Structural and functional analysis of validoxylamine A 7'-phosphate synthase ValL involved in validamycin A biosynthesis.

Directory of Open Access Journals (Sweden)

Lina Zheng

Full Text Available Validamycin A (Val-A is an effective antifungal agent widely used in Asian countries as crop protectant. Validoxylamine A, the core structure and intermediate of Val-A, consists of two C(7-cyclitol units connected by a rare C-N bond. In the Val-A biosynthetic gene cluster in Streptomyces hygroscopicus 5008, the ORF valL was initially annotated as a validoxylamine A 7'-phosphate(V7P synthase, whose encoded 497-aa protein shows high similarity with trehalose 6-phosphate(T6P synthase. Gene inactivation of valL abolished both validoxylamine A and validamycin A productivity, and complementation with a cloned valL recovered 10% production of the wild-type in the mutant, indicating the involvement of ValL in validoxylamine A biosynthesis. Also we determined the structures of ValL and ValL/trehalose complex. The structural data indicates that ValL adopts the typical fold of GT-B protein family, featuring two Rossmann-fold domains and an active site at domain junction. The residues in the active site are arranged in a manner homologous to that of Escherichia coli (E.coli T6P synthase OtsA. However, a significant discrepancy is found in the active-site loop region. Also noticeable structural variance is found around the active site entrance in the apo ValL structure while the region takes an ordered configuration upon binding of product analog trehalose. Furthermore, the modeling of V7P in the active site of ValL suggests that ValL might have a similar SNi-like mechanism as OtsA.

Trehalose metabolism genes render rice white tip nematode Aphelenchoides besseyi (Nematoda: Aphelenchoididae) resistant to an anaerobic environment

Science.gov (United States)

Chen, Qiaoli; Zhang, Ruizhi; Ling, Yaming

2018-01-01

ABSTRACT After experiencing anaerobic environments, Aphelenchoides besseyi will enter a state of suspended animation known as anoxybiosis, during which it may use trehalose as an energy supply to survive. To explore the function of trehalose metabolism, two trehalose-6-phosphate synthase (TPS) genes (Ab-tps1 and Ab-tps2) encoding enzymes catalysing trehalose synthesis, and three trehalase (TRE) genes (Ab-ntre1, Ab-ntre2 and Ab-atre) encoding enzymes catalysing the hydrolysis of trehalose, were identified and investigated. Ab-tps1 and Ab-tps2 were active during certain periods of anoxybiosis for A. besseyi, and Ab-tps2, Ab-ntre1, Ab-ntre2 and Ab-atre were active during certain periods of recovery. The results of RNA interference experiments suggested that TRE genes regulated each other and both TPS genes, while a single TPS gene only regulated the other TPS gene. However, two TPS genes together could regulate TRE genes, which indicated a feedback mechanism between these genes. All these genes also positively regulated the survival and resumption of active metabolism of the nematode. Genes functioning at re-aeration have a greater impact on nematode survival, suggesting that these genes could play roles in anoxybiosis regulation, but may function within restricted time frames. Changes in trehalose levels matched changes in TRE activity during the anoxybiosis–re-aeration process, suggesting that trehalose may act as an energy supply source. The observation of up-regulation of TPS genes during anoxybiosis suggested a possible signal role of trehalose. Trehalose metabolism genes could also work together to control trehalose levels at a certain level when the nematode is under anaerobic conditions. PMID:29158222

Expression of TPS1 gene from Saccharomycopsis fibuligera A11 in Saccharomyces sp. W0 enhances trehalose accumulation, ethanol tolerance, and ethanol production.

Science.gov (United States)

Cao, Tian-Shu; Chi, Zhe; Liu, Guang-Lei; Chi, Zhen-Ming

2014-01-01

It has been reported that trehalose plays an important role in stress tolerance in yeasts. Therefore, in order to construct a stably recombinant Saccharomyces sp. W0 with higher ethanol tolerance, the TPS1 gene encoding 6-phosphate-trehalose synthase cloned from Saccharomycopsis fibuligera A11 was ligated into the 18S rDNA integration vector pMIRSC11 and integrated into chromosomal DNA of Saccharomyces sp. W0. The transformant Z8 obtained had the content of 6.23 g of trehalose/100 g of cell dry weight, while Saccharomyces sp. W0 only contained 4.05 g of trehalose/100 g of cell dry weight. The transformant Z8 also had higher ethanol tolerance (cell survival was 25.1 % at 18 ml of ethanol/100 ml of solution) and trehalose-6-phosphate synthase (Tps1) activity (1.3 U/mg) and produced more ethanol (16.4 ml of ethanol/100 ml of medium) than Saccharomyces sp. W0 (cell survival was 12.1 % at 18 ml of ethanol/100 ml of solution, Tps1 activity was 0.8 U/mg and the produced ethanol concentration was 14.2 ml of ethanol/100 ml of medium) under the same conditions. The results show that trehalose indeed can play an important role in ethanol tolerance and ethanol production by Saccharomyces sp. W0.

Feedback Inhibition of Starch Degradation in Arabidopsis Leaves Mediated by Trehalose 6-Phosphate1[W][OPEN

Science.gov (United States)

Martins, Marina Camara Mattos; Hejazi, Mahdi; Fettke, Joerg; Steup, Martin; Feil, Regina; Krause, Ursula; Arrivault, Stéphanie; Vosloh, Daniel; Figueroa, Carlos María; Ivakov, Alexander; Yadav, Umesh Prasad; Piques, Maria; Metzner, Daniela; Stitt, Mark; Lunn, John Edward

2013-01-01

Many plants accumulate substantial starch reserves in their leaves during the day and remobilize them at night to provide carbon and energy for maintenance and growth. In this paper, we explore the role of a sugar-signaling metabolite, trehalose-6-phosphate (Tre6P), in regulating the accumulation and turnover of transitory starch in Arabidopsis (Arabidopsis thaliana) leaves. Ethanol-induced overexpression of trehalose-phosphate synthase during the day increased Tre6P levels up to 11-fold. There was a transient increase in the rate of starch accumulation in the middle of the day, but this was not linked to reductive activation of ADP-glucose pyrophosphorylase. A 2- to 3-fold increase in Tre6P during the night led to significant inhibition of starch degradation. Maltose and maltotriose did not accumulate, suggesting that Tre6P affects an early step in the pathway of starch degradation in the chloroplasts. Starch granules isolated from induced plants had a higher orthophosphate content than granules from noninduced control plants, consistent either with disruption of the phosphorylation-dephosphorylation cycle that is essential for efficient starch breakdown or with inhibition of starch hydrolysis by β-amylase. Nonaqueous fractionation of leaves showed that Tre6P is predominantly located in the cytosol, with estimated in vivo Tre6P concentrations of 4 to 7 µm in the cytosol, 0.2 to 0.5 µm in the chloroplasts, and 0.05 µm in the vacuole. It is proposed that Tre6P is a component in a signaling pathway that mediates the feedback regulation of starch breakdown by sucrose, potentially linking starch turnover to demand for sucrose by growing sink organs at night. PMID:24043444

The Production and Utilization of GDP-glucose in the Biosynthesis of Trehalose 6-Phosphate by Streptomyces venezuelae.

Science.gov (United States)

Asención Diez, Matías D; Miah, Farzana; Stevenson, Clare E M; Lawson, David M; Iglesias, Alberto A; Bornemann, Stephen

2017-01-20

Trehalose-6-phosphate synthase OtsA from streptomycetes is unusual in that it uses GDP-glucose as the donor substrate rather than the more commonly used UDP-glucose. We now confirm that OtsA from Streptomyces venezuelae has such a preference for GDP-glucose and can utilize ADP-glucose to some extent too. A crystal structure of the enzyme shows that it shares twin Rossmann-like domains with the UDP-glucose-specific OtsA from Escherichia coli However, it is structurally more similar to Streptomyces hygroscopicus VldE, a GDP-valienol-dependent pseudoglycosyltransferase enzyme. Comparison of the donor binding sites reveals that the amino acids associated with the binding of diphosphoribose are almost all identical in these three enzymes. By contrast, the amino acids associated with binding guanine in VldE (Asn, Thr, and Val) are similar in S. venezuelae OtsA (Asp, Ser, and Phe, respectively) but not conserved in E. coli OtsA (His, Leu, and Asp, respectively), providing a rationale for the purine base specificity of S. venezuelae OtsA. To establish which donor is used in vivo, we generated an otsA null mutant in S. venezuelae The mutant had a cell density-dependent growth phenotype and accumulated galactose 1-phosphate, glucose 1-phosphate, and GDP-glucose when grown on galactose. To determine how the GDP-glucose is generated, we characterized three candidate GDP-glucose pyrophosphorylases. SVEN_3027 is a UDP-glucose pyrophosphorylase, SVEN_3972 is an unusual ITP-mannose pyrophosphorylase, and SVEN_2781 is a pyrophosphorylase that is capable of generating GDP-glucose as well as GDP-mannose. We have therefore established how S. venezuelae can make and utilize GDP-glucose in the biosynthesis of trehalose 6-phosphate. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.

The Production and Utilization of GDP-glucose in the Biosynthesis of Trehalose 6-Phosphate by Streptomyces venezuelae*

Science.gov (United States)

Asención Diez, Matías D.; Miah, Farzana; Stevenson, Clare E. M.; Lawson, David M.; Iglesias, Alberto A.; Bornemann, Stephen

2017-01-01

Trehalose-6-phosphate synthase OtsA from streptomycetes is unusual in that it uses GDP-glucose as the donor substrate rather than the more commonly used UDP-glucose. We now confirm that OtsA from Streptomyces venezuelae has such a preference for GDP-glucose and can utilize ADP-glucose to some extent too. A crystal structure of the enzyme shows that it shares twin Rossmann-like domains with the UDP-glucose-specific OtsA from Escherichia coli. However, it is structurally more similar to Streptomyces hygroscopicus VldE, a GDP-valienol-dependent pseudoglycosyltransferase enzyme. Comparison of the donor binding sites reveals that the amino acids associated with the binding of diphosphoribose are almost all identical in these three enzymes. By contrast, the amino acids associated with binding guanine in VldE (Asn, Thr, and Val) are similar in S. venezuelae OtsA (Asp, Ser, and Phe, respectively) but not conserved in E. coli OtsA (His, Leu, and Asp, respectively), providing a rationale for the purine base specificity of S. venezuelae OtsA. To establish which donor is used in vivo, we generated an otsA null mutant in S. venezuelae. The mutant had a cell density-dependent growth phenotype and accumulated galactose 1-phosphate, glucose 1-phosphate, and GDP-glucose when grown on galactose. To determine how the GDP-glucose is generated, we characterized three candidate GDP-glucose pyrophosphorylases. SVEN_3027 is a UDP-glucose pyrophosphorylase, SVEN_3972 is an unusual ITP-mannose pyrophosphorylase, and SVEN_2781 is a pyrophosphorylase that is capable of generating GDP-glucose as well as GDP-mannose. We have therefore established how S. venezuelae can make and utilize GDP-glucose in the biosynthesis of trehalose 6-phosphate. PMID:27903647

Cloning and expression of pineapple sucrose- phosphate synthase ...

African Journals Online (AJOL)

hope&shola

2010-12-06

Dec 6, 2010 ... phosphate; EDTA, ethylene diamine tetraacetic acid; Ivr, invertase; SS .... phenolics, tannins and artifacts due to differences of tissue composition ..... Banana sucrose-phosphate synthase gene expression during fruit ripening.

Inducible expression of trehalose synthase in Bacillus licheniformis.

Science.gov (United States)

Li, Youran; Gu, Zhenghua; Zhang, Liang; Ding, Zhongyang; Shi, Guiyang

2017-02-01

Trehalose synthase (TreS) could transform maltose into trehalose via isomerization. It is a crucial enzyme in the process of trehalose enzymatical transformation. In this study, plasmid-based inducible expression systems were constructed to produce Thermomonospora curvata TreS in B. licheniformis. Xylose operons from B. subtilis, B. licheniformis and B. megaterium were introduced to regulate the expression of the gene encoding TreS. It was functionally expressed, and the BlsTs construct yielded the highest enzyme activity (12.1 U/mL). Furthermore, the effect of different cultural conditions on the inducible expression of BlsTs was investigated, and the optimal condition was as follows: 4% maltodextrin, 0.4% soybean powder, 1% xylose added after 10 h of growth and an induction time of 12 h at 37 °C. As a result, the maximal yield reached 24.7 U/mL. This study contributes to the industrial application of B. licheniformis, a GRAS workhorse for enzyme production. Copyright © 2016 Elsevier Inc. All rights reserved.

Glycogen Phosphorylase and Glycogen Synthase: Gene Cloning and Expression Analysis Reveal Their Role in Trehalose Metabolism in the Brown Planthopper, Nilaparvata lugens Stål (Hemiptera: Delphacidae).

Science.gov (United States)

Zhang, Lu; Wang, Huijuan; Chen, Jianyi; Shen, Qida; Wang, Shigui; Xu, Hongxing; Tang, Bin

2017-01-01

RNA interference has been used to study insects' gene function and regulation. Glycogen synthase (GS) and glycogen phosphorylase (GP) are two key enzymes in carbohydrates' conversion in insects. Glycogen content and GP and GS gene expression in several tissues and developmental stages of the Brown planthopper Nilaparvata lugens Stål (Hemiptera: Delphacidae) were analyzed in the present study, using quantitative reverse-transcription polymerase chain reaction to determine their response to double-stranded trehalases (dsTREs), trehalose-6-phosphate synthases (dsTPSs), and validamycin injection. The highest expression of both genes was detected in the wing bud, followed by leg and head tissues, and different expression patterns were shown across the developmental stages analyzed. Glycogen content significantly decreased 48 and 72 h after dsTPSs injection and 48 h after dsTREs injection. GP expression increased 48 h after dsTREs and dsTPSs injection and significantly decreased 72 h after dsTPSs, dsTRE1-1, and dsTRE1-2 injection. GS expression significantly decreased 48 h after dsTPS2 and dsTRE2 injection and 72 h after dsTRE1-1 and dsTRE1-2 injection. GP and GS expression and glycogen content significantly decreased 48 h after validamycin injection. The GP activity significantly decreased 48 h after validamycin injection, while GS activities of dsTPS1 and dsTRE2 injection groups were significantly higher than that of double-stranded GFP (dsGFP) 48 h after injection, respectively. Thus, glycogen is synthesized, released, and degraded across several insect tissues according to the need to maintain stable trehalose levels. © The Authors 2017. Published by Oxford University Press on behalf of Entomological Society of America.

In vitro silencing of Brugia malayi trehalose-6-phosphate phosphatase impairs embryogenesis and in vivo development of infective larvae in jirds.

Directory of Open Access Journals (Sweden)

Susheela Kushwaha

Full Text Available The trehalose metabolic enzymes have been considered as potential targets for drug or vaccine in several organisms such as Mycobacterium, plant nematodes, insects and fungi due to crucial role of sugar trehalose in embryogenesis, glucose uptake and protection from stress. Trehalose-6-phosphate phosphatase (TPP is one of the enzymes of trehalose biosynthesis that has not been reported in mammals. Silencing of tpp gene in Caenorhabditis elegans revealed an indispensable functional role of TPP in nematodes.In the present study, functional role of B. malayi tpp gene was investigated by siRNA mediated silencing which further validated this enzyme to be a putative antifilarial drug target. The silencing of tpp gene in adult female B. malayi brought about severe phenotypic deformities in the intrauterine stages such as distortion and embryonic development arrest. The motility of the parasites was significantly reduced and the microfilarial production as well as their in vitro release from the female worms was also drastically abridged. A majority of the microfilariae released in to the culture medium were found dead. B. malayi infective larvae which underwent tpp gene silencing showed 84.9% reduced adult worm establishment after inoculation into the peritoneal cavity of naïve jirds.The present findings suggest that B. malayi TPP plays an important role in the female worm embryogenesis, infectivity of the larvae and parasite viability. TPP enzyme of B. malayi therefore has the potential to be exploited as an antifilarial drug target.

Flux through trehalose synthase flows from trehalose to the alpha anomer of maltose in mycobacteria.

Science.gov (United States)

Miah, Farzana; Koliwer-Brandl, Hendrik; Rejzek, Martin; Field, Robert A; Kalscheuer, Rainer; Bornemann, Stephen

2013-04-18

Trehalose synthase (TreS) was thought to catalyze flux from maltose to trehalose, a precursor of essential trehalose mycolates in mycobacterial cell walls. However, we now show, using a genetic approach, that TreS is not required for trehalose biosynthesis in Mycobacterium smegmatis, whereas two alternative trehalose-biosynthetic pathways (OtsAB and TreYZ) are crucial. Consistent with this direction of flux, trehalose levels in Mycobacterium tuberculosis decreased when TreS was overexpressed. In addition, TreS was shown to interconvert the α anomer of maltose and trehalose using (1)H and (19)F-nuclear magnetic resonance spectroscopies using its normal substrates and deoxyfluoromaltose analogs, with the nonenzymatic mutarotation of α/β-maltose being slow. Therefore, flux through TreS in mycobacteria flows from trehalose to α-maltose, which is the appropriate anomer for maltose kinase of the GlgE α-glucan pathway, which in turn contributes to intracellular and/or capsular polysaccharide biosynthesis. Copyright © 2013 Elsevier Ltd. All rights reserved.

Identification of the trehalose-6-phosphate synthase gene family in ...

Indian Academy of Sciences (India)

2015-03-04

Mar 4, 2015 ... stress, however, our study mainly analysed the TPS gene family under freezing conditions in winter wheat .... size the first-strand cDNA using the Fermentas RevertAid ..... In the stem of Dongnongdongmai 1, TaTPS1, 2, 3, 4, 8,.

Effects of various types of stress on the metabolism of reserve carbohydrates in Saccharomyces cerevisiae: genetic evidence for a stress-induced recycling of glycogen and trehalose.

