Bcl-2, caspase-3, P53 expression were significantly suppressed. Conversely, HRE activation combined with Bcl-2-shRNA transduction markedly enhanced cell apoptosis and upregulated caspase-3 and P53 expression, while decreasing Bcl-2 expression. Furthermore, in apoptosis-resistant PMVECs, HRE-mediated Bcl-2 silencing effectively enhanced cell apoptosis and caspase-3 activity. The apoptosis rate was significantly depressed when Lv-HRE-Bcl-2-shRNA was combined with Lv-P53-shRNA or Lv-caspase3-shRNA transduction in a hypoxic environment. These results suggest that HRE-mediated Bcl-2 inhibition can effectively attenuate hypoxia-induced apoptosis resistance in PMVECs by downregulating Bcl-2 expression and upregulating caspase-3 and P53 expression. This study therefore reveals critical insight into potential therapeutic targets for treating PAH.

  3. Regression of mouse-derived renal cancer by adoptive transfer of ...

    African Journals Online (AJOL)

    USER

    2010-08-16

    Mizuguchi et al., 2005) and negative control shRNA targeting none specific gene ..... factor-beta type II receptor suppresses ocular inflammation and fibrosis. ... in bone marrow cells through a retroviral-mediated gene therapy in mice.

  4. Fulltext PDF

    Indian Academy of Sciences (India)

    Beiguang Zhang

    2017-07-27

    Jul 27, 2017 ... via shRNA inhibits cell proliferation in human ovarian cancer. BEIGUANG ZHANG .... wrote the informed consent and this research was approved by. Ethics Committee of Jilin Cancer Hospital, China. Ovarian cancer cell lines, ...

  5. Lentiviral Delivery of a Vesicular Glutamate Transporter 1 (VGLUT1)-Targeting Short Hairpin RNA Vector Into the Mouse Hippocampus Impairs Cognition

    NARCIS (Netherlands)

    King, Madeleine V.; Kurian, Nisha; Qin, Si; Papadopoulou, Nektaria; Westerink, Ben H. C.; Cremers, Thomas I.; Epping-Jordan, Mark P.; Le Poul, Emmanuel; Ray, David E.; Fone, Kevin C. F.; Kendall, David A.; Marsden, Charles A.; Sharp, Tyson V.

    Glutamate is the principle excitatory neurotransmitter in the mammalian brain, and dysregulation of glutamatergic neurotransmission is implicated in the pathophysiology of several psychiatric and neurological diseases. This study utilized novel lentiviral short hairpin RNA (shRNA) vectors to target

  6. Effects of short-hairpin RNA-inhibited {beta}-catenin expression on the growth of human multiple myeloma cells in vitro and in vivo

    Energy Technology Data Exchange (ETDEWEB)

    Liang, Wenqing, E-mail: liangwenqing_1234@126.com [Department of Orthopaedics, Shaoxing People' s Hospital, 568 Zhongxing North Road, Shaoxing 312000 (China); Yang, Chengwei [Department of Spinal Surgery, Lanzhou General Hospital, Lanzhou Military Area Command, 333 Nanbinhe Road, Lanzhou 730050 (China); Qian, Yu [Department of Orthopaedics, Shaoxing People' s Hospital, 568 Zhongxing North Road, Shaoxing 312000 (China); Fu, Qiang, E-mail: chyygklwq@hotmail.com [Department of Orthopaedics, Changhai Hospital, Second Military Medical University, 168 Changhai Road, Shanghai 200433 (China)

    2012-06-15

    Highlights: Black-Right-Pointing-Pointer {beta}-Catenin expression were markedly down-regulated by CTNNB1 shRNA. Black-Right-Pointing-Pointer CTNNB1 shRNA could inhibit the proliferation of RPMI8226 cells. Black-Right-Pointing-Pointer Significantly profound apoptotic cell death in CTNNB1 shRNA cells. Black-Right-Pointing-Pointer In vivo, CTNNB1 silence led to a growth inhibition of myeloma growth. Black-Right-Pointing-Pointer c-myc and {beta}-catenin in the expression cells of cleaved caspase-3 were increased. -- Abstract: Multiple myeloma (MM) is thrombogenic as a consequence of multiple hemostatic effects. Overexpression of {beta}-catenin has been observed in several types of malignant tumors, including MM. However, the relationship between {beta}-catenin expression and MM remains unclear. In the present study, RNA interference was used to inhibit {beta}-catenin expression in RPMI8226 cells. RT-PCR and Western blotting analyses showed that {beta}-catenin mRNA and protein expression were markedly down-regulated by CTNNB1 shRNA. Western blotting showed that the protein levels of cyclin D1 and glutamine synthetase were downregulated and supported the transcriptional regulatory function of {beta}-catenin. The MTT assay showed that CTNNB1 shRNA could have significant inhibitory effects on the proliferation of RPMI8226 cells. The TOPflash reporter assay demonstrated significant downregulation after CTNNB1 shRNA transfection in RPMI8226 cells. Flow cytometric analyses also showed significantly profound apoptosis in CTNNB1 shRNA cells. We found CTNNB1 silence led to growth inhibition of MM growth in vivo. Immunohistochemical analyses showed that c-myc and {beta}-catenin were reduced in CTNNB1 shRNA tumor tissues, but that expression of cleaved caspase-3 was increased. These results show that {beta}-catenin could be a new therapeutic agent that targets the biology of MM cells.

  7. [Knockdown of STAT3 inhibits proliferation and migration of HepG2 hepatoma cells induced by IFN1].

    Science.gov (United States)

    Li, Xiaofang; Wang, Yuqi; Yan, Ben; Fang, Peipei; Ma, Chao; Xu, Ning; Fu, Xiaoyan; Liang, Shujuan

    2018-02-01

    Objective To prepare lentiviruses expressing shRNA sequences targeting human signal transducer and activator of transcription 3 (STAT3) and detect the effect of STAT3 knockdown on type I interferon (IFN1)-induced proliferation and migration in HepG2 cells. Methods Four STAT3-targeting shRNA sequences (shRNA1-shRNA4) and one control sequence (Ctrl shRNA) were selected and cloned respectively into pLKO.1-sp6-pgk-GFP to construct shRNA-expressing vectors. Along with backbone psPAX2 and pMD2.G vectors, they were separately transfected into HEK293T cells to prepare lentiviruses. HepG2 cells were infected with the lentiviruses. Cytoplastic STAT3 level was detected by Western blotting to screen effective shRNA sequence(s) targeting STAT3. Proliferation and migration of HepG2 cells were analyzed by CCK-8 assay and Transwell TM migration and scratching assay, respectively. To detect the effect of IFN1 on cell proliferation and migration of HepG2 cells, the cells were treated with 2000 U/mL IFNα2b for indicated time and the activation of IFN-triggered STAT1 signal transduction was assayed by Western blotting. Results Two most effective STAT3-targeting shRNA sequences shRNA1 and shRNA2 were selected, and the expression of both STAT3 shRNA significantly decreased proliferation and migration of HepG2 cells. When treated with IFNα2b, 2000 U/mL of IFN1 showed more competent in attenuating growth and migration of HepG2 cells. Our data further proved that knockdown of STAT3 increased the phosphorylation of STAT1, and IFNα2b further enhanced the activation of STAT1 signaling in HepG2 cells. Conclusion Knockdown of STAT3 inhibits cell migration and growth, and rescues IFN response through up-regulating STAT1 signal transduction in HepG2 hepatoma cells.

  8. Inhibitors of MyD88-dependent proinflammatory cytokine production identified utilizing a novel RNA interference screening approach.

    Directory of Open Access Journals (Sweden)

    John S Cho

    2009-09-01

    Full Text Available The events required to initiate host defenses against invading pathogens involve complex signaling cascades comprised of numerous adaptor molecules, kinases, and transcriptional elements, ultimately leading to the production of proinflammatory cytokines, such as tumor necrosis factor alpha (TNF-alpha. How these signaling cascades are regulated, and the proteins and regulatory elements participating are still poorly understood.We report here the development a completely random short-hairpin RNA (shRNA library coupled with a novel forward genetic screening strategy to identify inhibitors of Toll-like receptor (TLR dependent proinflammatory responses. We developed a murine macrophage reporter cell line stably transfected with a construct expressing diphtheria toxin-A (DT-A under the control of the TNF-alpha-promoter. Stimulation of the reporter cell line with the TLR ligand lipopolysaccharide (LPS resulted in DT-A induced cell death, which could be prevented by the addition of an shRNA targeting the TLR adaptor molecule MyD88. Utilizing this cell line, we screened a completely random lentiviral short hairpin RNA (shRNA library for sequences that inhibited TLR-mediated TNF-alpha production. Recovery of shRNA sequences from surviving cells led to the identification of unique shRNA sequences that significantly inhibited TLR4-dependent TNF-alpha gene expression. Furthermore, these shRNA sequences specifically blocked TLR2 but not TLR3-dependent TNF-alpha production.Thus, we describe the generation of novel tools to facilitate large-scale forward genetic screens in mammalian cells and the identification of potent shRNA inhibitors of TLR2 and TLR4- dependent proinflammatory responses.

  9. [Effect of DOT1L gene silence on proliferation of acute monocytic leukemia cell line THP-1].

    Science.gov (United States)

    Zhang, Yu-Juan; Li, Hua-Wen; Chang, Guo-Qiang; Zhang, Hong-Ju; Wang, Jian; Lin, Ya-Ni; Zhou, Jia-Xi; Li, Qing-Hua; Pang, Tian-Xiang

    2013-08-01

    This study was aimed to investigate the influence of short hairpin RNA (shRNA) on proliferation of human leukemia cell line THP-1. The shRNA targeting the site 732-752 of DOT1L mRNA was designed and chemically synthesized, then a single-vector lentiviral, tet-inducible shRNA-DOT1L system (Plko-Tet-On) was generated. Thereafter, the THP-1 cells with lentivirus were infected to create stable cell line with regulatable shRNA expression. The expression of DOT1L in the THP-1 cell line was assayed by RT-PCR. Effect of shRNA-DOT1L on the proliferation of THP-1 cells was detected with MTT method,and the change of colony forming potential of THP-1 cells was analyzed by colony forming unit test. Cell cycle distribution was tested by flow cytometry. The results indicated that the expression of DOT1L was statistically lower than that in the control groups. The proliferation and colony forming capacity of THP-1 cells were significantly inhibited. The percentage of cells at G0/G1 phase increased in THP-1/shRNA cells treated with Dox while the percentage of cells at S phase significantly decreased as compared with that in the control group. It is concluded that the shRNA targeting DOT1L can effectively inhibit the proliferation of acute monocytic leukemia cell line THP-1.

  10. RNAi screening of subtracted transcriptomes reveals tumor suppression by taurine-activated GABAA receptors involved in volume regulation

    Science.gov (United States)

    van Nierop, Pim; Vormer, Tinke L.; Foijer, Floris; Verheij, Joanne; Lodder, Johannes C.; Andersen, Jesper B.; Mansvelder, Huibert D.; te Riele, Hein

    2018-01-01

    To identify coding and non-coding suppressor genes of anchorage-independent proliferation by efficient loss-of-function screening, we have developed a method for enzymatic production of low complexity shRNA libraries from subtracted transcriptomes. We produced and screened two LEGO (Low-complexity by Enrichment for Genes shut Off) shRNA libraries that were enriched for shRNA vectors targeting coding and non-coding polyadenylated transcripts that were reduced in transformed Mouse Embryonic Fibroblasts (MEFs). The LEGO shRNA libraries included ~25 shRNA vectors per transcript which limited off-target artifacts. Our method identified 79 coding and non-coding suppressor transcripts. We found that taurine-responsive GABAA receptor subunits, including GABRA5 and GABRB3, were induced during the arrest of non-transformed anchor-deprived MEFs and prevented anchorless proliferation. We show that taurine activates chloride currents through GABAA receptors on MEFs, causing seclusion of cell volume in large membrane protrusions. Volume seclusion from cells by taurine correlated with reduced proliferation and, conversely, suppression of this pathway allowed anchorage-independent proliferation. In human cholangiocarcinomas, we found that several proteins involved in taurine signaling via GABAA receptors were repressed. Low GABRA5 expression typified hyperproliferative tumors, and loss of taurine signaling correlated with reduced patient survival, suggesting this tumor suppressive mechanism operates in vivo. PMID:29787571

  11. Co-suppression of sterol-regulatory element binding protein ...

    African Journals Online (AJOL)

    Arabidopsis plants were transformed with a chimeric construct containing expression cassettes for GFP election marker and CaMV 35S promoter-driven At5g35220 cDNA, via Agro bacterium-mediated method. Two transformants produced pigmentation deficient phenotype. Analysis revealed the decrease of chlorophyll in ...

  12. IFNgamma enhances microglial reactions to hippocampal axonal degeneration

    DEFF Research Database (Denmark)

    Jensen, M B; Hegelund, I V; Lomholt, N D

    2000-01-01

    periods. Message for the immune cytokine interferon-gamma (IFNgamma) was undetectable, and glial reactivity to axonal lesions occurred as normal in IFNgamma-deficient mice. Microglial responses to lesion-induced neuronal injury were markedly enhanced in myelin basic protein promoter-driven transgenic mice...

  13. Single agent- and combination treatment with two targeted suicide gene therapy systems is effective in chemoresistant small cell lung cancer cells

    DEFF Research Database (Denmark)

    Michaelsen, Signe R; Christensen, Camilla L; Sehested, Maxwell

    2012-01-01

    Transcriptional targeted suicide gene (SG) therapy driven by the insulinoma-associated 1 (INSM1) promoter makes it possible to target suicide toxin production and cytotoxicity exclusively to small cell lung cancer (SCLC) cells and tumors. It remains to be determined whether acquired chemoresistance......, as observed in the majority of SCLC patients, desensitizes SCLC cells to INSM1 promoter-driven SG therapy....

  14. Effects of PKM2 Gene Silencing on the Proliferation and Apoptosis of Colorectal Cancer LS-147T and SW620 Cells

    Directory of Open Access Journals (Sweden)

    Ran Ao

    2017-07-01

    Full Text Available Background/Aims: This paper aims to explore the effects of pyruvate kinase (PK M2 gene silencing on the proliferation and apoptosis of colorectal cancer (CRC LS-147T and SW620 cells. Methods: CRC LS-147T and SW620 cells highly expressing PKM2 were randomly selected by quantitative real-time polymerase chain reaction (qRT-PCR and then assigned into the blank (no transfection, PKM2-shRNA (transfection with shRNA and empty plasmid (transfection with empty plasmid groups. Immunofluorescence was applied to detect PKM2 protein expression. qRT-PCR and Western blotting were conducted to assess mRNA and protein expression of PKM2, p53 and p21. The cell counting kit-8 (CCK-8 assay was used to assess cell proliferation. Flow cytometry was used to assess the cell cycle and apoptosis rate, and a senescence-associated β-galactosidase staining kit was used to assess cell senescence. Results: PKM2 exhibited high mRNA expression among CRC LS-147T and SW620 cells with remarkable protein expression noted in the cytoplasm and nucleus. The PKM2-shRNA group exhibited reduced PKM2 mRNA and protein expression, whereas p53 and p21 expression was increased compared with the blank and empty plasmid groups. Cell proliferation in PKM2-shRNA cells decreased significantly compared with the blank group and empty plasmid groups. The PKM2-shRNA group exhibited more cells in the G1 phase and fewer cells in the G2/M phase compared with the blank and empty plasmid groups. In addition, the PKM2-shRNA group exhibited significantly increased apoptosis rates and β-galactosidase activity compared with the blank and empty plasmid groups. Conclusion: Our study demonstrates that PKM2 gene silencing suppresses proliferation and promotes apoptosis in LS-147T and SW620 cells.

  15. Inhibition of STAT-3 results in radiosensitization of human squamous cell carcinoma

    International Nuclear Information System (INIS)

    Bonner, James A.; Trummell, Hoa Q.; Willey, Christopher D.; Plants, Brian A.; Raisch, Kevin P.

    2009-01-01

    Background: Signal transducer and activator of transcription-3 (STAT-3) is a downstream component of the Epidermal Growth Factor Receptor (EGFr) signaling process that may facilitate the resistance of tumor cells to conventional cancer treatments. Studies were performed to determine if inhibition of this downstream protein produces radiosensitization. Methods/Results: A431 cells (human squamous cell carcinoma cells with EGFr overexpression) were found to be sensitized to radiation after treatment with STAT-3 small interfering RNA (siRNA). Therefore, a short hairpin RNA (shRNA) against STAT-3 was designed and cloned into a pBABE vector system modified for shRNA expression. Following transfection, clone 2.1 was selected for further study as it showed a dramatic reduction of STAT-3 protein (and mRNA) when compared to A431 parental cells or a negative control shRNA cell line (transfected with STAT-3 shRNA with 2 base pairs mutated). A431 2.1 showed doubling times of 25-31 h as compared to 18-24 h for the parental cell line. The A431 shRNA knockdown STAT-3 cells A431 were more sensitive to radiation than A431 parental or negative STAT-3 control cells. Conclusion: A431 cells stably transfected with shRNA against STAT-3 resulted in enhanced radiosensitivity. Further work will be necessary to determine whether the inhibition of STAT-3 phosphorylation is a necessary step for the radiosensitization that is induced by the inhibition of EGFr.

  16. Adeno-Associated Viral Vector-Mediated mTOR Inhibition by Short Hairpin RNA Suppresses Laser-Induced Choroidal Neovascularization

    Directory of Open Access Journals (Sweden)

    Tae Kwann Park

    2017-09-01

    Full Text Available Choroidal neovascularization (CNV is the defining characteristic feature of the wet subtype of age-related macular degeneration (AMD and may result in irreversible blindness. Based on anti-vascular endothelial growth factor (anti-VEGF, the current therapeutic approaches to CNV are fraught with difficulties, and mammalian target of rapamycin (mTOR has recently been proposed as a possible therapeutic target, although few studies have been conducted. Here, we show that a recombinant adeno-associated virus-delivered mTOR-inhibiting short hairpin RNA (rAAV-mTOR shRNA, which blocks the activity of both mTOR complex 1 and 2, represents a promising therapeutic approach for the treatment of CNV. Eight-week-old male C57/B6 mice were treated with the short hairpin RNA (shRNA after generating CNV lesions in the eyes via laser photocoagulation. The recombinant adeno-associated virus (rAAV delivery vehicle was able to effectively transduce cells in the inner retina, and significantly fewer inflammatory cells and less extensive CNV were observed in the animals treated with rAAV-mTOR shRNA when compared with control- and rAAV-scrambled shRNA-treated groups. Presumably related to the reduction of CNV, increased autophagy was detected in CNV lesions treated with rAAV-mTOR shRNA, whereas significantly fewer apoptotic cells detected in the outer nuclear layer around the CNV indicate that mTOR inhibition may also have neuroprotective effects. Taken together, these results demonstrate the therapeutic potential of mTOR inhibition, resulting from rAAV-mTOR shRNA activity, in the treatment of AMD-related CNV. Keywords: retinal neovascularization, choroidal neovascularization, adeno-associated virus, mTOR, RNA interference, mTOR shRNA, autophagy

  17. EWS Knockdown and Taxifolin Treatment Induced Differentiation and Removed DNA Methylation from p53 Promoter to Promote Expression of Puma and Noxa for Apoptosis in Ewing's Sarcoma.

    Science.gov (United States)

    Hossain, Mohammad Motarab; Ray, Swapan Kumar

    2014-10-01

    Ewing's sarcoma is a pediatric tumor that mainly occurs in soft tissues and bones. Malignant characteristics of Ewing's sarcoma are correlated with expression of EWS oncogene. We achieved knockdown of EWS expression using a plasmid vector encoding EWS short hairpin RNA (shRNA) to increase anti-tumor mechanisms of taxifolin (TFL), a new flavonoid, in human Ewing's sarcoma cells in culture and animal models. Immunofluorescence microscopy and flow cytometric analysis showed high expression of EWS in human Ewing's sarcoma SK-N-MC and RD-ES cell lines. EWS shRNA plus TFL inhibited 80% cell viability and caused the highest decreases in EWS expression at mRNA and protein levels in both cell lines. Knockdown of EWS expression induced morphological features of differentiation. EWS shRNA plus TFL caused more alterations in molecular markers of differentiation than either agent alone. EWS shRNA plus TFL caused the highest decreases in cell migration with inhibition of survival, angiogenic and invasive factors. Knockdown of EWS expression was associated with removal of DNA methylation from p53 promoter, promoting expression of p53, Puma, and Noxa. EWS shRNA plus TFL induced the highest amounts of apoptosis with activation of extrinsic and intrinsic pathways in both cell lines in culture. EWS shRNA plus TFL also inhibited growth of Ewing's sarcoma tumors in animal models due to inhibition of differentiation inhibitors and angiogenic and invasive factors and also induction of activation of caspase-3 for apoptosis. Collectively, knockdown of EWS expression increased various anti-tumor mechanisms of TFL in human Ewing's sarcoma in cell culture and animal models.

  18. Substrate-assisted mechanism of RNP disruption by the spliceosomal Brr2 RNA helicase

    Science.gov (United States)

    Theuser, Matthias; Höbartner, Claudia; Wahl, Markus C.; Santos, Karine F.

    2016-01-01

    The Brr2 RNA helicase disrupts the U4/U6 di-small nuclear RNA–protein complex (di-snRNP) during spliceosome activation via ATP-driven translocation on the U4 snRNA strand. However, it is unclear how bound proteins influence U4/U6 unwinding, which regions of the U4/U6 duplex the helicase actively unwinds, and whether U4/U6 components are released as individual molecules or as subcomplexes. Here, we set up a recombinant Brr2-mediated U4/U6 di-snRNP disruption system, showing that sequential addition of the U4/U6 proteins small nuclear ribonucleoprotein-associated protein 1 (Snu13), pre-mRNA processing factor 31 (Prp31), and Prp3 to U4/U6 di-snRNA leads to a stepwise decrease of Brr2-mediated U4/U6 unwinding, but that unwinding is largely restored by a Brr2 cofactor, the C-terminal Jab1/MPN domain of the Prp8 protein. Brr2-mediated U4/U6 unwinding was strongly inhibited by mutations in U4/U6 di-snRNAs that diminish the ability of U6 snRNA to adopt an alternative conformation but leave the number and kind of U4/U6 base pairs unchanged. Irrespective of the presence of the cofactor, the helicase segregated a Prp3-Prp31-Snu13-U4/U6 RNP into an intact Prp31-Snu13-U4 snRNA particle, free Prp3, and free U6 snRNA. Together, these observations suggest that Brr2 translocates only a limited distance on the U4 snRNA strand and does not actively release RNA-bound proteins. Unwinding is then completed by the partially displaced U6 snRNA adopting an alternative conformation, which leads to dismantling of the Prp3-binding site on U4/U6 di-snRNA but leaves the Prp31- and Snu13-binding sites on U4 snRNA unaffected. In this fashion, Brr2 can activate the spliceosome by stripping U6 snRNA of all precatalytic binding partners, while minimizing logistic requirements for U4/U6 di-snRNP reassembly after splicing. PMID:27354531

  19. [Growth effect of eucalyptus-acacia mixed plantation in South China].

    Science.gov (United States)

    Yang, Zeng-Jiang; Xu, Da-Ping; Chen, Wen-Ping; Huang, Lie-Jian; Li, Shang-Jun; Chen, Yuan

    2009-10-01

    Eucalyptus U6 and Acacia crassicarpa were mixed planted with different ratios and modes to investigate the growth parameters of the two tree species. In the 2-3 years old mixed plantation, the wind-throw of A. crassicarpa decreased markedly with increasing ratio of Eucalyptus U6, the decrement being 26.14% when the Eucalyptus U6/A. crassicarpa ratio was 3 : 1, but the survival rates of Eucalyptus U6 and A. crassicarpa had no significant difference under different planting modes. Mixed planting retarded the A. crassicarpa growth to some extent, with the DBH being 90% of that in pure A. crassicarpa stand. The mixed planting had little effects on the height growth of Eucalyptus U6, but promoted its DBH growth markedly, and the beneficial effect increased with increasing ratio of A. crassicarpa. In the 6 years old 1 : 1 Eucalyptus U6/A. crassicarpa plantation, the Eucalyptus U6 individuals with DBH > 15 cm occupied 32.1%; while in pure Eucalyptus U6 stand, they only accounted for 5.83%. Mixed planting with 2 : 1 Eucalyptus U6/A. crassicarpa could obtain a maximum total biomass of 198.8 m3 x hm(-2), which was 118.8% of the total biomass in pure Eucalyptus U6 stand, or 169.9% of that in pure A. crassicarpa stand. Mixture of Eucalyptus with Acacia would be a good choice to produce Eucalyptus trees with larger DBH.

  20. CSFV proliferation is associated with GBF1 and Rab2

    Indian Academy of Sciences (India)

    2016-12-29

    Dec 29, 2016 ... 2.4 GBF1and Rab2 shRNA vector construction and cell ... CSFV RNA in ST cells at the earliest time point were selected as ... Real-time PCR for detection of GBF1 ..... pathways are also regulated by GBF1 and are involved in.

  1. Tubulin Polymerization-promoting Protein (TPPP/p25α) Promotes Unconventional Secretion of α-Synuclein through Exophagy by Impairing Autophagosome-Lysosome Fusion

    DEFF Research Database (Denmark)

    Ejlerskov, Patrick; Rasmussen, Izabela; Nielsen, Troels Tolstrup

    2013-01-01

    increase in the basal level of α-synuclein secreted into the medium. Secretion was strictly dependent on autophagy and could be up-regulated (trehalose and Rab1A) or down-regulated (3-methyladenine and ATG5 shRNA) by enhancers or inhibitors of autophagy or by modulating minus-end-directed (HDAC6 sh...

  2. Dicer-independent processing of short hairpin RNAs

    NARCIS (Netherlands)

    Liu, Ying Poi; Schopman, Nick C. T.; Berkhout, Ben

    2013-01-01

    Short hairpin RNAs (shRNAs) are widely used to induce RNA interference (RNAi). We tested a variety of shRNAs that differed in stem length and terminal loop size and revealed strikingly different RNAi activities and shRNA-processing patterns. Interestingly, we identified a specific shRNA design that

  3. Experiment list: SRX757029 [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available s; ChIP-Seq source_name=Cultured SH-SY5Y cells || cell line=SH-SY5Y || infection=control shRNA || neuronal m... Diagnosis=Neuroblastoma 26745539,88.4,7.1,1085 GSM1542254: Sample H3K9me2 Input SH-SY5Y B3 I19; Homo sapien

  4. Targeting PRMT5 as a Novel Radiosensitization Approach for Primary and Recurrent Prostate Cancer Treatment

    Science.gov (United States)

    2015-08-01

    primary and recurrent prostate cancer cells toRT During the third grant period. we generated stable cell liens to indue bly express PRMT5 shRNA using...significant impact on the reporter gene activity (data not shown). Taken together, these results suggest that these SNPs have negligible effect on the 1.8 kb

  5. Stable suppression of myostatin gene expression in goat fetal fibroblast cells by lentiviral vector-mediated RNAi.

    Science.gov (United States)

    Patel, Utsav A; Patel, Amrutlal K; Joshi, Chaitanya G

    2015-01-01

    Myostatin (MSTN) is a secreted growth factor that negatively regulates skeletal muscle mass, and therefore, strategies to block myostatin-signaling pathway have been extensively pursued to increase the muscle mass in livestock. Here, we report a lentiviral vector-based delivery of shRNA to disrupt myostatin expression into goat fetal fibroblasts (GFFs) that were commonly used as karyoplast donors in somatic-cell nuclear transfer (SCNT) studies. Sh-RNA positive cells were screened by puromycin selection. Using real-time polymerase chain reaction (PCR), we demonstrated efficient knockdown of endogenous myostatin mRNA with 64% down-regulation in sh2 shRNA-treated GFF cells compared to GFF cells treated by control lentivirus without shRNA. Moreover, we have also demonstrated both the induction of interferon response and the expression of genes regulating myogenesis in GFF cells. The results indicate that myostatin-targeting siRNA produced endogenously could efficiently down-regulate myostatin expression. Therefore, targeted knockdown of the MSTN gene using lentivirus-mediated shRNA transgenics would facilitate customized cell engineering, allowing potential use in the establishment of stable cell lines to produce genetically engineered animals. © 2014 American Institute of Chemical Engineers.

  6. Partial Correction of Psoriasis upon Genetic Knock-Down of Human TNF-α by Lentivirus-Encoded shRNAs in a Xenograft Mouse Model

    DEFF Research Database (Denmark)

    Jakobsen, Maria; Stenderup, Karin; Rosada, Cecilia

    samples treated with irrelevant shRNAs, were selected and cloned into lentiviral vectors. The lentiviral vectors expressing TNF- shRNAs were used to transduce HEK-293 cells and verify vector-derived knock-down of stable TNF- expression in vitro. The most efficient TNF- -directed shRNA, which in cell lines...

  7. Short hairpin RNA targeting 2B gene of coxsackievirus B3 exhibits potential antiviral effects both in vitro and in vivo

    Directory of Open Access Journals (Sweden)

    Yao Hailan

    2012-08-01

    Full Text Available Abstract Background Coxsackievirus B3 is an important infectious agent of viral myocarditis, pancreatitis and aseptic meningitis, but there are no specific antiviral therapeutic reagents in clinical use. RNA interference-based technology has been developed to prevent the viral infection. Methods To evaluate the impact of RNA interference on viral replication, cytopathogenicity and animal survival, short hairpin RNAs targeting the viral 2B region (shRNA-2B expressed by a recombinant vector (pGCL-2B or a recombinant lentivirus (Lenti-2B were tansfected in HeLa cells or transduced in mice infected with CVB3. Results ShRNA-2B exhibited a significant effect on inhibition of viral production in HeLa cells. Furthermore, shRNA-2B improved mouse survival rate, reduced the viral tissues titers and attenuated tissue damage compared with those of the shRNA-NC treated control group. Lenti-2B displayed more effective role in inhibition of viral replication than pGCL-2B in vivo. Conclusions Coxsackievirus B3 2B is an effective target of gene silencing against coxsackievirus B3 infection, suggesting that shRNA-2B is a potential agent for further development into a treatment for enterviral diseases.

  8. Multifunctional PLGA Nanobubbles as Theranostic Agents: Combining Doxorubicin and P-gp siRNA Co-Delivery Into Human Breast Cancer Cells and Ultrasound Cellular Imaging.

    Science.gov (United States)

    Yang, Hong; Deng, Liwei; Li, Tingting; Shen, Xue; Yan, Jie; Zuo, Liangming; Wu, Chunhui; Liu, Yiyao

    2015-12-01

    Multidrug resistance (MDR) is a major impediment to the success of cancer chemotherapy. One of the effective approaches to overcome MDR is to use nanoparticle-mediated the gene silence of chemotherapeutic export proteins by RNA interference to increase drug accumulation in drug resistant cancer cells. In this work, a new co-delivery system, DOX-PLGA/PEI/P-gp shRNA nanobubbles (NBs) around 327 nm, to overcome doxorubicin (DOX) resistance in MCF-7 human breast cancer was designed and developed. Positively charged polyethylenimine (PEI) were modified onto the surface of DOX-PLGA NBs through DCC/NHS crosslinking, and could efficiently condense P-gp shRNA into DOX-PLGA/PEI NBs at vector/shRNA weight ratios of 70:1 and above. An in vitro release profile demonstrated an efficient DOX release (more than 80%) from DOX-PLGA/PEI NBs at pH 4.4, suggesting a pH-responsive drug release for the multifunctionalized NBs. Cellular experimental results further showed that DOX-PLGA/PEI/P-gp shRNA NBs could facilitate cellular uptake of DOX into cells and increase the cell proliferation suppression effect of DOX against MCF-7/ADR cells (a DOX-resistant and P-glycoprotein (P-gp) over-expression cancer cell line). The IC50 of DOX-PLGA NBs against MCF-7/ADR cells was 2-fold lower than that of free DOX. The increased cellular uptake and nuclear accumulation of DOX delivered by DOX-PLGA/PEI/P-gp shRNA NBs in MCF-7/ADR cells was confirmed by fluorescence microscopy and fluorescence spectrophotometry, and might be owning to the down-regulation of P-gp and reduced the efflux of DOX. The cellular uptake mechanism of DOX-PLGA/PEI/P-gp shRNA NBs indicated that the macropinocytosis was one of the pathways for the uptake of NBs by MCF-7/ADR cells, which was also an energy-dependent process. Furthermore, the in vitro cellular ultrasound imaging suggested that the employment of the DOX-PLGA/PEI/P-gp shRNA NBs could efficiently enhance ultrasound imaging of cancer cells. These results demonstrated

  9. Short-hairpin RNA-mediated Heat shock protein 90 gene silencing inhibits human breast cancer cell growth in vitro and in vivo

    International Nuclear Information System (INIS)

    Zuo, Keqiang; Li, Dan; Pulli, Benjamin; Yu, Fei; Cai, Haidong; Yuan, Xueyu; Zhang, Xiaoping; Lv, Zhongwei

    2012-01-01

    Highlights: ► Hsp90 is over-expressed in human breast cancer. ► The shRNA-mediated gene silencing of Hsp90 resulted in inhibition of cell growth. ► Akt and NF-kB were down-regulation after transfection due to Hsp90 silencing. ► The tumor growth ratio was decline due to Hsp90 silencing. ► The PCNA expression was down-regulation due to Hsp90 silencing. -- Abstract: Hsp90 interacts with proteins that mediate signaling pathways involved in the regulation of essential processes such as proliferation, cell cycle control, angiogenesis and apoptosis. Hsp90 inhibition is therefore an attractive strategy for blocking abnormal pathways that are crucial for cancer cell growth. In the present study, the role of Hsp90 in human breast cancer MCF-7 cells was examined by stably silencing Hsp90 gene expression with an Hsp90-silencing vector (Hsp90-shRNA). RT-PCR and Western blot analyses showed that Hsp90-shRNA specifically and markedly down-regulated Hsp90 mRNA and protein expression. NF-kB and Akt protein levels were down-regulated in Hsp90-shRNA transfected cells, indicating that Hsp90 knockout caused a reduction of survival factors and induced apoptosis. Treatment with Hsp90-shRNA significantly increased apoptotic cell death and caused cell cycle arrest in the G1/S phase in MCF-7 cells, as shown by flow cytometry. Silencing of Hsp90 also reduced cell viability, as determined by MTT assay. In vivo experiments showed that MCF-7 cells stably transfected with Hsp90-shRNA grew slowly in nude mice as compared with control groups. In summary, the Hsp90-shRNA specifically silenced the Hsp90 gene, and inhibited MCF-7 cell growth in vitro and in vivo. Possible molecular mechanisms underlying the effects of Hsp90-shRNA include the degradation of Hsp90 breast cancer-related client proteins, the inhibition of survival signals and the upregulation of apoptotic pathways. shRNA-mediated interference may have potential therapeutic utility in human breast cancer.

  10. The Fanconi anemia pathway sensitizes to DNA alkylating agents by inducing JNK-p53-dependent mitochondrial apoptosis in breast cancer cells.

    Science.gov (United States)

    Zhao, Lin; Li, Yanlin; He, Miao; Song, Zhiguo; Lin, Shu; Yu, Zhaojin; Bai, Xuefeng; Wang, Enhua; Wei, Minjie

    2014-07-01

    The Fanconi anemia/BRCA (FA/BRCA) DNA damage repair pathway plays a pivotal role in the cellular response to DNA alkylating agents and greatly influences drug response in cancer treatment. However, the molecular mechanisms underlying the FA/BRCA pathway reversed resistance have received limited attention. In the present study, we investigated the effect of Fanconi anemia complementation group F protein (FANCF), a critical factor of the FA/BRCA pathway, on cancer cell apoptosis induced by DNA alkylating agents such as mitomycin c (MMC). We found that FANCF shRNA potentiated MMC-induced cytotoxicity and apoptosis in MCF-7 and MDA-MB-231 breast cancer cells. At a mechanistic level, FANCF shRNA downregulated the anti-apoptotic protein Bcl-2 and upregulated the pro-apoptotic protein Bax, accompanied by release of cyt-c and smac into the cytosol in MMC-treated cells. Furthermore, activation of caspase-3 and -9, other than caspase-8, cleavage of poly(ADP ribose) polymerase (PARP), and a decrease of mitochondrial membrane potential (MMP) indicated that involvement of the mitochondrial apoptotic pathway in FANCF silencing of MMC-treated breast cancer cells. A decrease in IAP family proteins XIAP and survivin were also observed following FANCF silencing in MMC-treated breast cancer cells. Notably, FANCF shRNA was able to increase p53 levels through activation of the JNK pathway in MMC-treated breast cancer cells. Furthermore, p53 inhibition using pifithrin-α abolished the induction of caspase-3 and PARP by FANCF shRNA and MMC, indicating that MMC-induced apoptosis is substantially enhanced by FANCF shRNA via p53-dependent mechanisms. To our knowledge, we provide new evidence for the potential application of FANCF as a chemosensitizer in breast cancer therapy.

  11. The critical role of myostatin in differentiation of sheep myoblasts

    Energy Technology Data Exchange (ETDEWEB)

    Liu, Chenxi [College of Life Science and Technology, Xinjiang University, Urumqi (China); Xinjiang Laboratory of Animal Biotechnology, Urumqi (China); Li, Wenrong; Zhang, Xuemei; Zhang, Ning; He, Sangang; Huang, Juncheng [Xinjiang Laboratory of Animal Biotechnology, Urumqi (China); Laboratory of Grass-fed Animal Genetics, Breeding and Reproduction of Ministry of Agriculture, Urumqi (China); Animal Biotechnological Research Center, Xinjiang Academy of Animal Science, Urumqi (China); Ge, Yubin [The State Engineering Laboratory of AIDS Vaccine, College of Life Science, Jilin University, Changchun (China); Liu, Mingjun, E-mail: xjlmj2004@yahoo.com.cn [Xinjiang Laboratory of Animal Biotechnology, Urumqi (China); Laboratory of Grass-fed Animal Genetics, Breeding and Reproduction of Ministry of Agriculture, Urumqi (China); Animal Biotechnological Research Center, Xinjiang Academy of Animal Science, Urumqi (China)

    2012-06-08

    Highlights: Black-Right-Pointing-Pointer Identification of the effective and specific shRNA to knockdown MSTN. Black-Right-Pointing-Pointer Overexpression of MSTN reversibly suppressed myogenic differentiation. Black-Right-Pointing-Pointer shRNA knockdown of endogenous MSTN promoted ovine myoblast differentiation. Black-Right-Pointing-Pointer MSTN inhibits myogenic differentiation through down-regulation of MyoD and Myogenin and up-regulation of Smad3. Black-Right-Pointing-Pointer Provides a promise for the generation of transgenic sheep to improve meat productivity. -- Abstract: Myostatin [MSTN, also known as growth differentiation factor 8 (GDF8)], is an inhibitor of skeletal muscle growth. Blockade of MSTN function has been reported to result in increased muscle mass in mice. However, its role in myoblast differentiation in farm animals has not been determined. In the present study, we sought to determine the role of MSTN in the differentiation of primary sheep myoblasts. We found that ectopic overexpression of MSTN resulted in lower fusion index in sheep myoblasts, which indicated the repression of myoblast differentiation. This phenotypic change was reversed by shRNA knockdown of the ectopically expressed MSTN in the cells. In contrast, shRNA knockdown of the endogenous MSTN resulted in induction of myogenic differentiation. Additional studies revealed that the induction of differentiation by knocking down the ectopically or endogenously expressed MSTN was accompanied by up-regulation of MyoD and myogenin, and down-regulation of Smad3. Our results demonstrate that MSTN plays critical role in myoblast differentiation in sheep, analogous to that in mice. This study also suggests that shRNA knockdown of MSTN could be a potentially promising approach to improve sheep muscle growth, so as to increase meat productivity.

  12. The critical role of myostatin in differentiation of sheep myoblasts

    International Nuclear Information System (INIS)

    Liu, Chenxi; Li, Wenrong; Zhang, Xuemei; Zhang, Ning; He, Sangang; Huang, Juncheng; Ge, Yubin; Liu, Mingjun

    2012-01-01

    Highlights: ► Identification of the effective and specific shRNA to knockdown MSTN. ► Overexpression of MSTN reversibly suppressed myogenic differentiation. ► shRNA knockdown of endogenous MSTN promoted ovine myoblast differentiation. ► MSTN inhibits myogenic differentiation through down-regulation of MyoD and Myogenin and up-regulation of Smad3. ► Provides a promise for the generation of transgenic sheep to improve meat productivity. -- Abstract: Myostatin [MSTN, also known as growth differentiation factor 8 (GDF8)], is an inhibitor of skeletal muscle growth. Blockade of MSTN function has been reported to result in increased muscle mass in mice. However, its role in myoblast differentiation in farm animals has not been determined. In the present study, we sought to determine the role of MSTN in the differentiation of primary sheep myoblasts. We found that ectopic overexpression of MSTN resulted in lower fusion index in sheep myoblasts, which indicated the repression of myoblast differentiation. This phenotypic change was reversed by shRNA knockdown of the ectopically expressed MSTN in the cells. In contrast, shRNA knockdown of the endogenous MSTN resulted in induction of myogenic differentiation. Additional studies revealed that the induction of differentiation by knocking down the ectopically or endogenously expressed MSTN was accompanied by up-regulation of MyoD and myogenin, and down-regulation of Smad3. Our results demonstrate that MSTN plays critical role in myoblast differentiation in sheep, analogous to that in mice. This study also suggests that shRNA knockdown of MSTN could be a potentially promising approach to improve sheep muscle growth, so as to increase meat productivity.

  13. A comprehensive platform for highly multiplexed mammalian functional genetic screens

    Directory of Open Access Journals (Sweden)

    Cheung-Ong Kahlin

    2011-05-01

    Full Text Available Abstract Background Genome-wide screening in human and mouse cells using RNA interference and open reading frame over-expression libraries is rapidly becoming a viable experimental approach for many research labs. There are a variety of gene expression modulation libraries commercially available, however, detailed and validated protocols as well as the reagents necessary for deconvolving genome-scale gene screens using these libraries are lacking. As a solution, we designed a comprehensive platform for highly multiplexed functional genetic screens in human, mouse and yeast cells using popular, commercially available gene modulation libraries. The Gene Modulation Array Platform (GMAP is a single microarray-based detection solution for deconvolution of loss and gain-of-function pooled screens. Results Experiments with specially constructed lentiviral-based plasmid pools containing ~78,000 shRNAs demonstrated that the GMAP is capable of deconvolving genome-wide shRNA "dropout" screens. Further experiments with a larger, ~90,000 shRNA pool demonstrate that equivalent results are obtained from plasmid pools and from genomic DNA derived from lentivirus infected cells. Parallel testing of large shRNA pools using GMAP and next-generation sequencing methods revealed that the two methods provide valid and complementary approaches to deconvolution of genome-wide shRNA screens. Additional experiments demonstrated that GMAP is equivalent to similar microarray-based products when used for deconvolution of open reading frame over-expression screens. Conclusion Herein, we demonstrate four major applications for the GMAP resource, including deconvolution of pooled RNAi screens in cells with at least 90,000 distinct shRNAs. We also provide detailed methodologies for pooled shRNA screen readout using GMAP and compare next-generation sequencing to GMAP (i.e. microarray based deconvolution methods.

  14. Role of FAT/CD36 in fatty acid sensing, energy, and glucose homeostasis regulation in DIO and DR rats.

    Science.gov (United States)

    Le Foll, Christelle; Dunn-Meynell, Ambrose A; Levin, Barry E

    2015-02-01

    Hypothalamic fatty acid (FA) sensing neurons alter their activity utilizing the FA translocator/receptor, FAT/CD36. Depletion of ventromedial hypothalamus (VMH) CD36 with adeno-associated viral vector expressing CD36 shRNA (AAV CD36 shRNA) leads to redistribution of adipose stores and insulin resistance in outbred rats. This study assessed the requirement of VMH CD36-mediated FA sensing for the regulation of energy and glucose homeostasis in postnatal day 5 (P5) and P21 selectively bred diet-induced obese (DIO) and diet-resistant (DR) rats using VMH AAV CD36 shRNA injections. P5 CD36 depletion altered VMH neuronal FA sensing predominantly in DIO rats. After 10 wk on a 45% fat diet, DIO rats injected with VMH AAV CD36 shRNA at P21 ate more and gained more weight than DIO AAV controls, while DR AAV CD36 shRNA-injected rats gained less weight than DR AAV controls. VMH CD36 depletion increased inguinal fat pad weights and leptin levels in DIO and DR rats. Although DR AAV CD36 shRNA-injected rats became as obese as DIO AAV controls, only DIO control and CD36 depleted rats became insulin-resistant on a 45% fat diet. VMH CD36 depletion stunted linear growth in DIO and DR rats. DIO rats injected with AAV CD36 shRNA at P5 had increased fat mass, mostly due to a 45% increase in subcutaneous fat. They were also insulin-resistant with an associated 71% increase of liver triglycerides. These results demonstrate that VMH CD36-mediated FA sensing is a critical factor in the regulation of energy and glucose homeostasis and fat deposition in DIO and DR rats.

  15. Low light and low ammonium are key factors for guayule leaf tissue shoot organogenesis and transformation.

    Science.gov (United States)

    Dong, Niu; Montanez, Belen; Creelman, Robert A; Cornish, Katrina

    2006-02-01

    A new method has been developed for guayule tissue culture and transformation. Guayule leaf explants have a poor survival rate when placed on normal MS medium and under normal culture room light conditions. Low light and low ammonium treatment greatly improved shoot organogenesis and transformation from leaf tissues. Using this method, a 35S promoter driven BAR gene and an ubiquitin-3 promoter driven GUS gene (with intron) have been successfully introduced into guayule. These transgenic guayule plants were resistant to the herbicide ammonium-glufosinate and were positive to GUS staining. Molecular analysis showed the expected band and signal in all GUS positive transformants. The transformation efficiency with glufosinate selection ranged from 3 to 6%. Transformation with a pBIN19-based plasmid containing a NPTII gene and then selection with kanamycin also works well using this method. The ratio of kanamycin-resistant calli to total starting explants reached 50% in some experiments.

  16. Acute activation of GLP-1-expressing neurons promotes glucose homeostasis and insulin sensitivity

    OpenAIRE

    Xuemei Shi; Shaji Chacko; Feng Li; Depei Li; Douglas Burrin; Lawrence Chan; Xinfu Guan

    2017-01-01

    Objective: Glucagon-like peptides are co-released from enteroendocrine L cells in the gut and preproglucagon (PPG) neurons in the brainstem. PPG-derived GLP-1/2 are probably key neuroendocrine signals for the control of energy balance and glucose homeostasis. The objective of this study was to determine whether activation of PPG neurons per se modulates glucose homeostasis and insulin sensitivity in vivo. Methods: We generated glucagon (Gcg) promoter-driven Cre transgenic mice and injected...

  17. VM-ADCP measured upper ocean currents in the southeastern Arabian Sea and Equatorial Indian Ocean during December, 2000

    Digital Repository Service at National Institute of Oceanography (India)

    Murty, V.S.N.; Suryanarayana, A.; Somayajulu, Y.K.; Raikar, V.; Tilvi, V.

    west wind forcing through December and retroflection of NEC. The transport of the NECC in the upper 100 m varies from 4x10@u6@@ m@u3@@ /s at 83 degrees E to 7x10@u6@@ m@u3@@ /s at 93 degrees E. The data details the structure of the South Equatorial...

  18. Short hairpin RNA interference therapy for ischemic heart disease

    Science.gov (United States)

    Huang, Mei; Chan, Denise; Jia, Fangjun; Xie, Xiaoyan; Li, Zongjin; Hoyt, Grant; Robbins, Robert C.; Chen, Xiaoyuan; Giaccia, Amato; Wu, Joseph C.

    2013-01-01

    Background During hypoxia, upregulation of hypoxia inducible factor-1 alpha (HIF-1α) transcriptional factor can activate several downstream angiogenic genes. However, HIF-1α is naturally degraded by prolyl hydroxylase-2 (PHD2) protein. Here we hypothesize that short hairpin RNA (shRNA) interference therapy targeting PHD2 can be used for treatment of myocardial ischemia and this process can be followed noninvasively by molecular imaging. Methods and Results PHD2 was cloned from mouse embryonic stem (ES) cells by comparing the homolog gene in human and rat. The best candidate shRNA sequence for inhibiting PHD2 was inserted into the pSuper vector driven by the H1 promoter, followed by a separate hypoxia response element (HRE)-incorporated promoter driving a firefly luciferase (Fluc) reporter gene. This construct was used to transfect mouse C2C12 myoblast cell line for in vitro confirmation. Compared to the control short hairpin scramble (shScramble) as control, inhibition of PHD2 increased levels of HIF-1α protein and several downstream angiogenic genes by >30% (P<0.01). Afterwards, shRNA targeting PHD2 (shPHD2) plasmid was injected intramyocardially following ligation of left anterior descending (LAD) artery in mice. Animals were randomized into shPHD2 group (n=20) versus shScramble sequence as control (n=20). Bioluminescence imaging detected transgene expression for 4–5 weeks. Echocardiographic study showed the shPHD2 group had improved fractional shortening compared with the shScramble group at week 4 (33.7%±1.9% vs. 28.4%±2.8%; P<0.05). Postmortem analysis showed increased presence of small capillaries and venules in the infarcted zones by CD31 staining. Finally, Western blot anlaysis of explanted hearts also confirm that animals treated with shPHD2 had significantly higher levels of HIF-1α protein. Conclusions This is the first study to image the biological role of shRNA therapy for improving cardiac function. Inhibition of PHD2 by shRNA led to

  19. Stable replication of the EBNA1/OriP-mediated baculovirus vector and its application to anti-HCV gene therapy

    Directory of Open Access Journals (Sweden)

    Chang Myint OO

    2009-10-01

    Full Text Available Abstract Background Hepatitis C virus (HCV is one of the main causes of liver-related morbidity and mortality. Although combined interferon-α-ribavirin therapy is effective for about 50% of the patients with HCV, better therapies are needed and preventative vaccines have yet to be developed. Short-hairpin RNAs (shRNAs inhibit gene expression by RNA interference. The application of transient shRNA expression is limited, however, due to the inability of the shRNA to replicate in mammalian cells and its inefficient transduction. The duration of transgene (shRNA expression in mammalian cells can be significantly extended using baculovirus-based shRNA-expressing vectors that contain the latent viral protein Epstein-Barr nuclear antigen 1 (EBNA1 and the origin of latent viral DNA replication (OriP sequences. These recombinant vectors contain compatible promoters and are highly effective for infecting primary hepatocyte and hepatoma cell lines, making them very useful tools for studies of hepatitis B and hepatitis C viruses. Here, we report the use of these baculovirus-based vector-derived shRNAs to inhibit core-protein expression in full-length hepatitis C virus (HCV replicon cells. Results We constructed a long-term transgene shRNA expression vector that contains the EBV EBNA1 and OriP sequences. We also designed baculovirus vector-mediated shRNAs against the highly conserved core-protein region of HCV. HCV core protein expression was inhibited by the EBNA1/OriP baculovirus vector for at least 14 days, which was considerably longer than the 3 days of inhibition produced by the wild-type baculovirus vector. Conclusion These findings indicate that we successfully constructed a long-term transgene (shRNA expression vector (Ac-EP-shRNA452 using the EBNA1/OriP system, which was propagated in Escherichia coli and converted into mammalian cells. The potential anti-HCV activity of the long-term transgene (shRNA expression vector was evaluated with the view

  20. Knockdown of Pokemon protein expression inhibits hepatocellular carcinoma cell proliferation by suppression of AKT activity.

    Science.gov (United States)

    Zhu, Xiaosan; Dai, Yichen; Chen, Zhangxin; Xie, Junpei; Zeng, Wei; Lin, Yuanyuan

    2013-01-01

    Overexpression of Pokemon, which is an erythroid myeloid ontogenic factor protein, occurs in different cancers, including hepatocellular carcinoma (HCC). Pokemon is also reported to have an oncogenic activity in various human cancers. This study investigated the effect of Pokemon knockdown on the regulation of HCC growth. POK shRNA suppressed the expression of Pokemon protein in HepG2 cells compared to the negative control vector-transfected HCC cells. Pokemon knockdown also reduced HCC cell viability and enhanced cisplatin-induced apoptosis in HCC cells. AKT activation and the expression of various cell cycle-related genes were inhibited following Pokemon knockdown. These data demonstrate that Pokemon may play a role in HCC progression, suggesting that inhibition of Pokemon expression using Pokemon shRNA should be further evaluated as a novel target for the control of HCC.

  1. Synergistic effect of intervention of glypican-3 gene transcription combined with antitumor drugs in inhibiting hepatoma cell proliferation

    Directory of Open Access Journals (Sweden)

    YANG Jie

    2016-12-01

    Full Text Available ObjectiveTo investigate the inhibitory effect of intervention of glypican-3 (GPC3 gene transcription combined with antitumor drugs on hepatoma cell proliferation. MethodsFour types of GPC3-shRNA plasmids were established and transfected into HepG2 hepatoma cells. Quantitative real-time PCR and Western blot were used to measure the mRNA and protein expression of GPC3 to analyze its association with hepatoma cell proliferation and apoptosis. The independent samples t-test was used for comparison of continuous data between any two groups, and a one-way analysis of variance was used for comparison between multiple groups. ResultsAmong these four plasmids, shRNA1 had a transfection efficiency of >85% in the transfection of HepG2 cells and a silence efficiency of 89.3% at the mRNA level, and the protein expression of GPC3 was significantly inhibited(P<0.01). At 72 hours, the GPC3-shRNA1 co-intervention group had an HepG2 cell inhibition rate of 71.1%, significantly different from that in the negative group (t=18.092, P<0.001, an inhibition rate of migration of 89.1%, significantly lower than that in the negative group (t=8.326, P<0.001, and inhibition rates of HepG2 cell movement and invasion of 53.6% and 60.1%, which were significantly different from those in the negative group (t=52.400 and 48.245, both P<0.001. The GPC3-shRNA1 co-intervention group had a β-catenin mRNA inhibition rate of 46.9% and a Gli1 mRNA upregulation rate of 7.4%, significantly different from those in the negative group (t=30.108 and -3.551, P<0.001 and P=0.009. At 24 hours, 10 μmol/L sorafenib combined with shRNA1 had an inhibition rate of tumor cells of 52.6% and 100 μmol/L sorafenib combined with shRNA1 had an inhibition rate of tumor cells of 79.5%, which were significantly different from that in the control group (t=23.314 and 50.352, both P<0.001. The half-maximal inhibitory concentrations of sorafenib, rapamycin, and erlotinib for HepG2 were 4.67±1

  2. Knock down of the myostatin gene by RNA interference increased body weight in chicken.

    Science.gov (United States)

    Bhattacharya, T K; Shukla, R; Chatterjee, R N; Dushyanth, K

    2017-01-10

    Myostatin is a negative regulator of muscular growth in poultry and other animals. Of several approaches, knocking down the negative regulator is an important aspect to augment muscular growth in chicken. Knock down of myostatin gene has been performed by shRNA acting against the expression of gene in animals. Two methods of knock down of gene in chicken such as embryo manipulation and sperm mediated method have been performed. The hatching percentage in embryo manipulation and sperm mediated method of knock down was 58.0 and 41.5%, respectively. The shRNA in knock down chicken enhanced body weight at 6 weeks by 26.9%. The dressing percentage and serum biochemical parameters such as SGPT and alkaline phosphatase differed significantly (Pknock down and control birds. It is concluded that knocking down the myostatin gene successfully augmented growth in chicken. Copyright © 2016 Elsevier B.V. All rights reserved.

  3. The Role of Skp2 in the Prostate Tumorigenesis Following Rb and p53 Loss

    Science.gov (United States)

    2015-12-01

    Cancer center seminar, departmental weekly working in progress and journal club give me opportunities to developmental presentation skills and group...Einstein Gene therapy Core, lentivirus vectors expressing p27, p53, or shRNAs from Einstein shRNA Core facility. Lentiviral helper constructs were...inhibitors. We further show that GC B cells and T cells use different mechanisms to regulate their p27 protein levels, and propose a T helper cell

  4. Emory University: MEDICI (Mining Essentiality Data to Identify Critical Interactions) for Cancer Drug Target Discovery and Development | Office of Cancer Genomics

    Science.gov (United States)

    The CTD2 Center at Emory University has developed a computational methodology to combine high-throughput knockdown data with known protein network topologies to infer the importance of protein-protein interactions (PPIs) for the survival of cancer cells.  Applying these data to the Achilles shRNA results, the CCLE cell line characterizations, and known and newly identified PPIs provides novel insights for potential new drug targets for cancer therapies and identifies important PPI hubs.

  5. Decreased Expression of the Early Mitotic Gene, CHFR, Contributes to the Acquisition of Breast Cancer Phenotypes

    Science.gov (United States)

    2008-03-01

    A composite image of two separate Western blots. Whole-cell lysate from the MCF10A IHMEC line was used as a control on both blots in the composite ...which the nucleolus is depicted as a dark spot within the nucleus. Parental (far left ) and scramble shRNA controls (middle ) normally contain one or... Chemistry of Life Processes” Cumulative GPA: 3.97/4.0 Honors and Awards: University of Michigan Department of Defense Breast Cancer

  6. Small Molecule Protection of Bone Marrow Hematopoietic Stem Cells

    Science.gov (United States)

    2016-10-01

    human CD34+ cells Determine formaldehyde dose-dependent survival on FANCG-deficient/control CD34+ cells in culture 9 - 15 Dr. Monnat – 4...molecule provides aldehyde dose-dependent protection in human cells in culture . Next steps: In the next award period we will: - extend above...U2-OS human osteosarcoma cells (Expt. 2) that were either untransduced (untx), transduced with and expressing a scrambled shRNA (shCTR), or

  7. Shortcomings of short hairpin RNA-based transgenic RNA interference in mouse oocytes

    Czech Academy of Sciences Publication Activity Database

    Sarnová, Lenka; Malík, Radek; Sedláček, Radislav; Svoboda, Petr

    2010-01-01

    Roč. 9, č. 8 (2010), s. 1-10 ISSN 1477-5751 R&D Project s: GA MŠk ME09039 Grant - others:EMBO SDIG(DE) project 1483 Institutional research plan: CEZ:AV0Z50520514 Keywords : transgenic RNAi * shRNA * oocyte Subject RIV: EB - Genetics ; Molecular Biology http://www.jnrbm.com/content/9/1/8

  8. Knockdown of MAGEA6 Activates AMP-Activated Protein Kinase (AMPK) Signaling to Inhibit Human Renal Cell Carcinoma Cells.

    Science.gov (United States)

    Ye, Xueting; Xie, Jing; Huang, Hang; Deng, Zhexian

    2018-01-01

    Melanoma antigen A6 (MAGEA6) is a cancer-specific ubiquitin ligase of AMP-activated protein kinase (AMPK). The current study tested MAGEA6 expression and potential function in renal cell carcinoma (RCC). MAGEA6 and AMPK expression in human RCC tissues and RCC cells were tested by Western blotting assay and qRT-PCR assay. shRNA method was applied to knockdown MAGEA6 in human RCC cells. Cell survival and proliferation were tested by MTT assay and BrdU ELISA assay, respectively. Cell apoptosis was tested by the TUNEL assay and single strand DNA ELISA assay. The 786-O xenograft in nude mouse model was established to test RCC cell growth in vivo. MAGEA6 is specifically expressed in RCC tissues as well as in the established (786-O and A498) and primary human RCC cells. MAGEA6 expression is correlated with AMPKα1 downregulation in RCC tissues and cells. It is not detected in normal renal tissues nor in the HK-2 renal epithelial cells. MAGEA6 knockdown by targeted-shRNA induced AMPK stabilization and activation, which led to mTOR complex 1 (mTORC1) in-activation and RCC cell death/apoptosis. AMPK inhibition, by AMPKα1 shRNA or the dominant negative AMPKα1 (T172A), almost reversed MAGEA6 knockdown-induced RCC cell apoptosis. Conversely, expression of the constitutive-active AMPKα1 (T172D) mimicked the actions by MAGEA6 shRNA. In vivo, MAGEA6 shRNA-bearing 786-O tumors grew significantly slower in nude mice than the control tumors. AMPKα1 stabilization and activation as well as mTORC1 in-activation were detected in MAGEA6 shRNA tumor tissues. MAGEA6 knockdown inhibits human RCC cells via activating AMPK signaling. © 2018 The Author(s). Published by S. Karger AG, Basel.

  9. Do Prostate Cancer Exosomes Generate a Field Effect Leading to Tumor Multifocality

    Science.gov (United States)

    2016-04-01

    Undergraduate Research program (to K. Gabriel and E. Frisch), and a generous gift from Melinda and Edward Subia of Orange County CA. Abstract Field effect or...kind gift of Dr. W. Xiao, University of Science and Technology of China, Hefei, China. pLKO.1 control and pLKO.1/EGR-1 shRNA plasmids were from...Pathology and Hospital: Trisha Fleet for procuring prostate tissues through patient consent; Myra Zucker, Cathy Martinez, and Kari Rigg for skillfully

  10. PRMT1-Mediated Translation Regulation is a Crucial Vulnerability of Cancer | Office of Cancer Genomics

    Science.gov (United States)

    Through an shRNA screen, we identified the protein arginine methyltransferase Prmt1 as a vulnerable intervention point in murine p53/Rb-null osteosarcomas, the human counterpart of which lacks effective therapeutic options. Depletion of Prmt1 in p53-deficient cells impaired tumor initiation and maintenance in vitro and in vivo Mechanistic studies reveal that translation-associated pathways were enriched for Prmt1 downstream targets, implicating Prmt1 in translation control.

  11. Shortcomings of short hairpin RNA-based transgenic RNA interference in mouse oocytes

    Czech Academy of Sciences Publication Activity Database

    Sarnová, Lenka; Malík, Radek; Sedláček, Radislav; Svoboda, Petr

    2010-01-01

    Roč. 9, č. 8 (2010), s. 1-10 ISSN 1477-5751 R&D Projects: GA MŠk ME09039 Grant - others:EMBO SDIG(DE) project 1483 Institutional research plan: CEZ:AV0Z50520514 Keywords : transgenic RNAi * shRNA * oocyte Subject RIV: EB - Genetics ; Molecular Biology http://www.jnrbm.com/content/9/1/8

  12. SETD1A modulates cell cycle progression through a miRNA network that regulates p53 target genes

    OpenAIRE

    Tajima, Ken; Yae, Toshifumi; Javaid, Sarah; Tam, Oliver; Comaills, Valentine; Morris, Robert; Wittner, Ben S.; Liu, Mingzhu; Engstrom, Amanda; Takahashi, Fumiyuki; Black, Joshua C.; Ramaswamy, Sridhar; Shioda, Toshihiro; Hammell, Molly; Haber, Daniel A.

    2015-01-01

    Expression of the p53-inducible antiproliferative gene BTG2 is suppressed in many cancers in the absence of inactivating gene mutations, suggesting alternative mechanisms of silencing. Using a shRNA screen targeting 43 histone lysine methyltransferases (KMTs), we show that SETD1A suppresses BTG2 expression through its induction of several BTG2-targeting miRNAs. This indirect but highly specific mechanism, by which a chromatin regulator that mediates transcriptional activating marks can lead t...

  13. Towards Antiviral shRNAs Based on the AgoshRNA Design.

    Directory of Open Access Journals (Sweden)

    Ying Poi Liu

    Full Text Available RNA interference (RNAi can be induced by intracellular expression of a short hairpin RNA (shRNA. Processing of the shRNA requires the RNaseIII-like Dicer enzyme to remove the loop and to release the biologically active small interfering RNA (siRNA. Dicer is also involved in microRNA (miRNA processing to liberate the mature miRNA duplex, but recent studies indicate that miR-451 is not processed by Dicer. Instead, this miRNA is processed by the Argonaute 2 (Ago2 protein, which also executes the subsequent cleavage of a complementary mRNA target. Interestingly, shRNAs that structurally resemble miR-451 can also be processed by Ago2 instead of Dicer. The key determinant of these "AgoshRNA" molecules is a relatively short basepaired stem, which avoids Dicer recognition and consequently allows alternative processing by Ago2. AgoshRNA processing yields a single active RNA strand, whereas standard shRNAs produce a duplex with guide and passenger strands and the latter may cause adverse off-target effects. In this study, we converted previously tested active anti-HIV-1 shRNA molecules into AgoshRNA. We tested several designs that could potentially improve AgoshRNA activity, including extension of the complementarity between the guide strand and the mRNA target and reduction of the thermodynamic stability of the hairpins. We demonstrate that active AgoshRNAs can be generated. However, the RNAi activity is reduced compared to the matching shRNAs. Despite reduced RNAi activity, comparison of an active AgoshRNA and the matching shRNA in a sensitive cell toxicity assay revealed that the AgoshRNA is much less toxic.

