Lifescience Database Archive (English)
Full Text Available GTAACAAAAATTAGTAATTTAAAA AAAAAAAAACCAAAAAAAAAAXXXXXXXXXXTGTCGAATGTCCAGATTTCCATANA...AAAAA---------- Length of 5' end seq. 141 3' end seq. ID AFO146Z 3' end seq. >AFO146Z.Seq ----------TGTCGAATGTCCAGATTTCCATANA...AAAAAAGTTAAAATTAAATTTGTAAAATCAATTTGTAACAAAAATTAGTAATTTAAAA AAAAAAAAACCAAAAAAAAAA----------TGTCGAATGTCCAGATTTCCATANA
Energy Technology Data Exchange (ETDEWEB)
Sun, Haiyan; Kamkaew, Anyanee; Jiang, Dawei; Yang, Yunan [University of Wisconsin-Madison, Department of Radiology, Madison, WI (United States); England, Christopher G.; Hernandez, Reinier; Graves, Stephen A.; Barnhart, Todd E. [University of Wisconsin-Madison, Department of Medical Physics, Madison, WI (United States); Majewski, Rebecca L. [University of Wisconsin-Madison, Department of Biomedical Engineering, Madison, WI (United States); Cai, Weibo [University of Wisconsin-Madison, Department of Radiology, Madison, WI (United States); University of Wisconsin-Madison, Department of Medical Physics, Madison, WI (United States); University of Wisconsin-Madison, Department of Biomedical Engineering, Madison, WI (United States); University of Wisconsin Carbone Cancer Center, Madison, WI (United States)
2016-11-15
Overexpression of CD146 in solid tumors has been linked to disease progression, invasion, and metastasis. We describe the generation of a {sup 64}Cu-labeled CD146-specific antibody and its use for quantitative immunoPET imaging of CD146 expression in six lung cancer models. The anti-CD146 antibody (YY146) was conjugated to 1,4,7-triazacyclononane-triacetic acid (NOTA) and radiolabeled with {sup 64}Cu. CD146 expression was evaluated in six human lung cancer cell lines (A549, NCI-H358, NCI-H522, HCC4006, H23, and NCI-H460) by flow cytometry and quantitative western blot studies. The biodistribution and tumor uptake of {sup 64}Cu-NOTA-YY146 was assessed by sequential PET imaging in athymic nude mice bearing subcutaneous lung cancer xenografts. The correlation between CD146 expression and tumor uptake of {sup 64}Cu-NOTA-YY146 was evaluated by graphical software while ex vivo biodistribution and immunohistochemistry studies were performed to validate the accuracy of PET data and spatial expression of CD146. Flow cytometry and western blot studies showed similar findings with H460 and H23 cells showing high levels of expression of CD146. Small differences in CD146 expression levels were found among A549, H4006, H522, and H358 cells. Tumor uptake of {sup 64}Cu-NOTA-YY146 was highest in CD146-expressing H460 and H23 tumors, peaking at 20.1 ± 2.86 and 11.6 ± 2.34 %ID/g at 48 h after injection (n = 4). Tumor uptake was lowest in the H522 model (4.1 ± 0.98 %ID/g at 48 h after injection; n = 4), while H4006, A549 and H358 exhibited similar uptake of {sup 64}Cu-NOTA-YY146. A positive correlation was found between tumor uptake of {sup 64}Cu-NOTA-YY146 (%ID/g) and relative CD146 expression (r {sup 2} = 0.98, p < 0.01). Ex vivo biodistribution confirmed the accuracy of the PET data. The strong correlation between tumor uptake of {sup 64}Cu-NOTA-YY146 and CD146 expression demonstrates the potential use of this radiotracer for imaging tumors that elicit varying levels of CD146
21 CFR 146.146 - Frozen concentrated orange juice.
2010-04-01
... 21 Food and Drugs 2 2010-04-01 2010-04-01 false Frozen concentrated orange juice. 146.146 Section... Fruit Juices and Beverages § 146.146 Frozen concentrated orange juice. (a) Frozen concentrated orange juice is the food prepared by removing water from the juice of mature oranges as provided in § 146.135...
A proposed HTTP service based IDS
Directory of Open Access Journals (Sweden)
Mohamed M. Abd-Eldayem
2014-03-01
Full Text Available The tremendous growth of the web-based applications has increased information security vulnerabilities over the Internet. Security administrators use Intrusion-Detection System (IDS to monitor network traffic and host activities to detect attacks against hosts and network resources. In this paper IDS based on Naïve Bayes classifier is analyzed. The main objective is to enhance IDS performance through preparing the training data set allowing to detect malicious connections that exploit the http service. Results of application are demonstrated and discussed. In the training phase of the proposed IDS, at first a feature selection technique based on Naïve Bayes classifier is used, this technique identifies the most important HTTP traffic features that can be used to detect HTTP attacks. In the testing and running phases proposed IDS classifies the network traffic based on the requested service, then based on the selected features Naïve Bayes classifier is used to analyze the HTTP service based traffic and identifies the HTTP normal connections and attacks. The performance of the IDS is measured through experiments using NSL-KDD data set. The results show that the detection rate of the IDS is about 99%, the false-positive rate is about 1%, and the false-negative rate is about 0.25%; therefore, proposed IDS holds the highest detection rate and the lowest false alarm compared with other leading IDS. In addition, the proposed IDS based on Naïve Bayes is used to classify network connections as a normal or attack. And it holds a high detection rate and a low false alarm.
International Nuclear Information System (INIS)
Sharma, Pankaj; Patel, Divya; Chaudhary, Jaideep
2012-01-01
As transcriptional regulators of basic helix–oop–helix (bHLH) transcription and non-bHLH factors, the inhibitor of differentiation (Id1, Id2, Id3, and Id4) proteins play a critical role in coordinated regulation of cell growth, differentiation, tumorigenesis, and angiogenesis. Id1 regulates prostate cancer (PCa) cell proliferation, apoptosis, and androgen independence, but its clinical significance in PCa remains controversial. Moreover, there is lack of evidence on the expression of Id2 and Id3 in PCa progression. In this study we investigated the expression of Id2 and Id3 and reevaluated the expression of Id1 in PCa. We show that increased Id1 and Id3 protein expression is strongly associated with increasing grade of PCa. At the molecular level, we report that silencing either Id1 or Id3 attenuates cell cycle. Although structurally and mechanistically similar, our results show that both these proteins are noncompensatory at least in PCa progression. Moreover, through gene silencing approaches we show that Id1 and Id3 primarily attenuates CDKN1A (p21) and CDKN1B (p27), respectively. We also demonstrate that silencing Id3 alone significantly attenuates proliferation of PCa cells as compared with Id1. We propose that increased Id1 and Id3 expression attenuates all three cyclin-dependent kinase inhibitors (CDKN2B, -1A, and -1B) resulting in a more aggressive PCa phenotype
2010-04-01
... 22 Foreign Relations 1 2010-04-01 2010-04-01 false Recruitment. 146.310 Section 146.310 Foreign... Recruitment Prohibited § 146.310 Recruitment. (a) Nondiscriminatory recruitment. A recipient to which §§ 146.300 through 146.310 apply shall not discriminate on the basis of sex in the recruitment and admission...
Now called RSA SecurID, SecurID is a mechanism developed by Security Dynamics that allows two-factor authentication for a user on a network resource. It works on the principle of the unique password mode, based on a shared secret. Every sixty seconds, the component generates a new six-digit token on the screen. The latter comes from the current time (internal clock) and the seed (SecurID private key that is available on the component, and is also from the SecurID server). During an authentication request, the SecurID server will check the entered token by performing exactly the same calculation as that performed by your component. The server knows the two information required for this calculation: the current time and the seed of your component. Access is allowed if the token calculated by the server matches the token you specified.
Babakhanyan, Anna; Leke, Rose G. F.; Salanti, Ali; Bobbili, Naveen; Gwanmesia, Philomina; Leke, Robert J. I.; Quakyi, Isabella A.; Chen, John J.; Taylor, Diane Wallace
2014-01-01
In pregnant women, Plasmodium falciparum-infected erythrocytes expressing the VAR2CSA antigen bind to chondroitin sulfate A in the placenta causing placental malaria. The binding site of VAR2CSA is present in the ID1-ID2a region. This study sought to determine if pregnant Cameroonian women naturally acquire antibodies to ID1-ID2a and if antibodies to ID1-ID2a correlate with absence of placental malaria at delivery. Antibody levels to full-length VAR2CSA and ID1-ID2a were measured in plasma samples from 745 pregnant Cameroonian women, 144 Cameroonian men, and 66 US subjects. IgM levels and IgG avidity to ID1-ID2a were also determined. As expected, antibodies to ID1-ID2a were absent in US controls. Although pregnant Cameroonian women developed increasing levels of antibodies to full-length VAR2CSA during pregnancy, no increase in either IgM or IgG to ID1-ID2a was observed. Surprisingly, no differences in antibody levels to ID1-ID2a were detected between Cameroonian men and pregnant women. For example, in rural settings only 8–9% of males had antibodies to full-length VAR2CSA, but 90–96% had antibodies to ID1-ID2a. In addition, no significant difference in the avidity of IgG to ID1-ID2a was found between pregnant women and Cameroonian men, and no correlation between antibody levels at delivery and absence of placental malaria was found. Thus, the response to ID1-ID2a was not pregnancy specific, but predominantly against cross-reactivity epitopes, which may have been induced by other PfEMP1 antigens, malarial antigens, or microbes. Currently, ID1-ID2a is a leading vaccine candidate, since it binds to the CSA with the same affinity as the full-length molecule and elicits binding-inhibitory antibodies in animals. Further studies are needed to determine if the presence of naturally acquired cross-reactive antibodies in women living in malaria endemic countries will alter the response to ID1-ID2a following vaccination with ID1-ID2a. PMID:24505415
Directory of Open Access Journals (Sweden)
Anna Babakhanyan
Full Text Available In pregnant women, Plasmodium falciparum-infected erythrocytes expressing the VAR2CSA antigen bind to chondroitin sulfate A in the placenta causing placental malaria. The binding site of VAR2CSA is present in the ID1-ID2a region. This study sought to determine if pregnant Cameroonian women naturally acquire antibodies to ID1-ID2a and if antibodies to ID1-ID2a correlate with absence of placental malaria at delivery. Antibody levels to full-length VAR2CSA and ID1-ID2a were measured in plasma samples from 745 pregnant Cameroonian women, 144 Cameroonian men, and 66 US subjects. IgM levels and IgG avidity to ID1-ID2a were also determined. As expected, antibodies to ID1-ID2a were absent in US controls. Although pregnant Cameroonian women developed increasing levels of antibodies to full-length VAR2CSA during pregnancy, no increase in either IgM or IgG to ID1-ID2a was observed. Surprisingly, no differences in antibody levels to ID1-ID2a were detected between Cameroonian men and pregnant women. For example, in rural settings only 8-9% of males had antibodies to full-length VAR2CSA, but 90-96% had antibodies to ID1-ID2a. In addition, no significant difference in the avidity of IgG to ID1-ID2a was found between pregnant women and Cameroonian men, and no correlation between antibody levels at delivery and absence of placental malaria was found. Thus, the response to ID1-ID2a was not pregnancy specific, but predominantly against cross-reactivity epitopes, which may have been induced by other PfEMP1 antigens, malarial antigens, or microbes. Currently, ID1-ID2a is a leading vaccine candidate, since it binds to the CSA with the same affinity as the full-length molecule and elicits binding-inhibitory antibodies in animals. Further studies are needed to determine if the presence of naturally acquired cross-reactive antibodies in women living in malaria endemic countries will alter the response to ID1-ID2a following vaccination with ID1-ID2a.
2010-01-01
... 7 Agriculture 14 2010-01-01 2009-01-01 true Advertising. 1955.146 Section 1955.146 Agriculture... REGULATIONS (CONTINUED) PROPERTY MANAGEMENT Disposal of Inventory Property General § 1955.146 Advertising. (a... real estate brokers, it is the servicing official's responsibility to ensure adequate advertising of...
2010-04-01
... 22 Foreign Relations 1 2010-04-01 2010-04-01 false Recruitment. 146.510 Section 146.510 Foreign... Education Programs or Activities Prohibited § 146.510 Recruitment. (a) Nondiscriminatory recruitment and hiring. A recipient shall not discriminate on the basis of sex in the recruitment and hiring of employees...
2010-04-01
... 24 Housing and Urban Development 1 2010-04-01 2010-04-01 false Mediation. 146.35 Section 146.35... ASSISTANCE Investigation, Settlement, and Enforcement Procedures § 146.35 Mediation. (a) HUD shall refer to the Federal Mediation and Conciliation Service, a mediation agency designated by the Secretary of...
2010-04-01
... 22 Foreign Relations 1 2010-04-01 2010-04-01 false Housing. 146.405 Section 146.405 Foreign... Activities Prohibited § 146.405 Housing. (a) Generally. A recipient shall not, on the basis of sex, apply... benefits related to housing, except as provided in this section (including housing provided only to married...
2010-04-01
... 22 Foreign Relations 1 2010-04-01 2010-04-01 false Employment. 146.500 Section 146.500 Foreign... ACTIVITIES RECEIVING FEDERAL FINANCIAL ASSISTANCE Discrimination on the Basis of Sex in Employment in Education Programs or Activities Prohibited § 146.500 Employment. (a) General. (1) No person shall, on the...
2010-10-01
... MARITIME SERVICES Operating Requirements and Procedures Shipboard General Purpose Watches § 80.146 [Reserved] ... 47 Telecommunication 5 2010-10-01 2010-10-01 false [Reserved] 80.146 Section 80.146...
2010-04-01
... 22 Foreign Relations 1 2010-04-01 2010-04-01 false Advertising. 146.540 Section 146.540 Foreign Relations DEPARTMENT OF STATE CIVIL RIGHTS NONDISCRIMINATION ON THE BASIS OF SEX IN EDUCATION PROGRAMS OR... Education Programs or Activities Prohibited § 146.540 Advertising. A recipient shall not in any advertising...
2010-07-01
... 33 Navigation and Navigable Waters 3 2010-07-01 2010-07-01 false Price. 211.146 Section 211.146 Navigation and Navigable Waters CORPS OF ENGINEERS, DEPARTMENT OF THE ARMY, DEPARTMENT OF DEFENSE REAL ESTATE... Industrial Facilities § 211.146 Price. No conveyance shall be made for a price less than the fair market...
Expression patterns of miR-146a and miR-146b in mastitis infected dairy cattle.
Wang, Xing Ping; Luoreng, Zhuo Ma; Zan, Lin Sen; Raza, Sayed Haidar Abbas; Li, Feng; Li, Na; Liu, Shuan
2016-10-01
This study reports a significant up-regulation of bta-miR-146a and bta-miR-146b expression levels in bovine mammary tissues infected with subclinical, clinical and experimental mastitis. Potential target genes are involved in multiple immunological pathways. These results suggest a regulatory function of both miRNAs for the bovine inflammatory response in mammary tissue. Copyright © 2016 Elsevier Ltd. All rights reserved.
21 CFR 146.141 - Canned orange juice.
2010-04-01
... 21 Food and Drugs 2 2010-04-01 2010-04-01 false Canned orange juice. 146.141 Section 146.141 Food... Beverages § 146.141 Canned orange juice. (a) Canned orange juice is the food prepared from orange juice as specified in § 146.135 or frozen orange juice as specified in § 146.137, or a combination of both, to which...
Id-1 and Id-2 genes and products as markers of epithelial cancer
Desprez, Pierre-Yves [El Cerrito, CA; Campisi, Judith [Berkeley, CA
2008-09-30
A method for detection and prognosis of breast cancer and other types of cancer. The method comprises detecting expression, if any, for both an Id-1 and an Id-2 genes, or the ratio thereof, of gene products in samples of breast tissue obtained from a patient. When expressed, Id-1 gene is a prognostic indicator that breast cancer cells are invasive and metastatic, whereas Id-2 gene is a prognostic indicator that breast cancer cells are localized and noninvasive in the breast tissue.
22 CFR 146.525 - Fringe benefits.
2010-04-01
... 22 Foreign Relations 1 2010-04-01 2010-04-01 false Fringe benefits. 146.525 Section 146.525... Employment in Education Programs or Activities Prohibited § 146.525 Fringe benefits. (a) “Fringe benefits” defined. For purposes of these Title IX regulations, fringe benefits means: Any medical, hospital...
Energy Technology Data Exchange (ETDEWEB)
Kinoshita, N. [Tandem Accelerator Complex, Research Facility Center for Science and Technology, University of Tsukuba (Japan); Paul, M., E-mail: paul@vms.huji.ac.il [Racah Institute of Physics, Hebrew University, Jerusalem 91904 (Israel); Alcorta, M. [Physics Division, Argonne National Laboratory, Argonne, IL 60439 (United States); Bowers, M.; Collon, P. [Department of Physics, University of Notre Dame, Notre Dame, IN 46556-5670 (United States); Deibel, C.M. [Physics Division, Argonne National Laboratory, Argonne, IL 60439 (United States); Joint Institute for Nuclear Astrophysics, Michigan State University, East Lansing, MI 46624 (United States); DiGiovine, B. [Physics Division, Argonne National Laboratory, Argonne, IL 60439 (United States); Goriely, S. [Universite Libre de Bruxelles, CP-226, Brussels 1050 (Belgium); Greene, J.P.; Henderson, D.J.; Jiang, C.L. [Physics Division, Argonne National Laboratory, Argonne, IL 60439 (United States); Kashiv, Y. [Department of Physics, University of Notre Dame, Notre Dame, IN 46556-5670 (United States); Kay, B.P.; Lee, H.Y.; Marley, S.T. [Physics Division, Argonne National Laboratory, Argonne, IL 60439 (United States); Nakanishi, T. [Faculty of Chemistry, Institute of Science and Engineering, Kanazawa University (Japan); Pardo, R.C.; Patel, N.; Rehm, K.E. [Physics Division, Argonne National Laboratory, Argonne, IL 60439 (United States); Robertson, D. [Department of Physics, University of Notre Dame, Notre Dame, IN 46556-5670 (United States); and others
2013-01-15
The extinct p-process nuclide {sup 146}Sm (t{sub 1/2} = 103 {+-} 5 Myr) is known to have been present in the Early-Solar System and has been proposed as an astrophysical chronometer. {sup 146}Sm is also intensely used to date meteorite and planetary differentiation processes, enhancing the importance of an accurate knowledge of the {sup 146}Sm half-life. We are engaged in a new determination of the {sup 146}Sm half-life in which the {sup 146}Sm/{sup 147}Sm atom ratio is determined by accelerator mass spectrometry at the ATLAS facility of Argonne National Laboratory. In order to reduce systematic errors in the AMS determination of the {sup 146}Sm/{sup 147}Sm ratios (in the range of 10{sup -7}-10{sup -9}), {sup 146}Sm and {sup 147}Sm ions were alternately counted in the same detector in the focal plane of a gas-filled magnet, respectively in continuous-wave and attenuated mode. Quantitative attenuation is obtained with the 12 MHz pulsed and ns-bunched ATLAS beam by chopping beam pulses with an RF sweeper in a ratio (digitally determined) down to 1:10{sup 6}. The experiments and preliminary results are discussed.
Directory of Open Access Journals (Sweden)
Ting-Yu Chang
Full Text Available Functional impairment of endothelial colony-forming cells (ECFCs, a specific cell lineage of endothelial progenitor cells (EPCs is highly associated with the severity of coronary artery disease (CAD, the most common type of cardiovascular disease (CVD. Emerging evidence show that circulating microRNAs (miRNAs in CAD patients' body fluid hold a great potential as biomarkers. However, our knowledge of the role of circulating miRNA in regulating the function of ECFCs and the progression of CAD is still in its infancy. We showed that when ECFCs from healthy volunteers were incubated with conditioned medium or purified exosomes of cultured CAD ECFCs, the secretory factors from CAD ECFCs dysregulated migration and tube formation ability of healthy ECFCs. It is known that exosomes influence the physiology of recipient cells by introducing RNAs including miRNAs. By using small RNA sequencing (smRNA-seq, we deciphered the circulating miRNome in the plasma of healthy individual and CAD patients, and found that the plasma miRNA spectrum from CAD patients was significantly different from that of healthy control. Interestingly, smRNA-seq of both healthy and CAD ECFCs showed that twelve miRNAs that had a higher expression in the plasma of CAD patients also showed higher expression in CAD ECFCs when compared with healthy control. This result suggests that these miRNAs may be involved in the regulation of ECFC functions. For identification of potential mRNA targets of the differentially expressed miRNA in CAD patients, cDNA microarray analysis was performed to identify the angiogenesis-related genes that were down-regulated in CAD ECFCs and Pearson's correlation were used to identify miRNAs that were negatively correlated with the identified angiogenesis-related genes. RT-qPCR analysis of the five miRNAs that negatively correlated with the down-regulated angiogenesis-related genes in plasma and ECFC of CAD patients showed miR-146a-5p and miR-146b-5p up
21 CFR 146.140 - Pasteurized orange juice.
2010-04-01
... 21 Food and Drugs 2 2010-04-01 2010-04-01 false Pasteurized orange juice. 146.140 Section 146.140... and Beverages § 146.140 Pasteurized orange juice. (a) Pasteurized orange juice is the food prepared from unfermented juice obtained from mature oranges as specified in § 146.135, to which may be added...
Pengalaman Komunikasi Pelanggan Zalora.co.id (Studi Fenomenologi Pelanggan Zalora.co.id)
Aji, Widya Andhika; Pradekso, Tandiyo; Ulfa, Nurist Surayya
2013-01-01
1PENGALAMAN KOMUNIKASI PELANGGAN ZALORA.CO.ID(Studi Fenomenologi Pelanggan Zalora.co.id)Oleh:Widya Andhika AjiFakultas Ilmu Sosial dan Ilmu PolitikUniversitas Diponegoro SemarangABSTRAKPenelitian ini bertujuan untuk menganalisis pengalaman komunikasi danpemahaman penerimaan konsumen terkait pesan komunikasi pemasaran dalamberbelanja di Zalora.co.id. Dengan menggunakan sampel pada lima informandan metode wawancara, dapat ditarik kesimpulan: Pelanggan Zalora.co.idmemiliki pengalaman komunikasi ...
19 CFR 146.3 - Customs supervision.
2010-04-01
... 19 Customs Duties 2 2010-04-01 2010-04-01 false Customs supervision. 146.3 Section 146.3 Customs Duties U.S. CUSTOMS AND BORDER PROTECTION, DEPARTMENT OF HOMELAND SECURITY; DEPARTMENT OF THE TREASURY (CONTINUED) FOREIGN TRADE ZONES General Provisions § 146.3 Customs supervision. (a) Assignment of Customs officers. Customs officers will be...
21 CFR 146.145 - Orange juice from concentrate.
2010-04-01
... 21 Food and Drugs 2 2010-04-01 2010-04-01 false Orange juice from concentrate. 146.145 Section 146... Juices and Beverages § 146.145 Orange juice from concentrate. (a) Orange juice from concentrate is the food prepared by mixing water with frozen concentrated orange juice as defined in § 146.146 or with...
21 CFR 146.137 - Frozen orange juice.
2010-04-01
... 21 Food and Drugs 2 2010-04-01 2010-04-01 false Frozen orange juice. 146.137 Section 146.137 Food... Beverages § 146.137 Frozen orange juice. (a) Frozen orange juice is orange juice as defined in § 146.135, except that it is frozen. (b) The name of the food is “Frozen orange juice”. Such name may be preceded on...
19 CFR 146.26 - System review.
2010-04-01
... 19 Customs Duties 2 2010-04-01 2010-04-01 false System review. 146.26 Section 146.26 Customs... (CONTINUED) FOREIGN TRADE ZONES Inventory Control and Recordkeeping System § 146.26 System review. The operator shall perform an annual internal review of the inventory control and recordkeeping system and...
42 CFR 410.146 - Diabetes outcome measurements.
2010-10-01
... 42 Public Health 2 2010-10-01 2010-10-01 false Diabetes outcome measurements. 410.146 Section 410.146 Public Health CENTERS FOR MEDICARE & MEDICAID SERVICES, DEPARTMENT OF HEALTH AND HUMAN SERVICES... Training and Diabetes Outcome Measurements § 410.146 Diabetes outcome measurements. (a) Information...
19 CFR 146.63 - Entry for consumption.
2010-04-01
... 19 Customs Duties 2 2010-04-01 2010-04-01 false Entry for consumption. 146.63 Section 146.63... TREASURY (CONTINUED) FOREIGN TRADE ZONES Transfer of Merchandise From a Zone § 146.63 Entry for consumption... status may be entered for consumption from a zone. (b) Zone-restricted merchandise. Merchandise in a zone...
2010-04-01
... 27 Alcohol, Tobacco Products and Firearms 1 2010-04-01 2010-04-01 false Bonds. 24.146 Section 24.146 Alcohol, Tobacco Products and Firearms ALCOHOL AND TOBACCO TAX AND TRADE BUREAU, DEPARTMENT OF THE.... (c) Wine vinegar plant bond. The proprietor of a wine vinegar plant who withdraws wine from a bonded...
21 CFR 146.150 - Canned concentrated orange juice.
2010-04-01
... 21 Food and Drugs 2 2010-04-01 2010-04-01 false Canned concentrated orange juice. 146.150 Section... Fruit Juices and Beverages § 146.150 Canned concentrated orange juice. (a) Canned concentrated orange... labeling of ingredients prescribed for frozen concentrated orange juice by § 146.146, except that it is not...
Beam transport radiation shielding for branch lines 2-ID-B and 2-ID-C
International Nuclear Information System (INIS)
Feng, Y.P.; Lai, B.; McNulty, I.; Dejus, R.J.; Randall, K.J.; Yun, W.
1995-01-01
The x-ray radiation shielding requirements beyond the first optics enclosure have been considered for the beam transport of the 2-ID-B and 2-ID-C branch lines of Sector 2 (SRI-CAT) of the APS. The first three optical components (mirrors) of the 2-ID-B branch are contained within the shielded first optics enclosure. Calculations indicate that scattering of the primary synchrotron beam by beamline components outside the enclosure, such as apertures and monochromators, or by gas particles in case of vacuum failure is within safe limits for this branch. A standard 2.5-inch-diameter stainless steel pipe with 1/16-inch-thick walls provides adequate shielding to reduce the radiation dose equivalent rate to human tissue to below the maximum permissible limit of 0.25 mrem/hr. The 2-ID-C branch requires, between the first optics enclosure where only two mirrors are used and the housing for the third mirror, additional lead shielding (0.75 mm) and a minimum approach distance of 2.6 cm. A direct beam stop consisting of at least 4.5 mm of lead is also required immediately downstream of the third mirror for 2-ID-C. Finally, to stop the direct beam from escaping the experimental station, a beam stop consisting of at least 4-mm or 2.5-mm steel is required for the 2-ID-B or 2-ID-C branches, respectively. This final requirement can be met by the vacuum chambers used to house the experiments for both branch lines
19 CFR 146.23 - Accountability for merchandise in a zone.
2010-04-01
... 19 Customs Duties 2 2010-04-01 2010-04-01 false Accountability for merchandise in a zone. 146.23 Section 146.23 Customs Duties U.S. CUSTOMS AND BORDER PROTECTION, DEPARTMENT OF HOMELAND SECURITY....23 Accountability for merchandise in a zone. (a) Identification of merchandise—(1) General. A zone...
Synergistic Effect of MiR-146a Mimic and Cetuximab on Hepatocellular Carcinoma Cells
Directory of Open Access Journals (Sweden)
Suning Huang
2014-01-01
Full Text Available Previously, we found that the expression of microRNA-146a (miR-146a was downregulated in hepatocellular carcinoma (HCC formalin-fixed paraffin-embedded (FFPE tissues compared to the adjacent noncancerous hepatic tissues. In the current study, we have explored the in vitro effect of miR-146a on the malignant phenotypes of HCC cells. MiR-146a mimic could suppress cell growth and increase cellular apoptosis in HCC cell lines HepG2, HepB3, and SNU449, as assessed by spectrophotometry, fluorimetry, and fluorescence microscopy, respectively. Furthermore, western blot showed that miR-146a mimic downregulated EGFR, ERK1/2, and stat5 signalings. These effects were less potent compared to that of a siRNA targeting EGFR, a known target gene of miR-146a. Moreover, miR-146a mimic could enhance the cell growth inhibition and apoptosis induction impact of various EGFR targeting agents. The most potent combination was miR-146a mimic with cetuximab, presenting a synergistic effect. In conclusion, miR-146a plays a vital role in the cell growth and apoptosis of HCC cells and inducing miR-146a level might be a critical targeted molecular therapy strategy for HCC.
Synergistic effect of MiR-146a mimic and cetuximab on hepatocellular carcinoma cells.
Huang, Suning; He, Rongquan; Rong, Minhua; Dang, Yiwu; Chen, Gang
2014-01-01
Previously, we found that the expression of microRNA-146a (miR-146a) was downregulated in hepatocellular carcinoma (HCC) formalin-fixed paraffin-embedded (FFPE) tissues compared to the adjacent noncancerous hepatic tissues. In the current study, we have explored the in vitro effect of miR-146a on the malignant phenotypes of HCC cells. MiR-146a mimic could suppress cell growth and increase cellular apoptosis in HCC cell lines HepG2, HepB3, and SNU449, as assessed by spectrophotometry, fluorimetry, and fluorescence microscopy, respectively. Furthermore, western blot showed that miR-146a mimic downregulated EGFR, ERK1/2, and stat5 signalings. These effects were less potent compared to that of a siRNA targeting EGFR, a known target gene of miR-146a. Moreover, miR-146a mimic could enhance the cell growth inhibition and apoptosis induction impact of various EGFR targeting agents. The most potent combination was miR-146a mimic with cetuximab, presenting a synergistic effect. In conclusion, miR-146a plays a vital role in the cell growth and apoptosis of HCC cells and inducing miR-146a level might be a critical targeted molecular therapy strategy for HCC.
21 CFR 146.187 - Canned prune juice.
2010-04-01
... 21 Food and Drugs 2 2010-04-01 2010-04-01 false Canned prune juice. 146.187 Section 146.187 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) FOOD FOR... Beverages § 146.187 Canned prune juice. (a) Canned prune juice is the food prepared from a water extract of...
A brief review of revocable ID-based public key cryptosystem
Directory of Open Access Journals (Sweden)
Tsu-Yang Wu
2016-03-01
Full Text Available The design of ID-based cryptography has received much attention from researchers. However, how to revoke the misbehaviour/compromised user in ID-based public key cryptosystem becomes an important research issue. Recently, Tseng and Tsai proposed a novel public key cryptosystem called revocable ID-based public key cryptosystem (RIBE to solve the revocation problem. Later on, numerous research papers based on the Tseng-Tsai key RIBE were proposed. In this paper, we brief review Tseng and Tsai's RIBE. We hope this review can help the readers to understand the Tseng and Tsai's revocable ID-based public key cryptosystem.
2011-06-01
... crack was present at the time of the embodiment of M-D SB 146-32-150, Part B or Part C, it could... inspections, by embodiment of Messier-Dowty (M-D) Service Bulletin (SB) SB.146-32-150. Later, as part of an... optional closing action of EASA AD 2010-0001-E is embodiment of M-D SB 146-32-150 (polishing and shot...
Jin, Hye Jin; Kwon, Ji Hye; Kim, Miyeon; Bae, Yun Kyung; Choi, Soo Jin; Oh, Wonil; Yang, Yoon Sun; Jeon, Hong Bae
2016-04-01
Therapeutic applications of mesenchymal stem cells (MSCs) for treating various diseases have increased in recent years. To ensure that treatment is effective, an adequate MSC dosage should be determined before these cells are used for therapeutic purposes. To obtain a sufficient number of cells for therapeutic applications, MSCs must be expanded in long-term cell culture, which inevitably triggers cellular senescence. In this study, we investigated the surface markers of human umbilical cord blood-derived MSCs (hUCB-MSCs) associated with cellular senescence using fluorescence-activated cell sorting analysis and 242 cell surface-marker antibodies. Among these surface proteins, we selected the melanoma cell adhesion molecule (MCAM/CD146) for further study with the aim of validating observed expression differences and investigating the associated implications in hUCB-MSCs during cellular senescence. We observed that CD146 expression markedly decreased in hUCB-MSCs following prolonged in vitro expansion. Using preparative sorting, we found that hUCB-MSCs with high CD146 expression displayed high growth rates, multilineage differentiation, expression of stemness markers, and telomerase activity, as well as significantly lower expression of the senescence markers p16, p21, p53, and senescence-associated β-galactosidase, compared with that observed in hUCB-MSCs with low-level CD146 expression. In contrast, CD146 downregulation with small interfering RNAs enhanced the senescence phenotype. In addition, CD146 suppression in hUCB-MSCs caused downregulation of other cellular senescence regulators, including Bmi-1, Id1, and Twist1. Collectively, our results suggest that CD146 regulates cellular senescence; thus, it could be used as a therapeutic marker to identify senescent hUCB-MSCs. One of the fundamental requirements for mesenchymal stem cell (MSC)-based therapies is the expansion of MSCs during long-term culture because a sufficient number of functional cells is required
Thais, Savannah Jennifer; The ATLAS collaboration
2018-01-01
Efficient and accurate electron identification is of critical importance to measuring many physics processes with leptons in the final state, including H->4l, dark vector boson searches, and various SUSY searches. This poster will describe the current status of the Likelihood driven Electron ID, highlighting the recent move from a MC driven ID to a data-driven ID. It will include the most recent identification efficiency and scale-factor measurements. Additionally, it will describe continued improvements for Run 2 electron ID, highlighting improvements in the low pt region and potential Machine Learning improvements.
How to save distressed IDS-physician marriages: a case study.
Collins, H; Johnson, B A
1998-04-01
A hospital-driven IDS that encounters serious problems resulting from ownership of a physician practice should address those problems by focusing on three core areas: vision and leadership, effectiveness of operations, and physician compensation arrangements. If changes in these areas do not lead to improvements, the IDS may need to consider organizational restructuring. In one case study, a hospital-driven IDS faced the problem of owning a poorly performing MSO with a captive physician group. The IDS's governing board determined that the organization lacked effective communication with the physicians and that realization of the organization's vision would require greater physician involvement in organizational decision making. The organization is expected to undergo some corporate reorganization in which physicians will acquire an equity interest in the enterprise.
Directory of Open Access Journals (Sweden)
Chong-Tao Du
2018-03-01
Full Text Available The gut microbiota and microRNAs play important roles in the defense against infection. However, the role of miR-146a in L. monocytogenes infection and gut microbiota remains unclear. We tried to determine whether miR-146a controlled L. monocytogenes infection by regulating the gut microbiota. Wild-type and miR-146a-deficient mice or macrophages were used to characterize the impact of miR-146a on animal survival, cell death, bacterial clearance, and gut microbiota following L. monocytogenes challenge. We found that L. monocytogenes infection induced miR-146a expression both in vitro and in vivo. When compared to wild-type mice, miR-146a-deficient mice were more resistant to L. monocytogenes infection. MiR-146a deficiency in macrophages resulted in reduced invasion and intracellular survival of L. monocytogenes. High-throughput sequencing of 16S rRNA revealed that the gut microbiota composition differed between miR-146a-deficient and wild-type mice. Relative to wild-type mice, miR-146a-deficient mice had decreased levels of the Proteobacteria phylum, Prevotellaceae family, and Parasutterella genus, and significantly increased short-chain fatty acid producing bacteria, including the genera Alistipes, Blautia, Coprococcus_1, and Ruminococcus_1. Wild-type mice co-housed with miR-146a-deficient mice had increased resistance to L. monocytogenes, indicating that miR-146a deficiency guides the gut microbiota to alleviate infection. Together, these results suggest that miR-146a deficiency protects against L. monocytogenes infection by regulating the gut microbiota.
Du, Chong-Tao; Gao, Wei; Ma, Ke; Yu, Shui-Xing; Li, Na; Yan, Shi-Qing; Zhou, Feng-Hua; Liu, Zhen-Zhen; Chen, Wei; Lei, Lian-Cheng; Yang, Yong-Jun; Han, Wen-Yu
2018-03-26
The gut microbiota and microRNAs play important roles in the defense against infection. However, the role of miR-146a in L. monocytogenes infection and gut microbiota remains unclear. We tried to determine whether miR-146a controlled L. monocytogenes infection by regulating the gut microbiota. Wild-type and miR-146a-deficient mice or macrophages were used to characterize the impact of miR-146a on animal survival, cell death, bacterial clearance, and gut microbiota following L. monocytogenes challenge. We found that L. monocytogenes infection induced miR-146a expression both in vitro and in vivo. When compared to wild-type mice, miR-146a-deficient mice were more resistant to L. monocytogenes infection. MiR-146a deficiency in macrophages resulted in reduced invasion and intracellular survival of L. monocytogenes . High-throughput sequencing of 16S rRNA revealed that the gut microbiota composition differed between miR-146a-deficient and wild-type mice. Relative to wild-type mice, miR-146a-deficient mice had decreased levels of the Proteobacteria phylum, Prevotellaceae family, and Parasutterella genus, and significantly increased short-chain fatty acid producing bacteria, including the genera Alistipes , Blautia , Coprococcus_1, and Ruminococcus_1 . Wild-type mice co-housed with miR-146a-deficient mice had increased resistance to L. monocytogenes , indicating that miR-146a deficiency guides the gut microbiota to alleviate infection. Together, these results suggest that miR-146a deficiency protects against L. monocytogenes infection by regulating the gut microbiota.
Tinjauan Desain Website Kemlu.Go.Id
Danu Widhyatmoko
2013-01-01
Review of kemlu.go.id website design is a research report on Kemlu.go.id website design. Kemlu.go.id website aims to be the information gateway of Ministry of Foreign Affairs, and also as guidelines of foreign politic policies of Republic of Indonesia. The review had been accomplished by using analytical method based on the "Nine Essential Principles for Good Web Design" developed by Collis Ta'eed (2007). At the end of the article, several recommendations in developing kemlu.go.id website are...
10 CFR 72.146 - Design control.
2010-01-01
... 10 Energy 2 2010-01-01 2010-01-01 false Design control. 72.146 Section 72.146 Energy NUCLEAR... Design control. (a) The licensee, applicant for a license, certificate holder, and applicant for a CoC... shall establish measures for the identification and control of design interfaces and for coordination...
Tinjauan Desain Website Kemlu.Go.Id
Directory of Open Access Journals (Sweden)
Danu Widhyatmoko
2013-04-01
Full Text Available Review of kemlu.go.id website design is a research report on Kemlu.go.id website design. Kemlu.go.id website aims to be the information gateway of Ministry of Foreign Affairs, and also as guidelines of foreign politic policies of Republic of Indonesia. The review had been accomplished by using analytical method based on the "Nine Essential Principles for Good Web Design" developed by Collis Ta'eed (2007. At the end of the article, several recommendations in developing kemlu.go.id website are presented to create better appearance.
21 CFR 146.152 - Orange juice with preservative.
2010-04-01
... 21 Food and Drugs 2 2010-04-01 2010-04-01 false Orange juice with preservative. 146.152 Section... Fruit Juices and Beverages § 146.152 Orange juice with preservative. (a) Orange juice with preservative... of orange juice for manufacturing as provided for in § 146.151, except that a preservative is added...
19 CFR 146.51 - Customs control of merchandise.
2010-04-01
... 19 Customs Duties 2 2010-04-01 2010-04-01 false Customs control of merchandise. 146.51 Section 146.51 Customs Duties U.S. CUSTOMS AND BORDER PROTECTION, DEPARTMENT OF HOMELAND SECURITY; DEPARTMENT OF THE TREASURY (CONTINUED) FOREIGN TRADE ZONES Handling of Merchandise in a Zone § 146.51 Customs...
A Good IDS Response Protocol of MANET Containment Strategies
Cheng, Bo-Chao; Chen, Huan; Tseng, Ryh-Yuh
Much recent research concentrates on designing an Intrusion Detection System (IDS) to detect the misbehaviors of the malicious node in MANET with ad-hoc and mobility natures. However, without rapid and appropriate IDS response mechanisms performing follow-up management services, even the best IDS cannot achieve the desired primary goal of the incident response. A competent containment strategy is needed to limit the extent of an attack in the Incident Response Life Cycle. Inspired by the T-cell mechanisms in the human immune system, we propose an efficient MANET IDS response protocol (T-SecAODV) that can rapidly and accurately disseminate alerts of the malicious node attacks to other nodes so as to modify their AODV routing tables to isolate the malicious nodes. Simulations are conducted by the network simulator (Qualnet), and the experiment results indicate that T-SecAODV is able to spread alerts steadily while greatly reduce faulty rumors under simultaneous multiple malicious node attacks.
2010-07-07
... oleo. The AD also provided an optional terminating action for the repetitive inspections, by embodiment... for the repetitive inspections, by embodiment of Messier-Dowty SB.146-32-150. As part of a recent... inspections, by embodiment of Messier-Dowty SB.146-32-150. As part of a recent accident investigation, the...
21 CFR 146.151 - Orange juice for manufacturing.
2010-04-01
... 21 Food and Drugs 2 2010-04-01 2010-04-01 false Orange juice for manufacturing. 146.151 Section... Fruit Juices and Beverages § 146.151 Orange juice for manufacturing. (a) Orange juice for manufacturing... from oranges as provided in § 146.135, except that the oranges may deviate from the standards for...
Desprez, Pierre-Yves; Campisi, Judith
2014-09-30
A method for treatment and amelioration of breast, cervical, ovarian, endometrial, squamous cells, prostate cancer and melanoma in a patient comprising targeting Id-1 or Id-2 gene expression with a delivery vehicle comprising a product which modulates Id-1 or Id-2 expression.
One ID Card for the Entire Campus.
Ridenour, David P.; Ferguson, Linda M.
1986-01-01
The implementation by Indiana State University of a machine-readable photo ID system for their food services prompted an investigation into the available alternatives and requirements for a more efficient all-University ID card system. The new ID system is described. (AUTHOR/MLW)
Inhibitor of differentiation 4 (Id4) is a potential tumor suppressor in prostate cancer
International Nuclear Information System (INIS)
Carey, Jason PW; Asirvatham, Ananthi J; Galm, Oliver; Ghogomu, Tandeih A; Chaudhary, Jaideep
2009-01-01
Inhibitor of differentiation 4 (Id4), a member of the Id gene family is also a dominant negative regulator of basic helix loop helix (bHLH) transcription factors. Some of the functions of Id4 appear to be unique as compared to its other family members Id1, Id2 and Id3. Loss of Id4 gene expression in many cancers in association with promoter hypermethylation has led to the proposal that Id4 may act as a tumor suppressor. In this study we provide functional evidence that Id4 indeed acts as a tumor suppressor and is part of a cancer associated epigenetic re-programming. Data mining was used to demonstrate Id4 expression in prostate cancer. Methylation specific polymerase chain reaction (MSP) analysis was performed to understand molecular mechanisms associated with Id4 expression in prostate cancer cell lines. The effect of ectopic Id4 expression in DU145 cells was determined by cell cycle analysis (3H thymidine incorporation and FACS), expression of androgen receptor, p53 and cyclin dependent kinase inhibitors p27 and p21 by a combination of RT-PCR, real time-PCR, western blot and immuno-cytochemical analysis. Id4 expression was down-regulated in prostate cancer. Id4 expression was also down-regulated in prostate cancer line DU145 due to promoter hyper-methylation. Ectopic Id4 expression in DU145 prostate cancer cell line led to increased apoptosis and decreased cell proliferation due in part by an S-phase arrest. In addition to S-phase arrest, ectopic Id4 expression in PC3 cells also resulted in prolonged G2/M phase. At the molecular level these changes were associated with increased androgen receptor (AR), p21, p27 and p53 expression in DU145 cells. The results suggest that Id4 acts directly as a tumor suppressor by influencing a hierarchy of cellular processes at multiple levels that leads to a decreased cell proliferation and change in morphology that is possibly mediated through induction of previously silenced tumor suppressors
Li, Miao; Wang, Jinli; Fang, Yimin; Gong, Sitang; Li, Meiyu; Wu, Minhao; Lai, Xiaomin; Zeng, Gucheng; Wang, Yi; Yang, Kun; Huang, Xi
2016-03-30
Macrophages play a crucial role in host innate anti-mycobacterial defense, which is tightly regulated by multiple factors, including microRNAs. Our previous study showed that a panel of microRNAs was markedly up-regulated in macrophages upon mycobacterial infection. Here, we investigated the biological function of miR-146a during mycobacterial infection. miR-146a expression was induced both in vitro and in vivo after Mycobacterium bovis BCG infection. The inducible miR-146a could suppress the inducible nitric oxide (NO) synthase (iNOS) expression and NO generation, thus promoting mycobacterial survival in macrophages. Inhibition of endogenous miR-146a increased NO production and mycobacterial clearance. Moreover, miR-146a attenuated the activation of nuclear factor κB and mitogen-activated protein kinases signaling pathways during BCG infection, which in turn repressed iNOS expression. Mechanistically, miR-146a directly targeted tumor necrosis factor (TNF) receptor-associated factor 6 (TRAF6) at post-transcriptional level. Silencing TRAF6 decreased iNOS expression and NO production in BCG-infected macrophages, while overexpression of TRAF6 reversed miR-146a-mediated inhibition of NO production and clearance of mycobacteria. Therefore, we demonstrated a novel role of miR-146a in the modulation of host defense against mycobacterial infection by repressing NO production via targeting TRAF6, which may provide a promising therapeutic target for tuberculosis.
21 CFR 146.135 - Orange juice.
2010-04-01
... 21 Food and Drugs 2 2010-04-01 2010-04-01 false Orange juice. 146.135 Section 146.135 Food and....135 Orange juice. (a) Orange juice is the unfermented juice obtained from mature oranges of the... name of the food is “orange juice”. The name “orange juice” may be preceded on the label by the...
Inhibitor of differentiation 4 (Id4 is a potential tumor suppressor in prostate cancer
Directory of Open Access Journals (Sweden)
Carey Jason PW
2009-06-01
Full Text Available Abstract Background Inhibitor of differentiation 4 (Id4, a member of the Id gene family is also a dominant negative regulator of basic helix loop helix (bHLH transcription factors. Some of the functions of Id4 appear to be unique as compared to its other family members Id1, Id2 and Id3. Loss of Id4 gene expression in many cancers in association with promoter hypermethylation has led to the proposal that Id4 may act as a tumor suppressor. In this study we provide functional evidence that Id4 indeed acts as a tumor suppressor and is part of a cancer associated epigenetic re-programming. Methods Data mining was used to demonstrate Id4 expression in prostate cancer. Methylation specific polymerase chain reaction (MSP analysis was performed to understand molecular mechanisms associated with Id4 expression in prostate cancer cell lines. The effect of ectopic Id4 expression in DU145 cells was determined by cell cycle analysis (3H thymidine incorporation and FACS, expression of androgen receptor, p53 and cyclin dependent kinase inhibitors p27 and p21 by a combination of RT-PCR, real time-PCR, western blot and immuno-cytochemical analysis. Results Id4 expression was down-regulated in prostate cancer. Id4 expression was also down-regulated in prostate cancer line DU145 due to promoter hyper-methylation. Ectopic Id4 expression in DU145 prostate cancer cell line led to increased apoptosis and decreased cell proliferation due in part by an S-phase arrest. In addition to S-phase arrest, ectopic Id4 expression in PC3 cells also resulted in prolonged G2/M phase. At the molecular level these changes were associated with increased androgen receptor (AR, p21, p27 and p53 expression in DU145 cells. Conclusion The results suggest that Id4 acts directly as a tumor suppressor by influencing a hierarchy of cellular processes at multiple levels that leads to a decreased cell proliferation and change in morphology that is possibly mediated through induction of previously
40 CFR 146.2 - Law authorizing these regulations.
2010-07-01
... 40 Protection of Environment 22 2010-07-01 2010-07-01 false Law authorizing these regulations. 146.2 Section 146.2 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) WATER PROGRAMS (CONTINUED) UNDERGROUND INJECTION CONTROL PROGRAM: CRITERIA AND STANDARDS General Provisions § 146.2 Law...
A Contextual Model for Identity Management (IdM) Interfaces
Fuller, Nathaniel J.
2014-01-01
The usability of Identity Management (IdM) systems is highly dependent upon design that simplifies the processes of identification, authentication, and authorization. Recent findings reveal two critical problems that degrade IdM usability: (1) unfeasible techniques for managing various digital identifiers, and (2) ambiguous security interfaces.…
Kim, Eunjeong; Ma, Eunsook
2007-04-01
The chemoselectivity of rigid cyclic alpha,beta-unsaturated carbonyl group on the reducing agents was influenced by the ring size and steric factor. Cholesterol (cholest-5-en-3beta-ol) and dehydroepiandrosterone (DHEA) were oxidized with 2,3-dichloro-5,6-dicyano-1,4-benzoquinone to form 1,4,6-cholestatrien-3-one and 1,4,6-androstatriene-3,17-dione. They were reduced with NaBH(4), lithium tri-sec-butylborohydride (l-Selectride), LiAlH(4), 9-borabicyclo[3.3.1]nonane (9-BBN), lithium triethylborohydride (Super-hydride), and BH(3) x (CH(3))(2)S in various conditions, respectively. Reduction of 1,4,6-cholestatrien-3-one and 1,4,6-androstatriene-3,17-dione by NaBH(4) (4 equiv.) produced 4,6-cholestadien-3beta-ol and 4,6-androstadiene-3beta,17beta-diol, respectively. Reduction by l-Selectride (12 equiv.) afforded 4,6-cholestadien-3alpha-ol and 4,6-androstadiene-3alpha,17beta-diol, chemoselectively. Reaction with Super-hydride (12 equiv.) produced 4,6-cholestadien-3-one and 3-oxo-4,6-androstadien-17beta-ol. Reduction of 1,4,6-cholestatrien-3-one by 9-BBN (14 equiv.) produced 1,4,6-cholestatrien-3alpha-ol, but 1,4,6-androstatriene-3,17-dione was not reacted with 9-BBN in the reaction conditions. Reaction of LiAlH(4) (6 equiv.) formed 4,6-cholestadien-3beta-ol and 3-oxo-1,4,6-androstatrien-17beta-ol. Reduction of 1,4,6-cholestatrien-3-one by BH(3) x (CH(3))(2)S (11 equiv.) gave cholestane as major compound and unlike reactivity of cholesterol, 1,4,6-androstatriene-3,17-dione by 8 equiv. of BH(3) x (CH(3))(2)S formed 3-oxo-1,4,6-androstatrien-17beta-ol. LiAlH(4) and BH(3) x (CH(3))(2)S showed relatively low chemoselectivity.
MicroRNA-146a Contributes to SCI Recovery via Regulating TRAF6 and IRAK1 Expression.
Wei, Jinsong; Wang, Jiafeng; Zhou, Yulan; Yan, Shouquan; Li, Keshen; Lin, Hongsheng
2016-01-01
MicroRNA-146a participates in spinal cord injury (SCI) recovery. Until recently, how miRNA-146a participates in SCI remained unclear. In this study, we tried to explore the roles of miRNA-146a in the recovery of SCI using a rat model. The expression of the probable target genes of miRNA-146a (including IRAK1 and TARF6) as well as proinflammation cytokines were measured until 7 days after surgery in the three groups (sham group, SCI group, and miRNA-146a antagomir injection group). Also, the animals' motivations were estimated using Basso Beattie Bresnahan (BBB) during the whole experiment. A luciferase assay was performed to demonstrate that miRNA-146a could directly target the mRNAs of IRAK1 and TRAF6 . Our experiments indicate that miRNA-146a inhibits proinflammatory cytokine secretion by suppressing IRAK1 and TRAF6 expression in the SCI model. In contrast, miRNA-146a may be upregulated by inflammatory mediators via the IRAK1 / TRAF6 pathway in the spinal cord. As a negative feedback element, miRNA-146a could make sure that the expression of IRAK1 - and TRAF6 -mediated genes was under tight control. Thus, miRNA-146a may serve as a novel therapeutic target for SCI interventions.
DEFF Research Database (Denmark)
Jensen, Tenna; Jespersen, Astrid Pernille; Grønnow, Liv Cæcilie
2015-01-01
Idékataloget er en selvstændig publikation hørende til projekt Appetit på maden. Idékataloget er udviklet til brug i Københavns Kommune.......Idékataloget er en selvstændig publikation hørende til projekt Appetit på maden. Idékataloget er udviklet til brug i Københavns Kommune....
MicroRNA-146a Regulates Perfusion Recovery in Response to Arterial Occlusion via Arteriogenesis
Directory of Open Access Journals (Sweden)
Joshua L. Heuslein
2018-01-01
Full Text Available The growth of endogenous collateral arteries that bypass arterial occlusion(s, or arteriogenesis, is a fundamental shear stress-induced adaptation with implications for treating peripheral arterial disease. MicroRNAs (miRs are key regulators of gene expression in response to injury and have strong therapeutic potential. In a previous study, we identified miR-146a as a candidate regulator of vascular remodeling. Here, we tested whether miR-146a regulates in vitro angiogenic endothelial cell (EC behaviors, as well as perfusion recovery, arteriogenesis, and angiogenesis in response to femoral arterial ligation (FAL in vivo. We found miR-146a inhibition impaired EC tube formation and migration in vitro. Following FAL, Balb/c mice were treated with a single, intramuscular injection of anti-miR-146a or scramble locked nucleic acid (LNA oligonucleotides directly into the non-ischemic gracilis muscles. Serial laser Doppler imaging demonstrated that anti-miR-146a treated mice exhibited significantly greater perfusion recovery (a 16% increase compared mice treated with scramble LNA. Moreover, anti-miR-146a treated mice exhibited a 22% increase in collateral artery diameter compared to controls, while there was no significant effect on in vivo angiogenesis or muscle regeneration. Despite exerting no beneficial effects on angiogenesis, the inhibition of mechanosensitive miR-146a enhances perfusion recovery after FAL via enhanced arteriogenesis.
22 CFR 146.400 - Education programs or activities.
2010-04-01
... Basis of Sex in Education Programs or Activities Prohibited § 146.400 Education programs or activities... 22 Foreign Relations 1 2010-04-01 2010-04-01 false Education programs or activities. 146.400 Section 146.400 Foreign Relations DEPARTMENT OF STATE CIVIL RIGHTS NONDISCRIMINATION ON THE BASIS OF SEX...
19 CFR 146.13 - Customs forms and procedures.
2010-04-01
... 19 Customs Duties 2 2010-04-01 2010-04-01 false Customs forms and procedures. 146.13 Section 146.13 Customs Duties U.S. CUSTOMS AND BORDER PROTECTION, DEPARTMENT OF HOMELAND SECURITY; DEPARTMENT OF THE TREASURY (CONTINUED) FOREIGN TRADE ZONES General Provisions § 146.13 Customs forms and procedures...
19 CFR 146.10 - Authority to examine merchandise.
2010-04-01
... 19 Customs Duties 2 2010-04-01 2010-04-01 false Authority to examine merchandise. 146.10 Section 146.10 Customs Duties U.S. CUSTOMS AND BORDER PROTECTION, DEPARTMENT OF HOMELAND SECURITY; DEPARTMENT OF THE TREASURY (CONTINUED) FOREIGN TRADE ZONES General Provisions § 146.10 Authority to examine...
CD146 Expression Influences Periapical Cyst Mesenchymal Stem Cell Properties.
Paduano, Francesco; Marrelli, Massimo; Palmieri, Francesca; Tatullo, Marco
2016-10-01
Recent studies have identified a new human dental derived progenitor cell population with multi-lineage differentiation potential referred to as human periapical cyst mesenchymal stem cells (hPCy-MSCs). In the present study, we compared two subpopulations of hPCy-MSCs characterised by the low or high expression of CD146 to establish whether this expression can regulate their stem cell properties. Using flow cytometry, we evaluated the stem cell marker profile of hPCy-MSCs during passaging. Furthermore, CD146 Low and CD146 High cells were sorted by magnetic beads and subsequently both cell populations were evaluated for differences in their proliferation, self-renewal, stem cell surface markers, stemness genes expression and osteogenic differentiation potential.We found that hPCy-MSCs possessed a stable expression of several mesenchymal stem cell surface markers, whereas CD146 expression declined during passaging.In addition, sorted CD146 Low cells proliferated significantly faster, displayed higher colony-forming unit-fibroblast capacity and showed higher expression of Klf4 when compared to the CD146 High subset. Significantly, the osteogenic potential of hPCy-MSCs was greater in the CD146 Low than in CD146 High population. These results demonstrate that CD146 is spontaneously downregulated with passaging at both mRNA and protein levels and that the high expression of CD146 reduces the proliferative, self-renewal and osteogenic differentiation potential of hPCy-MSCs. In conclusion, our study demonstrates that changes in the expression of CD146 can influence the stem cell properties of hPCy-MSCs.
Promotion of Hendra Virus Replication by MicroRNA 146a
Marsh, Glenn A.; Jenkins, Kristie A.; Gantier, Michael P.; Tizard, Mark L.; Middleton, Deborah; Lowenthal, John W.; Haining, Jessica; Izzard, Leonard; Gough, Tamara J.; Deffrasnes, Celine; Stambas, John; Robinson, Rachel; Heine, Hans G.; Pallister, Jackie A.; Foord, Adam J.; Bean, Andrew G.; Wang, Lin-Fa
2013-01-01
Hendra virus is a highly pathogenic zoonotic paramyxovirus in the genus Henipavirus. Thirty-nine outbreaks of Hendra virus have been reported since its initial identification in Queensland, Australia, resulting in seven human infections and four fatalities. Little is known about cellular host factors impacting Hendra virus replication. In this work, we demonstrate that Hendra virus makes use of a microRNA (miRNA) designated miR-146a, an NF-κB-responsive miRNA upregulated by several innate immune ligands, to favor its replication. miR-146a is elevated in the blood of ferrets and horses infected with Hendra virus and is upregulated by Hendra virus in human cells in vitro. Blocking miR-146a reduces Hendra virus replication in vitro, suggesting a role for this miRNA in Hendra virus replication. In silico analysis of miR-146a targets identified ring finger protein (RNF)11, a member of the A20 ubiquitin editing complex that negatively regulates NF-κB activity, as a novel component of Hendra virus replication. RNA interference-mediated silencing of RNF11 promotes Hendra virus replication in vitro, suggesting that increased NF-κB activity aids Hendra virus replication. Furthermore, overexpression of the IκB superrepressor inhibits Hendra virus replication. These studies are the first to demonstrate a host miRNA response to Hendra virus infection and suggest an important role for host miRNAs in Hendra virus disease. PMID:23345523
13 CFR 146.500 - Secretary of Defense.
2010-01-01
... 13 Business Credit and Assistance 1 2010-01-01 2010-01-01 false Secretary of Defense. 146.500 Section 146.500 Business Credit and Assistance SMALL BUSINESS ADMINISTRATION NEW RESTRICTIONS ON LOBBYING..., a covered Federal action from the prohibition whenever the Secretary determines, in writing, that...
DEFF Research Database (Denmark)
Babakhanyan, Anna; Leke, Rose G F; Salanti, Ali
2014-01-01
In pregnant women, Plasmodium falciparum-infected erythrocytes expressing the VAR2CSA antigen bind to chondroitin sulfate A in the placenta causing placental malaria. The binding site of VAR2CSA is present in the ID1-ID2a region. This study sought to determine if pregnant Cameroonian women natura...
Evaluation of ID-PaGIA syphilis antibody test.
Naaber, Paul; Makoid, Ene; Aus, Anneli; Loivukene, Krista; Poder, Airi
2009-01-01
Laboratory diagnosis of syphilis is usually accomplished by serology. There are currently a large number of different commercial treponemal tests available that vary in format, sensitivity and specificity. To evaluate the ID-PaGIA Syphilis Antibody Test as an alternative to other specific treponemal tests for primary screening or confirmation of diagnosis. Serum samples from healthy adults (n = 100) were used for detection of specificity of ID-PaGIA. To evaluate sensitivity of ID-PaGIA serum samples (n = 101) from patients with confirmed or suspected syphilis were tested for syphilis antibodies with FTA-Abs IgM, ID-PaGIA, ELISA IgM and TPHA tests. No false-positive results were found with ID-PaGIA. Sensitivity of various treponemal tests was the following: FTA-Abs IgM: 95.5%, ID-PaGIA and ELISA IgM: 94%, and TPHA 75%. The positive and negative predictive values of ID-PaGIA were 100 and 89.5%, respectively. Compared with other treponemal tests ID-PaGIA has excellent sensitivity and specificity.
19 CFR 146.93 - Inventory control and recordkeeping system.
2010-04-01
... 19 Customs Duties 2 2010-04-01 2010-04-01 false Inventory control and recordkeeping system. 146.93... § 146.93 Inventory control and recordkeeping system. (a) Attribution. All final products removed from or... provided for under § 146.95(b) of this subpart. (3) Other inventory method. An operator may use the FIFO...
Facts about Infectious Diseases (ID)
... an ID Specialist? Facts about ID Pocketcard Infectious diseases are caused by microscopic organisms that penetrate the body’s natural ... from diseases such as AIDS or treatment of diseases such as cancer, may allow ... of contaminated food or water, bites from vectors such as ticks or mosquitoes ...
Experimental Demyelination and Axonal Loss Are Reduced in MicroRNA-146a Deficient Mice.