Science.gov (United States)

Parrou, J L; Teste, M A; François, J

1997-06-01

It is well known that glycogen and trehalose accumulate in yeast under nutrient starvation or entering into the stationary phase of growth, and that high levels of trehalose are found in heat-shocked cells. However, effects of various types of stress on trehalose, and especially on glycogen, are poorly documented. Taking into account that almost all genes encoding the enzymes involved in the metabolism of these two reserve carbohydrates contain between one and several copies of the stress-responsive element (STRE), an investigation was made of the possibility of a link between the potential transcriptional induction of these genes and the accumulation of glycogen and trehalose under different stress conditions. Using transcriptional fusions, it was found that all these genes were induced in a similar fashion, although to various extents, by temperature, osmotic and oxidative stresses. Experiments performed with an msn2/msn4 double mutant proved that the transcriptional induction of the genes encoding glycogen synthase (GSY2) and trehalose-6-phosphate synthase (TPS1) was needed for the small increase in glycogen and trehalose upon exposure to a mild heat stress and salt shock. However, the extent of transcriptional activation of these genes upon stresses in wild-type strains was not correlated with a proportional rise in either glycogen or trehalose. The major explanation for this lack of correlation comes from the fact that genes encoding the enzymes of the biosynthetic and of the biodegradative pathways were almost equally induced. Hence, trehalose and glycogen accumulated to much higher levels in cells lacking neutral trehalose or glycogen phosphorylase exposed to stress conditions, which suggested that one of the major effects of stress in yeast is to induce a wasteful expenditure of energy by increasing the recycling of these molecules. We also found that transcriptional induction of STRE-controlled genes was abolished at temperatures above 40 degree C, while

Trehalose-6-phosphate and SnRK1 kinases in plant development and signaling: the emerging picture

Directory of Open Access Journals (Sweden)

Sonia eGazzarrini

2014-04-01

Full Text Available Carbohydrates, or sugars, regulate various aspects of plant growth through modulation of cell division and expansion. Besides playing essential roles as sources of energy for growth and as structural components of cells, carbohydrates also regulate the timing of expression of developmental programs. The disaccharide trehalose is used as an energy source, as a storage and transport molecule for glucose, and as a stress-responsive compound important for cellular protection during stress in all kingdoms. Trehalose, however, is found in very low amounts in most plants, pointing to a signaling over metabolic role for this non-reducing disaccharide. In the last decade, trehalose-6-phosphate (T6P, an intermediate in trehalose metabolism, has been shown to regulate embryonic and vegetative development, flowering time, meristem determinacy and cell fate specification in plants. T6P acts as a global regulator of metabolism and transcription promoting plant growth and triggering developmental phase transitions in response to sugar availability. Among the T6P targets are members of the Sucrose-non-fermenting1-Related Kinase1 (SnRK1 family, which are sensors of energy availability and inhibit plant growth and development during metabolic stress to maintain energy homeostasis. In this review, we will discuss the opposite roles of the sugar metabolite T6P and the SnRK1 kinases in the regulation of developmental phase transitions in response to carbohydrate levels. We will focus on how these two global regulators of metabolic processes integrate environmental cues and interact with hormonal signaling pathways to modulate plant development.

The dual nature of trehalose in citrus canker disease: a virulence factor for Xanthomonas citri subsp. citri and a trigger for plant defence responses

KAUST Repository

Piazza, A.

2015-03-14

Xanthomonas citri subsp. citri (Xcc) is a bacterial pathogen that causes citrus canker in susceptible Citrus spp. The Xcc genome contains genes encoding enzymes from three separate pathways of trehalose biosynthesis. Expression of genes encoding trehalose-6-phosphate synthase (otsA) and trehalose phosphatase (otsB) was highly induced during canker development, suggesting that the two-step pathway of trehalose biosynthesis via trehalose-6-phosphate has a function in pathogenesis. This pathway was eliminated from the bacterium by deletion of the otsA gene. The resulting XccΔotsA mutant produced less trehalose than the wild-type strain, was less resistant to salt and oxidative stresses, and was less able to colonize plant tissues. Gene expression and proteomic analyses of infected leaves showed that infection with XccΔotsA triggered only weak defence responses in the plant compared with infection with Xcc, and had less impact on the host plant\\'s metabolism than the wild-type strain. These results suggested that trehalose of bacterial origin, synthesized via the otsA-otsB pathway, in Xcc, plays a role in modifying the host plant\\'s metabolism to its own advantage but is also perceived by the plant as a sign of pathogen attack. Thus, trehalose biosynthesis has both positive and negative consequences for Xcc. On the one hand, it enables this bacterial pathogen to survive in the inhospitable environment of the leaf surface before infection and exploit the host plant\\'s resources after infection, but on the other hand, it is a tell-tale sign of the pathogen\\'s presence that triggers the plant to defend itself against infection. © The Author 2015. Published by Oxford University Press on behalf of the Society for Experimental Biology.

The effect of high pressure on the intracellular trehalose synthase activity of Thermus aquaticus.

Science.gov (United States)

Dong, Yongsheng; Ma, Lei; Duan, Yuanliang

2016-01-01

To understand the effect of high pressure on the intracellular trehalose synthase activity, Thermus aquaticus (T. aquaticus) in the logarithmic growth phase was treated with high-pressure air, and its intracellular trehalose synthase (TSase) activity was determined. Our results indicated that pressure is a factor strongly affecting the cell growth. High pressure significantly attenuated the growth rate of T. aquaticus and shortened the duration of stationary phase. However, after 2 h of culture under 1.0 MPa pressure, the activity of intracellular TSase in T. aquaticus reached its maximum value, indicating that pressure can significantly increase the activity of intracellular TSase in T. aquaticus. Thus the present study provides an important guide for the enzymatic production of trehalose.

Trehalose-6-phosphate synthesis controls yeast gluconeogenesis downstream and independent of SNF1.

Science.gov (United States)

Deroover, Sofie; Ghillebert, Ruben; Broeckx, Tom; Winderickx, Joris; Rolland, Filip

2016-06-01

Trehalose-6-P (T6P), an intermediate of trehalose biosynthesis, was identified as an important regulator of yeast sugar metabolism and signaling. tps1Δ mutants, deficient in T6P synthesis (TPS), are unable to grow on rapidly fermentable medium with uncontrolled influx in glycolysis, depletion of ATP and accumulation of sugar phosphates. However, the exact molecular mechanisms involved are not fully understood. We show that SNF1 deletion restores the tps1Δ growth defect on glucose, suggesting that lack of TPS hampers inactivation of SNF1 or SNF1-regulated processes. In addition to alternative, non-fermentable carbon metabolism, SNF1 controls two major processes: respiration and gluconeogenesis. The tps1Δ defect appears to be specifically associated with deficient inhibition of gluconeogenesis, indicating more downstream effects. Consistently, Snf1 dephosphorylation and inactivation on glucose medium are not affected, as confirmed with an in vivo Snf1 activity reporter. Detailed analysis shows that gluconeogenic Pck1 and Fbp1 expression, protein levels and activity are not repressed upon glucose addition to tps1Δ cells, suggesting a link between the metabolic defect and persistent gluconeogenesis. While SNF1 is essential for induction of gluconeogenesis, T6P/TPS is required for inactivation of gluconeogenesis in the presence of glucose, downstream and independent of SNF1 activity and the Cat8 and Sip4 transcription factors. © FEMS 2016. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

Trehalose 6-phosphate signal is closely related to sorbitol in apple (Malus domestica Borkh. cv. Gala

Directory of Open Access Journals (Sweden)

Wen Zhang

2017-02-01

Full Text Available Trehalose-6-phosphate (Tre6P is a precursor of trehalose, which is widespread in nature and greatly influences plant growth and development. Tre6P acts as a signal of carbon availability in many plants, but little is known about the function of Tre6P in rosaceous plants, which have specific sorbitol biosynthesis and transportation pathways. In the present study, Tre6P levels and Sorbitol:Tre6P ratios were analyzed in apple (Malus domestica, Borkh. cv. Gala. Tre6P levels were positively correlated with sorbitol content but negatively correlated with sucrose, glucose, and fructose content in developing fruit. However, under sorbitol-limited conditions, Tre6P levels were positively correlated with both sorbitol and sucrose. In the presence of different exogenous sugar supply, Tre6P levels increased corresponding with sorbitol, but this was not the case with sucrose. In addition, Tre6P content and sorbitol:Tre6P ratios were more highly correlated with ADP-glucose levels under sorbitol-limited conditions and fruit development stages, respectively. These results suggest that Tre6P is more closely related to sorbitol than other soluble sugars and has an important role in influencing carbon metabolism in apple.

Trehalose 6-phosphate signal is closely related to sorbitol in apple (Malus domestica Borkh. cv. Gala)

Science.gov (United States)

Zhang, Wen; Lunn, John E.; Feil, Regina; Wang, Yufei; Zhao, Jingjing; Tao, Hongxia; Zhao, Zhengyang

2017-01-01

ABSTRACT Trehalose-6-phosphate (Tre6P) is a precursor of trehalose, which is widespread in nature and greatly influences plant growth and development. Tre6P acts as a signal of carbon availability in many plants, but little is known about the function of Tre6P in rosaceous plants, which have specific sorbitol biosynthesis and transportation pathways. In the present study, Tre6P levels and Sorbitol:Tre6P ratios were analyzed in apple (Malus domestica, Borkh. cv. Gala). Tre6P levels were positively correlated with sorbitol content but negatively correlated with sucrose, glucose, and fructose content in developing fruit. However, under sorbitol-limited conditions, Tre6P levels were positively correlated with both sorbitol and sucrose. In the presence of different exogenous sugar supply, Tre6P levels increased corresponding with sorbitol, but this was not the case with sucrose. In addition, Tre6P content and sorbitol:Tre6P ratios were more highly correlated with ADP-glucose levels under sorbitol-limited conditions and fruit development stages, respectively. These results suggest that Tre6P is more closely related to sorbitol than other soluble sugars and has an important role in influencing carbon metabolism in apple. PMID:28069587

Regulation of trehalose metabolism in Saccharomyces

International Nuclear Information System (INIS)

Panek, A.D.; Costa-Carvalho, V.L.A.; Ortiz, C.H.D.; Dellamora-Ortiz, G.M.; Paschoalin, V.M.F.; Panek, A.C.

1984-01-01

The regulation of trehalose metabolism in Saccharomyces is studied by construction of mutants with specific lesions, cloning of genes involved in the regulation of trehalose synthase and of trehalase, as well as, isolation and purification of enzymes from the various mutants constructed. (M.A.C.) [pt

Evaluation of synthase and hemisynthase activities of glucosamine-6-phosphate synthase by matrix-assisted laser desorption/ionization time-of-flight mass spectrometry.

Science.gov (United States)

Gaucher-Wieczorek, Florence; Guérineau, Vincent; Touboul, David; Thétiot-Laurent, Sophie; Pelissier, Franck; Badet-Denisot, Marie-Ange; Badet, Bernard; Durand, Philippe

2014-08-01

Glucosamine-6-phosphate synthase (GlmS, EC 2.6.1.16) catalyzes the first and rate-limiting step in the hexosamine biosynthetic pathway, leading to the synthesis of uridine-5'-diphospho-N-acetyl-D-glucosamine, the major building block for the edification of peptidoglycan in bacteria, chitin in fungi, and glycoproteins in mammals. This bisubstrate enzyme converts D-fructose-6-phosphate (Fru-6P) and L-glutamine (Gln) into D-glucosamine-6-phosphate (GlcN-6P) and L-glutamate (Glu), respectively. We previously demonstrated that matrix-assisted laser desorption/ionization time-of-flight mass spectrometry (MALDI-TOF-MS) allows determination of the kinetic parameters of the synthase activity. We propose here to refine the experimental protocol to quantify Glu and GlcN-6P, allowing determination of both hemisynthase and synthase parameters from a single assay kinetic experiment, while avoiding interferences encountered in other assays. It is the first time that MALDI-MS is used to survey the activity of a bisubstrate enzyme. Copyright © 2014 Elsevier Inc. All rights reserved.

Application of a Colorimetric Assay to Identify Putative Ribofuranosylaminobenzene 5'-Phosphate Synthase Genes Expressed with Activity in Escherichia coli

OpenAIRE

Bechard, Matthew E.; Chhatwal, Sonya; Garcia, Rosemarie E.; Rasche, Madeline E.

2003-01-01

Tetrahydromethanopterin (H4MPT) is a tetrahydrofolate analog originally discovered in methanogenic archaea, but later found in other archaea and bacteria. The extent to which H4MPT occurs among living organisms is unknown. The key enzyme which distinguishes the biosynthetic pathways of H4MPT and tetrahydrofolate is ribofuranosylaminobenzene 5'-phosphate synthase (RFAP synthase). Given the importance of RFAP synthase in H4MPT biosynthesis, the identification of putative RFAP synthase genes and...

Application of a Colorimetric Assay to Identify Putative Ribofuranosylaminobenzene 5'-Phosphate Synthase Genes Expressed with Activity in Escherichia coli

Directory of Open Access Journals (Sweden)

Bechard Matthew E.

2003-01-01

Full Text Available Tetrahydromethanopterin (H4MPT is a tetrahydrofolate analog originally discovered in methanogenic archaea, but later found in other archaea and bacteria. The extent to which H4MPT occurs among living organisms is unknown. The key enzyme which distinguishes the biosynthetic pathways of H4MPT and tetrahydrofolate is ribofuranosylaminobenzene 5'-phosphate synthase (RFAP synthase. Given the importance of RFAP synthase in H4MPT biosynthesis, the identification of putative RFAP synthase genes and measurement of RFAP synthase activity would provide an indication of the presence of H4MPT in untested microorganisms. Investigation of putative archaeal RFAP synthase genes has been hampered by the tendency of the resulting proteins to form inactive inclusion bodies in Escherichia coli. The current work describes a colorimetric assay for measuring RFAP synthase activity, and two modified procedures for expressing recombinant RFAP synthase genes to produce soluble, active enzyme. By lowering the incubation temperature during expression, RFAP synthase from Archaeoglobus fulgidus was produced in E. coli and purified to homogeneity. The production of active RFAP synthase from Methanothermobacter thermautotrophicus was achieved by coexpression of the gene MTH0830 with a molecular chaperone. This is the first direct biochemical identification of a methanogen gene that codes for an active RFAP synthase.

Application of a Colorimetric Assay to Identify Putative Ribofuranosylaminobenzene 5'-Phosphate Synthase Genes Expressed with Activity in Escherichia coli.

Science.gov (United States)

Bechard, Matthew E.; Chhatwal, Sonya; Garcia, Rosemarie E.; Rasche, Madeline E.

2003-01-01

Tetrahydromethanopterin (H(4)MPT) is a tetrahydrofolate analog originally discovered in methanogenic archaea, but later found in other archaea and bacteria. The extent to which H(4)MPT occurs among living organisms is unknown. The key enzyme which distinguishes the biosynthetic pathways of H(4)MPT and tetrahydrofolate is ribofuranosylaminobenzene 5'-phosphate synthase (RFAP synthase). Given the importance of RFAP synthase in H(4)MPT biosynthesis, the identification of putative RFAP synthase genes and measurement of RFAP synthase activity would provide an indication of the presence of H(4)MPT in untested microorganisms. Investigation of putative archaeal RFAP synthase genes has been hampered by the tendency of the resulting proteins to form inactive inclusion bodies in Escherichia coli. The current work describes a colorimetric assay for measuring RFAP synthase activity, and two modified procedures for expressing recombinant RFAP synthase genes to produce soluble, active enzyme. By lowering the incubation temperature during expression, RFAP synthase from Archaeoglobus fulgidus was produced in E. coli and purified to homogeneity. The production of active RFAP synthase from Methanothermobacter thermautotrophicus was achieved by coexpression of the gene MTH0830 with a molecular chaperone. This is the first direct biochemical identification of a methanogen gene that codes for an active RFAP synthase.

The In Vitro Effect of Ivermectin on the Activity of Trehalose Synthesis Pathway Enzymes and Their mRNA Expression in the Muscle of Adult Female Ascaris suum (Nematoda)

OpenAIRE

Dmitryjuk, Małgorzata; Łopieńska-Biernat, Elżbieta; Zaobidna, Ewa Anna

2014-01-01

The in vitro effect of ivermectin lethal dose on the activity of trehalose-6-phosphate synthase (TPS) and phosphatase (TPP) and the expression of their mRNA (tps1, tps2, and tpp genes) in the muscle of adult female Ascaris suum was investigated. The presence of ivermectin in the medium caused a decrease in TPS and TPP activities during the experiment compared with the start and control groups. The exception was the group of worms grown for 8 hours in a IVM solution, in which there was a littl...

Heat-induced accumulation and futile cycling of trehalose in Saccharomyces cerevisiae

International Nuclear Information System (INIS)

Hottiger, T.; Schmutz, P.; Wiemken, A.

1987-01-01

Heat shock resulted in rapid accumulation of large amounts of trehalose in Saccharomyces cerevisiae. In cultures growing exponentially on glucose, the trehalose content of the cells increased from 0.01 to 1 g/g of protein within 1 h after the incubation temperature was shifted from 27 to 40 0 C. When the temperature was readjusted to 27 0 C, the accumulated trehalose was rapidly degraded. In parallel, the activity of the trehalose-phosphate synthase, the key enzyme of trehalose biosynthesis, increased about six fold during the heat shock and declined to normal level after readjustment of the temperature. Surprisingly, the activity of neutral trehalase, the key enzyme of trehalose degradation, also increased about threefold during the heat shock and remained almost constant during recovery of the cells at 27 0 C. In pulse-labeling experiments with [ 14 C] glucose, trehalose was found to be turned over rapidly in heat-shocked cells, indicating that both anabolic and catabolic enzymes of trehalose metabolism were active in vivo. Possible functions of the heat-induced accumulation of trehalose and its rapid turnover in an apparently futile cycle during heat shock are discussed

Arabidopsis thaliana sucrose phosphate synthase (sps) genes are expressed differentially in organs and tissues, and their transcription is regulated by osmotic stress.

