WorldWideScience

Sample records for twin pairs based

  1. MZ twin pairs or MZ singletons in population family-based GWAS? More power in pairs

    NARCIS (Netherlands)

    Minica, C.C.; Boomsma, D.I.; Vink, J.M.; Dolan, C.V.

    2014-01-01

    Family-based genome-wide association studies (GWAS) involve testing the genetic association of (many) genetic variants with the phenotype of interest, while taking into account the relatedness among family members. Occasionally in family-based GWAS, including monozygotic (MZ) twins, the data from

  2. Reared-Apart Chinese Twins: Chance Discovery/Twin-Based Research: Twin Study of Media Use; Twin Relations Over the Life Span; Breast-Feeding Opposite-Sex Twins/Print and Online Media: Twins in Fashion; Second Twin Pair Born to Tennis Star; Twin Primes; Twin Pandas.

    Science.gov (United States)

    Segal, Nancy L

    2017-04-01

    A January 2017 reunion of 10-year-old reared-apart Chinese twin girls was captured live on ABC's morning talk show Good Morning America, and rebroadcast on their evening news program Nightline. The twins' similarities and differences, and their participation in ongoing research will be described. This story is followed by reviews of twin research concerning genetic and environmental influences on media use, twin relations across the lifespan and the breast-feeding of opposite-sex twins. Popular interest items include twins in fashion, the second twin pair born to an internationally renowned tennis star, twin primes and twin pandas.

  3. The 16th International Twin Congress: Highlights from Madrid/Twin Research: Twin Study of Partner Aggression; ABO Incompatibility in Dizygotic Twins; Growth Discordance in a Monoamniotic Twin Pair; Quick Note on Twin Implantation/In the Media: Long-Lost Twins Found; NASA Twin Experiment; Twin Brothers and the Las Vegas Attack; Retired Twin Airline Pilots; Twin Film Clips.

    Science.gov (United States)

    Segal, Nancy L

    2018-02-01

    Highlights from the 16th International Twin Congress, held in Madrid, Spain from November 16-18, 2017, are presented. The Twin Congress, formerly held every three years, now takes place biennially with a single-day meeting organized during the off years. This meeting is the largest gathering of scientific twin researchers, medical personnel, and representatives of multiple birth organizations in the world. This overview is followed by reviews of recent twin research and commentary concerning partner aggression, ABO incompatibility in dizygotic twins, growth discordance in a monoamniotic twin pair and twin implantation. The article closes with summaries of timely topics in the media, namely a father's finding of his long-lost twin children, early results from the NASA twin experiment, twin brothers at the center of the October 2017 Las Vegas attack, retired twin airline pilots, and clips from recent films with twin-based themes.

  4. Personality, depression, and premorbid lifestyle in twin pairs discordant for Parkinson's disease

    Science.gov (United States)

    Heberlein, I.; Ludin, H.; Scholz, J.; Vieregge, P.

    1998-01-01

    Present personality traits (Freiburg personality inventory, FPI-R), depression (von Zerssen's depression scale), and self assessed state of health were evaluated in 15 twin pairs (six monozygotic and nine dizygotic; mean age 62.5 years) discordant for idiopathic Parkinson's disease and in 17 unrelated healthy control subjects. The twins had additional questionnaire based interviews on premorbid lifestyle.
For disability, twins with Parkinson's disease scored lower on FPI-R than controls in "achievement orientation" and "extraversion", higher in "inhibitedness", "somatic complaints", and "emotionality". They scored higher for depression and for state of health than unaffected twins and controls. For zygosity, monozygotic twins scored lower than dizygotic twins in "achievement orientation", "aggressiveness", and "strain". Monozygotic twins had less "achievement orientation" and "extraversion" and more "somatic complaints" than controls. Monozygotic twins had a lower within pair difference than dizygotic twins in "social orientation". During premorbid times the affected twin with later Parkinson's disease was estimated to have been "less often the leader" in the twin pair.
Although small in sample size, this twin study indicates a genetic impact for some personality features beyond the Parkinson's disease motor syndrome.

 PMID:9489545

  5. Functional and effective whole brain connectivity using magnetoencephalography to identify monozygotic twin pairs.

    Science.gov (United States)

    Demuru, M; Gouw, A A; Hillebrand, A; Stam, C J; van Dijk, B W; Scheltens, P; Tijms, B M; Konijnenberg, E; Ten Kate, M; den Braber, A; Smit, D J A; Boomsma, D I; Visser, P J

    2017-08-29

    Resting-state functional connectivity patterns are highly stable over time within subjects. This suggests that such 'functional fingerprints' may have strong genetic component. We investigated whether the functional (FC) or effective (EC) connectivity patterns of one monozygotic twin could be used to identify the co-twin among a larger sample and determined the overlap in functional fingerprints within monozygotic (MZ) twin pairs using resting state magnetoencephalography (MEG). We included 32 cognitively normal MZ twin pairs from the Netherlands Twin Register who participate in the EMIF-AD preclinAD study (average age 68 years). Combining EC information across multiple frequency bands we obtained an identification rate over 75%. Since MZ twin pairs are genetically identical these results suggest a high genetic contribution to MEG-based EC patterns, leading to large similarities in brain connectivity patterns between two individuals even after 60 years of life or more.

  6. Gut microbiomes of Malawian twin pairs discordant for kwashiorkor

    Science.gov (United States)

    Kwashiorkor, an enigmatic form of severe acute malnutrition, is the consequence of inadequate nutrient intake plus additional environmental insults. To investigate the role of the gut microbiome, we studied 317 Malawian twin pairs during the first 3 years of life. During this time, half of the twin ...

  7. Age of Onset in Concordant Twins and Other Relative Pairs With Multiple Sclerosis

    OpenAIRE

    Sadovnick, A. Dessa; Yee, Irene M.; Guimond, Colleen; Reis, Jacques; Dyment, David A.; Ebers, George C.

    2009-01-01

    The ages of onset in multiple sclerosis cases span more than 7 decades. Data are presented for affected relative pairs from a Canadian population base of 30,000 multiple sclerosis index cases (1993?2008). The effects of genetic sharing, parent of origin, intergenerational versus collinear differences, and gender on the ages of onset were evaluated in the following concordant pairs: monozygotic twins (n?=?29), dizygotic twins (n?=?10), siblings (n?=?614), first cousins (n?=?405), half siblings...

  8. Twin photon pairs in a high-Q silicon microresonator

    Energy Technology Data Exchange (ETDEWEB)

    Rogers, Steven; Lu, Xiyuan [Department of Physics and Astronomy, University of Rochester, Rochester, New York 14627 (United States); Jiang, Wei C. [Institute of Optics, University of Rochester, Rochester, New York 14627 (United States); Lin, Qiang, E-mail: qiang.lin@rochester.edu [Institute of Optics, University of Rochester, Rochester, New York 14627 (United States); Department of Electrical and Computer Engineering, University of Rochester, Rochester, New York 14627 (United States)

    2015-07-27

    We report the generation of high-purity twin photon pairs through cavity-enhanced non-degenerate four-wave mixing (FWM) in a high-Q silicon microdisk resonator. Twin photon pairs are created within the same cavity mode and are consequently expected to be identical in all degrees of freedom. The device is able to produce twin photons at telecommunication wavelengths with a pair generation rate as large as (3.96 ± 0.03) × 10{sup 5} pairs/s, within a narrow bandwidth of 0.72 GHz. A coincidence-to-accidental ratio of 660 ± 62 was measured, the highest value reported to date for twin photon pairs, at a pair generation rate of (2.47 ± 0.04) × 10{sup 4} pairs/s. Through careful engineering of the dispersion matching window, we have reduced the ratio of photons resulting from degenerate FWM to non-degenerate FWM to less than 0.15.

  9. Hyperthyroidism is associated with work disability and loss of labour market income. A Danish register-based study in singletons and disease-discordant twin pairs.

    Science.gov (United States)

    Brandt, Frans; Thvilum, Marianne; Hegedüs, Laszlo; Brix, Thomas Heiberg

    2015-11-01

    To examine the risk of disability pension and changes in labour market income in patients with hyperthyroidism. From a 5% random sample of the Danish population and twins from the Danish Twin Registry we identified 1942 hyperthyroid singletons and 7768 non-hyperthyroid (matched 1:4) controls as well as 584 same-sex twin pairs discordant for hyperthyroidism. Singletons and twins were followed for a mean of 9 years (range 1-20). Cox regression analysis was used to examine the risk of disability pension and a difference-in-differences model was used to evaluate changes in labour market income. Hyperthyroid individuals had an increased risk of receiving disability pension: hazard ratio (HR) was 1.88, (95% CI: 1.57-2.24). Subdividing as to the cause of hyperthyroidism did not change this finding: Graves' disease (GD) HR was 1.51 (95% CI: 0.87-2.63) and toxic nodular goitre (TNG) HR was 2.10 (95% CI: 1.02-4.36). With respect to labour market income, the income of hyperthyroid individuals increased on average 1189 € less than their controls (Phyperthyroidism. Hyperthyroidism is associated with severe work disability as reflected by an 88% increased risk of receiving disability pension and a significant loss of labour market income. Similar results in monozygotic twins discordant for hyperthyroidism suggest that genetic confounding is unlikely. © 2015 European Society of Endocrinology.

  10. The Concordance and Heritability of Type 2 Diabetes in 34,166 Twin Pairs From International Twin Registers

    DEFF Research Database (Denmark)

    Willemsen, G.; Ward, K. J.; Bell, C. G.

    2015-01-01

    studies worldwide need to pool their resources. The Discordant Twin (DISCOTWIN) consortium was established for this goal. Here, we describe the DISCOTWIN Consortium and present an analysis of type 2 diabetes (T2D) data in nearly 35,000 twin pairs. Seven twin cohorts from Europe (Denmark, Finland, Norway...... and medication use, fasting glucose and insulin measures, or medical records. The prevalence of T2D ranged from 2.6% to 12.3% across the cohorts depending on age, body mass index (BMI), and national diabetes prevalence. T2D discordance rate was lower for MZ (5.1%, range 2.9-11.2%) than for same-sex dizygotic (DZ......, the Netherlands, Spain, Sweden, and the United Kingdom) and one from Australia investigated the rate of discordance for T2D in same-sex twin pairs aged 45 years and older. Data were available for 34,166 same-sex twin pairs, of which 13,970 were MZ, with T2D diagnosis based on self-reported diagnosis...

  11. Adolescent idiopathic scoliosis in twins: a population-based survey

    DEFF Research Database (Denmark)

    Andersen, Mikkel O; Thomsen, Karsten; Kyvik, Kirsten O

    2007-01-01

    STUDY DESIGN: A questionnaire-based identification of adolescent idiopathic scoliosis (AIS) patients in a twin cohort. OBJECTIVE: The purpose of this study was to establish a scoliosis twin cohort to provide data on the heritability of AIS. SUMMARY OF BACKGROUND DATA: The etiology of AIS is still...... environmental factors. METHODS: All 46,418 twins registered in the Danish Twin Registry born from 1931 to 1982 were sent a questionnaire, which included questions about scoliosis. A total of 34,944 (75.3%) representing 23,204 pairs returned the questionnaire. RESULTS: A subgroup of 220 subjects considered...... of monozygotic and dizygotic pairs was significantly different (P scoliosis in 1 twin whose other twin has scoliosis is smaller than believed up until now....

  12. Genetic and environmental factors in alexithymia: A population-based study of 8.785 Danish twin pairs

    DEFF Research Database (Denmark)

    Jørgensen, Michael Martini; Zachariae, Robert; Skytthe, Axel

    2007-01-01

    by shared (12-20%) and nonshared environmental effects (50-56%). CONCLUSION: The results from this large population-based sample suggest that genetic factors have a noticeable and similar impact on all facets of alexithymia. While the results suggested a moderate influence of shared environmental factors......BACKGROUND: The role of genetic and environmental factors for developing alexithymia is still unclear, and the aim of this study was to examine these factors in a large population-based sample of twins. METHODS: The Toronto Alexithymia Scale-20 (TAS-20) was included in a mail survey of 46...... modeling of the noncategorical data, an ACE model including additive genetic, shared environmental and nonshared environmental effects, provided the best fit for all three facets of alexithymia as well as total alexithymia scores, with heritabilities of 30-33% and the remaining variance being explained...

  13. Prevalence of Polycystic Ovary Syndrome in Women from Opposite-Sex Twin Pairs

    NARCIS (Netherlands)

    Kuijper, E.A.M.; Vink, J.M.; Lambalk, C.B.; Boomsma, D.I.

    2009-01-01

    Introduction: Intrauterine androgens of a male fetus may influence the female fetus in opposite-sex twin pairs. Because female intrauterine overexposure to androgens could lead to polycystic ovary syndrome (PCOS), the prevalence of PCOS should be higher in women from opposite-sex twin pairs.

  14. Motor Development and Physical Activity: A Longitudinal Discordant Twin-Pair Study.

    Science.gov (United States)

    Aaltonen, Sari; Latvala, Antti; Rose, Richard J; Pulkkinen, Lea; Kujala, Urho M; Kaprio, Jaakko; Silventoinen, Karri

    2015-10-01

    Previous longitudinal research suggests that motor proficiency in early life predicts physical activity in adulthood. Familial effects including genetic and environmental factors could explain the association, but no long-term follow-up studies have taken into account potential confounding by genetic and social family background. The present twin study investigated whether childhood motor skill development is associated with leisure-time physical activity levels in adulthood independent of family background. Altogether, 1550 twin pairs from the FinnTwin12 study and 1752 twin pairs from the FinnTwin16 study were included in the analysis. Childhood motor development was assessed by the parents' report of whether one of the co-twins had been ahead of the other in different indicators of motor skill development in childhood. Leisure-time physical activity (MET·h·d) was self-reported by the twins in young adulthood and adulthood. Statistical analyses included conditional and ordinary linear regression models within twin pairs. Using all activity-discordant twin pairs, the within-pair difference in a sum score of motor development in childhood predicted the within-pair difference in the leisure-time physical activity level in young adulthood (P men and women.

  15. Sports pairs: insights on athletic talent; research reviews: twins with leukemia; parents and twins.

    Science.gov (United States)

    Segal, Nancy L

    2007-06-01

    Twin research exploring genetic and environmental influences on athletic interests and talents is reviewed. Illustrative examples of twin athletes representing a variety of sports activities are presented. This is followed by an overview of twin studies offering critical insights into the onset and progress of leukemia. In the last section, timely events involving twins and parents of twins will be described--each case provides a new look at an old question.

  16. Heredity In Sarcoidosis - A Registry-Based Twin Study

    DEFF Research Database (Denmark)

    Sverrild, Asger; Backer, Vibeke; Kyvik, Kirsten Ohm

    2008-01-01

    BACKGROUND: Sarcoidosis is a multiorgan, granulomatous, inflammatory disease with unknown aetiology. Familial clustering of cases and ethnic variation in the epidemiology suggests a genetic influence on the disease susceptibility. AIM: This paper reports twin concordance and heritability estimates...... of sarcoidosis in order to assess the overall contribution of genetic factors to the disease susceptibility. METHODS: Monozygotic and dizygotic twins enrolled in either the Danish or the Finnish population-based, national Twin Cohorts (61,662 pairs in total) were linked to diagnostic information on sarcoidosis.......012. Compared to the general population we found an 80-fold increased risk of developing sarcoidosis in co-twins of affected monozygotic brothers or sisters. The increased risk in dizygotic twins was on the other hand only 7-fold. Aetiological model fitting gave a heritability of sarcoidosis of 0.66 (95% CI 0...

  17. Register-based research on twins

    DEFF Research Database (Denmark)

    Christensen, Kaare; Ohm Kyvik, Kirsten; Holm, Niels V

    2011-01-01

    Introduction: The Danish Twin Registry (DTR) has for more than 50 years been based on surveys and clinical investigations and over the two last decades also on register linkage. Currently these two approaches are merged within Statistics Denmark. Research topics: Here we report on three major...... groups of register-based research in the DTR that used the uniqueness of twinning. First, we focus on the ''long-term prognosis'' of being a twin compared with being a singleton and show that Danish twins have health trajectories in adulthood similar to singletons, which is a result of interest for twins...... illustrate how the co-twin control method in a register setting can be used to control for the effect of rearing environment and genetic factors in studies of the association between exposures and health. CONCLUSION: The spectrum of register-based twin studies is very wide and have changed in accordance...

  18. Risk of chronic bronchitis in twin pairs discordant for smoking

    DEFF Research Database (Denmark)

    Meteran, Howraman; Thomsen, Simon Francis; Harmsen, Lotte

    2012-01-01

    It is well known that smoking is a major risk factor for lung disease and respiratory symptoms. We examined the association between smoking and the risk of chronic bronchitis in a large twin sample.......It is well known that smoking is a major risk factor for lung disease and respiratory symptoms. We examined the association between smoking and the risk of chronic bronchitis in a large twin sample....

  19. Heritability of cortical thickness changes over time in twin pairs discordant for schizophrenia.

    Science.gov (United States)

    Hedman, Anna M; van Haren, Neeltje E M; van Baal, G Caroline M; Brouwer, Rachel M; Brans, Rachel G H; Schnack, Hugo G; Kahn, René S; Hulshoff Pol, Hilleke E

    2016-06-01

    Cortical thickness and surface area changes have repeatedly been found in schizophrenia. Whether progressive loss in cortical thickness and surface area are mediated by genetic or disease related factors is unknown. Here we investigate to what extent genetic and/or environmental factors contribute to the association between change in cortical thickness and surface area and liability to develop schizophrenia. Longitudinal magnetic resonance imaging study over a 5-year interval. Monozygotic (MZ) and dizygotic (DZ) twin pairs discordant for schizophrenia were compared with healthy control twin pairs using repeated measures analysis of variance (RM-ANOVA) and structural equation modeling (SEM). Twins discordant for schizophrenia and healthy control twins were recruited from the twin cohort at the University Medical Centre Utrecht, The Netherlands. A total of 90 individuals from 46 same sex twin pairs were included: 9 MZ and 10 DZ discordant for schizophrenia and 14 MZ and 13 (11 complete and 2 incomplete) DZ healthy twin-pairs. Age varied between 19 and 57years. Higher genetic liability for schizophrenia was associated with progressive global thinning of the cortex, particularly of the left superior temporal cortex. Higher environmental liability for schizophrenia was associated with global attenuated thinning of the cortex, and including of the left superior temporal cortex. Cortical surface area change was heritable, but not significantly associated with higher genetic or environmental liability for schizophrenia. Excessive cortical thinning, particularly of the left superior temporal cortex, may represent a genetic risk marker for schizophrenia. Copyright © 2015 Elsevier B.V. All rights reserved.

  20. Heritability of Biomarkers of Oxidized Lipoproteins: Twin Pair Study.

    Science.gov (United States)

    Rao, Fangwen; Schork, Andrew J; Maihofer, Adam X; Nievergelt, Caroline M; Marcovina, Santica M; Miller, Elizabeth R; Witztum, Joseph L; O'Connor, Daniel T; Tsimikas, Sotirios

    2015-07-01

    To determine whether biomarkers of oxidized lipoproteins are genetically determined. Lipoprotein(a) (Lp[a]) is a heritable risk factor and carrier of oxidized phospholipids (OxPL). We measured oxidized phospholipids on apolipoprotein B-containing lipoproteins (OxPL-apoB), Lp(a), IgG, and IgM autoantibodies to malondialdehyde-modified low-density lipoprotein, copper oxidized low-density lipoprotein, and apoB-immune complexes in 386 monozygotic and dizygotic twins to estimate trait heritability (h(2)) and determine specific genetic effects among traits. A genome-wide linkage study followed by genetic association was performed. The h(2) (scale: 0-1) for Lp(a) was 0.91±0.01 and for OxPL-apoB 0.87±0.02, which were higher than physiological, inflammatory, or lipid traits. h(2) of IgM malondialdehyde-modified low-density lipoprotein, copper oxidized low-density lipoprotein, and apoB-immune complexes were 0.69±0.04, 0.67±0.05, and 0.80±0.03, respectively, and for IgG malondialdehyde-modified low-density lipoprotein, copper oxidized low-density lipoprotein, and apoB-immune complexes 0.62±0.05, 0.52±0.06, and 0.53±0.06, respectively. There was an inverse correlation between the major apo(a) isoform and OxPL-apoB (R=-0.49; Plipoprotein and copper oxidized low-density lipoprotein, and apoB-immune complexes. Sib-pair genetic linkage of the Lp(a) trait revealed that single nucleotide polymorphism rs10455872 was significantly associated with OxPL-apoB after adjusting for Lp(a). OxPL-apoB and other biomarkers of oxidized lipoproteins are highly heritable cardiovascular risk factors that suggest novel genetic origins of atherothrombosis. © 2015 American Heart Association, Inc.

  1. Estimating Twin Pair Concordance for Age of Onset

    DEFF Research Database (Denmark)

    Scheike, Thomas H; Hjelmborg, Jacob B; Holst, Klaus K

    2015-01-01

    that they will develop the disease. The aim of this contribution is to show that the standard casewise concordance and standard prevalence estimators do not work in general for age-of-onset data. We show how one can in fact do something easy and simple even with censored data. The key is to take age into account when......Twin and family data provide a key source for evaluating inheritance of specific diseases. A standard analysis of such data typically involves the computation of prevalences and different concordance measures such as the casewise concordance, that is the probability that one twin has the disease...

  2. Metabolome and fecal microbiota in monozygotic twin pairs discordant for weight: a Big Mac challenge

    OpenAIRE

    Bondia-Pons, Isabel; Maukonen, Johanna; Mattila, Ismo; Rissanen, Aila; Saarela, Maria; Kaprio, Jaakko; Hakkarainen, Antti; Lundbom, Jesper; Lundbom, Nina; Hy?tyl?inen, Tuulia; Pietil?inen, Kirsi H.; Ore?i?, Matej

    2014-01-01

    Postprandial responses to food are complex, involving both genetic and environmental factors. We studied postprandial responses to a Big Mac meal challenge in monozygotic co-twins highly discordant for body weight. This unique design allows assessment of the contribution of obesity, independent of genetic liability. Comprehensive metabolic profiling using 3 analytical platforms was applied to fasting and postprandial serum samples from 16 healthy monozygotic twin pairs discordant for weight (...

  3. Highlights from the 15th International Congress of Twin Studies/Twin Research: Differentiating MZ Co-twins Via SNPs; Mistaken Infant Twin-Singleton Hospital Registration; Narcolepsy With Cataplexy; Hearing Loss and Language Learning/Media Mentions: Broadway Musical Recalls Conjoined Hilton Twins; High Fashion Pair; Twins Turn 102; Insights From a Conjoined Twin Survivor.

    Science.gov (United States)

    Segal, Nancy L

    2015-02-01

    Highlights from the 15th International Congress of Twin Studies are presented. The congress was held November 16-19, 2014 in Budapest, Hungary. This report is followed by summaries of research addressing the differentiation of MZ co-twins by single nucleotide polymorphisms (SNPs), an unusual error in infant twin-singleton hospital registration, twins with childhood-onset narcolepsy with cataplexy, and the parenting effects of hearing loss in one co-twin. Media interest in twins covers a new Broadway musical based on the conjoined twins Violet and Daisy Hilton, male twins becoming famous in fashion, twins who turned 102 and unique insights from a conjoined twin survivor. This article is dedicated to the memory of Elizabeth (Liz) Hamel, DZA twin who met her co-twin for the first time at age seventy-eight years. Liz and her co-twin, Ann Hunt, are listed in the 2015 Guinness Book of Records as the longest separated twins in the world.

  4. Metabolome and fecal microbiota in monozygotic twin pairs discordant for weight: a Big Mac challenge.

    Science.gov (United States)

    Bondia-Pons, Isabel; Maukonen, Johanna; Mattila, Ismo; Rissanen, Aila; Saarela, Maria; Kaprio, Jaakko; Hakkarainen, Antti; Lundbom, Jesper; Lundbom, Nina; Hyötyläinen, Tuulia; Pietiläinen, Kirsi H; Orešič, Matej

    2014-09-01

    Postprandial responses to food are complex, involving both genetic and environmental factors. We studied postprandial responses to a Big Mac meal challenge in monozygotic co-twins highly discordant for body weight. This unique design allows assessment of the contribution of obesity, independent of genetic liability. Comprehensive metabolic profiling using 3 analytical platforms was applied to fasting and postprandial serum samples from 16 healthy monozygotic twin pairs discordant for weight (body mass index difference >3 kg/m(2)). Nine concordant monozygotic pairs were examined as control pairs. Fecal samples were analyzed to assess diversity of the major bacterial groups by using 5 different validated bacterial group specific denaturing gradient gel electrophoresis methods. No differences in fecal bacterial diversity were detected when comparing co-twins discordant for weight (ANOVA, P<0.05). We found that within-pair similarity is a dominant factor in the metabolic postprandial response, independent of acquired obesity. Branched chain amino acids were increased in heavier as compared with leaner co-twins in the fasting state, but their levels converged postprandially (paired t tests, FDR q<0.05). We also found that specific bacterial groups were associated with postprandial changes of specific metabolites. Our findings underline important roles of genetic and early life factors in the regulation of postprandial metabolite levels. © FASEB.

  5. Sex differences in the pathways to major depression: a study of opposite-sex twin pairs.

    Science.gov (United States)

    Kendler, Kenneth S; Gardner, Charles O

    2014-04-01

    The authors sought to clarify the nature of sex differences in the etiologic pathways to major depression. Retrospective and prospective assessments of 20 developmentally organized risk factors and the occurrence of past-year major depression were conducted at two waves of personal interviews at least 12 months apart in 1,057 opposite-sex dizygotic twin pairs from a population-based register. Analyses were conducted by structural modeling, examining within-pair differences. Sixty percent of all paths in the best-fit model exhibited sex differences. Eleven of the 20 risk factors differed across sexes in their impact on liability to major depression. Five had a greater impact in women: parental warmth, neuroticism, divorce, social support, and marital satisfaction. Six had a greater impact in men: childhood sexual abuse, conduct disorder, drug abuse, prior history of major depression, and distal and dependent proximal stressful life events. The life event categories responsible for the stronger effect in males were financial, occupational, and legal in nature. In a co-twin control design, which matches sisters and brothers on genetic and familial-environmental background, personality and failures in interpersonal relationships played a stronger etiologic role in major depression for women than for men. Externalizing psychopathology, prior depression, and specific "instrumental" classes of acute stressors were more important in the etiologic pathway to major depression for men. The results are consistent with previously proposed typologies of major depression that suggest two subtypes that differ in prevalence in women (deficiencies in caring relationships and interpersonal loss) and men (failures to achieve expected goals, with lowered self-worth).

  6. Biotin-dependent functions in adiposity: a study of monozygotic twin pairs.

    Science.gov (United States)

    Järvinen, E; Ismail, K; Muniandy, M; Bogl, L H; Heinonen, S; Tummers, M; Miettinen, S; Kaprio, J; Rissanen, A; Ollikainen, M; Pietiläinen, K H

    2016-05-01

    Biotin acts as a coenzyme for carboxylases regulating lipid and amino-acid metabolism. We investigated alterations of the biotin-dependent functions in obesity and the downstream effects of biotin restriction in adipocytes in vitro. Twenty-four monozygotic twin pairs discordant for body mass index (BMI). Mean within-pair difference (heavy-lean co-twin, Δ) of BMI was 6.0 kg m(-2) (range 3.1-15.2 kg m(-)(2)). Adipose tissue (AT) DNA methylation, gene expression of AT and adipocytes, and leukocytes (real-time quantitative PCR), serum biotin, C-reactive protein (CRP) and triglycerides were measured in the twins. Human adipocytes were cultured in low and control biotin concentrations and analyzed for lipid droplet content, mitochondrial morphology and mitochondrial respiration. The gene expression levels of carboxylases, PCCB and MCCC1, were upregulated in the heavier co-twins' leukocytes. ΔPCCB (r=0.91, P=0.0046) and ΔMCCC1 (r=0.79, P=0.036) correlated with ΔCRP within-pairs. Serum biotin levels were lower in the heavier (274 ng l(-1)) than in the lean co-twins (390 ng l(-1), P=0.034). ΔBiotin correlated negatively with Δtriglycerides (r=-0.56, P=0.045) within-pairs. In AT, HLCS and ACACB were hypermethylated and biotin cycle genes HLCS and BTD were downregulated (PBiotin-dependent carboxylases were downregulated (ACACA, ACACB, PCCB, MCCC2 and PC; Pbiotin had decreased lipid accumulation, altered mitochondrial morphology and deficient mitochondrial respiration. Biotin-dependent functions are modified by adiposity independent of genetic effects, and correlate with inflammation and hypertriglyceridemia. Biotin restriction decreases lipid accumulation and respiration, and alters mitochondrial morphology in adipocytes.

  7. A Danish population-based twin study on autism spectrum disorders

    DEFF Research Database (Denmark)

    Nordenbaek, Claudia; Jorgensen, Meta; Kyvik, Kirsten Ohm

    2014-01-01

    Genetic epidemiological studies of Autism Spectrum Disorders (ASDs) based on twin pairs ascertained from the population and thoroughly assessed to obtain a high degree of diagnostic validity are few. All twin pairs aged 3-14 years in the nationwide Danish Twin Registry were approached. A three......-step procedure was used. Five items from the "Child Behaviour Checklist" (CBCL) were used in the first screening phase, while screening in the second phase included the "Social and Communication Questionnaire" and the "Autism Spectrum Screening Questionnaire". The final clinical assessment was based on "gold...

  8. No Evidence of Genetic Mediation in the Association Between Birthweight and Academic Performance in 2,413 Danish Adolescent Twin Pairs

    DEFF Research Database (Denmark)

    Petersen, Inge; Jensen, Vibeke Myrup; McGue, Matt K.

    2009-01-01

    Abstract Evidence of a positive association between birthweight and IQ has been established in several studies. Analyses of within twin pair differences in birthweight and IQ have been used to shed light on the basis of the association. The strength of this approach is the possibility of controll...... and school achievements at age 16. For both sexes we observed a monotonic increase in academic performance with increasing percentiles of birthweight. However, we did not find that this association is due to genetic mediation....... twin studies find no evidence of such mediation. In the present study we use a large population-based national register study of 2,413 Danish twin-pairs from birth cohorts 1986-1990, of which we have zygosity information on 74%. We perform individual level as well as intra-pair analyses of birthweight...

  9. No evidence of genetic mediation in the association between birthweight and academic performance in 2,413 danish adolescent twin pairs

    DEFF Research Database (Denmark)

    Petersen, Inge; Jensen, Vibeke Myrup; McGue, Matt

    2009-01-01

    Abstract Evidence of a positive association between birthweight and IQ has been established in several studies. Analyses of within twin pair differences in birthweight and IQ have been used to shed light on the basis of the association. The strength of this approach is the possibility of controll...... and school achievements at age 16. For both sexes we observed a monotonic increase in academic performance with increasing percentiles of birthweight. However, we did not find that this association is due to genetic mediation....... twin studies find no evidence of such mediation. In the present study we use a large population-based national register study of 2,413 Danish twin-pairs from birth cohorts 1986-1990, of which we have zygosity information on 74%. We perform individual level as well as intra-pair analyses of birthweight...

  10. Prosocial and self-interested intra-twin pair behavior in monozygotic and dizygotic twins in the early to middle childhood transition.

    Science.gov (United States)

    Yirmiya, Karen; Segal, Nancy L; Bloch, Guy; Knafo-Noam, Ariel

    2018-04-06

    Several related and complementary theoretical frameworks have been proposed to explain the existence of prosocial behavior, despite its potential fitness cost to the individual. These include kin selection theory, proposing that organisms have a propensity to help those to whom they are genetically related, and reciprocity, referring to the benefit of being prosocial, depending on past and future mutual interactions. A useful paradigm to examine prosociality is to compare mean levels of this behavior between monozygotic (MZ) and dizygotic (DZ) twins. Here, we examined the performance of 883 6.5-year-old twins (139 MZ and 302 DZ same-sex 6.5-year-old full twin pairs) in the Differential Productivity Task. In this task, the twins' behaviors were observed under two conditions: working for themselves vs. working for their co-twin. There were no significant differences between the performances of MZ and DZ twins in the prosocial condition of the task. Correlations within the twin dyads were significantly higher in MZ than DZ twins in the self-interested condition. However, similar MZ and DZ correlations were found in the prosocial condition, supporting the role of reciprocity in twins' prosociality towards each other. © 2018 John Wiley & Sons Ltd.

  11. Genetic and Environmental Etiologies of Reading Difficulties: DeFries-Fulker Analysis of Reading Performance Data from Twin Pairs and Their Non-Twin Siblings

    Science.gov (United States)

    Astrom, Raven L.; Wadsworth, Sally J.; Olson, Richard K.; Willcutt, Erik G.; DeFries, John C.

    2012-01-01

    Reading performance data from 254 pairs of identical (MZ) and 420 pairs of fraternal (DZ) twins, 8.0 to 20.0 years of age, were subjected to multiple regression analyses. An extension of the DeFries-Fulker (DF) analysis (DeFries & Fulker, 1985, 1988) that facilitated inclusion of data from 303 of their nontwin siblings was employed. In addition to…

  12. A Possible Twin: The 1960s Twin Study Revisited/Twin Research: Twin-to-Twin Heart Transplantation; Distinguishing Monozygotic Twins; Twin Conceptions via Oocyte Donation; Factors Affecting Craniofacial Traits/In the Media: Triplet Delivery in the UK; Conjoined Twins and the Concept of Self; Colombian Twin Trainers; Skin Grafting to Save an Identical Co-Twin; Lack of Physical Flaws in Dolly the Cloned Sheep; Possible Conjoined Twins of Opposite-Sex; Passing of the Remaining Twin From the World's Longest Separated Pair.

    Science.gov (United States)

    Segal, Nancy L

    2018-04-01

    This article begins with the story of a 51-year-old Los Angeles, California man, Justin Goldberg, whose daughter caught a glimpse of his striking look-alike at a popular market. Many people have so-called doppelgängers, but this occurrence is especially intriguing - the individual in question, born in New York City in the mid-1960s to an unwed mother, was an adoptee placed by the Louise Wise Adoption Agency. This agency, under the guidance of a prominent psychiatrist, decided to place twins in separate homes. Some of these twin children were part of a controversial child development study that was hidden from them and their parents. Next, recent and current twin research on heart transplantation, distinguishing monozygotic co-twins, twin conceptions via oocyte donation and factors affecting craniofacial traits are summarized. The article concludes with highlights on twins in the media, specifically, a triplet delivery in the United Kingdom, self-concept and consciousness in conjoined twins, Colombian twin trainers, skin grafting to save an identical co-twin, lack of physical flaws in Dolly the cloned sheep, possible opposite-sex conjoined twins, and the passing of the remaining twin from the world's longest separated pair.

  13. Non-random X chromosome inactivation in an affected twin in a monozygotic twin pair discordant for Wiedemann-Beckwith syndrome

    Energy Technology Data Exchange (ETDEWEB)

    Oestavik, R.E.; Eiklid, K.; Oerstavik, K.H. [Ulleval Univ. Hospital, Oslo (Norway)] [and others

    1995-03-27

    Wiedemann-Beckwith syndrome (WBS) is a syndrome including exomphalos, macroglossia, and generalized overgrowth. The locus has been assigned to 11p15, and genomic imprinting may play a part in the expression of one or more genes involved. Most cases are sporadic. An excess of female monozygotic twins discordant for WBS have been reported, and it has been proposed that this excess could be related to the process of X chromosome inactivation. We have therefore studied X chromosome inactivation in 13-year-old monozygotic twin girls who were discordant for WBS. In addition, both twins had Tourette syndrome. The twins were monochorionic and therefore the result of a late twinning process. This has also been the case in previously reported discordant twin pairs with information on placentation. X chromosome inactivation was determined in DNA from peripheral blood cells by PCR analysis at the androgen receptor locus. The affected twin had a completely skewed X inactivation, where the paternal allele was on the active X chromosome in all cells. The unaffected twin had a moderately skewed X inactivation in the same direction, whereas the mother had a random pattern. Further studies are necessary to establish a possible association between the expression of WBS and X chromosome inactivation. 18 refs., 2 figs., 1 tab.

  14. [A 20-year follow-up study of a sample of 50 pairs of twins with neurotic-psychosomatic disorders].

    Science.gov (United States)

    Muhs, A; Schepank, H; Manz, R

    1990-01-01

    As part of a research project, examination was made of a sample of 50 pairs of twins (21 pairs of identical twins, 16 pairs of non-identical twins of the same sex, and 13 pairs of male-female twins [n = 100 test persons]) between 1963 and 1969 and again recently after a period of 20 years. The index twins were drawn from among the patients who made use of the services of an out-patient psychotherapeutic clinic, and they were determined to be either psychoneurotic, character neurotic, or psychosomatically ill. The question examined was again one of nature vs. nurture. Identical twins showed a significantly higher similarity with regard to the seriousness of their neuroses and the manifestation of neurotic symptoms than did non-identical twins. Noticeable similarities existed in cases of depressive disturbances, disturbances of oral and aggressive behavior, and disturbances of interpersonal contact. With regard to the influence of variables in the environment, we examined the effect of factors in early childhood on neurotic development. Lack of a reference person, a negative attitude on the part of parents toward the child, etc., frustration within and outside the family have an effect on the manifestation of neuroses and on the course of their development. The influence of early childhood factors on the degree of neurotic disorder is still to be noted in the current point prevalence.

  15. Pathological findings in dicephalus dipus dibrachius: implications for mechanisms in two pairs of lateral conjoined twins.

    Science.gov (United States)

    Itoh, K; Imai, Y; Obayashi, C; Hayashi, Y; Hanioka, K; Itoh, H

    1993-06-01

    The anatomical and pathological features of two pairs of dicephalic conjoined twins (case 1 and 2) are described. Both twins showed duplicitas lateralis representing diprosopus dipus dibrachius. There were two complete heads on two necks, one thorax, one abdomen and externally normal two arms and two legs. Case 1 showed dicephalus with anencephaly, two vertebral columns and two spinal cords, which converged from the thoracic region distally. The esophagus, stomachs and partial small intestines were duplicated, which fused at yolk sac (with Meckel's diverticulum). The heart was incompletely fused. The lungs and trachea were doubled. Two spinal cords were fused from the thoracic region caudally and showed myelomeningocele and Arnold-Chiari malformation in case 2. Two larynxes and two thracheas connected with the incompletely fused three lobes of lungs. The conjoined lungs were hypoplastic. The heart was single, showing ventral septal defect, transposition of great arteries, two cuspid aortic valves and preductal aortic coarctation. The duplicated esophagi were conjoined in Y-shape and single stomach, duodenum, intestine and colon were found. There were pairs of kidneys, adrenal glands and ureters and single female genitalia in both cases. These findings indicate that the craniocaudal paleoaxes were separated in the cranial region and converted or fused under the thoracic region like a Y-shape. Further development defects and deformations might be important factors to form malformations in these case.

  16. A population-based study of gastroesophageal reflux disease and sleep problems in elderly twins.

    Directory of Open Access Journals (Sweden)

    Anna Lindam

    Full Text Available BACKGROUND & AIMS: Previous studies indicate an association between sleep problems and gastroesophageal reflux disease (GERD. Although both these conditions separately have moderate heritabilities, confounding by genetic factors has not previously been taken into account. This study aimed to reveal the association between sleep problems and GERD, while adjusting for heredity and other potential confounding factors. METHODS: This cross-sectional population-based study included all 8,014 same-sexed twins of at least 65 years of age and born in Sweden between 1886 and 1958, who participated in telephone interviews in 1998-2002. Three logistic regression models were used 1 external control analysis, 2 within-pair co-twin analysis with dizygotic (DZ twin pairs discordant for GERD, and 3 within-pair co-twin analysis with monozygotic (MZ twin pairs discordant for GERD. Odds ratios (ORs with 95% confidence intervals (CIs were calculated and adjusted for established risk factors for GERD, i.e. sex, age, body mass index (BMI, tobacco smoking, and educational level. RESULTS: A dose-response association was identified between increasing levels of sleep problems and GERD in the external control analysis. Individuals who often experienced sleep problems had a two-fold increased occurrence of GERD compared to those who seldom had sleep problems (OR 2.0, 95% CI 1.8-2.4. The corresponding association was of similar strength in the co-twin analysis including 356 DZ pairs (OR 2.2, 95% CI 1.6-3.4, and in the co-twin analysis including 210 MZ pairs (OR 1.5, 95% CI 0.9-2.7. CONCLUSION: A dose-dependent association between sleep problems and GERD remains after taking heredity and other known risk factors for GERD into account.

  17. Differentially Methylated DNA Regions in Monozygotic Twin Pairs Discordant for Rheumatoid Arthritis

    DEFF Research Database (Denmark)

    Svendsen, Anders J; Gervin, Kristina; Lyle, Robert

    2016-01-01

    : Smoking was significantly associated with hypomethylation of a DMR overlapping the promoter region of the RNF5 and the AGPAT1, which are implicated in inflammation and autoimmunity, whereas DMARD treatment induced hypermethylation of the same region. Additionally, the promotor region of both S100A6......OBJECTIVES: In an explorative epigenome-wide association study (EWAS) to search for gene independent, differentially methylated DNA positions and regions (DMRs) associated with rheumatoid arthritis (RA) by studying monozygotic (MZ) twin pairs discordant for RA. METHODS: Genomic DNA was isolated......: We identified several differentially methylated regions associated with RA, which may represent environmental effects or consequences of the disease and plausible biological pathways pertinent to the pathogenesis of RA....

  18. Discordant tooth agenesis and peg-shaped in a pair of monozygotic twins: Clinical and molecular study

    Directory of Open Access Journals (Sweden)

    Lívia Azeredo Alves Antunes

    2013-01-01

    Full Text Available The present report aimed to study an uncommon case of a pair of twins that presented a discordant dental phenotype. Family investigation, clinical, radiographic examination and molecular analysis were performed in both girls. Molecular analysis confirmed the monozygosity by deoxyribonucleic acid chip technology. One twin presented tooth agenesis in left upper lateral incisor and peg-shaped on the contra lateral side while the other twin had no dental alterations. The dental casts study employed digital caliper to compare morphological dimensions and showed alteration only in peg-shaped tooth. In conclusion, this study provide support that one or more mutated gene could cause discordances in dental phenotype in these monozygotic twins.

  19. Estimating heritability for cause specific mortality based on twin studies

    DEFF Research Database (Denmark)

    Scheike, Thomas; Holst, Klaus Kähler; von Bornemann Hjelmborg, Jacob

    2014-01-01

    the Danish twin registry and discuss how to define heritability for cancer occurrence. The key point is that this should be done taking censoring as well as competing risks due to e.g.  death into account. We describe the dependence between twins on the probability scale and show that various models can...... be used to achieve sensible estimates of the dependence within monozygotic and dizygotic twin pairs that may vary over time. These dependence measures can subsequently be decomposed into a genetic and environmental component using random effects models. We here present several novel models that in essence...

  20. Study of 3-D stress development in parent and twin pairs of a hexagonal close-packed polycrystal: Part II – crystal plasticity finite element modeling

    International Nuclear Information System (INIS)

    Abdolvand, Hamidreza; Majkut, Marta; Oddershede, Jette; Wright, Jonathan P.; Daymond, Mark R.

    2015-01-01

    Stress heterogeneity within each individual grain of polycrystalline Zircaloy-2 is studied using a crystal plasticity finite element (CPFE) model. For this purpose, the weighted Voronoi tessellation method is used to construct 3D geometries of more than 2600 grains based on their center-of-mass positions and volumes as measured by three-dimensional X-ray diffraction (3DXRD) microscopy. The constructed microstructure is meshed with different element densities and for different numbers of grains. Then a selected group of twin and parent pairs are studied. It is shown that the measured average stress for each grain from the 3DXRD experiment is within the stress variation zone of the grain modeled in the CPFE simulation. Also, the CPFE average stress calculation for each grain is in good agreement with the measured average stress values. It is shown that upon considering the stress variations within each grain, stresses in the parent and twin are quite different if they are plotted in the global coordinate system. However, if the stress tensor is rotated into the local coordinate system of the twin habit plane, all the stress components averaged over the presented population are close, except for the shear acting on the twin plane and the transverse stress. This result is significant as it provides information needed to model such parent-twin interactions in crystal plasticity codes

  1. Gut resistome development in healthy twin pairs in the first year of life.

    Science.gov (United States)

    Moore, Aimee M; Ahmadi, Sara; Patel, Sanket; Gibson, Molly K; Wang, Bin; Ndao, Malick I; Deych, Elena; Shannon, William; Tarr, Phillip I; Warner, Barbara B; Dantas, Gautam

    2015-01-01

    The early life of the human host marks a critically important time for establishment of the gut microbial community, yet the developmental trajectory of gut community-encoded resistance genes (resistome) is unknown. We present a longitudinal study of the fecal antibiotic resistome of healthy amoxicillin-exposed and antibiotic-naive twins and their mothers during the first year of life. We extracted metagenomic DNA (mgDNA) from fecal samples collected from three healthy twin pairs at three timepoints (1 or 2 months, 6 or 7 months, and 11 months) and from their mothers (collected at delivery). The mgDNA was used to construct metagenomic expression libraries in an Escherichia coli host. These libraries were screened for antibiotic resistance, and functionally selected resistance genes were sequenced and annotated. A diverse fecal resistome distinct from the maternal resistome was apparent by 2 months of age, and infants' fecal resistomes included resistance to clinically important broad-spectrum beta-lactam antibiotics (e.g., piperacillin-tazobactam, aztreonam, cefepime) not found in their mothers. Dissemination of resistance genes among members of a given family was positively correlated with sharing of those same resistance genes between unrelated families, potentially identifying within-family sharing as a marker of resistance genes emerging in the human community at large. Finally, we found a distinct developmental trajectory for a community-encoded function: chloramphenicol resistance. All study subjects at all timepoints harbored chloramphenicol resistance determinants, but multidrug efflux pumps (rarely found in mothers) were the primary effectors of chloramphenicol resistance in young infants. Chloramphenicol acetyltransferases were more common in mothers than in infants and were found in nearly all the infants at later timepoints. Our results suggest that healthy 1-2-month-old infants' gut microbes harbor clinically relevant resistance genes distinct from

  2. Twin RSA

    OpenAIRE

    Lenstra, Arjen K.; Weger, De; Benjamin, M. M.

    2005-01-01

    We introduce Twin RSA, pairs of RSA moduli (n, n+ 2), and formulate several questions related to it. Our main questions are: is Twin RSA secure, and what is it good for? © Springer-Verlag Berlin Heidelberg 2005.

  3. Motives for and barriers to physical activity in twin pairs discordant for leisure time physical activity for 30 years.

    Science.gov (United States)

    Aaltonen, S; Leskinen, T; Morris, T; Alen, M; Kaprio, J; Liukkonen, J; Kujala, U

    2012-02-01

    Long-term persistent physical activity is important in the prevention of chronic diseases, but a large number of people do not participate in physical activity to obtain health benefits. The purpose of this study was to examine the motives and perceived barriers to long-term engagement in leisure time physical activity. Same-sex twin pairs (N=16, mean age 60) discordant for physical activity over 30 years were identified from the Finnish Twin Cohort. We evaluated participants' physical activity motivation with the 73-item Recreational Exercise Motivation Measure and assessed barriers to physical activity with a 25-item questionnaire. The characteristics of physical activity motivation and perceived barriers between the active and inactive co-twins were analysed using paired tests. Motives related to the sub-dimensions of enjoyment and physical fitness and psychological state were the most important reasons for participation in physical activity among all the twin individuals analysed. The sub-dimensions mastery (p=0.018, Cohen's d=0.76), physical fitness (p=0.029, Cohen's d=0.69), and psychological state (p=0.039, Cohen's d=0.65) differed significantly between active and inactive co-twins. More than half of the participants reported no reasons for not being physically active. If reasons existed, participation in physical activity was deterred mostly by pain and various health problems. This study found no differences in perceived barriers between active and inactive co-twins. We conclude from our results that the main factors promoting persistent leisure time physical activity were participants' wish to improve or maintain their physical skills or techniques, a feeling that exercise would improve their mental and physical health and that they found the activity enjoyable. This study helps us understand the importance of the role of motives and the minor role of perceived barriers for engagement in persistent physical activity. © Georg Thieme Verlag KG Stuttgart

  4. Ischiopagus and diprosopus in India: two pairs of conjoined twins perceived as incarnations of Hindu deities.

    Science.gov (United States)

    Tubbs, R Shane; Ditty, Benjamin; Bosmia, Anand N; Bosmia, Arpan N

    2015-02-01

    This article briefly reviews two specific types of conjoined twins, ischiopagus and diprosopus, and discusses recent cases of such twins born in India. Some members of the Hindu community worshiped these conjoined twins as incarnations of Hindu deities. In discussing this phenomenon, the authors aim to elucidate certain features of the faith tradition of Hinduism itself. The reception of these conjoined twins as incarnations of Hindu deities can be understood by examining two salient features of Hindu polytheism: the pictorial depiction of Hindu deities with multiple appendages and the concept of an incarnation, or avatar, of a Hindu deity.

  5. Nuchal translucency measurements are highly correlated in both mono- and dichorionic twin pairs

    DEFF Research Database (Denmark)

    Wøjdemann, Karen R; Larsen, Severin Olesen; Shalmi, Anne-Cathrine

    2006-01-01

    OBJECTIVES: To establish the distribution of serological and ultrasound first-trimester Down syndrome markers in twins and identify correlations of significance for risk calculation. METHODS: Nuchal translucency (NT), PAPP-A and betahCG data were extracted from 181 twin pregnancies (31 mono- and ...

  6. Autopsy Findings on a Pair of Dicephalic Parapagus Twins: A Case ...

    African Journals Online (AJOL)

    Conjoined twins are a rare occurrence that presents significant challenges to both parents and medical care givers with many theories being advanced to explain this occurrence.“Parapagus” is a fairly recent term, in which the twins lie side by side with ventro-lateral fusion and are extremely rare representing 0.5% of all ...

  7. Exploring Subclinical Phenotypic Features in Twin Pairs Discordant for Cleft Lip and Palate

    DEFF Research Database (Denmark)

    Leslie, Elizabeth J; Carlson, Jenna C; Cooper, Margaret E

    2017-01-01

    OBJECTIVE: Monozygotic twins of an individual with an orofacial cleft have a significantly elevated risk for orofacial cleft compared with the general population, but still the concordance rate for orofacial cleft in monozygotic twins is about 40% to 50%. The goal of this study was to determine w...

  8. Differences in frontal and limbic brain activation in a small sample of monozygotic twin pairs discordant for severe stressful life events

    Directory of Open Access Journals (Sweden)

    Detre A. Godinez

    2016-12-01

    Full Text Available Monozygotic twin pairs provide a valuable opportunity to control for genetic and shared environmental influences while studying the effects of nonshared environmental influences. The question we address with this design is whether monozygotic twins selected for discordance in exposure to severe stressful life events during development (before age 18 demonstrate differences in brain activation during performance of an emotional word-face Stroop task. In this study, functional magnetic resonance imaging was used to assess brain activation in eighteen young adult twins who were discordant in exposure to severe stress such that one twin had two or more severe events compared to their control co-twin who had no severe events. Twins who experienced higher levels of stress during development, compared to their control co-twins with lower stress, exhibited significant clusters of greater activation in the ventrolateral and medial prefrontal cortex, basal ganglia, and limbic regions. The control co-twins showed only the more typical recruitment of frontoparietal regions thought to be important for executive control of attention and maintenance of task goals. Behavioral performance was not significantly different between twins within pairs, suggesting the twins with stress recruited additional neural resources associated with affective processing and updating working memory when performing at the same level. This study provides a powerful glimpse at the potential effects of stress during development while accounting for shared genetic and environmental influences.

  9. The USC Adult Twin Cohorts: International Twin Study and California Twin Program.

    Science.gov (United States)

    Cozen, Wendy; Hwang, Amie E; Cockburn, Myles G; Hamilton, Ann S; Zadnick, John; Mack, Thomas M

    2013-02-01

    The study of twin subjects permits the documentation of crude heritability and may promote the identification of specific causal alleles. We believe that at the current time, the chief research advantage of twins as subjects, especially monozygotic twins, is that the commonality of their genetic and cultural identity simplifies the interpretation of biological associations. In order to study genetic and environmental determinants of cancer and chronic diseases, we developed two twin registries, maintained at the University of Southern California: The International Twin Study (ITS) and the California Twin Program (CTP). The ITS is a volunteer registry of twins with cancer and chronic disease consisting of 17,245 twin pairs affected by cancer and chronic disease, respectively, ascertained by advertising in periodicals from 1980-1991. The CTP is a population-based registry of California-born twin pairs ascertained by linking the California birth records to the State Department of Motor Vehicles. Over 51,000 individual California twins representing 36,965 pairs completed and returned 16-page questionnaires. Cancer diagnoses in the California twins are updated by regular linkage to the California Cancer Registry. Over 5,000 cancer patients are represented in the CTP. Twins from both registries have participated extensively in studies of breast cancer, melanoma, lymphoma, multiple sclerosis, systemic lupus erythematosus, diabetes mellitus type 1, mammographic density, smoking, and other traits and conditions.

  10. Genetic influences on exercise participation in 37.051 twin pairs from seven countries.

    NARCIS (Netherlands)

    Stubbe, J.H.; Boomsma, D.I.; Vink, J.M.; Cornes, B.; Martin, N.G.; Skytthe, A.; Kyvik, K.; Rose, R.J.; Kujala, U.; Kaprio, J.; Harris, J.R.; Pedersen, N.L.; Hunkin, J.; Spector, T.D.; de Geus, E.J.C.

    2006-01-01

    Background. A sedentary lifestyle remains a major threat to health in contemporary societies. To get more insight in the relative contribution of genetic and environmental influences on individual differences in exercise participation, twin samples from seven countries participating in the

  11. Low birth weight is associated with NIDDM in discordant monozygotic and dizygotic twin pairs

    DEFF Research Database (Denmark)

    Poulsen, P; Vaag, Allan; Kyvik, K O

    1997-01-01

    between the putative "NIDDM susceptibility genotype" and a genetically determined low weight at birth. It is also unclear whether differences in gestational age, maternal height, birth order and/or sex could explain the association. Twins are born of the same mother and have similar gestational ages......Previous studies have demonstrated an association between low weight at birth and risk of later development of non-insulin-dependent diabetes mellitus (NIDDM). It is not known whether this association is due to an impact of intrauterine malnutrition per se, or whether it is due to a coincidence....... Furthermore, monozygotic (MZ) twins have identical genotypes. Original midwife birth weight record determinations were traced in MZ and dizygotic (DZ) twins discordant for NIDDM. Birth weights were lower in the NIDDM twins (n = 2 x 14) compared with both their identical (MZ; n = 14) and non-identical (DZ; n...

  12. Basic Research on A-bomb exposed and nonexposed pair of twins and the pilot case study from socio-psycho-historical viewpoint

    International Nuclear Information System (INIS)

    Watanabe, Shoji; Satow, Yukio; Okamoto, Naomasa

    1980-01-01

    A-bomb exposed and nonexposed pair monozygotic twins were investigated. In all the cases, a pair of twins had great similarity in appearance and were connected firmly each other from their childhood. In family relations, each of them was required to take a role as the younger or the elder. Interview and psychological test suggested some psychological trauma in the exposed one compared with the other nonexposed. The mental state of the exposed is little understood even by the other half of twins who are in close relation. (Ueda, J.)

  13. Report on Pairing-based Cryptography.

    Science.gov (United States)

    Moody, Dustin; Peralta, Rene; Perlner, Ray; Regenscheid, Andrew; Roginsky, Allen; Chen, Lily

    2015-01-01

    This report summarizes study results on pairing-based cryptography. The main purpose of the study is to form NIST's position on standardizing and recommending pairing-based cryptography schemes currently published in research literature and standardized in other standard bodies. The report reviews the mathematical background of pairings. This includes topics such as pairing-friendly elliptic curves and how to compute various pairings. It includes a brief introduction to existing identity-based encryption (IBE) schemes and other cryptographic schemes using pairing technology. The report provides a complete study of the current status of standard activities on pairing-based cryptographic schemes. It explores different application scenarios for pairing-based cryptography schemes. As an important aspect of adopting pairing-based schemes, the report also considers the challenges inherent in validation testing of cryptographic algorithms and modules. Based on the study, the report suggests an approach for including pairing-based cryptography schemes in the NIST cryptographic toolkit. The report also outlines several questions that will require further study if this approach is followed.

  14. Functional and effective whole brain connectivity using magnetoencephalography to identify monozygotic twin pairs

    NARCIS (Netherlands)

    Demuru, M.; Gouw, A.; Hillebrand, A.; Stam, C J; van Dijk, B W; Scheltens, P.; Tijms, B.M.; Konijnenberg, E.; ten Kate-Booij, M.J.; den Braber, A; Smit, D J A; Boomsma, D I; Visser, P J

    2017-01-01

    Resting-state functional connectivity patterns are highly stable over time within subjects. This suggests that such 'functional fingerprints' may have strong genetic component. We investigated whether the functional (FC) or effective (EC) connectivity patterns of one monozygotic twin could be used

  15. Playing a Musical Instrument as a Protective Factor against Dementia and Cognitive Impairment: A Population-Based Twin Study.

    Science.gov (United States)

    Balbag, M Alison; Pedersen, Nancy L; Gatz, Margaret

    2014-01-01

    Increasing evidence supports that playing a musical instrument may benefit cognitive development and health at young ages. Whether playing an instrument provides protection against dementia has not been established. In a population-based cotwin control study, we examined the association between playing a musical instrument and whether or not the twins developed dementia or cognitive impairment. Participation in playing an instrument was taken from informant-based reports of twins' leisure activities. Dementia diagnoses were based on a complete clinical workup using standard diagnostic criteria. Among 157 twin pairs discordant for dementia and cognitive impairment, 27 pairs were discordant for playing an instrument. Controlling for sex, education, and physical activity, playing a musical instrument was significantly associated with less likelihood of dementia and cognitive impairment (odds ratio [OR] = 0.36 [95% confidence interval 0.13-0.99]). These findings support further consideration of music as a modifiable protective factor against dementia and cognitive impairment.

  16. The relationship between subjective well-being and mortality within discordant twin pairs from two independent samples

    DEFF Research Database (Denmark)

    Saunders, Gretchen R B; Elkins, Irene J; Christensen, Kaare

    2018-01-01

    Prior research has shown robust associations between greater subjective well-being (SWB) and reduced mortality. Whether this observed association is causal in nature or due instead to confounding genetic or environmental factors affecting both SWB and mortality is not well understood. We used a c...... when accounting for demographic factors, physical health, and cognitive functioning. (PsycINFO Database Record...... a combined sample of 6,802 twins drawn from two cohorts: the Longitudinal Study of Middle-Aged Danish Twins (MADT; N = 2,815, baseline age between 45 and 69 years, M = 56.8, SD = 6.4) and the Longitudinal Study of Aging Danish Twins (LSADT; N = 3,987, baseline age between 70 and 97 years, M = 76.6, SD = 4...... of SWB on reduced mortality remained significant within both MZ and DZ pairs, suggesting that the association is independent of genetic and nonshared environmental confounding factors. These findings, which generalized across both younger (MADT) and older (LSADT) cohorts of adults, remained significant...

  17. Hormone replacement therapy improves contractile function and myonuclear organization of single muscle fibres from postmenopausal monozygotic female twin pairs.

    Science.gov (United States)

    Qaisar, Rizwan; Renaud, Guillaume; Hedstrom, Yvette; Pöllänen, Eija; Ronkainen, Paula; Kaprio, Jaakko; Alen, Markku; Sipilä, Sarianna; Artemenko, Konstantin; Bergquist, Jonas; Kovanen, Vuokko; Larsson, Lars

    2013-05-01

    Ageing is associated with a decline in muscle mass and strength leading to increased physical dependency in old age. Postmenopausal women experience a greater decline than men of similar age in parallel with the decrease in female sex steroid hormone production. We recruited six monozygous female twin pairs (55-59 years old) where only one twin pair was on hormone replacement therapy (HRT use = 7.8 ± 4.3 years) to investigate the association of HRT with the cytoplasmic volume supported by individual myonuclei (myonuclear domain (MND) size,) together with specific force at the single fibre level. HRT use was associated with a significantly smaller (∼27%; P muscle fibres expressing the type I but not the IIa myosin heavy chain (MyHC) isoform. In comparison to non-users, higher specific force was recorded in HRT users both in muscle fibres expressing type I (∼27%; P fibre-type dependent, i.e. the higher specific force in fast-twitch muscle fibres was primarily caused by higher force per cross-bridge while slow-twitch fibres relied on both a higher number and force per cross-bridge. HRT use had no effect on fibre cross-sectional area (CSA), velocity of unloaded shortening (V0) and relative proportion of MyHC isoforms. In conclusion, HRT appears to have significant positive effects on both regulation of muscle contraction and myonuclei organization in postmenopausal women.

  18. The Qingdao Twin Registry

    DEFF Research Database (Denmark)

    Duan, Haiping; Ning, Feng; Zhang, Dongfeng

    2013-01-01

    In 1998, the Qingdao Twin Registry was initiated as the main part of the Chinese National Twin Registry. By 2005, a total of 10,655 twin pairs had been recruited. Since then new twin cohorts have been sampled, with one longitudinal cohort of adolescent twins selected to explore determinants of me...

  19. Genetic and environmental etiologies of reading difficulties: DeFries-Fulker analysis of reading performance data from twin pairs and their nontwin siblings

    OpenAIRE

    Astrom, Raven L.; Wadsworth, Sally J.; Olson, Richard K.; Willcutt, Erik G.; DeFries, John C.

    2012-01-01

    Reading performance data from 254 pairs of identical (MZ) and 420 pairs of fraternal (DZ) twins, 8.0 to 20.0 years of age, were subjected to multiple regression analyses. An extension of the DeFries-Fulker (DF) analysis (DeFries & Fulker, 1985, 1988) that facilitated inclusion of data from 303 of their nontwin siblings was employed. In addition to providing estimates of heritability, this analysis yields a test of the difference between shared environmental influences for twins versus sibling...

  20. Genetic influences on exercise participation in 37,051 twin pairs from seven countries.

    Directory of Open Access Journals (Sweden)

    Janine H Stubbe

    2006-12-01

    Full Text Available A sedentary lifestyle remains a major threat to health in contemporary societies. To get more insight in the relative contribution of genetic and environmental influences on individual differences in exercise participation, twin samples from seven countries participating in the GenomEUtwin project were used.Self-reported data on leisure time exercise behavior from Australia, Denmark, Finland, Norway, The Netherlands, Sweden and United Kingdom were used to create a comparable index of exercise participation in each country (60 minutes weekly at a minimum intensity of four metabolic equivalents.Modest geographical variation in exercise participation was revealed in 85,198 subjects, aged 19-40 years. Modeling of monozygotic and dizygotic twin resemblance showed that genetic effects play an important role in explaining individual differences in exercise participation in each country. Shared environmental effects played no role except for Norwegian males. Heritability of exercise participation in males and females was similar and ranged from 48% to 71% (excluding Norwegian males.Genetic variation is important in individual exercise behavior and may involve genes influencing the acute mood effects of exercise, high exercise ability, high weight loss ability, and personality. This collaborative study suggests that attempts to find genes influencing exercise participation can pool exercise data across multiple countries and different instruments.

  1. Factors that affect skin aging: a cohort-based survey on twins.

    Science.gov (United States)

    Martires, Kathryn J; Fu, Pingfu; Polster, Amy M; Cooper, Kevin D; Baron, Elma D

    2009-12-01

    To identify environmental factors that correlate with skin photoaging, controlling for genetic susceptibility by using a questionnaire administered to twins. The survey collected information about each participant's Fitzpatrick type, history of skin cancer, smoking and drinking habits, and weight from a cohort of twins. Clinicians then assigned a clinical photodamage score to each participant. The annual Twins Days Festival in Twinsburg, Ohio. A voluntary cohort of twins from the general community, mostly from Ohio, Pennsylvania, and the northeastern United States. The survey was completed on a voluntary basis by sets of monozygotic (MZ) and dizygotic (DZ) twins. A total of 130 surveys taken by 65 complete twin pairs were analyzed. Skin aging was assessed using a validated photographic scale of photodamage, graded by such characteristics as wrinkling and pigmentation change. Photodamage scores among twins of a pair, whether MZ or DZ, were highly correlated (P = .92). Factors found to predict higher photodamage include history of skin cancer (P < .001), zygosity status (MZ vs DZ) (P = .001), weight (P = .02), and cigarette smoking (P = .046). Alcohol consumption was significantly associated with lower photodamage scores (P = .003). The study of twins provides a unique opportunity to control for genetic susceptibility in order to elucidate environmental influences on skin aging. The relationships found between smoking, weight, sunscreen use, skin cancer, and photodamage in these twin pairs may help to motivate the reduction of risky behaviors.

  2. Evidences of extragalactic origin and planet engulfment in the metal-poor twin pair HD 134439/HD 134440

    Science.gov (United States)

    Reggiani, Henrique; Meléndez, Jorge

    2018-04-01

    Recent studies of chemical abundances in metal-poor halo stars show the existence of different populations, which is important for studies of Galaxy formation and evolution. Here, we revisit the twin pair of chemically anomalous stars HD 134439 and HD 134440, using high resolution (R ˜ 72 000) and high S/N ratio (S/N ˜ 250) HDS/Subaru spectra. We compare them to the well-studied halo star HD 103095, using the line-by-line differential technique to estimate precise stellar parameters and LTE chemical abundances. We present the abundances of C, O, Na, Mg, Si, Ca, Sc, Ti, V, Cr, Mn, Co, Ni, Cu, Zn, Sr, Y, Ba, La, Ce, Nd, and Sm. We compare our results to the precise abundance patterns of Nissen & Schuster (2010) and data from dwarf Spheroidal galaxies (dSphs). We show that the abundance pattern of these stars appears to be closely linked to that of dSphs with [α/Fe] knee below [Fe/H] < -1.5. We also find a systematic difference of 0.06 ± 0.01 dex between the abundances of these twin binary stars, which could be explained by the engulfment of a planet, thus suggesting that planet formation is possible at low metallicities ([Fe/H] = -1.4).

  3. Absence of Substantial Copy Number Differences in a Pair of Monozygotic Twins Discordant for Features of Autism Spectrum Disorder

    Directory of Open Access Journals (Sweden)

    Marina Laplana

    2014-01-01

    Full Text Available Autism spectrum disorder (ASD is a highly heritable disease (~0.9 with a complex genetic etiology. It is initially characterized by altered cognitive ability which commonly includes impaired language and communication skills as well as fundamental deficits in social interaction. Despite the large amount of studies described so far, the high clinical diversity affecting the autism phenotype remains poorly explained. Recent studies suggest that rare genomic variations, in particular copy number variation (CNV, may account for a significant proportion of the genetic basis of ASD. The use of disease-discordant monozygotic twins represents a powerful strategy to identify de novo and inherited CNV in the disorder. Here we present the results of a comparative genome hybridization (CGH analysis with a pair of monozygotic twins affected of ASD with significant differences in their clinical manifestations that specially affect speech language impairment and communication skills. Array CGH was performed in three different tissues: blood, saliva, and hair follicle, in an attempt to identify germinal and somatic CNV regions that may explain these differences. Our results argue against a role of large CNV rearrangements as a molecular etiology of the observed differences. This forwards future research to explore de novo point mutation and epigenomic alterations as potential explanations of the observed clinical differences.

  4. Study of 3-D stress development in parent and twin pairs of a hexagonal close-packed polycrystal: Part II - Crystal plasticity finite element modeling

    DEFF Research Database (Denmark)

    Abdolvand, Hamidreza; Majkut, Marta; Oddershede, Jette

    2015-01-01

    for each grain from the 3DXRD experiment is within the stress variation zone of the grain modeled in the CPFE simulation. Also, the CPFE average stress calculation for each grain is in good agreement with the measured average stress values. It is shown that upon considering the stress variations within......Stress heterogeneity within each individual grain of polycrystalline Zircaloy-2 is studied using a crystal plasticity finite element (CPFE) model. For this purpose, the weighted Voronoi tessellation method is used to construct 3D geometries of more than 2600 grains based on their center......-of-mass positions and volumes as measured by three-dimensional X-ray diffraction (3DXRD) microscopy. The constructed microstructure is meshed with different element densities and for different numbers of grains. Then a selected group of twin and parent pairs are studied. It is shown that the measured average stress...

  5. A population-based twin study of self-esteem and gender.

    Science.gov (United States)

    Kendler, K S; Gardner, C O; Prescott, C A

    1998-11-01

    Self-esteem (SE), a widely used construct in the social sciences, is usually conceptualized as a reflection of socialization and interpersonal experiences that may differ considerably between the genders. The Rosenberg self-esteem scale was assessed at personal interview in both members of 3793 unselected twin pairs (1517 male-male, 856 female-female and 1420 male-female) from the population-based Virginia Twin Registry. Gender effects on SE were assessed by both analysis of variance and biometrical twin modelling. The mean SE score was slightly but significantly lower in women v. men, and in women who grew up with a male v. a female co-twin. Twin modelling suggested that: (i) individual differences in self-esteem in both men and women were best explained by genetic and individual-specific environment factors; (ii) heritability estimates were similar in women (32%) and in men (29%); and (iii) the same genetic factors that influenced SE in women also influenced SE in men. Analyses supported the validity of the equal environment assumption for SE. The heritability of SE cannot be explained by the moderate correlation between SE and symptoms of depression. These results are inconsistent with prominent gender-related aetiological models for SE, which postulate that individual differences arise from socialization experiences both within and outside the home of origin which differ widely for the two genders. Instead, a significant proportion of the population variance in SE is due to genetically-influenced temperamental variables that are the same in men and women.

  6. Kinetics of 3H-serotonin uptake by platelets in infantile autism and developmental language disorder (including five pairs of twins)

    International Nuclear Information System (INIS)

    Katsui, T.; Okuda, M.; Usuda, S.; Koizumi, T.

    1986-01-01

    The kinetics of 5-HT uptake by platelets was studied in cases of infantile autism and developmental language disorder (DLD) and normal subjects. Two patients of the autism group were twins, and the seven patients of the DLD group were members of four pairs of twins. The Vmax values (means +/- SD) for autism and DLD were 6.46 +/- .90 pmol 5-HT/10(7) cells/min and 4.85 +/- 1.50 pmol 5-HT/10(7) cells/min, respectively. These values were both significantly higher than that of 2.25 +/- .97 pmole 5-HT/10(7) cells/min for normal children. The Km values of the three groups were not significantly different. Data on the five pairs of twins examined suggested that the elevated Vmax of 5-HT uptake by platelets was determined genetically

  7. Aggregation of thyroid autoantibodies in twins from opposite-sex pairs suggests that microchimerism may play a role in the early stages of thyroid autoimmunity

    DEFF Research Database (Denmark)

    Brix, Thomas Heiberg; Hansen, Pia Skov; Kyvik, Kirsten Ohm

    2009-01-01

    to play a role in the pathogenesis of thyroid autoimmunity. In that case, twins from opposite-sex pairs (OS) should have an increased risk of thyroid autoantibodies (TA). AIM: The aim of the study was to compare the frequency of TA in twin individuals from OS and monozygotic (MZ) twin pairs. Design...... positive if greater than 60 U/ml, greater than 60 U/ml, and greater than 1.0 U/liter, respectively. RESULTS: The frequency of TPOAb, TgAb, and TSHRAb among female cases was 15.0, 5.0, and 4.2%, respectively, which was higher than the corresponding prevalences in the female control population: 7.4% (P = 0...

  8. Kinetics of 3H-serotonin uptake by platelets in infantile autism and developmental language disorder (including five pairs of twins)

    Energy Technology Data Exchange (ETDEWEB)

    Katsui, T.; Okuda, M.; Usuda, S.; Koizumi, T.

    1986-03-01

    The kinetics of 5-HT uptake by platelets was studied in cases of infantile autism and developmental language disorder (DLD) and normal subjects. Two patients of the autism group were twins, and the seven patients of the DLD group were members of four pairs of twins. The Vmax values (means +/- SD) for autism and DLD were 6.46 +/- .90 pmol 5-HT/10(7) cells/min and 4.85 +/- 1.50 pmol 5-HT/10(7) cells/min, respectively. These values were both significantly higher than that of 2.25 +/- .97 pmole 5-HT/10(7) cells/min for normal children. The Km values of the three groups were not significantly different. Data on the five pairs of twins examined suggested that the elevated Vmax of 5-HT uptake by platelets was determined genetically.