Martin, Nellie A; Molnar, Viktor; Szilagyi, Gabor T; Elkjaer, Maria L; Nawrocki, Arkadiusz; Okarmus, Justyna; Wlodarczyk, Agnieszka; Thygesen, Eva K; Palkovits, Miklos; Gallyas, Ferenc; Larsen, Martin R; Lassmann, Hans; Benedikz, Eirikur; Owens, Trevor; Svenningsen, Asa F; Illes, Zsolt
2018-01-01
The cuprizone (CPZ) model of multiple sclerosis (MS) was used to identify microRNAs (miRNAs) related to in vivo de- and remyelination. We further investigated the role of miR-146a in miR-146a-deficient (KO) mice: this miRNA is differentially expressed in MS lesions and promotes differentiation of oligodendrocyte precursor cells (OPCs) during remyelination, but its role has not been examined during demyelination. MicroRNAs were examined by Agilent Mouse miRNA Microarray in the corpus callosum during CPZ-induced demyelination and remyelination. Demyelination, axonal loss, changes in number of oligodendrocytes, OPCs, and macrophages/microglia was compared by histology/immunohistochemistry between KO and WT mice. Differential expression of target genes and proteins of miR-146a was analyzed in the transcriptome (4 × 44K Agilent Whole Mouse Genome Microarray) and proteome (liquid chromatography tandem mass spectrometry) of CPZ-induced de- and remyelination in WT mice. Levels of proinflammatory molecules in the corpus callosum were compared in WT versus KO mice by Meso Scale Discovery multiplex protein analysis. miR-146a was increasingly upregulated during CPZ-induced de- and remyelination. The absence of miR-146a in KO mice protected against demyelination, axonal loss, body weight loss, and atrophy of thymus and spleen. The number of CNP + oligodendrocytes was increased during demyelination in the miR-146a KO mice, while there was a trend of increased number of NG2 + OPCs in the WT mice. miR-146a target genes, SNAP25 and SMAD4, were downregulated in the proteome of demyelinating corpus callosum in WT mice. Higher levels of SNAP25 were measured by ELISA in the corpus callosum of miR-146a KO mice, but there was no difference between KO and WT mice during demyelination. Multiplex protein analysis of the corpus callosum lysate revealed upregulated TNF-RI, TNF-RII, and CCL2 in the WT mice in contrast to KO mice. The number of Mac3 + and Iba1 + macrophages/microglia was
Kloos, W E; George, C G
1991-01-01
The accuracies of the MicroScan Pos ID and Rapid Pos ID panel systems (Baxter Diagnostic Inc., MicroScan Division, West Sacramento, Calif.) were compared with each other and with the accuracies of conventional methods for the identification of 25 Staphylococcus species and 4 subspecies. Conventional methods included those used in the original descriptions of species and subspecies and DNA-DNA hybridization. The Pos ID panel uses a battery of 18 tests, and the Rapid Pos ID panel uses a battery of 42 tests for the identification of Staphylococcus species. The Pos ID panel has modified conventional and chromogenic tests that can be read after 15 to 48 h of incubation; the Rapid Pos ID panel has tests that use fluorogenic substrates or fluorometric indicators, and test results can be read after 2 h of incubation in the autoSCAN-W/A. Results indicated that both MicroScan systems had a high degree of congruence (greater than or equal to 90%) with conventional methods for the species S. capitis, S. aureus, S. auricularis, S. saprophyticus, S. cohnii, S. arlettae, S. carnosus, S. lentus, and S. sciuri and, in particular, the subspecies S. capitis subsp. capitis and S. cohnii subsp. cohnii. The Rapid Pos ID panel system also had greater than or equal to 90% congruence with conventional methods for S. epidermidis, S. caprae, S. warneri subsp. 2, S. xylosus, S. kloosii, and S. caseolyticus. For both MicroScan systems, congruence with conventional methods was 80 to 90% for S. haemolyticus subsp. 1, S. equorum, S. intermedius, and S. hyicus; and in addition, with the Rapid Pos ID panel system congruence was 80 to 89% for S. capitis subsp. ureolyticus, S. warneri subsp. 1, S. hominis, S. cohnii subsp. urealyticum, and S. simulans. The MicroScan systems identified a lower percentage (50 to 75%) of strains of S. lugdunensis, S. gallinarum, S. schleiferi, and S. chromogenes, although the addition of specific tests to the systems might increase the accuracy of identification
Immunohistochemical Expression of MCAM/CD146 in Canine Melanoma.
Abou Asa, S
2017-07-01
MCAM/CD146 (melanoma cell adhesion molecule/CD146) is a transmembrane immunoglobulin superfamily cell adhesion molecule involved in transendothelial migration and signal transduction. It is expressed in melanoma, squamous cell carcinoma, prostatic, ovarian, cervical and endometrial cancers and promotes tumour growth, angiogenesis and metastasis. Melanoma is the most common malignant oral tumour of dogs and also arises in the skin, nail bed and footpad. The aim of this study was to investigate the immunohistochemical expression of MCAM/CD146 in 51 canine melanomas, including oral, cutaneous and ocular tumours. Seventeen of the 51 (33.3%) cases were negative, eight (15.7%) were weakly positive, seven (13.7%) were moderately positive and 19 (37.3%) were strongly positive. MCAM/CD146 was expressed by both oral and cutaneous melanomas; however, the intensity and the extent of the immunoreactivity was higher in oral (P = 0.009) than in cutaneous tumours (P = 0.058). Most ocular melanomas did not express MCAM/CD146 (P = 0.256). Expression of MCAM/CD146 by canine melanomas may suggest the molecule as a target for treatment, especially in oral melanomas. Copyright © 2017 Elsevier Ltd. All rights reserved.
Experimental Demyelination and Axonal Loss Are Reduced in MicroRNA-146a Deficient Mice
Directory of Open Access Journals (Sweden)
Nellie A. Martin
2018-03-01
Full Text Available BackgroundThe cuprizone (CPZ model of multiple sclerosis (MS was used to identify microRNAs (miRNAs related to in vivo de- and remyelination. We further investigated the role of miR-146a in miR-146a-deficient (KO mice: this miRNA is differentially expressed in MS lesions and promotes differentiation of oligodendrocyte precursor cells (OPCs during remyelination, but its role has not been examined during demyelination.MethodsMicroRNAs were examined by Agilent Mouse miRNA Microarray in the corpus callosum during CPZ-induced demyelination and remyelination. Demyelination, axonal loss, changes in number of oligodendrocytes, OPCs, and macrophages/microglia was compared by histology/immunohistochemistry between KO and WT mice. Differential expression of target genes and proteins of miR-146a was analyzed in the transcriptome (4 × 44K Agilent Whole Mouse Genome Microarray and proteome (liquid chromatography tandem mass spectrometry of CPZ-induced de- and remyelination in WT mice. Levels of proinflammatory molecules in the corpus callosum were compared in WT versus KO mice by Meso Scale Discovery multiplex protein analysis.ResultsmiR-146a was increasingly upregulated during CPZ-induced de- and remyelination. The absence of miR-146a in KO mice protected against demyelination, axonal loss, body weight loss, and atrophy of thymus and spleen. The number of CNP+ oligodendrocytes was increased during demyelination in the miR-146a KO mice, while there was a trend of increased number of NG2+ OPCs in the WT mice. miR-146a target genes, SNAP25 and SMAD4, were downregulated in the proteome of demyelinating corpus callosum in WT mice. Higher levels of SNAP25 were measured by ELISA in the corpus callosum of miR-146a KO mice, but there was no difference between KO and WT mice during demyelination. Multiplex protein analysis of the corpus callosum lysate revealed upregulated TNF-RI, TNF-RII, and CCL2 in the WT mice in contrast to KO mice. The number of Mac3+ and
13 CFR 146.600 - Semi-annual compilation.
2010-01-01
... 13 Business Credit and Assistance 1 2010-01-01 2010-01-01 false Semi-annual compilation. 146.600 Section 146.600 Business Credit and Assistance SMALL BUSINESS ADMINISTRATION NEW RESTRICTIONS ON LOBBYING.... (c) Information that involves intelligence matters shall be reported only to the Select Committee on...
29 CFR 4.146 - Contract obligations after award, generally.
2010-07-01
... 29 Labor 1 2010-07-01 2010-07-01 true Contract obligations after award, generally. 4.146 Section 4.146 Labor Office of the Secretary of Labor LABOR STANDARDS FOR FEDERAL SERVICE CONTRACTS Application of the McNamara-O'Hara Service Contract Act Period of Coverage § 4.146 Contract obligations after...
34 CFR 300.146 - Responsibility of SEA.
2010-07-01
... special education and related services— (1) In conformance with an IEP that meets the requirements of... 34 Education 2 2010-07-01 2010-07-01 false Responsibility of SEA. 300.146 Section 300.146 Education Regulations of the Offices of the Department of Education (Continued) OFFICE OF SPECIAL EDUCATION...
Zhang, Bin; Wang, Aihong; Xia, Cuiping; Lin, Qunfeng; Chen, Chunfu
2015-09-01
Alzheimer's disease (AD) is a progressive neurodegenerative disorder and is the most common form of dementia among the aging population. Although the incidence of the disease continues to increase, no cure has been developed. Effective treatment is restricted not only due to the lack of curative medicine, but also due to limited understanding of the underlying mechanisms and the difficulties in accurately diagnosing AD in its earliest stages prior to clinical symptoms. Micro (mi) RNAs (miR) have gained increasing attention in the investigation of neurodegenerative diseases. Previous reports have demonstrated that deregulation of miR‑146a‑5p is associated with the pathogenesis of human AD. In the present study, the coding region of primary (pri)‑miR‑146a in patients with AD was scanned and the rare C allele of rs2910164 was found to be associated with AD. Using reverse transcription quantitative polymerase chain reaction, it was demonstrated that site variation reduced the expression of mature miR‑146a‑5p. Notably, a reduction in the expression of miR‑146a‑5p led to less efficient inhibition of target genes, including Toll‑like receptor (TLR)2, which is important in the pathogenesis of AD. Biological function investigations in RAW264.7 cells indicated that, compared with the G allele, the rare C allele upregulated the expression of tumor necrosis factor‑α following stimulation with β‑amyloid. These findings suggested that one common polymorphism in pri‑miR‑146a may contribute to the genetic predisposition to AD by disrupting the production of miR‑146a‑5p and affecting the expression and function of TLR2.
miR-146a modulates autoreactive Th17 cell differentiation and regulates organ-specific autoimmunity.
Li, Bo; Wang, Xi; Choi, In Young; Wang, Yu-Chen; Liu, Siyuan; Pham, Alexander T; Moon, Heesung; Smith, Drake J; Rao, Dinesh S; Boldin, Mark P; Yang, Lili
2017-10-02
Autoreactive CD4 T cells that differentiate into pathogenic Th17 cells can trigger autoimmune diseases. Therefore, investigating the regulatory network that modulates Th17 differentiation may yield important therapeutic insights. miR-146a has emerged as a critical modulator of immune reactions, but its role in regulating autoreactive Th17 cells and organ-specific autoimmunity remains largely unknown. Here, we have reported that miR-146a-deficient mice developed more severe experimental autoimmune encephalomyelitis (EAE), an animal model of human multiple sclerosis (MS). We bred miR-146a-deficient mice with 2D2 T cell receptor-Tg mice to generate 2D2 CD4 T cells that are deficient in miR-146a and specific for myelin oligodendrocyte glycoprotein (MOG), an autoantigen in the EAE model. miR-146a-deficient 2D2 T cells induced more severe EAE and were more prone to differentiate into Th17 cells. Microarray analysis revealed enhancements in IL-6- and IL-21-induced Th17 differentiation pathways in these T cells. Further study showed that miR-146a inhibited the production of autocrine IL-6 and IL-21 in 2D2 T cells, which in turn reduced their Th17 differentiation. Thus, our study identifies miR-146a as an important molecular brake that blocks the autocrine IL-6- and IL-21-induced Th17 differentiation pathways in autoreactive CD4 T cells, highlighting its potential as a therapeutic target for treating autoimmune diseases.
33 CFR 146.120 - Manning of survival craft.
2010-07-01
... 33 Navigation and Navigable Waters 2 2010-07-01 2010-07-01 false Manning of survival craft. 146.120 Section 146.120 Navigation and Navigable Waters COAST GUARD, DEPARTMENT OF HOMELAND SECURITY... craft. The owner, the owner's agent, or the person in charge shall assign a person to each life float...
Association of MicroRNA-146a rs2910164 Gene Polymorphism with Metabolic Syndrome.
Mehanna, E T; Ghattas, M H; Mesbah, N M; Saleh, S M; Abo-Elmatty, D M
2015-01-01
Alteration in microRNA-146a (miRNA-146a) expression is an important event in the pathogenesis of many human diseases. MiRNA-146a rs2910164 is a functional polymorphism that showed association with several diseases. Metabolic syndrome is an aggregation of multiple risk factors including impaired glucose tolerance, increased highdensity lipoprotein, abdominal obesity, and high blood pressure. The aim of this study was to assess the relation of miRNA-146a rs2910164 with metabolic syndrome and its component traits in Egyptian women from the Suez Canal area. The study included 100 healthy female subjects and 100 metabolic syndrome patients. The component traits of metabolic syndrome were determined and the genotypes of the polymorphisms were assessed using the polymerase chain reaction-restriction fragment length polymorphism technique using the restriction enzyme Hpy188I. The rare C allele had a significantly higher frequency in metabolic syndrome patients (P = 0.013). The heterozygote GC and the rare CC genotypes showed a significant increase in body mass index, waist circumference, triglycerides, total cholesterol, low-density lipoprotein, systolic and diastolic blood pressure. The GC genotype was associated with higher fasting blood glucose, fasting serum insulin and insulin resistance. The carriers of CC genotype had significantly lower HDL compared with the GG genotype carriers. In conclusion, The C allele of miRNA-146a rs2910164 showed positive association with increased susceptibility to metabolic syndrome and its phenotypes in the study population.
MicroRNA-146a expression as a potential biomarker for rheumatoid ...
African Journals Online (AJOL)
MicroRNA-146a expression as a potential biomarker for rheumatoid arthritis in Egypt. Heba Mohamed Abdelkader Elsayed, Walaa Shawky Khater, Ayman Asaad Ibrahim, Maha Salah El-din Hamdy, Nashwa Aly Morshedy ...
miR-146a Suppresses Invasion of Pancreatic Cancer Cells
Li, Yiwei; VandenBoom, Timothy G.; Wang, Zhiwei; Kong, Dejuan; Ali, Shadan; Philip, Philip A.; Sarkar, Fazlul H.
2010-01-01
The aggressive course of pancreatic cancer is believed to reflect its unusually invasive and metastatic nature, which is associated with epidermal growth factor receptor (EGFR) overexpression and NF-κB activation. MicroRNAs (miRNA) have been implicated in the regulation of various pathobiological processes in cancer, including metastasis in pancreatic cancer and in other human malignancies. In this study, we report lower expression of miR-146a in pancreatic cancer cells compared with normal human pancreatic duct epithelial cells. Reexpression of miR-146a inhibited the invasive capacity of pancreatic cancer cells with concomitant downregulation of EGFR and the NF-κB regulatory kinase interleukin 1 receptor–associated kinase 1 (IRAK-1). Cellular mechanism studies revealed crosstalk between EGFR, IRAK-1, IκBα, NF-κB, and MTA-2, a transcription factor that regulates metastasis. Treatment of pancreatic cancer cells with the natural products 3,3′-diinodolylmethane (DIM) or isoflavone, which increased miR-146a expression, caused a downregulation of EGFR, MTA-2, IRAK-1, and NF-κB, resulting in an inhibition of pancreatic cancer cell invasion. Our findings reveal DIM and isoflavone as nontoxic activators of a miRNA that can block pancreatic cancer cell invasion and metastasis, offering starting points to design novel anticancer agents. PMID:20124483
Zhang, H-L; Li, L; Cheng, C-J; Sun, X-C
2018-02-01
The study aims to detect the association of miR-146a-5p with intracranial aneurysms (IAs). The expression of miR-146a-5p was compared from plasma samples between 72 patients with intracranial aneurysms (IAs) and 40 healthy volunteers by quantitative Real-time polymerase chain reaction (qRT-PCR). Statistical analysis was performed to analyze the relationship between miR-146a-5p expression and clinical data and overall survival (OS) time of IAs patients. Univariate and multivariate Cox proportional hazards have also been performed. Notably, higher miR-146a-5p expression was found in plasma samples from 72 patients with intracranial aneurysms (IAs) compared with 40 healthy controls. Higher miR-146a-5p expression was significantly associated with rupture and Hunt-Hess level in IAs patients. Kaplan-Meier survival analysis verified that higher miR-146a-5p expression predicted a shorter overall survival (OS) compared with lower miR-146a-5p expression in IAs patients. Univariate and multivariate Cox proportional hazards demonstrated that higher miR-146a-5p expression, rupture, and Hunt-Hess were independent risk factors of OS in patients with intracranial aneurysms (IAs). MiR-146a-5p expression may serve as a biomarker for predicting prognosis in patients with IAs.
MicroRNA-146a and AMD3100, two ways to control CXCR4 expression in acute myeloid leukemias
Energy Technology Data Exchange (ETDEWEB)
Spinello, I; Quaranta, M T; Riccioni, R; Riti, V; Pasquini, L; Boe, A; Pelosi, E [Department of Hematology, Oncology and Molecular Medicine, Istituto Superiore di Sanità, Rome (Italy); Vitale, A; Foà, R [Department of Cellular Biotechnologies and Hematology, Division of Hematology, ‘Sapienza' University, Rome (Italy); Testa, U; Labbaye, C [Department of Hematology, Oncology and Molecular Medicine, Istituto Superiore di Sanità, Rome (Italy)
2011-06-01
CXCR4 is a negative prognostic marker in acute myeloid leukemias (AMLs). Therefore, it is necessary to develop novel ways to inhibit CXCR4 expression in leukemia. AMD3100 is an inhibitor of CXCR4 currently used to mobilize cancer cells. CXCR4 is a target of microRNA (miR)-146a that may represent a new tool to inhibit CXCR4 expression. We then investigated CXCR4 regulation by miR-146a in primary AMLs and found an inverse correlation between miR-146a and CXCR4 protein expression levels in all AML subtypes. As the lowest miR-146a expression levels were observed in M5 AML, we analyzed the control of CXCR4 expression by miR-146a in normal and leukemic monocytic cells and showed that the regulatory miR-146a/CXCR4 pathway operates during monocytopoiesis, but is deregulated in AMLs. AMD3100 treatment and miR-146a overexpression were used to inhibit CXCR4 in leukemic cells. AMD3100 treatment induces the decrease of CXCR4 protein expression, associated with miR-146a increase, and increases sensitivity of leukemic blast cells to cytotoxic drugs, this effect being further enhanced by miR-146a overexpression. Altogether our data indicate that miR-146a and AMD3100, acting through different mechanism, downmodulate CXCR4 protein levels, impair leukemic cell proliferation and then may be used in combination with anti-leukemia drugs, for development of new therapeutic strategies.
MicroRNA-146a and AMD3100, two ways to control CXCR4 expression in acute myeloid leukemias
International Nuclear Information System (INIS)
Spinello, I; Quaranta, M T; Riccioni, R; Riti, V; Pasquini, L; Boe, A; Pelosi, E; Vitale, A; Foà, R; Testa, U; Labbaye, C
2011-01-01
CXCR4 is a negative prognostic marker in acute myeloid leukemias (AMLs). Therefore, it is necessary to develop novel ways to inhibit CXCR4 expression in leukemia. AMD3100 is an inhibitor of CXCR4 currently used to mobilize cancer cells. CXCR4 is a target of microRNA (miR)-146a that may represent a new tool to inhibit CXCR4 expression. We then investigated CXCR4 regulation by miR-146a in primary AMLs and found an inverse correlation between miR-146a and CXCR4 protein expression levels in all AML subtypes. As the lowest miR-146a expression levels were observed in M5 AML, we analyzed the control of CXCR4 expression by miR-146a in normal and leukemic monocytic cells and showed that the regulatory miR-146a/CXCR4 pathway operates during monocytopoiesis, but is deregulated in AMLs. AMD3100 treatment and miR-146a overexpression were used to inhibit CXCR4 in leukemic cells. AMD3100 treatment induces the decrease of CXCR4 protein expression, associated with miR-146a increase, and increases sensitivity of leukemic blast cells to cytotoxic drugs, this effect being further enhanced by miR-146a overexpression. Altogether our data indicate that miR-146a and AMD3100, acting through different mechanism, downmodulate CXCR4 protein levels, impair leukemic cell proliferation and then may be used in combination with anti-leukemia drugs, for development of new therapeutic strategies
CD146 positive human dental pulp stem cells promote regeneration of dentin/pulp-like structures.
Matsui, Mikiko; Kobayashi, Tomoko; Tsutsui, Takeo W
2018-04-01
CD146 and STRO-1 are endothelial biomarkers that are co-expressed on the cellular membranes of blood vessels within human dental pulp tissue. This study characterized the percentage of dentin-like structures produced by CD146-positive (CD146 + ) human dental pulp stem cells (DPSCs), compared with their CD146-negative (CD146 - ) counterparts. DPSC populations were enriched using magnetic-activated cell sorting (MACS), yielding CD146 + and CD146 - cells, as well as mixtures composed of 25% CD146 + cells and 75% CD146 - cells (CD146 +/- ). Cell growth assays indicated that CD146 + cells exhibit an approximate 3-4 h difference in doubling time, compared with CD146 - cells. Cell cycle distributions were determined by flow cytometry analysis. The low percentage of CD146 + cells' DNA content in G 0 /G 1 phase were compared with CD146 - and non-separated cells. In contrast to CD146 - and non-separated cells, prompt mineralization was observed in CD146 + cells. Subsequently, qRT-PCR revealed high mRNA expression of CD146 and Alkaline phosphatase in mineralization-induced CD146 + cells. CD146 + cells were also observed high adipogenic ability by Oil red O staining. Histological examinations revealed an increased area of dentin/pulp-like structures in transplanted CD146 + cells, compared with CD146 - and CD146 +/- cells. Immunohistochemical studies detected dentin matrix protein-1 (DMP1) and dentin sialophosphoprotein (DSPP), as well as human mitochondria, in transplanted DPSCs. Co-expression of CD146 and GFP indicated that CD146 was expressed in transplanted CD146 + cells. CD146 + cells may promote mineralization and generate dentin/pulp-like structures, suggesting a role in self-renewal of stem cells and dental pulp regenerative therapy.
Increased Inhibitor of Differentiation 4 (Id4 Expression in Glioblastoma: A Tissue Microarray Study
Directory of Open Access Journals (Sweden)
Weifin Zeng, Elisabeth J. Rushing, Daniel P. Hartmann, Norio Azumi
2010-01-01
Full Text Available Background: The inhibitor of differentiation/DNA binding protein family (Id1-4 is involved in cell cycle control, tumorigenesis and angiogenesis through the negative regulation of helix-loop-helix transcription factors. Of these proteins, Id4 is known to play an important role in neural stem cell differentiation, and deregulation has been implicated in glial neoplasia. However, the expression and significance of Id4 in astrocytomas has not been fully addressed. Herein we report the differential expression of Id4 in astrocytomas of various grades using tissue microarrays (TMA and immunohistochemistry (IHC. Design: The GBM TMA was constructed from 53 archival cases at Georgetown University Hospital and a TMA with normal brain controls and grades II-III astrocytoma was obtained from Cybrdi (Rockville, MD. TMA sections were stained with Id4 antibody and the slides were scored according to the percentage of staining astrocytic nuclei (<9% -, 10-50% +, >51% ++. The Fisher Exact test was used to test for statistical significance. Results: Nuclear staining for Id4 was seen in 73.58% GBMs, 25% grade III, and 12.5% grade II astrocytomas; staining was absent in normal brain tissue. There was a statistically significant difference between GBM and grades II, III astrocytoma (p <0.01. Significant Id4 expression was not detected in normal brain. Conclusions: Our study confirms the frequent upregulation of Id4 expression in GBM, which lends support to its role in tumorigenesis, possibly in the transformation of low to high-grade astrocytoma (i.e. GBM. Further studies are warranted to determine the precise role of Id4 in glial neoplasia and its potential use in targeted therapy for GBM.
Commissioning of the IDS Neutron Detector and $\\beta$-decay fast-timing studies at IDS
Piersa, Monika
2016-01-01
The following report describes my scientific activities performed during the Summer Student Programme at ISOLDE. The main part of my project was focused on commissioning the neutron detector dedicated to nuclear decay studies at ISOLDE Decay Station (IDS). I have participated in all the steps needed to make it operational for the IS609 experiment. In the testing phase, we obtained expected detector response and calibrations confirmed its successful commissioning. The detector was mounted in the desired geometry at IDS and used in measurements of the beta-delayed neutron emission of $^8$He. After completing aforementioned part of my project, I became familiar with the fast-timing method. This technique was applied at IDS in the IS610 experiment performed in June 2016 to explore the structure of neutron-rich $^{130-134}$Sn nuclei. Since the main part of my PhD studies will be the analysis of data collected in this experiment, the second part of my project was dedicated to acquiring knowledge about technical de...
TR146 cells grown on filters as a model of human buccal epithelium
DEFF Research Database (Denmark)
Mørck Nielsen, H; Rømer Rassing, M; Nielsen, Hanne Mørck
2000-01-01
cell culture model, and human and porcine buccal epithelium were compared. The esterase activity in the intact cell culture model and in the porcine buccal mucosa was compared. Further, the TR146 cell culture model was used to study the permeability rate and metabolism of leu-enkephalin. The activity...... of the three enzymes in the TR146 homogenate supernatants was in the same range as the activity in homogenate supernatants of human buccal epithelium. In the TR146 cell culture model, the activity of aminopeptidase (13.70+/-2.10 nmol/min per mg protein) was approx. four times the activity of carboxypeptidase...
MiR-146a modulates macrophage polarization by inhibiting Notch1 pathway in RAW264.7 macrophages.
Huang, Cheng; Liu, Xue-Jiao; QunZhou; Xie, Juan; Ma, Tao-Tao; Meng, Xiao-Ming; Li, Jun
2016-03-01
Macrophages are heterogeneous and plastic cells which are able to undergo dynamic transition between M1 and M2 polarized phenotypes in response to the microenvironment signals. However, the underlying molecular mechanisms of macrophage polarization are still obscure. In the current study, it was revealed that miR-146a might play a pivotal role in macrophage polarization. As our results indicated, miR-146a was highly expressed in M2 macrophages rather than M1 macrophages. Over-expression of miR-146a resulted in significantly decreased production of pro-inflammatory cytokines including iNOS and TNF-α in M1 macrophages, while increased production of M2 marker genes such as Arg1 and CD206 in M2 macrophages. In contrast, knockdown of miR-146a promoted M1 macrophage polarization but diminished M2 macrophage polarization. Mechanistically, it was revealed that miR-146a modulated macrophage polarization by targeting Notch1. Of note, PPARγ was responsible as another target for miR-146a-mediated macrophage polarization. Taken together, it was suggested that miR-146a might serve as a molecular regulator in macrophage polarization and is a potential therapeutic target for inflammatory diseases. Copyright © 2016 Elsevier B.V. All rights reserved.
Levels in 146Ce and the N = 88 isotones
International Nuclear Information System (INIS)
Gowdy, G.M.; Chrien, R.E.; Chu, Y.Y.
1981-01-01
An investigation of the level structure of 146 Ce following the beta decay of the low-spin isomer of 146 La has been carried out at the ISOL facility TRISTAN at Brookhaven National Laboratory. The half-life for the low spin isomer was found to be 6.0 +- 0.4s. A partial level scheme for 146 Ce below 2 MeV is given. The level energies and some B(E2) values extracted from our data have been compared with IBA-2 calculations done entirely with extrapolated parameters from neighboring Z nuclei in order to check the predictive power of the model. Systematics of the Z = 58 isotopes and N = 88 isotones indicate that although 146 Ce is more deformed than its isotones with Z greater than or equal to 60, the transition to the well-deformed region can probably more correctly be thought to occur after 146 Ce, between N = 88 and N = 90, as it does for Z greater than or equal to 60. The abrupt onset of deformation present in the higher Z isotopes is not seen in the Ce isotopes where the trend is found to be rather smooth throughout
International Nuclear Information System (INIS)
Noetzel, Erik; Veeck, Jürgen; Niederacher, Dieter; Galm, Oliver; Horn, Felicitas; Hartmann, Arndt; Knüchel, Ruth; Dahl, Edgar
2008-01-01
Inhibitor of DNA binding/Inhibitor of differentiation 4 (ID4) is a critical factor for cell proliferation and differentiation in normal vertebrate development. ID4 has regulative functions for differentiation and growth of the developing brain. The role of ID1, ID2 and ID3 are expected to be oncogenic due to their overexpression in pancreatic cancer and colorectal adenocarcinomas, respectively. Aside from these findings, loss of ID3 expression was demonstrated in ovarian cancer. The aim of the present study was to reveal the factual role of ID4 in carcinogenesis in more detail, since its role for the pathogenesis of human breast cancer has been discussed controversially, assigning both oncogenic and tumour suppressive functions. ID4 promoter methylation, ID4 mRNA expression and ID4 protein expression were analysed in primary human breast cancer specimens using methylation-specific PCR (MSP) (n=170), semiquantitative realtime RT-PCR (n=46) and immunhistochemistry (n=3), respectively. In order to demonstrate a functional association of ID4 promoter methylation with its gene silencing, we performed DNA demethylation analysis with four human breast cell lines using MSP and semiquantitative realtime RT-PCR. In addition, we performed correlations of ID4 promoter methylation with ID4 mRNA and ID4 protein expression in matched samples of breast tumour and corresponding normal tissue. We carried out statistical analyses in order to find correlations between ID4 promoter methylation and clinicopathological parameters. Frequent ID4 promoter methylation was observed in primary breast cancer samples (69%, 117/170). We found a tight correlation (P<0.0001) between ID4 promoter methylation and loss of ID4 expression in primary breast cancer 3 specimens. Demethylating treatment with breast cancer cell lines was associated with clear ID4 mRNA re-expression. Tumours with ID4 promoter methylation showed distinct loss of ID4 expression on both transcription and protein level
Portland cement induces human periodontal ligament cells to differentiate by upregulating miR-146a
Directory of Open Access Journals (Sweden)
Min-Ching Wang
2018-04-01
Full Text Available Background/Purpose: Bioaggregates such as Portland cement (PC can be an economical alternative for mineral trioxide aggregate (MTA with additional benefit of less discoloration. MTA has been known to induce differentiations of several dental cells. MicroRNAs are important regulators of biological processes, including differentiation, physiologic homeostasis, and disease progression. This study is to explore how PC enhances the differentiation of periodontal ligament (PDL cells in microRNAs level. Methods: PDL cells were cultured in a regular PC- or MTA-conditioned medium or an osteoinduction medium (OIM. Alizarin red staining was used to evaluate the extent of mineralization. Transfection of microRNA mimics induced exogenous miR-31 and miR-146a expression. The expression of microRNAs and differentiation markers was assayed using reverse-transcriptase polymerase chain reaction. Results: PC enhanced the mineralization of PDL cells in a dose-dependent manner in the OIM. Exogenous miR-31 and miR-146a expression upregulated alkaline phosphatase (ALP, bone morphogenic protein (BMP, and dentin matrix protein 1 (DMP1 expression. However, miR-31 and miR-146a modulates cementum protein 1 (CEMP1 expression in different ways. PC also enhanced ALP and BMP but attenuated CEMP1 in the OIM. Although the OIM or PC treatment upregulated miR-21, miR-29b, and miR-146a, only miR-146a was able to be induced by PC in combination with OIM. Conclusion: This study demonstrated that PC enhances the differentiation of PDL cells, especially osteogenic through miR-146a upregulation. In order to control the ankylosis after regenerative endodontics with the usage of bioaggregates, further investigations to explore these differentiation mechanisms in the miRNA level may be needed. Keywords: Portland cement, Bioaggregate, miR-146a, Osteogenic differentiation, Periodontal ligament (PDL
40 CFR 146.9 - Criteria for establishing permitting priorities.
2010-07-01
....9 Criteria for establishing permitting priorities. In determining priorities for setting times for... priorities. 146.9 Section 146.9 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) WATER... (a), (c), (g) or § 144.22(f), the Director shall base these priorities upon consideration of the...
Enhanced E3 Excitations in 144,146Ba and the Evolution of Octupole Collectivity
Bucher, B.; Zhu, S.; ANL, LLNL, LBNL, INL, UAM, Rochester, Maryland Collaboration
2017-09-01
Recent Coulomb excitation studies on 144,146Ba using the GRETINA-CHICO2 detection system with post-accelerated CARIBU beams have confirmed the existence of enhanced E3 transitions in these isotopes which are centered in a region that has long been predicted to exhibit stable octupole-deformed shapes. Furthermore, the widely-varying E1 strength observed between these isotopes is well-accounted for by models having octupole-deformed potentials, and the variation has been linked to increased occupancies of specific single-particle orbitals in the reflection-asymmetric potential. This talk will summarize the most recent experimental and theoretical results. In addition, data on octupole-related properties in the surrounding isotopes will be discussed in an attempt to better understand the origin and evolution of octupole collectivity in this mass region. This work is supported by the U.S. Department of Energy, Office of Nuclear Physics, under Contract No. DE-AC02-06CH11357 (ANL), DE-AC02-05CH11231 (LBNL, GRETINA), DOE DE-AC52-07NA27344 (LLNL), DE-AC07-05ID14517 (INL), and MINECO (Spain).
TR146 cells grown on filters as a model of human buccal epithelium
DEFF Research Database (Denmark)
Nielsen, H M; Rassing, M R; Nielsen, Hanne Mørck
2000-01-01
The objective of the present study was to evaluate the TR146 cell culture model as an in vitro model of human buccal epithelium. For this purpose, the permeability of water, mannitol and testosterone across the TR146 cell culture model was compared to the permeability across human, monkey...
21 CFR 146.154 - Concentrated orange juice with preservative.
2010-04-01
... 21 Food and Drugs 2 2010-04-01 2010-04-01 false Concentrated orange juice with preservative. 146... Canned Fruit Juices and Beverages § 146.154 Concentrated orange juice with preservative. (a) Concentrated orange juice with preservative complies with the requirements for composition and labeling of optional...
Cyclin D1, Id1 and EMT in breast cancer
International Nuclear Information System (INIS)
Tobin, Nicholas P; Sims, Andrew H; Lundgren, Katja L; Lehn, Sophie; Landberg, Göran
2011-01-01
Cyclin D1 is a well-characterised cell cycle regulator with established oncogenic capabilities. Despite these properties, studies report contrasting links to tumour aggressiveness. It has previously been shown that silencing cyclin D1 increases the migratory capacity of MDA-MB-231 breast cancer cells with concomitant increase in 'inhibitor of differentiation 1' (ID1) gene expression. Id1 is known to be associated with more invasive features of cancer and with the epithelial-mesenchymal transition (EMT). Here, we sought to determine if the increase in cell motility following cyclin D1 silencing was mediated by Id1 and enhanced EMT-features. To further substantiate these findings we aimed to delineate the link between CCND1, ID1 and EMT, as well as clinical properties in primary breast cancer. Protein and gene expression of ID1, CCND1 and EMT markers were determined in MDA-MB-231 and ZR75 cells by western blot and qPCR. Cell migration and promoter occupancy were monitored by transwell and ChIP assays, respectively. Gene expression was analysed from publicly available datasets. The increase in cell migration following cyclin D1 silencing in MDA-MB-231 cells was abolished by Id1 siRNA treatment and we observed cyclin D1 occupancy of the Id1 promoter region. Moreover, ID1 and SNAI2 gene expression was increased following cyclin D1 knock-down, an effect reversed with Id1 siRNA treatment. Similar migratory and SNAI2 increases were noted for the ER-positive ZR75-1 cell line, but in an Id1-independent manner. In a meta-analysis of 1107 breast cancer samples, CCND1 low /ID1 high tumours displayed increased expression of EMT markers and were associated with reduced recurrence free survival. Finally, a greater percentage of CCND1 low /ID1 high tumours were found in the EMT-like 'claudin-low' subtype of breast cancer than in other subtypes. These results indicate that increased migration of MDA-MB-231 cells following cyclin D1 silencing can be mediated by Id
RPD: Reusable Pseudo-Id Distribution for a Secure and Privacy Preserving VANET
Directory of Open Access Journals (Sweden)
Sulaiman Ashraph
2013-08-01
Full Text Available In any VANET, security and privacy are the two fundamental issues. Obtaining efficient security in vehicular communication is essential without compromising privacy-preserving mechanisms. Designing a suitable protocol for VANET by having these two issues in mind is challenging because efficiency, unlinkablity and traceability are the three qualities having contradictions between them. In this paper, we introduce an efficient Reusable Pseudo-id Distribution (RPD scheme. The Trusted Authority (TA designating the Road Side Units (RSUs to generate n reusable pseudo ids and distribute them to the On Board Units (OBUs on request characterizes the proposed protocol. RSUs issue the aggregated hashes of all its valid pseudo-ids along with a symmetric shared key and a particular pseudo-id to each vehicle that enters into its coverage range. Through this the certificates attached to the messages can be eliminated and thus resulting in a significantly reduced packet size. The same anonymous keys can then be re-distributed by the RSUs episodically to other vehicles. We analyze the proposed protocol extensively to demonstrate its merits and efficiency.
Experimental demyelination and axonal loss are reduced in MicroRNA-146a deficient mice
DEFF Research Database (Denmark)
Martin, Nellie A.; Molnar, Viktor; Szilagyi, Gabor T.
2018-01-01
Background: The cuprizone (CPZ) model of multiple sclerosis (MS) was used to identify microRNAs (miRNAs) related to in vivo de- and remyelination. We further investigated the role of miR-146a in miR-146a-deficient (KO) mice: this miRNA is differentially expressed in MS lesions and promotes differ...
Demonstrating idAnimate : a multi-touch system for sketching and rapidly manipulating animations
Quevedo Fernandez, Javier; Martens, J.B.O.S.
2012-01-01
This demonstration presents idAnimate, a multi-touch application for sketching animations. Thanks to the affordances provided by multitouch interfaces, idAnimate yields a novel, intuitive and easy to use animation technique named transformation-by-example, that allows users to author animations in
Expression of Id2 in the Second Heart Field and Cardiac Defects in Id2 Knock-Out Mice
Jongbloed, M. R. M.; Vicente-Steijn, R.; Douglas, Y. L.; Wisse, L. J.; Mori, K.; Yokota, Y.; Bartelings, M. M.; Schalij, M. J.; Mahtab, E. A.; Poelmann, R. E.; Gittenberger-De Groot, A. C.
2011-01-01
The inhibitor of differentiation Id2 is expressed in mesoderm of the second heart field, which contributes myocardial and mesenchymal cells to the primary heart tube. The role of Id2 in cardiac development is insufficiently known. Heart development was studied in sequential developmental stages in
Araújo, Rita; Santos, Joana M O; Fernandes, Mara; Dias, Francisca; Sousa, Hugo; Ribeiro, Joana; Bastos, Margarida M S M; Oliveira, Paula A; Carmo, Diogo; Casaca, Fátima; Silva, Sandra; Medeiros, Rui; Gil da Costa, Rui M
2018-02-01
Persistent human papillomavirus (HPV) infection is associated with the development of certain types of cancer and the dysregulation of microRNAs has been implicated in HPV-associated carcinogenesis. This is the case of microRNA-146a (miR-146a), which is thought to regulate tumor-associated inflammation. We sought to investigate the expression levels of miR-146a during HPV16-mediated carcinogenesis using skin samples from K14-HPV16 transgenic mice which develop the consecutive phases of the carcinogenesis process. Female transgenic (HPV +/- ) and wild-type (HPV -/- ) mice were sacrificed at 24-26 weeks-old or 28-30 weeks-old. Chest and ear skin samples from HPV +/- and HPV -/- mice were histologically classified and used for microRNA extraction and quantification by qPCR. Chest skin samples from 24 to 26 weeks-old HPV +/- mice presented diffuse epidermal hyperplasia and only 22.5% showed multifocal dysplasia, while at 28-30 weeks-old all (100.0%) HPV +/- animals showed epidermal dysplasia. All HPV +/- ear skin samples showed carcinoma in situ (CIS). MiR-146a expression levels were higher in HPV +/- compared to HPV -/- mice (p = 0.006). There was also an increase in miR-146a expression in dysplastic skin lesions compared with hyperplasic lesions (p = 0.011). Samples showing CIS had a significant decrease in miR-146a expression when compared to samples showing epidermal hyperplasia (p = 0.018) and epidermal dysplasia (p = 0.009). These results suggest that HPV16 induces the overexpression of miR-146a in the initial stages of carcinogenesis (hyperplasia and dysplasia), whereas decreases its expression at later stages (CIS). Taken together, these data implicate and suggest different roles of miR-146a in HPV-mediated carcinogenesis.
ID3 contributes to cerebrospinal fluid seeding and poor prognosis in medulloblastoma
International Nuclear Information System (INIS)
Phi, Ji Hoon; Choi, Seung Ah; Lim, Sang-Hee; Lee, Joongyub; Wang, Kyu-Chang; Park, Sung-Hye; Kim, Seung-Ki
2013-01-01
The inhibitor of differentiation (ID) genes have been implicated as promoters of tumor progression and metastasis in many human cancers. The current study investigated the expression and functional roles of ID genes in seeding and prognosis of medulloblastoma. ID gene expression was screened in human medulloblastoma tissues. Knockdown of ID3 gene was performed in medulloblastoma cells in vitro. The expression of metastasis-related genes after ID3 knockdown was assessed. The effect of ID3 knockdown on tumor seeding was observed in an animal model in vivo. The survival of medulloblastoma patients was plotted according to the ID3 expression levels. Significantly higher ID3 expression was observed in medulloblastoma with cerebrospinal fluid seeding than tumors without seeding. Knockdown of ID3 decreased proliferation, increased apoptosis, and suppressed the migration of D283 medulloblastoma cells in vitro. In a seeding model of medulloblastoma, ID3 knockdown in vivo with shRNA inhibited the growth of primary tumors, prevented the development of leptomeningeal seeding, and prolonged animal survival. High ID3 expression was associated with shorter survival of medulloblastoma patients, especially in Group 4 medulloblastomas. High ID3 expression is associated with medullolbastoma seeding and is a poor prognostic factor, especially in patients with Group 4 tumors. ID3 may represent the metastatic/ aggressive phenotype of a subgroup of medulloblastoma
2010-04-01
... ACTIVITIES RECEIVING FEDERAL FINANCIAL ASSISTANCE Introduction § 146.105 Definitions. As used in these Title... financial assistance, or by a recipient, as a condition to becoming a recipient. Designated agency official... education, or an institution of vocational education, as defined in this section. Federal financial...
22 CFR 146.455 - Textbooks and curricular material.
2010-04-01
... 22 Foreign Relations 1 2010-04-01 2010-04-01 false Textbooks and curricular material. 146.455 Section 146.455 Foreign Relations DEPARTMENT OF STATE CIVIL RIGHTS NONDISCRIMINATION ON THE BASIS OF SEX IN EDUCATION PROGRAMS OR ACTIVITIES RECEIVING FEDERAL FINANCIAL ASSISTANCE Discrimination on the Basis of Sex in Education Programs or Activities...
Id2 reinforces TH1 differentiation and inhibits E2A to repress TFH differentiation.
Shaw, Laura A; Bélanger, Simon; Omilusik, Kyla D; Cho, Sunglim; Scott-Browne, James P; Nance, J Philip; Goulding, John; Lasorella, Anna; Lu, Li-Fan; Crotty, Shane; Goldrath, Ananda W
2016-07-01
The differentiation of helper T cells into effector subsets is critical to host protection. Transcription factors of the E-protein and Id families are important arbiters of T cell development, but their role in the differentiation of the TH1 and TFH subsets of helper T cells is not well understood. Here, TH1 cells showed more robust Id2 expression than that of TFH cells, and depletion of Id2 via RNA-mediated interference increased the frequency of TFH cells. Furthermore, TH1 differentiation was blocked by Id2 deficiency, which led to E-protein-dependent accumulation of effector cells with mixed characteristics during viral infection and severely impaired the generation of TH1 cells following infection with Toxoplasma gondii. The TFH cell-defining transcriptional repressor Bcl6 bound the Id2 locus, which provides a mechanism for the bimodal Id2 expression and reciprocal development of TH1 cells and TFH cells.
Excited states in 146Sm and 147Sm
International Nuclear Information System (INIS)
Kownacki, J.; Sujkowski, Z.; Hammaren, E.; Liukkonen, E.; Piiparinen, M.; Lindblad, Th.; Ryde, H.
1979-10-01
The sup(144,146)Nd(α,xn) and sup(146,148)Nd( 3 He,xn) reactions with Esub(α) = 20 - 43 MeV and E 3 sub(He) = 19 - 27 MeV are used to investigate excited states in the isotopes 146 Sm and 147 Sm. The experiments involve measurements of singles γ-ray spectra and conversion electron spectra, γ-ray angular distributions and three parameter (E sub(γ)E sub(γ) time) coincidences. From these experiments information is obtained for states with spin up to I = 13 + and I = 27/2 - , respectively, These states are interpeted within the framework of the cluster-vibration model (CVM) as well as the shell model. (author)
Epigenetic inactivation of inhibitor of differentiation 4 (Id4) correlates with prostate cancer
International Nuclear Information System (INIS)
Sharma, Pankaj; Chinaranagari, Swathi; Patel, Divya; Carey, Jason; Chaudhary, Jaideep
2012-01-01
The inhibitor of DNA-binding (Id) proteins, Id1–4 are negative regulators of basic helix-loop-helix (bHLH) transcription factors. As key regulators of cell cycle and differentiation, expression of Id proteins are increasingly observed in many cancers and associated with aggressiveness of the disease. Of all the four Id proteins, the expression of Id1, Id2, and to a lesser extent, Id3 in prostate cancer and the underlying molecular mechanism is relatively well known. On the contrary, our previous results demonstrated that Id4 acts as a potential tumor suppressor in prostate cancer. In the present study, we extend these observations and demonstrate that Id4 is down-regulated in prostate cancer due to promoter hypermethylation. We used prostate cancer tissue microarrays to investigate Id4 expression. Methylation specific PCR on bisulfite treated DNA was used to determine methylation status of Id4 promoter in laser capture micro-dissected normal, stroma and prostate cancer regions. High Id4 expression was observed in the normal prostate epithelial cells. In prostate cancer, a stage-dependent decrease in Id4 expression was observed with majority of high grade cancers showing no Id4 expression. Furthermore, Id4 expression progressively decreased in prostate cancer cell line LNCaP and with no expression in androgen-insensitive LNCaP-C81 cell line. Conversely, Id4 promoter hypermethylation increased in LNCaP-C81 cells suggesting epigenetic silencing. In prostate cancer samples, loss of Id4 expression was also associated with promoter hypermethylation. Our results demonstrate loss of Id4 expression in prostate cancer due to promoter hypermethylation. The data strongly support the role of Id4 as a tumor suppressor
Association of microRNA 146 with middle ear hyperplasia in pediatric otitis media.
Samuels, Tina L; Yan, Justin; Khampang, Pawjai; MacKinnon, Alexander; Hong, Wenzhou; Johnston, Nikki; Kerschner, Joseph E
2016-09-01
Toll-like receptor signaling activated by bacterial otitis media pathogens in the middle ear has been shown to play a key role in OM susceptibility, pathogenesis and recovery. Recent studies implicate microRNA 146 (miR-146) in regulation of inflammation via negative feedback of toll-like receptor signaling (TLR) in a wide variety of tissues, however its involvement in otitis media is unknown. Human middle ear epithelial cells were stimulated with proinflammatory cytokines, interleukin 1 beta or tumor necrosis factor alpha, for two to twenty-four hours. Middle ear biopsies were collected from children with otitis media with effusion (n = 20), recurrent otitis media (n = 9), and control subjects undergoing cochlear implantation (n = 10). miR-146a, miR-146b expression was assayed by quantitative PCR (qPCR). Expression of miR-146 targets involved in TLR signaling, IRAK1 and TRAF6, was assayed by qPCR in middle ear biopsies. Middle ear biopsies were cryosectioned and epithelial thickness measured by a certified pathologist. Proinflammatory cytokines induced expression of miR-146 in middle ear epithelial cells in vitro. Middle ear miR-146a and miR-146b expression was elevated in otitis media patients relative to control subjects and correlated with middle ear epithelial thickness. A trend towards inverse correlation was observed between miR-146 and TRAF6 expression in the clinical population. This report is the first to assess miRNA expression in a clinical population with OM. Findings herein suggest miR-146 may play a role in OM. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.
Deng, Minnan; Du, Ganqin; Zhao, Jiegang; Du, Xiaowei
2017-06-01
Increasing evidence confirms the involvement of virus infection and miRNA, such as miR-146a, in neuroinflammation-associated epilepsy. In the present study, we investigated the upregulation of miR-146a with RT-qPCR and in situ hybridization methods in a mice infection model of Japanese encephalitis virus (JEV) and in vitro. Subsequently we investigated the involvement of miR-146a in modulating JEV-induced neuroinflammation. It was demonstrated that JEV infection promoted miR-146a production in BALB/c mice brain and in cultured mouse microglial C8-B4 cells, along with pro-inflammatory cytokines, such as IL-1β, IL-6, TNF-α, IFN-β and IFN-α. We also found that miR-146a exerted negative regulatory effects upon IL-1β, IL-6, TNF-α, IFN-β and IFN-α in C8-B4 cells. Accordingly, miR-146a downregulation with a miR-146a inhibitor promoted the upregulation of IL-1β, IL-6, TNF-α, IFN-β and IFN-α, whereas miR-146a upregulation with miR-146a mimics reduced the upregulation of these cytokines. Moreover, miR-146a exerted no regulation upon JEV growth in C8-B4 cells. In conclusion, JEV infection upregulated miR-146a and pro-inflammatory cytokine production, in mice brain and in cultured C8-B4 cells. Furthermore, miR-146a negatively regulated the production of JEV-induced pro-inflammatory cytokines, in virus growth independent fashion, identifying miR-146a as a negative feedback regulator in JEV-induced neuroinflammation, and possibly in epilepsy.
Achieving Payoffs from an Industry Cloud Ecosystem at BankID
DEFF Research Database (Denmark)
Eaton, Ben; Hallingby, Hanne Kristine; Nesse, Per-Jonny
2014-01-01
BankID is an industry cloud owned by Norwegian banks. It provides electronic identity, authentication and electronic signing capabilities for banking, merchant and government services. More than 60% of the population uses BankID services. As the broader ecosystem around BankID evolved, challenges......—arising from tensions between different parts of the ecosystem—had to be resolved. The four lessons learned from the BankID case will help others to build an industry cloud and establish a healthy ecosystem to service a broad user base....
29 CFR 1990.146 - Issues to be considered in the rulemaking.
2010-07-01
... 29 Labor 9 2010-07-01 2010-07-01 false Issues to be considered in the rulemaking. 1990.146 Section 1990.146 Labor Regulations Relating to Labor (Continued) OCCUPATIONAL SAFETY AND HEALTH ADMINISTRATION... CARCINOGENS Regulation of Potential Occupational Carcinogens § 1990.146 Issues to be considered in the...
STUDY OF THE HIGH-SPIN STRUCTURE OF PM-146
RZACAURBAN, T; DURELL, JL; PHILLIPS, WR; VARLEY, BJ; HESS, CP; PEARSON, CJ; VERMEER, WJ; VIEU, C; DIONISIO, JS; PAUTRAT, M; Urban, W
1995-01-01
Excited states in Pm-146 have been investigated through the Xe-136(N-15,5n) and the Nd-146(d,xn) compound-nucleus reactions. A level scheme extending up to 6.9 MeV of excitation energy and (I = 25HBAR) is proposed. Most of the high-spin levels are interpreted in terms of multi-particle-hole states
2010-04-01
... PAYMENT OF TAX, OR WITH DRAWBACK OF TAX Operations by Export Warehouse Proprietors Inventories § 44.146 Closing. A closing inventory shall be made by the export warehouse proprietor when he transfers ownership or concludes business. Where the proprietor transfers ownership the closing inventory shall be made...
A non-parametric peak calling algorithm for DamID-Seq.
Directory of Open Access Journals (Sweden)
Renhua Li
Full Text Available Protein-DNA interactions play a significant role in gene regulation and expression. In order to identify transcription factor binding sites (TFBS of double sex (DSX-an important transcription factor in sex determination, we applied the DNA adenine methylation identification (DamID technology to the fat body tissue of Drosophila, followed by deep sequencing (DamID-Seq. One feature of DamID-Seq data is that induced adenine methylation signals are not assured to be symmetrically distributed at TFBS, which renders the existing peak calling algorithms for ChIP-Seq, including SPP and MACS, inappropriate for DamID-Seq data. This challenged us to develop a new algorithm for peak calling. A challenge in peaking calling based on sequence data is estimating the averaged behavior of background signals. We applied a bootstrap resampling method to short sequence reads in the control (Dam only. After data quality check and mapping reads to a reference genome, the peaking calling procedure compromises the following steps: 1 reads resampling; 2 reads scaling (normalization and computing signal-to-noise fold changes; 3 filtering; 4 Calling peaks based on a statistically significant threshold. This is a non-parametric method for peak calling (NPPC. We also used irreproducible discovery rate (IDR analysis, as well as ChIP-Seq data to compare the peaks called by the NPPC. We identified approximately 6,000 peaks for DSX, which point to 1,225 genes related to the fat body tissue difference between female and male Drosophila. Statistical evidence from IDR analysis indicated that these peaks are reproducible across biological replicates. In addition, these peaks are comparable to those identified by use of ChIP-Seq on S2 cells, in terms of peak number, location, and peaks width.
A non-parametric peak calling algorithm for DamID-Seq.
Li, Renhua; Hempel, Leonie U; Jiang, Tingbo
2015-01-01
Protein-DNA interactions play a significant role in gene regulation and expression. In order to identify transcription factor binding sites (TFBS) of double sex (DSX)-an important transcription factor in sex determination, we applied the DNA adenine methylation identification (DamID) technology to the fat body tissue of Drosophila, followed by deep sequencing (DamID-Seq). One feature of DamID-Seq data is that induced adenine methylation signals are not assured to be symmetrically distributed at TFBS, which renders the existing peak calling algorithms for ChIP-Seq, including SPP and MACS, inappropriate for DamID-Seq data. This challenged us to develop a new algorithm for peak calling. A challenge in peaking calling based on sequence data is estimating the averaged behavior of background signals. We applied a bootstrap resampling method to short sequence reads in the control (Dam only). After data quality check and mapping reads to a reference genome, the peaking calling procedure compromises the following steps: 1) reads resampling; 2) reads scaling (normalization) and computing signal-to-noise fold changes; 3) filtering; 4) Calling peaks based on a statistically significant threshold. This is a non-parametric method for peak calling (NPPC). We also used irreproducible discovery rate (IDR) analysis, as well as ChIP-Seq data to compare the peaks called by the NPPC. We identified approximately 6,000 peaks for DSX, which point to 1,225 genes related to the fat body tissue difference between female and male Drosophila. Statistical evidence from IDR analysis indicated that these peaks are reproducible across biological replicates. In addition, these peaks are comparable to those identified by use of ChIP-Seq on S2 cells, in terms of peak number, location, and peaks width.
Inhibition of KLF7-Targeting MicroRNA 146b Promotes Sciatic Nerve Regeneration.
Li, Wen-Yuan; Zhang, Wei-Ting; Cheng, Yong-Xia; Liu, Yan-Cui; Zhai, Feng-Guo; Sun, Ping; Li, Hui-Ting; Deng, Ling-Xiao; Zhu, Xiao-Feng; Wang, Ying
2018-06-01
A previous study has indicated that Krüppel-like factor 7 (KLF7), a transcription factor that stimulates Schwann cell (SC) proliferation and axonal regeneration after peripheral nerve injury, is a promising therapeutic transcription factor in nerve injury. We aimed to identify whether inhibition of microRNA-146b (miR-146b) affected SC proliferation, migration, and myelinated axon regeneration following sciatic nerve injury by regulating its direct target KLF7. SCs were transfected with miRNA lentivirus, miRNA inhibitor lentivirus, or KLF7 siRNA lentivirus in vitro. The expression of miR146b and KLF7, as well as SC proliferation and migration, were subsequently evaluated. In vivo, an acellular nerve allograft (ANA) followed by injection of GFP control vector or a lentiviral vector encoding an miR-146b inhibitor was used to assess the repair potential in a model of sciatic nerve gap. miR-146b directly targeted KLF7 by binding to the 3'-UTR, suppressing KLF7. Up-regulation of miR-146b and KLF7 knockdown significantly reduced the proliferation and migration of SCs, whereas silencing miR-146b resulted in increased proliferation and migration. KLF7 protein was localized in SCs in which miR-146b was expressed in vivo. Similarly, 4 weeks after the ANA, anti-miR-146b increased KLF7 and its target gene nerve growth factor cascade, promoting axonal outgrowth. Closer analysis revealed improved nerve conduction and sciatic function index score, and enhanced expression of neurofilaments, P0 (anti-peripheral myelin), and myelinated axon regeneration. Our findings provide new insight into the regulation of KLF7 by miR-146b during peripheral nerve regeneration and suggest a potential therapeutic strategy for peripheral nerve injury.
31 CFR 363.146 - May a certificate of indebtedness be pledged or used as collateral?
2010-07-01
... pledged or used as collateral? 363.146 Section 363.146 Money and Finance: Treasury Regulations Relating to... certificate of indebtedness be pledged or used as collateral? A certificate of indebtedness may not be pledged or used as collateral for the performance of an obligation. [69 FR 50309, Aug. 16, 2004. Redesignated...
Transcriptional regulation of miR-146b by C/EBPβ LAP2 in esophageal cancer cells
International Nuclear Information System (INIS)
Li, Junxia; Shan, Fabo; Xiong, Gang; Wang, Ju-Ming; Wang, Wen-Lin; Xu, Xueqing; Bai, Yun
2014-01-01
Highlights: • MiR-146b promotes esophageal cancer cell proliferation. • MiR-146b inhibits esophageal cancer cell apoptosis. • C/EBPβ directly binds to miR-146b promoter conserved region. • MiR-146b is up-regulated by C/EBPβ LAP2 transcriptional activation. - Abstract: Recent clinical study indicated that up-regulation of miR-146b was associated with poor overall survival of patients in esophageal squamous cell carcinoma. However, the underlying mechanism of miR-146b dysregulation remains to be explored. Here we report that miR-146b promotes cell proliferation and inhibits cell apoptosis in esophageal cancer cell lines. Mechanismly, two C/EBPβ binding motifs are located in the miR-146b promoter conserved region. Among the three isoforms of C/EBPβ, C/EBPβ LAP2 positively regulated miR-146b expression and increases miR-146b levels in a dose-dependent manner through transcription activation of miR-146b gene. Together, these results suggest a miR-146b regulatory mechanism involving C/EBPβ, which may contribute to the up-regulation of miR-146b in esophageal squamous cell carcinoma
CDCP1 identifies a CD146 negative subset of marrow fibroblasts involved with cytokine production.
Directory of Open Access Journals (Sweden)
Mineo Iwata
Full Text Available In vitro expanded bone marrow stromal cells contain at least two populations of fibroblasts, a CD146/MCAM positive population, previously reported to be critical for establishing the stem cell niche and a CD146-negative population that expresses CUB domain-containing protein 1 (CDCP1/CD318. Immunohistochemistry of marrow biopsies shows that clusters of CDCP1+ cells are present in discrete areas distinct from areas of fibroblasts expressing CD146. Using a stromal cell line, HS5, which approximates primary CDCP1+ stromal cells, we show that binding of an activating antibody against CDCP1 results in tyrosine-phosphorylation of CDCP1, paralleled by phosphorylation of Src Family Kinases (SFKs Protein Kinase C delta (PKC-δ. When CDCP1 expression is knocked-down by siRNA, the expression and secretion of myelopoietic cytokines is increased. These data suggest CDCP1 expression can be used to identify a subset of marrow fibroblasts functionally distinct from CD146+ fibroblasts. Furthermore the CDCP1 protein may contribute to the defining function of these cells by regulating cytokine expression.
Directory of Open Access Journals (Sweden)
Robert B Lochhead
2014-06-01
Full Text Available MicroRNAs have been shown to be important regulators of inflammatory and immune responses and are implicated in several immune disorders including systemic lupus erythematosus and rheumatoid arthritis, but their role in Lyme borreliosis remains unknown. We performed a microarray screen for expression of miRNAs in joint tissue from three mouse strains infected with Borrelia burgdorferi. This screen identified upregulation of miR-146a, a key negative regulator of NF-κB signaling, in all three strains, suggesting it plays an important role in the in vivo response to B. burgdorferi. Infection of B6 miR-146a-/- mice with B. burgdorferi revealed a critical nonredundant role of miR-146a in modulating Lyme arthritis without compromising host immune response or heart inflammation. The impact of miR-146a was specifically localized to the joint, and did not impact lesion development or inflammation in the heart. Furthermore, B6 miR-146a-/- mice had elevated levels of NF-κB-regulated products in joint tissue and serum late in infection. Flow cytometry analysis of various lineages isolated from infected joint tissue of mice showed that myeloid cell infiltration was significantly greater in B6 miR-146a-/- mice, compared to B6, during B. burgdorferi infection. Using bone marrow-derived macrophages, we found that TRAF6, a known target of miR-146a involved in NF-κB activation, was dysregulated in resting and B. burgdorferi-stimulated B6 miR-146a-/- macrophages, and corresponded to elevated IL-1β, IL-6 and CXCL1 production. This dysregulated protein production was also observed in macrophages treated with IL-10 prior to B. burgdorferi stimulation. Peritoneal macrophages from B6 miR-146a-/- mice also showed enhanced phagocytosis of B. burgdorferi. Together, these data show that miR-146a-mediated regulation of TRAF6 and NF-κB, and downstream targets such as IL-1β, IL-6 and CXCL1, are critical for modulation of Lyme arthritis during chronic infection with B
2010-04-01
... CONSUMPTION CANNED FRUIT JUICES General Provisions § 146.3 Definitions. For the purposes of this part: (a) The... hydrolyzed starch. (c) The term dried glucose sirup means the product obtained by drying glucose sirup. (d... following: Unless otherwise provided in a standard, a lot of canned fruits shall be deemed in compliance for...