Science.gov (United States)

Solís-Guzmán, María Gloria; Argüello-Astorga, Gerardo; López-Bucio, José; Ruiz-Herrera, León Francisco; López-Meza, Joel Edmundo; Sánchez-Calderón, Lenin; Carreón-Abud, Yazmín; Martínez-Trujillo, Miguel

2017-11-01

Sucrose is synthesized from UDP-Glc and Fru-6-phosphate via the activity of sucrose-phosphate synthase (SPS) enzymes, which produce Suc-6-phosphate. Suc-6-phosphate is rapidly dephosphorylated by phosphatases to produce Suc and inorganic phosphate. Arabidopsis has four sps genes encoding SPS enzymes. Of these enzymes, AtSPS1F and AtSPS2F have been grouped with other dicotyledonous SPS enzymes, while AtSPS3F and AtSPS4F are included in groups with both dicotyledonous and monocotyledonous SPS enzymes. In this work, we generated Arabidopsis thaliana transformants containing the promoter region of each sps gene fused to gfp::uidA reporter genes. A detailed characterization of expression conferred by the sps promoters in organs and tissues was performed. We observed expression of AtSPS1F, AtSPS2F and AtSPS3F in the columella roots of the plants that support sucrose synthesis. Hence, these findings support the idea that sucrose synthesis occurs in the columella cells, and suggests that sucrose has a role in this tissue. In addition, the expression of AtSPS4F was identified in embryos and suggests its participation in this developmental stage. Quantitative transcriptional analysis of A. thaliana plants grown in media with different osmotic potential showed that AtSPS2F and AtSPS4F respond to osmotic stress. Copyright © 2017 Elsevier B.V. All rights reserved.

Bacillus caldolyticus prs gene encoding phosphoribosyldiphosphate synthase

DEFF Research Database (Denmark)

Krath, Britta N.; Hove-Jensen, Bjarne

1996-01-01

The prs gene, encoding phosphoribosyl-diphosphate (PRPP) synthase, as well as the flanking DNA sequences were cloned and sequenced from the Gram-positive thermophile, Bacillus caldolyticus. Comparison with the homologous sequences from the mesophile, Bacillus subtilis, revealed a gene (gca......D) encoding N-acetylglucosamine-l-phosphate uridyltransferase upstream of prs, and a gene homologous to ctc downstream of prs. cDNA synthesis with a B. caldolyticus gcaD-prs-ctc-specified mRNA as template, followed by amplification utilising the polymerase chain reaction indicated that the three genes are co......-transcribed. Comparison of amino acid sequences revealed a high similarity among PRPP synthases across a wide phylogenetic range. An E. coli strain harbouring the B. caldolyticus prs gene in a multicopy plasmid produced PRPP synthase activity 33-fold over the activity of a haploid B. caldolyticus strain. B. caldolyticus...

Isolation and Characterization of D-Myo-Inositol-3-Phosphate Synthase Gene Family Members in Soybean

OpenAIRE

Good, Laura Lee

2001-01-01

The objective of this research was to isolate genes encoding isoforms of the enzyme D-myo-inositol 3-phosphate synthase (MIPS, E.C. 5.5.1.4) from soybean and to characterize their expression, especially with respect to their involvement in phytic acid biosynthesis. A MIPS-homologous cDNA, designated GmMIPS1, was isolated via PCR using total RNA from developing seeds. Southern blot analysis and examination of MIPS-homologous soybean EST sequences suggested that GmMIPS1 is part of a multigene...

Mechanistic studies of 3-deoxy-D-manno-octulosonic acid 8-phosphate synthase

International Nuclear Information System (INIS)

Dotson, G.D.; Woodard, R.W.

1994-01-01

The enzyme 3-deOXY-D-manno-octulosonic acid 8-phosphate synthase (KDO 8-P synthase) catalyses the condensation of arabinose 5-phosphate (A 5-P) with phosphoenolpyruvate (PEP) to give the unique eight-carbon acidic sugar 3-deoxy-D-nianno-octulosonic acid 8-phosphate (KDO 8-P) found only in gram-negative bacteria and required for lipid A maturation and cellular growth. The E. coli gene kdsA that encodes KDO 8-P synthase has been amplified by standard PCR methodologies. The synthetic gene, subcloned into the expression vector pT7-7 was used to infect E. coli BL 21 (DE 3). Purification of crude supernatant from this transformant on Q Sepharose yields >200 mg of near-homogeneous KDO 8-P synthase per liter of cell culture. To explore the mechanism of KDO 8-P synthase, we prepared (E)- and (Z)-(3 2 H)PEP, (2- 13 C)PEP, and (2- 13 C, 18 O)PEP chemically from the appropriately labeled 3-bromopyruvates by reaction with trimethylphosphite under Perkow reaction conditions. Our 1 H-NMR analysis of the stereochemistry at C3 of the KDO 8-Ps, obtained by separate incubation of (E)- and (Z)-(3- 2 H)PEP with A 5-P in the presence of KDO 8-P synthase, demonstrated that the reaction is stereospecific with respect to both the C3 of PEP and the C1 carbonyl of A 5-P. (Z)-(3- 2 H)PEP gave predominantly (3S)-(3 2 H)KDO 8-P and (E)-(3- 2 H)PEP gave predominantly (3R)-(3 2 H)KDO-8P, which indicates condensation of the si face of PEP upon the re face of A 5-P-an orientation analogous to that seen with the similar aldehyde Iyase DAH 7-P synthase. The fate of the enolic oxygen of (2- 13 C, 18 O)PEP, during the course of the KDO 8-P synthase-catalyzed reaction as monitored by both 13 C- and 31 P-NMR spectroscopy demonstrated that the inorganic phosphate (Pi) and not the KDO 8-P contained the 18 O

Mechanistic studies of 3-deoxy-D-manno-octulosonic acid 8-phosphate synthase

Energy Technology Data Exchange (ETDEWEB)

Dotson, G.D.; Woodard, R.W. [Univ. of Michigan, Ann Arbor, MI (United States)

1994-12-01

The enzyme 3-deOXY-D-manno-octulosonic acid 8-phosphate synthase (KDO 8-P synthase) catalyses the condensation of arabinose 5-phosphate (A 5-P) with phosphoenolpyruvate (PEP) to give the unique eight-carbon acidic sugar 3-deoxy-D-nianno-octulosonic acid 8-phosphate (KDO 8-P) found only in gram-negative bacteria and required for lipid A maturation and cellular growth. The E. coli gene kdsA that encodes KDO 8-P synthase has been amplified by standard PCR methodologies. The synthetic gene, subcloned into the expression vector pT7-7 was used to infect E. coli BL 21 (DE 3). Purification of crude supernatant from this transformant on Q Sepharose yields >200 mg of near-homogeneous KDO 8-P synthase per liter of cell culture. To explore the mechanism of KDO 8-P synthase, we prepared (E)- and (Z)-(3{sup 2}H)PEP, (2-{sup 13}C)PEP, and (2-{sup 13}C,{sup 18}O)PEP chemically from the appropriately labeled 3-bromopyruvates by reaction with trimethylphosphite under Perkow reaction conditions. Our {sup 1}H-NMR analysis of the stereochemistry at C3 of the KDO 8-Ps, obtained by separate incubation of (E)- and (Z)-(3-{sup 2}H)PEP with A 5-P in the presence of KDO 8-P synthase, demonstrated that the reaction is stereospecific with respect to both the C3 of PEP and the C1 carbonyl of A 5-P. (Z)-(3-{sup 2}H)PEP gave predominantly (3S)-(3{sup 2}H)KDO 8-P and (E)-(3-{sup 2}H)PEP gave predominantly (3R)-(3{sup 2}H)KDO-8P, which indicates condensation of the si face of PEP upon the re face of A 5-P-an orientation analogous to that seen with the similar aldehyde Iyase DAH 7-P synthase. The fate of the enolic oxygen of (2-{sup 13}C, {sup 18}O)PEP, during the course of the KDO 8-P synthase-catalyzed reaction as monitored by both {sup 13}C- and {sup 31}P-NMR spectroscopy demonstrated that the inorganic phosphate (Pi) and not the KDO 8-P contained the {sup 18}O.

Synthesis and modifications of heterocyclic derivatives of D-arabinose: potential inhibitors of glucose-6-phosphate isomerase and glucosamine-6-phosphate synthase

International Nuclear Information System (INIS)

Viana, Renato Marcio Ribeiro; Prado, Maria Auxiliadora Fontes; Alves, Ricardo Jose

2008-01-01

The synthesis of -5-(D-arabino-1,2,3,4-tetrahydroxybutyl)tetrazole and -2-(d-arabino-1,2,3,4-tetra-acetoxybutyl)-5-methyl-1,3,4-oxadiazole from d-arabinose is described. Attempts at removing the protecting groups of the oxadiazole derivative were unsuccessful, leading to products resulting from the opening of the oxadiazole ring. The unprotected tetrazole derivative was selectively phosphorylated at the primary hydroxyl group with diethyl phosphoryl chloride. The resulting 5-[d-arabino-4-(diethylphosphoryloxy)-1,2,3-trihydroxybutyl]tetrazole is a protected form of a potential inhibitor of the enzymes glucose-6-phosphate isomerase and glucosamine synthase. (author)

Virtual Screening of Novel Glucosamine-6-Phosphate Synthase Inhibitors.

Science.gov (United States)

Lather, Amit; Sharma, Sunil; Khatkar, Anurag

2018-01-01

Infections caused by microorganisms are the major cause of death today. The tremendous and improper use of antimicrobial agents leads to antimicrobial resistance. Various currently available antimicrobial drugs are inadequate to control the infections and lead to various adverse drug reactions. Efforts based on computer-aided drug design (CADD) can excavate a large number of databases to generate new, potent hits and minimize the requirement of time as well as money for the discovery of newer antimicrobials. Pharmaceutical sciences also have made development with advances in drug designing concepts. The current research article focuses on the study of various G-6-P synthase inhibitors from literature cited molecular database. Docking analysis was conducted and ADMET data of various molecules was evaluated by Schrodinger Glide and PreADMET software, respectively. Here, the results presented efficacy of various inhibitors towards enzyme G-6-P synthase. Docking scores, binding energy and ADMET data of various molecules showed good inhibitory potential toward G-6-P synthase as compared to standard antibiotics. This novel antimicrobial drug target G-6-P synthase has not so extensively been explored for its application in antimicrobial therapy, so the work done so far proved highly essential. This article has helped the drug researchers and scientists to intensively explore about this wonderful antimicrobial drug target. The Schrodinger, Inc. (New York, USA) software was utilized to carry out the computational calculations and docking studies. The hardware configuration was Intel® core (TM) i5-4210U CPU @ 2.40GHz, RAM memory 4.0 GB under 64-bit window operating system. The ADMET data was calculated by using the PreADMET tool (PreADMET ver. 2.0). All the computational work was completed in the Laboratory for Enzyme Inhibition Studies, Department of Pharmaceutical Sciences, M.D. University, Rohtak, INDIA. Molecular docking studies were carried out to identify the binding

Downregulation of dTps1 in Drosophila melanogaster larvae confirms involvement of trehalose in redox regulation following desiccation.

Science.gov (United States)

Thorat, Leena; Mani, Krishna-Priya; Thangaraj, Pradeep; Chatterjee, Suvro; Nath, Bimalendu B

2016-03-01

As a survival strategy to environmental water deficits, desiccation-tolerant organisms are commonly known for their ability to recruit stress-protective biomolecules such as trehalose. We have previously reported the pivotal role of trehalose in larval desiccation tolerance in Drosophila melanogaster. Trehalose has emerged as a versatile molecule, serving mainly as energy source in insects and also being a stress protectant. While several recent reports have revealed the unconventional role of trehalose in scavenging reactive oxygen species in yeast and plants, this aspect has not received much attention in animals. We examined the status of desiccation-induced generation of reactive oxygen species in D. melanogaster larvae and the possible involvement of trehalose in ameliorating the harmful consequences thereof. Insect trehalose synthesis is governed by the enzyme trehalose 6-phosphate synthase 1 (TPS1). Using the ubiquitous da-GAL4-driven expression of the dTps1-RNAi transgene, we generated dTps1-downregulated Drosophila larvae possessing depleted levels of dTps1 transcripts. This resulted in the inability of the larvae for trehalose synthesis, thereby allowing us to elucidate the significance of trehalose in the regulation of desiccation-responsive redox homeostasis. Furthermore, the results from molecular genetics studies, biochemical assays, electron spin resonance analyses and a simple, non-invasive method of whole larval live imaging suggested that trehalose in collaboration with superoxide dismutase (SOD) is involved in the maintenance of redox state in D. melanogaster.

Increasing crop yield and resilience with trehalose 6-phosphate: targeting a feast-famine mechanism in cereals for better source-sink optimization.

Science.gov (United States)

Paul, Matthew J; Oszvald, Maria; Jesus, Claudia; Rajulu, Charukesi; Griffiths, Cara A

2017-07-20

Food security is a pressing global issue. New approaches are required to break through a yield ceiling that has developed in recent years for the major crops. As important as increasing yield potential is the protection of yield from abiotic stresses in an increasingly variable and unpredictable climate. Current strategies to improve yield include conventional breeding, marker-assisted breeding, quantitative trait loci (QTLs), mutagenesis, creation of hybrids, genetic modification (GM), emerging genome-editing technologies, and chemical approaches. A regulatory mechanism amenable to three of these approaches has great promise for large yield improvements. Trehalose 6-phosphate (T6P) synthesized in the low-flux trehalose biosynthetic pathway signals the availability of sucrose in plant cells as part of a whole-plant sucrose homeostatic mechanism. Modifying T6P content by GM, marker-assisted selection, and novel chemistry has improved yield in three major cereals under a range of water availabilities from severe drought through to flooding. Yield improvements have been achieved by altering carbon allocation and how carbon is used. Targeting T6P both temporally and spatially offers great promise for large yield improvements in productive (up to 20%) and marginal environments (up to 120%). This opinion paper highlights this important breakthrough in fundamental science for crop improvement. © The Author 2017. Published by Oxford University Press on behalf of the Society for Experimental Biology. All rights reserved. For permissions, please email: journals.permissions@oup.com.

Plasmodium falciparum dolichol phosphate mannose synthase represents a novel clade

International Nuclear Information System (INIS)

Shams-Eldin, Hosam; Santos de Macedo, Cristiana; Niehus, Sebastian; Dorn, Caroline; Kimmel, Juergen; Azzouz, Nahid; Schwarz, Ralph T.

2008-01-01

Dolichol phosphate mannose synthase (DPM) catalyzes the reaction between dolichol phosphate (Dol-P) and guanosine diphosphate mannose (GDP-Man) to form dolichol-phosphate-mannose (Dol-P-Man). This molecule acts as mannose donor for N-glycosylation and glycosylphosphatidylinositol (GPI) biosynthesis. The Plasmodium falciparum DPM1 (Pfdpm1) possesses a single predicted transmembrane region near the N-, but not the C-terminus. Here we show that the cloned Pfdpm1 gene failed to complement a Saccharomyces cerevisiae mutant indicating that the parasite gene does not belong to the baker's yeast group, as was previously assumed. Furthermore, Pfdpm1 was unable to complement a mouse mutant deficient in DPM but efficiently complements the Schizosaccharomyces pombe fission yeast mutant, indicating a difference between fission yeast and mammalian DPM genes. Therefore, we reanalyzed the hydrophobicity scales of all known DPMs and consequently reclassify the DPM clade into six major novel subgroups. Furthermore, we show that Pfdpm1 represents a unique enzyme among these subgroups

Cloning and sequence analysis of sucrose phosphate synthase gene from varieties of Pennisetum species.

Science.gov (United States)

Li, H C; Lu, H B; Yang, F Y; Liu, S J; Bai, C J; Zhang, Y W

2015-03-31

Sucrose phosphate synthase (SPS) is an enzyme used by higher plants for sucrose synthesis. In this study, three primer sets were designed on the basis of known SPS sequences from maize (GenBank: NM_001112224.1) and sugarcane (GenBank: JN584485.1), and five novel SPS genes were identified by RT-PCR from the genomes of Pennisetum spp (the hybrid P. americanum x P. purpureum, P. purpureum Schum., P. purpureum Schum. cv. Red, P. purpureum Schum. cv. Taiwan, and P. purpureum Schum. cv. Mott). The cloned sequences showed 99.9% identity and 80-88% similarity to the SPS sequences of other plants. The SPS gene of hybrid Pennisetum had one nucleotide and four amino acid polymorphisms compared to the other four germplasms, and cluster analysis was performed to assess genetic diversity in this species. Additional characterization of the SPS gene product can potentially allow Pennisetum to be exploited as a biofuel source.

Sucrose Phosphate Synthase and Sucrose Accumulation at Low Temperature 1

Science.gov (United States)

Guy, Charles L.; Huber, Joan L. A.; Huber, Steven C.

1992-01-01

The influence of growth temperature on the free sugar and sucrose phosphate synthase content and activity of spinach (Spinacia oleracea) leaf tissue was studied. When plants were grown at 25°C for 3 weeks and then transferred to a constant 5°C, sucrose, glucose, and fructose accumulated to high levels during a 14-d period. Predawn sugar levels increased from 14- to 20-fold over the levels present at the outset of the low-temperature treatment. Sucrose was the most abundant free sugar before, during, and after exposure to 5°C. Leaf sucrose phosphate synthase activity was significantly increased by the low-temperature treatment, whereas sucrose synthase and invertases were not. Synthesis of the sucrose phosphate synthase subunit was increased during and after low-temperature exposure and paralleled an increase in the steady-state level of the subunit. The increases in sucrose and its primary biosynthetic enzyme, sucrose phosphate synthase, are discussed in relation to adjustment of metabolism to low nonfreezing temperature and freezing stress tolerance. Images Figure 1 Figure 2 Figure 3 PMID:16652990

Characterization of a double deletion mutant of Fusarium verticillioides lacking two putative trehalose-6-phosphate phosphatase genes

Science.gov (United States)

Fusarium verticillioides is a fungal pathogen that commonly infects the stalk, ear, and kernels of corn and can produce fumonisins, a family of mycotoxins linked to disease in livestock and humans. Our goal is to characterize the role of the disaccharide trehalose in growth and stress response in F....

Timecourse microarray analyses reveal global changes in gene expression of susceptible Glycine max (soybean) roots during infection by Heterodera glycines (soybean cyst nematode).