  14. [Knockdown of indoleamine 2, 3-dioxygenase 2 (IDO2)gene inhibits tumor growth and enhances immune function in mice bearing melanoma].

    Science.gov (United States)

    Liu, Yanling; Liu, Huan; Xiang, Yingqing; Chen, Xiaoyan; Xu, Ping; Min, Weiping

    2017-12-01

    Objective To study the role of indoleamine 2, 3-dioxygenase 2 (IDO2) in anti-tumor therapy and its effect on the immune response when using IDO2 as therapeutic target. Methods B16-BL6 cells were used to construct mouse xenografted melanoma model. IDO2-shRNA that contained IDO2-siRNA or control shRNA (scrambled-shRNA) was injected hydrodynamically via the tail vein to treat melanoma. The tumor size was measured by vernier caliper. Flow cytometry was performed to analyze the percentage of regulatory T cells (Tregs), T cell apoptosis rate in draining lymph nodes and the expressions of co-stimulatory molecules on splenic dendritic cells (DCs) from different treatment groups. The lactate dehydrogenase (LDH) assay was used to determine the CD8 + cytotoxic T lymphocyte (CTL) activity. The serum levels of tumor necrosis factor α (TNF-α) and interferon γ (IFN-γ) were detected by ELISA. Results In the IDO2-shRNA treated group, the tumor formation time was delayed, tumor grew slowly, and excised tumor mass was significantly reduced. IDO2-shRNA treatment also decreased the percentage of Tregs and T cell apoptosis in draining lymph nodes and increased the expressions of co-stimulatory molecules CD80 and CD86 on splenic DCs. The capacity of CD8 + T cells to kill B16-BL6 cells was enhanced and the serum levels of TNF-α and IFN-γ were upregulated. Conclusion Silencing IDO2 can effectively inhibit the growth of melanoma and improve the anti-tumor immune response in vivo.

  15. Experiment list: SRX189411 [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available ction=Pleura|Tissue Diagnosis=Adenocarcinoma 382984730,0.6,16.2,7193 GSM1008581: Duke DnaseSeq MCF-7 CTCF shRNA knock... cell lineage=ectoderm || cell sex=F || treatment=CTCF_shRNA_knockdown || treatme...nt description=CTCF (CCCTC-binding factor) transcript levels were knocked down in cells using lentiviral tra...to select for cells containing the retroviral construct. By western blot, CTCF protein levels in the knockdo

  16. The acquired radioresistance in HeLa cells under conditions mimicking hypoxia was attenuated by a decreased expression of HIF subunit genes induced by RNA interference

    International Nuclear Information System (INIS)

    Doi, Nobutaka; Ogawa, Ryohei; Cui, Zheng-Guo; Morii, Akihiro; Watanabe, Akihiko; Kanayama, Shinji; Yoneda, Yuko; Kondo, Takashi

    2015-01-01

    The cancer cells residing in the hypoxic layer are resistant to radiation and these are ones responsible for cancer recurrence after radiation therapy. One of the reasons why hypoxic cancer cells acquire radioresistance may be attributable to changes in the gene expression profile by the activation of hypoxia inducible factors (HIFs). However, the details underlying this process remain unknown. In this study, we investigated the effects of knockdown of HIF subunit genes to elucidate how HIF subunit genes may be involved in the radioresistance acquired by HeLa cells following exposure to a hypoxia mimic. Interestingly, HIF-1α and HIF-2α seemed mutually complementary for each other when either of them was suppressed. We thus suppressed the expression of both genes simultaneously. To do this, we developed a short hairpin RNA (shRNA) targeting a high homology region between HIF-1α and HIF-2α. It was shown that the expression of the shRNA effectively suppressed the acquisition of radioresistance following the hypoxia mimic. Moreover, it was confirmed that suppression of both subunits resulted in the downregulation of stem cell markers and the suppression of spheroid formation during the hypoxia mimicking-conditions. This shRNA-mediated knockdown method targeting a common region shared by a family of genes may offer a new candidate cancer treatment. - Highlights: • Incubation with CoCl 2 confers radioresistance to HeLa cells. • Both HIF-1α and HIF-2α are involved in the acquisition of radioresistance. • An shRNA to a homology region of HIF-1α and HIF-2α suppressed the radioresistance. • The shRNA decreased cells with stem cell markers and a stem cell phenotype

  17. Inhibition of osteoclastogenesis by RNA interference targeting RANK

    Directory of Open Access Journals (Sweden)

    Ma Ruofan

    2012-08-01

    Full Text Available Abstract Background Osteoclasts and osteoblasts regulate bone resorption and formation to allow bone remodeling and homeostasis. The balance between bone resorption and formation is disturbed by abnormal recruitment of osteoclasts. Osteoclast differentiation is dependent on the receptor activator of nuclear factor NF-kappa B (RANK ligand (RANKL as well as the macrophage colony-stimulating factor (M-CSF. The RANKL/RANK system and RANK signaling induce osteoclast formation mediated by various cytokines. The RANK/RANKL pathway has been primarily implicated in metabolic, degenerative and neoplastic bone disorders or osteolysis. The central role of RANK/RANKL interaction in osteoclastogenesis makes RANK an attractive target for potential therapies in treatment of osteolysis. The purpose of this study was to assess the effect of inhibition of RANK expression in mouse bone marrow macrophages on osteoclast differentiation and bone resorption. Methods Three pairs of short hairpin RNAs (shRNA targeting RANK were designed and synthesized. The optimal shRNA was selected among three pairs of shRNAs by RANK expression analyzed by Western blot and Real-time PCR. We investigated suppression of osteoclastogenesis of mouse bone marrow macrophages (BMMs using the optimal shRNA by targeting RANK. Results Among the three shRANKs examined, shRANK-3 significantly suppressed [88.3%] the RANK expression (p Conclusions These findings suggest that retrovirus-mediated shRNA targeting RANK inhibits osteoclast differentiation and osteolysis. It may appear an attractive target for preventing osteolysis in humans with a potential clinical application.

  18. The acquired radioresistance in HeLa cells under conditions mimicking hypoxia was attenuated by a decreased expression of HIF subunit genes induced by RNA interference

    Energy Technology Data Exchange (ETDEWEB)

    Doi, Nobutaka [Department of Radiological Sciences, Graduate School of Medicine and Pharmaceutical Sciences, University of Toyama, Toyama 930-0194 (Japan); New Products Research & Development, Gene Engineering Division, NIPPON GENE Co., Ltd. (Japan); Ogawa, Ryohei, E-mail: ogawa@med.u-toyama.ac.jp [Department of Radiological Sciences, Graduate School of Medicine and Pharmaceutical Sciences, University of Toyama, Toyama 930-0194 (Japan); Cui, Zheng-Guo [Department of Public Health, Graduate School of Medicine and Pharmaceutical Sciences, University of Toyama (Japan); Morii, Akihiro; Watanabe, Akihiko [Department of Urology, Graduate School of Medicine and Pharmaceutical Sciences, University of Toyama (Japan); Kanayama, Shinji; Yoneda, Yuko [New Products Research & Development, Gene Engineering Division, NIPPON GENE Co., Ltd. (Japan); Kondo, Takashi [Department of Radiological Sciences, Graduate School of Medicine and Pharmaceutical Sciences, University of Toyama, Toyama 930-0194 (Japan)

    2015-05-01

    The cancer cells residing in the hypoxic layer are resistant to radiation and these are ones responsible for cancer recurrence after radiation therapy. One of the reasons why hypoxic cancer cells acquire radioresistance may be attributable to changes in the gene expression profile by the activation of hypoxia inducible factors (HIFs). However, the details underlying this process remain unknown. In this study, we investigated the effects of knockdown of HIF subunit genes to elucidate how HIF subunit genes may be involved in the radioresistance acquired by HeLa cells following exposure to a hypoxia mimic. Interestingly, HIF-1α and HIF-2α seemed mutually complementary for each other when either of them was suppressed. We thus suppressed the expression of both genes simultaneously. To do this, we developed a short hairpin RNA (shRNA) targeting a high homology region between HIF-1α and HIF-2α. It was shown that the expression of the shRNA effectively suppressed the acquisition of radioresistance following the hypoxia mimic. Moreover, it was confirmed that suppression of both subunits resulted in the downregulation of stem cell markers and the suppression of spheroid formation during the hypoxia mimicking-conditions. This shRNA-mediated knockdown method targeting a common region shared by a family of genes may offer a new candidate cancer treatment. - Highlights: • Incubation with CoCl{sub 2} confers radioresistance to HeLa cells. • Both HIF-1α and HIF-2α are involved in the acquisition of radioresistance. • An shRNA to a homology region of HIF-1α and HIF-2α suppressed the radioresistance. • The shRNA decreased cells with stem cell markers and a stem cell phenotype.

  19. The role of integrin-α5 in the proliferation and odontogenic differentiation of human dental pulp stem cells.

    Science.gov (United States)

    Cui, Li; Xu, Shuaimei; Ma, Dandan; Gao, Jie; Liu, Ying; Yue, Jing; Wu, Buling

    2014-02-01

    It has been reported that integrin-α5 (ITGA5) activity is related to cell proliferation, differentiation, migration, and organ development. However, the involvement of ITGA5 in the biological functions of human dental pulp stem cells (hDPSCs) has not been explored. The aim of this study was to investigate the role of ITGA5 in the proliferation and odontogenic differentiation of hDPSCs. We knocked down ITGA5 in hDPSCs using lentivirus-mediated ITGA5 short hairpin RNA (shRNA). Changes in the proliferation in hDPSCs infected with lentiviruses expressing ITGA5-specific shRNA or negative control shRNA were examined using the 3-(4,5-Dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) assay and 5-ethynyl-2'-deoxyuridine labeling. Both ITGA5 knockdown cells and shMock cells were cultured in mineralization medium for 3 weeks, and the differentiation of cells was detected with alizarin red S staining. The expression of odontogenic differentiation-related molecular markers was assessed using real-time polymerase chain reaction and Western blot assays. The knockdown of ITGA5 decreased the proliferation capacity of hDPSCs. ITGA5 shRNA promoted odontogenic differentiation of hDPSCs with the enhanced formation of mineralized nodules. It also up-regulated the messenger RNA expression of multiple markers of odontogenesis and the expression of dentin sialophosphoprotein protein. These findings suggest that ITGA5 plays an important role in maintaining hDPSCs in a proliferative state. The inhibition of ITGA5 signaling promotes the odontogenic differentiation of hDPSCs. Copyright © 2014 American Association of Endodontists. Published by Elsevier Inc. All rights reserved.

  20. High-Throughput Silencing Using the CRISPR-Cas9 System: A Review of the Benefits and Challenges.

    Science.gov (United States)

    Wade, Mark

    2015-09-01

    The clustered regularly interspaced short palindromic repeats (CRISPR)/Cas system has been seized upon with a fervor enjoyed previously by small interfering RNA (siRNA) and short hairpin RNA (shRNA) technologies and has enormous potential for high-throughput functional genomics studies. The decision to use this approach must be balanced with respect to adoption of existing platforms versus awaiting the development of more "mature" next-generation systems. Here, experience from siRNA and shRNA screening plays an important role, as issues such as targeting efficiency, pooling strategies, and off-target effects with those technologies are already framing debates in the CRISPR field. CRISPR/Cas can be exploited not only to knockout genes but also to up- or down-regulate gene transcription-in some cases in a multiplex fashion. This provides a powerful tool for studying the interaction among multiple signaling cascades in the same genetic background. Furthermore, the documented success of CRISPR/Cas-mediated gene correction (or the corollary, introduction of disease-specific mutations) provides proof of concept for the rapid generation of isogenic cell lines for high-throughput screening. In this review, the advantages and limitations of CRISPR/Cas are discussed and current and future applications are highlighted. It is envisaged that complementarities between CRISPR, siRNA, and shRNA will ensure that all three technologies remain critical to the success of future functional genomics projects. © 2015 Society for Laboratory Automation and Screening.

  1. Transcription factor Runx2 knockdown regulates colon cancer transplantation tumor growth in vitro: an experimental study

    Directory of Open Access Journals (Sweden)

    Bin Xu1

    2017-05-01

    Full Text Available Objective: To study the effect of transcription factor Runx2 knockdown on colon cancer transplantation tumor growth in vitro. Methods: Colon cancer cell lines HT29 were cultured and transfected with negative control (NC - shRNA plasmids and Runx2-shRNA plasmids respectively, the colon cancer cells transfected with shRNA were subcutaneously injected into C57 nude mice, and they were included in NC group and Runx2 knockdown group respectively. 1 week, 2 weeks and 3 weeks after model establishment, serum was collected to determine the contents of tumor markers, and tumor lesions were collected to determine proliferation and apoptosis gene expression. Results: CCSA-2, CEA and CA19-9 levels in serum as well as Rac1, Wnt3a, PLD2 and FAM96B protein expression in transplantation tumor lesions of Runx2 knockdown group were significantly lower than those of NC group while MS4A12, ASPP2 and Fas protein expression in transplantation tumor lesions of Runx2 knockdown group were significantly higher than those of NC group. Conclusion: Transcription factor Runx2 knockdown could inhibit the colon cancer transplantation tumor growth in vitro.

  2. Multi-resistance strategy for viral diseases and short hairpin RNA verification method in pigs

    Directory of Open Access Journals (Sweden)

    Jong-nam Oh

    2018-04-01

    Full Text Available Objective Foot and mouth disease (FMD and porcine reproductive and respiratory syndrome (PRRS are major diseases that interrupt porcine production. Because they are viral diseases, vaccinations are of only limited effectiveness in preventing outbreaks. To establish an alternative multi-resistant strategy against FMD virus (FMDV and PRRS virus (PRRSV, the present study introduced two genetic modification techniques to porcine cells. Methods First, cluster of differentiation 163 (CD163, the PRRSV viral receptor, was edited with the clustered regularly interspaced short palindromic repeats-CRISPR-associated protein 9 technique. The CD163 gene sequences of edited cells and control cells differed. Second, short hairpin RNA (shRNAs were integrated into the cells. The shRNAs, targeting the 3D gene of FMDV and the open reading frame 7 (ORF7 gene of PRRSV, were transferred into fibroblasts. We also developed an in vitro shRNA verification method with a target gene expression vector. Results shRNA activity was confirmed in vitro with vectors that expressed the 3D and ORF7 genes in the cells. Cells containing shRNAs showed lower transcript levels than cells with only the expression vectors. The shRNAs were integrated into CD163-edited cells to combine the two techniques, and the viral genes were suppressed in these cells. Conclusion We established a multi-resistant strategy against viral diseases and an in vitro shRNA verification method.

  3. Pathogenic effects of Rift Valley fever virus NSs gene are alleviated in cultured cells by expressed antiviral short hairpin RNAs.

    Science.gov (United States)

    Scott, Tristan; Paweska, Janusz T; Arbuthnot, Patrick; Weinberg, Marc S

    2012-01-01

    Rift Valley fever virus (RVFV), a member of the Bunyaviridae family, may cause severe hepatitis, encephalitis and haemorrhagic fever in humans. There are currently no available licensed vaccines or therapies to treat the viral infection in humans. RNA interference (RNAi)-based viral gene silencing offers a promising approach to inhibiting replication of this highly pathogenic virus. The small (S) segment of the RVFV tripartite genome carries the genetic determinates for pathogenicity during infection. This segment encodes the non-structural S (NSs) and essential nucleocapsid (N) genes. To advance RNAi-based inhibition of RVFV replication, we designed several Pol III short hairpin RNA (shRNA) expression cassettes against the NSs and N genes, including a multimerized plasmid vector that included four shRNA expression cassettes. Effective target silencing was demonstrated using full- and partial-length target reporter assays, and confirmed by western blot analysis of exogenous N and NSs expression. Small RNA northern blots showed detectable RNAi guide strand formation from single and multimerized shRNA constructs. Using a cell culture model of RVFV replication, shRNAs targeting the N gene decreased intracellular nucleocapsid protein concentration and viral replication. The shRNAs directed against the NSs gene reduced NSs protein concentrations and alleviated NSs-mediated cytotoxicity, which may be caused by host transcription suppression. These data are the first demonstration that RNAi activators have a potential therapeutic benefit for countering RVFV infection.

  4. RNAi Knockdown of Hypoxia-Inducible Factor-1α Decreased the Proliferation, Migration, and Invasion of Hypoxic Hepatocellular Carcinoma Cells.

    Science.gov (United States)

    Chen, ChengShi; Liu, Rong; Wang, JianHua; Yan, ZhiPing; Qian, Sheng; Zhang, Wei

    2015-04-01

    The obstruction of hepatic arterial blood flow results in tumor tissue hypoxia and elevated expression of hypoxia-inducible factor-1alpha (HIF-1α). Our study evaluated whether lentivirus-mediated short interference RNA against HIF-1α inhibits proliferation, invasion, and migration of hepatocellular carcinoma (HCC) cells under hypoxia. RNA interference knockdown of HIF-1α was achieved by HIF-1α-directed lentiviral shRNA, in a rat HCC cell line cultured under hypoxia condition for varying length of times. The expression levels of HIF-1α and vascular endothelial growth factor were examined using reverse transcription polymerase chain reaction and western blot analyses. Cell proliferation, migration, and invasion were measured by cell viability, transwell migration, and invasion assays, respectively. Inhibition of HIF-1α expression by shRNA suppressed vascular endothelial growth factor mRNA and protein levels under both normoxia and hypoxia. It also suppressed cell migration and invasion, which were enhanced under hypoxic conditions. RNAi knockdown of HIF-1α further suppressed hypoxia-mediated inhibition of the cell proliferation. These data suggest that shRNA of HIF-1α could antagonize the hypoxia-mediated increase in hepatic cancer cell migration and invasion, and synergize with hypoxia to inhibit the cell proliferation in HCC cells.

  5. Cooperation of decay-accelerating factor and membrane cofactor protein in regulating survival of human cervical cancer cells

    International Nuclear Information System (INIS)

    Gao, Ling-Juan; Guo, Shu-Yu; Cai, You-Qun; Gu, Ping-Qing; Su, Ya-Juan; Gong, Hui; Liu, Yun; Chen, Chen

    2009-01-01

    Decay-accelerating factor (DAF) and membrane cofactor protein (MCP) are the key molecules involved in cell protection against autologus complement, which restricts the action of complement at critical stages of the cascade reaction. The cooperative effect of DAF and MCP on the survival of human cervical cancer cell (ME180) has not been demonstrated. In this study we applied, for the first time, short hairpin RNA (shRNA) to knock down the expression of the DAF and MCP with the aim of exploiting complement more effectively for tumor cell damage. Meanwhile, we investigated the cooperative effects of DAF and MCP on the viability and migration, moreover the proliferation of ME180 cell. The results showed that shRNA inhibition of DAF and MCP expression enhanced complement-dependent cytolysis (CDC) up to 39% for MCP and up to 36% for DAF, and the combined inhibition of both regulators yielded further additive effects in ME180 cells. Thus, the activities of DAF and MCP, when present together, are greater than the sum of the two protein individually. These data indicated that combined DAF and MCP shRNA described in this study may offer an additional alternative to improve the efficacy of antibody-and complement-based cancer immunotherapy

  6. Enhanced osteogenesis of adipose derived stem cells with Noggin suppression and delivery of BMP-2.

    Directory of Open Access Journals (Sweden)

    Jiabing Fan

    Full Text Available Bone morphogenetic proteins (BMPs are believed to be the most potent osteoinductive factors. However, BMPs are highly pleiotropic molecules and their supra-physiological high dose requirement leads to adverse side effects and inefficient bone formation. Thus, there is a need to develop alternative osteoinductive growth factor strategies that can effectively complement BMP activity. In this study, we intrinsically stimulated BMP signaling in adipose derived stem cells (ASCs by downregulating noggin, a potent BMP antagonist, using an RNAi strategy. ASCs transduced with noggin shRNA significantly enhanced osteogenic differentiation of cells. The potency of endogenous BMPs was subsequently enhanced by stimulating ASCs with exogenous BMPs at a significantly reduced dose. The level of mineralization in noggin shRNA treated ASCs when treated with BMP-2 was comparable to that of control shRNA treated cell treated with 10-fold more BMP-2. The complementary strategy of noggin suppression + BMP-2 to enhance osteogenesis was further confirmed in 3D in vitro environments using scaffolds consisting of chitosan (CH, chondroitin sulfate (CS, and apatite layer on their surfaces designed to slowly release BMP-2. This finding supports the novel therapeutic potential of this complementary strategy in bone regeneration.

  7. CryoEM structures of two spliceosomal complexes: starter and dessert at the spliceosome feast.

    Science.gov (United States)

    Nguyen, Thi Hoang Duong; Galej, Wojciech P; Fica, Sebastian M; Lin, Pei-Chun; Newman, Andrew J; Nagai, Kiyoshi

    2016-02-01

    The spliceosome is formed on pre-mRNA substrates from five small nuclear ribonucleoprotein particles (U1, U2, U4/U6 and U5 snRNPs), and numerous non-snRNP factors. Saccharomyces cerevisiae U4/U6.U5 tri-snRNP comprises U5 snRNA, U4/U6 snRNA duplex and approximately 30 proteins and represents a substantial part of the spliceosome before activation. Schizosaccharomyces pombe U2.U6.U5 spliceosomal complex is a post-catalytic intron lariat spliceosome containing U2 and U5 snRNPs, NTC (nineteen complex), NTC-related proteins (NTR), U6 snRNA, and an RNA intron lariat. Two recent papers describe near-complete atomic structures of these complexes based on cryoEM single-particle analysis. The U4/U6.U5 tri-snRNP structure provides crucial insight into the activation mechanism of the spliceosome. The U2.U6.U5 complex reveals the striking architecture of NTC and NTR and important features of the group II intron-like catalytic RNA core remaining after spliced mRNA is released. These two structures greatly advance our understanding of the mechanism of pre-mRNA splicing. Copyright © 2016 The Authors. Published by Elsevier Ltd.. All rights reserved.

  8. Polyetherimide-grafted Fe3O4@SiO2 nanoparticles as theranostic agents for simultaneous VEGF siRNA delivery and magnetic resonance cell imaging

    Directory of Open Access Journals (Sweden)

    Li T

    2015-07-01

    Full Text Available Tingting Li,1 Xue Shen,1 Yin Chen,1 Chengchen Zhang,1 Jie Yan,1 Hong Yang,1 Chunhui Wu,1,2 Hongjun Zeng,1,2 Yiyao Liu1,21Department of Biophysics, School of Life Science and Technology, 2Center for Information in Biomedicine, University of Electronic Science and Technology of China, Chengdu, Sichuan, People’s Republic of ChinaAbstract: Engineering a safe and high-efficiency delivery system for efficient RNA interference is critical for successful gene therapy. In this study, we designed a novel nanocarrier system of polyethyleneimine (PEI-modified Fe3O4@SiO2, which allows high efficient loading of VEGF small hairpin (shRNA to form Fe3O4@SiO2/PEI/VEGF shRNA nanocomposites for VEGF gene silencing as well as magnetic resonance (MR imaging. The size, morphology, particle stability, magnetic properties, and gene-binding capacity and protection were determined. Low cytotoxicity and hemolyticity against human red blood cells showed the excellent biocompatibility of the multifunctional nanocomposites, and also no significant coagulation was observed. The nanocomposites maintain their superparamagnetic property at room temperature and no appreciable change in magnetism, even after PEI modification. The qualitative and quantitative analysis of cellular internalization into MCF-7 human breast cancer cells by Prussian blue staining and inductively coupled plasma atomic emission spectroscopy analysis, respectively, demonstrated that the Fe3O4@SiO2/PEI/VEGF shRNA nanocomposites could be easily internalized by MCF-7 cells, and they exhibited significant inhibition of VEGF gene expression. Furthermore, the MR cellular images showed that the superparamagnetic iron oxide core of our Fe3O4@SiO2/PEI/VEGF shRNA nanocomposites could also act as a T2-weighted contrast agent for cancer MR imaging. Our data highlight multifunctional Fe3O4@SiO2/PEI/VEGF shRNA nanocomposites as a potential platform for simultaneous gene delivery and MR cell imaging, which are promising

  9. Survivin knockdown increased anti-cancer effects of (-)-epigallocatechin-3-gallate in human malignant neuroblastoma SK-N-BE2 and SH-SY5Y cells

    Energy Technology Data Exchange (ETDEWEB)

    Hossain, Md. Motarab [Department of Pathology, Microbiology, and Immunology, University of South Carolina School of Medicine, Columbia, SC (United States); Banik, Naren L. [Department of Neurosciences, Medical University of South Carolina, Charleston, SC (United States); Ray, Swapan K., E-mail: swapan.ray@uscmed.sc.edu [Department of Pathology, Microbiology, and Immunology, University of South Carolina School of Medicine, Columbia, SC (United States)

    2012-08-01

    Neuroblastoma is a solid tumor that mostly occurs in children. Malignant neuroblastomas have poor prognosis because conventional chemotherapeutic agents are hardly effective. Survivin, which is highly expressed in some malignant neuroblastomas, plays a significant role in inhibiting differentiation and apoptosis and promoting cell proliferation, invasion, and angiogenesis. We examined consequences of survivin knockdown by survivin short hairpin RNA (shRNA) plasmid and then treatment with (-)-epigallocatechin-3-gallate (EGCG), a green tea flavonoid, in malignant neuroblastoma cells. Our Western blotting and laser scanning confocal immunofluorescence microscopy showed that survivin was highly expressed in malignant neuroblastoma SK-N-BE2 and SH-SY5Y cell lines and slightly in SK-N-DZ cell line. Expression of survivin was very faint in malignant neuroblastoma IMR32 cell line. We transfected SK-N-BE2 and SH-SY-5Y cells with survivin shRNA, treated with EGCG, and confirmed knockdown of survivin at mRNA and protein levels. Survivin knockdown induced morphological features of neuronal differentiation, as we observed following in situ methylene blue staining. Combination of survivin shRNA and EGCG promoted neuronal differentiation biochemically by increases in the expression of NFP, NSE, and e-cadherin and also decreases in the expression of Notch-1, ID2, hTERT, and PCNA. Our in situ Wright staining and Annexin V-FITC/PI staining showed that combination therapy was highly effective in inducing, respectively, morphological and biochemical features of apoptosis. Apoptosis occurred with activation of caspase-8 and cleavage of Bid to tBid, increase in Bax:Bcl-2 ratio, mitochondrial release of cytochrome c, and increases in the expression and activity of calpain and caspase-3. Combination therapy decreased migration of cells through matrigel and inhibited proliferative (p-Akt and NF-{kappa}B), invasive (MMP-2 and MMP-9), and angiogenic (VEGF and b-FGF) factors. Also, in vitro

  10. Survivin knockdown increased anti-cancer effects of (−)-epigallocatechin-3-gallate in human malignant neuroblastoma SK-N-BE2 and SH-SY5Y cells

    International Nuclear Information System (INIS)

    Hossain, Md. Motarab; Banik, Naren L.; Ray, Swapan K.

    2012-01-01

    Neuroblastoma is a solid tumor that mostly occurs in children. Malignant neuroblastomas have poor prognosis because conventional chemotherapeutic agents are hardly effective. Survivin, which is highly expressed in some malignant neuroblastomas, plays a significant role in inhibiting differentiation and apoptosis and promoting cell proliferation, invasion, and angiogenesis. We examined consequences of survivin knockdown by survivin short hairpin RNA (shRNA) plasmid and then treatment with (−)-epigallocatechin-3-gallate (EGCG), a green tea flavonoid, in malignant neuroblastoma cells. Our Western blotting and laser scanning confocal immunofluorescence microscopy showed that survivin was highly expressed in malignant neuroblastoma SK-N-BE2 and SH-SY5Y cell lines and slightly in SK-N-DZ cell line. Expression of survivin was very faint in malignant neuroblastoma IMR32 cell line. We transfected SK-N-BE2 and SH-SY-5Y cells with survivin shRNA, treated with EGCG, and confirmed knockdown of survivin at mRNA and protein levels. Survivin knockdown induced morphological features of neuronal differentiation, as we observed following in situ methylene blue staining. Combination of survivin shRNA and EGCG promoted neuronal differentiation biochemically by increases in the expression of NFP, NSE, and e-cadherin and also decreases in the expression of Notch-1, ID2, hTERT, and PCNA. Our in situ Wright staining and Annexin V-FITC/PI staining showed that combination therapy was highly effective in inducing, respectively, morphological and biochemical features of apoptosis. Apoptosis occurred with activation of caspase-8 and cleavage of Bid to tBid, increase in Bax:Bcl-2 ratio, mitochondrial release of cytochrome c, and increases in the expression and activity of calpain and caspase-3. Combination therapy decreased migration of cells through matrigel and inhibited proliferative (p-Akt and NF-κB), invasive (MMP-2 and MMP-9), and angiogenic (VEGF and b-FGF) factors. Also, in vitro

  11. [Effects of transient receptor potential melastatin 8 cation channels on inflammatory reaction induced by cold temperatures in human airway epithelial cells].

    Science.gov (United States)

    Li, Min-chao; Perelman, Juliy M; Kolosov, Victor P; Zhou, Xiang-dong

    2011-10-01

    To explore the role of transient receptor potential melastatin 8 cation channels (TRPM8) in cold-induced production of inflammatory factors in airway epithelial cells and related signal transduction mechanism. The 16HBE human airway epithelial cells were stimulated with cold temperature (18°C). In intervention experiments, cells were pretreated with TRPM8 channel antagonist BCTC, protein kinase C (PKC) specific inhibitor calphostin C and transfected with TRPM8 shRNA or control shRNA respectively, and thereafter cold stimulation was applied. Cells were divided into 6 groups: a control group (incubated at 37°C), a cold stimulation group, a cold stimulation + BCTC group, a cold stimulation + TRPM8 shRNA group, a cold stimulation + control shRNA group, a cold stimulation + calphostin C group. Western blot was performed to show the extent of knockdown in TRPM8 protein expression in the TRPM8 shRNA transfected cells. Dynamics of relative concentration of intracellular Ca(2+) in the former 5 groups were measured by calcium imaging techniques. Images were taken at one frame per 10 seconds. The levels of interleukin (IL)-6, IL-8, tumor necrosis factor (TNF)-α mRNA and protein were detected by real-time PCR and ELISA respectively. The highest relative concentration of intracellular calcium in cold stimulation group (2.36 ± 0.24) was higher than that of control group (1.01 ± 0.02) (t = 12.52, P cold stimulation group (t = 6.69 and 9.12, all P cold stimulation group[0.66 ± 0.16, 0.77 ± 0.15, 0.73 ± 0.09 and (92 ± 13) ng/L, (125 ± 22) ng/L, (88 ± 12) ng/L ] were significantly higher than those in control group [0.37 ± 0.08, 0.32 ± 0.07, 0.48 ± 0.10 and (52 ± 8) ng/L, (50 ± 9) ng/L, (61 ± 8) ng/L] (t = 3.20 - 6.26, all P cold stimulation + BCTC group [0.42 ± 0.09, 0.52 ± 0.13, 0.52 ± 0.12 and (72 ± 8) ng/L, (92 ± 14) ng/L, (68 ± 11) ng/L], cold stimulation + TRPM8 shRNA group [0.41 ± 0.10, 0.49 ± 0.08, 0.50 ± 0.08 and (60 ± 12) ng/L, (89 ± 14) ng

  12. Development of a gene therapy strategy to target hepatocellular carcinoma based inhibition of protein phosphatase 2A using the α-fetoprotein promoter enhancer and pgk promoter: an in vitro and in vivo study

    International Nuclear Information System (INIS)

    Li, Wei; Tao, Min; Li, Dao-Ming; Chen, Kai; Chen, Zheng; Zong, Yang; Yin, Hong; Xu, Ze-Kuan; Zhu, Yi; Gong, Fei-Ran

    2012-01-01

    Hepatocellular carcinoma (HCC) is one of the leading causes of cancer-related deaths worldwide. Current therapies are insufficient, making HCC an intractable disease. Our previous studies confirmed that inhibition of protein phosphatase 2A (PP2A) may provide a promising therapeutic strategy for cancer. Unfortunately, constitutive expression of PP2A in normal tissues limits the application of PP2A inhibition. Thus, a HCC-specific gene delivery system should be developed. The α-fetoprotein (AFP) promoter is commonly used in HCC-specific gene therapy strategies; however, the utility of this approach is limited due to the weak activity of the AFP promoter. It has been shown that linking the AFP enhancer with the promoter of the non-tissue-specific, human housekeeping phosphoglycerate kinase (pgk) gene can generate a strong and HCC-selective promoter. We constructed a HCC-specific gene therapy system to target PP2A using the AFP enhancer/pgk promoter, and evaluated the efficiency and specificity of this system both in vitro and in vivo. AFP enhancer/pgk promoter-driven expression of the dominant negative form of the PP2A catalytic subunit α (DN-PP2Acα) exerted cytotoxic effects against an AFP-positive human hepatoma cell lines (HepG2 and Hep3B), but did not affect AFP-negative human hepatoma cells (SK-HEP-1) or normal human liver cells (L-02). Moreover, AFP enhancer/pgk promoter driven expression of DN-PP2Acα inhibited the growth of AFP-positive HepG2 tumors in nude mice bearing solid tumor xenografts, but did not affect AFP-negative SK-HEP-1 tumors. The novel approach of AFP enhancer/pgk promoter-driven expression of DN-PP2Acα may provide a useful cancer gene therapy strategy to selectively target HCC

  13. The Free-Radical Copolymerization of Difurylmethane with Maleic

    African Journals Online (AJOL)

    Prof. Jo Michael

    Reaction feeds containing 85 mol % and higher of difurylmethane ... Keywords: difurylmethane; maleic anhydride; copolymerization; thermodecomposition ... delivery apparatus set at 500 psi for a flow rate of 1 cm3 min-1; a Waters model U6K.

  14. PLC and SCADA based automation of injection casting process for casting of uranium-zirconium blanket fuel slugs for metallic fuel fabrication

    International Nuclear Information System (INIS)

    Yathish Kumar, G.; Jagadeeschandran, J.; Avvaru, Prafulla Kumar; Yadaw, Abhishek Kumar; Lavakumar, R.; Prabhu, T.V.; Muralidharan, P.; Anthonysamy, S.

    2016-01-01

    Fabrication of metallic (U-6wt.%Zr) slugs involves melting of binary alloy under vacuum and injection casting into quartz moulds at high pressure. Injection casting system housed inside glove box comprises of high vacuum, induction melting, high pressure control, motion control, mould preheating, chamber cooling, crucible handling and glove box pressure control systems. The technology development for process automation of injection casting system and process optimisation for fabrication of metallic (U-6%Zr) slugs is outlined in this paper. (author)

  15. The mitogenome of a 35,000-year-old Homo sapiens from Europe supports a Palaeolithic back-migration to Africa.

    Science.gov (United States)

    Hervella, M; Svensson, E M; Alberdi, A; Günther, T; Izagirre, N; Munters, A R; Alonso, S; Ioana, M; Ridiche, F; Soficaru, A; Jakobsson, M; Netea, M G; de-la-Rua, C

    2016-05-19

    After the dispersal of modern humans (Homo sapiens) Out of Africa, hominins with a similar morphology to that of present-day humans initiated the gradual demographic expansion into Eurasia. The mitogenome (33-fold coverage) of the Peştera Muierii 1 individual (PM1) from Romania (35 ky cal BP) we present in this article corresponds fully to Homo sapiens, whilst exhibiting a mosaic of morphological features related to both modern humans and Neandertals. We have identified the PM1 mitogenome as a basal haplogroup U6*, not previously found in any ancient or present-day humans. The derived U6 haplotypes are predominantly found in present-day North-Western African populations. Concomitantly, those found in Europe have been attributed to recent gene-flow from North Africa. The presence of the basal haplogroup U6* in South East Europe (Romania) at 35 ky BP confirms a Eurasian origin of the U6 mitochondrial lineage. Consequently, we propose that the PM1 lineage is an offshoot to South East Europe that can be traced to the Early Upper Paleolithic back migration from Western Asia to North Africa, during which the U6 lineage diversified, until the emergence of the present-day U6 African lineages.

  16. Selective permeability of uranyl peroxide nanocages to different alkali ions: influences from surface pores and hydration shells

    International Nuclear Information System (INIS)

    Gao, Yunyi; Haso, Fadi; Zhou, Jing; Hu, Lang; Liu, Tianbo; Szymanowski, Jennifer E.S.; Burns, Peter C.

    2015-01-01

    The precise guidance to different ions across the biological channels is essential for many biological processes. An artificial nanopore system will facilitate the study of the ion-transport mechanism through nanosized channels and offer new views for designing nanodevices. Herein we reveal that a 2.5 nm-sized, fullerene-shaped molecular cluster Li_4_8_+_mK_1_2(OH)_m[UO_2(O_2)(OH)]_6_0_-(H_2O)_n (m∼20 and n∼310) (U_6_0) shows selective permeability to different alkali ions. The subnanometer pores on the water-ligand-rich surface of U_6_0 are able to block Rb"+ and Cs"+ ions from passing through, while allowing Na"+ and K"+ ions, which possess larger hydrated sizes, to enter the interior space of U_6_0. An interestingly high entropy gain during the binding process between U_6_0 and alkali ions suggests that the hydration shells of Na"+/K"+ and U_6_0 are damaged during the interaction. The ion selectivity of U_6_0 is greatly influenced by both the morphologies of the surface nanopores and the dynamics of the hydration shells. (copyright 2015 WILEY-VCH Verlag GmbH and Co. KGaA, Weinheim)

  17. Spatially and Temporally Regulated NRF2 Gene Therapy Using Mcp-1 Promoter in Retinal Ganglion Cell Injury

    Directory of Open Access Journals (Sweden)

    Kosuke Fujita

    2017-06-01

    Full Text Available Retinal ganglion cell degeneration triggered by axonal injury is believed to underlie many ocular diseases, including glaucoma and optic neuritis. In these diseases, retinal ganglion cells are affected unevenly, both spatially and temporally, such that healthy and unhealthy cells coexist in different patterns at different time points. Herein, we describe a temporally and spatially regulated adeno-associated virus gene therapy aiming to reduce undesired off-target effects on healthy retinal neurons. The Mcp-1 promoter previously shown to be activated in stressed retinal ganglion cells following murine optic nerve injury was combined with the neuroprotective intracellular transcription factor Nrf2. In this model, Mcp-1 promoter-driven NRF2 expression targeting only stressed retinal ganglion cells showed efficacy equivalent to non-selective cytomegalovirus promoter-driven therapy for preventing cell death. However, cytomegalovirus promoter-mediated NRF2 transcription induced cellular stress responses and death of Brn3A-positive uninjured retinal ganglion cells. Such undesired effects were reduced substantially by adopting the Mcp-1 promoter. Combining a stress-responsive promoter and intracellular therapeutic gene is a versatile approach for specifically targeting cells at risk of degeneration. This strategy may be applicable to numerous chronic ocular and non-ocular conditions.

  18. Pivotal Role of O-GlcNAc Modification in Cold-Induced Thermogenesis by Brown Adipose Tissue Through Mitochondrial Biogenesis.

    Science.gov (United States)

    Ohashi, Natsuko; Morino, Katsutaro; Ida, Shogo; Sekine, Osamu; Lemecha, Mengistu; Kume, Shinji; Park, Shi-Young; Choi, Cheol Soo; Ugi, Satoshi; Maegawa, Hiroshi

    2017-09-01

    Adipose tissues considerably influence metabolic homeostasis, and both white (WAT) and brown (BAT) adipose tissue play significant roles in lipid and glucose metabolism. O -linked N -acetylglucosamine ( O -GlcNAc) modification is characterized by the addition of N -acetylglucosamine to various proteins by O -GlcNAc transferase (Ogt), subsequently modulating various cellular processes. However, little is known about the role of O -GlcNAc modification in adipose tissues. Here, we report the critical role of O -GlcNAc modification in cold-induced thermogenesis. Deletion of Ogt in WAT and BAT using adiponectin promoter-driven Cre recombinase resulted in severe cold intolerance with decreased uncoupling protein 1 (Ucp1) expression. Furthermore, Ogt deletion led to decreased mitochondrial protein expression in conjunction with decreased peroxisome proliferator-activated receptor γ coactivator 1-α protein expression. This phenotype was further confirmed by deletion of Ogt in BAT using Ucp1 promoter-driven Cre recombinase, suggesting that O -GlcNAc modification in BAT is responsible for cold-induced thermogenesis. Hypothermia was significant under fasting conditions. This effect was mitigated after normal diet consumption but not after consumption of a fatty acid-rich ketogenic diet lacking carbohydrates, suggesting impaired diet-induced thermogenesis, particularly by fat. In conclusion, O -GlcNAc modification is essential for cold-induced thermogenesis and mitochondrial biogenesis in BAT. Glucose flux into BAT may be a signal to maintain BAT physiological responses. © 2017 by the American Diabetes Association.

  19. Construction of a Dual-Fluorescence Reporter System to Monitor the Dynamic Progression of Pluripotent Cell Differentiation.

    Science.gov (United States)

    Sun, Wu-Sheng; Chun, Ju-Lan; Do, Jeong-Tae; Kim, Dong-Hwan; Ahn, Jin-Seop; Kim, Min-Kyu; Hwang, In-Sul; Kwon, Dae-Jin; Hwang, Seong-Soo; Lee, Jeong-Woong

    2016-01-01

    Oct4 is a crucial germ line-specific transcription factor expressed in different pluripotent cells and downregulated in the process of differentiation. There are two conserved enhancers, called the distal enhancer (DE) and proximal enhancer (PE), in the 5' upstream regulatory sequences (URSs) of the mouse Oct4 gene, which were demonstrated to control Oct4 expression independently in embryonic stem cells (ESCs) and epiblast stem cells (EpiSCs). We analyzed the URSs of the pig Oct4 and identified two similar enhancers that were highly consistent with the mouse DE and PE. A dual-fluorescence reporter was later constructed by combining a DE-free- Oct4 -promoter-driven EGFP reporter cassette with a PE-free- Oct4 -promoter-driven mCherry reporter cassette. Then, it was tested in a mouse ESC-like cell line (F9) and a mouse EpiSC-like cell line (P19) before it is formally used for pig. As a result, a higher red fluorescence was observed in F9 cells, while green fluorescence was primarily detected in P19 cells. This fluorescence expression pattern in the two cell lines was consistent with that in the early naïve pluripotent state and late primed pluripotent state during differentiation of mouse ESCs. Hence, this reporter system will be a convenient tool for screening out ESC-like naïve pluripotent stem cells from other metastable state cells in a heterogenous population.

  20. Construction of a Dual-Fluorescence Reporter System to Monitor the Dynamic Progression of Pluripotent Cell Differentiation

    Directory of Open Access Journals (Sweden)

    Wu-Sheng Sun

    2016-01-01

    Full Text Available Oct4 is a crucial germ line-specific transcription factor expressed in different pluripotent cells and downregulated in the process of differentiation. There are two conserved enhancers, called the distal enhancer (DE and proximal enhancer (PE, in the 5′ upstream regulatory sequences (URSs of the mouse Oct4 gene, which were demonstrated to control Oct4 expression independently in embryonic stem cells (ESCs and epiblast stem cells (EpiSCs. We analyzed the URSs of the pig Oct4 and identified two similar enhancers that were highly consistent with the mouse DE and PE. A dual-fluorescence reporter was later constructed by combining a DE-free-Oct4-promoter-driven EGFP reporter cassette with a PE-free-Oct4-promoter-driven mCherry reporter cassette. Then, it was tested in a mouse ESC-like cell line (F9 and a mouse EpiSC-like cell line (P19 before it is formally used for pig. As a result, a higher red fluorescence was observed in F9 cells, while green fluorescence was primarily detected in P19 cells. This fluorescence expression pattern in the two cell lines was consistent with that in the early naïve pluripotent state and late primed pluripotent state during differentiation of mouse ESCs. Hence, this reporter system will be a convenient tool for screening out ESC-like naïve pluripotent stem cells from other metastable state cells in a heterogenous population.

  1. A Baculovirus immediate-early gene, ie1, promoter drives efficient expression of a transgene in both Drosophila melanogaster and Bombyx mori.

    Directory of Open Access Journals (Sweden)

    Mika Masumoto

    Full Text Available Many promoters have been used to drive expression of heterologous transgenes in insects. One major obstacle in the study of non-model insects is the dearth of useful promoters for analysis of gene function. Here, we investigated whether the promoter of the immediate-early gene, ie1, from the Bombyx mori nucleopolyhedrovirus (BmNPV could be used to drive efficient transgene expression in a wide variety of insects. We used a piggyBac-based vector with a 3xP3-DsRed transformation marker to generate a reporter construct; this construct was used to determine the expression patterns driven by the BmNPV ie1 promoter; we performed a detailed investigation of the promoter in transgene expression pattern in Drosophila melanogaster and in B. mori. Drosophila and Bombyx belong to different insect orders (Diptera and Lepidoptera, respectively; however, and to our surprise, ie1 promoter-driven expression was evident in several tissues (e.g., prothoracic gland, midgut, and tracheole in both insects. Furthermore, in both species, the ie1 promoter drove expression of the reporter gene from a relatively early embryonic stage, and strong ubiquitous ie1 promoter-driven expression continued throughout the larval, pupal, and adult stages by surface observation. Therefore, we suggest that the ie1 promoter can be used as an efficient expression driver in a diverse range of insect species.

  2. The PIN family of proteins in potato and their putative role in tuberisation

    Directory of Open Access Journals (Sweden)

    Efstathios eRoumeliotis

    2013-12-01

    Full Text Available The PIN family of trans-membrane proteins mediates auxin efflux throughout the plant and during various phases of plant development. In Arabidopsis thaliana, the PIN family comprised of 8 members, divided into ‘short’ and ‘long’ PINs according to the length of the hydrophilic domain of the protein. Based on sequence homology using the recently published potato genome sequence (Solanum tuberosum group Phureja we identified ten annotated potato StPIN genes. Mining the publicly available gene expression data, we constructed a catalogue tissue specificity of StPIN gene expression, focusing on the process of tuberization. A total of four StPIN genes exhibited increased expression four days after tuber induction, prior to the onset of stolon swelling. For two PIN genes, StPIN4 and StPIN2, promoter sequences were cloned and fused to the GUS reporter protein to study tissue specificity in more detail. StPIN4 promoter driven GUS staining was detected in the flower stigma, in the flower style, below the ovary and petals, in the root tips, in the vascular tissue of the stolons and in the tuber parenchyma cells. StPIN2 promoter driven GUS staining was detected in flower buds, in the vascular tissue of the swelling stolons and in the storage parenchyma of the growing tubers. Based on our results, we postulate a role for the StPINs in redistributing auxin in the swelling stolon during early events in tuber development.

  3. Reduction of adenovirus E1A mRNA by RNAi results in enhanced recombinant protein expression in transiently transfected HEK293 cells.

    Science.gov (United States)

    Hacker, David L; Bertschinger, Martin; Baldi, Lucia; Wurm, Florian M

    2004-10-27

    Human embryonic kidney 293 (HEK293) cells, a widely used host for large-scale transient expression of recombinant proteins, are transformed with the adenovirus E1A and E1B genes. Because the E1A proteins function as transcriptional activators or repressors, they may have a positive or negative effect on transient transgene expression in this cell line. Suspension cultures of HEK293 EBNA (HEK293E) cells were co-transfected with a reporter plasmid expressing the GFP gene and a plasmid expressing a short hairpin RNA (shRNA) targeting the E1A mRNAs for degradation by RNA interference (RNAi). The presence of the shRNA in HEK293E cells reduced the steady state level of E1A mRNA up to 75% and increased transient GFP expression from either the elongation factor-1alpha (EF-1alpha) promoter or the human cytomegalovirus (HCMV) immediate early promoter up to twofold. E1A mRNA depletion also resulted in a twofold increase in transient expression of a recombinant IgG in both small- and large-scale suspension cultures when the IgG light and heavy chain genes were controlled by the EF-1alpha promoter. Finally, transient IgG expression was enhanced 2.5-fold when the anti-E1A shRNA was expressed from the same vector as the IgG light chain gene. These results demonstrated that E1A has a negative effect on transient gene expression in HEK293E cells, and they established that RNAi can be used to enhance recombinant protein expression in mammalian cells.

  4. Adenoviral short hairpin RNA therapy targeting phosphodiesterase 5a relieves cardiac remodeling and dysfunction following myocardial infarction

    Science.gov (United States)

    Li, Longhu; Haider, Husnain Kh.; Wang, Linlin; Lu, Gang

    2012-01-01

    We previously showed that treatment with tadalafil, a long-acting phosphodiesterase-5a (PDE5a) inhibitor, effectively prevented adverse left ventricular (LV) remodeling of the infarcted heart. We hypothesized that short-hairpin RNA (shRNA) therapy targeting PDE5a would simulate the effects of pharmacological intervention for treatment of postinfarction LV remodeling and dysfunction. Experimental model of myocardial infarction was developed in female mice by permanent ligation of left coronary artery. Immediately after that, an adenoviral vector encoding for shRNA sequence targeting PDE5a (Ad-shPDE5a) was injected intramyocardially, which specifically inhibited PDE5a in the heart. Four weeks later, Ad-shPDE5a treated mice showed significant mitigation of the left ventricle (LV) dilatation and dysfunction as indicated by smaller LV cavity and more preserved ejection fraction and fractional shortening. Infarction size and fibrosis were significantly reduced in Ad-shPDE5a-treated mice. Additionally, more salvaged cardiomyocytes, significantly reduced collagen contents, and higher blood vessel density were observed in Ad-shPDE5a-treated mice. The cytoprotective effects of Ad-shPDE5a were demonstrated in vitro in Ad-shPDE5a transfected cardiomyocytes cultured under oxygen glucose deprivation. Among downstream mediators of PDE5a signaling, cyclic GMP (cGMP) and cGMP-dependent protein kinase G (PKG) were activated with concomitant reduction in caspase-3 activity. However, no significant change in PKA and cAMP activities were observed in Ad-shPDE5a-treated hearts. Inhibition with shRNA improved cardiac remodeling and dysfunction by reducing infarction size and cardiac fibrosis and increased cGMP and PKG activity. These findings suggest that PDE5 inhibition with Ad-shPDE5a is a novel approach for treatment of myocardial infarction. PMID:22447941

  5. TRB3 reverses chemotherapy resistance and mediates crosstalk between endoplasmic reticulum stress and AKT signaling pathways in MHCC97H human hepatocellular carcinoma cells.

    Science.gov (United States)

    Li, Yang; Zhu, Danxi; Hou, Lidan; Hu, Bin; Xu, Min; Meng, Xiangjun

    2018-01-01

    Tribbles homolog 3 (TRB3), a type of pseudokinase that contains a consensus serine/threonine kinase catalytic core structure, is upregulated in hepatocellular carcinoma. However, the effect of TRB3 expression in hepatocellular carcinoma and the molecular mechanisms underlying TRB3-mediated effects on tumorigenesis in hepatocellular carcinoma have not been fully elucidated. The present study focused on the effect of TRB3 expression in MHCC97H hepatocellular carcinoma cells and investigated the underlying molecular mechanisms in MHCC97H cells. In the present study, it was revealed that TRB3 was significantly overexpressed in the MHCC97H hepatocellular carcinoma cell compared with L-02 normal hepatic cells. Under endoplasmic reticulum (ER) stress induced by thapsigargin and tunicamycin, the levels of TRB3, CCAAT/enhancer binding protein homologous protein (CHOP), protein kinase B (AKT) and phosphorylated (p)AKT expression were upregulated. Furthermore, when the expression of TRB3 was silenced by short hairpin (sh)RNA, the survival of MHCC97H hepatocellular carcinoma cells was increased. Notably, following transduction with lentiviral containing TRB3-shRNA, cell survival also increased after treatment with chemotherapy drug cisplatin. The present study demonstrated that knockdown of CHOP by shRNA was able to reduce TRB3 expression, and the knockdown of TRB3 markedly increased the level of pAKT. TRB3 was overexpressed in MHCC97H hepatocellular carcinoma cells, particularly under endoplasmic reticulum stress. Knockdown of TRB3 was able to increase cell survival. Therefore, TRB3 expression may induce apoptosis and reverse resistance to chemotherapy in MHCC97H hepatic carcinoma cells. The present study suggests that TRB3 is a key molecule that mediates the crosstalk between ER stress and AKT signal pathways. Furthermore, the present study may provide further insight into the cancer biology of hepatocellular carcinoma and the development of anticancer drugs targeting the ER

  6. Down-regulation of human endogenous retrovirus type K (HERV-K) viral env RNA in pancreatic cancer cells decreases cell proliferation and tumor growth

    Science.gov (United States)

    Li, Ming; Radvanyi, Laszlo; Yin, Bingnan; Li, Jia; Chivukula, Raghavender; Lin, Kevin; Lu, Yue; Shen, JianJun; Chang, David Z.; Li, Donghui; Johanning, Gary L.; Wang-Johanning, Feng

    2017-01-01

    Purpose We investigated the role of the human endogenous retrovirus type K (HERV-K) envelope (env) gene in pancreatic cancer (PC). Experimental Design shRNA was employed to knockdown (KD) the expression of HERV-K in PC cells. Results HERV-K env expression was detected in seven PC cell lines and in 80% of PC patient biopsies, but not in two normal pancreatic cell lines or uninvolved normal tissues. A new HERV-K splice variant was discovered in several PC cell lines. RT activity and virus-like particles were observed in culture media supernatant obtained from Panc-1 and Panc-2 cells. HERV-K viral RNA levels and anti-HERV-K antibody titers were significantly higher in PC patient sera (N=106) than in normal donor sera (N=40). Importantly, the in vitro and in vivo growth rates of three PC cell lines were significantly reduced after HERV-K KD by shRNA targeting HERV-K env, and there was reduced metastasis to lung after treatment. RNA-seq results revealed changes in gene expression after HERV-K env KD, including RAS and TP53. Furthermore, downregulation of HERV-K Env protein expression by shRNA also resulted in decreased expression of RAS, p-ERK, p-RSK, and p-AKT in several PC cells or tumors. Conclusion These results demonstrate that HERV-K influences signal transduction via the RAS-ERK-RSK pathway in PC. Our data highlight the potentially important role of HERV-K in tumorigenesis and progression of PC, and indicate that HERV-K viral proteins may be attractive biomarkers and/or tumor-associated antigens, as well as potentially useful targets for detection, diagnosis and immunotherapy of PC. PMID:28679769

  7. AAV Gene Therapy for Alcoholism: Inhibition of Mitochondrial Aldehyde Dehydrogenase Enzyme Expression in Hepatoma Cells.

    Science.gov (United States)

    Sanchez, Anamaria C; Li, Chengwen; Andrews, Barbara; Asenjo, Juan A; Samulski, R Jude

    2017-09-01

    Most ethanol is broken down in the liver in two steps by alcohol dehydrogenase (ADH) and aldehyde dehydrogenase (ALDH2) enzymes, which metabolize down ethanol into acetaldehyde and then acetate. Some individuals from the Asian population who carry a mutation in the aldehyde dehydrogenase gene (ALDH2*2) cannot metabolize acetaldehyde as efficiently, producing strong effects, including facial flushing, dizziness, hypotension, and palpitations. This results in an aversion to alcohol intake and protection against alcoholism. The large prevalence of this mutation in the human population strongly suggests that modulation of ALDH2 expression by genetic technologies could result in a similar phenotype. scAAV2 vectors encoding ALDH2 small hairpin RNA (shRNA) were utilized to validate this hypothesis by silencing ALDH2 gene expression in human cell lines. Human cell lines HEK-293 and HepG2 were transduced with scAAV2/shRNA, showing a reduction in ALDH2 RNA and protein expression with the two viral concentration assayed (1 × 10 4 and 1 × 10 5 vg/cell) at two different time points. In both cell lines, ALDH2 RNA levels were reduced by 90% and protein expression was inhibited by 90% and 52%, respectively, 5 days post infection. Transduced HepG2 VL17A cells (ADH+) exposed to ethanol resulted in a 50% increase in acetaldehyde levels. These results suggest that gene therapy could be a useful tool for the treatment of alcoholism by knocking down ALDH2 expression using shRNA technology delivered by AAV vectors.

  8. The sodium-bicarbonate cotransporter NBCe2 (slc4a5) expressed in human renal proximal tubules shows increased apical expression under high-salt conditions.

    Science.gov (United States)

    Gildea, John J; Xu, Peng; Carlson, Julia M; Gaglione, Robert T; Bigler Wang, Dora; Kemp, Brandon A; Reyes, Camellia M; McGrath, Helen E; Carey, Robert M; Jose, Pedro A; Felder, Robin A

    2015-12-01

    The electrogenic sodium bicarbonate cotransporter (NBCe2) is encoded by SLC4A5, variants of which have been associated with salt sensitivity of blood pressure, which affects 25% of the adult population. NBCe2 is thought to mediate sodium bicarbonate cotransport primarily in the renal collecting duct, but NBCe2 mRNA is also found in the rodent renal proximal tubule (RPT). The protein expression or function of NBCe2 has not been demonstrated in the human RPT. We validated an NBCe2 antibody by shRNA and Western blot analysis, as well as overexpression of an epitope-tagged NBCe2 construct in both RPT cells (RPTCs) and human embryonic kidney 293 (HEK293) cells. Using this validated NBCe2 antibody, we found NBCe2 protein expression in the RPT of fresh and frozen human kidney slices, RPTCs isolated from human urine, and isolated RPTC apical membrane. Under basal conditions, NBCe2 was primarily found in the Golgi, while NBCe1 was primarily found at the basolateral membrane. Following an acute short-term increase in intracellular sodium, NBCe2 expression was increased at the apical membrane in cultured slices of human kidney and polarized, immortalized RPTCs. Sodium bicarbonate transport was increased by monensin and overexpression of NBCe2, decreased by NBCe2 shRNA, but not by NBCe1 shRNA, and blocked by 2,2'-(1,2-ethenediyl)bis[5-isothiocyanato-benzenesulfonic acid]. NBCe2 could be important in apical sodium and bicarbonate cotransport under high-salt conditions; the implication of the ex vivo studies to the in vivo situation when salt intake is increased remains unclear. Therefore, future studies will examine the role of NBCe2 in mediating increased renal sodium transport in humans whose blood pressures are elevated by an increase in sodium intake. Copyright © 2015 the American Physiological Society.

  9. HPV16 E6 regulates annexin 1 (ANXA1) protein expression in cervical carcinoma cell lines

    Energy Technology Data Exchange (ETDEWEB)

    Calmon, Marilia Freitas [Department of Biology, Institute of Bioscience, Language and Exact Science, São Paulo State University, São Jose do Rio Preto (Brazil); Sichero, Laura [Molecular Biology Laboratory, Centre for Translational Research in Oncology, Instituto do Câncer do Estado de São Paulo (ICESP), São Paulo (Brazil); Boccardo, Enrique [Department of Microbiology, Institute of Biomedical Sciences, University of São Paulo., São Paulo (Brazil); Villa, Luisa Lina [Department of Radiology and Oncology, Faculdade de Medicina, Universidade de São Paulo, São Paulo (Brazil); Rahal, Paula, E-mail: rahalp@yahoo.com.br [Department of Biology, Institute of Bioscience, Language and Exact Science, São Paulo State University, São Jose do Rio Preto (Brazil)

    2016-09-15

    Annexin 1 (ANXA1) is a substrate for E6AP mediated ubiquitylation. It has been hypothesized that HPV 16 E6 protein redirects E6AP away from ANXA1, increasing its stability and possibly contributing to viral pathogenesis. We analyzed ANXA1 expression in HPV-positive and negative cervical carcinoma-derived cells, in cells expressing HPV-16 oncogenes and in cells transduced with shRNA targeting E6AP. We observed that ANXA1 protein expression increased in HPV-16-positive tumor cells, in keratinocytes expressing HPV-16 E6wt (wild-type) or E6/E7 and C33 cells expressing HPV-16 E6wt. ANXA1 protein expression decreased in cells transfected with E6 Dicer-substrate RNAs (DsiRNA) and C33 cells cotransduced with HPV-16 E6wt and E6AP shRNA. Moreover, colony number and proliferation rate decreased in HPV16-positive cells transduced with ANXA1 shRNA. We observed that in cells infected with HPV16, the E6 binds to E6AP to degrade p53 and upregulate ANXA1. We suggest that ANXA1 may play a role in HPV-mediated carcinogenesis. - Highlights: • ANXA1 upregulation requires the presence of E6 and E6AP and is dependent on E6 integrity. • E6 binds to E6AP to degrade p53 and upregulate ANXA1 in cells infected with HPV16. • ANXA1 plays a role in cell proliferation in HPV-positive cervical cells.

  10. M3 receptor is involved in the effect of penehyclidine hydrochloride reduced endothelial injury in LPS-stimulated human pulmonary microvascular endothelial cell.

    Science.gov (United States)

    Yuan, Qinghong; Xiao, Fei; Liu, Qiangsheng; Zheng, Fei; Shen, Shiwen; He, Qianwen; Chen, Kai; Wang, Yanlin; Zhang, Zongze; Zhan, Jia

    2018-02-01

    LPS has been recently shown to induce muscarinic acetylcholine 3 receptor (M 3 receptor) expression and penehyclidine hydrochloride (PHC) is an anticholinergic drug which could block the expression of M 3 receptor. PHC has been demonstrated to perform protective effect on cell injury. This study is to investigate whether the effect of PHC on microvascular endothelial injury is related to its inhibition of M 3 receptor or not. HPMVECs were treated with specific M 3 receptor shRNA or PBS, and randomly divided into LPS group (A group), LPS+PHC group (B group), LPS + M 3 shRNA group (C group) and LPS + PHC + M 3 shRNA group (D group). Cells were collected at 60 min after LPS treatment to measure levels of LDH, endothelial permeability, TNF-α and IL-6 levels, NF-κB p65 activation, I-κB protein expression, p38MAPK, and ERK1/2 activations as well as M 3 mRNA expression. PHC could decrease LDH levels, cell permeability, TNF-α and IL-6 levels, p38 MAPK, ERK1/2, NF-κB p65 activations and M 3 mRNA expressions compared with LPS group. When M 3 receptor was silence, the changes of these indices were much more obvious. These findings suggest that M 3 receptor plays an important role in LPS-induced pulmonary microvascular endothelial injury, which is regulated through NF-κB p65 and MAPK activation. And knockout of M 3 receptor could attenuate LPS-induced pulmonary microvascular endothelial injury. Regulative effects of PHC on pulmonary microvascular permeability and NF-κB p65 as well as MAPK activations are including but not limited to inhibition of M 3 receptor. Copyright © 2017 Elsevier Ltd. All rights reserved.

  11. An Evolutionarily Conserved Role of Presenilin in Neuronal Protection in the Aging Drosophila Brain.

    Science.gov (United States)

    Kang, Jongkyun; Shin, Sarah; Perrimon, Norbert; Shen, Jie

    2017-07-01

    Mutations in the Presenilin genes are the major genetic cause of Alzheimer's disease. Presenilin and Nicastrin are essential components of γ-secretase, a multi-subunit protease that cleaves Type I transmembrane proteins. Genetic studies in mice previously demonstrated that conditional inactivation of Presenilin or Nicastrin in excitatory neurons of the postnatal forebrain results in memory deficits, synaptic impairment, and age-dependent neurodegeneration. The roles of Drosophila Presenilin ( Psn ) and Nicastrin ( Nct ) in the adult fly brain, however, are unknown. To knockdown (KD) Psn or Nct selectively in neurons of the adult brain, we generated multiple shRNA lines. Using a ubiquitous driver, these shRNA lines resulted in 80-90% reduction of mRNA and pupal lethality-a phenotype that is shared with Psn and Nct mutants carrying nonsense mutations. Furthermore, expression of these shRNAs in the wing disc caused notching wing phenotypes, which are also shared with Psn and Nct mutants. Similar to Nct , neuron-specific Psn KD using two independent shRNA lines led to early mortality and rough eye phenotypes, which were rescued by a fly Psn transgene. Interestingly, conditional KD (cKD) of Psn or Nct in adult neurons using the elav-Gal4 and tubulin-Gal80 ts system caused shortened lifespan, climbing defects, increases in apoptosis, and age-dependent neurodegeneration. Together, these findings demonstrate that, similar to their mammalian counterparts, Drosophila Psn and Nct are required for neuronal survival during aging and normal lifespan, highlighting an evolutionarily conserved role of Presenilin in neuronal protection in the aging brain. Copyright © 2017 by the Genetics Society of America.