  9. Using Twins to Better Understand Sibling Relationships.

    Science.gov (United States)

    Mark, Katharine M; Pike, Alison; Latham, Rachel M; Oliver, Bonamy R

    2017-03-01

    We compared the nature of the sibling relationship in dyads of varying genetic relatedness, employing a behavioural genetic design to estimate the contribution that genes and the environment have on this familial bond. Two samples were used-the Sisters and Brothers Study consisted of 173 families with two target non-twin children (mean ages = 7.42 and 5.22 years respectively); and the Twins, Family and Behaviour study included 234 families with two target twin children (mean age = 4.70 years). Mothers and fathers reported on their children's relationship with each other, via a postal questionnaire (the Sisters and Brothers Study) or a telephone interview (the Twins, Family and Behaviour study). Contrary to expectations, no mean level differences emerged when monozygotic twin pairs, dizygotic twin pairs, and non-twin pairs were compared on their sibling relationship quality. Behavioural genetic analyses also revealed that the sibling bond was modestly to moderately influenced by the genetic propensities of the children within the dyad, and moderately to substantially influenced by the shared environment common to both siblings. In addition, for sibling negativity, we found evidence of twin-specific environmental influence-dizygotic twins showed more reciprocity than did non-twins. Our findings have repercussions for the broader application of results from future twin-based investigations.

  10. Cervical column morphology and craniofacial profiles in monozygotic twins.

    Science.gov (United States)

    Sonnesen, Liselotte; Pallisgaard, Carsten; Kjaer, Inger

    2008-02-01

    Previous studies have described the relationships between cervical column morphology and craniofacial morphology. The aims of the present study were to describe cervical column morphology in 38 pairs of adult monozygotic (MZ) twins, and compare craniofacial morphology in twins with fusions with craniofacial morphology in twins without fusion. Visual assessment of cervical column morphology and cephalometric measurements of craniofacial morphology were performed on profile radiographs. In the cervical column, fusion between corpora of the second and third vertebrae was registered as fusion. In the twin group, 8 twin pairs had fusion of the cervical column in both individuals within the pair (sub-group A), 25 pairs had no fusions (subgroup B), and in 5 pairs, cervical column morphology was different within the pair (subgroup C), as one twin had fusion and the other did not. Comparison of craniofacial profiles showed a tendency to increased jaw retrognathia, larger cranial base angle, and larger mandibular inclination in subgroup A than in subgroup B. The same tendency was observed within subgroup C between the individual twins with fusion compared with those without fusion. These results confirm that cervical fusions and craniofacial morphology may be interrelated in twins when analysed on profile radiographs. The study also documents that differences in cervical column morphology can occur in individuals within a pair of MZ twins. It illustrates that differences in craniofacial morphology between individuals within a pair of MZ twins can be associated with cervical fusion.

  11. Heritability of psoriasis in a large twin sample

    DEFF Research Database (Denmark)

    Lønnberg, Ann Sophie; Skov, Liselotte; Skytthe, A

    2013-01-01

    AIM: To study the concordance of psoriasis in a population-based twin sample. METHODS: Data on psoriasis in 10,725 twin pairs, 20-71 years of age, from the Danish Twin Registry was collected via a questionnaire survey. The concordance and heritability of psoriasis were estimated. RESULTS: In total...

  12. Radical-pair based avian magnetoreception

    Science.gov (United States)

    Procopio, Maria; Ritz, Thorsten

    2014-03-01

    Behavioural experiments suggest that migratory birds possess a magnetic compass sensor able to detect the direction of the geomagnetic. One hypothesis for the basis of this remarkable sensory ability is that the coherent quantum spin dynamics of photoinduced radical pair reactions transduces directional magnetic information from the geomagnetic field into changes of reaction yields, possibly involving the photoreceptor cryptochrome in the birds retina. The suggested radical-pair based avian magnetoreception has attracted attention in the field of quantum biology as an example of a biological sensor which might exploit quantum coherences for its biological function. Investigations on such a spin-based sensor have focussed on uncovering the design features for the design of a biomimetic magnetic field sensor. We study the effects of slow fluctuations in the nuclear spin environment on the directional signal. We quantitatively evaluate the robustness of signals under fluctuations on a timescale longer than the lifetime of a radical pair, utilizing two models of radical pairs. Our results suggest design principles for building a radical-pair based compass sensor that is both robust and highly directional sensitive.

  13. Base pair probability estimates improve the prediction accuracy of RNA non-canonical base pairs.

    Directory of Open Access Journals (Sweden)

    Michael F Sloma

    2017-11-01

    Full Text Available Prediction of RNA tertiary structure from sequence is an important problem, but generating accurate structure models for even short sequences remains difficult. Predictions of RNA tertiary structure tend to be least accurate in loop regions, where non-canonical pairs are important for determining the details of structure. Non-canonical pairs can be predicted using a knowledge-based model of structure that scores nucleotide cyclic motifs, or NCMs. In this work, a partition function algorithm is introduced that allows the estimation of base pairing probabilities for both canonical and non-canonical interactions. Pairs that are predicted to be probable are more likely to be found in the true structure than pairs of lower probability. Pair probability estimates can be further improved by predicting the structure conserved across multiple homologous sequences using the TurboFold algorithm. These pairing probabilities, used in concert with prior knowledge of the canonical secondary structure, allow accurate inference of non-canonical pairs, an important step towards accurate prediction of the full tertiary structure. Software to predict non-canonical base pairs and pairing probabilities is now provided as part of the RNAstructure software package.

  14. Base pair probability estimates improve the prediction accuracy of RNA non-canonical base pairs.

    Science.gov (United States)

    Sloma, Michael F; Mathews, David H

    2017-11-01

    Prediction of RNA tertiary structure from sequence is an important problem, but generating accurate structure models for even short sequences remains difficult. Predictions of RNA tertiary structure tend to be least accurate in loop regions, where non-canonical pairs are important for determining the details of structure. Non-canonical pairs can be predicted using a knowledge-based model of structure that scores nucleotide cyclic motifs, or NCMs. In this work, a partition function algorithm is introduced that allows the estimation of base pairing probabilities for both canonical and non-canonical interactions. Pairs that are predicted to be probable are more likely to be found in the true structure than pairs of lower probability. Pair probability estimates can be further improved by predicting the structure conserved across multiple homologous sequences using the TurboFold algorithm. These pairing probabilities, used in concert with prior knowledge of the canonical secondary structure, allow accurate inference of non-canonical pairs, an important step towards accurate prediction of the full tertiary structure. Software to predict non-canonical base pairs and pairing probabilities is now provided as part of the RNAstructure software package.

  15. Migraine and risk of stroke: a national population-based twin study.

    Science.gov (United States)

    Lantz, Maria; Sieurin, Johanna; Sjölander, Arvid; Waldenlind, Elisabet; Sjöstrand, Christina; Wirdefeldt, Karin

    2017-10-01

    Numerous studies have indicated an increased risk for stroke in patients with migraine, especially migraine with aura; however, many studies used self-reported migraine and only a few controlled for familial factors. We aimed to investigate migraine as a risk factor for stroke in a Swedish population-based twin cohort, and whether familial factors contribute to an increased risk. The study population included twins without prior cerebrovascular disease who answered a headache questionnaire during 1998 and 2002 for twins born 1935-58 and during 2005-06 for twins born between 1959 and 1985. Migraine with and without aura and probable migraine was defined by an algorithm mapping on to clinical diagnostic criteria according to the International Classification of Headache Disorders. Stroke diagnoses were obtained from the national patient and cause of death registers. Twins were followed longitudinally, by linkage of national registers, from date of interview until date of first stroke, death, or end of study on 31 Dec 2014. In total, 8635 twins had any migraineous headache, whereof 3553 had migraine with aura and 5082 had non-aura migraineous headache (including migraine without aura and probable migraine), and 44 769 twins had no migraine. During a mean follow-up time of 11.9 years we observed 1297 incident cases of stroke. The Cox proportional hazards model with attained age as underlying time scale was used to estimate hazard ratios with 95% confidence intervals for stroke including ischaemic and haemorrhagic subtypes related to migraine with aura, non-aura migraineous headache, and any migraineous headache. Analyses were adjusted for gender and cardiovascular risk factors. Where appropriate; within-pair analyses were performed to control for confounding by familial factors. The age- and gender-adjusted hazard ratio for stroke related to migraine with aura was 1.27 (95% confidence interval 1.00-1.62), P = 0.05, and 1.07 (95% confidence interval 0.91-1.26), P = 0

  16. A comparison of anthropometric, metabolic and reproductive characteristics of young adult women from opposite-sex and same sex twin pairs

    Directory of Open Access Journals (Sweden)

    Pirkko eKorsoff

    2014-03-01

    Full Text Available Background: Prenatal exposure to androgens has been linked to masculinization of several traits. We aimed to determine whether putative female intra-uterine exposure to androgens influences PCOS-related phenotypes, including anthropometric, metabolic and reproductive parameters using a twin design.Methods: Two cohorts of Finnish twins born in 1975-1979 and 1983-1987 formed the basis for the longitudinal FinnTwin16 (FT16 and FinnTwin12 (FT12 studies. Self-reported anthropometric characteristics, disease status and reproductive history were compared between 679 same-sex (SS and 789 opposite-sex (OS female twins (mean age ± SD: 34 ± 1.1 from the wave 5 of data collection in FT16. Serum lipid and lipoprotein subclass concentrations measured by nuclear magnetic resonance spectroscopy were compared in 226 SS and 169 OS female twins (mean age ± SD: 24 ± 2.1 from wave 4 of data collection in FT12 and FT16. Results: Anthropometric measures, the prevalence of hypertension and diabetes mellitus type 2 did not differ significantly between females from SS and OS twin pairs at age 34. Similarly, the prevalence of infertility, age at first pregnancy and number of induced and spontaneous abortions did not differ significantly between these two groups of women. The serum lipid and lipoprotein profile did not differ between females from SS and OS twins at age 24. Conclusion: We found no evidence that androgen overexposure of the female fetus affects obesity, metabolic profile or reproductive health in young adult females. However, these results do not exclude the possibility that prenatal androgen exposure in females could be adversely associated with intermediate phenotypes of PCOS later in life.

  17. Metal-mediated DNA base pairing: alternatives to hydrogen-bonded Watson-Crick base pairs.

    Science.gov (United States)

    Takezawa, Yusuke; Shionoya, Mitsuhiko

    2012-12-18

    With its capacity to store and transfer the genetic information within a sequence of monomers, DNA forms its central role in chemical evolution through replication and amplification. This elegant behavior is largely based on highly specific molecular recognition between nucleobases through the specific hydrogen bonds in the Watson-Crick base pairing system. While the native base pairs have been amazingly sophisticated through the long history of evolution, synthetic chemists have devoted considerable efforts to create alternative base pairing systems in recent decades. Most of these new systems were designed based on the shape complementarity of the pairs or the rearrangement of hydrogen-bonding patterns. We wondered whether metal coordination could serve as an alternative driving force for DNA base pairing and why hydrogen bonding was selected on Earth in the course of molecular evolution. Therefore, we envisioned an alternative design strategy: we replaced hydrogen bonding with another important scheme in biological systems, metal-coordination bonding. In this Account, we provide an overview of the chemistry of metal-mediated base pairing including basic concepts, molecular design, characteristic structures and properties, and possible applications of DNA-based molecular systems. We describe several examples of artificial metal-mediated base pairs, such as Cu(2+)-mediated hydroxypyridone base pair, H-Cu(2+)-H (where H denotes a hydroxypyridone-bearing nucleoside), developed by us and other researchers. To design the metallo-base pairs we carefully chose appropriate combinations of ligand-bearing nucleosides and metal ions. As expected from their stronger bonding through metal coordination, DNA duplexes possessing metallo-base pairs exhibited higher thermal stability than natural hydrogen-bonded DNAs. Furthermore, we could also use metal-mediated base pairs to construct or induce other high-order structures. These features could lead to metal-responsive functional

  18. Gray and white matter density changes in monozygotic and same-sex dizygotic twins discordant for schizophrenia using voxel-based morphometry

    DEFF Research Database (Denmark)

    Hulshoff Pol, HE; Schnack, HG; Mandl, RC

    2006-01-01

    Global gray matter brain tissue volume decreases in schizophrenia have been associated to disease-related (possibly nongenetic) factors. Global white matter brain tissue volume decreases were related to genetic risk factors for the disease. However, which focal gray and white matter brain regions...... best reflect the genetic and environmental risk factors in the brains of patients with schizophrenia remains unresolved. 1.5-T MRI brain scans of 11 monozygotic and 11 same-sex dizygotic twin-pairs discordant for schizophrenia were compared to 11 monozygotic and 11 same-sex dizygotic healthy control...... twin-pairs using voxel-based morphometry. Linear regression analysis was done in each voxel for the average and difference in gray and white matter density separately, in each twin-pair, with group (discordant, healthy) and zygosity (monozygotic, dizygotic) as between subject variables, and age, sex...

  19. The utility of twins in developmental cognitive neuroscience research: How twins strengthen the ABCD research design.

    Science.gov (United States)

    Iacono, William G; Heath, Andrew C; Hewitt, John K; Neale, Michael C; Banich, Marie T; Luciana, Monica M; Madden, Pamela A; Barch, Deanna M; Bjork, James M

    2018-08-01

    The ABCD twin study will elucidate the genetic and environmental contributions to a wide range of mental and physical health outcomes in children, including substance use, brain and behavioral development, and their interrelationship. Comparisons within and between monozygotic and dizygotic twin pairs, further powered by multiple assessments, provide information about genetic and environmental contributions to developmental associations, and enable stronger tests of causal hypotheses, than do comparisons involving unrelated children. Thus a sub-study of 800 pairs of same-sex twins was embedded within the overall Adolescent Brain and Cognitive Development (ABCD) design. The ABCD Twin Hub comprises four leading centers for twin research in Minnesota, Colorado, Virginia, and Missouri. Each site is enrolling 200 twin pairs, as well as singletons. The twins are recruited from registries of all twin births in each State during 2006-2008. Singletons at each site are recruited following the same school-based procedures as the rest of the ABCD study. This paper describes the background and rationale for the ABCD twin study, the ascertainment of twin pairs and implementation strategy at each site, and the details of the proposed analytic strategies to quantify genetic and environmental influences and test hypotheses critical to the aims of the ABCD study. Copyright © 2017 The Authors. Published by Elsevier Ltd.. All rights reserved.

  20. Effect of birth order on neonatal morbidity and mortality among very low birthweight twins: a population based study

    Science.gov (United States)

    Shinwell, E; Blickstein, I; Lusky, A; Reichman, B

    2004-01-01

    Objective: To study the effect of birth order on the risk for respiratory distress syndrome (RDS), chronic lung disease (CLD), adverse neurological findings, and death in very low birthweight (VLBW; < 1500 g) twins. Methods: A population based study of VLBW infants from the Israel National VLBW Infant Database. The sample included all complete sets of VLBW twin pairs admitted to all 28 neonatal intensive care units between 1995 and 1999. Outcome variables were compared by birth order and stratified by mode of delivery and gestational age, using General Estimating Equation models, with results expressed as odds ratio (OR) with 95% confidence interval (CI). Results: Second twins were at increased risk for RDS (OR 1.51, 95% CI 1.29 to 1.76), CLD (OR 1.36, 95% CI 1.11 to 1.66), and death (OR 1.24, 95% CI 1.02 to 1.51) but not for adverse neurological findings (OR 1.20, 95% CI 0.91 to 1.60). Mode of delivery did not significantly influence outcome. The odds ratio for RDS in the second twin was inversely related to gestational age, and the increased risk for RDS and CLD was found in both vaginal and caesarean deliveries. Conclusions: VLBW second twins are at increased risk for acute and chronic lung disease and neonatal mortality, irrespective of mode of delivery. PMID:14977899

  1. Signature scheme based on bilinear pairs

    Science.gov (United States)

    Tong, Rui Y.; Geng, Yong J.

    2013-03-01

    An identity-based signature scheme is proposed by using bilinear pairs technology. The scheme uses user's identity information as public key such as email address, IP address, telephone number so that it erases the cost of forming and managing public key infrastructure and avoids the problem of user private generating center generating forgery signature by using CL-PKC framework to generate user's private key.

  2. An elasto-plastic self-consistent model with hardening based on dislocation density, twinning and de-twinning: Application to strain path changes in HCP metals

    International Nuclear Information System (INIS)

    Zecevic, Milovan; Knezevic, Marko; Beyerlein, Irene J.; Tomé, Carlos N.

    2015-01-01

    In this work, we develop a polycrystal mean-field constitutive model based on an elastic–plastic self-consistent (EPSC) framework. In this model, we incorporate recently developed subgrain models for dislocation density evolution with thermally activated slip, twin activation via statistical stress fluctuations, reoriented twin domains within the grain and associated stress relaxation, twin boundary hardening, and de-twinning. The model is applied to a systematic set of strain path change tests on pure beryllium (Be). Under the applied deformation conditions, Be deforms by multiple slip modes and deformation twinning and thereby provides a challenging test for model validation. With a single set of material parameters, determined using the flow-stress vs. strain responses during monotonic testing, the model predicts well the evolution of texture, lattice strains, and twinning. With further analysis, we demonstrate the significant influence of internal residual stresses on (1) the flow stress drop when reloading from one path to another, (2) deformation twin activation, (3) de-twinning during a reversal strain path change, and (4) the formation of additional twin variants during a cross-loading sequence. The model presented here can, in principle, be applied to other metals, deforming by multiple slip and twinning modes under a wide range of temperature, strain rate, and strain path conditions

  3. Theoretical analysis of noncanonical base pairing interactions in ...

    Indian Academy of Sciences (India)

    PRAKASH KUMAR

    Noncanonical base pairs in RNA have strong structural and functional implications but are currently not considered ..... Full optimizations of the systems were also carried out using ... of the individual bases in the base pair through the equation.

  4. Musical Interests and Talent: Twin Jazz Musicians and Twin Studies/Twin Research: Loss of a Preterm Multiple; Conjoined Twin Conception; Depression in Fathers of Twins; Twin-to-Twin Transfusion Syndrome/Twin News: High-Achieving Twins; Twin Children of a Tennis Star; Conjoined Twin Separation; Twin Delivery to a Giant Panda.

    Science.gov (United States)

    Segal, Nancy L

    2017-12-01

    Findings from twin studies of musical interests and talent are reviewed as a backdrop to the lives and careers of twin jazz musicians, Peter and Will Anderson. The Anderson twins exemplify many aspects of twin research, namely their matched musical abilities, shared musical interests, and common career. This overview is followed by reviews of studies and case reports of bereavement in families who have lost a preterm multiple birth infant, the conception of conjoined twins following in vitro fertilization (IVF), depression in fathers of twins, and twin-to-twin transfusion incidence in monochorionic-diamniotic IVF twin pairs. Twins highlighted in the media include high-achieving identical female twins with nearly identical academic standing, tennis star Roger Federer's two sets of identical twin children, surgical separation of craniopagus conjoined twins, and the rare delivery of twins to a 23-year-old giant panda.

  5. Fingerprint recognition with identical twin fingerprints.

    Science.gov (United States)

    Tao, Xunqiang; Chen, Xinjian; Yang, Xin; Tian, Jie

    2012-01-01

    Fingerprint recognition with identical twins is a challenging task due to the closest genetics-based relationship existing in the identical twins. Several pioneers have analyzed the similarity between twins' fingerprints. In this work we continue to investigate the topic of the similarity of identical twin fingerprints. Our study was tested based on a large identical twin fingerprint database that contains 83 twin pairs, 4 fingers per individual and six impressions per finger: 3984 (83*2*4*6) images. Compared to the previous work, our contributions are summarized as follows: (1) Two state-of-the-art fingerprint identification methods: P071 and VeriFinger 6.1 were used, rather than one fingerprint identification method in previous studies. (2) Six impressions per finger were captured, rather than just one impression, which makes the genuine distribution of matching scores more realistic. (3) A larger sample (83 pairs) was collected. (4) A novel statistical analysis, which aims at showing the probability distribution of the fingerprint types for the corresponding fingers of identical twins which have same fingerprint type, has been conducted. (5) A novel analysis, which aims at showing which finger from identical twins has higher probability of having same fingerprint type, has been conducted. Our results showed that: (a) A state-of-the-art automatic fingerprint verification system can distinguish identical twins without drastic degradation in performance. (b) The chance that the fingerprints have the same type from identical twins is 0.7440, comparing to 0.3215 from non-identical twins. (c) For the corresponding fingers of identical twins which have same fingerprint type, the probability distribution of five major fingerprint types is similar to the probability distribution for all the fingers' fingerprint type. (d) For each of four fingers of identical twins, the probability of having same fingerprint type is similar.

  6. Fingerprint recognition with identical twin fingerprints.

    Directory of Open Access Journals (Sweden)

    Xunqiang Tao

    Full Text Available Fingerprint recognition with identical twins is a challenging task due to the closest genetics-based relationship existing in the identical twins. Several pioneers have analyzed the similarity between twins' fingerprints. In this work we continue to investigate the topic of the similarity of identical twin fingerprints. Our study was tested based on a large identical twin fingerprint database that contains 83 twin pairs, 4 fingers per individual and six impressions per finger: 3984 (83*2*4*6 images. Compared to the previous work, our contributions are summarized as follows: (1 Two state-of-the-art fingerprint identification methods: P071 and VeriFinger 6.1 were used, rather than one fingerprint identification method in previous studies. (2 Six impressions per finger were captured, rather than just one impression, which makes the genuine distribution of matching scores more realistic. (3 A larger sample (83 pairs was collected. (4 A novel statistical analysis, which aims at showing the probability distribution of the fingerprint types for the corresponding fingers of identical twins which have same fingerprint type, has been conducted. (5 A novel analysis, which aims at showing which finger from identical twins has higher probability of having same fingerprint type, has been conducted. Our results showed that: (a A state-of-the-art automatic fingerprint verification system can distinguish identical twins without drastic degradation in performance. (b The chance that the fingerprints have the same type from identical twins is 0.7440, comparing to 0.3215 from non-identical twins. (c For the corresponding fingers of identical twins which have same fingerprint type, the probability distribution of five major fingerprint types is similar to the probability distribution for all the fingers' fingerprint type. (d For each of four fingers of identical twins, the probability of having same fingerprint type is similar.

  7. Risk of Monozygotic Twins After Assisted Reproduction: A Population-Based Approach.

    Science.gov (United States)

    Parazzini, Fabio; Cipriani, Sonia; Bianchi, Stefano; Bulfoni, Camilla; Bortolus, Renata; Somigliana, Edgardo

    2016-02-01

    Recent studies have suggested that ovarian stimulation and assisted reproductive techniques (ART) may increase the frequency of monozygotic twins. In this article, we present the analysis of the estimated frequency of twin deliveries following in vitro fertilization (IVF) in Lombardy during the period 2010-2014 for a total of 450,949 pregnancies. This is a population-based study using data from the regional data base of Lombardy, a northern Italian region with a population of about 10 million inhabitants. During the considered period, a total of 461,424 single or multiple births were registered in Lombardy. After exclusion of triplets or more pregnancies, the total number of twin deliveries, in separate strata of like and unlike sex pregnancies twin deliveries, were obtained and the rate of twin deliveries was computed according to spontaneous and non-spontaneous conception and type of ART. Further, estimates of dizygotic or monozygotic twin births were calculated using Weinberg's methods. The frequency of twins deliveries was 1.24/100 deliveries after natural conception and 20.05 after assisted conception. The estimated rates of monozygotic twins was 0.45 and 0.72/100 (95% CI: 0.58-0.91) deliveries after natural and assisted conception, respectively. This difference was statistically significant (p assisted than after natural conception.

  8. Heritability of Schizophrenia and Schizophrenia Spectrum Based on the Nationwide Danish Twin Register

    DEFF Research Database (Denmark)

    Hilker, Rikke; Helenius, Dorte; Fagerlund, Birgitte

    2018-01-01

    sample. The estimated 79% heritability of SZ is congruent with previous reports and indicates a substantial genetic risk. The high genetic risk also applies to a broader phenotype of SZ spectrum disorders. The low concordance rate of 33% in monozygotic twins demonstrates that illness vulnerability......BACKGROUND: Twin studies have provided evidence that both genetic and environmental factors contribute to schizophrenia (SZ) risk. Heritability estimates of SZ in twin samples have varied methodologically. This study provides updated heritability estimates based on nationwide twin data...... the heritability of SZ to be 79%. When expanding illness outcome to include SZ spectrum disorders, the heritability estimate was almost similar (73%). CONCLUSIONS: The key strength of this study is the application of a novel statistical method accounting for censoring in the follow-up period to a nationwide twin...

  9. Twin-tubes: 3D tracking based on the ATLAS muon drift tubes

    International Nuclear Information System (INIS)

    Woudstra, M.; Bobbink, G.J.; Eldik, N. van; Graaf, H. van der; Kluit, P.; Koutsman, A.; Limper, M.; Linde, F.; Massaro, G.; Snuverink, J.; Vreeswijk, M.; Groenstege, H.; Koopstra, J.; Mos, S.; Rewiersma, P.; Timmermans, C.; Dijkema, J.

    2006-01-01

    The Monitored Drift Tubes (MDTs) of the ATLAS Muon Spectrometer have been paired to form so-called twin-tubes to measure the coordinate which runs along the wire direction. This modification endows the MDTs with full 3D track reconstruction using specially designed electronic boards. The performance of the twin-tubes has been measured for an equipped MDT chamber at the ATLAS Muon Cosmic Ray Test Stand at NIKHEF. The efficiency of a twin-tube has been determined to be 99.8%, and the measured resolution 17 cm per hit. By equipping one multilayer consisting of three layers and combining the measurements a resolution of 10 cm has been obtained

  10. Attractiveness Differences Between Twins Predicts Evaluations of Self and Co-Twin

    Science.gov (United States)

    Principe, Connor P.; Rosen, Lisa H.; Taylor-Partridge, Teresa; Langlois, Judith H.

    2012-01-01

    One of the most consistent findings in psychology shows that people prefer and make positive attributions about attractive compared with unattractive people. The goal of the current study was to determine the power of attractiveness effects by testing whether these social judgments are made where attractiveness differences are smallest: between twins. Differences in facial attractiveness predicted twins’ evaluations of self and their co-twin (n = 158; 54 male). In twin pairs, the more attractive twin judged their less attractive sibling as less physically attractive, athletic, socially competent, and emotionally stable. The less attractive twin did the reverse. Given that even negligible differences in facial attractiveness predicted self and co-twin attitudes, these results provide the strongest test yet of appearance-based stereotypes. PMID:23467329

  11. Playing a Musical Instrument as a Protective Factor against Dementia and Cognitive Impairment: A Population-Based Twin Study

    Directory of Open Access Journals (Sweden)

    M. Alison Balbag

    2014-01-01

    Full Text Available Increasing evidence supports that playing a musical instrument may benefit cognitive development and health at young ages. Whether playing an instrument provides protection against dementia has not been established. In a population-based cotwin control study, we examined the association between playing a musical instrument and whether or not the twins developed dementia or cognitive impairment. Participation in playing an instrument was taken from informant-based reports of twins’ leisure activities. Dementia diagnoses were based on a complete clinical workup using standard diagnostic criteria. Among 157 twin pairs discordant for dementia and cognitive impairment, 27 pairs were discordant for playing an instrument. Controlling for sex, education, and physical activity, playing a musical instrument was significantly associated with less likelihood of dementia and cognitive impairment (odds ratio [OR] = 0.36 [95% confidence interval 0.13–0.99]. These findings support further consideration of music as a modifiable protective factor against dementia and cognitive impairment.

  12. Predictors of fibromyalgia: a population-based twin cohort study.

    Science.gov (United States)

    Markkula, Ritva A; Kalso, Eija A; Kaprio, Jaakko A

    2016-01-15

    Fibromyalgia (FM) is a pain syndrome, the mechanisms and predictors of which are still unclear. We have earlier validated a set of FM-symptom questions for detecting possible FM in an epidemiological survey and thereby identified a cluster with "possible FM". This study explores prospectively predictors for membership of that FM-symptom cluster. A population-based sample of 8343 subjects of the older Finnish Twin Cohort replied to health questionnaires in 1975, 1981, and 1990. Their answers to the set of FM-symptom questions in 1990 classified them in three latent classes (LC): LC1 with no or few symptoms, LC2 with some symptoms, and LC3 with many FM symptoms. We analysed putative predictors for these symptom classes using baseline (1975 and 1981) data on regional pain, headache, migraine, sleeping, body mass index (BMI), physical activity, smoking, and zygosity, adjusted for age, gender, and education. Those with a high likelihood of having fibromyalgia at baseline were excluded from the analysis. In the final multivariate regression model, regional pain, sleeping problems, and overweight were all predictors for membership in the class with many FM symptoms. The strongest non-genetic predictor was frequent headache (OR 8.6, CI 95% 3.8-19.2), followed by persistent back pain (OR 4.7, CI 95% 3.3-6.7) and persistent neck pain (OR 3.3, CI 95% 1.8-6.0). Regional pain, frequent headache, and persistent back or neck pain, sleeping problems, and overweight are predictors for having a cluster of symptoms consistent with fibromyalgia.

  13. Genetic and environmental contributions to weight, height, and BMI from birth to 19 years of age: an international study of over 12,000 twin pairs.

    Directory of Open Access Journals (Sweden)

    Lise Dubois

    Full Text Available OBJECTIVE: To examine the genetic and environmental influences on variances in weight, height, and BMI, from birth through 19 years of age, in boys and girls from three continents. DESIGN AND SETTINGS: Cross-sectional twin study. Data obtained from a total of 23 twin birth-cohorts from four countries: Canada, Sweden, Denmark, and Australia. Participants were Monozygotic (MZ and dizygotic (DZ (same- and opposite-sex twin pairs with data available for both height and weight at a given age, from birth through 19 years of age. Approximately 24,036 children were included in the analyses. RESULTS: Heritability for body weight, height, and BMI was low at birth (between 6.4 and 8.7% for boys, and between 4.8 and 7.9% for girls but increased over time, accounting for close to half or more of the variance in body weight and BMI after 5 months of age in both sexes. Common environmental influences on all body measures were high at birth (between 74.1-85.9% in all measures for boys, and between 74.2 and 87.3% in all measures for girls and markedly reduced over time. For body height, the effect of the common environment remained significant for a longer period during early childhood (up through 12 years of age. Sex-limitation of genetic and shared environmental effects was observed. CONCLUSION: Genetics appear to play an increasingly important role in explaining the variation in weight, height, and BMI from early childhood to late adolescence, particularly in boys. Common environmental factors exert their strongest and most independent influence specifically in pre-adolescent years and more significantly in girls. These findings emphasize the need to target family and social environmental interventions in early childhood years, especially for females. As gene-environment correlation and interaction is likely, it is also necessary to identify the genetic variants that may predispose individuals to obesity.

  14. AT Base Pair Anions vs. (9-methyl-A)(1-methyl-T) Base Pair Anions

    International Nuclear Information System (INIS)

    Radisic, Dunja; Bowen, Kit H.; Dabkowska, Iwona; Storoniak, Piotr; Rak, Janusz; Gutowski, Maciej S.

    2005-01-01

    The anionic base pairs of adenine and thymine, (AT)-, and 9-methyladenine and 1-methylthymine, (MAMT)-, have been investigated both theoretically and experimentally in a complementary, synergistic study. Calculations on (AT)- found that it had undergone a barrier-free proton transfer (BFPT) similar to that seen in other dimer anion systems and that its structural configuration that was neither Watson-Crick (WC) nor Hoogsteen (HS). The vertical detachment energy (VDE) of (AT)- was determined by anion photoelectron spectroscopy and found to be in agreement with the VDE value predicted by theory for the BFPT mechanism. An AT pair in DNA is structurally immobilized into the WC configuration, in part, by being bonded to the sugars of the double helix. This circumstance was mimicked by methylating the sites on both A and T where these sugars would have been tied, viz., 9-methyladenine and 1-methylthymine. Calculations found no BFPT in (MAMT)- and a resulting (MAMT)- configuration that wa s either HS or WC, with the configurations differing in stability by ca. 2 kcal/mol. The photoelectron spectrum of (MAMT)- occurred at a completely different electron binding energy than had (AT)-. Moreover, the VDE value of (MAMT)- was in agreement with that predicted by theory. The configuration of (MAMT)- and its lack of electron-induced proton transfer are inter-related. While there may be other pathways for electron-induced damage, BFPT in the WC/HS configurations of (AT)- is not feasible

  15. AT base pair anions versus (9-methyl-A)(1-methyl-T) base pair anions.

    Science.gov (United States)

    Radisic, Dunja; Bowen, Kit H; Dabkowska, Iwona; Storoniak, Piotr; Rak, Janusz; Gutowski, Maciej

    2005-05-04

    The anionic base pairs of adenine and thymine, (AT)(-), and 9-methyladenine and 1-methylthymine, (MAMT)(-), have been investigated both theoretically and experimentally in a complementary, synergistic study. Calculations on (AT)(-) found that it had undergone a barrier-free proton transfer (BFPT) similar to that seen in other dimer anion systems and that its structural configuration was neither Watson-Crick (WC) nor Hoogsteen (HS). The vertical detachment energy (VDE) of (AT)(-) was determined by anion photoelectron spectroscopy and found to be in agreement with the VDE value predicted by theory for the BFPT mechanism. An AT pair in DNA is structurally immobilized into the WC configuration, in part, by being bonded to the sugars of the double helix. This circumstance was mimicked by methylating the sites on both A and T where these sugars would have been tied, viz., 9-methyladenine and 1-methylthymine. Calculations found no BFPT in (MAMT)(-) and a resulting (MAMT)(-) configuration that was either HS or WC, with the configurations differing in stability by ca. 2 kcal/mol. The photoelectron spectrum of (MAMT)(-) occurred at a completely different electron binding energy than had (AT)(-). Moreover, the VDE value of (MAMT)(-) was in agreement with that predicted by theory. The configuration of (MAMT)(-) and its lack of electron-induced proton transfer are inter-related. While there may be other pathways for electron-induced DNA alterations, BFPT in the WC/HS configurations of (AT)(-) is not feasible.

  16. The Role of Adolescent Nutrition and Physical Activity in the Prediction of Verbal Intelligence during Early Adulthood: A Genetically Informed Analysis of Twin Pairs

    Directory of Open Access Journals (Sweden)

    Dylan B. Jackson

    2015-01-01

    Full Text Available A large body of research has revealed that nutrition and physical activity influence brain functioning at various stages of the life course. Nevertheless, very few studies have explored whether diet and exercise influence verbal intelligence as youth transition from adolescence into young adulthood. Even fewer studies have explored the link between these health behaviors and verbal intelligence while accounting for genetic and environmental factors that are shared between siblings. Employing data from the National Longitudinal Study of Adolescent Health, the current study uses a sample of same-sex twin pairs to test whether youth who engage in poorer fitness and nutritional practices are significantly more likely to exhibit reduced verbal intelligence during young adulthood. The results suggests that, independent of the effects of genetic and shared environmental factors, a number of nutritional and exercise factors during adolescence influence verbal intelligence during adulthood. Limitations are noted and suggestions for future research are outlined.

  17. The role of adolescent nutrition and physical activity in the prediction of verbal intelligence during early adulthood: a genetically informed analysis of twin pairs.

    Science.gov (United States)

    Jackson, Dylan B; Beaver, Kevin M

    2015-01-05

    A large body of research has revealed that nutrition and physical activity influence brain functioning at various stages of the life course. Nevertheless, very few studies have explored whether diet and exercise influence verbal intelligence as youth transition from adolescence into young adulthood. Even fewer studies have explored the link between these health behaviors and verbal intelligence while accounting for genetic and environmental factors that are shared between siblings. Employing data from the National Longitudinal Study of Adolescent Health, the current study uses a sample of same-sex twin pairs to test whether youth who engage in poorer fitness and nutritional practices are significantly more likely to exhibit reduced verbal intelligence during young adulthood. The results suggests that, independent of the effects of genetic and shared environmental factors, a number of nutritional and exercise factors during adolescence influence verbal intelligence during adulthood. Limitations are noted and suggestions for future research are outlined.

  18. A Wavelet Kernel-Based Primal Twin Support Vector Machine for Economic Development Prediction

    Directory of Open Access Journals (Sweden)

    Fang Su

    2013-01-01

    Full Text Available Economic development forecasting allows planners to choose the right strategies for the future. This study is to propose economic development prediction method based on the wavelet kernel-based primal twin support vector machine algorithm. As gross domestic product (GDP is an important indicator to measure economic development, economic development prediction means GDP prediction in this study. The wavelet kernel-based primal twin support vector machine algorithm can solve two smaller sized quadratic programming problems instead of solving a large one as in the traditional support vector machine algorithm. Economic development data of Anhui province from 1992 to 2009 are used to study the prediction performance of the wavelet kernel-based primal twin support vector machine algorithm. The comparison of mean error of economic development prediction between wavelet kernel-based primal twin support vector machine and traditional support vector machine models trained by the training samples with the 3–5 dimensional input vectors, respectively, is given in this paper. The testing results show that the economic development prediction accuracy of the wavelet kernel-based primal twin support vector machine model is better than that of traditional support vector machine.

  19. Sex differences in jealousy: a population-based twin study in Sweden.

    Science.gov (United States)

    Walum, Hasse; Larsson, Henrik; Westberg, Lars; Lichtenstein, Paul; Magnusson, Patrik K E

    2013-10-01

    According to the theory of evolved sex differences in jealousy, the challenge for women to ensure paternal investment increased their jealousy response to emotional infidelity, whereas paternal uncertainty exerted selective pressures that shaped men to become more distressed by sexual infidelity. Several studies have investigated whether the effect of these sexually dimorphic selection pressures can be detected in contemporary human populations, with conflicting results. To date, no genetically informed studies of sex differences in jealousy have been conducted. We used data from the Screening Across the Lifespan of Twins Younger (SALTY) sample, containing information concerning self-rated jealousy from 3,197 complete twin pairs collected by the Swedish Twin Registry. Intra-class correlations and structural equation models were used to assess the genetic influence on jealousy and to investigate sex differences at genetic level. We saw a highly significant sex effect on the relationship between infidelity types, indicating that men, relative to women, reported greater jealousy in response to sexual infidelity than in response to emotional infidelity. The twin models revealed significant heritabilities for both sexual (32%) and emotional (26%) jealousy. The heritabilities were of a similar magnitude in both sexes, and no qualitative sex differences could be detected. We show for the first time that variance in jealousy is to some extent explained by genetic factors. Even though our results from the mean value analyses are in line with the theory of evolved sex differences in jealousy, we could not identify any sex differences on a genetic level.

  20. The Spread of Substance Use and Delinquency between Adolescent Twins

    Science.gov (United States)

    Laursen, Brett; Hartl, Amy C.; Vitaro, Frank; Brendgen, Mara; Dionne, Ginette; Boivin, Michel

    2017-01-01

    This investigation examines the spread of problem behaviors (substance use and delinquency) between twin siblings. A sample of 628 twins (151 male twin pairs and 163 female twin pairs) drawn from the Quebec Newborn Twin Study completed inventories describing delinquency and substance use at ages 13, 14, and 15. A 3-wave longitudinal actor-partner…

  1. Birth weight and gestational age on retinopathy of prematurity in discordant twins in China

    Directory of Open Access Journals (Sweden)

    Zong-Hua Wang

    2014-08-01

    Full Text Available AIM:To assess the relative effect of birth weight and gestational age on retinopathy of prematurity (ROP using preterm twin pairs discordant for birth weigh in a tertiary neonatal intensive care unit in China.METHODS: Fifty-six discordant twin pairs of 112 preterm infants were retrospectively analyzed. The twin pairs were divided into two subgroups based on birth weight in each pair. The occurrence of ROP and severe ROP requiring treatment were compared between the lower birth weight infants and their co-twins with the higher birth weight. Some neonatal morbidities related to prematurity and neonatal characteristics were also compared between the twin pairs.RESULTS: Based on the univariate analysis, gestational age and birth weight were significantly associated with the occurrence and progression of ROP. But no significant differences in ROP between larger and smaller infants were observed in the twin-paired analysis. The incidence of neonatal morbidities regarding respiratory distress syndrome (RDS, patent ductus arteriosus (PDA, intraventricular hemorrhage (IVH, sepsis and neonatal characteristics regarding gender distribution, one- and five-minute Apgar score, postnatal steroid treatment, blood transfusion, supplemental oxygen therapy, and mechanical ventilation were not different between the twins. However, gestational age of ≤28wk was significantly associated with significantly higher rates of ROP and severe ROP.CONCLUSION: Gestational age is a better predictor of ROP than birth weight in the twin-paired study.

  2. The Danish Twin Registry

    DEFF Research Database (Denmark)

    Skytthe, Axel; Ohm Kyvik, Kirsten; Vilstrup Holm, Niels

    2011-01-01

    Introduction: The Danish Twin Registry is a unique source for studies of genetic, familial and environmental factors on life events, health conditions and diseases. Content: More than 85,000 twin pairs born 1870-2008 in Denmark. Validity and coverage: Four main ascertainment methods have been emp...

  3. Structure of 2,4-Diaminopyrimidine - Theobromine Alternate Base Pairs

    Science.gov (United States)

    Gengeliczki, Zsolt; Callahan, Michael P.; Kabelac, Martin; Rijs, Anouk M.; deVries, Mattanjah S.

    2011-01-01

    We report the structure of clusters of 2,4-diaminopyrimidine with 3,7-dimethylxanthine (theobromine) in the gas phase determined by IR-UV double resonance spectroscopy in both the near-IR and mid-IR regions in combination with ab initio computations. These clusters represent potential alternate nucleobase pairs, geometrically equivalent to guanine-cytosine. We have found the four lowest energy structures, which include the Watson-Crick base pairing motif. This Watson-Crick structure has not been observed by resonant two-photon ionization (R2PI) in the gas phase for the canonical DNA base pairs.

  4. Birth size and gestational age in opposite-sex twins as compared to same-sex twins

    DEFF Research Database (Denmark)

    Jelenkovic, Aline; Sund, Reijo; Yokoyama, Yoshie

    2018-01-01

    It is well established that boys are born heavier and longer than girls, but it remains unclear whether birth size in twins is affected by the sex of their co-twin. We conducted an individual-based pooled analysis of 21 twin cohorts in 15 countries derived from the COllaborative project of Develo......It is well established that boys are born heavier and longer than girls, but it remains unclear whether birth size in twins is affected by the sex of their co-twin. We conducted an individual-based pooled analysis of 21 twin cohorts in 15 countries derived from the COllaborative project....... In girls, birth size was not associated (5 g birth weight; 95% CI -8 to -18 and -0.089 cm birth length; 95% CI -0.202 to 0.025) with the sex of the co-twin. Gestational age was slightly shorter in boy-boy pairs than in boy-girl and girl-girl pairs. When birth size was standardized by gestational age......, the magnitude of the associations was attenuated in boys, particularly for birth weight. In conclusion, boys with a co-twin sister are heavier and longer at birth than those with a co-twin brother. However, these differences are modest and partly explained by a longer gestation in the presence of a co...

  5. Theoretical study of GC+/GC base pair derivatives

    International Nuclear Information System (INIS)

    Meng Fancui; Wang Huanjie; Xu Weiren; Liu Chengbu

    2005-01-01

    The geometries of R (R=CH 3 , CH 3 O, F, NO 2 ) substituted GC base pair derivatives and their cations have been optimized at B3LYP/6-31G* level and the substituent effects on the neutral and cationic geometric structures and energies have been discussed. The inner reorganization energies of various base pair derivatives and the native GC base pair have been calculated to discuss the substituent effects on the reorganization energy. NBO (natural bond orbital) analysis has been carried out on both the neutral and the cationic systems to investigate the differences of the charge distributions and the electronic structures. The outcomes indicate that 8-CH 3 O-G:C has the greatest reorganization energy and 8-NO 2 -G:C has the least, while the other substituted base pairs have a reorganization energy close to that of G:C. The one charge is mostly localized on guanine part after ionization and as high as 0.95e. The bond distances of N1-N3'andN2-O2' in the cationic base pair derivatives shortened and that of O6-N4' elongated as compared with the corresponding bond distances of the neutral GC base pair derivatives

  6. Sport disciplines, types of sports, and waist circumference in young adulthood - a population-based twin study.

    Science.gov (United States)

    Rottensteiner, Mirva; Mäkelä, Sara; Bogl, Leonie H; Törmäkangas, Timo; Kaprio, Jaakko; Kujala, Urho M

    2017-10-01

    The benefits of physical activity (PA) in preventing abdominal obesity are well recognized, but the role of different sport disciplines remains open. We aimed, therefore, to investigate how participation in different sport disciplines, and the number and types of sports engaged in are associated with waist circumference (WC) in young adulthood. This population-based cohort study comprised 4027 Finnish twin individuals (1874 men), with a mean age of 34 y (32-37), who answered a survey, including self-measured WC. We extracted the number and identified the types (aerobic, power, and mixed) of the different sport disciplines respondents reported participating in. The number of sport disciplines participated in was inversely associated with WC, the linear decrease averaging 1.38 cm (95% CI 1.10-1.65) per each additional sport discipline. The result persisted after adjustment for the main covariates, such as volume of PA and diet quality. Among dizygotic twin pairs discordant for sports participation (0-2 vs. 5 or more disciplines), the mean within-pair difference in WC was 4.8 cm (95% CI 0.4-9.1) for men and 11.2 cm (95% CI 4.4-18.0) for women; among discordant monozygotic pairs, no differences were observed. In men, all three types of sports were individually associated with smaller WC, while in women, only mixed and power sports showed this association. Participation in several sport disciplines and sport types was associated with smaller WC among young adults in their mid-30s. Shared genetic background may explain some of the associations.

  7. Disease-Concordant Twins Empower Genetic Association Studies

    DEFF Research Database (Denmark)

    Tan, Qihua; Li, Weilong; Vandin, Fabio

    2017-01-01

    and ordinary healthy samples as controls. We examined the power gain of the twin-based design for various scenarios (i.e., cases from monozygotic and dizygotic twin pairs concordant for a disease) and compared the power with the ordinary case-control design with cases collected from the unrelated patient...... concordant for a disease, should confer increased power in genetic association analysis because of their genetic relatedness. We conducted a computer simulation study to explore the power advantage of the disease-concordant twin design, which uses singletons from disease-concordant twin pairs as cases...... population. Simulation was done by assigning various allele frequencies and allelic relative risks for different mode of genetic inheritance. In general, for achieving a power estimate of 80%, the sample sizes needed for dizygotic and monozygotic twin cases were one half and one fourth of the sample size...

  8. Learning preferences from paired opposite-based semantics

    DEFF Research Database (Denmark)

    Franco de los Ríos, Camilo; Rodríguez, J. Tinguaro; Montero, Javier

    2017-01-01

    Preference semantics examine the meaning of the preference predicate, according to the way that alternatives can be understood and organized for decision making purposes. Through opposite-based semantics, preference structures can be characterized by their paired decomposition of preference...... on the character of opposition, the compound meaning of preference emerges from the fuzzy reinforcement of paired opposite concepts, searching for significant evidence for affirming dominance among the decision objects. Here we propose a general model for the paired decomposition of preference, examining its...

  9. Integrated fiber Michelson interferometer based on poled hollow twin-core fiber.

    Science.gov (United States)

    Liu, Zhihai; Bo, Fusen; Wang, Lei; Tian, Fengjun; Yuan, Libo

    2011-07-01

    We propose an integrated fiber Michelson interferometer based on a poled hollow twin-core fiber. The Michelson interferometer can be used as an electro-optic modulator by thermal poling one core of the twin-core fiber and introducing second-order nonlinearity in the fiber. The proposed fiber Michelson interferometer is experimentally demonstrated under driving voltages at the frequency range of 149 to 1000 Hz. The half-wave voltage of the poled fiber is 135 V, and the effective second-order nonlinear coefficient χ² is 1.23 pm/V.

  10. Twin-singleton differences in intelligence: a register-based birth cohort study of Norwegian males.

    Science.gov (United States)

    Eriksen, Willy; Sundet, Jon M; Tambs, Kristian

    2012-10-01

    The aim was to determine the difference in intelligence between singletons and twins in young adulthood. Data from the Medical Birth Register of Norway were linked with register data from the Norwegian National Conscript Service. The study base consisted of data on the 445,463 males who were born alive in either single or twin births in Norway during 1967-1984 and who were examined at the time of the mandatory military conscription (age 18-20). Within this study base, there were data on 1,653 sibships of full brothers that included at least one man born in single birth and at least one man born in twin birth (4,307 persons, including 2,378 twins and 1,929 singletons). The intelligence scores of the singletons were 11% (95% confidence interval [CI]: 9-14%) of a standard deviation higher than those of the twins, after adjustment for birth year, birth order, parental ages at delivery, parental education levels, and other factors. The adjusted within-family difference was also 11% (95 % CI: 6-16%) of a standard deviation, indicating that unmeasured factors shared by siblings (e.g., maternal body height) have not influenced the estimate in important ways. When gestational age at birth was added to the model, the estimate for the difference in intelligence score was approximately the same. Including birth weight in the model strongly reduced the estimate. In conclusion, twins born in Norway during 1967-1984 had slightly lower intelligence in early adulthood compared with the singletons.

  11. White matter differences in monozygotic twins discordant or concordant for obsessive-compulsive symptoms: a combined diffusion tensor imaging/voxel-based morphometry study.

    Science.gov (United States)

    den Braber, Anouk; van 't Ent, Dennis; Boomsma, Dorret I; Cath, Danielle C; Veltman, Dick J; Thompson, Paul M; de Geus, Eco J C

    2011-11-15

    Neuroimaging studies of obsessive-compulsive disorder (OCD) patients point to deficits in cortico-striato-thalamo-cortical circuits that might include changes in white matter. The contribution of environmental and genetic factors to the various OCD-related changes in brain structures remains to be established. White matter structures were analyzed in 140 subjects with both diffusion tensor imaging and voxel-based morphometry. We studied 20 monozygotic twin pairs discordant for obsessive-compulsive symptoms (OCS) to detect the effects of environmental risk factors for obsessive-compulsive (OC) symptomatology. Furthermore, we compared 28 monozygotic twin pairs concordant for low OCS scores with 23 twin pairs concordant for high OCS scores to detect the effects of genetic risk factors for OC symptomatology. Discordant pair analysis showed that the environmental risk was associated with an increase in dorsolateral-prefrontal white matter. Analysis of concordant pairs showed that the genetic risk was associated with a decrease in inferior frontal white matter. Various white matter tracts showed opposite effects of environmental and genetic risk factors (e.g., right medial frontal, left parietal, and right middle temporal), illustrating the need for designs that separate these classes of risk factors. Different white matter regions were affected by environmental and genetic risk factors for OC symptomatology, but both classes of risk factors might, in aggregate, create an imbalance between the indirect loop of the cortico-striato-thalamo-cortical network (to the dorsolateral-prefrontal region)-important for inhibition and switching between behaviors-and the direct loop (involving the inferior frontal region) that contributes to the initiation and continuation of behaviors. Copyright © 2011 Society of Biological Psychiatry. Published by Elsevier Inc. All rights reserved.

  12. Evolution of the Annealing Twin Density during δ-Supersolvus Grain Growth in the Nickel-Based Superalloy Inconel™ 718

    Directory of Open Access Journals (Sweden)

    Yuan Jin

    2015-12-01

    Full Text Available Grain growth experiments were performed on Inconel™ 718 to investigate the possible correlation of the annealing twin density with grain size and with annealing temperature. Those experiments were conducted at different temperatures in the δ supersolvus domain and under such conditions that only capillarity forces were involved in the grain boundary migration process. In the investigated range, there is a strong inverse correlation of the twin density with the average grain size. On the other hand, the twin density at a given average grain size is not sensitive to annealing temperature. Consistent with previous results for pure nickel, the twin density evolution in Inconel™ 718 is likely to be mainly controlled by the propagation of the pre-existing twins of the growing grains; i.e., the largest ones of the initial microstructure. Almost no new twin boundaries are created during the grain growth process itself. Therefore, the twin density at a given average grain size is mainly dependent on the twin density in the largest grains of the initial microstructure and independent of the temperature at which grains grow. Based on the observations, a mean field model is proposed to predict annealing twin density as a function of grain size during grain growth.

  13. Anorexia and bulimia nervosa in same-sex and opposite-sex twins: lack of association with twin type in a nationwide study of Finnish twins.

    Science.gov (United States)

    Raevuori, Anu; Kaprio, Jaakko; Hoek, Hans W; Sihvola, Elina; Rissanen, Aila; Keski-Rahkonen, Anna

    2008-12-01

    The authors tested the hypothesis that either prenatal feminization or masculinization hormone influences in utero or later socialization affects the risk for anorexia and bulimia nervosa and disordered eating in members of opposite-sex twin pairs. Finnish twins (N=2,426 women, N=1,962 men with known zygosity) from birth cohorts born 1974-1979 were assessed at age 22 to 28 years with a questionnaire for eating disorder symptoms. Based on the questionnaire screen, women (N=292), men (N=53), and their cotwins were interviewed to assess diagnoses of anorexia nervosa and bulimia nervosa (per DSM-IV and broad criteria). In women from opposite-sex twin pairs, the prevalence of DSM-IV or broad anorexia nervosa was not significantly different than that of women from monozygotic pairs or same-sex dizygotic pairs. Of the five male anorexia nervosa probands, only one was from an opposite-sex twin pair. Bulimia nervosa in men was too rare to be assessed by zygosity; the prevalence of DSM-IV or broad bulimia nervosa did not differ in women from opposite- versus same-sex twin pairs. In both sexes, the overall profile of indicators on eating disorders was rather similar between individuals from opposite- and same-sex pairs. The authors found little evidence that the risk for anorexia nervosa, bulimia nervosa, or disordered eating was associated with zygosity or sex composition of twin pairs, thus making it unlikely that in utero femininization or masculinization or socialization effects of growing up with an opposite-sex twin have a major influence on the later development of eating disorders.

  14. X-chromosome inactivation patterns in monozygotic twins and sib pairs discordant for nonsyndromic cleft lip and/or palate

    DEFF Research Database (Denmark)

    Kimani, Jane W; Shi, Min; Daack-Hirsch, Sandra

    2007-01-01

    Nonsyndromic clefts of the lip and/or palate are common birth defects with a strong genetic component. Based on unequal gender ratios for clefting phenotypes, evidence for linkage to the X chromosome and the occurrence of several X-linked clefting syndromes, we investigated the role of skewed X c...

  15. Hydration of Watson-Crick base pairs and dehydration of Hoogsteen base pairs inducing structural polymorphism under molecular crowding conditions.

    Science.gov (United States)

    Miyoshi, Daisuke; Nakamura, Kaori; Tateishi-Karimata, Hisae; Ohmichi, Tatsuo; Sugimoto, Naoki

    2009-03-18

    It has been revealed recently that molecular crowding, which is one of the largest differences between in vivo and in vitro conditions, is a critical factor determining the structure, stability, and function of nucleic acids. However, the effects of molecular crowding on Watson-Crick and Hoogsteen base pairs remain unclear. In order to investigate directly and quantitatively the molecular crowding effects on base pair types in nucleic acids, we designed intramolecular parallel- and antiparallel-stranded DNA duplexes consisting of Hoogsteen and Watson-Crick base pairs, respectively, as well as an intramolecular parallel-stranded triplex containing both types of base pairs. Thermodynamic analyses demonstrated that the values of free energy change at 25 degrees C for Hoogsteen base-pair formations decreased from +1.45 +/- 0.15 to +1.09 +/- 0.13 kcal mol(-1), and from -1.89 +/- 0.13 to -2.71 +/- 0.11 kcal mol(-1) in the intramolecular duplex and triplex, respectively, when the concentration of PEG 200 (polyethylene glycol with average molecular weight 200) increased from 0 to 20 wt %. However, corresponding values for Watson-Crick formation in the duplex and triplex increased from -10.2 +/- 0.2 to -8.7 +/- 0.1 kcal mol(-1), and from -10.8 +/- 0.2 to -9.2 +/- 0.2 kcal mol(-1), respectively. Furthermore, it was revealed that the opposing effects of molecular crowding on the Hoogsteen and Watson-Crick base pairs were due to different behaviors of water molecules binding to the DNA strands.

  16. Charge transfer in DNA: role of base pairing

    Czech Academy of Sciences Publication Activity Database

    Kratochvílová, Irena; Bunček, M.; Schneider, Bohdan

    2009-01-01

    Roč. 38, Suppl. (2009), S123-S123 ISSN 0175-7571. [EBSA European Biophysics Congress /7./. Genoa, 11.07.2009-15.07.2009] Institutional research plan: CEZ:AV0Z10100520; CEZ:AV0Z50520701 Keywords : DNA * charge transport * base pairing Subject RIV: CF - Physical ; Theoretical Chemistry Impact factor: 2.437, year: 2009

  17. Ferrocene-based Lewis acids and Lewis pairs: Synthesis and ...

    Indian Academy of Sciences (India)

    The design and synthesis of molecules containing non-interacting Lewis base and Lewis acid groups. [Frustrated Lewis pairs (FLP's)] have received intense attention due to their potential applications in the area of molecular catalysis.1–3. For example,. Stephen's and co-workers have demonstrated that the unquenched ...

  18. Micromechanics of base pair unzipping in the DNA duplex

    International Nuclear Information System (INIS)

    Volkov, Sergey N; Paramonova, Ekaterina V; Yakubovich, Alexander V; Solov’yov, Andrey V

    2012-01-01

    All-atom molecular dynamics (MD) simulations of DNA duplex unzipping in a water environment were performed. The investigated DNA double helix consists of a Drew-Dickerson dodecamer sequence and a hairpin (AAG) attached to the end of the double-helix chain. The considered system is used to examine the process of DNA strand separation under the action of an external force. This process occurs in vivo and now is being intensively investigated in experiments with single molecules. The DNA dodecamer duplex is consequently unzipped pair by pair by means of the steered MD. The unzipping trajectories turn out to be similar for the duplex parts with G⋅C content and rather distinct for the parts with A⋅T content. It is shown that during the unzipping each pair experiences two types of motion: relatively quick rotation together with all the duplex and slower motion in the frame of the unzipping fork. In the course of opening, the complementary pair passes through several distinct states: (i) the closed state in the double helix, (ii) the metastable preopened state in the unzipping fork and (iii) the unbound state. The performed simulations show that water molecules participate in the stabilization of the metastable states of the preopened base pairs in the DNA unzipping fork. (paper)

  19. AudioPairBank: Towards A Large-Scale Tag-Pair-Based Audio Content Analysis

    OpenAIRE

    Sager, Sebastian; Elizalde, Benjamin; Borth, Damian; Schulze, Christian; Raj, Bhiksha; Lane, Ian

    2016-01-01

    Recently, sound recognition has been used to identify sounds, such as car and river. However, sounds have nuances that may be better described by adjective-noun pairs such as slow car, and verb-noun pairs such as flying insects, which are under explored. Therefore, in this work we investigate the relation between audio content and both adjective-noun pairs and verb-noun pairs. Due to the lack of datasets with these kinds of annotations, we collected and processed the AudioPairBank corpus cons...

  20. Genetic liability to disability pension in women and men: a prospective population-based twin study.

    Directory of Open Access Journals (Sweden)

    Jurgita Narusyte

    Full Text Available BACKGROUND: Previous studies of risk factors for disability pension (DP have mainly focused on psychosocial, or environmental, factors, while the relative importance of genetic effects has been less studied. Sex differences in biological mechanisms have not been investigated at all. METHODS: The study sample included 46,454 Swedish twins, consisting of 23,227 complete twin pairs, born 1928-1958, who were followed during 1993-2008. Data on DP, including diagnoses, were obtained from the National Social Insurance Agency. Within-pair similarity in liability to DP was assessed by calculating intraclass correlations. Genetic and environmental influences on liability to DP were estimated by applying discrete-time frailty modeling. RESULTS: During follow-up, 7,669 individuals were granted DP (18.8% women and 14.1% men. Intraclass correlations were generally higher in MZ pairs than DZ pairs, while DZ same-sexed pairs were more similar than opposite-sexed pairs. The best-fitting model indicated that genetic factors contributed 49% (95% CI: 39-59 to the variance in DP due to mental diagnoses, 35% (95% CI: 29-41 due to musculoskeletal diagnoses, and 27% (95% CI: 20-33 due to all other diagnoses. In both sexes, genetic effects common to all ages explained one-third, whereas age-specific factors almost two-thirds, of the total variance in liability to DP irrespective of diagnosis. Sex differences in liability to DP were indicated, in that partly different sets of genes were found to operate in women and men, even though the magnitude of genetic variance explained was equal for both sexes. CONCLUSIONS: The findings of the study suggest that genetic effects are important for liability to DP due to different diagnoses. Moreover, genetic contributions to liability to DP tend to differ between women and men, even though the overall relative contribution of genetic influences does not differ by sex. Hence, the pathways leading to DP might differ between women and

  1. NOTE TAKING PAIRS TO IMPROVE STUDENTS‟ SENTENCE BASED WRITING ACHIEVEMENT

    Directory of Open Access Journals (Sweden)

    Testiana Deni Wijayatiningsih

    2017-04-01

    Full Text Available Students had skill to actualize their imagination and interpret their knowledge through writing which could be combined with good writing structure. Moreover, their writing skill still had low motivation and had not reached the standard writing structure. Based on the background above, this research has purpose to know the influence Note Taking Pairs in improving students‘sentence based writing achievement. The subject of this research was the second semester of English Department in Muhammadiyah University of Semarang. It also used statistic non parametric method to analyze the students‘ writing achievement. The result of this research showed that Note Taking Pairs strategy could improve students‘sentence based writing achievement. Hopefully this research is recommended into learning process to improve students‘writing skill especially in sentence-based writing subject.

  2. Incidence of hand eczema in a population-based twin cohort

    DEFF Research Database (Denmark)

    Lerbaek, A; Kyvik, Kirsten Ohm; Ravn, H

    2007-01-01

    BACKGROUND: Population-based studies on the incidence of hand eczema are sparse. OBJECTIVES: The aim of this prospective follow-up study was to determine the incidence rate of hand eczema in a population-based twin cohort. Secondly, the role of genetic factors and other potential risk factors...... for hand eczema was investigated. METHODS: A questionnaire on self-reported hand eczema was answered by 5610 and 4128 twin individuals in 1996 and 2005, respectively. Data were analysed in a Poisson regression analysis. RESULTS: The crude incidence rate was 8.8 cases per 1000 person-years (95% confidence...... with an increased risk, whereas no association with age, sex, smoking or alcohol was found...

  3. A Computational Discriminability Analysis on Twin Fingerprints

    Science.gov (United States)

    Liu, Yu; Srihari, Sargur N.

    Sharing similar genetic traits makes the investigation of twins an important study in forensics and biometrics. Fingerprints are one of the most commonly found types of forensic evidence. The similarity between twins’ prints is critical establish to the reliability of fingerprint identification. We present a quantitative analysis of the discriminability of twin fingerprints on a new data set (227 pairs of identical twins and fraternal twins) recently collected from a twin population using both level 1 and level 2 features. Although the patterns of minutiae among twins are more similar than in the general population, the similarity of fingerprints of twins is significantly different from that between genuine prints of the same finger. Twins fingerprints are discriminable with a 1.5%~1.7% higher EER than non-twins. And identical twins can be distinguished by examine fingerprint with a slightly higher error rate than fraternal twins.

  4. Investigating the Association between Autistic-Like and Internalizing Traits in a Community-Based Twin Sample

    Science.gov (United States)

    Hallett, Victoria; Ronald, Angelica; Happe, Francesca

    2009-01-01

    The phenotypic and etiologic relation between internalizing and autistic-like traits is studied using a community-based twin sample. Internalizing and autistic-like traits showed moderate phenotypic overlap but have specific genetic influences.

  5. Evidence of genetic susceptibility to infectious mononucleosis: a twin study.

    Science.gov (United States)

    Hwang, A E; Hamilton, A S; Cockburn, M G; Ambinder, R; Zadnick, J; Brown, E E; Mack, T M; Cozen, W

    2012-11-01

    Infectious mononucleosis is a clinical manifestation of primary Epstein-Barr virus infection. It is unknown whether genetic factors contribute to risk. To assess heritability, we compared disease concordance in monozygotic to dizygotic twin pairs from the population-based California Twin Program and assessed the risk to initially unaffected co-twins. One member of 611 and both members of 58 twin pairs reported a history of infectious mononucleosis. Pairwise concordance in monozygotic and dizygotic pairs was respectively 12·1% [standard error (s.e.)=1·9%] and 6·1% (s.e.=1·2%). The relative risk (hazard ratio) of monozygotic compared to dizygotic unaffected co-twins of cases was 1·9 [95% confidence interval (CI) 1·1-3·4, P=0·03], over the follow-up period. When the analysis was restricted to same-sex twin pairs, that estimate was 2·5 (95% CI 1·2-5·3, P=0·02). The results are compatible with a heritable contribution to the risk of infectious mononucleosis.

  6. Comparison of sequencing based CNV discovery methods using monozygotic twin quartets.

    Directory of Open Access Journals (Sweden)

    Marc-André Legault

    Full Text Available The advent of high throughput sequencing methods breeds an important amount of technical challenges. Among those is the one raised by the discovery of copy-number variations (CNVs using whole-genome sequencing data. CNVs are genomic structural variations defined as a variation in the number of copies of a large genomic fragment, usually more than one kilobase. Here, we aim to compare different CNV calling methods in order to assess their ability to consistently identify CNVs by comparison of the calls in 9 quartets of identical twin pairs. The use of monozygotic twins provides a means of estimating the error rate of each algorithm by observing CNVs that are inconsistently called when considering the rules of Mendelian inheritance and the assumption of an identical genome between twins. The similarity between the calls from the different tools and the advantage of combining call sets were also considered.ERDS and CNVnator obtained the best performance when considering the inherited CNV rate with a mean of 0.74 and 0.70, respectively. Venn diagrams were generated to show the agreement between the different algorithms, before and after filtering out familial inconsistencies. This filtering revealed a high number of false positives for CNVer and Breakdancer. A low overall agreement between the methods suggested a high complementarity of the different tools when calling CNVs. The breakpoint sensitivity analysis indicated that CNVnator and ERDS achieved better resolution of CNV borders than the other tools. The highest inherited CNV rate was achieved through the intersection of these two tools (81%.This study showed that ERDS and CNVnator provide good performance on whole genome sequencing data with respect to CNV consistency across families, CNV breakpoint resolution and CNV call specificity. The intersection of the calls from the two tools would be valuable for CNV genotyping pipelines.

  7. Genetic and environmental effects on body mass index from infancy to the onset of adulthood: an individual-based pooled analysis of 45 twin cohorts participating in the COllaborative project of Development of Anthropometrical measures in Twins (CODATwins) study.

    Science.gov (United States)

    Silventoinen, Karri; Jelenkovic, Aline; Sund, Reijo; Hur, Yoon-Mi; Yokoyama, Yoshie; Honda, Chika; Hjelmborg, Jacob vB; Möller, Sören; Ooki, Syuichi; Aaltonen, Sari; Ji, Fuling; Ning, Feng; Pang, Zengchang; Rebato, Esther; Busjahn, Andreas; Kandler, Christian; Saudino, Kimberly J; Jang, Kerry L; Cozen, Wendy; Hwang, Amie E; Mack, Thomas M; Gao, Wenjing; Yu, Canqing; Li, Liming; Corley, Robin P; Huibregtse, Brooke M; Christensen, Kaare; Skytthe, Axel; Kyvik, Kirsten O; Derom, Catherine A; Vlietinck, Robert F; Loos, Ruth Jf; Heikkilä, Kauko; Wardle, Jane; Llewellyn, Clare H; Fisher, Abigail; McAdams, Tom A; Eley, Thalia C; Gregory, Alice M; He, Mingguang; Ding, Xiaohu; Bjerregaard-Andersen, Morten; Beck-Nielsen, Henning; Sodemann, Morten; Tarnoki, Adam D; Tarnoki, David L; Stazi, Maria A; Fagnani, Corrado; D'Ippolito, Cristina; Knafo-Noam, Ariel; Mankuta, David; Abramson, Lior; Burt, S Alexandra; Klump, Kelly L; Silberg, Judy L; Eaves, Lindon J; Maes, Hermine H; Krueger, Robert F; McGue, Matt; Pahlen, Shandell; Gatz, Margaret; Butler, David A; Bartels, Meike; van Beijsterveldt, Toos Cem; Craig, Jeffrey M; Saffery, Richard; Freitas, Duarte L; Maia, José Antonio; Dubois, Lise; Boivin, Michel; Brendgen, Mara; Dionne, Ginette; Vitaro, Frank; Martin, Nicholas G; Medland, Sarah E; Montgomery, Grant W; Chong, Youngsook; Swan, Gary E; Krasnow, Ruth; Magnusson, Patrik Ke; Pedersen, Nancy L; Tynelius, Per; Lichtenstein, Paul; Haworth, Claire Ma; Plomin, Robert; Bayasgalan, Gombojav; Narandalai, Danshiitsoodol; Harden, K Paige; Tucker-Drob, Elliot M; Öncel, Sevgi Y; Aliev, Fazil; Spector, Timothy; Mangino, Massimo; Lachance, Genevieve; Baker, Laura A; Tuvblad, Catherine; Duncan, Glen E; Buchwald, Dedra; Willemsen, Gonneke; Rasmussen, Finn; Goldberg, Jack H; Sørensen, Thorkild Ia; Boomsma, Dorret I; Kaprio, Jaakko

    2016-08-01

    Both genetic and environmental factors are known to affect body mass index (BMI), but detailed understanding of how their effects differ during childhood and adolescence is lacking. We analyzed the genetic and environmental contributions to BMI variation from infancy to early adulthood and the ways they differ by sex and geographic regions representing high (North America and Australia), moderate (Europe), and low levels (East Asia) of obesogenic environments. Data were available for 87,782 complete twin pairs from 0.5 to 19.5 y of age from 45 cohorts. Analyses were based on 383,092 BMI measurements. Variation in BMI was decomposed into genetic and environmental components through genetic structural equation modeling. The variance of BMI increased from 5 y of age along with increasing mean BMI. The proportion of BMI variation explained by additive genetic factors was lowest at 4 y of age in boys (a(2) = 0.42) and girls (a(2) = 0.41) and then generally increased to 0.75 in both sexes at 19 y of age. This was because of a stronger influence of environmental factors shared by co-twins in midchildhood. After 15 y of age, the effect of shared environment was not observed. The sex-specific expression of genetic factors was seen in infancy but was most prominent at 13 y of age and older. The variance of BMI was highest in North America and Australia and lowest in East Asia, but the relative proportion of genetic variation to total variation remained roughly similar across different regions. Environmental factors shared by co-twins affect BMI in childhood, but little evidence for their contribution was found in late adolescence. Our results suggest that genetic factors play a major role in the variation of BMI in adolescence among populations of different ethnicities exposed to different environmental factors related to obesity. © 2016 American Society for Nutrition.

  8. Alanine aminotransferase, gamma-glutamyltransferase (GGT) and all-cause mortality: results from a population-based Danish twins study alanine aminotransferase, GGT and mortality in elderly twins

    DEFF Research Database (Denmark)

    Fraser, Abigail; Thinggaard, Mikael; Christensen, Kaare

    2009-01-01

    Abstract Background/Aims: Alanine aminotransferase (ALT) and gamma-glutamyltransferase (GGT) are widely used markers of liver disease. Several population-based cohort studies have found associations of these liver enzymes with all-cause mortality. None of these studies controlled for genetic...... for potential confounders and existing diabetes and cardiovascular disease. Environmental developmental origins may explain the association, but larger twin studies are required to replicate our findings....

  9. The relationship between avoidant personality disorder and social phobia: a population-based twin study.

    Science.gov (United States)

    Reichborn-Kjennerud, Ted; Czajkowski, Nikolai; Torgersen, Svenn; Neale, Michael C; Ørstavik, Ragnhild E; Tambs, Kristian; Kendler, Kenneth S

    2007-11-01

    The purpose of this study was to determine the sources of comorbidity for social phobia and dimensional representations of avoidant personality disorder by estimating to what extent the two disorders are influenced by common genetic and shared or unique environmental factors versus the extent to which these factors are specific to each disorder. Young adult female-female twin pairs (N=1,427) from the Norwegian Institute of Public Health Twin Panel were assessed at personal interview for avoidant personality disorder and social phobia using the Structured Interview for DSM-IV Personality and the Composite International Diagnostic Interview. Bivariate Cholesky models were fitted using the Mx statistical program. The best-fitting model included additive genetic and unique environmental factors only. Avoidant personality disorder and social phobia were influenced by the same genetic factors, whereas the environmental factors influencing the two disorders were uncorrelated. Within the limits of statistical power, these results suggest that there is a common genetic vulnerability to avoidant personality disorder and social phobia in women. An individual with high genetic liability will develop avoidant personality disorder versus social phobia entirely as a result of the environmental risk factors unique to each disorder. The results are in accordance with the hypothesis that psychobiological dimensions span the axis I and axis II disorders.