Science.gov (United States)

Alkharouf, Nadim W; Klink, Vincent P; Chouikha, Imed B; Beard, Hunter S; MacDonald, Margaret H; Meyer, Susan; Knap, Halina T; Khan, Rana; Matthews, Benjamin F

2006-09-01

Changes in gene expression within roots of Glycine max (soybean), cv. Kent, susceptible to infection by Heterodera glycines (the soybean cyst nematode [SCN]), at 6, 12, and 24 h, and 2, 4, 6, and 8 days post-inoculation were monitored using microarrays containing more than 6,000 cDNA inserts. Replicate, independent biological samples were examined at each time point. Gene expression was analyzed statistically using T-tests, ANOVA, clustering algorithms, and online analytical processing (OLAP). These analyses allow the user to query the data in several ways without importing the data into third-party software. RT-PCR confirmed that WRKY6 transcription factor, trehalose phosphate synthase, EIF4a, Skp1, and CLB1 were differentially induced across most time-points. Other genes induced across most timepoints included lipoxygenase, calmodulin, phospholipase C, metallothionein-like protein, and chalcone reductase. RT-PCR demonstrated enhanced expression during the first 12 h of infection for Kunitz trypsin inhibitor and sucrose synthase. The stress-related gene, SAM-22, phospholipase D and 12-oxophytodienoate reductase were also induced at the early time-points. At 6 and 8 dpi there was an abundance of transcripts expressed that encoded genes involved in transcription and protein synthesis. Some of those genes included ribosomal proteins, and initiation and elongation factors. Several genes involved in carbon metabolism and transport were also more abundant. Those genes included glyceraldehyde 3-phosphate dehydrogenase, fructose-bisphosphate aldolase and sucrose synthase. These results identified specific changes in gene transcript levels triggered by infection of susceptible soybean roots by SCN.

Trehalose as an indicator of desiccation stress in Drosophila melanogaster larvae: A potential marker of anhydrobiosis

Energy Technology Data Exchange (ETDEWEB)

Thorat, Leena J. [Centre for Advanced Studies, Department of Zoology, University of Pune, Pune 411007 (India); Gaikwad, Sushama M. [Division of Biochemical Sciences, National Chemical Laboratory, Pune 411008 (India); Nath, Bimalendu B., E-mail: bbnath@unipune.ac.in [Centre for Advanced Studies, Department of Zoology, University of Pune, Pune 411007 (India)

2012-03-23

Highlights: Black-Right-Pointing-Pointer First report confirming anhydrobiosis in Drosophila melanogaster larvae. Black-Right-Pointing-Pointer Trehalose synthesis and accumulation in larvae that hydrolyzed on rehydration. Black-Right-Pointing-Pointer Trehalose synthesis in concert with the enzymes involved in trehalose metabolism. Black-Right-Pointing-Pointer Inhibition of trehalose hydrolysis in presence of a specific trehalase inhibitor. Black-Right-Pointing-Pointer Trehalose proposed as a reliable marker for biomonitoring of climate change studies. -- Abstract: In the current scenario of global climate change, desiccation is considered as one of the major environmental stressors for the biota exposed to altered levels of ambient temperature and humidity. Drosophila melanogaster, a cosmopolitan terrestrial insect has been chosen as a humidity-sensitive bioindicator model for the present study since its habitat undergoes frequent stochastic and/or seasonally aggravated dehydration regimes. We report here for the first time the occurrence of anhydrobiosis in D. melanogaster larvae by subjecting them to desiccation stress under laboratory conditions. Larvae desiccated for ten hours at <5% relative humidity could enter anhydrobiosis and could revive upon rehydration followed by resumption of active metabolism. As revealed by FTIR and HPLC analyzes, our findings strongly indicated the synthesis and accumulation of trehalose in the desiccating larvae. Biochemical measurements pointed out the desiccation-responsive trehalose metabolic pathway that was found to be coordinated in concert with the enzymes trehalose 6-phosphate synthase and trehalase. Further, an inhibitor-based experimental approach using deoxynojirimycin, a specific trehalase inhibitor, demonstrated the pivotal role of trehalose in larval anhydrobiosis of D. melanogaster. We therefore propose trehalose as a potential marker for the assessment of anhydrobiosis in Drosophila. The present findings thus add

Trehalose as an indicator of desiccation stress in Drosophila melanogaster larvae: A potential marker of anhydrobiosis

International Nuclear Information System (INIS)

Thorat, Leena J.; Gaikwad, Sushama M.; Nath, Bimalendu B.

2012-01-01

Highlights: ► First report confirming anhydrobiosis in Drosophila melanogaster larvae. ► Trehalose synthesis and accumulation in larvae that hydrolyzed on rehydration. ► Trehalose synthesis in concert with the enzymes involved in trehalose metabolism. ► Inhibition of trehalose hydrolysis in presence of a specific trehalase inhibitor. ► Trehalose proposed as a reliable marker for biomonitoring of climate change studies. -- Abstract: In the current scenario of global climate change, desiccation is considered as one of the major environmental stressors for the biota exposed to altered levels of ambient temperature and humidity. Drosophila melanogaster, a cosmopolitan terrestrial insect has been chosen as a humidity-sensitive bioindicator model for the present study since its habitat undergoes frequent stochastic and/or seasonally aggravated dehydration regimes. We report here for the first time the occurrence of anhydrobiosis in D. melanogaster larvae by subjecting them to desiccation stress under laboratory conditions. Larvae desiccated for ten hours at <5% relative humidity could enter anhydrobiosis and could revive upon rehydration followed by resumption of active metabolism. As revealed by FTIR and HPLC analyzes, our findings strongly indicated the synthesis and accumulation of trehalose in the desiccating larvae. Biochemical measurements pointed out the desiccation-responsive trehalose metabolic pathway that was found to be coordinated in concert with the enzymes trehalose 6-phosphate synthase and trehalase. Further, an inhibitor-based experimental approach using deoxynojirimycin, a specific trehalase inhibitor, demonstrated the pivotal role of trehalose in larval anhydrobiosis of D. melanogaster. We therefore propose trehalose as a potential marker for the assessment of anhydrobiosis in Drosophila. The present findings thus add to the growing list of novel biochemical markers in specific bioindicator organisms for fulfilling the urgent need of

Incorporation of phosphate into glycogen by glycogen synthase.

Science.gov (United States)

Contreras, Christopher J; Segvich, Dyann M; Mahalingan, Krishna; Chikwana, Vimbai M; Kirley, Terence L; Hurley, Thomas D; DePaoli-Roach, Anna A; Roach, Peter J

2016-05-01

The storage polymer glycogen normally contains small amounts of covalently attached phosphate as phosphomonoesters at C2, C3 and C6 atoms of glucose residues. In the absence of the laforin phosphatase, as in the rare childhood epilepsy Lafora disease, the phosphorylation level is elevated and is associated with abnormal glycogen structure that contributes to the pathology. Laforin therefore likely functions in vivo as a glycogen phosphatase. The mechanism of glycogen phosphorylation is less well-understood. We have reported that glycogen synthase incorporates phosphate into glycogen via a rare side reaction in which glucose-phosphate rather than glucose is transferred to a growing polyglucose chain (Tagliabracci et al. (2011) Cell Metab13, 274-282). We proposed a mechanism to account for phosphorylation at C2 and possibly at C3. Our results have since been challenged (Nitschke et al. (2013) Cell Metab17, 756-767). Here we extend the evidence supporting our conclusion, validating the assay used for the detection of glycogen phosphorylation, measurement of the transfer of (32)P from [β-(32)P]UDP-glucose to glycogen by glycogen synthase. The (32)P associated with the glycogen fraction was stable to ethanol precipitation, SDS-PAGE and gel filtration on Sephadex G50. The (32)P-signal was not affected by inclusion of excess unlabeled UDP before analysis or by treatment with a UDPase, arguing against the signal being due to contaminating [β-(32)P]UDP generated in the reaction. Furthermore, [(32)P]UDP did not bind non-covalently to glycogen. The (32)P associated with glycogen was released by laforin treatment, suggesting that it was present as a phosphomonoester. The conclusion is that glycogen synthase can mediate the introduction of phosphate into glycogen, thereby providing a possible mechanism for C2, and perhaps C3, phosphorylation. Copyright © 2016 Elsevier Inc. All rights reserved.

Biocatalytic Production of Trehalose from Maltose by Using Whole Cells of Permeabilized Recombinant Escherichia coli.

Directory of Open Access Journals (Sweden)

Zhaojuan Zheng

Full Text Available Trehalose is a non-reducing disaccharide, which can protect proteins, lipid membranes, and cells from desiccation, refrigeration, dehydration, and other harsh environments. Trehalose can be produced by different pathways and trehalose synthase pathway is a convenient, practical, and low-cost pathway for the industrial production of trehalose. In this study, 3 candidate treS genes were screened from genomic databases of Pseudomonas and expressed in Escherichia coli. One of them from P. stutzeri A1501 exhibited the best transformation ability from maltose into trehalose and the least byproduct. Thus, whole cells of this recombinant E. coli were used as biocatalyst for trehalose production. In order to improve the conversion rate of maltose to trehalose, optimization of the permeabilization and biotransformation were carried out. Under optimal conditions, 92.2 g/l trehalose was produced with a high productivity of 23.1 g/(l h. No increase of glucose was detected during the whole course. The biocatalytic process developed in this study might serve as a candidate for the large scale production of trehalose.

Journal of Genetics | Indian Academy of Sciences

Indian Academy of Sciences (India)

Home; Journals; Journal of Genetics; Volume 94; Issue 1. Identification of the trehalose-6-phosphate synthase gene family in winter wheat and expression analysis under conditions of freezing stress. D. W. Xie X. N. Wang L. S. Fu J. Sun W. Zheng Z. F. Li. Research Article Volume 94 Issue 1 March 2015 pp 55-65 ...

Disruption of Bcchs4, Bcchs6 or Bcchs7 chitin synthase genes in Botrytis cinerea and the essential role of class VI chitin synthase (Bcchs6).

Science.gov (United States)

Morcx, Serena; Kunz, Caroline; Choquer, Mathias; Assie, Sébastien; Blondet, Eddy; Simond-Côte, Elisabeth; Gajek, Karina; Chapeland-Leclerc, Florence; Expert, Dominique; Soulie, Marie-Christine

2013-03-01

Chitin synthases play critical roles in hyphal development and fungal pathogenicity. Previous studies on Botrytis cinerea, a model organism for necrotrophic pathogens, have shown that disruption of Bcchs1 and more particularly Bcchs3a genes have a drastic impact on virulence (Soulié et al., 2003, 2006). In this work, we investigate the role of other CHS including BcCHS4, BcCHS6 and BcCHS7 during the life cycle of B. cinerea. Single deletions of corresponding genes were carried out. Phenotypic analysis indicates that: (i) BcCHS4 enzyme is not essential for development and pathogenicity of the fungus; (ii) BcCHS7 is required for pathogenicity in a host dependant manner. For Bcchs6 gene disruption, we obtained only heterokaryotic strains. Indeed, sexual or asexual purification assays were unsuccessful. We concluded that class VI chitin synthase could be essential for B. cinerea and therefore BcCHS6 represents a valuable antifungal target. Copyright © 2012 Elsevier Inc. All rights reserved.

Identification, isolation and evaluation of a constitutive sucrose phosphate synthase gene promoter from tomato

International Nuclear Information System (INIS)

Naqvi, R.Z.; Mubeen, H.; Maqsood, A.; Khatoon, A.

2017-01-01

Sucrose phosphate synthase (SPS) is one of the abundantly expressed genes in plants. The promoters of SPS gene was identified, analyzed and retrieved from high throughput genomic sequence (HTGS) database. The cis-acting regulatory elements and transcription start sites of promoter were identified through different bioinformatics tools. The SPS promoter was isolated from Solanum lycopersicum and was initially cloned in TA vector (pTZ57R/T). Later on this promoter was transferred to a plant expression binary vector, pGR1 (pGRSPS) that was used for the transient GUS expression studies in various tissues of Nicotiana tabacum. SPS promoter was also cloned in plant stable expression vector pGA482 (pGASPS) and was transformed in Nicotiana tabacum through Agrobacterium-mediated transformation method. The histochemical GUS expression analysis of both transient and stable transgenic plants for this promoter indicated its functional importance in regulating gene expression in a constitutive manner. It was concluded that SPS promoter is constitutively expressed with a strength equivalent to CaMV 2X35S promoter. The promoter isolated through these studies may be effectively substituted in plant genetic engineering with other constitutive promoter for transgene expression in economically important agricultural crops. (author)

Effects of starvation on the carbohydrate metabolism in Harmonia axyridis (Pallas

Directory of Open Access Journals (Sweden)

Zuo-Kun Shi

2017-07-01

Full Text Available Trehalose plays an important role in energy storage, metabolism, and protection from extreme environmental conditions in insects. Trehalose is the main blood sugar in insects, and it can be rapidly used as an energy source in times of need. To elucidate the mechanisms of the starvation response, we observed the effects of starvation on trehalose and glycogen, trehalase activity, and the relative gene expression of genes in the trehalose and glycogen metabolic pathways in the invasive beetle Harmonia axyridis. Our results show that trehalose levels and the activities of two types of trehalases decreased significantly in the first 8 h of starvation, while the relative expression of HaTreh1-1 increased. While trehalose remained nearly constant at a relatively high level from 8 to 24 h, glycogen levels decreased significantly from 8 h to 24 h of starvation. Likewise, glycogen phosphorylase (HaGP expression was significantly higher at 12 to 24 h starvation than the first 8 h, while the expression of glycogen synthase (HaGS was relatively stable. Furthermore, trehalose decreased significantly from 24 h starvation to 72 h starvation, while trehalase activities and the relative expression of some HaTreh genes generally increased toward the end of the starvation period. The expression of trehalose-6-phosphate synthase (HaTPS increased significantly, supporting the increase in trehalose synthesis. These results show that trehalose plays a key role in the energy provided during the starvation process through the molecular and biochemical regulation of trehalose and glycogen metabolism.

Construction and characterization of a double deletion mutant of Fusarium verticillioides lacking two putative trehalose-6-phosphate phosphatase genes

Science.gov (United States)

Fusarium verticillioides is a fungal pathogen that commonly infects the stalk, ear, and kernels of corn and can produce fumonisins, a family of mycotoxins linked to disease in livestock and humans. Our goal is to characterize the role of the disaccharide trehalose in growth and stress response in F....

Investigating trehalose synthesis genes after cold acclimation in the Antarctic nematode Panagrolaimus sp. DAW1

Directory of Open Access Journals (Sweden)

Anna C. Seybold

2017-12-01

Full Text Available Panagrolaimus sp. DAW1 is a freeze-tolerant Antarctic nematode which survives extensive intracellular ice formation. The molecular mechanisms of this extreme adaptation are still poorly understood. We recently showed that desiccation-enhanced RNA interference (RNAi soaking can be used in conjunction with quantitative polymerase chain reaction (qPCR to screen for phenotypes associated with reduced expression of candidate genes in Panagrolaimus sp. DAW1. Here, we present the use of this approach to investigate the role of trehalose synthesis genes in this remarkable organism. Previous studies have shown that acclimating Panagrolaimus sp. DAW1 at 5°C before freezing or desiccation substantially enhances survival. In this study, the expression of tps-2 and other genes associated with trehalose metabolism, as well as lea-1, hsp-70 and gpx-1, in cold-acclimated and non-acclimated nematodes was analyzed using qPCR. Pd-tps-2 and Pd-lea-1 were significantly upregulated after cold acclimation, indicating an inducible expression in the cold adaptation of Panagrolaimus sp. DAW1. The role of trehalose synthesis genes in Panagrolaimus sp. DAW1 was further investigated by RNAi. Compared to the controls, Pd-tps-2a(RNAi-treated and cold-acclimated nematodes showed a significant decrease in mRNA, but no change in trehalose content or freezing survival. The involvement of two other trehalose synthesis genes (tps-2b and gob-1 was also investigated. These findings provide the first functional genomic investigation of trehalose synthesis genes in the non-model organism Panagrolaimus sp. DAW1. The presence of several trehalose synthesis genes with different RNAi sensitivities suggests the existence of multiple backup systems in Panagrolaimus sp. DAW1, underlining the importance of this sugar in preparation for freezing.

Over-expression of the mycobacterial trehalose-phosphate phosphatase OtsB2 results in a defect in macrophage phagocytosis associated with increased mycobacterial-macrophage adhesion

Directory of Open Access Journals (Sweden)

Hao Li

2016-11-01

Full Text Available Trehalose-6-phosphate phosphatase (OtsB2 is involved in the OtsAB trehalose synthesis pathway to produce free trehalose and is strictly essential for mycobacterial growth. We wished to determine the effects of OtsB2 expression on mycobacterial phenotypes such as growth, phagocytosis and survival in macrophages. Mycobacterium bovis-BCG (BCG over-expressing OtsB2 were able to better survive in stationary phase. Over-expression of OtsB2 led to a decrease in phagocytosis but not survival in THP-1 macrophage-like cells, and this was not due to a decrease in general macrophage phagocytic activity. Surprisingly, when we investigated macrophage-mycobacterial interactions by flow cytometry and atomic force microscopy, we discovered that BCG over-expressing OtsB2 have stronger binding to THP-1 cells than wild-type BCG. These results suggest that altering OtsB2 expression has implications for mycobacterial host-pathogen interactions. Macrophage-mycobacteria phagocytic interactions are complex and merit further study.

Trehalose-6-phosphate synthase and stabilization of yeast glycolysis

DEFF Research Database (Denmark)

Fraenkel, Dan; Nielsen, Jens

2016-01-01

‘Lost in transition: Startup of glycolysis yields subpopulations of nongrowing cells…’ (‘LIT’, van Heerden et al. 2014) is a massive paper from groups in Amsterdam and Delft, which deals with broad issues in metabolism and cell heterogeneity, as addressed for the predominant metabolic pathway......, glycolysis, in the context of a long studied but incompletely understood yeast mutant which is impaired in use of glucose without evident direct defects in the pathway. The primary approach is the quite original one of predicting, for the mutant, the dynamics of metabolism upon glucose addition, based...