  12. HPV16 E6 regulates annexin 1 (ANXA1) protein expression in cervical carcinoma cell lines

    International Nuclear Information System (INIS)

    Calmon, Marilia Freitas; Sichero, Laura; Boccardo, Enrique; Villa, Luisa Lina; Rahal, Paula

    2016-01-01

    Annexin 1 (ANXA1) is a substrate for E6AP mediated ubiquitylation. It has been hypothesized that HPV 16 E6 protein redirects E6AP away from ANXA1, increasing its stability and possibly contributing to viral pathogenesis. We analyzed ANXA1 expression in HPV-positive and negative cervical carcinoma-derived cells, in cells expressing HPV-16 oncogenes and in cells transduced with shRNA targeting E6AP. We observed that ANXA1 protein expression increased in HPV-16-positive tumor cells, in keratinocytes expressing HPV-16 E6wt (wild-type) or E6/E7 and C33 cells expressing HPV-16 E6wt. ANXA1 protein expression decreased in cells transfected with E6 Dicer-substrate RNAs (DsiRNA) and C33 cells cotransduced with HPV-16 E6wt and E6AP shRNA. Moreover, colony number and proliferation rate decreased in HPV16-positive cells transduced with ANXA1 shRNA. We observed that in cells infected with HPV16, the E6 binds to E6AP to degrade p53 and upregulate ANXA1. We suggest that ANXA1 may play a role in HPV-mediated carcinogenesis. - Highlights: • ANXA1 upregulation requires the presence of E6 and E6AP and is dependent on E6 integrity. • E6 binds to E6AP to degrade p53 and upregulate ANXA1 in cells infected with HPV16. • ANXA1 plays a role in cell proliferation in HPV-positive cervical cells.

  13. Expression of RNA interference triggers from an oncolytic herpes simplex virus results in specific silencing in tumour cells in vitro and tumours in vivo

    International Nuclear Information System (INIS)

    Anesti, Anna-Maria; Simpson, Guy R; Price, Toby; Pandha, Hardev S; Coffin, Robert S

    2010-01-01

    Delivery of small interfering RNA (siRNA) to tumours remains a major obstacle for the development of RNA interference (RNAi)-based therapeutics. Following the promising pre-clinical and clinical results with the oncolytic herpes simplex virus (HSV) OncoVEX GM-CSF , we aimed to express RNAi triggers from oncolytic HSV, which although has the potential to improve treatment by silencing tumour-related genes, was not considered possible due to the highly oncolytic properties of HSV. To evaluate RNAi-mediated silencing from an oncolytic HSV backbone, we developed novel replicating HSV vectors expressing short-hairpin RNA (shRNA) or artificial microRNA (miRNA) against the reporter genes green fluorescent protein (eGFP) and β-galactosidase (lacZ). These vectors were tested in non-tumour cell lines in vitro and tumour cells that are moderately susceptible to HSV infection both in vitro and in mice xenografts in vivo. Silencing was assessed at the protein level by fluorescent microscopy, x-gal staining, enzyme activity assay, and western blotting. Our results demonstrate that it is possible to express shRNA and artificial miRNA from an oncolytic HSV backbone, which had not been previously investigated. Furthermore, oncolytic HSV-mediated delivery of RNAi triggers resulted in effective and specific silencing of targeted genes in tumour cells in vitro and tumours in vivo, with the viruses expressing artificial miRNA being comprehensibly more effective. This preliminary data provide the first demonstration of oncolytic HSV-mediated expression of shRNA or artificial miRNA and silencing of targeted genes in tumour cells in vitro and in vivo. The vectors developed in this study are being adapted to silence tumour-related genes in an ongoing study that aims to improve the effectiveness of oncolytic HSV treatment in tumours that are moderately susceptible to HSV infection and thus, potentially improve response rates seen in human clinical trials

  14. SLUG promotes prostate cancer cell migration and invasion via CXCR4/CXCL12 axis.

    Science.gov (United States)

    Uygur, Berna; Wu, Wen-Shu

    2011-11-10

    SLUG is a zinc-finger transcription factor of the Snail/Slug zinc-finger family that plays a role in migration and invasion of tumor cells. Mechanisms by which SLUG promotes migration and invasion in prostate cancers remain elusive. Expression level of CXCR4 and CXCL12 was examined by Western blot, RT-PCR, and qPCR analyses. Forced expression of SLUG was mediated by retroviruses, and SLUG and CXCL12 was downregulated by shRNAs-expressing lentiviruses. Migration and invasion of prostate cancer were measured by scratch-wound assay and invasion assay, respectively. We demonstrated that forced expression of SLUG elevated CXCR4 and CXCL12 expression in human prostate cancer cell lines PC3, DU145, 22RV1, and LNCaP; conversely, reduced expression of SLUG by shRNA downregulated CXCR4 and CXCL12 expression at RNA and protein levels in prostate cancer cells. Furthermore, ectopic expression of SLUG increased MMP9 expression and activity in PC3, 22RV1, and DU-145 cells, and SLUG knockdown by shRNA downregulated MMP9 expression. We showed that CXCL12 is required for SLUG-mediated MMP9 expression in prostate cancer cells. Moreover, we found that migration and invasion of prostate cancer cells was increased by ectopic expression of SLUG and decreased by SLUG knockdown. Notably, knockdown of CXCL12 by shRNA impaired SLUG-mediated migration and invasion in prostate cancer cells. Lastly, our data suggest that CXCL12 and SLUG regulate migration and invasion of prostate cancer cells independent of cell growth. We provide the first compelling evidence that upregulation of autocrine CXCL12 is a major mechanism underlying SLUG-mediated migration and invasion of prostate cancer cells. Our findings suggest that CXCL12 is a therapeutic target for prostate cancer metastasis.

  15. Conserved features of cancer cells define their sensitivity to HAMLET-induced death; c-Myc and glycolysis.

    Science.gov (United States)

    Storm, P; Aits, S; Puthia, M K; Urbano, A; Northen, T; Powers, S; Bowen, B; Chao, Y; Reindl, W; Lee, D Y; Sullivan, N L; Zhang, J; Trulsson, M; Yang, H; Watson, J D; Svanborg, C

    2011-12-01

    HAMLET is the first member of a new family of tumoricidal protein-lipid complexes that kill cancer cells broadly, while sparing healthy, differentiated cells. Many and diverse tumor cell types are sensitive to the lethal effect, suggesting that HAMLET identifies and activates conserved death pathways in cancer cells. Here, we investigated the molecular basis for the difference in sensitivity between cancer cells and healthy cells. Using a combination of small-hairpin RNA (shRNA) inhibition, proteomic and metabolomic technology, we identified the c-Myc oncogene as one essential determinant of HAMLET sensitivity. Increased c-Myc expression levels promoted sensitivity to HAMLET and shRNA knockdown of c-Myc suppressed the lethal response, suggesting that oncogenic transformation with c-Myc creates a HAMLET-sensitive phenotype. Furthermore, HAMLET sensitivity was modified by the glycolytic state of tumor cells. Glucose deprivation sensitized tumor cells to HAMLET-induced cell death and in the shRNA screen, hexokinase 1 (HK1), 6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 1 and hypoxia-inducible factor 1α modified HAMLET sensitivity. HK1 was shown to bind HAMLET in a protein array containing ∼8000 targets, and HK activity decreased within 15 min of HAMLET treatment, before morphological signs of tumor cell death. In parallel, HAMLET triggered rapid metabolic paralysis in carcinoma cells. Tumor cells were also shown to contain large amounts of oleic acid and its derivatives already after 15 min. The results identify HAMLET as a novel anti-cancer agent that kills tumor cells by exploiting unifying features of cancer cells such as oncogene addiction or the Warburg effect.

  16. Identification of short hairpin RNA targeting foot-and-mouth disease virus with transgenic bovine fetal epithelium cells.

    Directory of Open Access Journals (Sweden)

    Hongmei Wang

    Full Text Available BACKGROUND: Although it is known that RNA interference (RNAi targeting viral genes protects experimental animals, such as mice, from the challenge of Foot-and-mouth disease virus (FMDV, it has not been previously investigated whether shRNAs targeting FMDV in transgenic dairy cattle or primary transgenic bovine epithelium cells will confer resistance against FMDV challenge. PRINCIPAL FINDING: Here we constructed three recombinant lentiviral vectors containing shRNA against VP2 (RNAi-VP2, VP3 (RNAi-VP3, or VP4 (RNAi-VP4 of FMDV, and found that all of them strongly suppressed the transient expression of a FLAG-tagged viral gene fusion protein in 293T cells. In BHK-21 cells, RNAi-VP4 was found to be more potent in inhibition of viral replication than the others with over 98% inhibition of viral replication. Therefore, recombinant lentiviral vector RNAi-VP4 was transfected into bovine fetal fibroblast cells to generate transgenic nuclear donor cells. With subsequent somatic cell cloning, we generated forty transgenic blastocysts, and then transferred them to 20 synchronized recipient cows. Three transgenic bovine fetuses were obtained after pregnant period of 4 months, and integration into chromosome in cloned fetuses was confirmed by Southern hybridization. The primary tongue epithelium cells of transgenic fetuses were isolated and inoculated with 100 TCID(50 of FMDV, and it was observed that shRNA significantly suppressed viral RNA synthesis and inhibited over 91% of viral replication after inoculation of FMDV for 48 h. CONCLUSION: RNAi-VP4 targeting viral VP4 gene appears to prevent primary epithelium cells of transgenic bovine fetus from FMDV infection, and it could be a candidate shRNA used for cultivation of transgenic cattle against FMDV.

  17. Silencing Nrf2 impairs glioma cell proliferation via AMPK-activated mTOR inhibition

    Energy Technology Data Exchange (ETDEWEB)

    Jia, Yue [Department of Neurosurgery, Jinling Hospital, School of Medicine, Nanjing University, 305 East Zhongshan Road, Nanjing 210002, Jiangsu Province (China); Wang, Handong, E-mail: njhdwang@hotmail.com [Department of Neurosurgery, Jinling Hospital, School of Medicine, Nanjing University, 305 East Zhongshan Road, Nanjing 210002, Jiangsu Province (China); Wang, Qiang [Department of Neurosurgery, Jinling Hospital, School of Medicine, Nanjing University, 305 East Zhongshan Road, Nanjing 210002, Jiangsu Province (China); Ding, Hui [Department of Neurosurgery, Jinling Hospital, School of Medicine, Southern Medical University (Guangzhou), 305 East Zhongshan Road, Nanjing 210002, Jiangsu Province (China); Wu, Heming [Department of Neurosurgery, Nanjing Jingdu Hospital, No. 34, Biao 34, Yanggongjing Road, Nanjing 210002, Jiangsu Province (China); Pan, Hao [Department of Neurosurgery, Jinling Hospital, School of Medicine, Nanjing University, 305 East Zhongshan Road, Nanjing 210002, Jiangsu Province (China)

    2016-01-15

    Gliomas are the leading cause of death among adults with primary brain malignancies. Treatment for malignant gliomas remains limited, and targeted therapies have been incompletely explored. Nuclear factor erythroid 2-related factor 2 (Nrf2), a key transcription regulator for antioxidant and detoxification enzymes, is abundantly expressed in cancer cells. In this study, the role and mechanism of Nrf2 in cancer cell proliferation was investigated in multiple glioma cell lines. We first evaluated the expression patterns of Nrf2 in four glioma cell lines and found all four cell lines expressed Nrf2, but the highest level was observed in U251 cells. We further evaluated the biological functions of Nrf2 in U251 glioma cell proliferation by specific inhibition of Nrf2 using short hairpin RNA (shRNA). We found that Nrf2 depletion inhibited glioma cell proliferation. Nrf2 depletion also decreased colony formation in U251 cells stably expressing Nrf2 shRNA compared to scrambled control shRNA. Moreover, suppression of Nrf2 expression could lead to ATP depletion (with concomitant rise in AMP/ATP ratio) and consequently to AMPK-activated mTOR inhibition. Finally, activation of adenosine monophosphate–activated protein kinase (AMPK) by treated with phenformin, an AMPK agonist, can mimic the inhibitory effect of Nrf2 knockdown in U251 cells. In conclusion, our findings will shed light to the role and mechanism of Nrf2 in regulating glioma proliferation via ATP-depletion-induced AMPK activation and consequent mTOR inhibition, a novel insight into our understanding the role and mechanism of Nrf2 in glioma pathoetiology. To our knowledge, this is also the first report to provide a rationale for the implication of cross-linking between Nrf2 and mTOR signaling.

  18. [Construction of recombinant lentiviral vector of Tie2-RNAi and its influence on malignant melanoma cells in vitro].

    Science.gov (United States)

    Shan, Xiu-ying; Liu, Zhao-liang; Wang, Biao; Guo, Guo-xiang; Wang, Mei-shui; Zhuang, Fu-lian; Cai, Chuan-shu; Zhang, Ming-feng; Zhang, Yan-ding

    2011-07-01

    To construct lentivector carrying Tie2-Small interfering RNA (SiRNA), so as to study its influence on malignant melanoma cells. Recombinant plasmid pSilencer 1.0-U6-Tie2-siRNA and plasmid pNL-EGFP were digested with XbaI, ligated a target lentiviral transfer plasmid of pNL-EGFP-U6-Tie2-I or pNL-EGFP-U6-Tie2-II, and then the electrophoresis clones was sequenced. Plasmids of pNL-EGFP-U6-Tie2-I and pNL-EGFP-U6-Tie2-II were constructed and combined with pVSVG and pHelper, respectively, to constitute lentiviral vector system of three plasmids. The Lentiviral vector system was transfected into 293T cell to produce pNL-EGFP-U6-Tie2- I and pNL-EGFP-U6-Tie2-II lentivirus. Then the supernatant was collected to determine the titer. Malignant melanoma cells were infected by both lentiviruses and identified by Realtime RT-PCR to assess inhibitory efficiency. The recombinant lentiviral vectors of Tie2-RNAi were constructed successfully which were analyzed with restriction enzyme digestion and identified by sequencing. And the titer of lentiviral vector was 8.8 x 10(3)/ml, which was determined by 293T cell. The results of Realtime RT-PCR demonstrated that the lentiviral vectors of Tie2-RNAi could infect malignant melanoma cells and inhibit the expression of Tie2 genes in malignant melanoma cells (P0.05) between the two lentiviral vectors of Tie2-RNAi. Lentivector carrying Tie2-SiRNA can be constructed successfully and inhibit the expression of Tie2 gene in vitro significantly. The study will supply the theory basis for the further research on the inhibition of tumor growth in vivo.

  19. Equation of state, phase stability, and phase transformations of uranium-6 wt. % niobium under high pressure and temperature

    Science.gov (United States)

    Zhang, Jianzhong; Vogel, Sven; Brown, Donald; Clausen, Bjorn; Hackenberg, Robert

    2018-05-01

    In-situ time-of-flight neutron diffraction experiments were conducted on the uranium-niobium alloy with 6 wt. % Nb (U-6Nb) at pressures up to 4.7 GPa and temperatures up to 1073 K. Upon static compression at room temperature, the monoclinic structure of U-6Nb (α″ U-6Nb) remains stable up to the highest experimental pressure. Based on the pressure-volume measurements at room temperature, the least-squares fit using the finite-strain equation of state (EOS) yields an isothermal bulk modulus of B0 = 127 ± 2 GPa for the α″-phase of U-6Nb. The calculated zero-pressure bulk sound speed from this EOS is 2.706 ± 0.022 km/s, which is in good agreement with the linear extrapolation of the previous Hugoniot data above 12 GPa for α″ U-6Nb, indicating that the dynamic response under those shock-loading conditions is consistent with the stabilization of the initial monoclinic phase of U-6Nb. Upon heating at ambient and high pressures, the metastable α″ U-6Nb exhibits complex transformation paths leading to the diffusional phase decomposition, which are sensitive to applied pressure, stress state, and temperature-time path. These findings provide new insight into the behavior of atypical systems such as U-Nb and suggest that the different U-Nb phases are separated by rather small energies and hence highly sensitive to compositional, thermal, and mechanical perturbations.

  20. Targeting Sulfotransferase (SULT) 2B1b as a Regulator of Cholesterol Metabolism in Prostate Cancer

    Science.gov (United States)

    2015-10-01

    next  subtask.       Subtask 2: Production of infective Lentivirus using co-transfection of HEK293 (pCa cells LNCaP, PC3, DU145, and VCaP...PCa lines. We determined that the level of shRNA expression from a stably intergrated transgene gene delivered by lentivirus was too low...effects  on  SULT2B1b  enzyme  activity  of   cholesterol  sulfate   production  in  vitro.     We  developed  a

  1. Defects in Histone H3.3 Phosphorylation and ATRX Recruitment to Misaligned Chromosomes during Mitosis Contribute to the Development of Pediatric Glioblastomas

    Science.gov (United States)

    2015-09-01

    aneuploidy. 2. Keywords: aneuploidy, ATRX, cell cycle, chromosome missegregation, CRISPR /Cas9, DAXX, glioblastoma, histone H3.3, microinjection, mitosis...histone H3.3 with mutant constructs. We have switched from shRNA hairpins to CRISPR /Cas9 gene editing to silence both alleles of H3.3 (and an H3.3...plasmids against H3F3B. Both plasmids had the Cas9 gene and a soluble GFP reporter. The CRISPR guide sequence in one of these plasmids was 100% match

  2. The Role of MMP-1 in Breast Cancer Growth and Metastasis to the Brain in a Xenograft Model

    Science.gov (United States)

    2012-12-07

    particles (with puromycin as selection marker) (Thermo Scientific Co) targeting the following sequences: sh1: GAGTACAACTTACATCGTG; sh2 ...data not shown). shRNA lentiviruses targeting sh1 and sh2 sequences were used to infected 231-BR and 231-BR3 cells. Two pools of selected 231-BR cells...lentiviruses targeting sh1 and sh2 sequences were named sh1 and sh2 respectively. RNA-isolation and real-time RT-PCR Total RNAs from different cell lines and

  3. RNAi Screening in Spodoptera frugiperda.

    Science.gov (United States)

    Ghosh, Subhanita; Singh, Gatikrushna; Sachdev, Bindiya; Kumar, Ajit; Malhotra, Pawan; Mukherjee, Sunil K; Bhatnagar, Raj K

    2016-01-01

    RNA interference is a potent and precise reverse genetic approach to carryout large-scale functional genomic studies in a given organism. During the past decade, RNAi has also emerged as an important investigative tool to understand the process of viral pathogenesis. Our laboratory has successfully generated transgenic reporter and RNAi sensor line of Spodoptera frugiperda (Sf21) cells and developed a reversal of silencing assay via siRNA or shRNA guided screening to investigate RNAi factors or viral pathogenic factors with extraordinary fidelity. Here we describe empirical approaches and conceptual understanding to execute successful RNAi screening in Spodoptera frugiperda 21-cell line.

  4. Bone Morphogenic Protein 4-Smad-Induced Upregulation of Platelet-Derived Growth Factor AA Impairs Endothelial Function.

    Science.gov (United States)

    Hu, Weining; Zhang, Yang; Wang, Li; Lau, Chi Wai; Xu, Jian; Luo, Jiang-Yun; Gou, Lingshan; Yao, Xiaoqiang; Chen, Zhen-Yu; Ma, Ronald Ching Wan; Tian, Xiao Yu; Huang, Yu

    2016-03-01

    Bone morphogenic protein 4 (BMP4) is an important mediator of endothelial dysfunction in cardio-metabolic diseases, whereas platelet-derived growth factors (PDGFs) are major angiogenic and proinflammatory mediator, although the functional link between these 2 factors is unknown. The present study investigated whether PDGF mediates BMP4-induced endothelial dysfunction in diabetes mellitus. We generated Ad-Bmp4 to overexpress Bmp4 and Ad-Pdgfa-shRNA to knockdown Pdgfa in mice through tail intravenous injection. SMAD4-shRNA lentivirus, SMAD1-shRNA, and SMAD5 shRNA adenovirus were used for knockdown in human and mouse endothelial cells. We found that PDGF-AA impaired endothelium-dependent vasodilation in aortas and mesenteric resistance arteries. BMP4 upregulated PDGF-AA in human and mouse endothelial cells, which was abolished by BMP4 antagonist noggin or knockdown of SMAD1/5 or SMAD4. BMP4-impared relaxation in mouse aorta was also ameliorated by PDGF-AA neutralizing antibody. Tail injection of Ad-Pdgfa-shRNA ameliorates endothelial dysfunction induced by Bmp4 overexpression (Ad-Bmp4) in vivo. Serum PDGF-AA was elevated in both diabetic patients and diabetic db/db mice compared with nondiabetic controls. Pdgfa-shRNA or Bmp4-shRNA adenovirus reduced serum PDGF-AA concentration in db/db mice. PDGF-AA neutralizing antibody or tail injection with Pdgfa-shRNA adenovirus improved endothelial function in aortas and mesenteric resistance arteries from db/db mice. The effect of PDGF-AA on endothelial function in mouse aorta was also inhibited by Ad-Pdgfra-shRNA to inhibit PDGFRα. The present study provides novel evidences to show that PDGF-AA impairs endothelium-dependent vasodilation and PDGF-AA mediates BMP4-induced adverse effect on endothelial cell function through SMAD1/5- and SMAD4-dependent mechanisms. Inhibition of PGDF-AA ameliorates vascular dysfunction in diabetic mice. © 2016 American Heart Association, Inc.

  5. Generation of induced pluripotent stem cells from peripheral blood CD34+ hematopoietic progenitors of a 31 year old healthy woman

    Directory of Open Access Journals (Sweden)

    Amornrat Tangprasittipap

    2017-04-01

    Full Text Available The MUi019-A human induced pluripotent stem cell line was generated from peripheral blood CD34+ hematopoietic progenitors of a healthy woman using a non-integrative reprogramming method. Episomal vectors carrying reprogramming factors OCT4, SOX2, KLF4, L-MYC, LIN28, and shRNA of TP53 and EBNA-1 were delivered using electroporation. The iPSC line can be used as a control in studying disease mechanisms. Furthermore, gene editing approaches can be used to introduce specific mutations into the MUi019-A to model disease while the cell type affected by the disease is inaccessible.

  6. Knock-down of ABCE1 gene induces G1/S arrest in human oral cancer cells

    OpenAIRE

    Wang, Lei; Zhang, Mei; Liu, Dong-Xu

    2014-01-01

    Purpose: This study aims to explore the clinical characteristics of ATP binding cassette E1 (ABCE1) in oral squamous cell carcinomas (OSCC) and its roles in the proliferation, invasiveness, migration and apoptosis of the human oral squamous cell carcinoma cells CAL-27. Methods: The expression of ABCE1 and its target protein-RNase L, were first studied in tumor tissues of OSCC and adjacent non-tumor tissues. Moreover, CAL-27cells were transfected by ABCE1-specific shRNA, then MTT assay, the tr...

  7. Identification of Cytoplasmic Proteins Interacting with the Mammary Cell Transforming Domain of Ese-1

    Science.gov (United States)

    2009-04-01

    measure auto - fluorescence , cells were incubated overnight at 4°C with blocking buffer alone. shRNA tranfected cells under- went the same procedure at 48...to a 50-GGA(A/T)-30 DNA coremotif [2]. All ETS proteins, with the exception of GA-binding protein (GABP)a, bind to DNA as a monomer and are auto ...skin, retina and other epithelia [7-10]. During mouse embryo develop- ment, Elf3 mRNA expression levels increase progressively, from embryonic day 7 to

  8. Annexin A9 (ANXA9) biomarker and therapeutic target in epithelial cancer

    Science.gov (United States)

    Hu, Zhi [El Cerrito, CA; Kuo, Wen-Lin [San Ramon, CA; Neve, Richard M [San Mateo, CA; Gray, Joe W [San Francisco, CA

    2012-06-12

    Amplification of the ANXA9 gene in human chromosomal region 1q21 in epithelial cancers indicates a likelihood of both in vivo drug resistance and metastasis, and serves as a biomarker indicating these aspects of the disease. ANXA9 can also serve as a therapeutic target. Interfering RNAs (iRNAs) (such as siRNA and miRNA) and shRNA adapted to inhibit ANXA9 expression, when formulated in a therapeutic composition, and delivered to cells of the tumor, function to treat the epithelial cancer.

  9. Copy-number and gene dependency analysis reveals partial copy loss of wild-type SF3B1 as a novel cancer vulnerability. | Office of Cancer Genomics

    Science.gov (United States)

    Genomic instability is a hallmark of human cancer, and results in widespread somatic copy number alterations. We used a genome-scale shRNA viability screen in human cancer cell lines to systematically identify genes that are essential in the context of particular copy-number alterations (copy-number associated gene dependencies). The most enriched class of copy-number associated gene dependencies was CYCLOPS (Copy-number alterations Yielding Cancer Liabilities Owing to Partial losS) genes, and spliceosome components were the most prevalent.

  10. Preclinical Validation of Novel Fluorescently Labeled Compounds to Treat Neurodegenerative Hearing Loss

    Science.gov (United States)

    2016-10-01

    dance at sporting events and concerts, and the aging of a populous generation place 1.1 billion more at risk (Daniel, 2007; Wallhagen et al., 1997...cochlea [Fig. 6(A)]. VOT-33 cells were transfected with Hnf4a shRNA to knock down HNF4a expression and observe the effects of HNF4a deficiency on cell...and cell viability due to Hnf4a knock - down, suggesting that HNF4a may play a role in cochlear neuroblast survival. DISCUSSION We report the first

  11. Study of RNA interference inhibiting rat ovarian androgen biosynthesis by depressing 17alpha-hydroxylase/17, 20-lyase activity in vivo

    Directory of Open Access Journals (Sweden)

    Yang Xing

    2009-07-01

    Full Text Available Abstract Background 17alpha-hydroxylase/17, 20-lyase encoded by CYP17 is the key enzyme in androgen biosynthesis pathway. Previous studies demonstrated the accentuation of the enzyme in patients with polycystic ovary syndrome (PCOS was the most important mechanism of androgen excess. We chose CYP17 as the therapeutic target, trying to suppress the activity of 17alpha-hydroxylase/17, 20-lyase and inhibit androgen biosynthesis by silencing the expression of CYP17 in the rat ovary. Methods Three CYP17-targeting and one negative control oligonucleotides were designed and used in the present study. The silence efficiency of lentivirus shRNA was assessed by qRT-PCR, Western blotting and hormone assay. After subcapsular injection of lentivirus shRNA in rat ovary, the delivery efficiency was evaluated by GFP fluorescence and qPCR. Total RNA was extracted from rat ovary for CYP17 mRNA determination and rat serum was collected for hormone measurement. Results In total, three CYP17-targeting lentivirus shRNAs were synthesized. The results showed that all of them had a silencing effect on CYP17 mRNA and protein. Moreover, androstenedione secreted by rat theca interstitial cells (TIC in the RNAi group declined significantly compared with that in the control group. Two weeks after rat ovarian subcapsular injection of chosen CYP17 shRNA, the GFP fluorescence of frozen ovarian sections could be seen clearly under fluorescence microscope. It also showed that the GFP DNA level increased significantly, and its relative expression level was 7.42 times higher than that in the control group. Simultaneously, shRNA treatment significantly decreased CYP17 mRNA and protein levels at 61% and 54%, respectively. Hormone assay showed that all the levels of androstenedione, 17-hydroxyprogesterone and testosterone declined to a certain degree, but progesterone levels declined significantly. Conclusion The present study proves for the first time that ovarian androgen

  12. TNF-α receptor 1 knockdown in the subfornical organ ameliorates sympathetic excitation and cardiac hemodynamics in heart failure rats.

    Science.gov (United States)

    Yu, Yang; Wei, Shun-Guang; Weiss, Robert M; Felder, Robert B

    2017-10-01

    In systolic heart failure (HF), circulating proinflammatory cytokines upregulate inflammation and renin-angiotensin system (RAS) activity in cardiovascular regions of the brain, contributing to sympathetic excitation and cardiac dysfunction. Important among these is the subfornical organ (SFO), a forebrain circumventricular organ that lacks an effective blood-brain barrier and senses circulating humors. We hypothesized that the tumor necrosis factor-α (TNF-α) receptor 1 (TNFR1) in the SFO contributes to sympathetic excitation and cardiac dysfunction in HF rats. Rats received SFO microinjections of a TNFR1 shRNA or a scrambled shRNA lentiviral vector carrying green fluorescent protein, or vehicle. One week later, some rats were euthanized to confirm the accuracy of the SFO microinjections and the transfection potential of the lentiviral vector. Other rats underwent coronary artery ligation (CL) to induce HF or a sham operation. Four weeks after CL, vehicle- and scrambled shRNA-treated HF rats had significant increases in TNFR1 mRNA and protein, NF-κB activity, and mRNA for inflammatory mediators, RAS components and c-Fos protein in the SFO and downstream in the hypothalamic paraventricular nucleus, along with increased plasma norepinephrine levels and impaired cardiac function, compared with vehicle-treated sham-operated rats. In HF rats treated with TNFR1 shRNA, TNFR1 was reduced in the SFO but not paraventricular nucleus, and the central and peripheral manifestations of HF were ameliorated. In sham-operated rats treated with TNFR1 shRNA, TNFR1 expression was also reduced in the SFO but there were no other effects. These results suggest a key role for TNFR1 in the SFO in the pathophysiology of systolic HF. NEW & NOTEWORTHY Activation of TNF-α receptor 1 in the subfornical organ (SFO) contributes to sympathetic excitation in heart failure rats by increasing inflammation and renin-angiotensin system activity in the SFO and downstream in the hypothalamic

  13. A solution to the rho-π puzzle: Spontaneously broken symmetries of the quark model

    International Nuclear Information System (INIS)

    Caldi, D.G.; Pagels, H.

    1976-01-01

    This article proposes a solution to the long-standing rho-π puzzle: How can the rho and π be members of a quark model U(6) 36 and the π be a Nambu-Goldstone boson satisfying partial conservation of the axial-vector current (PCAC) Our solution to the puzzle requires a revision of conventional concepts regarding the vector mesons rho, ω, K*, and phi. Just as the π is a Goldstone state, a collective excitation of the Nambu--Jona-Lasinio type, transforming as a member of the (3, 3) + (3, 3) representation of the chiral SU(3) x SU(3) group, so also the rho transforms like (3, 3) + (3, 3) and is also a collective state, a ''dormant'' Goldstone boson that is a true Goldstone boson in the static chiral U(6) x U(6) limit. The static chiral U(6) x U(6) is to be spontaneously broken to static U(6) in the vacuum. Relativisitc effects provide for U(6) breaking and a massive rho. This viewpoint has many consequences. Vector-meson dominance is a consequence of spontaneously broken chiral symmetry: the mechanism that couples the axial-vector current to the π couples the vector current to the rho. The transition rate is calculated as γ/sub rho/ -1 = f/sub pi//m/sub rho/ in rough agreement with experiment. This picture requires soft rho's to decouple. The chiral partner of the rho is not the A 1 but the B (1235). The experimental absence of the A 1 is no longer a theoretical embarrassment in this scheme. As the analog of PCAC for the pion we establish a tensor-field identity for the rho meson in which the rho is interpreted as a dormant Goldstone state. The decays delta → eta + π, B → ω + π, epsilon → 2π are estimated and are found to be in agreement with the observed rates. A static U(6) x U(6) generalization of the Σ model is presented with the π, rho, sigma, B in the (6, 6) + (6, 6) representation. The rho emerges as a dormant Goldstone boson in this model

  14. Preparation of U-Si/U-Me (Me = Fe, Ni, Mn) aluminum-dispersion plate-type fuel (miniplates) for capsule irradiation

    International Nuclear Information System (INIS)

    Ugajin, Mitsuhiro; Itoh, Akinori; Akabori, Mitsuo

    1993-06-01

    Details of equipment installed, method adopted and final products were described on the preparation of uranium silicides and other fuels for capsule irradiation. Main emphasis was placed on the preparation of laboratory-scale aluminum-dispersion plate-type fuel (miniplates) loaded to the first and second JMTR silicide capsules. Fuels contained in the capsules are as follows: (A) uranium-silicide base alloys U 3 Si 2 , Mo- added U 3 Si 2 , U 3 Si 2 +U 3 Si, U 3 Si 2 +USi, U 3 Si, U 3 (Si 0.8 Ge 0.2 ), U 3 (Si 0.6 Ge 0.4 ) (B) U 6 Me-type alloys with higher uranium density U 6 Mn, U 6 Ni, U 6 (Fe 0.4 Ni 0.6 ), U 6 (Fe 0.6 Mn 0.4 ) The powder-metallurgical picture-frame method was adopted and laboratory-scale technique was established for the preparation of miniplates. As a result of inspection for capsule irradiation, miniplates were prepared to meet the requirements of specification. (author)

  15. Expression profile of CREB knockdown in myeloid leukemia cells

    International Nuclear Information System (INIS)

    Pellegrini, Matteo; Cheng, Jerry C; Voutila, Jon; Judelson, Dejah; Taylor, Julie; Nelson, Stanley F; Sakamoto, Kathleen M

    2008-01-01

    The cAMP Response Element Binding Protein, CREB, is a transcription factor that regulates cell proliferation, differentiation, and survival in several model systems, including neuronal and hematopoietic cells. We demonstrated that CREB is overexpressed in acute myeloid and leukemia cells compared to normal hematopoietic stem cells. CREB knockdown inhibits leukemic cell proliferation in vitro and in vivo, but does not affect long-term hematopoietic reconstitution. To understand downstream pathways regulating CREB, we performed expression profiling with RNA from the K562 myeloid leukemia cell line transduced with CREB shRNA. By combining our expression data from CREB knockdown cells with prior ChIP data on CREB binding we were able to identify a list of putative CREB regulated genes. We performed extensive analyses on the top genes in this list as high confidence CREB targets. We found that this list is enriched for genes involved in cancer, and unexpectedly, highly enriched for histone genes. Furthermore, histone genes regulated by CREB were more likely to be specifically expressed in hematopoietic lineages. Decreased expression of specific histone genes was validated in K562, TF-1, and primary AML cells transduced with CREB shRNA. We have identified a high confidence list of CREB targets in K562 cells. These genes allow us to begin to understand the mechanisms by which CREB contributes to acute leukemia. We speculate that regulation of histone genes may play an important role by possibly altering the regulation of DNA replication during the cell cycle

  16. Increased cFLIP expression in thymic epithelial tumors blocks autophagy via NF-κB signalling.

    Science.gov (United States)

    Belharazem, Djeda; Grass, Albert; Paul, Cornelia; Vitacolonna, Mario; Schalke, Berthold; Rieker, Ralf J; Körner, Daniel; Jungebluth, Philipp; Simon-Keller, Katja; Hohenberger, Peter; Roessner, Eric M; Wiebe, Karsten; Gräter, Thomas; Kyriss, Thomas; Ott, German; Geserick, Peter; Leverkus, Martin; Ströbel, Philipp; Marx, Alexander

    2017-10-27

    The anti-apoptotic cellular FLICE-like inhibitory protein cFLIP plays a pivotal role in normal tissues homoeostasis and the development of many tumors, but its role in normal thymus (NT), thymomas and thymic carcinomas (TC) is largely unknown. Expression, regulation and function of cFLIP were analyzed in biopsies of NT, thymomas, thymic squamous cell carcinomas (TSCC), thymic epithelial cells (TECs) derived thereof and in the TC line 1889c by qRT-PCR, western blot, shRNA techniques, and functional assays addressing survival, senescence and autophagy. More than 90% of thymomas and TSCCs showed increased cFLIP expression compared to NT. cFLIP expression declined with age in NTs but not in thymomas. During short term culture cFLIP expression levels declined significantly slower in neoplastic than non-neoplastic primary TECs. Down-regulation of cFLIP by shRNA or NF-κB inhibition accelerated senescence and induced autophagy and cell death in neoplastic TECs. The results suggest a role of cFLIP in the involution of normal thymus and the development of thymomas and TSCC. Since increased expression of cFLIP is a known tumor escape mechanism, it may serve as tissue-based biomarker in future clinical trials, including immune checkpoint inhibitor trials in the commonly PD-L1 high thymomas and TCs.

  17. GDNF facilitates differentiation of the adult dentate gyrus-derived neural precursor cells into astrocytes via STAT3

    Energy Technology Data Exchange (ETDEWEB)

    Boku, Shuken, E-mail: shuboku@med.hokudai.ac.jp [Department of Psychiatry, Hokkaido University Graduate School of Medicine, Sapporo (Japan); Nakagawa, Shin [Department of Psychiatry, Hokkaido University Graduate School of Medicine, Sapporo (Japan); Takamura, Naoki [Pharmaceutical Laboratories, Dainippon Sumitomo Pharma Co. Ltd., Osaka (Japan); Kato, Akiko [Department of Psychiatry, Hokkaido University Graduate School of Medicine, Sapporo (Japan); Takebayashi, Minoru [Department of Psychiatry, National Hospital Organization Kure Medical Center, Kure (Japan); Hisaoka-Nakashima, Kazue [Department of Pharmacology, Hiroshima University Graduate School of Biomedical Sciences, Hiroshima (Japan); Omiya, Yuki; Inoue, Takeshi; Kusumi, Ichiro [Department of Psychiatry, Hokkaido University Graduate School of Medicine, Sapporo (Japan)

    2013-05-17

    Highlights: •GDNF has no effect on ADP proliferation and apoptosis. •GDNF increases ADP differentiation into astrocyte. •A specific inhibitor of STAT3 decreases the astrogliogenic effect of GDNF. •STAT3 knockdown by lentiviral shRNA vector also decreases the astrogliogenic effect of GDNF. •GDNF increases the phosphorylation of STAT3. -- Abstract: While the pro-neurogenic actions of antidepressants in the adult hippocampal dentate gyrus (DG) are thought to be one of the mechanisms through which antidepressants exert their therapeutic actions, antidepressants do not increase proliferation of neural precursor cells derived from the adult DG. Because previous studies showed that antidepressants increase the expression and secretion of glial cell line-derived neurotrophic factor (GDNF) in C6 glioma cells derived from rat astrocytes and GDNF increases neurogenesis in adult DG in vivo, we investigated the effects of GDNF on the proliferation, differentiation and apoptosis of cultured neural precursor cells derived from the adult DG. Data showed that GDNF facilitated the differentiation of neural precursor cells into astrocytes but had no effect on their proliferation or apoptosis. Moreover, GDNF increased the phosphorylation of STAT3, and both a specific inhibitor of STAT3 and lentiviral shRNA for STAT3 decreased their differentiation into astrocytes. Taken together, our findings suggest that GDNF facilitates astrogliogenesis from neural precursor cells in adult DG through activating STAT3 and that this action might indirectly affect neurogenesis.

  18. Inhibition of GLO1 in Glioblastoma Multiforme Increases DNA-AGEs, Stimulates RAGE Expression, and Inhibits Brain Tumor Growth in Orthotopic Mouse Models

    Directory of Open Access Journals (Sweden)

    Rahul Jandial

    2018-01-01

    Full Text Available Cancers that exhibit the Warburg effect may elevate expression of glyoxylase 1 (GLO1 to detoxify the toxic glycolytic byproduct methylglyoxal (MG and inhibit the formation of pro-apoptotic advanced glycation endproducts (AGEs. Inhibition of GLO1 in cancers that up-regulate glycolysis has been proposed as a therapeutic targeting strategy, but this approach has not been evaluated for glioblastoma multiforme (GBM, the most aggressive and difficult to treat malignancy of the brain. Elevated GLO1 expression in GBM was established in patient tumors and cell lines using bioinformatics tools and biochemical approaches. GLO1 inhibition in GBM cell lines and in an orthotopic xenograft GBM mouse model was examined using both small molecule and short hairpin RNA (shRNA approaches. Inhibition of GLO1 with S-(p-bromobenzyl glutathione dicyclopentyl ester (p-BrBzGSH(Cp2 increased levels of the DNA-AGE N2-1-(carboxyethyl-2′-deoxyguanosine (CEdG, a surrogate biomarker for nuclear MG exposure; substantially elevated expression of the immunoglobulin-like receptor for AGEs (RAGE; and induced apoptosis in GBM cell lines. Targeting GLO1 with shRNA similarly increased CEdG levels and RAGE expression, and was cytotoxic to glioma cells. Mice bearing orthotopic GBM xenografts treated systemically with p-BrBzGSH(Cp2 exhibited tumor regression without significant off-target effects suggesting that GLO1 inhibition may have value in the therapeutic management of these drug-resistant tumors.

  19. Inhibition of GLO1 in Glioblastoma Multiforme Increases DNA-AGEs, Stimulates RAGE Expression, and Inhibits Brain Tumor Growth in Orthotopic Mouse Models.

    Science.gov (United States)

    Jandial, Rahul; Neman, Josh; Lim, Punnajit P; Tamae, Daniel; Kowolik, Claudia M; Wuenschell, Gerald E; Shuck, Sarah C; Ciminera, Alexandra K; De Jesus, Luis R; Ouyang, Ching; Chen, Mike Y; Termini, John

    2018-01-30

    Cancers that exhibit the Warburg effect may elevate expression of glyoxylase 1 (GLO1) to detoxify the toxic glycolytic byproduct methylglyoxal (MG) and inhibit the formation of pro-apoptotic advanced glycation endproducts (AGEs). Inhibition of GLO1 in cancers that up-regulate glycolysis has been proposed as a therapeutic targeting strategy, but this approach has not been evaluated for glioblastoma multiforme (GBM), the most aggressive and difficult to treat malignancy of the brain. Elevated GLO1 expression in GBM was established in patient tumors and cell lines using bioinformatics tools and biochemical approaches. GLO1 inhibition in GBM cell lines and in an orthotopic xenograft GBM mouse model was examined using both small molecule and short hairpin RNA (shRNA) approaches. Inhibition of GLO1 with S -( p -bromobenzyl) glutathione dicyclopentyl ester ( p- BrBzGSH(Cp)₂) increased levels of the DNA-AGE N ²-1-(carboxyethyl)-2'-deoxyguanosine (CEdG), a surrogate biomarker for nuclear MG exposure; substantially elevated expression of the immunoglobulin-like receptor for AGEs (RAGE); and induced apoptosis in GBM cell lines. Targeting GLO1 with shRNA similarly increased CEdG levels and RAGE expression, and was cytotoxic to glioma cells. Mice bearing orthotopic GBM xenografts treated systemically with p -BrBzGSH(Cp)₂ exhibited tumor regression without significant off-target effects suggesting that GLO1 inhibition may have value in the therapeutic management of these drug-resistant tumors.

  20. Combinatorial RNA Interference Therapy Prevents Selection of Pre-existing HBV Variants in Human Liver Chimeric Mice

    Science.gov (United States)

    Shih, Yao-Ming; Sun, Cheng-Pu; Chou, Hui-Hsien; Wu, Tzu-Hui; Chen, Chun-Chi; Wu, Ping-Yi; Enya Chen, Yu-Chen; Bissig, Karl-Dimiter; Tao, Mi-Hua

    2015-01-01

    Selection of escape mutants with mutations within the target sequence could abolish the antiviral RNA interference activity. Here, we investigated the impact of a pre-existing shRNA-resistant HBV variant on the efficacy of shRNA therapy. We previously identified a highly potent shRNA, S1, which, when delivered by an adeno-associated viral vector, effectively inhibits HBV replication in HBV transgenic mice. We applied the “PICKY” software to systemically screen the HBV genome, then used hydrodynamic transfection and HBV transgenic mice to identify additional six highly potent shRNAs. Human liver chimeric mice were infected with a mixture of wild-type and T472C HBV, a S1-resistant HBV variant, and then treated with a single or combined shRNAs. The presence of T472C mutant compromised the therapeutic efficacy of S1 and resulted in replacement of serum wild-type HBV by T472C HBV. In contrast, combinatorial therapy using S1 and P28, one of six potent shRNAs, markedly reduced titers for both wild-type and T472C HBV. Interestingly, treatment with P28 alone led to the emergence of escape mutants with mutations in the P28 target region. Our results demonstrate that combinatorial RNAi therapy can minimize the escape of resistant viral mutants in chronic HBV patients. PMID:26482836

  1. Upregulation of EMMPRIN (OX47 in Rat Dorsal Root Ganglion Contributes to the Development of Mechanical Allodynia after Nerve Injury

    Directory of Open Access Journals (Sweden)

    Qun Wang

    2015-01-01

    Full Text Available Matrix metalloproteinases (MMPs are widely implicated in inflammation and tissue remodeling associated with various neurodegenerative diseases and play an important role in nociception and allodynia. Extracellular Matrix Metalloproteinase Inducer (EMMPRIN plays a key regulatory role for MMP activities. However, the role of EMMPRIN in the development of neuropathic pain is not clear. Western blotting, real-time quantitative RT-PCR (qRT-PCR, and immunofluorescence were performed to determine the changes of messenger RNA and protein of EMMPRIN/OX47 and their cellular localization in the rat dorsal root ganglion (DRG after nerve injury. Paw withdrawal threshold test was examined to evaluate the pain behavior in spinal nerve ligation (SNL model. The lentivirus containing OX47 shRNA was injected into the DRG one day before SNL. The expression level of both mRNA and protein of OX47 was markedly upregulated in ipsilateral DRG after SNL. OX47 was mainly expressed in the extracellular matrix of DRG. Administration of shRNA targeted against OX47 in vivo remarkably attenuated mechanical allodynia induced by SNL. In conclusion, peripheral nerve injury induced upregulation of OX47 in the extracellular matrix of DRG. RNA interference against OX47 significantly suppressed the expression of OX47 mRNA and the development of mechanical allodynia. The altered expression of OX47 may contribute to the development of neuropathic pain after nerve injury.

  2. Inhibition of CD147 expression by RNA interference reduces proliferation, invasion and increases chemosensitivity in cancer stem cell-like HT-29 cells.

    Science.gov (United States)

    Chen, Jie; Pan, Yuqin; He, Bangshun; Ying, Houqun; Wang, Feng; Sun, Huiling; Deng, Qiwen; Liu, Xian; Lin, Kang; Peng, Hongxin; Cho, William C; Wang, Shukui

    2015-10-01

    The association between CD147 and cancer stem cells (CSCs) provides a new angle for cancer treatments. The aim of this study was to investigate the biological roles of CD147 in colorectal CSCs. The Oct4-green fluorescent protein (GFP) vector was used to isolate CSCs and pYr-mir30-shRNA was used to generate short hairpin RNA (shRNA) specifically for CD147. After RNA interference (RNAi), CD147 was evaluated by reverse transcription‑quantitative PCR and western blot analysis, and its biological functions were assessed by MTT and invasion assays. The results showed that the differentiation of isolated CSC-like HT-29 cells was blocked and these cells were highly positive for CD44 and CD147. RNAi-mediated CD147 silencing reduced the expression of CD147 at both mRNA and protein levels. Moreover, the activities of proliferation and invasion were decreased obviously in CSCs. Knockdown of CD147 increased the chemosensitivity of CSC-like cells to gemcitabine, cisplatin, docetaxel at 0.1, 1 and 10 µM respectively, however, there was no significant difference among the three groups to paclitaxel at 10 µM. In conclusion, these results suggest that CD147 plays an important role in colorectal CSCs and might be regarded as a novel CSC-specific targeted strategy against colorectal cancer.

  3. Downregulation of CD147 expression by RNA interference inhibits HT29 cell proliferation, invasion and tumorigenicity in vitro and in vivo.

    Science.gov (United States)

    Li, Rui; Pan, Yuqin; He, Bangshun; Xu, Yeqiong; Gao, Tianyi; Song, Guoqi; Sun, Huiling; Deng, Qiwen; Wang, Shukui

    2013-12-01

    We investigated the effect of CD147 silencing on HT29 cell proliferation and invasion. We constructed a novel short hairpin RNA (shRNA) expression vector pYr-mir30-shRNA. The plasmid was transferred to HT29 cells. The expression of CD147, MCT1 (lactate transporters monocarboxylate transporter 1) and MCT4 (lactate transporters monocarboxylate transporter 4) were monitored by quantitative PCR and western blotting, respectively. The MMP-2 (matrix metalloproteinase-2) and MMP-9 (matrix metalloproteinase-9) activities were determined by gelatin zymography assay, while the intracellular lactate concentration was determined by the lactic acid assay kit. WST-8 assay was used to determine the HT29 cell proliferation and the chemosensitivity. Invasion assay was used to determine the invasion of HT29 cells. In addition, we established a colorectal cancer model, and detected CD147 expression in vivo. The results showed that the expression of CD147 and MCT1 was significantly reduced at both mRNA and protein levels, and also the activity of MMP-2 and MMP-9 was reduced. The proliferation and invasion were decreased, but chemosensitivity to cisplatin was increased. In vivo, the CD147 expression was also significantly decreased, and reduced the tumor growth after CD147 gene silencing. The results demonstrated that silencing of CD147 expression inhibited the proliferation and invasion, suggesting CD147 silencing might be an adjuvant gene therapy strategy to chemotherapy.

  4. Electrotransfer parameters as a tool for controlled and targeted gene expression in skin

    Directory of Open Access Journals (Sweden)

    Spela Kos

    2016-01-01

    Full Text Available Skin is an attractive target for gene electrotransfer. It consists of different cell types that can be transfected, leading to various responses to gene electrotransfer. We demonstrate that these responses could be controlled by selecting the appropriate electrotransfer parameters. Specifically, the application of low or high electric pulses, applied by multi-electrode array, provided the possibility to control the depth of the transfection in the skin, the duration and the level of gene expression, as well as the local or systemic distribution of the transgene. The influence of electric pulse type was first studied using a plasmid encoding a reporter gene (DsRed. Then, plasmids encoding therapeutic genes (IL-12, shRNA against endoglin, shRNA against melanoma cell adhesion molecule were used, and their effects on wound healing and cutaneous B16F10 melanoma tumors were investigated. The high-voltage pulses resulted in gene expression that was restricted to superficial skin layers and induced a local response. In contrast, the low-voltage electric pulses promoted transfection into the deeper skin layers, resulting in prolonged gene expression and higher transgene production, possibly with systemic distribution. Therefore, in the translation into the clinics, it will be of the utmost importance to adjust the electrotransfer parameters for different therapeutic approaches and specific mode of action of the therapeutic gene.

  5. Preclinical safety and efficacy of an anti–HIV-1 lentiviral vector containing a short hairpin RNA to CCR5 and the C46 fusion inhibitor

    Directory of Open Access Journals (Sweden)

    Orit Wolstein

    2014-01-01

    Full Text Available Gene transfer has therapeutic potential for treating HIV-1 infection by generating cells that are resistant to the virus. We have engineered a novel self-inactivating lentiviral vector, LVsh5/C46, using two viral-entry inhibitors to block early steps of HIV-1 cycle. The LVsh5/C46 vector encodes a short hairpin RNA (shRNA for downregulation of CCR5, in combination with the HIV-1 fusion inhibitor, C46. We demonstrate here the effective delivery of LVsh5/C46 to human T cell lines, peripheral blood mononuclear cells, primary CD4+ T lymphocytes, and CD34+ hematopoietic stem/progenitor cells (HSPC. CCR5-targeted shRNA (sh5 and C46 peptide were stably expressed in the target cells and were able to effectively protect gene-modified cells against infection with CCR5- and CXCR4-tropic strains of HIV-1. LVsh5/C46 treatment was nontoxic as assessed by cell growth and viability, was noninflammatory, and had no adverse effect on HSPC differentiation. LVsh5/C46 could be produced at a scale sufficient for clinical development and resulted in active viral particles with very low mutagenic potential and the absence of replication-competent lentivirus. Based on these in vitro results, plus additional in vivo safety and efficacy data, LVsh5/C46 is now being tested in a phase 1/2 clinical trial for the treatment of HIV-1 disease.

  6. Gremlin promotes retinal pigmentation epithelial (RPE) cell proliferation, migration and VEGF production via activating VEGFR2-Akt-mTORC2 signaling.

    Science.gov (United States)

    Liu, Yuan; Chen, Zhijun; Cheng, Haixia; Chen, Juan; Qian, Jing

    2017-01-03

    Retinopathy of prematurity (ROP) is characterized by late-phase pathologic retinal vasoproliferation. Gremlin is a novel vascular endothelial growth factors (VEGF) receptor 2 (VEGFR2) agonist and promotes angiogenic response. We demonstrated that gremlin expression was significantly increased in retinas of ROP model mice, which was correlated with VEGF upregulation. In retinal pigmentation epithelial (RPE) cells, gremlin activated VEGFR2-Akt-mTORC2 (mammalian target of rapamycin complex 2) signaling, and promoted cell proliferation, migration and VEGF production. VEGFR inhibition (by SU5416) or shRNA knockdown almost abolished gremlin-mediated pleiotropic functions in RPE cells. Further, pharmacological inhibition of Akt-mTOR, or shRNA knockdown of key mTORC2 component (Rictor or Sin1) also attenuated gremlin-exerted activities in RPE cells. We conclude that gremlin promotes RPE cell proliferation, migration and VEGF production possibly via activating VEGFR2-Akt-mTORC2 signaling. Gremlin could be a novel therapeutic target of ROP or other retinal vasoproliferation diseases.

  7. An Inducible, Isogenic Cancer Cell Line System for Targeting the State of Mismatch Repair Deficiency

    Science.gov (United States)

    Bailis, Julie M.; Gordon, Marcia L.; Gurgel, Jesse L.; Komor, Alexis C.; Barton, Jacqueline K.; Kirsch, Ilan R.

    2013-01-01

    The DNA mismatch repair system (MMR) maintains genome stability through recognition and repair of single-base mismatches and small insertion-deletion loops. Inactivation of the MMR pathway causes microsatellite instability and the accumulation of genomic mutations that can cause or contribute to cancer. In fact, 10-20% of certain solid and hematologic cancers are MMR-deficient. MMR-deficient cancers do not respond to some standard of care chemotherapeutics because of presumed increased tolerance of DNA damage, highlighting the need for novel therapeutic drugs. Toward this goal, we generated isogenic cancer cell lines for direct comparison of MMR-proficient and MMR-deficient cells. We engineered NCI-H23 lung adenocarcinoma cells to contain a doxycycline-inducible shRNA designed to suppress the expression of the mismatch repair gene MLH1, and compared single cell subclones that were uninduced (MLH1-proficient) versus induced for the MLH1 shRNA (MLH1-deficient). Here we present the characterization of these MMR-inducible cell lines and validate a novel class of rhodium metalloinsertor compounds that differentially inhibit the proliferation of MMR-deficient cancer cells. PMID:24205301

  8. Autophagy influences the low-dose hyper-radiosensitivity of human lung adenocarcinoma cells by regulating MLH1.

    Science.gov (United States)

    Wang, Qiong; Xiao, Zhuya; Lin, Zhenyu; Zhou, Jie; Chen, Weihong; Jie, Wuyun; Cao, Xing; Yin, Zhongyuan; Cheng, Jing

    2017-06-01

    To investigate the impact of autophagy on the low-dose hyper-radiosensitivity (HRS) of human lung adenocarcinoma cells via MLH1 regulation. Immunofluorescent staining, Western blotting, and electron microscopy were utilized to detect autophagy in A549 and H460 cells. shRNA was used to silence MLH1 expression. The levels of MLH1, mTOR, p-mTOR, BNIP3, and Beclin-1 were measured by real-time polymerase chain reaction (PCR) and Western blotting. A549 cells, which have low levels of MLH1 expression, displayed HRS/induced radioresistance (IRR). Conversely, the radiosensitivity of H460 cells, which express high levels of MLH1, conformed to the linear-quadratic (LQ) model. After down-regulating MLH1 expression, A549 cells showed increased HRS and inhibition of autophagy, whereas H460 cells exhibited HRS/IRR. The levels of mTOR, p-mTOR, and BNIP3 were reduced in cells harboring MLH1 shRNA, and the changes in the mTOR/p-mTOR ratio mirrored those in MLH1 expression. Low MLH1-expressing A549 cells may exhibit HRS. Both the mTOR/p-mTOR and BNIP3/Beclin-1 signaling pathways were found to be related to HRS, but only mTOR/p-mTOR is involved in the regulation of HRS via MLH1 and autophagy.

  9. Lentiviral-mediated RNAi targeting caspase-3 inhibits apoptosis induced by serum deprivation in rat endplate chondrocytes in vitro

    International Nuclear Information System (INIS)

    Ding, L.; Wu, J.P.; Xu, G.; Zhu, B.; Zeng, Q.M.; Li, D.F.; Lu, W.

    2014-01-01

    Current studies find that degenerated cartilage endplates (CEP) of vertebrae, with fewer diffusion areas, decrease nutrient supply and accelerate intervertebral disc degeneration. Many more apoptotic cells have been identified in degenerated than in normal endplates, and may be responsible for the degenerated grade. Previous findings suggest that inhibition of apoptosis is one possible approach to improve disc regeneration. It is postulated that inhibition of CEP cell apoptosis may be responsible for the regeneration of endplates. Caspase-3, involved in the execution phase of apoptosis, is a candidate for regulating the apoptotic process. In the present study, CEP cells were incubated in 1% fetal bovine serum. Activated caspases were detected to identify the apoptotic pathway, and apoptosis was quantified by flow cytometry. Lentiviral caspase-3 short hairpin RNA (shRNA) was employed to study its protective effects against serum deprivation. Silencing of caspase-3 expression was quantified by reverse transcription-polymerase chain reaction and Western blots, and inhibition of apoptosis was quantified by flow cytometry. Serum deprivation increased apoptosis of rat CEP cells through activation of a caspase cascade. Lentiviral caspase-3 shRNA was successfully transduced into CEP cells, and specifically silenced endogenous caspase-3 expression. Surviving cells were protected by the downregulation of caspase-3 expression and activation. Thus, lentiviral caspase-3 shRNA-mediated RNAi successfully silenced endogenous caspase-3 expression, preventing inappropriate or premature apoptosis

  10. JNK1 protects against glucolipotoxicity-mediated beta-cell apoptosis

    DEFF Research Database (Denmark)

    Prause, Michala; Christensen, Dan Ploug; Billestrup, Nils

    2014-01-01

    Pancreatic β-cell dysfunction is central to type 2 diabetes pathogenesis. Prolonged elevated levels of circulating free-fatty acids and hyperglycemia, also termed glucolipotoxicity, mediate β-cell dysfunction and apoptosis associated with increased c-Jun N-terminal Kinase (JNK) activity. Endoplas......Pancreatic β-cell dysfunction is central to type 2 diabetes pathogenesis. Prolonged elevated levels of circulating free-fatty acids and hyperglycemia, also termed glucolipotoxicity, mediate β-cell dysfunction and apoptosis associated with increased c-Jun N-terminal Kinase (JNK) activity....... Endoplasmic reticulum (ER) and oxidative stress are elicited by palmitate and high glucose concentrations further potentiating JNK activity. Our aim was to determine the role of the JNK subtypes JNK1, JNK2 and JNK3 in palmitate and high glucose-induced β-cell apoptosis. We established insulin-producing INS1...... INS1 cells showed increased apoptosis and cleaved caspase 9 and 3 compared to non-sense shRNA expressing control INS1 cells when exposed to palmitate and high glucose associated with increased CHOP expression, ROS formation and Puma mRNA expression. JNK2 shRNA expressing INS1 cells did not affect...

  11. Growth delay of human bladder cancer cells by Prostate Stem Cell Antigen downregulation is associated with activation of immune signaling pathways

    Directory of Open Access Journals (Sweden)

    Nicosia Alfredo

    2010-04-01

    Full Text Available Abstract Background Prostate stem cell antigen (PSCA is a glycosylphosphatidylinositol (GPI anchored protein expressed not only in prostate but also in pancreas and bladder cancer as shown by immunohistochemistry and mRNA analysis. It has been targeted by monoclonal antibodies in preclinical animal models and more recently in a clinical trial in prostate cancer patients. The biological role played in tumor growth is presently unknown. In this report we have characterized the contribution of PSCA expression to tumor growth. Methods A bladder cell line was engineered to express a doxycycline (dox regulated shRNA against PSCA. To shed light on the PSCA biological role in tumor growth, microarray analysis was carried out as a function of PSCA expression. Expression of gene set of interest was further analyzed by qPCR Results Down regulation of the PSCA expression was associated with reduced cell proliferation in vitro and in vivo. Mice bearing subcutaneous tumors showed a reduced tumor growth upon treatment with dox, which effectively induced shRNA against PSCA as revealed by GFP expression. Pathway analysis of deregulated genes suggests a statistical significant association between PSCA downregulation and activation of genes downstream of the IFNα/β receptor. Conclusions These experiments established for the first time a correlation between the level of PSCA expression and tumor growth and suggest a role of PSCA in counteracting the natural immune response.

  12. Homeobox gene Dlx-2 is implicated in metabolic stress-induced necrosis

    Directory of Open Access Journals (Sweden)

    Lim Sung-Chul

    2011-09-01

    Full Text Available Abstract Background In contrast to tumor-suppressive apoptosis and autophagic cell death, necrosis promotes tumor progression by releasing the pro-inflammatory and tumor-promoting cytokine high mobility group box 1 (HMGB1, and its presence in tumor patients is associated with poor prognosis. Thus, necrosis has important clinical implications in tumor development; however, its molecular mechanism remains poorly understood. Results In the present study, we show that Distal-less 2 (Dlx-2, a homeobox gene of the Dlx family that is involved in embryonic development, is induced in cancer cell lines dependently of reactive oxygen species (ROS in response to glucose deprivation (GD, one of the metabolic stresses occurring in solid tumors. Increased Dlx-2 expression was also detected in the inner regions, which experience metabolic stress, of human tumors and of a multicellular tumor spheroid, an in vitro model of solid tumors. Dlx-2 short hairpin RNA (shRNA inhibited metabolic stress-induced increase in propidium iodide-positive cell population and HMGB1 and lactate dehydrogenase (LDH release, indicating the important role(s of Dlx-2 in metabolic stress-induced necrosis. Dlx-2 shRNA appeared to exert its anti-necrotic effects by preventing metabolic stress-induced increases in mitochondrial ROS, which are responsible for triggering necrosis. Conclusions These results suggest that Dlx-2 may be involved in tumor progression via the regulation of metabolic stress-induced necrosis.

  13. Dual oxidase maturation factor 1 (DUOXA1) overexpression increases reactive oxygen species production and inhibits murine muscle satellite cell differentiation.

    Science.gov (United States)

    Sandiford, Shelley D E; Kennedy, Karen A M; Xie, Xiaojun; Pickering, J Geoffrey; Li, Shawn S C

    2014-01-11

    Dual oxidase maturation factor 1 (DUOXA1) has been associated with the maturation of the reactive oxygen species (ROS) producing enzyme, dual oxidase 1 (DUOX1) in the adult thyroid. However, ROS have also been implicated in the development of several tissues. We found that activated muscle satellite cells and primary myoblasts isolated from mice express robust levels of DUOXA1 and that its levels are altered as cells differentiate. To determine whether DUOXA1 levels affect muscle differentiation, we used an adenoviral construct (pCMV5-DUOXA1-GFP) to drive constitutive overexpression of this protein in primary myoblasts. High levels of DUOXA1 throughout myogenesis resulted in enhanced H2O2 production, fusion defects, reduced expression of early (myogenin) and late (myosin heavy chain) markers of differentiation, and elevated levels of apoptosis compared to control cells infected with an empty adenoviral vector (pCMV5-GFP). DUOXA1 knockdown (using a DUOXA1 shRNA construct) resulted in enhanced differentiation compared to cells subjected to a control shRNA, and subjecting DUOXA1 overexpressing cells to siRNAs targeting DUOX1 or apoptosis signal-regulating kinase 1 (ASK1) rescued the phenotype. This study represents the first to demonstrate the importance of DUOXA1 in skeletal muscle myoblasts and that DUOXA1 overexpression in muscle stem cells induces apoptosis and inhibits differentiation through DUOX1 and ASK1.

  14. Incorporation of aptamers in the terminal loop of shRNAs yields an effective and novel combinatorial targeting strategy.

    Science.gov (United States)

    Pang, Ka Ming; Castanotto, Daniela; Li, Haitang; Scherer, Lisa; Rossi, John J

    2018-01-09

    Gene therapy by engineering patient's own blood cells to confer HIV resistance can potentially lead to a functional cure for AIDS. Toward this goal, we have previously developed an anti-HIV lentivirus vector that deploys a combination of shRNA, ribozyme and RNA decoy. To further improve this therapeutic vector against viral escape, we sought an additional reagent to target HIV integrase. Here, we report the development of a new strategy for selection and expression of aptamer for gene therapy. We developed a SELEX protocol (multi-tag SELEX) for selecting RNA aptamers against proteins with low solubility or stability, such as integrase. More importantly, we expressed these aptamers in vivo by incorporating them in the terminal loop of shRNAs. This novel strategy allowed efficient expression of the shRNA-aptamer fusions that targeted RNAs and proteins simultaneously. Expressed shRNA-aptamer fusions targeting HIV integrase or reverse transcriptase inhibited HIV replication in cell cultures. Viral inhibition was further enhanced by combining an anti-integrase aptamer with an anti-HIV Tat-Rev shRNA. This construct exhibited efficacy comparable to that of integrase inhibitor Raltegravir. Our strategy for the selection and expression of RNA aptamers can potentially extend to other gene therapy applications. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

  15. 55K isoform of CDK9 associates with Ku70 and is involved in DNA repair

    International Nuclear Information System (INIS)

    Liu, Hongbing; Herrmann, Christine H.; Chiang, Karen; Sung, Tzu-Ling; Moon, Sung-Hwan; Donehower, Lawrence A.; Rice, Andrew P.