  10. Conceptual framework for model-based analysis of residence time distribution in twin-screw granulation

    DEFF Research Database (Denmark)

    Kumar, Ashish; Vercruysse, Jurgen; Vanhoorne, Valerie

    2015-01-01

    Twin-screw granulation is a promising continuous alternative for traditional batchwise wet granulation processes. The twin-screw granulator (TSG) screws consist of transport and kneading element modules. Therefore, the granulation to a large extent is governed by the residence time distribution...... within each module where different granulation rate processes dominate over others. Currently, experimental data is used to determine the residence time distributions. In this study, a conceptual model based on classical chemical engineering methods is proposed to better understand and simulate...... the residence time distribution in a TSG. The experimental data were compared with the proposed most suitable conceptual model to estimate the parameters of the model and to analyse and predict the effects of changes in number of kneading discs and their stagger angle, screw speed and powder feed rate...

  11. Optical refractometer based on an asymmetrical twin-core fiber Michelson interferometer.

    Science.gov (United States)

    Zhou, Ai; Zhang, Yanhui; Li, Guangping; Yang, Jun; Wang, Yuzhuo; Tian, Fengjun; Yuan, Libo

    2011-08-15

    We report and demonstrate an optical refractometer based on a compact fiber Michelson interferometer. The Michelson interferometer is composed of an asymmetrical twin-core fiber containing a central core and a side core. By chemically etching a segment of the twin-core fiber until the side core is exposed, the effective index of the side core in the etched region is sensitive to the environmental refractive index, which leads to a shift of the transmission spectrum of the Michelson interferometer. The experimental results show that such a device has a refractive index resolution of more than 800 nm/refractive index unit in the range of 1.34-1.37. © 2011 Optical Society of America

  12. DFT study on metal-mediated uracil base pair complexes

    Directory of Open Access Journals (Sweden)

    Ayhan Üngördü

    2017-11-01

    Full Text Available The most stable of metal-mediated uracil base pair complexes were determined. Method was used density functional theory, B3LYP. The calculations of systems containing C, H, N, O were described by 6-311++G(d,p and cc-PVTZ basis sets and LANL2DZ and SDD basis sets was used for transition metals. Then Egap values of complexes were calculated and the electrical conductivity of the complexes for single nanowires was studied by band theory. Metal-mediated uracil base pair complexes which will be used as conductive wires in nanotechnology were predicted. In nanoworld, this study is expected to show a way for practical applications.

  13. Optimization of twin gear-based pretreatment of rice straw for bioethanol production

    International Nuclear Information System (INIS)

    Ahmed, Muhammad Ajaz; Rehman, Muhammd Saif Ur; Terán-Hilares, Ruly; Khalid, Saira; Han, Jong-In

    2017-01-01

    Highlights: • Twin gear reactor is a continuous high solids pretreatment reactor. • RSM was applied to optimize twin gear pretreatment for enzymatic digestibility. • 89% enzymatic digestibility was achieved under optimum conditions. • Thermomechanical pretreatment altered the structural features of rice straw. - Abstract: A laboratory twin-gear reactor (TGR) was investigated as a new means for the pretreatment of high solid lignocelluloses. Response surface methodology based on Box Behnken Design was used to optimize the enzymatic digestibility with respect to the pretreatment process variables: temperature of 50–90 °C, NaOH concentration of 2–6% and no. of cycles of 30–60. The results revealed that the TGR-based pretreatment led to the significant structural alterations through increases in pore size, pore volume, cellulose crystallinity and surface area. SEM images also confirmed the surface modifications in the pretreated rice straw. A response surface quadratic model predicted 90% of the enzymatic digestibility, and it was confirmed experimentally and through the analysis of variance (ANOVA) as well. The TGR extrusion proved to be an effective means for exceedingly high solids lignocellulose.

  14. Photochemical selectivity in guanine-cytosine base-pair structures

    Czech Academy of Sciences Publication Activity Database

    Abo-Riziq, A.; Grace, L.; Nir, E.; Kabeláč, Martin; Hobza, Pavel; Vries de, M. S.

    2005-01-01

    Roč. 102, č. 1 (2005), s. 20-23 ISSN 0027-8424 R&D Projects: GA ČR(CZ) GA203/05/0009 Grant - others:NSF(US) CHE-0244341 Institutional research plan: CEZ:AV0Z40550506 Keywords : DNA base pairs * IR-UV spectroscopy * phytochemistry Subject RIV: CF - Physical ; Theoretical Chemistry Impact factor: 10.231, year: 2005

  15. A population-based Swedish Twin and Sibling Study of cannabis, stimulant and sedative abuse in men.

    Science.gov (United States)

    Kendler, Kenneth S; Ohlsson, Henrik; Maes, Hermine H; Sundquist, Kristina; Lichtenstein, Paul; Sundquist, Jan

    2015-04-01

    Prior studies, utilizing interview-based assessments, suggest that most of the genetic risk factors for drug abuse (DA) are non-specific with a minority acting specifically on risk for abuse of particular psychoactive substance classes. We seek to replicate these findings using objective national registry data. We examined abuse of cannabis, stimulants (including cocaine) and sedatives ascertained from national Swedish registers in male-male monozygotic (1720 pairs) and dizygotic twins (1219 pairs) combined with near-age full siblings (76,457 pairs) to provide sufficient power. Modeling was performed using Mx. A common pathway model fitted better than an independent pathway model. The latent liability to DA was highly heritable but also influenced by shared environment. Cannabis, stimulant and sedative abuse all loaded strongly on the common factor. Estimates for the total heritability for the three forms of substance abuse ranged from 64 to 70%. Between 75 and 90% of that genetic risk was non-specific, coming from the common factor with the remainder deriving from substance specific genetic risk factors. By contrast, all of the shared environmental effects, which accounted for 18-20% of the variance in liability, were non-specific. In accord with prior studies based on personal interviews, the large preponderance of genetic risk factors for abuse of specific classes of psychoactive substance are non-specific. These results suggest that genetic variation in the primary sites of action of the psychoactive drugs, which differ widely across most drug classes, play a minor role in human individual differences in risk for DA. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.

  16. Midlife Alcohol Consumption and Risk of Dementia Over 43 Years of Follow-Up: A Population-Based Study From the Swedish Twin Registry.

    Science.gov (United States)

    Handing, Elizabeth P; Andel, Ross; Kadlecova, Pavla; Gatz, Margaret; Pedersen, Nancy L

    2015-10-01

    Midlife alcohol consumption (beer, wine, and spirits) was examined in relation to dementia incidence over 43 years. Participants were 12,326 members of the population-based Swedish Twin Registry born during 1907-1925 who responded to items about alcohol consumption in 1967/1970, subsequently classified as nondrinking (0 grams of ethanol per day), light (1-5g/d), moderate (5-12g/d), heavy (12-24g/d), and very heavy (>24g/d) drinking. Dementia was identified from the National Patient and Cause of Death Registries. Cox proportional hazard models adjusted for cluster-correlated data were used in cohort analyses. Conditional logistic regression (dementia-discordant pairs) and mixed effects models (dementia-concordant pairs) were used in twin analyses. Overall, nondrinkers did not differ from light drinkers in dementia risk. Heavy drinking (hazard ratio = 1.10, p = .028) and very heavy drinking (hazard ratio = 1.18, p = .033) were associated with increased dementia risk controlling for sociodemographic, lifestyle, and cardiovascular factors. More alcohol from spirits was related to increased risk of dementia, whereas more alcohol from wine with decreased risk, although the association for wine reversed direction at high amounts. Relative to co-twins drinking light amounts, moderate-to-heavy drinking twins had (a) greater risk of dementia by 57% (p = .006, 300% in monozygotic pairs only) and (b) reduced time to dementia by 4.76 years (p = .019, 4.78 years in monozygotic pairs only). Averaging more than 12 grams of alcohol per day may increase risk of dementia. Alcohol from spirits appears particularly important for the increased dementia risk. Genetic and/or familial factors do not explain these associations. Alcohol use reduction may be a useful population-wide intervention strategy. © The Author 2015. Published by Oxford University Press on behalf of The Gerontological Society of America. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  17. Single base pair mutation analysis by PNA directed PCR clamping

    DEFF Research Database (Denmark)

    Ørum, H.; Nielsen, P.E.; Egholm, M.

    1993-01-01

    A novel method that allows direct analysis of single base mutation by the polymerase chain reaction (PCR) is described. The method utilizes the finding that PNAs (peptide nucleic acids) recognize and bind to their complementary nucleic acid sequences with higher thermal stability and specificity...... allows selective amplification/suppression of target sequences that differ by only one base pair. Finally we show that PNAs can be designed in such a way that blockage can be accomplished when the PNA target sequence is located between the PCR primers....

  18. Oliver Sacks: Our Correspondence About Twins/Twin Research: Vanishing Twins Syndrome; Discordant Sex in MZ Twins; Pregnancy Outcomes in IVF and ICSI Conceived Twins/Print and Media: Superfetated Twins; Twins Discordant for Smoking; Twins in Fashion; Yale University Twin Hockey Players; Conjoined Twin-Visiting Professor.

    Science.gov (United States)

    Segal, Nancy L

    2017-08-01

    The late neurologist and author, Oliver Sacks, published an insightful 1986 review of Marjorie Wallace's book, The Silent Twins, in the New York Times. Taking exception to his assertion about Sir Francis Galton, I wrote a letter to the Times' editor. The letter was unpublished, but it brought a wonderful response from Sacks himself that is reproduced and examined. Next, brief reviews of twin research concerning the vanishing twin syndrome (VTS), discordant sex in a monozygotic (MZ) twin pair, and multiple pregnancy outcomes from assisted reproductive technology (ART) are presented. This section is followed by popular coverage of superfetated twins, smoking-discordant co-twins, twins in fashion, Yale University twin hockey players, and a visiting professor who was a conjoined twin.

  19. Neonatal status of twins

    Directory of Open Access Journals (Sweden)

    Božinović Dragica

    2012-01-01

    Full Text Available Multiple pregnancy is a pregnancy where more than one fetus develops simultaneously in the womb, as a result of the ovulation and fertilization of more than one egg. It is relatively rare in humans and represents the rest of the phylogenetic stages. The most common are twins and they indicate the development of two fetuses in the womb. The frequency of twin pregnancies is about 1%. Multiple pregnancies belong to a group of high-risk pregnancies because of the many complications that occur during the pregnancy: higher number of premature deliveries, bleeding, early neonatal complications and higher perinatal morbidity and mortality. Such pregnancies and infants require greater supervision and monitoring. The aim of this study was to determine the percentage of baby twins born at the maternity ward of the General Hospital in Prokuplje and their morbidity and mortality. Data on the total number of deliveries, number of twins, parity and maternal age, gestational age, body weight of twins, method of delivery, Apgar score and perinatal mortality were collected and statistically analyzed by means of retrospective analysis of operative birth and neonatal protocol for 6 years (2005 of 2010. Out of 4527 mothers who gave birth 43 were pairs of twins, or 0.95% of women gave birth to twins. These babies are more likely born by Caesarean section, but delivered with slightly lower birth weight.

  20. Treatment of pairing correlations based on the equations of motion for zero-coupled pair operators

    International Nuclear Information System (INIS)

    Andreozzi, F.; Covello, A.; Gargano, A.; Ye, L.J.; Porrino, A.

    1985-01-01

    The pairing problem is treated by means of the equations of motion for zero-coupled pair operators. Exact equations for the seniority-v states of N particles are derived. These equations can be solved by a step-by-step procedure which consists of progressively adding pairs of particles to a core. The theory can be applied at several levels of approximation depending on the number of core states which are taken into account. Some numerical applications to the treatment of v = 0, v = 1, and v = 2 states in the Ni isotopes are performed. The accuracy of various approximations is tested by comparison with exact results. For the seniority-one and seniority-two problems it turns out that the results obtained from the first-order theory are very accurate, while those of higher order calculations are practically exact. Concerning the seniority-zero problem, a fifth-order calculation reproduces quite well the three lowest states

  1. A study of the occurrence of monochorionic and monozygotic twinning in the pig

    DEFF Research Database (Denmark)

    Bjerre, Ditte; Thorup, F.; Jørgensen, Claus Bøttcher

    2009-01-01

    the investigation of porcine monochorionic embryos from 76 sows at days 26-29 post-insemination (p.i.), as well as an examination of 10 whole litters at days 21-22 p.i. In the former group, 29% of the sows carried monochorionic embryos. Based on DNA profiling using microsatellite markers, one monozygotic twin pair...... was found among these embryos. In the latter group, three monozygotic twin pairs were identified. Thus, it can be concluded that although the occurrence of monozygotic twins in pigs is a sporadic event, the fusion of extra-embryonic membranes is relatively common....

  2. The use of twin-screen-based WIMPS in spacecraft control

    Science.gov (United States)

    Klim, R. D.

    1990-10-01

    The ergonomic problems of designing a sophisticated Windows Icons Mouse Pop-up (WIMP) based twin screen workstation are outlined. These same problems will be encountered by future spacecraft controllers. The design of a modern, advanced workstation for use on a distributed multicontrol center in a multisatellite control system is outlined. The system uses access control mechanisms to ensure that only authorized personnel can undertake certain operations on the workstation. Rules governing the use of windowing features, screen attributes, icons, keyboard and mouse in spacecraft control are discussed.

  3. The nature of pseudo-twinning modes on the basis of a twin classification scheme

    International Nuclear Information System (INIS)

    Singh, Jung B.; Sundararaman, M.; Krishnan, M.

    2011-01-01

    Pseudo-twins can form in ordered structures under high stress conditions. These twins are defined by lattice sites that are at twin positions but are incorrectly occupied by different species of atoms. The present note discusses if it is possible to further classify pseudo-twins into different modes based on the nature of associated twinning elements.

  4. Genetic Linkage and Association Analysis for Loneliness in Dutch Twin and Sibling Pairs Points to a Region on Chromosome 12q23–24

    NARCIS (Netherlands)

    Boomsma, D.I.; Cacioppo, J.T.; Slagboom, P.E.; Posthuma, D.

    2006-01-01

    We obtained evidence from a large study in Dutch twins (N = 8387) and siblings (N = 2295) that variation in loneliness has a genetic component. The heritability estimate for loneliness, which was assessed as an ordinal trait, was 40% and did not differ between males and females. There were 682

  5. [Adult twins].

    Science.gov (United States)

    Charlemaine, Christiane

    2006-12-31

    This paper explores the deep roots of closeness that twins share in their youngest age and their effect on their destiny at the adult age. Psychologists believe the bond between twins begins in utero and develops throughout the twins' lives. The four patterns of twinship described show that the twin bond is determined by the quality of parenting that twins receive in their infancy and early childhood. Common problems of adult twins bring about difficulties to adapt in a non-twin world. The nature versus nurture controversy has taken on new life focusing on inter-twin differences and the importance of parent-child interaction as fundamental to the growth and development of personality.

  6. Twin anemia polycythemia sequence

    NARCIS (Netherlands)

    Slaghekke, Femke

    2014-01-01

    In this thesis we describe that Twin Anemia Polycythemia Sequence (TAPS) is a form of chronic feto-fetal transfusion in monochorionic (identical) twins based on a small amount of blood transfusion through very small anastomoses. For the antenatal diagnosis of TAPS, Middle Cerebral Artery – Peak

  7. Production of palm frond based wood plastic composite by using twin screw extruder

    Science.gov (United States)

    Russita, M.; Bahruddin

    2018-04-01

    Wood plastic composite (WPC) is the blending product from wood as filler and polymer thermoplastic as matric. Palm frond waste is a material with selulose about 68%, so it has potential to be developed as raw material for WPC. The purpose of this research was to learn how to produce WPC based on palm frond use twin screw extruder. It used popropilen as matric. As for aditif, it used Maleated Polypropilene (MAPP) as compatibilizer and paraffin as plasticizer. The size of palm frond is 40 – 80 mesh. WPC is made from blending polipropylene, palm frond, MAPP and paraffin with dry mixing method in room temperature. Then, PP, Palm frond and additive from dry mixing is fed into twin screw extruder at 190°C and 60 rpm. It use palm frond/polypropylene 60/40, MAPP 5% w/w and paraffin 2% w/w. From the result, it shown that WPC based on palm frond met the standards forcommercial WPC. It has tensile strength up to 19.2 MPa, bending strength 43.6 MPa and water adsorption 0,32% w/w. So, WPC based on palm frond has prospective to be developed for commercial WPC.

  8. Borderline personality disorder traits and their relationship with dimensions of normative personality: a web-based cohort and twin study.

    Science.gov (United States)

    Kendler, K S; Myers, J; Reichborn-Kjennerud, T

    2011-05-01

    To describe the structure of genetic and environmental risk factors for four dimensions of borderline personality disorder (BPD) and to understand the source of resemblance of these dimensions and normal personality. A web-based sample (n = 44,112 including 542 twin pairs) completed items from 4 scales of the Dimensional Assessment of Personality Pathology Basic Questionnaire and the Big Five Inventory. A one-factor common pathway model best fits the 4 BPD scales producing a highly heritable latent liability (heritability = 60%) and strong loadings on all 4 dimensions. Affective instability had the lowest trait-specific genetic loading, suggesting that it was a core feature of BPD. A complex pattern of genetic and environmental associations was found between the big five personality traits and BPD dimensions. The strongest genetic correlations with the BPD traits were generally seen for neuroticism (positive), followed by conscientiousness and agreeableness, both negative. In the general population, these four BPD dimensions reflect one underlying highly heritable factor. The association between normative personality and dimensions of BPD is complex with high degrees of genetic correlation. © 2010 John Wiley & Sons A/S.

  9. Sleep Terrors in Twins

    Directory of Open Access Journals (Sweden)

    J Gordon Millichap

    2008-12-01

    Full Text Available In an attempt to clarify the genetic and environmental causes of sleep terrors in childhood, reasearchers in Canada followed 390 pairs of monozygotic and dizygotic twins by assessing the frequency of sleep terrors at 18 and 30 months of age using a questionnaire administered to the biological mothers.

  10. Sleep Terrors in Twins

    OpenAIRE

    J Gordon Millichap

    2008-01-01

    In an attempt to clarify the genetic and environmental causes of sleep terrors in childhood, reasearchers in Canada followed 390 pairs of monozygotic and dizygotic twins by assessing the frequency of sleep terrors at 18 and 30 months of age using a questionnaire administered to the biological mothers.

  11. Effects of Light-Emitting Diode Therapy on Muscle Hypertrophy, Gene Expression, Performance, Damage, and Delayed-Onset Muscle Soreness: Case-control Study with a Pair of Identical Twins.

    Science.gov (United States)

    Ferraresi, Cleber; Bertucci, Danilo; Schiavinato, Josiane; Reiff, Rodrigo; Araújo, Amélia; Panepucci, Rodrigo; Matheucci, Euclides; Cunha, Anderson Ferreira; Arakelian, Vivian Maria; Hamblin, Michael R; Parizotto, Nivaldo; Bagnato, Vanderlei

    2016-10-01

    The aim of this study was to verify how a pair of monozygotic twins would respond to light-emitting diode therapy (LEDT) or placebo combined with a strength-training program during 12 weeks. This case-control study enrolled a pair of male monozygotic twins, allocated randomly to LEDT or placebo therapies. Light-emitting diode therapy or placebo was applied from a flexible light-emitting diode array (λ = 850 nm, total energy = 75 J, t = 15 seconds) to both quadriceps femoris muscles of each twin immediately after each strength training session (3 times/wk for 12 weeks) consisting of leg press and leg extension exercises with load of 80% and 50% of the 1-repetition maximum test, respectively. Muscle biopsies, magnetic resonance imaging, maximal load, and fatigue resistance tests were conducted before and after the training program to assess gene expression, muscle hypertrophy and performance, respectively. Creatine kinase levels in blood and visual analog scale assessed muscle damage and delayed-onset muscle soreness, respectively, during the training program. Compared with placebo, LEDT increased the maximal load in exercise and reduced fatigue, creatine kinase, and visual analog scale. Gene expression analyses showed decreases in markers of inflammation (interleukin 1β) and muscle atrophy (myostatin) with LEDT. Protein synthesis (mammalian target of rapamycin) and oxidative stress defense (SOD2 [mitochondrial superoxide dismutase]) were up-regulated with LEDT, together with increases in thigh muscle hypertrophy. Light-emitting diode therapy can be useful to reduce muscle damage, pain, and atrophy, as well as to increase muscle mass, recovery, and athletic performance in rehabilitation programs and sports medicine.

  12. Birth weight, sex, and celiac disease: a nationwide twin study

    Directory of Open Access Journals (Sweden)

    Kuja-Halkola R

    2017-11-01

    =1.11–2.02. However, the association was not significant in within-pair analyses for both dizygotic and monozygotic twins and for both sexes.Conclusion: This population-based study found that in male twins, higher birth weight was associated with higher risk of CD. However, when comparing discordant twin pairs in within-twin pair analyses, there was no statistically significant association between birth weight, intrauterine growth, and future risk of CD. Keywords: autoimmune, gestational age, gluten, registries, risk factors, twins

  13. Neuroanatomic alterations and social and communication deficits in monozygotic twins discordant for autism disorder.

    Science.gov (United States)

    Mitchell, Shanti R; Reiss, Allan L; Tatusko, Danielle H; Ikuta, Ichiro; Kazmerski, Dana B; Botti, Jo-Anna C; Burnette, Courtney P; Kates, Wendy R

    2009-08-01

    Investigating neuroanatomic differences in monozygotic twins who are discordant for autism can help unravel the relative contributions of genetics and environment to this pervasive developmental disorder. The authors used magnetic resonance imaging (MRI) to investigate several brain regions of interest in monozygotic twins who varied in degree of phenotypic discordance for narrowly defined autism. The subjects were 14 pairs of monozygotic twins between the ages of 5 and 14 years old and 14 singleton age- and gender-matched typically developing comparison subjects. The monozygotic twin group was a cohort of children with narrowly defined autistic deficits and their co-twins who presented with varying levels of autistic deficits. High-resolution MRIs were acquired and volumetric/area measurements obtained for the frontal lobe, amygdala, and hippocampus and subregions of the prefrontal cortex, corpus callosum, and cerebellar vermis. No neurovolumetric/area differences were found between twin pairs. Relative to typically developing comparison subjects, dorsolateral prefrontal cortex volumes and anterior areas of the corpus callosum were significantly altered in autistic twins, and volumes of the posterior vermis were altered in both autistic twins and co-twins. Intraclass correlation analysis of brain volumes between children with autism and their co-twins indicated that the degree of within-pair neuroanatomic concordance varied with brain region. In the group of subjects with narrowly defined autism only, dorsolateral prefrontal cortex, amygdala, and posterior vermis volumes were significantly associated with the severity of autism based on scores from the Autism Diagnostic Observation Schedule-Generic. These findings support previous research demonstrating alterations in the prefrontal cortex, corpus callosum, and posterior vermis in children with autism and further suggest that alterations are associated with the severity of the autism phenotype. Continued research

  14. Twin-Core Fiber-Based Mach Zehnder Interferometer for Simultaneous Measurement of Strain and Temperature

    Science.gov (United States)

    Kowal, Dominik; Urbanczyk, Waclaw; Mergo, Pawel

    2018-01-01

    In this paper we present an all-fiber interferometric sensor for the simultaneous measurement of strain and temperature. It is composed of a specially fabricated twin-core fiber spliced between two pieces of a single-mode fiber. Due to the refractive index difference between the two cores in a twin-core fiber, a differential interference pattern is produced at the sensor output. The phase response of the interferometer to strain and temperature is measured in the 850–1250 nm spectral range, showing zero sensitivity to strain at 1000 nm. Due to the significant difference in sensitivities to both parameters, our interferometer is suitable for two-parameter sensing. The simultaneous response of the interferometer to strain and temperature was studied using the two-wavelength interrogation method and a novel approach based on the spectral fitting of the differential phase response. As the latter technique uses all the gathered spectral information, it is more reliable and yields the results with better accuracy. PMID:29558386

  15. TwinFocus, a concentrated photovoltaic module based on mature technologies

    Directory of Open Access Journals (Sweden)

    Antonini Piergiorgio

    2014-01-01

    Full Text Available Among solar power generation, concentrated photovoltaics (CPV based on multijunction (MJ solar cells, is one of the most promising technology for hot climates. The fact that multijunction solar cells based on direct band gap semiconductors demonstrate lower dependence on temperature than silicon solar cells boosted their use in concentrated photovoltaics modules. Departing from the mainstream design of Fresnel lenses, the CPV module based on TwinFocus design with off-axis quasi parabolic mirrors differentiates itself for its compactness and the possibility of easy integration also in roof-top applications. A detailed description of the module and of the systems will be given together with measured performances, and expectations for the next release.

  16. Unnatural base pair systems toward the expansion of the genetic alphabet in the central dogma.

    Science.gov (United States)

    Hirao, Ichiro; Kimoto, Michiko

    2012-01-01

    Toward the expansion of the genetic alphabet of DNA, several artificial third base pairs (unnatural base pairs) have been created. Synthetic DNAs containing the unnatural base pairs can be amplified faithfully by PCR, along with the natural A-T and G-C pairs, and transcribed into RNA. The unnatural base pair systems now have high potential to open the door to next generation biotechnology. The creation of unnatural base pairs is a consequence of repeating "proof of concept" experiments. In the process, initially designed base pairs were modified to address their weak points. Some of them were artificially evolved to ones with higher efficiency and selectivity in polymerase reactions, while others were eliminated from the analysis. Here, we describe the process of unnatural base pair development, as well as the tests of their applications.

  17. The Project TALENT Twin and Sibling Study.

    Science.gov (United States)

    Prescott, Carol A; Achorn, Deanna Lyter; Kaiser, Ashley; Mitchell, Lindsey; McArdle, John J; Lapham, Susan J

    2013-02-01

    Project TALENT is a US national longitudinal study of about 377,000 individuals born in 1942-1946, first assessed in 1960. Students in about 1,200 schools participated in a 2-day battery covering aptitudes, abilities, interests, and individual and family characteristics (Flanagan, 1962; www.projectTALENT.org). Follow-up assessments 1, 5, and 11 years later assessed educational and occupational outcomes. The sample includes approximately 92,000 siblings from 40,000 families, including 2,500 twin pairs and 1,200 other siblings of twins. Until recently, almost no behavior genetic research has been conducted with the sample. In the original data collection information was not collected with the intent to link family members. Recently, we developed algorithms using names, addresses, birthdates, and information about family structure to link siblings and identify twins. We are testing several methods to determine zygosity, including use of yearbook photographs. In this paper, we summarize the design and measures in Project TALENT, describe the Twin and Sibling sample, and present our twin-sib-classmate model. In most twin and family designs, the 'shared environment' includes factors specific to the family combined with between-family differences associated with macro-level variables such as socioeconomic status. The school-based sampling design used in Project TALENT provides a unique opportunity to partition the shared environment into variation shared by siblings, specific to twins, and associated with school- and community-level factors. The availability of many measured characteristics on the family, schools, and neighborhoods enhances the ability to study the impact of specific factors on behavioral variation.

  18. Cohort Profile : The National Academy of Sciences-National Research Council Twin Registry (NAS-NRC Twin Registry)

    NARCIS (Netherlands)

    Gatz, Margaret; Harris, Jennifer R.; Kaprio, Jaakko; McGue, Matt; Smith, Nicholas L.; Snieder, Harold; Spiro, Avron; Butler, David A.

    The National Academy of Sciences-National Research Council Twin Registry (NAS-NRC Twin Registry) is a comprehensive registry of White male twin pairs born in the USA between 1917 and 1927, both of the twins having served in the military. The purpose was medical research and ultimately improved

  19. Ecosensitivity and genetic polymorphism of somatic traits in the perinatal development of twins.

    Science.gov (United States)

    Waszak, Małgorzata; Cieślik, Krystyna; Skrzypczak-Zielińska, Marzena; Szalata, Marlena; Wielgus, Karolina; Kempiak, Joanna; Bręborowicz, Grzegorz; Słomski, Ryszard

    2016-04-01

    In view of criticism regarding the usefulness of heritability coefficients, the aim of this study was to analyze separately the information on genetic and environmental variability. Such an approach, based on the normalization of trait's variability for its value, is determined by the coefficients of genetic polymorphism (Pg) and ecosensitivity (De). The studied material included 1263 twin pairs of both sexes (among them 424 pairs of monozygotic twins and 839 pairs of dizygotic twins) born between the 22nd and 41st week of gestation. Variability of six somatic traits was analyzed. The zygosity of same-sex twins was determined based on the polymorphism of DNA from lymphocytes of the umbilical cord blood, obtained at birth. The coefficients of genetic polymorphism and ecosensitivity for analyzed traits of male and female twins born at various months of gestation were calculated. Our study revealed that a contribution of the genetic component predominated over that of the environmental component in determining the phenotypic variability of somatic traits of newborns from twin pregnancies. The genetically determined phenotypic variability in male twins was greater than in the females. The genetic polymorphism and ecosensitivity of somatic traits were relatively stable during the period of fetal ontogeny analyzed in this study. Only in the case of body weight, a slight increase in the genetic contribution of polygenes to the phenotypic variance could be observed with gestational age, along with a slight decrease in the influence of environmental factors. Copyright © 2015 Elsevier GmbH. All rights reserved.

  20. Chronic pain, depression and cardiovascular disease linked through a shared genetic predisposition: Analysis of a family-based cohort and twin study

    Science.gov (United States)

    Padmanabhan, Sandosh; Porteous, David J.; Burri, Andrea V.; Tanaka, Haruka; Williams, Frances M. K.

    2017-01-01

    Background Depression and chronic pain are the two most important causes of disability (Global Burden of Disease Study 2013). They occur together more frequently than expected and both conditions have been shown to be co-morbid with cardiovascular disease. Although shared socio-demographic risk factors (e.g. gender, deprivation) might explain the co-morbidity of these three conditions, we hypothesised that these three long-term, highly prevalent conditions co-occur and may be due to shared familial risk, and/or genetic factors. Methods and findings We employed three different study designs in two independent cohorts, namely Generation Scotland and TwinsUK, having standardised, validated questionnaire data on the three traits of interest. First, we estimated the prevalence and co-occurrence of chronic pain, depression and angina among 24,024 participants of a population-based cohort of extended families (Generation Scotland: Scottish Family Health Study), adjusting for age, gender, education, smoking status, and deprivation. Secondly, we compared the odds of co-morbidity in sibling-pairs with the odds in unrelated individuals for the three conditions in the same cohort. Lastly, examination of similar traits in a sample of female twins (TwinsUK, n = 2,902), adjusting for age and BMI, allowed independent replication of the findings and exploration of the influence of additive genetic (A) factors and shared (C) and non-shared (E) environmental factors predisposing to co-occurring chronic widespread pain (CWP) and cardiovascular disease (hypertension, angina, stroke, heart attack, elevated cholesterol, angioplasty or bypass surgery). In the Generation Scotland cohort, individuals with depression were more than twice as likely to have chronic pain as those without depression (adjusted OR 2·64 [95% CI 2·34–2·97]); those with angina were four times more likely to have chronic pain (OR 4·19 [3·64–4·82]); those with depression were twice as likely to have angina

  1. Chronic pain, depression and cardiovascular disease linked through a shared genetic predisposition: Analysis of a family-based cohort and twin study.

    Directory of Open Access Journals (Sweden)

    Oliver van Hecke

    Full Text Available Depression and chronic pain are the two most important causes of disability (Global Burden of Disease Study 2013. They occur together more frequently than expected and both conditions have been shown to be co-morbid with cardiovascular disease. Although shared socio-demographic risk factors (e.g. gender, deprivation might explain the co-morbidity of these three conditions, we hypothesised that these three long-term, highly prevalent conditions co-occur and may be due to shared familial risk, and/or genetic factors.We employed three different study designs in two independent cohorts, namely Generation Scotland and TwinsUK, having standardised, validated questionnaire data on the three traits of interest. First, we estimated the prevalence and co-occurrence of chronic pain, depression and angina among 24,024 participants of a population-based cohort of extended families (Generation Scotland: Scottish Family Health Study, adjusting for age, gender, education, smoking status, and deprivation. Secondly, we compared the odds of co-morbidity in sibling-pairs with the odds in unrelated individuals for the three conditions in the same cohort. Lastly, examination of similar traits in a sample of female twins (TwinsUK, n = 2,902, adjusting for age and BMI, allowed independent replication of the findings and exploration of the influence of additive genetic (A factors and shared (C and non-shared (E environmental factors predisposing to co-occurring chronic widespread pain (CWP and cardiovascular disease (hypertension, angina, stroke, heart attack, elevated cholesterol, angioplasty or bypass surgery. In the Generation Scotland cohort, individuals with depression were more than twice as likely to have chronic pain as those without depression (adjusted OR 2·64 [95% CI 2·34-2·97]; those with angina were four times more likely to have chronic pain (OR 4·19 [3·64-4·82]; those with depression were twice as likely to have angina (OR 2·20 [1·90-2·54

  2. The morphology of the sella turcica in monozygotic twins

    DEFF Research Database (Denmark)

    Brock-Jacobsen, Mette T; Pallisgaard, Carsten; Kjaer, Inger

    2009-01-01

    of 42 twin pairs (18 male and 24 female pairs, aged 18-23 years) comprised the material. Sella turcica measurements from non-twins aged 6-21 years were used as normal reference. Length, depth and diameter of the sella turcica were measured and controlled by re-measurements. Pearson's correlation...... showed that the size of the sella turcica may be partly similar and partly dissimilar within the pair of monozygotic twins. Statistical evaluation of the data showed correlations between length, depth and diameter of the sella turcica between the two twin individuals in the same twin pair. Differences...

  3. Monozygotic twin pairs discordant for Hashimoto's thyroiditis share a high proportion of thyroid peroxidase autoantibodies to the immunodominant region A. Further evidence for genetic transmission of epitopic "fingerprints"

    DEFF Research Database (Denmark)

    Brix, Thomas Heiberg; Hegedüs, Laszlo; Gardas, Andrzej

    2011-01-01

    Thyroid peroxidase antibodies (TPOAbs) in patients with Hashimoto's thyroiditis (HT) predominantly react with two immunodominant regions (IDR-A, IDR-B). Theoretically, as shown for the level of TPOAbs, the autoantibody epitopic recognition of the IDRs could be under genetic control. To examine this......, we compared the distribution of TPOAb epitopic fingerprints between healthy monozygotic (MZ) co-twins and siblings to patients with clinically overt HT with a control group of euthyroid subjects, matched for sex and age, but without autoimmune thyroid disease (AITD) among their first-degree relatives...

  4. Heritability analysis of surface-based cortical thickness estimation on a large twin cohort

    Science.gov (United States)

    Shen, Kaikai; Doré, Vincent; Rose, Stephen; Fripp, Jurgen; McMahon, Katie L.; de Zubicaray, Greig I.; Martin, Nicholas G.; Thompson, Paul M.; Wright, Margaret J.; Salvado, Olivier

    2015-03-01

    The aim of this paper is to assess the heritability of cerebral cortex, based on measurements of grey matter (GM) thickness derived from structural MR images (sMRI). With data acquired from a large twin cohort (328 subjects), an automated method was used to estimate the cortical thickness, and EM-ICP surface registration algorithm was used to establish the correspondence of cortex across the population. An ACE model was then employed to compute the heritability of cortical thickness. Heritable cortical thickness measures various cortical regions, especially in frontal and parietal lobes, such as bilateral postcentral gyri, superior occipital gyri, superior parietal gyri, precuneus, the orbital part of the right frontal gyrus, right medial superior frontal gyrus, right middle occipital gyrus, right paracentral lobule, left precentral gyrus, and left dorsolateral superior frontal gyrus.

  5. The etiology of autistic traits in preschoolers : a population-based twin study

    NARCIS (Netherlands)

    de Zeeuw, E.L.; van Beijsterveldt, Catharina E M; Hoekstra, Rosa A; Bartels, Meike; Boomsma, Dorret I

    2017-01-01

    BACKGROUND: Autism Spectrum Disorders (ASD) are highly heritable, but the exact etiological mechanisms underlying the condition are still unclear. METHODS: Using a multiple rater twin design in a large sample of general population preschool twins, this study aimed to (a) estimate the contribution of

  6. 'Biracial'-Looking Twins: A New Twin Type?/Twin Research: Twins with Cystic Teratomas; Sleep Quality and Body Mass Index; Previable Membrane Rupture/Print and Online Reports: Twins Born to a Sister Surrogate; NASA Twin Study; African-Cosmopolitan Twin Fashion Inspirations; Triplet Hockey Stars.

    Science.gov (United States)

    Segal, Nancy L

    2017-06-01

    Dizygotic (DZ) co-twins born to mothers and fathers from different racial or ethnic backgrounds often resemble one parent much more than the other. As such, these pairs comprise a unique subset of twins for investigating how others' responses to their different looks may affect their personalities and self-esteem. This article describes some of these twin pairs and some challenges of raising them, and suggests ways they may be used in research. Next, recent twin research on cystic teratomas, relations between sleep quality and body mass index, and previable membrane rupture is described. The final section concerns twins, twin studies, and related events in the media, namely: twins born to a sister surrogate, the NASA twin investigation, inspiring African-Cosmopolitan twins in fashion, and triplet Hockey Stars.

  7. Twins and non-twin siblings: different estimates of shared environmental influence in early childhood.

    Science.gov (United States)

    Koeppen-Schomerus, Gesina; Spinath, Frank M; Plomin, Robert

    2003-04-01

    Twin studies typically indicate shared environmental influence for cognitive abilities, especially in early childhood. However, across studies, DZ twin correlations tend to be greater than non-twin sibling correlations, suggesting that twin estimates of shared environment are to some extent specific to twins. We tested this hypothesis in a sample of more than 1800 MZ and 1800 same-sex DZ pairs from the Twins Early Development Study (TEDS), a study of twins born in England and Wales in 1994 and 1995. For this analysis, we obtained comparable data from more than 130 same-sex younger siblings of the twins. Twins and their younger siblings were assessed for language, cognitive abilities and behavior problems by their parents at 2 and 3 years of age. For language and cognitive measures at both 2 and 3 years, but not for behavior problems, estimates of shared environment were more than twice as large for twins as compared to non-twin siblings. We conclude that about half of twin study estimates of shared environment for cognitive abilities in early childhood are specific to twins. Although many possibilities exist for explaining the special shared environment effect for twins, we suggest that cognitive-relevant experiences that are not shared by siblings are shared by twins because they are exactly the same age.

  8. Twin pregnancy

    DEFF Research Database (Denmark)

    Sperling, Lene; Tabor, A

    2001-01-01

    Determination of chorionicity is one of the most important issues in the management of twin pregnancy. Modern ultrasound equipment has made it possible to accurately assess placentation already in the first trimester with the lambda sign. With regard to prenatal diagnosis, it is important to know...... for clinicians caring for twin pregnancies....

  9. Flexibility of short DNA helices with finite-length effect: From base pairs to tens of base pairs

    International Nuclear Information System (INIS)

    Wu, Yuan-Yan; Bao, Lei; Zhang, Xi; Tan, Zhi-Jie

    2015-01-01

    Flexibility of short DNA helices is important for the biological functions such as nucleosome formation and DNA-protein recognition. Recent experiments suggest that short DNAs of tens of base pairs (bps) may have apparently higher flexibility than those of kilo bps, while there is still the debate on such high flexibility. In the present work, we have studied the flexibility of short DNAs with finite-length of 5–50 bps by the all-atomistic molecular dynamics simulations and Monte Carlo simulations with the worm-like chain model. Our microscopic analyses reveal that short DNAs have apparently high flexibility which is attributed to the significantly strong bending and stretching flexibilities of ∼6 bps at each helix end. Correspondingly, the apparent persistence length l p of short DNAs increases gradually from ∼29 nm to ∼45 nm as DNA length increases from 10 to 50 bps, in accordance with the available experimental data. Our further analyses show that the short DNAs with excluding ∼6 bps at each helix end have the similar flexibility with those of kilo bps and can be described by the worm-like chain model with l p ∼ 50 nm

  10. Use of a twin dataset to identify AMD-related visual patterns controlled by genetic factors

    Science.gov (United States)

    Quellec, Gwénolé; Abràmoff, Michael D.; Russell, Stephen R.

    2010-03-01

    The mapping of genotype to the phenotype of age-related macular degeneration (AMD) is expected to improve the diagnosis and treatment of the disease in a near future. In this study, we focused on the first step to discover this mapping: we identified visual patterns related to AMD which seem to be controlled by genetic factors, without explicitly relating them to the genes. For this purpose, we used a dataset of eye fundus photographs from 74 twin pairs, either monozygotic twins, who have the same genotype, or dizygotic twins, whose genes responsible for AMD are less likely to be identical. If we are able to differentiate monozygotic twins from dizygotic twins, based on a given visual pattern, then this pattern is likely to be controlled by genetic factors. The main visible consequence of AMD is the apparition of drusen between the retinal pigment epithelium and Bruch's membrane. We developed two automated drusen detectors based on the wavelet transform: a shape-based detector for hard drusen, and a texture- and color- based detector for soft drusen. Forty visual features were evaluated at the location of the automatically detected drusen. These features characterize the texture, the shape, the color, the spatial distribution, or the amount of drusen. A distance measure between twin pairs was defined for each visual feature; a smaller distance should be measured between monozygotic twins for visual features controlled by genetic factors. The predictions of several visual features (75.7% accuracy) are comparable or better than the predictions of human experts.

  11. Heisenberg-limited interferometry with pair coherent states and parity measurements

    International Nuclear Information System (INIS)

    Gerry, Christopher C.; Mimih, Jihane

    2010-01-01

    After reviewing parity-measurement-based interferometry with twin Fock states, which allows for supersensitivity (Heisenberg limited) and super-resolution, we consider interferometry with two different superpositions of twin Fock states, namely, two-mode squeezed vacuum states and pair coherent states. This study is motivated by the experimental challenge of producing twin Fock states on opposite sides of a beam splitter. We find that input two-mode squeezed states, while allowing for Heisenberg-limited sensitivity, do not yield super-resolutions, whereas both are possible with input pair coherent states.

  12. Maternal obesity in singleton versus twin gestations: a population-based matched case-control study.

    Science.gov (United States)

    Lucovnik, Miha; Blickstein, Isaac; Verdenik, Ivan; Trojner-Bregar, Andreja; Tul, Natasa

    2015-04-01

    To examine the impact of pre-pregnancy obesity on adverse outcomes in twin compared to singleton pregnancies. Dichorionic twin gestations with maternal body mass index >30 were matched to three singleton controls. Both obese groups were matched (1:3) with non-obese controls. Rates of preeclampsia, gestational diabetes, cesarean section, and preterm birth were compared. One hundred eighty-nine dichorionic twin pregnancies in obese mothers were matched to 567 twin pregnancies in non-obese mothers, and to 567 singleton pregnancies in obese mothers. The latter were matched to 1701 non-obese mothers with singletons. Preeclampsia was more common in obese mothers with both twins and singletons (odds ratio (OR) 3.95, 95% confidence interval (CI) 2.18-7.16 and OR 6.53, 95% CI 3.75-11.4, respectively) as was gestational diabetes (OR 4.35, 95% CI 2.18-8.69; OR 5.53 95% CI 3.60-8.50). Obese mothers with singletons were more likely to deliver abdominally, but the cesarean rates were obesity independent in twins. Obese mothers were more likely to deliver at Obesity-attributable adverse outcomes are lower in twins compared to singletons. Obesity increases the risk of preterm birth regardless of plurality.

  13. Paired structures and other opposite-based models

    DEFF Research Database (Denmark)

    Rodríguez, J. Tinguaro; Franco, Camilo; Gómez, Daniel

    2015-01-01

    , that we will assume dependent on a specific negation, previously determined. In this way we can define a paired fuzzy set as a couple of opposite valuation fuzzy sets. Then we shall explore what kind of new valuation fuzzy sets can be generated from the semantic tension between those two poles, leading...... to a more complex valuation structure that still keeps the essence of being paired. In this way several neutral fuzzy sets can appear, in particular indeterminacy, ambivalence and conflict. Two consequences are then presented: on one hand, we will show how Atanassov´s Intuitionistic Fuzzy Sets can be viewed...

  14. Nanoswitches based on DNA base pairs: why adenine-thymine is less suitable than guanine-cytosine

    NARCIS (Netherlands)

    Fonseca Guerra, C.; van der Wijst, T.; Bickelhaupt, F.M.

    2006-01-01

    Substituted Watson-Crick guanine-cytosine (GC) base pairs were recently shown to yield robust three-state nanoswitches. Here, we address the question: Can such supramolecular switches also be based on Watson-Crick adenine-thymine (AT) base pairs? We have theoretically analyzed AT pairs in which

  15. Is it possible to use 'twin cores' as a unique sedimentary record? An experimental design based on sediment color

    International Nuclear Information System (INIS)

    Veiga-Pires, C; Mestre, N C

    2009-01-01

    Sedimentary cores are widely used for studying Quaternary records. However, the amount of sediment that is available is proportional to the diameter of the core, which is rarely bigger than 15 cm. One way to obtain more sediment is to use two cores retrieved from almost the same location and use them as if they represent a unique sedimentary record. In the present work, an experimental design has been applied to verify if 'twin cores' from an estuary can be considered as representing the same sedimentary record with twice the amount of sediment to study. Because sediment can be characterized based on its color, the variables used as replicates in the experimental design are the three Lab CIE colors acquired with a X-Rite Colortron spectrophotometer. Sediment cores were retrieved from the upper saltmarsh of Gilao River's estuary, southern Portugal. Twin cores, with in between distances of 50 cm, 100 cm and 200 cm, from two different sites were analysed. Results from a nested ANOVA show that even for the closest twin cores (50 cm apart) there is at least one color variable that shows significant variations between the profiles of both cores. These results clearly show that 'twin cores' cannot be used as a unique sedimentary record without any previous testing, at least in such transitional regions.

  16. Accurate interaction energies of base pairing and base stacking. The final chapter

    Czech Academy of Sciences Publication Activity Database

    Šponer, Jiří; Jurečka, Petr; Hobza, Pavel

    2005-01-01

    Roč. 22, č. 6 (2005), s. 767 ISSN 0739-1102. [Albany 2005. Conversation /14./. 14.06.2005-18.06.2005, Albany] Institutional research plan: CEZ:AV0Z50040507 Keywords : base pairing * base stacking * nucleic acids Subject RIV: BO - Biophysics

  17. Twin birth order, birthweight and birthweight discordance: any relationship

    Directory of Open Access Journals (Sweden)

    Onyiriuka A.N.

    2010-12-01

    Full Text Available Background: It is widely believed that in twin pairs, at birth, the first-born weigh more than the second-born but this concept has been challenged. Objective: To assess the truthfulness of this common concept that first-born twins are usually heavier than their second-born siblings at birth. Methods: In a series of 104 sets of live-born twins, the birth weights of first-born twins were compared with those of their second-born siblings, after controlling for gender. Their intra-pair birthweight differences were determined and twin pairs whose birthweight difference was 15% or more were designated as discordant. Results: Twin I was heavier than Twin II in 61.5% of cases while Twin II was heavier than Twin I in 28.9% of cases. Twins I and II had equal birthweights in 9.6% of cases. Comparing the mean birthweight of the first-born-male twin with that of second-born- male twin, it was 2515+427g (95% Confidence Interval, CI=2402-2628 versus 2432 +435g (95% CI=2321-2543 p>0.05. The mean birthweight of first-born-female twin was 2326+445g (95% CI=2214-2439 while that of the second-born-female twin was 2325+501g (95% CI=2197-2453 p>0.05. When the birthweight difference exceeded 750g, the probability that Twin I will be heavier than Twin II was 83.3% (5 of 6. Conclusion: Although the first-born twin was more often heavier than their second-born siblings, either could weigh more or less at birth. The larger the birthweight difference between growth-discordant twin pair, the greater the probability that the heavier twin would be delivered first

  18. Widespread Transient Hoogsteen Base-Pairs in Canonical Duplex DNA with Variable Energetics

    Science.gov (United States)

    Alvey, Heidi S.; Gottardo, Federico L.; Nikolova, Evgenia N.; Al-Hashimi, Hashim M.

    2015-01-01

    Hoogsteen base-pairing involves a 180 degree rotation of the purine base relative to Watson-Crick base-pairing within DNA duplexes, creating alternative DNA conformations that can play roles in recognition, damage induction, and replication. Here, using Nuclear Magnetic Resonance R1ρ relaxation dispersion, we show that transient Hoogsteen base-pairs occur across more diverse sequence and positional contexts than previously anticipated. We observe sequence-specific variations in Hoogsteen base-pair energetic stabilities that are comparable to variations in Watson-Crick base-pair stability, with Hoogsteen base-pairs being more abundant for energetically less favorable Watson-Crick base-pairs. Our results suggest that the variations in Hoogsteen stabilities and rates of formation are dominated by variations in Watson-Crick base pair stability, suggesting a late transition state for the Watson-Crick to Hoogsteen conformational switch. The occurrence of sequence and position-dependent Hoogsteen base-pairs provide a new potential mechanism for achieving sequence-dependent DNA transactions. PMID:25185517

  19. Unstable Hoogsteen base pairs adjacent to echinomycin binding sites within a DNA duplex

    International Nuclear Information System (INIS)

    Gilbert, D.E.; van der Marel, G.A.; van Boom, J.H.; Feigon, J.

    1989-01-01

    The bisintercalation complex present between the DNA octamer [d(ACGTACGT)] 2 and the cyclic octadepsipeptide antibiotic echinomycin has been studied by one- and two-dimensional proton NMR, and the results obtained have been compared with the crystal structures of related DNA-echinomycin complexes. Two echinomycins are found to bind cooperatively to each DNA duplex at the CpG steps, with the two quinoxaline rings of each echinomycin bisintercalating between the C·G and A·T base pairs. At low temperatures, the A·T base pairs on either side of the intercalation site adopt the Hoogsteen conformation, as observed in the crystal structures. However, as the temperature is raised, the Hoogsteen base pairs in the interior of the duplex are destabilized and are observed to be exchanging between the Hoogsteen base pair and either an open or a Watson-Crick base-paired state. The terminal A·T base pairs, which are not as constrained by the helix as the internal base pairs, remain stably Hoogsteen base-paired up to at least 45 degree C. The implications of these results for the biological role of Hoogsteen base pairs in echinomycin-DNA complexes in vivo are discussed

  20. [Under what conditions does G.C Watson-Crick DNA base pair acquire all four configurations characteristic for A.T Watson-Crick DNA base pair?].

    Science.gov (United States)

    Brovarets', O O

    2013-01-01

    At the MP2/6-311++G(2df,pd)//B3LYP/6-311++G(d,p) level of theory it was established for the first time, that the Löwdin's G*.C* DNA base pair formed by the mutagenic tautomers can acquire, as the A-T Watson-Crick DNA base pair, four biologically important configurations, namely: Watson-Crick, reverse Watson-Crick, Hoogsteen and reverse Hoogsteen. This fact demonstrates rather unexpected role of the tautomerisation of the one of the Watson-Crick DNA base pairs, in particular, via double proton transfer: exactly the G.C-->G*.C* tautomerisation allows to overcome steric hindrances for the implementation of the above mentioned configurations. Geometric, electron-topological and energetic properties of the H-bonds that stabilise the studied pairs, as well as the energetic characteristics of the latters are presented.

  1. Predicting the Mechanism and Kinetics of the Watson-Crick to Hoogsteen Base Pairing Transition

    NARCIS (Netherlands)

    Vreede, J.; Bolhuis, P.G.; Swenson, D.W.H.

    2016-01-01

    DNA duplexes predominantly contain Watson-Crick (WC) base pairs. Yet, a non-negligible number of base pairs converts to the Hoogsteen (HG) hydrogen bonding pattern, involving a 180° rotation of the purine base relative to Watson-Crick. These WC to HG conversions alter the conformation of DNA, and

  2. Long-term leisure time physical activity and properties of bone: a twin study.

    Science.gov (United States)

    Ma, Hongqiang; Leskinen, Tuija; Alen, Markku; Cheng, Sulin; Sipilä, Sarianna; Heinonen, Ari; Kaprio, Jaakko; Suominen, Harri; Kujala, Urho M

    2009-08-01

    Effects of physical activity on bone properties, when controlled for genetic effects, are not fully understood. We aimed to study the association between long-term leisure time physical activity (LTPA) and bone properties using twin pairs known to be discordant for leisure time physical activity for at least 30 yr. Volumetric BMD and geometric properties were measured at the tibia shaft and distal end using pQCT in 16 middle-aged (50-74 yr) same-sex twin pairs (seven monozygotic [MZ] and nine dizygotic [DZ] pairs) selected from a population-based cohort. Paired differences between active and inactive co-twins were studied. Active members of MZ twin pairs had larger cortical bone cross-sectional area (intrapair difference: 8%, p = 0.006), thicker cortex (12%, p = 0.003), and greater moment of inertia (I(max), 20%, p = 0.024) at the tibia shaft than their inactive co-twins. At the distal tibia, trabecular BMD (12%, p = 0.050) and compressive strength index (18%, p = 0.038) were also higher in physically active MZ pair members than their inactive co-twins. The trends were similar, but less consistently so, in DZ pairs as in MZ pairs. Our genetically controlled study design shows that LTPA during adulthood strengthens bones in a site-specific manner, that is, the long bone shaft has a thicker cortex, and thus higher bending strength, whereas the distal bone has higher trabecular density and compressive strength. These results suggest that LTPA has a potential causal role in decreasing the long-term risk of osteoporosis and thus preventing osteoporotic fractures.

  3. ON THE OBSERVATION AND SIMULATION OF SOLAR CORONAL TWIN JETS

    Energy Technology Data Exchange (ETDEWEB)

    Liu, Jiajia; Wang, Yuming; Zhang, Quanhao [CAS Key Laboratory of Geospace Environment, School of Earth and Space Sciences, University of Science and Technology of China, NO. 96, Jinzhai Road, Hefei, Anhui 230026 (China); Fang, Fang [Laboratory for Atmospheric and Space Physics, University of Colorado at Boulder, 1234 Innovation Drive, Boulder, CO 80303 (United States); McIntosh, Scott W.; Fan, Yuhong [High Altitude Observatory, National Center for Atmospheric Research, P.O. Box 3000, Boulder, CO 80307 (United States)

    2016-02-01

    We present the first observation, analysis, and modeling of solar coronal twin jets, which occurred after a preceding jet. Detailed analysis on the kinetics of the preceding jet reveals its blowout-jet nature, which resembles the one studied in Liu et al. However, the erupting process and kinetics of the twin jets appear to be different from the preceding one. Lacking detailed information on the magnetic fields in the twin jet region, we instead use a numerical simulation using a three-dimensional (3D) MHD model as described in Fang et al., and find that in the simulation a pair of twin jets form due to reconnection between the ambient open fields and a highly twisted sigmoidal magnetic flux, which is the outcome of the further evolution of the magnetic fields following the preceding blowout jet. Based on the similarity between the synthesized and observed emission, we propose this mechanism as a possible explanation for the observed twin jets. Combining our observation and simulation, we suggest that with continuous energy transport from the subsurface convection zone into the corona, solar coronal twin jets could be generated in the same fashion addressed above.

  4. On the Observation and Simulation of Solar Coronal Twin Jets

    Science.gov (United States)

    Liu, Jiajia; Fang, Fang; Wang, Yuming; McIntosh, Scott W.; Fan, Yuhong; Zhang, Quanhao

    2016-02-01

    We present the first observation, analysis, and modeling of solar coronal twin jets, which occurred after a preceding jet. Detailed analysis on the kinetics of the preceding jet reveals its blowout-jet nature, which resembles the one studied in Liu et al. However, the erupting process and kinetics of the twin jets appear to be different from the preceding one. Lacking detailed information on the magnetic fields in the twin jet region, we instead use a numerical simulation using a three-dimensional (3D) MHD model as described in Fang et al., and find that in the simulation a pair of twin jets form due to reconnection between the ambient open fields and a highly twisted sigmoidal magnetic flux, which is the outcome of the further evolution of the magnetic fields following the preceding blowout jet. Based on the similarity between the synthesized and observed emission, we propose this mechanism as a possible explanation for the observed twin jets. Combining our observation and simulation, we suggest that with continuous energy transport from the subsurface convection zone into the corona, solar coronal twin jets could be generated in the same fashion addressed above.

  5. Excess Mortality in Hyperthyroidism: The Influence of Preexisting Comorbidity and Genetic Confounding: A Danish Nationwide Register-Based Cohort Study of Twins and Singletons

    Science.gov (United States)

    Brandt, Frans; Almind, Dorthe; Christensen, Kaare; Green, Anders; Brix, Thomas Heiberg

    2012-01-01

    Context: Hyperthyroidism is associated with severe comorbidity, such as stroke, and seems to confer increased mortality. However, it is unknown whether this increased mortality is explained by hyperthyroidism per se, comorbidity, and/or genetic confounding. Objective: The objective of the study was to investigate whether hyperthyroidism is associated with an increased mortality and, if so, whether the association is influenced by comorbidity and/or genetic confounding. Methods: This was an observational cohort study using record-linkage data from nationwide Danish health registers. We identified 4850 singletons and 926 twins from same-sex pairs diagnosed with hyperthyroidism. Each case was matched with four controls for age and gender. The Charlson score was calculated from discharge diagnoses on an individual level to measure comorbidity. Cases and controls were followed up for a mean of 10 yr (range 0–31 yr), and the hazard ratio (HR) for mortality was calculated using Cox regression analyses. Results: In singletons there was a significantly higher mortality in individuals diagnosed with hyperthyroidism than in controls [HR 1.37; 95% confidence interval (CI) 1.30–1.46]. This persisted after adjustment for preexisting comorbidity (HR 1,28; 95% CI 1.21–1.36). In twin pairs discordant for hyperthyroidism (625 pairs), the twin with hyperthyroidism had an increased mortality compared with the corresponding cotwin (HR 1.43; 95% CI 1.09–1.88). However, this was found only in dizygotic pairs (HR 1.80; 95% CI 1.27–2.55) but not in monozygotic pairs (HR 0.95; 95% CI 0.60–1.50). Conclusions: Hyperthyroidism is associated with an increased mortality independent of preexisting comorbidity. The study of twin pairs discordant for hyperthyroidism suggests that genetic confounding influences the association between hyperthyroidism and mortality. PMID:22930783

  6. Late language emergence in 24-month-old twins: heritable and increased risk for late language emergence in twins.

    Science.gov (United States)

    Rice, Mabel L; Zubrick, Stephen R; Taylor, Catherine L; Gayán, Javier; Bontempo, Daniel E

    2014-06-01

    This study investigated the etiology of late language emergence (LLE) in 24-month-old twins, considering possible twinning, zygosity, gender, and heritability effects for vocabulary and grammar phenotypes. A population-based sample of 473 twin pairs participated. Multilevel modeling estimated means and variances of vocabulary and grammar phenotypes, controlling for familiality. Heritability was estimated with DeFries-Fulker regression and variance components models to determine effects of heritability, shared environment, and nonshared environment. Twins had lower average language scores than norms for single-born children, with lower average performance for monozygotic than dizygotic twins and for boys than girls, although gender and zygosity did not interact. Gender did not predict LLE. Significant heritability was detected for vocabulary (0.26) and grammar phenotypes (0.52 and 0.43 for boys and girls, respectively) in the full sample and in the sample selected for LLE (0.42 and 0.44). LLE and the appearance of Word Combinations were also significantly heritable (0.22-0.23). The findings revealed an increased likelihood of LLE in twin toddlers compared with single-born children that is modulated by zygosity and gender differences. Heritability estimates are consistent with previous research for vocabulary and add further suggestion of heritable differences in early grammar acquisition.

  7. Physical activity, fitness, glucose homeostasis, and brain morphology in twins.

    Science.gov (United States)

    Rottensteiner, Mirva; Leskinen, Tuija; Niskanen, Eini; Aaltonen, Sari; Mutikainen, Sara; Wikgren, Jan; Heikkilä, Kauko; Kovanen, Vuokko; Kainulainen, Heikki; Kaprio, Jaakko; Tarkka, Ina M; Kujala, Urho M

    2015-03-01

    The main aim of the present study (FITFATTWIN) was to investigate how physical activity level is associated with body composition, glucose homeostasis, and brain morphology in young adult male monozygotic twin pairs discordant for physical activity. From a population-based twin cohort, we systematically selected 10 young adult male monozygotic twin pairs (age range, 32-36 yr) discordant for leisure time physical activity during the past 3 yr. On the basis of interviews, we calculated a mean sum index for leisure time and commuting activity during the past 3 yr (3-yr LTMET index expressed as MET-hours per day). We conducted extensive measurements on body composition (including fat percentage measured by dual-energy x-ray absorptiometry), glucose homeostasis including homeostatic model assessment index and insulin sensitivity index (Matsuda index, calculated from glucose and insulin values from an oral glucose tolerance test), and whole brain magnetic resonance imaging for regional volumetric analyses. According to pairwise analysis, the active twins had lower body fat percentage (P = 0.029) and homeostatic model assessment index (P = 0.031) and higher Matsuda index (P = 0.021) compared with their inactive co-twins. Striatal and prefrontal cortex (subgyral and inferior frontal gyrus) brain gray matter volumes were larger in the nondominant hemisphere in active twins compared with those in inactive co-twins, with a statistical threshold of P physical activity is associated with improved glucose homeostasis and modulation of striatum and prefrontal cortex gray matter volume, independent of genetic background. The findings may contribute to later reduced risk of type 2 diabetes and mobility limitations.

  8. Características de superdotação em um par de gêmeos monozigóticos Characteristics of giftedness in a pair of monozygotic twins

    Directory of Open Access Journals (Sweden)

    Carolina Sertã Passos

    2011-12-01

    Full Text Available Com objetivo de comparar características de superdotação em um par de gêmeos monozigóticos, mais especificamente criatividade, motivação e capacidade superior, foram utilizados dados provenientes de um programa que identifica estudantes talentosos com o Modelo das Portas Giratórias. Os gêmeos responderam, também, ao Teste Torrance de Pensamento Criativo, à Escala de Avaliação da Motivação para Aprender de Alunos do Ensino Fundamental e à Bateria de Provas de Raciocínio. Eles possuem superdotação acadêmica e artística, sendo que um deles possui, também, altas habilidades para liderança e comunicação. Verificou-se que eles apresentaram elevada criatividade, principalmente verbal. O envolvimento com a tarefa, que neste estudo foi reduzido à motivação para aprender, não está presente em níveis superiores nos gêmeos. Mais semelhanças que diferenças entre os irmãos, talvez por eles compartilharem genes e ambientes, foram identificadas.Data from program that identifies talent through the Revolving Door Identification Model was used to compare characteristics of giftedness of a pair of monozygotic twins, specifically focusing on creativity, motivation and high ability. The twins also answered the Torrance Test of Creative Thinking, the Scale of Motivation to Learn in Elementary School Students and the Battery of Reasoning Tests. They have academic and artistic giftedness; one of them also has high leadership and communication skills. It was found that they showed great creativity, mainly verbal. Task commitment, which in this study was limited to motivation to learn, is not present at higher levels for the twins. More similarities than differences between the two brothers were identified, possibly because they share genes and environments.

  9. The Fourth International Network of Twin Registries: Overview from Osaka/Research Reviews: Familial Fraternal Twinning; Twin Study of Masculine Faces; Physical Aggression and Epigenetics; Prenatal Education for Parents of Twins/Current Events: 2016 Guinness Book of World Records; Oldest Living Male Twins; Twins Reunited at Sixty-Nine; Panda Twins; Twins.com.

    Science.gov (United States)

    Segal, Nancy L

    2015-12-01

    The 4th International Network of Twin Registries (INTR) Consortium Meeting took place in Osaka, Japan, September 28-29, 2015. The venue was the Osaka Medical Center for Medical Innovation and Translational Research. An overview of presentations and other activities is provided. Next, 1930s research on familial fraternal twinning, preference for masculine faces, physical aggression and epigenetics, and a prenatal education program for parents of multiples are described. Current twin-related events include the 2016 Guinness Book of World Records (GWR), the oldest living male twins, newly reunited twins, the birth of panda twins and a controversial twin-based website.

  10. Initiation and strain compatibility of connected extension twins in AZ31 magnesium alloy at high temperature

    Energy Technology Data Exchange (ETDEWEB)

    Liu, Xiao, E-mail: liuxiao0105@163.com [Key Laboratory of High Temperature Wear Resistant Materials Preparation Technology of Hunan Province, Hunan University of Science and Technology, Xiangtan, Hunan 411201 (China); State Key Laboratory of Advanced Design and Manufacturing for Vehicle Body, Hunan University, Changsha, Hunan 410082 (China); Zhu, Biwu [Key Laboratory of High Temperature Wear Resistant Materials Preparation Technology of Hunan Province, Hunan University of Science and Technology, Xiangtan, Hunan 411201 (China); Huang, Guangjie [College of Materials Science and Engineering, Chongqing University, Chongqing, Chongqing 400045 (China); Li, Luoxing, E-mail: luoxing_li@yahoo.com [State Key Laboratory of Advanced Design and Manufacturing for Vehicle Body, Hunan University, Changsha, Hunan 410082 (China); Xie, Chao [Faculty of Mechanical Engineering and Mechanics, Ningbo University, Ningbo 315211 (China); Tang, Changping [Key Laboratory of High Temperature Wear Resistant Materials Preparation Technology of Hunan Province, Hunan University of Science and Technology, Xiangtan, Hunan 411201 (China)

    2016-12-15

    Uniaxial compression tests were carried out at 350 °C and a strain rate of 0.3 s{sup −1} on as-extruded AZ31 magnesium alloy samples. At a true strain of − 0.1, extension twin pairs in a grain and twin chains across adjacent grains were detected. The orientation of selected twins and their host grains were determined by electron backscattered diffraction (EBSD) techniques. The Schmid factors (SFs), accommodation strains and geometric compatibility factors (m{sup ′}) were calculated. Analysis of the data indicated that the formation of twin pair and twin chain was related to the SF and m{sup ′}. Regarding to twin chain across adjacent grains, accommodation strain was also involved. The selection of twin variants in twin chain was generally determined by m{sup ′}. When the twins required the operation of pyramidal slip or twinning in adjacent grain, the corresponding connected twins with a relative high m{sup ′} were selected in this adjacent grain. - Highlights: •The formation of paired twins is studied during high temperature deformation. •The initiation of twinning in twin pair and twin chain obeys the Schmid law. •The twin variants' selection in twin chain is related to the geometric compatibility factor. •The accommodation strain plays an important role on the formation of twin chain.

  11. A twin study of the trough plasma steady-state concentration of metformin

    DEFF Research Database (Denmark)

    Stage, Tore B; Damkier, Per; Pedersen, Rasmus S

    2015-01-01

    OBJECTIVE: The aim of this study was to determine the intrapair similarity in trough steady-state plasma concentrations of metformin in monozygotic and dizygotic twin pairs. METHODS: We included 16 twin pairs (eight monozygotic and eight dizygotic twin pairs) for this study after contacting 524 t...

  12. Nanoscale protein diffusion by STED-based pair correlation analysis.

    Directory of Open Access Journals (Sweden)

    Paolo Bianchini

    Full Text Available We describe for the first time the combination between cross-pair correlation function analysis (pair correlation analysis or pCF and stimulated emission depletion (STED to obtain diffusion maps at spatial resolution below the optical diffraction limit (super-resolution. Our approach was tested in systems characterized by high and low signal to noise ratio, i.e. Capsid Like Particles (CLPs bearing several (>100 active fluorescent proteins and monomeric fluorescent proteins transiently expressed in living Chinese Hamster Ovary cells, respectively. The latter system represents the usual condition encountered in living cell studies on fluorescent protein chimeras. Spatial resolution of STED-pCF was found to be about 110 nm, with a more than twofold improvement over conventional confocal acquisition. We successfully applied our method to highlight how the proximity to nuclear envelope affects the mobility features of proteins actively imported into the nucleus in living cells. Remarkably, STED-pCF unveiled the existence of local barriers to diffusion as well as the presence of a slow component at distances up to 500-700 nm from either sides of nuclear envelope. The mobility of this component is similar to that previously described for transport complexes. Remarkably, all these features were invisible in conventional confocal mode.

  13. Lewis pair polymerization by classical and frustrated Lewis pairs: Acid, base and monomer scope and polymerization mechanism

    KAUST Repository

    Zhang, Yuetao

    2012-01-01

    Classical and frustrated Lewis pairs (LPs) of the strong Lewis acid (LA) Al(C 6F 5) 3 with several Lewis base (LB) classes have been found to exhibit exceptional activity in the Lewis pair polymerization (LPP) of conjugated polar alkenes such as methyl methacrylate (MMA) as well as renewable α-methylene-γ-butyrolactone (MBL) and γ-methyl- α-methylene-γ-butyrolactone (γ-MMBL), leading to high molecular weight polymers, often with narrow molecular weight distributions. This study has investigated a large number of LPs, consisting of 11 LAs as well as 10 achiral and 4 chiral LBs, for LPP of 12 monomers of several different types. Although some more common LAs can also be utilized for LPP, Al(C 6F 5) 3-based LPs are far more active and effective than other LA-based LPs. On the other hand, several classes of LBs, when paired with Al(C 6F 5) 3, can render highly active and effective LPP of MMA and γ-MMBL; such LBs include phosphines (e.g., P tBu 3), chiral chelating diphosphines, N-heterocyclic carbenes (NHCs), and phosphazene superbases (e.g., P 4- tBu). The P 4- tBu/Al(C 6F 5) 3 pair exhibits the highest activity of the LP series, with a remarkably high turn-over frequency of 9.6 × 10 4 h -1 (0.125 mol% catalyst, 100% MMA conversion in 30 s, M n = 2.12 × 10 5 g mol -1, PDI = 1.34). The polymers produced by LPs at RT are typically atactic (P γMMBL with ∼47% mr) or syndio-rich (PMMA with ∼70-75% rr), but highly syndiotactic PMMA with rr ∼91% can be produced by chiral or achiral LPs at -78 °C. Mechanistic studies have identified and structurally characterized zwitterionic phosphonium and imidazolium enolaluminates as the active species of the current LPP system, which are formed by the reaction of the monomer·Al(C 6F 5) 3 adduct with P tBu 3 and NHC bases, respectively. Kinetic studies have revealed that the MMA polymerization by the tBu 3P/ Al(C 6F 5) 3 pair is zero-order in monomer concentration after an initial induction period, and the polymerization

  14. Silver(I)-Mediated Base Pairs in DNA Sequences Containing 7-Deazaguanine/Cytosine: towards DNA with Entirely Metallated Watson-Crick Base Pairs.

    Science.gov (United States)

    Méndez-Arriaga, José M; Maldonado, Carmen R; Dobado, José A; Galindo, Miguel A

    2018-03-26

    DNA sequences comprising noncanonical 7-deazaguanine ( 7C G) and canonical cytosine (C) are capable of forming Watson-Crick base pairs via hydrogen bonds as well as silver(I)-mediated base pairs by coordination to central silver(I) ions. Duplexes I and II containing 7C G and C have been synthesized and characterized. The incorporation of silver(I) ions into these duplexes has been studied by means of temperature-dependent UV spectroscopy, circular dichroism, and DFT calculations. The results suggest the formation of DNA molecules comprising contiguous metallated 7C G-Ag I -C Watson-Crick base pairs that preserve the original B-type conformation. Furthermore, additional studies performed on duplex III indicated that, in the presence of Ag I ions, 7C G-C and 7C A-T Watson-Crick base pairs ( 7C A, 7-deazadenine; T, thymine) can be converted to metallated 7C G-Ag I -C and 7C A-Ag I -T base pairs inside the same DNA molecule whilst maintaining its initial double helix conformation. These findings are very important for the development of customized silver-DNA nanostructures based on a Watson-Crick complementarity pattern. © 2018 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  15. The Influence of Square Planar Platinum Complexes on DNA Bases Pairing. An ab initio DFT Study

    Czech Academy of Sciences Publication Activity Database

    Burda, J. V.; Šponer, Jiří; Leszczynski, J.

    2001-01-01

    Roč. 3, č. 19 (2001), s. 4404-4411 ISSN 1463-9076 R&D Projects: GA MŠk LN00A032 Institutional research plan: CEZ:AV0Z4040901 Keywords : DNA base pairing * platinated base pairs * ab initio DFT study Subject RIV: CF - Physical ; Theoretical Chemistry Impact factor: 1.787, year: 2001

  16. Solvent effects on hydrogen bonds in Watson-Crick, mismatched, and modified DNA base pairs

    NARCIS (Netherlands)

    Poater, Jordi; Swart, Marcel; Guerra, Celia Fonseca; Bickelhaupt, F. Matthias

    2012-01-01

    We have theoretically analyzed a complete series of Watson–Crick and mismatched DNA base pairs, both in gas phase and in solution. Solvation causes a weakening and lengthening of the hydrogen bonds between the DNA bases because of the stabilization of the lone pairs involved in these bonds. We have

  17. A novel pseudo-complementary PNA G-C base pair

    DEFF Research Database (Denmark)

    Olsen, Anne G.; Dahl, Otto; Petersen, Asger Bjørn

    2011-01-01

    Pseudo-complementary oligonucleotide analogues and mimics provide novel opportunities for targeting duplex structures in RNA and DNA. Previously, a pseudo-complementary A-T base pair has been introduced. Towards sequence unrestricted targeting, a pseudo-complementary G-C base pair consisting...