Design, synthesis and in vitro evaluation on glucosamine-6P synthase of aromatic analogs of 2-Aminohexitols-6P

Energy Technology Data Exchange (ETDEWEB)

Dias, Danielle F.; Alves, Ricardo J., E-mail: ricardodylan@farmacia.ufmg.b [Universidade Federal de Minas Gerais (UFMG), Belo Horizonte, MG (Brazil). Faculdade de Farmacia; Roux, Celine; Durand, Philippe; Iorga, Bogdan; Badet-Denisot, Marie A.; Badet, Bernard [Centre National de la Recherche Scientifique (CNRS), Gif-sur-Yvette (France). Inst. de Chimie des Substances Naturelles

2010-07-01

The aminosugars are very important structural components of bacterial and fungi cell walls. Glucosamine-6-phosphate synthase (GlmS), which catalyses the first step of the aminosugar biosynthetic pathway i.e. the formation of D-glucosamine-6-phosphate from D-fructose-6-phosphate, is therefore an interesting target in the fight against microorganisms. In this work is described the synthesis of aromatic analogs of 2-amino-2-deoxy-D-glucitol-6-phosphate (ADGP) and its epimer 2-amino-2-deoxy-D-manitol-6-phosphate (ADMP), two important inhibitors of GlmS. The aromatic analogs displayed modest inhibitory activity against GlmS, with IC{sub 50} in the mmol L{sup -1} range. (author)

[BIOINFORMATIC SEARCH AND PHYLOGENETIC ANALYSIS OF THE CELLULOSE SYNTHASE GENES OF FLAX (LINUM USITATISSIMUM)].

Science.gov (United States)

Pydiura, N A; Bayer, G Ya; Galinousky, D V; Yemets, A I; Pirko, Ya V; Podvitski, T A; Anisimova, N V; Khotyleva, L V; Kilchevsky, A V; Blume, Ya B

2015-01-01

A bioinformatic search of sequences encoding cellulose synthase genes in the flax genome, and their comparison to dicots orthologs was carried out. The analysis revealed 32 cellulose synthase gene candidates, 16 of which are highly likely to encode cellulose synthases, and the remaining 16--cellulose synthase-like proteins (Csl). Phylogenetic analysis of gene products of cellulose synthase genes allowed distinguishing 6 groups of cellulose synthase genes of different classes: CesA1/10, CesA3, CesA4, CesA5/6/2/9, CesA7 and CesA8. Paralogous sequences within classes CesA1/10 and CesA5/6/2/9 which are associated with the primary cell wall formation are characterized by a greater similarity within these classes than orthologous sequences. Whereas the genes controlling the biosynthesis of secondary cell wall cellulose form distinct clades: CesA4, CesA7, and CesA8. The analysis of 16 identified flax cellulose synthase gene candidates shows the presence of at least 12 different cellulose synthase gene variants in flax genome which are represented in all six clades of cellulose synthase genes. Thus, at this point genes of all ten known cellulose synthase classes are identify in flax genome, but their correct classification requires additional research.

Characterization of D-myo-inositol 3-phosphate synthase gene expression in two soybean low phytate mutants

International Nuclear Information System (INIS)

Yuan Fengjie; Dong Dekun; Li Baiquan; Yu Xiaomin; Fu Xujun; Zhu Danhua; Zhu Shenlong; Yang Qinghua

2013-01-01

1D-myo-inositol 3-phosphate synthase (MIPS) gene plays a significant role in phytic acid biosynthesis. In this study, we used two low phytic acid mutants Gm-lpa-TW-1, Gm-lpa-ZC-2 and their respective wild type parents Taiwan75 and Zhechun No.3 to analyze the expression pattern and characterization of MIPS1 gene. The results showed that there was a common expression pattern of MIPS1 in soybean developing seeds. Expression was weak as detected by RT-PCR in initial stage, increased in the following stages, and the peak expression was appeared in 22 day after flowering (DAF). The expression of MIPS1 gene of non-seed tissues in mutant Gm-lpa-TW-1 and its wildtype Taiwan75 was very weak. In the developing seeds, the MIPS1 expression by qRT-PCR revealed a significant reduction in 22 DAF in mutant Gm-lpa-TW-1 as compared with the wildtype. Similarly, the expression of MIPS1 gene in non-seed tissue of Zhenchun No.3 and Gm-lpa-ZC-2 was very weak. However, stronger expression in developing seeds of the mutant Gm-lpa-ZC-2 than Zhechun No.3 was found. We concluded that the MIPS1 gene expression in the developing seed exhibited an up-regulation pattern in mutant Gm-lpa-ZC-2, but a down-regulation pattern in the mutant Gm-lpa-TW-1. (authors)

UVB-irradiated keratinocytes induce melanoma-associated ganglioside GD3 synthase gene in melanocytes via secretion of tumor necrosis factor α and interleukin 6

Energy Technology Data Exchange (ETDEWEB)

Miyata, Maiko [Department of Life and Medical Sciences, Chubu University Faculty of Life and Health Sciences, Matsumoto, Kasugai 487-8501 (Japan); Department of Biochemistry II, Nagoya University Graduate School of Medicine, 65 Tsurumai, Showa-ku, Nagoya 466-0065 (Japan); Ichihara, Masatoshi; Tajima, Orie; Sobue, Sayaka; Kambe, Mariko [Department of Life and Medical Sciences, Chubu University Faculty of Life and Health Sciences, Matsumoto, Kasugai 487-8501 (Japan); Sugiura, Kazumitsu [Department of Dermatology, Nagoya University Graduate School of Medicine, 65 Tsurumai, Showa-ku, Nagoya 466-0065 (Japan); Furukawa, Koichi, E-mail: koichi@med.nagoya-u.ac.jp [Department of Biochemistry II, Nagoya University Graduate School of Medicine, 65 Tsurumai, Showa-ku, Nagoya 466-0065 (Japan); Furukawa, Keiko [Department of Life and Medical Sciences, Chubu University Faculty of Life and Health Sciences, Matsumoto, Kasugai 487-8501 (Japan); Department of Biochemistry II, Nagoya University Graduate School of Medicine, 65 Tsurumai, Showa-ku, Nagoya 466-0065 (Japan)

2014-03-07

Highlights: • Melanocytes showed low ST8SIA1 and high B3GALT4 levels in contrast with melanomas. • Direct UVB irradiation of melanocytes did not induce ganglioside synthase genes. • Culture supernatants of UVB-irradiated keratinocytes induced ST8SIA1 in melanocytes. • TNFα and IL-6 secreted from keratinocytes enhanced ST8SIA1 expression in melanocytes. • Inflammatory cytokines induced melanoma-related ST8SIA1 in melanocytes. - Abstract: Although expression of gangliosides and their synthetic enzyme genes in malignant melanomas has been well studied, that in normal melanocytes has been scarcely analyzed. In particular, changes in expression levels of glycosyltransferase genes responsible for ganglioside synthesis during evolution of melanomas from melanocytes are very important to understand roles of gangliosides in melanomas. Here, expression of glycosyltransferase genes related to the ganglioside synthesis was analyzed using RNAs from cultured melanocytes and melanoma cell lines. Quantitative RT-PCR revealed that melanomas expressed high levels of mRNA of GD3 synthase and GM2/GD2 synthase genes and low levels of GM1/GD1b synthase genes compared with melanocytes. As a representative exogenous stimulation, effects of ultraviolet B (UVB) on the expression levels of 3 major ganglioside synthase genes in melanocytes were analyzed. Although direct UVB irradiation of melanocytes caused no marked changes, culture supernatants of UVB-irradiated keratinocytes (HaCaT cells) induced definite up-regulation of GD3 synthase and GM2/GD2 synthase genes. Detailed examination of the supernatants revealed that inflammatory cytokines such as TNFα and IL-6 enhanced GD3 synthase gene expression. These results suggest that inflammatory cytokines secreted from UVB-irradiated keratinocytes induced melanoma-associated ganglioside synthase genes, proposing roles of skin microenvironment in the promotion of melanoma-like ganglioside profiles in melanocytes.

UVB-irradiated keratinocytes induce melanoma-associated ganglioside GD3 synthase gene in melanocytes via secretion of tumor necrosis factor α and interleukin 6

International Nuclear Information System (INIS)

Miyata, Maiko; Ichihara, Masatoshi; Tajima, Orie; Sobue, Sayaka; Kambe, Mariko; Sugiura, Kazumitsu; Furukawa, Koichi; Furukawa, Keiko

2014-01-01

Highlights: • Melanocytes showed low ST8SIA1 and high B3GALT4 levels in contrast with melanomas. • Direct UVB irradiation of melanocytes did not induce ganglioside synthase genes. • Culture supernatants of UVB-irradiated keratinocytes induced ST8SIA1 in melanocytes. • TNFα and IL-6 secreted from keratinocytes enhanced ST8SIA1 expression in melanocytes. • Inflammatory cytokines induced melanoma-related ST8SIA1 in melanocytes. - Abstract: Although expression of gangliosides and their synthetic enzyme genes in malignant melanomas has been well studied, that in normal melanocytes has been scarcely analyzed. In particular, changes in expression levels of glycosyltransferase genes responsible for ganglioside synthesis during evolution of melanomas from melanocytes are very important to understand roles of gangliosides in melanomas. Here, expression of glycosyltransferase genes related to the ganglioside synthesis was analyzed using RNAs from cultured melanocytes and melanoma cell lines. Quantitative RT-PCR revealed that melanomas expressed high levels of mRNA of GD3 synthase and GM2/GD2 synthase genes and low levels of GM1/GD1b synthase genes compared with melanocytes. As a representative exogenous stimulation, effects of ultraviolet B (UVB) on the expression levels of 3 major ganglioside synthase genes in melanocytes were analyzed. Although direct UVB irradiation of melanocytes caused no marked changes, culture supernatants of UVB-irradiated keratinocytes (HaCaT cells) induced definite up-regulation of GD3 synthase and GM2/GD2 synthase genes. Detailed examination of the supernatants revealed that inflammatory cytokines such as TNFα and IL-6 enhanced GD3 synthase gene expression. These results suggest that inflammatory cytokines secreted from UVB-irradiated keratinocytes induced melanoma-associated ganglioside synthase genes, proposing roles of skin microenvironment in the promotion of melanoma-like ganglioside profiles in melanocytes

myo-Inositol-1-phosphate synthase is required for polar auxin transport and organ development

KAUST Repository

Chen, Hao

2010-06-01

myo-Inositol-1-phosphate synthase is a conserved enzyme that catalyzes the first committed and rate-limiting step in inositol biosynthesis. Despite its wide occurrence in all eukaryotes, the role of myo-inositol-1-phosphate synthase and de novo inositol biosynthesis in cell signaling and organism development has been unclear. In this study, we isolated loss-of-function mutants in the Arabidopsis MIPS1 gene from different ecotypes. It was found that all mips1 mutants are defective in embryogenesis, cotyledon venation patterning, root growth, and root cap development. The mutant roots are also agravitropic and have reduced basipetal auxin transport. mips1 mutants have significantly reduced levels of major phosphatidylinositols and exhibit much slower rates of endocytosis. Treatment with brefeldin A induces slower PIN2 protein aggregation in mips1, indicating altered PIN2 trafficking. Our results demonstrate that MIPS1 is critical for maintaining phosphatidylinositol levels and affects pattern formation in plants likely through regulation of auxin distribution. © 2010 by The American Society for Biochemistry and Molecular Biology, Inc.

Trehalose: a biophysics approach to modulate the inflammatory response during endotoxic shock.

Science.gov (United States)

Minutoli, Letteria; Altavilla, Domenica; Bitto, Alessandra; Polito, Francesca; Bellocco, Ersilia; Laganà, Giuseppina; Fiumara, Tiziana; Magazù, Salvatore; Migliardo, Federica; Venuti, Francesco Saverio; Squadrito, Francesco

2008-07-28

We evaluated the effects of trehalose against endotoxic shock, a condition in which the loss of bio-membrane integrity plays a pivotal role. In addition we performed a biophysics experiment by quasi elastic neutron scattering (QENS) study, to investigate whether the membrane stability effect of trehalose might be correlated with its high capability to switch-off the water diffusive dynamics and, hence, the kinetic mechanisms of interaction. Endotoxic shock was induced in male rats by a single injection of Salmonella enteritidis lipopolysaccharide (LPS; 20 mg/kg/i.p.). Thirty minutes before and 2 h after LPS injection, the animals were randomized to receive vehicle (1 ml/kg/i.p. 0.9%NaCl), sucrose (1 g/kg/i.p.) or trehalose (1 g/kg/i.p.). Mean arterial blood pressure, nuclear factor-kappaB (NF-kappaB) binding activity, Ikappa-Balpha and toll-like receptor-4 (TLR-4) activation were evaluated in both liver and lung. Plasmatic tumor necrosis factor-alpha (TNF-alpha), interleukin-1 (IL-1), interleukin-6 (IL-6) and malondialdehyde (MDA) were also investigated. We studied liver injury by means of blood alanine aminotransferase activity (ALT); inducible nitric oxide synthase (iNOS) expression, myeloperoxidase (MPO) activity and tissue edema evaluation. Lung injury was investigated by means of tissue monocyte chemoattractant protein-1 (MCP-1) levels, MPO activity, iNOS expression and edema formation. Trehalose reduced hypotension, NF-kappaB binding activity, IkappaBalpha protein loss and TLR-4 activation. In addition trehalose reduced TNF-alpha, IL-1, IL-6 and MDA levels. Trehalose also blunted liver and lung injury. QENS measurements showed also that trehalose possesses a high "switching off" capability. Sucrose did not modify endotoxic shock-induced sequelae. Trehalose blocked the inflammatory cascade triggered by endotoxin shock, stabilizing the bio-membranes and switching off the water diffusive dynamics.

Cloning and characterization of indole synthase (INS) and a putative tryptophan synthase α-subunit (TSA) genes from Polygonum tinctorium.

Science.gov (United States)

Jin, Zhehao; Kim, Jin-Hee; Park, Sang Un; Kim, Soo-Un

2016-12-01

Two cDNAs for indole-3-glycerol phosphate lyase homolog were cloned from Polygonum tinctorium. One encoded cytosolic indole synthase possibly in indigoid synthesis, whereas the other encoded a putative tryptophan synthase α-subunit. Indigo is an old natural blue dye produced by plants such as Polygonum tinctorium. Key step in plant indigoid biosynthesis is production of indole by indole-3-glycerol phosphate lyase (IGL). Two tryptophan synthase α-subunit (TSA) homologs, PtIGL-short and -long, were isolated by RACE PCR from P. tinctorium. The genome of the plant contained two genes coding for IGL. The short and the long forms, respectively, encoded 273 and 316 amino acid residue-long proteins. The short form complemented E. coli ΔtnaA ΔtrpA mutant on tryptophan-depleted agar plate signifying production of free indole, and thus was named indole synthase gene (PtINS). The long form, either intact or without the transit peptide sequence, did not complement the mutant and was tentatively named PtTSA. PtTSA was delivered into chloroplast as predicted by 42-residue-long targeting sequence, whereas PtINS was localized in cytosol. Genomic structure analysis suggested that a TSA duplicate acquired splicing sites during the course of evolution toward PtINS so that the targeting sequence-containing pre-mRNA segment was deleted as an intron. PtINS had about two to fivefolds higher transcript level than that of PtTSA, and treatment of 2,1,3-benzothiadiazole caused the relative transcript level of PtINS over PtTSA was significantly enhanced in the plant. The results indicate participation of PtINS in indigoid production.

L-Myo-inositol 1-phosphate synthase in the aquatic fern Azolla filiculoides.

Science.gov (United States)

Benaroya, Rony Oren; Zamski, Eli; Tel-Or, Elisha

2004-02-01

L-Myo-inositol 1-phosphate synthase (INPS EC 5.5.1.4) catalyzes the conversion of D-glucose 6-phosphate to L-myo-inositol 1-phosphate. INPS is a key enzyme involved in the biosynthesis of phytate which is a common form of stored phosphates in higher plants. The present study monitored the increase of INPS expression in Azolla filiculoides resulting from exposure to inorganic phosphates, metals and salt stress. The expression of INPS was significantly higher in Azolla plants that were grown in rich mineral growth medium than those maintained on nutritional growth medium. The expression of INPS protein and corresponding mRNA increased in plants cultured in minimal nutritional growth medium when phosphate or Zn2+, Cd2+ and NaCl were added to the growth medium. When employing rich mineral growth medium, INPS protein content increased with the addition of Zn2+, but decreased in the presence of Cd2+ and NaCl. These results indicated that accumulation of phytate in Azolla is a result of the intensified expression of INPS protein and mRNA, and its regulation may be primarily derived by the uptake of inorganic phosphate, and Zn2+, Cd2+ or NaCl.

Expression, purification and preliminary crystallographic analysis of sucrose phosphate synthase (SPS) from Halothermothrix orenii

International Nuclear Information System (INIS)

Huynh, Frederick; Tan, Tien-Chye; Swaminathan, Kunchithapadam; Patel, Bharat K. C.

2004-01-01

The first crystallographic study of a sucrose phosphate synthase from H. orenii, an organism that is both thermophilic and halophilic, is reported. The protein crystal diffracts X-rays to 3.01 Å. This is the first report of the crystallization of a sucrose phosphate synthase (SPS; EC 2.4.1.14). It also constitutes the first study of a sucrose phosphate synthase from a non-photosynthetic thermohalophilic anaerobic bacterium, Halothermothrix orenii. The purified recombinant spsA protein has been crystallized in the monoclinic space group C2, with unit-cell parameters a = 154.2, b = 47.9, c = 72.3 Å, β = 103.16°, using the hanging-drop vapour-diffusion method. The crystal diffracts X-rays to a resolution limit of 3.01 Å. Heavy-metal and halide-soaking trials are currently in progress to solve the structure

Engineered Trehalose Permeable to Mammalian Cells.