UL146 variability among clinical isolates of Human Cytomegalovirus from Japan
Directory of Open Access Journals (Sweden)
Francisco Aguayo
2010-01-01
Full Text Available Human Cytomegalovirus (HCMV is a herpesvirus associated with serious diseases in immunocompromised subjects. The region between ORF UL133 and UL151 from HCMV, named ULb' is frequently deleted in attenuated AD169 and in highly passaged laboratory strains. However, this region is conserved in low-passaged and more virulent HCMV, like the Toledo strain. The UL146 gene, which is located in the ULb' region, encodes a CXC-chemokine analogue. The diversity of UL146 gene was evaluated among fifty-six clinical isolates of HCMV from Japan. Results show that UL146 gene was successfully amplified by the polymerase chain reaction (PCR in only 17/56 strains (30%, while the success rate for UL145/UL147 gene was 18/56 strains (32%. After DNA sequencing, the 35 amplified strains were classified into 8 groups. When compared, variability of UL146 ranged from 25.1% to 52.9% at the DNA level and from 34.5% to 67% at the amino acid level. Seven groups had the interleukin-8 (IL-8 motif ERL (Glu-Leu-Arg CXC and one group had only the CXC motif, suggesting the absence of the IL-8 function of UL146. In conclusion, we found that UL146 gene of HCMV is hyper-variable in clinical strains from Japan suggesting the possibility of a different function in each sequence group.
Id1 represses osteoclast-dependent transcription and affects bone formation and hematopoiesis.
Directory of Open Access Journals (Sweden)
April S Chan
2009-11-01
Full Text Available The bone-bone marrow interface is an area of the bone marrow microenvironment in which both bone remodeling cells, osteoblasts and osteoclasts, and hematopoietic cells are anatomically juxtaposed. The close proximity of these cells naturally suggests that they interact with one another, but these interactions are just beginning to be characterized.An Id1(-/- mouse model was used to assess the role of Id1 in the bone marrow microenvironment. Micro-computed tomography and fracture tests showed that Id1(-/- mice have reduced bone mass and increased bone fragility, consistent with an osteoporotic phenotype. Osteoclastogenesis and pit formation assays revealed that loss of Id1 increased osteoclast differentiation and resorption activity, both in vivo and in vitro, suggesting a cell autonomous role for Id1 as a negative regulator of osteoclast differentiation. Examination by flow cytometry of the hematopoietic compartment of Id1(-/- mice showed an increase in myeloid differentiation. Additionally, we found increased expression of osteoclast genes, TRAP, Oscar, and CTSK in the Id1(-/- bone marrow microenvironment. Lastly, transplantation of wild-type bone marrow into Id1(-/- mice repressed TRAP, Oscar, and CTSK expression and activity and rescued the hematopoietic and bone phenotype in these mice.In conclusion, we demonstrate an osteoporotic phenotype in Id1(-/- mice and a mechanism for Id1 transcriptional control of osteoclast-associated genes. Our results identify Id1 as a principal player responsible for the dynamic cross-talk between bone and bone marrow hematopoietic cells.
Sabolčák, Peter
2006-01-01
FlowIDS is system which can detect some of the undesirable traffi c in computer networks (undesirable traffic could be also ie. virus activity or overloading of network) and mostly doing counteraction which are set by administrator. Information about data ows are provided by hardware of network infrastructure, eliminitaion of undesirable activity is done through changes in network hardware settings. Regarding the quantity of solution which are provided on market, I decided to focus on Cisco n...
RNA-ID, a Powerful Tool for Identifying and Characterizing Regulatory Sequences.
Brule, C E; Dean, K M; Grayhack, E J
2016-01-01
The identification and analysis of sequences that regulate gene expression is critical because regulated gene expression underlies biology. RNA-ID is an efficient and sensitive method to discover and investigate regulatory sequences in the yeast Saccharomyces cerevisiae, using fluorescence-based assays to detect green fluorescent protein (GFP) relative to a red fluorescent protein (RFP) control in individual cells. Putative regulatory sequences can be inserted either in-frame or upstream of a superfolder GFP fusion protein whose expression, like that of RFP, is driven by the bidirectional GAL1,10 promoter. In this chapter, we describe the methodology to identify and study cis-regulatory sequences in the RNA-ID system, explaining features and variations of the RNA-ID reporter, as well as some applications of this system. We describe in detail the methods to analyze a single regulatory sequence, from construction of a single GFP variant to assay of variants by flow cytometry, as well as modifications required to screen libraries of different strains simultaneously. We also describe subsequent analyses of regulatory sequences. © 2016 Elsevier Inc. All rights reserved.
Schultz, A. B.; Spight, L. D.; Colegrove, P. T.; Disanti, M. A.; Fink, U.
1990-01-01
Four color maps of Arp 146 are given. The structure and color of the ring galaxy and its companion show evidence of a bridge of material between the companion and the remnant nucleus of the original galaxy now forming the ring. Broad band spatial coverage clearly defines regions of starburst occurrence.
2010-01-01
... Regulations of the Department of Agriculture (Continued) AGRICULTURAL MARKETING SERVICE (MARKETING AGREEMENTS AND ORDERS; MISCELLANEOUS COMMODITIES), DEPARTMENT OF AGRICULTURE BEEF PROMOTION AND RESEARCH Beef Promotion and Research Order Cattlemen's Beef Promotion and Research Board § 1260.146 Vacancies. To fill any...
Kanabus, Benoît; Popa, Délia
2017-01-01
Dès lors, on entend mieux la question sur laquelle se referment les mille pages du Marx : « La pensée de Marx nous place devant la question abyssale : qu’est-ce que la vie » ? Cette question peut être reposée à nouveaux frais à l’âge du capitalisme avancé, où, comme le notait Adorno, la vie est devenue « l’idéologie de sa propre absence ». La recherche d’un autre rapport à l’idéologie vient alors prendre le relais de la lutte anti-idéologique de la théorie critique. Cette recherche part du po...
19 CFR 146.61 - Constructive transfer to Customs territory.
2010-04-01
... 19 Customs Duties 2 2010-04-01 2010-04-01 false Constructive transfer to Customs territory. 146.61 Section 146.61 Customs Duties U.S. CUSTOMS AND BORDER PROTECTION, DEPARTMENT OF HOMELAND SECURITY... Constructive transfer to Customs territory. The port director shall accept receipt of any entry in proper form...
22 CFR 146.440 - Health and insurance benefits and services.
2010-04-01
... 22 Foreign Relations 1 2010-04-01 2010-04-01 false Health and insurance benefits and services. 146... the Basis of Sex in Education Programs or Activities Prohibited § 146.440 Health and insurance... insurance benefit, service, policy, or plan to any of its students, a recipient shall not discriminate on...
21 CFR 146.148 - Reduced acid frozen concentrated orange juice.
2010-04-01
... 21 Food and Drugs 2 2010-04-01 2010-04-01 false Reduced acid frozen concentrated orange juice. 146... Canned Fruit Juices and Beverages § 146.148 Reduced acid frozen concentrated orange juice. (a) Reduced acid frozen concentrated orange juice is the food that complies with the requirements for composition...
9 CFR 146.33 - Terminology and classification; meat-type chicken slaughter plants.
2010-01-01
...-type chicken slaughter plants. 146.33 Section 146.33 Animals and Animal Products ANIMAL AND PLANT... PLAN FOR COMMERCIAL POULTRY Special Provisions for Meat-Type Chicken Slaughter Plants § 146.33 Terminology and classification; meat-type chicken slaughter plants. Participating meat-type chicken slaughter...
CD146/MCAM defines functionality of human bone marrow stromal stem cell populations
DEFF Research Database (Denmark)
Harkness, Linda; Zaher, Walid; Ditzel, Nicholas
2016-01-01
BACKGROUND: Identification of surface markers for prospective isolation of functionally homogenous populations of human skeletal (stromal, mesenchymal) stem cells (hMSCs) is highly relevant for cell therapy protocols. Thus, we examined the possible use of CD146 to subtype a heterogeneous hMSC...... population. METHODS: Using flow cytometry and cell sorting, we isolated two distinct hMSC-CD146(+) and hMSC-CD146(-) cell populations from the telomerized human bone marrow-derived stromal cell line (hMSC-TERT). Cells were examined for differences in their size, shape and texture by using high...... and adipocytes on the basis of gene expression and protein production of lineage-specific markers. In vivo, hMSC-CD146(+) and hMSC-CD146(-) cells formed bone and bone marrow organ when implanted subcutaneously in immune-deficient mice. Bone was enriched in hMSC-CD146(-) cells (12.6 % versus 8.1 %) and bone...
International Nuclear Information System (INIS)
Kuang Wei; Tan Jiali; Duan Yinzhong; Duan Jianmin; Wang Weijian; Jin Fang; Jin Zuolin; Yuan Xiao; Liu Yanpu
2009-01-01
Proliferation and differentiation of muscle stem cells must be tightly regulated by intrinsic and extrinsic signals for effective regeneration and adaptive response. MicroRNAs have been implicated as potent regulators in diverse biological processes at the level of posttranscriptional repression. In this study, we found that miR-146a was significantly upregulated upon a 48-h cyclic stretch of 5% elongation/10cycles/min. Importantly, miR-146 was predicted to base-pair with sequences in the 3' UTR of Numb, which promotes satellite cell differentiation towards muscle cells by inhibiting Notch signaling. Through reporter assay and exogenous expression experiment, we confirmed Numb was inhibited by miR-146a. Inhibition of miR-146a by antago-miR-146a rescued the expression of Numb and facilitated the differentiation of C2C12 at a cost of compromised proliferation. Thus, for the first time, we propose a role of miR-146a in skewing the balance of muscle differentiation and proliferation through inhibiting the expression of Numb.
Si, Chengshuai; Yu, Qiao; Yao, Yufeng
2018-05-01
MicroRNA (miR)-146a-5p functions as a tumor suppressor in various types of cancer. However, the role of miR-146a-5p in the development of triple-negative breast cancer (TNBC) is unclear. The present study aimed to investigate the role of miR-146a-5p in TNBC. The expression level of miR-146a-5p in TNBC tissues and cell lines was initially detected using reverse transcription-quantitative polymerase chain reaction. To predict the target gene of miR-146a-5p, TargetScan software was used and a dual luciferase assay was performed to verify the prediction. Furthermore, in order to explore the role of miR-146a-5p in TNBC, miR-146a-5p was overexpressed in TNBC cells using miR-146a-5p mimics. An MTT assay was performed to detect cell proliferation, and a Transwell assay was conducted to determine cell migration and invasion. Furthermore, western blotting was performed to measure associated protein expression. It was revealed that miR-146a-5p was downregulated in TNBC tissues and cell lines. SOX5 was indicated to be a target gene of miR-146a-5p and was upregulated in TNBC cells. Additionally, miR-146a-5p could inhibit TNBC cell proliferation, migration and invasion, repress the expression of mesenchymal markers (N-cadherin, vimentin and fibronectin) and increase epithelial marker (E-cadherin) expression. Furthermore, SOX5 overexpression eliminated the effects of miR-146a-5p mimics on TNBC cells. In conclusion, the data of the present study indicated that miR-146a-5p inhibits the proliferation and metastasis of TNBC cells by regulating SOX5.
ID-pilet teeb Tallinnas võidukäiku / Anneli Lepp
Lepp, Anneli
2006-01-01
Vt. ka Postimees : na russkom jazõke 12. jaan. lk 3. Tallinna transpordiameti peaökonomisti Mart Moosuse sõnul moodustas ID-pilet 60,7% ühistranspordi piletituludest, Tartus oli vastav näitaja aga alla 1%. Tartut teenindava bussifirma AS Connex Eesti finantsjuht Tiina Telling peab suure erinevuse põhjuseks asjaolu, et Tallinnas on ID-pilet paberpiletist 40-88% soodsam, Tartus hinnavahe aga puudub või on lausa negatiivne ID-pileti kahjuks. Lisa: ID-pilet
Directory of Open Access Journals (Sweden)
Hendro Agus Prakoso
2016-09-01
berita kedua media tersebut. Frekuensi berita berjumlah 107 di Republika.co.id dan 51 berita di Tempo.co.id Ragam berita Republika.co.id didominasi konsep Spesialisasi sebesar 22,4% dari 107 berita, sedangkan pada Tempo.co.id didominasi konsep Nama baik sebesar 23,5% dari 51 berita. Sumber berita pada Republika.co.id mayoritas berasal dari Liputan langsung sebesar 42,9% dari 107 berita sedangkan pada Tempo.co.id mayoritas berasal dari Intelektual sebesar 54,9% dari 51 berita.
Id2 reinforces TH1 cell differentiation and inhibits E2A to repress TFH cell differentiation
Shaw, Laura A.; Bélanger, Simon; Omilusik, Kyla D.; Cho, Sunglim; Scott-Browne, James P.; Nance, J. Philip; Goulding, John; Lasorella, Anna; Lu, Li-Fan; Crotty, Shane; Goldrath, Ananda W.
2016-01-01
Differentiation of T helper (TH) effector subsets is critical for host protection. E protein transcription factors and Id proteins are important arbiters of T cell development, but their role in differentiation of TH1 and TFH cells is not well understood. TH1 cells showed robust Id2 expression compared to TFH cells, and RNAi depletion of Id2 increased TFH cell frequencies. Further, TH1 cell differentiation was blocked by Id2 deficiency, leading to E protein-dependent accumulation of effector cells with mixed characteristics during viral infection and severely impaired generation of TH1 cells following Toxoplasma gondii infection. The TFH-defining transcriptional repressor Bcl6 bound the Id2 locus, providing a mechanism for the bimodal Id2 expression and reciprocal development of TH1 and TFH cell fates. PMID:27213691
People with ID as interviewers and co-researchers: experiences and reflection.
Lieshout, H. van
2012-01-01
Aim: To share the experience of working with people with intellectual disabilities (ID) as interviewers in a qualitative study about community participation of people with ID. We reflect on two perspectives: the interviewers and the researchers. Method: Eighteen people with ID were interviewed by
Relationship between major depressive disorder and ACE gene I/D polymorphism in a Turkish population
Directory of Open Access Journals (Sweden)
Sema Inanir
2016-04-01
Full Text Available Abstract Background Major depressive disorder (MDD is a complex disease and a significant health problem that is prevalent across the world. Angiotensin-converting enzyme (ACE has an important role in renin-angiotensin system (RAS and converts inactive angiotensin I to a potent vasopressor and aldosterone-stimulating peptide angiotensin II. Levels of ACE in plasma vary according to the insertion/deletion (I/D polymorphism of ACE gene. Objective The aim of the current study was to examine the influence ACE gene I/D variations on the risk of MDD. Methods In the present case-control study, we analyzed ACE I/D polymorphism in 346 MDD patients and 210 healthy subjects using polymerase chain reaction technique. Results Comparing the two groups, no significant difference was observed with regard to either genotype distributions or allele frequencies of the I/D polymorphism of ACE gene. Discussion Our findings suggest that the ACE I/D polymorphism is not associated with MDD in Turkish case-control study. Further studies are still needed.
An online ID identification system for liquefied-gas cylinder plant
He, Jin; Ding, Zhenwen; Han, Lei; Zhang, Hao
2017-11-01
An automatic ID identification system for gas cylinders' online production was developed based on the production conditions and requirements of the Technical Committee for Standardization of Gas Cylinders. A cylinder ID image acquisition system was designed to improve the image contrast of ID regions on gas cylinders against the background. Then the ID digits region was located by the CNN template matching algorithm. Following that, an adaptive threshold method based on the analysis of local average grey value and standard deviation was proposed to overcome defects of non-uniform background in the segmentation results. To improve the single digit identification accuracy, two BP neural networks were trained respectively for the identification of all digits and the easily confusable digits. If the single digit was classified as one of confusable digits by the former BP neural network, it was further tested by the later one, and the later result was taken as the final identification result of this single digit. At last, the majority voting was adopted to decide the final identification result for the 6-digit cylinder ID. The developed system was installed on a production line of a liquefied-petroleum-gas cylinder plant and worked in parallel with the existing weighing step on the line. Through the field test, the correct identification rate for single ID digit was 94.73%, and none of the tested 2000 cylinder ID was misclassified through the majority voting.
11 CFR 100.146 - Legal or accounting services to other political committees.
2010-01-01
... 11 Federal Elections 1 2010-01-01 2010-01-01 false Legal or accounting services to other political committees. 100.146 Section 100.146 Federal Elections FEDERAL ELECTION COMMISSION GENERAL SCOPE AND DEFINITIONS (2 U.S.C. 431) Exceptions to Expenditures § 100.146 Legal or accounting services to other...
38 CFR 21.146 - Independent instructor course.
2010-07-01
.... Chapter 31 Special Rehabilitation Services § 21.146 Independent instructor course. (a) Definition. An... the customary channels leading to employment may not be readily available to a veteran requiring an...
A functionally significant polymorphism in ID3 is associated with human coronary pathology.
Directory of Open Access Journals (Sweden)
Ani Manichaikul
Full Text Available We previously identified association between the ID3 SNP rs11574 and carotid intima-media thickness in the Diabetes Heart Study, a predominantly White diabetic population. The nonsynonymous SNP rs11574 results in an amino acid substitution in the C-terminal region of ID3, attenuating the dominant negative function of ID3 as an inhibitor of basic HLH factor E12-mediated transcription. In the current investigation, we characterize the association between the functionally significant polymorphism in ID3, rs11574, with human coronary pathology.The Multi-Ethnic Study of Atherosclerosis (MESA is a longitudinal study of subclinical cardiovascular disease, including non-Hispanic White (n = 2,588, African American (n = 2,560 and Hispanic (n = 2,130 participants with data on coronary artery calcium (CAC. The Coronary Assessment in Virginia cohort (CAVA included 71 patients aged 30-80 years, undergoing a medically necessary cardiac catheterization and intravascular ultrasound (IVUS at the University of Virginia. ID3 SNP rs11574 risk allele was associated with the presence of CAC in MESA Whites (P = 0.017. In addition, the risk allele was associated with greater atheroma burden and stenosis in the CAVA cohort (P = 0.003, P = 0.04 respectively. The risk allele remained predictive of atheroma burden in multivariate analysis (Model 1: covariates age, gender, and LDL, regression coefficient = 9.578, SE = 3.657, p = 0.0110; Model 2: covariates Model 1, presence of hypertension, presence of diabetes, regression coefficient = 8.389, SE = 4.788, p = 0.0163.We present additional cohorts that demonstrate association of ID3 SNP rs11574 directly with human coronary artery pathology as measured by CAC and IVUS: one a multiethnic, relatively healthy population with low levels of diabetes and the second a predominantly White population with a higher incidence of T2DM referred for cardiac catheterization.
Schieve, Laura A.; Clayton, Heather B.; Durkin, Maureen S.; Wingate, Martha S.; Drews-Botsch, Carolyn
2015-01-01
While studies report associations between perinatal outcomes and both autism spectrum disorder (ASD) and intellectual disability (ID), there has been little study of ASD with versus without co-occurring ID. We compared perinatal risk factors among 7547 children in the 2006-2010 Autism and Developmental Disability Monitoring Network classified as…
19 CFR 146.8 - Seals, authority of operator to break and affix.
2010-04-01
... 19 Customs Duties 2 2010-04-01 2010-04-01 false Seals, authority of operator to break and affix. 146.8 Section 146.8 Customs Duties U.S. CUSTOMS AND BORDER PROTECTION, DEPARTMENT OF HOMELAND SECURITY; DEPARTMENT OF THE TREASURY (CONTINUED) FOREIGN TRADE ZONES General Provisions § 146.8 Seals, authority of...
14 CFR 1260.146 - Procurement records.
2010-01-01
... Higher Education, Hospitals, and Other Non-Profit Organizations Procurement Standards § 1260.146... of competition when competitive bids or offers are not obtained, and (c) Basis for award cost or price. ...
19 CFR 146.21 - General requirements.
2010-04-01
... TREASURY (CONTINUED) FOREIGN TRADE ZONES Inventory Control and Recordkeeping System § 146.21 General requirements. (a) Systems capability. The operator shall maintain either manual or automated inventory control... English language copy of its written inventory control and recordkeeping systems procedures manual in...
Supporting co-creation with software, the idSpace platform
Van Rosmalen, Peter; Boon, Jo; Bitter-Rijpkema, Marlies; Sie, Rory; Sloep, Peter
2014-01-01
Innovation, in general, requires teamwork among specialist of different disciplines. The idSpace project developed ideas on how teams of collaborating innovators could best be supported. These ideas were embodied in a platform that the project developed. This idSpace platform allows its users to
22 CFR 146.120 - Transfers of property.
2010-04-01
... PROGRAMS OR ACTIVITIES RECEIVING FEDERAL FINANCIAL ASSISTANCE Introduction § 146.120 Transfers of property... financial assistance to a transferee that operates any education program or activity, and the Federal share...
Picture This: How to Establish an Effective School ID Card Program
Finkelstein, David
2013-01-01
Most school districts do not have an ID card policy that everyone knows and follows, yet. many school districts are implementing ID card programs to address concerns about safety, efficiency, and convenience. A well-thought-out ID card program leads to greater security and smoother operations throughout the school and should thus be a priority.…
IMI's CANCER-ID: Status of liquid biopsy standardization
Pantel, Klaus; Terstappen, Leon W. M. M.; Baggiani, Barbara; Krahn, Thomas; Schlange, Thomas
The CANCER-ID (www.cancer-id.eu) consortium was established in early 2015 with more than 30 partners as part of the Innovative Medicines Initiative (IMI), Europe's largest public-private partnership funded in equal parts by the European Union and the European Federation of Pharmaceutical Industries
Security analysis for biometric data in ID documents
Schimke, S.; Kiltz, S.; Vielhauer, C.; Kalker, A.A.C.M.
2005-01-01
In this paper we analyze chances and challenges with respect to the security of using biometrics in ID documents. We identify goals for ID documents, set by national and international authorities, and discuss the degree of security, which is obtainable with the inclusion of biometric into documents
Knoto-ID: a tool to study the entanglement of open protein chains using the concept of knotoids.
Dorier, Julien; Goundaroulis, Dimos; Benedetti, Fabrizio; Stasiak, Andrzej
2018-05-02
The backbone of most proteins forms an open curve. To study their entanglement, a common strategy consists in searching for the presence of knots in their backbones using topological invariants. However, this approach requires to close the curve into a loop, which alters the geometry of curve. Knoto-ID allows evaluating the entanglement of open curves without the need to close them, using the recent concept of knotoids which is a generalization of the classical knot theory to open curves. Knoto-ID can analyse the global topology of the full chain as well as the local topology by exhaustively studying all subchains or only determining the knotted core. Knoto-ID permits to localize topologically non-trivial protein folds that are not detected by informatics tools detecting knotted protein folds. Knoto-ID is written in C ++ and includes R (www.R-project.org) scripts to generate plots of projections maps, fingerprint matrices and disk matrices. Knoto-ID is distributed under the GNU General Public License (GPL), version 2 or any later version and is available at https://github.com/sib-swiss/Knoto-ID. A binary distribution for Mac OS X, Linux and Windows with detailed user guide and examples can be obtained from https://www.vital-it.ch/software/Knoto-ID. julien.dorier@sib.swiss.
Optical isotype shifts of 146Sm and 151Sm
International Nuclear Information System (INIS)
Eastham, D.A.; Walker, P.M.; Griffith, J.A.R.; Evans, D.E.; England, J.G.; Grant, I.S.
1984-01-01
We have measured the optical isotope shifts of 146 Sm and 151 Sm by laser resonance fluorescence. From these measurements the changes in the mean square nuclear radii are: delta 2 > (A=144 to 146)=0.266(10) fm 2 , and delta 2 > (A=151 to 152)=0.262(10) fm 2 . These results, together with those of the stable isotopes, show that the average nuclear expansion of samarium can be accounted for by the liquid drop model with deformations. (orig.)
22 CFR 146.115 - Assurance required.
2010-04-01
... PROGRAMS OR ACTIVITIES RECEIVING FEDERAL FINANCIAL ASSISTANCE Introduction § 146.115 Assurance required. (a... applications for Federal financial assistance or awards of Federal financial assistance contain, be accompanied... assurance. (b) Duration of obligation. (1) In the case of Federal financial assistance extended to provide...
40 CFR 146.67 - Operating requirements.
2010-07-01
... serving as a water supply, place a notice in a newspaper of general circulation. (2) The Director may... 146.67 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) WATER PROGRAMS (CONTINUED... steps to determine the presence or absence of a leak; and (3) Notify the Director within 24 hours after...
A Neighborhood Condition for Fractional ID-[A, B]-Factor-Critical Graphs
Directory of Open Access Journals (Sweden)
Zhou Sizhong
2016-05-01
Full Text Available Let G be a graph of order n, and let a and b be two integers with 1 ≤ a ≤ b. Let h : E(G → [0, 1] be a function. If a ≤ ∑e∋x h(e ≤ b holds for any x ∈ V (G, then we call G[Fh] a fractional [a, b]-factor of G with indicator function h, where Fh = {e ∈ E(G : h(e > 0}. A graph G is fractional independent-set-deletable [a, b]-factor-critical (in short, fractional ID-[a, b]- factor-critical if G − I has a fractional [a, b]-factor for every independent set I of G. In this paper, it is proved that if for any two nonadjacent vertices x, y ∈ V (G, then G is fractional ID-[a, b]-factor-critical. Furthermore, it is shown that this result is best possible in some sense.
Guinea pig ID-like families of SINEs.
Kass, David H; Schaetz, Brian A; Beitler, Lindsey; Bonney, Kevin M; Jamison, Nicole; Wiesner, Cathy
2009-05-01
Previous studies have indicated a paucity of SINEs within the genomes of the guinea pig and nutria, representatives of the Hystricognathi suborder of rodents. More recent work has shown that the guinea pig genome contains a large number of B1 elements, expanding to various levels among different rodents. In this work we utilized A-B PCR and screened GenBank with sequences from isolated clones to identify potentially uncharacterized SINEs within the guinea pig genome, and identified numerous sequences with a high degree of similarity (>92%) specific to the guinea pig. The presence of A-tails and flanking direct repeats associated with these sequences supported the identification of a full-length SINE, with a consensus sequence notably distinct from other rodent SINEs. Although most similar to the ID SINE, it clearly was not derived from the known ID master gene (BC1), hence we refer to this element as guinea pig ID-like (GPIDL). Using the consensus to screen the guinea pig genomic database (Assembly CavPor2) with Ensembl BlastView, we estimated at least 100,000 copies, which contrasts markedly to just over 100 copies of ID elements. Additionally we provided evidence of recent integrations of GPIDL as two of seven analyzed conserved GPIDL-containing loci demonstrated presence/absence variants in Cavia porcellus and C. aperea. Using intra-IDL PCR and sequence analyses we also provide evidence that GPIDL is derived from a hystricognath-specific SINE family. These results demonstrate that this SINE family continues to contribute to the dynamics of genomes of hystricognath rodents.
Directory of Open Access Journals (Sweden)
Sylvie Bouvier
Full Text Available Although progress was made in in vitro fertilization (IVF techniques, the majority of embryos transferred fail to implant. Morphology embryo scoring is the standard procedure for most of IVF centres for choosing the best embryo, but remains limited since even the embryos classified as "top quality" may not implant. As it has been shown that i CD146 is involved in embryo implantation and ii membrane form is shed to generate soluble CD146 (sCD146, we propose that sCD146 in embryo supernatants may constitute a new biomarker of embryo selection. Immunocytochemical staining showed expression of CD146 in early embryo stages and sCD146 was detected by ELISA and Western-blot in embryo supernatants from D2. We retrospectively studied 126 couples who underwent IVF attempt. The embryo culture medium from each transferred embryo (n = 222 was collected for measurement of sCD146 by ELISA. Significantly higher sCD146 concentrations were present in embryo supernatants that did not implant (n = 185 as compared to those that successfully implanted (n = 37 (1310 +/- 1152 pg.mL-1 vs. 845+/- 1173 pg.mL-1, p = 0.024. Sensitivity analysis performed on single embryo transfers (n = 71 confirmed this association (p = 0.0054. The computed ROC curve established that the optimal sCD146 concentration for embryo implantation is under 1164 pg.mL-1 (sensitivity: 76%, specificity: 48%, PPV: 25% and NPV: 92%. Over this sCD146 threshold, the implantation rate was significantly lower (9% with sCD146 levels >1164 pg.ml-1 vs. 22% with sCD146 levels ≤ 1164 pg.mL-1, p = 0.01. Among the embryos preselected by morphologic scoring, sCD146 determination could allow a better selection of the embryo(s, thus improving the success of elective single embryo transfer. This study establishes the proof of concept for the use of sCD146 as a biomarker for IVF by excluding the embryo with the highest sCD146 level. A multicentre prospective study will now be necessary to further establish its use in
Directory of Open Access Journals (Sweden)
Wing Pui Tsang
Full Text Available The human umbilical cord perivascular cells (HUCPVCs have been considered as an alternative source of mesenchymal progenitors for cell based regenerative medicine. However, the biological properties of these cells remain to be well characterized. In the present study, HUCPVCs were isolated and sorted by CD146(+ pericyte marker. The purified CD146(+ HUCPVCs were induced to differentiate efficiently into osteoblast, chondrocyte and adipocyte lineages in vitro. Six weeks following subcutaneous transplantation of CD146(+ HUCPVCs-Gelfoam-alginate 3D complexes in severe combined immunodeficiency (SCID mice, newly formed bone matrix with embedded osteocytes of donor origin was observed. The functional engraftment of CD146(+ HUCPVCs in the new bone regenerates was further confirmed in a critical-sized bone defect model in SCID mice. Hypoxic conditions suppressed osteogenic differentiation while increased cell proliferation and colony-forming efficiency of CD146(+ HUCPVCs as compared to that under normoxic conditions. Re-oxygenation restored the multi-differentiation potential of the CD146(+ HUCPVCs. Western blot analysis revealed an upregulation of HIF-1α, HIF-2α, and OCT-4 protein expression in CD146(+ HUCPVCs under hypoxia, while there was no remarkable change in SOX2 and NANOG expression. The gene expression profiles of stem cell transcription factors between cells treated by normoxia and hypoxic conditions were compared by PCR array analysis. Intriguingly, PPAR-γ was dramatically downregulated (20-fold in mRNA expression under hypoxia, and was revealed to possess a putative binding site in the Hif-2α gene promoter region. Chromatin immunoprecipitation assays confirmed the binding of PPAR-γ protein to the Hif-2α promoter and the binding was suppressed by hypoxia treatment. Luciferase reporter assay showed that the Hif-2α promoter activity was suppressed by PPAR expression. Thus, PPAR-γ may involve in the regulation of HIF-2α for stemness
La certificazione professionale I&D in Europa
Franco, Augusta
2003-01-01
The statement points out the activity of I&D European associations in the field of competences' certification, in ECIA federation's area as well as in the national one. In the statement there are references on history and outcomes of DECIDoc project; objectives and operative stages of CERTIDoc project, promoted by ECIA; and enterprises of I&D associations in France, Spain, Germany and Italy. Secondly, it is illustrated the activity of Italian librarians and archivists associatio...
New levels and reinvestigation of octupole correlations in {sup 146,147}La
Energy Technology Data Exchange (ETDEWEB)
Wang, E.H.; Zachary, C.J.; Hamilton, J.H.; Ramayya, A.V.; Hwang, J.K.; Liu, S.H.; Brewer, N.T. [Vanderbilt University, Department of Physics and Astronomy, Nashville, TN (United States); Lewis, W. [Vanderbilt University, Department of Physics and Astronomy, Nashville, TN (United States); Furman University, Department of Physics, Greenville, SC (United States); Luo, Y.X. [Vanderbilt University, Department of Physics and Astronomy, Nashville, TN (United States); Lawrence Berkeley National Laboratory, Berkeley, CA (United States); Rasmussen, J.O. [Lawrence Berkeley National Laboratory, Berkeley, CA (United States); Zhu, S.J. [Tsinghua University, Department of Physics, Beijing (China); Ter-Akopian, G.M.; Oganessian, Yu.Ts. [Joint Institute for Nuclear Research, Dubna (Russian Federation)
2017-12-15
High spin states of neutron-rich {sup 146,147}La have been reinvestigated by γ-γ-γ and γ-γ-γ-γ coincidence data from a {sup 252}Cf spontaneous fission experiment by using Gammasphere. Thirty-two new transitions in {sup 146}La are observed. Two new bands in {sup 146}La have been established. One of them is proposed to be the octupole parity partner of the previously known band. Twenty new transitions in {sup 147}La are observed. The ground state band of {sup 147}La has been established with a proposed 5/2{sup +} band-head. Angular correlation of cascades has been used to study the spins and parities of the states. The B(E1)/B(E2) ratios and dipole moments of bands in {sup 146,} {sup 147}La have been measured. (orig.)
The Self-Identity Protein IdsD Is Communicated between Cells in Swarming Proteus mirabilis Colonies.
Saak, Christina C; Gibbs, Karine A
2016-12-15
Proteus mirabilis is a social bacterium that is capable of self (kin) versus nonself recognition. Swarming colonies of this bacterium expand outward on surfaces to centimeter-scale distances due to the collective motility of individual cells. Colonies of genetically distinct populations remain separate, while those of identical populations merge. Ids proteins are essential for this recognition behavior. Two of these proteins, IdsD and IdsE, encode identity information for each strain. These two proteins bind in vitro in an allele-restrictive manner. IdsD-IdsE binding is correlated with the merging of populations, whereas a lack of binding is correlated with the separation of populations. Key questions remained about the in vivo interactions of IdsD and IdsE, specifically, whether IdsD and IdsE bind within single cells or whether IdsD-IdsE interactions occur across neighboring cells and, if so, which of the two proteins is exchanged. Here we demonstrate that IdsD must originate from another cell to communicate identity and that this nonresident IdsD interacts with IdsE resident in the recipient cell. Furthermore, we show that unbound IdsD in recipient cells does not cause cell death and instead appears to contribute to a restriction in the expansion radius of the swarming colony. We conclude that P. mirabilis communicates IdsD between neighboring cells for nonlethal kin recognition, which suggests that the Ids proteins constitute a type of cell-cell communication. We demonstrate that self (kin) versus nonself recognition in P. mirabilis entails the cell-cell communication of an identity-encoding protein that is exported from one cell and received by another. We further show that this intercellular exchange affects swarm colony expansion in a nonlethal manner, which adds social communication to the list of potential swarm-related regulatory factors. Copyright © 2016, American Society for Microbiology. All Rights Reserved.
Bogema, Daniel R; Deutscher, Ania T; Woolley, Lauren K; Seymour, Lisa M; Raymond, Benjamin B A; Tacchi, Jessica L; Padula, Matthew P; Dixon, Nicholas E; Minion, F Chris; Jenkins, Cheryl; Walker, Mark J; Djordjevic, Steven P
2012-01-01
Mycoplasma hyopneumoniae causes enormous economic losses to swine production worldwide by colonizing the ciliated epithelium in the porcine respiratory tract, resulting in widespread damage to the mucociliary escalator, prolonged inflammation, reduced weight gain, and secondary infections. Protein Mhp684 (P146) comprises 1,317 amino acids, and while the N-terminal 400 residues display significant sequence identity to the archetype cilium adhesin P97, the remainder of the molecule is novel and displays unusual motifs. Proteome analysis shows that P146 preprotein is endogenously cleaved into three major fragments identified here as P50(P146), P40(P146), and P85(P146) that reside on the cell surface. Liquid chromatography with tandem mass spectrometry (LC-MS/MS) identified a semitryptic peptide that delineated a major cleavage site in Mhp684. Cleavage occurred at the phenylalanine residue within sequence (672)ATEF↓QQ(677), consistent with a cleavage motif resembling S/T-X-F↓X-D/E recently identified in Mhp683 and other P97/P102 family members. Biotinylated surface proteins recovered by avidin chromatography and separated by two-dimensional gel electrophoresis (2-D GE) showed that more-extensive endoproteolytic cleavage of P146 occurs. Recombinant fragments F1(P146)-F3(P146) that mimic P50(P146), P40(P146), and P85(P146) were constructed and shown to bind porcine epithelial cilia and biotinylated heparin with physiologically relevant affinity. Recombinant versions of F3(P146) generated from M. hyopneumoniae strain J and 232 sequences strongly bind porcine plasminogen, and the removal of their respective C-terminal lysine and arginine residues significantly reduces this interaction. These data reveal that P146 is an extensively processed, multifunctional adhesin of M. hyopneumoniae. Extensive cleavage coupled with variable cleavage efficiency provides a mechanism by which M. hyopneumoniae regulates protein topography. Vaccines used to control Mycoplasma
Application of Sharī‘ah contracts in contemporary Islamic finance: A maqāṣid perspective
Directory of Open Access Journals (Sweden)
Younes Soualhi
2015-12-01
Full Text Available This research exposes the underlying maqāṣid embedded in Sharī‘ah contracts as applied in Islamic banking and finance. It addresses the problem of not observing maqāṣid in nominated and combined Sharī‘ah contracts as well as the problem of not sufficiently imbuing maqāṣid in products developed by Islamic financial institutions. As a benchmark of the maqāṣid of wealth, the research adopts Ibn ‘Āshūr’s classification of maqāṣid to evaluate the conformity of Sharī‘ah contracts to Maqāṣid al-Sharī‘ah namely, justice, circulation, transparency, and firmness. The study focuses on three markets related to the application of Sharī‘ah contracts, namely, banking, Islamic capital market, and takāful. The study concludes that, by and large, the application of Sharī‘ah contracts has observed Maqāṣid al-Sharī‘ah during its development and initial application stages of Islamic finance products; however, offering such products in the market has raised economic questions as to their viability and economic values. In addition, the malpractice of some Sharī‘ah contracts has long raised concerns as to the maqāṣid compliance of such products. The research recommends a de-sophistication of Islamic financial engineering to minimise the possibility of convergence with conventional finance. The research also emphasises product differentiation based on less complicated combined Sharī‘ah contracts.
International Nuclear Information System (INIS)
Liu Xiangde; Nelson, Amy; Wang Xingqi; Kanaji, Nobuhiro; Kim, Miok; Sato, Tadashi; Nakanishi, Masanori; Li Yingji; Sun Jianhong; Michalski, Joel; Patil, Amol; Basma, Hesham; Rennard, Stephen I.
2009-01-01
MicroRNA plays an important role in cell differentiation, proliferation and cell death. The current study found that miRNA-146a was up-regulated in human bronchial epithelial cells (HBECs) in response to stimulation by TGF-ss1 plus cytomix (a mixture of IL-1ss, IFN-γ and TNF-α). TGF-ss1 plus cytomix (TCM) induced apoptosis in HBECs (3.4 ± 0.6% of control vs 83.1 ± 4.0% of TCM treated cells, p < 0.01), and this was significantly blocked by the miRNA-146a mimic (8.8 ± 1.5%, p < 0.01). In contrast, a miRNA-146a inhibitor had only a modest effect on cell survival but appeared to augment the induction of epithelial-mesenchymal transition (EMT) in response to the cytokines. The MicroRNA-146a mimic appears to modulate HBEC survival through a mechanism of up-regulating Bcl-XL and STAT3 phosphorylation, and by this mechanism it could contribute to tissue repair and remodeling.
Best practices for the implementation of the REAL ID Act.
2015-10-01
The REAL ID Act specifies the minimum standards that must be used to produce and issue drivers license and : identification cards that are REAL ID compliant. Beginning in 2020, if a person does not possess a form of : identification that meets REA...
OpenID Connect as a security service in cloud-based medical imaging systems.
Ma, Weina; Sartipi, Kamran; Sharghigoorabi, Hassan; Koff, David; Bak, Peter
2016-04-01
The evolution of cloud computing is driving the next generation of medical imaging systems. However, privacy and security concerns have been consistently regarded as the major obstacles for adoption of cloud computing by healthcare domains. OpenID Connect, combining OpenID and OAuth together, is an emerging representational state transfer-based federated identity solution. It is one of the most adopted open standards to potentially become the de facto standard for securing cloud computing and mobile applications, which is also regarded as "Kerberos of cloud." We introduce OpenID Connect as an authentication and authorization service in cloud-based diagnostic imaging (DI) systems, and propose enhancements that allow for incorporating this technology within distributed enterprise environments. The objective of this study is to offer solutions for secure sharing of medical images among diagnostic imaging repository (DI-r) and heterogeneous picture archiving and communication systems (PACS) as well as Web-based and mobile clients in the cloud ecosystem. The main objective is to use OpenID Connect open-source single sign-on and authorization service and in a user-centric manner, while deploying DI-r and PACS to private or community clouds should provide equivalent security levels to traditional computing model.
Interoperability for electronic ID
Zygadlo, Zuzanna
2009-01-01
Electronic Business, including eBanking, eCommerce and eGovernmental services, is today based on a large variety of security solutions, comprising electronic IDs provided by a broad community of Public Key Infrastructure (PKI) vendors. Significant differences in implementations of those solutions introduce a problem of lack of interoperability in electronic business, which have not yet been resolved by standardization and interoperability initiatives based on existing PKI trust models. It i...
ID4 promotes AR expression and blocks tumorigenicity of PC3 prostate cancer cells
International Nuclear Information System (INIS)
Komaragiri, Shravan Kumar; Bostanthirige, Dhanushka H.; Morton, Derrick J.; Patel, Divya; Joshi, Jugal; Upadhyay, Sunil; Chaudhary, Jaideep
2016-01-01
Deregulation of tumor suppressor genes is associated with tumorigenesis and the development of cancer. In prostate cancer, ID4 is epigenetically silenced and acts as a tumor suppressor. In normal prostate epithelial cells, ID4 collaborates with androgen receptor (AR) and p53 to exert its tumor suppressor activity. Previous studies have shown that ID4 promotes tumor suppressive function of AR whereas loss of ID4 results in tumor promoter activity of AR. Previous study from our lab showed that ectopic ID4 expression in DU145 attenuates proliferation and promotes AR expression suggesting that ID4 dependent AR activity is tumor suppressive. In this study, we examined the effect of ectopic expression of ID4 on highly malignant prostate cancer cell, PC3. Here we show that stable overexpression of ID4 in PC3 cells leads to increased apoptosis and decreased cell proliferation and migration. In addition, in vivo studies showed a decrease in tumor size and volume of ID4 overexpressing PC3 cells, in nude mice. At the molecular level, these changes were associated with increased androgen receptor (AR), p21, and AR dependent FKBP51 expression. At the mechanistic level, ID4 may regulate the expression or function of AR through specific but yet unknown AR co-regulators that may determine the final outcome of AR function. - Highlights: • ID4 expression induces AR expression in PC3 cells, which generally lack AR. • ID4 expression increased apoptosis and decreased cell proliferation and invasion. • Overexpression of ID4 reduces tumor growth of subcutaneous xenografts in vivo. • ID4 induces p21 and FKBP51 expression- co-factors of AR tumor suppressor activity.
ID4 promotes AR expression and blocks tumorigenicity of PC3 prostate cancer cells
Energy Technology Data Exchange (ETDEWEB)
Komaragiri, Shravan Kumar; Bostanthirige, Dhanushka H.; Morton, Derrick J.; Patel, Divya; Joshi, Jugal; Upadhyay, Sunil; Chaudhary, Jaideep, E-mail: jchaudhary@cau.edu
2016-09-09
Deregulation of tumor suppressor genes is associated with tumorigenesis and the development of cancer. In prostate cancer, ID4 is epigenetically silenced and acts as a tumor suppressor. In normal prostate epithelial cells, ID4 collaborates with androgen receptor (AR) and p53 to exert its tumor suppressor activity. Previous studies have shown that ID4 promotes tumor suppressive function of AR whereas loss of ID4 results in tumor promoter activity of AR. Previous study from our lab showed that ectopic ID4 expression in DU145 attenuates proliferation and promotes AR expression suggesting that ID4 dependent AR activity is tumor suppressive. In this study, we examined the effect of ectopic expression of ID4 on highly malignant prostate cancer cell, PC3. Here we show that stable overexpression of ID4 in PC3 cells leads to increased apoptosis and decreased cell proliferation and migration. In addition, in vivo studies showed a decrease in tumor size and volume of ID4 overexpressing PC3 cells, in nude mice. At the molecular level, these changes were associated with increased androgen receptor (AR), p21, and AR dependent FKBP51 expression. At the mechanistic level, ID4 may regulate the expression or function of AR through specific but yet unknown AR co-regulators that may determine the final outcome of AR function. - Highlights: • ID4 expression induces AR expression in PC3 cells, which generally lack AR. • ID4 expression increased apoptosis and decreased cell proliferation and invasion. • Overexpression of ID4 reduces tumor growth of subcutaneous xenografts in vivo. • ID4 induces p21 and FKBP51 expression- co-factors of AR tumor suppressor activity.
Événement, idéologie et utopie
Directory of Open Access Journals (Sweden)
Jean-Luc AMALRIC
2014-12-01
Full Text Available RESUMEL’hypothèse que tente d’esquisser cet article est que l’idée ricœurienne d’une médiatisation dynamique des contradictions de l’imaginaire social présuppose une corrélation originaire de l’idéologie et de l’utopie qui ne peut elle-même être comprise qu’à partir de l’événement de l’institution d’un imaginaire social constituant. Dans un premier temps, l’article s’efforce de cerner ce qui fait la spécificité de la théorie ricœurienne de l’idéologie et de l’utopie comme « pratiques imaginatives », en soulignant à ce titre l’influence déterminante des thèses de Jacques Ellul sur l’idéologie. Puis, dans un second temps, il s’engage dans une analyse régressive qui conduit de la réappropriation ricœurienne de la conception dialectique de l’idéologie et de l’utopie exposée par Mannheim à l’idée d’un fondement événementiel de ces deux formes opposées de l’imaginaire social.Mots-Clés : Evénement, idéologie, utopie, Ellul, Mannheim. ABSTRACTThis paper attempts to sketch out the hypothesis that the Ricœurian conception of a dynamic mediatization of the contradictions of the social imaginary presupposes an original correlation between ideology and utopia, which can itself be understood only from the event that institutes a constitutive social imaginary. The first part of the paper marks out the specificity of the Ricœurian theory of ideology and utopia in terms of “imaginative practices”, underlining the determining influence of Jacques Ellul’s theses on ideology. The second part tries to develop a regressive argument, starting from the Ricœurian re-appropriation of Mannheim’s dialectical conception of ideology and utopia, and leading back to the idea of an event foundation for these two opposed forms of the social imaginary.Keywords : Event, Ideology, Utopia, Ellul, Mannheim
21 CFR 133.146 - Grated cheeses.
2010-04-01
... Products § 133.146 Grated cheeses. (a) Description. Grated cheeses is the class of foods prepared by..., and skim milk cheese for manufacturing may not be used. All cheese ingredients used are either made... ___ cheese”, the name of the cheese filling the blank. (ii) If only parmesan and romano cheeses are used and...
CASK inhibits ECV304 cell growth and interacts with Id1
International Nuclear Information System (INIS)
Qi Jie; Su Yongyue; Sun Rongju; Zhang Fang; Luo Xiaofeng; Yang Zongcheng; Luo Xiangdong
2005-01-01
Calcium/calmodulin-dependent serine protein kinase (CASK) is generally known as a scaffold protein. Here we show that overexpression of CASK resulted in a reduced rate of cell growth, while inhibition of expression of endogenous CASK via RNA-mediated interference resulted in an increased rate of cell growth in ECV304 cells. To explore the molecular mechanism, we identified a novel CASK-interacting protein, inhibitor of differentiation 1 (Id1) with a yeast two-hybrid screening. Furthermore, endogenous CASK and Id1 proteins were co-precipitated from the lysates of ECV304 cells by immunoprecipitation. Mammalian two-hybrid protein-protein interaction assays indicated that CASK possessed a different binding activity for Id1 and its alternative splicing variant. It is known that Id proteins play important roles in regulation of cell proliferation and differentiation. Thus, we speculate that the regulation of cell growth mediated by CASK may be involved in Id1. Our findings indicate a novel function of CASK, the mechanism that remains to be further investigated
ID card number detection algorithm based on convolutional neural network
Zhu, Jian; Ma, Hanjie; Feng, Jie; Dai, Leiyan
2018-04-01
In this paper, a new detection algorithm based on Convolutional Neural Network is presented in order to realize the fast and convenient ID information extraction in multiple scenarios. The algorithm uses the mobile device equipped with Android operating system to locate and extract the ID number; Use the special color distribution of the ID card, select the appropriate channel component; Use the image threshold segmentation, noise processing and morphological processing to take the binary processing for image; At the same time, the image rotation and projection method are used for horizontal correction when image was tilting; Finally, the single character is extracted by the projection method, and recognized by using Convolutional Neural Network. Through test shows that, A single ID number image from the extraction to the identification time is about 80ms, the accuracy rate is about 99%, It can be applied to the actual production and living environment.
Cui, Lili; Tao, Hua; Wang, Yan; Liu, Zhou; Xu, Zhien; Zhou, Haihong; Cai, Yujie; Yao, Lifen; Chen, Beichu; Liang, Wandong; Liu, Yu; Cheng, Wanwen; Liu, Tingting; Ma, Guoda; Li, You; Zhao, Bin; Li, Keshen
2015-04-01
Epilepsy is the third most common chronic brain disorder and is characterized by an enduring predisposition for seizures. Recently, a growing body of evidence has suggested that microRNA-146a (miR-146a) is upregulated in the brains of epilepsy patients and of mouse models; furthermore, miR-146a may be involved in the development and progression of seizures through the regulation of inflammation and immune responses. In this report, we performed a case-control study to analyze the relationship between the two potentially functional single nucleotide polymorphisms (SNPs) of the miR-146a gene (rs2910464 and rs57095329) and the risk of epilepsy in a Chinese population comprising 249 cases and 249 healthy controls. Our study comprised 249 epilepsy patients and 249 healthy controls in two regions of China. The DNA was genotyped using the ABI PRISM SNapShot method. The statistical analysis was estimated using the chi-square test or Fisher's exact test. Our results indicated a significant association between the rs57095329 SNP of the miR-146a gene and the risk of drug resistant epilepsy (DRE) (genotypes, p = 0.0258 and alleles, p = 0.0108). Moreover, the rs57095329 A allele was found to be associated with a reduced risk of seizures frequency in DRE patients (all p epilepsy. Our data indicate that the rs57095329 polymorphism in the promoter region of miR-146a is involved in the genetic susceptibility to DRE and the seizures frequency. Copyright © 2015 British Epilepsy Association. Published by Elsevier Ltd. All rights reserved.
Lipopolysaccharide induces the migration of human dental pulp cells by up-regulating miR-146a.
Wang, Min-Ching; Hung, Pei-Shih; Tu, Hsi-Feng; Shih, Wen-Yu; Li, Wan-Chun; Chang, Kuo-Wei
2012-12-01
MicroRNAs are small noncoding RNAs that play crucial roles in regulating normal and pathologic functions. Bacterial lipopolysaccharide (LPS) is one of the key regulators of pulpal pathogenesis. This study investigated how LPS regulates microRNA expression and affects the phenotype of human dental pulp cells (DPCs). Primary DPCs were established and immortalized to achieve immortalized DPCs (I-DPCs). DPCs and I-DPCs were treated with LPS and examined to identify changes in microRNA expression, cell proliferation, and cell migration. Quantitative reverse-transcriptase polymerase chain reaction was used to detect changes in gene expression. Exogenous miR-146a expression was performed transfection with pre-mir-146a mimic. Knockdown of interleukin receptor-associated kinase (IRAK1) and tumor necrosis factor receptor-associated factor 6 (TRAF6) expression was performed by small interference oligonucleotide transfection. Western blot analysis was used to detect changes in the expression of the IRAK1 and TRAF6 proteins. The differentiation of DPCs was induced by osteogenic medium. I-DPCs had a higher level of human telomerase reverse transcriptase gene than the parental DPCs. Up-regulation of miR-146a expression and an increase in migration was induced by LPS treatment of DPCs and I-DPCs. Exogenous miR-146a expression increased the migration of DPCs and I-DPCs and down-regulated the expression of IRAK1 and TRAF6. Knockdown of IRAK1 and/or TRAF6 increased the migration of DPCs. The results suggested that LPS is able to increase the migration of DPCs by modulating the miR-146a-TRAF6/IRAK1 regulatory cascade. Copyright © 2012 American Association of Endodontists. All rights reserved.
Regulation of Id2 expression in EL4 T lymphoma cells overexpressing growth hormone.
Weigent, Douglas A
2009-01-01
In previous studies, we have shown that overexpression of growth hormone (GH) in cells of the immune system upregulates proteins involved in cell growth and protects from apoptosis. Here, we report that overexpression of GH in EL4 T lymphoma cells (GHo) also significantly increased levels of the inhibitor of differentiation-2 (Id2). The increase in Id2 was suggested in both Id2 promoter luciferase assays and by Western analysis for Id2 protein. To identify the regulatory elements that mediate transcriptional activation by GH in the Id2 promoter, promoter deletion analysis was performed. Deletion analysis revealed that transactivation involved a 301-132bp region upstream to the Id2 transcriptional start site. The pattern in the human GHo Jurkat T lymphoma cell line paralleled that found in the mouse GHo EL4 T lymphoma cell line. Significantly less Id2 was detected in the nucleus of GHo EL4 T lymphoma cells compared to vector alone controls. Although serum increased the levels of Id2 in control vector alone cells, no difference was found in the total levels of Id2 in GHo EL4 T lymphoma cells treated with or without serum. The increase in Id2 expression in GHo EL4 T lymphoma cells measured by Id2 promoter luciferase expression and Western blot analysis was blocked by the overexpression of a dominant-negative mutant of STAT5. The results suggest that in EL4 T lymphoma cells overexpressing GH, there is an upregulation of Id2 protein that appears to involve STAT protein activity.
Psychometrics and latent structure of the IDS and QIDS with young adult students.
González, David Andrés; Boals, Adriel; Jenkins, Sharon Rae; Schuler, Eric R; Taylor, Daniel
2013-07-01
Students and young adults have high rates of suicide and depression, thus are a population of interest. To date, there is no normative psychometric information on the IDS and QIDS in these populations. Furthermore, there is equivocal evidence on the factor structure and subscales of the IDS. Two samples of young adult students (ns=475 and 1681) were given multiple measures to test the psychometrics and dimensionality of the IDS and QIDS. The IDS, its subscales, and QIDS had acceptable internal consistencies (αs=.79-90) and favorable convergent and divergent validity correlations. A three-factor structure and two Rasch-derived subscales best fit the IDS. The samples were collected from one university, which may influence generalizability. The IDS and QIDS are desirable measures of depressive symptoms when studying young adult students. Copyright © 2013 Elsevier B.V. All rights reserved.
MicroRNA-146a expression as a potential biomarker for rheumatoid ...
African Journals Online (AJOL)
Heba Mohamed Abdelkader Elsayed
2016-07-26
Jul 26, 2016 ... lows; enzyme activation at 95 °C, followed by 40 cycles of denaturation at 94 °C for 15s annealing at 55 °C for 30 s and extension at 70 °C for 30 s. The expression of the U6B small nuclear RNA (RNU6B) was used as endogenous control for data normalization. The RQ level (fold change) for miR-146a was ...
A Cross-Layer, Anomaly-Based IDS for WSN and MANET.
Amouri, Amar; Morgera, Salvatore D; Bencherif, Mohamed A; Manthena, Raju
2018-02-22
Intrusion detection system (IDS) design for mobile adhoc networks (MANET) is a crucial component for maintaining the integrity of the network. The need for rapid deployment of IDS capability with minimal data availability for training and testing is an important requirement of such systems, especially for MANETs deployed in highly dynamic scenarios, such as battlefields. This work proposes a two-level detection scheme for detecting malicious nodes in MANETs. The first level deploys dedicated sniffers working in promiscuous mode. Each sniffer utilizes a decision-tree-based classifier that generates quantities which we refer to as correctly classified instances (CCIs) every reporting time. In the second level, the CCIs are sent to an algorithmically run supernode that calculates quantities, which we refer to as the accumulated measure of fluctuation (AMoF) of the received CCIs for each node under test (NUT). A key concept that is used in this work is that the variability of the smaller size population which represents the number of malicious nodes in the network is greater than the variance of the larger size population which represents the number of normal nodes in the network. A linear regression process is then performed in parallel with the calculation of the AMoF for fitting purposes and to set a proper threshold based on the slope of the fitted lines. As a result, the malicious nodes are efficiently and effectively separated from the normal nodes. The proposed scheme is tested for various node velocities and power levels and shows promising detection performance even at low-power levels. The results presented also apply to wireless sensor networks (WSN) and represent a novel IDS scheme for such networks.
Ebrahimi, Seyed Omar; Reiisi, Somayeh; Parchami Barjui, Shahrbanou
2018-04-11
Polycystic ovary syndrome (PCOS) is an endocrinopathy in reproductive-age women believed to be affected by several genetics and environmental factors or both. Different miRNAs are one of such genetic factors that their associations with PCOS have been implicated. For instance, miR-146a that is well known for strongly regulating the immune response and inflammation was upregulated in serum plasma, follicular fluid and granulosa cells of PCOS patients. Different studies have shown that genetic changes in pre-miRNA can cause change in the expression or biological function of mature miRNA. Therefore, the main aim of this study was to investigate the association of miR-146a gene variation (rs2910164) with the susceptibility to PCOS. This study consists of 180 patients with PCOS and 192 healthy women matched by age and geographical region. Genotyping were determined by using PCR-RFLP in all subjects. The genotype frequency and allele distributions of all subjects were evaluated using Fisher's exact test directed by SPSS v.20. The genotype and allele frequencies of the miR-146a polymorphism (rs2910164) significantly differ between PCOS and healthy controls. The frequencies of CC genotype (p = .054) and 'C' allele (p = .0001) of the miR-146a variant indicated a significant incidence in cases compared to controls. Such association was obtained in co-dominant (OR = 3.16) and dominant (OR = 2.29) models. Result of this study can be proposed that women with miR-146a variation are at a higher risk for developing PCOS, which can be due to up-regulation of miR-146a.
DEFF Research Database (Denmark)
Schøsler, Jørn
2013-01-01
Der gives en analyse af begreberne 'evidens' og 'medfødte idéer' hos Descartes og Locke samt hos de franske oplysningsfilosoffer.......Der gives en analyse af begreberne 'evidens' og 'medfødte idéer' hos Descartes og Locke samt hos de franske oplysningsfilosoffer....
21 CFR 146.185 - Pineapple juice.
2010-04-01
... reconstituted with water suitable for the purpose of maintaining essential composition and quality factors of... Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) FOOD FOR HUMAN CONSUMPTION CANNED FRUIT JUICES Requirements for Specific Standardized Canned Fruit Juices and Beverages § 146...
Yang, Xuecheng; Mao, Xin; Ding, Xuemei; Guan, Fengju; Jia, Yuefeng; Luo, Lei; Li, Bin; Tan, Hailin; Cao, Caixia
2018-02-26
Oxidative stress and miRNAs have been confirmed to play an important role in neurological diseases. The study aimed to explore the underlying effect and mechanisms of miR-146a in H 2 O 2 -induced injury of PC12 cells. Here, PC12 cells were stimulated with 200 μM of H 2 O 2 to construct oxidative injury model. Cell injury was evaluated on the basis of the changes in cell viability, migration, invasion, apoptosis, and DNA damage. Results revealed that miR-146a expression was up-regulated in H 2 O 2 -induced PC12 cells. Functional analysis showed that down-regulation of miR-146a alleviated H 2 O 2 -induced cytotoxicity in PC12 cells. Dual-luciferase reporter and western blot assay verified that MCL1 was a direct target gene of miR-146a. Moreover, anti-miR-146a-mediated suppression on cell cytotoxicity was abated following MCL1 knockdown in H 2 O 2 -induced PC12 cells. Furthermore, MCL1 activated JAK/STAT signaling pathway and MCL1 overexpression attenuated H 2 O 2 -induced cytotoxicity in PC12 cells by JAK/STAT signaling pathway. In conclusion, this study suggested that suppression of miR-146a abated H 2 O 2 -induced cytotoxicity in PC12 cells via regulating MCL1/JAK/STAT pathway.
REFORMASI PEMAHAMAN TEORI MAQᾹṢID SYARIAH Analisis Pendekatan Sistem Jasser Auda
Directory of Open Access Journals (Sweden)
Muhammad Iqbal Fasa
2016-12-01
Full Text Available This paper attempts to offer reform ideas Jasser Auda thought related reforms theoretical understanding of maqᾱṣid sharia. The systems approach is done by Auda critize the theory of classical maqᾱṣid more likely to hierarchical and narrow mindset. The classical maqᾱṣid pressure a point more on protection and preservation. Whereas the new maqᾱṣid theory emphasizes development (construction, development and rights (rights. Thus, Auda developed the concept of human development as the main target of maslahah (public interest. Auda offers the systems approach, namely: cognitive nature; interrelated; wholeness; openness; multi dimentionality and purposefulness. At the end of the discussion in this paper, the authors develop the idea of Jasser Auda by offering Sharia Maqᾱṣid concept in the context of Islamic Economics
Ekspert : mobiil-ID kasutamine valimistel turvariske ei tekita / Holger Roonemaa
Roonemaa, Holger
2008-01-01
E-valimiste projektijuhi Taavi Martensi väitel pole põhjust kahelda mobiil-ID turvalisuses. Valimiskomisjoni esimehe Heiki Sibula meelest peaks m-ID kaarte välja andma kodakondsus- ja migratsiooniamet
Tracey, Monica W.; Unger, Kelly L.