  18. Heritability and mortality risk of insomnia-related symptoms: a genetic epidemiologic study in a population-based twin cohort.

    Science.gov (United States)

    Hublin, Christer; Partinen, Markku; Koskenvuo, Markku; Kaprio, Jaakko

    2011-07-01

    Our aim was to estimate heritability in phenotypic insomnia and the association between insomnia and mortality. Representative follow-up study. 1990 survey of the Finnish Twin Cohort (N = 12502 adults; 1554 monozygotic and 2991 dizygotic twin pairs). Current insomnia-related symptoms (insomnia in general, difficulty in initiating sleep, sleep latency, nocturnal awakening, early morning awakening, and non-restorative sleep assessed in the morning and during the day) were asked. Latent class analysis was used to classify subjects into different sleep quality classes. Quantitative genetic modelling was used to estimate heritability. Mortality data was obtained from national registers until end of April 2009. The heritability estimates of each symptom were similar in both genders varying from 34% (early morning awakening) to 45% (nocturnal awakening). The most parsimonious latent class analysis produced 3 classes: good sleepers (48%), average sleepers (up to weekly symptoms, 40%), and poor sleepers (symptoms daily or almost daily, 12%). The heritability estimate for the cluster was 46% (95% confidence interval 41% to 50%). In a model adjusted for smoking, BMI, and depressive symptoms, the all-cause mortality of poor sleepers was elevated (excess mortality 55% in men and 51% in women). Further adjustment for sleep length, use of sleep promoting medications, and sleep apnea-related symptoms did not change the results. Insomnia-related symptoms were common in both genders. The symptoms and their clusters showed moderate heritability estimates. A significant association was found between poor sleep and risk of mortality, especially in those with somatic disease.

  19. Gestation period and twinning in chimpanzees.

    Science.gov (United States)

    PEACOCK, L J; ROGERS, C M

    1959-04-10

    The length of the gestation period in 118 births in a colony of chimpanzees was found to be 226.8 days, with a standard deviation of 13.3 and a range of 196 to 260 days. Six pairs of twins were born in 120 parturitions; thus the apparent twinning rate is higher than that in man.

  20. Fetal behavior in normal dichorionic twin pregnancy

    NARCIS (Netherlands)

    Mulder, E. J. H.; Derks, J. B.; de Laat, M. W. M.; Visser, G. H. A.

    2012-01-01

    Objectives: A prospective study was performed to compare fetal behavioral development in healthy dichorionic twins and singletons, and identify twin intra-pair associations (synchrony) of fetal movements and rest-activity cycles using different criteria to define synchrony. Subjects and methods:

  1. Roles of the Amino Group of Purine Bases in the Thermodynamic Stability of DNA Base Pairing

    Directory of Open Access Journals (Sweden)

    Shu-ichi Nakano

    2014-08-01

    Full Text Available The energetic aspects of hydrogen-bonded base-pair interactions are important for the design of functional nucleotide analogs and for practical applications of oligonucleotides. The present study investigated the contribution of the 2-amino group of DNA purine bases to the thermodynamic stability of oligonucleotide duplexes under different salt and solvent conditions, using 2'-deoxyriboinosine (I and 2'-deoxyribo-2,6-diaminopurine (D as non-canonical nucleotides. The stability of DNA duplexes was changed by substitution of a single base pair in the following order: G•C > D•T ≈ I•C > A•T > G•T > I•T. The apparent stabilization energy due to the presence of the 2-amino group of G and D varied depending on the salt concentration, and decreased in the water-ethanol mixed solvent. The effects of salt concentration on the thermodynamics of DNA duplexes were found to be partially sequence-dependent, and the 2-amino group of the purine bases might have an influence on the binding of ions to DNA through the formation of a stable base-paired structure. Our results also showed that physiological salt conditions were energetically favorable for complementary base recognition, and conversely, low salt concentration media and ethanol-containing solvents were effective for low stringency oligonucleotide hybridization, in the context of conditions employed in this study.

  2. Traits of ADHD and autism in girls with a twin brother

    DEFF Research Database (Denmark)

    Attermann, Jørn; Obel, Carsten; Bilenberg, Niels

    2012-01-01

    It has been hypothesized that prenatal exposure to testosterone may be associated with traits of attention-deficit/hyperactivity disorder (ADHD) or autism spectrum disorder (ASD). We conducted a population-based study of dizygotic female twins to elucidate this hypothesis, assuming that the sex...... of the co-twin influences the level of prenatal exposure to testosterone. We invited parents of 24,552 3- to 15-year-old twins to answer questionnaires on traits of ADHD and ASD. We analysed the data using a proportional odds model with sex of the co-twin as an instrumental variable for prenatal exposure...... to testosterone of female twins. We received responses for 6,339 girls from dizygotic twin pairs. Odds ratios for male versus female co-twin were 0.71 (95 % confidence interval 0.61-0.81) for ADHD traits and 0.74 (0.66-0.83) for ASD traits, indicating that a twin brother reduces traits of ADHD and ASD in females...

  3. KlenTaq polymerase replicates unnatural base pairs by inducing a Watson-Crick geometry.

    Science.gov (United States)

    Betz, Karin; Malyshev, Denis A; Lavergne, Thomas; Welte, Wolfram; Diederichs, Kay; Dwyer, Tammy J; Ordoukhanian, Phillip; Romesberg, Floyd E; Marx, Andreas

    2012-07-01

    Many candidate unnatural DNA base pairs have been developed, but some of the best-replicated pairs adopt intercalated structures in free DNA that are difficult to reconcile with known mechanisms of polymerase recognition. Here we present crystal structures of KlenTaq DNA polymerase at different stages of replication for one such pair, dNaM-d5SICS, and show that efficient replication results from the polymerase itself, inducing the required natural-like structure.

  4. Genetic and environmental influences on adult attention deficit hyperactivity disorder symptoms: a large Swedish population-based study of twins.

    Science.gov (United States)

    Larsson, H; Asherson, P; Chang, Z; Ljung, T; Friedrichs, B; Larsson, J-O; Lichtenstein, P

    2013-01-01

    Attention deficit hyperactivity disorder (ADHD) frequently persists into adulthood. Family and twin studies delineate a disorder with strong genetic influences among children and adolescents based on parent- and teacher-reported data but little is known about the genetic and environmental contribution to DSM-IV ADHD symptoms in adulthood. We therefore aimed to investigate the impact of genetic and environmental influences on the inattentive and hyperactive-impulsive symptoms of ADHD in adults. Twin methods were applied to self-reported assessments of ADHD symptoms from a large population-based Swedish twin study that included data from 15 198 Swedish male and female twins aged 20 to 46 years. The broad heritability [i.e., A + D, where A is an additive genetic factor and D (dominance) a non-additive genetic factor] was 37% (A = 11%, D = 26%) for inattention and 38% (A = 18%, D = 20%) for hyperactivity-impulsivity. The results also indicate that 52% of the phenotypic correlation between inattention and hyperactivity-impulsivity (r = 0.43) was explained by genetic influences whereas the remaining part of the covariance was explained by non-shared environmental influences. These results were replicated across age strata. Our findings of moderate broad heritability estimates are consistent with previous literature on self-rated ADHD symptoms in older children, adolescents and adults and retrospective reports of self-rated childhood ADHD by adults but differ from studies of younger children with informant ratings. Future research needs to clarify whether our data indicate a true decrease in the heritability of ADHD in adults compared to children, or whether this relates to the use of self-ratings in contrast to informant data.

  5. Covering All the Bases in Genetics: Simple Shorthands and Diagrams for Teaching Base Pairing to Biology Undergraduates

    Directory of Open Access Journals (Sweden)

    Sergei Kuchin

    2011-03-01

    Full Text Available Explaining base pairing is an important element in teaching undergraduate genetics. I propose a teaching approach that aims to close the gap between the mantra “A pairs with T, and G pairs with C” and the “intimidating” chemical diagrams. The approach offers a set of simple “shorthands” for the key bases that can be used to quickly deduce all canonical and wobble pairs that the students need to know. The approach can be further developed to analyze mutagenic mismatch pairing.

  6. Fetal growth disorders in twin gestations.

    LENUS (Irish Health Repository)

    Breathnach, Fionnuala M

    2012-06-01

    Twin growth is frequently mismatched. This review serves to explore the pathophysiologic mechanisms that underlie growth aberrations in twin gestations, the prenatal recognition of abnormal twin growth, and the critical importance of stratifying management of abnormal twin growth by chorionicity. Although poor in utero growth of both twins may reflect maternal factors resulting in global uteroplacental dysfunction, discordant twin growth may be attributed to differences in genetic potential between co-twins, placental dysfunction confined to one placenta only, or one placental territory within a shared placenta. In addition, twin-twin transfusion syndrome represents a distinct entity of which discordant growth is a common feature. Discordant growth is recognized as an independent risk factor for adverse perinatal outcome. Intertwin birth weight disparity of 18% or more should be considered to represent a discordance threshold, which serves as an independent risk factor for adverse perinatal outcome. At this cutoff, perinatal morbidity is found to increase both for the larger and the smaller twin within a discordant pair. There remains uncertainty surrounding the sonographic parameters that are most predictive of discordance. Although heightening of fetal surveillance in the face of discordant twin growth follows the principles applied to singleton gestations complicated by fetal growth restriction, the timing of intervention is largely influenced by chorionicity.

  7. Hallux Valgus, By Nature or Nurture? A Twin Study.

    Science.gov (United States)

    Munteanu, Shannon E; Menz, Hylton B; Wark, John D; Christie, Jemma J; Scurrah, Katrina J; Bui, Minh; Erbas, Bircan; Hopper, John L; Wluka, Anita E

    2017-09-01

    To evaluate the contributions of shared but unmeasured genetic and environmental factors to hallux valgus (HV). Between 2011 and 2012, 74 monozygotic (MZ) and 56 dizygotic (DZ) female twin pairs self-reported HV and putative risk factors, including footwear use across their lifespan. Estimates of casewise concordance (P C ), correlation (ρ), and odds ratios (ORs) were calculated, adjusting for age and other risk factors, and compared between MZ and DZ pairs using logistic regression, generalized estimating equations, and a maximum likelihood-based method, respectively. A total of 70 participants (27%) reported HV, with 12 MZ and 7 DZ pairs being concordant. After adjusting for age, twins were correlated (ρ = 0.27 [95% confidence interval (95% CI) 0.08, 0.46]) and concordant (P C  = 0.45 [95% CI 0.29, 0.61]; mean age 58 years), with no difference between MZ and DZ pairs (P = 0.7). HV was associated with regularly wearing footwear with a constrictive toe-box during the fourth decade (adjusted OR 2.73 [95% CI 1.12, 6.67]). This risk factor was correlated in MZ (ρ = 0.38 [95% CI 0.15, 0.60]) but not DZ (ρ = -0.20 [95% CI -0.43, 0.03]) pairs. These correlations were significantly different (P = 0.002). Twins are correlated for HV, but we found no evidence that correlation was due to shared genetic factors. We identified an environmental risk factor, footwear with a constrictive toe-box, that is not shared to the same extent by MZ and DZ pairs, contrary to the assumption of the classic twin model. Footwear, and possibly genetic factors and unknown shared environmental factors, could contribute to developing HV. © 2016, American College of Rheumatology.

  8. Hoogsteen base pairs proximal and distal to echinomycin binding sites on DNA

    International Nuclear Information System (INIS)

    Mendel, D.; Dervan, P.B.

    1987-01-01

    Forms of the DNA double helix containing non-Watson-Crick base-pairing have been discovered recently based on x-ray diffraction analysis of quionoxaline antibiotic-oligonucleotide complexes. In an effort to find evidence for Hoogsteen base-pairing at quinoxaline-binding sites in solution, chemical footprinting (differential cleavage reactivity) of echinomycin bound to DNA restriction fragments was examined. The authors report that purines (A>G) in the first and/or fourth base-pair positions of occupied echinomycin-binding sites are hyperreactive to diethyl pyrocarbonate. The correspondence of the solid-state data and the sites of diethyl pyrocarbonate hyperreactivity suggests that diethyl pyrocarbonate may be a sensitive reagent for the detection of Hoogsteen base-pairing in solution. Moreover, a 12-base-pair segment of alternating A-T DNA, which is 6 base pairs away from the nearest strong echinomycin-binding site, is also hyperreactive to diethyl pyrocarbonate in the presence of echinomycin. This hyperreactive segment may be an altered form of right-handed DNA that is entirely Hoogsteen base-paired

  9. An outcome-based approach for the creation of fetal growth standards: do singletons and twins need separate standards?

    Science.gov (United States)

    Joseph, K S; Fahey, John; Platt, Robert W; Liston, Robert M; Lee, Shoo K; Sauve, Reg; Liu, Shiliang; Allen, Alexander C; Kramer, Michael S

    2009-03-01

    Contemporary fetal growth standards are created by using theoretical properties (percentiles) of birth weight (for gestational age) distributions. The authors used a clinically relevant, outcome-based methodology to determine if separate fetal growth standards are required for singletons and twins. All singleton and twin livebirths between 36 and 42 weeks' gestation in the United States (1995-2002) were included, after exclusions for missing information and other factors (n = 17,811,922). A birth weight range was identified, at each gestational age, over which serious neonatal morbidity and neonatal mortality rates were lowest. Among singleton males at 40 weeks, serious neonatal morbidity/mortality rates were lowest between 3,012 g (95% confidence interval (CI): 3,008, 3,018) and 3,978 g (95% CI: 3,976, 3,980). The low end of this optimal birth weight range for females was 37 g (95% CI: 21, 53) less. The low optimal birth weight was 152 g (95% CI: 121, 183) less for twins compared with singletons. No differences were observed in low optimal birth weight by period (1999-2002 vs. 1995-1998), but small differences were observed for maternal education, race, parity, age, and smoking status. Patterns of birth weight-specific serious neonatal morbidity/neonatal mortality support the need for plurality-specific fetal growth standards.

  10. Differences in Religiousness in Opposite-Sex and Same-Sex Twins in a Secular Society.

    Science.gov (United States)

    Ahrenfeldt, Linda J; Lindahl-Jacobsen, Rune; Möller, Sören; Christensen, Kaare; Hvidtjørn, Dorte; Hvidt, Niels Christian

    2016-02-01

    Sex differences in religion are well known, with females generally being more religious than males, and shared environmental factors have been suggested to have a large influence on religiousness. Twins from opposite-sex (OS) and same-sex (SS) pairs may differ because of a dissimilar psycho-social rearing environment and/or because of different exposures to hormones in utero. We hypothesized that OS females may display more masculine patterns of religiousness and, vice versa, that OS males may display more feminine patterns. We used a web-based survey conducted in Denmark, which is a secular society. The survey included 2,997 twins aged 20-40 years, identified through the population-based Danish Twin Registry. We applied la Cour and Hvidt's adaptation of Fishman's three conceptual dimensions of meaning: Cognition, Practice, and Importance, and we used Pargament's measure of religious coping (RCOPE) for the assessment of positive and negative religious coping patterns. Differences between OS and SS twins were investigated using logistic regression for each sex. The analyses were adjusted for dependence within twin pairs. No significant differences in religiousness and religious coping were found for OS and SS twins except that more OS than SS females were members of the Danish National Evangelical Lutheran Church and fewer OS than SS females were Catholic, Muslim, or belonged to other religious denominations. Moreover, OS males at age 12 had higher rates of church attendance than did SS males. This study did not provide evidence for masculinization of female twins with male co-twins with regard to religiousness. Nor did it show any significant differences between OS and SS males except from higher rates of church attendance in childhood among males with female co-twins.

  11. Performance of various density functionals for the hydrogen bonds in DNA base pairs

    NARCIS (Netherlands)

    van der Wijst, T.; Fonseca Guerra, C.; Swart, M.; Bickelhaupt, F.M.

    2006-01-01

    We have investigated the performance of seven popular density functionals (B3LYP, BLYP, BP86, mPW, OPBE, PBE, PW91) for describing the geometry and stability of the hydrogen bonds in DNA base pairs. For the gas-phase situation, the hydrogen-bond lengths and strengths in the DNA pairs have been

  12. Envisaging quantum transport phenomenon in a muddled base pair of DNA

    Science.gov (United States)

    Vohra, Rajan; Sawhney, Ravinder Singh

    2018-05-01

    The effect of muddled base pair on electron transfer through a deoxyribonucleic acid (DNA) molecule connected to the gold electrodes has been elucidated using tight binding model. The effect of hydrogen and nitrogen bonds on the resistance of the base pair has been minutely observed. Using the semiempirical extended Huckel approach within NEGF regime, we have determined the current and conductance vs. bias voltage for disordered base pairs of DNA made of thymine (T) and adenine (A). The asymmetrical behaviour amid five times depreciation in the current characteristics has been observed for deviated Au-AT base pair-Au devices. An interesting revelation is that the conductance of the intrinsic AT base pair configuration attains dramatically high values with the symmetrical zig-zag pattern of current, which clearly indicates the transformation of the bond length within the strands of base pair when compared with other samples. A thorough investigation of the transmission coefficients T( E) and HOMO-LUMO gap reveals the misalignment of the strands in base pairs of DNA. The observed results present an insight to extend this work to build biosensing devices to predict the abnormality with the DNA.

  13. Twin Studies of Atopic Dermatitis

    DEFF Research Database (Denmark)

    Elmose, Camilla; Thomsen, Simon Francis

    2015-01-01

    Aim. The aim of this study was to conduct a systematic review of population-based twin studies of (a) the concordance and heritability of AD and (b) the relationship between AD and asthma and, furthermore, to reinterpret findings from previous twin studies in the light of the emerging knowledge a...

  14. Discrimination among individual Watson–Crick base pairs at the termini of single DNA hairpin molecules

    Science.gov (United States)

    Vercoutere, Wenonah A.; Winters-Hilt, Stephen; DeGuzman, Veronica S.; Deamer, David; Ridino, Sam E.; Rodgers, Joseph T.; Olsen, Hugh E.; Marziali, Andre; Akeson, Mark

    2003-01-01

    Nanoscale α-hemolysin pores can be used to analyze individual DNA or RNA molecules. Serial examination of hundreds to thousands of molecules per minute is possible using ionic current impedance as the measured property. In a recent report, we showed that a nanopore device coupled with machine learning algorithms could automatically discriminate among the four combinations of Watson–Crick base pairs and their orientations at the ends of individual DNA hairpin molecules. Here we use kinetic analysis to demonstrate that ionic current signatures caused by these hairpin molecules depend on the number of hydrogen bonds within the terminal base pair, stacking between the terminal base pair and its nearest neighbor, and 5′ versus 3′ orientation of the terminal bases independent of their nearest neighbors. This report constitutes evidence that single Watson–Crick base pairs can be identified within individual unmodified DNA hairpin molecules based on their dynamic behavior in a nanoscale pore. PMID:12582251

  15. Genetic and environmental influences on risk of death due to infections assessed in Danish twins, 1943-2001

    DEFF Research Database (Denmark)

    Obel, Niels; Christensen, Kaare; Petersen, Inge

    2010-01-01

    Genetic differences have been proposed to play a strong role in risk of death from infectious diseases. The study base of 44,005 included all same-sex twin pairs born in 1870-2001, with both twins alive on January 1, 1943, or those born thereafter. Cause of death was obtained from the Danish Cause...... from infectious diseases could be demonstrated, the absolute effect of the genetic component on mortality was small....... genetic influence on the risk of death...

  16. Estimating the Per-Base-Pair Mutation Rate in the Yeast Saccharomyces cerevisiae

    OpenAIRE

    Lang, Gregory I.; Murray, Andrew W.

    2008-01-01

    Although mutation rates are a key determinant of the rate of evolution they are difficult to measure precisely and global mutations rates (mutations per genome per generation) are often extrapolated from the per-base-pair mutation rate assuming that mutation rate is uniform across the genome. Using budding yeast, we describe an improved method for the accurate calculation of mutation rates based on the fluctuation assay. Our analysis suggests that the per-base-pair mutation rates at two genes...

  17. Heritability of Addison's disease and prevalence of associated autoimmunity in a cohort of 112,100 Swedish twins.

    Science.gov (United States)

    Skov, Jakob; Höijer, Jonas; Magnusson, Patrik K E; Ludvigsson, Jonas F; Kämpe, Olle; Bensing, Sophie

    2017-12-01

    The pathophysiology behind autoimmune Addison's disease (AAD) is poorly understood, and the relative influence of genetic and environmental factors remains unclear. In this study, we examined the heritability of AAD and explored disease-associated autoimmune comorbidity among Swedish twins. A population-based longitudinal cohort of 112,100 Swedish twins was used to calculate the heritability of AAD, and to explore co-occurrence of 10 organ-specific autoimmune disorders in twin pairs with AAD. Diagnoses were collected 1964-2012 through linkage to the Swedish National Patient Register. The Swedish Prescribed Drug Register was used for additional diagnostic precision. When available, biobank serum samples were used to ascertain the AAD diagnosis through identification of 21-hydroxylase autoantibodies. We identified 29 twins with AAD. Five out of nine (5/9) monozygotic pairs and zero out of fifteen (0/15) dizygotic pairs were concordant for AAD. The probandwise concordance for monozygotic twins was 0.71 (95% CI 0.40-0.90) and the heritability 0.97 (95% CI 0.88-99). Autoimmune disease patterns of monozygotic twin pairs affected by AAD displayed a higher degree of similarity than those of dizygotic twins, with an incidence rate ratio of 15 (95% CI 1.8-116) on the number of shared autoimmune diagnoses within pairs. The heritability of AAD appears to be very high, emphasizing the need for further research on the genetic etiology of the disease. Monozygotic twin concordance for multiple autoimmune manifestations suggests strong genetic influence on disease specificity in organ-specific autoimmunity.

  18. Differential stabilities and sequence-dependent base pair opening dynamics of Watson-Crick base pairs with 5-hydroxymethylcytosine, 5-formylcytosine, or 5-carboxylcytosine.

    Science.gov (United States)

    Szulik, Marta W; Pallan, Pradeep S; Nocek, Boguslaw; Voehler, Markus; Banerjee, Surajit; Brooks, Sonja; Joachimiak, Andrzej; Egli, Martin; Eichman, Brandt F; Stone, Michael P

    2015-02-10

    5-Hydroxymethylcytosine (5hmC), 5-formylcytosine (5fC), and 5-carboxylcytosine (5caC) form during active demethylation of 5-methylcytosine (5mC) and are implicated in epigenetic regulation of the genome. They are differentially processed by thymine DNA glycosylase (TDG), an enzyme involved in active demethylation of 5mC. Three modified Dickerson-Drew dodecamer (DDD) sequences, amenable to crystallographic and spectroscopic analyses and containing the 5'-CG-3' sequence associated with genomic cytosine methylation, containing 5hmC, 5fC, or 5caC placed site-specifically into the 5'-T(8)X(9)G(10)-3' sequence of the DDD, were compared. The presence of 5caC at the X(9) base increased the stability of the DDD, whereas 5hmC or 5fC did not. Both 5hmC and 5fC increased imino proton exchange rates and calculated rate constants for base pair opening at the neighboring base pair A(5):T(8), whereas 5caC did not. At the oxidized base pair G(4):X(9), 5fC exhibited an increase in the imino proton exchange rate and the calculated kop. In all cases, minimal effects to imino proton exchange rates occurred at the neighboring base pair C(3):G(10). No evidence was observed for imino tautomerization, accompanied by wobble base pairing, for 5hmC, 5fC, or 5caC when positioned at base pair G(4):X(9); each favored Watson-Crick base pairing. However, both 5fC and 5caC exhibited intranucleobase hydrogen bonding between their formyl or carboxyl oxygens, respectively, and the adjacent cytosine N(4) exocyclic amines. The lesion-specific differences observed in the DDD may be implicated in recognition of 5hmC, 5fC, or 5caC in DNA by TDG. However, they do not correlate with differential excision of 5hmC, 5fC, or 5caC by TDG, which may be mediated by differences in transition states of the enzyme-bound complexes.

  19. Differential Stabilities and Sequence-Dependent Base Pair Opening Dynamics of Watson–Crick Base Pairs with 5-Hydroxymethylcytosine, 5-Formylcytosine, or 5-Carboxylcytosine

    Science.gov (United States)

    2016-01-01

    5-Hydroxymethylcytosine (5hmC), 5-formylcytosine (5fC), and 5-carboxylcytosine (5caC) form during active demethylation of 5-methylcytosine (5mC) and are implicated in epigenetic regulation of the genome. They are differentially processed by thymine DNA glycosylase (TDG), an enzyme involved in active demethylation of 5mC. Three modified Dickerson–Drew dodecamer (DDD) sequences, amenable to crystallographic and spectroscopic analyses and containing the 5′-CG-3′ sequence associated with genomic cytosine methylation, containing 5hmC, 5fC, or 5caC placed site-specifically into the 5′-T8X9G10-3′ sequence of the DDD, were compared. The presence of 5caC at the X9 base increased the stability of the DDD, whereas 5hmC or 5fC did not. Both 5hmC and 5fC increased imino proton exchange rates and calculated rate constants for base pair opening at the neighboring base pair A5:T8, whereas 5caC did not. At the oxidized base pair G4:X9, 5fC exhibited an increase in the imino proton exchange rate and the calculated kop. In all cases, minimal effects to imino proton exchange rates occurred at the neighboring base pair C3:G10. No evidence was observed for imino tautomerization, accompanied by wobble base pairing, for 5hmC, 5fC, or 5caC when positioned at base pair G4:X9; each favored Watson–Crick base pairing. However, both 5fC and 5caC exhibited intranucleobase hydrogen bonding between their formyl or carboxyl oxygens, respectively, and the adjacent cytosine N4 exocyclic amines. The lesion-specific differences observed in the DDD may be implicated in recognition of 5hmC, 5fC, or 5caC in DNA by TDG. However, they do not correlate with differential excision of 5hmC, 5fC, or 5caC by TDG, which may be mediated by differences in transition states of the enzyme-bound complexes. PMID:25632825

  20. Concordance for multiple sclerosis in Danish twins

    DEFF Research Database (Denmark)

    Hansen, T; Skytthe, Axel; Stenager, Egon

    2005-01-01

    The occurrence of multiple sclerosis (MS) in twins has not previously been studied in complete nationwide data sets. The existence of almost complete MS and twin registries in Denmark ensures that essentially unbiased samples of MS cases among twins can be obtained. In this population-based study...

  1. An ID-based Blind Signature Scheme from Bilinear Pairings

    OpenAIRE

    B.Umaprasada Rao; K.A.Ajmath

    2010-01-01

    Blind signatures, introduced by Chaum, allow a user to obtain a signature on a message without revealing any thing about the message to the signer. Blind signatures play on important role in plenty of applications such as e-voting, e-cash system where anonymity is of great concern. Identity based(ID-based) public key cryptography can be a good alternative for certified based public key setting, especially when efficient key management and moderate security are required. In this paper, we prop...

  2. Principles of RNA base pairing: Structures and energies of cis and trans-Watson-Crick/Sugar Edge base pairs revealed by quantum chemical calculations

    Czech Academy of Sciences Publication Activity Database

    Šponer, Judit E.; Leszczynski, J.; Šponer, Jiří

    2005-01-01

    Roč. 22, č. 6 (2005), s. 826 ISSN 0739-1102. [Albany 2005. Conversation /14./. 14.06.2005-18.06.2005, Albany] Institutional research plan: CEZ:AV0Z50040507 Keywords : RNA base pairing * DNA * Watson-Crick/Sugar Edge Subject RIV: BO - Biophysics

  3. Higher Rates of DZ Twinning in a Twenty-First Century Birth Cohort.

    Science.gov (United States)

    Rhea, Sally Ann; Corley, Robin P; Heath, Andrew C; Iacono, William G; Neale, Michael C; Hewitt, John K

    2017-09-01

    The Colorado Twin Registry is a population based registry initiated in 1984 with the involvement of the Colorado Department of Health, Division of Vital Statistics. Recruitment includes birth cohorts several years prior to 1984 and all subsequent years. As part of a recent evaluation of Colorado birth records for the years 2006 through 2008 we became aware of a shifting trend in the proportion of MZ and DZ twins in the Colorado population. Historically (Bulmer 1970 The biology of twinning in man, Clarendon, Oxford) we have expected a 1/3, 1/3, 1/3 ratio of MZ, same-sex DZ and opposite sex DZ twins in Caucasian populations. An excess of MZ pairs in most studies was assumed to be due to selection bias. Somewhat more recently, Hur et al.(1995 Behav Genet 25, 337-340) provided evidence that the DZ twinning rate was falling and that therefore selection bias was not the reason for higher MZ enrollment in most twin studies. They suggested that twin researchers might consider strategies to over-enroll DZ pairs to maximize statistical power. In contrast, we now find that of the 3217 twin births in Colorado from 2006 to 2008 with identified sex information the MZ rate is estimated at only 22%, and we have corroborating reports from other states of similar estimates. These were calculated applying Weinberg's rule which assumes an equal birth rate for same sex and opposite sex DZ pairs so that the proportion of MZ in a sample is the proportion of same sex (MM + FF) minus the proportion of opposite-sex (MF, FM). We explore factors, such as an increase in the proportion of non-Caucasian parents and an increase in average maternal age, which may contribute to this shift.

  4. The extension of a DNA double helix by an additional Watson-Crick base pair on the same backbone

    DEFF Research Database (Denmark)

    Kumar, P.; Sharma, P. K.; Madsen, Charlotte S.

    2013-01-01

    Additional base pair: The DNA duplex can be extended with an additional Watson-Crick base pair on the same backbone by the use of double-headed nucleotides. These also work as compressed dinucleotides and form two base pairs with cognate nucleobases on the opposite strand.......Additional base pair: The DNA duplex can be extended with an additional Watson-Crick base pair on the same backbone by the use of double-headed nucleotides. These also work as compressed dinucleotides and form two base pairs with cognate nucleobases on the opposite strand....

  5. Twins with omphalocele in Denmark (1970-1989)

    DEFF Research Database (Denmark)

    Bugge, Merete

    2010-01-01

    Seven pairs of twins, two monozygotic (MZ), two dizygotic (DZ), and three like-sex pairs of unknown zygosity are described. The twin pairs were all discordant for omphalocele except for one pair of conjoined twins. The 8 infants with omphalocele represent 3.1% of the 253 infants with omphalocele......, ascertained in an almost complete nationwide data set of live- and stillborn infants with abdominal wall defects in two decades in Denmark (1970-1989). The occurrence of twins with omphalocele was not significantly different from the occurrence of twins in the Danish population in the same period. To our...... knowledge this is the first report of the occurrence of twins with omphalocele in a systematic nationwide epidemiological study....

  6. Validation of a Crowdsourcing Methodology for Developing a Knowledge Base of Related Problem-Medication Pairs.

    Science.gov (United States)

    McCoy, A B; Wright, A; Krousel-Wood, M; Thomas, E J; McCoy, J A; Sittig, D F

    2015-01-01

    Clinical knowledge bases of problem-medication pairs are necessary for many informatics solutions that improve patient safety, such as clinical summarization. However, developing these knowledge bases can be challenging. We sought to validate a previously developed crowdsourcing approach for generating a knowledge base of problem-medication pairs in a large, non-university health care system with a widely used, commercially available electronic health record. We first retrieved medications and problems entered in the electronic health record by clinicians during routine care during a six month study period. Following the previously published approach, we calculated the link frequency and link ratio for each pair then identified a threshold cutoff for estimated problem-medication pair appropriateness through clinician review; problem-medication pairs meeting the threshold were included in the resulting knowledge base. We selected 50 medications and their gold standard indications to compare the resulting knowledge base to the pilot knowledge base developed previously and determine its recall and precision. The resulting knowledge base contained 26,912 pairs, had a recall of 62.3% and a precision of 87.5%, and outperformed the pilot knowledge base containing 11,167 pairs from the previous study, which had a recall of 46.9% and a precision of 83.3%. We validated the crowdsourcing approach for generating a knowledge base of problem-medication pairs in a large non-university health care system with a widely used, commercially available electronic health record, indicating that the approach may be generalizable across healthcare settings and clinical systems. Further research is necessary to better evaluate the knowledge, to compare crowdsourcing with other approaches, and to evaluate if incorporating the knowledge into electronic health records improves patient outcomes.

  7. Validation of a Crowdsourcing Methodology for Developing a Knowledge Base of Related Problem-Medication Pairs

    Science.gov (United States)

    Wright, A.; Krousel-Wood, M.; Thomas, E. J.; McCoy, J. A.; Sittig, D. F.

    2015-01-01

    Summary Background Clinical knowledge bases of problem-medication pairs are necessary for many informatics solutions that improve patient safety, such as clinical summarization. However, developing these knowledge bases can be challenging. Objective We sought to validate a previously developed crowdsourcing approach for generating a knowledge base of problem-medication pairs in a large, non-university health care system with a widely used, commercially available electronic health record. Methods We first retrieved medications and problems entered in the electronic health record by clinicians during routine care during a six month study period. Following the previously published approach, we calculated the link frequency and link ratio for each pair then identified a threshold cutoff for estimated problem-medication pair appropriateness through clinician review; problem-medication pairs meeting the threshold were included in the resulting knowledge base. We selected 50 medications and their gold standard indications to compare the resulting knowledge base to the pilot knowledge base developed previously and determine its recall and precision. Results The resulting knowledge base contained 26,912 pairs, had a recall of 62.3% and a precision of 87.5%, and outperformed the pilot knowledge base containing 11,167 pairs from the previous study, which had a recall of 46.9% and a precision of 83.3%. Conclusions We validated the crowdsourcing approach for generating a knowledge base of problem-medication pairs in a large non-university health care system with a widely used, commercially available electronic health record, indicating that the approach may be generalizable across healthcare settings and clinical systems. Further research is necessary to better evaluate the knowledge, to compare crowdsourcing with other approaches, and to evaluate if incorporating the knowledge into electronic health records improves patient outcomes. PMID:26171079

  8. Vinylimidazole-Based Asymmetric Ion Pair Comonomers: Synthesis, Polymerization Studies and Formation of Ionically Crosslinked PMMA

    NARCIS (Netherlands)

    Jana, S.; Vasantha, V.A.; Stubbs, L.P.; Parthiban, A.; Vancso, Gyula J.

    2013-01-01

    Vinylimidazole-based asymmetric ion pair comonomers (IPCs) which are free from nonpolymerizable counter ions have been synthesized, characterized and polymerized by free radical polymerization (FRP), atom transfer radical polymerization (ATRP), and reversible addition-fragmentation chain transfer

  9. Non-Watson Crick base pairs might stabilize RNA structural motifs in ...

    Indian Academy of Sciences (India)

    Watson Crick base pairs, internal loops and pseudoknots have been the highlighting feature of recent structural determination of RNAs. The recent crystal structure of group-I introns has demonstrated that these might constitute RNA structural ...

  10. Investigating Unique Environmental Influences of Parenting Practices on Youth Anxiety: A Monozygotic Twin Differences Study

    Science.gov (United States)

    Chen, Jie; Yu, Jing; Zhang, Jianxin

    2016-01-01

    The associations between parenting practices and adolescent anxiety symptoms were examined in both individual and monozygotic (MZ) twin differences levels. Participants were 804 pairs of Chinese MZ adolescent twins aged 10-18 years (M = 13.57, SD = 2.67, 52% females). Twins' anxiety symptoms were assessed by self- and parent-reports. Twins also…

  11. Modelica-based modeling and simulation of a twin screw compressor for heat pump applications

    International Nuclear Information System (INIS)

    Chamoun, Marwan; Rulliere, Romuald; Haberschill, Philippe; Peureux, Jean-Louis

    2013-01-01

    A new twin screw compressor has been developed by SRM (Svenska Rotor Maskiner) for use in a new high temperature heat pump using water as refrigerant. This article presents a mathematical model of the thermodynamic process of compression in twin screw compressors. Using a special discretization method, a transient twin screw compressor model has been developed using Modelica in order to study the dry compression cycle of this machine at high temperature levels. The pressure and enthalpy evolution in the control volumes of the model are calculated as a function of the rotational angle of the male rotor using energy and continuity equations. In addition, associated processes encountered in real machines such as variable fluid leakages, water injection and heat losses are modeled and implemented in the main compressor model. A comparison is performed using the model developed, demonstrating the behavior of the compressor and the evolution of its different parameters in different configurations with and without water injection. This comparison shows the need for water injection to avoid compressor failure and improve its efficiency. -- Highlights: • Difficulties related to the compressor limit the development of a high temperature heat pump using water as refrigerant. • A new water vapor double screw compressor has been developed to overcome compression problems. • A dynamic model of this compressor has been developed and simulated using Modelica. • The behavior of the compressor has been identified all along the compression cycle and efficiencies have been calculated

  12. Base Pair Opening in a Deoxynucleotide Duplex Containing a cis-syn Thymine Cyclobutane Dimer Lesion

    Science.gov (United States)

    Wenke, Belinda B.; Huiting, Leah N.; Frankel, Elisa B.; Lane, Benjamin F.; Núñez, Megan E.

    2014-01-01

    The cis-syn thymine cyclobutane dimer is a DNA photoproduct implicated in skin cancer. We compared the stability of individual base pairs in thymine dimer-containing duplexes to undamaged parent 10-mer duplexes. UV melting thermodynamic measurements, CD spectroscopy, and 2D NOESY NMR spectroscopy confirm that the thymine dimer lesion is locally and moderately destabilizing within an overall B-form duplex conformation. We measured the rates of exchange of individual imino protons by NMR using magnetization transfer from water and determined the equilibrium constant for the opening of each base pair Kop. In the normal duplex Kop decreases from the frayed ends of the duplex toward the center, such that the central TA pair is the most stable with a Kop of 8×10−7. In contrast, base pair opening at the 5’T of the thymine dimer is facile. The 5’T of the dimer has the largest equilibrium constant (Kop =3×10−4) in its duplex, considerably larger than even the frayed penultimate base pairs. Notably, base pairing by the 3’T of the dimer is much more stable than by the 5’T, indicating that the predominant opening mechanism for the thymine dimer lesion is not likely to be flipping out into solution as a single unit. The dimer asymmetrically affects the stability of the duplex in its vicinity, destabilizing base pairing on its 5’ side more than on the 3’ side. The striking differences in base pair opening between parent and dimer duplexes occur independently of the duplex-single strand melting transitions. PMID:24328089

  13. The identical-twin transfusion syndrome: a source of error in estimating IQ resemblance and heritability.

    Science.gov (United States)

    Munsinger, H

    1977-01-01

    Published studies show that among identical twins, lower birthweight is associated with lower adult intelligence. However, no such relation between birthweight and adult IQ exists among fraternal twins. A likely explanation for the association between birthweight and intelligence among identical twins is the identical twin transfusion syndrome which occurs only between some monochorionic identical twin pairs. The IQ scores from separated identical twins were reanalysed to explore the consequences of identical twin transfusion syndrome for IQ resemblance and heritability. Among 129 published cases of identical twin pairs reared apart, 76 pairs contained some birthweight information. The 76 pairs were separated into three classes: 23 pairs in which there was clear evidence of a substantial birthweight differences (indicating the probable existence of the identical twin transfusion syndrome), 27 pairs in which the information on birthweight was ambiguous (?), and 26 pairs in which there was clear evidence that the twins were similar in birthweight. The reanalyses showed: (1) birthweight differences are positively associated with IQ differences in the total sample of separated identical twins; (2) within the group of 23 twin pairs who showed large birthweight differences, there was a positive relation between birthweight differences and IQ differences; (3) when heritability of IQ is estimated for those twins who do not suffer large birthweight differences, the resemblance (and thus, h2/b) of the separated identical twins' IG is 0-95. Given that the average reliability of the individual IQ test is around 0-95, these data suggest that genetic factors and errors of measurement cause the individual differences in IQ among human beings. Because of the identical twin transfusion syndrome, previous studies of MZ twins have underestimated the effect of genetic factors on IQ. An analysis of the IQs for heavier and lighter birthweight twins suggests that the main effect of the

  14. Is that me or my twin? Lack of self-face recognition advantage in identical twins.

    Directory of Open Access Journals (Sweden)

    Matteo Martini

    Full Text Available Despite the increasing interest in twin studies and the stunning amount of research on face recognition, the ability of adult identical twins to discriminate their own faces from those of their co-twins has been scarcely investigated. One's own face is the most distinctive feature of the bodily self, and people typically show a clear advantage in recognizing their own face even more than other very familiar identities. Given the very high level of resemblance of their faces, monozygotic twins represent a unique model for exploring self-face processing. Herein we examined the ability of monozygotic twins to distinguish their own face from the face of their co-twin and of a highly familiar individual. Results show that twins equally recognize their own face and their twin's face. This lack of self-face advantage was negatively predicted by how much they felt physically similar to their co-twin and by their anxious or avoidant attachment style. We speculate that in monozygotic twins, the visual representation of the self-face overlaps with that of the co-twin. Thus, to distinguish the self from the co-twin, monozygotic twins have to rely much more than control participants on the multisensory integration processes upon which the sense of bodily self is based. Moreover, in keeping with the notion that attachment style influences perception of self and significant others, we propose that the observed self/co-twin confusion may depend upon insecure attachment.

  15. Risk factors for Staphylococcus aureus nasal colonization in Danish middle-aged and elderly twins

    DEFF Research Database (Denmark)

    Andersen, P S; Larsen, Lisbeth Aagaard; Fowler, V G

    2013-01-01

    on S. aureus carriage in Danish middle-aged and elderly twins, which indicated no significant heritability that could account for the observed S. aureus carriage. In the present study, we performed a questionnaire-based study of S. aureus colonization on the same cohort of 2,196 Danish middle......-aged and elderly twins to identify specific risk factors for S. aureus nasal colonization, including analyzing the paired twins (n = 478) that were discordant for S. aureus colonization. We found associations between risk factors and S. aureus nasal colonization among middle-aged and elderly twins, including age......, male gender, psoriasis, and atopic diseases. Also, present living on a farm is clearly associated with S. aureus colonization, while smoking had a borderline statistically significant protective effect....

  16. Tunnel conductance of Watson-Crick nucleoside-base pairs from telegraph noise

    International Nuclear Information System (INIS)

    Chang Shuai; He Jin; Lin Lisha; Zhang Peiming; Liang Feng; Huang Shuo; Lindsay, Stuart; Young, Michael

    2009-01-01

    The use of tunneling signals to sequence DNA is presently hampered by the small tunnel conductance of a junction spanning an entire DNA molecule. The design of a readout system that uses a shorter tunneling path requires knowledge of the absolute conductance across base pairs. We have exploited the stochastic switching of hydrogen-bonded DNA base-nucleoside pairs trapped in a tunnel junction to determine the conductance of individual molecular pairs. This conductance is found to be sensitive to the geometry of the junction, but a subset of the data appears to come from unstrained molecular pairs. The conductances determined from these pairs are within a factor of two of the predictions of density functional calculations. The experimental data reproduces the counterintuitive theoretical prediction that guanine-deoxycytidine pairs (3 H-bonds) have a smaller conductance than adenine-thymine pairs (2 H-bonds). A bimodal distribution of switching lifetimes shows that both H-bonds and molecule-metal contacts break.

  17. Physical implementation of pair-based spike timing dependent plasticity

    International Nuclear Information System (INIS)

    Azghadi, M.R.; Al-Sarawi, S.; Iannella, N.; Abbott, D.

    2011-01-01

    Full text: Objective Spike-timing-dependent plasticity (STOP) is one of several plasticity rules which leads to learning and memory in the brain. STOP induces synaptic weight changes based on the timing of the pre- and post-synaptic neurons. A neural network which can mimic the adaptive capability of biological brains in the temporal domain, requires the weight of single connections to be altered by spike timing. To physically realise this network into silicon, a large number of interconnected STOP circuits on the same substrate is required. This imposes two significant limitations in terms of power and area. To cover these limitations, very large scale integrated circuit (VLSI) technology provides attractive features in terms of low power and small area requirements. An example is demonstrated by (lndiveli et al. 2006). The objective of this paper is to present a new implementation of the STOP circuit which demonstrates better power and area in comparison to previous implementations. Methods The proposed circuit uses complementary metal oxide semiconductor (CMOS) technology as depicted in Fig. I. The synaptic weight can be stored on a capacitor and charging/discharging current can lead to potentiation and depression. HSpice simulation results demonstrate that the average power, peak power, and area of the proposed circuit have been reduced by 6, 8 and 15%, respectively, in comparison with Indiveri's implementation. These improvements naturally lead to packing more STOP circuits onto the same substrate, when compared to previous proposals. Hence, this new implementation is quite interesting for real-world large neural networks.

  18. Community Mining Method of Label Propagation Based on Dense Pairs

    Directory of Open Access Journals (Sweden)

    WENG Wei

    2014-03-01

    Full Text Available In recent years, with the popularity of handheld Internet equipments like mobile phones, increasing numbers of people are becoming involved in the virtual social network. Because of its large amount of data and complex structure, the network faces new challenges of community mining. A label propagation algorithm with low time complexity and without prior parameters deals easily with a large networks. This study explored a new method of community mining, based on label propagation with two stages. The first stage involved identifying closely linked nodes according to their local adjacency relations that gave rise to a micro-community. The second stage involved expanding and adjusting this community through a label propagation algorithm (LPA to finally obtain the community structure of the entire social network. This algorithm reduced the number of initial labels and avoided the merging of small communities in general LPAs. Thus, the quality of community discovery was improved, and the linear time complexity of the LPA was maintained.

  19. Heritability of myopia and ocular biometrics in Koreans: the healthy twin study.

    Science.gov (United States)

    Kim, Myung Hun; Zhao, Di; Kim, Woori; Lim, Dong-Hui; Song, Yun-Mi; Guallar, Eliseo; Cho, Juhee; Sung, Joohon; Chung, Eui-Sang; Chung, Tae-Young

    2013-05-01

    To estimate the heritabilities of myopia and ocular biometrics among different family types among a Korean population. We studied 1508 adults in the Healthy Twin Study. Spherical equivalent, axial length, anterior chamber depth, and corneal astigmatism were measured by refraction, corneal topography, and A-scan ultrasonography. To see the degree of resemblance among different types of family relationships, intraclass correlation coefficients (ICC) were calculated. Variance-component methods were applied to estimate the genetic contributions to eye phenotypes as heritability based on the maximum likelihood estimation. Narrow sense heritability was calculated as the proportion of the total phenotypic variance explained by additive genetic effects, and linear and nonlinear effects of age, sex, and interactions between age and sex were adjusted. A total of 240 monozygotic twin pairs, 45 dizygotic twin pairs, and 938 singleton adult family members who were first-degree relatives of twins in 345 families were included in the study. ICCs for spherical equivalent from monozygotic twins, pooled first-degree pairs, and spouse pairs were 0.83, 0.34, and 0.20, respectively. The ICCs of other ocular biometrics were also significantly higher in monozygotic twins compared with other relative pairs, with greater consistency and conformity. The estimated narrow sense heritability (95% confidence interval) was 0.78 (0.71-0.84) for spherical equivalent; 0.86 (0.82-0.90) for axial length; 0.83 (0.76-0.91) for anterior chamber depth; and 0.70 (0.63-0.77) for corneal astigmatism. The estimated heritability of spherical equivalent and ocular biometrics in the Korean population suggests the compelling evidence that all traits are highly heritable.

  20. Genetic and environmental influences on height from infancy to early adulthood: An individual-based pooled analysis of 45 twin cohorts.

    Science.gov (United States)

    Jelenkovic, Aline; Sund, Reijo; Hur, Yoon-Mi; Yokoyama, Yoshie; Hjelmborg, Jacob V B; Möller, Sören; Honda, Chika; Magnusson, Patrik K E; Pedersen, Nancy L; Ooki, Syuichi; Aaltonen, Sari; Stazi, Maria A; Fagnani, Corrado; D'Ippolito, Cristina; Freitas, Duarte L; Maia, José Antonio; Ji, Fuling; Ning, Feng; Pang, Zengchang; Rebato, Esther; Busjahn, Andreas; Kandler, Christian; Saudino, Kimberly J; Jang, Kerry L; Cozen, Wendy; Hwang, Amie E; Mack, Thomas M; Gao, Wenjing; Yu, Canqing; Li, Liming; Corley, Robin P; Huibregtse, Brooke M; Derom, Catherine A; Vlietinck, Robert F; Loos, Ruth J F; Heikkilä, Kauko; Wardle, Jane; Llewellyn, Clare H; Fisher, Abigail; McAdams, Tom A; Eley, Thalia C; Gregory, Alice M; He, Mingguang; Ding, Xiaohu; Bjerregaard-Andersen, Morten; Beck-Nielsen, Henning; Sodemann, Morten; Tarnoki, Adam D; Tarnoki, David L; Knafo-Noam, Ariel; Mankuta, David; Abramson, Lior; Burt, S Alexandra; Klump, Kelly L; Silberg, Judy L; Eaves, Lindon J; Maes, Hermine H; Krueger, Robert F; McGue, Matt; Pahlen, Shandell; Gatz, Margaret; Butler, David A; Bartels, Meike; van Beijsterveldt, Toos C E M; Craig, Jeffrey M; Saffery, Richard; Dubois, Lise; Boivin, Michel; Brendgen, Mara; Dionne, Ginette; Vitaro, Frank; Martin, Nicholas G; Medland, Sarah E; Montgomery, Grant W; Swan, Gary E; Krasnow, Ruth; Tynelius, Per; Lichtenstein, Paul; Haworth, Claire M A; Plomin, Robert; Bayasgalan, Gombojav; Narandalai, Danshiitsoodol; Harden, K Paige; Tucker-Drob, Elliot M; Spector, Timothy; Mangino, Massimo; Lachance, Genevieve; Baker, Laura A; Tuvblad, Catherine; Duncan, Glen E; Buchwald, Dedra; Willemsen, Gonneke; Skytthe, Axel; Kyvik, Kirsten O; Christensen, Kaare; Öncel, Sevgi Y; Aliev, Fazil; Rasmussen, Finn; Goldberg, Jack H; Sørensen, Thorkild I A; Boomsma, Dorret I; Kaprio, Jaakko; Silventoinen, Karri

    2016-06-23

    Height variation is known to be determined by both genetic and environmental factors, but a systematic description of how their influences differ by sex, age and global regions is lacking. We conducted an individual-based pooled analysis of 45 twin cohorts from 20 countries, including 180,520 paired measurements at ages 1-19 years. The proportion of height variation explained by shared environmental factors was greatest in early childhood, but these effects remained present until early adulthood. Accordingly, the relative genetic contribution increased with age and was greatest in adolescence (up to 0.83 in boys and 0.76 in girls). Comparing geographic-cultural regions (Europe, North-America and Australia, and East-Asia), genetic variance was greatest in North-America and Australia and lowest in East-Asia, but the relative proportion of genetic variation was roughly similar across these regions. Our findings provide further insights into height variation during childhood and adolescence in populations representing different ethnicities and exposed to different environments.

  1. Visualizing RNA Secondary Structure Base Pair Binding Probabilities using Nested Concave Hulls

    OpenAIRE

    Sansen , Joris; Bourqui , Romain; Thebault , Patricia; Allali , Julien; Auber , David

    2015-01-01

    International audience; The challenge 1 of the BIOVIS 2015 design contest consists in designing an intuitive visual depiction of base pairs binding probabilities for secondary structure of ncRNA. Our representation depicts the potential nucleotide pairs binding using nested concave hulls over the computed MFE ncRNA secondary structure. Thus, it allows to identify regions with a high level of uncertainty in the MFE computation and the structures which seem to match to reality.

  2. Thermodynamic stability of Hoogsteen and Watson-Crick base pairs in the presence of histone H3-mimicking peptide.

    Science.gov (United States)

    Pramanik, Smritimoy; Nakamura, Kaori; Usui, Kenji; Nakano, Shu-ichi; Saxena, Sarika; Matsui, Jun; Miyoshi, Daisuke; Sugimoto, Naoki

    2011-03-14

    We found that Hoogsteen base pairs were stabilized by molecular crowding and a histone H3-mimicking peptide, which was not observed for Watson-Crick base pairs. Our findings demonstrate that the type of DNA base pair is critical for the interaction between DNA and histones.

  3. The extension of a DNA double helix by an additional Watson-Crick base pair on the same backbone.

    Science.gov (United States)

    Kumar, Pawan; Sharma, Pawan K; Madsen, Charlotte S; Petersen, Michael; Nielsen, Poul

    2013-06-17

    Additional base pair: The DNA duplex can be extended with an additional Watson-Crick base pair on the same backbone by the use of double-headed nucleotides. These also work as compressed dinucleotides and form two base pairs with cognate nucleobases on the opposite strand. Copyright © 2013 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  4. An atlas of RNA base pairs involving modified nucleobases with optimal geometries and accurate energies

    KAUST Repository

    Chawla, Mohit

    2015-06-27

    Posttranscriptional modifications greatly enhance the chemical information of RNA molecules, contributing to explain the diversity of their structures and functions. A significant fraction of RNA experimental structures available to date present modified nucleobases, with half of them being involved in H-bonding interactions with other bases, i.e. ‘modified base pairs’. Herein we present a systematic investigation of modified base pairs, in the context of experimental RNA structures. To this end, we first compiled an atlas of experimentally observed modified base pairs, for which we recorded occurrences and structural context. Then, for each base pair, we selected a representative for subsequent quantum mechanics calculations, to find out its optimal geometry and interaction energy. Our structural analyses show that most of the modified base pairs are non Watson–Crick like and are involved in RNA tertiary structure motifs. In addition, quantum mechanics calculations quantify and provide a rationale for the impact of the different modifications on the geometry and stability of the base pairs they participate in.

  5. An atlas of RNA base pairs involving modified nucleobases with optimal geometries and accurate energies

    KAUST Repository

    Chawla, Mohit; Oliva, R.; Bujnicki, J. M.; Cavallo, Luigi

    2015-01-01

    Posttranscriptional modifications greatly enhance the chemical information of RNA molecules, contributing to explain the diversity of their structures and functions. A significant fraction of RNA experimental structures available to date present modified nucleobases, with half of them being involved in H-bonding interactions with other bases, i.e. ‘modified base pairs’. Herein we present a systematic investigation of modified base pairs, in the context of experimental RNA structures. To this end, we first compiled an atlas of experimentally observed modified base pairs, for which we recorded occurrences and structural context. Then, for each base pair, we selected a representative for subsequent quantum mechanics calculations, to find out its optimal geometry and interaction energy. Our structural analyses show that most of the modified base pairs are non Watson–Crick like and are involved in RNA tertiary structure motifs. In addition, quantum mechanics calculations quantify and provide a rationale for the impact of the different modifications on the geometry and stability of the base pairs they participate in.

  6. An entropy-based improved k-top scoring pairs (TSP) method for ...

    African Journals Online (AJOL)

    An entropy-based improved k-top scoring pairs (TSP) (Ik-TSP) method was presented in this study for the classification and prediction of human cancers based on gene-expression data. We compared Ik-TSP classifiers with 5 different machine learning methods and the k-TSP method based on 3 different feature selection ...

  7. A statistic to estimate the variance of the histogram-based mutual information estimator based on dependent pairs of observations

    NARCIS (Netherlands)

    Moddemeijer, R

    In the case of two signals with independent pairs of observations (x(n),y(n)) a statistic to estimate the variance of the histogram based mutual information estimator has been derived earlier. We present such a statistic for dependent pairs. To derive this statistic it is necessary to avail of a

  8. Generation of arbitrary vector fields based on a pair of orthogonal elliptically polarized base vectors.

    Science.gov (United States)

    Xu, Danfeng; Gu, Bing; Rui, Guanghao; Zhan, Qiwen; Cui, Yiping

    2016-02-22

    We present an arbitrary vector field with hybrid polarization based on the combination of a pair of orthogonal elliptically polarized base vectors on the Poincaré sphere. It is shown that the created vector field is only dependent on the latitude angle 2χ but is independent on the longitude angle 2ψ on the Poincaré sphere. By adjusting the latitude angle 2χ, which is related to two identical waveplates in a common path interferometric arrangement, one could obtain arbitrary type of vector fields. Experimentally, we demonstrate the generation of such kind of vector fields and confirm the distribution of state of polarization by the measurement of Stokes parameters. Besides, we investigate the tight focusing properties of these vector fields. It is found that the additional degree of freedom 2χ provided by arbitrary vector field with hybrid polarization allows one to control the spatial structure of polarization and to engineer the focusing field.

  9. Comparable stability of Hoogsteen and Watson-Crick base pairs in ionic liquid choline dihydrogen phosphate.

    Science.gov (United States)

    Tateishi-Karimata, Hisae; Nakano, Miki; Sugimoto, Naoki

    2014-01-08

    The instability of Hoogsteen base pairs relative to Watson-Crick base pairs has limited biological applications of triplex-forming oligonucleotides. Hydrated ionic liquids (ILs) provide favourable environments for a wide range of chemical reactions and are known to impact the stabilities of Watson-Crick base pairs. We found that DNA triplex formation was significantly stabilized in hydrated choline dihydrogen phosphate as compared with an aqueous buffer at neutral pH. Interestingly, the stability of Hoogsteen base pairs was found to be comparable with that of Watson-Crick base pairs in the hydrated IL. Molecular dynamics simulations of a DNA triplex in the presence of choline ions revealed that the DNA triplex was stabilized because of the binding of choline ion around the third strand in the grooves. Our finding will facilitate the development of new DNA materials. Our data also indicate that triplex formation may be stabilized inside cells where choline ions and their derivatives are abundant in vivo.

  10. Comparable Stability of Hoogsteen and Watson–Crick Base Pairs in Ionic Liquid Choline Dihydrogen Phosphate

    Science.gov (United States)

    Tateishi-Karimata, Hisae; Nakano, Miki; Sugimoto, Naoki

    2014-01-01

    The instability of Hoogsteen base pairs relative to Watson–Crick base pairs has limited biological applications of triplex-forming oligonucleotides. Hydrated ionic liquids (ILs) provide favourable environments for a wide range of chemical reactions and are known to impact the stabilities of Watson–Crick base pairs. We found that DNA triplex formation was significantly stabilized in hydrated choline dihydrogen phosphate as compared with an aqueous buffer at neutral pH. Interestingly, the stability of Hoogsteen base pairs was found to be comparable with that of Watson–Crick base pairs in the hydrated IL. Molecular dynamics simulations of a DNA triplex in the presence of choline ions revealed that the DNA triplex was stabilized because of the binding of choline ion around the third strand in the grooves. Our finding will facilitate the development of new DNA materials. Our data also indicate that triplex formation may be stabilized inside cells where choline ions and their derivatives are abundant in vivo. PMID:24399194

  11. Molecular dynamics study of some non-hydrogen-bonding base pair DNA strands

    Science.gov (United States)

    Tiwari, Rakesh K.; Ojha, Rajendra P.; Tiwari, Gargi; Pandey, Vishnudatt; Mall, Vijaysree

    2018-05-01

    In order to elucidate the structural activity of hydrophobic modified DNA, the DMMO2-D5SICS, base pair is introduced as a constituent in different set of 12-mer and 14-mer DNA sequences for the molecular dynamics (MD) simulation in explicit water solvent. AMBER 14 force field was employed for each set of duplex during the 200ns production-dynamics simulation in orthogonal-box-water solvent by the Particle-Mesh-Ewald (PME) method in infinite periodic boundary conditions (PBC) to determine conformational parameters of the complex. The force-field parameters of modified base-pair were calculated by Gaussian-code using Hartree-Fock /ab-initio methodology. RMSD Results reveal that the conformation of the duplex is sequence dependent and the binding energy of the complex depends on the position of the modified base-pair in the nucleic acid strand. We found that non-bonding energy had a significant contribution to stabilising such type of duplex in comparison to electrostatic energy. The distortion produced within strands by such type of base-pair was local and destabilised the duplex integrity near to substitution, moreover the binding energy of duplex depends on the position of substitution of hydrophobic base-pair and the DNA sequence and strongly supports the corresponding experimental study.

  12. Estimating twin concordance for bivariate competing risks twin data

    DEFF Research Database (Denmark)

    Scheike, Thomas; Holst, Klaus K.; Hjelmborg, Jacob B.

    2014-01-01

    For twin time-to-event data, we consider different concordance probabilities, such as the casewise concordance that are routinely computed as a measure of the lifetime dependence/correlation for specific diseases. The concordance probability here is the probability that both twins have experience...... events with the competing risk death. We thus aim to quantify the degree of dependence through the casewise concordance function and show a significant genetic component...... the event of interest. Under the assumption that both twins are censored at the same time, we show how to estimate this probability in the presence of right censoring, and as a consequence, we can then estimate the casewise twin concordance. In addition, we can model the magnitude of within pair dependence...... over time, and covariates may be further influential on the marginal risk and dependence structure. We establish the estimators large sample properties and suggest various tests, for example, for inferring familial influence. The method is demonstrated and motivated by specific twin data on cancer...

  13. Energetics and dynamics of the non-natural fluorescent 4AP:DAP base pair

    KAUST Repository

    Chawla, Mohit

    2018-01-02

    The fluorescent non-natural 4-aminophthalimide (4AP) base, when paired to the complementary 2,4-diaminopyrimidine (DAP) nucleobase, is accommodated in a B-DNA duplex being efficiently recognized and incorporated by DNA polymerases. To complement the experimental studies and rationalize the impact of the above non-natural bases on the structure, stability and dynamics of nucleic acid structures, we performed quantum mechanics (QM) calculations along with classical molecular dynamics (MD) simulations. QM calculations were initially focused on the geometry and energetics of the 4AP:DAP non-natural pair and of H-bonded base pairs between 4AP and all the natural bases in their classical Watson-Crick geometries. The QM calculations indicate that the 4AP:DAP pair, despite the fact that it can form 3 H-bonds in a classic Watson-Crick geometry, has a stability comparable to the A:T pair. Then, we extended the study to reverse Watson-Crick geometries, characteristic of parallel strands. MD simulations were carried out on two 13-mer DNA duplexes, featuring a central 4AP:DAP or A:T pair, respectively. No major structural deformation of the duplex was observed during the MD simulation. Snapshots from the MD simulations were subjected to QM calculations to investigate the 4AP:DAP interaction energy when embedded into a duplex structure, and to investigate the impact of the two non-natural bases on the stacking interactions with adjacent bases in the DNA duplex. We found a slight increase in stacking interactions involving the 4AP:DAP pair, counterbalanced by a moderate decrease in H-bonding interactions of the 4AP:DAP and of the adjacent base pairs in the duplex. The results of our study are in agreement with experimental data and complement them by providing an insight into which factors contribute positively and which factors contribute negatively to the structural compatibility of the fluorescent 4AP:DAP pair with a B-DNA structure.

  14. Sensitivity to Peer Evaluation and Its Genetic and Environmental Determinants: Findings from a Population-Based Twin Study.

    Science.gov (United States)

    Klippel, Annelie; Reininghaus, Ulrich; Viechtbauer, Wolfgang; Decoster, Jeroen; Delespaul, Philippe; Derom, Cathérine; de Hert, Marc; Jacobs, Nele; Menne-Lothmann, Claudia; Rutten, Bart; Thiery, Evert; van Os, Jim; van Winkel, Ruud; Myin-Germeys, Inez; Wichers, Marieke

    2018-02-23

    Adolescents and young adults are highly focused on peer evaluation, but little is known about sources of their differential sensitivity. We examined to what extent sensitivity to peer evaluation is influenced by interacting environmental and genetic factors. A sample of 354 healthy adolescent twin pairs (n = 708) took part in a structured, laboratory task in which they were exposed to peer evaluation. The proportion of the variance in sensitivity to peer evaluation due to genetic and environmental factors was estimated, as was the association with specific a priori environmental risk factors. Differences in sensitivity to peer evaluation between adolescents were explained mainly by non-shared environmental influences. The results on shared environmental influences were not conclusive. No impact of latent genetic factors or gene-environment interactions was found. Adolescents with lower self-rated positions on the social ladder or who reported to have been bullied more severely showed significantly stronger responses to peer evaluation. Not genes, but subjective social status and past experience of being bullied seem to impact sensitivity to peer evaluation. This suggests that altered response to peer evaluation is the outcome of cumulative sensitization to social interactions.

  15. Objective assessment of facial skin aging and the associated environmental factors in Japanese monozygotic twins

    OpenAIRE

    Ichibori, Ryoko; Fujiwara, Takashi; Tanigawa, Tomoko; Kanazawa, Shigeyuki; Shingaki, Kenta; Torii, Kosuke; Tomita, Koichi; Yano, Kenji; Sakai, Yasuo; Hosokawa, Ko

    2014-01-01

    Twin studies, especially those involving monozygotic (MZ) twins, facilitate the analysis of factors affecting skin aging while controlling for age, gender, and genetic susceptibility. The purpose of this study was to objectively assess various features of facial skin and analyze the effects of environmental factors on these features in MZ twins. At the Osaka Twin Research Center, 67 pairs of MZ twins underwent medical interviews and photographic assessments, using the VISIA® Complexion Analys...

  16. Urticaria in monozygotic and dizygotic twins

    DEFF Research Database (Denmark)

    Thomsen, Simon Francis; van der Sluis, Sophie; Kyvik, Kirsten Ohm

    2012-01-01

    Aim. To identify risk factors for urticaria, to determine the relative proportion of the susceptibility to urticaria that is due to genetic factors in an adult clinical twin sample, and to further determine whether the genetic susceptibility to urticaria overlaps with the genetic susceptibility...... to atopic diseases. Methods. A total of 256 complete twin pairs and 63 single twins, who were selected from sibships with self-reported asthma via a questionnaire survey of 21,162 adult twins from the Danish Twin Registry, were clinically interviewed about a history of urticaria and examined for atopic...... diseases. Data were analysed with Cox proportional hazards regression and variance components models. Results. A total of 151 individuals (26%) had a history of urticaria, whereas 24 (4%) had had symptoms within the past year. Female sex, HR = 2.09 (1.46-2.99), P = 0.000; hay fever, HR = 1.92 (1...

  17. [Association between obesity and DNA methylation among the 7-16 year-old twins].

    Science.gov (United States)

    Li, C X; Gao, Y; Gao, W J; Yu, C Q; Lyu, J; Lyu, R R; Duan, J L; Sun, Y; Guo, X H; Wang, S F; Zhou, B; Wang, G; Cao, W H; Li, L M

    2018-04-10

    Objective: On whole-genome scale, we tried to explore the correlation between obesity-related traits and DNA methylation sites, based on discordant monozygotic twin pairs. Methods: A total of 90 pairs of 6-17 year-old twins were recruited in Chaoyang district, Yanqing district and Fangshan district in Beijing in 2016. Information on twins was gathered through a self-designed questionnaire and results: from physical examination, including height, weight and waist circumference of the subjects under study. DNA methylation detection was chosen on the Illumina Human Methylation EPIC BeadChip. R 3.3.1 language was used to read the DNA methylation signal under quality control on samples and probes. Ebayes function of empirical Bayes paired moderated t -test was used to identify the differential methylated CpG sites (DMCs). VarFit function of empirical Bayes paired moderated Levene test was used to identify the differentially variables CpG sits (DVCs) in obese and normal groups. Results According to the obesity discordance criteria, we collected 23 pairs of twins (age range 7 to 16 years), including 12 male pairs. A total of 817 471 qualified CpG loci were included in the genome-wide correlation analysis. According to the significance level of FDR set as obesity traits. After multiple testing corrections, no positive sites were found to have associated with obesity. However, results from the correlation analysis demonstrated sites cg05684382 (chr: 12) and cg26188191 (chr: 16) might have played a role in the development of obesity. This study provides a methodologic reference for the studies on discordance twins related problems.

  18. A quantum theoretical study of reactions of methyldiazonium ion with DNA base pairs

    International Nuclear Information System (INIS)

    Shukla, P.K.; Ganapathy, Vinay; Mishra, P.C.

    2011-01-01

    Graphical abstract: Reactions of methyldiazonium ion at the different sites of the DNA bases in the Watson-Crick GC and AT base pairs were investigated employing density functional and second order Moller-Plesset (MP2) perturbation theories. Display Omitted Highlights: → Methylation of the DNA bases is important as it can cause mutation and cancer. → Methylation reactions of the GC and AT base pairs with CH 3 N 2 + were not studied earlier theoretically. → Experimental observations have been explained using theoretical methods. - Abstract: Methylation of the DNA bases in the Watson-Crick GC and AT base pairs by the methyldiazonium ion was investigated employing density functional and second order Moller-Plesset (MP2) perturbation theories. Methylation at the N3, N7 and O6 sites of guanine, N1, N3 and N7 sites of adenine, O2 and N3 sites of cytosine and the O2 and O4 sites of thymine were considered. The computed reactivities for methylation follow the order N7(guanine) > N3(adenine) > O6(guanine) which is in agreement with experiment. The base pairing in DNA is found to play a significant role with regard to reactivities of the different sites.

  19. Base-pairing preferences, physicochemical properties and mutational behaviour of the DNA lesion 8-nitroguanine.

    Science.gov (United States)

    Bhamra, Inder; Compagnone-Post, Patricia; O'Neil, Ian A; Iwanejko, Lesley A; Bates, Andrew D; Cosstick, Richard

    2012-11-01

    8-Nitro-2'-deoxyguanosine (8-nitrodG) is a relatively unstable, mutagenic lesion of DNA that is increasingly believed to be associated with tissue inflammation. Due to the lability of the glycosidic bond, 8-nitrodG cannot be incorporated into oligodeoxynucleotides (ODNs) by chemical DNA synthesis and thus very little is known about its physicochemical properties and base-pairing preferences. Here we describe the synthesis of 8-nitro-2'-O-methylguanosine, a ribonucleoside analogue of this lesion, which is sufficiently stable to be incorporated into ODNs. Physicochemical studies demonstrated that 8-nitro-2'-O-methylguanosine adopts a syn conformation about the glycosidic bond; thermal melting studies and molecular modelling suggest a relatively stable syn-8-nitroG·anti-G base pair. Interestingly, when this lesion analogue was placed in a primer-template system, extension of the primer by either avian myeloblastosis virus reverse transcriptase (AMV-RT) or human DNA polymerase β (pol β), was significantly impaired, but where incorporation opposite 8-nitroguanine did occur, pol β showed a 2:1 preference to insert dA over dC, while AMV-RT incorporated predominantly dC. The fact that no 8-nitroG·G base pairing is seen in the primer extension products suggests that the polymerases may discriminate against this pairing system on the basis of its poor geometric match to a Watson-Crick pair.

  20. Base-pairing preferences, physicochemical properties and mutational behaviour of the DNA lesion 8-nitroguanine†

    Science.gov (United States)

    Bhamra, Inder; Compagnone-Post, Patricia; O’Neil, Ian A.; Iwanejko, Lesley A.; Bates, Andrew D.; Cosstick, Richard

    2012-01-01

    8-Nitro-2′-deoxyguanosine (8-nitrodG) is a relatively unstable, mutagenic lesion of DNA that is increasingly believed to be associated with tissue inflammation. Due to the lability of the glycosidic bond, 8-nitrodG cannot be incorporated into oligodeoxynucleotides (ODNs) by chemical DNA synthesis and thus very little is known about its physicochemical properties and base-pairing preferences. Here we describe the synthesis of 8-nitro-2′-O-methylguanosine, a ribonucleoside analogue of this lesion, which is sufficiently stable to be incorporated into ODNs. Physicochemical studies demonstrated that 8-nitro-2′-O-methylguanosine adopts a syn conformation about the glycosidic bond; thermal melting studies and molecular modelling suggest a relatively stable syn-8-nitroG·anti-G base pair. Interestingly, when this lesion analogue was placed in a primer-template system, extension of the primer by either avian myeloblastosis virus reverse transcriptase (AMV-RT) or human DNA polymerase β (pol β), was significantly impaired, but where incorporation opposite 8-nitroguanine did occur, pol β showed a 2:1 preference to insert dA over dC, while AMV-RT incorporated predominantly dC. The fact that no 8-nitroG·G base pairing is seen in the primer extension products suggests that the polymerases may discriminate against this pairing system on the basis of its poor geometric match to a Watson–Crick pair. PMID:22965127

  1. Dislocation mechanism of void growth at twin boundary of nanotwinned nickel based on molecular dynamics simulation

    International Nuclear Information System (INIS)

    Zhang, Yanqiu; Jiang, Shuyong; Zhu, Xiaoming; Zhao, Yanan

    2016-01-01

    Molecular dynamics simulation was performed to investigate dislocation mechanism of void growth at twin boundary (TB) of nanotwinned nickel. Simulation results show that the deformation of nanotwinned nickel containing a void at TB is dominated by the slip involving both leading and trailing partials, where the trailing partials are the dissociation products of stair-rod dislocations formed by the leading partials. The growth of a void at TB is attributed to the successive emission of the leading partials followed by trailing partials as well as the escape of these partial dislocations from the void surface. - Highlights: • Dislocation mechanism of void growth at TB of nanotwinned nickel is investigated. • Deformation of the nanotwinned nickel is dominated by leading and trailing partials. • Growth of void at TB is caused by successive emission and escape of these partials.