Directory of Open Access Journals (Sweden)

Alireza Abazari

Full Text Available Trehalose is a naturally occurring disaccharide which is associated with extraordinary stress-tolerance capacity in certain species of unicellular and multicellular organisms. In mammalian cells, presence of intra- and extracellular trehalose has been shown to confer improved tolerance against freezing and desiccation. Since mammalian cells do not synthesize nor import trehalose, the development of novel methods for efficient intracellular delivery of trehalose has been an ongoing investigation. Herein, we studied the membrane permeability of engineered lipophilic derivatives of trehalose. Trehalose conjugated with 6 acetyl groups (trehalose hexaacetate or 6-O-Ac-Tre demonstrated superior permeability in rat hepatocytes compared with regular trehalose, trehalose diacetate (2-O-Ac-Tre and trehalose tetraacetate (4-O-Ac-Tre. Once in the cell, intracellular esterases hydrolyzed the 6-O-Ac-Tre molecules, releasing free trehalose into the cytoplasm. The total concentration of intracellular trehalose (plus acetylated variants reached as high as 10 fold the extracellular concentration of 6-O-Ac-Tre, attaining concentrations suitable for applications in biopreservation. To describe this accumulation phenomenon, a diffusion-reaction model was proposed and the permeability and reaction kinetics of 6-O-Ac-Tre were determined by fitting to experimental data. Further studies suggested that the impact of the loading and the presence of intracellular trehalose on cellular viability and function were negligible. Engineering of trehalose chemical structure rather than manipulating the cell, is an innocuous, cell-friendly method for trehalose delivery, with demonstrated potential for trehalose loading in different types of cells and cell lines, and can facilitate the wide-spread application of trehalose as an intracellular protective agent in biopreservation studies.

The Tomato Terpene Synthase Gene Family1[W][OA

Science.gov (United States)

Falara, Vasiliki; Akhtar, Tariq A.; Nguyen, Thuong T.H.; Spyropoulou, Eleni A.; Bleeker, Petra M.; Schauvinhold, Ines; Matsuba, Yuki; Bonini, Megan E.; Schilmiller, Anthony L.; Last, Robert L.; Schuurink, Robert C.; Pichersky, Eran

2011-01-01

Compounds of the terpenoid class play numerous roles in the interactions of plants with their environment, such as attracting pollinators and defending the plant against pests. We show here that the genome of cultivated tomato (Solanum lycopersicum) contains 44 terpene synthase (TPS) genes, including 29 that are functional or potentially functional. Of these 29 TPS genes, 26 were expressed in at least some organs or tissues of the plant. The enzymatic functions of eight of the TPS proteins were previously reported, and here we report the specific in vitro catalytic activity of 10 additional tomato terpene synthases. Many of the tomato TPS genes are found in clusters, notably on chromosomes 1, 2, 6, 8, and 10. All TPS family clades previously identified in angiosperms are also present in tomato. The largest clade of functional TPS genes found in tomato, with 12 members, is the TPS-a clade, and it appears to encode only sesquiterpene synthases, one of which is localized to the mitochondria, while the rest are likely cytosolic. A few additional sesquiterpene synthases are encoded by TPS-b clade genes. Some of the tomato sesquiterpene synthases use z,z-farnesyl diphosphate in vitro as well, or more efficiently than, the e,e-farnesyl diphosphate substrate. Genes encoding monoterpene synthases are also prevalent, and they fall into three clades: TPS-b, TPS-g, and TPS-e/f. With the exception of two enzymes involved in the synthesis of ent-kaurene, the precursor of gibberellins, no other tomato TPS genes could be demonstrated to encode diterpene synthases so far. PMID:21813655

Antisense repression of sucrose phosphate synthase in transgenic muskmelon alters plant growth and fruit development

International Nuclear Information System (INIS)

Tian, Hongmei; Ma, Leyuan; Zhao, Cong; Hao, Hui; Gong, Biao; Yu, Xiyan; Wang, Xiufeng

2010-01-01

To unravel the roles of sucrose phosphate synthase (SPS) in muskmelon (Cucumis melo L.), we reduced its activity in transgenic muskmelon plants by an antisense approach. For this purpose, an 830 bp cDNA fragment of muskmelon sucrose phosphate synthase was expressed in antisense orientation behind the 35S promoter of the cauliflower mosaic virus. The phenotype of the antisense plants clearly differed from that of control plants. The transgenic plant leaves were markedly smaller, and the plant height and stem diameter were obviously shorter and thinner. Transmission electron microscope observation revealed that the membrane degradation of chloroplast happened in transgenic leaves and the numbers of grana and grana lamella in the chloroplast were significantly less, suggesting that the slow growth and weaker phenotype of transgenic plants may be due to the damage of the chloroplast ultrastructure, which in turn results in the decrease of the net photosynthetic rate. The sucrose concentration and levels of sucrose phosphate synthase decreased in transgenic mature fruit, and the fruit size was smaller than the control fruit. Together, our results suggest that sucrose phosphate synthase may play an important role in regulating the muskmelon plant growth and fruit development.

Antisense repression of sucrose phosphate synthase in transgenic muskmelon alters plant growth and fruit development

Energy Technology Data Exchange (ETDEWEB)

Tian, Hongmei; Ma, Leyuan; Zhao, Cong; Hao, Hui; Gong, Biao [College of Horticulture Science and Engineering, State Key Laboratory of Crop Biology, Shandong Agricultural University, Tai' an, Shandong 271018 (China); Yu, Xiyan, E-mail: yuxiyan@sdau.edu.cn [College of Horticulture Science and Engineering, State Key Laboratory of Crop Biology, Shandong Agricultural University, Tai' an, Shandong 271018 (China); Wang, Xiufeng, E-mail: xfwang@sdau.edu.cn [College of Horticulture Science and Engineering, State Key Laboratory of Crop Biology, Shandong Agricultural University, Tai' an, Shandong 271018 (China)

2010-03-12

To unravel the roles of sucrose phosphate synthase (SPS) in muskmelon (Cucumis melo L.), we reduced its activity in transgenic muskmelon plants by an antisense approach. For this purpose, an 830 bp cDNA fragment of muskmelon sucrose phosphate synthase was expressed in antisense orientation behind the 35S promoter of the cauliflower mosaic virus. The phenotype of the antisense plants clearly differed from that of control plants. The transgenic plant leaves were markedly smaller, and the plant height and stem diameter were obviously shorter and thinner. Transmission electron microscope observation revealed that the membrane degradation of chloroplast happened in transgenic leaves and the numbers of grana and grana lamella in the chloroplast were significantly less, suggesting that the slow growth and weaker phenotype of transgenic plants may be due to the damage of the chloroplast ultrastructure, which in turn results in the decrease of the net photosynthetic rate. The sucrose concentration and levels of sucrose phosphate synthase decreased in transgenic mature fruit, and the fruit size was smaller than the control fruit. Together, our results suggest that sucrose phosphate synthase may play an important role in regulating the muskmelon plant growth and fruit development.

Glycogen synthase activation by sugars in isolated hepatocytes.

Science.gov (United States)

Ciudad, C J; Carabaza, A; Bosch, F; Gòmez I Foix, A M; Guinovart, J J

1988-07-01

We have investigated the activation by sugars of glycogen synthase in relation to (i) phosphorylase a activity and (ii) changes in the intracellular concentration of glucose 6-phosphate and adenine nucleotides. All the sugars tested in this work present the common denominator of activating glycogen synthase. On the other hand, phosphorylase a activity is decreased by mannose and glucose, unchanged by galactose and xylitol, and increased by tagatose, glyceraldehyde, and fructose. Dihydroxyacetone exerts a biphasic effect on phosphorylase. These findings provide additional evidence proving that glycogen synthase can be activated regardless of the levels of phosphorylase a, clearly establishing that a nonsequential mechanism for the activation of glycogen synthase occurs in liver cells. The glycogen synthase activation state is related to the concentrations of glucose 6-phosphate and adenine nucleotides. In this respect, tagatose, glyceraldehyde, and fructose deplete ATP and increase AMP contents, whereas glucose, mannose, galactose, xylitol, and dihydroxyacetone do not alter the concentration of these nucleotides. In addition, all these sugars, except glyceraldehyde, increase the intracellular content of glucose 6-phosphate. The activation of glycogen synthase by sugars is reflected in decreases on both kinetic constants of the enzyme, M0.5 (for glucose 6-phosphate) and S0.5 (for UDP-glucose). We propose that hepatocyte glycogen synthase is activated by monosaccharides by a mechanism triggered by changes in glucose 6-phosphate and adenine nucleotide concentrations which have been described to modify glycogen synthase phosphatase activity. This mechanism represents a metabolite control of the sugar-induced activation of hepatocyte glycogen synthase.

Identification of TPS family members in apple (Malus x domestica Borkh.) and the effect of sucrose sprays on TPS expression and floral induction.

Science.gov (United States)

Du, Lisha; Qi, Siyan; Ma, Juanjuan; Xing, Libo; Fan, Sheng; Zhang, Songwen; Li, Youmei; Shen, Yawen; Zhang, Dong; Han, Mingyu

2017-11-01

Trehalose (α-D-glucopyranosyl α-D-glucopyranoside) is a non-reducing disaccharide that serves as a carbon source and stress protectant in apple trees. Trehalose-6-phosphate (T6P) is the biosynthetic precursor of trehalose. It functions as a crucial signaling molecule involved in the regulation of floral induction, and is closely related to sucrose. Trehalose-6-phosphate synthase (TPS) family members are pivotal components of the T6P biosynthetic pathway. The present study identified 13 apple TPS family members and characterized their expression patterns in different tissues and in response to exogenous application of sucrose during floral induction. 'Fuji' apple trees were sprayed with sucrose prior to the onset of floral induction. Bud growth, flowering rate, and endogenous sugar levels were then monitored. The expression of genes associated with sucrose metabolism and flowering were also characterized by RT-quantitative PCR. Results revealed that sucrose applications significantly improved flower production and increased bud size and fresh weight, as well as the sucrose content in buds and leaves. Furthermore, the expression of MdTPS1, 2, 4, 10, and 11 was rapidly and significantly up-regulated in response to the sucrose treatments. In addition, the expression levels of flowering-related genes (e.g., SPL genes, FT1, and AP1) also increased in response to the sucrose sprays. In summary, apple TPS family members were identified that may influence the regulation of floral induction and other responses to sucrose. The relationship between sucrose and T6P or TPS during the regulation of floral induction in apple trees is discussed. Copyright © 2017 Elsevier Masson SAS. All rights reserved.

Trehalose Analogues: Latest Insights in Properties and Biocatalytic Production

Directory of Open Access Journals (Sweden)

Maarten Walmagh

2015-06-01

Full Text Available Trehalose (α-d-glucopyranosyl α-d-glucopyranoside is a non-reducing sugar with unique stabilizing properties due to its symmetrical, low energy structure consisting of two 1,1-anomerically bound glucose moieties. Many applications of this beneficial sugar have been reported in the novel food (nutricals, medical, pharmaceutical and cosmetic industries. Trehalose analogues, like lactotrehalose (α-d-glucopyranosyl α-d-galactopyranoside or galactotrehalose (α-d-galactopyranosyl α-d-galactopyranoside, offer similar benefits as trehalose, but show additional features such as prebiotic or low-calorie sweetener due to their resistance against hydrolysis during digestion. Unfortunately, large-scale chemical production processes for trehalose analogues are not readily available at the moment due to the lack of efficient synthesis methods. Most of the procedures reported in literature suffer from low yields, elevated costs and are far from environmentally friendly. “Greener” alternatives found in the biocatalysis field, including galactosidases, trehalose phosphorylases and TreT-type trehalose synthases are suggested as primary candidates for trehalose analogue production instead. Significant progress has been made in the last decade to turn these into highly efficient biocatalysts and to broaden the variety of useful donor and acceptor sugars. In this review, we aim to provide an overview of the latest insights and future perspectives in trehalose analogue chemistry, applications and production pathways with emphasis on biocatalysis.

Mitochondrially-Encoded Adenosine Triphosphate Synthase 6 Gene Haplotype Variation among World Population during 2003-2013

OpenAIRE

Steven Steven; Yoni F Syukriani; Julius B Dewanto

2016-01-01

Background: Adaptation and natural selection serve as an important part of evolution. Adaptation in molecular level can lead to genetic drift which causes mutation of genetic material; one of which is polymorphism of mitochondrial DNA (mtDNA). The aim of this study is to verify the polymorphism of mitochondrially-encoded Adenosine Triphosphate synthase6gene (MT-ATP6) as one of mtDNA building blocks among tropic, sub-tropic, and polar areas. Methods: This descriptive quantitative research used...

Influence of trehalose 6,6'-diester (TDX) chain length on the physicochemical and immunopotentiating properties of DDA/TDX liposomes

DEFF Research Database (Denmark)

Kallerup, Rie Selchau; Madsen, Cecilie Maria; Schiøth, Mikkel Lohmann

2015-01-01

Linking physicochemical characterization to functional properties is crucial for defining critical quality attributes during development of subunit vaccines toward optimal safety and efficacy profiles. We investigated how the trehalose 6,6'-diester (TDX) chain length influenced the physicochemical...... and immunopotentiating properties of the clinically tested liposomal adjuvant composed of dimethyldioctadecylammonium (DDA) bromide and analogues of trehalose-6,6'-dibehenate (TDB). TDB analogues with symmetrically shortened acyl chains [denoted X: arachidate (A), stearate (S), palmitate (P), myristate (Myr) and laurate...

Nucleotide variability in the 5-enolpyruvylshikimate-3-phosphate synthase gene from Eleusine indica (L.) Gaertn.

Science.gov (United States)

Chong, J L; Wickneswari, R; Ismail, B S; Salmijah, S

2008-02-01

This study reports the results of the partial DNA sequence analysis of the 5-enolpyruvyl-shikimate-3-phosphate synthase (EPSPS) gene in glyphosate-resistant (R) and glyphosate-susceptible (S) biotypes of Eleusine indica (L.) Gaertn from Peninsular Malaysia. Sequencing results revealed point mutation at nucleotide position 875 in the R biotypes of Bidor, Chaah and Temerloh. In the Chaah R population, substitution of cytosine (C) to adenine (A) resulted in the change of threonine (Thr106) to proline (Pro106) and from C to thymidine (T) in the Bidor R population, leading to serine (Ser106) from Pro106. As for the Temerloh R, C was substituted by T resulting in the change of Pro106 to Ser106. A new mutation previously undetected in the Temerloh R was revealed with C being substituted with A, resulting in the change of Pro106 to Thr106 indicating multiple founding events rather than to the spread of a single resistant allele. There was no point mutation recorded at nucleotide position 875 previously demonstrated to play a pivotal role in conferring glyphosate resistance to E. indica for the Lenggeng, Kuala Selangor, Melaka R populations. Thus, there may be another resistance mechanism yet undiscovered in the resistant Lenggeng, Kuala Selangor and Melaka populations.

Immunization of Mastomys coucha with Brugia malayi recombinant trehalose-6-phosphate phosphatase results in significant protection against homologous challenge infection.

Directory of Open Access Journals (Sweden)

Susheela Kushwaha

Full Text Available Development of a vaccine to prevent or reduce parasite development in lymphatic filariasis would be a complementary approach to existing chemotherapeutic tools. Trehalose-6-phosphate phosphatase of Brugia malayi (Bm-TPP represents an attractive vaccine target due to its absence in mammals, prevalence in the major life stages of the parasite and immunoreactivity with human bancroftian antibodies, especially from endemic normal subjects. We have recently reported on the cloning, expression, purification and biochemical characterization of this vital enzyme of B. malayi. In the present study, immunoprophylactic evaluation of Bm-TPP was carried out against B. malayi larval challenge in a susceptible host Mastomys coucha and the protective ability of the recombinant protein was evaluated by observing the adverse effects on microfilarial density and adult worm establishment. Immunization caused 78.4% decrease in microfilaremia and 71.04% reduction in the adult worm establishment along with sterilization of 70.06% of the recovered live females. The recombinant protein elicited a mixed Th1/Th2 type of protective immune response as evidenced by the generation of both pro- and anti-inflammatory cytokines IL-2, IFN-γ, TNF-α, IL-4 and an increased production of antibody isotypes IgG1, IgG2a, IgG2b and IgA. Thus immunization with Bm-TPP conferred considerable protection against B. malayi establishment by engendering a long-lasting effective immune response and therefore emerges as a potential vaccine candidate against lymphatic filariasis (LF.

Fine tuning of trehalose biosynthesis and hydrolysis as novel tools for the generation of abiotic stress tolerant plants

Directory of Open Access Journals (Sweden)

Ines eDelorge

2014-04-01

Full Text Available The impact of abiotic stress on plant growth and development has been and still is a major research topic. An important pathway that has been linked to abiotic stress tolerance is the trehalose biosynthetic pathway. Recent findings showed that trehalose metabolism is also important for normal plant growth and development. The intermediate compound – Trehalose-6-Phosphate (T6P – is now confirmed to act as a sensor for available sucrose, hereby directly influencing the type of response to the changing environmental conditions. This is possible because T6P and/or trehalose or their biosynthetic enzymes are part of complex interaction networks with other crucial hormone and sugar-induced signalling pathways, which may function at different developmental stages. Because of its effect on plant growth and development, modification of trehalose biosynthesis, either at the level of T6P synthesis, T6P hydrolysis or trehalose hydrolysis, has been utilized to try to improve crop yield and biomass. It was shown that alteration of the amounts of either T6P and/or trehalose did result in increased stress tolerance, but also resulted in many unexpected phenotypic alterations. A main challenge is to characterize the part of the signalling pathway resulting in improved stress tolerance, without affecting the pathways resulting in the unwanted phenotypes. One such specific pathway where modification of trehalose metabolism improved stress tolerance, without any side effects, was recently obtained by overexpression of trehalase, which results in a more sensitive reaction of the stomatal guard cells and closing of the stomata under drought stress conditions. We have used the data that have been obtained from different studies to generate the optimal plant that can be constructed based on modifications of trehalose metabolism.

A high-performance liquid chromatography-based radiometric assay for sucrose-phosphate synthase and other UDP-glucose requiring enzymes

International Nuclear Information System (INIS)

Salvucci, M.E.; Crafts-Brandner, S.J.