2012-01-01
As the need for instructing a globalized workforce increases, instructional designers must embrace the constraints and the opportunities these projects provide in order to move the field of cross-cultural instructional design (ID) forward. Cross-cultural projects offer multiple avenues for growth in ID practice, overcoming cultural barriers, and a…
Id-1 is not expressed in the luminal epithelial cells of mammary glands
International Nuclear Information System (INIS)
Uehara, Norihisa; Chou, Yu-Chien; Galvez, Jose J; Candia, Paola de; Cardiff, Robert D; Benezra, Robert; Shyamala, Gopalan
2003-01-01
The family of inhibitor of differentiation/DNA binding (Id) proteins is known to regulate development in several tissues. One member of this gene family, Id-1, has been implicated in mammary development and carcinogenesis. Mammary glands contain various cell types, among which the luminal epithelial cells are primarily targeted for proliferation, differentiation and carcinogenesis. Therefore, to assess the precise significance of Id-1 in mammary biology and carcinogenesis, we examined its cellular localization in vivo using immunohistochemistry. Extracts of whole mammary glands from wild type and Id-1 null mutant mice, and tissue sections from paraffin-embedded mouse mammary glands from various developmental stages and normal human breast were subjected to immunoblot and immunohistochemical analyses, respectively. In both these procedures, an anti-Id-1 rabbit polyclonal antibody was used for detection of Id-1. In immunoblot analyses, using whole mammary gland extracts, Id-1 was detected. In immunohistochemical analyses, however, Id-1 was not detected in the luminal epithelial cells of mammary glands during any stage of development, but it was detected in vascular endothelial cells. Id-1 is not expressed in the luminal epithelial cells of mammary glands
ID Barrel installed in cryostat
Apsimon, R.; Romaniouk, A.
Wednesday 23rd August was a memorable day for the Inner Detector community as they witnessed the transport and installation of the central part of the inner detector (ID-barrel) into the ATLAS detector. Many members of the collaboration gathered to witness this moment at Point 1. After years of design, construction and commissioning, the outer two detectors (TRT and SCT) of the ID barrel were moved from the SR1 cleanroom to the ATLAS cavern. The barrel was moved across the car park from building 2175 to SX1. Although only a journey of about 100 metres, this required weeks of planning and some degree of luck as far as the weather was concerned. Accelerometers were fitted to the barrel to provide real-time monitoring and no values greater than 0.1 g were recorded, fully satisfying the transport specification for this extremely precise and fragile detector. Muriel, despite her fear of heights, bravely volunteered to keep a close eye on the detector. Swapping cranes to cross the entire parking lot, while Mur...
Intranasal Delivery of miR-146a Mimics Delayed Seizure Onset in the Lithium-Pilocarpine Mouse Model
Directory of Open Access Journals (Sweden)
Hua Tao
2017-01-01
Full Text Available Unveiling the key mechanism of temporal lobe epilepsy (TLE for the development of novel treatments is of increasing interest, and anti-inflammatory miR-146a is now considered a promising molecular target for TLE. In the current study, a C57BL/6 TLE mouse model was established using the lithium-pilocarpine protocol. The seizure degree was evaluated according to the Racine scale, and level 5 was considered the threshold for generalized convulsions. Animals were sacrificed to analyze the hippocampus at three time points (2 h and 4 and 8 weeks after pilocarpine administration to evaluate the acute, latent, and chronic phases, resp.. After intranasal delivery of miR-146a mimics (30 min before pilocarpine injection, the percent of animals with no induced seizures increased by 6.7%, the latency to generalized convulsions was extended, and seizure severity was reduced. Additionally, hippocampal damage was alleviated. While the relative miR-146a levels significantly increased, the expression of its target mRNAs (IRAK-1 and TRAF-6 and typical inflammatory modulators (NF-κB, TNF-α, IL-1β, and IL-6 decreased, supporting an anti-inflammatory role of miR-146a via the TLR pathway. This study is the first to demonstrate that intranasal delivery of miR-146a mimics can improve seizure onset and hippocampal damage in the acute phase of lithium-pilocarpine-induced seizures, which provides inflammation-based clues for the development of novel TLE treatments.
Xiong, Xin; Yan, Junfeng; Li, Linghua; Li, Yun; Cao, Yi; Tu, Yi; Mei, Jinhong
2017-08-01
MicroRNAs (miRNAs) are identified negatively regulating gene expression and acting as oncogenes or tumor suppressors in tumorigenesis. The association between miR-146a rs2910164 (G>C) polymorphism and susceptibility to digestive system cancers was contradictory and inconsistent in previously published studies. Presently, we performed a comprehensive literature retrieve on PubMed, Web of Science, Embase, Wanfang and CNKI databases to identify all relevant studies published before July 30, 2016. Odds ratio (OR) and 95% confidential interval (95%CI) were used to calculate the relationship between miR-146a rs2910164 (G>C) polymorphism and digestive system cancers susceptibility. Finally, a total of 45 publications comprising 47 separate case-control studies were enrolled in the present updated meta-analysis including 20,281 cases and 26,099 controls. However, no significant association was uncovered for miR-146a rs2910164 polymorphism and digestive system cancers susceptibility in all the genetic models. Moreover, in the stratification analyses by cancer type, the source of control, ethnicity and Hardy-Weinberg Equilibrium (HWE) status, we also revealed a negative result. To conclude, our work suggests that miR-146a rs2910164 (G>C) polymorphism is not a susceptibility factor for digestive system cancers. © 2017 by the Association of Clinical Scientists, Inc.
45 CFR 146.122 - Additional requirements prohibiting discrimination based on genetic information.
2010-10-01
... genetic information and should review the records to excise any genetic information. N assembles the data requested by M and, although N reviews it to delete genetic information, the data from a specific region... based on genetic information. 146.122 Section 146.122 Public Welfare DEPARTMENT OF HEALTH AND HUMAN...
idRHa+ProMod - Rail Hardening Control System
International Nuclear Information System (INIS)
Ferro, L
2016-01-01
idRHa+ProMod is the process control system developed by Primetals Technologies to foresee the thermo-mechanical evolution and micro-structural composition of rail steels subjected to slack quenching into idRHa+ Rail Hardening equipments in a simulation environment. This tool can be used both off-line or in-line, giving the user the chance to test and study the best cooling strategies or letting the automatic control system free to adjust the proper cooling recipe. Optimization criteria have been tailored in order to determine the best cooling conditions according to the metallurgical requirements imposed by the main rail standards and also taking into account the elastoplastic bending phenomena occurring during all stages of the head hardening process. The computational core of idRHa+ProMod is a thermal finite element procedure coupled with special algorithms developed to work out the main thermo-physical properties of steel, to predict the non-isothermal austenite decomposition into all the relevant phases and subsequently to evaluate the amount of latent heat of transformation released, the compound thermal expansion coefficient and the amount of plastic deformation in the material. Air mist and air blades boundary conditions have been carefully investigated by means of pilot plant tests aimed to study the jet impingement on rail surfaces and the cooling efficiency at all working conditions. Heat transfer coefficients have been further checked and adjusted directly on field during commissioning. idRHa+ is a trademark of Primetals Technologies Italy Srl (paper)
idRHa+ProMod - Rail Hardening Control System
Ferro, L.
2016-03-01
idRHa+ProMod is the process control system developed by Primetals Technologies to foresee the thermo-mechanical evolution and micro-structural composition of rail steels subjected to slack quenching into idRHa+ Rail Hardening equipments in a simulation environment. This tool can be used both off-line or in-line, giving the user the chance to test and study the best cooling strategies or letting the automatic control system free to adjust the proper cooling recipe. Optimization criteria have been tailored in order to determine the best cooling conditions according to the metallurgical requirements imposed by the main rail standards and also taking into account the elastoplastic bending phenomena occurring during all stages of the head hardening process. The computational core of idRHa+ProMod is a thermal finite element procedure coupled with special algorithms developed to work out the main thermo-physical properties of steel, to predict the non-isothermal austenite decomposition into all the relevant phases and subsequently to evaluate the amount of latent heat of transformation released, the compound thermal expansion coefficient and the amount of plastic deformation in the material. Air mist and air blades boundary conditions have been carefully investigated by means of pilot plant tests aimed to study the jet impingement on rail surfaces and the cooling efficiency at all working conditions. Heat transfer coefficients have been further checked and adjusted directly on field during commissioning. idRHa+ is a trademark of Primetals Technologies Italy Srl
Internal validation of the RapidHIT® ID system.
Wiley, Rachel; Sage, Kelly; LaRue, Bobby; Budowle, Bruce
2017-11-01
Traditionally, forensic DNA analysis has required highly skilled forensic geneticists in a dedicated laboratory to generate short tandem repeat (STR) profiles. STR profiles are routinely used either to associate or exclude potential donors of forensic biological evidence. The typing of forensic reference samples has become more demanding, especially with the requirement in some jurisdictions to DNA profile arrestees. The Rapid DNA (RDNA) platform, the RapidHIT ® ID (IntegenX ® , Pleasanton, CA), is a fully automated system capable of processing reference samples in approximately 90min with minimal human intervention. Thus, the RapidHIT ID instrument can be deployed to non-laboratory environments (e.g., booking stations) and run by trained atypical personnel such as law enforcement. In order to implement the RapidHIT ID platform, validation studies are needed to define the performance and limitations of the system. Internal validation studies were undertaken with four early-production RapidHIT ID units. Reliable and concordant STR profiles were obtained from reference buccal swabs. Throughout the study, no contamination was observed. The overall first-pass success rate with an "expert-like system" was 72%, which is comparable to another current RDNA platform commercially available. The system's second-pass success rate (involving manual interpretation on first-pass inconclusive results) increased to 90%. Inhibitors (i.e., coffee, smoking tobacco, and chewing tobacco) did not appear to affect typing by the instrument system; however, substrate (i.e., swab type) did impact typing success. Additionally, one desirable feature not available with other Rapid systems is that in the event of a system failed run, a swab can be recovered and subsequently re-analyzed in a new sample cartridge. Therefore, rarely should additional sampling or swab consumption be necessary. The RapidHIT ID system is a robust and reliable tool capable of generating complete STR profiles within
The effect of stem cell factor on proliferation of human endometrial CD146+ cells
Directory of Open Access Journals (Sweden)
Mehri Fayazi
2016-07-01
Full Text Available Background: Stem cell factor (SCF is a transcriptional factor which plays crucial roles in normal proliferation, differentiation and survival in a range of stem cells. Objective: The aim of the present study was to examine the proliferation effect of different concentrations of SCF on expansion of human endometrial CD146+ cells. Materials and Methods: In this experimental study, total populations of isolated human endometrial suspensions after fourth passage were isolated by magnetic activated cell sorting (MACS into CD146+ cells. Human endometrial CD146+ cells were karyotyped and tested for the effect of SCF on proliferation of CD146+ cells, then different concentrations of 0, 12.5, 25, 50 and 100 ng/ml was carried out and mitogens-stimulated endometrial CD146+ cells proliferation was assessed by MTT assay. Results: Chromosomal analysis showed a normal metaphase spread and 46XX karyotype. The proliferation rate of endometrial CD146P + P cells in the presence of 0, 12.5, 25, 50 and 100 ng/ml SCF were 0.945±0.094, 0.962±0.151, 0.988±0.028, 1.679±0.012 and 1.129±0.145 respectively. There was a significant increase in stem/ stromal cell proliferation following in vitro treatment by 50 ng/ml than other concentrations of SCF (p=0.01. Conclusion: The present study suggests that SCF could have effect on the proliferation and cell survival of human endometrial CD146P+P cells and it has important implications for medical sciences and cell therapies
10 CFR 1.46 - Office of Nuclear Security and Incident Response.
2010-01-01
... 10 Energy 1 2010-01-01 2010-01-01 false Office of Nuclear Security and Incident Response. 1.46... Headquarters Program Offices § 1.46 Office of Nuclear Security and Incident Response. The Office of Nuclear... evaluation and assessment of technical issues involving security at nuclear facilities, and is the agency...
Id3 induces an Elk-1–caspase-8-dependent apoptotic pathway in squamous carcinoma cells
International Nuclear Information System (INIS)
Chen, You-Shin; Aubee, Joseph; DiVito, Kyle A; Zhou, Hengbo; Zhang, Weiyi; Chou, Fen-Pi; Simbulan-Rosenthal, Cynthia M; Rosenthal, Dean S
2015-01-01
Inhibitor of differentiation/DNA-binding (Id) proteins are helix–loop–helix (HLH) transcription factors. The Id protein family (Id1–Id4) mediates tissue homeostasis by regulating cellular processes including differentiation, proliferation, and apoptosis. Ids typically function as dominant negative HLH proteins, which bind other HLH proteins and sequester them away from DNA promoter regions. Previously, we have found that Id3 induced apoptosis in immortalized human keratinocytes upon UVB exposure, consistent with its role as a tumor suppressor. To investigate the role of Id3 in malignant squamous cell carcinoma (SCC) cells (A431), a tetracycline-regulated inducible system was used to induce Id3 in cell culture and mouse xenograft models. We found that upon Id3 induction, there was a decrease in cell number under low serum conditions, as well as in soft agar. Microarray, RT-PCR, immunoblot, siRNA, and inhibitor studies revealed that Id3 induced expression of Elk-1, an E-twenty-six (ETS)-domain transcription factor, inducing procaspase-8 expression and activation. Id3 deletion mutants revealed that 80 C-terminal amino acids, including the HLH, are important for Id3-induced apoptosis. In a mouse xenograft model, Id3 induction decreased tumor size by 30%. Using immunofluorescent analysis, we determined that the tumor size decrease was also mediated through apoptosis. Furthermore, we show that Id3 synergizes with 5-FU and cisplatin therapies for nonmelanoma skin cancer cells. Our studies have shown a molecular mechanism by which Id3 induces apoptosis in SCC, and this information can potentially be used to develop new treatments for SCC patients
Bio-fortification and shelf-life extension of idli batter using curry leaves (Murraya koenigii).
Chelliah, R; Ramakrishnan, S R; Premkumar, D; Antony, U
2016-06-01
Among several traditional foods of India, idli is one of the most popular and commonly consumed steamed products. A new method of adding Murraya koenigii (curry leaves) to idli batter as a vehicle for fortification and extension of shelf-life has been developed. Dried curry leaves powder was incorporated with other ingredients like rice and dehusked black gram in different proportions to optimize the most palatable formulation. Rate of fermentation and microbial changes in the batter; nutritional qualities, texture and sensory properties of the prepared product were assessed. Incorporation of curry leaves powder (5 %) in idli batter increased the shelf-life and also increased the flavour, texture and appearance of the idli. The calcium content of the prepared idli was 10 times more than that of the control idli, while dietary fiber content increased by 18.6 %. Anti-microbial activity of the curry leaves in idli batter extended the shelf-life from 2 to 5 days when stored at 30 °C.
To ID or Not to ID? Changes in Classification Rates of Intellectual Disability Using "DSM-5"
Papazoglou, Aimilia; Jacobson, Lisa A.; McCabe, Marie; Kaufmann, Walter; Zabel, T. Andrew
2014-01-01
The "Diagnostic and Statistical Manual of Mental Disorders-Fifth Edition" ("DSM-5") diagnostic criteria for intellectual disability (ID) include a change to the definition of adaptive impairment. New criteria require impairment in one adaptive domain rather than two or more skill areas. The authors examined the diagnostic…
Tang, Yi-Wei; Lowery, Kristin S; Valsamakis, Alexandra; Schaefer, Virginia C; Chappell, James D; White-Abell, Jill; Quinn, Criziel D; Li, Haijing; Washington, Cicely A; Cromwell, Jenna; Giamanco, Chantel M; Forman, Michael; Holden, Jeffery; Rothman, Richard E; Parker, Michelle L; Ortenberg, Elaine V; Zhang, Lei; Lin, Yea-Lin; Gaydos, Charlotte A
2013-01-01
Respiratory tract infections caused by influenza A and B viruses often present nonspecifically, and a rapid, high-throughput laboratory technique that can identify influenza viruses is clinically and epidemiologically desirable. The PLEX-ID Flu assay (Abbott Molecular Inc., Des Plaines, IL) incorporates multilocus PCR and electrospray ionization-mass spectrometry to detect and differentiate influenza A 2009 H1N1 (H1N1-p), seasonal H1N1 (H1N1-s), influenza A H3N2, and influenza B viruses in nasopharyngeal swab (NPS) specimens. The clinical performance characteristics of the PLEX-ID Flu assay in symptomatic patients were determined in this multicenter trial. A total of 2,617 prospectively and retrospectively collected NPS specimens from patients with influenza-like illness between February 2008 and 28 May 2010 were eligible for inclusion in the study. Each specimen was tested in parallel by the PLEX-ID Flu assay and by the Prodesse ProFLU+ assay (Prodesse Inc., Madison, WI), to detect influenza A and B viruses. Specimens testing positive for influenza A virus by ProFLU+ were subtyped as H1N1-p, H1N1-s, or H3N2 by using the ProFAST+ assay (Gen-Probe Prodesse Inc.). The reproducibility of the PLEX-ID Flu assay ranged from 98.3 to 100.0%, as determined by testing a nine-specimen panel at three clinical sites on each of 5 days. Positive percent agreements (PPAs) and negative percent agreements (NPAs) of the PLEX-ID Flu assay were 94.5% and 99.0% for influenza A virus and 96.0% and 99.9% for influenza B virus, respectively. For the influenza A virus subtyping characterization, the PLEX-ID Flu assay had PPAs and NPAs of 98.3% and 97.5% for H1N1-p, 88.6% and 100.0% for H1N1-s, and 98.0% and 99.9% for H3N2, respectively. The overall agreements between the PLEX-ID and Prodesse ProFLU+/ProFAST+ assays were 97.1 to 100.0%. Bidirectional Sanger sequencing analysis revealed that 87.5% of 96 discrepant results between the PLEX-ID Flu and ProFLU+/ProFAST+ assays were found upon
A Plan to Optimize the Management of Weld ID SSN Numbering System for Nuclear Power Plants in Korea
International Nuclear Information System (INIS)
Yoo, Hyun Ju; Cho, Chan Hee; Kim, Jin Hoi; Park, Dong Min
2016-01-01
Summary Sheet Number(SSN) in the current LTP is an ID which means a weldment in a nuclear power plant. However, the SSN ID, which is unique on in a nuclear power plant, is not unique one if the weldments of entire nuclear power plant in Korea are treated in one system. Therefore, it is hard to manage the data during life time using the existing SSN ID system. It is also hard to configure the characteristics of weldment in mind because IDs implying Alloy600 and overlay weld do not exist in the existing SSN ID System. An optimized SSN numbering system managing weldments for the life time is introduced in this paper. Moreover, it is explained how to manage the SSN numbering system in the computer program system, too. The problem, which the weld is not harmoniously managed, would be solved provided adapting the new SSN ID introduced in this paper. A weld is managed during its life time from creation to extinction. The inquiry of inspection history of a concerned weld and the reference of statistics would be performed easily and rightly because the concerned weld can be accessed from anywhere connected to KHNP network such as KHNP headquater, plants and CRI
2010-04-01
... the risk and expense of the operator. The port director may require an accounting of all merchandise.... An operator shall make written application to the port director for approval of an alteration of an... accompanied by the supporting document requirements specified in § 146.6, as applicable. The port director may...
Habibi, Fatemeh; Ghadiri Soufi, Farhad; Ghiasi, Rafighe; Khamaneh, Amir Mahdi; Alipour, Mohammad Reza
2016-03-01
The purpose of the present study is to evaluate the expression of miR-146a gene, its adaptor genes (TRAF6, NF-KB, and IRAK1), and possible changes in the cellular signaling pathway in diabetic hippocampus tissue. Male Sprague-Dawley rats are randomly selected and divided into control and diabetic (n=6) groups. Diabetes induced by the single-dose injection of nicotinamide [110 mg/kg, (i.p.)], 15 min before streptozotocin (50 mg/kg; i.p.) in 12-h fasted rats. The rats are kept at the laboratory for two months. After anaesthetization, hippocampus of the rats was removed in order to measure the expression of miR-146a, NFK-B, IRAK1, and TRAF6 genes using real-time PCR and activity of NF-KB as well as amount of apoptosis rate using ELISA. The results indicated a reduction in expression of miR-146a and an increase in expression of IRAK1, NF-KB, and TRAF6 genes in the hippocampus of diabetic rats compared to control. Also it reveals an increase in the activity of NF-KB and apoptosis rate in the hippocampus of diabetic rats. Our results report the probability that reduction of miR-146a expression in the negative feedback loop between miR-146a and NF-KB increases NF-kB expression and thus intensifies inflammation and apoptosis in hippocampus.
Directory of Open Access Journals (Sweden)
Jiang Xiaoying
2010-06-01
Full Text Available Abstract Background Despite the widespread induction of miR-146a during the innate immune response little is known regarding its biogenesis, function and mechanism. We have therefore examined the role of miR-146a during the interleukin (IL-1β-stimulated IL-6 and IL-8 release and proliferation in primary human airway smooth muscle (HASM cells. Methods HASM cells were isolated from human lung re-section, cultured to a maximum of 3 - 6 passages and then exposed to IL-1β. miR-146a expression were determined by qRT-PCR, IL-6 and IL-8 release by ELISA and proliferation using bromodeoxyuridine incorporation. The role of NF-κB and the MAP kinase pathways was assessed using pharmacological inhibitors of IKK2 (TPCA-1, JNK (SP600125, p38 MAP kinase (SB203580 and MEK-1/2 (PD98059. miR-146a function was determined following transfection of HASM with inhibitors and mimics using Amaxa electroporation. Results IL-1β induced a time-dependent and prolonged 100-fold induction in miR-146a expression, which correlated with release of IL-6 and IL-8. Exposure to IL-1β had no effect upon HASM proliferation. Pharmacological studies showed that expression of primary miR-146a was regulated at the transcriptional levels by NF-κB whilst post-transcriptional processing to mature miR-146a was regulated by MEK-1/2 and JNK-1/2. Functional studies indicated that IL-1β-induced miR-146a expression does not negatively regulate IL-6 and IL-8 release or basal proliferation. However, inhibition of IL-1β-induced IL-6 and IL-8 release was observed at the super-maximal intracellular miR-146a levels obtained by transfection with miR-146a mimics and indicates that studies using miRNA mimics can produce false positive results. Mechanistic studies showed that in the presence of super-maximal levels, the action of miR-146a mimics was mediated at a step following IL-6 and IL-8 mRNA transcription and not through down-regulation of IL-1 receptor associated kinase 1 (IRAK-1 and TNF
International Nuclear Information System (INIS)
Bizzeti, P.G.; Bizzetti-Sona, A.M.
1998-01-01
The mean lives of the lowest 9 - and 12 + states of 146 Sm have been measured by means of the RDM. Their (preliminary) values are r m (9 - )=0.97±0.05 ns and r m (12 + )=15±2 ps, respectively. The strengths of the collective E3 transitions of the 12 + →9 - →6 6 cascade are compared with the corresponding ones in 148 Gd
Up-regulation of miR-146a contributes to the inhibition of invasion of pancreatic cancer cells
Li, Yiwei; VandenBoom, Timothy G.; Wang, Zhiwei; Kong, Dejuan; Ali, Shadan; Philip, Philip A.; Sarkar, Fazlul H.
2009-01-01
Pancreatic cancer (PC) is an aggressive malignancy with high mortality and is believed to be in part due to its highly invasive and metastatic behavior, which is associated with over-expression of EGFR and activation of NF-κB. Emerging evidence also suggest critical roles of microRNAs (miRNAs) in the regulation of various pathobiological processes including metastasis in PC and in other human malignancies. In the present study, we found lower expression of miR-146a in PC cells compared to normal human pancreatic duct epithelial (HPDE) cells. Interestingly, re-expression of miR-146a inhibited the invasive capacity of Colo357 and Panc-1 PC cells with concomitant down-regulation of EGFR and IRAK-1. Mechanistic studies including miR-146a re-expression, anti-miR-146 transfection, and EGFR knock-down experiment showed that there was a crosstalk between EGFR, MTA-2, IRAK-1, IκBα and NF-κB. Most importantly, we found that the treatment of PC cells with “natural agents” [3,3′-diinodolylmethane (DIM) or isoflavone] led to an increase in the expression of miR-146a and consequently down-regulated the expression of EGFR, MTA-2, IRAK-1 and NF-κB, resulting in the inhibition of invasion of Colo357 and Panc-1 cells. These results provide experimental evidence in support of the role of DIM and isoflavone as potential non-toxic agents as regulators of miRNA, which could be useful for the inhibition of cancer cell invasion and metastasis, and further suggesting that these agents could be important for designing novel targeted strategy for the treatment of PC. PMID:25242818
Energy Technology Data Exchange (ETDEWEB)
Jared Verba; Michael Milvich
2008-05-01
Current Intrusion Detection System (IDS) technology is not suited to be widely deployed inside a Supervisory, Control and Data Acquisition (SCADA) environment. Anomaly- and signature-based IDS technologies have developed methods to cover information technology-based networks activity and protocols effectively. However, these IDS technologies do not include the fine protocol granularity required to ensure network security inside an environment with weak protocols lacking authentication and encryption. By implementing a more specific and more intelligent packet inspection mechanism, tailored traffic flow analysis, and unique packet tampering detection, IDS technology developed specifically for SCADA environments can be deployed with confidence in detecting malicious activity.
Directory of Open Access Journals (Sweden)
Finn Hedefalk
2014-09-01
Full Text Available The Intermediate Data Structure (IDS is a standardised database structure for longitudinal historical databases. Such a common structure facilitates data sharing and comparative research. In this study, we propose an extended version of IDS, named IDS-Geo, that also includes geographic data. The geographic data that will be stored in IDS-Geo are primarily buildings and/or property units, and the purpose of these geographic data is mainly to link individuals to places in space. When we want to assign such detailed spatial locations to individuals (in times before there were any detailed house addresses available, we often have to create tailored geographic datasets. In those cases, there are benefits of storing geographic data in the same structure as the demographic data. Moreover, we propose the export of data from IDS-Geo using an eXtensible Markup Language (XML Schema. IDS-Geo is implemented in a case study using historical property units, for the period 1804 to 1913, stored in a geographically extended version of the Scanian Economic Demographic Database (SEDD. To fit into the IDS-Geo data structure, we included an object lifeline representation of all of the property units (based on the snapshot time representation of single historical maps and poll-tax registers. The case study verifies that the IDS-Geo model is capable of handling geographic data that can be linked to demographic data.
BDNF VAL66MET Polymorphism Elevates the Risk of Bladder Cancer via MiRNA-146b in Micro-Vehicles
Directory of Open Access Journals (Sweden)
Cong Li
2018-01-01
Full Text Available Background/Aims: Emerging studies on brain-derived neurotrophic factor (BDNF have shown that might be novel biomarkers and therapeutic targets for cancer. We explore the role of BDNF in the tumorigenesis of bladder cancer and the underlying molecular mechanism. Methods: 368 patients with diagnosed bladder cancer and 352 healthy controls were enrolled to evaluate the association of BDNF and the miR-146b. Bioinformatics algorithm analysis and luciferase assay were performed to identify the target genes of miR-146b. Real-time PCR and western-blot were carried out to validate the relationship between miR-146b and CRK. MTT assay and FACS were used to evaluated the proliferation and apoptosis of cancer cells. MVs were isolated and transfect into the culture cells to confirm the above observation. Results: The clinical study shows that BDNF Met/Met was significantly associated with the risk of bladder cancer. In addition, comparing with Val/Val and Val/Met, Met/Met has lower miR-146b level. Luciferase assay shows that BDNF Val/Val is apparently enhanced miR-146b promoter-luciferase, but not BDNF Met/Met. Based on luciferase assay, CRK is a direct target gene of miR-146b. MiR-146b mimics significantly inhibited the expression of CRK and activation of AKT level. The expression of CRK and the activation of AKT (p-AKT were significantly inhibited by MV-BDNF Val/Val-miR-146b or MV-BDNF Val/Met-miR-146b, but not MV-BDNF Met/Met-miR-146b. MV-BDNF Val/Val-miR-146b or Val/Met-miR-146b obviously inhibited cell proliferation, which eliminated by CRK. Meanwhile, with MV-BDNF Met/Met-miR-146b or Met/Met-miR-146b+CRK did not affect the proliferation. MV-BDNF Val/Val-miR-146b or Val/Met-miR-146b enhanced cell apoptosis, which could be eliminated by CRK. Meanwhile, MV-BDNF Met/Met-miR-146b or Met/Met-miR-146b+CRK did not promote apoptosis. Conclusion: BDNF VAL66MET polymorphism is associated with miR-146b and its target gene CRK. MiR-146b and CRK mediated BDNF VAL66
ACE I/D genotype, adiposity, and blood pressure in children
Directory of Open Access Journals (Sweden)
Rothschild Max
2009-03-01
Full Text Available Abstract Background Angiotensin converting enzyme (ACE is a possible candidate gene that may influence both body fatness and blood pressure. Although several genetic studies have been conducted in adults, relatively few studies have examined the contribution of potential candidate genes, and specifically ACE I/D, on adiposity and BP phenotypes in childhood. Such studies may prove insightful for the development of the obesity-hypertension phenotype early in life. The purpose of this study was to examine differences in body fatness and resting blood pressure (BP by ACE I/D genotype, and determine if the association between adiposity and BP varies by ACE I/D genotype in children. Methods 152 children (75 girls, 77 boys were assessed for body composition (% body fat using dual energy x-ray absorbtiometry and resting BP according to American Heart Association recommendations. Buccal cell samples were genotyped using newly developed PCR-RFLP tests for two SNPs (rs4341 and rs4343 in complete linkage disequilibrium with the ACE I/D polymorphism. Partial correlations were computed to assess the ociations between % body fat and BP in the total sample and by genotype. ANCOVA was used to examine differences in resting BP by ACE I/D genotype and fatness groups. Results Approximately 39% of youth were overfat based on % body fat (>30% fat in girls, 25% fat in boys. Body mass, body mass index, and fat-free mass were significantly higher in the ACE D-carriers compared to the II group (p Conclusion ACE D-carriers are heavier than ACE II children; however, BP did not differ by ACE I/D genotype but was adversely influenced in the overfat D-carriers. Further studies are warranted to investigate the genetics of fatness and BP phenotypes in children.
Muon Identification performance: hadron mis-Id measurements and RPC Muon selections
CMS Collaboration
2014-01-01
Pion, kaon, proton mis-identification probabilities as muons have been measured for different Muon ID algorithms. Results from two independent analyses are presented. The performance of a new muon ID algorithm based on matching of inner tracks with hits in muon RPC chambers is also presented.
Luo, Xi; Hong, Haiyu; Tang, Jun; Wu, Xingmei; Lin, Zhibin; Ma, Renqiang; Fan, Yunping; Xu, Geng; Liu, Dabo; Li, Huabin
2016-03-01
MicroRNAs (miRs) were recently recognized to be important for immune cell differentiation and immune regulation. However, whether miRs were involved in allergen-specific immunotherapy (SIT) remains largely unknown. This study sought to examine changes in miR-146a and T regulatory cells in children with persistent allergic rhinitis (AR) after 3 months of subcutaneous immunotherapy (SCIT) and sublingual immunotherapy (SLIT). Twenty-four HDM-sensitized children with persistent AR were enrolled and treated with SCIT (n=13) or SLIT (n=11) for 3 months. Relative miR-146a and Foxp3 mRNA expression, the TRAF6 protein level, and the ratio of post-treatment to baseline IL-10+CD4+ T cells between the SCIT and SLIT groups were examined in the peripheral blood mononuclear cells (PBMCs) of AR patients using quantitative reverse transcription polymerase chain reaction (qRT-PCR), flow cytometry, and Western blot analysis, respectively. Serum levels of IL-5 and IL-10 were determined using ELISA. After 3 months of SIT, both the TNSS and INSS scores were significantly decreased compared to the baseline value (P<0.01). The relative expression of miR-146a and Foxp3 mRNA was significantly increased after both SCIT and SLIT (P<0.01). The ratio of post-treatment to baseline IL-10⁺CD4⁺ T cells and the serum IL-10 level were significantly increased in both the SCIT and SLIT groups (P<0.01), whereas the TRAF6 protein level and serum IL-5 level were significantly decreased (P<0.01). No significant differences in these biomarkers were observed between the SCIT and SLIT groups. Our findings suggest that miR-146a and its related biomarkers may be comparably modulated after both SCIT and SLIT, highlighting miR-146a as a potential therapeutic target for the improved management of AR.
DEFF Research Database (Denmark)
Johansen, P; Andersen, J D; Børsting, Claus
2013-01-01
on the peak height and the signal to noise data exported from the TYPER 4.0 software. With the forensic analysis parameters, all inconsistencies were eliminated in reactions with ≥10ng DNA. However, the average call rate decreased to 69.9%. The iPLEX(®) Sample ID Plus Panel was tested on 10 degraded samples......Sequenom launched the first commercial SNP typing kit for human identification, named the iPLEX(®) Sample ID Plus Panel. The kit amplifies 47 of the 52 SNPs in the SNPforID panel, amelogenin and two Y-chromosome SNPs in one multiplex PCR. The SNPs were analyzed by single base extension (SBE......) and Matrix Assisted Laser Desorption/Ionization-Time of Flight Mass Spectrometry (MALDI-TOF MS). In this study, we evaluated the accuracy and sensitivity of the iPLEX(®) Sample ID Plus Panel by comparing the typing results of the iPLEX(®) Sample ID Plus Panel with those obtained with our ISO 17025 accredited...
Evaluation of the miRNA-146a and miRNA-155 Expression Levels in Patients with Oral Lichen Planus.
Ahmadi-Motamayel, Fatemeh; Bayat, Zeynab; Hajilooi, Mehrdad; Shahryar-Hesami, Soroosh; Mahdavinezhad, Ali; Samie, Lida; Solgi, Ghasem
2017-12-01
Oral Lichen Planus (OLP) is a chronic autoimmune disease that could be considered as a potential premalignant status. To evaluate the miRNA-146a and miRNA-155 expression levels in patients with oral Lichen planus lesions compared to healthy subjects with normal oral mucosa. Forty patients with oral lichen planus and 18 healthy age and gender-matched controls were recruited in this case-control study. Oral lichen planus was diagnosed clinically and pathologically. The expression levels of two miRNAs in peripheral blood samples were determined using commercial TaqMan MicroRNA Assays. Relative quantification of gene expression was calculated by the 2-ΔΔct method. The expression levels of miRNA-146a and miRNA-155 in patients with oral Lichen planus were significantly higher than those of healthy controls. Also, a direct but insignificant correlation was found between miRNA-155 and miRNA-146a expression levels among the patient group. Our findings indicate that miRNA-146a and miRNA-155 could be potential biomarkers for the immunopathogenesis of oral lichen planus.
78 FR 65555 - Establishment of Class E Airspace; Salmon, ID
2013-11-01
...-0531; Airspace Docket No. 13-ANM-20] Establishment of Class E Airspace; Salmon, ID AGENCY: Federal... at the Salmon VHF Omni-Directional Radio Range/Distance Measuring Equipment (VOR/DME) navigation aid, Salmon, ID, to facilitate vectoring of Instrument Flight Rules (IFR) aircraft under control of Salt Lake...
Declining Physical Performance Associates with Serum FasL, miR-21, and miR-146a in Aging Sprinters
Directory of Open Access Journals (Sweden)
Reeta Kangas
2017-01-01
Full Text Available Aging is associated with systemic inflammation and cellular apoptosis accelerating physiological dysfunctions. Whether physically active way of life affects these associations is unclear. This study measured the levels of serum inflammatory and apoptotic molecules, their change over 10 years, and their associations with physical performance in sprint-trained male athletes. HsCRP, cell counts, HGB, FasL, miR-21, and miR-146a were measured cross-sectionally (n=67, 18–90 yrs and serum FasL, miR-21, and miR-146a and their aging-related associations with physical performance were assessed over a 10-year follow-up (n=49, 50–90 yrs. The cross-sectional study showed positive age correlations for neutrophils and negative for lymphocytes, red blood cells, HGB, FasL, and miR-146a. During the 10-year follow-up, FasL decreased (P=0.017 and miR-21 (P<0.001 and miR-146a (P=0.005 levels increased. When combining the molecule levels, aging, and physical performance, FasL associated with countermovement jump and bench press (P<0.001, miR-21 and miR-146a with knee flexion (P=0.023; P<0.001, and bench press (P=0.004; P<0.001 and miR-146a with sprint performance (P<0.001. The studied serum molecules changed in an age-dependent manner and were associated with declining physical performance. They have potential as biomarkers of aging-related processes influencing the development of physiological dysfunctions. Further research is needed focusing on the origins and targets of circulating microRNAs to clarify their function in various tissues with aging.
OpenID connect as a security service in Cloud-based diagnostic imaging systems
Ma, Weina; Sartipi, Kamran; Sharghi, Hassan; Koff, David; Bak, Peter
2015-03-01
The evolution of cloud computing is driving the next generation of diagnostic imaging (DI) systems. Cloud-based DI systems are able to deliver better services to patients without constraining to their own physical facilities. However, privacy and security concerns have been consistently regarded as the major obstacle for adoption of cloud computing by healthcare domains. Furthermore, traditional computing models and interfaces employed by DI systems are not ready for accessing diagnostic images through mobile devices. RESTful is an ideal technology for provisioning both mobile services and cloud computing. OpenID Connect, combining OpenID and OAuth together, is an emerging REST-based federated identity solution. It is one of the most perspective open standards to potentially become the de-facto standard for securing cloud computing and mobile applications, which has ever been regarded as "Kerberos of Cloud". We introduce OpenID Connect as an identity and authentication service in cloud-based DI systems and propose enhancements that allow for incorporating this technology within distributed enterprise environment. The objective of this study is to offer solutions for secure radiology image sharing among DI-r (Diagnostic Imaging Repository) and heterogeneous PACS (Picture Archiving and Communication Systems) as well as mobile clients in the cloud ecosystem. Through using OpenID Connect as an open-source identity and authentication service, deploying DI-r and PACS to private or community clouds should obtain equivalent security level to traditional computing model.
22 CFR 146.100 - Purpose and effective date.
2010-04-01
... EDUCATION PROGRAMS OR ACTIVITIES RECEIVING FEDERAL FINANCIAL ASSISTANCE Introduction § 146.100 Purpose and... basis of sex in any education program or activity receiving Federal financial assistance, whether or not...
Directory of Open Access Journals (Sweden)
Cǎtǎlin NAE
2010-03-01
Full Text Available This paper is dedicated to a very specific type of analysis tool (VLM - Vortex Lattice Method to be integrated in a IDS - Integrated Design System, tailored for the usage of small aircraft industry. The major interest is to have the possibility to simulate at very low computational costs a preliminary set of aerodynamic characteristics for basic aerodynamic global characteristics (Lift, Drag, Pitching Moment and aerodynamic derivatives for longitudinal and lateral-directional stability analysis. This work enables fast investigations of the influence of configuration changes in a very efficient computational environment. Using experimental data and/or CFD information for a specific calibration of VLM method, reliability of the analysis may me increased so that a first type (iteration zero aerodynamic evaluation of the preliminary 3D configuration is possible. The output of this tool is basic state aerodynamic and associated stability and control derivatives, as well as a complete set of information on specific loads on major airframe components.The major interest in using and validating this type of methods is coming from the possibility to integrate it as a tool in an IDS system for conceptual design phase, as considered for development for CESAR project (IP, UE FP6.
2011-02-07
.... * * * * * * * * * * * [I]nvestigation by M-D showed that if any undetected crack was present at the time of the embodiment... terminating action for the repetitive inspections, by embodiment of Messier-Dowty (M-D) Service Bulletin (SB... optional closing action of EASA AD 2010-0001-E is embodiment of M-D B 146-32-150 (polishing and shot...
Efficient coding and detection of ultra-long IDs for visible light positioning systems.
Zhang, Hualong; Yang, Chuanchuan
2018-05-14
Visible light positioning (VLP) is a promising technique to complement Global Navigation Satellite System (GNSS) such as Global positioning system (GPS) and BeiDou Navigation Satellite System (BDS) which features the advantage of low-cost and high accuracy. The situation becomes even more crucial for indoor environments, where satellite signals are weak or even unavailable. For large-scale application of VLP, there would be a considerable number of Light emitting diode (LED) IDs, which bring forward the demand of long LED ID detection. In particular, to provision indoor localization globally, a convenient way is to program a unique ID into each LED during manufacture. This poses a big challenge for image sensors, such as the CMOS camera in everybody's hands since the long ID covers the span of multiple frames. In this paper, we investigate the detection of ultra-long ID using rolling shutter cameras. By analyzing the pattern of data loss in each frame, we proposed a novel coding technique to improve the efficiency of LED ID detection. We studied the performance of Reed-Solomon (RS) code in this system and designed a new coding method which considered the trade-off between performance and decoding complexity. Coding technique decreases the number of frames needed in data processing, significantly reduces the detection time, and improves the accuracy of detection. Numerical and experimental results show that the detected LED ID can be much longer with the coding technique. Besides, our proposed coding method is proved to achieve a performance close to that of RS code while the decoding complexity is much lower.
MicroED Structure of Au146(p-MBA)57 at Subatomic Resolution Reveals a Twinned FCC Cluster.
Vergara, Sandra; Lukes, Dylan A; Martynowycz, Michael W; Santiago, Ulises; Plascencia-Villa, Germán; Weiss, Simon C; de la Cruz, M Jason; Black, David M; Alvarez, Marcos M; López-Lozano, Xochitl; Barnes, Christopher O; Lin, Guowu; Weissker, Hans-Christian; Whetten, Robert L; Gonen, Tamir; Yacaman, Miguel Jose; Calero, Guillermo
2017-11-16
Solving the atomic structure of metallic clusters is fundamental to understanding their optical, electronic, and chemical properties. Herein we present the structure of the largest aqueous gold cluster, Au 146 (p-MBA) 57 (p-MBA: para-mercaptobenzoic acid), solved by electron micro-diffraction (MicroED) to subatomic resolution (0.85 Å) and by X-ray diffraction at atomic resolution (1.3 Å). The 146 gold atoms may be decomposed into two constituent sets consisting of 119 core and 27 peripheral atoms. The core atoms are organized in a twinned FCC structure, whereas the surface gold atoms follow a C 2 rotational symmetry about an axis bisecting the twinning plane. The protective layer of 57 p-MBAs fully encloses the cluster and comprises bridging, monomeric, and dimeric staple motifs. Au 146 (p-MBA) 57 is the largest cluster observed exhibiting a bulk-like FCC structure as well as the smallest gold particle exhibiting a stacking fault.
22 CFR 146.520 - Job classification and structure.
2010-04-01
... 22 Foreign Relations 1 2010-04-01 2010-04-01 false Job classification and structure. 146.520... IN EDUCATION PROGRAMS OR ACTIVITIES RECEIVING FEDERAL FINANCIAL ASSISTANCE Discrimination on the... and structure. A recipient shall not: (a) Classify a job as being for males or for females; (b...
ACE insertion/deletion (I/D) polymorphism and diabetic nephropathy.
Rahimi, Zohreh
2012-10-01
Angiotensin converting enzyme (ACE) gene encodes ACE, a key component of renin angiotensin system (RAS), plays an important role in blood pressure homeostasis by generating the vasoconstrictor peptide angiotensin II. Directory of Open Access Journals (DOAJ), Google Scholar, Pubmed (NLM), LISTA (EBSCO) and Web of Science have been searched. The presence of ACE insertion/deletion (I/D) polymorphism affects the plasma level of ACE. ACE DD genotype is associated with the highest systemic and renal ACE levels compared with the lowest ACE activity in carriers of II genotype. In this review focus has been performed on the study of ACE I/D polymorphism in various populations and its influence on the risk of onset and progression of diabetic nephropathy. Also, association between ACE I/D polymorphism and response to ACE inhibitor and angiotensin II receptor antagonists will be reviewed. Further, synergistic effect of this polymorphism and variants of some genes on the risk of development of diabetic nephropathy will be discussed.
ID.alistic: identificatie met een touch voor de patiënt
M. Wilschut; M. Zijlmans; Dr. L.S.G.L Wauben
2017-01-01
ID.alistic is een conceptuele patiëntidentificatie methode (middels een vingerafdrukscanner), ter vervanging van het polsbandjessysteem van het Albert Schweitzer ziekenhuis (ASz) dialysecentrum. Dit onderzoek bepaalt de implementeerbaarheid van ID.alistic binnen het dialysecentrum door
Dioxin induces expression of hsa-miR-146b-5p in human neuroblastoma cells.
Xu, Tuan; Xie, Heidi Q; Li, Yunping; Xia, Yingjie; Sha, Rui; Wang, Lingyun; Chen, Yangsheng; Xu, Li; Zhao, Bin
2018-01-01
Dioxin can cause a series of neural toxicological effects. MicroRNAs (miRs) play important roles in regulating nervous system function and mediating cellular responses to environmental pollutants, such as dioxin. Hsa-miR-146b-5p appears to be involved in neurodegenerative diseases and brain tumors. However, little is known about effects of dioxin on the expression of hsa-miR-146b-5p. We found that the hsa-miR-146b-5p expression and its promoter activity were significantly increased in dioxin treated SK-N-SH cells, a human-derived neuroblastoma cell line. Potential roles of hsa-miR-146b-5p in mediating neural toxicological effects of dioxin may be due to the regulation of certain target genes. We further confirmed that hsa-miR-146b-5p significantly suppressed acetylcholinesterase (AChE) activity and targeted the 3'-untranslated region of the AChE T subunit, which has been down-regulated in dioxin treated SK-N-SH cells. Functional bioinformatic analysis showed that the known and predicted target genes of hsa-miR-146b-5p were involved in some brain functions or cyto-toxicities related to known dioxin effects, including synapse transmission, in which AChE may serve as a responsive gene for mediating the effect. Copyright © 2017. Published by Elsevier B.V.
International Nuclear Information System (INIS)
Maw, Min Khine; Fujimoto, Jiro; Tamaya, Teruhiko
2009-01-01
The inhibitor of DNA-binding (ID) has been involved in cell cycle regulation, apoptosis and angiogenesis. This prompted us to study ID functions in tumor advancement of ovarian cancers. Sixty patients underwent surgery for ovarian cancers. In ovarian cancers, the levels of ID-1, ID-2 and ID-3 mRNAs were determined by real-time reverse transcription-polymerase chain reaction. The histoscore with the localization of ID-1 was determined by immunohistochemistry. Patient prognosis was analyzed with a 36-month survival rate. Microvessel counts were determined by immunohistochemistry for CD34 and factor VIII-related antigen. ID-1 histoscores and mRNA levels both significantly (p < 0.001) increased in ovarian cancers according to clinical stage, regardless of histopathological type. Furthermore, 30 patients with high ID-1 expression had a lower survival rate (53%) compared to patients with low ID-1 expression (80%). ID-1 histoscores and mRNA levels significantly (p < 0.0001) correlated with microvessel counts in ovarian cancers. ID-1 increased in ovarian cancer cells during tumor progression. Moreover, ID-1 expression levels correlated with microvessel counts. Therefore, ID-1 might work on tumor advancement via angiogenesis and is considered to be a candidate for a prognostic indicator in ovarian cancers
40 CFR 146.4 - Criteria for exempted aquifers.
2010-07-01
... (CONTINUED) UNDERGROUND INJECTION CONTROL PROGRAM: CRITERIA AND STANDARDS General Provisions § 146.4 Criteria... of a permit application for a Class II or III operation to contain minerals or hydrocarbons that... public water system. (Clean Water Act, Safe Drinking Water Act, Clean Air Act, Resource Conservation and...
MicroRNA-146 protects A549 and H1975 cells from LPS-induced ...
Indian Academy of Sciences (India)
Qiang Wang
2017-10-26
Oct 26, 2017 ... States, pneumonia is the sixth most common cause of dis- ease-related deaths. In addition, pneumonia is the most common hospital-acquired fatal infections. ... 146 targets the messengers of bacterial lipopolysaccharide.
22 CFR 146.445 - Marital or parental status.
2010-04-01
... EDUCATION PROGRAMS OR ACTIVITIES RECEIVING FEDERAL FINANCIAL ASSISTANCE Discrimination on the Basis of Sex in Education Programs or Activities Prohibited § 146.445 Marital or parental status. (a) Status..., or marital status that treats students differently on the basis of sex. (b) Pregnancy and related...
Toward operation of series IDs at BL43LXU of SPring-8
Energy Technology Data Exchange (ETDEWEB)
Baron, A. Q. R.; Tanaka, T.; Soutome, K.; Takao, M.; Nakamura, T.; Kobayashi, K.; Fujita, T.; Takahashi, S.; Aoyagi, H.; Shimosaki, Y.; Seike, T.; Uchiyama, H.; Ishikawa, D.; Chuang, T.-H.; Kimura, H.; Tanaka, H.; Kitamura, H.; Ishikawa, T. [SPring-8, 1-1-1 Kouto, Sayo, Hyogo, 679 (Japan)
2016-07-27
This paper discusses two issues relating to using 3 small gap insertion devices in series at BL43LXU of SPring-8 to make a uniquely powerful source in the 15-26 keV region of the x-ray spectrum. The issues discussed are (1) damage to the covers of the downstream IDs by radiation from the upstream IDs and (2) proper steering of the electron beam to get the best photon beam properties. After tests in several configurations, including one where an ID was run without an impedance-reducing cover, the damage issue was solved by installing a distributed absorber in the most downstream ID. The steering issues were mostly resolved by the introduction of appropriate corrector magnets and feedback. The paper is written from the viewpoint of an interested beamline scientist impressed with the cooperation of different groups to make a source for new science possible.
45 CFR 146.120 - Interaction with the Family and Medical Leave Act. [Reserved
2010-10-01
... 45 Public Welfare 1 2010-10-01 2010-10-01 false Interaction with the Family and Medical Leave Act. [Reserved] 146.120 Section 146.120 Public Welfare DEPARTMENT OF HEALTH AND HUMAN SERVICES REQUIREMENTS... Interaction with the Family and Medical Leave Act. [Reserved] ...
Mapping of Id locus for dermal shank melanin in a Chinese ...
Indian Academy of Sciences (India)
JIGUO XU
2017-12-08
Dec 8, 2017 ... Information on the SNPs used for the association analysis. ID. Position (galGal3) .... using Bio-Rad Manager software, and the data were nor- malized to the ..... This work was supported by the High Technology Research.
Vibrational measurements in 3-ID-B
International Nuclear Information System (INIS)
Sutter, J.; Alp, E.; Barraza, J.; Shu, D.
1998-04-01
The authors have undertaken a series of vibrational measurements in hutch 3-ID-B. Their motivation was to compare two different methods of mounting an interferometer for effectiveness in vibrational isolation and stability. In addition they were able to compare the stability of the optical table with and without its eight large bolts inserted
Directory of Open Access Journals (Sweden)
Paula F T Cezar-de-Mello
2014-09-01
Full Text Available Mycobacterium leprae infects macrophages and Schwann cells inducing a gene expression program to facilitate its replication and progression to disease. MicroRNAs (miRNAs are key regulators of gene expression and could be involved during the infection. To address the genetic influence of miRNAs in leprosy, we enrolled 1,098 individuals and conducted a case-control analysis in order to study four miRNAs genes containing single nucleotide polymorphism (miRSNP. We tested miRSNP-125a (rs12975333 G>T, miRSNP-223 (rs34952329 *>T, miRSNP-196a-2 (rs11614913 C>T and miRSNP-146a (rs2910164 G>C. Amongst them, miRSNP-146a was the unique gene associated with risk to leprosy per se (GC OR = 1.44, p = 0.04; CC OR = 2.18, p = 0.0091. We replicated this finding showing that the C-allele was over-transmitted (p = 0.003 using a transmission-disequilibrium test. A functional analysis revealed that live M. leprae (MOI 100:1 was able to induce miR-146a expression in THP-1 (p<0.05. Furthermore, pure neural leprosy biopsies expressed augmented levels of that miRNA as compared to biopsy samples from neuropathies not related with leprosy (p = 0.001. Interestingly, carriers of the risk variant (C-allele produce higher levels of mature miR-146a in nerves (p = 0.04. From skin biopsies, although we observed augmented levels of miR-146a, we were not able to correlate it with a particular clinical form or neither host genotype. MiR-146a is known to modulate TNF levels, thus we assessed TNF expression (nerve biopsies and released by peripheral blood mononuclear cells infected with BCG Moreau. In both cases lower TNF levels correlates with subjects carrying the risk C-allele, (p = 0.0453 and p = 0.0352; respectively, which is consistent with an immunomodulatory role of this miRNA in leprosy.
FDIC Institution Directory (ID) -- Insured Insitution Download File
Federal Deposit Insurance Corporation — The FDIC's Institution Directory (ID) download file provides a list of all FDIC-insured institutions. The file includes demographic information related to the...
2013-02-06
... Services Group, Inc., Commercial/Actuarial/ Information Delivery Services (IDS)/Corporate & Financial... workers and former workers of Hartford Financial Services Group, Inc., Commercial/Actuarial/Information Delivery Services (IDS)/Corporate & Financial Reporting group, Hartford, Connecticut (The Hartford-IDS...
Wicked ID: Conceptual Framework for Considering Instructional Design as a Wicked Problem
Directory of Open Access Journals (Sweden)
Katrin Becker
2007-02-01
Full Text Available The process of instructional design has parallels in other design disciplines. Software design is one that has experienced intense attention in the last 30 or so years, and many lessons learned there can be applied to ID. Using software design as a springboard, this concept paper seeks to propose a new approach to ID. It suggests that instructional design is almost always a Wicked Problem. The connection is formed between Wicked Problems as first described by Rittel and Webber in 1973, and the models in and processes of instructional design. The areas of social planning, organizational management and software design all posses some accepted and tested approaches to the solution of Wicked Problems. These will be described, and how they can be applied to ID will be explained. Finally, this paper will propose a meta-model for ID and explain how it can be used in the current context. Résumé : Le processus de conception pédagogique a des similitudes avec d’autres disciplines. La conception de logiciels a fait l’objet d’une grande attention dans les trente dernières années et de nombreuses leçons tirées peuvent s’appliquer à la conception pédagogique. En se basant sur la conception de logiciels, cet article cherche à proposer une nouvelle méthode à la conception pédagogique. Il laisse entendre que la conception pédagogique constitue presque toujours un problème épineux. Le lien est formé entre les problèmes épineux tels que décrits par Rittel et Webber en 1973 et les modèles et processus de la conception pédagogique. Les secteurs de l’organisation sociale, de la gestion des organisations et de la conception de logiciels comptent des méthodes acceptées et validées à la résolution de problèmes épineux. Nous les décrirons et expliquerons comment ils peuvent servir à la conception pédagogique. Enfin, l’article proposera un meta-modèle de la conception pédagogique et expliquera comment il peut servir dans le
International Nuclear Information System (INIS)
Zhang, Long; Shi, Songting; Zhang, Juan; Zhou, Fangfang; Dijke, Peter ten
2012-01-01
Highlights: ► Expression of Id3 but not Id1 is induced by Wnt3a stimulation in C2C12 cells. ► Wnt3a induces Id3 expression via canonical Wnt/β-catenin pathway. ► Wnt3a-induced Id3 expression does not depend on BMP signaling activation. ► Induction of Id3 expression is critical determinant in Wnt3a-induced cell proliferation and differentiation. -- Abstract: Canonical Wnt signaling plays important roles in regulating cell proliferation and differentiation. In this study, we report that inhibitor of differentiation (Id)3 is a Wnt-inducible gene in mouse C2C12 myoblasts. Wnt3a induced Id3 expression in a β-catenin-dependent manner. Bone morphogenetic protein (BMP) also potently induced Id3 expression. However, Wnt-induced Id3 expression occurred independent of the BMP/Smad pathway. Functional studies showed that Id3 depletion in C2C12 cells impaired Wnt3a-induced cell proliferation and alkaline phosphatase activity, an early marker of osteoblast cells. Id3 depletion elevated myogenin induction during myogenic differentiation and partially impaired Wnt3a suppressed myogenin expression in C2C12 cells. These results suggest that Id3 is an important Wnt/β-catenin induced gene in myoblast cell fate determination.
ID'ing innate and innate-like lymphoid cells.
Verykokakis, Mihalis; Zook, Erin C; Kee, Barbara L
2014-09-01
The immune system can be divided into innate and adaptive components that differ in their rate and mode of cellular activation, with innate immune cells being the first responders to invading pathogens. Recent advances in the identification and characterization of innate lymphoid cells have revealed reiterative developmental programs that result in cells with effector fates that parallel those of adaptive lymphoid cells and are tailored to effectively eliminate a broad spectrum of pathogenic challenges. However, activation of these cells can also be associated with pathologies such as autoimmune disease. One major distinction between innate and adaptive immune system cells is the constitutive expression of ID proteins in the former and inducible expression in the latter. ID proteins function as antagonists of the E protein transcription factors that play critical roles in lymphoid specification as well as B- and T-lymphocyte development. In this review, we examine the transcriptional mechanisms controlling the development of innate lymphocytes, including natural killer cells and the recently identified innate lymphoid cells (ILC1, ILC2, and ILC3), and innate-like lymphocytes, including natural killer T cells, with an emphasis on the known requirements for the ID proteins. © 2014 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.
Directory of Open Access Journals (Sweden)
Lili Cui
Full Text Available miR146a is well known for its regulatory role in the immune response and inflammation. Recent studies have demonstrated the links between miR146a and Alzheimer disease (AD and suggested that miR146a may be involved in neuroinflammation and the metabolism of amyloid-β (Aβ, which are critical events in AD pathology. Although genetic studies have focused on the association between the miR146a gene and susceptibility to several diseases, no association study of miR146a variability with AD has been conducted. In this report, we performed a case-control association study to analyze the genotype and allele distributions of the miR146a, rs2910464 and rs57095329 polymorphisms in a Chinese population consisting of 292 AD cases and 300 healthy controls. We found a significant difference in the genotypes and allele frequencies of rs57095329 between the AD cases and the controls (p = 0.0147 and p = 0.0184, respectively, where the AA genotype of rs57095329 was associated with an increased risk of AD as well the cognitive decline in AD patients. Additionally, the AA genotype of rs57095329 exhibited significantly higher miR146a expression than the GG+GA genotypes of rs2910164 in the peripheral blood cells (PBMCs of healthy individuals and had a stronger effect on the production of IL-6 and IL-1β when the cells were stimulated with LPS. Our data provide preliminary evidence that the rs57095329 polymorphism in the miR146a promoter is involved in the genetic susceptibility to AD, and this risk AA genotype may increase the expression of miR146a and influence certain proinflammatory cytokines, thus playing a role in the pathogenesis of AD.
Identity Management ToolKit (IdM TK)
Department of Veterans Affairs — With the IdM TK, authorized users can search and view identity and exception information from the Administrative Data Repository (ADR). Specifically, users can view...
Determination of local chromatin composition by CasID.
Schmidtmann, Elisabeth; Anton, Tobias; Rombaut, Pascaline; Herzog, Franz; Leonhardt, Heinrich
2016-09-02
Chromatin structure and function are determined by a plethora of proteins whose genome-wide distribution is typically assessed by immunoprecipitation (ChIP). Here, we developed a novel tool to investigate the local chromatin environment at specific DNA sequences. We combined the programmable DNA binding of dCas9 with the promiscuous biotin ligase BirA* (CasID) to biotinylate proteins in the direct vicinity of specific loci. Subsequent streptavidin-mediated precipitation and mass spectrometry identified both known and previously unknown chromatin factors associated with repetitive telomeric, major satellite and minor satellite DNA. With super-resolution microscopy, we confirmed the localization of the putative transcription factor ZNF512 at chromocenters. The versatility of CasID facilitates the systematic elucidation of functional protein complexes and locus-specific chromatin composition.
A decade of user operation on the macromolecular crystallography MAD beamline ID14-4 at the ESRF
International Nuclear Information System (INIS)
McCarthy, Andrew A.; Brockhauser, Sandor; Nurizzo, Didier; Theveneau, Pascal; Mairs, Trevor; Spruce, Darren; Guijarro, Matias; Lesourd, Marc; Ravelli, Raimond B. G.; McSweeney, Sean
2009-01-01
The improvement of the X-ray beam quality achieved on ID14-4 by the installation of new X-ray optical elements is described. ID14-4 at the ESRF is the first tunable undulator-based macromolecular crystallography beamline that can celebrate a decade of user service. During this time ID14-4 has not only been instrumental in the determination of the structures of biologically important molecules but has also contributed significantly to the development of various instruments, novel data collection schemes and pioneering radiation damage studies on biological samples. Here, the evolution of ID14-4 over the last decade is presented, and some of the major improvements that were carried out in order to maintain its status as one of the most productive macromolecular crystallography beamlines are highlighted. The experimental hutch has been upgraded to accommodate a high-precision diffractometer, a sample changer and a large CCD detector. More recently, the optical hutch has been refurbished in order to improve the X-ray beam quality on ID14-4 and to incorporate the most modern and robust optical elements used at other ESRF beamlines. These new optical elements will be described and their effect on beam stability discussed. These studies may be useful in the design, construction and maintenance of future X-ray beamlines for macromolecular crystallography and indeed other applications, such as those planned for the ESRF upgrade
Overestimation of the 25(OH)D serum concentration with the automated IDS EIA kit.