  2. Magnetic resonance in multiple sclerose twins

    International Nuclear Information System (INIS)

    Polman, C.H.; UitdeHaag, B.M.J.; Koetsier, C.J.; Valk, J.; Lucas, C.J.

    1989-01-01

    Magnetic resonance imaging (MR) examinations were performed in a series of 7 twin sets (4 monozygotic and 3 dizygotic) and one triplet set who were clinically discordant for multiple sclerosis (MS). MRI abnormalities were detected in a number of the unaffected members of the nonzygotic twin pairs. The authors discuss the possible implications of their findings for the present view on the aetiology of MS. (author). 3 refs.; 1 fig.; 1 tab

  3. Screening and Invasive Testing in Twins

    Directory of Open Access Journals (Sweden)

    Giovanni Monni

    2014-07-01

    Full Text Available Prenatal screening and testing for trisomy 21 in twin pregnancies poses a number of challenges: the exact estimate of the a priori risk of trisomy 21, the choice of prenatal screening test and/or invasive techniques to employ for the diagnosis and the impact of the result on the options of treatment in case of discordant results within a twin pair or among multiples. These different aspects are discussed below while recognizing that many issues remain unresolved.

  4. Epigenetic signature of birth weight discordance in adult twins

    DEFF Research Database (Denmark)

    Tan, Qihua; Nielsen, Morten Frost Munk; Heijmans, Bastiaan T

    2014-01-01

    between birth weight and adult life health while controlling for not only genetics but also postnatal rearing environment. We performed an epigenome-wide profiling on blood samples from 150 pairs of adult monozygotic twins discordant for birth weight to look for molecular evidence of epigenetic signatures...... profiling did not reveal epigenetic signatures of birth weight discordance although some sites displayed age-dependent intra-pair differential methylation in the extremely discordant twin pairs....

  5. Ventricular strain changes in monochorionic twins with and without twin-to-twin transfusion syndrome.

    Science.gov (United States)

    Taylor-Clarke, Marisa C; Matsui, Hikoro; Roughton, Michael; Wimalasundera, Ruwan C; Gardiner, Helena M

    2013-06-01

    The objective of the study was to investigate whether vector velocity imaging (VVI), a non-Doppler speckle tracking ultrasound technology, is feasible in twin pregnancies and can aid management of twin-twin transfusion syndrome (TTTS). Twenty-seven women pregnant with monochorionic diamniotic twins affected by TTTS and 28 monochorionic pregnancies that did not develop TTTS were included in a prospective case-control study at a fetal medicine center. Fetal echocardiograms were recorded with dummy electrocardiography to retain original frame rates when exported for offline speckle tracking analysis using Syngo-VVI software (Siemens Corp, Munich, Germany). Right and left ventricular (LV) free wall Lagrangian strain was measured from the original coordinates. Within-twin pair ventricular strain differences including relationship to Quintero staging and response to laser therapy for TTTS were analyzed by Wilcoxon signed-rank test. The VVI strain measurements could be analyzed in 182 of 200 TTTS and 96 of 112 non-TTTS control ventricles. Within-pair strain was concordant in non-TTTS controls. Recipient LV strain was reduced at all Quintero stages compared with donors (P < .01). Recipient right ventricular strain was reduced only in stages 3 and 4 (P < .01). Strain improved at a median of 2 weeks following successful laser therapy. Intertwin differences in strain were independent of weight discordance. Recipient LV strain is reduced in stages 1 and 2 TTTS. Within-pair strain discordance may distinguish early TTTS from growth discordance and guide timing of and management following treatment. Copyright © 2013 Mosby, Inc. All rights reserved.

  6. Triple helical DNA in a duplex context and base pair opening

    Science.gov (United States)

    Esguerra, Mauricio; Nilsson, Lennart; Villa, Alessandra

    2014-01-01

    It is fundamental to explore in atomic detail the behavior of DNA triple helices as a means to understand the role they might play in vivo and to better engineer their use in genetic technologies, such as antigene therapy. To this aim we have performed atomistic simulations of a purine-rich antiparallel triple helix stretch of 10 base triplets flanked by canonical Watson–Crick double helices. At the same time we have explored the thermodynamic behavior of a flipping Watson–Crick base pair in the context of the triple and double helix. The third strand can be accommodated in a B-like duplex conformation. Upon binding, the double helix changes shape, and becomes more rigid. The triple-helical region increases its major groove width mainly by oversliding in the negative direction. The resulting conformations are somewhere between the A and B conformations with base pairs remaining almost perpendicular to the helical axis. The neighboring duplex regions maintain a B DNA conformation. Base pair opening in the duplex regions is more probable than in the triplex and binding of the Hoogsteen strand does not influence base pair breathing in the neighboring duplex region. PMID:25228466

  7. Twin target self-amplification-based DNA machine for highly sensitive detection of cancer-related gene.

    Science.gov (United States)

    Xu, Huo; Jiang, Yifan; Liu, Dengyou; Liu, Kai; Zhang, Yafeng; Yu, Suhong; Shen, Zhifa; Wu, Zai-Sheng

    2018-06-29

    The sensitive detection of cancer-related genes is of great significance for early diagnosis and treatment of human cancers, and previous isothermal amplification sensing systems were often based on the reuse of target DNA, the amplification of enzymatic products and the accumulation of reporting probes. However, no reporting probes are able to be transformed into target species and in turn initiate the signal of other probes. Herein we reported a simple, isothermal and highly sensitive homogeneous assay system for tumor suppressor p53 gene detection based on a new autonomous DNA machine, where the signaling probe, molecular beacon (MB), was able to execute the function similar to target DNA besides providing the common signal. In the presence of target p53 gene, the operation of DNA machine can be initiated, and cyclical nucleic acid strand-displacement polymerization (CNDP) and nicking/polymerization cyclical amplification (NPCA) occur, during which the MB was opened by target species and cleaved by restriction endonuclease. In turn, the cleaved fragments could activate the next signaling process as target DNA did. According to the functional similarity, the cleaved fragment was called twin target, and the corresponding fashion to amplify the signal was named twin target self-amplification. Utilizing this newly-proposed DNA machine, the target DNA could be detected down to 0.1 pM with a wide dynamic range (6 orders of magnitude) and single-base mismatched targets were discriminated, indicating a very high assay sensitivity and good specificity. In addition, the DNA machine was not only used to screen the p53 gene in complex biological matrix but also was capable of practically detecting genomic DNA p53 extracted from A549 cell line. This indicates that the proposed DNA machine holds the potential application in biomedical research and early clinical diagnosis. Copyright © 2018 Elsevier B.V. All rights reserved.

  8. Conjoined twin piglets with duplicated cranial and caudal axes.

    Science.gov (United States)

    McManus, C A; Partlow, G D; Fisher, K R

    1994-06-01

    Twins with doubling of the cranial and caudal poles, yet having a single thorax, are rare. One set of diprosopus, dipygus porcine conjoined twins was studied. In addition to the conjoining anomaly, these twins also exhibited ambiguous internal reproductive features. The twins had two snouts, three eyes, a single thorax, and were duplicated from the umbilicus caudally. Radiography indicated a single vertebral column in the cervical region. The vertebral columns were separate caudally from this point. There was a total of six limbs--one pair of forelimbs and two pairs of hindlimbs. Many medial structures failed to develop in these twins. Medial cranial nerves V-XII were absent or displaced although apparently normal laterally. The medial palates were present but shortened, whereas the medial mandibular rami had folded back on themselves rostrally to form a midline mass between the two chins. Each twin had only one lateral kidney and one lateral testis. Medial scrotal sacs were present but devoid of a testis. There was a midline, "uterine"-like structure which crossed between the twins. However, histological analysis of this structure revealed it to be dysplastic testicular tissue. The relationship between the abnormal reproductive features in these twins and the conjoining is unclear. The anatomy of these twins, in addition to the literature reviewed, illustrates the internal anatomical heterogeneity of grossly similar conjoined twins. A review of the literature also suggests that conjoined twinning may be more common in swine than was previously suspected.

  9. Measurement and theory of hydrogen bonding contribution to isosteric DNA base pairs.

    Science.gov (United States)

    Khakshoor, Omid; Wheeler, Steven E; Houk, K N; Kool, Eric T

    2012-02-15

    We address the recent debate surrounding the ability of 2,4-difluorotoluene (F), a low-polarity mimic of thymine (T), to form a hydrogen-bonded complex with adenine in DNA. The hydrogen bonding ability of F has been characterized as small to zero in various experimental studies, and moderate to small in computational studies. However, recent X-ray crystallographic studies of difluorotoluene in DNA/RNA have indicated, based on interatomic distances, possible hydrogen bonding interactions between F and natural bases in nucleic acid duplexes and in a DNA polymerase active site. Since F is widely used to measure electrostatic contributions to pairing and replication, it is important to quantify the impact of this isostere on DNA stability. Here, we studied the pairing stability and selectivity of this compound and a closely related variant, dichlorotoluene deoxyriboside (L), in DNA, using both experimental and computational approaches. We measured the thermodynamics of duplex formation in three sequence contexts and with all possible pairing partners by thermal melting studies using the van't Hoff approach, and for selected cases by isothermal titration calorimetry (ITC). Experimental results showed that internal F-A pairing in DNA is destabilizing by 3.8 kcal/mol (van't Hoff, 37 °C) as compared with T-A pairing. At the end of a duplex, base-base interactions are considerably smaller; however, the net F-A interaction remains repulsive while T-A pairing is attractive. As for selectivity, F is found to be slightly selective for adenine over C, G, T by 0.5 kcal mol, as compared with thymine's selectivity of 2.4 kcal/mol. Interestingly, dichlorotoluene in DNA is slightly less destabilizing and slightly more selective than F, despite the lack of strongly electronegative fluorine atoms. Experimental data were complemented by computational results, evaluated at the M06-2X/6-31+G(d) and MP2/cc-pVTZ levels of theory. These computations suggest that the pairing energy of F to A

  10. Heritability of spinal pain and consequences of spinal pain: a comprehensive genetic epidemiologic analysis using a population-based sample of 15,328 twins ages 20-71 years

    DEFF Research Database (Denmark)

    Hartvigsen, Jan; Nielsen, Jan; Kyvik, Kirsten Ohm

    2009-01-01

    on 15,328 twin individuals (44% monozygotic and 56% dizygotic) from complete twin pairs were included. Genetic susceptibility explained approximately 38% of lumbar pain, 32% of thoracic pain, and 39% of neck pain. For patterns of pain, estimates were 7% for lumbar/thoracic, 24% for lumbar/cervical, 0......% for thoracic/cervical, and 35% for pain in all 3 areas. Moderate to high genetic correlations indicated a common genetic basis for many spinal pain syndromes. In general, heritability was higher for women, and only a minor age effect was seen. CONCLUSION: Heritability estimates for pain in different spinal......OBJECTIVE: To assess the relative contribution of genetic and environmental factors to different definitions of spinal pain and consequences of spinal pain. METHODS: The Danish Twin Registry contains detailed survey information on spinal pain and its consequences in twins ages 20-71 years...

  11. Concealed d-wave pairs in the s± condensate of iron-based superconductors.

    Science.gov (United States)

    Ong, Tzen; Coleman, Piers; Schmalian, Jörg

    2016-05-17

    A central question in iron-based superconductivity is the mechanism by which the paired electrons minimize their strong mutual Coulomb repulsion. In most unconventional superconductors, Coulomb repulsion is minimized through the formation of higher angular momentum Cooper pairs, with Fermi surface nodes in the pair wavefunction. The apparent absence of such nodes in the iron-based superconductors has led to a belief they form an s-wave ([Formula: see text]) singlet state, which changes sign between the electron and hole pockets. However, the multiorbital nature of these systems opens an alternative possibility. Here, we propose a new class of [Formula: see text] state containing a condensate of d-wave Cooper pairs, concealed by their entanglement with the iron orbitals. By combining the d-wave ([Formula: see text]) motion of the pairs with the internal angular momenta [Formula: see text] of the iron orbitals to make a singlet ([Formula: see text]), an [Formula: see text] superconductor with a nontrivial topology is formed. This scenario allows us to understand the development of octet nodes in potassium-doped Ba1-x KXFe2As2 as a reconfiguration of the orbital and internal angular momentum into a high spin ([Formula: see text]) state; the reverse transition under pressure into a fully gapped state can then be interpreted as a return to the low-spin singlet. The formation of orbitally entangled pairs is predicted to give rise to a shift in the orbital content at the Fermi surface, which can be tested via laser-based angle-resolved photoemission spectroscopy.

  12. Refractive index and strain sensor based on twin-core fiber with a novel T-shaped taper

    Science.gov (United States)

    Zhang, Chuanbiao; Ning, Tigang; Li, Jing; Zheng, JingJing; Gao, Xuekai; Pei, Li

    2018-06-01

    A compact in-fiber Mach-Zehnder interferometer (MZI) based on twin-core fiber (TCF) with a novel T-shaped taper is proposed and demonstrated. The taper was firstly fabricated by a short section of TCF, and then spliced with a section of cleaved single mode fiber (SMF). When the light transmit into the TCF, multiple modes will be excited and will propagate within the TCF. In experiment, the proposed device had a maximum interferometric extinction ratio about 17 dB. And the refractive index (RI), strain, and temperature response properties of the sensor have been investigated, which show a relatively high RI, strain sensitivity and low temperature cross sensitivity. Hence, the sensor can be a suitable candidate in the biochemical and physical sensing applications. And due to its easy and controllable fabrication, the novel drawing technology can be applied to more multicore optical fibers.

  13. Modeling acardiac twin pregnancies

    NARCIS (Netherlands)

    de Groot, Rosa; van den Wijngaard, Jeroen P. H. M.; Umur, Asli; Beek, Johan F.; Nikkels, Peter G. J.; van Gemert, Martin J. C.

    2007-01-01

    Acardiac twin pregnancies are a rare but severe complication of monochorionic twinning, where the acardiac twin lacks cardiac function but nevertheless grows during pregnancy because it is perfused by the pump twin through a set of placental arterioarterial and venovenous anastomoses. Because the

  14. The Influence of the Thymine C5 Methyl Group on Spontaneous Base Pair Breathing in DNA

    Czech Academy of Sciences Publication Activity Database

    Wärmländer, S.; Šponer, Jiří; Leijon, M.; Šponer, Judit E.

    2002-01-01

    Roč. 277, č. 32 (2002), s. 28491-28497 ISSN 0021-9258 R&D Projects: GA MŠk LN00A016 Institutional research plan: CEZ:AV0Z4040901 Keywords : thymine * DNA * base pairs Subject RIV: CF - Physical ; Theoretical Chemistry Impact factor: 6.696, year: 2002

  15. Watson-Crick base pairs with thiocarbonyl groups: How sulfur changes the hydrogen bonds in DNA

    NARCIS (Netherlands)

    Fonseca Guerra, C.; Baerends, E.J.; Bickelhaupt, F.M.

    2008-01-01

    We have theoretically analyzed mimics of Watson-Crick AT and GC base pairs in which N-H•••O hydrogen bonds are replaced by N-H•••S, using the generalized gradient approximation (GGA) of density functional theory at BP86/TZ2P level. The general effect of the above substitutions is an elongation and a

  16. Substituent effif ects on hydrogen bonding in Watson-Crick base pairs. A theoretical study

    NARCIS (Netherlands)

    Fonseca Guerra, C.; van der Wijst, T.; Bickelhaupt, F.M.

    2005-01-01

    We have theoretically analyzed Watson-Crick AT and GC base pairs in which purine C8 and/or pyrimidine C6 positions carry a substituent X = H, F, Cl or Br, using the generalized gradient approximation (GGA) of density functional theory at BP86/TZ2P. The purpose is to study the effects on structure

  17. Hydrogen Bonding in DNA Base Pairs: Reconciliation of Theory and Experiment

    NARCIS (Netherlands)

    Fonseca Guerra, C.; Bickelhaupt, F.M.; Snijders, J.G.; Baerends, E.J.

    2000-01-01

    Up till now, there has been a significant disagreement between theory and experiment regarding hydrogen bond lengths in Watson - Crick base pairs. To investigate the possible sources of this discrepancy, we have studied numerous model systems for adenine - thymine (AT) and guanine - cytosine (GC)

  18. Metalophillic attraction in the consecutive T-HgII-T DNA base pairs

    Czech Academy of Sciences Publication Activity Database

    Benda, Ladislav; Straka, Michal; Bouř, Petr; Tanaka, Y.; Sychrovský, Vladimír

    2012-01-01

    Roč. 12, č. 1 (2012), s. 50-50 ISSN 1210-8529. [10th Discussions in Structural Molecular Biology. 22.03.2012-24.03.2012, Nové Hrady] Institutional research plan: CEZ:AV0Z40550506 Keywords : T-HgII-T * DNA base pairs Subject RIV: CF - Physical ; Theoretical Chemistry

  19. Differences in outcome between twins and singletons born very preterm: results from a population-based European cohort.

    NARCIS (Netherlands)

    Papiernik, E.; Zeitlin, J.; Delmas, D.; Blondel, B.; Kunzel, W.; Cuttini, M.; Weber, T.; Petrou, S.; Gortner, L.; Kollee, L.A.A.; Draper, E.S.

    2010-01-01

    BACKGROUND: About 10% of twins are born before 32 weeks of gestation and very preterm birth rates are increasing. Preterm twins tend to have more favourable outcomes than singletons of the same gestational age, but fewer data are available for very preterm infants. This study aims to determine

  20. Differences in outcome between twins and singletons born very preterm: results from a population-based European cohort

    DEFF Research Database (Denmark)

    Papiernik, Emile; Zeitlin, Jennifer; Delmas, Dominique

    2010-01-01

    About 10% of twins are born before 32 weeks of gestation and very preterm birth rates are increasing. Preterm twins tend to have more favourable outcomes than singletons of the same gestational age, but fewer data are available for very preterm infants. This study aims to determine whether outcom...

  1. Family-Based Treatment of a 17-Year-Old Twin Presenting with Emerging Anorexia Nervosa: A Case Study Using the "Maudsley Method"

    Science.gov (United States)

    Loeb, Katharine L.; Hirsch, Alicia M.; Greif, Rebecca; Hildebrandt, Thomas B.

    2009-01-01

    This article describes the successful application of family-based treatment (FBT) for a 17-year-old identical twin presenting with a 4-month history of clinically significant symptoms of anorexia nervosa (AN). FBT is a manualized treatment that has been studied in randomized controlled trials for adolescents with AN. This case study illustrates…

  2. Time series regression-based pairs trading in the Korean equities market

    Science.gov (United States)

    Kim, Saejoon; Heo, Jun

    2017-07-01

    Pairs trading is an instance of statistical arbitrage that relies on heavy quantitative data analysis to profit by capitalising low-risk trading opportunities provided by anomalies of related assets. A key element in pairs trading is the rule by which open and close trading triggers are defined. This paper investigates the use of time series regression to define the rule which has previously been identified with fixed threshold-based approaches. Empirical results indicate that our approach may yield significantly increased excess returns compared to ones obtained by previous approaches on large capitalisation stocks in the Korean equities market.

  3. Anorexia and Bulimia Nervosa in Same-Sex and Opposite-Sex Twins : Lack of Association With Twin Type in a Nationwide Study of Finnish Twins

    NARCIS (Netherlands)

    Raevuori, Anu; Kaprio, Jaakko; Hoek, Hans W.; Sihvola, Elina; Rissanen, Aila; Keski-Rahkonen, Anna

    2008-01-01

    Objective: The authors tested the hypothesis that either prenatal feminization or masculinization hormone influences in utero or later socialization affects the risk for anorexia and bulimia nervosa and disordered eating in members of opposite-sex twin pairs. Method: Finnish twins (N=2,426 women,

  4. The etiologic role of genetic and environmental factors in criminal behavior as determined from full- and half-sibling pairs: an evaluation of the validity of the twin method.

    Science.gov (United States)

    Kendler, K S; Lönn, S L; Maes, H H; Sundquist, J; Sundquist, K

    2015-07-01

    Twin studies have shown that criminal behavior (CB) is influenced by both genetic and shared environmental factors. Could these results be replicated using full-siblings and half-siblings? In 911 009 full-siblings reared together (FSRT), 41 872 half-siblings reared together (HSRT) and 52 590 half-siblings reared apart (HSRA), CB was assessed from the Swedish Crime Register. Modeling, including testing for age differences and rearing status, was performed using the OpenMx package. Five sibling models were fitted examining FSRT and HSRT 0-2 years different in age, and both FSRT and HSRT, and FSRT, HSRT and HSRA 0-10 years different in age with and without a specified shared environment indexing age differences. Heritability estimates for CB ranged from 33 to 55% in females and 39 to 56% in males, similar to those found in our prior twin study on the same population. Estimates for the shared environment varied from 1 to 14% in females and 10 to 23% in males, lower than those estimated in the twin study. The specified shared environment indexed by sibling age differences was significant in all models tested. Heritability estimates for CB from full- and half-siblings closely approximated those found from twins in the same population, validating the twin method. Shared environmental estimates were lower, suggesting the presence of shared environmental factors for CB specific to twins. When rearing status can be assessed, full- and half-siblings offer an additional method for assessing the role of genetic and environmental factors in complex disorders. However, age differences in siblings may need to be included in the models.

  5. Burst strength of tubing and casing based on twin shear unified strength theory.

    Science.gov (United States)

    Lin, Yuanhua; Deng, Kuanhai; Sun, Yongxing; Zeng, Dezhi; Liu, Wanying; Kong, Xiangwei; Singh, Ambrish

    2014-01-01

    The internal pressure strength of tubing and casing often cannot satisfy the design requirements in high pressure, high temperature and high H2S gas wells. Also, the practical safety coefficient of some wells is lower than the design standard according to the current API 5C3 standard, which brings some perplexity to the design. The ISO 10400: 2007 provides the model which can calculate the burst strength of tubing and casing better than API 5C3 standard, but the calculation accuracy is not desirable because about 50 percent predictive values are remarkably higher than real burst values. So, for the sake of improving strength design of tubing and casing, this paper deduces the plastic limit pressure of tubing and casing under internal pressure by applying the twin shear unified strength theory. According to the research of the influence rule of yield-to-tensile strength ratio and mechanical properties on the burst strength of tubing and casing, the more precise calculation model of tubing-casing's burst strength has been established with material hardening and intermediate principal stress. Numerical and experimental comparisons show that the new burst strength model is much closer to the real burst values than that of other models. The research results provide an important reference to optimize the tubing and casing design of deep and ultra-deep wells.

  6. A rule of seven in Watson-Crick base-pairing of mismatched sequences.

    Science.gov (United States)

    Cisse, Ibrahim I; Kim, Hajin; Ha, Taekjip

    2012-05-13

    Sequence recognition through base-pairing is essential for DNA repair and gene regulation, but the basic rules governing this process remain elusive. In particular, the kinetics of annealing between two imperfectly matched strands is not well characterized, despite its potential importance in nucleic acid-based biotechnologies and gene silencing. Here we use single-molecule fluorescence to visualize the multiple annealing and melting reactions of two untethered strands inside a porous vesicle, allowing us to precisely quantify the annealing and melting rates. The data as a function of mismatch position suggest that seven contiguous base pairs are needed for rapid annealing of DNA and RNA. This phenomenological rule of seven may underlie the requirement for seven nucleotides of complementarity to seed gene silencing by small noncoding RNA and may help guide performance improvement in DNA- and RNA-based bio- and nanotechnologies, in which off-target effects can be detrimental.

  7. Study of 3-D stress development in parent and twin pairs of a hexagonal close-packed polycrystal: Part I - In-situ three-dimensional synchrotron X-ray diffraction measurement

    DEFF Research Database (Denmark)

    Abdolvand, Hamidreza; Majkut, Marta; Oddershede, Jette

    2015-01-01

    to reconstruct the 3D microstructure and statistically study neighborhood effects on the load sharing. The investigated volume of the sample contained 6132 grains initially, yet as a result of twin formation, 9724 grains were measured in the same volume at the last loading step. It is shown that the most favored......) microscopy. In-situ uniaxial straining was carried out at seven steps up to 2.7% in the macroscopic direction that favors twin formation, while center-of-mass position, crystallographic orientation, elastic strain, stress, and relative volume of each grain were measured. This information was used...

  8. Long-term relationships between symptoms of Attention Deficit Hyperactivity Disorder and self-esteem in a prospective longitudinal study of twins.

    Science.gov (United States)

    Edbom, Tobias; Lichtenstein, Paul; Granlund, Mats; Larsson, Jan-Olov

    2006-06-01

    To study the long-term relationship between symptoms of Attention Deficit Hyperactivity Disorder and the developing self-esteem in a population-based sample of twins. The cohort is all twin pair families born in Sweden between May 1985 and December 1986 (n = 1.480). Wave 1 took place in 1994 when the twins were 8 years old and wave 2 in 1999 when the children were 13 years old. In wave 1 and 2 the parents completed questionnaires regarding ADHD-symptoms about their children. In wave 2 the twins completed a questionnaire about self-esteem and Youth Self Report (YSR). ADHD-symptoms and self-esteem were analyzed in the total study group. There was a long-term relationship between high scores of parental-reported ADHD-symptoms at 8 and 13 years of age and low scores in measures of self-reported self-esteem at 13 years of age. In the cotwin control method controlling for YSR internalizing problem, paired comparisons within the twin pairs revealed that a high score of ADHD-symptoms at age 8 was related to significantly lower scores at age 13 in the self-esteem. The long-term relationships between ADHD-symptoms and a low self-esteem in a population-based sample were confirmed by the co-twin analyses.

  9. Asymmetry and discordance for congenital anomalies in conjoined twins: a report of six cases.

    Science.gov (United States)

    Ornoy, A; Navot, D; Menashi, M; Laufer, N; Chemke, J

    1980-10-01

    Six pairs of conjoined twins have been studied. The first case was a pair of 13-week-old omphalopagus fetuses. One was a holoacradius amorphus and the other had rachischisis and anencephaly. The second case was a pair of omphalopagus twins. One of the twins was macerated and corresponded to a developmental age of 13-14 weeks, while the other was developed to 28-30 weeks of gestation and exhibited urogenital and gastrointestinal defects not found in the smaller twin. In the third case, that of a thoracoomphalopagus, one had cleft lip and palate, pulmonic stenosis, and atresia of the ileocecal valve, while the other did not show these anomalies. In the fourth cae, also omphalopagus twins, one had a lumbosacral meningomyelocele and severe gastrointestinal and urogenital anomalies not found in the second twin. The fifth case was a pair of thoracoomphalopagus twins, sharing a common heart with asymmetrical anomalies. The sixth case was a diprosopus anencephalic conjoined twin. The first pairs of conjoined twins were discordant for several abnormalities in nonshared organs, in addition to having abnormalities of the conjoined organs. It seems that discordance in conjoined twins is not a rare finding. The factors that play a role in discordance of anomalies in conjoined twins are probably similar to the factors in monozygotic twins--i.e., environmental, genetic, and abnormal placental and/or fetal circulation.

  10. Site-Specific Incorporation of Functional Components into RNA by an Unnatural Base Pair Transcription System

    Directory of Open Access Journals (Sweden)

    Rie Kawai

    2012-03-01

    Full Text Available Toward the expansion of the genetic alphabet, an unnatural base pair between 7-(2-thienylimidazo[4,5-b]pyridine (Ds and pyrrole-2-carbaldehyde (Pa functions as a third base pair in replication and transcription, and provides a useful tool for the site-specific, enzymatic incorporation of functional components into nucleic acids. We have synthesized several modified-Pa substrates, such as alkylamino-, biotin-, TAMRA-, FAM-, and digoxigenin-linked PaTPs, and examined their transcription by T7 RNA polymerase using Ds-containing DNA templates with various sequences. The Pa substrates modified with relatively small functional groups, such as alkylamino and biotin, were efficiently incorporated into RNA transcripts at the internal positions, except for those less than 10 bases from the 3′-terminus. We found that the efficient incorporation into a position close to the 3′-terminus of a transcript depended on the natural base contexts neighboring the unnatural base, and that pyrimidine-Ds-pyrimidine sequences in templates were generally favorable, relative to purine-Ds-purine sequences. The unnatural base pair transcription system provides a method for the site-specific functionalization of large RNA molecules.

  11. Birth weight in opposite sex twins as compared to same sex dizygotic twins

    NARCIS (Netherlands)

    Orlebeke, J.F.; van Baal, G.C.M.; Boomsma, D.I.; Neeleman, D.

    1993-01-01

    The question addressed in the present report is whether the large birth weight differences in dizygotic twin pairs of opposite sex (DZos), especially in 'male first' couples - observed by Blickstein and Weissman (Blickstein I, Weissman A. Birth weight discordancy in male-first and female-first pairs

  12. Aviram–Ratner rectifying mechanism for DNA base-pair sequencing through graphene nanogaps

    International Nuclear Information System (INIS)

    Agapito, Luis A; Gayles, Jacob; Wolowiec, Christian; Kioussis, Nicholas

    2012-01-01

    We demonstrate that biological molecules such as Watson–Crick DNA base pairs can behave as biological Aviram–Ratner electrical rectifiers because of the spatial separation and weak hydrogen bonding between the nucleobases. We have performed a parallel computational implementation of the ab initio non-equilibrium Green’s function (NEGF) theory to determine the electrical response of graphene—base-pair—graphene junctions. The results show an asymmetric (rectifying) current–voltage response for the cytosine–guanine base pair adsorbed on a graphene nanogap. In sharp contrast we find a symmetric response for the thymine–adenine case. We propose applying the asymmetry of the current–voltage response as a sensing criterion to the technological challenge of rapid DNA sequencing via graphene nanogaps. (paper)

  13. Watson-Crick Base Pair Radical Cation as a Model for Oxidative Damage in DNA.

    Science.gov (United States)

    Feketeová, Linda; Chan, Bun; Khairallah, George N; Steinmetz, Vincent; Maitre, Philippe; Radom, Leo; O'Hair, Richard A J

    2017-07-06

    The deleterious cellular effects of ionizing radiation are well-known, but the mechanisms causing DNA damage are poorly understood. The accepted molecular events involve initial oxidation and deprotonation at guanine sites, triggering hydrogen atom abstraction reactions from the sugar moieties, causing DNA strand breaks. Probing the chemistry of the initially formed radical cation has been challenging. Here, we generate, spectroscopically characterize, and examine the reactivity of the Watson-Crick nucleobase pair radical cation in the gas phase. We observe rich chemistry, including proton transfer between the bases and propagation of the radical site in deoxyguanosine from the base to the sugar, thus rupturing the sugar. This first example of a gas-phase model system providing molecular-level details on the chemistry of an ionized DNA base pair paves the way toward a more complete understanding of molecular processes induced by radiation. It also highlights the role of radical propagation in chemistry, biology, and nanotechnology.

  14. Watson-Crick base pairing controls excited-state decay in natural DNA.

    Science.gov (United States)

    Bucher, Dominik B; Schlueter, Alexander; Carell, Thomas; Zinth, Wolfgang

    2014-10-13

    Excited-state dynamics are essential to understanding the formation of DNA lesions induced by UV light. By using femtosecond IR spectroscopy, it was possible to determine the lifetimes of the excited states of all four bases in the double-stranded environment of natural DNA. After UV excitation of the DNA duplex, we detected a concerted decay of base pairs connected by Watson-Crick hydrogen bonds. A comparison of single- and double-stranded DNA showed that the reactive charge-transfer states formed in the single strands are suppressed by base pairing in the duplex. The strong influence of the Watson-Crick hydrogen bonds indicates that proton transfer opens an efficient decay path in the duplex that prohibits the formation or reduces the lifetime of reactive charge-transfer states. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  15. Hemoglobin Differences in Uncomplicated Monochorionic Twins in Relation to Birth Order and Mode of Delivery.

    Science.gov (United States)

    Verbeek, Lianne; Zhao, Depeng P; Te Pas, Arjan B; Middeldorp, Johanna M; Hooper, Stuart B; Oepkes, Dick; Lopriore, Enrico

    2016-06-01

    To determine the differences in hemoglobin (Hb) levels in the first 2 days after birth in uncomplicated monochorionic twins in relation to birth order and mode of delivery. All consecutive uncomplicated monochorionic pregnancies with two live-born twins delivered at our center were included in this retrospective study. We recorded Hb levels at birth and on day 2, and analyzed Hb levels in association with birth order, mode of delivery, and time interval between delivery of twin 1 and 2. A total of 290 monochorionic twin pairs were analyzed, including 171 (59%) twins delivered vaginally and 119 (41%) twins born by cesarean section (CS). In twins delivered vaginally, mean Hb levels at birth and on day 2 were significantly higher in second-born twins compared to first-born twins: 17.8 versus 16.1 g/dL and 18.0 versus 14.8 g/dL, respectively (p < .01). Polycythemia was detected more often in second-born twins (12%, 20/166) compared to first-born twins (1%, 2/166; p < .01). Hb differences within twin pairs delivered by CS were not statistically or clinically significant. We found no association between inter-twin delivery time intervals and Hb differences. Second-born twins after vaginal delivery have higher Hb levels and more often polycythemia than their co-twin, but not when born by CS.

  16. A longitudinal, population-based twin study of avoidant and obsessive-compulsive personality disorder traits from early to middle adulthood.

    Science.gov (United States)

    Gjerde, L C; Czajkowski, N; Røysamb, E; Ystrom, E; Tambs, K; Aggen, S H; Ørstavik, R E; Kendler, K S; Reichborn-Kjennerud, T; Knudsen, G P

    2015-12-01

    The phenotypic stability of avoidant personality disorder (AVPD) and obsessive-compulsive personality disorder (OCPD) has previously been found to be moderate. However, little is known about the longitudinal structure of genetic and environmental factors for these disorders separately and jointly, and to what extent genetic and environmental factors contribute to their stability. AVPD and OCPD criteria were assessed using the Structured Interview for DSM-IV Personality in 2793 young adult twins (1385 pairs, 23 singletons) from the Norwegian Institute of Public Health Twin Panel at wave 1 and 2282 (986 pairs, 310 singletons) of these on average 10 years later at wave 2. Longitudinal biometric models were fitted to AVPD and OCPD traits. For twins who participated at both time-points, the number of endorsed sub-threshold criteria for both personality disorders (PDs) decreased 31% from wave 1 to wave 2. Phenotypic correlations between waves were 0.54 and 0.37 for AVPD and OCPD, respectively. The heritability estimates of the stable PD liabilities were 0.67 for AVPD and 0.53 for OCPD. The genetic correlations were 1.00 for AVPD and 0.72 for OCPD, while the unique environmental influences correlated 0.26 and 0.23, respectively. The correlation between the stable AVPD and OCPD liabilities was 0.39 of which 63% was attributable to genetic influences. Shared environmental factors did not significantly contribute to PD variance at either waves 1 or 2. Phenotypic stability was moderate for AVPD and OCPD traits, and genetic factors contributed more than unique environmental factors to the stability both within and across phenotypes.

  17. Differential models of twin correlations in skew for body-mass index (BMI).

    Science.gov (United States)

    Tsang, Siny; Duncan, Glen E; Dinescu, Diana; Turkheimer, Eric

    2018-01-01

    Body Mass Index (BMI), like most human phenotypes, is substantially heritable. However, BMI is not normally distributed; the skew appears to be structural, and increases as a function of age. Moreover, twin correlations for BMI commonly violate the assumptions of the most common variety of the classical twin model, with the MZ twin correlation greater than twice the DZ correlation. This study aimed to decompose twin correlations for BMI using more general skew-t distributions. Same sex MZ and DZ twin pairs (N = 7,086) from the community-based Washington State Twin Registry were included. We used latent profile analysis (LPA) to decompose twin correlations for BMI into multiple mixture distributions. LPA was performed using the default normal mixture distribution and the skew-t mixture distribution. Similar analyses were performed for height as a comparison. Our analyses are then replicated in an independent dataset. A two-class solution under the skew-t mixture distribution fits the BMI distribution for both genders. The first class consists of a relatively normally distributed, highly heritable BMI with a mean in the normal range. The second class is a positively skewed BMI in the overweight and obese range, with lower twin correlations. In contrast, height is normally distributed, highly heritable, and is well-fit by a single latent class. Results in the replication dataset were highly similar. Our findings suggest that two distinct processes underlie the skew of the BMI distribution. The contrast between height and weight is in accord with subjective psychological experience: both are under obvious genetic influence, but BMI is also subject to behavioral control, whereas height is not.

  18. Does educational status impact adult mortality in Denmark? A twin approach.

    Science.gov (United States)

    Madsen, Mia; Andersen, Anne-Marie Nybo; Christensen, Kaare; Andersen, Per Kragh; Osler, Merete

    2010-07-15

    To disentangle an independent effect of educational status on mortality risk from direct and indirect selection mechanisms, the authors used a discordant twin pair design, which allowed them to isolate the effect of education by means of adjustment for genetic and environmental confounding per design. The study is based on data from the Danish Twin Registry and Statistics Denmark. Using Cox regression, they estimated hazard ratios for mortality according to the highest attained education among 5,260 monozygotic and 11,088 dizygotic same-sex twin pairs born during 1921-1950 and followed during 1980-2008. Both standard cohort and intrapair analyses were conducted separately for zygosity, gender, and birth cohort. Educational differences in mortality were demonstrated in the standard cohort analyses but attenuated in the intrapair analyses in all subgroups but men born during 1921-1935, and no effect modification by zygosity was observed. Hence, the results are most compatible with an effect of early family environment in explaining the educational inequality in mortality. However, large educational differences were still reflected in mortality risk differences within twin pairs, thus supporting some degree of independent effect of education. In addition, the effect of education may be more pronounced in older cohorts of Danish men.

  19. New population-based references for birth weight, length, and head circumference in singletons and twins from 23 to 43 gestation weeks.

    Science.gov (United States)

    Sankilampi, Ulla; Hannila, Marja-Leena; Saari, Antti; Gissler, Mika; Dunkel, Leo

    2013-09-01

    Birth size curves are needed for clinical and epidemiological purposes. We constructed birth weight (BW), length (BL), and head circumference (BHC) references, assessed effects of twinness and parity, and defined cut-off points for small, appropriate, and large for gestational age. Birth register data of all 753,036 infants born in 1996-2008 in Finland were cleaned to create references reflecting optimal intrauterine growth. The final data included 533,666 singletons and 15,033 twins (median gestation weeks (gws) 40.0 and 37.1, respectively, 41.6% primiparous). Sex-specific BW, BL, and BHC references were constructed from 23 to 43 gws separately for singletons and twins born to primiparous or multiparous mothers. GAMLSS method was used for modelling. In singletons from 36 gws onwards, increased BW and BL were observed in comparison to previous reference from 1979-1983. Twins diverged from singletons from 30 gws onwards. At 37.0 gws, mean BW was 400 g lower and mean BL 1.2 cm shorter than in singletons. From 30 gws onwards, birth size was larger in infants of multiparous than primiparous mothers. Population-based birth size references are available for the evaluation of birth size. Accounting for plurality and parity improves the accuracy of birth size evaluation.

  20. Caffeine intake, toxicity and dependence and lifetime risk for psychiatric and substance use disorders: an epidemiologic and co-twin control analysis.

    Science.gov (United States)

    Kendler, Kenneth S; Myers, John; O Gardner, Charles

    2006-12-01

    Although caffeine is the most commonly used psychoactive substance and often produces symptoms of toxicity and dependence, little is known, especially in community samples, about the association between caffeine use, toxicity and dependence and risk for common psychiatric and substance use disorders. Assessments of lifetime maximal caffeine use and symptoms of caffeine toxicity and dependence were available on over 3600 adult twins ascertained from the population-based Virginia Twin Registry. Lifetime histories of major depression (MD), generalized anxiety disorder (GAD) and panic disorder, alcohol dependence, adult antisocial behavior and cannabis and cocaine abuse/dependence were obtained at personal interview. Logistic regression analyses in the entire sample and within monozygotic (MZ) twin pairs were conducted in SAS. In the entire sample, measures of maximal caffeine use, heavy caffeine use, and caffeine-related toxicity and dependence were significantly and positively associated with all seven psychiatric and substance use disorders. However, within MZ twin pairs, controlling for genetic and family environmental factors, these associations, while positive, were all non-significant. These results were similar when excluding twins who denied regular caffeine use. Maximal lifetime caffeine intake and caffeine-associated toxicity and dependence are moderately associated with risk for a wide range of psychiatric and substance use disorders. Analyses of these relationships within MZ twin pairs suggest that most of the observed associations are not causal. Rather, familial factors, which are probably in part genetic, predispose to both caffeine intake, toxicity and dependence and the risk for a broad array of internalizing and externalizing disorders.

  1. Energy Landscape and Pathways for Transitions between Watson-Crick and Hoogsteen Base Pairing in DNA.

    Science.gov (United States)

    Chakraborty, Debayan; Wales, David J

    2018-01-04

    The recent discovery that Hoogsteen (HG) base pairs are widespread in DNA across diverse sequences and positional contexts could have important implications for understanding DNA replication and DNA-protein recognition. While evidence is emerging that the Hoogsteen conformation could be a thermodynamically accessible conformation of the DNA duplex and provide a means to expand its functionality, relatively little is known about the molecular mechanism underlying the Watson-Crick (WC) to HG transition. In this Perspective, we describe pathways and kinetics for this transition at an atomic level of detail, using the energy landscape perspective. We show that competition between the duplex conformations results in a double funnel landscape, which explains some recent experimental observations. The interconversion pathways feature a number of intermediates, with a variable number of WC and HG base pairs. The relatively slow kinetics, with possible deviations from two-state behavior, suggest that this conformational switch is likely to be a challenging target for both simulation and experiment.

  2. Hydrogen bond disruption in DNA base pairs from (14)C transmutation.

    Science.gov (United States)

    Sassi, Michel; Carter, Damien J; Uberuaga, Blas P; Stanek, Christopher R; Mancera, Ricardo L; Marks, Nigel A

    2014-09-04

    Recent ab initio molecular dynamics simulations have shown that radioactive carbon does not normally fragment DNA bases when it decays. Motivated by this finding, density functional theory and Bader analysis have been used to quantify the effect of C → N transmutation on hydrogen bonding in DNA base pairs. We find that (14)C decay has the potential to significantly alter hydrogen bonds in a variety of ways including direct proton shuttling (thymine and cytosine), thermally activated proton shuttling (guanine), and hydrogen bond breaking (cytosine). Transmutation substantially modifies both the absolute and relative strengths of the hydrogen bonding pattern, and in two instances (adenine and cytosine), the density at the critical point indicates development of mild covalent character. Since hydrogen bonding is an important component of Watson-Crick pairing, these (14)C-induced modifications, while infrequent, may trigger errors in DNA transcription and replication.

  3. Enhanced Stability of DNA Nanostructures by Incorporation of Unnatural Base Pairs.

    Science.gov (United States)

    Liu, Qing; Liu, Guocheng; Wang, Ting; Fu, Jing; Li, Rujiao; Song, Linlin; Wang, Zhen-Gang; Ding, Baoquan; Chen, Fei

    2017-11-03

    Self-assembled DNA nanostructures hold great promise in the fields of nanofabrication, biosensing and nanomedicine. However, the inherent low stability of the DNA double helices, formed by weak interactions, largely hinders the assembly and functions of DNA nanostructures. In this study, we redesigned and constructed a six-arm DNA junction by incorporation of the unnatural base pairs 5-Me-isoC/isoG and A/2-thioT into the double helices. They not only retained the structural integrity of the DNA nanostructure, but also showed enhanced thermal stability and resistance to T7 Exonuclease digestion. This research may expand the applications of DNA nanostructures in nanofabrication and biomedical fields, and furthermore, the genetic alphabet expansion with unnatural base pairs may enable us to construct more complicated and diversified self-assembled DNA nanostructures. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  4. Array based Discovery of Aptamer Pairs (Open Access Publisher’s Version)

    Science.gov (United States)

    2014-12-11

    Array-based Discovery of Aptamer Pairs Minseon Cho,†,‡ Seung Soo Oh,‡ Jeff Nie,§ Ron Stewart,§ Monte J. Radeke,⊥ Michael Eisenstein ,†,‡ Peter J...ac504076k | Anal. Chem. 2015, 87, 821−828827 (24) Cho, M.; Oh, S. S.; Nie, J.; Stewart, R.; Eisenstein , M.; Chambers, J.; Marth, J. D.; Walker, F

  5. DNA electronic circular dichroism on the inter-base pair scale

    DEFF Research Database (Denmark)

    Di Meo, Florent; Nørby, Morten Steen; Rubio-Magnieto, Jenifer

    2015-01-01

    A successful elucidation of the near-ultraviolet electronic circular dichroism spectrum of a short double-stranded DNA is reported. Time-dependent density functional theory methods are shown to accurately predict spectra and assign bands on the microscopic base-pair scale, a finding that opens...... the field for using circular dichroism spectroscopy as a sensitive nanoscale probe of DNA to reveal its complex interactions with the environment. (Chemical Equation Presented)....

  6. Non-standard base pairing and stacked structures in methyl xanthine clusters

    Czech Academy of Sciences Publication Activity Database

    Callahan, M. P.; Gengeliczki, Z.; Svadlenak, N.; Valdes, Haydee; Hobza, Pavel; de Vries, M. S.

    2008-01-01

    Roč. 10, č. 19 (2008), s. 2819-2826 ISSN 1463-9076 R&D Projects: GA MŠk LC512 Grant - others:NSF(US) CHE-0615401 Institutional research plan: CEZ:AV0Z40550506 Keywords : non-standard base pairing * stacked structures * in methyl xanthine Subject RIV: CF - Physical ; Theoretical Chemistry Impact factor: 4.064, year: 2008

  7. Paired-Associate and Feedback-Based Weather Prediction Tasks Support Multiple Category Learning Systems

    OpenAIRE

    Li, Kaiyun; Fu, Qiufang; Sun, Xunwei; Zhou, Xiaoyan; Fu, Xiaolan

    2016-01-01

    It remains unclear whether probabilistic category learning in the feedback-based weather prediction task (FB-WPT) can be mediated by a non-declarative or procedural learning system. To address this issue, we compared the effects of training time and verbal working memory, which influence the declarative learning system but not the non-declarative learning system, in the FB and paired-associate (PA) WPTs, as the PA task recruits a declarative learning system. The results of Experiment 1 showed...

  8. Thermodynamic and structural properties of the specific binding between Ag⁺ ion and C:C mismatched base pair in duplex DNA to form C-Ag-C metal-mediated base pair.

    Science.gov (United States)

    Torigoe, Hidetaka; Okamoto, Itaru; Dairaku, Takenori; Tanaka, Yoshiyuki; Ono, Akira; Kozasa, Tetsuo

    2012-11-01

    Metal ion-nucleic acid interactions have attracted considerable interest for their involvement in structure formation and catalytic activity of nucleic acids. Although interactions between metal ion and mismatched base pair duplex are important to understand mechanism of gene mutations related to heavy metal ions, they have not been well-characterized. We recently found that the Ag(+) ion stabilized a C:C mismatched base pair duplex DNA. A C-Ag-C metal-mediated base pair was supposed to be formed by the binding between the Ag(+) ion and the C:C mismatched base pair to stabilize the duplex. Here, we examined specificity, thermodynamics and structure of possible C-Ag-C metal-mediated base pair. UV melting indicated that only the duplex with the C:C mismatched base pair, and not of the duplexes with the perfectly matched and other mismatched base pairs, was specifically stabilized on adding the Ag(+) ion. Isothermal titration calorimetry demonstrated that the Ag(+) ion specifically bound with the C:C base pair at 1:1 molar ratio with a binding constant of 10(6) M(-1), which was significantly larger than those for nonspecific metal ion-DNA interactions. Electrospray ionization mass spectrometry also supported the specific 1:1 binding between the Ag(+) ion and the C:C base pair. Circular dichroism spectroscopy and NMR revealed that the Ag(+) ion may bind with the N3 positions of the C:C base pair without distorting the higher-order structure of the duplex. We conclude that the specific formation of C-Ag-C base pair with large binding affinity would provide a binding mode of metal ion-DNA interactions, similar to that of the previously reported T-Hg-T base pair. The C-Ag-C base pair may be useful not only for understanding of molecular mechanism of gene mutations related to heavy metal ions but also for wide variety of potential applications of metal-mediated base pairs in various fields, such as material, life and environmental sciences. Copyright © 2012 Elsevier

  9. High Temperature Deformation of Twin-Roll Cast Al-Mn-Based Alloys after Equal Channel Angular Pressing.

    Science.gov (United States)

    Málek, Přemysl; Šlapáková Poková, Michaela; Cieslar, Miroslav

    2015-11-12

    Twin roll cast Al-Mn- and Al-Mn-Zr-based alloys were subjected to four passes of equal channel angular pressing. The resulting grain size of 400 nm contributes to a significant strengthening at room temperature. This microstructure is not fully stable at elevated temperatures and recrystallization and vast grain growth occur at temperatures between 350 and 450 °C. The onset of these microstructure changes depends on chemical and phase composition. Better stability is observed in the Al-Mn-Zr-based alloy. High temperature tensile tests reveal that equal channel angular pressing results in a softening of all studied materials at high temperatures. This can be explained by an active role of grain boundaries in the deformation process. The maximum values of ductility and strain rate sensitivity parameter m found in the Al-Mn-Zr-based alloy are below the bottom limit of superplasticity (155%, m = 0.25). However, some features typical for superplastic behavior were observed-the strain rate dependence of the parameter m , the strengthening with increasing grain size, and the fracture by diffuse necking. Grain boundary sliding is believed to contribute partially to the overall strain in specimens where the grain size remained in the microcrystalline range.

  10. Solid state radiation chemistry of co-crystallized DNA base pairs studied with EPR and ENDOR

    International Nuclear Information System (INIS)

    Nelson, W.H.; Nimmala, S.; Hole, E.O.; Sagstuen, E.; Close, D.M.

    1995-01-01

    For a number of years, the authors' group has focused on identification of radicals formed from x-irradiation of DNA components by application of EPR and ENDOR spectroscopic techniques to samples in the form of single crystals. With single crystals as samples, it is possible to use the detailed packing and structural information available from x-ray or neutron diffraction reports. This report summarizes results from two crystal systems in which DNA bases are paired by hydrogen bonding. Extensive results are available from one of these, 1-methyl-thymine:9-methyladenine (MTMA), in which the base pairing is the Hoogsteen configuration. Although this configuration is different from that found by Watson-Crick in DNA, nonetheless the hydrogen bond between T(O4) and A(NH 2 ) is present. Although MTMA crystals have been studied previously, the objective was to apply the high-resolution technique of ENDOR to crystals irradiated and studied at temperatures of 10 K or lower in the effort to obtain direct evidence for specific proton transfers. The second system, from which the results are only preliminary, is 9-ethylguanine:1-methyl-5-fluorocytosine (GFC) in which the G:C bases pair is in the Watson Crick configuration. Both crystal systems are anhydrous, so the results include no possible effects from water interactions

  11. Silver-mediated base pairings: towards dynamic DNA nanostructures with enhanced chemical and thermal stability

    International Nuclear Information System (INIS)

    Swasey, Steven M; Gwinn, Elisabeth G

    2016-01-01

    The thermal and chemical fragility of DNA nanomaterials assembled by Watson–Crick (WC) pairing constrain the settings in which these materials can be used and how they can be functionalized. Here we investigate use of the silver cation, Ag + , as an agent for more robust, metal-mediated self-assembly, focusing on the simplest duplex building blocks that would be required for more elaborate Ag + –DNA nanostructures. Our studies of Ag + -induced assembly of non-complementary DNA oligomers employ strands of 2–24 bases, with varied base compositions, and use electrospray ionization mass spectrometry to determine product compositions. High yields of duplex products containing narrowly distributed numbers of Ag + can be achieved by optimizing solution conditions. These Ag + -mediated duplexes are stable to at least 60 mM Mg 2+ , higher than is necessary for WC nanotechnology schemes such as tile assemblies and DNA origami, indicating that sequential stages of Ag + -mediated and WC-mediated assembly may be feasible. Circular dichroism spectroscopy suggests simple helical structures for Ag + -mediated duplexes with lengths to at least 20 base pairs, and further indicates that the structure of cytosine-rich duplexes is preserved at high urea concentrations. We therefore propose an approach towards dynamic DNA nanomaterials with enhanced thermal and chemical stability through designs that combine sturdy silver-mediated ‘frames’ with WC paired ‘pictures’. (paper)

  12. Stability of non-Watson-Crick G-A/A-G base pair in synthetic DNA and RNA oligonucleotides.

    Science.gov (United States)

    Ito, Yuko; Sone, Yumiko; Mizutani, Takaharu

    2004-03-01

    A non-Watson-Crick G-A/A-G base pair is found in SECIS (selenocysteine-insertion sequence) element in the 3'-untranslated region of Se-protein mRNAs and in the functional site of the hammerhead ribozyme. We studied the stability of G-A/A-G base pair (bold) in 17mer GT(U)GACGGAAACCGGAAC synthetic DNA and RNA oligonucleotides by thermal melting experiments and gel electrophoresis. The measured Tm value of DNA oligonucleotide having G-A/A-G pair showed an intermediate value (58 degrees C) between that of Watson-Crick G-C/C-G base pair (75 degrees C) and that of G-G/A-A of non-base-pair (40 degrees C). Similar thermal melting patterns were obtained with RNA oligonucleotides. This result indicates that the secondary structure of oligonucleotide having G-A/A-G base pair is looser than that of the G-C type Watson-Crick base pair. In the comparison between RNA and DNA having G-A/A-G base pair, the Tm value of the RNA oligonucleotide was 11 degrees C lower than that of DNA, indicating that DNA has a more rigid structure than RNA. The stained pattern of oligonucleotide on polyacrylamide gel clarified that the mobility of the DNA oligonucleotide G-A/A-G base pair changed according to the urea concentration from the rigid state (near the mobility of G-C/C-G oligonucleotide) in the absence of urea to the random state (near the mobility of G-G/A-A oligonucleotide) in 7 M urea. However, the RNA oligonucleotide with G-A/A-G pair moved at an intermediate mobility between that of oligonucleotide with G-C/C-G and of the oligonucleotide with G-G/A-A, and the mobility pattern did not depend on urea concentration. Thus, DNA and RNA oligonucleotides with the G-A/A-G base pair showed a pattern indicating an intermediate structure between the rigid Watson-Crick base pair and the random structure of non-base pair. RNA with G-A/A-G base pair has the intermediate structure not influenced by urea concentration. Finally, this study indicated that the intermediate rigidity imparted by Non

  13. Family-Based Treatment of a 17-Year-Old Twin Presenting with Emerging Anorexia Nervosa: A Case Study Using the “Maudsley Method”

    OpenAIRE

    Loeb, Katharine L.; Hirsch, Alicia M.; Greif, Rebecca; Hildebrandt, Thomas B.

    2009-01-01

    This paper describes the successful application of family-based treatment (FBT) for a 17-year-old identical twin presenting with a four-month history of clinically significant symptoms of anorexia nervosa (AN). FBT is a manualized treatment that has been studied in randomized controlled trials for adolescents with AN. This case study illustrates the administration of this evidence-based intervention in a clinical setting, highlighting how the best available research was used to make clinical ...

  14. Socio-psycho-historical observation on the twin

    International Nuclear Information System (INIS)

    Watanabe, Shoji; Satow, Yukio; Ueoka, Hiroshi; Munaka, Masaki; Kurihara, Minoru

    1980-01-01

    The so-called ''twin control study'', mainly on the monozygotic twins one of which was A-bomb exposed and the other was non-exposed were carried out. Sampling was conducted utilizing the materials as follows: 1) The survey on casualities of A-bomb exposed families in Hiroshima which was undertaken in 1946. 2) The survey of A-bomb survivors in 1965. 3) A-bomb exposed family survey conducted between 1973 to 1975. 4) Investigations of A-bomb victims exposed in the proximal areas from the hypocenter. From the above mentioned materials 470 pairs were selected, of which 220 were exposed. Among them 172 pairs were twins of the same sex. Female and male pair were also employed. In one case they were exposed, while the others were nonexposed. Two pairs were examined under the following methods: 1) Depth interview to ascertain familial casualities with reference to the family life cycle. 2) Socio-historical research. 3) Motoaki's Jinkaku Shindan Kensa (Modified Rorschach test by H. Motoaki), and T.A.T. test. Results obtained were summarized as follows: 1) Both pairs of twins were similar appearance, and also personality traits, and had a strong feeling of companionship for each other. 2) In family relationships, the persons studied were very conscious of the role expectations of elder and younger siblings in the twin pairs. 3) Through depth interview and projective test, A-bomb exposed pairs still showed deep psychological stresses, resulting from the A-bomb disaster. 4) Both among the exposed twins and within the nonexposed control group twin siblings had a close feeling of companionship for each other. However, nonexposed twins could not understand the psychological experience of twins who had been subjected to the atomic disaster. (author)

  15. Leisure-time physical activity and intra-abdominal fat in young adulthood: A monozygotic co-twin control study.

    Science.gov (United States)

    Rottensteiner, Mirva; Leskinen, Tuija; Järvelä-Reijonen, Elina; Väisänen, Karoliina; Aaltonen, Sari; Kaprio, Jaakko; Kujala, Urho M

    2016-05-01

    To investigate differences in abdominal fat compartments between young adult monozygotic twin pairs discordant for leisure-time physical activity. Ten young adult male monozygotic twin pairs (age range 32-36 years) discordant for leisure-time physical activity during the past 3 years were systematically selected from a population-based Finnish twin cohort. Magnetic resonance image at the level of the L2-L3 intervertebral disc was used to predict intra-abdominal and subcutaneous abdominal fat masses. Dietary intake was assessed with a 4-day food diary. Inactive twins had 31% more intra-abdominal fat than their active co-twins (mean difference 0.52 kg, 95% CI 0.12 to 0.91, P = 0.016), whereas the difference in subcutaneous abdominal fat was only 13% (P = 0.21) and 3% in body mass index (P = 0.28). Intraperitoneal fat mass was 41% higher among inactive twins compared to their active co-twins (mean difference 0.41 kg, 95% CI 0.11 to 0.70, P = 0.012). Dietary intake did not differ between co-twins. A lower level of physical activity is related to greater accumulation of intra-abdominal fat among healthy adult males in their mid-30s. The findings highlight the importance of leisure-time physical activity independent of genes and diet in the prevention of intra-abdominal fat accumulation from early adulthood onward. © 2016 The Obesity Society.

  16. Bidirectional Influences between Maternal Parenting and Children's Peer Problems: A Longitudinal Monozygotic Twin Difference Study

    Science.gov (United States)

    Yamagata, Shinji; Takahashi, Yusuke; Ozaki, Koken; Fujisawa, Keiko K.; Nonaka, Koichi; Ando, Juko

    2013-01-01

    This twin study examined the bidirectional relationship between maternal parenting behaviors and children's peer problems that were not confounded by genetic and family environmental factors. Mothers of 259 monozygotic twin pairs reported parenting behaviors and peer problems when twins were 42 and 48 months. Path analyses on monozygotic twin…

  17. Cancer risk in opposite-sex and same-sex twins

    DEFF Research Database (Denmark)

    Juel Ahrenfeldt, Linda

    2015-01-01

    Twin pregnancies are characterized by simultaneous development of two fetuses that share the womb. An interest in opposite-sex (OS) twins, twin pairs consisting of one male and one female, comes from animal studies that showed that exposure to sex hormones is influenced by the position of the fetus...

  18. The Heritability of Breast Cancer among women in the Nordic Twin Study of Cancer

    DEFF Research Database (Denmark)

    Möller, Sören; Mucci, Lorelei A; Harris, Jennifer R

    2016-01-01

    and heritability of breast cancer among 21,054 monozygotic and 30,939 dizygotic female twin pairs from the Nordic Twin Study of Cancer, the largest twin study of cancer in the world. We accounted for left-censoring, right-censoring, as well as the competing risk of death. Results From 1943 through 2010, 3...

  19. Traces of embryogenesis are the same in monozygotic and dizygotic twins: not compatible with double ovulation.

    Science.gov (United States)

    Boklage, Charles E

    2009-06-01

    Common knowledge of over a century has it that monozygotic and dizygotic twinning events occur by unrelated mechanisms: monozygotic twinning 'splits' embryos, producing anomalously re-arranged embryogenic asymmetries; dizygotic twinning begins with independent ovulations yielding undisturbed parallel embryogeneses with no expectation of departures from singleton outcomes. The anomalies statistically associated with twin births are due to the re-arranged embryos of the monozygotics. Common knowledge further requires that dizygotic pairs are dichorionic; monochorionicity is exclusive to monozygotic pairs. These are fundamental certainties in the literature of twin biology. Multiple observations contradict those common knowledge understandings. The double ovulation hypothesis of dizygotic twinning is untenable. Girl-boy twins differ subtly from all other humans of either sex, absolutely not representative of all dizygotics. Embryogenesis of dizygotic twins differs from singleton development at least as much as monozygotic embryogenesis does, and in the same ways, and the differences between singletons and twins of both zygosities represent a coherent system of re-arranged embryogenic asymmetries. Dizygotic twinning and monozygotic twinning have the same list of consequences of anomalous embryogenesis. Those include an unignorable fraction of dizygotic pairs that are in fact monochorionic, plus many more sharing co-twins' cells in tissues other than a common chorion. The idea that monozygotic and dizygotic twinning events arise from the same embryogenic mechanism is the only plausible hypothesis that might explain all of the observations.

  20. Fetal Environment Is a Major Determinant of the Neonatal Blood Thyroxine Level: Results of a Large Dutch Twin Study.

    Science.gov (United States)

    Zwaveling-Soonawala, Nitash; van Beijsterveldt, Catharina E M; Mesfum, Ertirea T; Wiedijk, Brenda; Oomen, Petra; Finken, Martijn J J; Boomsma, Dorret I; van Trotsenburg, A S Paul

    2015-06-01

    The interindividual variability in thyroid hormone function parameters is much larger than the intraindividual variability, suggesting an individual set point for these parameters. There is evidence to suggest that environmental factors are more important than genetic factors in the determination of this individual set point. This study aimed to quantify the effect of genetic factors and (fetal) environment on the early postnatal blood T4 concentration. This was a classical twin study comparing the resemblance of neonatal screening blood T4 concentrations in 1264 mono- and 2566 dizygotic twin pairs retrieved from the population-based Netherlands Twin Register. Maximum-likelihood estimates of variance explained by genetic and environmental influences were obtained by structural equation modeling in data from full-term and preterm twin pairs. In full-term infants, genetic factors explained 40%/31% of the variance in standardized T4 scores in boys/girls, and shared environment, 27%/22%. The remaining variance of 33%/47% was due to environmental factors not shared by twins. For preterm infants, genetic factors explained 34%/0% of the variance in boys/girls, shared environment 31%/57%, and unique environment 35%/43%. In very preterm twins, no significant contribution of genetic factors was observed. Environment explains a large proportion of the resemblance of the postnatal blood T4 concentration in twin pairs. Because we analyzed neonatal screening results, the fetal environment is the most likely candidate for these environmental influences. Genetic influences on the T4 set point diminished with declining gestational age, especially in girls. This may be due to major environmental influences such as immaturity and nonthyroidal illness in very preterm infants.

  1. Birth order, gestational age, and risk of delivery related perinatal death in twins: retrospective cohort study

    Science.gov (United States)

    Smith, Gordon C S; Pell, Jill P; Dobbie, Richard

    2002-01-01

    Objective To determine whether twins born second are at increased risk of perinatal death because of complications during labour and delivery. Design Retrospective cohort study. Setting Scotland, 1992 and 1997. Participants All twin births at or after 24 weeks' gestation, excluding twin pairs in which either twin died before labour or delivery or died during or after labour and delivery because of congenital abnormality, non-immune hydrops, or twin to twin transfusion syndrome. Main outcome measure Delivery related perinatal deaths (deaths during labour or the neonatal period). Results Overall, delivery related perinatal deaths were recorded for 23 first twins only and 23 second twins only of 1438 twin pairs born before 36 weeks (preterm) by means other than planned caesarean section (P>0.99). No deaths of first twins and nine deaths of second twins (P=0.004) were recorded among the 2436 twin pairs born at or after 36 weeks (term). Discordance between first and second twins differed significantly in preterm and term births (P=0.007). Seven of nine deaths of second twins at term were due to anoxia during the birth (2.9 (95% confidence interval 1.2 to 5.9) per 1000); five of these deaths were associated with mechanical problems with the second delivery following vaginal delivery of the first twin. No deaths were recorded among 454 second twins delivered at term by planned caesarean section. Conclusions Second twins born at term are at higher risk than first twins of death due to complications of delivery. Previous studies may not have shown an increased risk because of inadequate categorisation of deaths, lack of statistical power, inappropriate analyses, and pooling of data about preterm births and term births. What is already known on this topicIt is difficult to assess the wellbeing of second twins during labourDeliveries of second twins are at increased risk of mechanical problems, such as cord prolapse and malpresentation, after vaginal delivery of first twins

  2. Socio-psycho-historical observation on the twin. Sampling methods and case study of the atomic bomb exposed twins

    Energy Technology Data Exchange (ETDEWEB)

    Watanabe, S; Satow, Y; Ueoka, Hiroshi; Munaka, M; Kurihara, M [Hiroshima Univ. (Japan). Research Inst. for Nuclear Medicine and Biology

    1980-07-01

    The so-called ''twin control study'', mainly on the monozygotic twins one of which was A-bomb exposed and the other was non-exposed were carried out. Sampling was conducted utilizing the materials as follows: 1) The survey on casualities of A-bomb exposed families in Hiroshima which was undertaken in 1946. 2) The survey of A-bomb survivors in 1965. 3) A-bomb exposed family survey conducted between 1973 to 1975. 4) Investigations of A-bomb victims exposed in the proximal areas from the hypocenter. From the above mentioned materials 470 pairs were selected, of which 220 were exposed. Among them 172 pairs were twins of the same sex. Female and male pair were also employed. In one case they were exposed, while the others were nonexposed. Two pairs were examined under the following methods: 1) Depth interview to ascertain familial casualities with reference to the family life cycle. 2) Socio-historical research. 3) Motoaki's Jinkaku Shindan Kensa (Modified Rorschach test by H. Motoaki), and T.A.T. test. Results obtained were summarized as follows: 1) Both pairs of twins were of similar appearance and personality traits, and had a strong feeling of companionship for each other. 2) In family relationships, the persons studied were very conscious of the role expectations of elder and younger siblings in the twin pairs. 3) Through depth interviews and projective tests, A-bomb exposed pairs still showed deep psychological stresses, resulting from the A-bomb disaster. 4) Both among the exposed twins and within the nonexposed control group twin siblings had a close feeling of companionship for each other. However, nonexposed twins could not understand the psychological experience of twins who had been subjected to the atomic disaster.

  3. Genetic and environmental influences on adolescents' smoking involvement: a multi-informant twin study.

    Science.gov (United States)

    Seglem, Karoline Brobakke; Waaktaar, Trine; Ask, Helga; Torgersen, Svenn

    2015-03-01

    Studying monozygotic and dizygotic adolescent twin pairs of both sexes reared together, the present study examined the extent to which the variance in smoking involvement is attributable to genetic and environmental effects, and to what extent there are sex differences in the etiology. Questionnaire data on how often the adolescent had ever smoked tobacco was collected from a population-based twin sample consisting of seven national birth cohorts (ages 12-18), their mothers, and their fathers (N = 1,394 families). The data was analyzed with multivariate genetic modeling, using a multi-informant design. The etiological structure of smoking involvement was best represented in an ACE common pathway model, with smoking defined as a latent factor loading onto all three informants' reports. Estimates could be set equal across sexes. Results showed that adolescent lifetime smoking involvement was moderately heritable (37 %). The largest influence was from the shared environment (56 %), while environmental effects unique to each twin had minimal influence (7 %).

  4. [The Murcia Twin Registry. A resource for research on health-related behaviour].

    Science.gov (United States)

    Ordoñana, Juan R; Sánchez Romera, Juan F; Colodro-Conde, Lucía; Carrillo, Eduvigis; González-Javier, Francisca; Madrid-Valero, Juan J; Morosoli-García, José J; Pérez-Riquelme, Francisco; Martínez-Selva, José M

    Genetically informative designs and, in particular, twin studies, are the most widely used methodology to analyse the relative contribution of genetic and environmental factors to inter-individual variability. These studies basically compare the degree of phenotypical similarity between monozygotic and dizygotic twin pairs. In addition to the traditional estimate of heritability, this kind of registry enables a wide variety of analyses which are unique due to the characteristics of the sample. The Murcia Twin Registry is population-based and focused on the analysis of health-related behaviour. The observed prevalence of health problems is comparable to that of other regional and national reference samples, which guarantees its representativeness. Overall, the characteristics of the Registry facilitate developing various types of research as well as genetically informative designs, and collaboration with different initiatives and consortia. Copyright © 2016 SESPAS. Publicado por Elsevier España, S.L.U. All rights reserved.

  5. Twin study of heritability of eating bread in Danish and Finnish men and women

    DEFF Research Database (Denmark)

    Hasselbalch, Ann Louise; Silventoinen, Karri; Keskitalo, Kaisu

    2010-01-01

    Bread is an elementary part of the western diet, and especially rye bread is regarded as an important source of fibre. We investigated the heritability of eating bread in terms of choice of white and rye bread and use-frequency of bread in female and male twins in Denmark and Finland. The study...... cohorts included 575 Danish (age range 18-67 years) and 2009 Finnish (age range 22-27 years) adult twin pairs. Self-reported frequency of eating bread was obtained by food frequency questionnaires. Univariate models based on linear structural equations for twin data were used to estimate the relative...... magnitude of the additive genetic, shared environmental and individual environmental effects on bread eating frequency and choice of bread. The analysis of bread intake frequency demonstrated moderate heritability ranging from 37-40% in the Finnish cohort and 23-26% in the Danish cohort. The genetic...

  6. Prediction of plant promoters based on hexamers and random triplet pair analysis

    Directory of Open Access Journals (Sweden)

    Noman Nasimul

    2011-06-01

    Full Text Available Abstract Background With an increasing number of plant genome sequences, it has become important to develop a robust computational method for detecting plant promoters. Although a wide variety of programs are currently available, prediction accuracy of these still requires further improvement. The limitations of these methods can be addressed by selecting appropriate features for distinguishing promoters and non-promoters. Methods In this study, we proposed two feature selection approaches based on hexamer sequences: the Frequency Distribution Analyzed Feature Selection Algorithm (FDAFSA and the Random Triplet Pair Feature Selecting Genetic Algorithm (RTPFSGA. In FDAFSA, adjacent triplet-pairs (hexamer sequences were selected based on the difference in the frequency of hexamers between promoters and non-promoters. In RTPFSGA, random triplet-pairs (RTPs were selected by exploiting a genetic algorithm that distinguishes frequencies of non-adjacent triplet pairs between promoters and non-promoters. Then, a support vector machine (SVM, a nonlinear machine-learning algorithm, was used to classify promoters and non-promoters by combining these two feature selection approaches. We referred to this novel algorithm as PromoBot. Results Promoter sequences were collected from the PlantProm database. Non-promoter sequences were collected from plant mRNA, rRNA, and tRNA of PlantGDB and plant miRNA of miRBase. Then, in order to validate the proposed algorithm, we applied a 5-fold cross validation test. Training data sets were used to select features based on FDAFSA and RTPFSGA, and these features were used to train the SVM. We achieved 89% sensitivity and 86% specificity. Conclusions We compared our PromoBot algorithm to five other algorithms. It was found that the sensitivity and specificity of PromoBot performed well (or even better with the algorithms tested. These results show that the two proposed feature selection methods based on hexamer frequencies

  7. Monochorionic twin pregnancies

    NARCIS (Netherlands)

    Hack, K.E.A.

    2008-01-01

    Following widespread application of assisted reproductive technology modalities and the increased age of motherhood, the incidence of twin gestations has increased markedly. Twins are either monozygotic or dizygotic. Dizygotic (i.e. fraternal) twins result from the fertilization of two different

  8. Desenvolvimento cognitivo e de linguagem expressiva em um par de gêmeos dizigóticos: influência da síndrome de Down e da prematuridade associada ao muito baixo peso Expressive language and cognitive development in a dizygotic twin pair: influence of Down syndrome and prematurity combined with very low birth-weight

    Directory of Open Access Journals (Sweden)

    Fabíola Custódio Flabiano

    2009-01-01

    -weight on their development process during the sensorimotor period. Participated in this study a pair of VLBW preterm dizygotic male twins, one of whom presented Down syndrome. The subjects' initial chronological age was seven months and four days and their initial corrected age was four months and 21 days. The twins were born with 29 weeks of gestational age and weighting less than 1500g. The subjects were followed up during 12 months in 45-minute fortnight sessions, monthly recorded in video. The Protocol for Expressive Language and Cognitive Development Observation (PELCDO was used for data gathering and data analysis. Significant differences were observed between the twin brothers concerning expressive language and cognitive development. Although the twin without DS showed better performance, he still presented a relevant delay, considering the references for typically developing children. This finding evidences the influence of prematurity combined with very low birth weight on expressive language and cognitive development. The results found for the other twin suggest that DS led to a significant increase of this delay. DS and prematurity combined with very low birth weight are conditions that negatively interfered on expressive language and cognitive development of the twin pair studied.