    2010-01-01

    Positive elongation factor b (P-TEFb) is a cellular protein kinase that is required for RNA polymerase II (RNAP II) transcriptional elongation of protein coding genes. P-TEFb is a set of different molecular complexes, each containing CDK9 as the catalytic subunit. There are two isoforms of the CDK9 protein - the major 42 KDa CDK9 isoform and the minor 55KDa isoform that is translated from an in-frame mRNA that arises from an upstream transcriptional start site. We found that shRNA depletion of the 55K CDK9 protein in HeLa cells induces apoptosis and double-strand DNA breaks (DSBs). The levels of apoptosis and DSBs induced by the depletion were reduced by expression of a 55K CDK9 protein variant resistant to the shRNA, indicating that these phenotypes are the consequence of depletion of the 55K protein and not off-target effects. We also found that the 55K CDK9 protein, but not the 42K CDK9 protein, specifically associates with Ku70, a protein involved in DSB repair. Our findings suggest that the 55K CDK9 protein may function in repair of DNA through an association with Ku70.

  16. GDNF facilitates differentiation of the adult dentate gyrus-derived neural precursor cells into astrocytes via STAT3

    International Nuclear Information System (INIS)

    Boku, Shuken; Nakagawa, Shin; Takamura, Naoki; Kato, Akiko; Takebayashi, Minoru; Hisaoka-Nakashima, Kazue; Omiya, Yuki; Inoue, Takeshi; Kusumi, Ichiro

    2013-01-01

    Highlights: •GDNF has no effect on ADP proliferation and apoptosis. •GDNF increases ADP differentiation into astrocyte. •A specific inhibitor of STAT3 decreases the astrogliogenic effect of GDNF. •STAT3 knockdown by lentiviral shRNA vector also decreases the astrogliogenic effect of GDNF. •GDNF increases the phosphorylation of STAT3. -- Abstract: While the pro-neurogenic actions of antidepressants in the adult hippocampal dentate gyrus (DG) are thought to be one of the mechanisms through which antidepressants exert their therapeutic actions, antidepressants do not increase proliferation of neural precursor cells derived from the adult DG. Because previous studies showed that antidepressants increase the expression and secretion of glial cell line-derived neurotrophic factor (GDNF) in C6 glioma cells derived from rat astrocytes and GDNF increases neurogenesis in adult DG in vivo, we investigated the effects of GDNF on the proliferation, differentiation and apoptosis of cultured neural precursor cells derived from the adult DG. Data showed that GDNF facilitated the differentiation of neural precursor cells into astrocytes but had no effect on their proliferation or apoptosis. Moreover, GDNF increased the phosphorylation of STAT3, and both a specific inhibitor of STAT3 and lentiviral shRNA for STAT3 decreased their differentiation into astrocytes. Taken together, our findings suggest that GDNF facilitates astrogliogenesis from neural precursor cells in adult DG through activating STAT3 and that this action might indirectly affect neurogenesis

  17. A heteromeric molecular complex regulates the migration of lung alveolar epithelial cells during wound healing.

    Science.gov (United States)

    Ghosh, Manik C; Makena, Patrudu S; Kennedy, Joseph; Teng, Bin; Luellen, Charlean; Sinclair, Scott E; Waters, Christopher M

    2017-05-19

    Alveolar type II epithelial cells (ATII) are instrumental in early wound healing in response to lung injury, restoring epithelial integrity through spreading and migration. We previously reported in separate studies that focal adhesion kinase-1 (FAK) and the chemokine receptor CXCR4 promote epithelial repair mechanisms. However, potential interactions between these two pathways were not previously considered. In the present study, we found that wounding of rat ATII cells promoted increased association between FAK and CXCR4. In addition, protein phosphatase-5 (PP5) increased its association with this heteromeric complex, while apoptosis signal regulating kinase-1 (ASK1) dissociated from the complex. Cell migration following wounding was decreased when PP5 expression was decreased using shRNA, but migration was increased in ATII cells isolated from ASK1 knockout mice. Interactions between FAK and CXCR4 were increased upon depletion of ASK1 using shRNA in MLE-12 cells, but unaffected when PP5 was depleted. Furthermore, we found that wounded rat ATII cells exhibited decreased ASK1 phosphorylation at Serine-966, decreased serine phosphorylation of FAK, and decreased association of phosphorylated ASK1 with FAK. These changes in phosphorylation were dependent upon expression of PP5. These results demonstrate a unique molecular complex comprising CXCR4, FAK, ASK1, and PP5 in ATII cells during wound healing.

  18. A Critical Analysis of the Role of SNARE Protein SEC22B in Antigen Cross-Presentation

    Directory of Open Access Journals (Sweden)

    S. Julia Wu

    2017-06-01

    Full Text Available Cross-presentation initiates immune responses against tumors and viral infections by presenting extracellular antigen on MHC I to activate CD8+ T cell-mediated cytotoxicity. In vitro studies in dendritic cells (DCs established SNARE protein SEC22B as a specific regulator of cross-presentation. However, the in vivo contribution of SEC22B to cross-presentation has not been tested. To address this, we generated DC-specific Sec22b knockout (CD11c-Cre Sec22bfl/fl mice. Contrary to the paradigm, SEC22B-deficient DCs efficiently cross-present both in vivo and in vitro. Although in vitro small hairpin RNA (shRNA-mediated Sec22b silencing in bone-marrow-derived dendritic cells (BMDCs reduced cross-presentation, treatment of SEC22B-deficient BMDCs with the same shRNA produced a similar defect, suggesting the Sec22b shRNA modulates cross-presentation through off-target effects. RNA sequencing of Sec22b shRNA-treated SEC22B-deficient BMDCs demonstrated several changes in the transcriptome. Our data demonstrate that contrary to the accepted model, SEC22B is not necessary for cross-presentation, cautioning against extrapolating phenotypes from knockdown studies alone.

  19. The Mu opioid receptor promotes opioid and growth factor-induced proliferation, migration and Epithelial Mesenchymal Transition (EMT in human lung cancer.

    Directory of Open Access Journals (Sweden)

    Frances E Lennon

    Full Text Available Recent epidemiologic studies implying differences in cancer recurrence based on anesthetic regimens raise the possibility that the mu opioid receptor (MOR can influence cancer progression. Based on our previous observations that overexpression of MOR in human non-small cell lung cancer (NSCLC cells increased tumor growth and metastasis, this study examined whether MOR regulates growth factor receptor signaling and epithelial mesenchymal transition (EMT in human NSCLC cells. We utilized specific siRNA, shRNA, chemical inhibitors and overexpression vectors in human H358 NSCLC cells that were either untreated or treated with various concentrations of DAMGO, morphine, fentanyl, EGF or IGF. Cell function assays, immunoblot and immunoprecipitation assays were then performed. Our results indicate MOR regulates opioid and growth factor-induced EGF receptor signaling (Src, Gab-1, PI3K, Akt and STAT3 activation which is crucial for consequent human NSCLC cell proliferation and migration. In addition, human NSCLC cells treated with opioids, growth factors or MOR overexpression exhibited an increase in snail, slug and vimentin and decrease ZO-1 and claudin-1 protein levels, results consistent with an EMT phenotype. Further, these effects were reversed with silencing (shRNA or chemical inhibition of MOR, Src, Gab-1, PI3K, Akt and STAT3 (p<0.05. Our data suggest a possible direct effect of MOR on opioid and growth factor-signaling and consequent proliferation, migration and EMT transition during lung cancer progression. Such an effect provides a plausible explanation for the epidemiologic findings.

  20. Zinc finger protein 598 inhibits cell survival by promoting UV-induced apoptosis.

    Science.gov (United States)

    Yang, Qiaohong; Gupta, Romi

    2018-01-19

    UV is one of the major causes of DNA damage induced apoptosis. However, cancer cells adopt alternative mechanisms to evade UV-induced apoptosis. To identify factors that protect cancer cells from UV-induced apoptosis, we performed a genome wide short-hairpin RNA (shRNA) screen, which identified Zinc finger protein 598 (ZNF598) as a key regulator of UV-induced apoptosis. Here, we show that UV irradiation transcriptionally upregulates ZNF598 expression. Additionally, ZNF598 knockdown in cancer cells inhibited UV-induced apoptosis. In our study, we observe that ELK1 mRNA level as well as phosphorylated ELK1 levels was up regulated upon UV irradiation, which was necessary for UV irradiation induced upregulation of ZNF598. Cells expressing ELK1 shRNA were also resistant to UV-induced apoptosis, and phenocopy ZNF598 knockdown. Upon further investigation, we found that ZNF598 knockdown inhibits UV-induced apoptotic gene expression, which matches with decrease in percentage of annexin V positive cell. Similarly, ectopic expression of ZNF598 promoted apoptotic gene expression and also increased annexin V positive cells. Collectively, these results demonstrate that ZNF598 is a UV irradiation regulated gene and its loss results in resistance to UV-induced apoptosis.

  1. Tumor-specific expression of shVEGF and suicide gene as a novel strategy for esophageal cancer therapy.

    Science.gov (United States)

    Liu, Ting; Wu, Hai-Jun; Liang, Yu; Liang, Xu-Jun; Huang, Hui-Chao; Zhao, Yan-Zhong; Liao, Qing-Chuan; Chen, Ya-Qi; Leng, Ai-Min; Yuan, Wei-Jian; Zhang, Gui-Ying; Peng, Jie; Chen, Yong-Heng

    2016-06-21

    To develop a potent and safe gene therapy for esophageal cancer. An expression vector carrying fusion suicide gene (yCDglyTK) and shRNA against vascular endothelial growth factor (VEGF) was constructed and delivered into EC9706 esophageal cancer cells by calcium phosphate nanoparticles (CPNP). To achieve tumor selectivity, expression of the fusion suicide gene was driven by a tumor-specific human telomerase reverse transcriptase (hTERT) promoter. The biologic properties and therapeutic efficiency of the vector, in the presence of prodrug 5-fluorocytosine (5-FC), were evaluated in vitro and in vivo. Both in vitro and in vivo testing showed that the expression vector was efficiently introduced by CPNP into tumor cells, leading to cellular expression of yCDglyTK and decreased VEGF level. With exposure to 5-FC, it exhibited strong anti-tumor effects against esophageal cancer. Combination of VEGF shRNA with the fusion suicide gene demonstrated strong anti-tumor activity. The shVEGF-hTERT-yCDglyTK/5-FC system provided a novel approach for esophageal cancer-targeted gene therapy.

  2. Inhibition of histone deacetylases 1 and 6 enhances cytarabine-induced apoptosis in pediatric acute myeloid leukemia cells.

    Science.gov (United States)

    Xu, Xuelian; Xie, Chengzhi; Edwards, Holly; Zhou, Hui; Buck, Steven A; Ge, Yubin

    2011-02-16

    Pediatric acute myeloid leukemia (AML) remains a challenging disease to treat even with intensified cytarabine-based chemotherapy. Histone deacetylases (HDACs) have been reported to be promising therapeutic targets for treating AML. However, HDAC family members that are involved in chemotherapy sensitivities remain unknown. In this study, we sought to identify members of the HDAC family that are involved in cytarabine sensitivities, and to select the optimal HDACI that is most efficacious when combined with cytarabine for treating children with AML. Expression profiles of classes I, II, and IV HDACs in 4 pediatric AML cell lines were determined by Western blotting. Inhibition of class I HDACs by different HDACIs was measured post immnunoprecipitation. Individual down-regulation of HDACs in pediatric AML cells was performed with lentiviral shRNA. The effects of cytarabine and HDACIs on apoptosis were determined by flow cytometry analysis. Treatments with structurally diverse HDACIs and HDAC shRNA knockdown experiments revealed that down-regulation of both HDACs 1 and 6 is critical in enhancing cytarabine-induced apoptosis in pediatric AML, at least partly mediated by Bim. However, down-regulation of HDAC2 may negatively impact cytarabine sensitivities in the disease. At clinically achievable concentrations, HDACIs that simultaneously inhibited both HDACs 1 and 6 showed the best anti-leukemic activities and significantly enhanced cytarabine-induced apoptosis. Our results further confirm that HDACs are bona fide therapeutic targets for treating pediatric AML and suggest that pan-HDACIs may be more beneficial than isoform-specific drugs.

  3. Reduced SHARPIN and LUBAC Formation May Contribute to CCl4- or Acetaminophen-Induced Liver Cirrhosis in Mice

    Directory of Open Access Journals (Sweden)

    Takeshi Yamamotoya

    2017-02-01

    Full Text Available Linear ubiquitin chain assembly complex (LUBAC, composed of SHARPIN (SHANK-associated RH domain-interacting protein, HOIL-1L (longer isoform of heme-oxidized iron-regulatory protein 2 ubiquitin ligase-1, and HOIP (HOIL-1L interacting protein, forms linear ubiquitin on nuclear factor-κB (NF-κB essential modulator (NEMO and induces NF-κB pathway activation. SHARPIN expression and LUBAC formation were significantly reduced in the livers of mice 24 h after the injection of either carbon tetrachloride (CCl4 or acetaminophen (APAP, both of which produced the fulminant hepatitis phenotype. To elucidate its pathological significance, hepatic SHARPIN expression was suppressed in mice by injecting shRNA adenovirus via the tail vein. Seven days after this transduction, without additional inflammatory stimuli, substantial inflammation and fibrosis with enhanced hepatocyte apoptosis occurred in the livers. A similar but more severe phenotype was observed with suppression of HOIP, which is responsible for the E3 ligase activity of LUBAC. Furthermore, in good agreement with these in vivo results, transduction of Hepa1-6 hepatoma cells with SHARPIN, HOIL-1L, or HOIP shRNA adenovirus induced apoptosis of these cells in response to tumor necrosis factor-α (TNFα stimulation. Thus, LUBAC is essential for the survival of hepatocytes, and it is likely that reduction of LUBAC is a factor promoting hepatocyte death in addition to the direct effect of drug toxicity.

  4. Kaempferol induces autophagic cell death of hepatocellular carcinoma cells via activating AMPK signaling.

    Science.gov (United States)

    Han, Bing; Yu, Yi-Qun; Yang, Qi-Lian; Shen, Chun-Ying; Wang, Xiao-Juan

    2017-10-17

    In the present study, we demonstrate that Kaempferol inhibited survival and proliferation of established human hepatocellular carcinoma (HCC) cell lines (HepG2, Huh-7, BEL7402, and SMMC) and primary human HCC cells. Kaempferol treatment in HCC cells induced profound AMP-activated protein kinase (AMPK) activation, which led to Ulk1 phosphorylation, mTOR complex 1 inhibition and cell autophagy. Autophagy induction was reflected by Beclin-1/autophagy gene 5 upregulation and p62 degradation as well as light chain 3B (LC3B)-I to LC3B-II conversion and LC3B puncta formation. Inhibition of AMPK, via AMPKα1 shRNA or dominant negative mutation, reversed above signaling changes. AMPK inhibition also largely inhibited Kaempferol-induced cytotoxicity in HCC cells. Autophagy inhibition, by 3-methyaldenine or Beclin-1 shRNA, also protected HCC cells from Kaempferol. Kaempferol downregulated melanoma antigen 6, the AMPK ubiquitin ligase, causing AMPKα1 stabilization and accumulation. We conclude that Kaempferol inhibits human HCC cells via activating AMPK signaling.

  5. Growth delay of human bladder cancer cells by Prostate Stem Cell Antigen downregulation is associated with activation of immune signaling pathways

    International Nuclear Information System (INIS)

    Marra, Emanuele; Ciliberto, Gennaro; Palombo, Fabio; Uva, Paolo; Viti, Valentina; Simonelli, Valeria; Dogliotti, Eugenia; De Rinaldis, Emanuele; Lahm, Armin; La Monica, Nicola; Nicosia, Alfredo

    2010-01-01

    Prostate stem cell antigen (PSCA) is a glycosylphosphatidylinositol (GPI) anchored protein expressed not only in prostate but also in pancreas and bladder cancer as shown by immunohistochemistry and mRNA analysis. It has been targeted by monoclonal antibodies in preclinical animal models and more recently in a clinical trial in prostate cancer patients. The biological role played in tumor growth is presently unknown. In this report we have characterized the contribution of PSCA expression to tumor growth. A bladder cell line was engineered to express a doxycycline (dox) regulated shRNA against PSCA. To shed light on the PSCA biological role in tumor growth, microarray analysis was carried out as a function of PSCA expression. Expression of gene set of interest was further analyzed by qPCR Down regulation of the PSCA expression was associated with reduced cell proliferation in vitro and in vivo. Mice bearing subcutaneous tumors showed a reduced tumor growth upon treatment with dox, which effectively induced shRNA against PSCA as revealed by GFP expression. Pathway analysis of deregulated genes suggests a statistical significant association between PSCA downregulation and activation of genes downstream of the IFNα/β receptor. These experiments established for the first time a correlation between the level of PSCA expression and tumor growth and suggest a role of PSCA in counteracting the natural immune response

  6. Heme oxygenase-1 mediates BAY 11-7085 induced ferroptosis.

    Science.gov (United States)

    Chang, Ling-Chu; Chiang, Shih-Kai; Chen, Shuen-Ei; Yu, Yung-Luen; Chou, Ruey-Hwang; Chang, Wei-Chao

    2018-03-01

    Ferroptosis is a form of oxidative cell death and has become a chemotherapeutic target for cancer treatment. BAY 11-7085 (BAY), which is a well-known IκBα inhibitor, suppressed viability in cancer cells via induction of ferroptotic death in an NF-κB-independent manner. Reactive oxygen species scavenging, relief of lipid peroxidation, replenishment of glutathione and thiol-containing agents, as well as iron chelation, rescued BAY-induced cell death. BAY upregulated a variety of Nrf2 target genes related to redox regulation, particularly heme oxygenase-1 (HO-1). Studies with specific inhibitors and shRNA interventions suggested that the hierarchy of induction is Nrf2-SLC7A11-HO-1. SLC7A11 inhibition by erastin, sulfasalazine, or shRNA interference sensitizes BAY-induced cell death. Overexperession of SLC7A11 attenuated BAY-inhibited cell viability. The ferroptotic process induced by hHO-1 overexpression further indicated that HO-1 is a key mediator of BAY-induced ferroptosis that operates through cellular redox regulation and iron accumulation. BAY causes compartmentalization of HO-1 into the nucleus and mitochondrion, and followed mitochondrial dysfunctions, leading to lysosome targeting for mitophagy. In this study, we first discovered that BAY induced ferroptosis via Nrf2-SLC7A11-HO-1 pathway and HO-1 is a key mediator by responding to the cellular redox status. Copyright © 2017 Elsevier B.V. All rights reserved.

  7. Deep Sequence Analysis of AgoshRNA Processing Reveals 3' A Addition and Trimming.

    Science.gov (United States)

    Harwig, Alex; Herrera-Carrillo, Elena; Jongejan, Aldo; van Kampen, Antonius Hubertus; Berkhout, Ben

    2015-07-14

    The RNA interference (RNAi) pathway, in which microprocessor and Dicer collaborate to process microRNAs (miRNA), was recently expanded by the description of alternative processing routes. In one of these noncanonical pathways, Dicer action is replaced by the Argonaute2 (Ago2) slicer function. It was recently shown that the stem-length of precursor-miRNA or short hairpin RNA (shRNA) molecules is a major determinant for Dicer versus Ago2 processing. Here we present the results of a deep sequence study on the processing of shRNAs with different stem length and a top G·U wobble base pair (bp). This analysis revealed some unexpected properties of these so-called AgoshRNA molecules that are processed by Ago2 instead of Dicer. First, we confirmed the gradual shift from Dicer to Ago2 processing upon shortening of the hairpin length. Second, hairpins with a stem larger than 19 base pair are inefficiently cleaved by Ago2 and we noticed a shift in the cleavage site. Third, the introduction of a top G·U bp in a regular shRNA can promote Ago2-cleavage, which coincides with a loss of Ago2-loading of the Dicer-cleaved 3' strand. Fourth, the Ago2-processed AgoshRNAs acquire a short 3' tail of 1-3 A-nucleotides (nt) and we present evidence that this product is subsequently trimmed by the poly(A)-specific ribonuclease (PARN).

  8. In Vivo Loss of Function Screening Reveals Carbonic Anhydrase IX as a Key Modulator of Tumor Initiating Potential in Primary Pancreatic Tumors

    Directory of Open Access Journals (Sweden)

    Nabendu Pore

    2015-06-01

    Full Text Available Reprogramming of energy metabolism is one of the emerging hallmarks of cancer. Up-regulation of energy metabolism pathways fuels cell growth and division, a key characteristic of neoplastic disease, and can lead to dependency on specific metabolic pathways. Thus, targeting energy metabolism pathways might offer the opportunity for novel therapeutics. Here, we describe the application of a novel in vivo screening approach for the identification of genes involved in cancer metabolism using a patient-derived pancreatic xenograft model. Lentiviruses expressing short hairpin RNAs (shRNAs targeting 12 different cell surface protein transporters were separately transduced into the primary pancreatic tumor cells. Transduced cells were pooled and implanted into mice. Tumors were harvested at different times, and the frequency of each shRNA was determined as a measure of which ones prevented tumor growth. Several targets including carbonic anhydrase IX (CAIX, monocarboxylate transporter 4, and anionic amino acid transporter light chain, xc- system (xCT were identified in these studies and shown to be required for tumor initiation and growth. Interestingly, CAIX was overexpressed in the tumor initiating cell population. CAIX expression alone correlated with a highly tumorigenic subpopulation of cells. Furthermore, CAIX expression was essential for tumor initiation because shRNA knockdown eliminated the ability of cells to grow in vivo. To the best of our knowledge, this is the first parallel in vivo assessment of multiple novel oncology target genes using a patient-derived pancreatic tumor model.

  9. SPAG6 regulates cell apoptosis through the TRAIL signal pathway in myelodysplastic syndromes.

    Science.gov (United States)

    Li, Xinxin; Yang, Bihui; Wang, Li; Chen, Liping; Luo, Xiaohua; Liu, Lin

    2017-05-01

    Myelodysplastic syndromes (MDSs) are a group of malignant clone hematopoietic stem-cell diseases, and the evolution and progression of MDS depend on the abnormal apoptosis of bone marrow cells. Our previous studies have indicated that sperm-associated antigen 6 (SPAG6), located in the uniparental disomy regions of myeloid cells, is overexpressed in patients with MDS as compared to controls, and SPAG6 can inhibit apoptosis of SKM-1. However, the concrete mechanism is still unclear. In the present study, it was found that the TNF-related apoptosis-inducing ligand (TRAIL)signal pathway was activated when the expression of SPAG6 was inhibited by SPAG6-shRNA lentivirus in SKM-1 cells. Additionally, the results of flow cytometry, Cell Counting Kit-8 assay and western blot analysis implied that the TRAIL signal pathway could be inhibited by a high expression of SPAG6. However, SPAG6 cannot influence the expression of TRAIL death receptors, except for FADD. Additionally the interaction between FADD and TRAIL death receptors also increased in SKM-1 cells infected with SPAG6-shRNA lentivirus. Thus, our study demonstrates that SPAG6 may regulate apoptosis in SKM-1 through the TRAIL signal pathway, indicating that SPAG6 could be a potential therapeutic target.

  10. RNAi reduces expression and intracellular retention of mutant cartilage oligomeric matrix protein.

    Directory of Open Access Journals (Sweden)

    Karen L Posey

    2010-04-01

    Full Text Available Mutations in cartilage oligomeric matrix protein (COMP, a large extracellular glycoprotein expressed in musculoskeletal tissues, cause two skeletal dysplasias, pseudoachondroplasia and multiple epiphyseal dysplasia. These mutations lead to massive intracellular retention of COMP, chondrocyte death and loss of growth plate chondrocytes that are necessary for linear growth. In contrast, COMP null mice have only minor growth plate abnormalities, normal growth and longevity. This suggests that reducing mutant and wild-type COMP expression in chondrocytes may prevent the toxic cellular phenotype causing the skeletal dysplasias. We tested this hypothesis using RNA interference to reduce steady state levels of COMP mRNA. A panel of shRNAs directed against COMP was tested. One shRNA (3B reduced endogenous and recombinant COMP mRNA dramatically, regardless of expression levels. The activity of the shRNA against COMP mRNA was maintained for up to 10 weeks. We also demonstrate that this treatment reduced ER stress. Moreover, we show that reducing steady state levels of COMP mRNA alleviates intracellular retention of other extracellular matrix proteins associated with the pseudoachondroplasia cellular pathology. These findings are a proof of principle and the foundation for the development of a therapeutic intervention based on reduction of COMP expression.

  11. Loss of Selenium-Binding Protein 1 Decreases Sensitivity to Clastogens and Intracellular Selenium Content in HeLa Cells.

    Science.gov (United States)

    Zhao, Changhui; Zeng, Huawei; Wu, Ryan T Y; Cheng, Wen-Hsing

    2016-01-01

    Selenium-binding protein 1 (SBP1) is not a selenoprotein but structurally binds selenium. Loss of SBP1 during carcinogenesis usually predicts poor prognosis. Because genome instability is a hallmark of cancer, we hypothesize that SBP1 sequesters cellular selenium and sensitizes cancer cells to DNA-damaging agents. To test this hypothesis, we knocked down SBP1 expression in HeLa cervical cancer cells by employing a short hairpin RNA (shRNA) approach. Reduced sensitivity to hydrogen peroxide, paraquat and camptothecin, reactive oxygen species content, and intracellular retention of selenium after selenomethionine treatment were observed in SBP1 shRNA HeLa cells. Results from Western analyses showed that treatment of HeLa cells with selenomethionine resulted in increased SBP1 protein expression in a dose-dependent manner. Knockdown of SBP1 rendered HeLa cells increased expression of glutathione peroxidase-1 but not glutathione peroxidase-4 protein levels and accelerated migration from a wound. Altogether, SBP1 retains supplemental selenium and sensitizes HeLa cancer cells to clastogens, suggesting a new cancer treatment strategy by sequestering selenium through SBP1.

  12. p600 regulates spindle orientation in apical neural progenitors and contributes to neurogenesis in the developing neocortex

    Directory of Open Access Journals (Sweden)

    Camille Belzil

    2014-05-01

    Full Text Available Apical neural progenitors (aNPs drive neurogenesis by means of a program consisting of self-proliferative and neurogenic divisions. The balance between these two manners of division sustains the pool of apical progenitors into late neurogenesis, thereby ensuring their availability to populate the brain with terminal cell types. Using knockout and in utero electroporation mouse models, we report a key role for the microtubule-associated protein 600 (p600 in the regulation of spindle orientation in aNPs, a cellular event that has been associated with cell fate and neurogenesis. We find that p600 interacts directly with the neurogenic protein Ndel1 and that aNPs knockout for p600, depleted of p600 by shRNA or expressing a Ndel1-binding p600 fragment all display randomized spindle orientation. Depletion of p600 by shRNA or expression of the Ndel1-binding p600 fragment also results in a decreased number of Pax6-positive aNPs and an increased number of Tbr2-positive basal progenitors destined to become neurons. These Pax6-positive aNPs display a tilted mitotic spindle. In mice wherein p600 is ablated in progenitors, the production of neurons is significantly impaired and this defect is associated with microcephaly. We propose a working model in which p600 controls spindle orientation in aNPs and discuss its implication for neurogenesis.

  13. Advanced glycation end product-induced astrocytic differentiation of cultured neurospheres through inhibition of Notch-Hes1 pathway-mediated neurogenesis.

    Science.gov (United States)

    Guo, Yijing; Wang, Pin; Sun, Haixia; Cai, Rongrong; Xia, Wenqing; Wang, Shaohua

    2013-12-23

    This study aims to investigate the roles of the Notch-Hes1 pathway in the advanced glycation end product (AGE)-mediated differentiation of neural stem cells (NSCs). We prepared pLentiLox3.7 lentiviral vectors that express short hairpin RNA (shRNA) against Notch1 and transfected it into NSCs. Cell differentiation was analyzed under confocal laser-scanning microscopy. The percentage of neurons and astrocytes was quantified by normalizing the total number of TUJ1+ (Neuron-specific class III β-tubulin) and GFAP+ (Glial fibrillary acidic protein) cells to the total number of Hoechst 33342-labeled cell nuclei. The protein and gene expression of Notch-Hes1 pathway components was examined via western blot analysis and real-time PCR. After 1 week of incubation, we found that AGE-bovine serum albumin (BSA) (400 μg/mL) induced the astrocytic differentiation of cultured neurospheres and inhibited neuronal formation. The expression of Notch-Hes1 pathway components was upregulated in the cells in the AGE-BSA culture medium. Immunoblot analysis indicated that shRNA silencing of Notch1 expression in NSCs significantly increases neurogenesis and suppresses astrocytic differentiation in NSCs incubated with AGE-BSA. AGEs promote the astrocytic differentiation of cultured neurospheres by inhibiting neurogenesis through the Notch-Hes1 pathway, providing a potential therapeutic target for hyperglycemia-related cognitive deficits.

  14. [Knockdown of dopamine receptor D2 upregulates the expression of adiogenic genes in mouse primary mesencephalic neurons].

    Science.gov (United States)

    Ding, Jiaqi; Chen, Xiaoli; Lin, Jiaji; Zhu, Junling; Li, Zhuyi

    2018-01-01

    Objective To study the effects of dopamine receptor D2 (DRD2) on the adipogenesis genes in mouse primary mesencephalic neurons. Methods The lentiviral vectors which expressed specific shRNA targeting DRD2 were constructed to decrease DRD2 expression in mouse primary mesencephalic neurons. High throughput sequencing (HTS) analysis was used to investigate gene expression changes between the DRD2 knock-down group and the negative control group. Real-time quantitative PCR (qRT-PCR) and Western blot analysis were applied to verify the differently expressed genes. Fatty acids were measured by fatty acid detection kit. Results DRD2 expression was effectively down-regulated in mouse primary mesencephalic neurons by lentiviral vectors. HTS revealed adipogenesis genes were significantly up-regulated after DRD2 down-regulation, mainly including delta(14)-sterol reductase, acetyl-coenzyme A synthetase, insulin-induced gene 1 protein and especially stearoyl-coenzyme A desaturase 1 (SCD1, 4-fold upregulated). The qRT-PCR and Western blot analysis verified that SCD1 was upregulated 2.6 folds and 2 folds respectively by lentiviral DRD2-shRNA vectors. Moreover, the SCD1-related free fatty acids were significantly more increased than the negative control group. Conclusion DRD2 in primary mesencephalic neurons had a significant regulative effect on the adipogenesis genes. The up-regulation of SCD1 can accelerate the conversion of saturated fatty acids to monounsaturated fatty acids and prevent the damage of lipid toxicity to cells.

  15. Lentiviral-mediated RNAi targeting caspase-3 inhibits apoptosis induced by serum deprivation in rat endplate chondrocytes in vitro

    Energy Technology Data Exchange (ETDEWEB)

    Ding, L.; Wu, J.P. [Fudan University, Jinshan Hospital, Department of Orthopaedics, Shanghai, China, Department of Orthopaedics, Jinshan Hospital, Fudan University, Shanghai (China); Xu, G. [Fudan University, Jinshan Hospital, Center Laboratory, Shanghai, China, Center Laboratory, Jinshan Hospital, Fudan University, Shanghai (China); Zhu, B.; Zeng, Q.M.; Li, D.F.; Lu, W. [Fudan University, Jinshan Hospital, Department of Orthopaedics, Shanghai, China, Department of Orthopaedics, Jinshan Hospital, Fudan University, Shanghai (China)

    2014-05-09

    Current studies find that degenerated cartilage endplates (CEP) of vertebrae, with fewer diffusion areas, decrease nutrient supply and accelerate intervertebral disc degeneration. Many more apoptotic cells have been identified in degenerated than in normal endplates, and may be responsible for the degenerated grade. Previous findings suggest that inhibition of apoptosis is one possible approach to improve disc regeneration. It is postulated that inhibition of CEP cell apoptosis may be responsible for the regeneration of endplates. Caspase-3, involved in the execution phase of apoptosis, is a candidate for regulating the apoptotic process. In the present study, CEP cells were incubated in 1% fetal bovine serum. Activated caspases were detected to identify the apoptotic pathway, and apoptosis was quantified by flow cytometry. Lentiviral caspase-3 short hairpin RNA (shRNA) was employed to study its protective effects against serum deprivation. Silencing of caspase-3 expression was quantified by reverse transcription-polymerase chain reaction and Western blots, and inhibition of apoptosis was quantified by flow cytometry. Serum deprivation increased apoptosis of rat CEP cells through activation of a caspase cascade. Lentiviral caspase-3 shRNA was successfully transduced into CEP cells, and specifically silenced endogenous caspase-3 expression. Surviving cells were protected by the downregulation of caspase-3 expression and activation. Thus, lentiviral caspase-3 shRNA-mediated RNAi successfully silenced endogenous caspase-3 expression, preventing inappropriate or premature apoptosis.

  16. FAT/CD36: a major regulator of neuronal fatty acid sensing and energy homeostasis in rats and mice.

    Science.gov (United States)

    Le Foll, Christelle; Dunn-Meynell, Ambrose; Musatov, Serguei; Magnan, Christophe; Levin, Barry E

    2013-08-01

    Hypothalamic "metabolic-sensing" neurons sense glucose and fatty acids (FAs) and play an integral role in the regulation of glucose, energy homeostasis, and the development of obesity and diabetes. Using pharmacologic agents, we previously found that ~50% of these neurons responded to oleic acid (OA) by using the FA translocator/receptor FAT/CD36 (CD36). For further elucidation of the role of CD36 in neuronal FA sensing, ventromedial hypothalamus (VMH) CD36 was depleted using adeno-associated viral (AAV) vector expressing CD36 short hairpin RNA (shRNA) in rats. Whereas their neuronal glucosensing was unaffected by CD36 depletion, the percent of neurons that responded to OA was decreased specifically in glucosensing neurons. A similar effect was seen in total-body CD36-knockout mice. Next, weanling rats were injected in the VMH with CD36 AAV shRNA. Despite significant VMH CD36 depletion, there was no effect on food intake, body weight gain, or total carcass adiposity on chow or 45% fat diets. However, VMH CD36-depleted rats did have increased plasma leptin and subcutaneous fat deposition and markedly abnormal glucose tolerance. These results demonstrate that CD36 is a critical factor in both VMH neuronal FA sensing and the regulation of energy and glucose homeostasis.

  17. Lentiviral-mediated RNAi targeting caspase-3 inhibits apoptosis induced by serum deprivation in rat endplate chondrocytes in vitro

    Directory of Open Access Journals (Sweden)

    L. Ding

    2014-06-01

    Full Text Available Current studies find that degenerated cartilage endplates (CEP of vertebrae, with fewer diffusion areas, decrease nutrient supply and accelerate intervertebral disc degeneration. Many more apoptotic cells have been identified in degenerated than in normal endplates, and may be responsible for the degenerated grade. Previous findings suggest that inhibition of apoptosis is one possible approach to improve disc regeneration. It is postulated that inhibition of CEP cell apoptosis may be responsible for the regeneration of endplates. Caspase-3, involved in the execution phase of apoptosis, is a candidate for regulating the apoptotic process. In the present study, CEP cells were incubated in 1% fetal bovine serum. Activated caspases were detected to identify the apoptotic pathway, and apoptosis was quantified by flow cytometry. Lentiviral caspase-3 short hairpin RNA (shRNA was employed to study its protective effects against serum deprivation. Silencing of caspase-3 expression was quantified by reverse transcription-polymerase chain reaction and Western blots, and inhibition of apoptosis was quantified by flow cytometry. Serum deprivation increased apoptosis of rat CEP cells through activation of a caspase cascade. Lentiviral caspase-3 shRNA was successfully transduced into CEP cells, and specifically silenced endogenous caspase-3 expression. Surviving cells were protected by the downregulation of caspase-3 expression and activation. Thus, lentiviral caspase-3 shRNA-mediated RNAi successfully silenced endogenous caspase-3 expression, preventing inappropriate or premature apoptosis.

  18. Ab initio study on the reaction between uranium and O2

    International Nuclear Information System (INIS)

    Shuai Maobing; Zhao Pengji; Tian Anmin

    2000-08-01

    Optimized geometries, total energies and electronic structures of some gaseous atoms and molecules of uranium-oxygen system are calculated with harmonic vibration analysis using ab initio method. The potential energy surfaces (PESs) of the uranium oxidation process are also constructed. The calculated optimized geometries, infrared vibrational frequencies and the first ionized potential energies are in well accordance with available experimental data. Although U6p, U7s and U6d valence orbital electrons take part in the formation of U - O bond, the U5f electrons play an dominant role in this process and because the energies of U5f, U6d, U7s and Uds atomic orbitals are close to each other, these orbitals may hybrid and interact with O2p orbital, simultaneously, to form molecular orbitals of uranium oxides. The PESs show that different reaction modes result in different product geometries

  19. Cajal bodies and snRNPs friends with benefits

    Czech Academy of Sciences Publication Activity Database

    Staněk, David

    2017-01-01

    Roč. 14, č. 6 (2017), s. 671-679 ISSN 1547-6286 R&D Projects: GA ČR GA15-00790S Institutional support: RVO:68378050 Keywords : spinal muscular-atrophy * small nuclear-rna * u4/u6.u5 tri-snrnp * xenopus-laevis oocytes * u6 spliceosomal rna * coiled bodies * smn complex * u1 snrnp * u2 snrnp * in-vivo Subject RIV: EB - Genetics ; Molecular Biology OBOR OECD: Cell biology Impact factor: 3.900, year: 2016

  20. Progress toward uranium scrap recycling via electron beam cold hearth refining

    International Nuclear Information System (INIS)

    McKoon, R.H.

    1994-01-01

    A 250 kW electron beam cold hearth refining (EBCHR) melt furnace at Lawrence Livermore National Laboratory (LLNL) has been in operation for over a year producing 5.5 in.-diameter ingots of various uranium alloys. Production of in-specification uranium-6%-niobium (U-6Nb) alloy ingots has been demonstrated using Virgin feedstock. A vibratory scrap feeder has been installed on the system and the ability to recycle chopped U-6Nb scrap has been established. A preliminary comparison of vacuum arc remelted (VAR) and electron beam (EB) melted product is presented

  1. Progress toward uranium scrap recycling via Electron Cold Hearth Refining (EBCHR)

    International Nuclear Information System (INIS)

    McKoon, R.H.

    1994-01-01

    A 250 kW electron beam cold hearth refining (EBCHR) melt furnace at Lawrence Livermore National Laboratory (LLNL) has been in operation for over a year producing 5.5 in.-diameter ingots of various uranium alloys. Production of in-specification uranium-6% - niobium (U-6Nb) alloy ingots has been demonstrated using virgin feedstock. A vibratory scrap feeder has been installed on the system and the ability to recycle chopped U-6Nb scrap has been established. A preliminary comparison of vacuum arc remelted (VAR) and electron beam (EB) melted product is presented

  2. Impact strength of the uranium-6 weight percent niobium alloy between -1980 and +2000C

    International Nuclear Information System (INIS)

    Anderson, R.C.

    1981-09-01

    A study was conducted to determine if a ductile-to-brittle transition wxisted for the uranium-6 wt % niobium (U-6Nb) alloy. Standard V-notched Charpy bars were made from both solution-quenched and solution-quenched and aged U-6Nb alloy and were tested between -198 0 and +200 0 C. It was found that a sharp ductile-brittle transition does not exist for the alloy. A linear relationship existed between test temperature and impact strength, and the alloy retained a significant amount of impact strength even at very low temperatures. 9 figures

  3. Comparison of Store Trajectory and Aerodynamic Loads, and Model Flow- Field Characteristics Obtained in the AEDC PWT/4T and VFK/A Wind Tunnels at Mach Number 1.63

    Science.gov (United States)

    1979-02-01

    8217 -13.2 i 2 Lt 5 8 10 D Zp . I i 2 u, 6 8 Zp b. Xp = O, Yp = -1 in., 0 = O, ~ = 0 Figure 17. Continued. 10 44 5YM TUNNEL REXI ~ e 0 4" 5.0 0 A...TUNNEL REXI ~ s 0 ~T 3.~ 0 R 5.0 CN Cm 6 ,u, 2 0 -2 -u, 6 I i𔃻 i I I I, t~ l I P -2 i i - 6 i Cy 2 i I ~ , r - - - I -2

  4. Rocky Mountain Arsenal Ecological Chemical Data (1984-1985)

    Science.gov (United States)

    1986-03-01

    0 0.00 0.05 LT DL US6 EPA ERR - ERR P,.ACOL LIV 3001 84242- 84243 CIMP 2 0 0.00 0.05 LT OL U66 ERR ERR - ERR PHACOL LIV O’ i4279- -4271 01? M0. 0...001 1094 M 84242 85058 CPMS02 LT 2.000 -1 UGG DBCP LT 2.000 -2 U6S cIMP LT 5.000 -2 UGS DITH LT 2.000 -1 U6G DLDRN 5.000 -2 UGG ENORN LT 2.000 -2 UGG

  5. Direct transcriptional activation of BT genes by NLP transcription factors is a key component of the nitrate response in Arabidopsis.

    Science.gov (United States)

    Sato, Takeo; Maekawa, Shugo; Konishi, Mineko; Yoshioka, Nozomi; Sasaki, Yuki; Maeda, Haruna; Ishida, Tetsuya; Kato, Yuki; Yamaguchi, Junji; Yanagisawa, Shuichi

    2017-01-29

    Nitrate modulates growth and development, functioning as a nutrient signal in plants. Although many changes in physiological processes in response to nitrate have been well characterized as nitrate responses, the molecular mechanisms underlying the nitrate response are not yet fully understood. Here, we show that NLP transcription factors, which are key regulators of the nitrate response, directly activate the nitrate-inducible expression of BT1 and BT2 encoding putative scaffold proteins with a plant-specific domain structure in Arabidopsis. Interestingly, the 35S promoter-driven expression of BT2 partially rescued growth inhibition caused by reductions in NLP activity in Arabidopsis. Furthermore, simultaneous disruption of BT1 and BT2 affected nitrate-dependent lateral root development. These results suggest that direct activation of BT1 and BT2 by NLP transcriptional activators is a key component of the molecular mechanism underlying the nitrate response in Arabidopsis. Copyright © 2016 Elsevier Inc. All rights reserved.

  6. Engineered promoters enable constant gene expression at any copy number in bacteria.

    Science.gov (United States)

    Segall-Shapiro, Thomas H; Sontag, Eduardo D; Voigt, Christopher A

    2018-04-01

    The internal environment of growing cells is variable and dynamic, making it difficult to introduce reliable parts, such as promoters, for genetic engineering. Here, we applied control-theoretic ideas to design promoters that maintained constant levels of expression at any copy number. Theory predicts that independence to copy number can be achieved by using an incoherent feedforward loop (iFFL) if the negative regulation is perfectly non-cooperative. We engineered iFFLs into Escherichia coli promoters using transcription-activator-like effectors (TALEs). These promoters had near-identical expression in different genome locations and plasmids, even when their copy number was perturbed by genomic mutations or changes in growth medium composition. We applied the stabilized promoters to show that a three-gene metabolic pathway to produce deoxychromoviridans could retain function without re-tuning when the stabilized-promoter-driven genes were moved from a plasmid into the genome.

  7. Molecular convergence of the parasitic plant species Cuscuta reflexa and Phelipanche aegyptiaca.

    Science.gov (United States)

    Rehker, Jan; Lachnit, Magdalena; Kaldenhoff, Ralf

    2012-08-01

    The parasitic plant species Cuscuta reflexa and Phelipanche aegyptiaca have independently developed parasitism, the former parasitizing on shoots and the latter attaching to roots. Regardless of these differences, the two species use similar organs, termed haustoria, to attach to the host plant. In this study, we show that this morphological similarity can be extended to the molecular level. An attAGP-promoter from Solanum lycopersicum, which is activated by Cuscuta infections, was also induced after infection by P. aegyptiaca. Furthermore, we show by validation of transcriptome sequencing data that the Phelipanche orthologue of a haustorium-specific Cuscuta gene, which codes for a cysteine proteinase, was activated in the early stages of Phelipanche invasion. Inhibition of the Phelipanche cysteine proteinase was achieved by 35S- or attAGP-promoter-driven expression of its intrinsic inhibitory polypeptide. A reduction in P. aegyptiaca infection rates during experiments in flower pots and in an in vitro polybag system in comparison to controls was recorded.

  8. Analysis of miR-302 host RNA as a stem cell marker

    DEFF Research Database (Denmark)

    Rahimi, Karim

    Stem cells have unique properties including self-renewal and multipotency that are shared with cancer stem cells (CSCs). MicroRNAs are short non-coding RNAs that posttranscriptionally regulate gene expression either by degradation or by translation inhibition of their mRNA targets. Mi...... in somatic cells and to repress mRNAs required for differentiation. In this study, we explored the possibility to use the miR-302 promoter/enhancer to drive stem cell specific expression of reporter genes. We first performed 'Rapid Amplification of cDNA Ends' (RACE) for the 5’ and 3’ ends of mmiR-302......, we were able to select stem cell like cells from teratomas which we used as tumor models for a proof of principle experiment. As predicted by our hypothesis, expression of the miR-302 promoter driven reporter was dependend on the undifferentiated state of the cells and cells not under selection...

  9. Hypoxia- and radiation-inducible, breast cell-specific targeting of retroviral vectors

    International Nuclear Information System (INIS)

    Lipnik, Karoline; Greco, Olga; Scott, Simon; Knapp, Elzbieta; Mayrhofer, Elisabeth; Rosenfellner, Doris; Guenzburg, Walter H.; Salmons, Brian; Hohenadl, Christine

    2006-01-01

    To facilitate a more efficient radiation and chemotherapy of mammary tumours, synthetic enhancer elements responsive to hypoxia and ionizing radiation were coupled to the mammary-specific minimal promoter of the murine whey acidic protein (WAP) encoding gene. The modified WAP promoter was introduced into a retroviral promoter conversion (ProCon) vector. Expression of a transduced reporter gene in response to hypoxia and radiation was analysed in stably infected mammary cancer cell lines and an up to 9-fold increase in gene expression demonstrated in comparison to the respective basic vector. Expression analyses in vitro, moreover, demonstrated a widely preserved mammary cell-specific promoter activity. For in vivo analyses, xenograft tumours consisting of infected human mammary adenocarcinoma cells were established in SCID/beige mice. Immunohistochemical analyses demonstrated a hypoxia-specific, markedly increased WAP promoter-driven expression in these tumours. Thus, this retroviral vector will facilitate a targeted gene therapeutic approach exploiting the unique environmental condition in solid tumours

  10. Co-Targeting Prostate Cancer Epithelium and Bone Stroma by Human Osteonectin-Promoter-Mediated Suicide Gene Therapy Effectively Inhibits Androgen-Independent Prostate Cancer Growth.

    Directory of Open Access Journals (Sweden)

    Shian-Ying Sung

    Full Text Available Stromal-epithelial interaction has been shown to promote local tumor growth and distant metastasis. We sought to create a promising gene therapy approach that co-targets cancer and its supporting stromal cells for combating castration-resistant prostate tumors. Herein, we demonstrated that human osteonectin is overexpressed in the prostate cancer epithelium and tumor stroma in comparison with their normal counterpart. We designed a novel human osteonectin promoter (hON-522E containing positive transcriptional regulatory elements identified in both the promoter and exon 1 region of the human osteonectin gene. In vitro reporter assays revealed that the hON-522E promoter is highly active in androgen receptor negative and metastatic prostate cancer and bone stromal cells compared to androgen receptor-positive prostate cancer cells. Moreover, in vivo prostate-tumor-promoting activity of the hON-522E promoter was confirmed by intravenous administration of an adenoviral vector containing the hON-522E promoter-driven luciferase gene (Ad-522E-Luc into mice bearing orthotopic human prostate tumor xenografts. In addition, an adenoviral vector with the hON-522E-promoter-driven herpes simplex virus thymidine kinase gene (Ad-522E-TK was highly effective against the growth of androgen-independent human prostate cancer PC3M and bone stromal cell line in vitro and in pre-established PC3M tumors in vivo upon addition of the prodrug ganciclovir. Because of the heterogeneity of human prostate tumors, hON-522E promoter-mediated gene therapy has the potential for the treatment of hormone refractory and bone metastatic prostate cancers.

  11. Irradiation testing of high density uranium alloy dispersion fuels

    International Nuclear Information System (INIS)

    Hayes, S.L.; Trybus, C.L.; Meyer, M.K.

    1997-10-01

    Two irradiation test vehicles have been designed, fabricated, and inserted into the Advanced Test Reactor in Idaho. Irradiation of these experiments began in August 1997. These irradiation tests were designed to obtain irradiation performance information on a variety of potential new, high-density dispersion fuels. Each of the two irradiation vehicles contains 32 microplates. Each microplate is aluminum clad, having an aluminum matrix phase and containing one of the following compositions as the fuel phase: U-10Mo, U-8Mo, U-6Mo, U-4Mo, U-9Nb-3Zr, U-6Nb-4Zr, U-5Nb-3Zr, U-6Mo-1Pt, U-6Mo-0.6Ru, U-10Mo-0.05Sn, U 2 Mo, or U 3 Si 2 . These experiments will be discharged at peak fuel burnups of 40% and 80%. Of particular interest is the fission gas retention/swelling characteristics of these new fuel alloys. This paper presents the design of the irradiation vehicles and the irradiation conditions

  12. HgCdTe Surface and Defect Study Program.

    Science.gov (United States)

    1985-07-01

    a! Td . - a,+ - , are the bonding and antibonding one electron energy states "- "𔃾 owing only to covalent and ionic interactions, . = T . . (U6 II .1...Group Meeting. Boulder CO. 1983; T. W. Jamet atid B. Fandvacncyforatin eerg) t inreae popotioal o a Ziack. 4bd . low inverse power of the average bond

  13. Postirradiation examination of high-density uranium alloy dispersion fuels

    International Nuclear Information System (INIS)

    Hayes, S.L.; Meyer, M.K.; Hofman, G.L.; Strain, R.V.

    1998-01-01

    Two irradiation test vehicles, designated RERTR-2, were inserted into the Advanced Test reactor in Idaho in August 1997. These tests were designed to obtain irradiation performance information on a variety of potential new, high-density uranium alloy dispersion fuels, including U-10Mo, U-8Mo, U-6Mo, U-4Mo, U-9Nb-3Zr, U-6Nb-4Zr, U-5Nb-3Zr, U-6Mo-1Pt, U-6Mo-0.6Ru and U-10Mo-0.05Sn: the intermetallic compounds U 2 Mo and U-10Mo-0.-5Sn; the intermetallic compounds U 2 Mo and U 3 Si 2 were also included in the fuel test matrix. These fuels are included in the experiments as microplates (76 mm x 22 mm x 1.3mm outer dimensions) with a nominal fuel volume loading of 25% and irradiated at relatively low temperature (∼100 deg C). RERTR-1 and RERTR-2 were discharged from the reactor in November 1997 and July 1998, respectively at calculated peak fuel burnups of 45 and 71 at %-U 235 Both experiments are currently under examination at the Alpha Gamma Hot Cell Facility at Argonne National Laboratory in Chicago. This paper presents the postirradiation examination results available to date from these experiments. (author)

  14. Unprecedented reduction of the uranyl ion [UO2]2+ into a polyoxo uranium(IV) cluster: synthesis and crystal structure of the first f-element oxide with a M6(micro3-O)8 core.

    Science.gov (United States)

    Berthet, Jean-Claude; Thuéry, Pierre; Ephritikhine, Michel

    2005-07-21

    The smooth comproportionation reaction of the U(VI) and U(III) complexes UO2(OTf)2 and U(OTf)3, afforded the hexanuclear U(IV) oxide cluster [U6(micro3-O)8(micro2-OTf)8(py)8], a rare example of a metal oxide with a M6(micro3-O)8 core.

  15. Influence of temperature, strain rate and thermal aging on the structure/property behavior of uranium 6 wt% Nb

    Energy Technology Data Exchange (ETDEWEB)

    Cady, C.M.; Gray, G.T.; Chen, S.R.; Lopez, M.F. [Los Alamos National Lab., MST-8, MS G-755, NM (United States); Field, R.D.; Korzekwa, D.R. [Los Alamos National Lab., MST-6, MS G-770, NM (United States); Hixson, R.S. [Los Alamos National Lab, DX-9, MS P-952, NM (United States)

    2006-08-15

    A rigorous experimentation and validation program is being undertaken to create constitutive models that elucidate the fundamental mechanisms controlling plasticity in uranium-6 wt% niobium alloys (U-6Nb). These models should accurately predict high-strain-rate large-strain plasticity, damage evolution and failure. The goal is a physically-based constitutive model that captures 1) an understanding of how strain rate, temperature, and aging affects the mechanical response of a material, and 2) an understanding of the operative deformation mechanisms. The stress-strain response of U-6Nb has been studied as a function of temperature, strain-rate, and thermal aging. U-6Nb specimens in a solution-treated and quenched condition and after subsequent aging at 473 K for 2 hours were studied. The constitutive behavior was evaluated over the range of strain rates from quasi-static (0.001 s{sup -1}) to dynamic ({approx} 2000 s{sup -1}) and temperatures ranging from 77 to 773 K. The yield stress of U-6Nb was exhibited pronounced temperature sensitivity. The strain hardening rate is seen to be less sensitive to strain rate and temperature beyond plastic strains of 0.10. The yield strength of the aged material is less significantly affected by temperature and the work hardening rate shows adiabatic heating at lower strains rates (1/s). (authors)

  16. Evaluation of MicroRNA 125b as a potential biomarker for ...

    African Journals Online (AJOL)

    miRNA – CT endogenous control U6 RNA) and ΔΔCT= (ΔCT– average ΔCT of ... more robust due to its much lower false positive rate than .... of studies demonstrating the predictive value of ... funding model which does not charge readers or ...

  17. Irradiation testing of high-density uranium alloy dispersion fuels

    International Nuclear Information System (INIS)

    Hayes, S.L.; Trybus, C.L.; Meyer, M.K.

    1997-01-01

    Two irradiation test vehicles have been designed, fabricated, and inserted into the Advanced Test Reactor in Idaho. Irradiation of these experiments began in August 1997. These irradiation tests were designed to obtain irradiation performance information on a variety of potential new, high-density dispersion fuels. Each of the two irradiation vehicles contains 32 'microplates'. Each microplate is aluminum clad, having an aluminum matrix phase and containing one of the following compositions as the fuel phase: U-10Mo, U-8Mo, U-6Mo, U-4Mo, U-9Nb-3Zr, U-6Nb-4Zr, U-5Nb-3Zr, U-6Mo-1Pt, U-6Mo-0.6Ru, U10Mo-0.05Sn, U2Mo, or U 3 Si 2 . These experiments will be discharged at peak fuel burnups of approximately 40 and 80 at.% U 235 . Of particular interest are the extent of reaction of the fuel and matrix phases and the fission gas retention/swelling characteristics of these new fuel alloys. This paper presents the design of the irradiation vehicles and the irradiation conditions. (author)

  18. Implementation of a new memristor-based multiscroll hyperchaotic ...

    Indian Academy of Sciences (India)

    2017-01-17

    Jan 17, 2017 ... The memris- tor model is simulated by circuit simulation. On this .... attractor generated by means of MATLAB simulation is illustrated in figure 5. .... to the input of the amplifier U6, realizing the process of integration, and then ...

  19. Tumor-targeting magnetic lipoplex delivery of short hairpin RNA suppresses IGF-1R overexpression of lung adenocarcinoma A549 cells in vitro and in vivo

    Energy Technology Data Exchange (ETDEWEB)

    Wang, Chunmao; Ding, Chao; Kong, Minjian [Department of Cardiothoracic Surgery, Second Affiliated Hospital, School of Medicine, Zhejiang University, Hangzhou 310009 (China); Dong, Aiqiang, E-mail: dr_dongaiqiang@sina.com [Department of Cardiothoracic Surgery, Second Affiliated Hospital, School of Medicine, Zhejiang University, Hangzhou 310009 (China); Qian, Jianfang; Jiang, Daming; Shen, Zhonghua [Department of Cardiothoracic Surgery, Second Affiliated Hospital, School of Medicine, Zhejiang University, Hangzhou 310009 (China)

    2011-07-08

    Highlights: {yields} We compared lipofection with magnetofection about difference of transfection efficiency on delivery a therapeutic gene in vitro and in vivo. {yields} We investigated the difference of shRNA induced by magnetofection and lipofection into A549 cell and subcutaneous tumor to knockdown IGF-1R overexpressed in A549 cell and A549 tumor. {yields} We investigated in vivo shRNA silenced IGF-1R overexpression 24, 48, and 72 h after shRNA intravenous injection into tumor-bearing mice by way of magnetofection and lipofection. {yields} Our results showed that magnetofection could achieve therapeutic gene targeted delivery into special site, which contributed to targeted gene therapy of lung cancers. -- Abstract: Liposomal magnetofection potentiates gene transfection by applying a magnetic field to concentrate magnetic lipoplexes onto target cells. Magnetic lipoplexes are self-assembling ternary complexes of cationic lipids with plasmid DNA associated with superparamagnetic iron oxide nanoparticles (SPIONs). Type1insulin-like growth factor receptor (IGF-1R), an important oncogene, is frequently overexpressed in lung cancer and mediates cancer cell proliferation and tumor growth. In this study, we evaluated the transfection efficiency (percentage of transfected cells) and therapeutic potential (potency of IGF-1R knockdown) of liposomal magnetofection of plasmids expressing GFP and shRNAs targeting IGF-1R (pGFPshIGF-1Rs) in A549 cells and in tumor-bearing mice as compared to lipofection using Lipofectamine 2000. Liposomal magnetofection provided a threefold improvement in transgene expression over lipofection and transfected up to 64.1% of A549 cells in vitro. In vitro, IGF-1R specific-shRNA transfected by lipofection inhibited IGF-1R protein by 56.1 {+-} 6% and by liposomal magnetofection by 85.1 {+-} 3%. In vivo delivery efficiency of the pGFPshIGF-1R plasmid into the tumor was significantly higher in the liposomal magnetofection group than in the

  20. Tumor-targeting magnetic lipoplex delivery of short hairpin RNA suppresses IGF-1R overexpression of lung adenocarcinoma A549 cells in vitro and in vivo

    International Nuclear Information System (INIS)

    Wang, Chunmao; Ding, Chao; Kong, Minjian; Dong, Aiqiang; Qian, Jianfang; Jiang, Daming; Shen, Zhonghua

    2011-01-01

    Highlights: → We compared lipofection with magnetofection about difference of transfection efficiency on delivery a therapeutic gene in vitro and in vivo. → We investigated the difference of shRNA induced by magnetofection and lipofection into A549 cell and subcutaneous tumor to knockdown IGF-1R overexpressed in A549 cell and A549 tumor. → We investigated in vivo shRNA silenced IGF-1R overexpression 24, 48, and 72 h after shRNA intravenous injection into tumor-bearing mice by way of magnetofection and lipofection. → Our results showed that magnetofection could achieve therapeutic gene targeted delivery into special site, which contributed to targeted gene therapy of lung cancers. -- Abstract: Liposomal magnetofection potentiates gene transfection by applying a magnetic field to concentrate magnetic lipoplexes onto target cells. Magnetic lipoplexes are self-assembling ternary complexes of cationic lipids with plasmid DNA associated with superparamagnetic iron oxide nanoparticles (SPIONs). Type1insulin-like growth factor receptor (IGF-1R), an important oncogene, is frequently overexpressed in lung cancer and mediates cancer cell proliferation and tumor growth. In this study, we evaluated the transfection efficiency (percentage of transfected cells) and therapeutic potential (potency of IGF-1R knockdown) of liposomal magnetofection of plasmids expressing GFP and shRNAs targeting IGF-1R (pGFPshIGF-1Rs) in A549 cells and in tumor-bearing mice as compared to lipofection using Lipofectamine 2000. Liposomal magnetofection provided a threefold improvement in transgene expression over lipofection and transfected up to 64.1% of A549 cells in vitro. In vitro, IGF-1R specific-shRNA transfected by lipofection inhibited IGF-1R protein by 56.1 ± 6% and by liposomal magnetofection by 85.1 ± 3%. In vivo delivery efficiency of the pGFPshIGF-1R plasmid into the tumor was significantly higher in the liposomal magnetofection group than in the lipofection group. In vivo IGF-1R

  1. ERK1/2 signalling pathway is involved in CD147-mediated gastric cancer cell line SGC7901 proliferation and invasion.

    Science.gov (United States)

    Chen, Liping; Pan, Yuqin; Gu, Ling; Nie, Zhenlin; He, Bangshun; Song, Guoqi; Li, Rui; Xu, Yeqiong; Gao, Tianyi; Wang, Shukui

    2013-08-01

    This study aimed to investigate the role of CD147 in the progression of gastric cancer and the signalling pathway involved in CD147-mediated gastric cancer cell line SGC7901 proliferation and invasion. Short hairpin RNA (shRNA) expression vectors targeting CD147 were constructed to silence CD147, and the expression of CD147 was monitored by quantitative realtime reverse transcriptase polymerase chain reaction and Western blot and further confirmed by immunohistochemistry in vivo. Cell proliferation was determined by Cell Counting Kit-8 assay, the activities of matrix metalloproteinase (MMP)-2 and MMP-9 were determined by gelatin zymography, and the invasion of SGC7901 was determined by invasion assay. The phosphorylation and non-phosphorylation of the mitogen-activated protein kinases, extracellular signal-regulated kinase1/2 (ERK1/2), P38 and c-Jun NH2-terminal kinase were examined by Western blot. Additionally, the ERK1/2 inhibitor U0126 were used to confirm the signalling pathway involved in CD147-mediated SGC7901 progression. The BALB/c nude mice were used to study tumour progression in vivo. The results revealed that CD147 silencing inhibited the proliferation and invasion of SGC7901 cells, and down-regulated the activities of MMP-2 and MMP-9 and the phosphorylation of the ERK1/2 in SGC7901 cells. ERK1/2 inhibitor U0126 decreased the proliferation, and invasion of SGC7901 cells, and down-regulated the MMP-2 and MMP-9 activities. In a nude mouse model of subcutaneous xenografts, the tumour volume was significantly smaller in the SGC7901/shRNA group compared to the SGC7901 and SGC7901/snc-RNA group. Immunohistochemistry analysis showed that CD147 and p-ERK1/2 protein expressions were down-regulated in the SGC7901/shRNA2 group compared to the SGC7901 and SGC7901/snc-RNA group. These results suggest that ERK1/2 pathway involves in CD147-mediated gastric cancer growth and invasion. These findings further highlight the importance of CD147 in cancer progression

  2. Clinical significance of proliferation, apoptosis and senescence of nasopharyngeal cells by the simultaneously blocking EGF, IGF-1 receptors and Bcl-xl genes

    International Nuclear Information System (INIS)

    Dai, Guodong; Peng, Tao; Zhou, Xuhong; Zhu, Jun; Kong, Zhihua; Ma, Li; Xiong, Zhi; Yuan, Yulin

    2013-01-01

    Highlight: •Construction of shRNA segments expression vectors is valid by the investigation of RT-PCR for IGF1R, EGFR and Bcl-xl mRNA and protein expression. •Studies have suggested that the vectors in blocking these genes of the growth factor receptors and anti- apoptosis is capable of breaking the balance of tumor growth so that tumor trend apoptosis and senescence. •Simultaneously blocking multiple genes that are abnormally expressed may be more effective in treating cancer cells than silencing a single gene. -- Abstract: Background: In previous work, we constructed short hairpin RNA (shRNA) expression plasmids that targeted human EGF and IGF-1 receptors messenger RNA, respectively, and demonstrated that these vectors could induce apoptosis of human nasopharyngeal cell lines (CNE2) and inhibit ligand-induced pAkt and pErk activation. Method: We have constructed multiple shRNA expression vectors of targeting EGFR, IGF1R and Bcl-xl, which were transfected to the CNE2 cells. The mRNA expression was assessed by RT-PCR. The growth of the cells, cell cycle progression, apoptosis of the cells, senescent tumor cells and the proteins of EGFR, IGF1R and Bcl-xl were analyzed by MTT, flow cytometry, cytochemical therapy or Western blot. Results: In group of simultaneously blocking EGFR, IGF1R and Bcl-xl genes, the mRNA of EGFR, IGF1R and Bcl-xl expression was decreased by (66.66 ± 3.42)%, (73.97 ± 2.83)% and (64.79 ± 2.83)%, and the protein expressions was diminished to (67.69 ± 4.02)%, (74.32 ± 2.30)%, and (60.00 ± 3.34)%, respectively. Meanwhile, the cell apoptosis increased by 65.32 ± 0.18%, 65.16 ± 0.25% and 55.47 ± 0.45%, and senescent cells increased by 1.42 ± 0.15%, 2.26 ± 0.15% and 3.22 ± 0.15% in the second, third and fourth day cultures, respectively. Conclusions: Simultaneously blocking EGFR, IGF1R and Bcl-xl genes is capable of altering the balance between proliferating versus apoptotic and senescent cells in the favor of both of apoptosis and

  3. Protein kinase C-delta inactivation inhibits the proliferation and survival of cancer stem cells in culture and in vivo

    International Nuclear Information System (INIS)

    Chen, Zhihong; Forman, Lora W; Williams, Robert M; Faller, Douglas V

    2014-01-01

    A subpopulation of tumor cells with distinct stem-like properties (cancer stem-like cells, CSCs) may be responsible for tumor initiation, invasive growth, and possibly dissemination to distant organ sites. CSCs exhibit a spectrum of biological, biochemical, and molecular features that are consistent with a stem-like phenotype, including growth as non-adherent spheres (clonogenic potential), ability to form a new tumor in xenograft assays, unlimited self-renewal, and the capacity for multipotency and lineage-specific differentiation. PKCδ is a novel class serine/threonine kinase of the PKC family, and functions in a number of cellular activities including cell proliferation, survival or apoptosis. PKCδ has previously been validated as a synthetic lethal target in cancer cells of multiple types with aberrant activation of Ras signaling, using both genetic (shRNA and dominant-negative PKCδ mutants) and small molecule inhibitors. In contrast, PKCδ is not required for the proliferation or survival of normal cells, suggesting the potential tumor-specificity of a PKCδ-targeted approach. shRNA knockdown was used validate PKCδ as a target in primary cancer stem cell lines and stem-like cells derived from human tumor cell lines, including breast, pancreatic, prostate and melanoma tumor cells. Novel and potent small molecule PKCδ inhibitors were employed in assays monitoring apoptosis, proliferation and clonogenic capacity of these cancer stem-like populations. Significant differences among data sets were determined using two-tailed Student’s t tests or ANOVA. We demonstrate that CSC-like populations derived from multiple types of human primary tumors, from human cancer cell lines, and from transformed human cells, require PKCδ activity and are susceptible to agents which deplete PKCδ protein or activity. Inhibition of PKCδ by specific genetic strategies (shRNA) or by novel small molecule inhibitors is growth inhibitory and cytotoxic to multiple types of human

  4. Interaction of c-Cbl with myosin IIA regulates Bleb associated macropinocytosis of Kaposi's sarcoma-associated herpesvirus.