1991-01-01

A method for product analysis that eliminates a problematic step in the radiometric sucrose-phosphate synthase assay is described. The method uses chromatography on a boronate-derivatized high-performance liquid chromatography column to separate the labeled product, [14C]sucrose phosphate, from unreacted uridine 5'-diphosphate-[14C]glucose (UDP-Glc). Direct separation of these compounds eliminates the need for treatment of the reaction mixtures with alkaline phosphatase, thereby avoiding the problem of high background caused by contaminating phosphodiesterase activity in alkaline phosphatase preparations. The method presented in this paper can be applied to many UDP-Glc requiring enzymes; here the authors show its use for determining the activities of sucrose-phosphate synthase, sucrose synthase, and uridine diphosphate-glucose pyrophosphorylase in plant extracts

[High gene conversion frequency between genes encoding 2-deoxyglucose-6-phosphate phosphatase in 3 Saccharomyces species].

Science.gov (United States)

Piscopo, Sara-Pier; Drouin, Guy

2014-05-01

Gene conversions are nonreciprocal sequence exchanges between genes. They are relatively common in Saccharomyces cerevisiae, but few studies have investigated the evolutionary fate of gene conversions or their functional impacts. Here, we analyze the evolution and impact of gene conversions between the two genes encoding 2-deoxyglucose-6-phosphate phosphatase in S. cerevisiae, Saccharomyces paradoxus and Saccharomyces mikatae. Our results demonstrate that the last half of these genes are subject to gene conversions among these three species. The greater similarity and the greater percentage of GC nucleotides in the converted regions, as well as the absence of long regions of adjacent common converted sites, suggest that these gene conversions are frequent and occur independently in all three species. The high frequency of these conversions probably result from the fact that they have little impact on the protein sequences encoded by these genes.

A novel member of the trehalose transporter family functions as an H+-dependent trehalose transporter in the reabsorption of trehalose in Malpighian tubules.

Directory of Open Access Journals (Sweden)

Shingo eKikuta

2012-07-01

Full Text Available In insects, Malpighian tubules are functionally analogous to mammalian kidneys in that they not only are essential to excrete waste molecules into the lumen but also are responsible for the reabsorption of indispensable molecules, such as sugars, from the lumen to the principal cells. Among sugars, the disaccharide trehalose is highly important to insects because it is the main hemolymph sugar to serve as a source of energy and carbon. The trehalose transporter TRET1 participates in the transfer of newly synthesized trehalose from the fat body across the cellular membrane into the hemolymph. Although transport proteins must play a pivotal role in the reabsorption of trehalose in Malpighian tubules, the molecular context underlying this process remains obscure. Previously, we identified a Tret1 homolog (Nlst8 that is expressed principally in the Malpighian tubules of the brown planthopper (BPH. Here, we used the Xenopus oocyte expression system to show that NlST8 exerts trehalose transport activity that is elevated under low pH conditions. These functional assays indicate that Nlst8 encodes a proton-dependent trehalose transporter (H-TRET1. To examine the involvement of Nlst8 in trehalose reabsorption, we analyzed the sugar composition of honeydew by using BPH with RNAi gene silencing. Trehalose was detected in the honeydew as waste excreted from Nlst8-dsRNA-injected BPH under hyperglycemic conditions. However, trehalose was not expelled from GFP-dsRNA-injected BPH even under hyperglycemic conditions. We conclude that NlST8 could participate in trehalose reabsorption driven by a H+ gradient from the lumen to the principal cells of the Malpighian tubules.

The role of Tre6P and SnRK1 in maize early kernel development and events leading to stress-induced kernel abortion.

Science.gov (United States)

Bledsoe, Samuel W; Henry, Clémence; Griffiths, Cara A; Paul, Matthew J; Feil, Regina; Lunn, John E; Stitt, Mark; Lagrimini, L Mark

2017-04-12

Drought stress during flowering is a major contributor to yield loss in maize. Genetic and biotechnological improvement in yield sustainability requires an understanding of the mechanisms underpinning yield loss. Sucrose starvation has been proposed as the cause for kernel abortion; however, potential targets for genetic improvement have not been identified. Field and greenhouse drought studies with maize are expensive and it can be difficult to reproduce results; therefore, an in vitro kernel culture method is presented as a proxy for drought stress occurring at the time of flowering in maize (3 days after pollination). This method is used to focus on the effects of drought on kernel metabolism, and the role of trehalose 6-phosphate (Tre6P) and the sucrose non-fermenting-1-related kinase (SnRK1) as potential regulators of this response. A precipitous drop in Tre6P is observed during the first two hours after removing the kernels from the plant, and the resulting changes in transcript abundance are indicative of an activation of SnRK1, and an immediate shift from anabolism to catabolism. Once Tre6P levels are depleted to below 1 nmol∙g -1 FW in the kernel, SnRK1 remained active throughout the 96 h experiment, regardless of the presence or absence of sucrose in the medium. Recovery on sucrose enriched medium results in the restoration of sucrose synthesis and glycolysis. Biosynthetic processes including the citric acid cycle and protein and starch synthesis are inhibited by excision, and do not recover even after the re-addition of sucrose. It is also observed that excision induces the transcription of the sugar transporters SUT1 and SWEET1, the sucrose hydrolyzing enzymes CELL WALL INVERTASE 2 (INCW2) and SUCROSE SYNTHASE 1 (SUSY1), the class II TREHALOSE PHOSPHATE SYNTHASES (TPS), TREHALASE (TRE), and TREHALOSE PHOSPHATE PHOSPHATASE (ZmTPPA.3), previously shown to enhance drought tolerance (Nuccio et al., Nat Biotechnol (October 2014):1-13, 2015). The impact

SNP in Chalcone Synthase gene is associated with variation of 6-gingerol content in contrasting landraces of Zingiber officinale.Roscoe.

Science.gov (United States)

Ghosh, Subhabrata; Mandi, Swati Sen

2015-07-25

Zingiber officinale, medicinally the most important species within Zingiber genus, contains 6-gingerol as the active principle. This compound obtained from rhizomes of Z.officinale, has immense medicinal importance and is used in various herbal drug formulations. Our record of variation in content of this active principle, viz. 6-gingerol, in land races of this drug plant collected from different locations correlated with our Gene expression studies exhibiting high Chalcone Synthase gene (Chalcone Synthase is the rate limiting enzyme of 6-gingerol biosynthesis pathway) expression in high 6-gingerol containing landraces than in the low 6-gingerol containing landraces. Sequencing of Chalcone Synthase cDNA and subsequent multiple sequence alignment revealed seven SNPs between these contrasting genotypes. Converting this nucleotide sequence to amino acid sequence, alteration of two amino acids becomes evident; one amino acid change (asparagine to serine at position 336) is associated with base change (A→G) and another change (serine to leucine at position 142) is associated with the base change (C→T). Since asparagine at position 336 is one of the critical amino acids of the catalytic triad of Chalcone Synthase enzyme, responsible for substrate binding, our study suggests that landraces with a specific amino acid change viz. Asparagine (found in high 6-gingerol containing landraces) to serine causes low 6-gingerol content. This is probably due to a weak enzyme substrate association caused by the absence of asparagine in the catalytic triad. Detailed study of this finding could also help to understand molecular mechanism associated with variation in 6-gingerol content in Z.officinale genotypes and thereby strategies for developing elite genotypes containing high 6-gingerol content. Copyright © 2015 Elsevier B.V. All rights reserved.

International collaborative study of the endogenous reference gene, sucrose phosphate synthase (SPS), used for qualitative and quantitative analysis of genetically modified rice.

Science.gov (United States)

Jiang, Lingxi; Yang, Litao; Zhang, Haibo; Guo, Jinchao; Mazzara, Marco; Van den Eede, Guy; Zhang, Dabing

2009-05-13

One rice ( Oryza sativa ) gene, sucrose phosphate synthase (SPS), has been proven to be a suitable endogenous reference gene for genetically modified (GM) rice detection in a previous study. Herein are the reported results of an international collaborative ring trial for validation of the SPS gene as an endogenous reference gene and its optimized qualitative and quantitative polymerase chain reaction (PCR) systems. A total of 12 genetically modified organism (GMO) detection laboratories from seven countries participated in the ring trial and returned their results. The validated results confirmed the species specificity of the method through testing 10 plant genomic DNAs, low heterogeneity, and a stable single-copy number of the rice SPS gene among 7 indica varieties and 5 japonica varieties. The SPS qualitative PCR assay was validated with a limit of detection (LOD) of 0.1%, which corresponded to about 230 copies of haploid rice genomic DNA, while the limit of quantification (LOQ) for the quantitative PCR system was about 23 copies of haploid rice genomic DNA, with acceptable PCR efficiency and linearity. Furthermore, the bias between the test and true values of eight blind samples ranged from 5.22 to 26.53%. Thus, we believe that the SPS gene is suitable for use as an endogenous reference gene for the identification and quantification of GM rice and its derivates.

Development of glyphosate-resistant alfalfa (Medicago sativa L.) upon transformation with the GR79Ms gene encoding 5-enolpyruvylshikimate-3-phosphate synthase.

Science.gov (United States)

Yi, Dengxia; Ma, Lin; Lin, Min; Li, Cong

2018-07-01

The glyphosate-resistant gene, GR79Ms, was successfully introduced into the genome of alfalfa. The transgenic events may serve as novel germplasm resources in alfalfa breeding. Weed competition can reduce the alfalfa yield, generating new alfalfa germplasm with herbicide resistance is essential. To obtain transgenic alfalfa lines with glyphosate resistance, a new synthetic glyphosate-resistant gene GR79Ms encoding 5-enolpyruvylshikimate-3-phosphate synthase (EPSPS) was introduced into alfalfa germplasm by Agrobacterium tumefaciens-mediated transformation. In total, 67 transformants were obtained. PCR and Southern blot analyses confirmed that GR79Ms was successfully inserted into the genome of alfalfa. Reverse transcription-PCR and western blot analyses further demonstrated the expression of GR79Ms and its product, GR79Ms EPSPS. Moreover, two homozygous transgenic lines were developed in the T 2 generation by means of molecular-assisted selection. Herbicide tolerance spray tests showed that the transgenic plants T 0 -GR1, T 0 -GR2, T 0 -GR3 and two homozygous lines were able to tolerate fourfold higher commercial usage of glyphosate than non-transgenic plants.

Recombinant expression of a functional myo-inositol-1-phosphate synthase (MIPS) in Mycobacterium smegmatis.

Science.gov (United States)

Huang, Xinyi; Hernick, Marcy

2015-10-01

Myo-inositol-1-phosphate synthase (MIPS, E.C. 5.5.1.4) catalyzes the first step in inositol production-the conversion of glucose-6-phosphate (Glc-6P) to myo-inositol-1-phosphate. While the three dimensional structure of MIPS from Mycobacterium tuberculosis has been solved, biochemical studies examining the in vitro activity have not been reported to date. Herein we report the in vitro activity of mycobacterial MIPS expressed in E. coli and Mycobacterium smegmatis. Recombinant expression in E. coli yields a soluble protein capable of binding the NAD(+) cofactor; however, it has no significant activity with the Glc-6P substrate. In contrast, recombinant expression in M. smegmatis mc(2)4517 yields a functionally active protein. Examination of structural data suggests that MtMIPS expressed in E. coli adopts a fold that is missing a key helix containing two critical (conserved) Lys side chains, which likely explains the inability of the E. coli expressed protein to bind and turnover the Glc-6P substrate. Recombinant expression in M. smegmatis may yield a protein that adopts a fold in which this key helix is formed enabling proper positioning of important side chains, thereby allowing for Glc-6P substrate binding and turnover. Detailed mechanistic studies may be feasible following optimization of the recombinant MIPS expression protocol in M. smegmatis.

Effect of trehalose coating on basic fibroblast growth factor release from tailor-made bone implants.

Science.gov (United States)

Choi, Sungjin; Lee, Jongil; Igawa, Kazuyo; Suzuki, Shigeki; Mochizuki, Manabu; Nishimura, Ryohei; Chung, Ung-il; Sasaki, Nobuo

2011-12-01

Artificial bone implants are often incorporated with osteoinductive factors to facilitate early bone regeneration. Calcium phosphate, the main component in artificial bone implants, strongly binds these factors, and in a few cases, the incorporated proteins are not released from the implant under conditions of physiological pH, thereby leading to reduction in their osteoinductivity. In this study, we coated tailor-made bone implants with trehalose to facilitate the release of basic fibroblast growth factor (bFGF). In an in vitro study, mouse osteoblastic cells were separately cultured for 48 hr in a medium with a untreated implant (T-), trehalose-coated implant (T+), bFGF-incorporated implant (FT-), and bFGF-incorporated implant with trehalose coating (FT+). In the FT+ group, cell viability was significantly higher than that in the other groups (Pbone implant without affecting the crystallinity or the mechanical strength of the artificial bone implant. These results suggest that coating artificial bone implants with trehalose could limit the binding of bFGF to calcium phosphate.

Distinctly Different Glass Transition Behaviors of Trehalose Mixed with Na2HPO 4 or NaH 2PO 4: Evidence for its Molecular Origin.

Science.gov (United States)

Weng, Lindong; Elliott, Gloria D

2015-07-01

The present study is aimed at understanding how the interactions between sugar molecules and phosphate ions affect the glass transition temperature of their mixtures, and the implications for pharmaceutical formulations. The glass transition temperature (Tg) and the α-relaxation temperature (Tα) of dehydrated trehalose/sodium phosphate mixtures (monobasic or dibasic) were determined by differential scanning calorimetry and dynamic mechanical analysis, respectively. Molecular dynamics simulations were also conducted to investigate the microscopic interactions between sugar molecules and phosphate ions. The hydrogen-bonding characteristics and the self-aggregation features of these mixtures were quantified and compared. Thermal analysis measurements demonstrated that the addition of NaH2PO4 decreased both the glass transition temperature and the α-relaxation temperature of the dehydrated trehalose/NaH2PO4 mixture compared to trehalose alone while both Tg and Tα were increased by adding Na2HPO4 to pure trehalose. The hydrogen-bonding interactions between trehalose and HPO4(2-) were found to be stronger than both the trehalose-trehalose hydrogen bonds and those formed between trehalose and H2PO4(-). The HPO4(2-) ions also aggregated into smaller clusters than H2PO4(-) ions. The trehalose/Na2HPO4 mixture yielded a higher T g than pure trehalose because marginally self-aggregated HPO4(2-) ions established a strengthened hydrogen-bonding network with trehalose molecules. In contrast H2PO4(-) ions served only as plasticizers, resulting in a lower Tg of the mixtures than trehalose alone, creating large-sized ionic pockets, weakening interactions, and disrupting the original hydrogen-bonding network amongst trehalose molecules.

Overexpression of the homologous lanosterol synthase gene in ganoderic acid biosynthesis in Ganoderma lingzhi.

Science.gov (United States)

Zhang, De-Huai; Li, Na; Yu, Xuya; Zhao, Peng; Li, Tao; Xu, Jun-Wei

2017-02-01

Ganoderic acids (GAs) in Ganoderma lingzhi exhibit anticancer and antimetastatic activities. GA yields can be potentially improved by manipulating G. lingzhi through genetic engineering. In this study, a putative lanosterol synthase (LS) gene was cloned and overexpressed in G. lingzhi. Results showed that its overexpression (OE) increased the ganoderic acid (GA) content and the accumulation of lanosterol and ergosterol in a submerged G. lingzhi culture. The maximum contents of GA-O, GA-Mk, GA-T, GA-S, GA-Mf, and GA-Me in transgenic strains were 46.6 ± 4.8, 24.3 ± 3.5, 69.8 ± 8.2, 28.9 ± 1.4, 15.4 ± 1.2, and 26.7 ± 3.1 μg/100 mg dry weight, respectively, these values being 6.1-, 2.2-, 3.2-, 4.8-, 2.0-, and 1.9-times higher than those in wild-type strains. In addition, accumulated amounts of lanosterol and ergosterol in transgenic strains were 2.3 and 1.4-fold higher than those in the control strains, respectively. The transcription level of LS was also increased by more than five times in the presence of the G. lingzhi glyceraldehyde-3-phosphate dehydrogenase gene promoter, whereas transcription levels of 3-hydroxy-3-methylglutaryl coenzyme A enzyme and squalene synthase did not change significantly in transgenic strains. This study demonstrated that OE of the homologous LS gene can enhance lanosterol accumulation. A large precursor supply promotes GA biosynthesis. Copyright © 2016 Elsevier Ltd. All rights reserved.

Expression of a mineral phosphate solubilizing gene from Erwinia herbicola in two rhizobacterial strains.

Science.gov (United States)

Rodríguez, H; Gonzalez, T; Selman, G

2001-11-30

A genetic construction was carried out using the broad host range vector pKT230 and plasmid pMCG898, which encodes the Erwinia herbicola pyrroloquinoline quinone (PQQ) synthase, a gene involved in mineral phosphate solubilization (mps). The final construction was transformed and expressed in Escherichia coli MC1061, and the recombinant plasmids were transferred to Burkholderia cepacia IS-16 and Pseudomonas sp. PSS recipient cells by conjugation. Clones containing recombinant plasmids produced higher clearing halos in plates with insoluble phosphate as the unique (P) source, in comparison with those of strains without plasmids, demonstrating the heterologous expression of the E. herbicola gene in the recipient strains. This genetic manipulation allowed the increase in mps ability of both strains, enhancing their potentialities as growth promoters of agricultural crops. These results represent the first report on the application of the recombinant DNA methodology for the obtaining of improved phosphate solubilizing ability from rhizobacterial strains for biofertilization purposes.

A highly prevalent equine glycogen storage disease is explained by constitutive activation of a mutant glycogen synthase

DEFF Research Database (Denmark)

Maile, C A; Hingst, Janne Rasmuss; Mahalingan, K K

2017-01-01

BACKGROUND: Equine type 1 polysaccharide storage myopathy (PSSM1) is associated with a missense mutation (R309H) in the glycogen synthase (GYS1) gene, enhanced glycogen synthase (GS) activity and excessive glycogen and amylopectate inclusions in muscle. METHODS: Equine muscle biochemical...... had significantly higher glycogen content than control horse muscle despite no difference in GS expression. GS activity was significantly higher in muscle from homozygous mutants than from heterozygote and control horses, in the absence and presence of the allosteric regulator, glucose 6 phosphate (G6...