  9. Concordance Rates of Adolescent Idiopathic Scoliosis in a Danish Twin Population

    DEFF Research Database (Denmark)

    Simony, Ane; Carreon, Leah Y; Højmark, Karen

    2016-01-01

    STUDY DESIGN: Clinical, radiological and genetic determination of zygosity of twin pairs from the Danish Twin Registry who self-reported having Adolescent Idiopathic Scoliosis (AIS). OBJECTIVE: To establish concordance rates of AIS. SUMMARY OF BACKGROUND DATA: The aetiology of and the true mode...... reported. METHODS: All 46,418 twins registered in the Danish Twin Registry born from 1931 to 1982 were sent a survey, which included questions about scoliosis. The survey was returned by 34,944 individuals (75.3%) representing 23,204 pairs. From this study, 548 individuals representing 274 complete twin...... pairs where at least one twin self-reported having scoliosis were invited to a clinical and radiological examination. Zygosity was established by genetic testing. RESULTS: 182 individuals (33.2%) of the original cohort agreed to participate, 128 of whom had scoliosis by self-report. There were 91 twin...

  10. Base pairing and structural insights into the 5-formylcytosine in RNA duplex

    Science.gov (United States)

    Wang, Rui; Luo, Zhipu; He, Kaizhang; Delaney, Michael O.; Chen, Doris; Sheng, Jia

    2016-01-01

    Abstract 5-Formylcytidine (f5C), a previously discovered natural nucleotide in the mitochondrial tRNA of many species including human, has been recently detected as the oxidative product of 5-methylcytidine (m5C) through 5-hydroxymethylcytidine (hm5C) in total RNA of mammalian cells. The discovery indicated that these cytosine derivatives in RNA might also play important epigenetic roles similar as in DNA, which has been intensively investigated in the past few years. In this paper, we studied the base pairing specificity of f5C in different RNA duplex contexts. We found that the 5-formyl group could increase duplex thermal stability and enhance base pairing specificity. We present three high-resolution crystal structures of an octamer RNA duplex [5′-GUA(f5C)GUAC-3′]2 that have been solved under three crystallization conditions with different buffers and pH values. Our results showed that the 5-formyl group is located in the same plane as the cytosine base and forms an intra-residue hydrogen bond with the amino group in the N4 position. In addition, this modification increases the base stacking between the f5C and the neighboring bases while not causing significant global and local structure perturbations. This work provides insights into the effects of 5-formylcytosine on RNA duplex. PMID:27079978

  11. Higher order structural effects stabilizing the reverse watson-crick guanine-cytosine base pair in functional RNAs

    KAUST Repository

    Chawla, Mohit

    2013-10-10

    The G:C reverse Watson-Crick (W:W trans) base pair, also known as Levitt base pair in the context of tRNAs, is a structurally and functionally important base pair that contributes to tertiary interactions joining distant domains in functional RNA molecules and also participates in metabolite binding in riboswitches. We previously indicated that the isolated G:C W:W trans base pair is a rather unstable geometry, and that dicationic metal binding to the Guanine base or posttranscriptional modification of the Guanine can increase its stability. Herein, we extend our survey and report on other H-bonding interactions that can increase the stability of this base pair. To this aim, we performed a bioinformatics search of the PDB to locate all the occurencies of G:C trans base pairs. Interestingly, 66% of the G:C trans base pairs in the PDB are engaged in additional H-bonding interactions with other bases, the RNA backbone or structured water molecules. High level quantum mechanical calculations on a data set of representative crystal structures were performed to shed light on the structural stability and energetics of the various crystallographic motifs. This analysis was extended to the binding of the preQ1 metabolite to a preQ1-II riboswitch. 2013 The Author(s).

  12. Familial resemblance in religiousness in a secular society: a twin study.

    Science.gov (United States)

    Hvidtjørn, Dorte; Petersen, Inge; Hjelmborg, Jacob; Skytthe, Axel; Christensen, Kaare; Hvidt, Niels C

    2013-04-01

    It is well known that human behavior and individual psychological traits are moderately to substantially heritable. Over the past decade, an increasing number of studies have explored the genetic and environmental influence on religiousness. These studies originate predominantly from countries generally considered more religious than the very secular northern European countries. Comparisons of the results are complicated by diverse definitions of religiousness, but several studies indicate that the influence of the family environment is most predominant in early life, whereas genetic influences increase with age. We performed a population-based twin study of religiousness in a secular society using data from a Web-based survey sent to 6,707 Danish twins born 1970-1989, who were identified in the Danish Twin Registry. We applied Fishman's three conceptual dimensions of religiousness: cognition, practice, and importance. In all polygenic models and biometric analyses, we controlled for gender and age. The study sample comprised 2,237 same sex twins, a response rate of 45%. We found high correlations within both monozygotic and dizygotic twin pairs in most items of religiousness, indicating a large influence from shared environmental factors. Personal religiousness such as praying to God, believing in God, and finding strength and comfort in religion were more influenced by genetic factors than were social forms of religiousness such as church attendance. We found a small tendency for increasing genetic influence with increasing age for some religious items, but not for all.

  13. Epigenetic differences in monozygotic twins discordant for major depressive disorder.

    Science.gov (United States)

    Malki, K; Koritskaya, E; Harris, F; Bryson, K; Herbster, M; Tosto, M G

    2016-06-14

    Although monozygotic (MZ) twins share the majority of their genetic makeup, they can be phenotypically discordant on several traits and diseases. DNA methylation is an epigenetic mechanism that can be influenced by genetic, environmental and stochastic events and may have an important impact on individual variability. In this study we explored epigenetic differences in peripheral blood samples in three MZ twin studies on major depressive disorder (MDD). Epigenetic data for twin pairs were collected as part of a previous study using 8.1-K-CpG microarrays tagging DNA modification in white blood cells from MZ twins discordant for MDD. Data originated from three geographical regions: UK, Australia and the Netherlands. Ninety-seven MZ pairs (194 individuals) discordant for MDD were included. Different methods to address non independently-and-identically distributed (non-i.i.d.) data were evaluated. Machine-learning methods with feature selection centered on support vector machine and random forest were used to build a classifier to predict cases and controls based on epivariations. The most informative variants were mapped to genes and carried forward for network analysis. A mixture approach using principal component analysis (PCA) and Bayes methods allowed to combine the three studies and to leverage the increased predictive power provided by the larger sample. A machine-learning algorithm with feature reduction classified affected from non-affected twins above chance levels in an independent training-testing design. Network analysis revealed gene networks centered on the PPAR-γ (NR1C3) and C-MYC gene hubs interacting through the AP-1 (c-Jun) transcription factor. PPAR-γ (NR1C3) is a drug target for pioglitazone, which has been shown to reduce depression symptoms in patients with MDD. Using a data-driven approach we were able to overcome challenges of non-i.i.d. data when combining epigenetic studies from MZ twins discordant for MDD. Individually, the studies yielded

  14. The analysis of photon pair source at telecom wavelength based on the BBO crystal (Conference Presentation)

    Science.gov (United States)

    Gajewski, Andrzej; Kolenderski, Piotr L.

    2016-10-01

    There are several problems that must be solved in order to increase the distance of quantum communication protocols based on photons as an information carriers. One of them is the dispersion, whose effects can be minimized by engineering spectral properties of transmitted photons. In particular, it is expected that positively correlated photon pairs can be very useful. We present the full characterization of a source of single photon pairs at a telecom wavelength based on type II spontaneous parametric down conversion (SPDC) process in a beta-barium borate (BBO) crystal. In the type II process, a pump photon, which is polarized extraordinarily, splits in a nonlinear medium into signal and idler photons, which are polarized perpendicularly to each other. In order for the process to be efficient a phase matching condition must be fulfilled. These conditions originate from momentum and energy conservation rules and put severe restrictions on source parameters. Seemingly, these conditions force the photon pair to be negatively correlated in their spectral domain. However, it is possible to achieve positive correlation for pulsed pumping. The experimentally available degrees of freedom of a source are the width of the pumping beam, the collected modes' widths, the length of the nonlinear crystal and the duration of the pumping pulse. In our numerical model we use the following figures of merit: the pair production rate, the efficiency of photon coupling into a single mode fiber, the spectral correlation of the coupled photon pair. The last one is defined as the Pearson correlation parameter for a joint spectral distribution. The aim here is to find the largest positive spectral correlation and the highest coupling efficiency. By resorting to the numerical model Ref. [1] we showed in Ref. [2], that by careful adjustment of the pump's and the collected modes' characteristics, one can optimize any of the source's parameters. Our numerical outcomes conform to the

  15. Hilbert-Twin – A Novel Hilbert Transform-Based Method To Compute Envelope Of Free Decaying Oscillations Embedded In Noise, And The Logarithmic Decrement In High-Resolution Mechanical Spectroscopy HRMS

    Directory of Open Access Journals (Sweden)

    Magalas L.B.

    2015-06-01

    Full Text Available In this work, we present a novel Hilbert-twin method to compute an envelope and the logarithmic decrement, δ, from exponentially damped time-invariant harmonic strain signals embedded in noise. The results obtained from five computing methods: (1 the parametric OMI (Optimization in Multiple Intervals method, two interpolated discrete Fourier transform-based (IpDFT methods: (2 the Yoshida-Magalas (YM method and (3 the classic Yoshida (Y method, (4 the novel Hilbert-twin (H-twin method based on the Hilbert transform, and (5 the conventional Hilbert transform (HT method are analyzed and compared. The fundamental feature of the Hilbert-twin method is the efficient elimination of intrinsic asymmetrical oscillations of the envelope, aHT (t, obtained from the discrete Hilbert transform of analyzed signals. Excellent performance in estimation of the logarithmic decrement from the Hilbert-twin method is comparable to that of the OMI and YM for the low- and high-damping levels. The Hilbert-twin method proved to be robust and effective in computing the logarithmic decrement and the resonant frequency of exponentially damped free decaying signals embedded in experimental noise. The Hilbert-twin method is also appropriate to detect nonlinearities in mechanical loss measurements of metals and alloys.

  16. Effect of morphological and functional changes in the secundines on biometric parameters of newborns from dichorionic twin pregnancies.

    Science.gov (United States)

    Waszak, Małgorzata; Cieślik, Krystyna; Pietryga, Marek; Lewandowski, Jacek; Chuchracki, Marek; Nowak-Markwitz, Ewa; Bręborowicz, Grzegorz

    2016-01-01

    The aim of the study was to determine if, and to what extent, structural and functional changes of the secundines influence biometric parameters of neonates from dichorionic twin pregnancies. The study included neonates from dichorionic, diamniotic twin pregnancies, along with their secundines. Based on histopathological examination of the secundines, the mass and dimensions of the placenta, length and condition of the umbilical cord, chorionicity, focal lesions, and microscopic placental abnormalities were determined for 445 pairs of twins. Morphological development of examined twins was characterized on the basis of their six somatic traits, while birth status of the newborns was assessed based on their Apgar scores. Statistical analysis included Student t-tests, Snedecor's F-tests, post-hoc tests, non-parametric chi-squared Pearson's tests, and determination of Spearman coefficients of rank correlation. The lowest values of analyzed somatic traits were observed in twins who had placentas with velamentous or marginal cord insertion. Inflammatory lesions in the placenta and placental abruption turned out to have the greatest impact of all analyzed abnormalities of the secundines. Inflammatory lesions in the placenta were associated with lower values of biometric parameters and a greater likelihood of preterm birth. Neonates with a history of placental abruption were characterized by significantly lower birth weight and smaller chest circumference. Morphological changes in the secundines have a limited impact on biometric parameters of neonates from dichorionic twin pregnancies. In turn, functional changes exert a significant effect and more often contribute to impaired fetal development.

  17. Detection of protonated non-Watson-Crick base pairs using electrospray ionization mass spectrometry.

    Science.gov (United States)

    Ishida, Riyoko; Iwahashi, Hideo

    2018-03-01

    Many studies have shown that protonated nucleic acid base pairs are involved in a wide variety of nucleic acid structures. However, little information is available on relative stability of hemiprotonated self- and non-self-dimers at monomer level. We used electrospray ionization mass spectrometry (ESI-MS) to evaluate the relative stability under various concentrations of hydrogen ion. These enable conjecture of the formation of protonated non-Watson-Crick base pairs based on DNA and RNA base sequence. In the present study, we observed that ESI-MS peaks corresponded to respective self-dimers for all examined nucleosides except for adenosine. Peak heights depended on the concentration of hydrogen ion. The ESI-MS peak heights of the hemiprotonated cytidine dimers and the hemiprotonated thymidine dimer sharply increased with increased concentration of hydrogen ion, suggesting direct participation of hydrogen ion in dimer formations. In ESI-MS measurements of the solutions containing adenosine, cytidine, thymidine and guanosine, we observed protonated cytidine-guanosine dimer (CH+-G) and protonated cytidine-thymidine dimer (CH+-T) in addition to hemiprotonated cytidine-cytidine dimer (CH+-C) with following relative peak height, (CH+-C) > (CH+-G) ≈ (CH+-T) > (CH+-A). Additionally, in the ESI-MS measurements of solutions containing adenosine, thymidine and guanosine, we observed a considerable amount of protonated adenosine-guanosine (AH+-G) and protonated adenosine-thymidine (AH+-T).

  18. Efficient and Provable Secure Pairing-Free Security-Mediated Identity-Based Identification Schemes

    Directory of Open Access Journals (Sweden)

    Ji-Jian Chin

    2014-01-01

    Full Text Available Security-mediated cryptography was first introduced by Boneh et al. in 2001. The main motivation behind security-mediated cryptography was the capability to allow instant revocation of a user’s secret key by necessitating the cooperation of a security mediator in any given transaction. Subsequently in 2003, Boneh et al. showed how to convert a RSA-based security-mediated encryption scheme from a traditional public key setting to an identity-based one, where certificates would no longer be required. Following these two pioneering papers, other cryptographic primitives that utilize a security-mediated approach began to surface. However, the security-mediated identity-based identification scheme (SM-IBI was not introduced until Chin et al. in 2013 with a scheme built on bilinear pairings. In this paper, we improve on the efficiency results for SM-IBI schemes by proposing two schemes that are pairing-free and are based on well-studied complexity assumptions: the RSA and discrete logarithm assumptions.

  19. Efficient and provable secure pairing-free security-mediated identity-based identification schemes.

    Science.gov (United States)

    Chin, Ji-Jian; Tan, Syh-Yuan; Heng, Swee-Huay; Phan, Raphael C-W

    2014-01-01

    Security-mediated cryptography was first introduced by Boneh et al. in 2001. The main motivation behind security-mediated cryptography was the capability to allow instant revocation of a user's secret key by necessitating the cooperation of a security mediator in any given transaction. Subsequently in 2003, Boneh et al. showed how to convert a RSA-based security-mediated encryption scheme from a traditional public key setting to an identity-based one, where certificates would no longer be required. Following these two pioneering papers, other cryptographic primitives that utilize a security-mediated approach began to surface. However, the security-mediated identity-based identification scheme (SM-IBI) was not introduced until Chin et al. in 2013 with a scheme built on bilinear pairings. In this paper, we improve on the efficiency results for SM-IBI schemes by proposing two schemes that are pairing-free and are based on well-studied complexity assumptions: the RSA and discrete logarithm assumptions.

  20. Genetic susceptibility to bilateral tinnitus in a Swedish twin cohort

    DEFF Research Database (Denmark)

    Maas, Iris Lianne; Brüggemann, Petra; Requena, Teresa

    2017-01-01

    PURPOSE: Genetic contributions to tinnitus have been difficult to determine due to the heterogeneity of the condition and its broad etiology. Here, we evaluated the genetic and nongenetic influences on self-reported tinnitus from the Swedish Twin Registry (STR). METHODS: Cross-sectional data from...... the STR was obtained. Casewise concordance rates (the risk of one twin being affected given that his/her twin partner has tinnitus) were compared for monozygotic (MZ) and dizygotic (DZ) twin pairs (N = 10,464 concordant and discordant twin pairs) and heritability coefficients (the proportion of the total...... variance attributable to genetic factors) were calculated using biometrical model fitting procedures. RESULTS: Stratification of tinnitus cases into subtypes according to laterality (unilateral versus bilateral) revealed that heritability of bilateral tinnitus was 0.56; however, it was 0.27 for unilateral...

  1. Atopic diseases in twins born after assisted reproduction

    DEFF Research Database (Denmark)

    Jäderberg, Ida; Thomsen, Simon F; Kyvik, Kirsten Ohm

    2012-01-01

    Jäderberg I, Thomsen SF, Kyvik KO, Skytthe A, Backer V. Atopic diseases in twins born after assisted reproduction. Paediatric and Perinatal Epidemiology 2012; 26: 140-145. We examined the risk of atopic diseases in twins born after assisted reproduction. Data on atopic diseases and assisted...... reproduction in 9694 twin pairs, 3-20 years of age, from the Danish Twin Registry were collected via multidisciplinary questionnaires. The risk of atopic diseases in twins born after assisted reproduction was compared with the risk in twins born after spontaneous conception using logistic regression...... and variance components analysis. Children born after assisted reproduction did not have a different risk of atopic outcomes (adjusted odds ratios [95% confidence intervals] for asthma: 0.95 [0.85, 1.07], P = 0.403; hay fever: 1.01 [0.86, 1.18], P = 0.918; and atopic dermatitis: 1.02 [0.81, 1.11], P = 0...

  2. Studies of base pair sequence effects on DNA solvation based on all-atom molecular dynamics simulations.

    Science.gov (United States)

    Dixit, Surjit B; Mezei, Mihaly; Beveridge, David L

    2012-07-01

    Detailed analyses of the sequence-dependent solvation and ion atmosphere of DNA are presented based on molecular dynamics (MD) simulations on all the 136 unique tetranucleotide steps obtained by the ABC consortium using the AMBER suite of programs. Significant sequence effects on solvation and ion localization were observed in these simulations. The results were compared to essentially all known experimental data on the subject. Proximity analysis was employed to highlight the sequence dependent differences in solvation and ion localization properties in the grooves of DNA. Comparison of the MD-calculated DNA structure with canonical A- and B-forms supports the idea that the G/C-rich sequences are closer to canonical A- than B-form structures, while the reverse is true for the poly A sequences, with the exception of the alternating ATAT sequence. Analysis of hydration density maps reveals that the flexibility of solute molecule has a significant effect on the nature of observed hydration. Energetic analysis of solute-solvent interactions based on proximity analysis of solvent reveals that the GC or CG base pairs interact more strongly with water molecules in the minor groove of DNA that the AT or TA base pairs, while the interactions of the AT or TA pairs in the major groove are stronger than those of the GC or CG pairs. Computation of solvent-accessible surface area of the nucleotide units in the simulated trajectories reveals that the similarity with results derived from analysis of a database of crystallographic structures is excellent. The MD trajectories tend to follow Manning's counterion condensation theory, presenting a region of condensed counterions within a radius of about 17 A from the DNA surface independent of sequence. The GC and CG pairs tend to associate with cations in the major groove of the DNA structure to a greater extent than the AT and TA pairs. Cation association is more frequent in the minor groove of AT than the GC pairs. In general, the

  3. Effect of co-twin gender on neurodevelopmental symptoms: a twin register study.

    Science.gov (United States)

    Eriksson, Jonna Maria; Lundström, Sebastian; Lichtenstein, Paul; Bejerot, Susanne; Eriksson, Elias

    2016-01-01

    Autism spectrum disorder (ASD) and attention-deficit/hyperactivity disorder (ADHD) are neurodevelopmental disorders thought to have both genetic and environmental causes. It has been hypothesized that exposure to elevated levels of prenatal testosterone is associated with elevated traits of ASD and ADHD. Assuming that testosterone levels from a dizygotic male twin fetus may lead to enhanced testosterone exposure of its co-twins, we aimed to test the prenatal testosterone hypothesis by comparing same-sex with opposite-sex dizygotic twins with respect to neurodevelopmental symptoms. Neuropsychiatric traits were assessed in a population-based twin cohort from the Child and Adolescent Twin Study in Sweden (CATSS). Parental interviews were conducted for 16,312 dizygotic twins, 9 and 12 years old, with the Autism-Tics, ADHD, and other Comorbidities inventory (A-TAC). Girls with a female co-twin had an increased risk of reaching the cut-off score for ADHD compared with girls with a male co-twin. Both boys and girls with a female co-twin displayed a larger number of traits related to attention deficit and repetitive and stereotyped behaviors than those with a male twin. In girls, this also extended to social interaction and the combined measures for ASD and ADHD, however, with small effect sizes. Our results are reverse to what would have been expected from the prenatal testosterone hypothesis but consistent with a previous study of ASD and ADHD traits in dizygotic twins. The seemingly protective effect for girls of having a twin brother may be an effect of parent report bias, but may also be an unexpected effect of sharing the intrauterine environment with a male co-twin.

  4. Uncertainty evaluation for three-dimensional scanning electron microscope reconstructions based on the stereo-pair technique

    DEFF Research Database (Denmark)

    Carli, Lorenzo; Genta, G; Cantatore, Angela

    2011-01-01

    3D-SEM is a method, based on the stereophotogrammetry technique, which obtains three-dimensional topographic reconstructions starting typically from two SEM images, called the stereo-pair. In this work, a theoretical uncertainty evaluation of the stereo-pair technique, according to GUM (Guide to ...

  5. Positive cooperativity of the specific binding between Hg2+ ion and T:T mismatched base pairs in duplex DNA

    International Nuclear Information System (INIS)

    Torigoe, Hidetaka; Miyakawa, Yukako; Ono, Akira; Kozasa, Tetsuo

    2012-01-01

    Highlights: ► Hg 2+ specifically bound with the T:T mismatched base pair at 1:1 molar ratio. ► The binding constant between Hg 2+ and the T:T mismatched base pair was 10 6 M −1 . ► The binding constant was larger than those for nonspecific metal–DNA interactions. ► The binding constant for the second Hg 2+ was larger than that for the first Hg 2+ . ► The positive cooperative binding was observed between Hg 2+ and multiple T:T. - Abstract: Metal-mediated base pairs by the interaction between metal ions and artificial bases in oligonucleotides have been developed for their potential applications in nanotechnology. We recently found that a natural T:T mismatched base pair bound with Hg 2+ ion to form a novel T–Hg–T base pair. Here, we examined the thermodynamic properties of the binding between Hg 2+ and each of the single and double T:T mismatched base pair duplex DNAs by isothermal titration calorimetry. Hg 2+ specifically bound with the T:T mismatched base pair at 1:1 molar ratio with 10 6 M −1 binding constant, which was significantly larger than those for nonspecific metal ion–DNA interactions. In the Hg 2+ –double T:T mismatched base pair interaction, the affinity for the second Hg 2+ binding was significantly larger than that for the first Hg 2+ binding. The positively cooperative binding may be favorable to align multiple Hg 2+ in duplex DNA for the application of the metal-mediated base pairs in nanotechnology.

  6. Conformational analysis of a covalently cross-linked Watson-Crick base pair model.

    Science.gov (United States)

    Jensen, Erik A; Allen, Benjamin D; Kishi, Yoshito; O'Leary, Daniel J

    2008-11-15

    Low-temperature NMR experiments and molecular modeling have been used to characterize the conformational behavior of a covalently cross-linked DNA base pair model. The data suggest that Watson-Crick or reverse Watson-Crick hydrogen bonding geometries have similar energies and can interconvert at low temperatures. This low-temperature process involves rotation about the crosslink CH(2)C(5') (psi) carbon-carbon bond, which is energetically preferred over the alternate CH(2)N(3) (phi) carbon-nitrogen bond rotation.

  7. Conformational Analysis of a Covalently Cross-Linked Watson-Crick Base Pair Model

    OpenAIRE

    Jensen, Erik A.; Allen, Benjamin D.; Kishi, Yoshito; O'Leary, Daniel J.

    2008-01-01

    Low temperature NMR experiments and molecular modeling have been used to characterize the conformational behavior of a covalently cross-linked DNA base pair model. The data suggest that Watson-Crick or reverse Watson-Crick hydrogen bonding geometries have similar energies and can interconvert at low temperatures. This low-temperature process involves rotation about the crosslink CH2–C(5′) (ψ) carbon-carbon bond, which is energetically preferred over the alternate CH2–N(3) (ϕ) carbon-nitrogen ...

  8. Enol tautomers of Watson-Crick base pair models are metastable because of nuclear quantum effects.

    Science.gov (United States)

    Pérez, Alejandro; Tuckerman, Mark E; Hjalmarson, Harold P; von Lilienfeld, O Anatole

    2010-08-25

    Intermolecular enol tautomers of Watson-Crick base pairs could emerge spontaneously via interbase double proton transfer. It has been hypothesized that their formation could be facilitated by thermal fluctuations and proton tunneling, and possibly be relevant to DNA damage. Theoretical and computational studies, assuming classical nuclei, have confirmed the dynamic stability of these rare tautomers. However, by accounting for nuclear quantum effects explicitly through Car-Parrinello path integral molecular dynamics calculations, we find the tautomeric enol form to be dynamically metastable, with lifetimes too insignificant to be implicated in DNA damage.

  9. Superior coexistence: systematicALLY regulatING land subsidence BASED on set pair theory

    Directory of Open Access Journals (Sweden)

    Y. Chen

    2015-11-01

    Full Text Available Anthropogenic land subsidence is an environmental side effect of exploring and using natural resources in the process of economic development. The key points of the system for controlling land subsidence include cooperation and superior coexistence while the economy develops, exploring and using natural resources, and geological environmental safety. Using the theory and method of set pair analysis (SPA, this article anatomises the factors, effects, and transformation of land subsidence. Based on the principle of superior coexistence, this paper promotes a technical approach to the system for controlling land subsidence, in order to improve the prevention and control of geological hazards.

  10. Base-pairing preferences, physicochemical properties and mutational behaviour of the DNA lesion 8-nitroguanine †

    OpenAIRE

    Bhamra, Inder; Compagnone-Post, Patricia; O’Neil, Ian A.; Iwanejko, Lesley A.; Bates, Andrew D.; Cosstick, Richard

    2012-01-01

    8-Nitro-2′-deoxyguanosine (8-nitrodG) is a relatively unstable, mutagenic lesion of DNA that is increasingly believed to be associated with tissue inflammation. Due to the lability of the glycosidic bond, 8-nitrodG cannot be incorporated into oligodeoxynucleotides (ODNs) by chemical DNA synthesis and thus very little is known about its physicochemical properties and base-pairing preferences. Here we describe the synthesis of 8-nitro-2′-O-methylguanosine, a ribonucleoside analogue of this lesi...

  11. Dimensional representations of DSM-IV cluster B personality disorders in a population-based sample of Norwegian twins: a multivariate study.

    Science.gov (United States)

    Torgersen, S; Czajkowski, N; Jacobson, K; Reichborn-Kjennerud, T; Røysamb, E; Neale, M C; Kendler, K S

    2008-11-01

    The personality disorders (PDs) in the 'dramatic' cluster B [antisocial (ASPD), histrionic (HPD), narcissistic (NPD) and borderline (BPD)] demonstrate co-morbidity. However, the degree to which genetic and/or environmental factors influence their co-occurrence is not known and, with the exception of ASPD, the relative impact of genetic and environmental risk factors on liability to the cluster B PDs has not been conclusively established. PD traits were assessed in 1386 Norwegian twin pairs between the age of 19 and 35 years using the Structured Interview for DSM-IV Personality Disorders (SIDP-IV). Using the statistical package Mx, multivariate twin models were fitted to dimensional representations of the PDs. The best-fitting model, which did not include sex or shared family environment effects, included common genetic and environmental factors influencing all four dramatic PD traits, and factors influencing only ASPD and BPD. Heritability was estimated at 38% for ASPD traits, 31% for HPD traits, 24% for NPD traits and 35% for BPD traits. BPD traits had the lowest and ASPD traits the highest disorder-specific genetic variance. The frequently observed co-morbidity between cluster B PDs results from both common genetic and environmental influences. Etiologically, cluster B has a 'substructure' in which ASPD and BPD are more closely related to each other than to the other cluster B disorders.

  12. Complexes of DNA bases and Watson-Crick base pairs with small neutral gold clusters.

    Science.gov (United States)

    Kryachko, E S; Remacle, F

    2005-12-08

    The nature of the DNA-gold interaction determines and differentiates the affinity of the nucleobases (adenine, thymine, guanine, and cytosine) to gold. Our preliminary computational study [Kryachko, E. S.; Remacle, F. Nano Lett. 2005, 5, 735] demonstrates that two major bonding factors govern this interaction: the anchoring, either of the Au-N or Au-O type, and the nonconventional N-H...Au hydrogen bonding. In this paper, we offer insight into the nature of nucleobase-gold interactions and provide a detailed characterization of their different facets, i.e., geometrical, energetic, and spectroscopic aspects; the gold cluster size and gold coordination effects; proton affinity; and deprotonation energy. We then investigate how the Watson-Crick DNA pairing patterns are modulated by the nucleobase-gold interaction. We do so in terms of the proton affinities and deprotonation energies of those proton acceptors and proton donors which are involved in the interbase hydrogen bondings. A variety of properties of the most stable Watson-Crick [A x T]-Au3 and [G x C]-Au3 hybridized complexes are described and compared with the isolated Watson-Crick A x T and G x C ones. It is shown that enlarging the gold cluster size to Au6 results in a rather short gold-gold bond in the Watson-Crick interbase region of the [G x C]-Au6 complex that bridges the G x C pair and thus leads to a significant strengthening of G x C pairing.

  13. Easy design of colorimetric logic gates based on nonnatural base pairing and controlled assembly of gold nanoparticles.

    Science.gov (United States)

    Zhang, Li; Wang, Zhong-Xia; Liang, Ru-Ping; Qiu, Jian-Ding

    2013-07-16

    Utilizing the principles of metal-ion-mediated base pairs (C-Ag-C and T-Hg-T), the pH-sensitive conformational transition of C-rich DNA strand, and the ligand-exchange process triggered by DL-dithiothreitol (DTT), a system of colorimetric logic gates (YES, AND, INHIBIT, and XOR) can be rationally constructed based on the aggregation of the DNA-modified Au NPs. The proposed logic operation system is simple, which consists of only T-/C-rich DNA-modified Au NPs, and it is unnecessary to exquisitely design and alter the DNA sequence for different multiple molecular logic operations. The nonnatural base pairing combined with unique optical properties of Au NPs promises great potential in multiplexed ion sensing, molecular-scale computers, and other computational logic devices.

  14. Capturing alternative secondary structures of RNA by decomposition of base-pairing probabilities.

    Science.gov (United States)

    Hagio, Taichi; Sakuraba, Shun; Iwakiri, Junichi; Mori, Ryota; Asai, Kiyoshi

    2018-02-19

    It is known that functional RNAs often switch their functions by forming different secondary structures. Popular tools for RNA secondary structures prediction, however, predict the single 'best' structures, and do not produce alternative structures. There are bioinformatics tools to predict suboptimal structures, but it is difficult to detect which alternative secondary structures are essential. We proposed a new computational method to detect essential alternative secondary structures from RNA sequences by decomposing the base-pairing probability matrix. The decomposition is calculated by a newly implemented software tool, RintW, which efficiently computes the base-pairing probability distributions over the Hamming distance from arbitrary reference secondary structures. The proposed approach has been demonstrated on ROSE element RNA thermometer sequence and Lysine RNA ribo-switch, showing that the proposed approach captures conformational changes in secondary structures. We have shown that alternative secondary structures are captured by decomposing base-paring probabilities over Hamming distance. Source code is available from http://www.ncRNA.org/RintW .

  15. Link-based quantitative methods to identify differentially coexpressed genes and gene Pairs

    Directory of Open Access Journals (Sweden)

    Ye Zhi-Qiang

    2011-08-01

    Full Text Available Abstract Background Differential coexpression analysis (DCEA is increasingly used for investigating the global transcriptional mechanisms underlying phenotypic changes. Current DCEA methods mostly adopt a gene connectivity-based strategy to estimate differential coexpression, which is characterized by comparing the numbers of gene neighbors in different coexpression networks. Although it simplifies the calculation, this strategy mixes up the identities of different coexpression neighbors of a gene, and fails to differentiate significant differential coexpression changes from those trivial ones. Especially, the correlation-reversal is easily missed although it probably indicates remarkable biological significance. Results We developed two link-based quantitative methods, DCp and DCe, to identify differentially coexpressed genes and gene pairs (links. Bearing the uniqueness of exploiting the quantitative coexpression change of each gene pair in the coexpression networks, both methods proved to be superior to currently popular methods in simulation studies. Re-mining of a publicly available type 2 diabetes (T2D expression dataset from the perspective of differential coexpression analysis led to additional discoveries than those from differential expression analysis. Conclusions This work pointed out the critical weakness of current popular DCEA methods, and proposed two link-based DCEA algorithms that will make contribution to the development of DCEA and help extend it to a broader spectrum.

  16. NMR and molecular modeling evidence for a G·A mismatch base pair in a purine-rich DNA duplex

    International Nuclear Information System (INIS)

    Li, Ying; Wilson, W.D.; Zon, G.

    1991-01-01

    1 H NMR experiments indicate that the oligomer 5'-d(ATGAGCGAATA) forms an unusual 10-base-pair duplex with 4 G·A base pairs and a 3' unpaired adenosine. NMR results indicate that guanoxine imino protons of the F·A mismatches are not hydrogen bonded but are stacked in the helix. A G→ I substitution in either G·A base pair causes a dramatic decrtease in duplex stability and indicates that hydrogen bonding of the guanosine amino group is critical. Nuclear Overhauser effect spectroscopy (NOESY) and two-dimensional correlated spectroscopy (COSY) results indicate that the overall duplex conformation is in the B-family. Cross-strand NOEs in two-dimensional NOESY spectra between a mismatched AH2 and an AH1' of the other mismatched base pair and between a mismatched GH8 and GNH1 of the other mismatch establish a purine-purine stacking pattern, adenosine over adenosine and guanosine over guanosine, which strongly stabilizes the duplex. A computer graphics molecular model of the ususual duplex was constructed with G·A base pairs containing A-NH 2 to GN3 and G-NH 2 to AN7 hydrogen bonds and B-form base pairs on both sides of the G·A pairs [5'-d(ATGAGC)]. The energy-minimized duplex satisfies all experimental constraints from NOESY and COSY results. A hydrogen bond from G-NH 2 of the mismatch to a phosphate oxygen is predicted

  17. Art for twins: Yorùbá artists and their statues/twin research studies: twins' education and conceptions; diurnal preference; inherited eye diseases; ultrasound counseling when twins are conjoined/popular twin reports: twin sisters (the film); rare pregnancy; diet test; French twins reared apart and reunited.

    Science.gov (United States)

    Segal, Nancy L

    2014-06-01

    The Yorùbá of Nigeria are well known for their high twinning rate and the statues they create to commemorate deceased twins. An impressive collection of this artwork was displayed at the University of California's Fowler Museum in Los Angeles between October 13, 2013 and March 2, 2014. An overview of this exhibit is provided. Next, twin research on maternal education and conception, diurnal preference, inherited eye diseases, and ultrasound counseling for couples with conjoined twins are briefly summarized. This article concludes with a discussion of media-based items related to twins. The topics include an award-winning twin film, a rare pregnancy, a diet test, and the separation and chance reunion of monozygotic female twins.

  18. Monozygotic twin pairs discordant for Hashimoto's thyroiditis share a high proportion of thyroid peroxidase autoantibodies to the immunodominant region A. Further evidence for genetic transmission of epitopic “fingerprints”

    DEFF Research Database (Denmark)

    Brix, Thomas Heiberg; Hegedüs, Laszlo; Gardas, Andrzej

    2010-01-01

    Thyroid peroxidase antibodies (TPOAbs) in patients with Hashimoto's thyroiditis (HT) predominantly react with two immunodominant regions (IDR-A, IDR-B). Theoretically, as shown for the level of TPOAbs, the autoantibody epitopic recognition of the IDRs could be under genetic control. To examine this......, we compared the distribution of TPOAb epitopic fingerprints between healthy monozygotic (MZ) co-twins and siblings to patients with clinically overt HT with a control group of euthyroid subjects, matched for sex and age, but without autoimmune thyroid disease (AITD) among their first-degree relatives...

  19. Twin study of heritability of eating bread in Danish and Finnish men and women.

    Science.gov (United States)

    Hasselbalch, Ann L; Silventoinen, Karri; Keskitalo, Kaisu; Pietiläinen, Kirsi H; Rissanen, Aila; Heitmann, Berit L; Kyvik, Kirsten O; Sørensen, Thorkild I A; Kaprio, Jaakko

    2010-04-01

    Bread is an elementary part of the western diet, and especially rye bread is regarded as an important source of fibre. We investigated the heritability of eating bread in terms of choice of white and rye bread and use-frequency of bread in female and male twins in Denmark and Finland. The study cohorts included 575 Danish (age range 18-67 years) and 2009 Finnish (age range 22-27 years) adult twin pairs. Self-reported frequency of eating bread was obtained by food frequency questionnaires. Univariate models based on linear structural equations for twin data were used to estimate the relative magnitude of the additive genetic, shared environmental and individual environmental effects on bread eating frequency and choice of bread. The analysis of bread intake frequency demonstrated moderate heritability ranging from 37-40% in the Finnish cohort and 23-26% in the Danish cohort. The genetic influence on intake of white bread was moderate (24-31%), while the genetic influence on intake of rye bread was higher in men (41-45%) than in women (24-33%). Environmental influences shared by the twins were not significant. Consumption of bread as well as choice of bread is influenced by genetic predisposition. Environmental factors shared by the co-twins (e.g., childhood environment) seem to have no significant effects on bread consumption and preference in adulthood.

  20. Matched molecular pair-based data sets for computer-aided medicinal chemistry

    Science.gov (United States)

    Bajorath, Jürgen

    2014-01-01

    Matched molecular pairs (MMPs) are widely used in medicinal chemistry to study changes in compound properties including biological activity, which are associated with well-defined structural modifications. Herein we describe up-to-date versions of three MMP-based data sets that have originated from in-house research projects. These data sets include activity cliffs, structure-activity relationship (SAR) transfer series, and second generation MMPs based upon retrosynthetic rules. The data sets have in common that they have been derived from compounds included in the ChEMBL database (release 17) for which high-confidence activity data are available. Thus, the activity data associated with MMP-based activity cliffs, SAR transfer series, and retrosynthetic MMPs cover the entire spectrum of current pharmaceutical targets. Our data sets are made freely available to the scientific community. PMID:24627802

  1. Heritability and Genome-Wide Association Analyses of Serum Uric Acid in Middle and Old-Aged Chinese Twins

    DEFF Research Database (Denmark)

    Wang, Weijing; Zhang, Dongfeng; Xu, Chunsheng

    2018-01-01

    Serum uric acid (SUA), as the end product of purine metabolism, has proven emerging roles in human disorders. Here based on a sample of 379 middle and old-aged Chinese twin pairs, we aimed to explore the magnitude of genetic impact on SUA variation by performing sex-limitation twin modeling analy...... involved in functional genes and regulatory domains that mediate SUA level. Our findings provide clues to further elucidate molecular physiology of SUA homeostasis and identify new diagnostic biomarkers and therapeutic targets for hyperuricemia and gout....

  2. A QM/MM refinement of an experimental DNA structure with metal-mediated base pairs.

    Science.gov (United States)

    Kumbhar, Sadhana; Johannsen, Silke; Sigel, Roland K O; Waller, Mark P; Müller, Jens

    2013-10-01

    A series of hybrid quantum mechanical/molecular mechanical (QM/MM) calculations was performed on models of a DNA duplex with artificial silver(I)-mediated imidazole base pairs. The optimized structures were compared to the original experimental NMR structure (Nat. Chem. 2 (2010) 229-234). The metal⋯metal distances are significantly shorter (~0.5Å) in the QM/MM model than in the original NMR structure. As a result, argentophilic interactions are feasible between the silver(I) ions of neighboring metal-mediated base pairs. Using the computationally determined metal⋯metal distances, a re-refined NMR solution structure of the DNA duplex was obtained. In this new NMR structure, all experimental constraints remain fulfilled. The new NMR structure shows less deviation from the regular B-type conformation than the original one. This investigation shows that the application of QM/MM models to generate additional constraints to be used during NMR structural refinements represents an elegant approach to obtaining high-resolution NMR structures. Copyright © 2013 Elsevier Inc. All rights reserved.

  3. [Biological and neural bases of partner preferences in rodents: models to understand human pair bonds].

    Science.gov (United States)

    Coria-Avila, G A; Hernández-Aguilar, M E; Toledo-Cárdenas, R; García-Hernández, L I; Manzo, J; Pacheco, P; Miquel, M; Pfaus, J G

    To analyse the biological and neural bases of partner preference formation in rodents as models to understand human pair bonding. Rodents are social individuals, capable of forming short- or long-lasting partner preferences that develop slowly by stimuli like cohabitation, or rapidly by stimuli like sex and stress. Dopamine, corticosteroids, oxytocin, vasopressin, and opioids form the neurochemical substrate for pair bonding in areas like the nucleus accumbens, the prefrontal cortex, the piriform cortex, the medial preoptic area, the ventral tegmental area and the medial amygdala, among others. Additional areas may participate depending on the nature of the conditioned stimuli by which and individual recognizes a preferred partner. Animal models help us understand that the capacity of an individual to display long-lasting and selective preferences depends on neural bases, selected throughout evolution. The challenge in neuroscience is to use this knowledge to create new solutions for mental problems associated with the incapacity of an individual to display a social bond, keep one, or cope with the disruption of a consolidated one.

  4. Dye-sensitized solar cell with a pair of carbon-based electrodes

    International Nuclear Information System (INIS)

    Kyaw, Aung Ko Ko; Demir, Hilmi Volkan; Sun Xiaowei; Tantang, Hosea; Zhang Qichun; Wu Tao; Ke, Lin; Wei Jun

    2012-01-01

    We have fabricated a dye-sensitized solar cell (DSSC) with a pair of carbon-based electrodes using a transparent, conductive carbon nanotubes (CNTs) film modified with ultra-thin titanium-sub-oxide (TiO x ) as the working electrode and a bilayer of conductive CNTs and carbon black as the counter electrode. Without TiO x modification, the DSSC is almost nonfunctional whereas the power conversion efficiency (PCE) increases significantly when the working electrode is modified with TiO x . The performance of the cell could be further improved when the carbon black film was added on the counter electrode. The improved efficiency can be attributed to the inhibition of the mass recombination at the working electrode/electrolyte interface by TiO x and the acceleration of the electron transfer kinetics at the counter electrode by carbon black. The DSSC with a pair of carbon-based electrodes gives the PCE of 1.37%. (paper)

  5. DNA base dimers are stabilized by hydrogen-bonding interactions including non-Watson-Crick pairing near graphite surfaces.

    Science.gov (United States)

    Shankar, Akshaya; Jagota, Anand; Mittal, Jeetain

    2012-10-11

    Single- and double-stranded DNA are increasingly being paired with surfaces and nanoparticles for numerous applications, such as sensing, imaging, and drug delivery. Unlike the majority of DNA structures in bulk that are stabilized by canonical Watson-Crick pairing between Ade-Thy and Gua-Cyt, those adsorbed on surfaces are often stabilized by noncanonical base pairing, quartet formation, and base-surface stacking. Not much is known about these kinds of interactions. To build an understanding of the role of non-Watson-Crick pairing on DNA behavior near surfaces, one requires basic information on DNA base pair stacking and hydrogen-bonding interactions. All-atom molecular simulations of DNA bases in two cases--in bulk water and strongly adsorbed on a graphite surface--are conducted to study the relative strengths of stacking and hydrogen bond interactions for each of the 10 possible combinations of base pairs. The key information obtained from these simulations is the free energy as a function of distance between two bases in a pair. We find that stacking interactions exert the dominant influence on the stability of DNA base pairs in bulk water as expected. The strength of stability for these stacking interactions is found to decrease in the order Gua-Gua > Ade-Gua > Ade-Ade > Gua-Thy > Gua-Cyt > Ade-Thy > Ade-Cyt > Thy-Thy > Cyt-Thy > Cyt-Cyt. On the other hand, mutual interactions of surface-adsorbed base pairs are stabilized mostly by hydrogen-bonding interactions in the order Gua-Cyt > Ade-Gua > Ade-Thy > Ade-Ade > Cyt-Thy > Gua-Gua > Cyt-Cyt > Ade-Cyt > Thy-Thy > Gua-Thy. Interestingly, several non-Watson-Crick base pairings, which are commonly ignored, have similar stabilization free energies due to interbase hydrogen bonding as Watson-Crick pairs. This clearly highlights the importance of non-Watson-Crick base pairing in the development of secondary structures of oligonucleotides near surfaces.

  6. Classification of pseudo pairs between nucleotide bases and amino acids by analysis of nucleotide-protein complexes.

    Science.gov (United States)

    Kondo, Jiro; Westhof, Eric

    2011-10-01

    Nucleotide bases are recognized by amino acid residues in a variety of DNA/RNA binding and nucleotide binding proteins. In this study, a total of 446 crystal structures of nucleotide-protein complexes are analyzed manually and pseudo pairs together with single and bifurcated hydrogen bonds observed between bases and amino acids are classified and annotated. Only 5 of the 20 usual amino acid residues, Asn, Gln, Asp, Glu and Arg, are able to orient in a coplanar fashion in order to form pseudo pairs with nucleotide bases through two hydrogen bonds. The peptide backbone can also form pseudo pairs with nucleotide bases and presents a strong bias for binding to the adenine base. The Watson-Crick side of the nucleotide bases is the major interaction edge participating in such pseudo pairs. Pseudo pairs between the Watson-Crick edge of guanine and Asp are frequently observed. The Hoogsteen edge of the purine bases is a good discriminatory element in recognition of nucleotide bases by protein side chains through the pseudo pairing: the Hoogsteen edge of adenine is recognized by various amino acids while the Hoogsteen edge of guanine is only recognized by Arg. The sugar edge is rarely recognized by either the side-chain or peptide backbone of amino acid residues.

  7. Classification of pseudo pairs between nucleotide bases and amino acids by analysis of nucleotide–protein complexes

    Science.gov (United States)

    Kondo, Jiro; Westhof, Eric

    2011-01-01

    Nucleotide bases are recognized by amino acid residues in a variety of DNA/RNA binding and nucleotide binding proteins. In this study, a total of 446 crystal structures of nucleotide–protein complexes are analyzed manually and pseudo pairs together with single and bifurcated hydrogen bonds observed between bases and amino acids are classified and annotated. Only 5 of the 20 usual amino acid residues, Asn, Gln, Asp, Glu and Arg, are able to orient in a coplanar fashion in order to form pseudo pairs with nucleotide bases through two hydrogen bonds. The peptide backbone can also form pseudo pairs with nucleotide bases and presents a strong bias for binding to the adenine base. The Watson–Crick side of the nucleotide bases is the major interaction edge participating in such pseudo pairs. Pseudo pairs between the Watson–Crick edge of guanine and Asp are frequently observed. The Hoogsteen edge of the purine bases is a good discriminatory element in recognition of nucleotide bases by protein side chains through the pseudo pairing: the Hoogsteen edge of adenine is recognized by various amino acids while the Hoogsteen edge of guanine is only recognized by Arg. The sugar edge is rarely recognized by either the side-chain or peptide backbone of amino acid residues. PMID:21737431

  8. Retesting with the TRUE Test in a population-based twin cohort with hand eczema

    DEFF Research Database (Denmark)

    Lerbaek, Anne; Kyvik, Kirsten Ohm; Menné, Torkil

    2007-01-01

    Population-based studies on contact allergy with retesting of individuals are infrequently performed. Variable degrees of persistence are reported when individuals with contact allergy are retested with years in between. The patch test results of 270 individuals tested in 2005-2006 are presented ...

  9. Nucleic Acid Base Analog FRET-Pair Facilitating Detailed Structural Measurements in Nucleic Acid Containing Systems

    DEFF Research Database (Denmark)

    Börjesson, Karl; Preus, Søren; El-Sagheer, Afaf

    2009-01-01

    We present the first nucleobase analog fluorescence resonance energy transfer (FRET)-pair. The pair consists of tCO, 1,3-diaza-2-oxophenoxazine, as an energy donor and the newly developed tC(nitro), 7-nitro-1,3-diaza-2-oxophenothiazine, as an energy acceptor. The FRET-pair successfully monitors d...

  10. Prevalence and heritability of body dysmorphic symptoms in adolescents and young adults: a population-based nationwide twin study.

    Science.gov (United States)

    Enander, Jesper; Ivanov, Volen Z; Mataix-Cols, David; Kuja-Halkola, Ralf; Ljótsson, Brjánn; Lundström, Sebastian; Pérez-Vigil, Ana; Monzani, Benedetta; Lichtenstein, Paul; Rück, Christian

    2018-02-28

    Body dysmorphic disorder (BDD) usually begins during adolescence but little is known about the prevalence, etiology, and patterns of comorbidity in this age group. We investigated the prevalence of BDD symptoms in adolescents and young adults. We also report on the relative importance of genetic and environmental influences on BDD symptoms, and the risk for co-existing psychopathology. Prevalence of BDD symptoms was determined by a validated cut-off on the Dysmorphic Concerns Questionnaire (DCQ) in three population-based twin cohorts at ages 15 (n = 6968), 18 (n = 3738), and 20-28 (n = 4671). Heritability analysis was performed using univariate model-fitting for the DCQ. The risk for co-existing psychopathology was expressed as odds ratios (OR). The prevalence of clinically significant BDD symptoms was estimated to be between 1 and 2% in the different cohorts, with a significantly higher prevalence in females (1.3-3.3%) than in males (0.2-0.6%). The heritability of body dysmorphic concerns was estimated to be 49% (95% CI 38-54%) at age 15, 39% (95% CI 30-46) at age 18, and 37% (95% CI 29-42) at ages 20-28, with the remaining variance being due to non-shared environment. ORs for co-existing neuropsychiatric and alcohol-related problems ranged from 2.3 to 13.2. Clinically significant BDD symptoms are relatively common in adolescence and young adulthood, particularly in females. The low occurrence of BDD symptoms in adolescent boys may indicate sex differences in age of onset and/or etiological mechanisms. BDD symptoms are moderately heritable in young people and associated with an increased risk for co-existing neuropsychiatric and alcohol-related problems.

  11. Prevalence, comorbidity and heritability of hoarding symptoms in adolescence: a population based twin study in 15-year olds.

    Directory of Open Access Journals (Sweden)

    Volen Z Ivanov

    Full Text Available Hoarding Disorder (HD is often assumed to be an 'old age' problem, but many individuals diagnosed with HD retrospectively report first experiencing symptoms in childhood or adolescence. We examined the prevalence, comorbidity and etiology of hoarding symptoms in adolescence.To determine the presence of clinically significant hoarding symptoms, a population-based sample of 15-year old twins (N = 3,974 completed the Hoarding Rating Scale-Self Report. Co-occurring Obsessive Compulsive Disorder (OCD, Autism Spectrum Disorders (ASD and Attention Deficit Hyperactivity Disorder (ADHD were estimated from parental report. Model-fitting analyses divided hoarding symptom scores into additive genetic, shared, and non-shared environmental effects.The prevalence of clinically significant hoarding symptoms was 2% (95% CI 1.6-2.5%, with a significantly higher prevalence in girls than boys. Exclusion of the clutter criterion (as adolescents do not have control over their environment increased the prevalence rate to 3.7% (95% CI 3.1-4.3%. Excessive acquisition was reported by 30-40% among those with clinically significant hoarding symptoms. The prevalence of co-occurring OCD (2.9%, ASD (2.9% and ADHD (10.0% was comparable in hoarding and non-hoarding teenagers. Model-fitting analyses suggested that, in boys, additive genetic (32%; 95% CI 13-44% and non-shared environmental effects accounted for most of the variance. In contrast, among girls, shared and non-shared environmental effects explained most of the variance, while additive genetic factors played a negligible role.Hoarding symptoms are relatively prevalent in adolescents, particularly in girls, and cause distress and/or impairment. Hoarding was rarely associated with other common neurodevelopmental disorders, supporting its DSM-5 status as an independent diagnosis. The relative importance of genetic and shared environmental factors for hoarding differed across sexes. The findings are suggestive of

  12. Enhancement of Twins Fetal ECG Signal Extraction Based on Hybrid Blind Extraction Techniques

    Directory of Open Access Journals (Sweden)

    Ahmed Kareem Abdullah

    2017-07-01

    Full Text Available ECG machines are noninvasive system used to measure the heartbeat signal. It’s very important to monitor the fetus ECG signals during pregnancy to check the heat activity and to detect any problem early before born, therefore the monitoring of ECG signals have clinical significance and importance. For multi-fetal pregnancy case the classical filtering algorithms are not sufficient to separate the ECG signals between mother and fetal. In this paper the mixture consists of mixing from three ECG signals, the first signal is the mother ECG (M-ECG signal, second signal the Fetal-1 ECG (F1-ECG, and third signal is the Fetal-2 ECG (F2-ECG, these signals are extracted based on modified blind source extraction (BSE techniques. The proposed work based on hybridization between two BSE techniques to ensure that the extracted signals separated well. The results demonstrate that the proposed work very efficiently to extract the useful ECG signals

  13. Effect of base-pair inhomogeneities on charge transport along the DNA molecule, mediated by twist and radial polarons

    International Nuclear Information System (INIS)

    Palmero, F; Archilla, J F R; Hennig, D; Romero, F R

    2004-01-01

    Some recent results for a three-dimensional, semi-classical, tight-binding model for DNA show that there are two types of polarons, namely radial and twist polarons, which can transport charge along the DNA molecule. However, the existence of two types of base pairs in real DNA makes it crucial to find out if charge transport also exists in DNA chains with different base pairs. In this paper, we address this problem in its simple case, a homogeneous chain except for a single different base pair, which we call a base-pair inhomogeneity, and its effect on charge transport. Radial polarons experience either reflection or trapping. However, twist polarons are good candidates for charge transport along real DNA. This transport is also very robust with respect to weak parametric and diagonal disorder

  14. Design, realization and testing of an adsorption refrigerator based on activated carbon/ethanol working pair

    International Nuclear Information System (INIS)

    Frazzica, A.; Palomba, V.; Dawoud, B.; Gullì, G.; Brancato, V.; Sapienza, A.; Vasta, S.; Freni, A.; Costa, F.; Restuccia, G.

    2016-01-01

    Highlights: • Development of a lab-scale adsorption refrigerator. • Optimization of working pair and adsorber configuration through experimental activity. • Experimental testing of the prototype under real working boundary conditions. - Abstract: In the present paper design, realization and testing of a novel small scale adsorption refrigerator prototype based on activated carbon/ethanol working pair is described. Firstly, experimental activity has been carried out for identification of the best performing activated carbon available on the market, through the evaluation of the achievable thermodynamic performance both under air conditioning and refrigeration conditions. Once identified the best performing activated carbon, the design of the adsorber was developed by experimental dynamic performance analysis, carried out by means of the Gravimetric-Large Temperature Jump (G-LTJ) apparatus available at CNR ITAE lab. Finally, the whole 0.5 kW refrigerator prototype was designed and built. First experimental results both under reference air conditioning and refrigeration cycles have been reported, to check the achievable performance. High Specific Cooling Powers (SCPs), 95 W/kg and 50 W/kg, for air conditioning and refrigeration respectively, were obtained, while the COP ranged between 0.09 and 0.11, thus showing an improvement of the current state of the art.

  15. Grating-based x-ray differential phase contrast imaging with twin peaks in phase-stepping curves—phase retrieval and dewrapping

    Energy Technology Data Exchange (ETDEWEB)

    Yang, Yi; Xie, Huiqiao; Tang, Xiangyang, E-mail: xiangyang.tang@emory.edu [Imaging and Medical Physics, Department of Radiology and Imaging Sciences, Emory University School of Medicine, 1701 Uppergate Dr., C-5018, Atlanta, Georgia 30322 (United States); Cai, Weixing [Department of Radiation Oncology, Brigham and Women’s Hospital Harvard Medical School, 75 Francis Street, Boston, Massachusetts 02115 (United States); Mao, Hui [Laboratory of Functional and Molecular Imaging and Nanomedicine, Department of Radiology and Imaging Sciences, Emory University School of Medicine, 1841 Clifton Road NE, Atlanta, Georgia 30329 (United States)

    2016-06-15

    Purpose: X-ray differential phase contrast CT implemented with Talbot interferometry employs phase-stepping to extract information of x-ray attenuation, phase shift, and small-angle scattering. Since inaccuracy may exist in the absorption grating G{sub 2} due to an imperfect fabrication, the effective period of G{sub 2} can be as large as twice the nominal period, leading to a phenomenon of twin peaks that differ remarkably in their heights. In this work, the authors investigate how to retrieve and dewrap the phase signal from the phase-stepping curve (PSC) with the feature of twin peaks for x-ray phase contrast imaging. Methods: Based on the paraxial Fresnel–Kirchhoff theory, the analytical formulae to characterize the phenomenon of twin peaks in the PSC are derived. Then an approach to dewrap the retrieved phase signal by jointly using the phases of the first- and second-order Fourier components is proposed. Through an experimental investigation using a prototype x-ray phase contrast imaging system implemented with Talbot interferometry, the authors evaluate and verify the derived analytic formulae and the proposed approach for phase retrieval and dewrapping. Results: According to theoretical analysis, the twin-peak phenomenon in PSC is a consequence of combined effects, including the inaccuracy in absorption grating G{sub 2}, mismatch between phase grating and x-ray source spectrum, and finite size of x-ray tube’s focal spot. The proposed approach is experimentally evaluated by scanning a phantom consisting of organic materials and a lab mouse. The preliminary data show that compared to scanning G{sub 2} over only one single nominal period and correcting the measured phase signal with an intuitive phase dewrapping method that is being used in the field, stepping G{sub 2} over twice its nominal period and dewrapping the measured phase signal with the proposed approach can significantly improve the quality of x-ray differential phase contrast imaging in both

  16. Intragranular twinning, detwinning, and twinning-like lattice reorientation in magnesium alloys

    International Nuclear Information System (INIS)

    Wu, Wei; Gao, Yanfei; Li, Nan; Parish, Chad M.; Liu, Wenjun; Liaw, Peter K.; An, Ke

    2016-01-01

    Deformation twinning plays a critical role on improving metals or alloys ductility, especially for hexagonal close-packed materials with low symmetry crystal structure. A rolled Mg alloy was selected as a model system to investigate the extension twinning behaviors and characteristics of parent-twin interactions by nondestructive in situ 3D synchrotron X-ray microbeam diffraction. Besides twinning-detwinning process, the “twinning-like” lattice reorientation process was captured within an individual grain inside a bulk material during the strain reversal. The distributions of parent, twin, and reorientated grains and sub-micron level strain variation across the twin boundary are revealed. A theoretical calculation of the lattice strain confirms that the internal strain distribution in parent and twinned grains correlates with the experimental setup, grain orientation of parent, twin, and surrounding grains, as well as the strain path changes. The study suggests a novel deformation mechanism within the hexagonal close-packed structure that cannot be determined from surface-based characterization methods.

  17. A study of diabetes mellitus within a large sample of Australian twins

    DEFF Research Database (Denmark)

    Condon, Julianne; Shaw, Joanne E; Luciano, Michelle

    2008-01-01

    with type 2 diabetes (T2D), 41 female pairs with gestational diabetes (GD), 5 pairs with impaired glucose tolerance (IGT) and one pair with MODY. Heritabilities of T1D, T2D and GD were all high, but our samples did not have the power to detect effects of shared environment unless they were very large......Twin studies of diabetes mellitus can help elucidate genetic and environmental factors in etiology and can provide valuable biological samples for testing functional hypotheses, for example using expression and methylation studies of discordant pairs. We searched the volunteer Australian Twin...... Registry (19,387 pairs) for twins with diabetes using disease checklists from nine different surveys conducted from 1980-2000. After follow-up questionnaires to the twins and their doctors to confirm diagnoses, we eventually identified 46 pairs where one or both had type 1 diabetes (T1D), 113 pairs...

  18. Genetic and environmental contributions to pro-social attitudes: a twin study of social responsibility.

    Science.gov (United States)

    Rushton, J Philippe

    2004-12-22

    Although 51 twin and adoption studies have been performed on the genetic architecture of antisocial behaviour, only four previous studies have examined a genetic contribution to pro-social behaviour. Earlier work by the author with the University of London Institute of Psychiatry Adult Twin Register found that genes contributed approximately half of the variance to measures of self-report altruism, empathy, nurturance and aggression, including acts of violence. The present study extends those results by using a 22-item Social Responsibility Questionnaire with 174 pairs of monozygotic twins and 148 pairs of dizygotic twins. Forty-two per cent of the reliable variance was due to the twins' genes, 23% to the twins' common environment and the remainder to the twins' non-shared environment.

  19. Perinatal hepatic infarction in twin-twin transfusion.

    LENUS (Irish Health Repository)

    O'Sullivan, M J

    2012-02-03

    We report a case of a twin pregnancy which was complicated by a twin-twin transfusion in which the recipient twin was noted to have an intra-abdominal echogenic mass. This twin died at two days of age of hepatic infarction. The donor twin was healthy at birth, at thirty weeks\\' gestation, and did not have any subsequent problems. Fetal intra-abdominal echogenicity may be a marker of hepatic infarction.

  20. The Brazilian Twin Registry.

    Science.gov (United States)

    Ferreira, Paulo H; Oliveira, Vinicius C; Junqueira, Daniela R; Cisneros, Lígia C; Ferreira, Lucas C; Murphy, Kate; Ordoñana, Juan R; Hopper, John L; Teixeira-Salmela, Luci F

    2016-12-01

    The Brazilian Twin Registry (BTR) was established in 2013 and has impelled twin research in South America. The main aim of the initiative was to create a resource that would be accessible to the Brazilian scientific community as well as international researchers interested in the investigation of the contribution of genetic and environmental factors in the development of common diseases, phenotypes, and human behavior traits. The BTR is a joint effort between academic and governmental institutions from Brazil and Australia. The collaboration includes the Federal University of Minas Gerais (UFMG) in Brazil, the University of Sydney and University of Melbourne in Australia, the Australian Twin Registry, as well as the research foundations CNPq and CAPES in Brazil. The BTR is a member of the International Network of Twin Registries. Recruitment strategies used to register twins have been through participation in a longitudinal study investigating genetic and environmental factors for low back pain occurrence, and from a variety of sources including media campaigns and social networking. Currently, 291 twins are registered in the BTR, with data on demographics, zygosity, anthropometrics, and health history having been collected from 151 twins using a standardized self-reported questionnaire. Future BTR plans include the registration of thousands of Brazilian twins identified from different sources and collaborate nationally and internationally with other research groups interested on twin studies.

  1. Fingerprint Identification Using SIFT-Based Minutia Descriptors and Improved All Descriptor-Pair Matching

    Directory of Open Access Journals (Sweden)

    Jiuqiang Han

    2013-03-01

    Full Text Available The performance of conventional minutiae-based fingerprint authentication algorithms degrades significantly when dealing with low quality fingerprints with lots of cuts or scratches. A similar degradation of the minutiae-based algorithms is observed when small overlapping areas appear because of the quite narrow width of the sensors. Based on the detection of minutiae, Scale Invariant Feature Transformation (SIFT descriptors are employed to fulfill verification tasks in the above difficult scenarios. However, the original SIFT algorithm is not suitable for fingerprint because of: (1 the similar patterns of parallel ridges; and (2 high computational resource consumption. To enhance the efficiency and effectiveness of the algorithm for fingerprint verification, we propose a SIFT-based Minutia Descriptor (SMD to improve the SIFT algorithm through image processing, descriptor extraction and matcher. A two-step fast matcher, named improved All Descriptor-Pair Matching (iADM, is also proposed to implement the 1:N verifications in real-time. Fingerprint Identification using SMD and iADM (FISiA achieved a significant improvement with respect to accuracy in representative databases compared with the conventional minutiae-based method. The speed of FISiA also can meet real-time requirements.

  2. Theoretical studies on the intermolecular interactions of potentially primordial base-pair analogues

    Czech Academy of Sciences Publication Activity Database

    Šponer, Judit E.; Vázquez-Mayagoitia, Á.; Sumpter, B.G.; Leszczynski, J.; Šponer, Jiří; Otyepka, M.; Banáš, P.; Fuentes-Cabrera, M.

    2010-01-01

    Roč. 16, č. 10 (2010), s. 3057-3065 ISSN 0947-6539 R&D Projects: GA MŠk(CZ) LC06030; GA AV ČR(CZ) 1QS500040581; GA AV ČR(CZ) IAA400040802; GA ČR(CZ) GA203/09/1476 Grant - others:GA MŠk(CZ) LC512; GA AV ČR(CZ) IAA400550701; GA ČR(CZ) GD203/09/H046 Program:LC; IA; GD Institutional research plan: CEZ:AV0Z50040507; CEZ:AV0Z50040702 Keywords : quantum chemistry * base pairing * origin of life Subject RIV: BO - Biophysics Impact factor: 5.476, year: 2010

  3. High-speed true random number generation based on paired memristors for security electronics

    Science.gov (United States)

    Zhang, Teng; Yin, Minghui; Xu, Changmin; Lu, Xiayan; Sun, Xinhao; Yang, Yuchao; Huang, Ru

    2017-11-01

    True random number generator (TRNG) is a critical component in hardware security that is increasingly important in the era of mobile computing and internet of things. Here we demonstrate a TRNG using intrinsic variation of memristors as a natural source of entropy that is otherwise undesirable in most applications. The random bits were produced by cyclically switching a pair of tantalum oxide based memristors and comparing their resistance values in the off state, taking advantage of the more pronounced resistance variation compared with that in the on state. Using an alternating read scheme in the designed TRNG circuit, the unbiasedness of the random numbers was significantly improved, and the bitstream passed standard randomness tests. The Pt/TaO x /Ta memristors fabricated in this work have fast programming/erasing speeds of ˜30 ns, suggesting a high random number throughput. The approach proposed here thus holds great promise for physically-implemented random number generation.

  4. Atomic-scale Visualization of Electronic Nematicity and Cooper Pairing in Iron-based Superconductors

    Science.gov (United States)

    Allan, Milan P.

    2013-03-01

    The mechanism of high-temperature superconductivity in the relatively novel iron-based high-Tc superconductors is unresolved, both in terms of how the phases evolve with doping, and in terms of the actual Cooper pairing process. To explore these issues, we used spectroscopic-imaging scanning tunneling microscopy to study the electronic structure of CaFe2As2 in the antiferromagnetic-orthorhombic `parent' state from which the superconductivity emerges. We discovered and visualized the now widely studied electronic `nematicity' of this phase, whose suppression is associated with the emergence of superconductivity (Science 327, 181, 2010). As subsequent transport experiments discovered a related anisotropic conductance which increases with dopant concentration, the interplay between the electronic structure surrounding each dopant atom, quasiparticle scattering therefrom, and the transport nematicity has become a pivotal focus of research. We find that substituting Co for Fe atoms in underdoped Ca(Fe1-xCox)2As2 generates a dense population of identical and strongly anisotropic impurity states that are distributed randomly but aligned with the antiferromagnetic a-axis. We also demonstrate, by imaging their surrounding interference patterns, that these impurity states scatter quasiparticles and thus influence transport in a highly anisotropic manner (M.P. Allan et al., 2013). Next, we studied the momentum dependence of the energy gaps of iron-based superconductivity, now focusing on LiFeAs. If strong electron-electron interactions mediate the Cooper pairing, then momentum-space anisotropic superconducting energy gaps Δi (k) were predicted by multiple techniques to appear on the different electronic bands i. We introduced intraband Bogoliubov quasiparticle scattering interference (QPI) techniques for the determination of anisotropic energy gaps to test these hypotheses and discovered the anisotropy, magnitude, and relative orientations of the energy gaps on multiple

  5. Conjoined (Siamese) Twins in Zambia

    African Journals Online (AJOL)

    year-old Zambian multiparous mother gave birth to a set of twins with two heads ... (symmetric or mirror image) but one twin attached with an incomplete foetus is known as hetropagtrs. (asymmetrical). Thoracopagus twins (joined at the chest).

  6. Gray and white matter volume abnormalities in monozygotic and same-gender dizygotic twins discordant for schizophrenia

    DEFF Research Database (Denmark)

    Hilshoff, Hilleke E.; Brans, Rachel G. H.; van Haren, Neeltje E. M.

    2004-01-01

    BACKGROUND: Whole brain tissue volume decreases in schizophrenia have been related to both genetic risk factors and disease-related (possibly nongenetic) factors; however, whether genetic and environmental risk factors in the brains of patients with schizophrenia are differentially reflected...... in gray or white matter volume change is not known. METHODS: Magnetic resonance imaging (1.5 T) brain scans of 11 monozygotic and 11 same-gender dizygotic twin pairs discordant for schizophrenia were acquired and compared with 11 monozygotic and 11 same-gender dizygotic healthy control twin pairs. RESULTS......: Repeated-measures volume analysis of covariance revealed decreased whole brain volume in the patients with schizophrenia as compared with their co-twins and with healthy twin pairs. Decreased white matter volume was found in discordant twin pairs compared with healthy twin pairs, particularly...

  7. Model-based analysis of a twin-screw wet granulation system for continuous solid dosage manufacturing

    DEFF Research Database (Denmark)

    Kumar, Ashish; Vercruysse, Jurgen; Mortier, Severine T. F. C.

    2016-01-01

    Implementation of twin-screw granulation in a continuous from-powder-to-tablet manufacturing line requires process knowledge development. This is often pursued by application of mechanistic models incorporating the underlying mechanisms. In this study, granulation mechanisms considered to be domi......Implementation of twin-screw granulation in a continuous from-powder-to-tablet manufacturing line requires process knowledge development. This is often pursued by application of mechanistic models incorporating the underlying mechanisms. In this study, granulation mechanisms considered...... to be dominant in the kneading element regions of the granulator i.e., aggregation and breakage, were included in a one-dimensional population balance model. The model was calibrated using the experimentally determined inflow granule size distribution, and the mean residence time was used as additional input...

  8. Upgrades for TwinSol facility

    Energy Technology Data Exchange (ETDEWEB)

    O’Malley, P.D.; Bardayan, D.W.; Kolata, J.J.; Hall, M.R.; Hall, O.; Allen, J. [Physics Department, University of Notre Dame, Notre Dame, IN 46556 (United States); Becchetti, F.D. [Physics Department, U. Michigan, Ann Arbor MI 48109 (United States)

    2016-06-01

    TwinSol, a pair of coupled, superconducting solenoids, was one of the first devices capable of producing beams of radioactive nuclei at energies near the Coulomb barrier. A primary beam from University of Notre Dame (UND) tandem accelerator is used to bombard a primary target producing a secondary beam in flight. TwinSol is used to gather, separate, and focus the recoils. Since it was commissioned at the UND in 1997, at least 58 publications have reported data from its use and there have been hundreds of collaborators from many different countries that use this device. Currently, plans are in place at the UND to provide several upgrades to TwinSol, including a multi-cell gas production target and the possible addition of a third solenoid. Upgrades currently in progress will be discussed along with future plans.

  9. Time trends in the natural dizygotic twinning rate.

    Science.gov (United States)

    Derom, Catherine; Gielen, Marij; Peeters, Hilde; Frijns, Jean-Pierre; Zeegers, Maurice P A

    2011-08-01

    The natural dizygotic (DZ) twinning rate has been proposed as a reliable and useful measure of human fecundity, if adjusted for maternal age at twin birth. The aim of this study was to analyze age-adjusted trends in natural DZ twinning rates over the past 40 years using data from the 'East Flanders Prospective Twin Survey (EFPTS)'. This study involved 4835 naturally conceived twin pregnancies between 1969 and 2009 from the population-based Belgian 'EFPTS'. Age-adjusted trends in the incidence of natural DZ twin pregnancies were calculated using a generalized linear model with Poisson distribution. Both the natural DZ twinning rates and maternal age at twin birth increased in a linear fashion from 1969 to 2009. When age-adjusted, we found that the trend in the natural DZ twinning rate was stable during the whole time period. According to our population-based data and after age-adjustment, a stable natural DZ twinning rate could be observed over the last four decades. Under the assumption that the spontaneous DZ twinning rate is a sensor of fecundity, this indicates a stable 'high' fecundity for this population.

  10. Evaluation of Helkimo anamnestic and dysfunction index in identical twins

    Directory of Open Access Journals (Sweden)

    Kučević Esad H.