    Directory of Open Access Journals (Sweden)

    Mohanan Valiya Veettil

    2010-12-01

    Full Text Available KSHV is etiologically associated with Kaposi's sarcoma (KS, an angioproliferative endothelial cell malignancy. Macropinocytosis is the predominant mode of in vitro entry of KSHV into its natural target cells, human dermal microvascular endothelial (HMVEC-d cells. Although macropinocytosis is known to be a major route of entry for many viruses, the molecule(s involved in the recruitment and integration of signaling early during macropinosome formation is less well studied. Here we demonstrate that tyrosine phosphorylation of the adaptor protein c-Cbl is required for KSHV induced membrane blebbing and macropinocytosis. KSHV induced the tyrosine phosphorylation of c-Cbl as early as 1 min post-infection and was recruited to the sites of bleb formation. Infection also led to an increase in the interaction of c-Cbl with PI3-K p85 in a time dependent manner. c-Cbl shRNA decreased the formation of KSHV induced membrane blebs and macropinocytosis as well as virus entry. Immunoprecipitation of c-Cbl followed by mass spectrometry identified the interaction of c-Cbl with a novel molecular partner, non-muscle myosin heavy chain IIA (myosin IIA, in bleb associated macropinocytosis. Phosphorylated c-Cbl colocalized with phospho-myosin light chain II in the interior of blebs of infected cells and this interaction was abolished by c-Cbl shRNA. Studies with the myosin II inhibitor blebbistatin demonstrated that myosin IIA is a biologically significant component of the c-Cbl signaling pathway and c-Cbl plays a new role in the recruitment of myosin IIA to the blebs during KSHV infection. Myosin II associates with actin in KSHV induced blebs and the absence of actin and myosin ubiquitination in c-Cbl ShRNA cells suggested that c-Cbl is also responsible for the ubiquitination of these proteins in the infected cells. This is the first study demonstrating the role of c-Cbl in viral entry as well as macropinocytosis, and provides the evidence that a signaling complex

  5. An essential role of Nrf2 in American ginseng-mediated anti-oxidative actions in cardiomyocytes.

    Science.gov (United States)

    Li, Jinqing; Ichikawa, Tomonaga; Jin, Yu; Hofseth, Lorne J; Nagarkatti, Prakash; Nagarkatti, Mitzi; Windust, Anthony; Cui, Taixing

    2010-07-20

    Ginseng has been used as a folk medicine for thousands of years in Asia, and has become a popular herbal medicine world-wide. Recent studies have revealed that ginseng, including American ginseng, exerts antioxidant effects in the cardiovascular system; however, the underlying mechanisms are not fully understood. Thus, we investigated role of Nrf2, a master transcription factor of endogenous anti-oxidative defense systems, in the regulation of American ginseng-mediated anti-oxidative actions in cardiomyocytes. A standardized crude extract of American ginseng was supplied by the National Research Council of Canada, Institute for National Measurement Standards. H9C2 cells, a rat cardiomyocyte cell line, were exposed to angiotensin II (Ang II) or tumor necrosis factor alpha (TNFalpha) to induce oxidative stress that was examined by measuring formation of reactive oxygen and nitrogen species. Oxidative stress-induced cell death was induced by exogenous addition of hydrogen peroxide (H(2)O(2)). Proteins were measured by Western blot and mRNA expression was determined by quantitative real time PCR. Nrf2-driven transcriptional activity was assessed by antioxidant response element (ARE)-luciferase reporter assay. Direct Nrf2 binding to its target gene promoters was determined by chromatin immunoprecipitation assay. Adenoviral over-expression of Nrf2 shRNA was utilized to knock down Nrf2 in H9C2 cells. Immunochemical staining was applied for Nrf2 expression in the heart. American ginseng induced dramatic increases in Nrf2 protein expression, Nrf2 nuclear translocation, Nrf2 transcriptional activity, direct Nrf2 binding to its target gene promoters, and expression of a group of anti-oxidative genes driven by Nrf2 in H9C2 cells. In addition, American ginseng inhibited Ang II- or TNFalpha-induced free radical formation and H(2)O(2)-induced cell death in H9C2 cells over-expressed with control shRNA but not in the cells over-expressed with Nrf2 shRNA. Finally, oral

  6. Regulation of DNA repair mechanism in human glioma xenograft cells both in vitro and in vivo in nude mice.

    Science.gov (United States)

    Ponnala, Shivani; Veeravalli, Krishna Kumar; Chetty, Chandramu; Dinh, Dzung H; Rao, Jasti S

    2011-01-01

    Glioblastoma Multiforme (GBM) is the most lethal form of brain tumor. Efficient DNA repair and anti-apoptotic mechanisms are making glioma treatment difficult. Proteases such as MMP9, cathepsin B and urokinase plasminogen activator receptor (uPAR) are over expressed in gliomas and contribute to enhanced cancer cell proliferation. Non-homologous end joining (NHEJ) repair mechanism plays a major role in double strand break (DSB) repair in mammalian cells. Here we show that silencing MMP9 in combination with uPAR/cathepsin B effects NHEJ repair machinery. Expression of DNA PKcs and Ku70/80 at both mRNA and protein levels in MMP9-uPAR (pMU) and MMP9-cathepsin B (pMC) shRNA-treated glioma xenograft cells were reduced. FACS analysis showed an increase in apoptotic peak and proliferation assays revealed a significant reduction in the cell population in pMU- and pMC-treated cells compared to untreated cells. We hypothesized that reduced NHEJ repair led to DSBs accumulation in pMU- and pMC-treated cells, thereby initiating cell death. This hypothesis was confirmed by reduced Ku70/Ku80 protein binding to DSB, increased comet tail length and elevated γH2AX expression in treated cells compared to control. Immunoprecipitation analysis showed that EGFR-mediated lowered DNA PK activity in treated cells compared to controls. Treatment with pMU and pMC shRNA reduced the expression of DNA PKcs and ATM, and elevated γH2AX levels in xenograft implanted nude mice. Glioma cells exposed to hypoxia and irradiation showed DSB accumulation and apoptosis after pMU and pMC treatments compared to respective controls. Our results suggest that pMU and pMC shRNA reduce glioma proliferation by DSB accumulation and increase apoptosis under normoxia, hypoxia and in combination with irradiation. Considering the radio- and chemo-resistant cancers favored by hypoxia, our study provides important therapeutic potential of MMP9, uPAR and cathepsin B shRNA in the treatment of glioma from clinical stand

  7. Regulation of DNA repair mechanism in human glioma xenograft cells both in vitro and in vivo in nude mice.

    Directory of Open Access Journals (Sweden)

    Shivani Ponnala

    Full Text Available Glioblastoma Multiforme (GBM is the most lethal form of brain tumor. Efficient DNA repair and anti-apoptotic mechanisms are making glioma treatment difficult. Proteases such as MMP9, cathepsin B and urokinase plasminogen activator receptor (uPAR are over expressed in gliomas and contribute to enhanced cancer cell proliferation. Non-homologous end joining (NHEJ repair mechanism plays a major role in double strand break (DSB repair in mammalian cells.Here we show that silencing MMP9 in combination with uPAR/cathepsin B effects NHEJ repair machinery. Expression of DNA PKcs and Ku70/80 at both mRNA and protein levels in MMP9-uPAR (pMU and MMP9-cathepsin B (pMC shRNA-treated glioma xenograft cells were reduced. FACS analysis showed an increase in apoptotic peak and proliferation assays revealed a significant reduction in the cell population in pMU- and pMC-treated cells compared to untreated cells. We hypothesized that reduced NHEJ repair led to DSBs accumulation in pMU- and pMC-treated cells, thereby initiating cell death. This hypothesis was confirmed by reduced Ku70/Ku80 protein binding to DSB, increased comet tail length and elevated γH2AX expression in treated cells compared to control. Immunoprecipitation analysis showed that EGFR-mediated lowered DNA PK activity in treated cells compared to controls. Treatment with pMU and pMC shRNA reduced the expression of DNA PKcs and ATM, and elevated γH2AX levels in xenograft implanted nude mice. Glioma cells exposed to hypoxia and irradiation showed DSB accumulation and apoptosis after pMU and pMC treatments compared to respective controls.Our results suggest that pMU and pMC shRNA reduce glioma proliferation by DSB accumulation and increase apoptosis under normoxia, hypoxia and in combination with irradiation. Considering the radio- and chemo-resistant cancers favored by hypoxia, our study provides important therapeutic potential of MMP9, uPAR and cathepsin B shRNA in the treatment of glioma from

  8. Survivin knockdown increased anti-cancer effects of (−)-epigallocatechin-3-gallate in human malignant neuroblastoma SK-N- BE2 and SH-SY5Y cells

    Science.gov (United States)

    Hossain, Md. Motarab; Banik, Naren L.; Ray, Swapan K.

    2012-01-01

    Neuroblastoma is a solid tumor that mostly occurs in children. Malignant neuroblastomas have poor prognosis because conventional chemotherapeutic agents are hardly effective. Survivin, which is highly expressed in some malignant neuroblastomas, plays a significant role in inhibiting differentiation and apoptosis and promoting cell proliferation, invasion, and angiogenesis. We examined consequences of survivin knockdown by survivin short hairpin RNA (shRNA) plasmid and then treatment with (−)-epigallocatechin-3-gallate (EGCG), a green tea flavonoid, in malignant neuroblastoma cells. Our Western blotting and laser scanning confocal immunofluorescence microscopy showed that survivin was highly expressed in malignant neuroblastoma SK-N-BE2 and SH-SY5Y cell lines and slightly in SK-N-DZ cell line. Expression of survivin was very faint in malignant neuroblastoma IMR32 cell line. We transfected SK-N-BE2 and SH-SY-5Y cells with survivin shRNA, treated with EGCG, and confirmed knockdown of survivin at mRNA and protein levels. Survivin knockdown induced morphological features of neuronal differentiation, as we observed following in situ methylene blue staining. Combination of survivin shRNA and EGCG promoted neuronal differentiation biochemically by increases in expression of NFP, NSE, and e-cadherin and also decreases in expression of Notch-1, ID2, hTERT, and PCNA. Our in situ Wright staining and Annexin V-FITC/PI staining showed that combination therapy was highly effective in inducing, respectively, morphological and biochemical features of apoptosis. Apoptosis occurred with activation of caspase-8 and cleavage of Bid to tBid, increase in Bax:Bcl-2 ratio, mitochondrial release of cytochrome c, and increases in expression and activity of calpain and caspase-3. Combination therapy decreased migration of cells through matrigel and inhibited proliferative (p-Akt and NF-κB), invasive (MMP-2 and MMP-9), and angiogenic (VEGF and b-FGF) factors. Also, in vitro network

  9. Survivin knockdown increased anti-cancer effects of (-)-epigallocatechin-3-gallate in human malignant neuroblastoma SK-N-BE2 and SH-SY5Y cells.

    Science.gov (United States)

    Hossain, Md Motarab; Banik, Naren L; Ray, Swapan K

    2012-08-01

    Neuroblastoma is a solid tumor that mostly occurs in children. Malignant neuroblastomas have poor prognosis because conventional chemotherapeutic agents are hardly effective. Survivin, which is highly expressed in some malignant neuroblastomas, plays a significant role in inhibiting differentiation and apoptosis and promoting cell proliferation, invasion, and angiogenesis. We examined consequences of survivin knockdown by survivin short hairpin RNA (shRNA) plasmid and then treatment with (-)-epigallocatechin-3-gallate (EGCG), a green tea flavonoid, in malignant neuroblastoma cells. Our Western blotting and laser scanning confocal immunofluorescence microscopy showed that survivin was highly expressed in malignant neuroblastoma SK-N-BE2 and SH-SY5Y cell lines and slightly in SK-N-DZ cell line. Expression of survivin was very faint in malignant neuroblastoma IMR32 cell line. We transfected SK-N-BE2 and SH-SY-5Y cells with survivin shRNA, treated with EGCG, and confirmed knockdown of survivin at mRNA and protein levels. Survivin knockdown induced morphological features of neuronal differentiation, as we observed following in situ methylene blue staining. Combination of survivin shRNA and EGCG promoted neuronal differentiation biochemically by increases in the expression of NFP, NSE, and e-cadherin and also decreases in the expression of Notch-1, ID2, hTERT, and PCNA. Our in situ Wright staining and Annexin V-FITC/PI staining showed that combination therapy was highly effective in inducing, respectively, morphological and biochemical features of apoptosis. Apoptosis occurred with activation of caspase-8 and cleavage of Bid to tBid, increase in Bax:Bcl-2 ratio, mitochondrial release of cytochrome c, and increases in the expression and activity of calpain and caspase-3. Combination therapy decreased migration of cells through matrigel and inhibited proliferative (p-Akt and NF-κB), invasive (MMP-2 and MMP-9), and angiogenic (VEGF and b-FGF) factors. Also, in vitro

  10. Engineering HIV-1-resistant T-cells from short-hairpin RNA-expressing hematopoietic stem/progenitor cells in humanized BLT mice.

    Directory of Open Access Journals (Sweden)

    Gene-Errol E Ringpis

    Full Text Available Down-regulation of the HIV-1 coreceptor CCR5 holds significant potential for long-term protection against HIV-1 in patients. Using the humanized bone marrow/liver/thymus (hu-BLT mouse model which allows investigation of human hematopoietic stem/progenitor cell (HSPC transplant and immune system reconstitution as well as HIV-1 infection, we previously demonstrated stable inhibition of CCR5 expression in systemic lymphoid tissues via transplantation of HSPCs genetically modified by lentiviral vector transduction to express short hairpin RNA (shRNA. However, CCR5 down-regulation will not be effective against existing CXCR4-tropic HIV-1 and emergence of resistant viral strains. As such, combination approaches targeting additional steps in the virus lifecycle are required. We screened a panel of previously published shRNAs targeting highly conserved regions and identified a potent shRNA targeting the R-region of the HIV-1 long terminal repeat (LTR. Here, we report that human CD4(+ T-cells derived from transplanted HSPC engineered to co-express shRNAs targeting CCR5 and HIV-1 LTR are resistant to CCR5- and CXCR4- tropic HIV-1-mediated depletion in vivo. Transduction with the combination vector suppressed CXCR4- and CCR5- tropic viral replication in cell lines and peripheral blood mononuclear cells in vitro. No obvious cytotoxicity or interferon response was observed. Transplantation of combination vector-transduced HSPC into hu-BLT mice resulted in efficient engraftment and subsequent stable gene marking and CCR5 down-regulation in human CD4(+ T-cells within peripheral blood and systemic lymphoid tissues, including gut-associated lymphoid tissue, a major site of robust viral replication, for over twelve weeks. CXCR4- and CCR5- tropic HIV-1 infection was effectively inhibited in hu-BLT mouse spleen-derived human CD4(+ T-cells ex vivo. Furthermore, levels of gene-marked CD4(+ T-cells in peripheral blood increased despite systemic infection with either

  11. Chemokine receptor CXCR7 regulates the invasion, angiogenesis and tumor growth of human hepatocellular carcinoma cells

    Directory of Open Access Journals (Sweden)

    Li Fan

    2010-04-01

    Full Text Available Abstract Background In spite of recent advances in diagnostic and therapeutic measures, the prognosis of hepatocellular carcinoma (HCC patients remains poor. Therefore, it is crucial to understand what factors are involved in promoting development of HCC. Evidence is accumulating that members of the chemokine receptor family are viewed as promising therapeutic targets in the fight against cancer. More recent studies have revealed that chemokine receptor CXCR7 plays an important role in cancer development. However, little is known about the effect of CXCR7 on the process of HCC cell invasion and angiogenesis. The aim of this study is to investigate the expression of CXCR7 in hepatocellular carcinoma tissues and cell lines and to evaluate the role of CXCR7 in tumor growth, angiogenesis and invasion of HCC cells. Methods We constructed CXCR7 expressing shRNA, and CXCR7shRNA was subsequently stably transfected into human HCC cells. We evaluated the effect of CXCR7 inhibition on cell invasion, adhesion, VEGF secretion, tube formation and tumor growth. Immunohistochemistry was done to assess the expression of CXCR7 in human hepatocellular carcinoma tissues and CD31 in tumor of mice. We also evaluated the effect of VEGF stimulation on expression of CXCR7. Results CXCR7 was overexpressed in hepatocellular carcinoma tissues. We showed that high invasive potential HCC cell lines express high levels of CXCR7. In vitro, CXCL12 was found to induce invasion, adhesion, tube formation, and VEGF secretion in SMMC-7721 cells. These biological effects were inhibited by silencing of CXCR7 in SMMC-7721 cells. In addition, we also found that VEGF stimulation can up-regulate CXCR7 expression in SMMC-7721 cells and HUVECs. More importantly, enhanced expression of CXCR7 by VEGF was founctional. In vivo, tumor growth and angiogenesis were suppressed by knockdown of CXCR7 in SMMC-7721 cells. However, silencing of CXCR7 did not affect metastasis of tumor in vivo

  12. Clinical significance of proliferation, apoptosis and senescence of nasopharyngeal cells by the simultaneously blocking EGF, IGF-1 receptors and Bcl-xl genes

    Energy Technology Data Exchange (ETDEWEB)

    Dai, Guodong [Anatomy and Embryology, Wuhan University School of Medicine, Wuhan, Hubei 430071 (China); Peng, Tao; Zhou, Xuhong [Department of Otolaryngology-Head and Neck Surgery, Zhongnan Hospital of Wuhan University, Wuhan 430071 (China); Zhu, Jun; Kong, Zhihua; Ma, Li; Xiong, Zhi [Anatomy and Embryology, Wuhan University School of Medicine, Wuhan, Hubei 430071 (China); Yuan, Yulin, E-mail: yuanyulin19620120@126.com [Anatomy and Embryology, Wuhan University School of Medicine, Wuhan, Hubei 430071 (China)

    2013-11-01

    Highlight: •Construction of shRNA segments expression vectors is valid by the investigation of RT-PCR for IGF1R, EGFR and Bcl-xl mRNA and protein expression. •Studies have suggested that the vectors in blocking these genes of the growth factor receptors and anti- apoptosis is capable of breaking the balance of tumor growth so that tumor trend apoptosis and senescence. •Simultaneously blocking multiple genes that are abnormally expressed may be more effective in treating cancer cells than silencing a single gene. -- Abstract: Background: In previous work, we constructed short hairpin RNA (shRNA) expression plasmids that targeted human EGF and IGF-1 receptors messenger RNA, respectively, and demonstrated that these vectors could induce apoptosis of human nasopharyngeal cell lines (CNE2) and inhibit ligand-induced pAkt and pErk activation. Method: We have constructed multiple shRNA expression vectors of targeting EGFR, IGF1R and Bcl-xl, which were transfected to the CNE2 cells. The mRNA expression was assessed by RT-PCR. The growth of the cells, cell cycle progression, apoptosis of the cells, senescent tumor cells and the proteins of EGFR, IGF1R and Bcl-xl were analyzed by MTT, flow cytometry, cytochemical therapy or Western blot. Results: In group of simultaneously blocking EGFR, IGF1R and Bcl-xl genes, the mRNA of EGFR, IGF1R and Bcl-xl expression was decreased by (66.66 ± 3.42)%, (73.97 ± 2.83)% and (64.79 ± 2.83)%, and the protein expressions was diminished to (67.69 ± 4.02)%, (74.32 ± 2.30)%, and (60.00 ± 3.34)%, respectively. Meanwhile, the cell apoptosis increased by 65.32 ± 0.18%, 65.16 ± 0.25% and 55.47 ± 0.45%, and senescent cells increased by 1.42 ± 0.15%, 2.26 ± 0.15% and 3.22 ± 0.15% in the second, third and fourth day cultures, respectively. Conclusions: Simultaneously blocking EGFR, IGF1R and Bcl-xl genes is capable of altering the balance between proliferating versus apoptotic and senescent cells in the favor of both of apoptosis and

  13. CLDN6 promotes chemoresistance through GSTP1 in human breast cancer

    Directory of Open Access Journals (Sweden)

    Minlan Yang

    2017-11-01

    Full Text Available Abstract Background Claudin-6 (CLDN6, a member of CLDN family and a key component of tight junction, has been reported to function as a tumor suppressor in breast cancer. However, whether CLDN6 plays any role in breast cancer chemoresistance remains unclear. In this study, we investigated the role of CLDN6 in the acquisition of chemoresistance in breast cancer cells. Methods We manipulated the expression of CLDN6 in MCF-7 and MCF-7/MDR cells with lv-CLDN6 and CLDN6-shRNA and investigated whether CLDN6 manipulation lead to different susceptibilities to several chemotherapeutic agents in these cells. The cytotoxicity of adriamycin (ADM, 5-fluorouracil (5-FU, and cisplatin (DDP was tested by cck-8 assay. Cell death was determined by DAPI nuclear staining. The enzyme activity of glutanthione S-transferase-p1 (GSTP1 was detected by a GST activity kit. Then lv-GSTP1 and GSTP1-shRNA plasmids were constructed to investigate the potential of GSTP1 in regulating chemoresistance of breast cancer. The TP53-shRNA was adopted to explore the regulation mechanism of GSTP1. Finally, immunohistochemistry was used to explore the relationship between CLDN6 and GSTP1 expression in breast cancer tissues. Results Silencing CLDN6 increased the cytotoxicity of ADM, 5-FU, and DDP in MCF-7/MDR cells. Whereas overexpression of CLDN6 in MCF-7, the parental cell line of MCF-7/MDR expressing low level of CLDN6, increased the resistance to the above drugs. GSTP1 was upregulated in CLDN6-overexpressed MCF-7 cells. RNAi –mediated silencing of CLDN6 downregulated both GSTP1 expression and GST enzyme activity in MCF-7/MDR cells. Overexpresssion of GSTP1 in CLDN6 silenced MCF-7/MDR cells restored chemoresistance, whereas silencing GSTP1 reduced the chemoresistance due to ectopic overexpressed of CLDN6 in MCF-7 cells. These observations were also repeated in TNBC cells Hs578t. We further confirmed that CLDN6 interacted with p53 and promoted translocation of p53 from nucleus to

  14. MicroRNA-129-5p inhibits the development of autoimmune encephalomyelitis-related epilepsy by targeting HMGB1 through the TLR4/NF-kB signaling pathway.

    Science.gov (United States)

    Liu, Ai-Hua; Wu, Ya-Ting; Wang, Yu-Ping

    2017-06-01

    The study aimed to explore the effects of microRNA-129-5p (miR-129-5p) on the development of autoimmune encephalomyelitis (AE)-related epilepsy by targeting HMGB1 through the TLR4/NF-kB signaling pathway in a rat model. AE-related epilepsy models were established. Sprague-Dawley (SD) rats were randomly divided into control, model, miR-129-5p mimics, miR-129-5p inhibitor, HMGB1 shRNA, TLR4/NF-kB (TLR4/NF-kB signaling pathway was inhibited) and miR-129-5p mimics+HMGB1 shRNA groups respectively. Latency to a first epilepsy seizure attack was recorded. Neuronal injuries in the hippocampus regions were detected using HE, Nissl and FJB staining methods 24h following model establishment. Microglial cells were detected by OX-42 immunohistochemistry. Expressions of miR-129-5p, HMGB1 and TLR4/NF-kB signaling pathway-related proteins were detected by qRT-PCR. Protein expressions of HMGB1 and TLR4/NF-kB signaling pathway-related proteins were detected by Western blotting. Dual luciferase reporter gene assay showed that miR-129-5p was negatively targeting HMGB1. Neurons of hippocampal tissues in rats were heavily injured by an injection of lithium chloride. Compared with the model and control groups, neuronal injury of the hippocampus and AE-related epilepsy decreased and microglial cells increased in the miR-129-5p mimics, HMGB1 shRNA and TLR4/NF-kB groups; however, in the miR-129-5p inhibitor group, miR-129-5p expression decreased, HMGB1 expression increased, TLR4/NF-kB signaling pathway was activated, latency to a first epilepsy seizure attack was shortened, and neuronal injury increased. This study provides evidence that miR-129-5p inhibits the development of AE-related epilepsy by suppressing HMGB1 expression and inhibiting TLR4/NF-kB signaling pathway. Copyright © 2017 Elsevier Inc. All rights reserved.

  15. Diagnostic criteria for severe acute malnutrition among infants aged under 6 mo.

    Science.gov (United States)

    Mwangome, Martha; Ngari, Moses; Fegan, Greg; Mturi, Neema; Shebe, Mohammed; Bauni, Evasius; Berkley, James A

    2017-06-01

    Background: There is an increasing recognition of malnutrition among infants under 6 mo of age (U6M). Current diagnosis criteria use weight-for-length z scores (WLZs), but the 2006 WHO standards exclude infants shorter than 45 cm. In older children, midupper arm circumference (MUAC) predicts mortality better than does WLZ. Outcomes may also be influenced by exposure to HIV and size or gestational age at birth. Diagnostic thresholds for WLZ, MUAC, and other indexes have not been fully evaluated against mortality risk among U6M infants. Objective: The aim was to determine the association of anthropometric indexes with risks of inpatient and postdischarge mortality among U6M infants recruited at the time of hospitalization. Design: We analyzed data from a cohort of U6M infants admitted to Kilifi County Hospital (2007-2013), Kenya. The primary outcomes were inpatient death and death during follow-up over 1 y after discharge. We calculated adjusted RRs for inpatient mortality and HRs for postdischarge mortality for different anthropometric measures and thresholds. Discriminatory value was assessed by using receiver operating characteristic curves. Results: A total of 2882 infants were admitted: 140 (4.9%) died in the hospital and 1405 infants were followed up after discharge. Of these, 75 (5.3%) died within 1 y during 1318 child-years of observation. MUAC and weight-for-age z score (WAZ) predicted inpatient and postdischarge mortality better than did WLZ ( P 0.05) and performed better than WLZ <-3 for both inpatient and postdischarge mortality (both P < 0.001). Reported small size at birth did not reduce the risk of death associated with anthropometric indexes. Conclusions: U6M infants at the highest risk of death are best targeted by using MUAC or WAZ. Further research into the effectiveness of potential interventions is required.

  16. Inhibiting trophoblast PAR-1 overexpression suppresses sFlt-1-induced anti-angiogenesis and abnormal vascular remodeling: a possible therapeutic approach for preeclampsia.

    Science.gov (United States)

    Zhao, Yin; Zheng, YanFang; Liu, XiaoXia; Luo, QingQing; Wu, Di; Liu, XiaoPing; Zou, Li

    2018-03-01

    Is it possible to improve vascular remodeling by inhibiting the excessive expression of protease-activated receptor 1 (PAR-1) in trophoblast of abnormal placenta? Inhibition of trophoblast PAR-1 overexpression may promote placental angiogenesis and vascular remodeling, offering an alternative therapeutic approach for preeclampsia. PAR-1 is high-affinity receptor of thrombin. Thrombin increases sFlt-1 secretion in trophoblast via the activation of PAR-1. It is reported that the expression of both thrombin and PAR-1 expression are increased in placentas of preeclampsia patients compared with normal placentas. Trophoblast cells were transfected with PAR-1 short hairpin RNA (shRNA) or PAR-1 overexpression plasmids in vitro. Tube formation assays and a villus-decidua co-culture system were used to study the effect of PAR-1 inhibition on placental angiogenesis and vascular remodeling, respectively. Placentas from rats with preeclampsia were transfected with PAR-1 shRNA to confirm the effect of inhibiting PAR-1 overexpression in placenta. The trophoblast cell line HTR-8/SVneo was transfected with PAR-1 shRNA or PAR-1 overexpression plasmids. After 48 h, supernatant was collected and the level of sFlt-1 secretion was measured by ELISA. Human umbilical cord epithelial cells and a villus-decidua co-culture system were treated with conditioned media to study the effect of PAR-1 inhibition on tube formation and villi vascular remodeling. A preeclampsia rat model was established by intraperitoneal injection of L-NAME. Plasmids were injected into the placenta of the preeclampsia rats and systolic blood pressure was measured on Days 15 and 19. The effect of different treatments was evaluated by proteinuria, placental weights, fetal weights and fetal numbers in study and control groups. The level of serum sFlt-1 in rats with preeclampsia was also measured. Changes in the placenta microvessels were studied by histopathological staining. PAR-1 shRNA inhibited PAR-1 expression and

  17. Suppression of the lipopolysaccharide-induced expression of MARCKS-related protein (MRP) affects transmigration in activated RAW264.7 cells.

    Science.gov (United States)

    Chun, Kwang-Rok; Bae, Eun Mi; Kim, Jae-Kwan; Suk, Kyoungho; Lee, Won-Ha

    2009-01-01

    The molecular action mechanism of MRP, one of the protein kinase C (PKC) substrates, has been under intense investigation, but reports on its role in macrophage function remain controversial. The treatment of macrophage cell lines with bacterial lipopolysaccharide (LPS) induced a high level of MRP expression suggesting that MRP plays a role in the function of activated macrophages. In order to investigate the role of MRP in activated RAW264.7 cells, we stably transfected MRP-specific shRNA expression constructs and tested for alterations in macrophage-related functions. The down-regulation of MRP expression resulted in a marked reduction in chemotaxis toward MCP-1 or extracellular matrix proteins. Furthermore, pharmacological inhibitors of PKC significantly inhibited the chemotaxis in RAW264.7 cells. These data reveals the pivotal role of MRP in the transmigration of activated RAW264.7 cells.

  18. In Vivo RNA Interference Screening Identifies a Leukemia-Specific Dependence on Integrin Beta 3 Signaling

    Science.gov (United States)

    Miller, Peter G.; Al-Shahrour, Fatima; Hartwell, Kimberly A.; Chu, Lisa P.; Järås, Marcus; Puram, Rishi V.; Puissant, Alexandre; Callahan, Kevin P.; Ashton, John; McConkey, Marie E.; Poveromo, Luke P.; Cowley, Glenn S.; Kharas, Michael G.; Labelle, Myriam; Shterental, Sebastian; Fujisaki, Joji; Silberstein, Lev; Alexe, Gabriela; Al-Hajj, Muhammad A.; Shelton, Christopher A.; Armstrong, Scott A.; Root, David E.; Scadden, David T.; Hynes, Richard O.; Mukherjee, Siddhartha; Stegmaier, Kimberly; Jordan, Craig T.; Ebert, Benjamin L.

    2013-01-01

    SUMMARY We used an in vivo short hairpin RNA (shRNA) screening approach to identify genes that are essential for MLL-AF9 acute myeloid leukemia (AML). We found that Integrin Beta 3 (Itgb3) is essential for murine leukemia cells in vivo, and for human leukemia cells in xenotransplantation studies. In leukemia cells, Itgb3 knockdown impaired homing, downregulated LSC transcriptional programs, and induced differentiation via the intracellular kinase, Syk. In contrast, loss of Itgb3 in normal HSPCs did not affect engraftment, reconstitution, or differentiation. Finally, we confirmed that Itgb3 is dispensable for normal hematopoiesis and required for leukemogenesis using an Itgb3 knockout mouse model. Our results establish the significance of the Itgb3 signaling pathway as a potential therapeutic target in AML. PMID:23770013

  19. A CRISPR CASe for High-Throughput Silencing

    Directory of Open Access Journals (Sweden)

    Jacob eHeintze

    2013-10-01

    Full Text Available Manipulation of gene expression on a genome-wide level is one of the most important systematic tools in the post-genome era. Such manipulations have largely been enabled by expression cloning approaches using sequence-verified cDNA libraries, large-scale RNA interference libraries (shRNA or siRNA and zinc finger nuclease technologies. More recently, the CRISPR (Clustered Regularly Interspaced Short Palindromic Repeats and CRISPR-associated (Cas9-mediated gene editing technology has been described that holds great promise for future use of this technology in genomic manipulation. It was suggested that the CRISPR system has the potential to be used in high-throughput, large-scale loss of function screening. Here we discuss some of the challenges in engineering of CRISPR/Cas genomic libraries and some of the aspects that need to be addressed in order to use this technology on a high-throughput scale.

  20. Implication of p53-dependent cellular senescence related gene, TARSH in tumor suppression

    International Nuclear Information System (INIS)

    Wakoh, Takeshi; Uekawa, Natsuko; Terauchi, Kunihiko; Sugimoto, Masataka; Ishigami, Akihito; Shimada, Jun-ichi; Maruyama, Mitsuo

    2009-01-01

    A novel target of NESH-SH3 (TARSH) was identified as a cellular senescence related gene in mouse embryonic fibroblasts (MEFs) replicative senescence, the expression of which has been suppressed in primary clinical lung cancer specimens. However, the molecular mechanism underlying the regulation of TARSH involved in pulmonary tumorigenesis remains unclear. Here we demonstrate that the reduction of TARSH gene expression by short hairpin RNA (shRNA) system robustly inhibited the MEFs proliferation with increase in senescence-associated β-galactosidase (SA-β-gal) activity. Using p53 -/- MEFs, we further suggest that this growth arrest by loss of TARSH is evoked by p53-dependent p21 Cip1 accumulation. Moreover, we also reveal that TARSH reduction induces multicentrosome in MEFs, which is linked in chromosome instability and tumor development. These results suggest that TARSH plays an important role in proliferation of replicative senescence and may serve as a trigger of tumor development.

  1. Design of 240,000 orthogonal 25mer DNA barcode probes.

    Science.gov (United States)

    Xu, Qikai; Schlabach, Michael R; Hannon, Gregory J; Elledge, Stephen J

    2009-02-17

    DNA barcodes linked to genetic features greatly facilitate screening these features in pooled formats using microarray hybridization, and new tools are needed to design large sets of barcodes to allow construction of large barcoded mammalian libraries such as shRNA libraries. Here we report a framework for designing large sets of orthogonal barcode probes. We demonstrate the utility of this framework by designing 240,000 barcode probes and testing their performance by hybridization. From the test hybridizations, we also discovered new probe design rules that significantly reduce cross-hybridization after their introduction into the framework of the algorithm. These rules should improve the performance of DNA microarray probe designs for many applications.

  2. Enhancement of the Acrolein-Induced Production of Reactive Oxygen Species and Lung Injury by GADD34

    Directory of Open Access Journals (Sweden)

    Yang Sun

    2015-01-01

    Full Text Available Chronic obstructive pulmonary disease (COPD is characterized by lung destruction and inflammation. As a major compound of cigarette smoke, acrolein plays a critical role in the induction of respiratory diseases. GADD34 is known as a growth arrest and DNA damage-related gene, which can be overexpressed in adverse environmental conditions. Here we investigated the effects of GADD34 on acrolein-induced lung injury. The intranasal exposure of acrolein induced the expression of GADD34, developing the pulmonary damage with inflammation and increase of reactive oxygen species (ROS. Conversely, the integrality of pulmonary structure was preserved and the generation of ROS was reduced in GADD34-knockout mice. Acrolein-induced phosphorylation of eIF2α in GADD34-knockout epithelial cells by shRNA protected cell death by reducing misfolded protein-caused oxidative stress. These data indicate that GADD34 participates in the development of acrolein-induced lung injury.

  3. Enhancement of the acrolein-induced production of reactive oxygen species and lung injury by GADD34.

    Science.gov (United States)

    Sun, Yang; Ito, Sachiko; Nishio, Naomi; Tanaka, Yuriko; Chen, Nana; Liu, Lintao; Isobe, Ken-ichi

    2015-01-01

    Chronic obstructive pulmonary disease (COPD) is characterized by lung destruction and inflammation. As a major compound of cigarette smoke, acrolein plays a critical role in the induction of respiratory diseases. GADD34 is known as a growth arrest and DNA damage-related gene, which can be overexpressed in adverse environmental conditions. Here we investigated the effects of GADD34 on acrolein-induced lung injury. The intranasal exposure of acrolein induced the expression of GADD34, developing the pulmonary damage with inflammation and increase of reactive oxygen species (ROS). Conversely, the integrality of pulmonary structure was preserved and the generation of ROS was reduced in GADD34-knockout mice. Acrolein-induced phosphorylation of eIF2α in GADD34-knockout epithelial cells by shRNA protected cell death by reducing misfolded protein-caused oxidative stress. These data indicate that GADD34 participates in the development of acrolein-induced lung injury.

  4. APLP2 regulates neuronal stem cell differentiation during cortical development.

    Science.gov (United States)

    Shariati, S Ali M; Lau, Pierre; Hassan, Bassem A; Müller, Ulrike; Dotti, Carlos G; De Strooper, Bart; Gärtner, Annette

    2013-03-01

    Expression of amyloid precursor protein (APP) and its two paralogues, APLP1 and APLP2 during brain development coincides with key cellular events such as neuronal differentiation and migration. However, genetic knockout and shRNA studies have led to contradictory conclusions about their role during embryonic brain development. To address this issue, we analysed in depth the role of APLP2 during neurogenesis by silencing APLP2 in vivo in an APP/APLP1 double knockout mouse background. We find that under these conditions cortical progenitors remain in their undifferentiated state much longer, displaying a higher number of mitotic cells. In addition, we show that neuron-specific APLP2 downregulation does not impact the speed or position of migrating excitatory cortical neurons. In summary, our data reveal that APLP2 is specifically required for proper cell cycle exit of neuronal progenitors, and thus has a distinct role in priming cortical progenitors for neuronal differentiation.

  5. HOXB4 Gene Expression Is Regulated by CDX2 in Intestinal Epithelial Cells

    DEFF Research Database (Denmark)

    Jørgensen, Steffen; Coshun, Mehmet; Mikkelsen Homburg, Keld

    2016-01-01

    analysis and expression data from Caco2 cells also suggests a role for CDX2 in the regulation of HOXB4 gene expression in the intestinal epithelium. Thus, the aim of this study was to investigate whether HOXB4 gene expression is regulated by CDX2 in the intestinal epithelium. We demonstrated binding of CDX......The mammalian Caudal-related homeobox transcription factor 2 (CDX2) plays a key role in the homeobox regulatory network and is essential in regulating the expression of several homeobox (HOX) genes during embryonic development, particularly in the gut. Genome-wide CDX2 chromatin immunoprecipitation......2 to four different CDX2 binding sites in an enhancer region located upstream of the HOXB4 transcription start site. Mutations in the CDX2 binding sites reduced HOXB4 gene activity, and knock down of endogenous CDX2 expression by shRNA reduced HOXB4 gene expression. This is the first report...

  6. Generation of integration-free induced pluripotent stem cell lines derived from two patients with X-linked Alport syndrome (XLAS).

    Science.gov (United States)

    Kuebler, Bernd; Aran, Begoña; Miquel-Serra, Laia; Muñoz, Yolanda; Ars, Elisabet; Bullich, Gemma; Furlano, Monica; Torra, Roser; Marti, Merce; Veiga, Anna; Raya, Angel

    2017-12-01

    Skin biopsies were obtained from two male patients with X-linked Alport syndrome (XLAS) with hemizygous COL4A5 mutations in exon 41 or exon 46. Dermal fibroblasts were extracted and reprogrammed by nucleofection with episomal plasmids carrying OCT3/4, SOX2, KLF4 LIN28, L-MYC and p53 shRNA. The generated induced Pluripotent Stem Cell (iPSC) lines AS-FiPS2-Ep6F-28 and AS-FiPS3-Ep6F-9 were free of genomically integrated reprogramming genes, had the specific mutations, a stable karyotype, expressed pluripotency markers and generated embryoid bodies which were differentiated towards the three germ layers in vitro. These iPSC lines offer a useful resource to study Alport syndrome pathomechanisms and drug testing. Copyright © 2017 The Authors. Published by Elsevier B.V. All rights reserved.

  7. Integration-free induced pluripotent stem cells derived from a patient with autosomal recessive Alport syndrome (ARAS).

    Science.gov (United States)

    Kuebler, Bernd; Aran, Begoña; Miquel-Serra, Laia; Muñoz, Yolanda; Ars, Elisabet; Bullich, Gemma; Furlano, Monica; Torra, Roser; Marti, Merce; Veiga, Anna; Raya, Angel

    2017-12-01

    A skin biopsy was obtained from a 25-year-old female patient with autosomal recessive Alport syndrome (ARAS) with the homozygous COL4A3 mutation c.345delG, p.(P166Lfs*37). Dermal fibroblasts were derived and reprogrammed by nucleofection with episomal plasmids carrying OCT3/4, SOX2, KLF4 LIN28, L-MYC and p53shRNA. The generated induced Pluripotent Stem Cell (iPSC) clone AS FiPS1 Ep6F-2 was free of genomically integrated reprogramming genes, had the specific homozygous mutation, a stable karyotype, expressed pluripotency markers and generated embryoid bodies which were differentiated towards the three germ layers in vitro. This iPSC line offers a useful resource to study Alport syndrome pathomechanisms and drug testing. Copyright © 2017 The Author(s). Published by Elsevier B.V. All rights reserved.

  8. Downregulation of TLX induces TET3 expression and inhibits glioblastoma stem cell self-renewal and tumorigenesis.

    Science.gov (United States)

    Cui, Qi; Yang, Su; Ye, Peng; Tian, E; Sun, Guoqiang; Zhou, Jiehua; Sun, Guihua; Liu, Xiaoxuan; Chen, Chao; Murai, Kiyohito; Zhao, Chunnian; Azizian, Krist T; Yang, Lu; Warden, Charles; Wu, Xiwei; D'Apuzzo, Massimo; Brown, Christine; Badie, Behnam; Peng, Ling; Riggs, Arthur D; Rossi, John J; Shi, Yanhong

    2016-02-03

    Glioblastomas have been proposed to be maintained by highly tumorigenic glioblastoma stem cells (GSCs) that are resistant to current therapy. Therefore, targeting GSCs is critical for developing effective therapies for glioblastoma. In this study, we identify the regulatory cascade of the nuclear receptor TLX and the DNA hydroxylase Ten eleven translocation 3 (TET3) as a target for human GSCs. We show that knockdown of TLX expression inhibits human GSC tumorigenicity in mice. Treatment of human GSC-grafted mice with viral vector-delivered TLX shRNA or nanovector-delivered TLX siRNA inhibits tumour development and prolongs survival. Moreover, we identify TET3 as a potent tumour suppressor downstream of TLX to regulate the growth and self-renewal in GSCs. This study identifies the TLX-TET3 axis as a potential therapeutic target for glioblastoma.

  9. Activation of PPARd and RXRa stimulates fatty acid oxidatin and insulin secretion inpancreatic beta-cells

    DEFF Research Database (Denmark)

    Børgesen, Michael; Ravnskjær, Kim; Frigerio, Francesca

    as a central effector of unsaturated fatty acids in pancreatic ß-cells. Interestingly, activation of PPARd increases basal as well as glucose-stimulated insulin secretion of INS-1E cells. This increase is further potentiated by RXR agonists. This observation suggests that PPARd may mediate some of the positive......ACTIVATION OF PPARd AND RXRa STIMULATES FATTY ACID OXIDATION AND INSULIN SECRETION IN PANCREATIC b-CELLS Michael Boergesen1, Kim Ravnskjaer2, Francesca Frigerio3, Allan E. Karlsen4, Pierre Maechler3 and Susanne Mandrup1 1 Department of Biochemistry and Molecular Biology, University of Southern...... of genes as PPARd specific agonists and stimulates ß-oxidation. Importantly, oleate-induction of gene expression and ß-oxidation in INS-1E cells is abolished by knock-down of PPARd using adenoviral transfer of shRNA. Thus, PPARd appears to be a central regulator of fatty acid metabolism as well...

  10. Keratin23 (KRT23) knockdown decreases proliferation and affects the DNA damage response of colon cancer cells

    DEFF Research Database (Denmark)

    Birkenkamp-Demtröder, Karin; Hahn, Stephan; Mansilla, Francisco

    2013-01-01

    correlated with absent expression, while increased KRT23 expression in tumor samples correlated with promoter hypomethylation, as confirmed by bisulfite sequencing. Demethylation induced KRT23 expression in vitro. Expression profiling of shRNA mediated stable KRT23 knockdown in colon cancer cell lines showed...... response, mainly molecules of the double strand break repair homologous recombination pathway. KRT23 knockdown decreased the transcript and protein expression of key molecules as e.g. MRE11A, E2F1, RAD51 and BRCA1. Knockdown of KRT23 rendered colon cancer cells more sensitive to irradiation and reduced......Keratin 23 (KRT23) is strongly expressed in colon adenocarcinomas but absent in normal colon mucosa. Array based methylation profiling of 40 colon samples showed that the promoter of KRT23 was methylated in normal colon mucosa, while hypomethylated in most adenocarcinomas. Promoter methylation...

  11. Radiosensitivity is increased by knockdown of FTS in uterine cervical cancer cells

    Energy Technology Data Exchange (ETDEWEB)

    Park, Wo Yoon; Anandharaj, Arunkumar; Cinghu, Senthikumar; Kim, Won Dong [Dept. of Radiation Oncology, Chungbuk National University College of Medicine, Cheongju (Korea, Republic of); Yu, Jae Ran [Dept. of Environmental and Tropical Medicine, Konkuk University College of Medicine, Seoul (Korea, Republic of)

    2012-04-15

    Uterine cervical cancer is still the second largest cancer in women worldwide, despite of effective screening methods. Radiotherapy is used to treat all the stages of cervical cancer and more than 60% of cervical cancer patients receive radiotherapy. New therapeutic targets or approaches are needed to further increase the results of radiotherapy. In the present study, we demonstrated the radiation induced overexpression and nuclear export of FTS in cervical cancer cells. Furthermore, we showed that silencing of FTS expression with FTS shRNA enhanced radiosensitivity of cervical cancer cells, induced cell cycle arrest and apoptosis FTS is involved in radioresistance of cervical cancer. Targeted inhibition of FTS can shutdown the key elemental characteristics of cervical cancer and could lead to an effective therapeutic strategy.

  12. RNAi Therapeutics in Autoimmune Disease

    Directory of Open Access Journals (Sweden)

    Seunghee Cha

    2013-03-01

    Full Text Available Since the discovery of RNA interference (RNAi, excitement has grown over its potential therapeutic uses. Targeting RNAi pathways provides a powerful tool to change biological processes post-transcriptionally in various health conditions such as cancer or autoimmune diseases. Optimum design of shRNA, siRNA, and miRNA enhances stability and specificity of RNAi-based approaches whereas it has to reduce or prevent undesirable immune responses or off-target effects. Recent advances in understanding pathogenesis of autoimmune diseases have allowed application of these tools in vitro as well as in vivo with some degree of success. Further research on the design and delivery of effectors of RNAi pathway and underlying molecular basis of RNAi would warrant practical use of RNAi-based therapeutics in human applications. This review will focus on the approaches used for current therapeutics and their applications in autoimmune diseases, including rheumatoid arthritis and Sjögren’s syndrome.

  13. Neuron-specific RNA interference using lentiviral vectors

    DEFF Research Database (Denmark)

    Nielsen, Troels Tolstrup; Marion, Ingrid van; Hasholt, Lis

    2009-01-01

    BACKGROUND: Viral vectors have been used in several different settings for the delivery of small hairpin (sh) RNAs. However, most vectors have utilized ubiquitously-expressing polymerase (pol) III promoters to drive expression of the hairpin as a result of the strict requirement for precise...... transcriptional initiation and termination. Recently, pol II promoters have been used to construct vectors for RNA interference (RNAi). By embedding the shRNA into a micro RNA-context (miRNA) the endogenous miRNA processing machinery is exploited to achieve the mature synthetic miRNA (smiRNA), thereby expanding...... the possible promoter choices and eventually allowing cell type specific down-regulation of target genes. METHODS: In the present study, we constructed lentiviral vectors expressing smiRNAs under the control of pol II promoters to knockdown gene expression in cell culture and in the brain. RESULTS: We...

  14. Radiosensitivity is increased by knockdown of FTS in uterine cervical cancer cells

    International Nuclear Information System (INIS)

    Park, Wo Yoon; Anandharaj, Arunkumar; Cinghu, Senthikumar; Kim, Won Dong; Yu, Jae Ran

    2012-01-01

    Uterine cervical cancer is still the second largest cancer in women worldwide, despite of effective screening methods. Radiotherapy is used to treat all the stages of cervical cancer and more than 60% of cervical cancer patients receive radiotherapy. New therapeutic targets or approaches are needed to further increase the results of radiotherapy. In the present study, we demonstrated the radiation induced overexpression and nuclear export of FTS in cervical cancer cells. Furthermore, we showed that silencing of FTS expression with FTS shRNA enhanced radiosensitivity of cervical cancer cells, induced cell cycle arrest and apoptosis FTS is involved in radioresistance of cervical cancer. Targeted inhibition of FTS can shutdown the key elemental characteristics of cervical cancer and could lead to an effective therapeutic strategy

  15. CHIP regulates aquaporin-2 quality control and body water homeostasis

    DEFF Research Database (Denmark)

    Wu, Qi; Moeller, Hanne B.; Stevens, Donté A.

    2018-01-01

    The importance of the kidney distal convoluted tubule (DCT) and cortical collecting duct (CCD) is highlighted by various water and electrolyte disorders that arise when the unique transport properties of these segments are disturbed. Despite this critical role, little is known about which proteins...... by vasopressin; interacts with aquaporin-2 (AQP2), Hsp70, and Hsc70; and can directly ubiquitylate the water channel AQP2 in vitro. shRNA knockdown of CHIP in CCD cells increased AQP2 protein t1/2 and reduced AQP2 ubiquitylation, resulting in greater levels of AQP2 andphosphorylatedAQP2.CHIP knockdown increased...... the plasma membrane abundance of AQP2 in these cells. Compared with wild-type controls, CHIP knockout mice or novel CRISPR/Cas9 mice without CHIPE3 ligase activity had greater AQP2 abundance and altered renal water handling, with decreased water intake and urine volume, alongside higher urine osmolality. We...

  16. Susceptibility of ATM-deficient pancreatic cancer cells to radiation.

    Science.gov (United States)

    Ayars, Michael; Eshleman, James; Goggins, Michael

    2017-05-19

    Ataxia telangiectasia mutated (ATM) is inactivated in a significant minority of pancreatic ductal adenocarcinomas and may be predictor of treatment response. We determined if ATM deficiency renders pancreatic cancer cells more sensitive to fractionated radiation or commonly used chemotherapeutics. ATM expression was knocked down in three pancreatic cancer cell lines using ATM-targeting shRNA. Isogenic cell lines were tested for sensitivity to several chemotherapeutic agents and radiation. DNA repair kinetics were analyzed in irradiated cells using the comet assay. We find that while rendering pancreatic cancer cells ATM-deficient did not significantly change their sensitivity to several chemotherapeutics, it did render them exquisitely sensitized to radiation. Pancreatic cancer ATM status may help predict response to radiotherapy.

  17. Perturbations of NAD+ salvage systems impact mitochondrial function and energy homeostasis in mouse myoblasts and intact skeletal muscle

    DEFF Research Database (Denmark)

    Andersen, Marianne Agerholm; Dall, Morten; Jensen, Benjamin Anderschou Holbech

    2018-01-01

    Nicotinamide adenine dinucleotide (NAD+) can be synthesized by nicotinamide phosphoribosyltransferase (NAMPT). We aimed to determine the role of NAMPT for maintaining NAD+ levels, mitochondrial function, and metabolic homeostasis in skeletal muscle cells. We generated stable Nampt knockdown (sh......Nampt KD) C2C12 cells using a shRNA lentiviral approach. Moreover, we applied gene electrotransfer to express cre recombinase in tibialis anterior muscle of floxed Nampt mice. In shNampt KD C2C12 myoblasts, Nampt and NAD+ levels were reduced by 70% and 50%, respectively, and maximal respiratory capacity...... was reduced by 25%. Moreover, anaerobic glycolytic flux increased by 55% and 2-deoxyglucose uptake increased by 25% in shNampt KD cells. Treatment with the NAD+ precursor nicotinamide riboside restored NAD+ levels in shNampt cells and increased maximal respiratory capacity by 18% and 32% in control and sh...

  18. A fast, simple method for screening radiation susceptibility genes by RNA interference

    International Nuclear Information System (INIS)

    Tsuji, Atsushi B.; Sudo, Hitomi; Sugyo, Aya; Otsuki, Marika; Miyagishi, Makoto; Taira, Kazunari; Imai, Takashi; Harada, Yoshi-nobu

    2005-01-01

    Radiotherapy can cause unacceptable levels of damage to normal tissues in some cancer patients. To understand the molecular mechanisms underlying radiation-induced physiological responses, and to be able to predict the radiation susceptibility of normal tissues in individual patients, it is important to identify a comprehensive set of genes responsible for radiation susceptibility. We have developed a simple and rapid 96-well screening protocol using cell proliferation assays and RNA interference to identify genes associated with radiation susceptibility. We evaluated the performance of alamarBlue-, BrdU-, and sulforhodamine B-based cell proliferation assays using the 96-well format. Each proliferation assay detected the known radiation susceptibility gene, PRKDC. In a trial screen using 28 shRNA vectors, another known gene, CDKN1A, and one new radiation susceptibility gene, ATP5G3, were identified. Our results indicate that this method may be useful for large-scale screens designed to identify novel radiation susceptibility genes

  19. N-(1-Pyrenyl Maleimide Induces Bak Oligomerization and Mitochondrial Dysfunction in Jurkat Cells

    Directory of Open Access Journals (Sweden)

    Pei-Rong Huang

    2015-01-01

    Full Text Available N-(1-pyrenyl maleimide (NPM is a fluorescent reagent that is frequently used as a derivatization agent for the detection of thio-containing compounds. NPM has been shown to display a great differential cytotoxicity against hematopoietic cancer cells. In this study, the molecular mechanism by which NPM induces apoptosis was examined. Here, we show that treatment of Jurkat cells with NPM leads to Bak oligomerization, loss of mitochondrial membrane potential (Δψm, and release of cytochrome C from mitochondria to cytosol. Induction of Bak oligomerization appears to play a critical role in NPM-induced apoptosis, as downregulation of Bak by shRNA significantly prevented NPM-induced apoptosis. Inhibition of caspase 8 by Z-IETD-FMK and/or depletion of Bid did not affect NPM-induced oligomerization of Bak. Taken together, these results suggest that NPM-induced apoptosis is mediated through a pathway that is independent of caspase-8 activation.

  20. Stemcell Information: SKIP000796 [SKIP Stemcell Database[Archive

    Lifescience Database Archive (English)

    Full Text Available s (iPSCs) 脊髄性筋萎縮症(Coriell GM03813)患者由来のiPS細胞 human ES-like Research Grade Other OCT...(CiRA), Kyoto University 京都大学iPS細胞研究所 ... Information Only Department of Clinical... Application, Center for iPS Cell Research and Application (CiRA), Kyoto University 京都大学iPS細胞研究所 http://www.... ATROPHY I; SMA1 253300 ... 3 0-9 Male ... Yes No SMA patient(Coriell IDs GM03813 Fibroblast)-derived induced pluripotent stem cell...3/4, SOX2, KLF4, L-MYC, LIN28 and p53 shRNA ... Yes SNL or MEF embryonic stem cell m

  1. Enhancement of the Acrolein-Induced Production of Reactive Oxygen Species and Lung Injury by GADD34

    Science.gov (United States)

    Sun, Yang; Ito, Sachiko; Nishio, Naomi; Tanaka, Yuriko; Chen, Nana; Isobe, Ken-ichi

    2015-01-01

    Chronic obstructive pulmonary disease (COPD) is characterized by lung destruction and inflammation. As a major compound of cigarette smoke, acrolein plays a critical role in the induction of respiratory diseases. GADD34 is known as a growth arrest and DNA damage-related gene, which can be overexpressed in adverse environmental conditions. Here we investigated the effects of GADD34 on acrolein-induced lung injury. The intranasal exposure of acrolein induced the expression of GADD34, developing the pulmonary damage with inflammation and increase of reactive oxygen species (ROS). Conversely, the integrality of pulmonary structure was preserved and the generation of ROS was reduced in GADD34-knockout mice. Acrolein-induced phosphorylation of eIF2α in GADD34-knockout epithelial cells by shRNA protected cell death by reducing misfolded protein-caused oxidative stress. These data indicate that GADD34 participates in the development of acrolein-induced lung injury. PMID:25821552

  2. Fascin-1 knock-down of human glioma cells reduces their microvilli/filopodia while improving their susceptibility to lymphocyte-mediated cytotoxicity

    Science.gov (United States)

    Hoa, Neil T; Ge, Lisheng; Erickson, Kate L; Kruse, Carol A; Cornforth, Andrew N; Kuznetsov, Yurii; McPherson, Alex; Martini, Filippo; Jadus, Martin R

    2015-01-01

    Cancer cells derived from Glioblastoma multiforme possess membranous protrusions allowing these cells to infiltrate surrounding tissue, while resisting lymphocyte cytotoxicity. Microvilli and filopodia are supported by actin filaments cross-linked by fascin. Fascin-1 was genetically silenced within human U251 glioma cells; these knock-down glioma cells lost their microvilli/filopodia. The doubling time of these fascin-1 knock-down cells was doubled that of shRNA control U251 cells. Fascin-1 knock-down cells lost their transmigratory ability responding to interleukin-6 or insulin-like growth factor-1. Fascin-1 silenced U251 cells were more easily killed by cytolytic lymphocytes. Fascin-1 knock-down provides unique opportunities to augment glioma immunotherapy by simultaneously targeting several key glioma functions: like cell transmigration, cell division and resisting immune responses. PMID:25901196

  3. The Atg1-Tor pathway regulates yolk catabolism in Drosophila embryos.

    Science.gov (United States)

    Kuhn, Hallie; Sopko, Richelle; Coughlin, Margaret; Perrimon, Norbert; Mitchison, Tim

    2015-11-15

    Yolk provides an important source of nutrients during the early development of oviparous organisms. It is composed mainly of vitellogenin proteins packed into membrane-bound compartments called yolk platelets. Catabolism of yolk is initiated by acidification of the yolk platelet, leading to the activation of Cathepsin-like proteinases, but it is unknown how this process is triggered. Yolk catabolism initiates at cellularization in Drosophila melanogaster embryos. Using maternal shRNA technology we found that yolk catabolism depends on the Tor pathway and on the autophagy-initiating kinase Atg1. Whereas Atg1 was required for a burst of spatially regulated autophagy during late cellularization, autophagy was not required for initiating yolk catabolism. We propose that the conserved Tor metabolic sensing pathway regulates yolk catabolism, similar to Tor-dependent metabolic regulation on the lysosome. © 2015. Published by The Company of Biologists Ltd.

  4. Autophagy downregulation contributes to insulin resistance mediated injury in insulin receptor knockout podocytes in vitro

    Directory of Open Access Journals (Sweden)

    Ying Xu

    2016-04-01

    Full Text Available It is unknown whether autophagy activity is altered in insulin resistant podocytes and whether autophagy could be a therapeutic target for diabetic nephropathy (DN. Here we used shRNA transfection to knockdown the insulin receptor (IR gene in cultured human immortalized podocytes as an in vitro insulin resistant model. Autophagy related proteins LC3, Beclin, and p62 as well as nephrin, a podocyte injury marker, were assessed using western blot and immunofluorescence staining. Our results show that autophagy is suppressed when podocytes lose insulin sensitivity and that treatment of rapamycin, an mTOR specific inhibitor, could attenuate insulin resistance induced podocytes injury via autophagy activation. The present study deepens our understanding of the role of autophagy in the pathogenesis of DN.

  5. The ubiquitin-conjugating enzyme E2-EPF is overexpressed in cervical cancer and associates with tumor growth.

    Science.gov (United States)

    Liang, Jing; Nishi, Hirotaka; Bian, Mei-Lu; Higuma, Chinatsu; Sasaki, Toru; Ito, Hiroe; Isaka, Keiichi

    2012-10-01

    We found that the ubiquitin-conjugating enzyme E2-EPF mRNA is highly expressed in cervical squamous cancer relative to normal tissues and its expression levels positively correlate with clinical stage. Reduction of E2-EPF protein levels by >80% using shRNA decreases the expression levels of HIF-1α, and the proliferation, invasion and tumorigenicity of SiHa, a cervical squamous cancer cell line. E2-EPF knockdown also increases the chemosensitivity to topoisomerase I inhibitor (topotecan) and II (etoposide and doxorubicin). Our results suggest that E2-EPF is associated with the growth and aggressivity of cervical tumor cells. Targeting the E2-EPF pathway may have potential clinical applications for the treatment of cervical cancer.

  6. RNA interference mediated pten knock-down inhibit the formation of polycystic ovary.

    Science.gov (United States)

    Ouyang, Jie-Xiu; Luo, Tao; Sun, Hui-Yun; Huang, Jian; Tang, Dan-Feng; Wu, Lei; Zheng, Yue-Hui; Zheng, Li-Ping

    2013-08-01

    Pten (phosphatase and tensin homolog deleted on chromosome 10), a kind of tumor suppressor gene, plays important roles in female reproductive system. But its expression and roles in the formation of polycystic ovaries are yet to be known. In this study, we constructed a rat model of PCOS using norethindrone and HCG injections and found the expressions of pten mRNA and PTEN protein increased significantly in the polycystic ovary tissue by immunohistochemistry, RT-PCR, and western blot. Furthermore, the results showed that in vivo ovaries could be effectively transfected by lentiviral vectors through the ovarian microinjection method and indicated that pten shRNA may inhibit the formation of polycystic ovaries by pten down-regulation. Our study provides new information regarding the role of PTEN in female reproductive disorders, such as polycystic ovary syndrome.