Cavalier, Etienne; Huberty, Véronique; Cormier, Catherine; Souberbielle, Jean-Claude
2011-02-01
We have recently observed an increasing number of patients presenting very high serum levels of 25-hydroxyvitamin D [25(OH)D] (> 150 ng/mL), which, in all cases, had been measured with the IDS EIA kit adapted on different "open" automated platforms. We performed a comparison between the IDS EIA kit adapted on two different "open"automated platforms and the DiaSorin RIA. We found a systematic bias (higher levels with the IDS EIA kit) for concentrations more than 50-60 ng/mL that was less obvious when the IDS EIA was used in its manual procedure. We thus suggest to use the IDS EIA kit in its manual procedure rather than to adapt it on an automated platform, and to interpret cautiously a 25(OH)D greater than 100 ng/mL with this kit. Copyright © 2011 American Society for Bone and Mineral Research.
Young, Vicky J; Ahmad, Syed F; Brown, Jeremy K; Duncan, W Colin; Horne, Andrew W
2015-11-18
VEGF-A, an angiogenic factor, is increased in the peritoneal fluid of women with endometriosis. The cytokine TGF-β1 is thought to play a role in the establishment of endometriosis lesions. Inhibitor of DNA binding (ID) proteins are transcriptional targets of TGF-β1 and ID1 has been implicated in VEGF-A regulation during tumor angiogenesis. Herein, we determined whether peritoneal expression of VEGF-A is regulated by TGF-β1 through the ID1 pathway in women with endometriosis. VEGF-A was measured in peritoneal fluid by ELISA (n = 16). VEGF-A and ID1 expression was examined in peritoneal biopsies (n = 13), and primary peritoneal and immortalized mesothelial cells (MeT5A) by immunohistochemistry, qRT-PCR and ELISA. VEGF-A was increased in peritoneal fluid from women with endometriosis and levels correlated with TGF-β1 concentrations (P peritoneal mesothelium and TGF-β1 increased VEGFA mRNA (P endometriosis and TGF-β1 increased concentrations of ID1 mRNA (P endometriosis, as an effector of TGFβ1 dependent upregulation of VEGF-A, and highlights a novel potential therapeutic target.
146----10 Dec indd [ FINAL VERSION].indd
African Journals Online (AJOL)
23 Sep 2009 ... e o lo g ic a l S tu d ie s http://www.hts.org.za. HTS. Original Research. A ... phronēsis and Paul Ricoeur's movement from mimēsis1 ... It is not only pastors' knowledge of the Bible, theological tradition and ...... way that we are led into the truth and life (John 14:6). ..... human brain, Harper Collins, New York.
A estabilização heterodoxa no brasil: idéias e redes políticas
Directory of Open Access Journals (Sweden)
Pio Carlos
2001-01-01
Full Text Available O artigo discute o papel das idéias e das "redes políticas" na explicação do conteúdo de políticas de estabilização no Brasil. As idéias heterodoxas dos economistas da Pontifícia Universidade Católica do Rio de Janeiro (PUC-RJ são apresentadas e comparadas ao conteúdo de dois programas de estabilização implementados no país: o Plano Cruzado (1986 e o Plano Real (desde 1993. Variáveis políticas são apontadas para explicar por que o segundo programa apresenta maior semelhança com as idéias originais dos economistas do que o primeiro, o que, segundo o autor, explica, em grande medida, seu maior êxito em reduzir a inflação.
Security and Privacy Improvements for the Belgian eID Technology
Verhaeghe, Pieter; Lapon, Jorn; de Decker, Bart; Naessens, Vincent; Verslype, Kristof
The Belgian Electronic Identity Card enables Belgian citizens to prove their identity digitally and to sign electronic documents. At the end of 2009, every Belgian citizen older than 12 years will have such an eID card. In the future, usage of the eID card may be mandatory. However, irresponsible use of the card may cause harm to individuals.
MiR-146-SIAH2-AR Signaling in Castration-Resistant Prostate Cancer
2015-09-01
determined whether miR-146a inhibitor promotes CRPC phenotype by upregulating SIAH2 in LNCaP and MDAPCa2b cells. First we determined the effect of DHT (5α...dihydrotestosterone) on proliferation of these cells grown in the presence of charcoal stripped calf serum. The results indicated that DHT increased...proliferation of both parental LNCaP and MDAPCa2b cells but DHT did not increase proliferation of miR-146a inhibitor expressing cell lines (Fig. 6
78 FR 25406 - Proposed Modification of Class E Airspace; Twin Falls, ID
2013-05-01
...) Global Positioning System (GPS) and the Instrument Landing System (ILS) or Localizer (LOC) standard... the earth. * * * * * ANM ID E5 Twin Falls, ID [Modified] Twin Falls Joslin Field-Magic Valley Regional...
Directory of Open Access Journals (Sweden)
Qian Cheng
2017-01-01
Full Text Available Exosomes derived from cancer cells can affect various functions of mesenchymal stem cells (MSCs via conveying microRNAs (miRs. miR-21 and miR-146a have been demonstrated to regulate MSC proliferation and transformation. Interleukin-6 (IL-6 secreted from transformed MSCs in turn favors the survival of multiple myeloma (MM cells. However, the effects of MM exosomes on MSC functions remain largely unclear. In this study, we investigated the effects of OPM2 (a MM cell line exosomes (OPM2-exo on regulating the proliferation, cancer-associated fibroblast (CAF transformation, and IL-6 secretion of MSCs and determined the role of miR-21 and miR-146a in these effects. We found that OPM2-exo harbored high levels of miR-21 and miR-146a and that OPM2-exo coculture significantly increased MSC proliferation with upregulation of miR-21 and miR-146a. Moreover, OPM2-exo induced CAF transformation of MSCs, which was evidenced by increased fibroblast-activated protein (FAP, α-smooth muscle actin (α-SMA, and stromal-derived factor 1 (SDF-1 expressions and IL-6 secretion. Inhibition of miR-21 or miR-146a reduced these effects of OPM2-exo on MSCs. In conclusion, MM could promote the proliferation, CAF transformation, and IL-6 secretion of MSCs partially through regulating miR21 and miR146a.
78 FR 45478 - Proposed Establishment of Class E Airspace; Salmon, ID
2013-07-29
...-0531; Airspace Docket No. 13-ANM-20] Proposed Establishment of Class E Airspace; Salmon, ID AGENCY... action proposes to establish Class E airspace at the Salmon VHF Omni-Directional Radio Range/Distance Measuring Equipment (VOR/DME) navigation aid, Salmon, ID, to facilitate vectoring of Instrument Flight Rules...
International Nuclear Information System (INIS)
Kurooka, Hisanori; Sugai, Manabu; Mori, Kentaro; Yokota, Yoshifumi
2013-01-01
Highlights: •Sodium arsenite induces cytoplasmic accumulation of Id3. •Arsenite binds to closely spaced N-terminal cysteine residues of Id3. •N-terminal cysteines are essential for arsenite-induced nuclear export of Id3. •Nuclear export of Id3 counteracts its transcriptional repression activity. -- Abstract: Ids are versatile transcriptional repressors that regulate cell proliferation and differentiation, and appropriate subcellular localization of the Id proteins is important for their functions. We previously identified distinct functional nuclear export signals (NESs) in Id1 and Id2, but no active NES has been reported in Id3. In this study, we found that treatment with the stress-inducing metalloid arsenite led to the accumulation of GFP-tagged Id3 in the cytoplasm. Cytoplasmic accumulation was impaired by a mutation in the Id3 NES-like sequence resembling the Id1 NES, located at the end of the HLH domain. It was also blocked by co-treatment with the CRM1-specific nuclear export inhibitor leptomycin B (LMB), but not with the inhibitors for mitogen-activated protein kinases (MAPKs). Importantly, we showed that the closely spaced N-terminal cysteine residues of Id3 interacted with the arsenic derivative phenylarsine oxide (PAO) and were essential for the arsenite-induced cytoplasmic accumulation, suggesting that arsenite induces the CRM1-dependent nuclear export of Id3 via binding to the N-terminal cysteines. Finally, we demonstrated that Id3 significantly repressed arsenite-stimulated transcription of the immediate-early gene Egr-1 and that this repression activity was inversely correlated with the arsenite-induced nuclear export. Our results imply that Id3 may be involved in the biological action of arsenite
MS2 VLP-based delivery of microRNA-146a inhibits autoantibody production in lupus-prone mice
Directory of Open Access Journals (Sweden)
Pan Y
2012-12-01
Full Text Available Yang Pan,1,2 Tingting Jia,1,2 Yuan Zhang,1,2 Kuo Zhang,1 Rui Zhang,1 Jinming Li,1 Lunan Wang11National Center for Clinical Laboratories, Beijing Hospital of the Ministry of Health, Beijing, People’s Republic of China; 2Graduate School, Peking Union Medical College, Chinese Academy of Medical Sciences, Beijing, People’s Republic of ChinaBackground: Systemic lupus erythematosus (SLE is a chronic autoimmune disease characterized by the presence of pathogenic autoantibodies. Recent studies suggest that microRNAs (miRNAs play an essential role in immunoregulation and may be involved in the pathogenesis of SLE. Therefore, it was of interest to investigate the potential therapeutic application of miRNAs in SLE, a concept that has not been thoroughly investigated thus far. Virus-like particles (VLPs are a type of recombinant nanoparticle enveloped by certain proteins derived from the outer coat of a virus. Herein, we describe a novel miRNA-delivery approach via bacteriophage MS2 VLPs and investigate the therapeutic effects of miR-146a, a well-studied and SLE-related miRNA, in BXSB lupus-prone mice.Methods: VLPs containing miR-146a, and the control VLPs, were prepared using an Escherichia coli expression system and then administered to lupus-prone mice over a 12-day period. We performed an enzyme-linked immunosorbent assay to evaluate the anti-dsDNA antibody, autoantibody to nuclear antigen (ANA, total IgG and total IgM levels in serum. The expression of miR-146a was analyzed by qRT-PCR. SLE-related cytokines as well as some toll-like receptor signaling pathway molecules were also measured.Results: Treatment with MS2-miR146a VLP showed profound effects on lupus-prone BXSB mice, including an increased level of mature miR-146a, which led to a significant reduction in the expression of autoantibodies and total IgG. Remarkably, these mice also exhibited reduced levels of proinflammatorycytokines, including IFN-Interferon-α (IFN-α, Interleukin-1β (Il-1
DNA origami-based shape IDs for single-molecule nanomechanical genotyping
Zhang, Honglu; Chao, Jie; Pan, Dun; Liu, Huajie; Qiang, Yu; Liu, Ke; Cui, Chengjun; Chen, Jianhua; Huang, Qing; Hu, Jun; Wang, Lianhui; Huang, Wei; Shi, Yongyong; Fan, Chunhai
2017-04-01
Variations on DNA sequences profoundly affect how we develop diseases and respond to pathogens and drugs. Atomic force microscopy (AFM) provides a nanomechanical imaging approach for genetic analysis with nanometre resolution. However, unlike fluorescence imaging that has wavelength-specific fluorophores, the lack of shape-specific labels largely hampers widespread applications of AFM imaging. Here we report the development of a set of differentially shaped, highly hybridizable self-assembled DNA origami nanostructures serving as shape IDs for magnified nanomechanical imaging of single-nucleotide polymorphisms. Using these origami shape IDs, we directly genotype single molecules of human genomic DNA with an ultrahigh resolution of ~10 nm and the multiplexing ability. Further, we determine three types of disease-associated, long-range haplotypes in samples from the Han Chinese population. Single-molecule analysis allows robust haplotyping even for samples with low labelling efficiency. We expect this generic shape ID-based nanomechanical approach to hold great potential in genetic analysis at the single-molecule level.
Nizyaeva, N V; Kulikova, G V; Nagovitsyna, M N; Kan, N E; Prozorovskaya, K N; Shchegolev, A I; Sukhikh, G T
2017-07-01
We studied the expression of microRNA-146a and microRNA-155 in placental villi from 18 women (26-39 weeks of gestation) of reproductive age with early- or late-onset preeclampsia. The reference group consisted of women with physiological pregnancy and full-term gestation and with preterm birth after caesarian section on gestation week 26-31. MicroRNA-146a and microRNA-155 were detected by in situ hybridization with digoxigenin on paraffin sections. It was found that the expression of microRNA-146a in both syncytiotrophoblast of the intermediate villi and syncytial knots was lower at late-onset preeclampsia than at physiologic pregnancy of full-term period (p=0.037 and p=0.001 respectively). The expression of microRNA-155 in syncytiotrophoblast of intermediate placental villi in early-onset preeclampsia was higher than in group with preterm delivery (p=0.003). However, in syncytiotrophoblast of intermediate villi and in syncytial knots, the expression of microRNA-155 was lower at late-onset preeclampsia in comparison with full-term physiological pregnancy (p=0.005). In addition, the expression of microRNA-146a and microRNA-155 did not increase in the later terms in preeclampsia, while in the reference groups demonstrating gradual increase in the expression of these markers with increasing gestational age. Expression microRNA-146a and microRNA-155 little differed in early- and late-onset preeclampsia. These findings suggest that different variants of preeclampsia are probably characterized by common pathogenetic pathways. Damaged trophoblast cannot maintain of microRNAs synthesis at the required level, which determines the formation of a vicious circle in preeclampsia and further progression of the disease.
Tormin, Ariane; Li, Ou; Brune, Jan Claas; Walsh, Stuart; Schütz, Birgit; Ehinger, Mats; Ditzel, Nicholas; Kassem, Moustapha
2011-01-01
Nonhematopoietic bone marrow mesenchymal stem cells (BM-MSCs) are of central importance for bone marrow stroma and the hematopoietic environment. However, the exact phenotype and anatomical distribution of specified MSC populations in the marrow are unknown. We characterized the phenotype of primary human BM-MSCs and found that all assayable colony-forming units-fibroblast (CFU-Fs) were highly and exclusively enriched not only in the lin−/CD271+/CD45−/CD146+ stem-cell fraction, but also in lin−/CD271+/CD45−/CD146−/low cells. Both populations, regardless of CD146 expression, shared a similar phenotype and genotype, gave rise to typical cultured stromal cells, and formed bone and hematopoietic stroma in vivo. Interestingly, CD146 was up-regulated in normoxia and down-regulated in hypoxia. This was correlated with in situ localization differences, with CD146 coexpressing reticular cells located in perivascular regions, whereas bone-lining MSCs expressed CD271 alone. In both regions, CD34+ hematopoietic stem/progenitor cells were located in close proximity to MSCs. These novel findings show that the expression of CD146 differentiates between perivascular versus endosteal localization of non-hematopoietic BM-MSC populations, which may be useful for the study of the hematopoietic environment. PMID:21415267
Independence Day 2004 (ID04) / Raul Hindov
Hindov, Raul
2004-01-01
Ülevaade 20.-22. veebruarini 2004 toimunud kaugluurepatrullide rännaku ja sõdurioskuste kompleksõppusest ID04 (Independence Day 2004 - Iseseisvuspäev 2004), millel osales 25 patrullvõistlusteks valmistuvat meest ja naist
Neutral V production with 14.6 x A GeV/c silicon beams
International Nuclear Information System (INIS)
Eiseman, S.E.; Etkin, A.; Foley, K.J.; Hackenburg, R.W.; Longacre, R.S.; Love, W.A.; Morris, T.W.; Platner, E.D.; Saulys, A.C.; Lindenbaum, S.J.; Chan, C.S.; Kramer, M.A.; Zhao, K.; Hallman, T.J.; Madansky, L.; Bonner, B.E.; Buchanan, J.A.; Chiou, C.N.; Clement, J.M.; Corcoran, M.D.; Kruk, J.W.; Mutchler, G.S.; Nessi-Tedaldi, F.; Nessi, M.; Roberts, J.B.
1990-01-01
We present the results of a measurement of neutral V production with 14.6xA GeV/c Si beams on Au and Cu targets. The Λ and K s 0 yields were measured as a function of negative particle multiplicity. Effective temperatures were determined from an exponential fit to the transverse mass distributions. (orig.)
On the validity of Ksub(Id)-measurements in instrumented impact tests
International Nuclear Information System (INIS)
Kalthoff, J.F.; Winkler, S.; Klemm, W.; Beinert, J.
1979-01-01
The influence of inertia effects in determining the dynamic fracture toughness Ksub(Id) by instrumented impact testing is investigated. Model experiments in the brittle fracture regime are carried out with precracked bend specimens machined from the epoxy resin Araldite B. As is usual in these tests, the loads at the tup of the impinging striker are recorded as a function of time during the impact process. For reference purposes, the dynamic fracture toughness value Ksub(Id)sup(m1) is derived from the measured maximum load utilizing static stress intensity factor formulas. In addition to this conventional procedure, the actual stress intensity factors are measured directly at the tip of the crack by means of the shadow optical method of caustics applied in combination with high speed photography. The critical value of these optically measured stress intensity factors (for onset of crack propagation), Ksub(Id)sup(opt), is the true dynamic fracture toughness. In the experiments, the specimen size and the impact velocity were varied. In accordance with expectations, it is found that the hammer load signal is not correlated with the actual crack tip stress intensity factor values by a simple proportionality. The conventionally determined Ksub(Id)sup(m1)-value overestimates the true dynamic fracture toughness Ksub(Id)sup(opt). This overestimation becomes larger for larger specimen sizes and larger impact velocities. The results demonstrate the dominating influence inertia effects can have on hammer load measurements and emphasize the importance of eliminating these effects in order to determine non-erroneous dynamic fracture toughness values. (orig.)
Shen, Jiangli; Yu, Zhaohui; Li, Na
2018-06-20
The E3 ubiquitin ligase ring finger protein 146 (RNF146) has been implicated in tumor development. However, the role and clinical significance of RNF146 in colorectal cancer (CRC) remain unknown. In this study, we reported for the first time that RNF146 was upregulated in CRC tissues as well as in cell lines. Further, RNF146 expression was independent prognostic factor for poor outcome of CRC patients. RNF146 knockdown in cell lines inhibited cell growth, promoted cell apoptosis in vitro and suppressed colorectal tumor growth in vivo. Mechanistic investigations revealed that RNF146 exerted oncogenic role through ubiquitination of Axin1 to activate β-catenin signalling. In addition, RNF146 expression was positively correlated with β-catenin expression in CRC tissues. Collectively, our data suggest that RNF146 might function as a oncogene in human CRC, and represent a promising prognostic factor and a valuable therapeutic target for CRC. Copyright © 2018. Published by Elsevier Inc.
Identification of an active ID-like group of SINEs in the mouse.
Kass, David H; Jamison, Nicole
2007-09-01
The mouse genome consists of five known families of SINEs: B1, B2, B4/RSINE, ID, and MIR. Using RT-PCR we identified a germ-line transcript that demonstrates 92.7% sequence identity to ID (excluding primer sequence), yet a BLAST search identified numerous matches of 100% sequence identity. We analyzed four of these elements for their presence in orthologous genes in strains and subspecies of Mus musculus as well as other species of Mus using a PCR-based assay. All four analyzed elements were identified either only in M. musculus or exclusively in both M. musculus and M. domesticus, indicative of recent integrations. In conjunction with the identification of transcripts, we present an active ID-like group of elements that is not derived from the proposed BC1 master gene of ID elements. A BLAST of the rat genome indicated that these elements were not in the rat. Therefore, this family of SINEs has recently evolved, and since it has thus far been observed mainly in M. musculus, we refer to this family as MMIDL.
Gysler, Stefan M; Mulla, Melissa J; Guerra, Marta; Brosens, Jan J; Salmon, Jane E; Chamley, Lawrence W; Abrahams, Vikki M
2016-07-01
What is the role of microRNAs (miRs) in antiphospholipid antibody (aPL)-induced trophoblast inflammation? aPL-induced up-regulation of trophoblast miR-146a-3p is mediated by Toll-like receptor 4 (TLR4), and miR-146a-3p in turn drives the cells to secrete interleukin (IL)-8 by activating the RNA sensor, TLR8. Obstetric antiphospholipid syndrome (APS) is an autoimmune disorder characterized by circulating aPL and an increased risk of pregnancy complications. We previously showed that aPL recognizing beta2 glycoprotein I (β2GPI) elicit human first trimester trophoblast secretion of IL-8 by activating TLR4. Since some miRs control TLR responses, their regulation in trophoblast cells by aPL and functional role in the aPL-mediated inflammatory response was investigated. miRs can be released from cells via exosomes, and therefore, miR exosome expression was also examined. A panel of miRs was selected based on their involvement with TLR signaling: miR-9; miR-146a-5p and its isomiR, miR-146a-3p; miR-155, miR-210; and Let-7c. Since certain miRs can activate the RNA sensor, TLR8, this was also investigated. For in vitro studies, the human first trimester extravillous trophoblast cell line, HTR8 was studied. HTR8 cells transfected to express a TLR8 dominant negative (DN) were also used. Plasma was evaluated from pregnant women who have aPL, either with or without systemic lupus erythematous (SLE) (n = 39); SLE patients without aPL (n = 30); and healthy pregnant controls (n = 20). Trophoblast HTR8 wildtype and TLR8-DN cells were incubated with or without aPL (mouse anti-human β2GPI mAb) for 48-72 h. HTR8 cells were also treated with or without aPL in the presence and the absence of a TLR4 antagonist (lipopolysaccharide from Rhodobacter sphaeroides; LPS-RS), specific miR inhibitors or specific miR mimics. miR expression levels in trophoblast cells, trophoblast-derived exosomes and exosomes isolated from patient plasma were measured by qPCR. Trophoblast IL-8 secretion was
He, Shuying; Guo, Weihong; Deng, Feihong; Chen, Kequan; Jiang, Yonghong; Dong, Minyu; Peng, Liang; Chen, Xueqing
2018-03-21
Non-alcoholic fatty liver disease (NAFLD) is one of the most common chronic liver diseases worldwide, and precision therapeutic will be a benefit for the NAFLD regression. In this study, we observed low microRNA 146 b (miR-146 b) expression in NAFLD mice model induced by methionine-choline-deficient diet (MCD) compared with control group. Furthermore, miR-146b -/- mice induced MCD exhibited severe liver steatosis and hepatitis. A bio-distribution study showed that novel Lactosylated PDMAEMA nanoparticles effectively targeted hepatocytes Lac-PDMAEMA. We coupled miR-146b mimic with Lac-PDMAEMA and then were administrated to NAFLD mice model, which could obviously alleviate the hepatic steatosis. Lac-PDMAEMA effectively delivered miR-146b mimic to hepatocytes with a ∼8-fold upregulation of miR-146b mimic targeting MyD88 and IRAK1, and in turn suppressed the expression of PPARγ. Meanwhile, TNF-α and IL-6 mRNA levels were decreased after administration of Lac-PDMAEMA/miR-146b mimic. So, we made a conclusion that targeted delivering miR-146b mimic to the hepatocytes by, coupling Lac-PDMAEMA nanoparticles could effectively alleviate the hepatic steatosis in NAFLD mice, which maybe bring a new and effective way to intervene and therapy the NAFLD.
Cloning and shake flask expression of hrIDS- Like in Pichia pastoris ...
African Journals Online (AJOL)
The human Iduronate-2-sulfate sulfatase (hIDS-Like) was cloned into the methylotrophic yeast Pichia pastoris under the control of alcohol oxidase promoter (AOX1) and the -mating factor signal peptide (a-factor). Six clones were identified by PCR. Using clone IDS28, the enzyme was secreted into the culture medium, ...
Alía, P; Mañá, J; Capdevila, O; Alvarez, A; Navarro, M A
2005-01-01
Serum angiotensin converting enzyme (SACE) concentration is considered a marker of sarcoidosis activity. This concentration is influenced by an insertion/deletion (I/D) polymorphism of the ACE gene, such that SACE levels follow the pattern DD>ID>II. The aim of our work was to study the relationship between I/D polymorphism and susceptibility to sarcoidosis, as well as the relation between this polymorphism and the clinical presentation and evolution of the disease in 177 sarcoidosis patients. A group of 104 individuals without sarcoidosis was included as control. Genotyping was done by a polymerase chain reaction (PCR) method, and SACE concentration at diagnosis was determined by a kinetic method. No differences were observed in genotype or allele distributions between patients and controls, nor between patients considering the type of presentation (Löfgren versus non-Löfgren) and evolution of the disease (acute versus chronic). As reported for healthy populations, SACE concentrations followed the pattern DD>ID>II in sarcoidosis patients, but significant differences between genotypes existed only in the Löfgren group (p = 0.003) and in acute patients (p = 0.02). SACE concentrations at diagnosis were lower in acute patients (p = 0.05) and in Löfgren's syndrome (p = 0.04), but this seemed to occur only in ID individuals (p = 0.02 and p = 0.01, respectively). No relation was thus found between I/D polymorphism and susceptibility to sarcoidosis, but ACE I/D genotyping may improve the assessment of disease activity, both at diagnosis and during the follow-up of treated and untreated patients.
An enhanced dynamic ID-based authentication scheme for telecare medical information systems
Directory of Open Access Journals (Sweden)
Ankita Chaturvedi
2017-01-01
Full Text Available The authentication schemes for telecare medical information systems (TMIS try to ensure secure and authorized access. ID-based authentication schemes address secure communication, but privacy is not properly addressed. In recent times, dynamic ID-based remote user authentication schemes for TMIS have been presented to protect user’s privacy. The dynamic ID-based authentication schemes efficiently protect the user’s privacy. Unfortunately, most of the existing dynamic ID-based authentication schemes for TMIS ignore the input verifying condition. This makes login and password change phases inefficient. Inefficiency of the password change phase may lead to denial of service attack in the case of incorrect input in the password change phase. To overcome these weaknesses, we proposed a new dynamic ID-based authentication scheme using a smart card. The proposed scheme can quickly detect incorrect inputs which makes the login and password change phase efficient. We adopt the approach with the aim to protect privacy, and efficient login and password change phases. The proposed scheme also resists off-line password guessing attack and denial of service attack. We also demonstrate the validity of the proposed scheme by utilizing the widely-accepted BAN (Burrows, Abadi, and Needham logic. In addition, our scheme is comparable in terms of the communication and computational overheads with relevant schemes for TMIS.
Zircaloy cladding ID/OD oxidation studies. Final report
International Nuclear Information System (INIS)
Westerman, R.E.; Hesson, G.M.
1977-11-01
The ID/OD oxide ratio that forms on Zircaloy tubing at temperatures relevant to postulated LOCA conditions was measured as a function of time, temperature, and distance from the rupture. The average ratio at the rupture position was less than unity, and decreased with decreasing test time and increasing distance from the point of rupture. The maximum observed ID/OD oxide ratio was 1.4. Ratios in excess of unity were typically found to be a consequence of the OD oxide being thinner than would have been anticipated from the nominal test conditions. Confirmatory data were also obtained on the isothermal oxidation kinetics of Zircaloy. These data are in good agreement with those obtained by other investigators and confirm the conservative nature of the Baker-Just equation that is required for use in licensing calculations
Directory of Open Access Journals (Sweden)
García-Carpintero, Esther
2014-06-01
Full Text Available The development and improvement of cooperation between the industrial sector and the public R&D system can produce competitive advantages for the companies. The present work describes experiences and perceptions of Spanish biotechnology companies in their collaboration with the public R&D system. Results show that almost all the biotechnological companies with R&D activities (93.6% have cooperated with the public R&D system. The main barriers found by the companies are the excess of bureaucracy and the slow response of public researchers. Results obtained also suggest the need to establish public policies and programmes to promote knowledge and technology transfer from public research centres to companies, with a special focus on encouraging researchers from the public R&D system and on improving how Technology Transfer Offices work.El desarrollo y la mejora de la cooperación entre el sector productivo y el sistema público de I+D puede generar un conjunto de ventajas competitivas para estas empresas. El presente trabajo describe las experiencias y percepciones de las empresas biotecnológicas españolas en su colaboración con el sistema público de I+D. Los resultados muestran que prácticamente la totalidad de empresas biotecnológicas españolas con actividades de I+D (un 93,6% han mantenido algún tipo de colaboración con el sistema público de I+D. Los principales obstáculos percibidos por estas empresas en su colaboración con el sistema público de I+D son el exceso de burocracia y la respuesta lenta de los investigadores. Los resultados obtenidos sugieren la conveniencia de establecer políticas y programas públicos para fomentar la transferencia de conocimiento y tecnología desde el sistema público de I+D a las empresas, fundamentalmente centrados en la necesidad de incentivar a los investigadores del sistema público de I+D y mejorar el funcionamiento de las Oficinas de Transferencia de Tecnología.
miR-342 regulates BRCA1 expression through modulation of ID4 in breast cancer.
Directory of Open Access Journals (Sweden)
Elisabetta Crippa
Full Text Available A miRNAs profiling on a group of familial and sporadic breast cancers showed that miRNA-342 was significantly associated with estrogen receptor (ER levels. To investigate at functional level the role of miR-342 in the pathogenesis of breast cancer, we focused our attention on its "in silico" predicted putative target gene ID4, a transcription factor of the helix-loop-helix protein family whose expression is inversely correlated with that of ER. ID4 is expressed in breast cancer and can negatively regulate BRCA1 expression. Our results showed an inverse correlation between ID4 and miR-342 as well as between ID4 and BRCA1 expression. We functionally validated the interaction between ID4 and miR-342 in a reporter Luciferase system. Based on these findings, we hypothesized that regulation of ID4 mediated by miR-342 could be involved in the pathogenesis of breast cancer by downregulating BRCA1 expression. We functionally demonstrated the interactions between miR-342, ID4 and BRCA1 in a model provided by ER-negative MDA-MB-231 breast cancer cell line that presented high levels of ID4. Overexpression of miR-342 in these cells reduced ID4 and increased BRCA1 expression, supporting a possible role of this mechanism in breast cancer. In the ER-positive MCF7 and in the BRCA1-mutant HCC1937 cell lines miR-342 over-expression only reduced ID4. In the cohort of patients we studied, a correlation between miR-342 and BRCA1 expression was found in the ER-negative cases. As ER-negative cases were mainly BRCA1-mutant, we speculate that the mechanism we demonstrated could be involved in the decreased expression of BRCA1 frequently observed in non BRCA1-mutant breast cancers and could be implicated as a causal factor in part of the familial cases grouped in the heterogeneous class of non BRCA1 or BRCA2-mutant cases (BRCAx. To validate this hypothesis, the study should be extended to a larger cohort of ER-negative cases, including those belonging to the BRCAx class.
Monetizing a Meme: YouTube, Content ID, and the Harlem Shake
Directory of Open Access Journals (Sweden)
Michael Soha
2016-01-01
Full Text Available This article analyzes the creation, evolution, and monetization of the Harlem Shake meme on YouTube to explore contemporary implementation of copyright and understanding of authorship in regard to monetization of works with distributed authorship. This article has three main findings: first, we highlight the collection of digital labor that comprises the “Harlem Shake” meme, its rise in popularity, and the subsequent rise in popularity of Baauer, the composer of the song which forms the backbone of the meme; second, we examine how YouTube’s “new bargain” of Content ID, as a departure from the site’s origins creates coercive control mechanisms, shedding new light on the concept of and debate over “digital sharecropping.” Finally, we argue for a “Fair(er use” system by exploring how memes might be understood outside of the contemporary copyright system, rethinking the rights of users engaged in collective production. The article is significant in that it challenges the current distribution of Content ID payments solely to copyright holders in an attempt to rethink a system that acknowledges the creative labor of memetic phenomena and collective authorship.
Particle production in Si + A and p + A collisions at 14.6 A·GeV/c
International Nuclear Information System (INIS)
Miake, Y.
1990-01-01
Particle production (π ± , K ± , p) has been measured in both Si+A and p+A collisions at 14.6 A·GeV/c. Comparisons of m t and dn/dy distributions between p+Be, p+Au and central Si+Au collisions are discussed. 8 refs., 3 figs
Hussain, Misbah; Awan, Fazli Rabbi; Gujjar, Amna; Hafeez, Shakir; Islam, Mehboob
2018-01-01
Angiotensin converting enzyme (ACE) is a key component of renin angiotensin aldosterone system. It converts angiotensin I to angiotensin II. Insertion/deletion (I/D) polymorphism of ACE gene is found associated with several complications. However, its association with hypertension and related metabolic diseases is still controversial. So, the aim of the present study was to check this association for Punjabi population from Faisalabad, Pakistan. For this purpose, blood samples (patients = 100, controls = 48) were collected and several biochemical parameters were measured. Genotyping for ACE (I/D) polymorphism was performed by polymerase chain reaction (PCR) assay. ID genotype is found prevalent in the studied population as 41% in control subjects and 61% in patients. Furthermore, chi-square analysis showed significant (p = 0.005) difference for genotypic frequencies between both groups. One-way ANOVA for association of II, ID, and DD genotypes with anthropometric, clinical, and biochemical parameters showed that in patient group, DD genotype is significantly (p = 0.041) associated with systolic blood pressure (SBP). Moreover, ID genotype is found associated with the presence of cardiovascular diseases. This study concludes that DD genotype is strongly associated with higher SBP in hypertensive patients.
The paradox of IDs: an account of an ethnographic experience in the US
Directory of Open Access Journals (Sweden)
Mariza Peirano
2008-01-01
Full Text Available In the modern world, IDs are indispensable objects, without which we cannot prove that we are who we say we are. We need material substantiation that attests to the authenticity of our self-identification. This paper is an account of an ethnographic experience about IDs and identification processes in the US, based on the examination of two events in which Eliot Spitzer, the New York State governor from January 2007 to March 2008, was a central figure. A comparison with the Brazilian scenario is present throughout the paper, and it ends by focusing on the ID theft phenomenon.
Implementasi Cell ID dan GPS dalam Pencarian Lokasi Fasilitas Kesehatan Terdekat
Directory of Open Access Journals (Sweden)
Fahmi Candra Permana
2017-07-01
Full Text Available Cell ID dan GPS merupakan layanan berbasis lokasi dan teknologi yang banyak membantu manusia dalam hal navigasi dan penemuan tempat-tempat yang bermanfaat di sekitarnya. Salah satu komponen utama dari teknologi ini dapat diterapkan pada telepon seluler. Dalam penelitian ini, dirancang sebuah aplikasi dengan memanfaatkan teknologi berdasar implementasi dari Cell ID dan GPS untuk mengetahui posisi user dan lokasi fasilitas kesehatan terdekat di sekitar user dan penggunaan JSON sebagai sarana untuk menyimpan database pada web. Aplikasi ini diimplementasikan pada telepon seluler dengan sistem operasi Android. Hasil dari penelitian ini menunjukkan bahwa Cell ID dan GPS dapat diimplementasikan dengan baik dengan memanfaatkan akses Internet dan Google Maps untuk mencari fasilitas kesehatan terdekat dan menggambarkan daerah sekitar user.
Study of nano - second isomers near 146Gd
International Nuclear Information System (INIS)
Pramanik, Dibyadyuti; Sarkar, S.; Bisoi, Abhijit; Ray, Sudatta; Ray, I.; Pradhan, M.K.; Goswami, A.; Banerjee, P.; Mukherjee, A.; Bhattacharya, S.; Saha Sarkar, M.; Chakraborty, A.; Dey, Gautam; Krishichayan; Kshetri, R.; Ganguly, S.; Raut, R.; Ray Basu, M.; Ganguly, G.; Ghugre, S.S.; Sinha, A.K.; Basu, S.K.
2010-01-01
The nuclei near 146 Gd show rich variety in their excitation spectra. Spectra exhibiting characteristics of extreme single particle, multi-particle-hole excitation, magnetic bands to strong collectivity manifested through superdeformation, and triaxial superdeformation have been widely studied. In the present work, a few isomers in the mass ≅150 region using the RF - gamma coincidence data are studied
Aguilar, Patricia V; Adams, A Paige; Suárez, Victor; Beingolea, Luis; Vargas, Jorge; Manock, Stephen; Freire, Juan; Espinoza, Willan R; Felices, Vidal; Diaz, Ana; Liang, Xiaodong; Roca, Yelin; Weaver, Scott C; Kochel, Tadeusz J
2009-09-15
Venezuelan equine encephalitis virus (VEEV) has been responsible for hundreds of thousands of human and equine cases of severe disease in the Americas. A passive surveillance study was conducted in Peru, Bolivia and Ecuador to determine the arboviral etiology of febrile illness. Patients with suspected viral-associated, acute, undifferentiated febrile illness of Peru, and more recently (2005), in Madre de Dios, Peru. We performed phylogenetic analyses with VEEV from Bolivia, Ecuador and Peru and compared their relationships to strains from other parts of South America. We found that VEEV subtype ID Panama/Peru genotype is the predominant one circulating in Peru. We also demonstrated that VEEV subtype ID strains circulating in Ecuador belong to the Colombia/Venezuela genotype and VEEV from Madre de Dios, Peru and Cochabamba, Bolivia belong to a new ID genotype. In summary, we identified a new major lineage of enzootic VEEV subtype ID, information that could aid in the understanding of the emergence and evolution of VEEV in South America.
Role of ID Proteins in BMP4 Inhibition of Profibrotic Effects of TGF-β2 in Human TM Cells.
Mody, Avani A; Wordinger, Robert J; Clark, Abbot F
2017-02-01
Increased expression of TGF-β2 in primary open-angle glaucoma (POAG) aqueous humor (AH) and trabecular meshwork (TM) causes deposition of extracellular matrix (ECM) in the TM and elevated IOP. Bone morphogenetic proteins (BMPs) regulate TGF-β2-induced ECM production. The underlying mechanism for BMP4 inhibition of TGF-β2-induced fibrosis remains undetermined. Bone morphogenic protein 4 induces inhibitor of DNA binding proteins (ID1, ID3), which suppress transcription factor activities to regulate gene expression. Our study will determine whether ID1and ID3 proteins are downstream targets of BMP4, which attenuates TGF-β2 induction of ECM proteins in TM cells. Primary human TM cells were treated with BMP4, and ID1 and ID3 mRNA, and protein expression was determined by quantitative PCR (Q-PCR) and Western immunoblotting. Intracellular ID1 and ID3 protein localization was studied by immunocytochemistry. Transformed human TM cells (GTM3 cells) were transfected with ID1 or ID3 expression vectors to determine their potential inhibitory effects on TGF-β2-induced fibronectin and plasminogen activator inhibitor-I (PAI-1) protein expression. Basal expression of ID1-3 was detected in primary human TM cells. Bone morphogenic protein 4 significantly induced early expression of ID1 and ID3 mRNA (P protein in primary TM cells, and a BMP receptor inhibitor blocked this induction. Overexpression of ID1 and ID3 significantly inhibited TGF-β2-induced expression of fibronectin and PAI-1 in TM cells (P protein 4 induced ID1 and ID3 expression suppresses TGF-β2 profibrotic activity in human TM cells. In the future, targeting specific regulators may control the TGF-β2 profibrotic effects on the TM, leading to disease modifying IOP lowering therapies.
Papaspyridonos, Marianna; Matei, Irina; Huang, Yujie; do Rosario Andre, Maria; Brazier-Mitouart, Helene; Waite, Janelle C; Chan, April S; Kalter, Julie; Ramos, Ilyssa; Wu, Qi; Williams, Caitlin; Wolchok, Jedd D; Chapman, Paul B; Peinado, Hector; Anandasabapathy, Niroshana; Ocean, Allyson J; Kaplan, Rosandra N; Greenfield, Jeffrey P; Bromberg, Jacqueline; Skokos, Dimitris; Lyden, David
2015-04-29
A central mechanism of tumour progression and metastasis involves the generation of an immunosuppressive 'macroenvironment' mediated in part through tumour-secreted factors. Here we demonstrate that upregulation of the Inhibitor of Differentiation 1 (Id1), in response to tumour-derived factors, such as TGFβ, is responsible for the switch from dendritic cell (DC) differentiation to myeloid-derived suppressor cell expansion during tumour progression. Genetic inactivation of Id1 largely corrects the myeloid imbalance, whereas Id1 overexpression in the absence of tumour-derived factors re-creates it. Id1 overexpression leads to systemic immunosuppression by downregulation of key molecules involved in DC differentiation and suppression of CD8 T-cell proliferation, thus promoting primary tumour growth and metastatic progression. Furthermore, advanced melanoma patients have increased plasma TGFβ levels and express higher levels of ID1 in myeloid peripheral blood cells. This study reveals a critical role for Id1 in suppressing the anti-tumour immune response during tumour progression and metastasis.
Kang, Hui-Yuan; Wang, Xin-Rong; Gao, Li; Wang, Wei; Li, Mian-Yang; Wang, Li-Li; Wang, Cheng-Bin; Yu, Li
2015-04-01
To evaluate significance of ID4 gene mehtylation in demethylating myelodysplastic syndrome(MDS) cell Line MUTZ1 and 2 patients with MDS. The methylation-specific PCR (MS-PCR) and reverse transcription-PCR (RT-PCR) were applied to identify the methylation status and gene expression of ID4 gene in MDS cell line MUTZ1, a patient with aplastic anemia(AA) and a donor with normal bone marrow (NBM). RT-PCR was applied to detect the ID4 gene expression status in MUTZ1 cell line treated with decitabine at 3 different concentrations. Then bisulfite sequencing PCR (BSP) was applied to detect ID4 gene methylation status in 2 MDS parients treated with decitabine. The MDS cell line MUTZ-1 displayed a complete methylation of ID4 gene promoter with little mRNA expression. Inversely, bone marrow of an AA patient and NBM showed complete unmethylation of this gene with intensity mRNA expression. With the increase of decitabine concentration, ID4 gene mRNA expression was more and more increased. After decitabine treatment, ID4 gene methylation-positive frequencies of both the 2 MDS patients were much more decreased than that of the first treatment. So, ID4 gene mRNA expression inhibited by promoter hypemethylation could be recovered by using demethylation medicine. ID4 as a new potential anti-oncogene suggests that its methylation may become a marker for selection and assessment of therapeutic schedules in patients with MDS.
77 FR 68065 - Amendment of Class D and Class E Airspace; Lewiston, ID
2012-11-15
... Measuring Equipment (VOR/ DME), and the Lewiston-Nez Perce Instrument Landing System (ILS) Localizer... feet or more above the surface of the earth. * * * * * ANM ID E5 Lewiston, ID [Modified] Lewiston-Nez...
Suurnimed jäid müümata / Maria-Kristiina Soomre
Soomre, Maria-Kristiina, 1978-
2001-01-01
9. mai Christie' oksjonist, müümata jäänud Picasso, Degas', Cezanne'i tööd. 8. mai Sotheby oksjonist, kus edukalt müüdi töid S. J. Seegeri kogust, 3,85 miljoni dollari eest M. Beckmanni "Perseuse viimane katsumus". Sotheby kaasaegse kunsti oksjonil New Yorgis müüdi 5,6 miljoni dollari eest J. Koonsi skulptuur M. Jacksonist. Müümata jäid A. Warholi "Viis supipurki", A. Calderi 3 skulptuuri
Energy Technology Data Exchange (ETDEWEB)
Li, Luchuan; Lv, Bin; Chen, Bo [Department of General Surgery, Shandong University Qilu Hospital, Jinan, Shandong 250012 (China); Guan, Ming [Department of General Surgery, Qihe People' s Hospital, Qihe, Shandong 251100 (China); Sun, Yongfeng [Department of General Surgery, Licheng District People' s Hospital, Jinan, Shandong 250115 (China); Li, Haipeng [Department of General Surgery, Caoxian People' s Hospital, Caoxian, Shandong 274400 (China); Zhang, Binbin; Ding, Changyuan; He, Shan [Department of General Surgery, Shandong University Qilu Hospital, Jinan, Shandong 250012 (China); Zeng, Qingdong, E-mail: qingdz0201@163.com [Department of General Surgery, Shandong University Qilu Hospital, Jinan, Shandong 250012 (China)
2015-07-10
Dedifferentiated thyroid carcinoma (DTC) with the loss of radioiodine uptake (RAIU) is often observed in clinical practice under radioiodine therapy, indicating the challenge for poor prognosis. MicroRNA (miRNA) has emerged as a promising therapeutic target in many diseases; yet, the role of miRNAs in RAIU has not been generally investigated. Based on recent studies about miRNA expression in papillary or follicular thyroid carcinomas, the expression profiles of several thyroid relative miRNAs were investigated in one DTC cell line, derived from normal DTC cells by radioiodine treatment. The top candidate miR-146b, with the most significant overexpression profiles in dedifferentiated cells, was picked up. Further research found that miR-146b could be negatively regulated by histone deacetylase 3 (HDAC3) in normal cells, indicating the correlation between miR-146b and Na{sup +}/I{sup −} symporter (NIS)-mediated RAIU. Fortunately, it was confirmed that miR-146b could regulate NIS expression/activity; what is more important, miR-146b interference would contribute to the recovery of radioiodine-sensitivity in dedifferentiated cells via positively regulating NIS. In the present study, it was concluded that NIS-mediated RAIU could be modulated by miR-146b; accordingly, miR-146b might serve as one of targets to enhance efficacy of radioactive therapy against poorly differential thyroid carcinoma (PDTC). - Highlights: • Significant upregulated miR-146b was picked up from thyroid relative miRNAs in DTC. • MiR-146b was negatively regulated by HDAC3 in normal thyroid carcinoma cells. • NIS activity and expression could be regulated by miR-146b in thyroid carcinoma. • MiR-146b inhibition could recover the decreased radioiodine-sensitivity of DTC cells.
78 FR 40382 - Modification of Class D and E Airspace; Twin Falls, ID
2013-07-05
... using the Navigation (RNAV) Global Positioning System (GPS) and the Instrument Landing System (ILS) or... or more above the surface of the earth. * * * * * ANM ID E5 Twin Falls, ID [Modified] Twin Falls...
DEFF Research Database (Denmark)
Li, Tong; Pires, Carlota; Nielsen, Troels Tolstrup
2016-01-01
Skin fibroblasts were obtained from a 46-year-old symptomatic man carrying a M146I mutation in the presenilin 1 gene (PSEN1), responsible for causing Alzheimer's disease (AD). Induced pluripotent stem cells (iPSCs) were derived via transfection with episomal vectors carrying hOCT4, hSOX2, hKLF2, h......L-MYC, hLIN28 and shTP53 genes. M146I-iPSCs were free of genomically integrated reprogramming genes, had the specific mutation but no additional genomic aberrancies, expressed the expected pluripotency markers and displayed in vitro differentiation potential to the three germ layers. The reported M146I...
TR146 cells grown on filters as a model of human buccal epithelium
DEFF Research Database (Denmark)
Nielsen, Hanne Mørck; Rassing, M R
1999-01-01
The aim of the present study was to evaluate the TR146 cell culture model as an in vitro model of human buccal epithelium with respect to the permeability enhancement by different pH values, different osmolality values or bile salts. For this purpose, the increase in the apparent permeability (P...
Bio-functionalized dense-silica nanoparticles for MR/NIRF imaging of CD146 in gastric cancer
Directory of Open Access Journals (Sweden)
Wang P
2015-01-01
Full Text Available Pu Wang,1,* Yazhuo Qu,2,* Chuan Li,3 Li Yin,2 Caifei Shen,1 Wei Chen,3 Shiming Yang,4 Xiuwu Bian,2 Dianchun Fang11Institute of Gastroenterology, 2Institute of Pathology, 3Department of Radiology, Southwest Hospital, The Third Military Medical University, Chongqing, People’s Republic of China; 4Department of Gastroenterology, Xinqiao Hospital, The Third Military Medical University, Chongqing, People’s Republic of China*These authors contributed equally to this workPurpose: Nano dense-silica (dSiO2 has many advantages such as adjustable core–shell structure, multiple drug delivery, and controllable release behavior. Improving the gastric tumor-specific targeting efficiency based on the development of various strategies is crucial for anti-cancer drug delivery systems.Methods: Superparamagnetic iron oxide nanoparticles (SPION were coated with dSiO2 as core–shell nanoparticles, and labeled with near infra-red fluorescence (NIRF dye 800ZW (excitation wavelength: 778 nm/emission wavelength: 806 nm and anti-CD146 monoclonal antibody YY146 for magnetic resonance (MR/NIRF imaging study in xenograft gastric cancer model. The morphology and the size of pre- and postlabeling SPION@dSiO2 core–shell nanoparticles were characterized using transmission electron microscopy. Iron content in SPION@dSiO2 nanoparticles was measured by inductively coupled plasma optical emission spectrometry. Fluorescence microscopy and fluorescence-activated cell sorter studies were carried out to confirm the binding specificity of YY146 and 800ZW–SPION@dSiO2–YY146 on MKN45 cells. In vivo and in vitro NIRF imaging, control (nanoparticles only and blocking studies, and histology were executed on MKN45 tumor-bearing nude mice to estimate the affinity of 800ZW–SPION@dSiO2–YY146 to target tumor CD146.Results: 800ZW–SPION@dSiO2–YY146 nanoparticles were uniformly spherical in shape and dispersed evenly in a cell culture medium. The diameter of the nanoparticle
The Implementation of C-ID, R2D2 Model on Learning Reading Comprehension
Rayanto, Yudi Hari; Rusmawan, Putu Ngurah
2016-01-01
The purposes of this research are to find out, (1) whether C-ID, R2D2 model is effective to be implemented on learning Reading comprehension, (2) college students' activity during the implementation of C-ID, R2D2 model on learning Reading comprehension, and 3) college students' learning achievement during the implementation of C-ID, R2D2 model on…
Anmeldung in ILIAS ohne Uni-Login-ID
Schanz, Nadja
2016-01-01
Gewusst wie...! Online-Tutorial der Universitätsbibliothek Tübingen. Erklärt die Anmeldung in Ilias zu Führungen ohne Uni-Login-ID Online Tutorial from university library tuebingen. teaches how to register in Ilias for courses and guided tours without university login
Directory of Open Access Journals (Sweden)
van Karnebeek Clara D M
2012-07-01
Full Text Available Abstract Background Intellectual disability (ID is a devastating and frequent condition, affecting 2-3% of the population worldwide. Early recognition of treatable underlying conditions drastically improves health outcomes and decreases burdens to patients, families and society. Our systematic literature review identified 81 such inborn errors of metabolism, which present with ID as a prominent feature and are amenable to causal therapy. The WebAPP translates this knowledge of rare diseases into a diagnostic tool and information portal. Methods & results Freely available as a WebAPP via http://www.treatable-id.org and end 2012 via the APP store, this diagnostic tool is designed for all specialists evaluating children with global delay / ID and laboratory scientists. Information on the 81 diseases is presented in different ways with search functions: 15 biochemical categories, neurologic and non-neurologic signs & symptoms, diagnostic investigations (metabolic screening tests in blood and urine identify 65% of all IEM, therapies & effects on primary (IQ/developmental quotient and secondary outcomes, and available evidence For each rare condition a ‘disease page’ serves as an information portal with online access to specific genetics, biochemistry, phenotype, diagnostic tests and therapeutic options. As new knowledge and evidence is gained from expert input and PubMed searches this tool will be continually updated. The WebAPP is an integral part of a protocol prioritizing treatability in the work-up of every child with global delay / ID. A 3-year funded study will enable an evaluation of its effectiveness. Conclusions For rare diseases, a field for which financial and scientific resources are particularly scarce, knowledge translation challenges are abundant. With this WebAPP technology is capitalized to raise awareness for rare treatable diseases and their common presenting clinical feature of ID, with the potential to improve health outcomes
2012-01-01
Background Intellectual disability (ID) is a devastating and frequent condition, affecting 2-3% of the population worldwide. Early recognition of treatable underlying conditions drastically improves health outcomes and decreases burdens to patients, families and society. Our systematic literature review identified 81 such inborn errors of metabolism, which present with ID as a prominent feature and are amenable to causal therapy. The WebAPP translates this knowledge of rare diseases into a diagnostic tool and information portal. Methods & results Freely available as a WebAPP via http://www.treatable-id.org and end 2012 via the APP store, this diagnostic tool is designed for all specialists evaluating children with global delay / ID and laboratory scientists. Information on the 81 diseases is presented in different ways with search functions: 15 biochemical categories, neurologic and non-neurologic signs & symptoms, diagnostic investigations (metabolic screening tests in blood and urine identify 65% of all IEM), therapies & effects on primary (IQ/developmental quotient) and secondary outcomes, and available evidence For each rare condition a ‘disease page’ serves as an information portal with online access to specific genetics, biochemistry, phenotype, diagnostic tests and therapeutic options. As new knowledge and evidence is gained from expert input and PubMed searches this tool will be continually updated. The WebAPP is an integral part of a protocol prioritizing treatability in the work-up of every child with global delay / ID. A 3-year funded study will enable an evaluation of its effectiveness. Conclusions For rare diseases, a field for which financial and scientific resources are particularly scarce, knowledge translation challenges are abundant. With this WebAPP technology is capitalized to raise awareness for rare treatable diseases and their common presenting clinical feature of ID, with the potential to improve health outcomes. This innovative digital
22 CFR 146.110 - Remedial and affirmative action and self-evaluation.
2010-04-01
... THE BASIS OF SEX IN EDUCATION PROGRAMS OR ACTIVITIES RECEIVING FEDERAL FINANCIAL ASSISTANCE Introduction § 146.110 Remedial and affirmative action and self-evaluation. (a) Remedial action. If the...
International Nuclear Information System (INIS)
Mulmule, Manoj D.; Shimmy, Shankar M.; Bambole, Vaishali; Jamdar, Sahayog N.; Rawat, K.P.; Sarma, K.S.S.
2017-01-01
Idli, a steam-cooked breakfast food item consumed in India, is famous as a staple food for its spongy texture and unique fermented taste. Idli preparation is a time consuming process; although instant Idli pre-mixes as powder or batter are available in the market, they do not have the distinctive taste and aroma similar to the Idli prepared at home. Hence ready-to-eat (RTE) form of this food is in demand. Therefore, an attempt was made to prepare RTE Idli bearing similar taste as home-cooked Idli with an extended shelf-life of up to two months at an ambient temperature using Electron Beam Irradiation (EBI) at dosages 2.5 kGy, 5 kGy and 7.5 kGy and combination processing comprised of EBI dosage at 2.5 kGy and thermal treatment (80 °C for 20 min). The treated Idli's were microbiologically and sensorially evaluated at storage periods of zero day, 14 days, 30 days and 60 days. Idli's irradiated at 7.5 kGy and subjected to combination processing at 2.5 kGy and thermal treatment were shelf-stable for 60 days. 2.5 kGy and 5 kGy radiation dosages alone were not sufficient to preserve Idli samples for more than 14 days. Undesirable change in sensory properties of Idli was observed at an EBI dosage of 7.5 kGy. Sensory properties of combination processed Idli's were found to undergo minor change over the storage period. The present work suggests that lowest radiation dosage in combination with thermal treatment could be useful to achieve the extended shelf-life without considerably impairing the organoleptic quality of Ready-to-Eat Idli. - Highlights: • Idli (traditional Indian fermented food) was prepared in ready-to-eat (RTE) form. • Ready-to-eat Idli was then subjected to combination processing comprised of lowest irradiation dosage of 2.5 kGy with mild heat treatment to extend its shelf life. • Increase in hardness and decrease in brightness of combination processed Idli was observed. • Combination processed Idli was microbiologically safe and
Directory of Open Access Journals (Sweden)
Shirin Abdolvand
2017-06-01
Full Text Available Abstract Background: The incidence of gastric cancer is different in two sexes with ratio 2 to 1 that it is more common in men. The most important biologically reason is sexual hormones between two sexes that lead to sexual dimorphism and in turn can cause a sex bias in incidence of disease between two sexes. Recently, studies have shown that microRNA is involved in sexual dimorphism in gene expression. Given the sexual dimorphism in the incidence of gastric cancer and sex hormones response elements in the regulatory regions of miR-146a and miR-148a genes, in this study, the expression of these two genes in the stomach of healthy men and women at different age groups were compared. Materials and Methods: Using endoscopy, gastric antrum tissues of 35 healthy women and 35 healthy men were collected. After RNA extraction and synthesis of cDNA, the expression of miR-146a and miR-148a genes were compared between sexes by Real time RT-PCR and data were analyzed using independent sample t and ANOVA tests. Results: There was no difference between men and women in genes expression of miR-146a and miR-148a. However, expression of miR-146a gene was significantly more in men under 45 years than men over 45 years (p= 0.017, df= 14, t= 1.47. Also, expression of miR-148a gene was significantly more in men over 45 years than men under 45 years (p=0.001, df= 12, t= 1.28. But the expression of both genes had no significant difference between women under 45 years and women over 45 years. Conclusion: Expression of miR-146a and miR-148a genes in the stomach is increased and decreased with aging in men, respectively.
Directory of Open Access Journals (Sweden)
Lu Liu
2016-01-01
Full Text Available Introduction. Inflammation in dental pulp cells (DPCs initiated by Lipopolysaccharide (LPS results in dental pulp necrosis. So far, whether there is a common system regulating inflammation response and tissue regeneration remains unknown. miR-146a is closely related to inflammation. Basic fibroblast growth factor (bFGF is an important regulator for differentiation. Methods. To explore the effect of miR-146a/bFGF on inflammation and tissue regeneration, polyethylene glycol-polyethyleneimine (PEG-PEI was synthesized, and physical characteristics were analyzed by dynamic light scattering and gel retardation analysis. Cell absorption, transfection efficiency, and cytotoxicity were assessed. Alginate gel was combined with miR-146a/PEG-PEI nanoparticles and bFGF. Drug release ratio was measured by ultraviolet spectrophotography. Proliferation and odontogenic differentiation of DPCs with 1 μg/mL LPS treatment were determined. Results. PEG-PEI prepared at N/P 2 showed complete gel retardation and smallest particle size and zeta potential. Transfection efficiency of PEG-PEI was higher than lipo2000. Cell viability decreased as N/P ratio increased. Drug release rate amounted to 70% at the first 12 h and then maintained slow release afterwards. Proliferation and differentiation decreased in DPCs with LPS treatment, whereas they increased in miR-146a/bFGF gel group. Conclusions. PEG-PEI is a promising vector for gene therapy. miR-146a and bFGF play critical roles in inflammation response and tissue regeneration of DPCs.
9 CFR 146.23 - Terminology and classification; flocks and products.
2010-01-01
... layers through routine serological surveillance of each participating commercial table-egg layer flock. A... SERVICE, DEPARTMENT OF AGRICULTURE LIVESTOCK IMPROVEMENT NATIONAL POULTRY IMPROVEMENT PLAN FOR COMMERCIAL POULTRY Special Provisions for Commercial Table-Egg Layer Flocks § 146.23 Terminology and classification...
Fraudulent ID using face morphs: Experiments on human and automatic recognition.
Robertson, David J; Kramer, Robin S S; Burton, A Mike
2017-01-01
Matching unfamiliar faces is known to be difficult, and this can give an opportunity to those engaged in identity fraud. Here we examine a relatively new form of fraud, the use of photo-ID containing a graphical morph between two faces. Such a document may look sufficiently like two people to serve as ID for both. We present two experiments with human viewers, and a third with a smartphone face recognition system. In Experiment 1, viewers were asked to match pairs of faces, without being warned that one of the pair could be a morph. They very commonly accepted a morphed face as a match. However, in Experiment 2, following very short training on morph detection, their acceptance rate fell considerably. Nevertheless, there remained large individual differences in people's ability to detect a morph. In Experiment 3 we show that a smartphone makes errors at a similar rate to 'trained' human viewers-i.e. accepting a small number of morphs as genuine ID. We discuss these results in reference to the use of face photos for security.
VIPP-LD: A promising Video Feedback intervention program for parents with ID
Hodes, M.W.; Kef, S.; Meppelder, H.M.; Schuengel, C.
2012-01-01
Aim: Parenting support has been shown to be of benefit to parents with intellectual disabilities (ID) on several outcomes; however, effects on parent-child interaction in the form of sensitive responsiveness and positive inductive discipline are still under debate. This study tested the effects of an
International Nuclear Information System (INIS)
Meng, Qingzhen; Jia, Zhuqing; Wang, Weiping; Li, Binhong; Ma, Kangtao; Zhou, Chunyan
2011-01-01
Highlights: → Id1 was upregulated during the cardiac differentiation process of P19CL6 cells. → Id1 upregulated expression of cardiac specific genes Gata4, α-MHC and ISL1. → Id1 promoted proliferation of P19CL6 cells. → Overexpression of Id1 increased activity of TOP flash. → Wnt3a or LiCl treatment promoted Id1 expression in P19CL6 cells. -- Abstract: The inhibitor of DNA binding (Id) family of genes encodes negative regulators of basic helix-loop-helix transcription factors and has been implicated in such diverse cellular processes as differentiation, proliferation, apoptosis and migration. Id knockout mouse embryos display multiple cardiac defects but the specific role of Id1 in cardiac differentiation is unclear. In the present study, we investigated the function of Id1 in DMSO-induced P19CL6 cells, a widely-accepted cell model of cardiac differentiation. We found that Id1 was upregulated during the cardiac differentiation of P19CL6 cells. The expression of cardiac specific marker genes, Gata4, α-MHC and ISL1, was upregulated in P19CL6 cells stably transfected with Id1 (P19CL6-Id1) during cardiac differentiation. The overexpression of Id1 reduced the number of cells in G1 phase and increased the cell population in G2, M and S phases, while knockdown of Id1 increased the number of cells in G1 phase from 48.6 ± 2.51% to 62.2 ± 1.52% at day 0 of cardiac induction, and from 52.5 ± 3.41% to 63.7 ± 1.02% at day 3 after cardiac induction, indicating that Id1 promoted proliferation of P19CL6 cells. Luciferase assays showed that the activity of TOP flash was higher in P19CL6-Id1 cells than wildtype P19CL6 cells, while Id1 expression was also upregulated in P19CL6 cells treated with Wnt3a or LiCl. This indicates that there may be positive feedback between Id1 and Wnt signaling which plays an important role in cardiac differentiation.