    2016-01-01

    Full Text Available Introduction: In 1974 Marti Helkimo designed special questionnaires which were used for entering adequate contemporary data collected by medical history, analyzing the functions of the orofacial system and analyzing occlusion. Data were evaluated numerically with 0, 1 or 5, depending on the severity of the relevant findings and severity of clinical signs or symptoms of dysfunction. Objective: The aim of the research was to establish and evaluate specially designed Helkimos anamnestic and dysfunction index in monozygotic twins. Materials and Methods: A longitudinal prospective study was carried out on a randomized sample of 30 pairs of twins, 20 to 40 years old, and of both sexes. Dedicated design of the questionnaire made it possible to calculate the Helkimos anamnestic index (Ai, based on subjective feeling and positive or negative answers of subjects about the state of their masticatory apparatus. The clinical dysfunction index (Di represents objective functional analysis of structural and functional disorders of the orofacial complex, because it monitors multiple parameters. Kinematics of the lower jaw, conditions and limited function of the temporomandibular joints, the presence or absence of painful sensations during mandible movements during palpation of the joints and masticatory muscles, and the overall quantification of the incidence of craniomandibular dysfunction were all monitored and evaluated. The study was conducted in accordance with the local and international laws and ethical standards. Results: Medical records of 47 (78.3% twins did not present the signs and symptoms of craniomandibular dysfunction, i.e., Ai = 0. Twelve respondents were aware of the existence of mild signs of craniomandibular disorders (CMD. Acute and expressed craniomandibular disorder was identified in one of the twins Ai II 1 (1.7%. By evaluating and analyzing the results obtained using Helkimo analysis, positive dysfunction index (Di> 0, or certain signs

  11. Childhood social class and cognitive aging in the Swedish Adoption/Twin Study of Aging.

    Science.gov (United States)

    Ericsson, Malin; Lundholm, Cecilia; Fors, Stefan; Dahl Aslan, Anna K; Zavala, Catalina; Reynolds, Chandra A; Pedersen, Nancy L

    2017-07-03

    In this report we analyzed genetically informative data to investigate within-person change and between-person differences in late-life cognitive abilities as a function of childhood social class. We used data from nine testing occasions spanning 28 y in the Swedish Adoption/Twin Study of Aging and parental social class based on the Swedish socioeconomic index. Cognitive ability included a general factor and the four domains of verbal, fluid, memory, and perceptual speed. Latent growth curve models of the longitudinal data tested whether level and change in cognitive performance differed as a function of childhood social class. Between-within twin-pair analyses were performed on twins reared apart to assess familial confounding. Childhood social class was significantly associated with mean-level cognitive performance at age 65 y, but not with rate of cognitive change. The association decreased in magnitude but remained significant after adjustments for level of education and the degree to which the rearing family was supportive toward education. A between-pair effect of childhood social class was significant in all cognitive domains, whereas within-pair estimates were attenuated, indicating genetic confounding. Thus, childhood social class is important for cognitive performance in adulthood on a population level, but the association is largely attributable to genetic influences.

  12. Attention problems and Attention-Deficit/Hyperactivity Disorder in discordant and concordant monozygotic twins: Evidence of environmental mediators.

    NARCIS (Netherlands)

    Lehn, H.; Derks, E.M.; Hudziak, J.; Heutink, P.; van Beijsterveldt, C.E.M.; Boomsma, D.I.

    2007-01-01

    OBJECTIVE: To study familial and nonfamilial environmental influences on attention problems and attention-deficit/hyperactivity disorder (ADHD) in monozygotic twins discordant and concordant-high and low for these traits. METHOD: Ninety-five twin pairs from The Netherlands Twin Register were

  13. Molecular analysis of the gut microbiota of identical twins with Crohn's disease.

    Science.gov (United States)

    Dicksved, Johan; Halfvarson, Jonas; Rosenquist, Magnus; Järnerot, Gunnar; Tysk, Curt; Apajalahti, Juha; Engstrand, Lars; Jansson, Janet K

    2008-07-01

    Increasing evidence suggests that a combination of host genetics and the composition of the gut microbiota are important for development of Crohn's disease (CD). Our aim was to study identical twins with CD to determine microbial factors independent of host genetics. Fecal samples were studied from 10 monozygotic twin pairs with CD (discordant n=6 and concordant n=4) and 8 healthy twin pairs. DNA was extracted, 16S rRNA genes were PCR amplified and T-RFLP fingerprints generated using general bacterial and Bacteroides group-specific primers. The microbial communities were also profiled based on their percentage G+C contents. Bacteroides 16S rRNA genes were cloned and sequenced from a subset of the samples. The bacterial diversity in each sample and similarity indices between samples were estimated based on the T-RFLP data using a combination of statistical approaches. Healthy individuals had a significantly higher bacterial diversity compared to individuals with CD. The fecal microbial communities were more similar between healthy twins than between twins with CD, especially when these were discordant for the disease. The microbial community profiles of individuals with ileal CD were significantly different from healthy individuals and those with colonic CD. Also, CD individuals had a lower relative abundance of B. uniformis and higher relative abundances of B. ovatus and B. vulgatus. Our results suggest that genetics and/or environmental exposure during childhood, in part, determine the gut microbial composition. However, CD is associated with dramatic changes in the gut microbiota and this was particularly evident for individuals with ileal CD.

  14. Molecular analysis of the gut microbiota of identical twins with Crohn's disease

    Energy Technology Data Exchange (ETDEWEB)

    Jansson, Janet; Dicksved, Johan; Halfvarson, Jonas; Rosenquist, Magnus; Jarnerot, Gunnar; Tysk, Curt; Apajalahti, Juha; Engstrand, Lars; Jansson, Janet K.

    2008-03-14

    Increasing evidence suggests that a combination of host genetics and the composition of the gut microbiota are important for development of Crohn's disease (CD). Our aim was to study identical twins with CD to determine microbial factors independently of host genetics. Fecal samples were studied from 10 monozygotic twin pairs with CD (discordant n=6, concordant n=4) and 8 healthy twin pairs. DNA was extracted, 16S rRNA genes were PCR amplified and T-RFLP fingerprints generated using general bacterial and Bacteroides group specific primers. The microbial communities were also profiled based on their % G+C contents. Bacteroides 16S rRNA genes were cloned and sequenced from a subset of the samples. The bacterial diversity in each sample and similarity indices between samples were estimated based on the T-RFLP data using a combination of statistical approaches. Healthy individuals had a significantly higher bacterial diversity compared to individuals with CD. The fecal microbial communities were more similar between healthy twins than between twins with CD, especially when these were discordant for the disease. The microbial community profiles of individuals with ileal CD were significantly different from healthy individuals and those with colonic CD. Also, CD individuals had a lower relative abundance of B. uniformis and higher relative abundances of B. ovatus and B. vulgatus. Our results suggest that genetics and/or environmental exposure during childhood in part determine the gut microbial composition. However, CD is associated with dramatic changes in the gut microbiota and this was particularly evident for individuals with ileal CD.

  15. Current Hormonal Contraceptive Use Predicts Female Extra-Pair and Dyadic Sexual Behavior: Evidence Based on Czech National Survey Data

    Directory of Open Access Journals (Sweden)

    Kateřina Klapilová

    2014-01-01

    Full Text Available Data from 1155 Czech women (493 using oral contraception, 662 non-users, obtained from the Czech National Survey of Sexual Behavior, were used to investigate evolutionary-based hypotheses concerning the predictive value of current oral contraceptive (OC use on extra-pair and dyadic (in-pair sexual behavior of coupled women. Specifically, the aim was to determine whether current OC use was associated with lower extra-pair and higher in-pair sexual interest and behavior, because OC use suppresses cyclical shifts in mating psychology that occur in normally cycling women. Zero-inflated Poisson (ZIP regression and negative binomial models were used to test associations between OC use and these sexual measures, controlling for other relevant predictors (e.g., age, parity, in-pair sexual satisfaction, relationship length. The overall incidence of having had an extra-pair partner or one-night stand in the previous year was not related to current OC use (the majority of the sample had not. However, among the women who had engaged in extra-pair sexual behavior, OC users had fewer one-night stands than non-users, and tended to have fewer partners, than non-users. OC users also had more frequent dyadic intercourse than non-users, potentially indicating higher commitment to their current relationship. These results suggest that suppression of fertility through OC use may alter important aspects of female sexual behavior, with potential implications for relationship functioning and stability.

  16. Evidence for shared genetic risk between ADHD symptoms and reduced mathematics ability: a twin study.

    Science.gov (United States)

    Greven, Corina U; Kovas, Yulia; Willcutt, Erik G; Petrill, Stephen A; Plomin, Robert

    2014-01-01

    Attention-deficit/hyperactivity disorder (ADHD) symptoms and mathematics ability are associated, but little is known about the genetic and environmental influences underlying this association. Data came from more than 6,000 twelve-year-old twin pairs from the UK population-representative Twins Early Development Study. Parents rated each twin's behaviour using a DSM-IV-based 18-item questionnaire of inattentive and hyperactive-impulsive ADHD symptoms. Mathematics tests based on the UK National Curriculum were completed by each twin. The twins also completed standardised tests of reading and general cognitive ability. Multivariate twin model fitting was applied. Inattentive and hyperactive-impulsive ADHD symptoms were highly heritable (67% and 73% respectively). Mathematics ability was moderately heritable (46%). Mathematics ability and inattentiveness showed a significantly greater phenotypic correlation (r(p) = -.26) and genetic correlation (r(A) = -.41) than mathematics ability and hyperactivity-impulsivity (r(p) = -.18; r(A) = -.22). The genetic correlation between inattentiveness and mathematics ability was largely independent from hyperactivity-impulsivity, and was only partially accounted for by genetic influences related to reading and general cognitive ability. Results revealed the novel finding that mathematics ability shows significantly stronger phenotypic and genetic associations with inattentiveness than with hyperactivity-impulsivity. Genetic associations between inattentiveness and mathematics ability could only partially be accounted for by hyperactivity-impulsivity, reading and general cognitive ability. Results suggest that mathematics ability is associated with ADHD symptoms largely because it shares genetic risk factors with inattentiveness, and provide further evidence for considering inattentiveness and hyperactivity-impulsivity separately. DNA markers for ADHD symptoms (especially inattentiveness) may also be candidate risk factors for

  17. The genetic basis for cognitive ability, memory, and depression symptomatology in middle-aged and elderly chinese twins

    DEFF Research Database (Denmark)

    Xu, Chunsheng; Sun, Jianping; Ji, Fuling

    2015-01-01

    The genetic influences on aging-related phenotypes, including cognition and depression, have been well confirmed in the Western populations. We performed the first twin-based analysis on cognitive performance, memory and depression status in middle-aged and elderly Chinese twins, representing...... the world's largest and most rapidly aging population. The sample consisted of 384 twin pairs with a median age of 50 years. Cognitive function was measured using the Montreal Cognitive Assessment (MoCA) scale; memory was assessed using the revised Wechsler Adult Intelligence scale; depression...... with heritability 0.44 for cognition and 0.56 for memory. Multivariate analysis by the reduced Cholesky model estimated significant genetic (rG = 0.69) and unique environmental (rE = 0.25) correlation between cognitive ability and memory. The model also estimated weak but significant inverse genetic correlation...

  18. Bio-activity of aminosulfonyl ureas in the light of nucleic acid bases and DNA base pair interaction.

    Science.gov (United States)

    Mondal Roy, Sutapa

    2018-08-01

    The quantum chemical descriptors based on density functional theory (DFT) are applied to predict the biological activity (log IC 50 ) of one class of acyl-CoA: cholesterol O-acyltransferase (ACAT) inhibitors, viz. aminosulfonyl ureas. ACAT are very effective agents for reduction of triglyceride and cholesterol levels in human body. Successful two parameter quantitative structure-activity relationship (QSAR) models are developed with a combination of relevant global and local DFT based descriptors for prediction of biological activity of aminosulfonyl ureas. The global descriptors, electron affinity of the ACAT inhibitors (EA) and/or charge transfer (ΔN) between inhibitors and model biosystems (NA bases and DNA base pairs) along with the local group atomic charge on sulfonyl moiety (∑Q Sul ) of the inhibitors reveals more than 90% efficacy of the selected descriptors for predicting the experimental log (IC 50 ) values. Copyright © 2018 Elsevier Ltd. All rights reserved.

  19. Genetic and environmental influences on dimensional representations of DSM-IV cluster C personality disorders: a population-based multivariate twin study.

    Science.gov (United States)

    Reichborn-Kjennerud, Ted; Czajkowski, Nikolai; Neale, Michael C; Ørstavik, Ragnhild E; Torgersen, Svenn; Tambs, Kristian; Røysamb, Espen; Harris, Jennifer R; Kendler, Kenneth S

    2007-05-01

    The DSM-IV cluster C Axis II disorders include avoidant (AVPD), dependent (DEPD) and obsessive-compulsive (OCPD) personality disorders. We aimed to estimate the genetic and environmental influences on dimensional representations of these disorders and examine the validity of the cluster C construct by determining to what extent common familial factors influence the individual PDs. PDs were assessed using the Structured Interview for DSM-IV Personality (SIDP-IV) in a sample of 1386 young adult twin pairs from the Norwegian Institute of Public Health Twin Panel (NIPHTP). A single-factor independent pathway multivariate model was applied to the number of endorsed criteria for the three cluster C disorders, using the statistical modeling program Mx. The best-fitting model included genetic and unique environmental factors only, and equated parameters for males and females. Heritability ranged from 27% to 35%. The proportion of genetic variance explained by a common factor was 83, 48 and 15% respectively for AVPD, DEPD and OCPD. Common genetic and environmental factors accounted for 54% and 64% respectively of the variance in AVPD and DEPD but only 11% of the variance in OCPD. Cluster C PDs are moderately heritable. No evidence was found for shared environmental or sex effects. Common genetic and individual environmental factors account for a substantial proportion of the variance in AVPD and DEPD. However, OCPD appears to be largely etiologically distinct from the other two PDs. The results do not support the validity of the DSM-IV cluster C construct in its present form.

  20. Monozygotic twins discordant for ROHHAD phenotype.

    Science.gov (United States)

    Patwari, Pallavi P; Rand, Casey M; Berry-Kravis, Elizabeth M; Ize-Ludlow, Diego; Weese-Mayer, Debra E

    2011-09-01

    Rapid-onset obesity with hypothalamic dysfunction, hypoventilation, and autonomic dysregulation (ROHHAD) falls within a group of pediatric disorders with both respiratory control and autonomic nervous system dysregulation. Children with ROHHAD typically present after 1.5 years of age with rapid weight gain as the initial sign. Subsequently, they develop alveolar hypoventilation, autonomic nervous system dysregulation, and, if untreated, cardiorespiratory arrest. To our knowledge, this is the first report of discordant presentation of ROHHAD in monozygotic twins. Twin girls, born at term, had concordant growth and development until 8 years of age. From 8 to 12 years of age, the affected twin developed features characteristic of ROHHAD including obesity, alveolar hypoventilation, scoliosis, hypothalamic dysfunction (central diabetes insipidus, hypothyroidism, premature pubarche, and growth hormone deficiency), right paraspinal/thoracic ganglioneuroblastoma, seizures, and autonomic dysregulation including altered pain perception, large and sluggishly reactive pupils, hypothermia, and profound bradycardia that required a cardiac pacemaker. Results of genetic testing for PHOX2B (congenital central hypoventilation syndrome disease-defining gene) mutations were negative. With early recognition and conservative management, the affected twin had excellent neurocognitive outcome that matched that of the unaffected twin. The unaffected twin demonstrated rapid weight gain later in age but not development of signs/symptoms consistent with ROHHAD. This discordant twin pair demonstrates key features of ROHHAD including the importance of early recognition (especially hypoventilation), complexity of signs/symptoms and clinical course, and importance of initiating comprehensive, multispecialty care. These cases confound the hypothesis of a monogenic etiology for ROHHAD and indicate alternative etiologies including autoimmune or epigenetic phenomenon or a combination of genetic

  1. Differences in genetic and environmental variation in adult BMI by sex, age, time period, and region: an individual-based pooled analysis of 40 twin cohorts.

    Science.gov (United States)

    Silventoinen, Karri; Jelenkovic, Aline; Sund, Reijo; Yokoyama, Yoshie; Hur, Yoon-Mi; Cozen, Wendy; Hwang, Amie E; Mack, Thomas M; Honda, Chika; Inui, Fujio; Iwatani, Yoshinori; Watanabe, Mikio; Tomizawa, Rie; Pietiläinen, Kirsi H; Rissanen, Aila; Siribaddana, Sisira H; Hotopf, Matthew; Sumathipala, Athula; Rijsdijk, Fruhling; Tan, Qihua; Zhang, Dongfeng; Pang, Zengchang; Piirtola, Maarit; Aaltonen, Sari; Öncel, Sevgi Y; Aliev, Fazil; Rebato, Esther; Hjelmborg, Jacob B; Christensen, Kaare; Skytthe, Axel; Kyvik, Kirsten O; Silberg, Judy L; Eaves, Lindon J; Cutler, Tessa L; Ordoñana, Juan R; Sánchez-Romera, Juan F; Colodro-Conde, Lucia; Song, Yun-Mi; Yang, Sarah; Lee, Kayoung; Franz, Carol E; Kremen, William S; Lyons, Michael J; Busjahn, Andreas; Nelson, Tracy L; Whitfield, Keith E; Kandler, Christian; Jang, Kerry L; Gatz, Margaret; Butler, David A; Stazi, Maria A; Fagnani, Corrado; D'Ippolito, Cristina; Duncan, Glen E; Buchwald, Dedra; Martin, Nicholas G; Medland, Sarah E; Montgomery, Grant W; Jeong, Hoe-Uk; Swan, Gary E; Krasnow, Ruth; Magnusson, Patrik Ke; Pedersen, Nancy L; Dahl Aslan, Anna K; McAdams, Tom A; Eley, Thalia C; Gregory, Alice M; Tynelius, Per; Baker, Laura A; Tuvblad, Catherine; Bayasgalan, Gombojav; Narandalai, Danshiitsoodol; Spector, Timothy D; Mangino, Massimo; Lachance, Genevieve; Burt, S Alexandra; Klump, Kelly L; Harris, Jennifer R; Brandt, Ingunn; Nilsen, Thomas S; Krueger, Robert F; McGue, Matt; Pahlen, Shandell; Corley, Robin P; Huibregtse, Brooke M; Bartels, Meike; van Beijsterveldt, Catharina Em; Willemsen, Gonneke; Goldberg, Jack H; Rasmussen, Finn; Tarnoki, Adam D; Tarnoki, David L; Derom, Catherine A; Vlietinck, Robert F; Loos, Ruth Jf; Hopper, John L; Sung, Joohon; Maes, Hermine H; Turkheimer, Eric; Boomsma, Dorret I; Sørensen, Thorkild Ia; Kaprio, Jaakko

    2017-08-01

    Background: Genes and the environment contribute to variation in adult body mass index [BMI (in kg/m 2 )], but factors modifying these variance components are poorly understood. Objective: We analyzed genetic and environmental variation in BMI between men and women from young adulthood to old age from the 1940s to the 2000s and between cultural-geographic regions representing high (North America and Australia), moderate (Europe), and low (East Asia) prevalence of obesity. Design: We used genetic structural equation modeling to analyze BMI in twins ≥20 y of age from 40 cohorts representing 20 countries (140,379 complete twin pairs). Results: The heritability of BMI decreased from 0.77 (95% CI: 0.77, 0.78) and 0.75 (95% CI: 0.74, 0.75) in men and women 20-29 y of age to 0.57 (95% CI: 0.54, 0.60) and 0.59 (95% CI: 0.53, 0.65) in men 70-79 y of age and women 80 y of age, respectively. The relative influence of unique environmental factors correspondingly increased. Differences in the sets of genes affecting BMI in men and women increased from 20-29 to 60-69 y of age. Mean BMI and variances in BMI increased from the 1940s to the 2000s and were greatest in North America and Australia, followed by Europe and East Asia. However, heritability estimates were largely similar over measurement years and between regions. There was no evidence of environmental factors shared by co-twins affecting BMI. Conclusions: The heritability of BMI decreased and differences in the sets of genes affecting BMI in men and women increased from young adulthood to old age. The heritability of BMI was largely similar between cultural-geographic regions and measurement years, despite large differences in mean BMI and variances in BMI. Our results show a strong influence of genetic factors on BMI, especially in early adulthood, regardless of the obesity level in the population. © 2017 American Society for Nutrition.

  2. Twinning in muskox and the cytogenetic investigation of a freemartin

    Directory of Open Access Journals (Sweden)

    N. J. Reindl

    1993-12-01

    Full Text Available The occurrence of twinning has been documented for muskox in both wild and captive populations. Of two known captive twin births only one set survived beyond 120 days. In both cases the twins were male-female pairs and both females showed abnormal sexual development. Two sets of stillborn twins have also been recorded. All four stillborn fetuses were female and none showed anomalies of the reproductive tract upon post-mortem examination. Blood cultures from the surviving male and female twins revealed that both were chimeric, indicating the admixture of fetal blood. Fibroblast cultures were normal for the respective sex of each individual. The freemartin heifer had anatomical abnormalities of the clitoris as well as the secondary sex characteristics of a male.

  3. Simulation-based investigation of the paired-gear method in cod-end selectivity studies

    DEFF Research Database (Denmark)

    Herrmann, Bent; Frandsen, Rikke; Holst, René

    2007-01-01

    In this paper, the paired-gear and covered cod-end methods for estimating the selectivity of trawl cod-ends are compared. A modified version of the cod-end selectivity simulator PRESEMO is used to simulate the data that would be collected from a paired-gear experiment where the test cod-end also ...

  4. Characterization of Gastric Microbiota in Twins.

    Science.gov (United States)

    Dong, Quanjiang; Xin, Yongning; Wang, Lili; Meng, Xinying; Yu, Xinjuan; Lu, Linlin; Xuan, Shiying

    2017-02-01

    Contribution of host genetic backgrounds in the development of gastric microbiota has not been clearly defined. This study was aimed to characterize the biodiversity, structure and composition of gastric microbiota among twins. A total of four pairs of twins and eight unrelated individuals were enrolled in the study. Antral biopsies were obtained during endoscopy. The bacterial 16S rRNA gene was amplified and pyrosequenced. Sequences were analyzed for the composition, structure, and α and β diversities of gastric microbiota. Proteobacteria, Firmicutes, Bacteroidetes, Actinobacteria, and Fusobacteria were the most predominant phyla of gastric microbiota. Each individual, twins as well as unrelated individuals, harbored a microbiota of distinct composition. There was no evidence of additional similarity in the richness and evenness of gastric microbiota among co-twins as compared to unrelated individuals. Calculations of θ YC and PCoA demonstrated that the structure similarity of gastric microbial community between co-twins did not increase compared to unrelated individuals. In contrast, the structure of microbiota was altered enormously by Helicobacter pylori infection. These results suggest that host genetic backgrounds had little effect in shaping the gastric microbiota. This property of gastric microbiota could facilitate the studies discerning the role of microbiota from genetic grounds in the pathogenesis.

  5. Separation surgery for total vertical craniopagus twins.

    Science.gov (United States)

    Goh, Keith Y C

    2004-08-01

    A pair of conjoined twins aged 11 months underwent investigations, followed by surgical separation in Singapore General Hospital in April 2001. They were joined at the skull vertex and facing in opposite directions. Radiological investigations including cerebral angiography, magnetic resonance imaging and computerized tomographic scans were performed, leading to the diagnosis of total vertical craniopagus. There were two separate brains, with separate arterial circulations, but with a common superior sagittal sinus. Tissue expanders were inserted in the subgaleal space for 6 months of scalp expansion prior to surgery. Pre-operative planning involved the use of virtual reality equipment and life-sized polymer models of the conjoined skulls and brains. Surgical separation of the twins was achieved after approximately 100 h of operating time, using intraoperative image guidance, microsurgical techniques and intraoperative neurophysiologic monitoring. Reconstruction of the dura, calvarium and scalp was performed with artificial dura, absorbable plates and split skin grafts. Postoperative complications included focal cortical infarction, meningitis, and hydrocephalus. Despite these complications, the twins recovered satisfactorily and were discharged to their home country within 6 months. The 3-month outcome was minor disability in one twin and severe developmental delays in the other. Separation surgery is possible for complex cranially-conjoined twins but requires detailed planning and extensive surgical management.

  6. Surprising conformers of the biologically important A·T DNA base pairs: QM/QTAIM proofs

    Science.gov (United States)

    Brovarets', Ol'ha O.; Tsiupa, Kostiantyn S.; Hovorun, Dmytro M.

    2018-02-01

    For the first time novel high-energy conformers – A·T(wWC) (5.36), A·T(wrWC) (5.97), A·T(wH) (5.78) and A·T(wrH) (ΔG=5.82 kcal•mol-1) were revealed for each of the four biologically important A·T(WC) DNA base pairs – Watson-Crick A·T(WC), reverse Watson-Crick A·T(rWC), Hoogsteen A·T(H) and reverse Hoogsteen A·T(rH) at the MP2/aug-cc-pVDZ//B3LYP/6-311++G(d,p) level of quantum-mechanical theory in the continuum with ɛ=4 under normal conditions. Each of these conformers possesses substantially non-planar wobble (w) structure and is stabilized by the participation of the two anti-parallel N6H/N6H'…O4/O2 and N3H…N6 H-bonds, involving the pyramidalized amino group of the A DNA base as an acceptor and a donor of the H-bonding. The transition states – TSA·T(WC)↔A·T(wWC), TSA·T(rWC)↔A·T(wrWC), TSA·T(H)↔A·T(wH) and TSA·T(rH)↔A·T(wrH), controlling the dipole-active transformations of the conformers from the main plane-symmetric state into the high-energy, significantly non-planar state and vice versa, were localized. They also possess wobble structures similarly to the high-energy conformers and are stabilized by the participation of the N6H/N6H'…O4/O2 and N3H…N6 H-bonds. Discovered conformers of the A·T DNA base pairs are dynamically stable short-lived structures (lifetime τ = (1.4-3.9) ps). Their possible biological significance and future perspectives have been briefly discussed.

  7. Surprising Conformers of the Biologically Important A·T DNA Base Pairs: QM/QTAIM Proofs

    Directory of Open Access Journals (Sweden)

    Ol'ha O. Brovarets'

    2018-02-01

    Full Text Available For the first time novel high-energy conformers–A·T(wWC (5.36, A·T(wrWC (5.97, A·T(wH (5.78, and A·T(wrH (ΔG = 5.82 kcal·mol−1 (See Graphical Abstract were revealed for each of the four biologically important A·T DNA base pairs – Watson-Crick A·T(WC, reverse Watson-Crick A·T(rWC, Hoogsteen A·T(H and reverse Hoogsteen A·T(rH at the MP2/aug-cc-pVDZ//B3LYP/6-311++G(d,p level of quantum-mechanical theory in the continuum with ε = 4 under normal conditions. Each of these conformers possesses substantially non-planar wobble (w structure and is stabilized by the participation of the two anti-parallel N6H/N6H′…O4/O2 and N3H…N6 H-bonds, involving the pyramidalized amino group of the A DNA base as an acceptor and a donor of the H-bonding. The transition states – TSA·T(WC↔A·T(wWC, TSA·T(rWC↔A·T(wrWC, TSA·T(H↔A·T(wH, and TSA·T(rH↔A·T(wrH, controlling the dipole-active transformations of the conformers from the main plane-symmetric state into the high-energy, significantly non-planar state and vice versa, were localized. They also possess wobble structures similarly to the high-energy conformers and are stabilized by the participation of the N6H/N6H′…O4/O2 and N3H…N6 H-bonds. Discovered conformers of the A·T DNA base pairs are dynamically stable short-lived structures [lifetime τ = (1.4–3.9 ps]. Their possible biological significance and future perspectives have been briefly discussed.

  8. Studies of base pair sequence effects on DNA solvation based on all

    Indian Academy of Sciences (India)

    Detailed analyses of the sequence-dependent solvation and ion atmosphere of DNA are presented based on molecular dynamics (MD) simulations on all the 136 unique tetranucleotide steps obtained by the ABC consortium using the AMBER suite of programs. Significant sequence effects on solvation and ion localization ...

  9. RNAHelix: computational modeling of nucleic acid structures with Watson-Crick and non-canonical base pairs.

    Science.gov (United States)

    Bhattacharyya, Dhananjay; Halder, Sukanya; Basu, Sankar; Mukherjee, Debasish; Kumar, Prasun; Bansal, Manju

    2017-02-01

    Comprehensive analyses of structural features of non-canonical base pairs within a nucleic acid double helix are limited by the availability of a small number of three dimensional structures. Therefore, a procedure for model building of double helices containing any given nucleotide sequence and base pairing information, either canonical or non-canonical, is seriously needed. Here we describe a program RNAHelix, which is an updated version of our widely used software, NUCGEN. The program can regenerate duplexes using the dinucleotide step and base pair orientation parameters for a given double helical DNA or RNA sequence with defined Watson-Crick or non-Watson-Crick base pairs. The original structure and the corresponding regenerated structure of double helices were found to be very close, as indicated by the small RMSD values between positions of the corresponding atoms. Structures of several usual and unusual double helices have been regenerated and compared with their original structures in terms of base pair RMSD, torsion angles and electrostatic potentials and very high agreements have been noted. RNAHelix can also be used to generate a structure with a sequence completely different from an experimentally determined one or to introduce single to multiple mutation, but with the same set of parameters and hence can also be an important tool in homology modeling and study of mutation induced structural changes.

  10. Graph-based surface reconstruction from stereo pairs using image segmentation

    Science.gov (United States)

    Bleyer, Michael; Gelautz, Margrit

    2005-01-01

    This paper describes a novel stereo matching algorithm for epipolar rectified images. The method applies colour segmentation on the reference image. The use of segmentation makes the algorithm capable of handling large untextured regions, estimating precise depth boundaries and propagating disparity information to occluded regions, which are challenging tasks for conventional stereo methods. We model disparity inside a segment by a planar equation. Initial disparity segments are clustered to form a set of disparity layers, which are planar surfaces that are likely to occur in the scene. Assignments of segments to disparity layers are then derived by minimization of a global cost function via a robust optimization technique that employs graph cuts. The cost function is defined on the pixel level, as well as on the segment level. While the pixel level measures the data similarity based on the current disparity map and detects occlusions symmetrically in both views, the segment level propagates the segmentation information and incorporates a smoothness term. New planar models are then generated based on the disparity layers' spatial extents. Results obtained for benchmark and self-recorded image pairs indicate that the proposed method is able to compete with the best-performing state-of-the-art algorithms.

  11. A Novel Clustering Model Based on Set Pair Analysis for the Energy Consumption Forecast in China

    Directory of Open Access Journals (Sweden)

    Mingwu Wang

    2014-01-01

    Full Text Available The energy consumption forecast is important for the decision-making of national economic and energy policies. But it is a complex and uncertainty system problem affected by the outer environment and various uncertainty factors. Herein, a novel clustering model based on set pair analysis (SPA was introduced to analyze and predict energy consumption. The annual dynamic relative indicator (DRI of historical energy consumption was adopted to conduct a cluster analysis with Fisher’s optimal partition method. Combined with indicator weights, group centroids of DRIs for influence factors were transferred into aggregating connection numbers in order to interpret uncertainty by identity-discrepancy-contrary (IDC analysis. Moreover, a forecasting model based on similarity to group centroid was discussed to forecast energy consumption of a certain year on the basis of measured values of influence factors. Finally, a case study predicting China’s future energy consumption as well as comparison with the grey method was conducted to confirm the reliability and validity of the model. The results indicate that the method presented here is more feasible and easier to use and can interpret certainty and uncertainty of development speed of energy consumption and influence factors as a whole.

  12. Pairing symmetries of several iron-based superconductor families and some similarities with cuprates and heavy-fermions

    Directory of Open Access Journals (Sweden)

    Das Tanmoy

    2012-03-01

    Full Text Available We show that, by using the unit-cell transformation between 1 Fe per unit cell to 2 Fe per unit cell, one can qualitatively understand the pairing symmetry of several families of iron-based superconductors. In iron-pnictides and iron-chalcogenides, the nodeless s±-pairing and the resulting magnetic resonance mode transform nicely between the two unit cells, while retaining all physical properties unchanged. However, when the electron-pocket disappears from the Fermi surface with complete doping in KFe2As2, we find that the unit-cell invariant requirement prohibits the occurrence of s±-pairing symmetry (caused by inter-hole-pocket nesting. However, the intra-pocket nesting is compatible here, which leads to a nodal d-wave pairing. The corresponding Fermi surface topology and the pairing symmetry are similar to Ce-based heavy-fermion superconductors. Furthermore, when the Fermi surface hosts only electron-pockets in KyFe2-xSe2, the inter-electron-pocket nesting induces a nodeless and isotropic d-wave pairing. This situation is analogous to the electron-doped cuprates, where the strong antiferromagnetic order creates similar disconnected electron-pocket Fermi surface, and hence nodeless d-wave pairing appears. The unit-cell transformation in KyFe2-xSe2 exhibits that the d-wave pairing breaks the translational symmetry of the 2 Fe unit cell, and thus cannot be realized unless a vacancy ordering forms to compensate for it. These results are consistent with the coexistence picture of a competing order and nodeless d-wave superconductivity in both cuprates and KyFe1.6Se2.

  13. Secular trends in gestational age and birthweight in twins.

    Science.gov (United States)

    Gielen, M; van Beijsterveldt, C E M; Derom, C; Vlietinck, R; Nijhuis, J G; Zeegers, M P A; Boomsma, D I

    2010-09-01

    In recent decades, the overall rate of preterm births has increased. The aim of the present study was to examine whether this trend is also seen for multiple gestations. More specifically, we examined if there has been a decrease in gestational age for live born monozygotic (MZ) and dizygotic (DZ) twins and if there has been a simultaneous change in birthweight. The contributions of fertility treatments and Caesarean sections were taken into consideration. All analyses were carried out in two large European twin cohorts. Cross-sectional study of 6310 live born twin pairs, born between 1964-2007, from the Belgian East Flanders Prospective Twin Survey and 14,712 twin pairs, born between 1990-2006, from the Netherlands Twin Register. Multiple regression analyses were performed with gestational age as outcome variable, and multilevel analysis with birthweight as outcome variable. All analyses were performed with and without adjustment for zygosity, parity, maternal age, mode of conception and delivery and, for the analyses of birthweight, gestational age. Gestational age decreased in a linear fashion from 1964 to 2007 with a decrease of 0.25 days per year in a similar way for MZ and DZ twins. Changes in birthweight depended on gestational age: up to 32 weeks, birthweight decreased and after 32 weeks birthweight increased. The frequency of infertility treatment and Caesarean sections, primiparity and advanced maternal age increased over the years, but none of these factors influenced the secular trends in gestational age and birthweight. The decrease in gestational age and change in birthweight in twins are sources of concern, especially for very preterm twins, for whom birthweight decreased. For twins born after 32 weeks, an increase in birthweight was observed and this is very likely the explanation for the decrease in gestational age.

  14. Does the sex of one's co-twin affect height and BMI in adulthood? A study of dizygotic adult twins from 31 cohorts.

    Science.gov (United States)

    Bogl, Leonie H; Jelenkovic, Aline; Vuoksimaa, Eero; Ahrenfeldt, Linda; Pietiläinen, Kirsi H; Stazi, Maria A; Fagnani, Corrado; D'Ippolito, Cristina; Hur, Yoon-Mi; Jeong, Hoe-Uk; Silberg, Judy L; Eaves, Lindon J; Maes, Hermine H; Bayasgalan, Gombojav; Narandalai, Danshiitsoodol; Cutler, Tessa L; Kandler, Christian; Jang, Kerry L; Christensen, Kaare; Skytthe, Axel; Kyvik, Kirsten O; Cozen, Wendy; Hwang, Amie E; Mack, Thomas M; Derom, Catherine A; Vlietinck, Robert F; Nelson, Tracy L; Whitfield, Keith E; Corley, Robin P; Huibregtse, Brooke M; McAdams, Tom A; Eley, Thalia C; Gregory, Alice M; Krueger, Robert F; McGue, Matt; Pahlen, Shandell; Willemsen, Gonneke; Bartels, Meike; van Beijsterveldt, Toos C E M; Pang, Zengchang; Tan, Qihua; Zhang, Dongfeng; Martin, Nicholas G; Medland, Sarah E; Montgomery, Grant W; Hjelmborg, Jacob V B; Rebato, Esther; Swan, Gary E; Krasnow, Ruth; Busjahn, Andreas; Lichtenstein, Paul; Öncel, Sevgi Y; Aliev, Fazil; Baker, Laura A; Tuvblad, Catherine; Siribaddana, Sisira H; Hotopf, Matthew; Sumathipala, Athula; Rijsdijk, Fruhling; Magnusson, Patrik K E; Pedersen, Nancy L; Aslan, Anna K Dahl; Ordoñana, Juan R; Sánchez-Romera, Juan F; Colodro-Conde, Lucia; Duncan, Glen E; Buchwald, Dedra; Tarnoki, Adam D; Tarnoki, David L; Yokoyama, Yoshie; Hopper, John L; Loos, Ruth J F; Boomsma, Dorret I; Sørensen, Thorkild I A; Silventoinen, Karri; Kaprio, Jaakko

    2017-01-01

    The comparison of traits in twins from opposite-sex (OS) and same-sex (SS) dizygotic twin pairs is considered a proxy measure of prenatal hormone exposure. To examine possible prenatal hormonal influences on anthropometric traits, we compared mean height, body mass index (BMI), and the prevalence of being overweight or obese between men and women from OS and SS dizygotic twin pairs. The data were derived from the COllaborative project of Development of Anthropometrical measures in Twins (CODATwins) database, and included 68,494 SS and 53,808 OS dizygotic twin individuals above the age of 20 years from 31 twin cohorts representing 19 countries. Zygosity was determined by questionnaires or DNA genotyping depending on the study. Multiple regression and logistic regression models adjusted for cohort, age, and birth year with the twin type as a predictor were carried out to compare height and BMI in twins from OS pairs with those from SS pairs and to calculate the adjusted odds ratios and 95% confidence intervals for being overweight or obese. OS females were, on average, 0.31 cm (95% confidence interval (CI) 0.20, 0.41) taller than SS females. OS males were also, on average, taller than SS males, but this difference was only 0.14 cm (95% CI 0.02, 0.27). Mean BMI and the prevalence of overweight or obesity did not differ between males and females from SS and OS twin pairs. The statistically significant differences between OS and SS twins for height were small and appeared to reflect our large sample size rather than meaningful differences of public health relevance. We found no evidence to support the hypothesis that prenatal hormonal exposure or postnatal socialization (i.e., having grown up with a twin of the opposite sex) has a major impact on height and BMI in adulthood.

  15. Soluplus®/TPGS-based solid dispersions prepared by hot-melt extrusion equipped with twin-screw systems for enhancing oral bioavailability of valsartan.

    Science.gov (United States)

    Lee, Jae-Young; Kang, Wie-Soo; Piao, Jingpei; Yoon, In-Soo; Kim, Dae-Duk; Cho, Hyun-Jong

    2015-01-01

    Soluplus(®) (SP) and D-alpha-tocopherol polyethylene glycol 1000 succinate (TPGS)-based solid dispersion (SD) formulations were developed by hot-melt extrusion (HME) to improve oral bioavailability of valsartan (VST). HME process with twin-screw configuration for generating a high shear stress was used to prepare VST SD formulations. The thermodynamic state of the drug and its dispersion in the polymers were evaluated by solid-state studies, including Fourier-transform infrared, X-ray diffraction, and differential scanning calorimetry. Drug release from the SD formulations was assessed at pH values of 1.2, 4.0, and 6.8. Pharmacokinetic study was performed in rats to estimate the oral absorption of VST. HME with a high shear rate produced by the twin-screw system was successfully applied to prepare VST-loaded SD formulations. Drug amorphization and its molecular dispersion in the polymer matrix were verified by several solid-state studies. Drug release from SD formulations was improved, compared to the pure drug, particularly at pH 6.8. Oral absorption of drug in rats was also enhanced in SP and TPGS-based SD groups compared to that in the pure drug group. SP and TPGS-based SDs, prepared by the HME process, could be used to improve aqueous solubility, dissolution, and oral absorption of poorly water-soluble drugs.

  16. Effects of social contact and zygosity on 21-y weight change in male twins.

    Science.gov (United States)

    McCaffery, Jeanne M; Franz, Carol E; Jacobson, Kristen; Leahey, Tricia M; Xian, Hong; Wing, Rena R; Lyons, Michael J; Kremen, William S

    2011-08-01

    Recent evidence indicates that social contact is related to similarities in weight gain over time. However, no studies have examined this effect in a twin design, in which genetic and other environmental effects can also be estimated. We determined whether the frequency of social contact is associated with similarity in weight change from young adulthood (mean age: 20 y) to middle age (mean age: 41 y) in twins and quantified the percentage of variance in weight change attributable to social contact, genetic factors, and other environmental influences. Participants were 1966 monozygotic and 1529 dizygotic male twin pairs from the Vietnam-Era Twin Registry. Regression models tested whether frequency of social contact and zygosity predicted twin pair similarity in body mass index (BMI) change and weight change. Twin modeling was used to partition the percentage variance attributable to social contact, genetic, and other environmental effects. Twins gained an average of 3.99 BMI units, or 13.23 kg (29.11 lb), over 21 y. In regression models, both zygosity (P social contact (P change. In twin modeling, social contact between twins contributed 16% of the variance in BMI change (P change. Frequency of social contact significantly predicted twin pair similarity in BMI and weight change over 21 y, independent of zygosity and other shared environmental influences.

  17. Heritability of retinal vascular fractals: a twin study

    DEFF Research Database (Denmark)

    Vergmann, Anna Stage; Broe, Rebecca; Kessel, Line

    . The retinal vascular fractal dimension was measured using the box-counting method and compared within monozygotic and dizygotic twin pairs using Pearson correlation coefficents. Falconer´s formula and quantitative genetic models were used to determine the genetic component of variation. Results: The retinal...... for quantitative analysis of heritability. The intrapair correlation was markedly higher (0.505, p=0.0002) in monozygotic twins than in dizygotic twins (0.108, p=0.46), corresponding to a heritability h2 for the fractal dimension of 0.79. In quantitative genetic models, 54% of the variation was explained...

  18. Ultrafast deactivation processes in the 2-aminopyridine dimer and the adenine-thymine base pair: Similarities and differences

    International Nuclear Information System (INIS)

    Ai Yuejie; Zhang Feng; Cui Ganglong; Fang Weihai; Luo Yi

    2010-01-01

    2-aminopyridine dimer has frequently been used as a model system for studying photochemistry of DNA base pairs. We examine here the relevance of 2-aminopyridine dimer for a Watson-Crick adenine-thymine base pair by studying UV-light induced photodynamics along two main hydrogen bridges after the excitation to the localized 1 ππ* excited-state. The respective two-dimensional potential-energy surfaces have been determined by time-dependent density functional theory with Coulomb-attenuated hybrid exchange-correlation functional (CAM-B3LYP). Different mechanistic aspects of the deactivation pathway have been analyzed and compared in detail for both systems, while the related reaction rates have also be obtained from Monte Carlo kinetic simulations. The limitations of the 2-aminopyridine dimer as a model system for the adenine-thymine base pair are discussed.

  19. Twin Pregnancy with Gastroschisis in Both Twins

    Directory of Open Access Journals (Sweden)

    Hui-Fen Kao

    2007-12-01

    Conclusion: The cause of gastroschisis is unknown, although possible exogenous causes have been studied. The diagnosis of gastroschisis in twin pregnancy is always in late gestation. Therefore, maternal serum alpha feto-protein screening and a detailed prenatal ultrasound evaluation are recommended in multifetal pregnancies.

  20. Doppler Broadening Analysis of Steel Specimens Using Accelerator Based In Situ Pair Production

    International Nuclear Information System (INIS)

    Makarashvili, V.; Wells, D. P.; Roy, A. K.

    2009-01-01

    Positron Annihilation Spectroscopy (PAS) techniques can be utilized as a sensitive probe of defects in materials. Studying these microscopic defects is very important for a number of industries in order to predict material failure or structural integrity. We have been developing gamma-induced pair-production techniques to produce positrons in thick samples (∼4-40 g/cm 2 , or ∼0.5-5 cm in steel). These techniques are called 'Accelerator-based Gamma-induced Positron Annihilation Spectroscopy'(AG-PAS). We have begun testing the capabilities of this technique for imaging of defect densities in thick structural materials. As a first step, a linear accelerator (LINAC) was employed to produce photon beams by stopping 15 MeV electrons in a 1 mm thick tungsten converter. The accelerator is capable of operating with 30-60 ns pulse width, up to 200 mA peak current at 1 kHz repetition rate. The highly collimated bremsstrahlung beam impinged upon our steel tensile specimens, after traveling through a 1.2 m thick concrete wall. Annihilation radiation was detected by a well-shielded and collimated high-purity germanium detector (HPGe). Conventional Doppler broadening spectrometry (DBS) was performed to determine S, W and T parameters for our samples.

  1. Study of intrinsic anchoring in nematic liquid crystals based on modified Gruhn-Hess pair potential

    International Nuclear Information System (INIS)

    Zhang Zhidong; Zhang Yanjun

    2008-01-01

    A nematic liquid crystal slab composed of N molecular layers is investigated using a simple cubic lattice model, based upon the molecular pair potential which is spatially anisotropic and dependent on elastic constants of liquid crystals. A perfect nematic order is assumed in the theoretical treatment, which means the orientation of the molecular long axis coincides with the director of liquid crystal and the total free energy equals to the total interaction energy. We present a modified Gruhn-Hess model, which is relative to the splay-bend elastic constant K 13 . Furthermore, we have studied the free nematic interfacial behavior (intrinsic anchoring) by this model in the assumption of the perfect nematic order. We find that the preferred orientation at the free interface and the intrinsic anchoring strength change with the value of modification, and that the director profile can be determined by the competition of the intrinsic anchoring with external forces present in the system. Also we simulate the intrinsic anchoring at different temperatures using Monte Carlo method and the simulation results show that the intrinsic anchoring favors planar alignment and the free interface is more disordered than the bulk

  2. Locations of Joint Physical Activity in Parent-Child Pairs Based on Accelerometer and GPS Monitoring

    Science.gov (United States)

    Dunton, Genevieve Fridlund; Liao, Yue; Almanza, Estela; Jerrett, Micheal; Spruijt-Metz, Donna; Pentz, Mary Ann

    2012-01-01

    Background Parental factors may play an important role in influencing children’s physical activity levels. Purpose This cross-sectional study sought to describe the locations of joint physical activity among parents and children. Methods Parent-child pairs (N = 291) wore an Actigraph GT2M accelerometer and GlobalSat BT-335 Global Positioning Systems (GPS) device over the same 7-day period. Children were ages 8–14 years. Joint behavior was defined by a linear separation distance of less than 50m between parent and child. Land use classifications were assigned to GPS data points. Results Joint physical activity was spread across residential locations (35%), and commercial venues (24%), and open spaces/parks (20%). Obese children and parents performed less joint physical activity in open spaces/parks than under/normal weight children and parents (p’s parent-child physical activity naturally occurs may inform location-based interventions to promote these behaviors. PMID:23011914

  3. Self-Similarity Based Corresponding-Point Extraction from Weakly Textured Stereo Pairs

    Directory of Open Access Journals (Sweden)

    Min Mao

    2014-01-01

    Full Text Available For the areas of low textured in image pairs, there is nearly no point that can be detected by traditional methods. The information in these areas will not be extracted by classical interest-point detectors. In this paper, a novel weakly textured point detection method is presented. The points with weakly textured characteristic are detected by the symmetry concept. The proposed approach considers the gray variability of the weakly textured local regions. The detection mechanism can be separated into three steps: region-similarity computation, candidate point searching, and refinement of weakly textured point set. The mechanism of radius scale selection and texture strength conception are used in the second step and the third step, respectively. The matching algorithm based on sparse representation (SRM is used for matching the detected points in different images. The results obtained on image sets with different objects show high robustness of the method to background and intraclass variations as well as to different photometric and geometric transformations; the points detected by this method are also the complement of points detected by classical detectors from the literature. And we also verify the efficacy of SRM by comparing with classical algorithms under the occlusion and corruption situations for matching the weakly textured points. Experiments demonstrate the effectiveness of the proposed weakly textured point detection algorithm.

  4. Proton tunneling in the A∙T Watson-Crick DNA base pair: myth or reality?

    Science.gov (United States)

    Brovarets', Ol'ha O; Hovorun, Dmytro M

    2015-01-01

    The results and conclusions reached by Godbeer et al. in their recent work, that proton tunneling in the A∙T(WC) Watson-Crick (WC) DNA base pair occurs according to the Löwdin's (L) model, but with a small (~10(-9)) probability were critically analyzed. Here, it was shown that this finding overestimates the possibility of the proton tunneling at the A∙T(WC)↔A*∙T*(L) tautomerization, because this process cannot be implemented as a chemical reaction. Furthermore, it was outlined those biologically important nucleobase mispairs (A∙A*↔A*∙A, G∙G*↔G*∙G, T∙T*↔T*∙T, C∙C*↔C*∙C, H∙H*↔H*∙H (H - hypoxanthine)) - the players in the field of the spontaneous point mutagenesis - where the tunneling of protons is expected and for which the application of the model proposed by Godbeer et al. can be productive.

  5. Intercalation of a Zn(II) complex containing ciprofloxacin drug between DNA base pairs.

    Science.gov (United States)

    Shahabadi, Nahid; Asadian, Ali Ashraf; Mahdavi, Mryam

    2017-11-02

    In this study, an attempt has been made to study the interaction of a Zn(II) complex containing an antibiotic drug, ciprofloxacin, with calf thymus DNA using spectroscopic methods. It was found that Zn(II) complex could bind with DNA via intercalation mode as evidenced by: hyperchromism in UV-Vis spectrum; these spectral characteristics suggest that the Zn(II) complex interacts with DNA most likely through a mode that involves a stacking interaction between the aromatic chromophore and the base pairs of DNA. DNA binding constant (K b = 1.4 × 10 4 M -1 ) from spectrophotometric studies of the interaction of Zn(II) complex with DNA is comparable to those of some DNA intercalative polypyridyl Ru(II) complexes 1.0 -4.8 × 10 4 M -1 . CD study showed stabilization of the right-handed B form of DNA in the presence of Zn(II) complex as observed for the classical intercalator methylene blue. Thermodynamic parameters (ΔH DNA-MB, indicating that it binds to DNA in strong competition with MB for the intercalation.

  6. DNA base pair resolution measurements using resonance energy transfer efficiency in lanthanide doped nanoparticles.

    Directory of Open Access Journals (Sweden)

    Aleksandra Delplanque

    Full Text Available Lanthanide-doped nanoparticles are of considerable interest for biodetection and bioimaging techniques thanks to their unique chemical and optical properties. As a sensitive luminescence material, they can be used as (bio probes in Förster Resonance Energy Transfer (FRET where trivalent lanthanide ions (La3+ act as energy donors. In this paper we present an efficient method to transfer ultrasmall (ca. 8 nm NaYF4 nanoparticles dispersed in organic solvent to an aqueous solution via oxidation of the oleic acid ligand. Nanoparticles were then functionalized with single strand DNA oligomers (ssDNA by inducing covalent bonds between surface carboxylic groups and a 5' amine modified-ssDNA. Hybridization with the 5' fluorophore (Cy5 modified complementary ssDNA strand demonstrated the specificity of binding and allowed the fine control over the distance between Eu3+ ions doped nanoparticle and the fluorophore by varying the number of the dsDNA base pairs. First, our results confirmed nonradiative resonance energy transfer and demonstrate the dependence of its efficiency on the distance between the donor (Eu3+ and the acceptor (Cy5 with sensitivity at a nanometre scale.

  7. DNA base pair resolution measurements using resonance energy transfer efficiency in lanthanide doped nanoparticles.

    Science.gov (United States)

    Delplanque, Aleksandra; Wawrzynczyk, Dominika; Jaworski, Pawel; Matczyszyn, Katarzyna; Pawlik, Krzysztof; Buckle, Malcolm; Nyk, Marcin; Nogues, Claude; Samoc, Marek

    2015-01-01

    Lanthanide-doped nanoparticles are of considerable interest for biodetection and bioimaging techniques thanks to their unique chemical and optical properties. As a sensitive luminescence material, they can be used as (bio) probes in Förster Resonance Energy Transfer (FRET) where trivalent lanthanide ions (La3+) act as energy donors. In this paper we present an efficient method to transfer ultrasmall (ca. 8 nm) NaYF4 nanoparticles dispersed in organic solvent to an aqueous solution via oxidation of the oleic acid ligand. Nanoparticles were then functionalized with single strand DNA oligomers (ssDNA) by inducing covalent bonds between surface carboxylic groups and a 5' amine modified-ssDNA. Hybridization with the 5' fluorophore (Cy5) modified complementary ssDNA strand demonstrated the specificity of binding and allowed the fine control over the distance between Eu3+ ions doped nanoparticle and the fluorophore by varying the number of the dsDNA base pairs. First, our results confirmed nonradiative resonance energy transfer and demonstrate the dependence of its efficiency on the distance between the donor (Eu3+) and the acceptor (Cy5) with sensitivity at a nanometre scale.

  8. Biomolecule Analogues 2-Hydroxypyridine and 2-Pyridone Base Pairing on Ice Nanoparticles.

    Science.gov (United States)

    Rubovič, Peter; Pysanenko, Andriy; Lengyel, Jozef; Nachtigallová, Dana; Fárník, Michal

    2016-07-14

    Ice nanoparticles (H2O)N, N ≈ 450 generated in a molecular beam experiment pick up individual gas phase molecules of 2-hydroxypyridine and 2-pyridone (HP) evaporated in a pickup cell at temperatures between 298 and 343 K. The mass spectra of the doped nanoparticles show evidence for generation of clusters of adsorbed molecules (HP)n up to n = 8. The clusters are ionized either by 70 eV electrons or by two photons at 315 nm (3.94 eV). The two ionization methods yield different spectra, and their comparison provides an insight into the neutral cluster composition, ionization and intracluster ion-molecule reactions, and cluster fragmentation. Quite a few molecules were reported not to coagulate on ice nanoparticles previously. The (HP)n cluster generation on ice nanoparticles represents the first evidence for coagulating of molecules and cluster formation on free ice nanoparticles. For comparison, we investigate the coagulation of HP molecules picked up on large clusters ArN, N ≈ 205, and also (HP)n clusters generated in supersonic expansions with Ar buffer gas. This comparison points to a propensity for the (HP)2 dimer generation on ice nanoparticles. This shows the feasibility of base pairing for model of biological molecules on free ice nanoparticles. This result is important for hypotheses of the biomolecule synthesis on ice grains in the space. We support our findings by theoretical calculations that show, among others, the HP dimer structures on water clusters.

  9. Paired-Associate and Feedback-Based Weather Prediction Tasks Support Multiple Category Learning Systems.

    Science.gov (United States)

    Li, Kaiyun; Fu, Qiufang; Sun, Xunwei; Zhou, Xiaoyan; Fu, Xiaolan

    2016-01-01

    It remains unclear whether probabilistic category learning in the feedback-based weather prediction task (FB-WPT) can be mediated by a non-declarative or procedural learning system. To address this issue, we compared the effects of training time and verbal working memory, which influence the declarative learning system but not the non-declarative learning system, in the FB and paired-associate (PA) WPTs, as the PA task recruits a declarative learning system. The results of Experiment 1 showed that the optimal accuracy in the PA condition was significantly decreased when the training time was reduced from 7 to 3 s, but this did not occur in the FB condition, although shortened training time impaired the acquisition of explicit knowledge in both conditions. The results of Experiment 2 showed that the concurrent working memory task impaired the optimal accuracy and the acquisition of explicit knowledge in the PA condition but did not influence the optimal accuracy or the acquisition of self-insight knowledge in the FB condition. The apparent dissociation results between the FB and PA conditions suggested that a non-declarative or procedural learning system is involved in the FB-WPT and provided new evidence for the multiple-systems theory of human category learning.

  10. Identification of somatic mutations in cancer through Bayesian-based analysis of sequenced genome pairs.

    Science.gov (United States)

    Christoforides, Alexis; Carpten, John D; Weiss, Glen J; Demeure, Michael J; Von Hoff, Daniel D; Craig, David W

    2013-05-04

    The field of cancer genomics has rapidly adopted next-generation sequencing (NGS) in order to study and characterize malignant tumors with unprecedented resolution. In particular for cancer, one is often trying to identify somatic mutations--changes specific to a tumor and not within an individual's germline. However, false positive and false negative detections often result from lack of sufficient variant evidence, contamination of the biopsy by stromal tissue, sequencing errors, and the erroneous classification of germline variation as tumor-specific. We have developed a generalized Bayesian analysis framework for matched tumor/normal samples with the purpose of identifying tumor-specific alterations such as single nucleotide mutations, small insertions/deletions, and structural variation. We describe our methodology, and discuss its application to other types of paired-tissue analysis such as the detection of loss of heterozygosity as well as allelic imbalance. We also demonstrate the high level of sensitivity and specificity in discovering simulated somatic mutations, for various combinations of a) genomic coverage and b) emulated heterogeneity. We present a Java-based implementation of our methods named Seurat, which is made available for free academic use. We have demonstrated and reported on the discovery of different types of somatic change by applying Seurat to an experimentally-derived cancer dataset using our methods; and have discussed considerations and practices regarding the accurate detection of somatic events in cancer genomes. Seurat is available at https://sites.google.com/site/seuratsomatic.

  11. Development of Maltodextrin-Based Immediate-Release Tablets Using an Integrated Twin-Screw Hot-Melt Extrusion and Injection-Molding Continuous Manufacturing Process.

    Science.gov (United States)

    Puri, Vibha; Brancazio, Dave; Desai, Parind M; Jensen, Keith D; Chun, Jung-Hoon; Myerson, Allan S; Trout, Bernhardt L

    2017-11-01

    The combination of hot-melt extrusion and injection molding (HME-IM) is a promising process technology for continuous manufacturing of tablets. However, there has been limited research on its application to formulate crystalline drug-containing immediate-release tablets. Furthermore, studies that have applied the HME-IM process to molded tablets have used a noncontinuous 2-step approach. The present study develops maltodextrin (MDX)-based extrusion-molded immediate-release tablets for a crystalline drug (griseofulvin) using an integrated twin-screw HME-IM continuous process. At 10% w/w drug loading, MDX was selected as the tablet matrix former based on a preliminary screen. Furthermore, liquid and solid polyols were evaluated for melt processing of MDX and for impact on tablet performance. Smooth-surfaced tablets, comprising crystalline griseofulvin solid suspension in the amorphous MDX-xylitol matrix, were produced by a continuous process on a twin-screw extruder coupled to a horizontally opening IM machine. Real-time HME process profiles were used to develop automated HME-IM cycles. Formulation adjustments overcame process challenges and improved tablet strength. The developed MDX tablets exhibited adequate strength and a fast-dissolving matrix (85% drug release in 20 min), and maintained performance on accelerated stability conditions. Copyright © 2017 American Pharmacists Association®. Published by Elsevier Inc. All rights reserved.

  12. Does the sex of one’s co-twin affect height and BMI in adulthood? A study of dizygotic adult twins from 31 cohorts

    DEFF Research Database (Denmark)

    Bogl, Leonie H; Jelenkovic, Aline; Vuoksimaa, Eero

    2017-01-01

    Background: The comparison of traits in twins from opposite-sex (OS) and same-sex (SS) dizygotic twin pairs is considered a proxy measure of prenatal hormone exposure. To examine possible prenatal hormonal influences on anthropometric traits, we compared mean height, body mass index (BMI), and th...

  13. Does the sex of one's co-twin affect height and BMI in adulthood? : A study of dizygotic adult twins from 31 cohorts

    NARCIS (Netherlands)

    Bogl, Leonie H; Jelenkovic, Aline; Vuoksimaa, Eero; Ahrenfeldt, Linda; Pietiläinen, Kirsi H; Stazi, Maria A; Fagnani, Corrado; D'Ippolito, Cristina; Hur, Yoon-Mi; Jeong, Hoe-Uk; Silberg, Judy L; Eaves, Lindon J; Maes, Hermine H; Bayasgalan, Gombojav; Narandalai, Danshiitsoodol; Cutler, Tessa L; Kandler, Christian; Jang, Kerry L; Christensen, Kaare; Skytthe, Axel; Kyvik, Kirsten Ohm; Cozen, Wendy; Hwang, Amie E; Mack, Thomas M; Derom, Catherine A; Vlietinck, Robert F; Nelson, Tracy L; Whitfield, Keith E; Corley, Robin P; Huibregtse, Brooke M; McAdams, Tom A; Eley, Thalia C; Gregory, Alice M; Krueger, Robert F; McGue, Matt; Pahlen, Shandell; Willemsen, Gonneke; Bartels, Meike; Pang, Zengchang; Tan, Qihua; Zhang, Dongfeng; Martin, Nicholas G; Medland, Sarah E; Montgomery, Grant W; Hjelmborg, Jacob V B; Rebato, Esther; Swan, Gary E; Krasnow, Ruth; Busjahn, Andreas; Lichtenstein, Paul; Öncel, Sevgi Y; Aliev, Fazil; Baker, Laura A; Tuvblad, Catherine; Siribaddana, Sisira H; Hotopf, Matthew; Sumathipala, Athula; Rijsdijk, Fruhling; Magnusson, Patrik K E; Pedersen, Nancy L; Aslan, Anna K Dahl; Ordoñana, Juan R; Sánchez-Romera, Juan F; Colodro-Conde, Lucia; Duncan, Glen E; Buchwald, Dedra; Tarnoki, Adam D; Tarnoki, David L; Yokoyama, Yoshie; Hopper, John L; Loos, Ruth J F; Boomsma, Dorret I; Sørensen, Thorkild I A; Silventoinen, Karri; Kaprio, Jaakko; van Beijsterveldt, C.E.M.

    2017-01-01

    BACKGROUND: The comparison of traits in twins from opposite-sex (OS) and same-sex (SS) dizygotic twin pairs is considered a proxy measure of prenatal hormone exposure. To examine possible prenatal hormonal influences on anthropometric traits, we compared mean height, body mass index (BMI), and the

  14. Universal quantum gates for Single Cooper Pair Box based quantum computing

    Science.gov (United States)

    Echternach, P.; Williams, C. P.; Dultz, S. C.; Braunstein, S.; Dowling, J. P.

    2000-01-01

    We describe a method for achieving arbitrary 1-qubit gates and controlled-NOT gates within the context of the Single Cooper Pair Box (SCB) approach to quantum computing. Such gates are sufficient to support universal quantum computation.

  15. Neutron matter, neutron pairing, and neutron drops based on chiral effective field theory interactions

    Energy Technology Data Exchange (ETDEWEB)

    Krueger, Thomas

    2016-10-19

    calculate the pairing gaps in neutron matter and provide uncertainty estimates. The formation of heavy elements in the early universe proceeds through the rapid neutron-capture process. This process requires precise knowledge of the properties of very neutron-rich nuclei, which are unstable and at present not accessible in experiments. Thus, one can explore their properties only with theoretical calculations. Currently the only approach to the properties of all nuclei are energy-density functionals (EDFs). All EDFs used today are based on phenomenological models and fits to stable nuclei, which makes their predictive power for unknown (neutron-rich) nuclei unclear. Deriving an ab initio EDF directly from the nuclear forces is an important goal of nuclear theory. A promising approach is the optimised effective potential (OEP) method. We take a step into that direction and calculate neutron drops within the OEP formalism. In addition to the exact-exchange approximation we study for the first time the effect of second-order contributions and compare to quantum Monte Carlo and other results.

  16. Charge transport properties of DNA aperiodic molecule: The role of interbase hopping in Watson-Crick base pair

    Science.gov (United States)

    Sinurat, E. N.; Yudiarsah, E.

    2017-07-01

    The charge transport properties of DNA aperiodic molecule has been studied by considering various interbase hopping parameter on Watson-Crick base pair. 32 base pairs long double-stranded DNA aperiodic model with sequence GCTAGTACGTGACGTAGCTAGGATATGCCTGA on one chain and its complement on the other chain is used. Transfer matrix method has been used to calculate transmission probabilities, for determining I-V characteristic using Landauer Büttiker formula. DNA molecule is modeled using tight binding hamiltonian combined with the theory of Slater-Koster. The result show, the increment of Watson-Crick hopping value leads to the transmission probabilities and current of DNA aperiodic molecule increases.

  17. Quantitative XRD analysis of {110} twin density in biotic aragonites.

    Science.gov (United States)

    Suzuki, Michio; Kim, Hyejin; Mukai, Hiroki; Nagasawa, Hiromichi; Kogure, Toshihiro

    2012-12-01

    {110} Twin densities in biotic aragonite have been estimated quantitatively from the peak widths of specific reflections in powder X-ray diffraction (XRD) patterns, as well as direct confirmation of the twins using transmission electron microscopy (TEM). Influence of the twin density on the peak widths in the XRD pattern was simulated using DIFFaX program, regarding (110) twin as interstratification of two types of aragonite unit layers with mirrored relationship. The simulation suggested that the twin density can be estimated from the difference of the peak widths between 111 and 021, or between 221 and 211 reflections. Biotic aragonite in the crossed-lamellar microstructure (three species) and nacreous microstructure (four species) of molluscan shells, fish otoliths (two species), and a coral were investigated. The XRD analyses indicated that aragonite crystals in the crossed-lamellar microstructure of the three species contain high density of the twins, which is consistent with the TEM examination. On the other hand, aragonite in the nacre of the four species showed almost no difference of the peak widths between the paired reflections, indicating low twin densities. The results for the fish otoliths were varied between the species. Such variation of the twin density in biotic aragonites may reflect different schemes of crystal growth in biomineralization. Copyright © 2012 Elsevier Inc. All rights reserved.

  18. Monozygotic twins with CAPN5 autosomal dominant neovascular inflammatory vitreoretinopathy.

    Science.gov (United States)

    Rowell, Hannah A; Bassuk, Alexander G; Mahajan, Vinit B

    2012-01-01

    The purpose of this study was to describe the clinical findings in a set of monozygotic twins with autosomal dominant neovascular inflammatory vitreoretinopathy (ADNIV) over a 23-year period. A pair of female twins were examined between 26 and 49 years of age. The concordance and discordance of their clinical features were determined. The CAPN5 gene was sequenced using genomic DNA. Both twins of an affected father demonstrated Stage I ADNIV with mild vitreous cells and a negative b-wave on electroretinography. Genetic analysis confirmed a guanine to thymine nucleotide (c.728G>T, pArg243Leu) mutation in the CAPN5 gene. Over the course of 23 years, each twin progressed to stage III disease, showing posterior uveitis, cystoid macular edema, intraocular fibrosis, early retinal neovascularization, retinal degeneration, and cataract. Disease progression varied moderately between each twin and was asymmetrical between eyes. Twin A had 20/70 and 20/125 in the right and left eye, respectively, and underwent vitrectomy surgery and intravitreal injections with bevacizumab for recurrent cystoid macular edema. Twin B maintained 20/20 and 20/40 in the right and left eye, respectively without intervention. There was asymmetry between the eyes and some discordance in the rate of disease progression in these monozygotic twins with ADNIV. The overall high disease concordance suggests genetic factors play a major role in clinical manifestations in CAPN5 vitreoretinopathy.

  19. SUSY meets her twin

    Energy Technology Data Exchange (ETDEWEB)

    Katz, Andrey [Theory Division, CERN,CH-1211 Geneva 23 (Switzerland); Département de Physique Théorique and Center for Astroparticle Physics (CAP),Université de Genève,24 quai Ansermet, CH-1211 Genève 4 (Switzerland); Mariotti, Alberto [Theoretische Natuurkunde and IIHE/ELEM, Vrije Universiteit Brussel,and International Solvay Institutes,Pleinlaan 2, B-1050 Brussels (Belgium); Pokorski, Stefan [Institute of Theoretical Physics, Faculty of Physics, University of Warsaw,ul. Pasteura 5, PL-02-093 Warsaw (Poland); Redigolo, Diego [Raymond and Beverly Sackler School of Physics and Astronomy, Tel-Aviv University,Tel-Aviv 69978 (Israel); Department of Particle Physics and Astrophysics, Weizmann Institute of Science,Rehovot 7610001 (Israel); Ziegler, Robert [Institute for Theoretical Particle Physics (TTP), Karlsruhe Institute of Technology,Engesserstraße 7, D-76128 Karlsruhe (Germany)

    2017-01-31

    We investigate the general structure of mirror symmetry breaking in the Twin Higgs scenario. We show, using the IR effective theory, that a significant gain in fine tuning can be achieved if the symmetry is broken hardly. We emphasize that weakly coupled UV completions can naturally accommodate this scenario. We analyze SUSY UV completions and present a simple Twin SUSY model with a tuning of around 10% and colored superpartners as heavy as 2 TeV. The collider signatures of general Twin SUSY models are discussed with a focus on the extended Higgs sectors.

  20. Temperament and character in the Child and Adolescent Twin Study in Sweden (CATSS: comparison to the general population, and genetic structure analysis.

    Directory of Open Access Journals (Sweden)

    Danilo Garcia

    Full Text Available BACKGROUND: The Child and Adolescent Twin Study in Sweden (CATSS is an on-going, large population-based longitudinal twin study. We aimed (1 to investigate the reliability of two different versions (125-items and 238-items of Cloninger's Temperament and Character Inventory (TCI used in the CATSS and the validity of extracting the short version from the long version, (2 to compare these personality dimensions between twins and adolescents from the general population, and (3 to investigate the genetic structure of Cloninger's model. METHOD: Reliability and correlation analyses were conducted for both TCI versions, 2,714 CATSS-twins were compared to 631 adolescents from the general population, and the genetic structure was investigated through univariate genetic analyses, using a model-fitting approach with structural equation-modeling techniques based on same-sex twin pairs from the CATSS (423 monozygotic and 408 dizygotic pairs. RESULTS: The TCI scores from the short and long versions showed comparable reliability coefficients and were strongly correlated. Twins scored about half a standard deviation higher in the character scales. Three of the four temperament dimensions (Novelty Seeking, Harm Avoidance, and Persistence had strong genetic and non-shared environmental effects, while Reward Dependence and the three character dimensions had moderate genetic effects, and both shared and non-shared environmental effects. CONCLUSIONS: Twins showed higher scores in character dimensions compared to adolescents from the general population. At least among adolescents there is a shared environmental influence for all of the character dimensions, but only for one of the temperament dimensions (i.e., Reward Dependence. This specific finding regarding the existence of shared environmental factors behind the character dimensions in adolescence, together with earlier findings showing a small shared environmental effects on character among young adults and no

  1. Genetic contribution to the relationship between social role function and depressive symptoms in Japanese elderly twins: a twin study.

    Science.gov (United States)

    Nishihara, Reiko; Inui, Fujio; Kato, Kenji; Tomizawa, Rie; Hayakawa, Kazuo

    2011-03-01

    Social role function is the capacity to maintain interpersonal relationships and is essential for being independent in the community. Limitations in social role function often coexist with depressive symptoms, suggesting a possible common mechanistic basis. We investigated whether the observed association between these traits is mainly a result of genetic or environmental influences. In 2008, a questionnaire was sent to 745 male twins aged 65 years and older. Our sample included 397 male twins. The number of monozygotic twins was 302, and dizygotic was 95. Among the twin pairs for whom data were available for both twins, 75 twin pairs (150 individuals) were monozygotic and 28 pairs (56 individuals) were dizygotic. Social role function was assessed using the Tokyo Metropolitan Institute of Gerontology Index of Competence. Depressive symptoms were measured by the 15-item version of the Geriatric Depression Scale. Relative importance of genes and environments for the phenotypes was calculated using structural equation analyses. Our results show that genetic influence was the major contributor to the relationship between social role function and depressive symptoms, and non-shared environmental influence was important for overall variation in each trait. We concluded that focusing on a non-shared environment is an essential approach for maintaining social role function and psychological well-being. It is suggested that treatments specific to depressive symptoms are more effective than indirect intervention targeting social role function. © 2011 The Authors. Psychogeriatrics © 2011 Japanese Psychogeriatric Society.

  2. Monozygotic twins discordant for attention-deficit/hyperactivity disorder: ascertainment and clinical characteristics.

    Science.gov (United States)

    Sharp, Wendy S; Gottesman, Rebecca F; Greenstein, Deanna K; Ebens, Christen L; Rapoport, Judith L; Castellanos, F Xavier

    2003-01-01

    Nongenetic factors and phenomenology of attention-deficit/hyperactivity disorder (ADHD) were examined in monozygotic (MZ) twin pairs discordant for ADHD. Recruitment included telephone screening (n = 297 pairs), behavioral ratings obtained from parents and teachers (n = 59 pairs), and, finally, in-person assessment (n = 25 pairs; structured classroom observation, diagnostic interview, psychoeducational evaluation, birth record review, establishment of monozygosity, and anatomic brain imaging). Affected twins were further contrasted with previously studied affected singletons. Of the 25 MZ twin pairs qualifying for in-person evaluation, only 10 proved discordant for ADHD. Affected twins were mostly comparable with affected singletons on clinical measures, although fathers' self-ratings of childhood ADHD status were significantly lower in twins than in singletons. Discordance for ADHD in MZ twins appears to be ascribable to greater environmental discordance and decreased familiality. Despite these differences, affected twins were phenotypically comparable with affected singletons. Thus MZ twins discordant for ADHD, while rare, can inform research on the etiology and pathophysiology of this disorder.