  7. mTOR inhibition sensitizes human hepatocellular carcinoma cells to resminostat

    Energy Technology Data Exchange (ETDEWEB)

    Peng, Xingang, E-mail: pengxinggang26@sina.com [Department of Emergency General Surgery, The Affiliated Hospital of Qingdao University, Qingdao (China); Zhang, Donghui, E-mail: zhangdonghuiyx@sina.com [Department of Infectious Disease, Linyi People’s Hospital, Linyi (China); Li, Zhengling, E-mail: lizhenglingzz@sina.com [Department of Nursing, Tengzhou Central People’s Hospital, Tengzhou (China); Fu, Meili, E-mail: fumeilidrlinyi@tom.com [Department of Infectious Disease, Linyi People’s Hospital, Linyi (China); Liu, Haiyan, E-mail: liuhaiyanlinyi5@sina.com [Department of Nursing, Linyi People’s Hospital, Linyi (China)

    2016-09-02

    Histone deacetylases (HDACs) hyper-activity in hepatocellular carcinoma (HCC) is often associated with patients’ poor prognosis. Our previous study has shown that resminostat, a novel HDAC inhibitor (HDACi), activated mitochondrial permeability transition pore (mPTP)-dependent apoptosis pathway in HCC cells. Here we explored the potential resminostat resistance factor by focusing on mammalian target of rapamycin (mTOR). We showed that AZD-2014, a novel mTOR kinase inhibitor, potentiated resminostat-induced cytotoxicity and proliferation inhibition in HCC cells. Molecularly, AZD-2014 enhanced resminostat-induced mPTP apoptosis pathway activation in HCC cells. Inhibition of this apoptosis pathway, by the caspase-9 specific inhibitor Ac-LEHD-CHO, the mPTP blockers (sanglifehrin A/cyclosporine A), or by shRNA-mediated knockdown of mPTP component cyclophilin-D (Cyp-D), significantly attenuated resminostat plus AZD-2014-induced cytotoxicity and apoptosis in HCC cells. Significantly, mTOR shRNA knockdown or kinase-dead mutation (Asp-2338-Ala) also sensitized HCC cells to resminostat, causing profound cytotoxicity and apoptosis induction. Together, these results suggest that mTOR could be a primary resistance factor of resminostat. Targeted inhibition of mTOR may thus significantly sensitize HCC cells to resminostat. - Highlights: • AZD-2014 potentiates resminostat’s cytotoxicity against HCC cells. • AZD-2014 facilitates resminostat-induced HCC cell apoptosis. • AZD-2014 augments resminostat-induced mitochondrial apoptosis pathway activation. • mTOR shRNA or kinase-dead mutation significantly sensitizes HCC cells to resminostat.

  8. PHD-2 Suppression in Mesenchymal Stromal Cells Enhances Wound Healing.

    Science.gov (United States)

    Ko, Sae Hee; Nauta, Allison C; Morrison, Shane D; Hu, Michael S; Zimmermann, Andrew S; Chung, Michael T; Glotzbach, Jason P; Wong, Victor W; Walmsley, Graham G; Peter Lorenz, H; Chan, Denise A; Gurtner, Geoffrey C; Giaccia, Amato J; Longaker, Michael T

    2018-01-01

    Cell therapy with mesenchymal stromal cells is a promising strategy for tissue repair. Restoration of blood flow to ischemic tissues is a key step in wound repair, and mesenchymal stromal cells have been shown to be proangiogenic. Angiogenesis is critically regulated by the hypoxia-inducible factor (HIF) superfamily, consisting of transcription factors targeted for degradation by prolyl hydroxylase domain (PHD)-2. The aim of this study was to enhance the proangiogenic capability of mesenchymal stromal cells and to use these modified cells to promote wound healing. Mesenchymal stromal cells harvested from mouse bone marrow were transduced with short hairpin RNA (shRNA) against PHD-2; control cells were transduced with scrambled shRNA (shScramble) construct. Gene expression quantification, human umbilical vein endothelial cell tube formation assays, and wound healing assays were used to assess the effect of PHD knockdown mesenchymal stromal cells on wound healing dynamics. PHD-2 knockdown mesenchymal stromal cells overexpressed HIF-1α and multiple angiogenic factors compared to control (p cells treated with conditioned medium from PHD-2 knockdown mesenchymal stromal cells exhibited increased formation of capillary-like structures and enhanced migration compared with human umbilical vein endothelial cells treated with conditioned medium from shScramble-transduced mesenchymal stromal cells (p cells healed at a significantly accelerated rate compared with wounds treated with shScramble mesenchymal stromal cells (p cells (p cells augments their proangiogenic potential in wound healing therapy. This effect appears to be mediated by overexpression of HIF family transcription factors and up-regulation of multiple downstream angiogenic factors.

  9. Protective role of downregulated MLK3 in myocardial adaptation to chronic hypoxia.

    Science.gov (United States)

    He, Siyi; Liu, Shunbi; Wu, Xiaochen; Xin, Mei; Ding, Sheng; Xin, Dong; Ouyang, Hui; Zhang, Jinbao

    2016-08-01

    A series of protective responses could be evoked to achieve compensatory adaptation once cardiomyocytes are subjected to chronic hypoxia. MLK3/JNK/c-jun signaling pathway was previously demonstrated to be involved in this process. In the present study, we aim to further examine the performance of MLK3 in hypoxic H9C2 cells and potential mechanism. Myocardial samples of patients with congenital heart disease (CHD) were collected. H9C2 cells were cultured in hypoxic conditions for various durations. MLK3 was silenced by transfection of shRNA to evaluate its role in cell viability. We found expression of MLK3 protein was lower in patients with cyanotic CHD. In hypoxic H9C2 cells, its expression was gradually decreased in a time-dependent manner. However, there was no significant difference about expression of MLK3 mRNA. According to the results of MTT, LDH, and TUNEL, faster cell growth curve, lower death rate, and less apoptotic cells could be observed in MLK-shRNA group compared with scramble-shRNA group. Silencing of MLK3 significantly reduced expression of cleaved caspase-3, cleaved PARP, Bad, and Bax, together with increased expression of Bcl-2 and ration of Bcl-2/Bax. Both ratio of phospho-JNK/total JNK and ratio of phospho-c-jun/total c-jun were significantly decreased once MLK3 was silenced. At various reoxygenation time, MLK3 shRNA could significantly promote cell survival and decrease cell death according to MTT and LDH. Our results suggested that chronic hypoxia could reduce MLK3 expression in a posttranscriptional regulatory manner. Downregulation of MLK3 protects H9C2 cells from hypoxia-induced apoptosis and H/R injury via blocking the activation of JNK and c-jun.

  10. Expression of β-catenin protein in hepatocellular carcinoma and its relationship with alpha-fetoprotein.

    Science.gov (United States)

    Ren, Ya-Jun; Huang, Tao; Yu, Hong-Lu; Zhang, Li; He, Qian-Jin; Xiong, Zhi-Fan; Peng, Hua

    2016-12-01

    This study aimed to investigate the expression of β-catenin in hepatocellular carcinoma (HCC) tissues and its relationship with α-fetoprotein (AFP) in HCC. Immunohistochemistry was used to determine the expression of β-catenin in normal liver tissues (n=10), liver cirrhosis tissues (n=20), and primary HCC tissues (n=60). The relationship between β-catenin expression and clinical parameters of HCC was investigated. Real-time PCR and Western blotting were used to detect the mRNA and protein expression levels of β-catenin in the liver cancer cell line SMMC-7721 transfected with a plasmid encoding AFP, and also the mRNA and protein expression levels of β-catenin were measured in the liver cancer cell line Huh7 before and after the transfection with AFP shRNA plasmids. The results showed that β-catenin was only expressed on the cell membrane in normal liver tissues. Its localization to the cytoplasm and nucleus of cells was observed in a small proportion of cirrhotic tissues or adjacent HCC tissues, and such ectopic expression of β-catenin was predominant in HCC tissues. The abnormal expression of β-catenin was correlated with serum AFP levels, cancer cell differentiation and vascular invasion (P<0.05). Additionally, the increased expression of AFP resulted in the upregulation of β-catenin mRNA and protein levels, while knockdown of AFP with AFP shRNA led to significantly decreased β-catenin mRNA and protein levels (P<0.05). It was suggested that the abnormal expression of β-catenin is implicated in hepatic carcinogenesis and development. AFP can lead to increased expression of β-catenin, which may account for the poor prognosis of AFP-associated HCC patients.

  11. Pioglitazone Confers Neuroprotection Against Ischemia-Induced Pyroptosis due to its Inhibitory Effects on HMGB-1/RAGE and Rac1/ROS Pathway by Activating PPAR-ɤ

    Directory of Open Access Journals (Sweden)

    Pingping Xia

    2018-03-01

    Full Text Available Background/Aims: Recent researches highlighted the protective potential of pioglitazone, a PPAR-γ agonist, in the progression of cerebral ischemia-reperfusion injury. However, there has been no study on the application of pioglitazone in treating ischemic stroke through mechanisms involving pyroptosis. Methods: The cerebral injury was established by middle cerebral artery occlusion (MCAO. in vitro ischemia in primary cultured astrocytes was induced by the oxygen-glucose deprivation (OGD. ELISA and Western Blot analysis were employed to the levels of PPAR-γ, pyroptosis-related biomarkers and cytoplasmic translocation of HMGB-1 and RAGE expression as well as Rac1 activity, respectively. Results: We demonstrated that repeated intraperitoneal administration of pioglitazone remarkably reduced the infarct volume, improved neurological deficits and suppressed the Rac1 activity with significant reduction of excessive ROS in rat model of middle cerebral artery occlusion (MCAO. Moreover, pioglitazone alleviated the up-regulation of pyroptosis-related biomarkers and the increased cytoplasmic translocation of HMGB-1 and RAGE expression in cerebral penumbra cortex. Similarly, the protective effects of pioglitazone on cultured astrocytes were characterized by reduced Rac1 activity, pyroptosis related protein expressions and lactate dehydrogenase (LDH release. However, these protective effects of pioglitazone were neutralized with the use of GW9662, a PPAR-γ inhibitor. Interestingly, Rac1 knockdown in lentivirus with the Rac1 small hair RNA (shRNA could inhibit the OGD-induced pyroptosis of primary cultured astrocytes. Furthermore, the combination of Rac1-shRNA and pioglitazone can further strengthen the inhibitory effects on pyroptosis induced by OGD. Conclusion: The neuroprotection of pioglitazone was attributable to the alleviated ischemia/hypoxia-induced pyroptosis and was also associated with the PPARγ-mediated suppression of HGMB-1/RAGE signaling

  12. A Large-Scale RNAi Screen Identifies SGK1 as a Key Survival Kinase for GBM Stem Cells.

    Science.gov (United States)

    Kulkarni, Shreya; Goel-Bhattacharya, Surbhi; Sengupta, Sejuti; Cochran, Brent H

    2018-01-01

    Glioblastoma multiforme (GBM) is the most common type of primary malignant brain cancer and has a very poor prognosis. A subpopulation of cells known as GBM stem-like cells (GBM-SC) have the capacity to initiate and sustain tumor growth and possess molecular characteristics similar to the parental tumor. GBM-SCs are known to be enriched in hypoxic niches and may contribute to therapeutic resistance. Therefore, to identify genetic determinants important for the proliferation and survival of GBM stem cells, an unbiased pooled shRNA screen of 10,000 genes was conducted under normoxic as well as hypoxic conditions. A number of essential genes were identified that are required for GBM-SC growth, under either or both oxygen conditions, in two different GBM-SC lines. Interestingly, only about a third of the essential genes were common to both cell lines. The oxygen environment significantly impacts the cellular genetic dependencies as 30% of the genes required under hypoxia were not required under normoxic conditions. In addition to identifying essential genes already implicated in GBM such as CDK4, KIF11 , and RAN , the screen also identified new genes that have not been previously implicated in GBM stem cell biology. The importance of the serum and glucocorticoid-regulated kinase 1 (SGK1) for cellular survival was validated in multiple patient-derived GBM stem cell lines using shRNA, CRISPR, and pharmacologic inhibitors. However, SGK1 depletion and inhibition has little effect on traditional serum grown glioma lines and on differentiated GBM-SCs indicating its specific importance in GBM stem cell survival. Implications: This study identifies genes required for the growth and survival of GBM stem cells under both normoxic and hypoxic conditions and finds SGK1 as a novel potential drug target for GBM. Mol Cancer Res; 16(1); 103-14. ©2017 AACR . ©2017 American Association for Cancer Research.

  13. iASPP is over-expressed in human non-small cell lung cancer and regulates the proliferation of lung cancer cells through a p53 associated pathway

    International Nuclear Information System (INIS)

    Chen, Jinfeng; Xie, Fei; Zhang, Lijian; Jiang, Wen G

    2010-01-01

    iASPP is a key inhibitor of tumour suppressor p53 and is found to be up-regulated in certain malignant conditions. The present study investigated the expression of iASPP in clinical lung cancer, a leading cancer type in the world, and the biological impact of this molecule on lung cancer cells. iASPP protein levels in lung cancer tissues were evaluated using an immunohistochemical method. In vitro, iASPP gene expression was suppressed with a lentvirus-mediated shRNA method and the biological impact after knocking down iASSP on lung cancer cell lines was investigated in connection with the p53 expression status. We showed here that the expression of iASPP was significantly higher in lung cancer tissues compared with the adjacent normal tissues. iASPP shRNA treatment resulted in a down-regulation of iASPP in lung cancer cells. There was a subsequent reduction of cell proliferation of the two lung tumour cell lines A459 and 95D both of which had wild-type p53 expression. In contrast, reduction of iASPP in H1229 cells, a cell with little p53 expression, had no impact on its growth rate. iASPP regulates the proliferation and motility of lung cancer cells. This effect is intimately associated with the p53 pathway. Together with the pattern of the over-expression in clinical lung cancers, it is concluded that iASPP plays an pivotal role in the progression of lung cancer and is a potential target for lung cancer therapy

  14. Interleukin-6-driven progranulin expression increases cholangiocarcinoma growth by an Akt-dependent mechanism.

    Science.gov (United States)

    Frampton, Gabriel; Invernizzi, Pietro; Bernuzzi, Francesca; Pae, Hae Yong; Quinn, Matthew; Horvat, Darijana; Galindo, Cheryl; Huang, Li; McMillin, Matthew; Cooper, Brandon; Rimassa, Lorenza; DeMorrow, Sharon

    2012-02-01

    Cholangiocarcinoma is a devastating cancer of biliary origin with limited treatment options. The growth factor, progranulin, is overexpressed in a number of tumours. The study aims were to assess the expression of progranulin in cholangiocarcinoma and to determine its effects on tumour growth. The expression and secretion of progranulin were evaluated in multiple cholangiocarcinoma cell lines and in clinical samples from patients with cholangiocarcinoma. The role of interleukin 6 (IL-6)-mediated signalling in the expression of progranulin was assessed using a combination of specific inhibitors and shRNA knockdown techniques. The effect of progranulin on proliferation and Akt activation and subsequent effects of FOXO1 phosphorylation were assessed in vitro. Progranulin knockdown cell lines were established, and the effects on cholangiocarcinoma growth were determined. Progranulin expression and secretion were upregulated in cholangiocarcinoma cell lines and tissue, which were in part via IL-6-mediated activation of the ERK1/2/RSK1/C/EBPβ pathway. Blocking any of these signalling molecules, by either pharmacological inhibitors or shRNA, prevented the IL-6-dependent activation of progranulin expression. Treatment of cholangiocarcinoma cells with recombinant progranulin increased cell proliferation in vitro by a mechanism involving Akt phosphorylation leading to phosphorylation and nuclear extrusion of FOXO1. Knockdown of progranulin expression in cholangiocarcinoma cells decreased the expression of proliferating cellular nuclear antigen, a marker of proliferative capacity, and slowed tumour growth in vivo. Evidence is presented for a role for progranulin as a novel growth factor regulating cholangiocarcinoma growth. Specific targeting of progranulin may represent an alternative for the development of therapeutic strategies.

  15. Lactoferrin promote primary rat osteoblast proliferation and differentiation via up-regulation of insulin-like growth factor-1 expression.

    Science.gov (United States)

    Hou, Jian-ming; Wu, Man; Lin, Qing-ming; Lin, Fan; Xue, Ying; Lan, Xu-hua; Chen, En-yu; Wang, Mei-li; Yang, Hai-yan; Wang, Feng-xiong

    2014-08-01

    The aim of this study was to explore the effect of lactoferrin (LF) in primary fetal rat osteoblasts proliferation and differentiation and investigate the underlying molecular mechanisms. Primary rat osteoblasts were obtained from the calvarias of neonatal rats. Osteoblasts were treated with LF (0.1-1000 μg/mL), or OSI-906 [a selective inhibitor of insulin-like growth factor 1 (IGF-1) receptor and insulin receptor]. The IGF-1 was then knocked down by small hairpin RNA (shRNA) technology and then was treated with recombinant human IGF-1 or LF. Cell proliferation and differentiation were measured by MTT assay and alkaline phosphatase (ALP) assay, respectively. The expression of IGF-1 and IGF binding protein 2 (IGFBP2) mRNA were analyzed using real-time PCR. LF promotes the proliferation and differentiation of osteoblasts in a certain range (1-100 μg/mL) in time- and dose-dependent manner. The mRNA level of IGF-1 was significantly increased, while the expression of IGFBP2 was suppressed by LF treatment. Knockdown of IGF-1 by shRNA in primary rat osteoblast dramatically decreased the abilities of proliferation and differentiation of osteoblasts and blocked the proliferation and differentiation effect of LF in osteoblasts. OSI906 (5 μM) blocked the mitogenic and differentiation of LF in osteoblasts. Proliferation and differentiation of primary rat osteoblasts in response to LF are mediated in part by stimulating of IGF-1 gene expression and alterations in the gene expression of IGFBP2.

  16. Activation of AMPK by berberine induces hepatic lipid accumulation by upregulation of fatty acid translocase CD36 in mice

    International Nuclear Information System (INIS)

    Choi, You-Jin; Lee, Kang-Yo; Jung, Seung-Hwan; Kim, Hyung Sik; Shim, Gayong; Kim, Mi-Gyeong; Oh, Yu-Kyoung; Oh, Seon-Hee; Jun, Dae Won; Lee, Byung-Hoon

    2017-01-01

    Emerging evidence has shown that berberine has a protective effect against metabolic syndrome such as obesity and type II diabetes mellitus by activating AMP-activated protein kinase (AMPK). AMPK induces CD36 trafficking to the sarcolemma for fatty acid uptake and oxidation in contracting muscle. However, little is known about the effects of AMPK on CD36 regulation in the liver. We investigated whether AMPK activation by berberine affects CD36 expression and fatty acid uptake in hepatocytes and whether it is linked to hepatic lipid accumulation. Activation of AMPK by berberine or transduction with adenoviral vectors encoding constitutively active AMPK in HepG2 and mouse primary hepatocytes increased the expression and membrane translocation of CD36, resulting in enhanced fatty acid uptake and lipid accumulation as determined by BODIPY-C16 and Nile red fluorescence, respectively. Activation of AMPK by berberine induced the phosphorylation of extracellular signal-regulated kinases 1/2 (ERK1/2) and subsequently induced CCAAT/enhancer-binding protein β (C/EBPβ) binding to the C/EBP-response element in the CD36 promoter in hepatocytes. In addition, hepatic CD36 expression and triglyceride levels were increased in normal diet-fed mice treated with berberine, but completely prevented when hepatic CD36 was silenced with adenovirus containing CD36-specific shRNA. Taken together, prolonged activation of AMPK by berberine increased CD36 expression in hepatocytes, resulting in fatty acid uptake via processes linked to hepatocellular lipid accumulation and fatty liver. - Highlights: • Berberine increases the expression and membrane translocation of CD36 in hepatocytes. • The increase of CD36 results in enhanced fatty acid uptake and lipid accumulation. • Berberine-induced fatty liver is mediated by AMPK-ERK-C/EBPβ pathway. • CD36-specific shRNA inhibited berberine-induced lipid accumulation in liver.

  17. Identification of BIRC6 as a novel intervention target for neuroblastoma therapy

    Directory of Open Access Journals (Sweden)

    Lamers Fieke

    2012-07-01

    Full Text Available Abstract Background Neuroblastoma are pediatric tumors of the sympathetic nervous system with a poor prognosis. Apoptosis is often deregulated in cancer cells, but only a few defects in apoptotic routes have been identified in neuroblastoma. Methods Here we investigated genomic aberrations affecting genes of the intrinsic apoptotic pathway in neuroblastoma. We analyzed DNA profiling data (CGH and SNP arrays and mRNA expression data of 31 genes of the intrinsic apoptotic pathway in a dataset of 88 neuroblastoma tumors using the R2 bioinformatic platform (http://r2.amc.nl. BIRC6 was selected for further analysis as a tumor driving gene. Knockdown experiments were performed using BIRC6 lentiviral shRNA and phenotype responses were analyzed by Western blot and MTT-assays. In addition, DIABLO levels and interactions were investigated with immunofluorescence and co-immunoprecipitation. Results We observed frequent gain of the BIRC6 gene on chromosome 2, which resulted in increased mRNA expression. BIRC6 is an inhibitor of apoptosis protein (IAP, that can bind and degrade the cytoplasmic fraction of the pro-apoptotic protein DIABLO. DIABLO mRNA expression was exceptionally high in neuroblastoma but the protein was only detected in the mitochondria. Upon silencing of BIRC6 by shRNA, DIABLO protein levels increased and cells went into apoptosis. Co-immunoprecipitation confirmed direct interaction between DIABLO and BIRC6 in neuroblastoma cell lines. Conclusion Our findings indicate that BIRC6 may have a potential oncogenic role in neuroblastoma by inactivating cytoplasmic DIABLO. BIRC6 inhibition may therefore provide a means for therapeutic intervention in neuroblastoma.

  18. Urotensin-II receptor is over-expressed in colon cancer cell lines and in colon carcinoma in humans.

    Science.gov (United States)

    Federico, Alessandro; Zappavigna, Silvia; Romano, Marco; Grieco, Paolo; Luce, Amalia; Marra, Monica; Gravina, Antonietta Gerarda; Stiuso, Paola; D'Armiento, Francesco Paolo; Vitale, Giovanni; Tuccillo, Concetta; Novellino, Ettore; Loguercio, Carmela; Caraglia, Michele

    2014-01-01

    Urotensin (U)-II receptor (UTR) has been previously reported to be over-expressed in a number of tumours. Whether UTR-related pathway plays a role in colon carcinogenesis is unknown. We evaluated UTR protein and mRNA expression in human epithelial colon cancer cell lines and in normal colon tissue, adenomatous polyps and colon cancer. U-II protein expression was assessed in cancer cell lines. Moreover, we evaluated the effects of U-II(4-11) (an UTR agonist), antagonists and knockdown of UTR protein expression through a specific shRNA, on proliferation, invasion and motility of human colon cancer cells. Cancer cell lines expressed U-II protein and UTR protein and mRNA. By immunohistochemistry, UTR was expressed in 5-30% of epithelial cells in 45 normal controls, in 30-48% in 21 adenomatous polyps and in 65-90% in 48 colon adenocarcinomas. UTR mRNA expression was increased by threefold in adenomatous polyps and eightfold in colon cancer, compared with normal colon. U-II(4-11) induced a 20-40% increase in cell growth while the blockade of the receptor with specific antagonists caused growth inhibition of 20-40%. Moreover, the knock down of UTR with a shRNA or the inhibition of UTR with the antagonist urantide induced an approximately 50% inhibition of both motility and invasion. UTR appears to be involved in the regulation of colon cancer cell invasion and motility. These data suggest that UTR-related pathway may play a role in colon carcinogenesis and that UTR may function as a target for therapeutic intervention in colon cancer. © 2013 Stichting European Society for Clinical Investigation Journal Foundation.

  19. Protective Effect of Klotho against Ischemic Brain Injury Is Associated with Inhibition of RIG-I/NF-κB Signaling

    Directory of Open Access Journals (Sweden)

    Hong-Jing Zhou

    2018-01-01

    Full Text Available Aging is the greatest independent risk factor for the occurrence of stroke and poor outcomes, at least partially through progressive increases in oxidative stress and inflammation with advanced age. Klotho is an antiaging gene, the expression of which declines with age. Klotho may protect against neuronal oxidative damage that is induced by glutamate. The present study investigated the effects of Klotho overexpression and knockdown by an intracerebroventricular injection of a lentiviral vector that encoded murine Klotho (LV-KL or rat Klotho short-hairpin RNA (LV-KL shRNA on cerebral ischemia injury and the underlying anti-neuroinflammatory mechanism. The overexpression of Klotho induced by LV-KL significantly improved neurobehavioral deficits and increased the number of live neurons in the hippocampal CA1 and caudate putamen subregions 72 h after cerebral hypoperfusion that was induced by transient bilateral common carotid artery occlusion (2VO in mice. The overexpression of Klotho significantly decreased the immunoreactivity of glial fibrillary acidic protein and ionized calcium binding adaptor molecule-1, the expression of retinoic-acid-inducible gene-I, the nuclear translocation of nuclear factor-κB, and the production of proinflammatory cytokines (tumor necrosis factor α and interleukin-6 in 2VO mice. The knockdown of Klotho mediated by LV-KL shRNA in the brain exacerbated neurological dysfunction and cerebral infarct after 22 h of reperfusion following 2 h middle cerebral artery occlusion in rats. These findings suggest that Klotho itself or enhancers of Klotho may compensate for its aging-related decline, thus providing a promising therapeutic approach for acute ischemic stroke during advanced age.

  20. Inhibition of Rac1 ameliorates neuronal oxidative stress damage via reducing Bcl-2/Rac1 complex formation in mitochondria through PI3K/Akt/mTOR pathway.

    Science.gov (United States)

    Pan, Yundan; Wang, Na; Xia, Pingping; Wang, E; Guo, Qulian; Ye, Zhi

    2018-02-01

    Although the neuroprotective effects of Rac1 inhibition have been reported in various cerebral ischemic models, the molecular mechanisms of action have not yet been fully elucidated. In this study, we investigated whether the inhibition of Rac1 provided neuroprotection in a diabetic rat model of focal cerebral ischemia and hyperglycemia-exposed PC-12 cells. Intracerebroventricular administration of lentivirus expressing the Rac1 small hairpin RNA (shRNA) and specific Rac1 inhibitor NSC23766 not only decreased the infarct volumes and improved neurologic deficits with a correlated significant activation of mitochondrial DNA specific proteins, such as OGG1 and POLG, but also elevated Bcl-2 S70 phosphorylation in mitochondria. Furthermore, the levels of p-PI3K, p-Akt and p-mTOR increased, while 8-OHdG, ROS production and Bcl-2/Rac1 complex formation in mitochondria reduced in both Rac1-shRNA- and NSC23766-treated rats. Moreover, to confirm our in vivo observations, inhibition of Rac1 activity by NSC23766 suppressed the interactions between Bcl-2 and Rac1 in the mitochondria of PC-12 cells cultured in high glucose conditions and protected PC-12 cells from high glucose-induced neurotoxicity. More importantly, these beneficial effects of Rac1 inhibition were abolished by PI3K inhibitor LY294002. In contrast to NSC23766 treatment, LY294002 had little effect on the decrement of p-PTEN level. Taken together, these findings revealed novel neuroprotective roles of Rac1 inhibition against cerebral ischemic reperfusion injury in vivo and high glucose-induced neurotoxicity in PC-12 cells in vitro, by reducing Bcl-2/Rac1 complex formation in mitochondria through the activation of PI3K/Akt/mTOR survival pathway. Copyright © 2017 Elsevier Inc. All rights reserved.

  1. Pioglitazone Confers Neuroprotection Against Ischemia-Induced Pyroptosis due to its Inhibitory Effects on HMGB-1/RAGE and Rac1/ROS Pathway by Activating PPAR-ɤ.

    Science.gov (United States)

    Xia, Pingping; Pan, Yundan; Zhang, Fan; Wang, Na; Wang, E; Guo, Qulian; Ye, Zhi

    2018-01-01

    Recent researches highlighted the protective potential of pioglitazone, a PPAR-γ agonist, in the progression of cerebral ischemia-reperfusion injury. However, there has been no study on the application of pioglitazone in treating ischemic stroke through mechanisms involving pyroptosis. The cerebral injury was established by middle cerebral artery occlusion (MCAO). in vitro ischemia in primary cultured astrocytes was induced by the oxygen-glucose deprivation (OGD). ELISA and Western Blot analysis were employed to the levels of PPAR-γ, pyroptosis-related biomarkers and cytoplasmic translocation of HMGB-1 and RAGE expression as well as Rac1 activity, respectively. We demonstrated that repeated intraperitoneal administration of pioglitazone remarkably reduced the infarct volume, improved neurological deficits and suppressed the Rac1 activity with significant reduction of excessive ROS in rat model of middle cerebral artery occlusion (MCAO). Moreover, pioglitazone alleviated the up-regulation of pyroptosis-related biomarkers and the increased cytoplasmic translocation of HMGB-1 and RAGE expression in cerebral penumbra cortex. Similarly, the protective effects of pioglitazone on cultured astrocytes were characterized by reduced Rac1 activity, pyroptosis related protein expressions and lactate dehydrogenase (LDH) release. However, these protective effects of pioglitazone were neutralized with the use of GW9662, a PPAR-γ inhibitor. Interestingly, Rac1 knockdown in lentivirus with the Rac1 small hair RNA (shRNA) could inhibit the OGD-induced pyroptosis of primary cultured astrocytes. Furthermore, the combination of Rac1-shRNA and pioglitazone can further strengthen the inhibitory effects on pyroptosis induced by OGD. The neuroprotection of pioglitazone was attributable to the alleviated ischemia/hypoxia-induced pyroptosis and was also associated with the PPARγ-mediated suppression of HGMB-1/RAGE signaling pathway. Moreover, the inhibition of Rac1 promoted this function

  2. The role of catechol-O-methyltransferase in catechol-enhanced erythroid differentiation of K562 cells

    International Nuclear Information System (INIS)

    Suriguga,; Li, Xiao-Fei; Li, Yang; Yu, Chun-Hong; Li, Yi-Ran; Yi, Zong-Chun

    2013-01-01

    Catechol is widely used in pharmaceutical and chemical industries. Catechol is also one of phenolic metabolites of benzene in vivo. Our previous study showed that catechol improved erythroid differentiation potency of K562 cells, which was associated with decreased DNA methylation in erythroid specific genes. Catechol is a substrate for the catechol-O-methyltransferase (COMT)-mediated methylation. In the present study, the role of COMT in catechol-enhanced erythroid differentiation of K562 cells was investigated. Benzidine staining showed that exposure to catechol enhanced hemin-induced hemoglobin accumulation and induced mRNA expression of erythroid specific genes in K562 cells. Treatment with catechol caused a time- and concentration-dependent increase in guaiacol concentration in the medium of cultured K562 cells. When COMT expression was knocked down by COMT shRNA expression in K562 cells, the production of guaiacol significantly reduced, and the sensitivity of K562 cells to cytotoxicity of catechol significantly increased. Knockdown of COMT expression by COMT shRNA expression also eliminated catechol-enhanced erythroid differentiation of K562 cells. In addition, the pre-treatment with methyl donor S-adenosyl-L-methionine or its demethylated product S-adenosyl-L-homocysteine induced a significant increase in hemin-induced Hb synthesis in K562 cells and the mRNA expression of erythroid specific genes. These findings indicated that O-methylation catalyzed by COMT acted as detoxication of catechol and involved in catechol-enhanced erythroid differentiation of K562 cells, and the production of S-adenosyl-L-homocysteine partly explained catechol-enhanced erythroid differentiation. - Highlights: • Catechol enhanced hemin-induced hemoglobin accumulation. • COMT-catalyzed methylation acted as detoxication of catechol. • COMT involved in catechol-enhanced erythroid differentiation

  3. The role of chicken ovalbumin upstream promoter transcription factor II in the regulation of hepatic fatty acid oxidation and gluconeogenesis in newborn mice.

    Science.gov (United States)

    Planchais, Julien; Boutant, Marie; Fauveau, Véronique; Qing, Lou Dan; Sabra-Makke, Lina; Bossard, Pascale; Vasseur-Cognet, Mireille; Pégorier, Jean-Paul

    2015-05-15

    Chicken ovalbumin upstream promoter transcription factor II (COUP-TFII) is an orphan nuclear receptor involved in the control of numerous functions in various organs (organogenesis, differentiation, metabolic homeostasis, etc.). The aim of the present work was to characterize the regulation and contribution of COUP-TFII in the control of hepatic fatty acid and glucose metabolisms in newborn mice. Our data show that postnatal increase in COUP-TFII mRNA levels is enhanced by glucagon (via cAMP) and PPARα. To characterize COUP-TFII function in the liver of suckling mice, we used a functional (dominant negative form; COUP-TFII-DN) and a genetic (shRNA) approach. Adenoviral COUP-TFII-DN injection induces a profound hypoglycemia due to the inhibition of gluconeogenesis and fatty acid oxidation secondarily to reduced PEPCK, Gl-6-Pase, CPT I, and mHMG-CoA synthase gene expression. Using the crossover plot technique, we show that gluconeogenesis is inhibited at two different levels: 1) pyruvate carboxylation and 2) trioses phosphate synthesis. This could result from a decreased availability in fatty acid oxidation arising cofactors such as acetyl-CoA and reduced equivalents. Similar results are observed using the shRNA approach. Indeed, when fatty acid oxidation is rescued in response to Wy-14643-induced PPARα target genes (CPT I and mHMG-CoA synthase), blood glucose is normalized in COUP-TFII-DN mice. In conclusion, this work demonstrates that postnatal increase in hepatic COUP-TFII gene expression is involved in the regulation of liver fatty acid oxidation, which in turn sustains an active hepatic gluconeogenesis that is essential to maintain an appropriate blood glucose level required for newborn mice survival. Copyright © 2015 the American Physiological Society.

  4. RhoB mediates antitumor synergy of combined ixabepilone and sunitinib in human ovarian serous cancer.

    Science.gov (United States)

    Vishnu, Prakash; Colon-Otero, Gerardo; Kennedy, Gregory T; Marlow, Laura A; Kennedy, William P; Wu, Kevin J; Santoso, Joseph T; Copland, John A

    2012-03-01

    The aim was to evaluate antitumor activity of the combination of ixabepilone and sunitinib in pre-clinical models of chemotherapy naïve and refractory epithelial ovarian tumors, and to investigate the mechanism of synergy of such drug combination. HOVTAX2 cell line was derived from a metastatic serous papillary epithelial ovarian tumor (EOC) and a paclitaxel-resistant derivative was established. Dose response curves for ixabepilone and sunitinib were generated and synergy was determined using combination indexes. The molecular mechanism of antitumor synergy was examined using shRNA silencing. The combination of ixabepilone and sunitinib demonstrated robust antitumor synergy in naïve and paclitaxel-resistant HOVTAX2 cell lines due to increased apoptosis. The GTPase, RhoB, was synergistically upregulated in cells treated with ixabepilone and sunitinib. Using shRNA, RhoB was demonstrated to mediate antitumor synergy. These results were validated in two other EOC cell lines. Ixabepilone plus sunitinib demonstrated antitumor synergy via RhoB in naïve and paclitaxel-resistant cells resulting in apoptosis. This study demonstrates a novel mechanism of action leading to antitumor synergy and provides 'proof-of-principle' for combining molecular targeted agents with cytotoxic chemotherapy to improve antitumor efficacy. RhoB could be envisioned as an early biomarker of response to therapy in a planned Phase II clinical trial to assess the efficacy of ixabepilone combined with a receptor tyrosine kinase inhibitor such as sunitinib. To the best of our knowledge, this is the first demonstration of antitumor synergy between these two classes of drugs in EOC and the pivotal role of RhoB in this synergy. Copyright © 2011 Elsevier Inc. All rights reserved.

  5. Adenovirus delivered short hairpin RNA targeting a conserved site in the 5' non-translated region inhibits all four serotypes of dengue viruses.

    Directory of Open Access Journals (Sweden)

    Anil Babu Korrapati

    Full Text Available BACKGROUND: Dengue is a mosquito-borne viral disease caused by four closely related serotypes of Dengue viruses (DENVs. This disease whose symptoms range from mild fever to potentially fatal haemorrhagic fever and hypovolemic shock, threatens nearly half the global population. There is neither a preventive vaccine nor an effective antiviral therapy against dengue disease. The difference between severe and mild disease appears to be dependent on the viral load. Early diagnosis may enable timely therapeutic intervention to blunt disease severity by reducing the viral load. Harnessing the therapeutic potential of RNA interference (RNAi to attenuate DENV replication may offer one approach to dengue therapy. METHODOLOGY/PRINCIPAL FINDINGS: We screened the non-translated regions (NTRs of the RNA genomes of representative members of the four DENV serotypes for putative siRNA targets mapping to known transcription/translation regulatory elements. We identified a target site in the 5' NTR that maps to the 5' upstream AUG region, a highly conserved cis-acting element essential for viral replication. We used a replication-defective human adenovirus type 5 (AdV5 vector to deliver a short-hairpin RNA (shRNA targeting this site into cells. We show that this shRNA matures to the cognate siRNA and is able to inhibit effectively antigen secretion, viral RNA replication and infectious virus production by all four DENV serotypes. CONCLUSION/SIGNIFICANCE: The data demonstrate the feasibility of using AdV5-mediated delivery of shRNAs targeting conserved sites in the viral genome to achieve inhibition of all four DENV serotypes. This paves the way towards exploration of RNAi as a possible therapeutic strategy to curtail DENV infection.

  6. The role of catechol-O-methyltransferase in catechol-enhanced erythroid differentiation of K562 cells

    Energy Technology Data Exchange (ETDEWEB)

    Suriguga,; Li, Xiao-Fei; Li, Yang; Yu, Chun-Hong; Li, Yi-Ran; Yi, Zong-Chun, E-mail: yizc@buaa.edu.cn

    2013-12-15

    Catechol is widely used in pharmaceutical and chemical industries. Catechol is also one of phenolic metabolites of benzene in vivo. Our previous study showed that catechol improved erythroid differentiation potency of K562 cells, which was associated with decreased DNA methylation in erythroid specific genes. Catechol is a substrate for the catechol-O-methyltransferase (COMT)-mediated methylation. In the present study, the role of COMT in catechol-enhanced erythroid differentiation of K562 cells was investigated. Benzidine staining showed that exposure to catechol enhanced hemin-induced hemoglobin accumulation and induced mRNA expression of erythroid specific genes in K562 cells. Treatment with catechol caused a time- and concentration-dependent increase in guaiacol concentration in the medium of cultured K562 cells. When COMT expression was knocked down by COMT shRNA expression in K562 cells, the production of guaiacol significantly reduced, and the sensitivity of K562 cells to cytotoxicity of catechol significantly increased. Knockdown of COMT expression by COMT shRNA expression also eliminated catechol-enhanced erythroid differentiation of K562 cells. In addition, the pre-treatment with methyl donor S-adenosyl-L-methionine or its demethylated product S-adenosyl-L-homocysteine induced a significant increase in hemin-induced Hb synthesis in K562 cells and the mRNA expression of erythroid specific genes. These findings indicated that O-methylation catalyzed by COMT acted as detoxication of catechol and involved in catechol-enhanced erythroid differentiation of K562 cells, and the production of S-adenosyl-L-homocysteine partly explained catechol-enhanced erythroid differentiation. - Highlights: • Catechol enhanced hemin-induced hemoglobin accumulation. • COMT-catalyzed methylation acted as detoxication of catechol. • COMT involved in catechol-enhanced erythroid differentiation.

  7. Decreased expression of RNA interference machinery, Dicer and Drosha, is associated with poor outcome in ovarian cancer patients

    Energy Technology Data Exchange (ETDEWEB)

    Merritt, William M.; Lin, Yvonne G.; Han, Liz Y.; Kamat, Aparna A.; Spannuth, Whitney A.; Schmandt, Rosemarie; Urbauer, Diana; Pennacchio, Len A.; Cheng, Jan-Fang; Zeidan, Alexandra; Wang, Hua; Mueller, Peter; Lenburg, Marc E.; Gray, Joe W.; Mok, Samuel; Birrer, Michael J.; Lopez-Berestein, Gabriel; Coleman, Robert L.; Bar-Eli, Menashe; Sood, Anil K.

    2008-05-06

    The clinical and functional significance of RNA interference (RNAi) machinery, Dicer and Drosha, in ovarian cancer is not known and was examined. Dicer and Drosha expression was measured in ovarian cancer cell lines (n=8) and invasive epithelial ovarian cancer specimens (n=111) and correlated with clinical outcome. Validation was performed with previously published cohorts of ovarian, breast, and lung cancer patients. Anti-Galectin-3 siRNA and shRNA transfections were used for in vitro functional studies. Dicer and Drosha mRNA and protein levels were decreased in 37% to 63% of ovarian cancer cell lines and in 60% and 51% of human ovarian cancer specimens, respectively. Low Dicer was significantly associated with advanced tumor stage (p=0.007), and low Drosha with suboptimal surgical cytoreduction (p=0.02). Tumors with both high Dicer and Drosha were associated with increased median patient survival (>11 years vs. 2.66 years for other groups; p<0.001). In multivariate analysis, high Dicer (HR=0.48; p=0.02), high-grade histology (HR=2.46; p=0.03), and poor chemoresponse (HR=3.95; p<0.001) were identified as independent predictors of disease-specific survival. Findings of poor clinical outcome with low Dicer expression were validated in separate cohorts of cancer patients. Galectin-3 silencing with siRNA transfection was superior to shRNA in cell lines with low Dicer (78-95% vs. 4-8% compared to non-targeting sequences), and similar in cell lines with high Dicer. Our findings demonstrate the clinical and functional impact of RNAi machinery alterations in ovarian carcinoma and support the use of siRNA constructs that do not require endogenous Dicer and Drosha for therapeutic applications.

  8. Inhibition of histone deacetylases 1 and 6 enhances cytarabine-induced apoptosis in pediatric acute myeloid leukemia cells.

    Directory of Open Access Journals (Sweden)

    Xuelian Xu

    Full Text Available BACKGROUND: Pediatric acute myeloid leukemia (AML remains a challenging disease to treat even with intensified cytarabine-based chemotherapy. Histone deacetylases (HDACs have been reported to be promising therapeutic targets for treating AML. However, HDAC family members that are involved in chemotherapy sensitivities remain unknown. In this study, we sought to identify members of the HDAC family that are involved in cytarabine sensitivities, and to select the optimal HDACI that is most efficacious when combined with cytarabine for treating children with AML. METHODOLOGY: Expression profiles of classes I, II, and IV HDACs in 4 pediatric AML cell lines were determined by Western blotting. Inhibition of class I HDACs by different HDACIs was measured post immnunoprecipitation. Individual down-regulation of HDACs in pediatric AML cells was performed with lentiviral shRNA. The effects of cytarabine and HDACIs on apoptosis were determined by flow cytometry analysis. RESULTS: Treatments with structurally diverse HDACIs and HDAC shRNA knockdown experiments revealed that down-regulation of both HDACs 1 and 6 is critical in enhancing cytarabine-induced apoptosis in pediatric AML, at least partly mediated by Bim. However, down-regulation of HDAC2 may negatively impact cytarabine sensitivities in the disease. At clinically achievable concentrations, HDACIs that simultaneously inhibited both HDACs 1 and 6 showed the best anti-leukemic activities and significantly enhanced cytarabine-induced apoptosis. CONCLUSION: Our results further confirm that HDACs are bona fide therapeutic targets for treating pediatric AML and suggest that pan-HDACIs may be more beneficial than isoform-specific drugs.

  9. Cytokinetically quiescent (G0/G1) human multiple myeloma cells are susceptible to simultaneous inhibition of Chk1 and MEK1/2.

    Science.gov (United States)

    Pei, Xin-Yan; Dai, Yun; Youssefian, Leena E; Chen, Shuang; Bodie, Wesley W; Takabatake, Yukie; Felthousen, Jessica; Almenara, Jorge A; Kramer, Lora B; Dent, Paul; Grant, Steven

    2011-11-10

    Effects of Chk1 and MEK1/2 inhibition were investigated in cytokinetically quiescent multiple myeloma (MM) and primary CD138(+) cells. Coexposure to the Chk1 and MEK1/2 inhibitors AZD7762 and selumetinib (AZD6244) robustly induced apoptosis in various MM cells and CD138(+) primary samples, but spared normal CD138(-) and CD34(+) cells. Furthermore, Chk1/MEK1/2 inhibitor treatment of asynchronized cells induced G(0)/G(1) arrest and increased apoptosis in all cell-cycle phases, including G(0)/G(1). To determine whether this regimen is active against quiescent G(0)/G(1) MM cells, cells were cultured in low-serum medium to enrich the G(0)/G(1) population. G(0)/G(1)-enriched cells exhibited diminished sensitivity to conventional agents (eg, Taxol and VP-16) but significantly increased susceptibility to Chk1 ± MEK1/2 inhibitors or Chk1 shRNA knock-down. These events were associated with increased γH2A.X expression/foci formation and Bim up-regulation, whereas Bim shRNA knock-down markedly attenuated lethality. Immunofluorescent analysis of G(0)/G(1)-enriched or primary MM cells demonstrated colocalization of activated caspase-3 and the quiescent (G(0)) marker statin, a nuclear envelope protein. Finally, Chk1/MEK1/2 inhibition increased cell death in the Hoechst-positive (Hst(+)), low pyronin Y (PY)-staining (2N Hst(+)/PY(-)) G(0) population and in sorted small side-population (SSP) MM cells. These findings provide evidence that cytokinetically quiescent MM cells are highly susceptible to simultaneous Chk1 and MEK1/2 inhibition.

  10. Inhibition of STAT-3 results in greater cetuximab sensitivity in head and neck squamous cell carcinoma

    International Nuclear Information System (INIS)

    Bonner, James A.; Yang, Eddy S.; Trummell, Hoa Q.; Nowsheen, Somaira; Willey, Christopher D.; Raisch, Kevin P.

    2011-01-01

    Objective: The inhibition of epidermal growth factor receptor (EGFr) with the monoclonal antibody cetuximab reduces cell proliferation and survival which correlates with increased DNA damage. Since the signal transducer and activator of transcription-3 (STAT-3) is involved in the EGFr-induced signaling pathway, we hypothesized that depletion of STAT-3 may augment cetuximab-induced processes in human head and neck cancer cells. Materials and methods: Human head and neck squamous carcinoma cells (UM-SCC-5) were transfected with short hairpin RNA (shRNA) against STAT-3 (STAT3-2.4 and 2.9 cells). A mutated form of this shRNA was transfected for a control (NEG4.17 cells). Radiosensitivity was assessed by a standard colony formation assay. Proliferation was assessed by daily cell counts following treatment and apoptosis was assessed by an annexin V-FITC assay. The alkaline comet assay was used to assess DNA damage. Results: The STAT-3 knockdown cells (STAT3-2.4 and STAT3-2.9 cells) demonstrated enhanced radiosensitivity compared to control NEG4.17 cells, which correlated with increased apoptosis. Also, the STAT-3 knockdown cells demonstrated decreased proliferation with cetuximab treatments compared to control cells (NEG4.17). The increased cetuximab sensitivity of the STAT-3 knockdown cells correlated with increased apoptosis and DNA damage compared to control cells (NEG4.17). Conclusion: These studies revealed that the greater anti-proliferative effects and increased cytotoxicity of cetuximab in the STAT3-2.4 and STAT3-2.9 cells compared to control NEG4.17 cells, may be a result of STAT3-mediated effects on cellular apoptosis and DNA damage.

  11. Silencing of reversion-inducing cysteine-rich protein with Kazal motifs stimulates hyperplastic phenotypes through activation of epidermal growth factor receptor and hypoxia-inducible factor-2α.

    Directory of Open Access Journals (Sweden)

    You Mie Lee

    Full Text Available Reversion-inducing cysteine-rich protein with Kazal motifs (RECK, a tumor suppressor is down-regulated by the oncogenic signals and hypoxia, but the biological function of RECK in early tumorigenic hyperplastic phenotypes is largely unknown. Knockdown of RECK by small interfering RNA (siRECK or hypoxia significantly promoted cell proliferation in various normal epithelial cells. Hypoxia as well as knockdown of RECK by siRNA increased the cell cycle progression, the levels of cyclin D1 and c-Myc, and the phosphorylation of Rb protein (p-pRb, but decreased the expression of p21(cip1, p27(kip1, and p16(ink4A. HIF-2α was upregulated by knockdown of RECK, indicating HIF-2α is a downstream target of RECK. As knockdown of RECK induced the activation of epidermal growth factor receptor (EGFR and treatment of an EGFR kinase inhibitor, gefitinib, suppressed HIF-2α expression induced by the silencing of RECK, we can suggest that the RECK silenicng-EGFR-HIF-2α axis might be a key molecular mechanism to induce hyperplastic phenotype of epithelial cells. It was also found that shRNA of RECK induced larger and more numerous colonies than control cells in an anchorage-independent colony formation assay. Using a xenograft assay, epithelial cells with stably transfected with shRNA of RECK formed a solid mass earlier and larger than those with control cells in nude mice. In conclusion, the suppression of RECK may promote the development of early tumorigenic hyperplastic characteristics in hypoxic stress.

  12. Suppression of autophagy enhances the cytotoxicity of the DNA-damaging aromatic amine p-anilinoaniline

    International Nuclear Information System (INIS)

    Elliott, Althea; Reiners, John J.

    2008-01-01

    p-Anilinoaniline (pAA) is an aromatic amine that is widely used in hair dying applications. It is also a metabolite of metanil yellow, an azo dye that is commonly used as a food coloring agent. Concentrations of pAA between 10 and 25 μM were cytostatic to cultures of the normal human mammary epithelia cell line MCF10A. Concentrations ≥ 50 μM were cytotoxic. Cytostatic concentrations induced transient G 1 and S cell cycle phase arrests; whereas cytotoxic concentrations induced protracted arrests. Cytotoxic concentrations of pAA caused DNA damage, as monitored by the alkaline single-cell gel electrophoresis (Comet) assay, and morphological changes consistent with cells undergoing apoptosis and/or autophagy. Enzymatic and western blot analyses, and binding analyses of fluorescent labeled VAD-FMK, suggested that caspase family members were activated by pAA. Western blot analyses documented the conversion of LC3-I to LC3-II, a post-translational modification involved in the development of the autophagosome. Suppression of autophagosome formation, via knockdown of ATG7 with shRNA, prevented pAA-induced vacuolization, enhanced the activation of pro-caspase-3, and increased susceptibility of ATG7-deficient cells to the cytostatic and cytotoxic activities of markedly lower concentrations of pAA. Cells stably transfected with a nonsense shRNA behaved like parental MCF10A cells. Collectively, these data suggest that MCF10A cultures undergo autophagy as a pro-survival response to concentrations of pAA sufficient to induce DNA damage

  13. DNMT1 is associated with cell cycle and DNA replication gene sets in diffuse large B-cell lymphoma.

    Science.gov (United States)

    Loo, Suet Kee; Ab Hamid, Suzina Sheikh; Musa, Mustaffa; Wong, Kah Keng

    2018-01-01

    Dysregulation of DNA (cytosine-5)-methyltransferase 1 (DNMT1) is associated with the pathogenesis of various types of cancer. It has been previously shown that DNMT1 is frequently expressed in diffuse large B-cell lymphoma (DLBCL), however its functions remain to be elucidated in the disease. In this study, we gene expression profiled (GEP) shRNA targeting DNMT1(shDNMT1)-treated germinal center B-cell-like DLBCL (GCB-DLBCL)-derived cell line (i.e. HT) compared with non-silencing shRNA (control shRNA)-treated HT cells. Independent gene set enrichment analysis (GSEA) performed using GEPs of shRNA-treated HT cells and primary GCB-DLBCL cases derived from two publicly-available datasets (i.e. GSE10846 and GSE31312) produced three separate lists of enriched gene sets for each gene sets collection from Molecular Signatures Database (MSigDB). Subsequent Venn analysis identified 268, 145 and six consensus gene sets from analyzing gene sets in C2 collection (curated gene sets), C5 sub-collection [gene sets from gene ontology (GO) biological process ontology] and Hallmark collection, respectively to be enriched in positive correlation with DNMT1 expression profiles in shRNA-treated HT cells, GSE10846 and GSE31312 datasets [false discovery rate (FDR) 0.8) with DNMT1 expression and significantly downregulated (log fold-change <-1.35; p<0.05) following DNMT1 silencing in HT cells. These results suggest the involvement of DNMT1 in the activation of cell cycle and DNA replication in DLBCL cells. Copyright © 2017 Elsevier GmbH. All rights reserved.

  14. Identification of NDRG1-regulated genes associated with invasive potential in cervical and ovarian cancer cells

    International Nuclear Information System (INIS)

    Zhao, Gang; Chen, Jiawei; Deng, Yanqiu; Gao, Feng; Zhu, Jiwei; Feng, Zhenzhong; Lv, Xiuhong; Zhao, Zheng

    2011-01-01

    Highlights: → NDRG1 was knockdown in cervical and ovarian cancer cell lines by shRNA technology. → NDRG1 knockdown resulted in increased cell invasion activities. → Ninety-six common deregulated genes in both cell lines were identified by cDNA microarray. → Eleven common NDRG1-regulated genes might enhance cell invasive activity. → Regulation of invasion by NDRG1 is an indirect and complicated process. -- Abstract: N-myc downstream regulated gene 1 (NDRG1) is an important gene regulating tumor invasion. In this study, shRNA technology was used to suppress NDRG1 expression in CaSki (a cervical cancer cell line) and HO-8910PM (an ovarian cancer cell line). In vitro assays showed that NDRG1 knockdown enhanced tumor cell adhesion, migration and invasion activities without affecting cell proliferation. cDNA microarray analysis revealed 96 deregulated genes with more than 2-fold changes in both cell lines after NDRG1 knockdown. Ten common upregulated genes (LPXN, DDR2, COL6A1, IL6, IL8, FYN, PTP4A3, PAPPA, ETV5 and CYGB) and one common downregulated gene (CLCA2) were considered to enhance tumor cell invasive activity. BisoGenet network analysis indicated that NDRG1 regulated these invasion effector genes/proteins in an indirect manner. Moreover, NDRG1 knockdown also reduced pro-invasion genes expression such as MMP7, TMPRSS4 and CTSK. These results suggest that regulation of invasion and metastasis by NDRG1 is a highly complicated process.

  15. Stable knockdown of PASG enhances DNA demethylation but does not accelerate cellular senescence in TIG-7 human fibroblasts.

    Science.gov (United States)

    Suzuki, Toshikazu; Farrar, Jason E; Yegnasubramanian, Srinivasan; Zahed, Muhammed; Suzuki, Nobuo; Arceci, Robert J

    2008-09-01

    Demethylation of 5-methylcytosine in genomic DNA is believed to be one of the mechanisms underlying replicative life-span of mammalian cells. Both proliferation associated SNF2-like gene (PASG, also termed Lsh) and DNA methyltransferase 3B (Dnmt3b) knockout mice result in embryonic genomic hypomethylation and a replicative senescent phenotype. However, it is unclear whether gradual demethylation of DNA during somatic cell division is directly involved in senescence. In this study, we retrovirally transduced TIG-7 human fibroblasts with a shRNA against PASG and compared the rate of change in DNA methylation as well as the replicative life-span to control cells under low (3%) and ambient (20%) oxygen. Expression of PASG protein was decreased by approximately 80% compared to control cells following transduction of PASG shRNA gene. The rate of cell growth was the same in both control and PASG-suppressed cells. The rate of demethylation of DNA was significantly increased in PASG-suppressed cells as compared control cells. However, decreased PASG expression did not shorten the replicative life-span of TIG-7 cells. Culture under low oxygen extended the life-span of TIG-7 cells but did not alter the rate of DNA demethylation. While knockout of PASG during development results in genomic hypomethylation and premature senescence, our results show that while downregulation of PASG expression in a somatic cell also leads to DNA hypomethylation, there is no associated senescent phenotype. These results suggest differences in cellular consequences of hypomethylation mediated by PASG during development compared to that in somatic cells.

  16. Metabolic remodeling precedes mitochondrial outer membrane permeabilization in human glioma xenograft cells.

    Science.gov (United States)

    Ponnala, Shivani; Chetty, Chandramu; Veeravalli, Krishna Kumar; Dinh, Dzung H; Klopfenstein, Jeffrey D; Rao, Jasti S

    2012-02-01

    Glioma cancer cells adapt to changing microenvironment and shift from mitochondrial oxidative phosphorylation to aerobic glycolysis for their metabolic needs irrespective of oxygen availability. In the present study, we show that silencing MMP-9 in combination with uPAR/cathepsin B switch the glycolytic metabolism of glioma cells to oxidative phosphorylation (OXPHOS) and generate reactive oxygen species (ROS) to predispose glioma cells to mitochondrial outer membrane permeabilization. shRNA for MMP-9 and uPAR (pMU) as well as shRNA for MMP-9 and cathepsin B (pMC) activated complexes of mitochondria involved in OXPHOS and inhibited glycolytic hexokinase expression. The decreased interaction of hexokinase 2 with mitochondria in the treated cells indicated the inhibition of glycolysis activation. Overexpression of Akt reversed the pMU- and pMC-mediated OXPHOS to glycolysis switch. The OXPHOS un-coupler oligomycin A altered the expression levels of the Bcl-2 family of proteins; treatment with pMU or pMC reversed this effect and induced mitochondrial outer membrane permeabilization. In addition, our results show changes in mitochondrial pore transition to release cytochrome c due to changes in the VDAC-Bcl-XL and BAX-BAK interaction with pMU and pMC treatments. Taken together, our results suggest that pMU and pMC treatments switch glioma cells from the glycolytic to the OXPHOS pathway through an inhibitory effect on Akt, ROS induction and an increase of cytosolic cytochrome c accumulation. These results demonstrate the potential of pMU and pMC as therapeutic candidates for the treatment of glioma.

  17. Functional characterization of six aspartate (D) recombinant mojastin mutants (r-Moj): A second aspartate amino acid carboxyl to the RGD in r-Moj-D_ peptides is not sufficient to induce apoptosis of SK-Mel-28 cells.

    Science.gov (United States)

    Ramos, Carla J; Gutierrez, Daniel A; Aranda, Ana S; Koshlaychuk, Melissa A; Carrillo, David A; Medrano, Rafael; McBride, Terri D; U, Andrew; Medina, Stephanie M; Lombardo, Melissa C; Lucena, Sara E; Sanchez, Elda E; Soto, Julio G

    2016-08-01

    Disintegrins are small peptides produced in viper venom that act as integrin antagonists. When bound to integrins, disintegrins induce altered cellular behaviors, such as apoptotic induction. Disintegrins with RGDDL or RGDDM motifs induce apoptosis of normal and cancer cells. We hypothesized that a second aspartate (D) carboxyl to the RGD is sufficient to induce apoptosis. Five recombinant mojastin D mutants were produced by site-directed mutagenesis (r-Moj-DA, r-Moj-DG, r-Moj-DL, r-Moj-DN, and r-Moj-DV). Stable αv integrin knockdown and shRNA scrambled control SK-Mel-28 cell lines were produced to test a second hypothesis: r-Moj-D_ peptides bind to αv integrin. Only r-Moj-DL, r-Moj-DM, and r-Moj-DN induced apoptosis of SK-Mel-28 cells (at 29.4%, 25.6%, and 36.2%, respectively). Apoptotic induction was significantly reduced in SK-Mel-28 cells with a stable αv integrin knockdown (to 2%, 17%, and 2%, respectively), but not in SK-Mel-28 cells with a stable scrambled shRNA. All six r-Moj-D_ peptides inhibited cell proliferation; ranging from 49.56% (r-Moj-DN) to 75.6% (r-Moj-DA). Cell proliferation inhibition by r-Moj-D_ peptides was significantly reduced in SK-Mel-28 cells with a stable αv integrin knockdown. All six r-Moj-D_ peptides inhibited SK-Mel-28 cell migration at high levels (69%-100%). As a consequence, rac-1 mRNA expression levels were significantly reduced as early as 1 h after treatment, suggesting that rac-1 is involved in the cell migration activity of SK-Mel-28. Copyright © 2016 Elsevier Ltd. All rights reserved.

  18. Recent Findings Concerning PAMAM Dendrimer Conjugates with Cyclodextrins as Carriers of DNA and RNA

    Directory of Open Access Journals (Sweden)

    Keiichi Motoyama

    2009-08-01

    Full Text Available We have evaluated the potential use of various polyamidoamine (PAMAM dendrimer [dendrimer, generation (G 2-4] conjugates with cyclodextrins (CyDs as novel DNA and RNA carriers. Among the various dendrimer conjugates with CyDs, the dendrimer (G3 conjugate with α-CyD having an average degree of substitution (DS of 2.4 [α-CDE (G3, DS2] displayed remarkable properties as DNA, shRNA and siRNA delivery carriers through the sensor function of α-CDEs toward nucleic acid drugs, cell surface and endosomal membranes. In an attempt to develop cell-specific gene transfer carriers, we prepared sugar-appended α-CDEs. Of the various sugar-appended α-CDEs prepared, galactose- or mannose-appended α-CDEs provided superior gene transfer activity to α-CDE in various cells, but not cell-specific gene delivery ability. However, lactose-appended α-CDE [Lac-α-CDE (G2] was found to possess asialoglycoprotein receptor (AgpR-mediated hepatocyte-selective gene transfer activity, both in vitro and in vivo. Most recently, we prepared folate-poly(ethylene glycol-appended α-CDE [Fol-PαC (G3] and revealed that Fol-PαC (G3 imparted folate receptor (FR-mediated cancer cell-selective gene transfer activity. Consequently, α-CDEs bearing integrated, multifunctional molecules may possess the potential to be novel carriers for DNA, shRNA and siRNA.

  19. Cytoplasmic p21 is a potential predictor for cisplatin sensitivity in ovarian cancer

    International Nuclear Information System (INIS)

    Xia, Xi; Weng, Yanjie; Liao, Shujie; Han, Zhiqiang; Liu, Ronghua; Zhu, Tao; Wang, Shixuan; Xu, Gang; Meng, Li; Zhou, Jianfeng; Ma, Ding; Ma, Quanfu; Li, Xiao; Ji, Teng; Chen, Pingbo; Xu, Hongbin; Li, Kezhen; Fang, Yong; Weng, Danhui

    2011-01-01

    P21 (WAF1/Cip1) binds to cyclin-dependent kinase complexes and inhibits their activities. It was originally described as an inhibitor of cancer cell proliferation. However, many recent studies have shown that p21 promotes tumor progression when accumulated in the cell cytoplasm. So far, little is known about the correlation between cytoplasmic p21 and drug resistance. This study was aimed to investigate the role of p21 in the cisplatin resistance of ovarian cancer. RT-PCR, western blot and immunofluorescence were used to detect p21 expression and location in cisplatin-resistant ovarian cancer cell line C13* and its parental line OV2008. Regulation of cytoplasmic p21 was performed through transfection of p21 siRNA, Akt2 shRNA and Akt2 constitutively active vector in the two cell lines; their effects on cisplatin-induced apoptosis were evaluated by flow cytometry. Tumor tissue sections of clinical samples were analyzed by immunohistochemistry. p21 predominantly localizes to the cytoplasm in C13* compared to OV2008. Persistent exposure to low dose cisplatin in OV2008 leads to p21 translocation from nuclear to cytoplasm, while it had not impact on p21 localization in C13*. Knockdown of cytoplasmic p21 by p21 siRNA transfection in C13* notably increased cisplatin-induced apoptosis through activation of caspase 3. Inhibition of p21 translocation into the cytoplasm by transfection of Akt2 shRNA into C13* cells significantly increased cisplatin-induced apoptosis, while induction of p21 translocation into the cytoplasm by transfection of constitutively active Akt2 in OV2008 enhanced the resistance to cisplatin. Immunohistochemical analysis of clinical ovarian tumor tissues demonstrated that cytoplasmic p21 was negatively correlated with the response to cisplatin based treatment. Cytoplasmic p21 is a novel biomarker of cisplatin resistance and it may represent a potential therapeutic target for ovarian tumors that are refractory to conventional treatment

  20. Effect of proline rich 15-deficiency on trophoblast viability and survival.

    Directory of Open Access Journals (Sweden)

    Katherine C Gates

    Full Text Available Deviations from the normal program of gene expression during early pregnancy can lead to early embryonic loss as well as dysfunctional placentation, which can cause significant morbidity and mortality. Proline rich 15 (PRR15 is a low molecular weight nuclear protein expressed by the trophoblast during early gestation. Lentivirus-mediated knockdown of PRR15 mRNA in ovine trophectoderm led to demise of the embryo by gestational day 15, providing compelling evidence that PRR15 expression is critical during this precarious window of development. Our objective was to determine the effect of PRR15 knockdown on trophoblast gene expression, proliferation, and survival. The first-trimester human trophoblast cell line, ACH-3P, was infected with control lentivirus or a lentivirus expressing a short hairpin (shRNA to target PRR15 mRNA for degradation, resulting in a 68% reduction in PRR15 mRNA. Microarray analysis of these cell lines revealed differential expression of genes related to cancer, focal adhesion, and p53 signaling. These changes included significant up-regulation of GDF15, a cytokine increased in pregnancies with preeclampsia. Viability and proliferation decreased in PRR15-deficient cells, which was consistent with down-regulation of cell cycle-related genes CCND1 and CDK6 and an up-regulation of CCNG2 and CDKN1A in the PRR15-deficient cells. TNFSF10, a tumor necrosis factor superfamily member known to induce apoptosis increased significantly in the PRR15-deficient cells. Migration through a basement membrane matrix decreased and an increased population of apoptotic cells was present when treated with shRNA to target PRR15. These results suggest that PRR15 enhances trophoblast viability and survival during early implantation and placentation.