Automatic spent fuel ID number reader (I)
International Nuclear Information System (INIS)
Tanabe, S.; Kawamoto, H.; Fujimaki, K.; Kobe, A.
1991-01-01
An effective and efficient technique has been developed for facilitating identification works of LWR spent fuel stored in large scale spent fuel storage pools of such as processing plants. Experience shows that there are often difficulties in the implementation of operator's nuclear material accountancy and control works as well as safeguards inspections conducted on spent fuel assemblies stored in deep water pool. This paper reports that the technique is realized as an automatic spent fuel ID number reader system installed on fuel handling machine. The ID number reader system consists of an optical sub-system and an image processing sub-system. Thousands of spent fuel assemblies stored in under water open racks in each storage pool could be identified within relatively short time (e.g. within several hours) by using this combination. Various performance tests were carried out on image processing sub-system in 1990 using TV images obtained from different types of spent fuel assemblies stored in various storage pools of PWR and BWR power stations
9 CFR 146.14 - Diagnostic surveillance program for H5/H7 low pathogenic avian influenza.
2010-01-01
.../H7 low pathogenic avian influenza. 146.14 Section 146.14 Animals and Animal Products ANIMAL AND PLANT... pathogenic avian influenza. (a) The Official State Agency must develop a diagnostic surveillance program for H5/H7 low pathogenic avian influenza for all poultry in the State. The exact provisions of the...
MiR-146a regulates PM1 -induced inflammation via NF-κB signaling pathway in BEAS-2B cells.
Liu, Limin; Wan, Chong; Zhang, Wei; Guan, Longfei; Tian, Guoxiong; Zhang, Fang; Ding, Wenjun
2018-04-18
Exposure to particulate matter (PM) leads to kinds of cardiopulmonary diseases, such as asthma, COPD, arrhythmias, lung cancer, etc., which are related to PM-induced inflammation. We have found that PM 2.5 (aerodynamics diameter <2.5 µm) exposure induces inflammatory response both in vivo and in vitro. Since the toxicity of PM is tightly associated with its size and components, PM 1 (aerodynamics diameter <1.0 µm) is supposed to be more toxic than PM 2.5 . However, the mechanism of PM 1 -induced inflammation is not clear. Recently, emerging evidences prove that microRNAs play a vital role in regulating inflammation. Therefore, we studied the regulation of miR-146a in PM 1 -induced inflammation in human lung bronchial epithelial BEAS-2B cells. The results show that PM 1 induces the increase of IL-6 and IL-8 in BEAS-2B cells and up-regulates the miR-146a expression by activating NF-κB signaling pathway. Overexpressed miR-146a prevents the nuclear translocation of p65 through inhibiting the IRAK1/TRAF6 expression, and downregulates the expression of IL-6 and IL-8. Taken together, these results demonstrate that miR-146a can negatively feedback regulate PM 1 -induced inflammation via NF-κB signaling pathway in BEAS-2B cells. © 2018 Wiley Periodicals, Inc.
ACE Gene I/D Polymorphism and Obesity in 1,574 Patients with Type 2 Diabetes Mellitus.
Pan, Yan-Hong; Wang, Min; Huang, Yan-Mei; Wang, Ying-Hui; Chen, Yin-Ling; Geng, Li-Jun; Zhang, Xiao-Xi; Zhao, Hai-Lu
2016-01-01
Association between ACE gene I/D polymorphism and the risk of overweight/obesity remains controversial. We investigated the possible relationship between ACE gene I/D polymorphism and obesity in Chinese type 2 diabetes mellitus (T2DM) patients. In this study, obesity was defined as a body mass index (BMI) value ≥ 25 kg/m 2 and subjects were classified into 4 groups (lean, normal, overweight, and obese). PCR (polymerase chain reaction) was used to detect the ACE gene I/D polymorphism in T2DM patients. Metabolic measurements including blood glucose, lipid profile, and blood pressure were obtained. Frequencies of the ACE genotypes (DD, ID, and II) were not significant among the 4 groups of BMI-defined patients ( P = 0.679) while ACE II carriers showed higher systolic blood pressure (SBP) and pulse pressure (PP) (all P ACE gene I/D polymorphism with obesity is insignificant in Chinese patients with T2DM. SBP and PP might be higher in the ACE II carriers than in the DD and ID carriers.
DeID – A Data Sharing Tool for Neuroimaging Studies
Directory of Open Access Journals (Sweden)
Xuebo eSong
2015-09-01
Full Text Available Funding institutions and researchers increasingly expect that data will be shared to increase scientific integrity and provide other scientists with the opportunity to use the data with novel methods that may advance understanding in a particular field of study. In practice, sharing human subject data can be complicated because data must be de-identified prior to sharing. Moreover, integrating varied data types collected in a study can be challenging and time consuming. For example, sharing data from structural imaging studies of a complex disorder requires the integration of imaging, demographic and/or behavioral data in a way that no subject identifiers are included in the de-identified dataset and with new subject labels or identification values that cannot be tracked back to the original ones. We have developed a Java program that users can use to remove identifying information in neuroimaging datasets, while still maintaining the association among different data types from the same subject for further studies. This software provides a series of user interaction wizards to allow users to select data variables to be de-identified, implements functions for auditing and validation of de-identified data, and enables the user to share the de-identified data in a single compressed package through various communication protocols, such as FTPS and SFTP. DeID runs with Windows, Linux, and Mac operating systems and its open architecture allows it to be easily adapted to support a broader array of data types, with the goal of facilitating data sharing. DeID can be obtained at http://www.nitrc.org/projects/deid.
International Nuclear Information System (INIS)
Busch, M.R.; Mace, J.E.; Ho, N.T.; Ho, Chien
1991-01-01
Assessment of the roles of the carboxyl-terminal β146 histidyl residues in the alkaline Bohr effect in human and normal adult hemoglobin by high-resolution proton nuclear magnetic resonance spectroscopy requires assignment of the resonances corresponding to these residues. By a careful spectroscopic study of human normal adult hemoglobin, enzymatically prepared des(His146β)-hemoglobin, and the mutant hemoglobins Cowtown (β146His → Leu) and York (β146His → Pro), the authors have resolved some of these conflicting results. By a close incremental variation of pH over a wide range in chloride-free 0.1 M N-(2-hydroxyethyl)piperazine-N'-2-ethanesulfonic acid buffer, a single resonance has been found to be consistently missing in the proton nuclear magnetic resonance spectra of these hemoglobin variants. The results indicate that the contribution of the β146 histidyl residues is 0.52 H + /hemoglobin tetramer at pH 7.6, markedly less than 0.8 H + /hemoglobin tetramer estimated by study of the mutant hemoglobin Cowtown (β146His → Leu) by Shih and Perutz. They have found that at least two histidyl residues in the carbonmonoxy form of this mutant have pK values that are perturbed, and they suggest that these pK differences may in part account for this discrepancy. The results show that the pK values of β146 histidyl residues in the carbonmonoxy form of hemoglobin are substantially affected by the presence of chloride and other anions in the solvent, and thus, the contribution of this amino acid residue to the alkaline Bohr effect can be shown to vary widely in magnitude, depending on the solvent composition. These results demonstrate that the detailed molecular mechanisms of the alkaline Bohr effect are not unique but are affected both by the hemoglobin structure and by the interactions with the solvent components in which the hemoglobin molecule resides
Sun, Feifei; He, Ning; Zhang, Keyong; Wu, Nan; Zhao, Jingbo; Qiu, Changchun
2018-01-01
Angiotensin converting enzyme (ACE) gene, as a strong candidate gene for essential hypertension(EH), has been extensively studied. In this study, we carried out a population-based case-control study to explore whether ACE gene I/D and A2350G polymorphisms could consider to be risk factors for EH. A total of 2040 subjeces were recruited from Chinese Han in this study, out of which 1010 were cases and 1030 were normotensive individuals. ACE gene A2350G and I/D polymorphisms were amplified by polymerase chain reaction (PCR) and A2350G polymorphism was detected after restriction enzyme digestion with BstuI. Besides, we choosed 10% samples randomly sequencing to verify the accuracy of results. Genotype and allele frequencies distribution of I/D and A2350G in EH and control groups were significantly different. After grouped by sex or age, there were still statistical significances for two polymorphisms. In dominant and recessive model of A2350G, we found significant differences between two groups, respectively. For ACE I/D polymorphism, we observed that the existence of dramatical difference in dominant model between two groups, while in recessive model, marginally significant difference was found. Among the four haplotypes composed by ACE gene A2350G and I/D, haplotype G-D reached the statistical significance in two groups, and exhibited to be a risk factor for the development of EH, whose P ACE gene A2350G and I/D polymorphisms were associated with increasing the risk of suffering from EH in the northernmost province of China individuals, with D allele and G allele individuals had a higher risk of EH(OR = 1.443, 95%CI = 1.273-1.636 and OR = 1.481, 95%CI = 1.303-1.684).
ID-1 mass storage system for mainframe by using FDDI network
International Nuclear Information System (INIS)
Morita, Y.; Fujii, H.; Inoue, E.; Kodama, H. Manabe, A.; Miyamoto, A.; Nomachi, M.; Watase, Y.; Yasu, Y.
1994-01-01
The authors have developed an ID-1 mass storage system as a distributed data server for Fujitsu mainframe computers. The system consists of a SONY ID-1 recorder DIR-1000, a tape robot system DMS-24 and a SCSI-II interface DFC-1500, which are connected to Spar Station 10 with an FDDI interface. The maximum speed of 7.5 Mbytes/sec is achieved for data transfer between Sparc Station 10 memory and DIR-1000 with a buffer size of 1 Mbytes. The system has been used successfully since last October to migrate more than 1 Tbytes data
Mulmule, Manoj D.; Shimmy, Shankar M.; Bambole, Vaishali; Jamdar, Sahayog N.; Rawat, K. P.; Sarma, K. S. S.
2017-02-01
Idli, a steam-cooked breakfast food item consumed in India, is famous as a staple food for its spongy texture and unique fermented taste. Idli preparation is a time consuming process; although instant Idli pre-mixes as powder or batter are available in the market, they do not have the distinctive taste and aroma similar to the Idli prepared at home. Hence ready-to-eat (RTE) form of this food is in demand. Therefore, an attempt was made to prepare RTE Idli bearing similar taste as home-cooked Idli with an extended shelf-life of up to two months at an ambient temperature using Electron Beam Irradiation (EBI) at dosages 2.5 kGy, 5 kGy and 7.5 kGy and combination processing comprised of EBI dosage at 2.5 kGy and thermal treatment (80 °C for 20 min). The treated Idli's were microbiologically and sensorially evaluated at storage periods of zero day, 14 days, 30 days and 60 days. Idli's irradiated at 7.5 kGy and subjected to combination processing at 2.5 kGy and thermal treatment were shelf-stable for 60 days. 2.5 kGy and 5 kGy radiation dosages alone were not sufficient to preserve Idli samples for more than 14 days. Undesirable change in sensory properties of Idli was observed at an EBI dosage of 7.5 kGy. Sensory properties of combination processed Idli's were found to undergo minor change over the storage period. The present work suggests that lowest radiation dosage in combination with thermal treatment could be useful to achieve the extended shelf-life without considerably impairing the organoleptic quality of Ready-to-Eat Idli.
Directory of Open Access Journals (Sweden)
Retha Arjadi
Full Text Available Depression screening and examination in Indonesia are highly challenging due to the disproportionately low number of mental health professionals in comparison to the Indonesian population. Self-report questionnaires on depression are cost-effective and time-efficient. The current study investigates the psychometric properties of the Indonesian Inventory of Depressive Symptomatology Self Report (IDS-SR.The participants were 904 Indonesians (aged 16-61; 50.2% female, recruited via an online survey using Qualtrics. Confirmatory factor analysis of the one-factor, three-factor, and four-factor model were explored. Convergent and divergent validity of the total score of the Indonesian IDS-SR and each factor were examined, as well as the Cronbach's Alpha reliability. In addition, an optimal cut-off score for the Indonesian IDS-SR was established using ROC curve analysis.The three-factor model of "cognitive/mood", "anxiety/arousal", and "sleep disturbance" was the best fit with the Indonesian IDS-SR data. Convergent and divergent validity were good. Cronbach's Alpha reliability was excellent for the total score, good for the factors "cognitive/mood" and "anxiety/arousal", but insufficient for the factor "sleep disturbance". The optimal cut-off score of the Indonesian IDS-SR was 14, with 87% sensitivity and 86% specificity.As a multifactorial instrument to measure depression that has good validity and reliability, the Indonesian IDS-SR can be used to assess depressive symptoms for the purpose of research and clinical practice. The optimal cut-off score of the Indonesian IDS-SR is in accordance with the internationally used cut-off score.
Screening of Lactobacillus plantarum isolated from fermented idli ...
African Journals Online (AJOL)
Probiotics are defined as live microorganisms which when administered in adequate amounts confer a health benefit on the host. The objective of this study was to screen eight potential probiotic Lactobacillus plantarum strains from fermented idli batter using in vitro assays such as bile tolerance, acid tolerance, transit ...
Directory of Open Access Journals (Sweden)
Daniela Annibali
Full Text Available The transcription factor ID2 is an important repressor of neural differentiation strongly implicated in nervous system cancers. MicroRNAs (miRNAs are increasingly involved in differentiation control and cancer development. Here we show that two miRNAs upregulated on differentiation of neuroblastoma cells--miR-9 and miR-103--restrain ID2 expression by directly targeting the coding sequence and 3' untranslated region of the ID2 encoding messenger RNA, respectively. Notably, the two miRNAs show an inverse correlation with ID2 during neuroblastoma cell differentiation induced by retinoic acid. Overexpression of miR-9 and miR-103 in neuroblastoma cells reduces proliferation and promotes differentiation, as it was shown to occur upon ID2 inhibition. Conversely, an ID2 mutant that cannot be targeted by either miRNA prevents retinoic acid-induced differentiation more efficient than wild-type ID2. These findings reveal a new regulatory module involving two microRNAs upregulated during neural differentiation that directly target expression of the key differentiation inhibitor ID2, suggesting that its alteration may be involved in neural cancer development.
Evaluation of σ-1 receptor radioligand 18F-FTC-146 in rats and squirrel monkeys using PET
DEFF Research Database (Denmark)
James, Michelle L; Shen, Bin; Nielsen, Carsten Haagen
2014-01-01
. Pretreatment with known S1R compounds, haloperidol, or BD1047, before radioligand administration, significantly attenuated (18)F-FTC-146 accumulation in all rat brain regions by approximately 85% (P ...-FTC-146 was observed in rat plasma. Preliminary monkey PET/MRI studies demonstrated specific accumulation of (18)F-FTC-146 in the brain (mainly in cortical structures, cerebellum, and vermis) that could be attenuated by pretreatment with haloperidol. HPLC of monkey plasma suggested radioligand metabolism...
Desprez, Pierre-Yves; Campisi, Judith
2014-08-19
A method for treatment of breast cancer and other types of cancer. The method comprises targeting and modulating Id-1 gene expression, if any, for the Id-1 gene, or gene products in breast or other epithelial cancers in a patient by delivering products that modulate Id-1 gene expression. When expressed, Id-1 gene is a prognostic indicator that cancer cells are invasive and metastatic.
Directory of Open Access Journals (Sweden)
Chmaisse Hania
2009-01-01
Full Text Available Type-2 diabetes mellitus (T2DM is a chronic disorder characterized by a varying range of predominant insulin resistance with relative insulin deficiency, to predominant insulin secretory defect with or without insulin resistance. Familial clustering as well as epidemiological studies has shown that genetic factors play a role in the development and progression of the disease. Among the genetic factors found to be associated with development of T2DM is the angiotensin-I converting enzyme (ACE gene, which is located on chromosome 17q23. This study was conducted to study the association between ACE gene insertion/deletion (I/D polymorphism and T2DM in a Lebanese diabetic cohort. Fifty-one patients with T2DM and 40 control subjects from different parts of Lebanon underwent genotyping for the ACE I/D, which was performed by PCR using specific primers. Chi-square and analysis of variance (ANOVA were used for asso-ciation studies and to assess the differences in the values among the groups. The distribution of the genotypes in the patients was as follows: 15/51 (29.4% were homozygous for deletion allele (DD genotype, 24/51 (47.1% were heterozygous (ID genotype, and 12/51 (23.5% were homo-zygous for insertion allele (II genotype. Among the control subjects, 16/40 (40% were homo-zygous for deletion (DD genotype, 13/40 (32.5% were heterozygous (ID genotype, and 11/40 (27.5% were homozygous for insertion (II genotype. The prevalence of the D-allele in T2DM patients (52.9% was not significantly different from that in the controls (56.3%. Thus, ACE I/D dimorphism cannot be considered a risk factor for T2DM in the Lebanese population.
Zhu, Ming; Zhang, Jie; Nie, Shaofa; Yan, Weirong
2012-09-01
There have been many studies concerning the associations of angiotensin-converting enzyme (ACE) I/D, angiotensinogen (AGT) M235T polymorphisms with pregnancy induced hypertension (PIH) among Chinese populations. However, the results were inconsistent, prompting the necessity of meta-analysis. Studies published in English and Chinese were mainly searched in EMbase, PubMed and CBM up to January 2012. Twenty-three studies with 3,551 subjects for ACE I/D and seven studies with 1,296 subjects for AGT M235T were included. Significant associations were found between ACE I/D and PIH under dominant, recessive and allelic models. A separate analysis confined to preeclampsia suggested that ACE I/D was associated with preeclampsia under recessive model and allelic model, but not dominant model. Stratified analyses were conducted as meta-regression analysis indicated that the sample size of case group was a significant source of heterogeneity, which suggested no significant association between ACE I/D and PIH in the subgroup of more than 100 cases. Associations were found between AGT M235T and PIH under dominant genetic model (OR = 1.59; 95 %CI: 1.04-2.42), recessive genetic model (OR = 1.60; 95 %CI: 1.07-2.40), and allelic model (OR = 1.40; 95 %CI: 1.17-1.68). No publication bias was found in either meta-analysis. The present meta-analysis suggested significant associations between ACE I/D, AGT M235T and PIH in Chinese populations. However, no significant association was found between ACE I/D and PIH in the subgroup of more than 100 cases. Studies with larger sample sizes are necessary to investigate the associations between gene polymorphisms and PIH in Chinese populations.
Drug evaluation: FavId, a patient-specific idiotypic vaccine for non-Hodgkin's lymphoma.
Czech Academy of Sciences Publication Activity Database
Reiniš, Milan
2007-01-01
Roč. 9, č. 3 (2007), s. 291-298 ISSN 1464-8431 Institutional research plan: CEZ:AV0Z50520514 Keywords : non-Hodgkin's lymphoma * lymphoma vaccine FavId Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 2.526, year: 2007
Wang, Xiaofang; Yuan, Taixian; Yuan, Jun; Su, Yufeng; Sun, Xiaoyu; Wu, Jingwen; Zhang, Hong; Min, Xun; Zhang, Xuemei; Yin, Yibing
2018-03-01
The fusion protein DnaJ-ΔA146Ply could induce cross-protective immunity against pneumococcal infection via mucosal and subcutaneous immunization in mice in the absence of additional adjuvants. DnaJ and Ply are both Toll-like receptor 4 (TLR4) but not TLR2 ligands. However, we found that TLR2 -/- mice immunized subcutaneously with DnaJ-ΔA146Ply showed significantly lower survival rates and higher bacterial loads in nasal washes than did wild-type (WT) mice after being challenged with pneumococcal strain D39 or 19F. The gamma interferon (IFN-γ) level in splenocytes decreased in TLR2 -/- mice, indicating that Th1 immunity elicited by DnaJ-ΔA146Ply was impaired in these mice. We explored the mechanism of protective immunity conferred by DnaJ-ΔA146Ply and the role of TLR2 in this process. DnaJ-ΔA146Ply effectively promoted dendritic cell (DC) maturation via TLR4 but not the TLR2 signaling pathway. In a DnaJ-ΔA146Ply-treated DC and naive CD4 + T cell coculture system, the deficiency of TLR2 in DCs resulted in a significant decline of IFN-γ production and Th1 subset differentiation. The same effect was observed in adoptive-transfer experiments. In addition, TLR2 -/- DCs showed remarkably lower levels of the Th1-polarizing cytokine IL-12p70 than did WT DCs, suggesting that TLR2 was indispensable for DnaJ-ΔA146Ply-induced IL-12 production and Th1 proliferation. Thus, our findings illustrate that dendritic cell expression of TLR2 is essential for optimal Th1 immune response against pneumococci in mice immunized subcutaneously with DnaJ-ΔA146Ply. Copyright © 2018 American Society for Microbiology.
dall'Acqua, Luisa
2011-08-01
The teleology of our research is to propose a solution to the request of "innovative, creative teaching", proposing a methodology to educate creative Students in a society characterized by multiple reference points and hyper dynamic knowledge, continuously subject to reviews and discussions. We apply a multi-prospective Instructional Design Model (PENTHA ID Model), defined and developed by our research group, which adopts a hybrid pedagogical approach, consisting of elements of didactical connectivism intertwined with aspects of social constructivism and enactivism. The contribution proposes an e-course structure and approach, applying the theoretical design principles of the above mentioned ID Model, describing methods, techniques, technologies and assessment criteria for the definition of lesson modes in an e-course.
The ubiquitin ligase ASB4 promotes trophoblast differentiation through the degradation of ID2.
Directory of Open Access Journals (Sweden)
W H Davin Townley-Tilson
Full Text Available Vascularization of the placenta is a critical developmental process that ensures fetal viability. Although the vascular health of the placenta affects both maternal and fetal well being, relatively little is known about the early stages of placental vascular development. The ubiquitin ligase Ankyrin repeat, SOCS box-containing 4 (ASB4 promotes embryonic stem cell differentiation to vascular lineages and is highly expressed early in placental development. The transcriptional regulator Inhibitor of DNA binding 2 (ID2 negatively regulates vascular differentiation during development and is a target of many ubiquitin ligases. Due to their overlapping spatiotemporal expression pattern in the placenta and contrasting effects on vascular differentiation, we investigated whether ASB4 regulates ID2 through its ligase activity in the placenta and whether this activity mediates vascular differentiation. In mouse placentas, ASB4 expression is restricted to a subset of cells that express both stem cell and endothelial markers. Placentas that lack Asb4 display immature vascular patterning and retain expression of placental progenitor markers, including ID2 expression. Using JAR placental cells, we determined that ASB4 ubiquitinates and represses ID2 expression in a proteasome-dependent fashion. Expression of ASB4 in JAR cells and primary isolated trophoblast stem cells promotes the expression of differentiation markers. In functional endothelial co-culture assays, JAR cells ectopically expressing ASB4 increased endothelial cell turnover and stabilized endothelial tube formation, both of which are hallmarks of vascular differentiation within the placenta. Co-transfection of a degradation-resistant Id2 mutant with Asb4 inhibits both differentiation and functional responses. Lastly, deletion of Asb4 in mice induces a pathology that phenocopies human pre-eclampsia, including hypertension and proteinuria in late-stage pregnant females. These results indicate that
Eisenman, Laura T.; Farley-Ripple, Elizabeth; Culnane, Mary; Freedman, Brian
2013-01-01
Social networks of persons with intellectual disabilities (ID) have been characterized as smaller and less diverse than those of typical peers. Advocates have focused on strengthening those social networks by expanding circles of social support, protection, and friendship. As young adults with ID experience increasing levels of community…
Angiotensin-converting enzyme I/D polymorphism in chronic obstructive pulmonary disease
Directory of Open Access Journals (Sweden)
Pabst S
2009-12-01
Full Text Available Abstract Study objective The etiology of chronic obstructive lung disease (COPD is unclear. It is supposed to be the product of an exogenous antigenic stimulus, such as tobacco smoke, and an endogenous genetic susceptibility. The angiotensin-converting enzyme (ACE gene contains a polymorphism based on the presence (insertion [I] or absence (deletion [D] of a 287-bp nonsense domain, resulting in three different genotypes (II, ID and DD. The aim of the study was to find out whether the ACE gene polymorphism can determine the course of COPD. Patients and design We genotyped 152 Caucasian patients with COPD and 158 healthy controls for the ACE (I/D polymorphism. We divided the COPD group into one group of 64 patients with a stable course of disease, defined as less than three hospitalizations over the last three years due to COPD, and another group of 88 patients with an instable course with more than three hospitalizations. Results The I-allele was significantly associated with an increased risk for COPD in a dominant model (OR 1.67 (95% CI 1.00 to 2.78, p = 0.048, but not in a recessive or co-dominant model. Moreover, the I-allele of ACE (I/D was significantly increased in patients with a stable course of COPD (p = 0.012 compared with controls. In a dominant model (II/ID v DD we found an even stronger association between the I-allele and a stable course of COPD (OR 3.24 (95% CI 1.44 to 7.31, p = 0.003. Conclusion These data suggest that the presence of an ACE I-allele determines a stable course of COPD.
2013-01-04
... Services Group, Inc., Commercial/Actuarial/ Information Delivery Services (IDS)/Corporate & Financial... Assistance (TAA) applicable to workers and former workers of Hartford Financial Services Group, Inc., Commercial/ Actuarial/Information Delivery Services (IDS)/Corporate & Financial Reporting group, Hartford...
Ko, Jupil; Rosen, Adam B; Brown, Cathleen N
2017-09-12
To cross-culturally adapt the Identification Functional Ankle Instability for use with Korean-speaking participants. The English version of the IdFAI was cross-culturally adapted into Korean based on the guidelines. The psychometric properties in the Korean version of the IdFAI were measured for test-retest reliability, internal consistency, criterion-related validity, discriminative validity, and measurement error 181 native Korean-speakers. Intra-class correlation coefficients (ICC 2,1 ) between the English and Korean versions of the IdFAI for test-retest reliability was 0.98 (standard error of measurement = 1.41). The Cronbach's alpha coefficient was 0.89 for the Korean versions of IdFAI. The Korean versions of the IdFAI had a strong correlation with the SF-36 (r s = -0.69, p 10 was the optimal cutoff score to distinguish between the group memberships. The minimally detectable change of the Korean versions of the IdFAI score was 3.91. The Korean versions of the IdFAI have shown to be an excellent, reliable, and valid instrument. The Korean versions of the IdFAI can be utilized to assess the presence of Chronic Ankle Instability by researchers and clinicians working among Korean-speaking populations. Implications for rehabilitation The high recurrence rate of sprains may result into Chronic Ankle Instability (CAI). The Identification of Functional Ankle Instability Tool (IdFAI) has been validated and recommended to identify patients with Chronic Ankle Instability (CAI). The Korean version of the Identification of Functional Ankle Instability Tool (IdFAI) may be also recommend to researchers and clinicians for assessing the presence of Chronic Ankle Instability (CAI) in Korean-speaking population.
Le traitement de l’idéologie dans la sociologie de Luc Boltanski
Directory of Open Access Journals (Sweden)
David Vrydaghs
2006-10-01
Full Text Available IntroductionLe concept d’idéologie apparaît dans la sociologie de Luc Boltanski à partir du Nouvel Esprit du capitalisme, publié en 1999. L’auteur y revient dans La Condition fœtale, paru en 2004. On aurait donc pu se contenter de ces ouvrages pour examiner le traitement réservé à l’idéologie dans la sociologie de Luc Boltanski. On préférera pourtant revenir aux travaux antérieurs du sociologue, et ce pour deux raisons.D’abord parce que le concept d’idéologie tel qu’il est employé dans Le Nou...
Evaluation of the Micro-ID system for the identification of Yersinia pestis.
Harrison, D N; Williams, J E
1985-01-01
One hundred isolates of Yersinia pestis identified by conventional means were tested by the Micro-ID system to assess its reliability for distinguishing Y. pestis from other members of the family Enterobacteriaceae. The Micro-ID system gave Y. pestis as a choice for the identification of 89 of these cultures, although not always as the first choice. Most nitrate-negative strains of Y. pestis keyed out with Yersinia pseudotuberculosis as first choice and Y. pestis as second or fourth choice.
Group-ID based RFID Mutual Authentication
Directory of Open Access Journals (Sweden)
LEE, Y.
2013-11-01
Full Text Available For passive type RFID tags, EPCglobal Class 1 Generation-2 Revision is used widely as a de facto standard. As it was designed for low cost, it is quite vulnerable to security issues, such as privacy concerns. This paper presents a new RFID mutual authentication protocol, which is designed to be configured on EPC Gen2 platform and to meet various security requirements while providing efficiency using PRNG (Pseudo Random Number Generator. Group-ID is used to minimize the authentication time. Security analysis of the proposed protocol is discussed.
40 CFR 146.73 - Financial responsibility for post-closure care.
2010-07-01
...-closure by using a trust fund, surety bond, letter of credit, financial test, insurance or corporate... 40 Protection of Environment 22 2010-07-01 2010-07-01 false Financial responsibility for post... Standards Applicable to Class I Hazardous Waste Injection Wells § 146.73 Financial responsibility for post...
Naruto, Takuya; Murakoshi, Hayato; Chikata, Takayuki; Koyanagi, Madoka; Kawashima, Yuka; Gatanaga, Hiroyuki; Oka, Shinichi; Takiguchi, Masafumi
2011-08-01
We previously showed the possibility that Gag A146P, which is an escape mutant from HLA-B∗57-restricted CTLs, was selected by HLA-B∗48:01-restricted Gag138-147(LI10)-specific CTLs in a Japanese cohort in which HLA-B∗57 individuals were not detected. We herein demonstrated Gag140-147(GI8) to be the optimal epitope rather than LI10 and that GI8-specific T cells failed to recognize the A146P mutant virus-infected cells. The sequence analysis of Gag146 in 261 chronically HIV-1-infected Japanese showed the accumulation of the A146P mutation in HLA-B∗48:01(+) individuals. These findings together indicate that the A146P mutant is accumulating in Japanese by selection by GI8-specific CTLs. Copyright © 2011 Institut Pasteur. Published by Elsevier SAS. All rights reserved.
DEFF Research Database (Denmark)
Crone, Stephanie Geisler; Jacobsen, Anders; Federspiel, Birgitte
2012-01-01
Gastric cancer is the second most common cause of cancer-related death in the world. Inflammatory signals originating from gastric cancer cells are important for recruiting inflammatory cells and regulation of metastasis of gastric cancer. Several microRNAs (miRNA) have been shown to be involved...... in development and progression of gastric cancer. miRNA-146a (miR-146a) is a modulator of inflammatory signals, but little is known about its importance in gastric cancer. We therefore wanted to identify targets of miR-146a in gastric cancer and examine its biological roles....
Angiotensin-I converting enzyme gene and I/D polymorphism ...
Indian Academy of Sciences (India)
Angiotensin-I converting enzyme gene and I/D polymorphism distribution in the Greek population and a comparison with other European populations. Sekerli Eleni Katsanidis Dimitrios Papadopoulou Vaya Makedou Areti Vavatsi Norma Gatzola Magdalini. Research Note Volume 87 Issue 1 April 2008 pp 91-93 ...
Development of the PARA-ID Program to Simulate a Unified Viscoplasticity Behaviour
International Nuclear Information System (INIS)
Koo, Gyeong Hoi
2009-01-01
The PARA-ID code is a general purpose computer simulation program for a nonlinear cyclic material behavior with and without viscous effects, which can simulate various constitutive models such as - Prager Model - Armstrong and Frederick Model - Chaboche 3-decomposed rule Model - Chaboche 4-decomposed rule Model - Ohno and Wang Model - Unified Chaboche Viscoplastic Model In this paper, the unified Chaboche viscoplasticity model is investigated with some examples of application for a cyclic hardening material of 316L
Rodriguez Viales, Rebecca; Diotel, Nicolas; Ferg, Marco; Armant, Olivier; Eich, Julia; Alunni, Alessandro; März, Martin; Bally-Cuif, Laure; Rastegar, Sepand; Strähle, Uwe
2015-03-01
The teleost brain has the remarkable ability to generate new neurons and to repair injuries during adult life stages. Maintaining life-long neurogenesis requires careful management of neural stem cell pools. In a genome-wide expression screen for transcription regulators, the id1 gene, encoding a negative regulator of E-proteins, was found to be upregulated in response to injury. id1 expression was mapped to quiescent type I neural stem cells in the adult telencephalic stem cell niche. Gain and loss of id1 function in vivo demonstrated that Id1 promotes stem cell quiescence. The increased id1 expression observed in neural stem cells in response to injury appeared independent of inflammatory signals, suggesting multiple antagonistic pathways in the regulation of reactive neurogenesis. Together, we propose that Id1 acts to maintain the neural stem cell pool by counteracting neurogenesis-promoting signals. © 2014 AlphaMed Press.
Enhancing privacy of users in eID schemes
Shrishak, Kris; Erkin, Z.; Schaar, Remco
2016-01-01
In todays world transactions are increasingly being performed over the internetbut require identication of users as in face-to-face transactions. In order to facilitate eGovernance as well as other eCommerce services Electronic Identiation(eID) schemes, which intend to provide unique and reliable
20 CFR 702.146 - Source of the special fund.
2010-04-01
... by the employer into the fund. Compensation orders shall be made and filed in accordance with the... during that period for compensation, and (2) the ratio of the amount of payments made by the special fund... 20 Employees' Benefits 3 2010-04-01 2010-04-01 false Source of the special fund. 702.146 Section...
Revocable ID-Based Signature with Short Size over Lattices
Directory of Open Access Journals (Sweden)
Ying-Hao Hung
2017-01-01
Full Text Available In the past, many ID-based signature (IBS schemes based on the integer factorization or discrete logarithm problems were proposed. With the progress on the development of quantum technology, IBS schemes mentioned above would become vulnerable. Recently, several IBS schemes over lattices were proposed to be secure against attacks in the quantum era. As conventional public-key settings, ID-based public-key settings have to offer a revocation mechanism to revoke misbehaving or malicious users. However, in the past, little work focuses on the revocation problem in the IBS schemes over lattices. In this article, we propose a new revocable IBS (RIBS scheme with short size over lattices. Based on the short integer solution (SIS assumption, we prove that the proposed RIBS scheme provides existential unforgeability against adaptive chosen-message attacks. As compared to the existing IBS schemes over lattices, our RIBS scheme has better performance in terms of signature size, signing key size, and the revocation mechanism with public channels.
Oberste, M S; Weaver, S C; Watts, D M; Smith, J F
1998-01-01
Venezuelan equine encephalitis (VEE) virus was isolated in 1993, 1994, and 1995 from human cases of acute, undifferentiated, febrile illness in the Peruvian Amazon Basin. Two virus isolates were recovered in 1994 from Peruvian soldiers at a jungle outpost near Pantoja in northern Peru, and 10 isolates were obtained from military personnel and civilians in 1993-1995 in Iquitos, an urban center in northeastern Peru. The genetic relationship of these isolates to other VEE virus strains was determined by sequencing 856-867 nucleotide reverse transcription-polymerase chain reaction fragments derived from the PE2 glycoprotein gene. The sequences were compared with those of other VEE virus strains, including representatives of the IAB, IC, ID, IE, II, and IIIC subtypes. The two Pantoja isolates were most closely related to subtype IC and ID viruses previously isolated in Colombia and Venezuela, and to the ID viruses isolated during the 1970s in Iquitos. All of the recent Iquitos isolates were similar to one another, but they were more closely related to Panamanian ID strains than to isolates previously obtained in Iquitos, Peru, or in Colombia and Venezuela. The recent Iquitos VEE viral isolates were the first Panama-genotype VEE ID virus strains identified outside of the Republic of Panama.
DEFF Research Database (Denmark)
Gibbs-Seymour, Ian; Oka, Yasuyoshi; Rajendra, Eeson
2015-01-01
We show that central components of the Fanconi anemia (FA) DNA repair pathway, the tumor suppressor proteins FANCI and FANCD2 (the ID complex), are SUMOylated in response to replication fork stalling. The ID complex is SUMOylated in a manner that depends on the ATR kinase, the FA ubiquitin ligase...
Identification of clinical yeasts by Vitek MS system compared with API ID 32 C.
Durán-Valle, M Teresa; Sanz-Rodríguez, Nuria; Muñoz-Paraíso, Carmen; Almagro-Moltó, María; Gómez-Garcés, José Luis
2014-05-01
We performed a clinical evaluation of the Vitek MS matrix-assisted laser desorption ionization-time-of-flight mass spectrometry (MALDI-TOF MS) system with the commercial database version 2.0 for rapid identification of medically important yeasts as compared with the conventional phenotypic method API ID 32 C. We tested 161 clinical isolates, nine isolates from culture collections and five reference strains. In case of discrepant results or no identification with one or both methods, molecular identification techniques were employed. Concordance between both methods was observed with 160/175 isolates (91.42%) and misidentifications by both systems occurred only when taxa were not included in the respective databases, i.e., one isolate of Candida etchellsii was identified as C. globosa by Vitek MS and two isolates of C. orthopsilosis were identified as C. parapsilosis by API ID 32 C. Vitek MS could not identify nine strains (5.14%) and API ID 32 C did not identify 13 (7.42%). Vitek MS was more reliable than API ID 32 C and reduced the time required for the identification of clinical isolates to only a few minutes.
9 CFR 146.53 - Terminology and classification; slaughter plants and premises.
2010-01-01
... from which the commercial waterfowl and commercial upland game bird industry may conduct a program to... COMMERCIAL POULTRY Special Provisions for Commercial Upland Game Birds, Commercial Waterfowl, Raised-for-Release Upland Game Birds, and Raised-for-Release Waterfowl § 146.53 Terminology and classification...
Pugliese, Cara E.; Kenworthy, Lauren; Bal, Vanessa Hus; Wallace, Gregory L.; Yerys, Benjamin E.; Maddox, Brenna B.; White, Susan W.; Popal, Haroon; Armour, Anna Chelsea; Miller, Judith; Herrington, John D.; Schultz, Robert T.; Martin, Alex; Anthony, Laura Gutermuth
2015-01-01
Recent updates have been proposed to the Autism Diagnostic Observation Schedule-2 Module 4 diagnostic algorithm. This new algorithm, however, has not yet been validated in an independent sample without intellectual disability (ID). This multi-site study compared the original and revised algorithms in individuals with ASD without ID. The revised…
The Danish eID Case: Twenty years of Delay
DEFF Research Database (Denmark)
Hoff, Jens Villiam; Hoff, Frederik Villiam
2010-01-01
the technological, organizational and legal dimensions of eID in Denmark, and comparing these with a number of other European countries made it possible to explain this paradox. Thus, the three main reasons for the special route development has taken in Denmark seems to be concerns over privacy, lack...
Directory of Open Access Journals (Sweden)
Elina Simanovich
2018-01-01
Full Text Available Tumors survive and progress by evading killing mechanisms of the immune system, and by generating a tumor microenvironment (TME that reprograms macrophages in situ to produce factors that support tumor growth, angiogenesis, and metastasis. We have previously shown that by blocking the translation of the enzyme inducible nitric oxide synthase (iNOS, miR-146a-5p inhibits nitric oxide (NO production in a mouse renal carcinoma cell line (RENCA, thereby endowing RENCA cells with resistance to macrophage-induced cell death. Here, we expand these findings to the mouse colon carcinoma CT26 cell line and demonstrate that neutralizing miR-146a-5p’s activity by transfecting both RENCA and CT26 cells with its antagomir restored iNOS expression and NO production and enhanced susceptibility to macrophage-induced cell death (by 48 and 25%, respectively, p < 0.001. Moreover, miR-146a-5p suppression simultaneously inhibited the expression of the pro-angiogenic protein EMMPRIN (threefolds, p < 0.001, leading to reduced MMP-9 and vascular endothelial growth factor secretion (twofolds and threefolds, respectively, p < 0.05, and reduced angiogenesis, as estimated by in vitro tube formation and scratch assays. When we injected tumors with pro-inflammatory-stimulated RAW 264.7 macrophages together with i.v. injection of the miR-146a-5p antagomir, we found inhibited tumor growth (sixfolds, p < 0.001 and angiogenesis (twofolds, p < 0.01, and increased apoptosis (twofolds, p < 0.01. This combination therapy increased nitrites and reduced TGFβ concentrations in tumor lysates, alleviated immune suppression, and allowed enhanced infiltration of cytotoxic CD8+ T cells. Thus, miR-146a-5p functions as a control switch between angiogenesis and cell death, and its neutralization can manipulate the crosstalk between tumor cells and macrophages and profoundly change the TME. This strategy can be therapeutically utilized in combination with the macrophage
19 CFR 146.2 - Port director as Board representative.
2010-04-01
...; DEPARTMENT OF THE TREASURY (CONTINUED) FOREIGN TRADE ZONES General Provisions § 146.2 Port director as Board representative. The appropriate port director shall be in charge of the zone as the representative of the Board. [T.D. 86-16, 51 FR 5049, Feb. 11, 1986, as amended by T.D. 99-27, 64 FR 13676, Mar. 22, 1999] ...
MiR-146a rs2910164 polymorphism increases the risk of digestive system cancer: A meta-analysis.
Xie, Wen Qun; Wang, Xiao Fan
2017-02-01
There is merging evidence suggesting that the miR-146a polymorphism might be associated with susceptibility to digestive system cancer. However, previous published studies have failed to achieve a definitive conclusion. To address this issue, an updated meta-analysis was performed. A comprehensive electronic search was conducted using the following source to identify the eligible studies: PubMed, Embase, China BioMedicine, the Cochrane Library, and Google Scholar. Odds ratios and its corresponding 95% confidence interval (CI) was used in the quantitative synthesis. The database search identified 1344 eligible studies, of which 32 (comprising 12,541 cases and 15,925 controls) were included. The results indicate that the miR-146a rs2910164 polymorphism was significantly associated with increased risk of digestive system cancer in heterozygote comparison (GC vs. CC: OR=1.15, 95% CI: 1.02-1.30, P=0.02), and recessive model (GG vs. GC+CC: OR=1.11, 95% CI: 1.04-1.17, P=0.006). Subgroup analysis by cancer site revealed increased risk in gastric cancer above heterozygote comparison (GG vs. GC: OR=1.13, 95% CI: 1.02-1.25, P=0.02), and recessive model (GG vs. GC+CC: OR=1.15, 95% CI: 1.04-1.26, P=0.006). Similarly, increased cancer risk was observed in hepatocellular carcinoma when compared with homozygote comparison (GG vs. CC: OR=1.21, 95% CI: 1.04-1.42, P=0.02), heterozygote comparison (GC vs. CC: OR=1.15, 95% CI: 1.02-1.29, P=0.02), and dominant model (GG+GC vs. CC: OR=1.16, 95% CI: 1.04-1.29, P=0.009). When stratified by ethnicity and quality score, increased cancer risks were also observed among Asians, Caucasians and high quality studies subgroup. The current study revealed that miR-146a G/C genetic polymorphism was more likely to be associated with digestive system cancer risk. Copyright © 2016 Elsevier Masson SAS. All rights reserved.
Towards fraud-proof ID documents using multiple data hiding technologies and biometrics
Picard, Justin; Vielhauer, Claus; Thorwirth, Niels
2004-06-01
Identity documents, such as ID cards, passports, and driver's licenses, contain textual information, a portrait of the legitimate holder, and eventually some other biometric characteristics such as a fingerprint or handwritten signature. As prices for digital imaging technologies fall, making them more widely available, we have seen an exponential increase in the ease and the number of counterfeiters that can effectively forge documents. Today, with only limited knowledge of technology and a small amount of money, a counterfeiter can effortlessly replace a photo or modify identity information on a legitimate document to the extent that it is very diffcult to differentiate from the original. This paper proposes a virtually fraud-proof ID document based on a combination of three different data hiding technologies: digital watermarking, 2-D bar codes, and Copy Detection Pattern, plus additional biometric protection. As will be shown, that combination of data hiding technologies protects the document against any forgery, in principle without any requirement for other security features. To prevent a genuine document to be used by an illegitimate user,biometric information is also covertly stored in the ID document, to be used for identification at the detector.
Pugliese, Cara E.; Kenworthy, Lauren; Bal, Vanessa Hus; Wallace, Gregory L; Yerys, Benjamin E; Maddox, Brenna B.; White, Susan W.; Popal, Haroon; Armour, Anna Chelsea; Miller, Judith; Herrington, John D.; Schultz, Robert T.; Martin, Alex; Anthony, Laura Gutermuth
2015-01-01
Recent updates have been proposed to the Autism Diagnostic Observation Schedule-2 Module 4 diagnostic algorithm. This new algorithm, however, has not yet been validated in an independent sample without intellectual disability (ID). This multi-site study compared the original and revised algorithms in individuals with ASD without ID. The revised algorithm demonstrated increased sensitivity, but lower specificity in the overall sample. Estimates were highest for females, individuals with a verb...
Chen, B; Han, B H; Sun, X H; Lim, R W
1997-01-15
We have examined the role of an Id-like protein, Id3 (also known as HLH462), in the regulation of muscle-specific gene expression. Id proteins are believed to block expression of muscle-specific genes by preventing the dimerization between ubiquitous bHLH proteins (E proteins) and myogenic bHLH proteins such as MyoD. Consistent with its putative role as an inhibitor of differentiation, Id3 mRNA was detected in proliferating skeletal muscle cells, was further induced by basic fibroblast growth factor (bFGF) and was down-regulated in differentiated muscle cultures. Overexpression of Id3 efficiently inhibited the MyoD-mediated activation of the muscle-specific creatine kinase (MCK) reporter gene. Deletion analysis indicated that the C-terminal 15 amino acids of Id3 are critical for the full inhibitory activity while deleting up to 42 residues from the C-terminus of the related protein, Id2, did not affect its ability to inhibit the MCK reporter gene. Chimeric protein containing the N-terminal region of Id3 and the C-terminus of Id2 was also non-functional in transfected cells. In contrast, wild-type Id3, the C-terminal mutants, and the Id3/Id2 chimera could all interact with the E-protein E47in vitro. Additional studies indicated that truncation of the Id3 C-terminus might have adversely affected the expression level of the mutant proteins but the Id3/Id2 chimera was stably expressed. Taken together, our results revealed a more complex requirement for the expression and proper function of the Id family proteins than was hitherto expected.
Energy Technology Data Exchange (ETDEWEB)
Liu, Chen; Jin, Rong [Department of Immunology, Peking University Health Science Center, Beijing (China); Wang, Hong-Cheng [Oklahoma Medical Research Foundation, Oklahoma City, OK (United States); Tang, Hui; Liu, Yuan-Feng; Qian, Xiao-Ping; Sun, Xiu-Yuan; Ge, Qing [Department of Immunology, Peking University Health Science Center, Beijing (China); Sun, Xiao-Hong, E-mail: sunx@omrf.org [Oklahoma Medical Research Foundation, Oklahoma City, OK (United States); Zhang, Yu, E-mail: zhangyu007@bjmu.edu.cn [Department of Immunology, Peking University Health Science Center, Beijing (China)
2013-06-21
Highlights: •Id1 expression enables naïve T cell proliferation without anti-CD28 co-stimulation. •Id1 expression facilitates T cells survival when stimulated with anti-CD3. •Elevation of IL-2 production by Id1 contributes increased proliferation and survival. •Id1 potentiates NF-κB activation by anti-CD3 stimulation. -- Abstract: Although the role of E proteins in the thymocyte development is well documented, much less is known about their function in peripheral T cells. Here we demonstrated that CD4 promoter-driven transgenic expression of Id1, a naturally occurring dominant-negative inhibitor of E proteins, can substitute for the co-stimulatory signal delivered by CD28 to facilitate the proliferation and survival of naïve CD4{sup +} cells upon anti-CD3 stimulation. We next discovered that IL-2 production and NF-κB activity after anti-CD3 stimulation were significantly elevated in Id1-expressing cells, which may be, at least in part, responsible for the augmentation of their proliferation and survival. Taken together, results from this study suggest an important role of E and Id proteins in peripheral T cell activation. The ability of Id proteins to by-pass co-stimulatory signals to enable T cell activation has significant implications in regulating T cell immunity.
The development and psychometric evaluation of the Internet Disorder Scale (IDS-15).
Pontes, Halley M; Griffiths, Mark D
2017-01-01
Previously published research suggests that improvement in the assessment of Internet addiction (IA) is paramount in advancing the field. However, little has been done to address inconsistencies in the assessment of IA using a more updated framework. The aim of the present study was to develop a new instrument to assess IA based on a modification of the nine Internet Gaming Disorder (IGD) criteria as suggested by the American Psychiatric Association in the latest (fifth) edition of the Diagnostic and Statistical Manual of Mental Disorders (DSM-5), and to provide a taxonomy of the potential risk of IA risk among participants. A heterogeneous sample of Internet users (n=1105) was recruited online (61.3% males, mean age 33years). Construct validity of the new instrument - Internet Disorder Scale (IDS-15) - was assessed by means of factorial, convergent, and discriminant validity. Criterion-related validity and reliability were also investigated. Additionally, latent profile analysis (LPA) was carried out to differentiate and characterize Internet users based on their potential IA risk. The construct and criterion-related validity of the IDS-15 were both warranted. The IDS-15 proved to be a valid and reliable tool. Using the LPA, participants were classed as "low addiction risk" (n=183, 18.2%), "medium addiction risk" (n=456, 41.1%), and "high addiction risk" (n=455, 40.77%). Furthermore, key differences emerged among these classes in terms of age, relationship status, cigarette consumption, weekly Internet usage, age of Internet use initiation, and IDS-15 total scores. The present findings support the viability of using adapted IGD criteria as a framework to assess IA. Copyright © 2015 Elsevier Ltd. All rights reserved.
ACE I/D polymorphism in Indian patients with hypertrophic cardiomyopathy and dilated cardiomyopathy
DEFF Research Database (Denmark)
Rai, Taranjit Singh; Dhandapany, Perundurai Subramaniam; Ahluwalia, Tarun Veer Singh
2008-01-01
The study was carried to determine the association of angiotensin converting enzyme (ACE) insertion/deletion (I/D) polymorphism with the risk of hypertrophic cardiomyopathy (HCM), dilated cardiomyopathy (DCM), and restrictive cardiomyopathy (RCM).......The study was carried to determine the association of angiotensin converting enzyme (ACE) insertion/deletion (I/D) polymorphism with the risk of hypertrophic cardiomyopathy (HCM), dilated cardiomyopathy (DCM), and restrictive cardiomyopathy (RCM)....
Assessment of the relationship between ACE I/D gene polymorphism and renal allograft survival.
Yang, Chun-Hua; Lu, Yi; Chen, Xue-Xia; Xian, Wen-Feng; Tu, Wei-Feng; Li, Hong-Yan
2015-12-01
The relationship between the angiotensin-converting enzyme (ACE) insertion/deletion (I/D) gene polymorphism and renal allograft survival after renal transplantation from the published reports are still debatable. This study was performed to evaluate the relationship between the ACE I/D gene polymorphism and renal allograft survival after renal transplantation using meta-analysis. Eligible studies were identified from PubMed and Cochrane Library on 1 November 2014, and eligible studies were recruited and synthesized using a meta-analysis methodology. Twelve investigations were included in this meta-analysis for the assessment of the relationship between the ACE I/D gene polymorphism and renal allograft survival. In this meta-analysis, the ACE I/D gene polymorphism was not associated with renal allograft survival after renal transplantation for overall populations, Caucasians, Brazilians and Africans. Interestingly, the ACE D allele and DD genotype were associated with renal allograft survival after renal transplantation in the Asian population. ACE D allele and DD genotype were associated with renal allograft survival after renal transplantation in the Asian population. However, more studies should be performed to confirm this association. © The Author(s) 2015.
Olszowski, Tomasz; Adler, Grażyna; Janiszewska-Olszowska, Joanna; Safranow, Krzysztof; Chlubek, Dariusz
2015-01-01
The aim of the study was to examine the frequencies of the genotypes and alleles of ACE insertion/deletion (I/D) polymorphism and their association with dental caries in a sample of Polish children. The study subjects were 120 children with dental caries experience (cases) and 41 caries-free individuals (controls). The genotyping was performed using polymerase chain reaction. The genotype distributions of ACE I/D polymorphism were not statistically different between carious and control children. However, we found a borderline overrepresentation of the II + ID genotypes versus the DD genotype in the carious compared to the control group (69.2% and 51.2%, respectively, p = 0.057). Logistic regression analysis adjusted for age and sex revealed that I allele carriage was a significant predictor of dental caries susceptibility (OR = 2.14, 95% CI = 1.02-4.49, p = 0.041). In conclusion, the DD genotype of ACE I/D polymorphism might be protective against dental caries in Polish children. © 2015 S. Karger AG, Basel.
Secure OpenID Authentication Model by Using Trusted Computing
Directory of Open Access Journals (Sweden)
E. Ghazizadeh
2014-01-01
Full Text Available The growth of Internet online services has been very quick in recent years. Each online service requires Internet users to create a new account to use the service. The problem can be seen when each user usually needs more than one service and, consequently, has numerous accounts. These numerous accounts have to be managed in a secure and simple way to be protected against identity theft. Single sign-on (SSO and OpenID have been used to decrease the complexity of managing numerous accounts required in the Internet identity environment. Trusted Platform Module (TPM and Trust Multitenancy are great trusted computing-based technologies to solve security concerns in the Internet identity environment. Since trust is one of the pillars of security in the cloud, this paper analyzes the existing cloud identity techniques in order to investigate their strengths and weaknesses. This paper proposes a model in which One Time Password (OTP, TPM, and OpenID are used to provide a solution against phishing as a common identity theft in cloud environment.
Time-and-ID-Based Proxy Reencryption Scheme
Mtonga, Kambombo; Paul, Anand; Rho, Seungmin
2014-01-01
Time- and ID-based proxy reencryption scheme is proposed in this paper in which a type-based proxy reencryption enables the delegator to implement fine-grained policies with one key pair without any additional trust on the proxy. However, in some applications, the time within which the data was sampled or collected is very critical. In such applications, for example, healthcare and criminal investigations, the delegatee may be interested in only some of the messages with some types sampled wi...
Radikal konservativ idédebat og højreautoritær fascination i Danmark, ca. 1928-1940
DEFF Research Database (Denmark)
Holm, Adam
1999-01-01
Historie, Højreradikalisme, Konservatisme, Fascisme, Mellemkrigstid, Idéhistorie, Intellektuelle......Historie, Højreradikalisme, Konservatisme, Fascisme, Mellemkrigstid, Idéhistorie, Intellektuelle...
Zago, Michela; Rico de Souza, Angela; Hecht, Emelia; Rousseau, Simon; Hamid, Qutayba; Eidelman, David H; Baglole, Carolyn J
2014-04-21
Diseases due to cigarette smoke exposure, including chronic obstructive pulmonary disease (COPD) and lung cancer, are associated with chronic inflammation typified by the increased expression of cyclooxygenase-2 (COX-2) protein. RelB is an NF-κB family member that suppresses cigarette smoke induction of COX-2 through an unknown mechanism. The ability of RelB to regulate COX-2 expression may be via miR-146a, a miRNA that attenuates COX-2 in lung fibroblasts. In this study we tested whether RelB attenuation of cigarette smoke-induced COX-2 protein is due to miR-146a. Utilizing pulmonary fibroblasts deficient in RelB expression, together with siRNA knock-down of RelB, we show the essential role of RelB in diminishing smoke-induced COX-2 protein expression despite robust activation of the canonical NF-κB pathway and subsequent induction of Cox-2 mRNA. RelB did not regulate COX-2 protein expression at the level of mRNA stability. Basal levels of miR-146a were significantly lower in Relb-deficient cells and cigarette smoke increased miR-146a expression only in Relb-expressing cells. Inhibition of miR-146a had no effects on Relb expression or induction of Cox-2 mRNA by cigarette smoke but significantly increased COX-2 protein. These data highlight the potential of a RelB-miR-146a axis as a novel regulatory pathway that attenuates inflammation in response to respiratory toxicants. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.
Directory of Open Access Journals (Sweden)
Michiel M. Harmsen
2017-08-01
Full Text Available Intact (146S foot-and-mouth disease virus (FMDVs can dissociate into specific (12S viral capsid degradation products. FMD vaccines normally consist of inactivated virions. Vaccine quality is dependent on 146S virus particles rather than 12S particles. We earlier isolated two llama single-domain antibody fragments (VHHs that specifically recognize 146S particles of FMDV strain O1 Manisa and shown their potential use in quality control of FMD vaccines during manufacturing. These 146S-specific VHHs were specific for particular O serotype strains and did not bind strains from other FMDV serotypes. Here, we describe the isolation of 146S-specific VHHs against FMDV SAT2 and Asia 1 strains by phage display selection from llama immune libraries. VHHs that bind both 12S and 146S particles were readily isolated but VHHs that bind specifically to 146S particles could only be isolated by phage display selection using prior depletion for 12S particles. We obtained one 146S-specific VHH—M332F—that binds to strain Asia 1 Shamir and several VHHs that preferentially bind 146S particles of SAT2 strain SAU/2/00, from which we selected VHH M379F for further characterization. Both M332F and M379F did not bind FMDV strains from other serotypes. In a sandwich enzyme-linked immunosorbent assay (ELISA employing unlabeled and biotinylated versions of the same VHH M332F showed high specificity for 146S particles but M379F showed lower 146S-specificity with some cross-reaction with 12S particles. These ELISAs could detect 146S particle concentrations as low as 2.3–4.6 µg/l. They can be used for FMD vaccine quality control and research and development, for example, to identify virion stabilizing excipients.
27 CFR 70.146 - 45-day period for making disbursements.
2010-04-01
... tax lien filing, to the lien imposed by 26 U.S.C. 6321 if, and to the extent, a right to payment has... Collection of Excise and Special (Occupational) Tax Lien for Taxes § 70.146 45-day period for making disbursements. Even though a notice of a lien imposed by 26 U.S.C. 6321 is filed in accordance with § 70.149 of...
Application of game theory for the interpretation of inventory differences (ID)
International Nuclear Information System (INIS)
Moglewer, S.
1978-01-01
In a study performed by the Test and Evaluation Branch, Division of Safeguards, at the U.S. Nuclear Regulatory Commission with contract assistance from Lawrence Berkeley Laboratory, the validity of the ID concept for estabilishing assurance concerning possible unauthorized diversion of SNM was examined. The evaluation methodology was based upon the theory of games and produced results that were quite different from those derived by classical statistical hypothesis testing. A model was developed based upon a decision maker's utilities and solved for generic facilities. Based upon the value of ID, obtained from each inventory, and specific for each facility, there is a best policy for estimating unauthorized deliberate diversion and establishing action limits (alarm thresholds). This paper presents the results of this study as applied to a generic facility
Directory of Open Access Journals (Sweden)
Gutmann Anja
2010-01-01
Full Text Available Abstract Background ID proteins are dominant negative inhibitors of basic helix-loop-helix transcription factors that have multiple functions during development and cellular differentiation. Ectopic (over-expression of ID1 extends the lifespan of primary human epithelial cells. High expression levels of ID1 have been detected in multiple human malignancies, and in some have been correlated with unfavorable clinical prognosis. ID1 protein is localized at the centrosomes and forced (over-expression of ID1 results in errors during centrosome duplication. Results Here we analyzed the steady state expression levels of the four ID-proteins in 18 tumor cell lines and assessed the number of centrosome abnormalities. While expression of ID1, ID2, and ID3 was detected, we failed to detect protein expression of ID4. Expression of ID1 correlated with increased supernumerary centrosomes in most cell lines analyzed. Conclusions This is the first report that shows that not only ectopic expression in tissue culture but endogenous levels of ID1 modulate centrosome numbers. Thus, our findings support the hypothesis that ID1 interferes with centrosome homeostasis, most likely contributing to genomic instability and associated tumor aggressiveness.
Siparex hits target with '146m for third mid-market fund
2003-01-01
Sigefi Private Equity has reached its target final closing of '146m ($155m) for its third mid-market buy-out and expansion capital fund. International investors contributed 26% of the capital including commitments from CERN, Switzerland (1 paragraph).
Nicotine permeability across the buccal TR146 cell culture model and porcine buccal mucosa in vitro
DEFF Research Database (Denmark)
Nielsen, Hanne Mørck; Rassing, Margrethe Rømer
2002-01-01
The present study was conducted to investigate and compare the effect of pH and drug concentration on nicotine permeability across the TR146 cell culture model and porcine buccal mucosa in vitro. As a further characterization of the TR146 cell culture model, it was explored whether the results were...... comparable for bi-directional and uni-directional transport in the presence of a transmembrane pH gradient. Nicotine concentrations between 10(-5) and 10(-2) M were applied to the apical side of the TR146 cell culture model or the mucosal side of porcine buccal mucosa. Buffers with pH values of 5.5, 7.......4 and 8.1 were used to obtain different fractions of non- and mono-ionized nicotine. The apparent permeability (P(app)) of nicotine across both models increased significantly with increasing pH, and the P(app) values obtained with the two models could be correlated in a linear manner. With increasing...
Martin, Lynn; Hirdes, John P.; Fries, Brant E.; Smith, Trevor F.