  3. Importance of genetic factors in the occurrence of epilepsy syndrome type: a twin study

    DEFF Research Database (Denmark)

    Corey, Linda A; Pellock, John M; Kjeldsen, Marianne J

    2011-01-01

    not appear to play an important role in determining risk for frontal, occipital or temporal lobe epilepsy. These results suggest that, while genetic factors contribute to risk for major syndrome types, determined when possible, their contribution to risk for localization-related syndrome sub......Although there is strong evidence that genetic factors contribute to risk for epilepsy, their role in the determination of syndrome type is less clear. This study was undertaken to address this question. Information related to epilepsy was obtained from twins included in 455 monozygotic and 868...... dizygotic pairs ascertained from population-based twin registries in Denmark, Norway and the United States. Syndrome type was determined based on medical record information and detailed clinical interviews and classified using the International Classification Systems for the Epilepsies and Epileptic...

  4. Ties of silence--Family lived experience of selective mutism in identical twins.

    Science.gov (United States)

    Albrigtsen, Vårin; Eskeland, Benedicte; Mæhle, Magne

    2016-04-01

    This article is based on an in-depth interview with a pair of twins diagnosed with selective mutism and their parents 2 years after recovery. Selective mutism (SM) is a rare disorder, and identical twins sharing the condition are extremely rare. The twins developed SM simultaneously during their first year of school. The treatment and follow-up they received for several years are briefly described in this article. The interview explored the children's and their parents' narratives about the origin of the condition, the challenges it entailed in their daily lives, and what they found helpful in the treatment they were offered. In the interview, the children conveyed experiences that even the parents were unaware of and revealed examples of daily life-traumas for which they were unable to obtain support and help. The whole family was trapped in the silence. The twins and their parents emphasized different aspects in terms of what they believed were helpful. The implications of these findings for our understanding and treatment of children with SM are discussed, as well as the potential of service user involvement in child and adolescent mental health research. © The Author(s) 2015.

  5. Grammar Clinical Marker Yields Substantial Heritability for Language Impairments in 16-Year-Old Twins.

    Science.gov (United States)

    Dale, Philip S; Rice, Mabel L; Rimfeld, Kaili; Hayiou-Thomas, Marianna E

    2018-01-22

    There is a need for well-defined language phenotypes suitable for adolescents in twin studies and other large-scale research projects. Rice, Hoffman, and Wexler (2009) have developed a grammatical judgment measure as a clinical marker of language impairment, which has an extended developmental range to adolescence. We conducted the first twin analysis, along with associated phenotypic analyses of validity, of an abridged, 20-item version of this grammatical judgment measure (GJ-20), based on telephone administration using prerecorded stimuli to 405 pairs of 16-year-olds (148 monozygotic and 257 dizygotic) drawn from the Twins Early Development Study (Haworth, Davis, & Plomin, 2012). The distribution of scores is markedly skewed negatively, as expected for a potential clinical marker. Low performance on GJ-20 is associated with lower maternal education, reported learning disability (age 7 years), and low scores on language tests administered via the Twins Early Development Study (age 16 years) as well as General Certificate of Secondary Education English and Math examination performance (age 16 years). Liability threshold estimates for the genetic influence on low performance on GJ-20 are substantial, ranging from 36% with a lowest 10% criterion to 74% for a lowest 5% criterion. The heritability of GJ-20 scores, especially at more extreme cutoffs, along with the score distribution and association with other indicators of language impairments, provides additional evidence for the potential value of this measure as a clinical marker of specific language impairment.

  6. A prospective study of twinning and perinatal mortality in urban Guinea-Bissau

    Directory of Open Access Journals (Sweden)

    Bjerregaard-Andersen Morten

    2012-12-01

    Full Text Available Abstract Background Despite twinning being common in Africa, few prospective twin studies have been conducted. We studied twinning rate, perinatal mortality and the clinical characteristics of newborn twins in urban Guinea-Bissau. Methods The study was conducted at the Bandim Health Project (BHP, a health and demographic surveillance site in Bissau, the capital of Guinea-Bissau. The cohort included all newborn twins delivered at the National Hospital Simão Mendes and in the BHP study area during the period September 2009 to August 2011 as well as singleton controls from the BHP study area. Data regarding obstetric history and pregnancy were collected at the hospital. Live children were examined clinically. For a subset of twin pairs zygosity was established by using genetic markers. Results Out of the 5262 births from mothers included in the BHP study area, 94 were twin births, i.e. a community twinning rate of 18/1000. The monozygotic rate was 3.4/1000. Perinatal mortality among twins vs. singletons was 218/1000 vs. 80/1000 (RR = 2.71, 95% CI: 1.93-3.80. Among the 13783 hospital births 388 were twin births (28/1000. The hospital perinatal twin mortality was 237/1000. Birth weight  Conclusions Twins had a very high perinatal mortality, three-fold higher than singletons. A birth weight 

  7. X-ray diffraction studies on merohedrally twinned Δ1–62NtNBCe1-A crystals of the sodium/bicarbonate cotransporter

    International Nuclear Information System (INIS)

    Gill, Harindarpal S.; Dutcher, Lauren; Boron, Walter F.; Patel, Samir; Guay-Woodford, Lisa M.

    2013-01-01

    A truncated mutant missing the first 62 residues of the N-terminal, cytoplasmic domain of the sodium-bicarbonate NBCe1-A cotransporter crystallizes in space group P3 1 with pseudo-P3 1 21 symmetry and a hemihedral twin fraction of 33.0%. Twinned fractions and twin-pair statistics over binned resolutions confirm that the calculated twin fraction is associated with hemihedral twinning and not to non-crystallographic symmetry. NBCe1-A membrane-embedded macromolecules that cotransport sodium and bicarbonate ions across the bilayer serve to maintain acid–base homeostasis throughout the body. Defects result in a number of renal and eye disorders, including type-II renal tubular acidosis and cataracts. Here, crystals of a human truncated mutant of the cytoplasmic N-terminal domain of NBCe1 (Δ1–62NtNBCe1-A) are reported that diffract X-rays to 2.4 Å resolution. The crystal symmetry of Δ1–62NtNBCe1-A is of space group P3 1 with pseudo-P3 1 21 symmetry and it has a hemihedral twin fraction of 33.0%. The crystals may provide insight into the pathogenic processes observed in a subset of patients with truncating and point mutations in the gene encoding NBCe1

  8. Total and Trimester-Specific Gestational Weight Gain and Offspring Birth and Early Childhood Weight: A Prospective Cohort Study on Monozygotic Twin Mothers and Their Offspring.

    Science.gov (United States)

    Scheers Andersson, Elina; Silventoinen, Karri; Tynelius, Per; Nohr, Ellen A; Sørensen, Thorkild I A; Rasmussen, Finn

    2016-08-01

    Gestational weight gain (GWG) has in numerous studies been associated with offspring birth weight (BW) and childhood weight. However, these associations might be explained by genetic confounding as offspring inherit their mother's genetic potential to gain weight. Furthermore, little is known about whether particular periods of pregnancy could influence offspring body weight differently. We therefore aimed to explore total and trimester-specific effects of GWG in monozygotic (MZ) twin mother-pairs on their offspring's BW, weight at 1 year and body mass index (BMI) at 5 and 10 years. MZ twin mothers born 1962-1975 were identified in national Swedish registers, and data on exposure and outcome variables was collected from medical records. We analyzed associations within and between twin pairs. We had complete data on the mothers' GWG and offspring BW for 82 pairs. The results indicated that total, and possibly also second and third trimester GWG were associated with offspring BW within the twin pairs in the fully adjusted model (β = 0.08 z-score units, 95% CI: 0.001, 0.17; β = 1.32 z-score units, 95% CI: -0.29, 2.95; and β = 1.02 z-score units, 95% CI: -0.50, 2.54, respectively). Our findings, although statistically weak, suggested no associations between GWG and offspring weight or BMI during infancy or childhood. Our study suggests that total, and possibly also second and third trimester, GWG are associated with offspring BW when taking shared genetic and environmental factors within twin pairs into account. Larger family-based studies with long follow-up are needed to confirm our findings.

  9. Preparing for Twins

    Science.gov (United States)

    ... Ribbon Commands Skip to main content Turn off Animations Turn on Animations Our Sponsors Log in | Register Menu Log in | ... challenges with twins. He also can suggest helpful reading material or refer you to organizations that help ...

  10. Search for Genomic Alterations in Monozygotic Twins Discordant for Cleft Lip and/or Palate

    DEFF Research Database (Denmark)

    Kimani, Jane W; Yoshiura, Koh-Ichiro; Shi, Min

    2009-01-01

    consisting of 1,536 SNPs, to scan for genomic alterations in a sample of monozygotic twin pairs with discordant cleft lip and/or palate phenotypes. Paired analysis for deletions, amplifications and loss of heterozygosity, along with sequence verification of SNPs with discordant genotype calls did not reveal...... any genomic discordance between twin pairs in lymphocyte DNA samples. Our results demonstrate that postzygotic genomic alterations are not a common cause of monozygotic twin discordance for isolated cleft lip and/or palate. However, rare or balanced genomic alterations, tissue-specific events...

  11. Metabolic studies in unaffected co-twins of non-insulin-dependent diabetics.

    OpenAIRE

    Barnett, A H; Spiliopoulos, A J; Pyke, D A; Stubbs, W A; Burrin, J; Alberti, K G

    1981-01-01

    Forty-eight out of 53 non-insulin-dependent diabetic identical twin pairs were concordant for diabetes. In the five discordant pairs the diabetic twin had only recently been diagnosed. Oral glucose tolerance tests were carried out on the unaffected twins of the five pairs and on matched controls. Fasting concentrations of blood glucose (5.5 +/- 0.6 v 3.7 +/- 0.3 mmol/l; 99.1 +/- 10.8 v 66.6 +/- 5.4 mg/100 ml), haemoglobin A1 (mean 9.1%, range 8.8-9.2% v mean 7.9%, range 7.4-8.4%), lactate, al...

  12. A rhodium(III) complex for high-affinity DNA base-pair mismatch recognition

    Science.gov (United States)

    Junicke, Henrik; Hart, Jonathan R.; Kisko, Jennifer; Glebov, Oleg; Kirsch, Ilan R.; Barton, Jacqueline K.

    2003-01-01

    A rhodium(III) complex, rac-[Rh(bpy)2phzi]3+ (bpy, 2,2′-bipyridine; phzi, benzo[a]phenazine-5,6-quinone diimine) has been designed as a sterically demanding intercalator targeted to destabilized mismatched sites in double-helical DNA. The complex is readily synthesized by condensation of the phenazine quinone with the corresponding diammine complex. Upon photoactivation, the complex promotes direct strand scission at single-base mismatch sites within the DNA duplex. As with the parent mismatch-specific reagent, [Rh(bpy)2(chrysi)]3+ [chrysene-5,6-quinone diimine (chrysi)], mismatch selectivity depends on the helix destabilization associated with mispairing. Unlike the parent chrysi complex, the phzi analogue binds and cleaves with high affinity and efficiency. The specific binding constants for CA, CC, and CT mismatches within a 31-mer oligonucleotide duplex are 0.3, 1, and 6 × 107 M−1, respectively; site-specific photocleavage is evident at nanomolar concentrations. Moreover, the specificity, defined as the ratio in binding affinities for mispaired vs. well paired sites, is maintained. The increase in affinity is attributed to greater stability in the mismatched site associated with stacking by the heterocyclic aromatic ligand. The high-affinity complex is also applied in the differential cleavage of DNA obtained from cell lines deficient in mismatch repair vs. those proficient in mismatch repair. Agreement is found between photocleavage by the mismatch-specific probes and deficiency in mismatch repair. This mismatch-specific targeting, therefore, offers a potential strategy for new chemotherapeutic design. PMID:12610209

  13. Mass renormalization and unconventional pairing in multi-band Fe-based superconductors- a phenomenological approach

    Energy Technology Data Exchange (ETDEWEB)

    Drechsler, S.L.; Efremov, D.; Grinenko, V. [IFW-Dresden (Germany); Johnston, S. [Inst. of Quantum Matter, University of British Coulumbia, Vancouver (Canada); Rosner, H. [MPI-cPfS, Dresden, (Germany); Kikoin, K. [Tel Aviv University (Israel)

    2015-07-01

    Combining DFT calculations of the density of states and plasma frequencies with experimental thermodynamic, optical, ARPES, and dHvA data taken from the literature, we estimate both the high-energy (Coulomb, Hund's rule coupling) and the low-energy (el-boson coupling) electronic mass renormalization [H(L)EMR] for typical Fe-pnictides with T{sub c}<40 K, focusing on (K,Rb,Cs)Fe{sub 2}As{sub 2}, (Ca,Na)122, (Ba,K)122, LiFeAs, and LaFeO{sub 1-x}F{sub x}As with and without As-vacancies. Using Eliashberg theory we show that these systems can NOT be described by a very strong el-boson coupling constant λ ≥ ∝ 2, being in conflict with the HEMR as seen by DMFT, ARPES and optics. Instead, an intermediate s{sub ±} coupling regime is realized, mainly based on interband spin fluctuations from one predominant pair of bands. For (Ca,Na)122, there is also a non-negligible intraband el-phonon/orbital fluctuation intraband contribution. The coexistence of magnetic As-vacancies and high-T{sub c}=28 K for LaFeO{sub 1-x}F{sub x}As{sub 1-δ} excludes an orbital fluctuation dominated s{sub ++} scenario at least for that system. In contrast, the line nodal BaFe{sub 2}(As,P){sub 2} near the quantum critical point is found as a superstrongly coupled system. The role of a pseudo-gap is briefly discussed for some of these systems.

  14. Twin probes for space geodesy

    International Nuclear Information System (INIS)

    Bertotti, B.

    1978-01-01

    The twin probe method, proposed by Bertotti and Colombo (1972) to get rid of nongravitational forces in interplanetary space, can be applied to a near-Earth orbit to eliminate the atmospheric drag. Two equal pairs of probes, each pair consisting of two passive, small and dense spheres of equal surface and different masses, are flown on a circular orbit at an altitude of about 300 km. Each pair determines the motion of an ideal point which feels only the gravitational forces. They are separated by a distance d of (100/200) km and are tracked from a spacecraft or the Space Shuttle, flying at the same altitude. The relative motion of the two ideal points is reconstructed and yields a measurement of the fine structure of the Earth gravitational field, corresponding to a harmonic order l approximately a/d (a is the radius of the Earth). The tracking can be done by laser ranging to the four spheres, covered by corner reflectors; Doppler ranging is more convenient for higher values of l and can also be used. The accuracy in the compensation of the non-gravitational forces and in the measurements one needs for a given l are discussed in detail. (author)

  15. A prospective study of twinning and perinatal mortality in urban Guinea-Bissau

    DEFF Research Database (Denmark)

    Bjerregaard-Andersen, Morten; Lund, Najaaraq; Jepsen, Frida Staarup

    2012-01-01

    ABSTRACT: BACKGROUND: Despite twinning being common in Africa, few prospective twin studies have been conducted. We studied twinning rate, perinatal mortality and the clinical characteristics of newborn twins in urban Guinea-Bissau. METHODS: The study was conducted at the Bandim Health Project (BHP......), a health and demographic surveillance site in Bissau, the capital of Guinea-Bissau. The cohort included all newborn twins delivered at the National Hospital Simao Mendes and in the BHP study area during the period September 2009 to August 2011 as well as singleton controls from the BHP study area. Data...... regarding obstetric history and pregnancy were collected at the hospital. Live children were examined clinically. For a subset of twin pairs zygosity was established by using genetic markers. RESULTS: Out of the 5262 births from mothers included in the BHP study area, 94 were twin births, i.e. a community...

  16. Leisure-time physical inactivity and association with body mass index: a Finnish Twin Study with a 35-year follow-up.

    Science.gov (United States)

    Piirtola, Maarit; Kaprio, Jaakko; Waller, Katja; Heikkilä, Kauko; Koskenvuo, Markku; Svedberg, Pia; Silventoinen, Karri; Kujala, Urho M; Ropponen, Annina

    2017-02-01

    We investigated the stability and change of leisure-time physical inactivity in adult men and women during a 35-year follow-up. We also analysed the impact of long-term physical inactivity on the development of body mass index (BMI). : In this population-based cohort study, 5254 Finnish twin individuals (59% women) participated in four surveys in 1975, 1981, 1990 and 2011. Mean age at baseline was 23.9 years. Individual long-term leisure-time physical activity (LTPA) was categorized into seven classes varying from 'persistently inactive' to 'persistently active'. We used the multivariate multilevel mixed-effects linear regression model and paired-sample t-test in the analyses. Co-twin control design was used for examining within-pair associations. : Of men 11%, and of women 8%, were persistently inactive. Among both sexes, the mean BMI slope trajectories were steeper among the persistently inactive and those who became inactive than among those who were persistently active. Overall, the inactive participants gained 1.4 kg/m 2 [95% confidence interval (CI) 1.2 to 1.7] more in weight than did the active participants from 1975 to 2011. Among twin pairs discordant for LTPA, the corresponding difference was 1.4 kg/m 2 (95% CI 0.83 to 2.0) in dizygotic pairs and 0.68 kg/m 2 (95% CI 0.05 to1.3) in monozygotic pairs. Over a 35-year time span from young adulthood, persistently inactive participants and those who had become inactive had greater weight increases than those who were persistently active. This association was also found in twin-pair analyses, although attenuated in monozygotic pairs. This may support the importance of LTPA in weight management, although further causal inference is required. © The Author 2016; all rights reserved. Published by Oxford University Press on behalf of the International Epidemiological Association

  17. The Child and Adolescent Twin Study in Sweden (CATSS).

    Science.gov (United States)

    Anckarsäter, Henrik; Lundström, Sebastian; Kollberg, Linnea; Kerekes, Nora; Palm, Camilla; Carlström, Eva; Långström, Niklas; Magnusson, Patrik K E; Halldner, Linda; Bölte, Sven; Gillberg, Christopher; Gumpert, Clara; Råstam, Maria; Lichtenstein, Paul

    2011-12-01

    The Child and Adolescent Twin Study in Sweden (CATSS) is an ongoing longitudinal twin study targeting all twins born in Sweden since July 1, 1992. Since 2004, parents of twins are interviewed regarding the children's somatic and mental health and social environment in connection with their 9th or 12th birthdays (CATSS-9/12). By January 2010, 8,610 parental interviews concerning 17,220 twins had been completed, with an overall response rate of 80%. At age 15 (CATSS-15) and 18 (CATSS-18), twins and parents complete questionnaires that, in addition to assessments of somatic and mental health, include measures of personality development and psychosocial adaptation. Twin pairs in CATSS-9/12 with one or both twins screening positive for autism spectrum disorders, attention deficit/hyperactivity disorder, tic disorders, developmental coordination disorder, learning disorders, oppositional defiant disorder, conduct disorder, obsessive-compulsive disorder, and/or eating problems have been followed with in-depth questionnaires on family, social environment and personality, and subsequently by clinical assessments at age 15 together with randomly selected population controls, including 195 clinically assessed twin pairs from the first 2 year cohorts (CATSS-15/DOGSS). This article describes the cohorts and study groups, data collection, and measures used. Prevalences, distributions, heritability estimates, ages at onset, and sex differences of mental health problems in the CATSS-9/12, that were analyzed and found to be overall comparable to those of other clinical and epidemiological studies. The CATSS study has the potential of answering important questions on the etiology of childhood mental health problems and their role in the development of later adjustment problems.

  18. Base pair mismatches and carcinogen-modified bases in DNA: an NMR study of G x T and G x O4meT pairing in dodecanucleotide duplexes

    International Nuclear Information System (INIS)

    Kalnik, M.W.; Kouchakdjian, M.; Li, B.F.L.; Swann, P.F.; Patel, D.J.

    1988-01-01

    High-resolution two-dimensional NMR studies have been completed on the self-complementary d(C-G-C-G-A-G-C-T-T-G-C-G) duplex (designated G x T 12-mer) and the self-complementary d(C-G-C-G-A-G-C-T-O 4 meT-G-C-G) duplex (designated G x O 4 meT 12-mer) containing G x T and G x O 4 meT pairs at identical positions four base pairs in from either end of the duplex. The exchangeable and nonexchangeable proton resonances have been assigned from an analysis of two-dimensional nuclear Overhauser enhancement (NOESY) spectra for the G x T 12-mer and G x O 4 meT 12-mer duplexes in H 2 O and D 2 O solution. The guanosine and thymidine imino protons in the G x T mismatch resonate at 10.57 and 11.98 ppm, respectively, and exhibit a strong NOE between themselves and to imino protons of flanking base pairs in the G x T 12-mer duplex. The large upfield chemical shift of this proton relative to that of the imino proton resonance of G in the G x T mismatch or in G x C base pairs indicates that hydrogen bonding to O 4 meT is either very weak or absent. This guanosine imino proton has an NOE to the OCH 3 group of O 4 meT across the pair and NOEs to the imino protons of flanking base pairs. Taken together with data from the NMR of nonexchangeable protons, this shows that both G and O 4 meT have anti-glycosidic torsion angles and are stacked into the duplex. Comparison of the intensity of the NOEs between the guanosine imino proton and the OCH 3 of O 4 meT as well as other protons in its vicinity demonstrates that the OCH 3 group of O 4 meT adopts the syn orientation with respect to N3 of the methylated thymidine. The authors propose an alternate base pairing mode stabilized by one short hydrogen bond between the 2-amino group of guanosine and the 2-carbonyl group of O 4 met

  19. Supramolecular Switches Based on the Guanine–Cytosine (GC) Watson–Crick Pair: Effect of Neutral and Ionic Substituents

    NARCIS (Netherlands)

    Guerra, C.F.; van der Wijst, T.; Bickelhaupt, F.M.

    2006-01-01

    We have theoretically analyzed Watson–Crick guanine–cytosine (GC) base pairs in which purine-C8 and/or pyrimidine-C6 positions carry a substituent X = NH−, NH2, NH3+ (N series), O−, OH, or OH2+ (O series), using the generalized gradient approximation (GGA) of density functional theory at the

  20. Higher order structural effects stabilizing the reverse watson-crick guanine-cytosine base pair in functional RNAs

    KAUST Repository

    Chawla, Mohit; Abdel-Azeim, Safwat; Oliva, Romina; Cavallo, Luigi

    2013-01-01

    of the Guanine can increase its stability. Herein, we extend our survey and report on other H-bonding interactions that can increase the stability of this base pair. To this aim, we performed a bioinformatics search of the PDB to locate all the occurencies of G

  1. A 3-base pair deletion, c.9711_9713del, in DMD results in intellectual disability without muscular dystrophy

    NARCIS (Netherlands)

    Brouwer, A.P.M. de; Nabuurs, S.B.; Verhaart, I.E.; Oudakker, A.R.; Hordijk, R.; Yntema, H.G.; Hordijk-Hos, J.M.; Voesenek, K.E.; Vries, B. de; Essen, T. van; Chen, W.; Hu, H; Chelly, J.; Dunnen, J.T. den; Kalscheuer, V.M.M.; Aartsma-Rus, A.M.; Hamel, B.C.J.; Bokhoven, H. van; Kleefstra, T.

    2014-01-01

    We have identified a deletion of 3 base pairs in the dystrophin gene (DMD), c.9711_9713del, in a family with nonspecific X-linked intellectual disability (ID) by sequencing of the exons of 86 known X-linked ID genes. This in-frame deletion results in the deletion of a single-amino-acid residue,

  2. Geminal phosphorus/aluminum-based frustrated Lewis pairs: C-H versus C≡C activation and CO2 fixation

    NARCIS (Netherlands)

    Appelt, C.; Westenberg, H.; Bertini, F.; Ehlers, A.W.; Slootweg, J.C.; Lammertsma, K.; Uhl, W.

    2011-01-01

    Catch it! Geminal phosphorus/aluminum-based frustrated Lewis pairs (FLPs) are easily obtained by hydroalumination of alkynylphosphines. These FLPs can activate terminal acetylenes by two competitive pathways, which were analyzed by DFT calculations, and they can bind carbon dioxide reversibly.

  3. Photoinduced electron transfer in a Watson-Crick base-paired, 2-aminopurine:uracil-C60 hydrogen bonding conjugate.

    Science.gov (United States)

    D'Souza, Francis; Gadde, Suresh; Islam, D-M Shafiqul; Pang, Siew-Cheng; Schumacher, Amy Lea; Zandler, Melvin E; Horie, Rumiko; Araki, Yasuyaki; Ito, Osamu

    2007-02-07

    A fluorescent reporter molecule, 2-aminopurine was self-assembled via Watson-Crick base-pairing to a uracil appended fullerene to form a donor-acceptor conjugate; efficient photoinduced charge separation was confirmed by time-resolved emission and transient absorption spectral studies.

  4. Identification of a two base pair deletion in five unrelated families with adrenoleukodystrophy: a possible hot spot for mutations

    NARCIS (Netherlands)

    Kemp, S.; Ligtenberg, M. J.; van Geel, B. M.; Barth, P. G.; Wolterman, R. A.; Schoute, F.; Sarde, C. O.; Mandel, J. L.; van Oost, B. A.; Bolhuis, P. A.

    1994-01-01

    The gene for X-linked adrenoleukodystrophy (ALD) was recently identified. Intragenic deletions of several kilobases were found in about 7% of patients. Point mutations, expected to be very heterogeneous, were identified so far in only two patients. We report the identification of a two base pair

  5. Sleep-EEG in dizygotic twins discordant for Williams syndrome.

    Science.gov (United States)

    Bódizs, Róbert; Gombos, Ferenc; Szocs, Katalin; Réthelyi, János M; Gerván, Patrícia; Kovács, Ilona

    2014-01-30

    Reports on twin pairs concordant and discordant for Williams syndrome were published before, but no study unravelled sleep physiology in these cases yet. We aim to fill this gap by analyzing sleep records of a twin pair discordant for Williams syndrome extending our focus on presleep wakefulness and sleep spindling. We performed multiplex ligation-dependent probe amplification of the 7q11.23 region of a 17 years old dizygotic opposite-sex twin pair discordant for Williams syndrome. Polysomnography of laboratory sleep at this age was analyzed and followed-up after 1.5 years by ambulatory polysomnography. Sleep stages scoring, EEG power spectra and sleep spindle analyses were carried out. The twin brother showed reduced levels of amplification for all of the probes in the 7q11.23 region indicating a typical deletion spanning at least 1.038 Mb between FKBP6 and CLIP2. The results of the twin sister showed normal copy numbers in the investigated region. Lower sleep times and efficiencies, as well as higher slow wave sleep percents of the twin brother were evident during both recordings. Roughly equal NREM, Stage 2 and REM sleep percents were found. EEG analyses revealed state and derivation-independent decreases in alpha power, lack of an alpha spectral peak in presleep wakefulness, as well as higher NREM sleep sigma peak frequency in the twin brother. Faster sleep spindles with lower amplitude and shorter duration characterized the records of the twin brother. Spectra show a striking reliability and correspondence between the two situations (laboratory vs. home records). Alterations in sleep and specific neural oscillations including the alpha/sigma waves are inherent aspects of Williams syndrome.

  6. Enhancing GMI properties of melt-extracted Co-based amorphous wires by twin-zone Joule annealing

    Energy Technology Data Exchange (ETDEWEB)

    Liu, J.S.; Cao, F.Y.; Xing, D.W.; Zhang, L.Y. [School of Materials Science and Engineering, Harbin Institute of Technology, Harbin 150001 (China); Qin, F.X. [Advanced Composite Center for Innovation and Science (ACCIS), Department of Aerospace Engineering, University of Bristol, University Walk, Bristol BS8 1TR (United Kingdom); Peng, H.X. [Advanced Composite Center for Innovation and Science (ACCIS), Department of Aerospace Engineering, University of Bristol, University Walk, Bristol BS8 1TR (United Kingdom); Centre for Nanoscience and Quantum Information, University of Bristol, Tyndall Avenue, Bristol BS8 1FD (United Kingdom); Xue, X. [School of Materials Science and Engineering, Harbin Institute of Technology, Harbin 150001 (China); Sun, J.F., E-mail: jfsun_hit@263.net [School of Materials Science and Engineering, Harbin Institute of Technology, Harbin 150001 (China)

    2012-11-15

    Highlights: Black-Right-Pointing-Pointer GMI effect is closely related to annealed microstructures observed by HRTEM. Black-Right-Pointing-Pointer Twin-zone Joule-heated annealing (TJHA) as a novel effective annealing treatment. Black-Right-Pointing-Pointer TJHA wires have relatively larger GMI ratio and field sensitivity. Black-Right-Pointing-Pointer From HRTEM perspective to explain the GMI peaks feature of different states wires. Black-Right-Pointing-Pointer TJHA wires are useful for high-resolution magnetic sensor applications. - Abstract: The influence of twin-zone Joule annealing (TJA) on the microstructure and magnetic properties of melt-extracted Co{sub 68.2}Fe{sub 4.3}B{sub 15}Si{sub 12.5} amorphous microwires has been investigated. Experimental results indicated that twin-zone Joule annealing treatment improved the GMI property of as-cast wires to a greater extent comparing with Joule annealing (JA) and conventional vacuum annealing (CVA) techniques. At 15 MHz, e.g., the maximum GMI ratio [{Delta}Z/Z{sub 0}]{sub max} of a TJA wire increases to 104.29%, which is more than 5 times of 20.49% for the as-cast wire, nearly two times of 56.47% for the JA wire, while the CVA wire has a decreased GMI ratio; the field response sensitivity of the TJA wire increased to 171.62%/Oe from 80.32%/Oe for the as-cast wire, exceeding the values of 140.76%/Oe for the JA wire and of 39.17%/Oe for the CVA wire. The stress or structural relaxation in TJA wire increases circumferential permeability, and magnetic moment achieves a critical state of excitation for overcoming eddy-current damping or 'nail-sticked' action in rotational magnetization process at relatively high frequency. From the microstructural point of view, the role of regularly arranged atomic micro-regions (RAAM) and of medium range order region (MROR) determines the efficiency of various annealing techniques. Conclusively, TJA is established as an efficient annealing technique to enhance the GMI effect

  7. A longitudinal twin study of the association between childhood autistic traits and psychotic experiences in adolescence

    OpenAIRE

    Taylor, Mark J.; Robinson, Elise B.; Happ?, Francesca; Bolton, Patrick; Freeman, Daniel; Ronald, Angelica

    2015-01-01

    Background: This twin study investigated whether autistic traits during childhood were associated with adolescent psychotic experiences. Methods: Data were collected from a community sample of approximately 5000 twin pairs, which included 32 individuals with diagnosed autism spectrum conditions (ASC). Parents rated autistic traits in the twins at four points between ages 8–16 years. Positive, negative, and cognitive psychotic experiences were assessed at age 16 years using self- and parent-re...

  8. A TWIN STUDY OF SCHIZOAFFECTIVE-MANIA, SCHIZOAFFECTIVE-DEPRESSION AND OTHER PSYCHOTIC SYNDROMES

    OpenAIRE

    Cardno, Alastair G; Rijsdijk, Frühling V; West, Robert M; Gottesman, Irving I; Craddock, Nick; Murray, Robin M; McGuffin, Peter

    2011-01-01

    The nosological status of schizoaffective disorders remains controversial. Twin studies are potentially valuable for investigating relationships between schizoaffective-mania, schizoaffective-depression and other psychotic syndromes, but no such study has yet been reported. We ascertained 224 probandwise twin pairs (106 monozygotic, 118 same-sex dizygotic), where probands had psychotic or manic symptoms, from the Maudsley Twin Register in London (1948–1993). We investigated Research Diagnosti...

  9. Laying the ghost of twin paradox

    Directory of Open Access Journals (Sweden)

    Popović Marko

    2009-01-01

    Full Text Available Someone's true age is not written in his ID, but in his biomarkers. Aging process is not caused by time passing, but by thermodynamically laws. Entropy, extent of metabolic reaction, and temperature are Lorentz invariant, so these facts make twin paradox impossible because there is no way for one twin to age slower than the other even if the time in his frame is dilated. Entropy is the function of state, not time. So as much as standard thermodynamics concerns, the path between two points in space is equivalent to the path between two states. Whether the point B is reached by moving faster using the longer way (with time dilatation, or slower by using shortcut (without time dilatation, the state of the system after completing the road should be the same. This is supported by the fact that when two twins reach the same space-time point (point B in which the state parameters are the same. If we use entropy as an age parameter, then both twins have the same entropy value and are exactly the same biological age. Therefore, the twin paradox is a logical mistake based on wrong first premise. Bergson symmetry is not necessary any more to explain the impossibility of twin paradox.

  10. The Mid-Atlantic Twin Registry, revisited.

    Science.gov (United States)

    Lilley, Emily C H; Silberg, Judy L

    2013-02-01

    The Mid-Atlantic Twin Registry (MATR) is a population-based registry of more than 56,000 twins primarily born or living in Virginia, North Carolina, and South Carolina. The MATR employs several methods of ascertaining twins, and devotes considerable resources to tracking and maintaining communication with MATR participants. Researchers may utilize the MATR for administration of research services including study recruitment, collection of DNA, archival data set creation, as well as data collection through mailed, phone, or online surveys. In addition, the MATR houses the MATR Repository, with over 1,200 blood samples available for researchers interested in DNA genotyping. For over 35 years MATR twins have participated in research studies with investigators from diverse scientific disciplines and various institutions. These studies, which have resulted in numerous publications, have covered a range of topics, including the human microbiome, developmental psychopathology, depression, anxiety, substance use, epigenetics of aging, children of twins, pre-term birth, social attitudes, seizures, eating disorders, as well as sleep homeostasis. Researchers interested in utilizing twins are encouraged to contact the MATR to discuss potential research opportunities.

  11. On the conformational stability of the smallest RNA kissing complexes maintained through two G·C base pairs

    International Nuclear Information System (INIS)

    Chu, Wally; Weerasekera, Akila; Kim, Chul-Hyun

    2017-01-01

    Two identical 5′GACG3′ tetra-loop motifs with different stem sequences (called H2 and H3) are found in the 5′ end region of Moloney Murine Leukemia Virus (MMLV) genomic RNA. They play important roles in RNA dimerization and encapsidation through two identical tetra-loops (5′GACG3′) forming a loop-to-loop kissing complex, the smallest RNA kissing complex ever found in nature. We examined the effects of a loop-closing base pair as well as a stem sequence on the conformational stability of the kissing complex. UV melting analysis and gel electrophoresis were performed on eight RNA sequences mimicking the H2 and H3 hairpin tetra-loops with variation in loop-closing base pairs. Our results show that changing the loop-closing base pair from the wildtype (5′A·U3′ for H3, 5′U·A3′ for H2) to 5′G·C3’/5′C·G3′ has significant effect on the stability of the kissing complexes: the substitution to 5′C·G3′ significantly decreases both thermal and mechanical stability, while switching to the 5′G·C3′ significantly increases the mechanical stability only. The kissing complexes with the wildtype loop-closing base pairs (5′A·U3′ for H3 and 5′U·A3′ for H2) show different stability when attached to a different stem sequence (H2 stem vs. H3 stem). This suggests that not only the loop-closing base pair itself, but also the stem sequence, affects the conformational stability of the RNA kissing complex. - Highlights: • Thermodynamic parameters of the smallest RNA kissing interactions were measured. • The effects of loop-closing base pairs on the RNA kissing complex was investigated. • Changing the base pair to 5′CG3′ decreases the stability of the kissing complex. • Changing it to 5′GC3′ increases the mechanical resilience of the kissing complex. • Difference in its stem sequence also affects the stability of the kissing complex.

  12. High-Resolution Crystal Structure of a Silver(I)-RNA Hybrid Duplex Containing Watson-Crick-like C-Silver(I)-C Metallo-Base Pairs.

    Science.gov (United States)

    Kondo, Jiro; Tada, Yoshinari; Dairaku, Takenori; Saneyoshi, Hisao; Okamoto, Itaru; Tanaka, Yoshiyuki; Ono, Akira

    2015-11-02

    Metallo-base pairs have been extensively studied for applications in nucleic acid-based nanodevices and genetic code expansion. Metallo-base pairs composed of natural nucleobases are attractive because nanodevices containing natural metallo-base pairs can be easily prepared from commercially available sources. Previously, we have reported a crystal structure of a DNA duplex containing T-Hg(II)-T base pairs. Herein, we have determined a high-resolution crystal structure of the second natural metallo-base pair between pyrimidine bases C-Ag(I)-C formed in an RNA duplex. One Ag(I) occupies the center between two cytosines and forms a C-Ag(I)-C base pair through N3-Ag(I)-N3 linear coordination. The C-Ag(I)-C base pair formation does not disturb the standard A-form conformation of RNA. Since the C-Ag(I)-C base pair is structurally similar to the canonical Watson-Crick base pairs, it can be a useful building block for structure-based design and fabrication of nucleic acid-based nanodevices. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  13. Natural history of disease in atomic bomb exposed twins in Hiroshima

    International Nuclear Information System (INIS)

    Satow, Yukio; Ohmae, Kiyokazu; Okamoto, Naomasa; Abe, Tsutomu; Watanabe, Shoji

    1982-01-01

    The subjects of this study are mainly pairs of monozygotic twins, one of whom was exposed to the atomic bomb and the other not exposed, and the natural history of the diseases of these twins was analyzed to find out genetic and environmental factors of the diseases and some biological effect of the atomic bomb exposure or other. In this study, 13 pairs of monozygotic and 5 pairs of dizygotic twins and other 34 cases of non-twins were examined by means of heart and lung X-ray films and electrocardiograms. The results suggest that most of the monozygotic twins show the similar findings of chest X-ray films, though their electrocardiograms have a tendency to deviate to the left in the QRS axis. These findings will not be enough to clear up the relation between the atomic bomb exposed and the abnormal electrocardiograms. (author)

  14. Fractal and twin SVM-based handgrip recognition for healthy subjects and trans-radial amputees using myoelectric signal.

    Science.gov (United States)

    Arjunan, Sridhar Poosapadi; Kumar, Dinesh Kant; Jayadeva J

    2016-02-01

    Identifying functional handgrip patterns using surface electromygram (sEMG) signal recorded from amputee residual muscle is required for controlling the myoelectric prosthetic hand. In this study, we have computed the signal fractal dimension (FD) and maximum fractal length (MFL) during different grip patterns performed by healthy and transradial amputee subjects. The FD and MFL of the sEMG, referred to as the fractal features, were classified using twin support vector machines (TSVM) to recognize the handgrips. TSVM requires fewer support vectors, is suitable for data sets with unbalanced distributions, and can simultaneously be trained for improving both sensitivity and specificity. When compared with other methods, this technique resulted in improved grip recognition accuracy, sensitivity, and specificity, and this improvement was significant (κ=0.91).

  15. Digital Twins in Health Care: Ethical Implications of an Emerging Engineering Paradigm.

    Science.gov (United States)

    Bruynseels, Koen; Santoni de Sio, Filippo; van den Hoven, Jeroen

    2018-01-01

    Personalized medicine uses fine grained information on individual persons, to pinpoint deviations from the normal. 'Digital Twins' in engineering provide a conceptual framework to analyze these emerging data-driven health care practices, as well as their conceptual and ethical implications for therapy, preventative care and human enhancement. Digital Twins stand for a specific engineering paradigm, where individual physical artifacts are paired with digital models that dynamically reflects the status of those artifacts. When applied to persons, Digital Twins are an emerging technology that builds on in silico representations of an individual that dynamically reflect molecular status, physiological status and life style over time. We use Digital Twins as the hypothesis that one would be in the possession of very detailed bio-physical and lifestyle information of a person over time. This perspective redefines the concept of 'normality' or 'health,' as a set of patterns that are regular for a particular individual , against the backdrop of patterns observed in the population. This perspective also will impact what is considered therapy and what is enhancement, as can be illustrated with the cases of the 'asymptomatic ill' and life extension via anti-aging medicine. These changes are the consequence of how meaning is derived, in case measurement data is available. Moral distinctions namely may be based on patterns found in these data and the meanings that are grafted on these patterns. Ethical and societal implications of Digital Twins are explored. Digital Twins imply a data-driven approach to health care. This approach has the potential to deliver significant societal benefits, and can function as a social equalizer, by allowing for effective equalizing enhancement interventions. It can as well though be a driver for inequality, given the fact that a Digital Twin might not be an accessible technology for everyone, and given the fact that patterns identified across a

  16. Ultraviolet Absorption Induces Hydrogen-Atom Transfer in G⋅C Watson-Crick DNA Base Pairs in Solution.

    Science.gov (United States)

    Röttger, Katharina; Marroux, Hugo J B; Grubb, Michael P; Coulter, Philip M; Böhnke, Hendrik; Henderson, Alexander S; Galan, M Carmen; Temps, Friedrich; Orr-Ewing, Andrew J; Roberts, Gareth M

    2015-12-01

    Ultrafast deactivation pathways bestow photostability on nucleobases and hence preserve the structural integrity of DNA following absorption of ultraviolet (UV) radiation. One controversial recovery mechanism proposed to account for this photostability involves electron-driven proton transfer (EDPT) in Watson-Crick base pairs. The first direct observation is reported of the EDPT process after UV excitation of individual guanine-cytosine (G⋅C) Watson-Crick base pairs by ultrafast time-resolved UV/visible and mid-infrared spectroscopy. The formation of an intermediate biradical species (G[-H]⋅C[+H]) with a lifetime of 2.9 ps was tracked. The majority of these biradicals return to the original G⋅C Watson-Crick pairs, but up to 10% of the initially excited molecules instead form a stable photoproduct G*⋅C* that has undergone double hydrogen-atom transfer. The observation of these sequential EDPT mechanisms across intermolecular hydrogen bonds confirms an important and long debated pathway for the deactivation of photoexcited base pairs, with possible implications for the UV photochemistry of DNA. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  17. Indigenous Manufacturing realization of TWIN Source

    Science.gov (United States)

    Pandey, R.; Bandyopadhyay, M.; Parmar, D.; Yadav, R.; Tyagi, H.; Soni, J.; Shishangiya, H.; Sudhir Kumar, D.; Shah, S.; Bansal, G.; Pandya, K.; Parmar, K.; Vuppugalla, M.; Gahlaut, A.; Chakraborty, A.

    2017-04-01

    TWIN source is two RF driver based negative ion source that has been planned to bridge the gap between single driver based ROBIN source (currently operational) and eight river based DNB source (to be operated under IN-TF test facility). TWIN source experiments have been planned at IPR keeping the objective of long term domestic fusion programme to gain operational experiences on vacuum immersed multi driver RF based negative ion source. High vacuum compatible components of twin source are designed at IPR keeping an aim on indigenous built in attempt. These components of TWIN source are mainly stainless steel and OFC-Cu. Being high heat flux receiving components, one of the major functional requirements is continuous heat removal via water as cooling medium. Hence for the purpose stainless steel parts are provided with externally milled cooling lines and that shall be covered with a layer of OFC-cu which would be on the receiving side of high heat flux. Manufacturability of twin source components requires joining of these dissimilar materials via process like electrode position, electron beam welding and vacuum brazing. Any of these manufacturing processes shall give a vacuum tight joint having proper joint strength at operating temperature and pressure. Taking the indigenous development effort vacuum brazing (in non-nuclear environment) has been opted for joining of dissimilar materials of twin source being one of the most reliable joining techniques and commercially feasible across the suppliers of country. Manufacturing design improvisation for the components has been done to suit the vacuum brazing process requirement and to ease some of the machining without comprising over the functional and operational requirements. This paper illustrates the details on the indigenous development effort, design improvisation to suits manufacturability, vacuum brazing basics and its procedures for twin source components.

  18. Craniofacial morphology in Chinese female twins: a semi-longitudinal cephalometric study.

    Science.gov (United States)

    Peng, Jing; Deng, Hui; Cao, CaiFang; Ishikawa, Masaaki

    2005-12-01

    It would be of benefit to have a better understanding of the relative effects of genetics and environmental factors on craniofacial parameters when undertaking orthodontic therapy and treatment planning. However, there is a lack of such information in pre-adolescents. The aim of this study was to verify the degree of genetic and environmental contribution to the growth of the facial skeleton in twins aged 6 to 12 years. The material comprised the lateral cephalograms of 89 pairs of female twins in Beijing, China, of whom 61 pairs were diagnosed by DNA analysis as monozygotic (MZ) and 28 pairs as dizygotic (DZ). Four main groups (with a starting age of 6, 7, 9 and 11 years) were studied in a semi-longitudinal manner, with a sub-group further investigated for 2-4 consecutive years. The total sample therefore consisted of 183 pairs (MZ 110, DZ 73) aged from 6 to 12 years. The depths of the cranial base, mid and lower face were measured, as well as anterior and posterior face height. A two-tailed t-test showed significant environmental effects on lower face depth (P < 0.01), whilst genetic effects on face height were also significant (P < 0.01). The results suggest that early orthodontic intervention would have a greater influence on the antero-posterior rather than on the vertical plane of growth.

  19. Adjusted Wald Confidence Interval for a Difference of Binomial Proportions Based on Paired Data

    Science.gov (United States)

    Bonett, Douglas G.; Price, Robert M.

    2012-01-01

    Adjusted Wald intervals for binomial proportions in one-sample and two-sample designs have been shown to perform about as well as the best available methods. The adjusted Wald intervals are easy to compute and have been incorporated into introductory statistics courses. An adjusted Wald interval for paired binomial proportions is proposed here and…

  20. Rationale, Design, and Methodological Aspects of the BUDAPEST-GLOBAL Study (Burden of Atherosclerotic Plaques Study in Twins-Genetic Loci and the Burden of Atherosclerotic Lesions).

    Science.gov (United States)

    Maurovich-Horvat, Pál; Tárnoki, Dávid L; Tárnoki, Ádám D; Horváth, Tamás; Jermendy, Ádám L; Kolossváry, Márton; Szilveszter, Bálint; Voros, Viktor; Kovács, Attila; Molnár, Andrea Á; Littvay, Levente; Lamb, Hildo J; Voros, Szilard; Jermendy, György; Merkely, Béla

    2015-12-01

    The heritability of coronary atherosclerotic plaque burden, coronary geometry, and phenotypes associated with increased cardiometabolic risk are largely unknown. The primary aim of the Burden of Atherosclerotic Plaques Study in Twins-Genetic Loci and the Burden of Atherosclerotic Lesions (BUDAPEST-GLOBAL) study is to evaluate the influence of genetic and environmental factors on the burden of coronary artery disease. By design this is a prospective, single-center, classical twin study. In total, 202 twins (61 monozygotic pairs, 40 dizygotic same-sex pairs) were enrolled from the Hungarian Twin Registry database. All twins underwent non-contrast-enhanced computed tomography (CT) for the detection and quantification of coronary artery calcium and for the measurement of epicardial fat volumes. In addition, a single non-contrast-enhanced image slice was acquired at the level of L3-L4 to assess abdominal fat distribution. Coronary CT angiography was used for the detection and quantification of plaque, stenosis, and overall coronary artery disease burden. For the primary analysis, we will assess the presence and volume of atherosclerotic plaques. Furthermore, the 3-dimensional coronary geometry will be assessed based on the coronary CT angiography datasets. Additional phenotypic analyses will include per-patient epicardial and abdominal fat quantity measurements. Measurements obtained from monozygotic and dizygotic twin pairs will be compared to evaluate the genetic or environmental effects of the given phenotype. The BUDAPEST-GLOBAL study provides a unique framework to shed some light on the genetic and environmental influences of cardiometabolic disorders. © 2015 Wiley Periodicals, Inc.

  1. Classification between normal and tumor tissues based on the pair-wise gene expression ratio

    International Nuclear Information System (INIS)

    Yap, YeeLeng; Zhang, XueWu; Ling, MT; Wang, XiangHong; Wong, YC; Danchin, Antoine

    2004-01-01

    Precise classification of cancer types is critically important for early cancer diagnosis and treatment. Numerous efforts have been made to use gene expression profiles to improve precision of tumor classification. However, reliable cancer-related signals are generally lacking. Using recent datasets on colon and prostate cancer, a data transformation procedure from single gene expression to pair-wise gene expression ratio is proposed. Making use of the internal consistency of each expression profiling dataset this transformation improves the signal to noise ratio of the dataset and uncovers new relevant cancer-related signals (features). The efficiency in using the transformed dataset to perform normal/tumor classification was investigated using feature partitioning with informative features (gene annotation) as discriminating axes (single gene expression or pair-wise gene expression ratio). Classification results were compared to the original datasets for up to 10-feature model classifiers. 82 and 262 genes that have high correlation to tissue phenotype were selected from the colon and prostate datasets respectively. Remarkably, data transformation of the highly noisy expression data successfully led to lower the coefficient of variation (CV) for the within-class samples as well as improved the correlation with tissue phenotypes. The transformed dataset exhibited lower CV when compared to that of single gene expression. In the colon cancer set, the minimum CV decreased from 45.3% to 16.5%. In prostate cancer, comparable CV was achieved with and without transformation. This improvement in CV, coupled with the improved correlation between the pair-wise gene expression ratio and tissue phenotypes, yielded higher classification efficiency, especially with the colon dataset – from 87.1% to 93.5%. Over 90% of the top ten discriminating axes in both datasets showed significant improvement after data transformation. The high classification efficiency achieved suggested

  2. 'Twin2twin' an innovative method of empowering midwives to strengthen their professional midwifery organisations.

    Science.gov (United States)

    Cadée, Franka; Perdok, Hilde; Sam, Betty; de Geus, Myrte; Kweekel, Liselotte

    2013-10-01

    midwives need professional support from a national midwifery organisation to be able to provide the services that are by regulatory mechanisms and accreditation expected of them. Not all midwives in the world are united in a professional organisation. The aim of this project was to strengthen the midwifery organisations of Sierra Leone and the Netherlands. During the process of the project it was realised that the development of a platform of exchange at organisational level would be enhanced by introducing personal exchange between individual midwives. In response to this new insight the original project plan was adjusted by incorporating the twin2twin method. twin2twin is a feminist methodology of mutual exchange between twenty pairs of midwives from different organisations (in this case Sierra Leone and the Netherlands). The method can be distinguished by 10 specific steps. It was developed, used and (re)evaluated through focus group discussions, storytelling and written evaluations. twinning of organisations was strengthened by adding a human component to the process. With the use of the 'twin2twin' method, midwives were encouraged to invested in a professional and personal bond with their 'twin sister'. This bond was independent and went beyond the relatively short four year project period. Through personal engagement and mutual exchange of knowledge and skills, midwives empowered each other to build and strengthen their midwifery organisations both in Sierra Leone and the Netherlands. (Empowerment refers to the expansion in people's ability to make strategic life choices in a context where this ability was previously denied to them (Narayan, 2005); organisational empowerment includes processes and structures that enhance members' skills and provides them with the mutual support necessary to effect community level change (Zimmerman, 1995).). despite challenges we are convinced that twin2twin can be of additional benefit for the success of other projects

  3. Education in Twins and Their Parents Across Birth Cohorts Over 100 years: An Individual-Level Pooled Analysis of 42-Twin Cohorts.

    Science.gov (United States)

    Silventoinen, Karri; Jelenkovic, Aline; Latvala, Antti; Sund, Reijo; Yokoyama, Yoshie; Ullemar, Vilhelmina; Almqvist, Catarina; Derom, Catherine A; Vlietinck, Robert F; Loos, Ruth J F; Kandler, Christian; Honda, Chika; Inui, Fujio; Iwatani, Yoshinori; Watanabe, Mikio; Rebato, Esther; Stazi, Maria A; Fagnani, Corrado; Brescianini, Sonia; Hur, Yoon-Mi; Jeong, Hoe-Uk; Cutler, Tessa L; Hopper, John L; Busjahn, Andreas; Saudino, Kimberly J; Ji, Fuling; Ning, Feng; Pang, Zengchang; Rose, Richard J; Koskenvuo, Markku; Heikkilä, Kauko; Cozen, Wendy; Hwang, Amie E; Mack, Thomas M; Siribaddana, Sisira H; Hotopf, Matthew; Sumathipala, Athula; Rijsdijk, Fruhling; Sung, Joohon; Kim, Jina; Lee, Jooyeon; Lee, Sooji; Nelson, Tracy L; Whitfield, Keith E; Tan, Qihua; Zhang, Dongfeng; Llewellyn, Clare H; Fisher, Abigail; Burt, S Alexandra; Klump, Kelly L; Knafo-Noam, Ariel; Mankuta, David; Abramson, Lior; Medland, Sarah E; Martin, Nicholas G; Montgomery, Grant W; Magnusson, Patrik K E; Pedersen, Nancy L; Dahl Aslan, Anna K; Corley, Robin P; Huibregtse, Brooke M; Öncel, Sevgi Y; Aliev, Fazil; Krueger, Robert F; McGue, Matt; Pahlen, Shandell; Willemsen, Gonneke; Bartels, Meike; van Beijsterveldt, Catharina E M; Silberg, Judy L; Eaves, Lindon J; Maes, Hermine H; Harris, Jennifer R; Brandt, Ingunn; Nilsen, Thomas S; Rasmussen, Finn; Tynelius, Per; Baker, Laura A; Tuvblad, Catherine; Ordoñana, Juan R; Sánchez-Romera, Juan F; Colodro-Conde, Lucia; Gatz, Margaret; Butler, David A; Lichtenstein, Paul; Goldberg, Jack H; Harden, K Paige; Tucker-Drob, Elliot M; Duncan, Glen E; Buchwald, Dedra; Tarnoki, Adam D; Tarnoki, David L; Franz, Carol E; Kremen, William S; Lyons, Michael J; Maia, José A; Freitas, Duarte L; Turkheimer, Eric; Sørensen, Thorkild I A; Boomsma, Dorret I; Kaprio, Jaakko

    2017-10-01

    Whether monozygotic (MZ) and dizygotic (DZ) twins differ from each other in a variety of phenotypes is important for genetic twin modeling and for inferences made from twin studies in general. We analyzed whether there were differences in individual, maternal and paternal education between MZ and DZ twins in a large pooled dataset. Information was gathered on individual education for 218,362 adult twins from 27 twin cohorts (53% females; 39% MZ twins), and on maternal and paternal education for 147,315 and 143,056 twins respectively, from 28 twin cohorts (52% females; 38% MZ twins). Together, we had information on individual or parental education from 42 twin cohorts representing 19 countries. The original education classifications were transformed to education years and analyzed using linear regression models. Overall, MZ males had 0.26 (95% CI [0.21, 0.31]) years and MZ females 0.17 (95% CI [0.12, 0.21]) years longer education than DZ twins. The zygosity difference became smaller in more recent birth cohorts for both males and females. Parental education was somewhat longer for fathers of DZ twins in cohorts born in 1990-1999 (0.16 years, 95% CI [0.08, 0.25]) and 2000 or later (0.11 years, 95% CI [0.00, 0.22]), compared with fathers of MZ twins. The results show that the years of both individual and parental education are largely similar in MZ and DZ twins. We suggest that the socio-economic differences between MZ and DZ twins are so small that inferences based upon genetic modeling of twin data are not affected.

  4. Investigations on therapeutic glucocerebrosidases through paired detection with fluorescent activity-based probes.

    Directory of Open Access Journals (Sweden)

    Wouter W Kallemeijn

    Full Text Available Deficiency of glucocerebrosidase (GBA causes Gaucher disease (GD. In the common non-neuronopathic GD type I variant, glucosylceramide accumulates primarily in the lysosomes of visceral macrophages. Supplementing storage cells with lacking enzyme is accomplished via chronic intravenous administration of recombinant GBA containing mannose-terminated N-linked glycans, mediating the selective uptake by macrophages expressing mannose-binding lectin(s. Two recombinant GBA preparations with distinct N-linked glycans are registered in Europe for treatment of type I GD: imiglucerase (Genzyme, contains predominantly Man(3 glycans, and velaglucerase (Shire PLC Man(9 glycans. Activity-based probes (ABPs enable fluorescent labeling of recombinant GBA preparations through their covalent attachment to the catalytic nucleophile E340 of GBA. We comparatively studied binding and uptake of ABP-labeled imiglucerase and velaglucerase in isolated dendritic cells, cultured human macrophages and living mice, through simultaneous detection of different GBAs by paired measurements. Uptake of ABP-labeled rGBAs by dendritic cells was comparable, as well as the bio-distribution following equimolar intravenous administration to mice. ABP-labeled rGBAs were recovered largely in liver, white-blood cells, bone marrow and spleen. Lungs, brain and skin, affected tissues in severe GD types II and III, were only poorly supplemented. Small, but significant differences were noted in binding and uptake of rGBAs in cultured human macrophages, in the absence and presence of mannan. Mannan-competed binding and uptake were largest for velaglucerase, when determined with single enzymes or as equimolar mixtures of both enzymes. Vice versa, imiglucerase showed more prominent binding and uptake not competed by mannan. Uptake of recombinant GBAs by cultured macrophages seems to involve multiple receptors, including several mannose-binding lectins. Differences among cells from different donors

  5. Web Camera Based Eye Tracking to Assess Visual Memory on a Visual Paired Comparison Task

    Directory of Open Access Journals (Sweden)

    Nicholas T. Bott

    2017-06-01

    Full Text Available Background: Web cameras are increasingly part of the standard hardware of most smart devices. Eye movements can often provide a noninvasive “window on the brain,” and the recording of eye movements using web cameras is a burgeoning area of research.Objective: This study investigated a novel methodology for administering a visual paired comparison (VPC decisional task using a web camera.To further assess this method, we examined the correlation between a standard eye-tracking camera automated scoring procedure [obtaining images at 60 frames per second (FPS] and a manually scored procedure using a built-in laptop web camera (obtaining images at 3 FPS.Methods: This was an observational study of 54 clinically normal older adults.Subjects completed three in-clinic visits with simultaneous recording of eye movements on a VPC decision task by a standard eye tracker camera and a built-in laptop-based web camera. Inter-rater reliability was analyzed using Siegel and Castellan's kappa formula. Pearson correlations were used to investigate the correlation between VPC performance using a standard eye tracker camera and a built-in web camera.Results: Strong associations were observed on VPC mean novelty preference score between the 60 FPS eye tracker and 3 FPS built-in web camera at each of the three visits (r = 0.88–0.92. Inter-rater agreement of web camera scoring at each time point was high (κ = 0.81–0.88. There were strong relationships on VPC mean novelty preference score between 10, 5, and 3 FPS training sets (r = 0.88–0.94. Significantly fewer data quality issues were encountered using the built-in web camera.Conclusions: Human scoring of a VPC decisional task using a built-in laptop web camera correlated strongly with automated scoring of the same task using a standard high frame rate eye tracker camera.While this method is not suitable for eye tracking paradigms requiring the collection and analysis of fine-grained metrics, such as

  6. Increased risk of type 2 diabetes in elderly twins

    DEFF Research Database (Denmark)

    Poulsen, Pernille; Grunnet, Louise G; Pilgaard, Kasper

    2009-01-01

    OBJECTIVE: Genetic susceptibility, low birth weight (LBW), and aging are key etiological factors in the development of type 2 diabetes. LBW is common among twins. It is unknown whether twin status per se is associated with risk of type 2 diabetes, and valid concordance rates of type 2 diabetes...... in twins on a lifetime perspective are lacking. RESEARCH DESIGN AND METHODS: A clinical study was done on a population-based cohort of same-sex elderly monozygotic (MZ) and dizygotic (DZ) twins (n = 297) and singleton control subjects (C) (n = 71) including measures of anthropometry and glucose tolerance...

  7. Twin Studies in Autism: What Might They Say about Genetic and Environmental Influences

    Science.gov (United States)

    Anderson, George M.

    2012-01-01

    Genetic and epigenetic differences exist within monozygote twin-pairs and might be especially important in the expression of autism. Assuming phenotypic differences between monozygotic twins are due to environmental influences may lead to mistaken conclusions regarding the relative genetic and environmental contribution to autism risk.

  8. Resemblances of Parents and Twins in Sport Participation and Heart Rate

    NARCIS (Netherlands)

    Boomsma, D.I.; van den Bree, M.B.; Orlebeke, J.F.; Molenaar, P.C.M.

    1989-01-01

    A model to analyze resemblances of twins and parents using LISREL is outlined and applied to sports participation and heart-rate data. Sports participation and heart rate were measured in 44 monozygotic and 46 dizygotic adolescent twin pairs and in their parents. Genetic factors influence variation

  9. Does the sex of one's co-twin affect height and BMI in adulthood?

    DEFF Research Database (Denmark)

    Bogl, Leonie H; Jelenkovic, Aline; Vuoksimaa, Eero

    2017-01-01

    BACKGROUND: The comparison of traits in twins from opposite-sex (OS) and same-sex (SS) dizygotic twin pairs is considered a proxy measure of prenatal hormone exposure. To examine possible prenatal hormonal influences on anthropometric traits, we compared mean height, body mass index (BMI), and th...

  10. The Application of Structural Equation Modeling to Maternal Ratings of Twins' Behavior and Emotional Problems.

    Science.gov (United States)

    Silberg, Judy L.; And Others

    1994-01-01

    Applied structural equation modeling to twin data to assess impact of genetic and environmental factors on children's behavioral and emotional functioning. Applied models to maternal ratings of behavior of 515 monozygotic and 749 dizygotic twin pairs. Importance of genetic, shared, and specific environmental factors for explaining variation was…

  11. Nephrolithiasis in identical twins: the impact of nature vs nurture.

    Science.gov (United States)

    Haleblian, George E; Cantor, David A; Sur, Roger L; Assimos, Dean G; Preminger, Glenn M

    2007-09-01

    To assess possible underlying metabolic abnormalities in three sets of monozygotic twins, to evaluate the interplay among the factors of kidney stone formation, a complex multifactorial process influenced by environmental, genetic and anatomical factors. Three sets of identical twins with either cystine or calcium oxalate stones were identified. Demographic data, medical histories and the results of 24-h urine testing, with samples collected on self-selected diets, were reviewed and analysed. The cystinuric twins had very similar cystine excretion rates, while stone activity was significantly more pronounced in one. Metabolic abnormalities were concordant in one set of twins with calcium oxalate stones, both being hypercalciuric and hyperuricosuric. However, metabolic abnormalities were discordant in the other pair, one twin with hypercalciuria and the other with hypocitraturia. Two of the three pairs had low urinary volume. These results support previous observations that environmental, genetic and potentially, anatomical factors play roles in kidney-stone formation. Additional controlled studies of monozygotic stone-forming twins might help to define the interplay between environmental and genetic factors, and allow the identification of susceptibility genes involved in stone generation.

  12. Contact ion pair formation between hard acids and soft bases in aqueous solutions observed with 2DIR spectroscopy.

    Science.gov (United States)

    Sun, Zheng; Zhang, Wenkai; Ji, Minbiao; Hartsock, Robert; Gaffney, Kelly J

    2013-12-12

    The interaction of charged species in aqueous solution has important implications for chemical, biological, and environmental processes. We have used 2DIR spectroscopy to study the equilibrium dynamics of thiocyanate chemical exchange between free ion (NCS(-)) and contact ion pair configurations (MNCS(+)), where M(2+) = Mg(2+) or Ca(2+). Detailed studies of the influence of anion concentration and anion speciation show that the chemical exchange observed with the 2DIR measurements results from NCS(-) exchanging with other anion species in the first solvation shell surrounding Mg(2+) or Ca(2+). The presence of chemical exchange in the 2DIR spectra provides an indirect, but robust, determinant of contact ion pair formation. We observe preferential contact ion pair formation between soft Lewis base anions and hard Lewis acid cations. This observation cannot be easily reconciled with Pearson's acid-base concept or Collins' Law of Matching Water Affinities. The anions that form contact ion pairs also correspond to the ions with an affinity for water and protein surfaces, so similar physical and chemical properties may control these distinct phenomena.

  13. Intense charge transfer surface based on graphene and thymine-Hg(II)-thymine base pairs for detection of Hg(2.).

    Science.gov (United States)

    Li, Jiao; Lu, Liping; Kang, Tianfang; Cheng, Shuiyuan

    2016-03-15

    In this article, we developed an electrochemiluminescence (ECL) sensor with a high-intensity charge transfer interface for Hg(2+) detection based on Hg(II)-induced DNA hybridization. The sensor was fabricated by the following simple method. First, graphene oxide (GO) was electrochemically reduced onto a glassy carbon electrode through cyclic voltammetry. Then, amino-labeled double-stranded (ds)DNA was assembled on the electrode surface using 1-pyrenebutyric acid N-hydroxysuccinimide as a linker between GO and DNA. The other terminal of dsDNA, which was labeled with biotin, was linked to CdSe quantum dots via biotin-avidin interactions. Reduced graphene oxide has excellent electrical conductivity. dsDNA with T-Hg(II)-T base pairs exhibited more facile charge transfer. They both accelerate the electron transfer performance and sensitivity of the sensor. The increased ECL signals were logarithmically linear with the concentration of Hg(II) when Hg(2+) was present in the detection solution. The linear range of the sensor was 10(-11) to 10(-8)mol/L (R=0.9819) with a detection limit of 10(-11)mol/L. This biosensor exhibited satisfactory results when it was used to detect Hg(II) in real water samples. The biosensor with high-intense charge transfer performance is a prospect avenue to pursue more and more sensitive detection method. Copyright © 2015 Elsevier B.V. All rights reserved.

  14. Measurement non-invariance of DSM-IV narcissistic personality disorder criteria across age and sex in a population-based sample of Norwegian twins.

    Science.gov (United States)

    Kubarych, Thomas S; Aggen, Steven H; Kendler, Kenneth S; Torgersen, Sven; Reichborn-Kjennerud, Ted; Neale, Michael C

    2010-09-01

    We investigated measurement non-invariance of DSM-IV narcissistic personality disorder (NPD) criteria across age and sex in a population-based cohort sample of 2794 Norwegian twins. Age had a statistically significant effect on the factor mean for NPD. Sex had a statistically significant effect on the factor mean and variance. Controlling for these factor level effects, item-level analysis indicated that the criteria were functioning differently across age and sex. After correcting for measurement differences at the item level, the latent factor mean effect for age was no longer statistically significant. The mean difference for sex remained statistically significant after correcting for item threshold effects. The results indicate that DSM-IV NPD criteria perform differently in males and females and across age. Differences in diagnostic rates across groups may not be valid without correcting for measurement non-invariance.

  15. 1,8-Naphthyridine-2,7-diamine: a potential universal reader of Watson-Crick base pairs for DNA sequencing by electron tunneling.

    Science.gov (United States)

    Liang, Feng; Lindsay, Stuart; Zhang, Peiming

    2012-11-21

    With the aid of Density Functional Theory (DFT), we designed 1,8-naphthyridine-2,7-diamine as a recognition molecule to read DNA base pairs for genomic sequencing by electron tunneling. NMR studies show that it can form stable triplets with both A : T and G : C base pairs through hydrogen bonding. Our results suggest that the naphthyridine molecule should be able to function as a universal base pair reader in a tunneling gap, generating distinguishable signatures under electrical bias for each of DNA base pairs.

  16. Mitochondrial DNA Copy Number in Sleep Duration Discordant Monozygotic Twins.

    Science.gov (United States)

    Wrede, Joanna E; Mengel-From, Jonas; Buchwald, Dedra; Vitiello, Michael V; Bamshad, Michael; Noonan, Carolyn; Christiansen, Lene; Christensen, Kaare; Watson, Nathaniel F

    2015-10-01

    Mitochondrial DNA (mtDNA) copy number is an important component of mitochondrial function and varies with age, disease, and environmental factors. We aimed to determine whether mtDNA copy number varies with habitual differences in sleep duration within pairs of monozygotic twins. Academic clinical research center. 15 sleep duration discordant monozygotic twin pairs (30 twins, 80% female; mean age 42.1 years [SD 15.0]). Sleep duration was phenotyped with wrist actigraphy. Each twin pair included a "normal" (7-9 h/24) and "short" (sleeping twin. Fasting peripheral blood leukocyte DNA was assessed for mtDNA copy number via the n-fold difference between qPCR measured mtDNA and nuclear DNA creating an mtDNA measure without absolute units. We used generalized estimating equation linear regression models accounting for the correlated data structure to assess within-pair effects of sleep duration on mtDNA copy number. Mean within-pair sleep duration difference per 24 hours was 94.3 minutes (SD 62.6 min). We found reduced sleep duration (β = 0.06; 95% CI 0.004, 0.12; P sleep efficiency (β = 0.51; 95% CI 0.06, 0.95; P sleep duration was associated with a decrease in mtDNA copy number of 0.06. Likewise, a 1% decrease in actigraphy-defined sleep efficiency was associated with a decrease in mtDNA copy number of 0.51. Reduced sleep duration and sleep efficiency were associated with reduced mitochondrial DNA copy number in sleep duration discordant monozygotic twins offering a potential mechanism whereby short sleep impairs health and longevity through mitochondrial stress. © 2015 Associated Professional Sleep Societies, LLC.

  17. Mispairs with Watson-Crick base-pair geometry observed in ternary complexes of an RB69 DNA polymerase variant.

    Science.gov (United States)

    Xia, Shuangluo; Konigsberg, William H

    2014-04-01

    Recent structures of DNA polymerase complexes with dGMPCPP/dT and dCTP/dA mispairs at the insertion site have shown that they adopt Watson-Crick geometry in the presence of Mn(2+) indicating that the tautomeric or ionization state of the base has changed. To see whether the tautomeric or ionization state of base-pair could be affected by its microenvironment, we determined 10 structures of an RB69 DNA polymerase quadruple mutant with dG/dT or dT/dG mispairs at position n-1 to n-5 of the Primer/Template duplex. Different shapes of the mispairs, including Watson-Crick geometry, have been observed, strongly suggesting that the local environment of base-pairs plays an important role in their tautomeric or ionization states. © 2014 The Protein Society.

  18. Has the "Equal Environments" assumption been tested in twin studies?

    Science.gov (United States)

    Eaves, Lindon; Foley, Debra; Silberg, Judy

    2003-12-01

    A recurring criticism of the twin method for quantifying genetic and environmental components of human differences is the necessity of the so-called "equal environments assumption" (EEA) (i.e., that monozygotic and dizygotic twins experience equally correlated environments). It has been proposed to test the EEA by stratifying twin correlations by indices of the amount of shared environment. However, relevant environments may also be influenced by genetic differences. We present a model for the role of genetic factors in niche selection by twins that may account for variation in indices of the shared twin environment (e.g., contact between members of twin pairs). Simulations reveal that stratification of twin correlations by amount of contact can yield spurious evidence of large shared environmental effects in some strata and even give false indications of genotype x environment interaction. The stratification approach to testing the equal environments assumption may be misleading and the results of such tests may actually be consistent with a simpler theory of the role of genetic factors in niche selection.

  19. Photon-Pair Sources Based on Intermodal Four-Wave Mixing in Few-Mode Fibers

    Directory of Open Access Journals (Sweden)

    Karsten Rottwitt

    2018-05-01

    Full Text Available Four-wave mixing in optical fibers has been proven to have many applications within processing of classical optical signals. In addition, recent developments in multimode fibers have made it possible to achieve the necessary phase-matching for efficient four-wave mixing over a very wide bandwidth. Thus, the combination of multimode fiber optics and four-wave mixing is very attractive for various applications. This is especially the case for applications in quantum communication, for example in photon-pair generation. This is the subject of this work, where we discuss the impact of fluctuations in core radius on the quality of the heralded single-photon states and demonstrate experimental results of intermodal spontaneous four-wave mixing for photon-pair generation.

  20. Free energy landscape and transition pathways from Watson–Crick to Hoogsteen base pairing in free duplex DNA

    Science.gov (United States)

    Yang, Changwon; Kim, Eunae; Pak, Youngshang

    2015-01-01

    Houghton (HG) base pairing plays a central role in the DNA binding of proteins and small ligands. Probing detailed transition mechanism from Watson–Crick (WC) to HG base pair (bp) formation in duplex DNAs is of fundamental importance in terms of revealing intrinsic functions of double helical DNAs beyond their sequence determined functions. We investigated a free energy landscape of a free B-DNA with an adenosine–thymine (A–T) rich sequence to probe its conformational transition pathways from WC to HG base pairing. The free energy landscape was computed with a state-of-art two-dimensional umbrella molecular dynamics simulation at the all-atom level. The present simulation showed that in an isolated duplex DNA, the spontaneous transition from WC to HG bp takes place via multiple pathways. Notably, base flipping into the major and minor grooves was found to play an important role in forming these multiple transition pathways. This finding suggests that naked B-DNA under normal conditions has an inherent ability to form HG bps via spontaneous base opening events. PMID:26250116