  1. Increased Renal Clearance of Rocuronium Compensates for Chronic Loss of Bile Excretion, via upregulation of Oatp2.

    Science.gov (United States)

    Wang, Long; Zhou, Mai-Tao; Chen, Cai-Yang; Yin, Wen; Wen, Da-Xiang; Cheung, Chi-Wai; Yang, Li-Qun; Yu, Wei-Feng

    2017-01-13

    Requirement for rocuronium upon surgery changes only minimally in patients with end-stage liver diseases. Our study consisted of both human and rat studies to explore the reason. The reduction rate of rocuronium infusion required to maintain neuromuscular blockade during the anhepatic phase (relative to paleohepatic phase) was examined in 16 children with congenital biliary atresia receiving orthotopic liver transplantation. Pharmacodynamics and pharmacokinetics of rocuronium were studied based on BDL rats. The role of increased Oatp2 and decrease Oatp1 expressions in renal compensation were explored. The reduction of rocuronium requirements significantly decreased in obstructively jaundiced children (24 ± 9 vs. 39 ± 11%). TOF50 in BDL rats was increased by functional removal of the kidneys but not the liver, and the percentage of rocuronium excretion through urine increased (20.3 ± 6.9 vs. 8.6 ± 1.8%), while that decreased through bile in 28d-BDL compared with control group. However, this enhanced renal secretion for rocuronium was eliminated by Oatp2 knock-down, rather than Oatp1 overexpression (28-d BDL vs. Oatp1-ShRNA or Oatp2-ShRNA, 20.3 ± 6.9 vs. 17.0 ± 6.6 or 9.3 ± 3.2%). Upon chronic/sub-chronic loss of bile excretion, rocuronium clearance via the kidneys is enhanced, by Oatp2 up-regulation.

  2. Conserved features of cancer cells define their sensitivity of HAMLET-induced death; c-Myc and glycolysis

    Science.gov (United States)

    Storm, Petter; Puthia, Manoj Kumar; Aits, Sonja; Urbano, Alexander; Northen, Trent; Powers, Scott; Bowen, Ben; Chao, Yinxia; Reindl, Wolfgang; Lee, Do Yup; Sullivan, Nancy Liu; Zhang, Jianping; Trulsson, Maria; Yang, Henry; Watson, James; Svanborg, Catharina

    2014-01-01

    HAMLET is the first member of a new family of tumoricidal protein-lipid complexes that kill cancer cells broadly, while sparing healthy, differentiated cells. Many and diverse tumor cell types are sensitive to the lethal effect, suggesting that HAMLET identifies and activates conserved death pathways in cancer cells. Here we investigated the molecular basis for the difference in sensitivity between cancer cells and healthy cells. Using a combination of small hairpin RNA inhibition, proteomic and metabolomic technology we identified the c-Myc oncogene as one essential determinant of HAMLET sensitivity. Increased c-Myc expression levels promoted the sensitivity to HAMLET and shRNA knockdown of c-Myc suppressed the lethal response, suggesting that oncogenic transformation with c-Myc creates a HAMLET-sensitive phenotype. Furthermore, the HAMLET sensitivity was modified by the glycolytic state of the tumor cells. Glucose deprivation sensitized tumor cells to HAMLET-induced cell death and in the shRNA screen Hexokinase 1, PFKFB1 and HIF1α modified HAMLET sensitivity. Hexokinase 1 was shown to bind HAMLET in a protein array containing approximately 8000 targets and Hexokinase activity decreased within 15 minutes of HAMLET treatment, prior to morphological signs of tumor cell death. In parallel, HAMLET triggered rapid metabolic paralysis in carcinoma cells. The glycolytic machinery was modified and glycolysis was shifted towards the pentose phosphate pathway. Tumor cells were also shown to contain large amounts of oleic acid and its derivatives already after 15 minutes. The results identify HAMLET as a novel anti-cancer agent that kills tumor cells by exploiting unifying features of cancer cells such as oncogene-addiction or the Warburg effect. PMID:21643007

  3. Ubiquitin-specific protease 14 regulates cell proliferation and apoptosis in oral squamous cell carcinoma.

    Science.gov (United States)

    Chen, Xiangyun; Wu, Jingjing; Chen, Yitian; Ye, Dongxia; Lei, Hu; Xu, Hanzhang; Yang, Li; Wu, Yingli; Gu, Wenli

    2016-10-01

    Ubiquitin-specific protease 14, a deubiquitinating enzyme, has been implicated in the tumorigenesis and progression of several cancers, but its role in oral squamous cell carcinoma remains to be elucidated. The aim of this study was to explore the expression pattern and roles of Ubiquitin-specific protease 14 in the occurrence and development of oral squamous cell carcinoma. Interestingly, Ubiquitin-specific protease 14 was overexpressed in oral cancer tissues and cell lines at both mRNA and protein levels. b-AP15, a specific inhibitor of Ubiquitin-specific protease 14, significantly inhibited the growth of cancer cells and increased cell apoptosis in a dose-dependent manner. Moreover, knockdown of Ubiquitin-specific protease 14 by shRNA significantly inhibited the proliferation and migration of cancer cells in vitro. Finally, using a xenograft mouse model of oral squamous cell carcinoma, knockdown of Ubiquitin-specific protease 14 markedly inhibited tumor growth and triggered the cancer cell apoptosis in vivo, supporting previous results. In conclusion, for the first time we have demonstrated the expression pattern of Ubiquitin-specific protease 14 in oral squamous cell carcinoma and verified a relationship with tumor growth and metastasis. These results may highlight new therapeutic strategies for tumor treatment, application of Ubiquitin-specific protease 14 selective inhibitor, such as b-AP15, or knockdown by shRNA. Collectively, Ubiquitin-specific protease 14 could be a potential therapeutic target for oral squamous cell carcinoma patients. Copyright © 2016 Elsevier Ltd. All rights reserved.

  4. Activation of the TXNIP/NLRP3 inflammasome pathway contributes to inflammation in diabetic retinopathy: a novel inhibitory effect of minocycline.

    Science.gov (United States)

    Chen, Wei; Zhao, Minjie; Zhao, Shuzhi; Lu, Qianyi; Ni, Lisha; Zou, Chen; Lu, Li; Xu, Xun; Guan, Huaijin; Zheng, Zhi; Qiu, Qinghua

    2017-02-01

    Chronic low-grade inflammation occurs in diabetic retinopathy (DR), but the underlying mechanism(s) remains (remain) unclear. NLRP3 inflammasome activation is involved in several other inflammatory diseases. Thus, we investigated the role of the NLRP3 inflammasome signaling pathway in the pathogenesis of DR. Diabetes was induced in rats by streptozotocin treatment for 8 weeks. They were treated with NLRP3 shRNA or minocycline during the last 4 weeks. High glucose-exposed human retinal microvascular endothelial cells (HRMECs) were co-incubated with antioxidants or subjected to TXNIP or NLRP3 shRNA interference. In high glucose-exposed HRMECs and retinas of diabetic rats, mRNA and protein expression of NLRP3, ASC, and proinflammatory cytokines were induced significantly by hyperglycemia. Upregulated interleukin (IL)-1β maturation, IL-18 secretion, and caspase-1 cleavage were also observed with increased cell apoptosis and retinal vascular permeability, compared with the control group. NLRP3 silencing blocked these effects in the rat model and HRMECs, confirming that inflammasome activation contributed to inflammation in DR. TXNIP expression was increased by reactive oxygen species (ROS) overproduction in animal and cell models, whereas antioxidant addition or TXNIP silencing blocked IL-1β and IL-18 secretion in high glucose-exposed HRMECs, indicating that the ROS-TXNIP pathway mediates NLRP3 inflammasome activation. Minocycline significantly downregulated ROS generation and reduced TXNIP expression, subsequently inhibited NLRP3 activation, and further decreased inflammatory factors, which were associated with a decrease in retinal vascular permeability and cell apoptosis. Together, our data suggest that the TXNIP/NLRP3 pathway is a potential therapeutic target for the treatment of DR, and the use of minocycline specifically for such therapy may be a new avenue of investigation in inflammatory disease.

  5. Hepatocyte nuclear factor 4A improves hepatic differentiation of immortalized adult human hepatocytes and improves liver function and survival.

    Science.gov (United States)

    Hang, Hua-Lian; Liu, Xin-Yu; Wang, Hai-Tian; Xu, Ning; Bian, Jian-Min; Zhang, Jian-Jun; Xia, Lei; Xia, Qiang

    2017-11-15

    Immortalized human hepatocytes (IHH) could provide an unlimited supply of hepatocytes, but insufficient differentiation and phenotypic instability restrict their clinical application. This study aimed to determine the role of hepatocyte nuclear factor 4A (HNF4A) in hepatic differentiation of IHH, and whether encapsulation of IHH overexpressing HNF4A could improve liver function and survival in rats with acute liver failure (ALF). Primary human hepatocytes were transduced with lentivirus-mediated catalytic subunit of human telomerase reverse transcriptase (hTERT) to establish IHH. Cells were analyzed for telomerase activity, proliferative capacity, hepatocyte markers, and tumorigenicity (c-myc) expression. Hepatocyte markers, hepatocellular functions, and morphology were studied in the HNF4A-overexpressing IHH. Hepatocyte markers and karyotype analysis were completed in the primary hepatocytes using shRNA knockdown of HNF4A. Nuclear translocation of β-catenin was assessed. Rat models of ALF were treated with encapsulated IHH or HNF4A-overexpressing IHH. A HNF4A-positive IHH line was established, which was non-tumorigenic and conserved properties of primary hepatocytes. HNF4A overexpression significantly enhanced mRNA levels of genes related to hepatic differentiation in IHH. Urea levels were increased by the overexpression of HNF4A, as measured 24h after ammonium chloride addition, similar to that of primary hepatocytes. Chromosomal abnormalities were observed in primary hepatocytes transfected with HNF4A shRNA. HNF4α overexpression could significantly promote β-catenin activation. Transplantation of HNF4A overexpressing IHH resulted in better liver function and survival of rats with ALF compared with IHH. HNF4A improved hepatic differentiation of IHH. Transplantation of HNF4A-overexpressing IHH could improve the liver function and survival in a rat model of ALF. Copyright © 2017 Elsevier Inc. All rights reserved.

  6. Silencing of OSBP-related protein 8 (ORP8) modifies the macrophage transcriptome, nucleoporin p62 distribution, and migration capacity

    International Nuclear Information System (INIS)

    Béaslas, Olivier; Vihervaara, Terhi; Li, Jiwei; Laurila, Pirkka-Pekka; Yan, Daoguang; Olkkonen, Vesa M.

    2012-01-01

    ORP8 is an oxysterol/cholesterol binding protein anchored to the endoplasmic reticulum and the nuclear envelope, and is abundantly expressed in the macrophage. We created and characterized mouse RAW264.7 macrophages with ORP8 stably silenced using shRNA lentiviruses. A microarray transcriptome and gene ontology pathway analysis revealed significant alterations in several nuclear pathways and ones associated with centrosome and microtubule organization. ORP8 knockdown resulted in increased expression and altered subcellular distribution of an interaction partner of ORP8, nucleoporin NUP62, with an intranuclear localization aspect and association with cytoplasmic vesicular structures and lamellipodial edges of the cells. Moreover, ORP8 silenced cells displayed enhanced migration, and a more pronounced microtubule cytoskeleton than controls expressing a non-targeting shRNA. ORP8 was shown to compete with Exo70 for interaction with NUP62, and NUP62 knockdown abolished the migration enhancement of ORP8-silenced cells, suggesting that the endogenous ORP8 suppresses migration via binding to NUP62. As a conclusion, the present study reveals new, unexpected aspects of ORP8 function in macrophages not directly involving lipid metabolism, but rather associated with nuclear functions, microtubule organization, and migration capacity. -- Highlights: ► The phenotype of Raw264.7 macrophage with ORP8 silenced is characterized. ► ORP8 silencing alters mRNA levels of nuclear and microtubule/centrosome pathways. ► ORP8 silencing results in increased expression and altered distribution of NUP62. ► ORP8 silenced macrophages show enhanced migration and altered microtubule cytoskeleton. ► ORP8 competes in vitro with Exo70 for binding to NUP62.

  7. The Role of Repeat Administration of Adventitial Delivery of Lentivirus-shRNA-Vegf-A in Arteriovenous Fistula to Prevent Venous Stenosis Formation.

    Science.gov (United States)

    Janardhanan, Rajiv; Yang, Binxia; Kilari, Sreenivasulu; Leof, Edward B; Mukhopadhyay, Debabrata; Misra, Sanjay

    2016-04-01

    To determine if a second dose of a lentivirus mediated small hairpin RNA that inhibits Vegf-A gene expression (LV-shRNA-Vegf-A) can improve lumen vessel area (LVA) of the outflow vein of an arteriovenous fistula (AVF) and decrease venous neointimal hyperplasia. Chronic kidney disease was created in C57BL/6 mice; 28 days later, an AVF was created by connecting the right carotid artery to the ipsilateral jugular vein. Immediately after AVF creation, 5 × 10(6) plaque-forming units of LV-shRNA-Vegf-A or control shRNA was administered to the adventitia of the outflow vein, and a second dose of the same treatment was administered 14 days later. Animals were sacrificed at 21 days, 28 days, and 42 days after AVF creation for reverse transcription polymerase chain reaction and histomorphometric analyses. By day 21, there was a 125% increase in the average LVA (day 21, P = .11), with a decrease in cell proliferation (day 21, P = .0079; day 28, P = .28; day 42, P = .5), decrease in α-smooth muscle cell actin staining (day 21, P < .0001; day 28, P < .05; day 42, P = .59), and decrease in hypoxic stress (day 21, P < .001; day 28, P = .28; day 42, P = .46) in LV versus control shRNA vessels. A second dose of LV-shRNA-Vegf-A administration results in a moderate improvement in LVA at day 21. Copyright © 2016 SIR. Published by Elsevier Inc. All rights reserved.

  8. Deep Sequence Analysis of AgoshRNA Processing Reveals 3’ A Addition and Trimming

    Directory of Open Access Journals (Sweden)

    Alex Harwig

    2015-01-01

    Full Text Available The RNA interference (RNAi pathway, in which microprocessor and Dicer collaborate to process microRNAs (miRNA, was recently expanded by the description of alternative processing routes. In one of these noncanonical pathways, Dicer action is replaced by the Argonaute2 (Ago2 slicer function. It was recently shown that the stem-length of precursor-miRNA or short hairpin RNA (shRNA molecules is a major determinant for Dicer versus Ago2 processing. Here we present the results of a deep sequence study on the processing of shRNAs with different stem length and a top G·U wobble base pair (bp. This analysis revealed some unexpected properties of these so-called AgoshRNA molecules that are processed by Ago2 instead of Dicer. First, we confirmed the gradual shift from Dicer to Ago2 processing upon shortening of the hairpin length. Second, hairpins with a stem larger than 19 base pair are inefficiently cleaved by Ago2 and we noticed a shift in the cleavage site. Third, the introduction of a top G·U bp in a regular shRNA can promote Ago2-cleavage, which coincides with a loss of Ago2-loading of the Dicer-cleaved 3’ strand. Fourth, the Ago2-processed AgoshRNAs acquire a short 3’ tail of 1–3 A-nucleotides (nt and we present evidence that this product is subsequently trimmed by the poly(A-specific ribonuclease (PARN.

  9. Identification of BIRC6 as a novel intervention target for neuroblastoma therapy

    International Nuclear Information System (INIS)

    Lamers, Fieke; Molenaar, Jan J; Schild, Linda; Koster, Jan; Speleman, Frank; Øra, Ingrid; Westerhout, Ellen M; Sluis, Peter van; Versteeg, Rogier; Caron, Huib N

    2012-01-01

    Neuroblastoma are pediatric tumors of the sympathetic nervous system with a poor prognosis. Apoptosis is often deregulated in cancer cells, but only a few defects in apoptotic routes have been identified in neuroblastoma. Here we investigated genomic aberrations affecting genes of the intrinsic apoptotic pathway in neuroblastoma. We analyzed DNA profiling data (CGH and SNP arrays) and mRNA expression data of 31 genes of the intrinsic apoptotic pathway in a dataset of 88 neuroblastoma tumors using the R2 bioinformatic platform. BIRC6 was selected for further analysis as a tumor driving gene. Knockdown experiments were performed using BIRC6 lentiviral shRNA and phenotype responses were analyzed by Western blot and MTT-assays. In addition, DIABLO levels and interactions were investigated with immunofluorescence and co-immunoprecipitation. We observed frequent gain of the BIRC6 gene on chromosome 2, which resulted in increased mRNA expression. BIRC6 is an inhibitor of apoptosis protein (IAP), that can bind and degrade the cytoplasmic fraction of the pro-apoptotic protein DIABLO. DIABLO mRNA expression was exceptionally high in neuroblastoma but the protein was only detected in the mitochondria. Upon silencing of BIRC6 by shRNA, DIABLO protein levels increased and cells went into apoptosis. Co-immunoprecipitation confirmed direct interaction between DIABLO and BIRC6 in neuroblastoma cell lines. Our findings indicate that BIRC6 may have a potential oncogenic role in neuroblastoma by inactivating cytoplasmic DIABLO. BIRC6 inhibition may therefore provide a means for therapeutic intervention in neuroblastoma

  10. Activation of AMPK by berberine induces hepatic lipid accumulation by upregulation of fatty acid translocase CD36 in mice

    Energy Technology Data Exchange (ETDEWEB)

    Choi, You-Jin; Lee, Kang-Yo; Jung, Seung-Hwan [College of Pharmacy, Research Institute of Pharmaceutical Sciences, Seoul National University, Seoul 151-742 (Korea, Republic of); Kim, Hyung Sik [School of Pharmacy, Sungkyunkwan University, Suwon 440-746 (Korea, Republic of); Shim, Gayong; Kim, Mi-Gyeong; Oh, Yu-Kyoung [College of Pharmacy, Research Institute of Pharmaceutical Sciences, Seoul National University, Seoul 151-742 (Korea, Republic of); Oh, Seon-Hee [The Division of Natural Medical Sciences, College of Health Science, Chosun University, Gwangju 501-759 (Korea, Republic of); Jun, Dae Won [Internal Medicine, Hanyang University School of Medicine, Seoul 133-791 (Korea, Republic of); Lee, Byung-Hoon, E-mail: lee@snu.ac.kr [College of Pharmacy, Research Institute of Pharmaceutical Sciences, Seoul National University, Seoul 151-742 (Korea, Republic of)

    2017-02-01

    Emerging evidence has shown that berberine has a protective effect against metabolic syndrome such as obesity and type II diabetes mellitus by activating AMP-activated protein kinase (AMPK). AMPK induces CD36 trafficking to the sarcolemma for fatty acid uptake and oxidation in contracting muscle. However, little is known about the effects of AMPK on CD36 regulation in the liver. We investigated whether AMPK activation by berberine affects CD36 expression and fatty acid uptake in hepatocytes and whether it is linked to hepatic lipid accumulation. Activation of AMPK by berberine or transduction with adenoviral vectors encoding constitutively active AMPK in HepG2 and mouse primary hepatocytes increased the expression and membrane translocation of CD36, resulting in enhanced fatty acid uptake and lipid accumulation as determined by BODIPY-C16 and Nile red fluorescence, respectively. Activation of AMPK by berberine induced the phosphorylation of extracellular signal-regulated kinases 1/2 (ERK1/2) and subsequently induced CCAAT/enhancer-binding protein β (C/EBPβ) binding to the C/EBP-response element in the CD36 promoter in hepatocytes. In addition, hepatic CD36 expression and triglyceride levels were increased in normal diet-fed mice treated with berberine, but completely prevented when hepatic CD36 was silenced with adenovirus containing CD36-specific shRNA. Taken together, prolonged activation of AMPK by berberine increased CD36 expression in hepatocytes, resulting in fatty acid uptake via processes linked to hepatocellular lipid accumulation and fatty liver. - Highlights: • Berberine increases the expression and membrane translocation of CD36 in hepatocytes. • The increase of CD36 results in enhanced fatty acid uptake and lipid accumulation. • Berberine-induced fatty liver is mediated by AMPK-ERK-C/EBPβ pathway. • CD36-specific shRNA inhibited berberine-induced lipid accumulation in liver.

  11. Silencing of OSBP-related protein 8 (ORP8) modifies the macrophage transcriptome, nucleoporin p62 distribution, and migration capacity

    Energy Technology Data Exchange (ETDEWEB)

    Beaslas, Olivier; Vihervaara, Terhi [Minerva Foundation Institute for Medical Research, FI-00290 Helsinki (Finland); Li, Jiwei [Department of Biology, Jinan University, Guangzhou 510632 (China); Laurila, Pirkka-Pekka [FIMM, Institute for Molecular Medicine Finland, FI-00290 Helsinki (Finland); National Institute for Health and Welfare, Public Health Genomics Unit, FI-00290 Helsinki (Finland); Yan, Daoguang [Department of Biology, Jinan University, Guangzhou 510632 (China); Olkkonen, Vesa M., E-mail: vesa.olkkonen@helsinki.fi [Minerva Foundation Institute for Medical Research, FI-00290 Helsinki (Finland); Institute of Biomedicine, Anatomy, University of Helsinki, FI-00014 (Finland)

    2012-09-10

    ORP8 is an oxysterol/cholesterol binding protein anchored to the endoplasmic reticulum and the nuclear envelope, and is abundantly expressed in the macrophage. We created and characterized mouse RAW264.7 macrophages with ORP8 stably silenced using shRNA lentiviruses. A microarray transcriptome and gene ontology pathway analysis revealed significant alterations in several nuclear pathways and ones associated with centrosome and microtubule organization. ORP8 knockdown resulted in increased expression and altered subcellular distribution of an interaction partner of ORP8, nucleoporin NUP62, with an intranuclear localization aspect and association with cytoplasmic vesicular structures and lamellipodial edges of the cells. Moreover, ORP8 silenced cells displayed enhanced migration, and a more pronounced microtubule cytoskeleton than controls expressing a non-targeting shRNA. ORP8 was shown to compete with Exo70 for interaction with NUP62, and NUP62 knockdown abolished the migration enhancement of ORP8-silenced cells, suggesting that the endogenous ORP8 suppresses migration via binding to NUP62. As a conclusion, the present study reveals new, unexpected aspects of ORP8 function in macrophages not directly involving lipid metabolism, but rather associated with nuclear functions, microtubule organization, and migration capacity. -- Highlights: Black-Right-Pointing-Pointer The phenotype of Raw264.7 macrophage with ORP8 silenced is characterized. Black-Right-Pointing-Pointer ORP8 silencing alters mRNA levels of nuclear and microtubule/centrosome pathways. Black-Right-Pointing-Pointer ORP8 silencing results in increased expression and altered distribution of NUP62. Black-Right-Pointing-Pointer ORP8 silenced macrophages show enhanced migration and altered microtubule cytoskeleton. Black-Right-Pointing-Pointer ORP8 competes in vitro with Exo70 for binding to NUP62.

  12. Adaptation of HepG2 cells to a steady-state reduction in the content of protein phosphatase 6 (PP6) catalytic subunit

    Energy Technology Data Exchange (ETDEWEB)

    Boylan, Joan M. [Department of Pediatrics, Brown University and Rhode Island Hospital, Providence, RI (United States); Salomon, Arthur R. [Department of Molecular Biology, Cell Biology and Biochemistry, Brown University, Providence, RI (United States); Department of Chemistry, Brown University, Providence, RI (United States); Tantravahi, Umadevi [Division of Genetics, Department of Pathology, Brown University and Women and Infants Hospital, Providence, RI (United States); Gruppuso, Philip A., E-mail: philip_gruppuso@brown.edu [Department of Pediatrics, Brown University and Rhode Island Hospital, Providence, RI (United States); Department of Molecular Biology, Cell Biology and Biochemistry, Brown University, Providence, RI (United States)

    2015-07-15

    Protein phosphatase 6 (PP6) is a ubiquitous Ser/Thr phosphatase involved in an array of cellular processes. To assess the potential of PP6 as a therapeutic target in liver disorders, we attenuated expression of the PP6 catalytic subunit in HepG2 cells using lentiviral-transduced shRNA. Two PP6 knock-down (PP6KD) cell lines (90% reduction of PP6-C protein content) were studied in depth. Both proliferated at a rate similar to control cells. However, flow cytometry indicated G2/M cell cycle arrest that was accounted for by a shift of the cells from a diploid to tetraploid state. PP6KD cells did not show an increase in apoptosis, nor did they exhibit reduced viability in the presence of bleomycin or taxol. Gene expression analysis by microarray showed attenuated anti-inflammatory signaling. Genes associated with DNA replication were downregulated. Mass spectrometry-based phosphoproteomic analysis yielded 80 phosphopeptides representing 56 proteins that were significantly affected by a stable reduction in PP6-C. Proteins involved in DNA replication, DNA damage repair and pre-mRNA splicing were overrepresented among these. PP6KD cells showed intact mTOR signaling. Our studies demonstrated involvement of PP6 in a diverse set of biological pathways and an adaptive response that may limit the effectiveness of targeting PP6 in liver disorders. - Highlights: • Lentiviral-transduced shRNA was used to generate a stable knockdown of PP6 in HepG2 cells. • Cells adapted to reduced PP6; cell proliferation was unaffected, and cell survival was normal. • However, PP6 knockdown was associated with a transition to a tetraploid state. • Genomic profiling showed downregulated anti-inflammatory signaling and DNA replication. • Phosphoproteomic profiling showed changes in proteins associated with DNA replication and repair.

  13. MEK-ERK inhibition potentiates WAY-600-induced anti-cancer efficiency in preclinical hepatocellular carcinoma (HCC) models

    Energy Technology Data Exchange (ETDEWEB)

    Wang, Kaifeng, E-mail: kaifeng_wangdr@sina.com [Cancer center, the Affiliated Hospital of Hangzhou Normal University, Hangzhou (China); Fan, Yaohua [Oncology Department, No. 1 Hospital of Jiaxing, Zhejiang Province, Jiaxing (China); Chen, Gongying [Oncology Department, The Affiliated Hospital Hangzhou Normal University, Hangzhou (China); Wang, Zhengrong [Taizhou Hospital, Zhejiang Province, Taizhou (China); Kong, Dexin; Zhang, Peng [Oncology Department, Sir Run Run Shaw Hospital, Medical School, Zhejiang University, Hangzhou (China)

    2016-05-27

    The search for novel anti-hepatocellular carcinoma (HCC) agents is important. Mammalian target of rapamycin (mTOR) hyper-activation plays a pivotal role in promoting HCC tumorigenesis and chemoresistance. The current preclinical study evaluated the potential anti-HCC activity by a potent mTOR kinase inhibitor, WAY-600. We showed that WAY-600 inhibited survival and proliferation of HCC cell lines (HepG2 and Huh7) and primary human HCC cells. Caspase-dependent apoptosis was activated by WAY-600 in above HCC cells. Reversely, caspase inhibitors largely attenuated WAY-600's lethality against HCC cells. At the signaling level, WAY-600 blocked mTOR complex 1/2 (mTORC1/2) assemble and activation, yet activated MEK-ERK pathway in HCC cells. MEK-ERK inhibitors, PD-98059 and MEK-162, or MEK1/2 shRNA significantly potentiated WAY-600's cytotoxicity in HCC cells. Further studies showed that WAY-600 intraperitoneal (i.p.) administration in nude mice inhibited p-AKT Ser-473 and displayed significant anti-cancer activity against HepG2 xenografts. Remarkably, co-administration of MEK-162 further potentiated WAY-600's anti-HCC activity in vivo. These preclinical results demonstrate the potent anti-HCC activity by WAY-600, either alone or with MEK-ERK inhibitors. -- Highlights: •WAY-600 inhibits HCC cell survival and proliferation in vitro. •WAY-600 activates caspase-dependent apoptosis in HCC cells. •WAY-600 blocks mTORC1/2 activation, but activates MEK-ERK in HCC cells. •MEK-ERK inhibitors or MEK1/2 shRNA enhances WAY-600's cytotoxicity against HCC cells. •MEK-162 co-administration potentiates WAY-600-induced the anti-HepG2 tumor efficacy.

  14. TP53inp1 Gene Is Implicated in Early Radiation Response in Human Fibroblast Cells

    Directory of Open Access Journals (Sweden)

    Nikolett Sándor

    2015-10-01

    Full Text Available Tumor protein 53-induced nuclear protein-1 (TP53inp1 is expressed by activation via p53 and p73. The purpose of our study was to investigate the role of TP53inp1 in response of fibroblasts to ionizing radiation. γ-Ray radiation dose-dependently induces the expression of TP53inp1 in human immortalized fibroblast (F11hT cells. Stable silencing of TP53inp1 was done via lentiviral transfection of shRNA in F11hT cells. After irradiation the clonogenic survival of TP53inp1 knockdown (F11hT-shTP cells was compared to cells transfected with non-targeting (NT shRNA. Radiation-induced senescence was measured by SA-β-Gal staining and autophagy was detected by Acridine Orange dye and microtubule-associated protein-1 light chain 3 (LC3B immunostaining. The expression of TP53inp1, GDF-15, and CDKN1A and alterations in radiation induced mitochondrial DNA deletions were evaluated by qPCR. TP53inp1 was required for radiation (IR induced maximal elevation of CDKN1A and GDF-15 expressions. Mitochondrial DNA deletions were increased and autophagy was deregulated following irradiation in the absence of TP53inp1. Finally, we showed that silencing of TP53inp1 enhances the radiation sensitivity of fibroblast cells. These data suggest functional roles for TP53inp1 in radiation-induced autophagy and survival. Taken together, we suppose that silencing of TP53inp1 leads radiation induced autophagy impairment and induces accumulation of damaged mitochondria in primary human fibroblasts.

  15. Effect of salt-inducible kinase 2 on checkpoint in response to γ-ray irradiation

    International Nuclear Information System (INIS)

    Yin Jiaojiao; Zhou Lijun; Wang Yu; Liu Xiaodan; Gu Yongqing; Zhou Pingkun

    2014-01-01

    Objective: To investigate the effect of salt-induced kinase 2 (SIK2) in the G_2/M checkpoint in response to ionizing radiation and the possible mechanism. Methods: HeLa cells were irradiated with "6"0Co γ-rays. The cell model of knockdown SIK2 expression was constrcuted by transfecting HeLa cells with a pSicoR-based lentivirus vector of expressing SIK2 shRNA by lipofectamin 2000. Western blot and flow cytometry were performed to measure the changes of SIK2 protein level and cell cycle distribution. The phosphorylated histone protein H3 on Ser 10 was used as a molecular marker of mitotic cells for detecting the function of G2/M checkpoint. Results: The expression level of SIK2 protein increased in HeLa cells after "6"0Co γ-ray irradiation. A cell model of knockdown SIK2 expression was successfully generated by transfecting the specific shRNA against SIK2. Depression of SIK2 significantly increased the cellular sensitivity at 1, 2, 4, 6 Gy post-irradiation (t = -3.445, -2.581, -3.251, -2.553, P < 0.05), and led cells to release earlier from the G_2/M boundary arrest compared to control cells at 5, 6 h post-irradiation(t = 4.341, 6.500, P < 0.05). Western blot analysis indicated that the irradiation-induced phosphorylated CHK2/T68 in SIK2 knock-down cells was earlier than that in control cells. Conclusions: salt-induced kinase 2 (SIK2) participates in the regulation of G_2/M checkpoint induced by ionizing radiation and affects cellular radiosensitivity. (authors)

  16. P2Y12 receptor upregulation in satellite glial cells is involved in neuropathic pain induced by HIV glycoprotein 120 and 2',3'-dideoxycytidine.

    Science.gov (United States)

    Yi, Zhihua; Xie, Lihui; Zhou, Congfa; Yuan, Huilong; Ouyang, Shuai; Fang, Zhi; Zhao, Shanhong; Jia, Tianyu; Zou, Lifang; Wang, Shouyu; Xue, Yun; Wu, Bing; Gao, Yun; Li, Guilin; Liu, Shuangmei; Xu, Hong; Xu, Changshui; Zhang, Chunping; Liang, Shangdong

    2018-03-01

    The direct neurotoxicity of HIV and neurotoxicity of combination antiretroviral therapy medications both contribute to the development of neuropathic pain. Activation of satellite glial cells (SGCs) in the dorsal root ganglia (DRG) plays a crucial role in mechanical and thermal hyperalgesia. The P2Y 12 receptor expressed in SGCs of the DRG is involved in pain transmission. In this study, we explored the role of the P2Y 12 receptor in neuropathic pain induced by HIV envelope glycoprotein 120 (gp120) combined with ddC (2',3'-dideoxycytidine). A rat model of gp120+ddC-induced neuropathic pain was used. Peripheral nerve exposure to HIV-gp120+ddC increased mechanical and thermal hyperalgesia in gp120+ddC-treated model rats. The gp120+ddC treatment increased expression of P2Y 12 receptor mRNA and protein in DRG SGCs. In primary cultured DRG SGCs treated with gp120+ddC, the levels of [Ca 2+ ] i activated by the P2Y 12 receptor agonist 2-(Methylthio) adenosine 5'-diphosphate trisodium salt (2-MeSADP) were significantly increased. P2Y 12 receptor shRNA treatment inhibited 2-MeSADP-induced [Ca 2+ ] i in primary cultured DRG SGCs treated with gp120+ddC. Intrathecal treatment with a shRNA against P2Y 12 receptor in DRG SGCs reduced the release of pro-inflammatory cytokines, decreased phosphorylation of p38 MAPK in the DRG of gp120+ddC-treated rats. Thus, downregulating the P2Y 12 receptor relieved mechanical and thermal hyperalgesia in gp120+ddC-treated rats.

  17. The role of catechol-O-methyltransferase in catechol-enhanced erythroid differentiation of K562 cells.

    Science.gov (United States)

    Suriguga; Li, Xiao-Fei; Li, Yang; Yu, Chun-Hong; Li, Yi-Ran; Yi, Zong-Chun

    2013-12-15

    Catechol is widely used in pharmaceutical and chemical industries. Catechol is also one of phenolic metabolites of benzene in vivo. Our previous study showed that catechol improved erythroid differentiation potency of K562 cells, which was associated with decreased DNA methylation in erythroid specific genes. Catechol is a substrate for the catechol-O-methyltransferase (COMT)-mediated methylation. In the present study, the role of COMT in catechol-enhanced erythroid differentiation of K562 cells was investigated. Benzidine staining showed that exposure to catechol enhanced hemin-induced hemoglobin accumulation and induced mRNA expression of erythroid specific genes in K562 cells. Treatment with catechol caused a time- and concentration-dependent increase in guaiacol concentration in the medium of cultured K562 cells. When COMT expression was knocked down by COMT shRNA expression in K562 cells, the production of guaiacol significantly reduced, and the sensitivity of K562 cells to cytotoxicity of catechol significantly increased. Knockdown of COMT expression by COMT shRNA expression also eliminated catechol-enhanced erythroid differentiation of K562 cells. In addition, the pre-treatment with methyl donor S-adenosyl-L-methionine or its demethylated product S-adenosyl-L-homocysteine induced a significant increase in hemin-induced Hb synthesis in K562 cells and the mRNA expression of erythroid specific genes. These findings indicated that O-methylation catalyzed by COMT acted as detoxication of catechol and involved in catechol-enhanced erythroid differentiation of K562 cells, and the production of S-adenosyl-L-homocysteine partly explained catechol-enhanced erythroid differentiation. © 2013.

  18. Adaptation of HepG2 cells to a steady-state reduction in the content of protein phosphatase 6 (PP6) catalytic subunit

    International Nuclear Information System (INIS)

    Boylan, Joan M.; Salomon, Arthur R.; Tantravahi, Umadevi; Gruppuso, Philip A.

    2015-01-01

    Protein phosphatase 6 (PP6) is a ubiquitous Ser/Thr phosphatase involved in an array of cellular processes. To assess the potential of PP6 as a therapeutic target in liver disorders, we attenuated expression of the PP6 catalytic subunit in HepG2 cells using lentiviral-transduced shRNA. Two PP6 knock-down (PP6KD) cell lines (90% reduction of PP6-C protein content) were studied in depth. Both proliferated at a rate similar to control cells. However, flow cytometry indicated G2/M cell cycle arrest that was accounted for by a shift of the cells from a diploid to tetraploid state. PP6KD cells did not show an increase in apoptosis, nor did they exhibit reduced viability in the presence of bleomycin or taxol. Gene expression analysis by microarray showed attenuated anti-inflammatory signaling. Genes associated with DNA replication were downregulated. Mass spectrometry-based phosphoproteomic analysis yielded 80 phosphopeptides representing 56 proteins that were significantly affected by a stable reduction in PP6-C. Proteins involved in DNA replication, DNA damage repair and pre-mRNA splicing were overrepresented among these. PP6KD cells showed intact mTOR signaling. Our studies demonstrated involvement of PP6 in a diverse set of biological pathways and an adaptive response that may limit the effectiveness of targeting PP6 in liver disorders. - Highlights: • Lentiviral-transduced shRNA was used to generate a stable knockdown of PP6 in HepG2 cells. • Cells adapted to reduced PP6; cell proliferation was unaffected, and cell survival was normal. • However, PP6 knockdown was associated with a transition to a tetraploid state. • Genomic profiling showed downregulated anti-inflammatory signaling and DNA replication. • Phosphoproteomic profiling showed changes in proteins associated with DNA replication and repair

  19. Kindlins, integrin activation and the regulation of talin recruitment to αIIbβ3.

    Directory of Open Access Journals (Sweden)

    Bryan N Kahner

    Full Text Available Talins and kindlins bind to the integrin β3 cytoplasmic tail and both are required for effective activation of integrin αIIbβ3 and resulting high-affinity ligand binding in platelets. However, binding of the talin head domain alone to β3 is sufficient to activate purified integrin αIIbβ3 in vitro. Since talin is localized to the cytoplasm of unstimulated platelets, its re-localization to the plasma membrane and to the integrin is required for activation. Here we explored the mechanism whereby kindlins function as integrin co-activators. To test whether kindlins regulate talin recruitment to plasma membranes and to αIIbβ3, full-length talin and kindlin recruitment to β3 was studied using a reconstructed CHO cell model system that recapitulates agonist-induced αIIbβ3 activation. Over-expression of kindlin-2, the endogenous kindlin isoform in CHO cells, promoted PAR1-mediated and talin-dependent ligand binding. In contrast, shRNA knockdown of kindlin-2 inhibited ligand binding. However, depletion of kindlin-2 by shRNA did not affect talin recruitment to the plasma membrane, as assessed by sub-cellular fractionation, and neither over-expression of kindlins nor depletion of kindlin-2 affected talin interaction with αIIbβ3 in living cells, as monitored by bimolecular fluorescence complementation. Furthermore, talin failed to promote kindlin-2 association with αIIbβ3 in CHO cells. In addition, purified talin and kindlin-3, the kindlin isoform expressed in platelets, failed to promote each other's binding to the β3 cytoplasmic tail in vitro. Thus, kindlins do not promote initial talin recruitment to αIIbβ3, suggesting that they co-activate integrin through a mechanism independent of recruitment.

  20. Targeting RNA transcription and translation in ovarian cancer cells with pharmacological inhibitor CDKI-73.

    Science.gov (United States)

    Lam, Frankie; Abbas, Abdullahi Y; Shao, Hao; Teo, Theodosia; Adams, Julian; Li, Peng; Bradshaw, Tracey D; Fischer, Peter M; Walsby, Elisabeth; Pepper, Chris; Chen, Yi; Ding, Jian; Wang, Shudong

    2014-09-15

    Dysregulation of cellular transcription and translation is a fundamental hallmark of cancer. As CDK9 and Mnks play pivotal roles in the regulation of RNA transcription and protein synthesis, respectively, they are important targets for drug development. We herein report the cellular mechanism of a novel CDK9 inhibitor CDKI-73 in an ovarian cancer cell line (A2780). We also used shRNA-mediated CDK9 knockdown to investigate the importance of CDK9 in the maintenance of A2780 cells. This study revealed that CDKI-73 rapidly inhibited cellular CDK9 kinase activity and down-regulated the RNAPII phosphorylation. This subsequently caused a decrease in the eIF4E phosphorylation by blocking Mnk1 kinase activity. Consistently, CDK9 shRNA was also found to down-regulate the Mnk1 expression. Both CDKI-73 and CDK9 shRNA decreased anti-apoptotic proteins Mcl-1 and Bcl-2 and induced apoptosis. The study confirmed that CDK9 is required for cell survival and that ovarian cancer may be susceptible to CDK9 inhibition strategy. The data also implied a role of CDK9 in eIF4E-mediated translational control, suggesting that CDK9 may have important implication in the Mnk-eIF4E axis, the key determinants of PI3K/Akt/mTOR- and Ras/Raf/MAPK-mediated tumorigenic activity. As such, CDK9 inhibitor drug candidate CDKI-73 should have a major impact on these pathways in human cancers.

  1. Overexpression of cell cycle regulator CDCA3 promotes oral cancer progression by enhancing cell proliferation with prevention of G1 phase arrest

    International Nuclear Information System (INIS)

    Uchida, Fumihiko; Uzawa, Katsuhiro; Kasamatsu, Atsushi; Takatori, Hiroaki; Sakamoto, Yosuke; Ogawara, Katsunori; Shiiba, Masashi; Tanzawa, Hideki; Bukawa, Hiroki

    2012-01-01

    Cell division cycle associated 3 (CDCA3), part of the Skp1-cullin-F-box (SCF) ubiquitin ligase, refers to a trigger of mitotic entry and mediates destruction of the mitosis inhibitory kinase. Little is known about the relevance of CDCA3 to human malignancy including oral squamous cell carcinoma (OSCC). We aimed to characterize the expression state and function of CDCA3 in OSCC. We evaluated CDCA3 mRNA and protein expression in both OSCC-derived cell lines and primary OSCCs and performed functional analyses of CDCA3 in OSCC-derived cells using the shRNA system. The CDCA3 expression at both the mRNA and protein levels was frequently up-regulated in all cell lines examined and primary tumors (mRNA, 51/69, 74 %; protein, 79/95, 83 %) compared to normal controls (p < 0.001). In contrast, no significant level of CDCA3 protein expression was seen in oral premalignant lesions (OPLs) (n = 20) compared with the expression in OSCCs. Among the clinical variables analyzed, the CDCA3 expression status was closely related to tumor size (p < 0.05). In addition, suppression of CDCA3 expression with shRNA significantly (p < 0.05) inhibited cellular proliferation compared with the control cells by arresting cell-cycle progression at the G1 phase. Further, there was up-regulation of the cyclin-dependent kinase inhibitors (p21 Cip1 , p27 Kip1 , p15 INK4B , and p16 INK4A ) in the knockdown cells. The current results showed that overexpression of CDCA3 occurs frequently during oral carcinogenesis and this overexpression might be associated closely with progression of OSCCs by preventing the arrest of cell-cycle progression at the G1 phase via decreased expression of the cyclin-dependent kinase inhibitors

  2. Characterization of the loss of SUMO pathway function on cancer cells and tumor proliferation.

    Directory of Open Access Journals (Sweden)

    Xingyue He

    Full Text Available SUMOylation is a post-translational ubiquitin-like protein modification pathway that regulates important cellular processes including chromosome structure, kinetochore function, chromosome segregation, nuclear and sub-nuclear organization, transcription and DNA damage repair. There is increasing evidence that the SUMO pathway is dysregulated in cancer, raising the possibility that modulation of this pathway may have therapeutic potential. To investigate the importance of the SUMO pathway in the context of cancer cell proliferation and tumor growth, we applied lentivirus-based short hairpin RNAs (shRNA to knockdown SUMO pathway genes in human cancer cells. shRNAs for SAE2 and UBC9 reduced SUMO conjugation activity and inhibited proliferation of human cancer cells. To expand upon these observations, we generated doxycycline inducible conditional shRNA cell lines for SAE2 to achieve acute and reversible SAE2 knockdown. Conditional SAE2 knockdown in U2OS and HCT116 cells slowed cell growth in vitro, and SAE2 knockdown induced multiple terminal outcomes including apoptosis, endoreduplication and senescence. Multinucleated cells became senescent and stained positive for the senescence marker, SA-β Gal, and displayed elevated levels of p53 and p21. In an attempt to explain these phenotypes, we confirmed that loss of SUMO pathway activity leads to a loss of SUMOylated Topoisomerase IIα and the appearance of chromatin bridges which can impair proper cytokinesis and lead to multinucleation. Furthermore, knockdown of SAE2 induces disruption of PML nuclear bodies which may further promote apoptosis or senescence. In an in vivo HCT116 xenograft tumor model, conditional SAE2 knockdown strongly impaired tumor growth. These data demonstrate that the SUMO pathway is required for cancer cell proliferation in vitro and tumor growth in vivo, implicating the SUMO pathway as a potential cancer therapeutic target.

  3. Von Hippel-Lindau tumor suppressor gene loss in renal cell carcinoma promotes oncogenic epidermal growth factor receptor signaling via Akt-1 and MEK-1.

    Science.gov (United States)

    Lee, S Justin; Lattouf, Jean-Baptiste; Xanthopoulos, Julie; Linehan, W Marston; Bottaro, Donald P; Vasselli, James R

    2008-10-01

    Clear-cell renal cell carcinoma (RCC) is the most prevalent form of kidney cancer and is frequently associated with loss of von Hippel-Lindau (VHL) gene function, resulting in the aberrant transcriptional activation of genes that contribute to tumor growth and metastasis, including transforming growth factor-alpha (TGF-alpha), a ligand of the epidermal growth factor receptor (EGFR) tyrosine kinase. To determine the functional impact of EGFR activation on RCC, we suppressed critical components of this pathway: EGFR, Akt-1, and MEK-1. Stable transfection of RCC cells with plasmids bearing shRNA directed against each of these genes was used to individually suppress their expression. Transfectants were characterized for growth and invasiveness in vitro and tumorigenesis in vivo. RCC cell transfectants displayed significantly reduced growth rate and matrix invasion in vitro and RCC tumor xenograft growth rate in vivo. Analysis of tumor cells that emerged after extended periods in each model showed that significant EGFR suppression was sustained, whereas Akt-1 and MEK-1 knock-down cells had escaped shRNA suppression. EGFR, Akt-1, and MEK-1 are individually critical for RCC cell invasiveness in vitro and tumorigenicity in vivo, and even partial suppression of each can have a significant impact on tumor progression. The emergence of transfectants that had escaped Akt-1 and MEK-1 suppression during tumorigenicity experiments suggests that these effectors may each be more critical than EGFR for RCC tumorigenesis, consistent with results from clinical trials of EGFR inhibitors for RCC, where durable clinical responses have not been seen.

  4. Von Hippel-Lindau Tumor Suppressor Gene Loss in Renal Cell Carcinoma Promotes Oncogenic Epidermal Growth Factor Receptor Signaling via Akt-1 and MEK1

    Science.gov (United States)

    Lee, S. Justin; Lattouf, Jean-Baptiste; Xanthopoulos, Julie; Linehan, W. Marston; Bottaro, Donald P.; Vasselli, James R.

    2008-01-01

    Objectives Clear-cell renal cell carcinoma (RCC) is the most prevalent form of kidney cancer and is frequently associated with loss of von Hippel-Lindau (VHL) gene function, resulting in the aberrant transcriptional activation of genes that contribute to tumor growth and metastasis, including transforming growth factor-α (TGF-α), a ligand of the epidermal growth factor receptor (EGFR) tyrosine kinase. To determine the functional impact of EGFR activation on RCC, we suppressed critical components of this pathway: EGFR, Akt-1, and MEK-1. Methods Stable transfection of RCC cells with plasmids bearing shRNA directed against each of these genes was used to individually suppress their expression. Transfectants were characterized for growth and invasiveness in vitro and tumorigenesis in vivo. Results RCC cell transfectants displayed significantly reduced growth rate and matrix invasion in vitro and RCC tumor xenograft growth rate in vivo. Analysis of tumor cells that emerged after extended periods in each model showed that significant EGFR suppression was sustained, whereas Akt-1 and MEK-1 knockdown cells had escaped shRNA suppression. Conclusions EGFR, Akt-1, and MEK-1 are individually critical for RCC cell invasiveness in vitro and tumorigenicity in vivo, and even partial suppression of each can have a significant impact on tumor progression. The emergence of transfectants that had escaped Akt-1 and MEK-1 suppression during tumorigenicity experiments suggests that these effectors may each be more critical than EGFR for RCC tumorigenesis, consistent with results from clinical trials of EGFR inhibitors for RCC, where durable clinical responses have not been seen. PMID:18243508

  5. Inhibiting cholesterol degradation induces neuronal sclerosis and epileptic activity in mouse hippocampus

    Science.gov (United States)

    Chali, Farah; Djelti, Fathia; Eugene, Emmanuel; Valderrama, Mario; Marquer, Catherine; Aubourg, Patrick; Duykaerts, Charles; Miles, Richard; Cartier, Nathalie; Navarro, Vincent

    2015-01-01

    Elevations in neuronal cholesterol have been associated with several degenerative diseases. An enhanced excitability and synchronous firing in surviving neurons are among the sequels of neuronal death in these diseases and also in some epileptic syndromes. Here, we attempted to increase neuronal cholesterol levels, using a short hairpin RNA (shRNA) to suppress expression of the enzyme CYP46A1. This protein hydroxylates cholesterol and so facilitates trans-membrane extrusion. A sh-RNA CYP46A1construction coupled to an adeno-associated virus (AAV5) was injected focally and unilaterally into mouse hippocampus. It was selectively expressed first in neurons of the CA3a region. Cytoplasmic and membrane cholesterol increased, neuronal soma volume increased and then decreased before pyramidal cells died. As CA3a pyramidal cells died, inter-ictal EEG events occurred during exploration and non-REM sleep. With time, neuronal death spread to involve pyramidal cells and interneurons of the CA1 region. CA1 neuronal death was correlated with a delayed local expression of phosphorylated tau. Astrocytes were activated throughout the hippocampus and microglial activation was specific to regions of neuronal death. CA1 neuronal death was correlated with distinct aberrant EEG activity. During exploratory behaviour and rapid eye movement sleep, EEG oscillations at 7-10 Hz (theta) could accelerate to 14-21 Hz (beta) waves. They were accompanied by low amplitude, high-frequency oscillations of peak power at ~300Hz and a range of 250-350 Hz. While episodes of EEG acceleration were not correlated with changes in exploratory behaviour, they were followed in some animals by structured seizure-like discharges. These data strengthen links between increased cholesterol, neuronal sclerosis and epileptic behavior PMID:25847620

  6. Spliceosomal small nuclear RNAs of Tetrahymena thermophila and some possible snRNA-snRNA base-pairing interactions

    DEFF Research Database (Denmark)

    Orum, H; Nielsen, Henrik; Engberg, J

    1991-01-01

    We have identified and characterized the full set of spliceosomal small nuclear RNAs (snRNAs; U1, U2, U4, U5 and U6) from the ciliated protozoan Tetrahymena thermophila. With the exception of U4 snRNA, the sizes of the T. thermophila snRNAs are closely similar to their metazoan homologues. The T....... thermophila snRNAs all have unique 5' ends, which start with an adenine residue. In contrast, with the exception of U6, their 3' ends show some size heterogeneity. The primary sequences of the T. thermophila snRNAs contain the sequence motifs shown, or proposed, to be of functional importance in other...

  7. Three-dimensional structure of a pre-catalytic human spliceosomal complex B.

    Science.gov (United States)

    Boehringer, Daniel; Makarov, Evgeny M; Sander, Bjoern; Makarova, Olga V; Kastner, Berthold; Lührmann, Reinhard; Stark, Holger

    2004-05-01

    Major structural changes occur in the spliceosome during its transition from the fully assembled complex B to the catalytically activated spliceosome. To understand the rearrangement, it is necessary to know the detailed three-dimensional structures of these complexes. Here, we have immunoaffinity-purified human spliceosomes (designated B Delta U1) at a stage after U4/U6.U5 tri-snRNP integration but before activation, and have determined the three-dimensional structure of B Delta U1 by single-particle electron cryomicroscopy at a resolution of approximately 40 A. The overall size of the complex is about 370 x 270 x 170 A. The three-dimensional structure features a roughly triangular body linked to a head domain in variable orientations. The body is very similar in size and shape to the isolated U4/U6.U5 tri-snRNP. This provides initial insight into the structural organization of complex B.

  8. Multiplex conditional mutagenesis in zebrafish using the CRISPR/Cas system.

    Science.gov (United States)

    Yin, L; Maddison, L A; Chen, W

    2016-01-01

    The clustered regularly interspaced short palindromic repeat (CRISPR)/CRISPR-associated protein (Cas) system is a powerful tool for genome editing in numerous organisms. However, the system is typically used for gene editing throughout the entire organism. Tissue and temporal specific mutagenesis is often desirable to determine gene function in a specific stage or tissue and to bypass undesired consequences of global mutations. We have developed the CRISPR/Cas system for conditional mutagenesis in transgenic zebrafish using tissue-specific and/or inducible expression of Cas9 and U6-driven expression of sgRNA. To allow mutagenesis of multiple targets, we have isolated four distinct U6 promoters and designed Golden Gate vectors to easily assemble transgenes with multiple sgRNAs. We provide experimental details on the reagents and applications for multiplex conditional mutagenesis in zebrafish. Copyright © 2016 Elsevier Inc. All rights reserved.

  9. Asymptotical approximation of interconnection of nucleons' quadrupole and cluster motion in atomic nucleus

    International Nuclear Information System (INIS)

    Kabulov, A.B.

    2003-01-01

    Atomic nuclei display different kinds of collective motion. The well known example - is the collective model arising from valent nucleons motion. The other a special kind of collective motion is cluster mode. If a collective model has quadrupole character, then cluster one has dipole character. In the boson formalism this model is describing by dynamic symmetry U(6) direct X U(4). The common Hamiltonian symmetrical to U(6) direct X U(4) group has a form H=H d +H p +V pd . In the paper the asymptotical wave function for dipole states connected with (N-1) bosons of s- and d-types is presented. In this case the problem for Hamiltonian eigenvalues is solving by analytical way. With use Elliot method and wave functions asymptotical form the operators for matrix elements of E2-, E1-, M1-transitions are cited

  10. Uranium alloy forming process research

    International Nuclear Information System (INIS)

    Chow, T.S.; Biesiada, T.A.; Sunwoo, A.; Long, J.; Anklam, T.; Kang, S.W.

    1997-01-01

    The study of modern U-6Nb processes is motivated by the needs to reduce fabrication costs and to improve efficiency in material usage. We have studied two potential options: physical vapor deposition (PVD) for manufacturing near-net-shape U-6Nb, and kinetic-energy metallization (KEM) as a supplemental process for refurbishing recycled parts. In FY 1996, we completed two series of PVD runs and heat treatment analyses, the characterization of the microstructure and mechanical properties, a comparison of the results to data for wrought-processed material, and experimental demonstration of the KEM feasibility process with a wide range of variables (particle materials and sizes, gases and gas pressures, and substrate materials), and computer modeling calculations

  11. Mechanisms of the plastic deformation of uranium alloys at low temperature

    International Nuclear Information System (INIS)

    Le Poac, P.; Nomine, A.M.; Miannay, D.

    1976-01-01

    The mechanical characteristics of the bcc binary alloys U-6Mo, U-8Mo, U-10Mo, U-12Mo and bcc ternary alloys U-8Mo-1Ti, U-10Mo-1Ti, U-10Mo-1Zr, stressed in compression, were determined between -196 deg C and + 450 deg C. The plastic flow shear stress in non-dependent on temperature above 300 deg C. At lower temperature shear stress is highly activated, except for the alloy U-6Mo and U-12Mo. Athermal shear stress above 300 deg C is due to the hardening of the solid solution described by Mott and Nabarro. In the thermal range, the recombination of the dissociated dislocations controls the plastic deformation [fr

  12. Gene Therapy for Human Lung Adenocarcinoma Using a Suicide Gene Driven by a Lung-Specific Promoter Delivered by JC Virus-Like Particles.

    Science.gov (United States)

    Chao, Chun-Nun; Lin, Mien-Chun; Fang, Chiung-Yao; Chen, Pei-Lain; Chang, Deching; Shen, Cheng-Huang; Wang, Meilin

    2016-01-01

    Lung adenocarcinoma, the most commonly diagnosed type of lung cancer, has a poor prognosis even with combined surgery, chemotherapy, or molecular targeted therapies. Most patients are diagnosed with an in-operable advanced or metastatic disease, both pointing to the necessity of developing effective therapies for lung adenocarcinoma. Surfactant protein B (SP-B) has been found to be overexpressed in lung adenocarcinoma. In addition, it has also been demonstrated that human lung adenocarcinoma cells are susceptible to the JC polyomavirus (JCPyV) infection. Therefore, we designed that the JCPyV virus-like particle (VLP) packaged with an SP-B promoter-driven thymidine kinase suicide gene (pSPB-tk) for possible gene therapy of human lung adenocarcinoma. Plasmids expressing the GFP (pSPB-gfp) or thymidine kinase gene (pSPB-tk) under the control of the human SP-B promoter were constructed. The promoter's tissue specificity was tested by transfection of pSPB-gfp into A549, CH27, and H460 human lung carcinoma cells and non-lung cells. The JCPyV VLP's gene transfer efficiency and the selective cytotoxicity of pSPB-tk combined with ganciclovir (GCV) were tested in vitro and in a xenograft mouse model. In the current study, we found that SP-B promoter-driven GFP was specifically expressed in human lung adenocarcinoma (A549) and large cell carcinoma (H460) cells. JCPyV VLPs were able to deliver a GFP reporter gene into A549 cells for expression. Selective cytotoxicity was observed in A549 but not non-lung cells that were transfected with pSPB-tk or infected with pSPB-tk-carrying JCPyV VLPs. In mice injected with pSPB-tk-carrying JCPyV VLPs through the tail vein and treated with ganciclovir (GCV), a potent 80% inhibition of growth of human lung adenocarcinoma nodules resulted. The JCPyV VLPs combined with the use of SP-B promoter demonstrates effectiveness as a potential gene therapy against human lung adenocarcinoma.

  13. Development of marker-free transgenic Jatropha curcas producing curcin-deficient seeds through endosperm-specific RNAi-mediated gene silencing.

    Science.gov (United States)

    Gu, Keyu; Tian, Dongsheng; Mao, Huizhu; Wu, Lifang; Yin, Zhongchao

    2015-10-08

    Jatropha curcas L. is a potential biofuel plant and its seed oil is suitable for biodiesel production. Despite this promising application, jatropha seeds contain two major toxic components, namely phorbol esters and curcins. These compounds would reduce commercial value of seed cake and raise safety and environment concerns on jatropha plantation and processing. Curcins are Type I ribosome inactivating proteins. Several curcin genes have been identified in the jatropha genome. Among which, the Curcin 1 (C1) gene is identified to be specifically expressed in endosperm, whereas the Curcin 2A (C2A) is mainly expressed in young leaves. A marker-free RNAi construct carrying a β-estradiol-regulated Cre/loxP system and a C1 promoter-driven RNAi cassette for C1 gene was made and used to generate marker-free transgenic RNAi plants to specifically silence the C1 gene in the endosperm of J. curcas. Plants of transgenic line L1, derived from T0-1, carry two copies of marker-free RNAi cassette, whereas plants of L35, derived from T0-35, harbored one copy of marker-free RNAi cassette and three copies of closely linked and yet truncated Hpt genes. The C1 protein content in endosperm of L1 and L35 seeds was greatly reduced or undetectable, while the C2A proteins in young leaves of T0-1 and T0-35 plants were unaffected. In addition, the C1 mRNA transcripts were undetectable in the endosperm of T3 seeds of L1 and L35. The results demonstrated that the expression of the C1 gene was specifically down-regulated or silenced by the double-stranded RNA-mediated RNA interference generated from the RNAi cassette. The C1 promoter-driven RNAi cassette for the C1 gene in transgenic plants was functional and heritable. Both C1 transcripts and C1 proteins were greatly down-regulated or silenced in the endosperm of transgenic J. curcas. The marker-free transgenic plants and curcin-deficient seeds developed in this study provided a solution for the toxicity of curcins in jatropha seeds and

  14. Gene Therapy for Human Lung Adenocarcinoma Using a Suicide Gene Driven by a Lung-Specific Promoter Delivered by JC Virus-Like Particles.

    Directory of Open Access Journals (Sweden)

    Chun-Nun Chao

    Full Text Available Lung adenocarcinoma, the most commonly diagnosed type of lung cancer, has a poor prognosis even with combined surgery, chemotherapy, or molecular targeted therapies. Most patients are diagnosed with an in-operable advanced or metastatic disease, both pointing to the necessity of developing effective therapies for lung adenocarcinoma. Surfactant protein B (SP-B has been found to be overexpressed in lung adenocarcinoma. In addition, it has also been demonstrated that human lung adenocarcinoma cells are susceptible to the JC polyomavirus (JCPyV infection. Therefore, we designed that the JCPyV virus-like particle (VLP packaged with an SP-B promoter-driven thymidine kinase suicide gene (pSPB-tk for possible gene therapy of human lung adenocarcinoma. Plasmids expressing the GFP (pSPB-gfp or thymidine kinase gene (pSPB-tk under the control of the human SP-B promoter were constructed. The promoter's tissue specificity was tested by transfection of pSPB-gfp into A549, CH27, and H460 human lung carcinoma cells and non-lung cells. The JCPyV VLP's gene transfer efficiency and the selective cytotoxicity of pSPB-tk combined with ganciclovir (GCV were tested in vitro and in a xenograft mouse model. In the current study, we found that SP-B promoter-driven GFP was specifically expressed in human lung adenocarcinoma (A549 and large cell carcinoma (H460 cells. JCPyV VLPs were able to deliver a GFP reporter gene into A549 cells for expression. Selective cytotoxicity was observed in A549 but not non-lung cells that were transfected with pSPB-tk or infected with pSPB-tk-carrying JCPyV VLPs. In mice injected with pSPB-tk-carrying JCPyV VLPs through the tail vein and treated with ganciclovir (GCV, a potent 80% inhibition of growth of human lung adenocarcinoma nodules resulted. The JCPyV VLPs combined with the use of SP-B promoter demonstrates effectiveness as a potential gene therapy against human lung adenocarcinoma.

  15. The nature of the emission transition of the octahedral uranate group, ch. 5

    International Nuclear Information System (INIS)

    Hair, J.Th.W. de

    1976-01-01

    Decay times of the green luminescence of U 6+ in oxides with perovskite structure are reported. The influence of the site symmetry is found to be considerable. The temperature dependence of the decay time gives evidence for a coupling of the electronic transition with a phonon of about 200 cm -1 in the excited state. The results show the emission to originate from a parity forbidden transition, vibronically allowed by coupling with vibrations of ungerade symmetry. (Auth.)

  16. The Analysis of a Longitudinal Control System for Underwater Vehicles

    Science.gov (United States)

    1975-10-01

    9 PERFORMING ORGANIZATION NAME AND ADDRESS Naval Coastal Systems Laboratory Panama City, Florida 32401 10. PROGRAM ELEMENT. PROJECT. TASK...TfM.PH) VCNC + 1 ) = 0# U(NC >»QP/UCNC*1 -) V(NC)=0. FORM NEW KFOUCEn COFF »- ICIFVTS Aft 00 A9 T=1#NC 000u6fl<*0 00006660 OOGu6S70 000O68M0

  17. Combustor Modelling

    Science.gov (United States)

    1980-02-01

    TABLE B I •~ 0 ~ 0 ,U6- v z VC r’𔃻/r 4!𔃻 !.!t + Ga/ fta clippe ditiuin cin nu’fI’ I Q- 1. C1, 1-++.9?Q0 tC The Gaussian clipped p.d~f...Film Cooling Geometries of a Practical Nature", Cranfield Int’II Prop. Symposium, 1969. 40. Papell , S.S. & Trout, A.M., "Experimental Investigation of

  18. MicroRNA-146a expression as a potential biomarker for rheumatoid ...

    African Journals Online (AJOL)

    Heba Mohamed Abdelkader Elsayed

    2016-07-26

    Jul 26, 2016 ... lows; enzyme activation at 95 °C, followed by 40 cycles of denaturation at 94 °C for 15s annealing at 55 °C for 30 s and extension at 70 °C for 30 s. The expression of the U6B small nuclear RNA (RNU6B) was used as endogenous control for data normalization. The RQ level (fold change) for miR-146a was ...