2007-01-01
This paper describes the development of the interRAI-Intellectual Disability (interRAI ID), a comprehensive instrument that assesses all key domains of interest to service providers relative to a person with an intellectual disability (ID). The authors report on the reliability and validity of embedded scales for cognition, self-care, aggression,…
International Nuclear Information System (INIS)
Zhao, Po; Lu, Yali; Liu, Lin; Zhong, Mei
2008-01-01
The relationships between the expression of ID2, EBV-LMP1 and P16(INK4A) in Chinese classical Hodgkin lymphoma are unknown and need exploring. Samples of classical Hodgkin lymphoma from 60 Chinese patients were analyzed for the expression of ID2, EBV-LMP1 and p16(INK4A) proteins by immunohistochemistry. ID2 protein was expressed in 83.3% of this group of classical Hodgkin lymphoma, staining strongly in both cytoplasm and nucleus of the Hodgkin and Reed-Sternberg (HRS) cells. EBV-LMP1 and P16(INK4A) were overexpressed in 85.0% and 71.7% of Hodgkin lymphoma, respectively. EBV-LMP1 was noted in the cytoplasm, membrane and nucleus of HRS cells; P16(INK4A) was in the nucleus and cytoplasm. Microscopically, ID2, EBV-LMP1 and P16(INK4A) staining distinguished the HRS cells from the complex background of lymphocytes. ID2 was positively correlated with EBV-LMP1(P < 0.01), but P16(INK4A) was inversely related to EBV-LMP1 (P < 0.05). It is suggested that ID2, EBV-LMP1 and P16(INK4A) could play an important role in the evolution of classical Hodgkin lymphoma, and be considered as potential adjunct markers to identify HRS cells in diagnosis
24 CFR 146.3 - Purpose of HUD's age discrimination regulation.
2010-04-01
... RECEIVING FEDERAL FINANCIAL ASSISTANCE General § 146.3 Purpose of HUD's age discrimination regulation. The purpose of this part is to state HUD's policies and procedures under the Age Discrimination Act of 1975... 24 Housing and Urban Development 1 2010-04-01 2010-04-01 false Purpose of HUD's age discrimination...
Directory of Open Access Journals (Sweden)
Maria Fernanda De Mello Costa
2012-10-01
Full Text Available Angiotensin II is a key regulator of blood pressure and cardiovascular function in mammals. The conversion of angiotensin into its active form is carried out by Angiotensin I-Converting Enzyme (ACE. The measurement of ACE concentration in plasma or serum, its enzymatic activity, and the correlation between an insertion/deletion (I/D genetic polymorphism of the ACE gene have been investigated as possible indicators of superior athletic performance in humans. In this context, other indicators of superior adaptation to exercise resulting in better athletic performance (such as ventricular hypertrophy, VO2 max, and competition results were mostly used to study the association between ACE I/D polymorphism and improved performance. Despite the fact that the existing literature presents little consensus, there is sufficient scientific evidence to warrant further investigation on the usage of ACE activity and the I/D ACE gene polymorphism as biomarkers of superior athletic performance in humans of specific ethnicities or in athletes involved in certain sports. In this sense, a biomarker would be a substance or genetic component that could be measured to provide a degree of certainty, or an indication, of the presence of a certain trait or characteristic that would be beneficial to the athlete’s performance. Difficulties in interpreting and comparing the results of scientific research on the topic arise from dissimilar protocols and variation in study design. This review aims to investigate the current literature on the use of ACE I/D polymorphism as a biomarker of performance in humans through the comparison of scientific publications.
Li, Xin; Kroin, Jeffrey S; Kc, Ranjan; Gibson, Gary; Chen, Di; Corbett, Grant T; Pahan, Kalipada; Fayyaz, Sana; Kim, Jae-Sung; van Wijnen, Andre J; Suh, Joon; Kim, Su-Gwan; Im, Hee-Jeong
2013-12-01
The objective of this study was to examine whether altered expression of microRNAs in central nervous system components is pathologically linked to chronic knee joint pain in osteoarthritis. A surgical animal model for knee joint OA was generated by medial meniscus transection in rats followed by behavioral pain tests. Relationships between pathological changes in knee joint and development of chronic joint pain were examined by histology and imaging analyses. Alterations in microRNAs associated with OA-evoked pain sensation were determined in bilateral lumbar dorsal root ganglia (DRG) and the spinal dorsal horn by microRNA array followed by individual microRNA analyses. Gain- and loss-of-function studies of selected microRNAs (miR-146a and miR-183 cluster) were conducted to identify target pain mediators regulated by these selective microRNAs in glial cells. The ipsilateral hind leg displayed significantly increased hyperalgesia after 4 weeks of surgery, and sensitivity was sustained for the remainder of the 8-week experimental period (F = 341, p pain was correlated with pathological changes in the knee joints as assessed by histological and imaging analyses. MicroRNA analyses showed that miR-146a and the miR-183 cluster were markedly reduced in the sensory neurons in DRG (L4/L5) and spinal cord from animals experiencing knee joint OA pain. The downregulation of miR-146a and/or the miR-183 cluster in the central compartments (DRG and spinal cord) are closely associated with the upregulation of inflammatory pain mediators. The corroboration between decreases in these signature microRNAs and their specific target pain mediators were further confirmed by gain- and loss-of-function analyses in glia, the major cellular component of the central nervous system (CNS). MicroRNA therapy using miR-146a and the miR-183 cluster could be powerful therapeutic intervention for OA in alleviating joint pain and concomitantly regenerating peripheral knee joint cartilage. © 2013
Angiotensin-converting enzyme gene I/D polymorphism in Pakistani ...
African Journals Online (AJOL)
hope&shola
two were the cases of antiphospholipid syndrome. Parsa et al. (2002) conducted an association of 3 polymor- phisms in angiotensin-converting enzyme including I/D polymorphism and 2 polymorphisms were associated with systemic lupus erythematosus and Lupus Nephritis among non-Caucasians that includes Hispanic, ...
Attachment quality of children with ID and its link to maternal sensitivity and structuring.
Feniger-Schaal, Rinat; Joels, Tirtsa
2018-05-01
Attachment theory produced a fertile field of research and clinical application. Although the topic of attachment of children with intellectual disability (ID) has received increasing research attention over the past 15 years, the empirical evidence is still limited. We applied theoretical and empirical knowledge of parenting typically developing children to examine the mother-child relationship in the ID population. The aim was to examine maternal sensitivity and structuring and its association with children's attachment classification and their disability. Forty preschool children (mean age 47.25, range 26-75 months) with non-specific ID and their mothers participated in the study. The mean developmental age was 25.92 months (SD = 10.89), The DQ mean score was 55.45 (SD = 17.28). We assessed children's quality of attachment using the SSP and maternal interactive behavior using the Emotional Availability Scales. Forty percent of children showed secure attachment, and 32.5% showed disorganized attachment. Attachment classifications correlated significantly with maternal sensitivity and maternal structuring but not with the child's cognitive disability. The results point to the importance of maternal interactive behavior for children with ID. Clinical implication may consider interventions aiming to enhance maternal sensitivity and structuring to improve children's quality of attachment. Copyright © 2018 Elsevier Ltd. All rights reserved.
Pätid võtsid varastatud ID-kaardiga kiirlaene / Põim Kama
Kama, Põim, 1985-
2008-01-01
ID-kaardi vargusega seotud pettusjuhtumist ning jaanuaris jõustunud rahapesu ja terrorismi rahastamise tõkestamise seaduse sättest, mis kohustab laenufirmasid esimese tehingu sooritamisel kliendiga silmast silma kohtuma. Lisatud: kiirlaenufirmad vilistavad seadusele
DEFF Research Database (Denmark)
Fyhrquist, Frej; Eriksson, Anders; Saijonmaa, Outi
2013-01-01
INTRODUCTION: Short telomeres are often associated with cardiovascular risk factors and age-related diseases, while the angiotensin converting enzyme (ACE) gene insertion/deletion polymorphism (DD, ID, II) has shown such associations less consistently. We hypothesized that telomere length...... and association of telomere length with cardiovascular risk is affected by ACE (I/D) genotype. METHODS: We measured leucocyte telomere length (LTL) by Southern blot and analysed ACE I/D genotypes in 1249 subjects with hypertension and left ventricular hypertrophy (LVH). We examined interactions of ACE I...
British military operation at Sheikh Sa‘id in the First World War
Directory of Open Access Journals (Sweden)
Abdol Rauh Yaccob
2017-09-01
Full Text Available It is a difficult task to measure the importance of South West Arabia to the Ottomans and the British prior to and during World War I. Early history of imperial expansion in the area which followed by constant conflicts and involved a considerable amount of diplomacy and intrigues with the natives may suggest that South West Arabia was considered as equally as important to other areas within the empire. However from the beginning of the 20th century South West Arabia was considered something of a backwater. It may also be observed that during the First World War the position of South West Arabia to these powers in relation to other war theatres remained practically the same except in the episodes of British action at Sheikh Said and the Ottomans advance at Lahej. The Indian authorities who believed that the Ottomans were contemplating a move to Sheikh Sa‘id with the aim of acting against British Perim with the telegraphic communication, convoys and shipping, only two miles away, took the opportunity of the movement of the troops through the Red Sea to attack the fort of Sheikh Sa‘id. The action was quickly taken before obtaining official approval from the Admiralty and the India Office in London. The action was taken due to the persistent reports of the Ottoman reinforcement with guns had been sent to Sheikh Sa‘id, further to take advantage of the presence of transports with troops for Egypt. Subsequently future military operations at Sheikh Sa‘id and the Red Sea appeared to dominate the discussions among the authorities at the India Office, the Admiralty, the Indian authorities and the Resident at Aden throughout the war without materializing any further military action.
Inanir, Ahmet; Basol, Nursah; Karakus, Nevin; Yigit, Serbulent
2013-11-10
Diabetic peripheral neuropathy (DPN) is a microvascular complication of diabetes mellitus (DM) due to decreasing quality of life. In the present study, it is aimed to evaluate angiotensin-converting enzyme (ACE) Gene I/D polymorphism in Turkish population. Two hundred and thirty-five DPN patients and two hundred and eighty-one controls were enrolled in this study. Genomic DNA was isolated and genotyped using polymerase chain reaction (PCR) analyses for the ACE gene I/D polymorphism. Baseline characteristics of the DPN patients according to ACE genotypes were similar, except for history of hypertension. The frequency of II genotype was significantly higher in patients with positive history of hypertension than the patients with negative history of hypertension (p=0.013). DD genotype of I/D polymorphism was found to be a susceptibility factor for DPN in homozygous form (p=0.032). According to allele frequencies, D allele of I/D polymorphism was found to be a susceptibility factor for DPN (p=0.031). ACE gene I/D polymorphism may research in DM patients to determine genetic predisposition for DPN. It can be useful for taking early measures and avoiding DPN in a Turkish population. © 2013 Elsevier B.V. All rights reserved.
2011-08-03
...-Challis National Forest, ID; Upper North Fork HFRA Ecosystem Restoration Project Environmental Impact... improve the health of the ecosystem and reach the desired future condition. DATES: Comments concerning the... Ecosystem Restoration Project EIS, P.O. Box 180, 11 Casey Rd., North Fork, ID 83466. Comments may also be...
idSpace Tooling and Training for collaborative distributed product innovation
Rutjens, Marjo; Bitter-Rijpkema, Marlies; Grube, Pascal; Heider, Thomas
2009-01-01
Rutjens, M., Bitter-Rijpkema, M., Grube, P. P., & Heider, T. (2009). idSpace Tooling and Training for collaborative distributed product innovation. Workshop during the e-Learning Baltic conference. June, 17-19, 2009, Rostock, Germany.
Directory of Open Access Journals (Sweden)
Patricia V Aguilar
2009-09-01
Full Text Available Venezuelan equine encephalitis virus (VEEV has been responsible for hundreds of thousands of human and equine cases of severe disease in the Americas. A passive surveillance study was conducted in Peru, Bolivia and Ecuador to determine the arboviral etiology of febrile illness. Patients with suspected viral-associated, acute, undifferentiated febrile illness of <7 days duration were enrolled in the study and blood samples were obtained from each patient and assayed by virus isolation. Demographic and clinical information from each patient was also obtained at the time of voluntary enrollment. In 2005-2007, cases of Venezuelan equine encephalitis (VEE were diagnosed for the first time in residents of Bolivia; the patients did not report traveling, suggesting endemic circulation of VEEV in Bolivia. In 2001 and 2003, VEE cases were also identified in Ecuador. Since 1993, VEEV has been continuously isolated from patients in Loreto, Peru, and more recently (2005, in Madre de Dios, Peru. We performed phylogenetic analyses with VEEV from Bolivia, Ecuador and Peru and compared their relationships to strains from other parts of South America. We found that VEEV subtype ID Panama/Peru genotype is the predominant one circulating in Peru. We also demonstrated that VEEV subtype ID strains circulating in Ecuador belong to the Colombia/Venezuela genotype and VEEV from Madre de Dios, Peru and Cochabamba, Bolivia belong to a new ID genotype. In summary, we identified a new major lineage of enzootic VEEV subtype ID, information that could aid in the understanding of the emergence and evolution of VEEV in South America.
19 CFR 146.52 - Manipulation, manufacture, exhibition or destruction; Customs Form 216.
2010-04-01
... 19 Customs Duties 2 2010-04-01 2010-04-01 false Manipulation, manufacture, exhibition or... Merchandise in a Zone § 146.52 Manipulation, manufacture, exhibition or destruction; Customs Form 216. (a... application) on Customs Form 216 for permission to manipulate, manufacture, exhibit, or destroy merchandise in...
An Improved Dynamic ID-Based Remote User Authentication with Key Agreement Scheme
Directory of Open Access Journals (Sweden)
Juan Qu
2013-01-01
Full Text Available In recent years, several dynamic ID-based remote user authentication schemes have been proposed. In 2012, Wen and Li proposed a dynamic ID-based remote user authentication with key agreement scheme. They claimed that their scheme can resist impersonation attack and insider attack and provide anonymity for the users. However, we will show that Wen and Li's scheme cannot withstand insider attack and forward secrecy, does not provide anonymity for the users, and inefficiency for error password login. In this paper, we propose a novel ECC-based remote user authentication scheme which is immune to various known types of attack and is more secure and practical for mobile clients.
Association of ACE Gene I/D polymorphism with migraine in Kashmiri population.
Wani, Irfan Yousuf; Sheikh, Saleem; Shah, Zafar Amin; Pandith, Arshid A; Wani, Mushtaq; Asimi, Ravouf; Wani, Maqbool; Sheikh, Shahnawaz; Mehraj, Iqra
2016-01-01
Migraine is a complex, recurrent headache disorder that is one of the most common complaints in neurology practice. The role of various genes in its pathogenesis is being studied. We did this study to see whether an association exists between ACE gene I/D polymorphism and migraine in our region. The study included 100 patients diagnosed with migraine and 121 healthy controls. The study subject were age and gender matched. The analysis was based on Polymerase Chain Reaction (PCR) and included following steps: DNA extraction from blood, PCR and Restriction Fragment Length Polymorphism (RFLP). Out of 100 cases, 69 were females and 31 were males. Fifty-seven were having migraine without aura and 43 had migraine with aura. 45 of the cases had II polymorphism, 40 had ID polymorphism and 15 had DD polymorphism in ACE gene. We were not able to find a statistically significant association between ACE gene I/D polymorphism with migraine. The reason for difference in results between our study and other studies could be because of different ethnicity in study populations. So a continuous research is needed in this regard in order to find the genes and different polymorphism that increase the susceptibility of Kashmiri population to migraine.
ID based cryptography for secure cloud data storage
Kaaniche , Nesrine; Boudguiga , Aymen; Laurent , Maryline
2013-01-01
International audience; This paper addresses the security issues of storing sensitive data in a cloud storage service and the need for users to trust the commercial cloud providers. It proposes a cryptographic scheme for cloud storage, based on an original usage of ID-Based Cryptography. Our solution has several advantages. First, it provides secrecy for encrypted data which are stored in public servers. Second, it offers controlled data access and sharing among users, so that unauthorized us...
Batf3 and Id2 have a synergistic effect on Irf8-directed classical CD8α+ dendritic cell development
Jaiswal, Hemant
2013-11-13
Dendritic cells (DCs) are heterogeneous cell populations represented by different subtypes, each varying in terms of gene expression patterns and specific functions. Recent studies identified transcription factors essential for the development of different DC subtypes, yet molecular mechanisms for the developmental program and functions remain poorly understood. In this study, we developed and characterized a mouse DC progenitor-like cell line, designated DC9, from Irf8-/- bone marrow cells as a model for DC development and function. Expression of Irf8 in DC9 cells led to plasmacytoid DCs and CD8α+ DC-like cells, with a concomitant increase in plasmacytoid DC- and CD8α+ DC-specific gene transcripts and induction of type I IFNs and IL12p40 following TLR ligand stimulation. Irf8 expression in DC9 cells led to an increase in Id2 and Batf3 transcript levels, transcription factors shown to be important for the development of CD8α+ DCs. We show that, without Irf8 , expression of Id2 and Batf3 was not sufficient for directing classical CD8α+ DC development. When coexpressed with Irf8, Batf3 and Id2 had a synergistic effect on classical CD8α+ DC development. We demonstrate that Irf8 is upstream of Batf3 and Id2 in the classical CD8α+ DC developmental program and define the hierarchical relationship of transcription factors important for classical CD8α+ DC development.
Gurav, Reshma S; Ganu, Sneha S; Panhale, Vrushali P
2014-10-01
Functional ankle instability (FAI) is the tendency of the foot to 'give way'. Identification of Functional Ankle Instability questionnaire (IdFAI) is a newly developed questionnaire to detect whether individuals meet the minimum criteria necessary for inclusion in an FAI population. However, the reliability of the questionnaire was studied only in a restricted age group. The purpose of this investigation was to examine the reliability of IdFAI across different age groups in adults. One hundred and twenty participants in the age group of 20-60 years consisting of 30 individuals in each age group were asked to complete the IdFAI on two occasions. Test-retest reliability was evaluated by intraclass correlation coefficient (ICC2,1). The study revealed that IdFAI has excellent test-retest reliability when studied across different age groups. The ICC2,1 in the age groups 20-30 years, 30-40 years, 40-50 years and 50-60 years was 0.978, 0.975, 0.961 and 0.922, respectively with Cronbach's alpha >0.9 in all the age groups. The IdFAI can accurately predict if an individual meets the minimum criterion for FAI across different age groups in adults. Thus, the questionnaire can be applied over different age groups in clinical and research set-ups.
Directory of Open Access Journals (Sweden)
Olfat Gamil Shaker
2018-05-01
Full Text Available Background/Aims: Rheumatoid arthritis (RA is a systemic autoimmune disease affecting up to 1% of the population worldwide. The aim of the present study was to investigate whether miRNA-146a rs2910164, miRNA-499 rs3746444, IRAK1 rs3027898 and PADI4 rs1748033 polymorphisms are associated with susceptibility to RA in Egyptians and whether they influence disease severity and activity. Methods: The study was performed on 104 unrelated RA patients and 112 healthy subjects. RA patients were further subdivided into active and inactive RA groups. Polymorphisms were genotyped by using real-time polymerase chain reaction with TaqMan allelic discrimination assay. Results: Significant differences in the frequency of miRNA-146a rs2910164, miRNA-499 rs3746444, IRAK1 rs3027898 and PADI4 rs1748033 alleles and genotypes were observed between RA patients and controls. Only CA and AA genotypes of IRAK1 rs3027898 shows a significant difference between active and inactive subgroups. MiRNA-146a rs2910164 and IRAK1 rs3027898 polymorphisms were a risk factor for predisposition to RA in codominant and dominant tested inheritance models, while, the miRNA-499 rs3746444 and PADI4 rs1748033 polymorphisms were a risk factor in codominant and recessive one. CG and GG genotypes of miRNA-146a rs2910164 were associated with positive erosions. CA genotype of IRAK1 rs3027898 was associated with low disease activity and negative erosions, while, the AA genotype was associated with high disease activity. CC genotype of PADI4 rs1748033 was associated with negative rheumatoid factor. Conclusion: The 4 studied SNPs were likely to play an important role in the susceptibility to RA and can influence disease severity and activity in Egyptian population.
Quand l’idée fixe se met « à table »
Directory of Open Access Journals (Sweden)
Cécile de Bary
2008-03-01
Full Text Available Un livre de cuisine, comme A table de Claudian, édité en 1963, peut relever de la prose d’idées dans la mesure où son projet est sous-tendu par une idéologie très précise, qui seule lui donne sa cohérence. Si l’ethnocentrisme consiste à ne pas reconnaître à l’autre une culture, par exemple, ce livre apparaît comme ethnocentrique, puisqu’il a pour projet de départager les peuples qui savent et ceux qui ne savent pas. Il est encore réactionnaire, voué au rétablissement des savoir-faire des terroirs, contre les corruptions parisiennes en particulier. Dès lors, la présentation d’un plat est toujours susceptible de s’étendre ou de se faire discours, sous la poussée d’un lyrisme acrimonieux. Pour autant, il ne s’agit pas d’un faux livre de cuisine, d’un traité ou d’une « physiologie ». La recette est l’aboutissement logique de l’idée fixe. Elle est le lieu d’une bataille que l’argumentation sert, qu’elle met en scène et qu’elle prépare.
40 CFR 264.146 - Use of a mechanism for financial assurance of both closure and post-closure care.
2010-07-01
... facilities by using a trust fund, surety bond, letter of credit, insurance, financial test, or corporate... 40 Protection of Environment 25 2010-07-01 2010-07-01 false Use of a mechanism for financial... HAZARDOUS WASTE TREATMENT, STORAGE, AND DISPOSAL FACILITIES Financial Requirements § 264.146 Use of a...
High-precision ID-TIMS zircon U-Pb geochronology using new 1013 Ohm resistors
Von Quadt, A.; Buret, Y.; Large, S.; Peytcheva, I.; Trinquier, A.; Wotzlaw, J. F.
2015-12-01
Faraday cups equipped with high gain amplifiers provide a means to measure small ion beams in static mode without the limited linear range of ion counting systems. We tested the application of newly available 1013 Ohm resistors to ID-TIMS zircon U-Pb geochronology using a range of natural and synthetic reference materials. The TritonPlus-RPQ at the Institute of Geochemistry and Petrology, ETH Zurich, is equipped with five new 1013 Ohm resistors and one MasCom secondary electron multiplier, allowing to measure the 202-204-205-206-207-208Pb masses in static mode. U is measured subsequently as U-oxide (265-267-270UO2) during a second step, also in static Faraday mode. The gain calibration of the 1013 Ohm resistors was performed using the procedure of Trinquier (2014), with 144Nd-146Nd being measured using 1011 Ohm resistor and 142-143-145-148-150Nd being measured using 1013 Ohm resitors (Trinquier, 2014; Koornneef et al., 2014). Standard deviations of the noise in all five new 1013 Ohm resistors are lower than 5.0 x 10-6 over a 6 month period, with no shift occurring over this time interval. This new detector set-up was tested by analyzing natural zircon standard materials and synthetic U/Pb solutions (www.earthime.org), ranging in age from ~2 Ma to ~600 Ma. All natural zircon standards were chemically abraded (Mattinson, 2005) and all samples were spiked with the ET2535 tracer solution. U-Pb dates obtained using the static measurement routine are compared to measurements employing dynamic peak jumping routines on the MasCom multiplier. This study illustrates the benefits and current limitations of using high gain amplifiers to measure small ion beams for zircon U-Pb geochronology compared to conventional dynamic ion counting techniques. Mattinson, J.M. (2005) Chemical Geology 220:47-66; Trinquier, A. (2014) Application Note 30281; Koornneef, J. et al (2014) Analytica Chimica Acta 819:49-55.
Su, Li-Na; Lei, Feng-Ying; Huang, Wei-Fang; Zhao, Yan-Jun
2011-01-01
Background The results from the published studies on the association between angiotensin-converting enzyme (ACE) insertion/deletion (I/D) gene polymorphism and the treatment response to steroid in Asian children with idiopathic nephrotic syndrome (INS) is still conflicting. This meta-analysis was performed to evaluate the relation between ACE I/D gene polymorphism and treatment response to steroid in Asian children and to explore whether ACE D allele or DD genotype could become a predictive marker for steroid responsiveness. Methodology/Principal Findings Association studies were identified from the databases of PubMed, Embase, Cochrane Library and CBM-disc (China Biological Medicine Database) as of September 1, 2010, and eligible investigations were synthesized using meta-analysis method. Five investigations were identified for the analysis of association between ACE I/D gene polymorphism and steroid-resistant nephrotic syndrome (SRNS) risk in Asian children and seven studies were included to explore the relationship between ACE I/D gene polymorphism and steroid-sensitive nephrotic syndrome (SSNS) susceptibility. Five investigations were recruited to explore the difference of ACE I/D gene distribution between SRNS and SSNS. There was no a markedly association between D allele or DD genotype and SRNS susceptibility or SSNS risk, and the gene distribution differences of ACE between SRNS and SSNS were not statistically significant. II genotype might play a positive role against SRNS onset but not for SSNS (OR = 0.51, P = 0.02; OR = 0.95, P = 0.85; respectively), however, the result for the association of II genotype with SRNS risk was not stable. Conclusions/Significance Our results indicate that D allele or DD homozygous can't become a significant genetic molecular marker to predict the treatment response to steroid in Asian children with INS. PMID:21611163
Energy Technology Data Exchange (ETDEWEB)
Gosnell, Thomas B. [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States); Chavez, Joseph R. [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States); Rowland, Mark S. [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States); Wong, James L. [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States)
2014-02-26
RadID is a new gamma-ray spectrum analysis program for rapid screening of HPGe gamma-ray data to reveal the presence of radionuclide signatures. It is an autonomous, rule-based heuristic system that can identify well over 200 radioactive sources with particular interest in uranium and plutonium characteristics. It executes in about one second. RadID does not require knowledge of the detector efficiency, the source-to-detector distance, or the geometry of the inspected radiation source—including any shielding. In this first of a three-document series we sketch the RadID program’s origin, its minimal requirements, the user experience, and the program operation.
Schwartz, R H; Farrow, J A; Banks, B; Giesel, A E
1998-01-01
Altered motor vehicle drivers's licenses or other falsified or counterfeit photo identification cards are widely and illegally used by teenagers to obtain beer and other alcohol beverages. We obtained information on the methods currently used by teenagers to purchase beer and wine by asking nine hundred teenagers, between 16-19 years old to complete a brief, confidential questionnaire. High school students most often obtained alcoholic beverages by requesting someone of legal age to purchase it for them. College students used borrowed, altered, or counterfeit identification (ID) more often than high school students. Photo IDs purchased through mail order from a magazine advertisement were used infrequently and when use was attempted, they were sometimes (25%) unsuccessful. Fifteen percent of high school students, 14% of college freshmen, and 24% of teenage drug abusers were able to purchase beer by the case with borrowed, altered, or fake ID. Suggestions to reduce sales of alcohol-containing beverages to minors include universal "carding" of prospective purchasers, use of two view or hologram photos on a drivers' license, requiring three different ID cards at the point of purchase, and penalties to stores that fail to make a good effort to identify underage customers.
2012-09-11
... DEPARTMENT OF COMMERCE Foreign-Trade Zones Board [B-68-2012] Foreign-Trade Zone 242--Boundary County, ID; Application for Subzone AREVA Enrichment Services, LLC; Bonneville County, ID An application... FTZ 242, requesting special-purpose subzone status for the facility of AREVA Enrichment Services, LLC...
ASSOCIATION OF ACTN3 R577X AND ACE I/D POLYMORPHISMS IN BRAZILIANS WRESTLERS
Directory of Open Access Journals (Sweden)
Marcelo Romanovitch Ribas
Full Text Available ABSTRACT Introduction: By associating genetics and sport, it is possible to identify subjects with greater capacity to adapt to training, and lower chances of injury. Objective: The investigation evaluated the genotypic and allelic distribution of ACTN3 R577X and ACE I/D polymorphisms in Brazilian high-performance athletes in wrestling and percussion combat sports. Methods: The study included 37 male athletes ranked from first to third place in world scenarios, divided into two groups: wrestling (23 wrestlers, being 11 of Judo, 4 of Greco-Roman style, 8 of Brazilian Jiu Jitsu, with mean age of 27.3 ± 6.9 years and percussion combat sports (14 athletes with a mean age of 25.7±4.4 years, being 6 of Karate, 3 of Muay Thai, 4 of Taekwondo, 1 Boxing. Genotyping of ACTN3 and ACE I/D polymorphisms was performed by polymerase chain reaction (PCR from the genomic DNA. Genotypic and allelic distributions were compared with control populations and athletes by Chi-square test and Fisher’s exact test; all analyzes considered p ≤ 0.05. Results: The genotypic distributions and allelic frequencies of ACTN3 RR=46%, RX=38% and XX=16%; R=65% and X=35%, and ACE I/D DD=47.7%, ID=34.3% and II=20%; D=62.9% and I=37.1% did not differ from the control population; however, when compared with wrestling athletes a significant difference was observed. Conclusion: These results suggest an association of ACTN3 R577X and ACE I/D genes with Brazilian high-performance wrestling athletes.
On Eddy current examination (ECE) of Incoloy 800 SG tube using OD encircling and ID bobbin coil
International Nuclear Information System (INIS)
Kapoor, K.; Sunder Krishna, K.; Bakshu, S.A.
2015-01-01
The purpose of this paper is to present and compare the results of ECE carried out on steam generator tubes from OD side and ID side. During the manufacturing of the tubes Eddy current testing is being carried out using OD encircling probe as per ASTM E 571. Here the purpose of the test is to capture the manufacturing defects. The parameters of the test are optimized to achieve best sensitivity to this requirement. These tubes are then installed in the steam generator and once again ECE is carried out during installation (pre-service inspection-PSI) and during in-service inspection (ISI) by using ID bobbin coil. These tests are carried out as per ASME section V article 8 appendix 1. Here the purpose of the test is to detect wall thinning, dent, pits etc due to operation and to locate these defects (OD side or ID side). Here the operating parameters are optimized for phase separation of defects from OD and ID. These parameters are quite different from those used during the manufacturing ECE. Interpretation of the signals detected in PSI/ISI in must be done with care to correlate with defect indications detected during manufacturing. In the present study, tubes with certain manufacturing defects, detected with OD encircling test were subjected to ID bobbin coil examination. Also certain tubes with signal picked up during test from ID were examined by using the OD encircling probe. This comparison of the results provides a clear picture about the sensitivity and deficiency of the either type of test. (author)
Causes of Mortality in Older People with Intellectual Disability: Results from the HA-ID Study
Oppewal, Alyt; Schoufour, Josje D.; van der Maarl, Hanne J. K.; Evenhuis, Heleen M.; Hilgenkamp, Thessa I. M.; Festen, Dederieke A.
2018-01-01
We aim to provide insight into the cause-specific mortality of older adults with intellectual disability (ID), with and without Down syndrome (DS), and compare this to the general population. Immediate and primary cause of death were collected through medical files of 1,050 older adults with ID, 5 years after the start of the Healthy Ageing and…
The Mathematica package TopoID and its application to the Higgs boson production cross section
Energy Technology Data Exchange (ETDEWEB)
Hoff, Jens
2016-07-15
We present the Mathematica package TopoID which aims at the automation of several steps in multiloop calculations. The algorithm which lies at the very core of the package is described and illustrated with an example. The main features of TopoID are stated and some of them are briefly demonstrated for NLO or NNLO Higgs boson production.
22 CFR 146.425 - Counseling and use of appraisal and counseling materials.
2010-04-01
... 22 Foreign Relations 1 2010-04-01 2010-04-01 false Counseling and use of appraisal and counseling... Discrimination on the Basis of Sex in Education Programs or Activities Prohibited § 146.425 Counseling and use of appraisal and counseling materials. (a) Counseling. A recipient shall not discriminate against any person on...
Energy Technology Data Exchange (ETDEWEB)
Castro, R., E-mail: rodrigo.castro@visite.es [Asociacion EURATOM/CIEMAT para Fusion, Madrid (Spain); Barbato, P. [Consorzio RFX, Euratom ENEA Association, Corso Stati Uniti 4, 35127 Padova (Italy); Vega, J. [Asociacion EURATOM/CIEMAT para Fusion, Madrid (Spain); Taliercio, C. [Consorzio RFX, Euratom ENEA Association, Corso Stati Uniti 4, 35127 Padova (Italy)
2011-10-15
Remote participation facilities among fusion laboratories require access control solutions with two main objectives: to preserve the usability of the systems and to guaranty the required level of security for accessing to shared services. On one hand, this security solution has to be: single-sign-on, transparent for users, compatible with user mobility, and compatible with used client applications. On the other hand, it has to be compatible with shared services and resources among organisations, providing in each case the required access security level. EFDA-Federation is a security infrastructure that integrates a set of fusion laboratories and enables to share resources and services fulfilling the requirements previously described. In EFDA community, JET and RFX have security access policies to some of their services that require strong authentication mechanisms. In both cases, strong authentication is based on RSA SecurID tokens. This is a hardware device that is supplied to and generates a new password every minute. The job presents two main results. The first one is the integration of RSA SecurID into EFDA-Federation. Thanks to it, federated organisations are able to offer SecurID to their users as an alternative strong authentication mechanism, with the corresponding increase of security level. The second result is the development of a new access control mechanism based on port knocking techniques and its integration into EFDA-Federation. Additionally, a real application in RFX is presented and includes the integration of its SecurID infrastructure as federated authentication mechanism, and the application of the new access control mechanism to its MDSplus server.
International Nuclear Information System (INIS)
Castro, R.; Barbato, P.; Vega, J.; Taliercio, C.
2011-01-01
Remote participation facilities among fusion laboratories require access control solutions with two main objectives: to preserve the usability of the systems and to guaranty the required level of security for accessing to shared services. On one hand, this security solution has to be: single-sign-on, transparent for users, compatible with user mobility, and compatible with used client applications. On the other hand, it has to be compatible with shared services and resources among organisations, providing in each case the required access security level. EFDA-Federation is a security infrastructure that integrates a set of fusion laboratories and enables to share resources and services fulfilling the requirements previously described. In EFDA community, JET and RFX have security access policies to some of their services that require strong authentication mechanisms. In both cases, strong authentication is based on RSA SecurID tokens. This is a hardware device that is supplied to and generates a new password every minute. The job presents two main results. The first one is the integration of RSA SecurID into EFDA-Federation. Thanks to it, federated organisations are able to offer SecurID to their users as an alternative strong authentication mechanism, with the corresponding increase of security level. The second result is the development of a new access control mechanism based on port knocking techniques and its integration into EFDA-Federation. Additionally, a real application in RFX is presented and includes the integration of its SecurID infrastructure as federated authentication mechanism, and the application of the new access control mechanism to its MDSplus server.
2013-01-01
Background The use of microorganisms in the synthesis of nanoparticles emerges as an eco-friendly and exciting approach, for production of nanoparticles due to its low energy requirement, environmental compatibility, reduced costs of manufacture, scalability, and nanoparticle stabilization compared with the chemical synthesis. Results The production of gold nanoparticles by the thermophilic bacterium Geobacillus sp. strain ID17 is reported in this study. Cells exposed to Au3+ turned from colourless into an intense purple colour. This change of colour indicates the accumulation of intracellular gold nanoparticles. Elemental analysis of particles composition was verified using TEM and EDX analysis. The intracellular localization and particles size were verified by TEM showing two different types of particles of predominant quasi-hexagonal shape with size ranging from 5–50 nm. The mayority of them were between 10‒20 nm in size. FT-IR was utilized to characterize the chemical surface of gold nanoparticles. This assay supports the idea of a protein type of compound on the surface of biosynthesized gold nanoparticles. Reductase activity involved in the synthesis of gold nanoparticles has been previously reported to be present in others microorganisms. This reduction using NADH as substrate was tested in ID17. Crude extracts of the microorganism could catalyze the NADH-dependent Au3+ reduction. Conclusions Our results strongly suggest that the biosynthesis of gold nanoparticles by ID17 is mediated by enzymes and NADH as a cofactor for this biological transformation. PMID:23919572
Design of Distortion-Invariant Optical ID Tags for Remote Identification and Verification of Objects
Pérez-Cabré, Elisabet; Millán, María Sagrario; Javidi, Bahram
Optical identification (ID) tags [1] have a promising future in a number of applications such as the surveillance of vehicles in transportation, control of restricted areas for homeland security, item tracking on conveyor belts or other industrial environment, etc. More specifically, passive optical ID tag [1] was introduced as an optical code containing a signature (that is, a characteristic image or other relevant information of the object), which permits its real-time remote detection and identification. Since their introduction in the literature [1], some contributions have been proposed to increase their usefulness and robustness. To increase security and avoid counterfeiting, the signature was introduced in the optical code as an encrypted function [2-5] following the double-phase encryption technique [6]. Moreover, the design of the optical ID tag was done in such a way that tolerance to variations in scale and rotation was achieved [2-5]. To do that, the encrypted information was multiplexed and distributed in the optical code following an appropriate topology. Further studies were carried out to analyze the influence of different sources of noise. In some proposals [5, 7], the designed ID tag consists of two optical codes where the complex-valued encrypted signature was separately introduced in two real-valued functions according to its magnitude and phase distributions. This solution was introduced to overcome some difficulties in the readout of complex values in outdoors environments. Recently, the fully phase encryption technique [8] has been proposed to increase noise robustness of the authentication system.
Gayibova, Ülkü; Dalyan Cılo, Burcu; Ağca, Harun; Ener, Beyza
2014-07-01
Opportunistic fungal pathogens are one of the important causes of nosocomial infections, and several different types of yeasts, especially Candida species are increasingly recovered from immunocompromised patients. Since many of the yeasts are resistant to the commonly used antifungal agents, the introduction of appropriate therapy depends on rapid and accurate identification. The aims of this study were to compare the commercial identification systems namely API® ID 32C (bioMerieux, France) and Phoenix™ Yeast ID Panel (Becton Dickinson Diagnostics, USA) for the identification of Candida species and to evaluate the effect of morphological findings in the identification process. A total of 211 yeast strains isolated from different clinical samples (111 urine, 34 blood/vascular catheter, 27 upper/lower respiratory tract, 16 abscess/pus, 13 throat/vagina swabs and 10 sterile body fluids) of 137 patients hospitalized in Uludag University Health and Research Center between October 2013 to January 2014, were included in the study. Samples were cultured on blood agar, chromogenic agar (CHROMagar Candida, BD, USA) and Saboraud's dextrose agar (SDA), and isolated yeast colonies were evaluated with germ tube test and morphological examination by microscopy on cornmeal/Tween-80 agar. The isolates were identified as well by two commercial systems according to the manufacturers' recommendations. Discrepant results between the systems were tried to be resolved by using morphological characteristics of the yeasts. Of the isolates 159 were identified identical by both of the systems, and the concordance between those systems were estimated as 75.4%. According to the concordant identification, the most frequently isolated species was C.albicans (44.1%) followed by C.tropicalis (9.9%), C.glabrata (9.5%), C.parapsilosis (8.5%) and C.kefyr (8.1%). The concordance rate was 81.7% in identification of frequently isolated species (C.albicans, C.tropicalis, C.parapsilosis, C.glabrata, C
The N=82 gap in /sup 146/Gd from beta -decay studies of Tb isotopes
Styczen, J; Kleinheinz, P; Piiparinen, M
1981-01-01
The beta -decay study of 23 s /sup 146/Tb suggests a ( pi h/sub 11/2/ nu d/sup -1//sub 3/2/) 5/sup -/ configuration for this activity. In its decay the authors have identified a pi h/sub 11/2/ to nu h/sub 9/2 / GT decay branch which populates neutron particle-hole states in /sup 146/Gd. Hence the N=82 single particle energy gap is less than 4 MeV. Neutron one-particle two-hole and two-particle one-hole states in /sup 145/Gd and /sup 147/Gd were identified in the beta -decays of 29 s /sup 145/Tb and 1.6 h /sup 147/Tb. (11 refs).
Angiotensin-converting enzyme gene I/D polymorphism in Pakistani ...
African Journals Online (AJOL)
The frequency of DD allele in SLE patients with lupus nephritis is 100%, Sjogren's syndrome 100%, Raynaud's phenomenon 88.88%, and with rheumatoid arthritis it is 78.94%. The frequency of ID allele in SLE patients with Raynaud's phenomenon is 5.55%, and with rheumatoid arthritis it is 10.52%. The frequency of II ...
Migraine headaches among university students using id migraine test as a screening tool
Directory of Open Access Journals (Sweden)
Caylan Ayse
2011-08-01
Full Text Available Abstract Background Migraine is a significant health problem, especially for the young people, due to its frequency and accompanying morbidity, causing disability and loss of performance. In this study, our aim was to determine the prevalence of migraine headaches among university students in Edirne, a Turkish city. Methods In this cross-sectional and descriptive study, study population was composed of students registered to Trakya University in the academic year of 2008-2009. Out of these, 3694 of them accepted to participate. Participants who had two or more headaches in the last 3 months formed the headache group. Afterwards, two preliminary questions were applied to the headache group and participants with at least one affirmative response were asked to perform the validated ID-Migraine™ test. Results The mean age of 3694 students participated in the study was 19.23 ± 1.84 (17-39 years, with adolescents:adult ratio being 2.5:1. 1613 students (43.7% did have at least two headaches in the last three months. Migraine-type headache was detected in 266 subjects (7.2% based on the ID-Migraine™ test. Of the migraine group, 72 were male (27.1% and 194 were female (72.9%. There was no significant difference in migraine prevalence between adolescent and adult age groups. Conclusions With a prevalence similar to adults, primary care physicians should be aware of the probability of migraine headaches in university students in order to maintain a successful school performance.
Le point de vue de la philosophie: L'entreprise idéologique
Pesqueux , Yvon
2004-01-01
Parler de l'entreprise conduit à questionner ce qui fonde le discours – scientifique ou médiatique – qui permette d'en parler. Et c'est bien en cela qu'il est nécessaire d'approfondir l'univers de l'idéologie et de la croyance qui est celui dans lequel modèle, image, métaphore et figure de l'entreprise plongent leurs racines dans la mesure où l'usage de ces notions, quand on les applique à l'entreprise, conduit à créer un monde qui soit cohérent avec ce qu'ils portent en eux. L'idéologie comm...
DEFF Research Database (Denmark)
Tetens, Inge
claims in relation to very low calorie diets (VLCDs) and reduction in body weight, reduction in the sense of hunger, reduction in body fat mass while maintaining lean body mass, reduction of post-prandial glycaemic responses, and maintenance of normal blood lipid profile. The scientific substantiation...... that whereas the diet that is the subject of the claim, very low calorie diet, is sufficiently characterised in relation to the following claimed effects: reduction in body weight (ID 1410), reduction in the sense of hunger (ID 1411), and reduction in body fat mass while maintaining lean body mass (ID 1412...... that formula foods for use in very low calorie diets should contain. The Panel concludes that a cause and effect relationship cannot be established between the consumption of a very low calorie diet and reduction of post-prandial glycaemic responses (ID 1414) and maintenance of normal blood lipid profile (ID...
Directory of Open Access Journals (Sweden)
Thais Fernanda de Almeida Galatro
Full Text Available Inhibitor of DNA Binding 4 (ID4 is a member of the helix-loop-helix ID family of transcription factors, mostly present in the central nervous system during embryonic development, that has been associated with TP53 mutation and activation of SOX2. Along with other transcription factors, ID4 has been implicated in the tumorigenic process of astrocytomas, contributing to cell dedifferentiation, proliferation and chemoresistance. In this study, we aimed to characterize the ID4 expression pattern in human diffusely infiltrative astrocytomas of World Health Organization (WHO grades II to IV of malignancy (AGII-AGIV; to correlate its expression level to that of SOX2, SOX4, OCT-4 and NANOG, along with TP53 mutational status; and to correlate the results with the clinical end-point of overall survival among glioblastoma patients. Quantitative real time PCR (qRT-PCR was performed in 130 samples of astrocytomas for relative expression, showing up-regulation of all transcription factors in tumor cases. Positive correlation was found when comparing ID4 relative expression of infiltrative astrocytomas with SOX2 (r = 0.50; p<0.005, SOX4 (r = 0.43; p<0.005 and OCT-4 (r = 0.39; p<0.05. The results from TP53 coding exon analysis allowed comparisons between wild-type and mutated status only in AGII cases, demonstrating significantly higher levels of ID4, SOX2 and SOX4 in mutated cases (p<0.05. This pattern was maintained in secondary GBM and further confirmed by immunohistochemistry, suggesting a role for ID4, SOX2 and SOX4 in early astrocytoma tumorigenesis. Combined hyperexpression of ID4, SOX4 and OCT-4 conferred a much lower (6 months median survival than did hypoexpression (18 months. Because both ID4 alone and a complex of SOX4 and OCT-4 activate SOX2 transcription, it is possible that multiple activation of SOX2 impair the prognosis of GBM patients. These observational results of associated expression of ID4 with SOX4 and OCT-4 may be used as a
DEFF Research Database (Denmark)
Pinto, V V; Salanti, A; Joergensen, L M
2012-01-01
720, Alhydrogel(®) and CAF01. Antibodies induced against DBL4¿-ID4 in combination with these adjuvants inhibited parasite binding to CSA from 82% to 99%. Although, different epitope recognition patterns were obtained for the different formulations, all adjuvant combinations induced strong Th1 and Th2......¿-ID4 to induce binding-inhibitory antibodies when formulated with adjuvants approved for human use. We have characterized the immune response of DBL4¿-ID4 in combination with Freund's complete and incomplete adjuvant and with three adjuvants currently being used in clinical trials: Montanide(®) ISA...... type responses, resulting in IgG with similar binding strength, with to the DBL4¿-ID4 antigen. These results demonstrate that the DBL4¿-ID4 antigen is highly immunogenic and that binding inhibitory antibodies are induced when formulated with any of the tested adjuvants....
Moreira, Jacqueline de Oliveira
2008-11-01
Theoretical, psychoanalytical constructs referring to the unconscious, the superego, and id, enjoy an autonomy within the I. As such, this study contemplates the discussion of these foreign entities that inhabit the interior of the I, producing an effect of foreignness. In the first section, I will develop a reflection on the state of foreignness of the unconscious. I will begin with an analogy used by Freud, which addresses the thesis of universality of consciousness with the psychoanalytical thesis of the subconscience within the I. Affirmation of consciousness in the other may be used analogously for affirm the idea of another inhabiting our own being. I shall continue, seeking to understand how the process of unconscious repression produces the effect of foreignness. The idea of a moral censor present in the entity of the superego constitutes the theme of the second section. The superego follows the principle of otherness in its constitution and in its effects on the I. Finally, a reflection on the dimension of otherness in the Id seems urgent to me, as with this concept, Freud radicalized in the idea of the foreign as the origin of the subject.
Student ID Cards: What You Should Know About Them
Hoffman, Jonathan; McGuire, Agnes C.
1973-01-01
Discusses the usefulness of photo ID cards for school security purposes, library control, student activities, and bus transportation control. Examines ways in which card costs can be reduced and the pros and cons of producing the cards at the school or of letting the work out. Problems involving card abuse and student rights are also considered.…
12 CFR 563.146 - Will the OTS permit my capital distribution?
2010-01-01
... under 12 U.S.C. 1831o(d)(1)(B). (b) Your proposed capital distribution raises safety or soundness... 12 Banks and Banking 5 2010-01-01 2010-01-01 false Will the OTS permit my capital distribution... SAVINGS ASSOCIATIONS-OPERATIONS Capital Distributions § 563.146 Will the OTS permit my capital...
The Id, Ego and Super-Ego in "Pride and Prejudice"
Liang, Yamin
2011-01-01
This paper mainly analyses the the id, ego, and super-ego which exists in the main character Elizabeth from several aspects, such as her pursuit for love, her prejudice towards Mr. Darcy, and the changes in her attitudes towards Wickham. This analysis helps readers appreciate this masterpiece from a different aspect which is related to the…
Predicting Students’ Performance using Modified ID3 Algorithm
Ramanathan L; Saksham Dhanda; Suresh Kumar D
2013-01-01
The ability to predict performance of students is very crucial in our present education system. We can use data mining concepts for this purpose. ID3 algorithm is one of the famous algorithms present today to generate decision trees. But this algorithm has a shortcoming that it is inclined to attributes with many values. So , this research aims to overcome this shortcoming of the algorithm by using gain ratio(instead of information gain) as well as by giving weights to each attribute at every...
RFID and Auto-ID in planning and logistics
Jones, Erick C
2011-01-01
As RFID technology is becoming increasingly popular, the need has arisen to address the challenges and approaches to successful implementation. RFID and Auto-ID in Planning and Logistics: A Practical Guide for Military UID Applications presents the concepts for students, military personnel and contractors, and corporate managers to learn about RFID and other automatic information capture technologies, and their integration into planning and logistics functions. The text includes comparisons of RFID with technologies such as bar codes, satellite tags, and global positioning systems and provides
Self-Reporting Tool On Pain in People with Intellectual Disabilities (STOP-ID!): A Usability Study
de Knegt, N.C.; Lobbezoo, F.; Schuengel, C.; Evenhuis, H.M.; Scherder, E.J.A.
2016-01-01
The use of the Self-reporting Tool On Pain in people with Intellectual Disabilities (STOP-ID!), an online application developed by the authors to aid in the self-reporting of pain, was evaluated in 40 adults with Down syndrome. Comprehension of the use of the tool (the ability to recognize
76 FR 43196 - Implementation of the Truth in Caller ID Act
2011-07-20
... National Network to End Domestic Violence (NNEDV) that the term ``harm'' is a broad concept that... evolution of technology, and the consequences of spoofing ANI and pseudo-ANI, we find that the delivery of... ID spoofing to protect victims of domestic violence. According to NNEDV, a verification requirement...
Underground Storage Tank Integrated Demonstration (UST-ID)
International Nuclear Information System (INIS)
1994-02-01
The DOE complex currently has 332 underground storage tanks (USTs) that have been used to process and store radioactive and chemical mixed waste generated from weapon materials production. Very little of the over 100 million gallons of high-level and low-level radioactive liquid waste has been treated and disposed of in final form. Two waste storage tank design types are prevalent across the DOE complex: single-shell wall and double-shell wall designs. They are made of stainless steel, concrete, and concrete with carbon steel liners, and their capacities vary from 5000 gallons (19 m 3 ) to 10 6 gallons (3785 m 3 ). The tanks have an overburden layer of soil ranging from a few feet to tens of feet. Responding to the need for remediation of tank waste, driven by Federal Facility Compliance Agreements (FFCAs) at all participating sites, the Underground Storage Tank Integrated Demonstration (UST-ID) Program was created by the US DOE Office of Technology Development in February 1991. Its mission is to focus the development, testing, and evaluation of remediation technologies within a system architecture to characterize, retrieve, treat to concentrate, and dispose of radioactive waste stored in USTs at DOE facilities. The ultimate goal is to provide safe and cost-effective solutions that are acceptable to the public and the regulators. The UST-ID has focused on five DOE locations: the Hanford Site, which is the host site, in Richland, Washington; the Fernald Site in Fernald, Ohio; the Idaho National Engineering Laboratory near Idaho Falls, Idaho; the Oak Ridge Reservation in Oak Ridge, Tennessee, and the Savannah River Site in Savannah River, South Carolina
TR146 cells grown on filters as a model of human buccal epithelium
DEFF Research Database (Denmark)
Nielsen, Hanne Mørck; Verhoef, J C; Ponec, M
1999-01-01
The aim of the present study was to characterize the TR146 cell culture model as an in vitro model of human buccal epithelium with respect to the permeability of test substances with different molecular weights (M(w)). For this purpose, the apparent permeability (P(app)) values for mannitol...... and for fluorescein isothiocyanate (FITC)-labelled dextrans (FD) with various M(w) (4000-40000) were compared to the P(app) values obtained using porcine buccal mucosa as an in vitro model of the human buccal epithelium. The effect of 10 mM sodium glycocholate (GC) on the P(app) values was examined. To identify...
ORCID Integration: Services to Create and Use ORCID IDs at KAUST
Grenz, Daryl M.
2015-06-09
As ORCID IDs become accepted as a global standard, the potential benefits to researchers and institutions of making use of them are multiplying. At King Abdullah University of Science and Technology (KAUST) we adopted the first institutional open access policy in the Arab region in June 2014 and are integrating with ORCID as part of services to researchers that improve the preservation and dissemination of their research. We started by using ORCID IDs to identify authors in our institutional repository. Our next step was to join ORCID as an institutional member and then set up a plan to support our faculty, researchers and students in the creation and use of ORCID identifiers. This presentation will look at the choices made and lessons learned during this process, focusing on the tools we developed to interact with the ORCID member API and the ways in which introducing ORCID has complemented other repository initiatives, such as the implementation of our institutional open access policy.
77 FR 55813 - Transition of DOE-ID Public Reading Room
2012-09-11
... to the INL Research Library at 1776 Science Center Drive, Idaho Falls, ID 83401, beginning September 1, 2012. Access to documents will also be electronically accessible through the World Wide Web. For direction in accessing documents electronically through the World Wide Web, please refer to the Idaho...
Ahuja, Suchit; Dogra, Deepika; Stainier, Didier Y R; Reischauer, Sven
2016-04-01
The atrioventricular canal (AVC) connects the atrial and ventricular chambers of the heart and its formation is critical for the development of the cardiac valves, chamber septation and formation of the cardiac conduction system. Consequently, problems in AVC formation can lead to congenital defects ranging from cardiac arrhythmia to incomplete cardiac septation. While our knowledge about early heart tube formation is relatively comprehensive, much remains to be investigated about the genes that regulate AVC formation. Here we identify a new role for the basic helix-loop-helix factor Id4 in zebrafish AVC valve development and function. id4 is first expressed in the AVC endocardium and later becomes more highly expressed in the atrial chamber. TALEN induced inactivation of id4 causes retrograde blood flow at the AV canal under heat induced stress conditions, indicating defects in AV valve function. At the molecular level, we found that id4 inactivation causes misexpression of several genes important for AVC and AV valve formation including bmp4 and spp1. We further show that id4 appears to control the number of endocardial cells that contribute to the AV valves by regulating Wnt signaling in the developing AVC endocardium. Copyright © 2016 Elsevier Inc. All rights reserved.
Heat transfer through He II in a 9.6 m long 35 mm ID tube
International Nuclear Information System (INIS)
Caspi, S.; Schafer, R.V.
1984-07-01
The limiting heat flux at the onset of He I was measured in a 9.6 m long tube of 35 mm ID at a bath temperature between 1.8 K and T/sub lambda/ and a pressure of 1 atm. The measured limiting heat flux during axial heating is 50% more than end heating at the same bath temperature. Both cases agrees with the Gorter-Mellink mutual friction theory
2010-04-01
... subsidiary, affiliate, or joint venture have on financial accountability to HUD and the Federal government... URBAN DEVELOPMENT PUBLIC HOUSING AGENCY CONSORTIA AND JOINT VENTURES Subsidiaries, Affiliates, Joint Ventures in Public Housing § 943.146 What impact does the use of a subsidiary, affiliate, or joint venture...
Directory of Open Access Journals (Sweden)
Sinem Nalbantoglu
2013-01-01
Full Text Available Henoch-Schönlein purpura (HSP is a small-vessel vasculitis of autoimmune hypersensitivity, and renin-angiotensin system (RAS regulates vascular homeostasis and inflammation with activation of cytokine release. Thus, we aimed to investigate the association between HSP and ACE I/D and AGT M235T polymorphisms. Genotyping was determined by allele specific PCR and PCR-RFLP. We obtained a significant difference in genotype distribution (p = 0.003 and allele frequencies (p 0.05 and allele frequencies (p > 0.05 of the AGT M235T polymorphism. Risk assessment showed significant risk for HSP in the subjects both with the ID + DD genotype (p = 0.019, OR: 2.288, 95% CI: 1.136–4.609 and D allele (OR: D vs. I: 2.0528, 95% CI: 1.3632–3.0912, p = 0.001 while no significant risk was obtained for HSP in the subjects both with the MT + TT genotype (p = 0.312, OR: 1.3905, 95% CI: 0.7326–2.6391 and T allele (OR: T vs. M: 1.065, 95% CI: 0.729–1.557, p = 0.743. Furthermore, when patients were stratified by the presence of certain systemic complications of HSP, no significant association was detected with ACE I/D, and AGT M235T polymorphisms. Our findings suggest that ACE I/D polymorphism is significantly associated with HSP susceptibility.
Oeseburg, B.; Jansen, D. E. M. C.; Reijneveld, S. A.; Dijkstra, G. J.; Groothoff, J. W.
2010-01-01
Evidence on teachers' knowledge about somatic and mental chronic diseases among ID-adolescent compared to the knowledge parents and healthcare professionals have, is limited. The aim of this study is: (1) to assess the knowledge of teachers on the presence of chronic diseases in ID-adolescents; (2)
Comparison of the optimized conditions for genotyping of ACE ID ...
African Journals Online (AJOL)
ACE ID polymorphism is inevitable for genetic epidemiology of several cardiovascular and non cardiovascular diseases due to its direct influence on ACE activity level. In the present work, conditions were optimized for its analysis using conventional and direct blood PCR (DB PCR). Blood samples from nine normotensive ...
Directory of Open Access Journals (Sweden)
Ankita Das
Full Text Available Cranial neural crest cells (CNCCs have the remarkable capacity to generate both the non-ectomesenchyme derivatives of the peripheral nervous system and the ectomesenchyme precursors of the vertebrate head skeleton, yet how these divergent lineages are specified is not well understood. Whereas studies in mouse have indicated that the Twist1 transcription factor is important for ectomesenchyme development, its role and regulation during CNCC lineage decisions have remained unclear. Here we show that two Twist1 genes play an essential role in promoting ectomesenchyme at the expense of non-ectomesenchyme gene expression in zebrafish. Twist1 does so by promoting Fgf signaling, as well as potentially directly activating fli1a expression through a conserved ectomesenchyme-specific enhancer. We also show that Id2a restricts Twist1 activity to the ectomesenchyme lineage, with Bmp activity preferentially inducing id2a expression in non-ectomesenchyme precursors. We therefore propose that the ventral migration of CNCCs away from a source of Bmps in the dorsal ectoderm promotes ectomesenchyme development by relieving Id2a-dependent repression of Twist1 function. Together our model shows how the integration of Bmp inhibition at its origin and Fgf activation along its migratory route would confer temporal and spatial specificity to the generation of ectomesenchyme from the neural crest.
Automatic ID heat load generation in ANSYS code
International Nuclear Information System (INIS)
Wang, Zhibi.
1992-01-01
Detailed power density profiles are critical in the execution of a thermal analysis using a finite element (FE) code such as ANSYS. Unfortunately, as yet there is no easy way to directly input the precise power profiles into ANSYS. A straight-forward way to do this is to hand-calculate the power of each node or element and then type the data into the code. Every time a change is made to the FE model, the data must be recalculated and reentered. One way to solve this problem is to generate a set of discrete data, using another code such as PHOTON2, and curve-fit the data. Using curve-fitted formulae has several disadvantages. It is time consuming because of the need to run a second code for generation of the data, curve-fitting, and doing the data check, etc. Additionally, because there is no generality for different beamlines or different parameters, the above work must be repeated for each case. And, errors in the power profiles due to curve-fitting result in errors in the analysis. To solve the problem once and for all and with the capability to apply to any insertion device (ID), a program for ED power profile was written in ANSYS Parametric Design Language (APDL). This program is implemented as an ANSYS command with input parameters of peak magnetic field, deflection parameter, length of ID, and distance from the source. Once the command is issued, all the heat load will be automatically generated by the code
24 CFR 146.1 - Purpose of the Age Discrimination Act of 1975.
2010-04-01
... ACTIVITIES RECEIVING FEDERAL FINANCIAL ASSISTANCE General § 146.1 Purpose of the Age Discrimination Act of... 24 Housing and Urban Development 1 2010-04-01 2010-04-01 false Purpose of the Age Discrimination... programs or activities receiving Federal financial assistance. The Act, however, permits federally assisted...
Directory of Open Access Journals (Sweden)
Mian-Yang Li
2015-01-01
Full Text Available Background: The diagnosis of myelodysplastic syndrome (MDS, especially hypoplastic MDS, and MDS with low blast counts or normal karyotype may be problematic. This study characterized ID4 gene methylation in patients with MDS and aplastic anemia (AA. Methods: The methylation status of ID4 was analyzed by bisulfite sequencing polymerase chain reaction (PCR and quantitative real-time methylation-specific PCR (MethyLight PCR in 100 patients with MDS and 31 patients with AA. Results: The MDS group had a higher ID4 gene methylation positivity rate (22.22% and higher methylation levels (0.21 [0-3.79] than the AA group (P < 0.05. Furthermore, there were significant differences between the hypoplastic MDS and AA groups, the MDS with low blast count and the AA groups, and the MDS with normal karyotype and the AA groups. The combination of genetic and epigenetic markers was used in much more patients with MDS (62.5% [35/56] than the use of genetic markers only (51.79% [29/56]. Conclusions: These results showed that the detection of ID4 methylation positivity rates and levels could be a useful biomarker for MDS diagnosis.
Shunmugam, Vicneswari; Say, Yee-How
2016-02-01
α-adrenergic receptor 2A (ADRA2A) and angiotensin-converting enzyme (ACE) genes have been variably associated with obesity and its related phenotypes in different populations worldwide. This cross-sectional study aims to investigate the association of adrenergic receptor α2A (ADRA2A) rs553668 and angiotensin-converting enzyme (ACE) I/D single nucleotide polymorphisms (SNPs) with obesity traits (body mass index-BMI; waist-hip ratio-WHR; total body fat percentage - TBF) in a Malaysian population. Demographic and clinical variables were initially collected from 230 subjects via convenience sampling among residents and workers in Setapak, Malaysia, but in the end only 214 multi-ethnic Malaysians (99 males; 45 Malays, 116 ethnic Chinese, and 53 ethnic Indians) were available for statistical analysis. Genotyping was performed by polymerase chain reaction using DNA extracted from mouthwash samples. The overall minor allele frequencies (MAFs) for ADRA2A rs553668 and ACE I/D were 0.55 and 0.56, respectively. Allele distribution of ACE I/D was significantly associated with ethnicity and WHR class. Logistic regression analysis showed that subjects with the ACE II genotype and I allele were, respectively, 2.15 and 1.55 times more likely to be centrally obese, but when adjusted for age and ethnicity, this association was abolished. Covariate analysis controlling for age, gender, and ethnicity also showed similar results, where subjects carrying the II genotype or I allele did not have significantly higher WHR. Combinatory genotype and allele analysis for ADRA2A rs553668 and ACE I/D showed that subjects with both ADRA2A rs553668 GG and ACE I/D II genotypes had significant lowest WHR compared to other genotype combinations. The ACE II genotype might be a protective factor against central adiposity risk among the Malaysian population when in combination with the ADRA2A rs553668 GG genotype.
Directory of Open Access Journals (Sweden)
Nishith Saurav Topno
2016-03-01
Full Text Available Inhibitor of DNA binding protein 3 (ID3 has long been characterized as an oncogene that implicates its functional role through its Helix–Loop–Helix (HLH domain upon protein–protein interaction. An insight into the dimerization brought by this domain helps in identifying the key residues that favor the mechanism behind it. Molecular dynamics (MD simulations were performed for the HLH proteins ID3 and Transcription factor E2-alpha (E2A/E12 and their ensemble complex (ID3-E2A/E12 to gather information about the HLH domain region and its role in the interaction process. Further evaluation of the results by Principal Component Analysis (PCA and Free Energy Landscape (FEL helped in revealing residues of E2A/E12: Lys570, Ala595, Val598, and Ile599 and ID3: Glu53, Gln63, and Gln66 buried in their HLH motifs imparting key roles in dimerization process. Furthermore the T-pad analysis results helped in identifying the key fluctuations and conformational transitions using the intrinsic properties of the residues present in the domain region of the proteins thus specifying their crucial role towards molecular recognition. The study provides an insight into the interacting mechanism of the ID3-E2A/E12 complex and maps the structural transitions arising in the essential conformational space indicating the key structural changes within the helical regions of the motif. It thereby describes how the internal dynamics of the proteins might regulate their intrinsic structural features and its subsequent functionality.
29 CFR 780.146 - Importance of relationship of the practice to farming generally.
2010-07-01
... to include typical factory workers or industrial operations, and the sponsors of the bill made it clear that the erection and operation on a farm by a farmer of a factory, even one using raw materials... in Conjunction Withâ the Farming Operations § 780.146 Importance of relationship of the practice to...
An ID-based Blind Signature Scheme from Bilinear Pairings
B.Umaprasada Rao; K.A.Ajmath
2010-01-01
Blind signatures, introduced by Chaum, allow a user to obtain a signature on a message without revealing any thing about the message to the signer. Blind signatures play on important role in plenty of applications such as e-voting, e-cash system where anonymity is of great concern. Identity based(ID-based) public key cryptography can be a good alternative for certified based public key setting, especially when efficient key management and moderate security are required. In this paper, we prop...
Lee, Jae-Chul; Kim, In Hye; Cho, Jeong Hwi; Lee, Tae-Kyeong; Park, Joon Ha; Ahn, Ji Hyeon; Shin, Bich Na; Yan, Bing Chun; Kim, Jong-Dai; Jeon, Yong Hwan; Lee, Young Joo; Won, Moo-Ho; Kang, Il Jun
2018-03-01
4-Hydroxy-3-methoxybenzaldehyde (vanillin), contained in a number of species of plant, has been reported to display beneficial effects against brain injuries. In the present study, the impact of vanillin on scopolamine‑induced alterations in cognition and the expression of DNA binding protein inhibitor ID‑1 (ID1), one of the inhibitors of DNA binding/differentiation proteins that regulate gene transcription, in the mouse hippocampus. Mice were treated with 1 mg/kg scopolamine with or without 40 mg/kg vanillin once daily for 4 weeks. Scopolamine‑induced cognitive impairment was observed from 1 week and was deemed to be severe 4 weeks following the administration of scopolamine. However, treatment with vanillin in scopolamine‑treated mice markedly attenuated cognitive impairment 4 weeks following treatment with scopolamine. ID1‑immunoreactive cells were revealed in the hippocampus of vehicle‑treated mice, and were hardly detected 4 weeks following treatment with scopolamine. However, treatment with vanillin in scopolamine‑treated mice markedly restored ID1‑immunoreactive cells and expression 4 weeks subsequent to treatment. The results of the present study suggested that vanillin may be beneficial for cognitive impairment, by preventing the reduction of ID1 expression which may be associated with cognitive impairment.
Lifescience Database Archive (English)
Full Text Available VF (Link to library) VFB788 (Link to dictyBase) - - - Contig-U14924-1 VFB788P (Link... to Original site) VFB788F 158 VFB788Z 768 VFB788P 926 - - Show VFB788 Library VF (Link to library) Clone ID VFB788 (Link to dict...yBase) Atlas ID - NBRP ID - dictyBase ID - Link to Contig Contig-U14924-1 Original site URL http://dict... (bits) Value N AC115592 |AC115592.2 Dictyostelium discoideum chromosome 2 map 1-...2_6( AC115592 |pid:none) Dictyostelium discoideum chromosom... 520 e-146 CU459003_2449( CU459003 |pid:none)
Directory of Open Access Journals (Sweden)
Xing He
2016-11-01
Full Text Available Schistosomiasis is a chronic disease caused by the parasite of the Schistosoma genus and is characterized by egg-induced hepatic granulomas and fibrosis. Macrophages play a central role in schistosomiasis with several studies highlighting their differentiation into M2 cells involved in the survival of infected mice through limitation of immunopathology. However, little is known regarding the mechanisms of regulating macrophage differentiation. Here, we showed that the early stage of infection by Schistosoma japonicum induced expression of type 1 T-helper-cell (Th1 cytokine, interferon-γ (IFN-γ, leading to increase in M1 cells. However, the presence of liver-trapped eggs induced the expression of Th2 cytokines including interleukin-4 (IL-4, IL-10, and IL-13 that upregulated the transcription of miR-146b by activating signal transducer and activator of transcription 3/6 (STAT3/6 that bind to the promoter of the pre-miR-146b gene. We found that the miR-146a/b was significantly upregulated in macrophages during the progression of hepatic schistosomiasis. The elevated miR-146a/b inhibited the IFN-γ-induced differentiation of macrophages to M1 cells through targeting STAT1. Our data indicate the protective roles of miR-146a/b in hepatic schistosomiasis through regulating the differentiation of macrophages into M2 cells.
Venugopal, Priyanka; Lavu, Vamsi; RangaRao, Suresh; Venkatesan, Vettriselvi
2017-04-01
Periodontitis is an inflammatory disease caused by bacterial triggering of the host immune-inflammatory response, which in turn is regulated by microRNAs (miRNA). Polymorphisms in the miRNA pathways affect the expression of several target genes such as tumor necrosis factor-α and interleukins, which are associated with progression of disease. The objective of this study was to identify the association between the MiR-146a single nucleotide polymorphisms (SNPs) (rs2910164, rs57095329, and rs73318382), the MiR-196a2 (rs11614913) SNP and chronic periodontitis. Genotyping was performed for the MiR-146a (rs2910164, rs57095329, and rs73318382) and the MiR-196a2 (rs11614913) polymorphisms in 180 healthy controls and 190 cases of chronic periodontitis by the direct Sanger sequencing technique. The strength of the association between the polymorphisms and chronic periodontitis was evaluated using logistic regression analysis. Haplotype and linkage analyses among the polymorphisms was performed. Multifactorial dimensionality reduction was performed to determine epistatic interaction among the polymorphisms. The MiR-196a2 polymorphism revealed a significant inverse association with chronic periodontitis. Haplotype analysis of MiR-146a and MiR-196a2 polymorphisms revealed 13 different combinations, of which 5 were found to have an inverse association with chronic periodontitis. The present study has demonstrated a significant inverse association of MiR-196a2 polymorphism with chronic periodontitis.
Study of intermittency of target fragments in the interactions of 28Si-Em collisions at 14.6 A GeV
International Nuclear Information System (INIS)
Ayaz Ahmad, M.; Ashraf T, M.; Ahmad, Shafiq
2008-01-01
An attempt has been made to investigate the intermittent behaviour and fractal properties of emission spectra of fast and slow target associated particles from 28 Si-emulsion interactions at 14.6 A GeV using nuclear emulsion in cosθ phase space
Iacomino, Giuseppe; Di Stasio, Luigia; Fierro, Olga; Picariello, Gianluca; Venezia, Antonella; Gazza, Laura; Ferranti, Pasquale; Mamone, Gianfranco
2016-12-01
A growing interest in developing new strategies for preventing coeliac disease has motivated efforts to identify cereals with null or reduced toxicity. In the current study, we investigate the biological effects of ID331 Triticum monococcum gliadin-derived peptides in human Caco-2 intestinal epithelial cells. Triticum aestivum gliadin derived peptides were employed as a positive control. The effects on epithelial permeability, zonulin release, viability, and cytoskeleton reorganization were investigated. Our findings confirmed that ID331 gliadin did not enhance permeability and did not induce zonulin release, cytotoxicity or cytoskeleton reorganization of Caco-2 cell monolayers. We also demonstrated that ID331 ω-gliadin and its derived peptide ω(105-123) exerted a protective action, mitigating the injury of Triticum aestivum gliadin on cell viability and cytoskeleton reorganization. These results may represent a new opportunity for the future development of innovative strategies to reduce gluten toxicity in the diet of patients with gluten intolerance. Copyright © 2016 Elsevier Ltd. All rights reserved.
DEFF Research Database (Denmark)
Lauritsen, Jens Peter Holst; Wong, Gladys W; Lee, Sang-Yun
2009-01-01
)-inhibitor of DNA binding 3 (Id3) pathway plays a defining role in this process. In particular, Id3 expression served to regulate adoption of the gammadelta fate. Moreover, Id3 was both necessary and sufficient to enable gammadelta-lineage cells to differentiate independently of Notch signaling and become competent...
Robust Fourier Watermarking for ID Images on Smart Card Plastic Supports
Directory of Open Access Journals (Sweden)
RIAD, R.
2016-11-01
Full Text Available Security checking can be improved by watermarking identity (ID images printed on smart cards plastic supports. The major challenge is resistance to attacks: printing the images on the plastic cards, durability and other attacks then scanning the image from the plastic card. In this work, a robust watermarking technique is presented in this context. It is composed of three main mechanisms. The first is a watermarking algorithm based on the Fourier transform to cope with global geometric distortions. The second comprises a filter that reduces image blurring. The third attenuates color degradations. Experiments on 400 ID images show that the Wiener filter strongly improves the detection rate and outperforms competitive algorithms (blind deconvolution and unsharp filter. Color corrections also enhance the watermarking score. The whole scheme has a high efficiency and a low computational cost. It makes it compatible with the desired industrial constraints, i.e. the watermark is to be invisible, the error rate must be lower than 1%, and the detection of the mark should be fast and simple for the user.
Directory of Open Access Journals (Sweden)
Kitsios Georgios
2009-06-01
Full Text Available Abstract Background The role of angiotensin-converting enzyme (ACE gene insertion/deletion (I/D polymorphism in modifying the response to treatment modalities in coronary artery disease is controversial. Methods PubMed was searched and a database of 58 studies with detailed information regarding ACE I/D polymorphism and response to treatment in coronary artery disease was created. Eligible studies were synthesized using meta-analysis methods, including cumulative meta-analysis. Heterogeneity and study quality issues were explored. Results Forty studies involved invasive treatments (coronary angioplasty or coronary artery by-pass grafting and 18 used conservative treatment options (including anti-hypertensive drugs, lipid lowering therapy and cardiac rehabilitation procedures. Clinical outcomes were investigated by 11 studies, while 47 studies focused on surrogate endpoints. The most studied outcome was the restenosis following coronary angioplasty (34 studies. Heterogeneity among studies (p ACE I/D polymorphism on the response to treatment for the rest outcomes (coronary events, endothelial dysfunction, left ventricular remodeling, progression/regression of atherosclerosis, individual studies showed significance; however, results were discrepant and inconsistent. Conclusion In view of available evidence, genetic testing of ACE I/D polymorphism prior to clinical decision making is not currently justified. The relation between ACE genetic variation and response to treatment in CAD remains an unresolved issue. The results of long-term and properly designed prospective studies hold the promise for pharmacogenetically tailored therapy in CAD.
Kim, Young Jin; Kim, Si Hyun; Park, Hyun-Jung; Park, Hae-Geun; Park, Dongchul; Song, Sae Am; Lee, Hee Joo; Yong, Dongeun; Choi, Jun Yong; Kook, Joong-Ki; Kim, Hye Ran; Shin, Jeong Hwan
2016-08-01
All 50 Clostridium difficile strains were definitely identified by Vitek2 system, Rapid ID 32A system, and MALDI-TOF. For 18 non-difficile Clostridium strains, the identification results were correct in 0, 2, and 17 strains by Vitek2, Rapid ID 32A, and MALDI-TOF, respectively. MALDI-TOF could be used as the primary tool for identification of Clostridium species. Copyright © 2016 Elsevier Ltd. All rights reserved.
MacKinnon, Neil; Somashekar, Bagganahalli S; Tripathi, Pratima; Ge, Wencheng; Rajendiran, Thekkelnaycke M; Chinnaiyan, Arul M; Ramamoorthy, Ayyalusamy
2013-01-01
Nuclear magnetic resonance based measurements of small molecule mixtures continues to be confronted with the challenge of spectral assignment. While multi-dimensional experiments are capable of addressing this challenge, the imposed time constraint becomes prohibitive, particularly with the large sample sets commonly encountered in metabolomic studies. Thus, one-dimensional spectral assignment is routinely performed, guided by two-dimensional experiments on a selected sample subset; however, a publicly available graphical interface for aiding in this process is currently unavailable. We have collected spectral information for 360 unique compounds from publicly available databases including chemical shift lists and authentic full resolution spectra, supplemented with spectral information for 25 compounds collected in-house at a proton NMR frequency of 900 MHz. This library serves as the basis for MetaboID, a Matlab-based user interface designed to aid in the one-dimensional spectral assignment process. The tools of MetaboID were built to guide resonance assignment in order of increasing confidence, starting from cursory compound searches based on chemical shift positions to analysis of authentic spike experiments. Together, these tools streamline the often repetitive task of spectral assignment. The overarching goal of the integrated toolbox of MetaboID is to centralize the one dimensional spectral assignment process, from providing access to large chemical shift libraries to providing a straightforward, intuitive means of spectral comparison. Such a toolbox is expected to be attractive to both experienced and new metabolomic researchers as well as general complex mixture analysts. Copyright © 2012 Elsevier Inc. All rights reserved.
Hall, James C; Jobson, Laura; Langdon, Peter E
2014-09-01
The aims of the study were to (1) revise the Impact of Event Scale-Revised for use with people with intellectual disabilities (IDs), creating the Impact of Event Scale-Intellectual Disabilities (IES-IDs), (2) assess the reliability of the IES-IDs, and (3) compare the IES-IDs to an existing measure trauma-related symptomatology, namely the Lancaster and Northgate Trauma Scale (LANTS), along with measures of anxiety and depression. Forty adults with IDs who had experienced at least one traumatic event were recruited and completed the IES-IDs and the LANTS on two occasions, separated by 2 weeks. Participants also completed the Glasgow Depression Scale and the Glasgow Anxiety Scale, along with the Trauma Information Form which was used to collect information about trauma history. Fifteen per cent of the sample had encountered five or more traumatic events. The IES-IDs and the LANTS had good to excellent internal consistency and test-retest reliability. Both measures correlated with self-report measures of depression and anxiety, although the strength of this correlation was greater with the LANTS. There was a significant positive correlation between trauma frequency and the IES-IDs, while trauma frequency did not correlate with the LANTS. Both the IES-IDs and the LANTS appear to have good reliability. There is a lack of well-developed questionnaires that can be used to assess symptoms of post-traumatic stress disorder (PTSD) in people with intellectual disabilities. The Impact of Event Scale-Revised was augmented creating the Impact of Event Scale-Intellectual Disabilities (IES-IDs). The IES-IDs was shown to have good psychometric properties. The IES-IDs was compared to the Lancaster and Northgate Trauma Scale (LANTS), but the LANTS did not correlate with trauma frequency. However, this study had a small sample size, and a much larger study is needed to examine the factor structure of both the IES-IDs and the LANTS. Future studies should attempt to recruit people with
Young, Vicky J; Ahmad, Syed F; Brown, Jeremy K; Duncan, W Colin; Horne, Andrew W
2016-09-01
Is inhibitor of DNA-binding protein 2 (ID2) a mediator of the transforming growth factor (TGF)-β1-induced Warburg-like effect seen in the peritoneum of women with endometriosis? The TGF-β1-induced changes in the metabolic phenotype of peritoneal mesothelial cells from women with endometriosis are mediated through the ID2 pathway. TGF-β1 induces the metabolic conversion of glucose to lactate via aerobic glycolysis (the 'Warburg effect') in the peritoneum of women with endometriosis, through increased expression of the transcription factor hypoxia inducible factor α (HIF-1α). ID proteins are transcriptional targets of TGF-β1. Expression of ID2 was investigated in luteal phase peritoneal biopsies from women with regular menstrual cycles, with and without endometriosis (n = 8-10 each group) by quantitative RT-PCR (qRT-PCR) and immunohistochemistry. ID2 mRNA expression in primary human peritoneal mesothelial cells (HPMC) and immortalized mesothelial cells (MeT-5A) was assessed by qRT-PCR (n = 6). The effects of TGF-β1 and ID2 siRNA on HIF-1α mRNA expression and lactate secretion was assessed using qRT-PCR and a colorimetric lactate assay. ID2 is localized to peritoneal mesothelial and stromal cells of women with and without endometriosis. ID2 mRNA expression is lower in peritoneum adjacent to the endometriosis lesions compared to distal sites (P endometriosis. None. This work was funded by a Wellbeing of Women research grant (R42533) awarded to A.W.H., J.K.B. and W.C.D.; and an MRC Centre Grant G1002033. V.J.Y. received grant support from Federation of Women Graduates (134225) and a PhD studentship from the College of Medicine and Veterinary Medicine at the University of Edinburgh. There are no competing interests to declare. © The Author 2016. Published by Oxford University Press on behalf of the European Society of Human Reproduction and Embryology. All rights reserved. For Permissions, please email: journals.permissions@oup.com.
Design and performance of the 2-ID-B scanning x-ray microscope
International Nuclear Information System (INIS)
McNulty, I.
1998-01-01
We have constructed a high resolution scanning x-ray microscope at the 2-ID-B beamline at the Advanced Photon Source for 1-4 keV x-ray imaging and microspectroscopy experiments. The microscope uses a Fresnel zone plate to focus coherent x-ray undulator radiation to a 150 nm focal spot on a sample. The spectral flux in the focus is 10 8 ph/s/0.1% BW. X-ray photons transmitted by the sample are detected by an avalanche photodiode as the sample is scanned to form an absorption image. The sample stage has both coarse and fine translation axes for raster scanning and a rotation axis for microtomography experiments. The incident x-ray beam energy can also be scanned via the 2-ID-B monochromator while the sample is kept in focus to record spatially resolved absorption spectra. We have measured the performance of the instrument with various test objects. The microscope hardware, software, and performance are discussed in this paper
James, Daylon; Nam, Hyung-song; Seandel, Marco; Nolan, Daniel; Janovitz, Tyler; Tomishima, Mark; Studer, Lorenz; Lee, Gabsang; Lyden, David; Benezra, Robert; Zaninovic, Nikica; Rosenwaks, Zev; Rabbany, Sina Y; Rafii, Shahin
2010-01-01
Previous efforts to differentiate human embryonic stem cells (hESCs) into endothelial cells have not achieved sustained expansion and stability of vascular cells. To define vasculogenic developmental pathways and enhance differentiation, we used an endothelial cell–specific VE-cadherin promoter driving green fluorescent protein (GFP) (hVPr-GFP) to screen for factors that promote vascular commitment. In phase 1 of our method, inhibition of transforming growth factor (TGF)β at day 7 of differentiation increases hVPr-GFP+ cells by tenfold. In phase 2, TGFβ inhibition maintains the proliferation and vascular identity of purified endothelial cells, resulting in a net 36-fold expansion of endothelial cells in homogenous monolayers, which exhibited a transcriptional profile of Id1highVEGFR2highVE-cadherin+ ephrinB2+. Using an Id1-YFP hESC reporter line, we showed that TGFβ inhibition sustains Id1 expression in hESC-derived endothelial cells and that Id1 is required for increased proliferation and preservation of endothelial cell commitment. Our approach provides a serum-free method for differentiation and long-term maintenance of hESC-derived endothelial cells at a scale relevant to clinical application. PMID:20081865
Três idéias sedutoras e quatro sugestões preciosas: algumas reflexões de Jerome Kagan
Directory of Open Access Journals (Sweden)
José Fernando Bitencourt Lomônaco
Full Text Available São consideradas três idéias, denominadas por Jerome Kagan idéias sedutoras pela sua capacidade de se apresentarem como intuitivamente verdadeiras. A primeira é a de que processos psicológicos tais como inteligência, consciência, etc, podem ser amplamente generalizados para uma ampla gama de situações. A segunda refere-se ao determinismo infantil, à crença de que as primeiras experiências infantis constituem uma influência determinante no desenvolvimento. A terceira é relativa ao princípio do prazer, à noção de que o comportamento humano é regido fundamentalmente pela busca do prazer. Fundamentado em dados de diferentes áreas do conhecimento, Kagan demonstra a falácia de cada uma dessas idéias e apresenta quatro sugestões construtivas para aqueles que trabalham nas ciências sociais e comportamentais.
Aneurysm-Specific miR-221 and miR-146a Participates in Human Thoracic and Abdominal Aortic Aneurysms
Directory of Open Access Journals (Sweden)
Premakumari Venkatesh
2017-04-01
Full Text Available Altered microRNA expression is implicated in cardiovascular diseases. Our objective was to determine microRNA signatures in thoracic aortic aneurysms (TAAs and abdominal aortic aneurysms (AAAs compared with control non-aneurysmal aortic specimens. We evaluated the expression of fifteen selected microRNA in human TAA and AAA operative specimens compared to controls. We observed significant upregulation of miR-221 and downregulation of miR-1 and -133 in TAA specimens. In contrast, upregulation of miR-146a and downregulation of miR-145 and -331-3p were found only for AAA specimens. Upregulation of miR-126 and -486-5p and downregulation of miR-30c-2*, -155, and -204 were observed in specimens of TAAs and AAAs. The data reveal microRNA expression signatures unique to aneurysm location and common to both thoracic and abdominal pathologies. Thus, changes in miR-1, -29a, -133a, and -221 are involved in TAAs and miR-145, -146, and -331-3p impact AAAs. This work validates prior studies on microRNA expression in aneurysmal diseases.
A new TLD badge with machine readable ID for fully automated readout
International Nuclear Information System (INIS)
Kannan, S. Ratna P.; Kulkarni, M.S.
2003-01-01
The TLD badge currently being used for personnel monitoring of more than 40,000 radiation workers has a few drawbacks such as lack of on-badge machine readable ID code, delicate two-point clamping of dosimeters on an aluminium card with the chances of dosimeters falling off during handling or readout, projections on one side making automation of readout difficult etc. A new badge has been designed with a 8-digit identification code in the form of an array of holes and smooth exteriors to enable full automation of readout. The new badge also permits changing of dosimeters when necessary. The new design does not affect the readout time or the dosimetric characteristics. The salient features and the dosimetric characteristics are discussed. (author)
Comparison of the optimized conditions for genotyping of ACE ID ...
African Journals Online (AJOL)
STORAGESEVER
2009-10-19
Oct 19, 2009 ... variants (Koyama et al., 2008). This method removed the chances of mistyping and gave 100% accuracy in the confirmation of ID heterozygotes but expenses of chromatography did not prove it to be cost effective. Normally, genomic DNA is used as template DNA for. PCR based studies. It is very difficult to ...
Self-propelled motion in a viscous compressible fluid
Czech Academy of Sciences Publication Activity Database
Mácha, Václav; Nečasová, Šárka
2016-01-01
Roč. 146, č. 2 (2016), s. 415-433 ISSN 0308-2105 R&D Projects: GA ČR(CZ) GAP201/11/1304; GA ČR GA13-00522S Institutional support: RVO:67985840 Keywords : self-propelled motion * compressible fluid * deformable structure Subject RIV: BA - General Mathematics Impact factor: 1.158, year: 2016 http://journals.cambridge.org/action/displayAbstract?fromPage=online&aid=10065194&fileId=S0308210515000487
Directory of Open Access Journals (Sweden)
Imkongtenla Pongen
2016-12-01
Full Text Available This study aims to evaluate the association of gender-dependent expression of angiotensin converting enzyme gene polymorphism (I/D with adiposity markers and blood pressure among AoNagas.57AoNagas[Males (n =26; Females (n = 31; Mean Age: 30.56±7.5 and 31.9 ±8.3 1]residing in Delhi were included in this cross sectionalstudy. Anthropometric measurements and blood pressure were taken using standardized techniques. Adiposity indices viz., BMI, WHR and WHtR were computed. Body fat percentage was assessed by bioelectricimpedance technique using Tanita Body composition analyzer (T-6360. Venous blood samples were withdrawn for DNA extraction and genotyping of ACE gene (I/D polymorphism was established by polymerase chain reaction (PCR. In female participants with DD homozygote, risk of both general and central obesity as depicted by BMI, body fat percentage, WC, WHR and WHtR were higher than ID heterozygote. Risk of hypertension was found to be greater among males with DD homozygote rather than females with DD homozygote. In males, obesity was not found to be associated with hypertension in either DD or ID genotypic variants of ACE. Whereas, in females obesity was significantly and positively correlated with hypertension in both DD and ID genotype. DD homozygous form of ACE is linked with both obesity and blood pressure in females and only with blood pressure in males. This genotype-by-gender interaction gives us a facet in understanding the complex genetic basis of adiposity and blood pressure phenotypes.
Directory of Open Access Journals (Sweden)
Alessandra Consonni
2017-09-01
Full Text Available Reinstating tissue-specific tolerance has attracted much attention as a means to treat autoimmune diseases. However, despite promising results in rodent models of autoimmune diseases, no established tolerogenic therapy is clinically available yet. In the experimental autoimmune myasthenia gravis (EAMG model several protocols have been reported that induce tolerance against the prime disease-associated antigen, the acetylcholine receptor (AChR at the neuromuscular junction. Using the whole AChR, the extracellular part or peptides derived from the receptor, investigators have reported variable success with their treatments, though, usually relatively large amounts of antigen has been required. Hence, there is a need for better formulations and strategies to improve on the efficacy of the tolerance-inducing therapies. Here, we report on a novel targeted fusion protein carrying the immunodominant peptide from AChR, mCTA1–T146, which given intranasally in repeated microgram doses strongly suppressed induction as well as ongoing EAMG disease in mice. The results corroborate our previous findings, using the same fusion protein approach, in the collagen-induced arthritis model showing dramatic suppressive effects on Th1 and Th17 autoaggressive CD4 T cells and upregulated regulatory T cell activities with enhanced IL10 production. A suppressive gene signature with upregulated expression of mRNA for TGFβ, IL10, IL27, and Foxp3 was clearly detectable in lymph node and spleen following intranasal treatment with mCTA1–T146. Amelioration of EAMG disease was accompanied by reduced loss of muscle AChR and lower levels of anti-AChR serum antibodies. We believe this targeted highly effective fusion protein mCTA1–T146 is a promising candidate for clinical evaluation in myasthenia gravis patients.
45 CFR 146.136 - Parity in mental health and substance use disorder benefits.
2010-10-01
... 45 Public Welfare 1 2010-10-01 2010-10-01 false Parity in mental health and substance use disorder... Benefits § 146.136 Parity in mental health and substance use disorder benefits. (a) Meaning of terms. For... benefits and mental health or substance use disorder benefits must comply with paragraph (b)(2), (b)(3), or...
Lee, Youn Soo; Gong, Gyungyub; Sohn, Jin Hee; Ryu, Ki Sung; Lee, Jung Hun; Khang, Shin Kwang; Cho, Kyung-Ja; Kim, Yong-Man; Kang, Chang Suk
2013-06-01
The objective of this study was to evaluate a newly-developed EASYPREP liquid-based cytology method in cervicovaginal specimens and compare it with SurePath. Cervicovaginal specimens were prospectively collected from 1,000 patients with EASYPREP and SurePath. The specimens were first collected by brushing for SurePath and second for EASYPREP. The specimens of both methods were diagnosed according to the Bethesda System. Additionally, we performed to REBA HPV-ID genotyping and sequencing analysis for human papillomavirus (HPV) on 249 specimens. EASYPREP and SurePath showed even distribution of cells and were equal in cellularity and staining quality. The diagnostic agreement between the two methods was 96.5%. Based on the standard of SurePath, the sensitivity, specificity, positive predictive value, and negative predictive value of EASYPREP were 90.7%, 99.2%, 94.8%, and 98.5%, respectively. The positivity of REBA HPV-ID was 49.4% and 95.1% in normal and abnormal cytological samples, respectively. The result of REBA HPV-ID had high concordance with sequencing analysis. EASYPREP provided comparable results to SurePath in the diagnosis and staining quality of cytology examinations and in HPV testing with REBA HPV-ID. EASYPREP could be another LBC method choice for the cervicovaginal specimens. Additionally, REBA HPV-ID may be a useful method for HPV genotyping.
KONSEP MᾹQᾹṢID AL-SYᾹRĪAH MENURUT ṬᾹHᾹ JᾹBIR AL-‘ALWᾹNĪ
Directory of Open Access Journals (Sweden)
Chasnak Najidah
2017-03-01
Full Text Available One discourse which is receiving considerable attention from scholars of Islam is about the objectives of Islamic law (maqasid al-shari'ah. Taha Jabir al-'Alwānī as one reviewer of Maqasid al-shari'ah contemporary formulate the concept of maqasid al-shari'ah different from previous scholars. This article describes the concept of maqasid al-shari'ah by Taha Jabir al-'Alwānī. According to him, there are three levels of hierarchical of Maqasid al-Sharia. The highest value of maqasid al-shari'ah says is what he describes as al-Maqasid al-'ulyā al-Hakimah (intentions of the highest shari'ah and a legal basis, which consists of three main elements, namely al-Tawhid ( Onesess of God, al-Tazkiyah (purification and al-'umrān (prosperity. The position of the second al-shari'ah Maqasid are universal values such as justice, freedom, and equality. While the third position is the formulation of the previous scholars regarding maqasid al-shari'ah consisting of ḍarūriyyat, ḥājiyyāt, and taḥsīniyyāt. In terms of methodological, Taha Jabir al-'Alwānī basing the new system for Maqasid al-syarī'ahnya on the methods of al-jam'u Baina al-qirā'atain, a reading of the two entities: the revelation of God and the universe. With this basis, he argues that the maqasid al-shari'ah formulations are qaṭ'ī, so it can be a reference to the scholars in solving the problems of contemporary law. [Salah satu diskursus yang mendapat perhatian cukup besar dari para akademisi Islam adalah seputar tujuan-tujuan hukum islam (maqāṣid al-syarī'ah. Ṭāhā Jābir al-‘Alwānī sebagai salah satu ulama pengkaji maqāṣid asy-syarī’ahkontemporer merumuskan konsep maqāṣid asy-syarī’ahyang berbeda dari ulama sebelumnya. Artikel ini mendeskripsikan konsep maqāṣid asy-syarī’ahmenurut Ṭāhā Jābir al-‘Alwānī. Menurutnya, ada tiga tingkatan hierarkis maqāṣid al-syarī'ah. Nilai tertinggi maqāṣid asy-syarī’ahmenurutnya adalah apa
PROYECTOS DE I+D, CARACTERIZACIÓN DEL TIPO DE INVESTIGACIÓN Y EL ROL DE GERENTE DE PROYECTOS
Directory of Open Access Journals (Sweden)
Aníbal N. Cassanelli
2014-12-01
Full Text Available En este artículo se pone de manifiesto la importancia del sector de la I+D y su organización fuertemente proyectizada que la convierte en un área clave para la aplicación de metodologías de gestión de proyectos. Se analizan los modelos de procesos de la I+D para proponer un esquema basado en dominios interrelacionados que permite dar pie a la identificación y caracterización de la investigación básica, aplicada, desarrollo e innovación. A partir de ahí, se comparan las competencias entre el gestor de proyectos general y los investigadores principales (gestores de proyectos de I+D de facto. Se concluye que existe una gran diferencia entre conocimientos y competencias requeridos para la gestión. Se muestran las dos tendencias que existen en el sector de I+D y la propuesta de separación del roles y la creación de una nueva figura distintiva del investigador principal que se ocupe de la gestión de proyectos.
International Nuclear Information System (INIS)
Villano, C.M.; White, L.A.
2006-01-01
The ID (inhibitor of differentiation or DNA binding) helix-loop-helix proteins are important mediators of cellular differentiation and proliferation in a variety of cell types through regulation of gene expression. Overexpression of the ID proteins in normal human keratinocytes results in extension of culture lifespan, indicating that these proteins are important for epidermal differentiation. Our hypothesis is that the ID proteins are targets of the retinoic acid signaling pathway in keratinocytes. Retinoids, vitamin A analogues, are powerful regulators of cell growth and differentiation and are widely used in the prevention and treatment of a variety of cancers in humans. Furthermore, retinoic acid is necessary for the maintenance of epithelial differentiation and demonstrates an inhibitory action on skin carcinogenesis. We examined the effect of all-trans retinoic acid on expression of ID-1, -2, -3, and -4 in normal human keratinocytes and found that exposure of these cells to all-trans retinoic acid causes an increase in both ID-1 and ID-3 gene expression. Furthermore, our data show that this increase is mediated by increased transcription involving several cis-acting elements in the distal portion of the promoter, including a CREB-binding site, an Egr1 element, and an YY1 site. These data demonstrate that the ID proteins are direct targets of the retinoic acid signaling pathway. Given the importance of the ID proteins to epidermal differentiation, these results suggest that IDs may be mediating some of the effects of all-trans retinoic acid in normal human keratinocytes
Directory of Open Access Journals (Sweden)
Kersten Christian
2005-05-01
Full Text Available Abstract Background Bone morphogenetic proteins (BMPs belong to the TGF-β superfamily and are secreted proteins with pleiotropic roles in many different cell types. A potential role of BMP-6 in the immune system has been implied by various studies of malignant and rheumatoid diseases. In the present study, we explored the role of BMP-6 in normal human peripheral blood B cells. Results The B cells were found to express BMP type I and type II receptors and BMP-6 rapidly induced phosphorylation of Smad1/5/8. Furthermore, Smad-phosphorylation was followed by upregulation of Id1 mRNA and Id1 protein, whereas Id2 and Id3 expression was not affected. Furthermore, we found that BMP-6 had an antiproliferative effect both in naïve (CD19+CD27- and memory B cells (CD19+CD27+ stimulated with anti-IgM alone or the combined action of anti-IgM and CD40L. Additionally, BMP-6 induced cell death in activated memory B cells. Importantly, the antiproliferative effect of BMP-6 in B-cells was completely neutralized by the natural antagonist, noggin. Furthermore, B cells were demonstrated to upregulate BMP-6 mRNA upon stimulation with anti-IgM. Conclusion In mature human B cells, BMP-6 inhibited cell growth, and rapidly induced phosphorylation of Smad1/5/8 followed by an upregulation of Id1.
López-Lozano, Xóchitl; Plascencia-Villa, G; Calero, G; Whetten, R L; Weissker, Hans-Christian
2017-12-07
The new water-soluble gold cluster Au 146 (p-MBA) 57 , the structure of which has been recently determined at sub-atomic resolution by Vergara et al., is the largest aqueous gold cluster ever structurally determined and likewise the smallest cluster with a stacking fault. The core presents a twinned truncated octahedron, while additional peripheral gold atoms follow a C 2 rotational symmetry. According to the usual counting rules of the superatom complex (SAC) model, the compound attains a number of 92 SAC electrons if the overall net charge is 3- (three additional electrons). As this is the number of electrons required for a major shell closing, the question arises of whether Au 146 (p-MBA) 57 should be regarded as a superatom complex. Starting from the experimental coordinates we have analyzed the structure using density-functional theory. The optimized (relaxed) structure retains all the connectivity of the experimental coordinates, while removing much of its irregularities in interatomic distances, thereby enhancing the C 2 -symmetry feature. On analyzing the angular-momentum-projected states, we show that, despite a small gap, the electronic structure does not exhibit SAC model character. In addition, optical absorption spectra are found to be relatively smooth compared to the example of the Au 144 (SR) 60 cluster. The Au 146 (SR) 57 does not derive its stability from SAC character; it cannot be considered as a superatom complex.
Harrison, Stephanie R; Scambler, Thomas; Oubussad, Lylia; Wong, Chi; Wittmann, Miriam; McDermott, Michael F; Savic, Sinisa
2018-01-01
Tumor necrosis factor (TNF)-receptor-associated periodic fever syndrome (TRAPS) is a rare monogenic autoinflammatory disorder characterized by mutations in the TNFRSF1A gene, causing TNF-receptor 1 (TNFR1) misfolding, increased cellular stress, activation of the unfolded protein response (UPR), and hyperresponsiveness to lipopolysaccharide (LPS). Both microRNA (miR)-146a and miR-155 provide negative feedback for LPS-toll-like receptor 2/4 signaling and cytokine production, through regulation of nuclear factor kappa B (NF-κB). In this study, we hypothesized that proinflammatory cytokine signaling in TRAPS downregulates these two miRs, resulting in LPS-induced hyperresponsiveness in TRAPS dermal fibroblasts (DFs), irrespective of the underlying genetic mutation. Primary DF were isolated from skin biopsies of TRAPS patients and healthy controls (HC). TNFR1 cell surface expression was measured using immunofluorescence. DF were stimulated with LPS, interleukin (IL)-1β, thapsigargin, or TNF, with and without inositol-requiring enzyme 1 (IRE1) inhibitor (4u8C), following which miR-146a and miR-155 expression was measured by RT-qPCR. IL-1β, IL-6, and TNF secretion was measured by enzyme-linked immunosorbent assays, and baseline expression of 384 different miRs was assessed using microfluidics assays. TNFR1 was found to be expressed on the surface of HC DF but expression was deficient in all samples with TRAPS-associated mutations. HC DF showed significant dose-dependent increases in both miR-146a and miR-155 expression levels in response to LPS; however, TRAPS DF failed to upregulate either miR-146a or miR-155 under the same conditions. This lack of miR-146a and miR-155 upregulation was associated with increased proinflammatory cytokine production in TRAPS DF in response to LPS challenge, which was abrogated by 4u8C. Incubation of HC DF with IL-1β led to downregulation of miR-146a and miR-155 expression, which was dependent on IRE1 enzyme. We observed global
Labelling IDS clusters by means of the silhouette index
Petrovic, Slovodan; Álvarez, Gonzalo; Orfila, Agustín; Carbó, Javier
2006-01-01
Proceeding of: IX Reunión Española sobre Criptología y Seguridad de la Información. Barcelona, 2006 One of the most difficult problems in the design of an anomaly based intrusion detection system (IDS) that uses clustering is that of labelling the ob- tained clusters, i.e. determining which of them correspond to ”good” behaviour on the network/host and which to ”bad” behaviour. In this paper, a new clusters’ labelling strategy, which makes use of the Silhouette clustering quality index is ...
ID-kaart on mugav ja praktiline dokument / Heiki Raudla
Raudla, Heiki, 1949-
2001-01-01
Ilmunud ka: Severnoje Poberezhje 12. okt., lk. 2; Lääne Elu 13. okt., lk. 2; Hiiumaa 13. okt., lk. 2; Koit 16. okt., lk. 6; Nädaline 16. okt., lk. 4; Sakala 18. okt., lk. 2; Valgamaalane 18. okt., lk. 2; Pjarnuskii Ekspress 12. okt., lk. 2; Meie Maa 19. okt., lk. 2; Hiiu Leht 23. okt., lk. 2; Järva Teataja 30. okt., lk. 2. Siseministri nõunik Heiki Raudla ID-kaardist
International Nuclear Information System (INIS)
Bäuerle, Bettina; Sandalova, Tatyana; Schneider, Gunter; Rieger, Paul-Gerhard
2006-01-01
This is the first report of the crystallization of an IDS-epimerase from A. tumefaciens BY6 and its l-selenomethionine derivative. The initial degradation of all stereoisomers of the complexing agent iminodisuccinate (IDS) is enabled by an epimerase in the bacterial strain Agrobacterium tumefaciens BY6. This protein was produced in Escherichia coli, purified and crystallized by the hanging-drop vapour-diffusion method. Crystals of IDS-epimerase were obtained under several conditions. The best diffracting crystals were grown in 22% PEG 3350, 0.2 M (NH 4 ) 2 SO 4 and 0.1 M bis-Tris propane pH 7.2 at 293 K. These crystals belong to the monoclinic space group P2 1 , with unit-cell parameters a = 55.4, b = 104.2, c = 78.6 Å, β = 103.3°, and diffracted to 1.7 Å resolution. They contain two protein molecules per asymmetric unit. In order to solve the structure using the MAD phasing method, crystals of the l-selenomethionine-substituted epimerase were grown in the presence of 20% PEG 3350, 0.2 M Na 2 SO 4 and 0.1 M bis-Tris propane pH 8.5
Saúde coletiva: história de uma idéia e de um conceito
Directory of Open Access Journals (Sweden)
Everardo Duarte Nunes
1994-12-01
Full Text Available O presente trabalho procura resgatar de forma sintética a trajetória histórica e conceitual da "Saúde Coletiva", evidenciando as suas raízes nos projetos preventivistas e da medicina social. Estes projetos, que se estenderam a partir dos anos 50 e que culminam com a idéia da chamada "Saúde Coletiva", apresentam aspectos que os diferenciam na apreensão do social e do coletivo. Ao tratar especificamente da idéia de uma Saúde Coletiva, o texto aponta para a sua tríplice dimensão: como corrente de pensamento, como movimento social e como prática teórica.
Search for hyperdeformation in 146Gd using the microball and gammasphere
International Nuclear Information System (INIS)
Hua, P.F.; LaFosse, D.; Korolija, M.; Sarantites, D.G.; Baktash, C.; Cross, C.; Cederwall, B.; Fallon, P.; Lee, I.Y.; Machiavelli, A.
1994-01-01
Results from the first attempt to observe hyperdeformation in 146 Gd by the 100 Mo( 51 V, p4n) reaction are presented. The γ-ray spectra were recorded with Gammasphere. The Microball was used to select protons with an efficiency of 90%. A total of 2 x 10 9 proton selected triple events were obtained. The pxn channels comprised ∼25% of the total events. The proton gating decreased the background from competing xn, αxn and fission by a factor of 4
International Nuclear Information System (INIS)
Zhou, Yan; Ming, Jia; Xu, Yan; Zhang, Yi; Jiang, Jun
2015-01-01
Highlights: • Expression of ERβ1 was positively correlated with E-cadherin in breast cancer cell. • ERβ1 upregulates E-cadherin expression in breast cancer cell lines. • ERβ1 upregulates E-cadherin expression in a Id1-dependent manner. - Abstract: ERβ1 is a member of the nuclear receptor superfamily of ligand-regulated transcription factors. It plays an important role in regulating the progression of breast cancer. However, the mechanisms of ERβ1 in tumorigenesis, metastasis and prognosis are still not fully clear. In this study, we showed that the expression of ERβ1 was positively correlated with E-cadherin expression in breast cancer cell lines. In addition, we found that ERβ1 upregulates E-cadherin expression in breast cancer cell lines. Furthermore, we also found that ERβ1 inhibits the migration and invasion of breast cancer cells and upregulated E-cadherin expression in a Id1-dependent manner. Taken together, our study provides further understanding of the molecular mechanism of ERβ1 in tumor metastasis and suggests the feasibility of developing novel therapeutic approaches to target Id1 to inhibit breast cancer metastasis
Temple, V; Drummond, C; Valiquette, S; Jozsvai, E
2010-06-01
Video conferencing (VC) technology has great potential to increase accessibility to healthcare services for those living in rural or underserved communities. Previous studies have had some success in validating a small number of psychological tests for VC administration; however, VC has not been investigated for use with persons with intellectual disabilities (ID). A comparison of test results for two well known and widely used assessment instruments was undertaken to establish if scores for VC administration would differ significantly from in-person assessments. Nineteen individuals with ID aged 23-63 were assessed once in-person and once over VC using the Wechsler Abbreviated Scale of Intelligence (WASI) and the Beery-Buktenica Test of Visual-Motor Integration (VMI). Highly similar results were found for test scores. Full-scale IQ on the WASI and standard scores for the VMI were found to be very stable across the two administration conditions, with a mean difference of less than one IQ point/standard score. Video conferencing administration does not appear to alter test results significantly for overall score on a brief intelligence test or a test of visual-motor integration.
Validez y fiabilidad del Researcher ID y de «Web of Science Production of Spanish Psychology»
Directory of Open Access Journals (Sweden)
José Alonso Olivas-Ávila
2014-01-01
Full Text Available La creación de sistemas integradores de productos de investigación, como el Researcher ID de Thomson Reuters, ha sido una necesidad emergente debido a lo complejo que es para los investigadores demostrar de manera periódica el impacto y difusión de su investigación. Sin embargo, estos sistemas se alimentan de información proveniente de las diversas bases de datos y cada vez son más inclusivos para captar productos de investigación. Varios estudios bibliométricos han demostrado que las bases de datos contienen imprecisiones de varios tipos, que afectan directamente a los sistemas integradores. Como consecuencia, se plantea este estudio descriptivo con el fin de analizar la precisión de los registros del Researcher ID de los miembros del consejo de www.psy-wos.es y de una muestra de usuarios de esta página para cotejar los registros con los contenidos en la base de datos Web of Science, diferenciándolos de contenidos ajenos a esta base de datos. Los resultados reflejan que existen imprecisiones y errores considerables en los Researcher ID de la muestra analizada, tales como duplicidad de registros y la inclusión de registros ajenos a la Web of Science. Se concluye que los Resercher ID así como el www.psy-wos.es no son válidos ni fiables.
Baumgartner, C; Freydiere, A M; Gille, Y
1996-01-01
Two chromogenic media, Albicans ID and CHROMagar Candida agar plates, were compared with a reference medium, Sabouraud-chloramphenicol agar, and standard methods for the identification of yeast species. This study involved 951 clinical specimens. The detection rates for the two chromogenic media for polymicrobial specimens were 20% higher than that for the Sabouraud-chloramphenicol agar plates. The rates of identification of Candida albicans for Albicans ID and CHROMagar Candida agar plates w...
Typing of two Middle Eastern populations with the Precision ID Ancestry Panel
DEFF Research Database (Denmark)
Truelsen, Ditte Mikkelsen; Farzad, Maryam Sharafi; Mogensen, Helle Smidt
2017-01-01
, Turkish and Iranian individuals were SNP typed with Massively Parallel Sequencing with the Precision ID Ancestry Panel (Thermo Fisher Scientific) to assess whether it was possible to differentiate geographically proximate populations in the Middle East using this kit. Analyses showed that it were...
Sègla, Aimé Dafon
The essay examines Idààcha cosmological vision as a kind of incorporation of Yoruba cosmology. It shows a process where the two strands, that is to say, knowledge and belief can not be readily distinguished. The divinatory traditional calendar is indeed based on a scale of fixed number values whose definitions are drawn from the concepts early traditional people have of the universe. Thus, the signification of the terms that designate entities such as angle, circle, center of the circle, midnight, time zone, the number of days in a week, etc., in the Yoruba dialect Idààcha, mirrors cosmological standards. These words constitute a landscape of memory shedding light on early Yoruba culture and history. Hence, Idààcha being a significant western periphery of the Yoruba region, we examine why its divinatory calendar would preserve an older spatio-temporal logic, beyond Ifè and Oyo revisionism in Yoruba history. Finally, the article points out that the translation of spatial and geometrical relations into temporal terms and vice-versa may suggest a new indexical approach to the study of cosmology in relation to the human body. As the body is in the mind, we say in relation to the human mind.
Energy Technology Data Exchange (ETDEWEB)
Bäuerle, Bettina [Institute of Microbiology, University of Stuttgart, 70569 Stuttgart (Germany); Sandalova, Tatyana; Schneider, Gunter [Department of Medical Biochemistry and Biophysics, Karolinska Institutet, 17177 Stockholm (Sweden); Rieger, Paul-Gerhard, E-mail: pg.rieger@imb.uni-stuttgart.de [Institute of Microbiology, University of Stuttgart, 70569 Stuttgart (Germany)
2006-08-01
This is the first report of the crystallization of an IDS-epimerase from A. tumefaciens BY6 and its l-selenomethionine derivative. The initial degradation of all stereoisomers of the complexing agent iminodisuccinate (IDS) is enabled by an epimerase in the bacterial strain Agrobacterium tumefaciens BY6. This protein was produced in Escherichia coli, purified and crystallized by the hanging-drop vapour-diffusion method. Crystals of IDS-epimerase were obtained under several conditions. The best diffracting crystals were grown in 22% PEG 3350, 0.2 M (NH{sub 4}){sub 2}SO{sub 4} and 0.1 M bis-Tris propane pH 7.2 at 293 K. These crystals belong to the monoclinic space group P2{sub 1}, with unit-cell parameters a = 55.4, b = 104.2, c = 78.6 Å, β = 103.3°, and diffracted to 1.7 Å resolution. They contain two protein molecules per asymmetric unit. In order to solve the structure using the MAD phasing method, crystals of the l-selenomethionine-substituted epimerase were grown in the presence of 20% PEG 3350, 0.2 M Na{sub 2}SO{sub 4} and 0.1 M bis-Tris propane pH 8.5.
Lifescience Database Archive (English)
Full Text Available List Contact us BodyParts3D Table of 3D organ model IDs and organ names (PART-OF Tree) Data detail Data name Table of 3D org...an model IDs and organ names (PART-OF Tree) DOI 10.18908/lsdba.nbdc00837-002 Description of ...data contents List of downloadable 3D organ models in a tab-delimited text file format, describing the correspondence between 3D org...an model IDs and organ names available in PART-OF Tree. D...atabase Site Policy | Contact Us Table of 3D organ model IDs and organ names (PART-OF Tree) - BodyParts3D | LSDB Archive ...
Wardenaar, Klaas J.; van Veen, Tineke; Giltay, Erik J.; den Hollander-Gijsman, Margien; Penninx, Brenda W. J. H.; Zitman, Frans G.
Background: The Inventory of Depressive Symptomatology Self Report (IDS-SR) is a widely used but heterogeneous measure of depression severity. Insight in its factor structure and dimensionality could help to develop more homogeneous IDS-SR subscales. However previous factoranalytical studies have
2013-02-08
... SECURITIES AND EXCHANGE COMMISSION [File No. 500-1] Advance Nanotech, Inc., Advanced ID Corp., Aeon Holdings, Inc. (n/k/a BCM Energy Partners, Inc.), ANTS Software, Inc., Beauty Brands Group, Inc... current and accurate information concerning the securities of Advanced Nanotech, Inc. because it has not...
Recombinant E. coli expressing Vitreoscilla haemoglobin prefers ...
Indian Academy of Sciences (India)
Vitreoscilla hemoglobin. (Marked as 'VHb' in figure 1A and figure 2A and C). NCBI ID: gi|114816. Accession No.: P04252. Source organism: Vitreoscilla stercoraria. Length: 146 amino acids. MW/pI: 15774.34/5.27. Protein Sequence. 1 MLDQQTINII KATVPVLKEH GVTITTTFYK NLFAKHPEVR PLFDMGRQES LEQPKALAMT.
Liu, Guohui; Zhou, Tian-Biao; Jiang, Zongpei; Zheng, Dongwen
2015-03-01
The association of the angiotensin-converting enzyme (ACE) insertion/deletion (I/D) gene polymorphism with type-2 diabetic nephropathy (T2DN) susceptibility and the risk of type-2 diabetes mellitus (T2DM) developing into T2DN in Caucasian populations is still controversial. A meta-analysis was performed to evaluate the association of ACE I/D gene polymorphism with T2DN susceptibility and the risk of T2DM developing into T2DN in Caucasian populations. A predefined literature search and selection of eligible relevant studies were performed to collect data from electronic databases. Sixteen articles were identified for the analysis of the association of ACE I/D gene polymorphism with T2DN susceptibility and the risk of T2DM developing into T2DN in Caucasian populations. ACE I/D gene polymorphism was not associated with T2DN susceptibility and the risk of patients with T2DM developing T2DN in Caucasian populations. Sensitivity analysis according to sample size of case (ACE I/D gene polymorphism was not associated with T2DN susceptibility and the risk of patients with T2DM developing T2DN in Caucasian populations. However, more studies should be performed in the future. © The Author(s) 2014.
Arbatsky, Nikolay P; Shneider, Mikhail M; Kenyon, Johanna J; Shashkov, Alexander S; Popova, Anastasiya V; Miroshnikov, Konstantin A; Volozhantsev, Nikolay V; Knirel, Yuriy A
2015-09-02
Capsular polysaccharide (CPS) was isolated from Acinetobacter baumannii NIPH146, and the following structure of branched pentasaccharide repeating unit was established by sugar analyses along with 1D and 2D NMR spectroscopy: In comparison to most other known capsular polysaccharides of A. baumannii, the CPS studied is neutral and lacks any specific monosaccharide component. The synthesis, assembly and export of this structure could be attributed to genes in a novel capsule biosynthesis gene cluster, designated KL37, which was found in the NIPH146 genome. The CPS of A. baumannii NIPH146 shares the α-d-Galp-(1→6)-β-d-Glcp-(1→3)-d-GalpNAc-(1→ trisaccharide fragment with the CPS units of several A. baumannii strains, including ATCC 17978 and LUH 5537 that carry the KL3 and KL22 gene clusters, respectively. KL37 contains two genes for glycosyltransferases that are related to two glycosyltransferase genes present in both KL3 and KL22, and the encoded proteins could be tentatively assigned to linkages between sugars in the CPS repeat. Copyright © 2015 Elsevier Ltd. All rights reserved.
Bose-Einstein correlations in Si + Al and Si + Au collisions at 14.6A GeV/c
Abbott, T.; Akiba, Y.; Beavis, D.; Bloomer, M. A.; Bond, P. D.; Chasman, C.; Chen, Z.; Chu, Y. Y.; Cole, B. A.; Costales, J. B.
1992-01-01
The E802 Spectrometer at the Brookhaven Alternating Gradient Synchrotron has been used to measure the correlation in relative momentum between like-sign pions emitted in central Si + Al and Si + Au collisions at 14.6A GeV/c. Data are presented in terms of the correlation function for both identified pi(-) and pi(+) pairs near the nucleon-nucleon center-of-mass rapidity. All parametrizations of the correlation function are consistent with a spherically symmetric source of rms radius 3.5 +/- 0.4 fm and lifetime fm/c.
de Winter, C. F.; Bastiaanse, L. P.; Hilgenkamp, T. I. M.; Evenhuis, H. M.; Echteld, M. A.
2012-01-01
Hypertension, diabetes, hypercholesterolemia and the metabolic syndrome are important risk factors for cardiovascular disease (CVD). In older people with intellectual disability (ID), CVD is a substantial morbidity risk. The aims of the present study, which was part of the Healthy Ageing in Intellectual Disability (HA-ID) study, were (1) to…
Bose-Einstein correlation of kaons in Si + Au collisions at 14.6 A GeV/c
Akiba, Y.; Beavis, D.; Beery, P.; Britt, H. C.; Budick, B.; Chasman, C.; Chen, Z.; Chi, C. Y.; Chu, Y. Y.; Cianciolo, V.
1993-01-01
The E-802 spectrometer at the Brookhaven Alternating Gradient Synchrotron, enhanced by a trigger for selection of events with one or more specified particles, has been used to measure the momentum-space correlation between pairs of K(+)s emitted in central Si + Au collisions at 14.6 A GeV/c. This correlation has been projected onto the Lorentz-invariant relative four-momentum axis. Fits to this correlation function yield a size for the kaon source that is comparable to that found using pi(+) pairs from a similar rapidity range, once a transformation from the particle-pair frames to a single source frame is made.
Influência do polimorfismo I/D do gene da eca na HPE de jovens normotensos
Directory of Open Access Journals (Sweden)
Manuella de Oliveira Fernandes
2015-08-01
Full Text Available INTRODUÇÃO: A hipotensão pós-exercício (HPE é considerada uma estratégia não farmacológica adotada para redução da pressão arterial (PA. Ademais, sabe-se que a presença de alguns polimorfismos genéticos influencia a resposta pressórica, como o I/D do gene da enzima conversora da angiotensina (ECA. Objetivo: Analisar a influência do polimorfismo I/D da ECA sobre a HPE após três diferentes intensidades de exercício em jovens normotensos e fisicamente ativos.MÉTODOS: Vinte e seis jovens saudáveis (DD = 11; ID/II = 15 realizaram uma sessão máxima de 1.600 metros, na pista de atletismo e outras três sessões experimentais (Sessão Moderada: 6% abaixo do limiar anaeróbio, Sessão Intensa: 6% acima do limiar anaeróbio e Sessão de Controle, com aferições prévias da PA, por 20 minutos e posteriores ao exercício por 60 minutos.RESULTADOS: Observou-se que o exercício moderado ocasionou HPE independentemente do grupo genotípico, sendo mais evidente para a pressão arterial sistólica nos momentos 45 minutos e 60 minutos (p ≤ 0,05. Verificou-se também que a característica gênica exerceu influência sobre a área abaixo da curva pressórica (p ≤ 0,005 sobre a pressão arterial diastólica, formada 1 hora após o exercício.CONCLUSÃO: Conclui-se que o exercício moderado ocasiona HPE em jovens normotensos e fisicamente ativos, independentemente do polimorfismo I/D no gene da ECA, sendo que esse polimorfismo exerce influência sobre a hipotensão diastólica, e os indivíduos portadores do alelo I apresentam maior decaimento da PA diastólica (PAD.
Validation of the Inventory of Depressive Symptomatology (IDS) in Cocaine Dependent Inmates.
Suris, Alina; Kashner, T. Michael; Gillaspy, James A., Jr.; Biggs, Melanie; Rush, A. John
2001-01-01
While the reliability and validity of Inventory of Depressive Symptomatology (IDS) scores have been established with outpatient adults being treated in community psychiatric clinics, it has not been used in special or dually diagnosed populations. Establishes internal consistency, concurrent validity, and construct validity for both the clinical…
Directory of Open Access Journals (Sweden)
Muhammad Syaifullah
2017-11-01
Full Text Available Learning Arabic qowa'id student Syari'ah Banking Second semester Ma'arif Institute of Islamic NU Metro Lampung still not maximized. Students have difficulties to understand Arabic qowa'id material. Student learning motivation is also low. This is what makes researchers want to do research in that class. Problems to be expressed in this research are: (1 How is the application of Arabic qowa'id learning with cooperative model of jigsaw method in class A, second semester of Syari'ah Banking, (2 How to improve learning qowa'id after getting learning with cooperative learning model of jigsaw method, (3 What are the advantages and disadvantages of implementing cooperative Arabic qawaid in class A with jigsaw method. This research is a classroom action research conducted in two cycles. Each cycle is done in a cycle consisting of four stages: planning, execution, observation and reflection. The results of this study indicate an increase from cycle I of cycle II. The average class cycle I is 60.83 and the average of cycle II is 71. The students also show behavior change in the positive direction. Student activity is increasing. The improvement of test result is also followed by behavioral and motivational change based on research which has been done by the researcher that through cooperative learning with jigsaw method, Arabic qowa'id learning becomes more fun and easier for students in learning qowa'id. Suggestions that can be given is a lecturer of Arabic language should be more creative in using techniques and learning methods that involve the active role of student learning so that the learning process to get the maximum value. One alternative of learning Arabic qowa'id is by using cooperative learning jigsaw model.
Directory of Open Access Journals (Sweden)
Alberto Morales
1983-06-01
Full Text Available Se realizó un experimento con el objeto de investigar la capacidad del mosquito Psorophora confinnis para transmitir por picadura a ratones blanco-suizos de 21 días una cepa de virus de encefalitis equina venezolana, subgrupo ID. Cuando los mosquitos se alimentaron sobre hamster con altas viremias (7.5, 6.5 y 6.3 dex en 0.1 ml. de suero, los porcentajes de infección de los mosquitos y los de transmisión fueron altos. Sin embargo, cuando los mosquitos se alimentaron sobre Proechimys hendei con viremias bajas (1,4 y 2.6 dex en 0.1 ml. de suero el porcentaje de infección de los mosquitos fue muy bajo y no hubo transmisión. Cuando la viremia en el Proechimys fue de 4.4 dex en 0.1 ml. de suero, el porcentaje de infección de los mosquitos aumentó y hubo transmisión baja (9%. Los resultados sugieren que Psorophora confinnis es un mosquito que tiene un alto umbral de infección para EEV subgrupo ID.