  19. Collembola feeding habits and niche specialization in agricultural grasslands of different composition

    DEFF Research Database (Denmark)

    Sechi, Valentina; D ’ Annibale, Alessandra; Ambus, Per

    2014-01-01

    lipid fatty acids (NLFAs) in Isotoma spp. compared to L. cyaneus . Poduromorpha showed a higher relative percentage of the NLFAs 16:1 u 7 and 20:4 compared to L. cyaneus , and of 18:3 compared to Isotoma spp. The NLFA oleic/ linoleic ratio (18:1 u 9/18:2 u 6,9) ratio was higher in Poduromorpha compared...

  20. Odd - even staggering, a result of γ - band split

    International Nuclear Information System (INIS)

    Singh, M.; Gupta, D.K.; Singh, Yuvraj; Gupta, K.K.; Bihari, Chhail; Sharma, Aparna; Varshney, A.K.; Varshney, Mani

    2011-01-01

    The structure of low - lying K = 2+ gamma band in even - even nuclei represents quadrupole vibration breaking axial symmetry in unified collective model of Bohr-Mottelson. In the group theoretical approach of the Interacting boson model (IBM) the band structure can belong to one of the three limiting symmetries of U (6) algebra viz. U (5), SU (3) and O (6), corresponding to the anharmonic vibrator, deformed rotor and γ - unstable respectively

  1. Insensitive Munitions (Les Munitions a Risque Attenue)

    Science.gov (United States)

    1992-07-01

    82176talonnage des tests d’IAD, qui ont U6 calibr~s iium~riquement et exp&imentalement k laide de jauges pi~zo-r~sistives. La figure 1 donne ces courbes d...tests siont instrumnentks avec des jauges de sitions B 2214 et B 3017, malgr6 Vaecroissement ,ýurpression "irienne. des came6ras rapides (500 1 30

  2. The crystal chemistry and structural analysis of uranium oxide hydrates. Final report, May 15, 1995--December 31, 1997

    International Nuclear Information System (INIS)

    Miller, M.L.; Ewing, R.C.

    1998-01-01

    The purpose of this research program was to develop a thorough understanding of the crystal-chemical and crystal-structural systematics of uranyl oxide hydrates which are the initial corrosion products of the UO 2 in spent nuclear fuel and the principal phases in which actinides occur in the near surface environment. The scope of this program has been expanded to include all inorganic phases in which U 6+ plays a significant structural role; currently 183 phases with known crystal structures

  3. On the effective temperature and Reynolds number concept for a heated circular cylinder: commentary of the article by Baranyi et al

    Czech Academy of Sciences Publication Activity Database

    Trávníček, Zdeněk; Wang, A.B.

    2011-01-01

    Roč. 25, č. 8 (2011), s. 1881-1884 ISSN 1738-494X R&D Projects: GA ČR(CZ) GCP101/11/J019 Institutional research plan: CEZ:AV0Z20760514 Keywords : heated circular cylinder * effective temperature * vortex shedding Subject RIV: BK - Fluid Dynamics Impact factor: 0.448, year: 2011 http://www.springerlink.com/content/2131l38t2u0504u6/

  4. The recruitment of the U5 snRNP to nascent transcripts requires internal loop 1 of U5 snRNA.

    Science.gov (United States)

    Kim, Rebecca; Paschedag, Joshua; Novikova, Natalya; Bellini, Michel

    2012-12-01

    In this study, we take advantage of the high spatial resolution offered by the nucleus and lampbrush chromosomes of the amphibian oocyte to investigate the mechanisms that regulate the intranuclear trafficking of the U5 snRNP and its recruitment to nascent transcripts. We monitor the fate of newly assembled fluorescent U5 snRNP in Xenopus oocytes depleted of U4 and/or U6 snRNAs and demonstrate that the U4/U6.U5 tri-snRNP is not required for the association of U5 snRNP with Cajal bodies, splicing speckles, and nascent transcripts. In addition, using a mutational analysis, we show that a non-functional U5 snRNP can associate with nascent transcripts, and we further characterize internal loop structure 1 of U5 snRNA as a critical element for licensing U5 snRNP to target both nascent transcripts and splicing speckles. Collectively, our data support the model where the recruitment of snRNPs onto pre-mRNAs is independent of spliceosome assembly and suggest that U5 snRNP may promote the association of the U4/U6.U5 tri-snRNP with nascent transcripts.

  5. Canonical form of three-fermion pure-states with six single particle states

    International Nuclear Information System (INIS)

    Chen, Lin; Ž Ðoković, Dragomir; Grassl, Markus; Zeng, Bei

    2014-01-01

    We construct a canonical form for pure states in ∧ 3 (C 6 ), the three-fermion system with six single particle states, under local unitary (LU) transformations, i.e., the unitary group U(6). We also construct a minimal set of generators of the algebra of polynomial U(6)-invariants on ∧ 3 (C 6 ). It turns out that this algebra is isomorphic to the algebra of polynomial LU-invariants of three-qubits which are additionally invariant under qubit permutations. As a consequence of this surprising fact, we deduce that there is a one-to-one correspondence between the U(6)-orbits of pure three-fermion states in ∧ 3 (C 6 ) and the LU orbits of pure three-qubit states when qubit permutations are allowed. As an important byproduct, we obtain a new canonical form for pure three-qubit states under LU transformations U(2) × U(2) × U(2) (no qubit permutations allowed)

  6. Welding of a powder metallurgy uranium alloy

    International Nuclear Information System (INIS)

    Holbert, R.K.; Doughty, M.W.; Alexander-Morrison, G.M.

    1989-01-01

    The interest at the Oak Ridge Y-12 Plant in powder metallurgy (P/M) uranium parts is due to the potential cost savings in the fabrication of the material, to achieving a more homogeneous product, and to the reduction of uranium scrap. The joining of P/M uranium-6 wt-% niobium (U-6Nb) alloys by the electron beam (EB) welding process results in weld porosity. Varying the EB welding parameters did not eliminate the porosity. Reducing the oxygen and nitrogen content in this P/M uranium material did minimize the weld porosity, but this step made the techniques of producing the material more difficult. Therefore, joining wrought and P/M U-6Nb rods with the inertia welding technique is considered. Since no gases will be evolved with the solid-state welding process and the weld area will be compacted, porosity should not be a problem in the inertia welding of uranium alloys. The welds that are evaluated are wrought-to-wrought, wrought-to-P/M, and P/M-to-P/M U-6Nb samples

  7. Superconductivity: Is there a problem in transuranics?

    International Nuclear Information System (INIS)

    Colineau, Eric; Griveau, Jean-Christophe; Eloirdi, Rachel; Hen, Amir; Caciuffo, Roberto

    2014-01-01

    Superconductivity was first reported in 1942 for uranium metal (¡-U) and in 1958 for U compounds: UCo, U6Mn, U6Fe, and U6Co, with critical temperatures Tc, of 1.7, 2.3, 3.9, and 2.3K, respectively. A new class of U superconductors emerged in the early 1980’s with the discovery of U heavy fermion superconductors : UBe13 (Tc = 0.85K), UPt3 (Tc = 0.53K), URu2Si2 (Tc = 1.5K) , UPd2Al3 (Tc = 1.9K) … Furthermore, in most of these systems, the superconducting phases coexist with antiferromagnetic (AF) correlations which have characteristic temperatures, usually the Néel temperature TN, that are typically one order of magnitude greater than the corresponding superconducting critical temperatures Tc. Superconductivity was even shown to co-exist with ferromagnetism in e.g. UGe2 (Tc ï» 0.8K, TC ï» 30K at p ï» 1.2GPa) and URhGe (Tc = 0.25K, TC = 9.5K). Heavy fermion superconductors still remain a major challenge for condensed matter physics. The existence of heavy fermion superconductivity and its coexistence or proximity with magnetic order suggests that the conventional mechanism of phonon-mediated superconductivity is inappropriate and that alternative mechanisms, like spin fluctuations, should be considered for Cooper pairing

  8. A Vector with a Single Promoter for In Vitro Transcription and Mammalian Cell Expression of CRISPR gRNAs.

    Directory of Open Access Journals (Sweden)

    Peter J Romanienko

    Full Text Available The genomes of more than 50 organisms have now been manipulated due to rapid advancement of gene editing technology. One way to perform gene editing in the mouse using the CRISPR/CAS system, guide RNA (gRNA and CAS9 mRNA transcribed in vitro are microinjected into fertilized eggs that are then allowed to develop to term. As a rule, gRNAs are tested first in tissue culture cells and the one with the highest locus-specific cleavage activity is chosen for microinjection. For cell transfections, gRNAs are typically expressed using the human U6 promoter (hU6. However, gRNAs for microinjection into zygotes are obtained by in vitro transcription from a T7 bacteriophage promoter in a separate plasmid vector. Here, we describe the design and construction of a combined U6T7 hybrid promoter from which the same gRNA sequence can be expressed. An expression vector containing such a hybrid promoter can now be used to generate gRNA for testing in mammalian cells as well as for microinjection purposes. The gRNAs expressed and transcribed from this vector are found to be functional in cells as well as in mice.

  9. [Relationship between PMI and relative expression of myocardial various RNAs in rats died of different causes].

    Science.gov (United States)

    Lü, Ye-Hui; Zhang, Heng; Pan, Hui; Ma, Kai-Jun; Li, Wen-Can; Chen, Wen-Feng; Jiang, Jie-Qing'; Xue, Ai-Min; Zhang, Ping; Wang, Hui-Jun; Chen, Long

    2014-02-01

    To observe the changes of relative expression of myocardial various RNAs in rats died of different causes and their relationship with PMI. The rat models were established in which the rats were sacrificed by broken neck, asphyxia, and hemorrhagic shock. Total RNAs were extracted from myocardium. The quantitative real time PCR was used to calculate threshold cycle values of RNAs including glyceraldehyde-3-phosphate dehydrogenase (GAPDH), beta-actin, inducible nitric oxide synthase (iNOS), hypoxia-inducible factor-1 (HIF-1), tumor necrosis factor-alpha (TNF-alpha), interleukin-6 (IL-6), and U6 small nuclear RNA (U6 snRNA) and to study the changes of the relative expressions of various indexes with PMI. U6 snRNA with stable expression level could be used as appropriate internal control. In the early PMI, the relative expression of GAPDH, HIF-1, iNOS, TNF-alpha, and IL-6 more characteristically increased in groups of asphyxia and hemorrhagic shock than in group of broken neck, but the quantity of beta-actin decreased in all groups. In the late PMI, all the relative expressions significantly declined in correlation with the degradation of RNA. The characteristic changes of each RNA expression can be used as references to estimate PMI in deaths by different causes.

  10. Small interference RNA-mediated knockdown of sperm associated antigen 9 having structural homology with c-Jun N-terminal kinase-interacting protein

    International Nuclear Information System (INIS)

    Rana, Ritu; Jagadish, Nirmala; Garg, Manoj; Mishra, Deepshikha; Dahiya, Neetu; Chaurasiya, Dipak; Suri, Anil

    2006-01-01

    Recently, we reported a novel testis-specific sperm associated antigen 9 (SPAG9) protein, a new member of the JNK-interacting protein family, having a functional role in sperm-egg fusion [N. Jagadish, R. Rana, R. Selvi, D. Mishra, M. Garg, S. Yadav, J.C. Herr, K. Okumura, A. Hasegawa, K. Koyama, A. Suri, Biochem. J. 389 (2005) 73-82]. NCBI Blast searches revealed SPAG9 nucleotide sequence similarities with ESTs of various cancerous tissues. In the present study, we compared the efficiency of two independent SPAG9 specific small interfering RNA (siRNA) constructs, BS/U6/spag9 and BS/U6/spag9-I, to ablate the SPAG9 expression in mammalian cells. A positive correlation between the ratio of target gene versus siRNA and the suppression of SPAG9 expression was observed. Further, the cotransfection of BS/U6/spag9 with pcDNA-SPAG9 and pFlag-CMV2-JNK-3 resulted in specific suppression of SPAG9 without affecting JNK-3 expression. The present investigation will eventually extend the application of SPAG9 siRNA in in vivo targeting experiments that aim to define the SPAG9 functional genomics in tumor and reproductive biology

  11. Dual RNA Processing Roles of Pat1b via Cytoplasmic Lsm1-7 and Nuclear Lsm2-8 Complexes

    Directory of Open Access Journals (Sweden)

    Caroline Vindry

    2017-08-01

    Full Text Available Pat1 RNA-binding proteins, enriched in processing bodies (P bodies, are key players in cytoplasmic 5′ to 3′ mRNA decay, activating decapping of mRNA in complex with the Lsm1-7 heptamer. Using co-immunoprecipitation and immunofluorescence approaches coupled with RNAi, we provide evidence for a nuclear complex of Pat1b with the Lsm2-8 heptamer, which binds to the spliceosomal U6 small nuclear RNA (snRNA. Furthermore, we establish the set of interactions connecting Pat1b/Lsm2-8/U6 snRNA/SART3 and additional U4/U6.U5 tri-small nuclear ribonucleoprotein particle (tri-snRNP components in Cajal bodies, the site of snRNP biogenesis. RNA sequencing following Pat1b depletion revealed the preferential upregulation of mRNAs normally found in P bodies and enriched in 3′ UTR AU-rich elements. Changes in >180 alternative splicing events were also observed, characterized by skipping of regulated exons with weak donor sites. Our data demonstrate the dual role of a decapping enhancer in pre-mRNA processing as well as in mRNA decay via distinct nuclear and cytoplasmic Lsm complexes.

  12. Trace metal chemistry in the Marcellus shale

    Energy Technology Data Exchange (ETDEWEB)

    Bank, Tracy [University at Buffalo (United States)

    2010-07-01

    In recent years, due to the depletion of traditional fossil fuel resources and the rising price of energy, the production of unconventional gas has increased. Several black shales contain uranium both in insoluble species, U4+, and in soluble U6+ phase. Those two forms of uranium are weakly radioactive, however they are toxic and can lead to kidney and liver damage. The aim of this paper is to assess the oxidation state of uranium in the Marcellus shale formation. Samples were analyzed using several methods such as XRD, X-ray absorption near edge structure, and time of flight secondary ion mass spectrometry to determine the rock geochemistry and examine the interaction between the uranium and the hydrocarbons. It was found that uranium exists in both UO2 and U-C forms with a dominance of U6+. This study demonstrated that uranium is present in the Marcellus shale in both U4+ and U6+ states and that more research must therefore be undertaken to determine how to dispose of waste from drilling and fracking activities.

  13. Involvement of Bmi-1 gene in the development of gastrointestinal stromal tumor by regulating p16Ink4A/p14ARF gene expressions: An in vivo and in vitro study.

    Science.gov (United States)

    Wang, Jiang-Li; Wu, Jiang-Hong; Hong, Cai; Wang, Ya-Nong; Zhou, Ye; Long, Zi-Wen; Zhou, Ying; Qin, Hai-Shu

    2017-12-01

    This study was conducted in order to explore the role that Bmi-1 plays during the development of a gastrointestinal stromal tumor (GIST) by regulation of the p16 Ink4A and p14 ARF expressions. Eighty-six patients diagnosed with GIST were selected to take part in this experiment. The Bmi-1 protein expressions in GIST and adjacent normal tissues were detected using immunohistochemistry and further analyzed by using photodensitometry. To monitor and track the progression of the GIST, a 3-year follow-up was conducted for all affected patients. After cell transfection, the GIST cells were assigned into the control group (without transfection), the negative control (NC) group (transfected with Bmi-1-Scramble plasmid), and the Bmi-1 shRNA group (transfected with the pcDNA3.1-Bmi-1 shRNA plasmid). Protein and mRNA expressions collected from Bmi-1, p16 lnk4A , P14 ARF , cyclin D1, and CDK4 were measured using both the RT-qPCR and western blotting methods Cell senescence was assessed and obtained by using the β-Galactosidase (β-Gal) activity assay. The use of a Soft agar colony formation assay and CCK-8 assay were performed in order to detect the cell growth and subsequent proliferation. Cell invasion and migration were analyzed using the Transwell assay and scratch test. Bmi-1 in the GIST tissues was found to be significantly higher and the p16 lnk4A and P14 ARF expressions were lower than those in the adjacent normal tissues. Bmi-1 was negatively correlated with p16 lnk4A and P14 ARF expressions according to the correlation analysis. Bmi-1 expression was associated with the TNM stage, postoperative recurrence, metastasis, tumor size, and the 5-year survival rate. Area under ROC curve was calculated at 0.884, and sensitivity, specificity, and accuracy of Bmi-1 predicting the GIST were 67.44%, 97.67%, and 65.12%, respectively. Patients exhibiting a high Bmi-1 expression in the GIST tissues had lower survival rates than those with low Bmi-1 expression. In comparison with

  14. Branched-Chain Amino Acid Negatively Regulates KLF15 Expression via PI3K-AKT Pathway.

    Science.gov (United States)

    Liu, Yunxia; Dong, Weibing; Shao, Jing; Wang, Yibin; Zhou, Meiyi; Sun, Haipeng

    2017-01-01

    Recent studies have linked branched-chain amino acid (BCAA) with numerous metabolic diseases. However, the molecular basis of BCAA's roles in metabolic regulation remains to be established. KLF15 (Krüppel-like factor 15) is a transcription factor and master regulator of glycemic, lipid, and amino acids metabolism. In the present study, we found high concentrations of BCAA suppressed KLF15 expression while BCAA starvation induced KLF15 expression, suggesting KLF15 expression is negatively controlled by BCAA.Interestingly, BCAA starvation induced PI3K-AKT signaling. KLF15 induction by BCAA starvation was blocked by PI3K and AKT inhibitors, indicating the activation of PI3K-AKT signaling pathway mediated the KLF15 induction. BCAA regulated KLF15 expression at transcriptional level but not post-transcriptional level. However, BCAA starvation failed to increase the KLF15-promoter-driven luciferase expression, suggesting KLF15 promoter activity was not directly controlled by BCAA. Finally, fasting reduced BCAA abundance in mice and KLF15 expression was dramatically induced in muscle and white adipose tissue, but not in liver. Together, these data demonstrated BCAA negatively regulated KLF15 expression, suggesting a novel molecular mechanism underlying BCAA's multiple functions in metabolic regulation.

  15. Dendritic cells modulate burn wound healing by enhancing early proliferation.

    Science.gov (United States)

    Vinish, Monika; Cui, Weihua; Stafford, Eboni; Bae, Leon; Hawkins, Hal; Cox, Robert; Toliver-Kinsky, Tracy

    2016-01-01

    Adequate wound healing is vital for burn patients to reduce the risk of infections and prolonged hospitalization. Dendritic cells (DCs) are antigen presenting cells that release cytokines and are central for the activation of innate and acquired immune responses. Studies have showed their presence in human burn wounds; however, their role in burn wound healing remains to be determined. This study investigated the role of DCs in modulating healing responses within the burn wound. A murine model of full-thickness contact burns was used to study wound healing in the absence of DCs (CD11c promoter-driven diphtheria toxin receptor transgenic mice) and in a DC-rich environment (using fms-like tyrosine kinase-3 ligand, FL- a DC growth factor). Wound closure was significantly delayed in DC-deficient mice and was associated with significant suppression of early cellular proliferation, granulation tissue formation, wound levels of TGFβ1 and formation of CD31+ vessels in healing wounds. In contrast, DC enhancement significantly accelerated early wound closure, associated with increased and accelerated cellular proliferation, granulation tissue formation, and increased TGFβ1 levels and CD31+ vessels in healing wounds. We conclude that DCs play an important role in the acceleration of early wound healing events, likely by secreting factors that trigger the proliferation of cells that mediate wound healing. Therefore, pharmacological enhancement of DCs may provide a therapeutic intervention to facilitate healing of burn wounds. © 2016 by the Wound Healing Society.

  16. Pineal photoreceptor cells are required for maintaining the circadian rhythms of behavioral visual sensitivity in zebrafish.

    Directory of Open Access Journals (Sweden)

    Xinle Li

    Full Text Available In non-mammalian vertebrates, the pineal gland functions as the central pacemaker that regulates the circadian rhythms of animal behavior and physiology. We generated a transgenic zebrafish line [Tg(Gnat2:gal4-VP16/UAS:nfsB-mCherry] in which the E. coli nitroreductase is expressed in pineal photoreceptor cells. In developing embryos and young adults, the transgene is expressed in both retinal and pineal photoreceptor cells. During aging, the expression of the transgene in retinal photoreceptor cells gradually diminishes. By 8 months of age, the Gnat2 promoter-driven nitroreductase is no longer expressed in retinal photoreceptor cells, but its expression in pineal photoreceptor cells persists. This provides a tool for selective ablation of pineal photoreceptor cells, i.e., by treatments with metronidazole. In the absence of pineal photoreceptor cells, the behavioral visual sensitivity of the fish remains unchanged; however, the circadian rhythms of rod and cone sensitivity are diminished. Brief light exposures restore the circadian rhythms of behavioral visual sensitivity. Together, the data suggest that retinal photoreceptor cells respond to environmental cues and are capable of entraining the circadian rhythms of visual sensitivity; however, they are insufficient for maintaining the rhythms. Cellular signals from the pineal photoreceptor cells may be required for maintaining the circadian rhythms of visual sensitivity.

  17. Spermatogenic Cell-Specific Gene Mutation in Mice via CRISPR-Cas9.

    Science.gov (United States)

    Bai, Meizhu; Liang, Dan; Wang, Yinghua; Li, Qing; Wu, Yuxuan; Li, Jinsong

    2016-05-20

    Tissue-specific knockout technology enables the analysis of the gene function in specific tissues in adult mammals. However, conventional strategy for producing tissue-specific knockout mice is a time- and labor-consuming process, restricting rapid study of the gene function in vivo. CRISPR-Cas9 system from bacteria is a simple and efficient gene-editing technique, which has enabled rapid generation of gene knockout lines in mouse by direct injection of CRISPR-Cas9 into zygotes. Here, we demonstrate CRISPR-Cas9-mediated spermatogenic cell-specific disruption of Scp3 gene in testes in one step. We first generated transgenic mice by pronuclear injection of a plasmid containing Hspa2 promoter driving Cas9 expression and showed Cas9 specific expression in spermatogenic cells. We then produced transgenic mice carrying Hspa2 promoter driven Cas9 and constitutive expressed sgRNA targeting Scp3 gene. Male founders were infertile due to developmental arrest of spermatogenic cells while female founders could produce progeny normally. Consistently, male progeny from female founders were infertile and females could transmit the transgenes to the next generation. Our study establishes a CRISPR-Cas9-based one-step strategy to analyze the gene function in adult tissues by a temporal-spatial pattern. Copyright © 2016 Institute of Genetics and Developmental Biology, Chinese Academy of Sciences, and Genetics Society of China. Published by Elsevier Ltd. All rights reserved.

  18. Crucial Role of Mesangial Cell-derived Connective Tissue Growth Factor in a Mouse Model of Anti-Glomerular Basement Membrane Glomerulonephritis.

    Science.gov (United States)

    Toda, Naohiro; Mori, Kiyoshi; Kasahara, Masato; Ishii, Akira; Koga, Kenichi; Ohno, Shoko; Mori, Keita P; Kato, Yukiko; Osaki, Keisuke; Kuwabara, Takashige; Kojima, Katsutoshi; Taura, Daisuke; Sone, Masakatsu; Matsusaka, Taiji; Nakao, Kazuwa; Mukoyama, Masashi; Yanagita, Motoko; Yokoi, Hideki

    2017-02-13

    Connective tissue growth factor (CTGF) coordinates the signaling of growth factors and promotes fibrosis. Neonatal death of systemic CTGF knockout (KO) mice has hampered analysis of CTGF in adult renal diseases. We established 3 types of CTGF conditional KO (cKO) mice to investigate a role and source of CTGF in anti-glomerular basement membrane (GBM) glomerulonephritis. Tamoxifen-inducible systemic CTGF (Rosa-CTGF) cKO mice exhibited reduced proteinuria with ameliorated crescent formation and mesangial expansion in anti-GBM nephritis after induction. Although CTGF is expressed by podocytes at basal levels, podocyte-specific CTGF (pod-CTGF) cKO mice showed no improvement in renal injury. In contrast, PDGFRα promoter-driven CTGF (Pdgfra-CTGF) cKO mice, which predominantly lack CTGF expression by mesangial cells, exhibited reduced proteinuria with ameliorated histological changes. Glomerular macrophage accumulation, expression of Adgre1 and Ccl2, and ratio of M1/M2 macrophages were all reduced both in Rosa-CTGF cKO and Pdgfra-CTGF cKO mice, but not in pod-CTGF cKO mice. TGF-β1-stimulated Ccl2 upregulation in mesangial cells and macrophage adhesion to activated mesangial cells were decreased by reduction of CTGF. These results reveal a novel mechanism of macrophage migration into glomeruli with nephritis mediated by CTGF derived from mesangial cells, implicating the therapeutic potential of CTGF inhibition in glomerulonephritis.

  19. Suppression of Oncolytic Adenovirus-Mediated Hepatotoxicity by Liver-Specific Inhibition of NF-κB

    Directory of Open Access Journals (Sweden)

    Mitsuhiro Machitani

    2017-12-01

    Full Text Available Telomerase-specific replication-competent adenoviruses (Ads, i.e., TRADs, which possess an E1 gene expression cassette driven by the human telomerase reverse transcriptase promoter, are promising agents for cancer treatment. However, even though oncolytic Ads, including TRAD, are intratumorally administered, they are disseminated from the tumor to systemic circulation, causing concern about oncolytic Ad-mediated hepatotoxicity (due mainly to leaky expression of Ad genes in liver. We reported that inhibition of nuclear factor-κB (NF-κB leads to the suppression of replication-incompetent Ad vector-mediated hepatotoxicity via reduction of the leaky expression of Ad genes in liver. Here, to develop a TRAD with an improved safety profile, we designed a TRAD that carries a liver-specific promoter-driven dominant-negative IκBα (DNIκBα expression cassette (TRAD-DNIκBα. Compared with a conventional TRAD, TRAD-DNIκBα showed hepatocyte-specific inhibition of NF-κB signaling and significantly reduced Ad gene expression and replication in the normal human hepatocyte cell line. TRAD-induced hepatotoxicity was largely suppressed in mice following intravenous administration of TRAD-DNIκBα. However, the replication profiles and oncolytic activities of TRAD-DNIκBα were comparable with those of the conventional TRAD in human non-hepatic tumor cells. These results indicate that oncolytic Ads containing the liver-specific DNIκBα expression cassette have improved safety profiles without inhibiting oncolytic activities.

  20. Anatomical characterization of Cre driver mice for neural circuit mapping and manipulation

    Science.gov (United States)

    Harris, Julie A.; Hirokawa, Karla E.; Sorensen, Staci A.; Gu, Hong; Mills, Maya; Ng, Lydia L.; Bohn, Phillip; Mortrud, Marty; Ouellette, Benjamin; Kidney, Jolene; Smith, Kimberly A.; Dang, Chinh; Sunkin, Susan; Bernard, Amy; Oh, Seung Wook; Madisen, Linda; Zeng, Hongkui

    2014-01-01

    Significant advances in circuit-level analyses of the brain require tools that allow for labeling, modulation of gene expression, and monitoring and manipulation of cellular activity in specific cell types and/or anatomical regions. Large-scale projects and individual laboratories have produced hundreds of gene-specific promoter-driven Cre mouse lines invaluable for enabling genetic access to subpopulations of cells in the brain. However, the potential utility of each line may not be fully realized without systematic whole brain characterization of transgene expression patterns. We established a high-throughput in situ hybridization (ISH), imaging and data processing pipeline to describe whole brain gene expression patterns in Cre driver mice. Currently, anatomical data from over 100 Cre driver lines are publicly available via the Allen Institute's Transgenic Characterization database, which can be used to assist researchers in choosing the appropriate Cre drivers for functional, molecular, or connectional studies of different regions and/or cell types in the brain. PMID:25071457

  1. Metabolic impact of adult-onset, isolated, growth hormone deficiency (AOiGHD due to destruction of pituitary somatotropes.

    Directory of Open Access Journals (Sweden)

    Raul M Luque

    2011-01-01

    Full Text Available Growth hormone (GH inhibits fat accumulation and promotes protein accretion, therefore the fall in GH observed with weight gain and normal aging may contribute to metabolic dysfunction. To directly test this hypothesis a novel mouse model of adult onset-isolated GH deficiency (AOiGHD was generated by cross breeding rat GH promoter-driven Cre recombinase mice (Cre with inducible diphtheria toxin receptor mice (iDTR and treating adult Cre(+/-,iDTR(+/- offspring with DT to selectively destroy the somatotrope population of the anterior pituitary gland, leading to a reduction in circulating GH and IGF-I levels. DT-treated Cre(-/-,iDTR(+/- mice were used as GH-intact controls. AOiGHD improved whole body insulin sensitivity in both low-fat and high-fat fed mice. Consistent with improved insulin sensitivity, indirect calorimetry revealed AOiGHD mice preferentially utilized carbohydrates for energy metabolism, as compared to GH-intact controls. In high-fat, but not low-fat fed AOiGHD mice, fat mass increased, hepatic lipids decreased and glucose clearance and insulin output were impaired. These results suggest the age-related decline in GH helps to preserve systemic insulin sensitivity, and in the context of moderate caloric intake, prevents the deterioration in metabolic function. However, in the context of excess caloric intake, low GH leads to impaired insulin output, and thereby could contribute to the development of diabetes.

  2. Silibinin and Paclitaxel Cotreatment Significantly Suppress the Activity and Lung Metastasis of Triple Negative 4T1 Mammary Tumor Cell in Mice

    Directory of Open Access Journals (Sweden)

    Bing-Ying Ho

    2012-10-01

    Full Text Available The in vitro and in vivo bioactivities of silibinin (SB, paclitaxel (PTX and SB and PTX in combination (SB+PTX against murine metastatic mammary 4T1 cancer cell line were investigated. Isobologram and combination index (CI analyses showed that SB and PTX can function synergistically in the inhibition of 4T1 cell proliferation with a CI value<1. Both SB and PTX alone or SB+PTX treatment inhibited 4T1 cell migration and motility possibly through downregulation of the serpin protease nexin-1 (PN-1 and N-cadherin expression, inhibition of matrix metalloprotease (MMP-9 activity, and upregulation of E-cadherin. Flow cytometry and Western blot analyses demonstrated that both drugs deregulated cell-cycle mediators and induced apoptosis in 4T1 cells. A real-time in vivo bioluminescence imaging system to monitor the breast cancer cell metastasis in syngeneic BALB/c mice was established using a stable 4T1pGL−COX−2/Luc cell clone carrying a COX-2 promoter driven-luciferase reporter gene. In vivo study using the allograft 4T1pGL−COX−2/Luc metastatic mouse model indicated that SB co-treated with PTX can significantly suppress lung metastasis of 4T1 cells likely through inhibiting cell proliferation and angiogenesis. Together, this study demonstrates that SB could act synergistically with PTX in 4T1 cells, providing a therapeutic option for highly metastatic triple negative breast cancer.

  3. The transcription factor MEF2C mediates cardiomyocyte hypertrophy induced by IGF-1 signaling

    Energy Technology Data Exchange (ETDEWEB)

    Munoz, Juan Pablo; Collao, Andres; Chiong, Mario; Maldonado, Carola; Adasme, Tatiana; Carrasco, Loreto; Ocaranza, Paula; Bravo, Roberto; Gonzalez, Leticia; Diaz-Araya, Guillermo [Centro FONDAP Estudios Moleculares de la Celula, Facultad de Medicina, Universidad de Chile, Santiago 8380492 (Chile); Facultad de Ciencias Quimicas y Farmaceuticas, Facultad de Medicina, Universidad de Chile, Santiago 8380492 (Chile); Hidalgo, Cecilia [Centro FONDAP Estudios Moleculares de la Celula, Facultad de Medicina, Universidad de Chile, Santiago 8380492 (Chile); Instituto de Ciencias Biomedicas, Facultad de Medicina, Universidad de Chile, Santiago 8380492 (Chile); Lavandero, Sergio, E-mail: slavander@uchile.cl [Centro FONDAP Estudios Moleculares de la Celula, Facultad de Medicina, Universidad de Chile, Santiago 8380492 (Chile); Facultad de Ciencias Quimicas y Farmaceuticas, Facultad de Medicina, Universidad de Chile, Santiago 8380492 (Chile); Instituto de Ciencias Biomedicas, Facultad de Medicina, Universidad de Chile, Santiago 8380492 (Chile)

    2009-10-09

    Myocyte enhancer factor 2C (MEF2C) plays an important role in cardiovascular development and is a key transcription factor for cardiac hypertrophy. Here, we describe MEF2C regulation by insulin-like growth factor-1 (IGF-1) and its role in IGF-1-induced cardiac hypertrophy. We found that IGF-1 addition to cultured rat cardiomyocytes activated MEF2C, as evidenced by its increased nuclear localization and DNA binding activity. IGF-1 stimulated MEF2 dependent-gene transcription in a time-dependent manner, as indicated by increased MEF2 promoter-driven reporter gene activity; IGF-1 also induced p38-MAPK phosphorylation, while an inhibitor of p38-MAPK decreased both effects. Additionally, inhibitors of phosphatidylinositol 3-kinase and calcineurin prevented IGF-1-induced MEF2 transcriptional activity. Via MEF2C-dependent signaling, IGF-1 also stimulated transcription of atrial natriuretic factor and skeletal {alpha}-actin but not of fos-lux reporter genes. These novel data suggest that MEF2C activation by IGF-1 mediates the pro-hypertrophic effects of IGF-1 on cardiac gene expression.

  4. Embryonic Stem Cell-Derived Cardiomyocyte Heterogeneity and the Isolation of Immature and Committed Cells for Cardiac Remodeling and Regeneration

    Directory of Open Access Journals (Sweden)

    Kenneth R. Boheler

    2011-01-01

    Full Text Available Pluripotent stem cells represent one promising source for cell replacement therapy in heart, but differentiating embryonic stem cell-derived cardiomyocytes (ESC-CMs are highly heterogeneous and show a variety of maturation states. In this study, we employed an ESC clonal line that contains a cardiac-restricted ncx1 promoter-driven puromycin resistance cassette together with a mass culture system to isolate ESC-CMs that display traits characteristic of very immature CMs. The cells display properties of proliferation, CM-restricted markers, reduced mitochondrial mass, and hypoxia-resistance. Following transplantation into rodent hearts, bioluminescence imaging revealed that immature cells, but not more mature CMs, survived for at least one month following injection. These data and comparisons with more mature cells lead us to conclude that immature hypoxia resistant ESC-CMs can be isolated in mass in vitro and, following injection into heart, form grafts that may mediate long-term recovery of global and regional myocardial contractile function following infarction.

  5. Abortive replication of Bombyx mori nucleopolyhedrovirus in Sf9 and High Five cells: Defective nuclear transport of the virions

    International Nuclear Information System (INIS)

    Katou, Yasuhiro; Ikeda, Motoko; Kobayashi, Michihiro

    2006-01-01

    Despite close genetic relationship, Bombyx mori nucleopolyhedrovirus (BmNPV) and Autographa californica multicapsid NPV (AcMNPV) display a distinct host range property. Here, BmNPV replication was examined in Sf9 and High Five cells that were nonproductive for BmNPV infection but supported high titers of AcMNPV replication. Recombinant BmNPV, vBm/gfp/lac, containing bm-ie1 promoter-driven egfp showed that few Sf9 and High Five cells infected with vBm/gfp/lac expressed EGFP, while large proportion of EGFP-expressing cells was observed when transfected with vBm/gfp/lac DNA. Immunocytochemical analysis showed that BmNPV was not imported into the nucleus of these two cell lines, while recombinant BmNPV, vBmΔ64/ac-gp64 possessing AcMNPV gp64 was imported into the nucleus, yielding progeny virions in High Five cells, but not Sf9 cells. These results indicate that the defective nuclear import of infected virions due to insufficient BmNPV GP64 function is involved in the restricted BmNPV replication in Sf9 and High Five cells

  6. Generation of a tenascin-C-CreER2 knockin mouse line for conditional DNA recombination in renal medullary interstitial cells.

    Directory of Open Access Journals (Sweden)

    Wenjuan He

    Full Text Available Renal medullary interstitial cells (RMIC are specialized fibroblast-like cells that exert important functions in maintaining body fluid homeostasis and systemic blood pressure. Here, we generated a RMIC specific tenascin-C promoter driven inducible CreER2 knockin mouse line with an EGFP reporter. Similar as endogenous tenascin-C expression, the reporter EGFP expression in the tenascin-C-CreER2(+/- mice was observed in the inner medulla of the kidney, and co-localized with COX2 but not with AQP2 or AQP1, suggesting selective expression in RMICs. After recombination (tenascin-C-CreER2(+/-/ROSA26-lacZ(+/- mice + tamoxifen, β-gal activity was restricted to the cells in the inner medulla of the kidney, and didn't co-localize with AQP2, consistent with selective Cre recombinase activity in RMICs. Cre activity was not obvious in other major organs or without tamoxifen treatment. This inducible RMIC specific Cre mouse line should therefore provide a novel tool to manipulate genes of interest in RMICs.

  7. The transcription factor MEF2C mediates cardiomyocyte hypertrophy induced by IGF-1 signaling

    International Nuclear Information System (INIS)

    Munoz, Juan Pablo; Collao, Andres; Chiong, Mario; Maldonado, Carola; Adasme, Tatiana; Carrasco, Loreto; Ocaranza, Paula; Bravo, Roberto; Gonzalez, Leticia; Diaz-Araya, Guillermo; Hidalgo, Cecilia; Lavandero, Sergio

    2009-01-01

    Myocyte enhancer factor 2C (MEF2C) plays an important role in cardiovascular development and is a key transcription factor for cardiac hypertrophy. Here, we describe MEF2C regulation by insulin-like growth factor-1 (IGF-1) and its role in IGF-1-induced cardiac hypertrophy. We found that IGF-1 addition to cultured rat cardiomyocytes activated MEF2C, as evidenced by its increased nuclear localization and DNA binding activity. IGF-1 stimulated MEF2 dependent-gene transcription in a time-dependent manner, as indicated by increased MEF2 promoter-driven reporter gene activity; IGF-1 also induced p38-MAPK phosphorylation, while an inhibitor of p38-MAPK decreased both effects. Additionally, inhibitors of phosphatidylinositol 3-kinase and calcineurin prevented IGF-1-induced MEF2 transcriptional activity. Via MEF2C-dependent signaling, IGF-1 also stimulated transcription of atrial natriuretic factor and skeletal α-actin but not of fos-lux reporter genes. These novel data suggest that MEF2C activation by IGF-1 mediates the pro-hypertrophic effects of IGF-1 on cardiac gene expression.

  8. Characterization of axon formation in the embryonic stem cell-derived motoneuron.

    Science.gov (United States)

    Pan, Hung-Chuan; Wu, Ya-Ting; Shen, Shih-Cheng; Wang, Chi-Chung; Tsai, Ming-Shiun; Cheng, Fu-Chou; Lin, Shinn-Zong; Chen, Ching-Wen; Liu, Ching-San; Su, Hong-Lin

    2011-01-01

    The developing neural cell must form a highly organized architecture to properly receive and transmit nerve signals. Neural formation from embryonic stem (ES) cells provides a novel system for studying axonogenesis, which are orchestrated by polarity-regulating molecules. Here the ES-derived motoneurons, identified by HB9 promoter-driven green fluorescent protein (GFP) expression, showed characteristics of motoneuron-specific gene expression. In the majority of motoneurons, one of the bilateral neurites developed into an axon that featured with axonal markers, including Tau1, vesicle acetylcholine transporter, and synaptophysin. Interestingly, one third of the motoneurons developed bi-axonal processes but no multiple axonal GFP cell was found. The neuronal polarity-regulating proteins, including the phosphorylated AKT and ERK, were compartmentalized into both of the bilateral axonal tips. Importantly, this aberrant axon morphology was still present after the engraftment of GFP(+) neurons into the spinal cord, suggesting that even a mature neural environment fails to provide a proper niche to guide normal axon formation. These findings underscore the necessity for evaluating the morphogenesis and functionality of neurons before the clinical trials using ES or somatic stem cells.

  9. Lack of promoter IV-driven BDNF transcription results in depression-like behavior.

    Science.gov (United States)

    Sakata, K; Jin, L; Jha, S

    2010-10-01

    Transcription of Bdnf is controlled by multiple promoters, in which promoter IV contributes significantly to activity-dependent Bdnf transcription. We have generated promoter IV mutant mice [brain-derived neurotrophic factor (BDNF)-KIV] in which promoter IV-driven expression of BDNF is selectively disrupted by inserting a green fluorescent protein (GFP)-STOP cassette within the Bdnf exon IV locus. BDNF-KIV animals exhibited depression-like behavior as shown by the tail suspension test (TST), sucrose preference test (SPT) and learned helplessness test (LHT). In addition, BDNF-KIV mice showed reduced activity in the open field test (OFT) and reduced food intake in the novelty-suppressed feeding test (NSFT). The mutant mice did not display anxiety-like behavior in the light and dark box test and elevated plus maze tests. Interestingly, the mutant mice showed defective response inhibition in the passive avoidance test (PAT) even though their learning ability was intact when measured with the active avoidance test (AAT). These results suggest that promoter IV-dependent BDNF expression plays a critical role in the control of mood-related behaviors. This is the first study that directly addressed the effects of endogenous promoter-driven expression of BDNF in depression-like behavior. © 2010 The Authors. Genes, Brain and Behavior © 2010 Blackwell Publishing Ltd and International Behavioural and Neural Genetics Society.

  10. Branched-Chain Amino Acid Negatively Regulates KLF15 Expression via PI3K-AKT Pathway

    Directory of Open Access Journals (Sweden)

    Yunxia Liu

    2017-10-01

    Full Text Available Recent studies have linked branched-chain amino acid (BCAA with numerous metabolic diseases. However, the molecular basis of BCAA's roles in metabolic regulation remains to be established. KLF15 (Krüppel-like factor 15 is a transcription factor and master regulator of glycemic, lipid, and amino acids metabolism. In the present study, we found high concentrations of BCAA suppressed KLF15 expression while BCAA starvation induced KLF15 expression, suggesting KLF15 expression is negatively controlled by BCAA.Interestingly, BCAA starvation induced PI3K-AKT signaling. KLF15 induction by BCAA starvation was blocked by PI3K and AKT inhibitors, indicating the activation of PI3K-AKT signaling pathway mediated the KLF15 induction. BCAA regulated KLF15 expression at transcriptional level but not post-transcriptional level. However, BCAA starvation failed to increase the KLF15-promoter-driven luciferase expression, suggesting KLF15 promoter activity was not directly controlled by BCAA. Finally, fasting reduced BCAA abundance in mice and KLF15 expression was dramatically induced in muscle and white adipose tissue, but not in liver. Together, these data demonstrated BCAA negatively regulated KLF15 expression, suggesting a novel molecular mechanism underlying BCAA's multiple functions in metabolic regulation.

  11. Nigral dopaminergic neuron replenishment in adult mice through VE-cadherin-expressing neural progenitor cells

    Directory of Open Access Journals (Sweden)

    Abir A Rahman

    2017-01-01

    Full Text Available The function of dopaminergic neurons in the substantia nigra is of central importance to the coordination of movement by the brain's basal ganglia circuitry. This is evidenced by the loss of these neurons, resulting in the cardinal motor deficits associated with Parkinson's disease. In order to fully understand the physiology of these key neurons and develop potential therapies for their loss, it is essential to determine if and how dopaminergic neurons are replenished in the adult brain. Recent work has presented evidence for adult neurogenesis of these neurons by Nestin+/Sox2– neural progenitor cells. We sought to further validate this finding and explore a potential atypical origin for these progenitor cells. Since neural progenitor cells have a proximal association with the vasculature of the brain and subsets of endothelial cells are Nestin+, we hypothesized that dopaminergic neural progenitors might share a common cell lineage. Therefore, we employed a VE-cadherin promoter-driven CREERT2:THlox/THlox transgenic mouse line to ablate the tyrosine hydroxylase gene from endothelial cells in adult animals. After 26 weeks, but not 13 weeks, following the genetic blockade of tyrosine hydroxylase expression in VE-cadherin+ cells, we observed a significant reduction in tyrosine hydroxylase+ neurons in the substantia nigra. The results from this genetic lineage tracing study suggest that dopaminergic neurons are replenished in adult mice by a VE-cadherin+ progenitor cell population potentially arising from an endothelial lineage.

  12. YB-1 facilitates basal and 5-fluorouracil-inducible expression of the human major vault protein (MVP) gene.

    Science.gov (United States)

    Stein, Ulrike; Bergmann, Stephan; Scheffer, George L; Scheper, Rik J; Royer, Hans-Dieter; Schlag, Peter M; Walther, Wolfgang

    2005-05-19

    Vaults have been suggested to play a direct role in multidrug resistance (MDR) to anticancer drugs. The human major vault protein (MVP) also known as lung resistance-related protein (LRP) represents the predominant component of vaults that may be involved in the defense against xenobiotics. Here, we demonstrate that besides MDR-related cytostatics, also the non-MDR-related drug 5-fluorouracil (5-FU) was able to induce MVP mRNA and protein expression. Treatment with 5-FU amplified the binding activity and interaction of the transcription factor Y-box binding protein-1 (YB-1) with the Y-box of the human MVP gene promoter in a time-dependent manner. 5-FU also induced reporter expressions driven by a panel of newly generated MVP promoter deletion mutants. Interestingly, stably YB-1 overexpressing cell clones showed enhanced binding of YB-1 to the Y-box motif, associated with enhanced basal as well as 5-FU-inducible MVP promoter-driven reporter expressions. Moreover, transduction of YB-1 cDNA led to increased expression of endogenous MVP protein. Under physiological conditions, we observed a strong coexpression of MVP and YB-1 in human colon carcinoma specimen. In summary, our data demonstrate a direct involvement of YB-1 in controlling basal and 5-FU-induced MVP promoter activity. Therefore, YB-1 is directly linked to MVP-mediated drug resistance.

  13. Novel Detection Strategy To Rapidly Evaluate the Efficacy of Antichlamydial Agents.

    Science.gov (United States)

    Zhang, Yan; Xian, Yuqi; Gao, Leiqiong; Elaasar, Hiba; Wang, Yao; Tauhid, Lamiya; Hua, Ziyu; Shen, Li

    2017-02-01

    Chlamydia trachomatis infections present a major heath burden worldwide. The conventional method used to detect C. trachomatis is laborious. In the present study, a novel strategy was utilized to evaluate the impact of antimicrobial agents on the growth of C. trachomatis and its expression of ompA promoter-driven green fluorescence protein (GFP). We demonstrate that this GFP reporter system gives a robust fluorescent display of C. trachomatis growth in human cervical epithelial cells and, further, that GFP production directly correlates to changes in ompA expression following sufficient exposure to antimicrobials. Validation with azithromycin, the first-line macrolide drug used for the treatment of C. trachomatis infection, highlights the advantages of this method over the traditional method because of its simplicity and versatility. The results indicate both that ompA is highly responsive to antimicrobials targeting the transcription and translation of C. trachomatis and that there is a correlation between changing GFP levels and C. trachomatis growth. This proof-of-concept study also reveals that the ompA-GFP system can be easily adapted to rapidly assess antimicrobial effectiveness in a high-throughput format. Copyright © 2017 American Society for Microbiology.

  14. Suppression of cancer growth in mice by adeno-associated virus vector-mediated IFN-beta expression driven by hTERT promoter.

    Science.gov (United States)

    He, Ling Feng; Wang, Yi Gang; Xiao, Tian; Zhang, Kang Jiang; Li, Gong Chu; Gu, Jin Fa; Chu, Liang; Tang, Wen Hao; Tan, Wen-Song; Liu, Xin Yuan

    2009-12-28

    Adeno-associated virus (AAV) has rapidly become a promising gene delivery vehicle for its excellent advantages of non-immunogenic, low pathogenicity and long-term gene expression in vivo. However, a major obstacle in development of effective AAV vector is the lack of tissue specificity, which caused low efficiency of AAV transfer to target cells. The application of human telomerase reverse transcriptase (hTERT) promoter is a prior targeting strategy for AAV in cancer gene therapy as hTERT activity is transcriptionally upregulated in most cancer cells. In the present work, we investigated whether AAV-mediated human interferon beta (IFN-beta) gene driven by hTERT promoter could specifically express in tumor cells and suppress tumor cell growth. Our data demonstrated that hTERT promoter-driven IFN-beta expression was the tumor-specific, decreased the cell viability of tumor cells but not normal cells, and induced tumor cell apoptosis via activation of caspase pathway and release of cytochrome c. AAV-mediated IFN-beta expression driven by hTERT promoter significantly suppressed the growth of colorectal cancer and lung cancer xenograft in mice and resulted in tumor cells death in vivo. These data suggested that AAVs in combination with hTERT-mediated IFN-beta expression could exert potential antitumor activity and provide a novel targeting approach to clinical gene therapy of varieties of cancers.

  15. Anatomical characterization of cre driver mice for neural circuit mapping and manipulation

    Directory of Open Access Journals (Sweden)

    Julie Ann Harris

    2014-07-01

    Full Text Available Significant advances in circuit-level analyses of the brain require tools that allow for labeling, modulation of gene expression, and monitoring and manipulation of cellular activity in specific cell types and/or anatomical regions. Large-scale projects and individual laboratories have produced hundreds of gene-specific promoter-driven Cre mouse lines invaluable for enabling genetic access to subpopulations of cells in the brain. However, the potential utility of each line may not be fully realized without systematic whole brain characterization of transgene expression patterns. We established a high-throughput in situ hybridization, imaging and data processing pipeline to describe whole brain gene expression patterns in Cre driver mice. Currently, anatomical data from over 100 Cre driver lines are publicly available via the Allen Institute’s Transgenic Characterization database, which can be used to assist researchers in choosing the appropriate Cre drivers for functional, molecular, or connectional studies of different regions and/or cell types in the brain.

  16. Targeting Stromal Androgen Receptor Suppresses Prolactin-Driven Benign Prostatic Hyperplasia (BPH)

    Science.gov (United States)

    Lai, Kuo-Pao; Huang, Chiung-Kuei; Fang, Lei-Ya; Izumi, Kouji; Lo, Chi-Wen; Wood, Ronald; Kindblom, Jon; Yeh, Shuyuan

    2013-01-01

    Stromal-epithelial interaction plays a pivotal role to mediate the normal prostate growth, the pathogenesis of benign prostatic hyperplasia (BPH), and prostate cancer development. Until now, the stromal androgen receptor (AR) functions in the BPH development, and the underlying mechanisms remain largely unknown. Here we used a genetic knockout approach to ablate stromal fibromuscular (fibroblasts and smooth muscle cells) AR in a probasin promoter-driven prolactin transgenic mouse model (Pb-PRL tg mice) that could spontaneously develop prostate hyperplasia to partially mimic human BPH development. We found Pb-PRL tg mice lacking stromal fibromuscular AR developed smaller prostates, with more marked changes in the dorsolateral prostate lobes with less proliferation index. Mechanistically, prolactin mediated hyperplastic prostate growth involved epithelial-stromal interaction through epithelial prolactin/prolactin receptor signals to regulate granulocyte macrophage-colony stimulating factor expression to facilitate stromal cell growth via sustaining signal transducer and activator of transcription-3 activity. Importantly, the stromal fibromuscular AR could modulate such epithelial-stromal interacting signals. Targeting stromal fibromuscular AR with the AR degradation enhancer, ASC-J9®, led to the reduction of prostate size, which could be used in future therapy. PMID:23893956

  17. TET-mediated oxidation of methylcytosine causes TDG or NEIL glycosylase dependent gene reactivation.

    Science.gov (United States)

    Müller, Udo; Bauer, Christina; Siegl, Michael; Rottach, Andrea; Leonhardt, Heinrich

    2014-07-01

    The discovery of hydroxymethyl-, formyl- and carboxylcytosine, generated through oxidation of methylcytosine by TET dioxygenases, raised the question how these modifications contribute to epigenetic regulation. As they are subjected to complex regulation in vivo, we dissected links to gene expression with in vitro modified reporter constructs. We used an Oct4 promoter-driven reporter gene and demonstrated that in vitro methylation causes gene silencing while subsequent oxidation with purified catalytic domain of TET1 leads to gene reactivation. To identify proteins involved in this pathway we screened for TET interacting factors and identified TDG, PARP1, XRCC1 and LIG3 that are involved in base-excision repair. Knockout and rescue experiments demonstrated that gene reactivation depended on the glycosylase TDG, but not MBD4, while NEIL1, 2 and 3 could partially rescue the loss of TDG. These results clearly show that oxidation of methylcytosine by TET dioxygenases and subsequent removal by TDG or NEIL glycosylases and the BER pathway results in reactivation of epigenetically silenced genes. © The Author(s) 2014. Published by Oxford University Press on behalf of Nucleic Acids Research.

  18. Mechanoresponsive stem cells to target cancer metastases through biophysical cues.

    Science.gov (United States)

    Liu, Linan; Zhang, Shirley X; Liao, Wenbin; Farhoodi, Henry P; Wong, Chi W; Chen, Claire C; Ségaliny, Aude I; Chacko, Jenu V; Nguyen, Lily P; Lu, Mengrou; Polovin, George; Pone, Egest J; Downing, Timothy L; Lawson, Devon A; Digman, Michelle A; Zhao, Weian

    2017-07-26

    Despite decades of effort, little progress has been made to improve the treatment of cancer metastases. To leverage the central role of the mechanoenvironment in cancer metastasis, we present a mechanoresponsive cell system (MRCS) to selectively identify and treat cancer metastases by targeting the specific biophysical cues in the tumor niche in vivo. Our MRCS uses mechanosensitive promoter-driven mesenchymal stem cell (MSC)-based vectors, which selectively home to and target cancer metastases in response to specific mechanical cues to deliver therapeutics to effectively kill cancer cells, as demonstrated in a metastatic breast cancer mouse model. Our data suggest a strong correlation between collagen cross-linking and increased tissue stiffness at the metastatic sites, where our MRCS is specifically activated by the specific cancer-associated mechano-cues. MRCS has markedly reduced deleterious effects compared to MSCs constitutively expressing therapeutics. MRCS indicates that biophysical cues, specifically matrix stiffness, are appealing targets for cancer treatment due to their long persistence in the body (measured in years), making them refractory to the development of resistance to treatment. Our MRCS can serve as a platform for future diagnostics and therapies targeting aberrant tissue stiffness in conditions such as cancer and fibrotic diseases, and it should help to elucidate mechanobiology and reveal what cells "feel" in the microenvironment in vivo. Copyright © 2017 The Authors, some rights reserved; exclusive licensee American Association for the Advancement of Science. No claim to original U.S. Government Works.

  19. Identification of 1,2,3,4,6-Penta-O-galloyl-β-d-glucopyranoside as a Glycine N-Methyltransferase Enhancer by High-Throughput Screening of Natural Products Inhibits Hepatocellular Carcinoma

    Directory of Open Access Journals (Sweden)

    Rajni Kant

    2016-05-01

    Full Text Available Glycine N-methyltransferase (GNMT expression is vastly downregulated in hepatocellular carcinomas (HCC. High rates of GNMT knockout mice developed HCC, while overexpression of GNMT prevented aflatoxin-induced carcinogenicity and inhibited liver cancer cell proliferation. Therefore, in this study, we aimed for the identification of a GNMT inducer for HCC therapy. We established a GNMT promoter-driven luciferase reporter assay as a drug screening platform. Screening of 324 pure compounds and 480 crude extracts from Chinese medicinal herbs resulted in the identification of Paeonia lactiflora Pall (PL extract and the active component 1,2,3,4,6-penta-O-galloyl-β-d-glucopyranoside (PGG as a GNMT inducer. Purified PL extract and PGG induced GNMT mRNA and protein expression in Huh7 human hepatoma cells and in xenograft tumors. PGG and PL extract had potent anti-HCC effects both in vitro and in vivo. Furthermore, PGG treatment induced apoptosis in Huh7 cells. Moreover, PGG treatment sensitized Huh7 cells to sorafenib treatment. Therefore, these results indicated that identifying a GNMT enhancer using the GNMT promoter-based assay might be a useful approach to find drugs for HCC. These data also suggested that PGG has therapeutic potential for the treatment of HCC.

  20. Troponin T3 expression in skeletal and smooth muscle is required for growth and postnatal survival: characterization of Tnnt3(tm2a(KOMP)Wtsi) mice.

    Science.gov (United States)

    Ju, Yawen; Li, Jie; Xie, Chao; Ritchlin, Christopher T; Xing, Lianping; Hilton, Matthew J; Schwarz, Edward M

    2013-09-01

    The troponin complex, which consists of three regulatory proteins (troponin C, troponin I, and troponin T), is known to regulate muscle contraction in skeletal and cardiac muscle, but its role in smooth muscle remains controversial. Troponin T3 (TnnT3) is a fast skeletal muscle troponin believed to be expressed only in skeletal muscle cells. To determine the in vivo function and tissue-specific expression of Tnnt3, we obtained the heterozygous Tnnt3+/flox/lacZ mice from Knockout Mouse Project (KOMP) Repository. Tnnt3(lacZ/+) mice are smaller than their WT littermates throughout development but do not display any gross phenotypes. Tnnt3(lacZ/lacZ) embryos are smaller than heterozygotes and die shortly after birth. Histology revealed hemorrhagic tissue in Tnnt3(lacZ/lacZ) liver and kidney, which was not present in Tnnt3(lacZ/+) or WT, but no other gross tissue abnormalities. X-gal staining for Tnnt3 promoter-driven lacZ transgene expression revealed positive staining in skeletal muscle and diaphragm and smooth muscle cells located in the aorta, bladder, and bronchus. Collectively, these findings suggest that troponins are expressed in smooth muscle and are required for normal growth and breathing for postnatal survival. Moreover, future studies with this mouse model can explore TnnT3 function in adult muscle function using the conditional-inducible gene deletion approach Copyright © 2013 Wiley Periodicals, Inc.

  1. NFIX Regulates Neural Progenitor Cell Differentiation During Hippocampal Morphogenesis

    Science.gov (United States)

    Heng, Yee Hsieh Evelyn; McLeay, Robert C.; Harvey, Tracey J.; Smith, Aaron G.; Barry, Guy; Cato, Kathleen; Plachez, Céline; Little, Erica; Mason, Sharon; Dixon, Chantelle; Gronostajski, Richard M.; Bailey, Timothy L.; Richards, Linda J.; Piper, Michael

    2014-01-01

    Neural progenitor cells have the ability to give rise to neurons and glia in the embryonic, postnatal and adult brain. During development, the program regulating whether these cells divide and self-renew or exit the cell cycle and differentiate is tightly controlled, and imbalances to the normal trajectory of this process can lead to severe functional consequences. However, our understanding of the molecular regulation of these fundamental events remains limited. Moreover, processes underpinning development of the postnatal neurogenic niches within the cortex remain poorly defined. Here, we demonstrate that Nuclear factor one X (NFIX) is expressed by neural progenitor cells within the embryonic hippocampus, and that progenitor cell differentiation is delayed within Nfix−/− mice. Moreover, we reveal that the morphology of the dentate gyrus in postnatal Nfix−/− mice is abnormal, with fewer subgranular zone neural progenitor cells being generated in the absence of this transcription factor. Mechanistically, we demonstrate that the progenitor cell maintenance factor Sry-related HMG box 9 (SOX9) is upregulated in the hippocampus of Nfix−/− mice and demonstrate that NFIX can repress Sox9 promoter-driven transcription. Collectively, our findings demonstrate that NFIX plays a central role in hippocampal morphogenesis, regulating the formation of neuronal and glial populations within this structure. PMID:23042739

  2. Hypoxia regulates the expression of the neuromedin B receptor through a mechanism dependent on hypoxia-inducible factor-1α.

    Directory of Open Access Journals (Sweden)

    Hyun-Joo Park

    Full Text Available The neuromedin B receptor (NMB-R, a member of the mammalian bombesin receptor family, is frequently overexpressed in various tumors. In the present study, we found that exposure to hypoxic conditions increases the levels of NMBR mRNA and protein in breast cancer cells, which are tightly regulated by hypoxia-inducible factor-1α (HIF-1α. We confirmed the effect of HIF-1α on NMBR transcription by performing an NMBR promoter-driven reporter assay and then identified a functional hypoxia-responsive element (HRE in the human NMBR promoter region. Further, the binding of HIF-1α to the NMBR promoter was corroborated by electrophoretic mobility shift and chromatin immunoprecipitation assays, which showed that HIF-1α specifically and directly bound to the NMBR promoter in response to hypoxia. Immunohistochemical analysis of a xenograft and a human breast cancer tissue array revealed a significant correlation between NMB-R and HIF-1α expression. Taken together, our findings indicate that hypoxia induces NMB-R expression through a novel mechanism to regulate HIF-1α expression in breast cancer cells.

  3. An SGS3-like protein functions in RNA-directed DNA methylation and transcriptional gene silencing in Arabidopsis

    KAUST Repository

    Zheng, Zhimin

    2010-01-06

    RNA-directed DNA methylation (RdDM) is an important epigenetic mechanism for silencing transgenes and endogenous repetitive sequences such as transposons. The RD29A promoter-driven LUCIFERASE transgene and its corresponding endogenous RD29A gene are hypermethylated and silenced in the Arabidopsis DNA demethylase mutant ros1. By screening for second-site suppressors of ros1, we identified the RDM12 locus. The rdm12 mutation releases the silencing of the RD29A-LUC transgene and the endogenous RD29A gene by reducing the promoter DNA methylation. The rdm12 mutation also reduces DNA methylation at endogenous RdDM target loci, including transposons and other repetitive sequences. In addition, the rdm12 mutation affects the levels of small interfering RNAs (siRNAs) from some of the RdDM target loci. RDM12 encodes a protein with XS and coiled-coil domains, and is similar to SGS3, which is a partner protein of RDR6 and can bind to double-stranded RNAs with a 5′ overhang, and is required for several post-transcriptional gene silencing pathways. Our results show that RDM12 is a component of the RdDM pathway, and suggest that RdDM may involve double-stranded RNAs with a 5′ overhang and the partnering between RDM12 and RDR2. © 2010 Blackwell Publishing Ltd.

  4. Visualization of the role of host heme on the virulence of the heme auxotroph Streptococcus agalactiae.

    Science.gov (United States)

    Joubert, Laetitia; Dagieu, Jean-Baptiste; Fernandez, Annabelle; Derré-Bobillot, Aurélie; Borezée-Durant, Elise; Fleurot, Isabelle; Gruss, Alexandra; Lechardeur, Delphine

    2017-01-16

    Heme is essential for several cellular key functions but is also toxic. Whereas most bacterial pathogens utilize heme as a metabolic cofactor and iron source, the impact of host heme during bacterial infection remains elusive. The opportunist pathogen Streptococcus agalactiae does not synthesize heme but still uses it to activate a respiration metabolism. Concomitantly, heme toxicity is mainly controlled by the HrtBA efflux transporter. Here we investigate how S. agalactiae manages heme toxicity versus benefits in the living host. Using bioluminescent bacteria and heme-responsive reporters for in vivo imaging, we show that the capacity of S. agalactiae to overcome heme toxicity is required for successful infection, particularly in blood-rich organs. Host heme is simultaneously required, as visualized by a generalized infection defect of a respiration-negative mutant. In S. agalactiae, HrtBA expression responds to an intracellular heme signal via activation of the two-component system HssRS. A hssRS promoter-driven intracellular luminescent heme sensor was designed to identify host compartments that supply S. agalactiae with heme. S. agalactiae acquires heme in heart, kidneys, and liver, but not in the brain. We conclude that S. agalactiae response to heme is organ-dependent, and its efflux may be particularly relevant in late stages of infection.

  5. The Arabidopsis GASA10 gene encodes a cell wall protein strongly expressed in developing anthers and seeds.

    Science.gov (United States)

    Trapalis, Menelaos; Li, Song Feng; Parish, Roger W

    2017-07-01

    The Arabidopsis GASA10 gene encodes a GAST1-like (Gibberellic Acid-Stimulated) protein. Reporter gene analysis identified consistent expression in anthers and seeds. In anthers expression was developmentally regulated, first appearing at stage 7