Delineating the structural, functional and evolutionary relationships of sucrose phosphate synthase gene family II in wheat and related grasses

Directory of Open Access Journals (Sweden)

Khalil Zaynali

2010-06-01

Full Text Available Abstract Background Sucrose phosphate synthase (SPS is an important component of the plant sucrose biosynthesis pathway. In the monocotyledonous Poaceae, five SPS genes have been identified. Here we present a detailed analysis of the wheat SPSII family in wheat. A set of homoeologue-specific primers was developed in order to permit both the detection of sequence variation, and the dissection of the individual contribution of each homoeologue to the global expression of SPSII. Results The expression in bread wheat over the course of development of various sucrose biosynthesis genes monitored on an Affymetrix array showed that the SPS genes were regulated over time and space. SPSII homoeologue-specific assays were used to show that the three homoeologues contributed differentially to the global expression of SPSII. Genetic mapping placed the set of homoeoloci on the short arms of the homoeologous group 3 chromosomes. A resequencing of the A and B genome copies allowed the detection of four haplotypes at each locus. The 3B copy includes an unspliced intron. A comparison of the sequences of the wheat SPSII orthologues present in the diploid progenitors einkorn, goatgrass and Triticum speltoides, as well as in the more distantly related species barley, rice, sorghum and purple false brome demonstrated that intronic sequence was less well conserved than exonic. Comparative sequence and phylogenetic analysis of SPSII gene showed that false purple brome was more similar to Triticeae than to rice. Wheat - rice synteny was found to be perturbed at the SPS region. Conclusion The homoeologue-specific assays will be suitable to derive associations between SPS functionality and key phenotypic traits. The amplicon sequences derived from the homoeologue-specific primers are informative regarding the evolution of SPSII in a polyploid context.

Modified cellulose synthase gene from Arabidopsis thaliana confers herbicide resistance to plants

Science.gov (United States)

Somerville, Chris R [Portola Valley, CA; Scheible, Wolf [Golm, DE

2007-07-10

Cellulose synthase ("CS"), a key enzyme in the biosynthesis of cellulose in plants is inhibited by herbicides comprising thiazolidinones such as 5-tert-butyl-carbamoyloxy-3-(3-trifluromethyl)phenyl-4-thiazolidinone (TZ), isoxaben and 2,6-dichlorobenzonitrile (DCB). Two mutant genes encoding isoxaben and TZ-resistant cellulose synthase have been isolated from isoxaben and TZ-resistant Arabidopsis thaliana mutants. When compared with the gene coding for isoxaben or TZ-sensitive cellulose synthase, one of the resistant CS genes contains a point mutation, wherein glycine residue 998 is replaced by an aspartic acid. The other resistant mutation is due to a threonine to isoleucine change at amino acid residue 942. The mutant CS gene can be used to impart herbicide resistance to a plant; thereby permitting the utilization of the herbicide as a single application at a concentration which ensures the complete or substantially complete killing of weeds, while leaving the transgenic crop plant essentially undamaged.

Beta-Glucan Synthase Gene Expression in Pleurotus sp

International Nuclear Information System (INIS)

Azhar Mohamad; Nie, H.J.

2016-01-01

Pleurotus sp. is a popular edible mushroom, containing various functional component, in particular, Beta-glucan. Beta-glucans is a part of glucan family of polysaccharides and supposedly contribute to medicinal and nutritional value of Pleurotus.sp. In order to understand the distribution of Beta-glucan in Pleurotus.sp, the Beta-glucan synthase gene expression was determined and compared in different part of Pleurotus, namely mycelium, stripe and cap. The Pleurotus.sp RNA was extracted using commercial kit, employing Tissuelyser ll (Qiagen, USA) to disrupt the cell walls. Then the RNA was quantified by Nano drop (Thermo Fisher, USA) and visualized using denaturing agarose gel. RNA with good OD 260.280 reading (∼2.0) was chosen and converted to cDNA. Using Laccase synthase gene as home keeping gene, Beta-glucan synthase gene expression was quantified using CFX 96 Real Time PCR detection system (Biorad, USA). Preliminary result shows that Beta-glucan synthase was relatively expressed the most in stripe, followed by mycelium and barely in cap. (author)

Artificial citrate operon and Vitreoscilla hemoglobin gene enhanced mineral phosphate solubilizing ability of Enterobacter hormaechei DHRSS.

Science.gov (United States)

Yadav, Kavita; Kumar, Chanchal; Archana, G; Kumar, G Naresh

2014-10-01

Mineral phosphate solubilization by bacteria is mediated through secretion of organic acids, among which citrate is one of the most effective. To overproduce citrate in bacterial systems, an artificial citrate operon comprising of genes encoding NADH-insensitive citrate synthase of E. coli and Salmonella typhimurium sodium-dependent citrate transporter was constructed. In order to improve its mineral phosphate solubilizing (MPS) ability, the citrate operon was incorporated into E. hormaechei DHRSS. The artificial citrate operon transformant secreted 7.2 mM citric acid whereas in the native strain, it was undetectable. The transformant released 0.82 mM phosphate in flask studies in buffered medium containing rock phosphate as sole P source. In fermenter studies, similar phenotype was observed under aerobic conditions. However, under microaerobic conditions, no citrate was detected and P release was not observed. Therefore, an artificial citrate gene cluster containing Vitreoscilla hemoglobin (vgb) gene under its native promoter, along with artificial citrate operon under constitutive tac promoter, was constructed and transformed into E. hormaechei DHRSS. This transformant secreted 9 mM citric acid under microaerobic conditions and released 1.0 mM P. Thus, incorporation of citrate operon along with vgb gene improves MPS ability of E. hormaechei DHRSS under buffered, microaerobic conditions mimicking rhizospheric environment.

Osmoregulation by trehalose synthesis in Salmonella manhattan after exposure to waste waters.

Science.gov (United States)

Dupray, E; Derrien, A; Pichon, R

1995-03-01

A 24 h period in waste waters improved the subsequent survival of Salmonella in oligotrophic sea water, at 20 degrees C, compared to a direct input control. The main osmoprotective compound accumulated, investigated by 1H-NMR spectroscopy (nuclear magnetic resonance), after 6 d in sea water was trehalose. Taking into account these observations, this paper put forward the following explanation concerning the survival mechanism: (1) stress in waste waters induces the endogenous synthesis of trehalose via the activation of the gene kat F; (2) when exposed to an osmotic stress, two degradative cytoplasmic enzymes are repressed and the bacteria accumulate trehalose which acts as an osmoprotectant. The succession of the two steps enables Salm. manhattan to immediately resist to the high salinity of oligotrophic seawater.

Sequence analysis of cereal sucrose synthase genes and isolation ...

African Journals Online (AJOL)

SERVER

2007-10-18

Oct 18, 2007 ... sequencing of sucrose synthase gene fragment from sor- ghum using primers designed at their conserved exons. MATERIALS AND METHODS. Multiple sequence alignment. Sucrose synthase gene sequences of various cereals like rice, maize, and barley were accessed from NCBI Genbank database.

Protein modelling of triterpene synthase genes from mangrove plants using Phyre2 and Swiss-model

Science.gov (United States)

Basyuni, M.; Wati, R.; Sulistiyono, N.; Hayati, R.; Sumardi; Oku, H.; Baba, S.; Sagami, H.

2018-03-01

Molecular cloning of five oxidosqualene cyclases (OSC) genes from Bruguiera gymnorrhiza, Kandelia candel, and Rhizophora stylosa had previously been cloned, characterized, and encoded mono and -multi triterpene synthases. The present study analyzed protein modelling of triterpene synthase genes from mangrove using Phyre2 and Swiss-model. The diversity was noted within protein modelling of triterpene synthases using Phyre2 from sequence identity (38-43%) and residue (696-703). RsM2 was distinguishable from others for template structure; it used lanosterol synthase as a template (PDB ID: w6j.1.A). By contrast, other genes used human lanosterol synthase (1w6k.1.A). The predicted bind sites were correlated with the product of triterpene synthase, the product of BgbAS was β-amyrin, while RsM1 contained a significant amount of β-amyrin. Similarly BgLUS and KcMS, both main products was lupeol, on the other hand, RsM2 with the outcome of taraxerol. Homology modelling revealed that 696 residues of BgbAS, BgLUS, RsM1, and RsM2 (91-92% of the amino acid sequence) had been modelled with 100% confidence by the single highest scoring template using Phyre2. This coverage was higher than Swiss-model (85-90%). The present study suggested that molecular cloning of triterpene genes provides useful tools for studying the protein modelling related regulation of isoprenoids biosynthesis in mangrove forests.

Enzymatic exchange of mycolic acid in mycobacterium smegmatis involving free trehalose and trehalose 6-mono-mycolate

International Nuclear Information System (INIS)

Sathyamoorthy, N.; Qureshi, N.; Takayama, K.

1986-01-01

When a dialyzed, cell-free extract of Mycobacterium smegmatis was incubated with [ 14 C]trehalose and unlabeled trehalose 6-monomycolate (TM), radiolabeled TM was formed. This appears to be an enzymatic mycolic acid exchange reaction. The TM was purified by DEAE cellulose and silicic acid column chromatography, followed by reverse-phase HPLC using a C 18 -bonded silica column with a linear gradient of 0-60% hexane-isopropanol (2:1, v/v) in isopropanol-water (9:1, v/v). The donor lipid, the 14 C-labeled product, and authentic TM all comigrated on HPLC. Three peak fractions were obtained from HPLC and analyzed by laser desorption mass spectrometry (LDMS) and the structural series of mycolic acids were identified. The major TM components gave molecular ions (M+K) + at m/z 1486, 1500, and 1528. This corresponded to the presence of dienyl mycolic acids with M/sub r/ of 1106, 1120, and 1148, respectively. Using organically synthesized TM, the authors confirmed that the donor lipid as well as the labeled product of this reaction are indeed TM. This enzyme has now been partially purified by ammonium sulfate precipitation and QAE-Sephadex A-50 column chromatography. This newly discovered mycolic acid exchange reaction might be an integral part of the last step in the biosynthesis of mycolic acid as well as the mycolic acid utilization pathway in Mycobacteria

Trehalose biosynthesis promotes Pseudomonas aeruginosa pathogenicity in plants.

Science.gov (United States)

Djonović, Slavica; Urbach, Jonathan M; Drenkard, Eliana; Bush, Jenifer; Feinbaum, Rhonda; Ausubel, Jonathan L; Traficante, David; Risech, Martina; Kocks, Christine; Fischbach, Michael A; Priebe, Gregory P; Ausubel, Frederick M

2013-03-01

Pseudomonas aeruginosa strain PA14 is a multi-host pathogen that infects plants, nematodes, insects, and vertebrates. Many PA14 factors are required for virulence in more than one of these hosts. Noting that plants have a fundamentally different cellular architecture from animals, we sought to identify PA14 factors that are specifically required for plant pathogenesis. We show that synthesis by PA14 of the disaccharide trehalose is required for pathogenesis in Arabidopsis, but not in nematodes, insects, or mice. In-frame deletion of two closely-linked predicted trehalose biosynthetic operons, treYZ and treS, decreased growth in Arabidopsis leaves about 50 fold. Exogenously co-inoculated trehalose, ammonium, or nitrate, but not glucose, sulfate, or phosphate suppressed the phenotype of the double ΔtreYZΔtreS mutant. Exogenous trehalose or ammonium nitrate does not suppress the growth defect of the double ΔtreYZΔtreS mutant by suppressing the plant defense response. Trehalose also does not function intracellularly in P. aeruginosa to ameliorate a variety of stresses, but most likely functions extracellularly, because wild-type PA14 rescued the in vivo growth defect of the ΔtreYZΔtreS in trans. Surprisingly, the growth defect of the double ΔtreYZΔtreS double mutant was suppressed by various Arabidopsis cell wall mutants that affect xyloglucan synthesis, including an xxt1xxt2 double mutant that completely lacks xyloglucan, even though xyloglucan mutants are not more susceptible to pathogens and respond like wild-type plants to immune elicitors. An explanation of our data is that trehalose functions to promote the acquisition of nitrogen-containing nutrients in a process that involves the xyloglucan component of the plant cell wall, thereby allowing P. aeruginosa to replicate in the intercellular spaces in a leaf. This work shows how P. aeruginosa, a multi-host opportunistic pathogen, has repurposed a highly conserved "house-keeping" anabolic pathway (trehalose

Trehalose biosynthesis promotes Pseudomonas aeruginosa pathogenicity in plants.

Directory of Open Access Journals (Sweden)

Slavica Djonović

2013-03-01

Full Text Available Pseudomonas aeruginosa strain PA14 is a multi-host pathogen that infects plants, nematodes, insects, and vertebrates. Many PA14 factors are required for virulence in more than one of these hosts. Noting that plants have a fundamentally different cellular architecture from animals, we sought to identify PA14 factors that are specifically required for plant pathogenesis. We show that synthesis by PA14 of the disaccharide trehalose is required for pathogenesis in Arabidopsis, but not in nematodes, insects, or mice. In-frame deletion of two closely-linked predicted trehalose biosynthetic operons, treYZ and treS, decreased growth in Arabidopsis leaves about 50 fold. Exogenously co-inoculated trehalose, ammonium, or nitrate, but not glucose, sulfate, or phosphate suppressed the phenotype of the double ΔtreYZΔtreS mutant. Exogenous trehalose or ammonium nitrate does not suppress the growth defect of the double ΔtreYZΔtreS mutant by suppressing the plant defense response. Trehalose also does not function intracellularly in P. aeruginosa to ameliorate a variety of stresses, but most likely functions extracellularly, because wild-type PA14 rescued the in vivo growth defect of the ΔtreYZΔtreS in trans. Surprisingly, the growth defect of the double ΔtreYZΔtreS double mutant was suppressed by various Arabidopsis cell wall mutants that affect xyloglucan synthesis, including an xxt1xxt2 double mutant that completely lacks xyloglucan, even though xyloglucan mutants are not more susceptible to pathogens and respond like wild-type plants to immune elicitors. An explanation of our data is that trehalose functions to promote the acquisition of nitrogen-containing nutrients in a process that involves the xyloglucan component of the plant cell wall, thereby allowing P. aeruginosa to replicate in the intercellular spaces in a leaf. This work shows how P. aeruginosa, a multi-host opportunistic pathogen, has repurposed a highly conserved "house-keeping" anabolic

Fatal attraction in glycolysis: how Saccharomyces cerevisiae manages sudden transitions to high glucose

Science.gov (United States)

Heerden, Johan H. v.; Wortel, Meike T.; Bruggeman, Frank J.; Heijnen, Joseph J.; Bollen, Yves J.; Planqué, Robert; Hulshof, Josephus; O’Toole, Tom G.; Wahl, S. A.; Teusink, Bas

2014-01-01

In the model eukaryote Saccharomyces cerevisiae, it has long been known that a functional trehalose pathway is indispensable for transitions to high glucose conditions. Upon addition of glucose, cells with a defect in trehalose 6-phosphate synthase (Tps1), the first committed step in the trehalose pathway, display what we have termed an imbalanced glycolytic state; in this state the flux through the upper part of glycolysis outpaces that through the lower part of glycolysis. As a consequence, the intermediate fructose 1,6-bisphosphate (FBP) accumulates at low concentrations of ATP and inorganic phosphate (Pi). Despite significant research efforts, a satisfactory understanding of the regulatory role that trehalose metabolism plays during such transitions has remained infamously unresolved. In a recent study, we demonstrate that the startup of glycolysis exhibits two dynamic fates: a proper, functional, steady state or the imbalanced state described above. Both states are stable, attracting states, and the probability distribution of initial states determines the fate of a yeast cell exposed to glucose. Trehalose metabolism steers the dynamics of glycolysis towards the proper functional state through its ATP hydrolysis activity; a mechanism that ensures that the demand and supply of ATP is balanced with Pi availability under dynamic conditions. [van Heerden et al. Science (2014), DOI: 10.1126/science.1245114.] PMID:28357229

Identification of glucose 6 phosphate dehydrogenase mutations by ...

African Journals Online (AJOL)

Identification of glucose 6 phosphate dehydrogenase mutations by single strand conformation polymorphism and gene sequencing analysis. ... Subject: Six DNA samples from Turkish males confirmed to have G-6-PD deficiency where available for the study. Results: One subject was found to have an abnormal mobility shift ...

Characterization of the human gene (TBXAS1) encoding thromboxane synthase.

Science.gov (United States)

Miyata, A; Yokoyama, C; Ihara, H; Bandoh, S; Takeda, O; Takahashi, E; Tanabe, T

1994-09-01

The gene encoding human thromboxane synthase (TBXAS1) was isolated from a human EMBL3 genomic library using human platelet thromboxane synthase cDNA as a probe. Nucleotide sequencing revealed that the human thromboxane synthase gene spans more than 75 kb and consists of 13 exons and 12 introns, of which the splice donor and acceptor sites conform to the GT/AG rule. The exon-intron boundaries of the thromboxane synthase gene were similar to those of the human cytochrome P450 nifedipine oxidase gene (CYP3A4) except for introns 9 and 10, although the primary sequences of these enzymes exhibited 35.8% identity each other. The 1.2-kb of the 5'-flanking region sequence contained potential binding sites for several transcription factors (AP-1, AP-2, GATA-1, CCAAT box, xenobiotic-response element, PEA-3, LF-A1, myb, basic transcription element and cAMP-response element). Primer-extension analysis indicated the multiple transcription-start sites, and the major start site was identified as an adenine residue located 142 bases upstream of the translation-initiation site. However, neither a typical TATA box nor a typical CAAT box is found within the 100-b upstream of the translation-initiation site. Southern-blot analysis revealed the presence of one copy of the thromboxane synthase gene per haploid genome. Furthermore, a fluorescence in situ hybridization study revealed that the human gene for thromboxane synthase is localized to band q33-q34 of the long arm of chromosome 7. A tissue-distribution study demonstrated that thromboxane synthase mRNA is widely expressed in human tissues and is particularly abundant in peripheral blood leukocyte, spleen, lung and liver. The low but significant levels of mRNA were observed in kidney, placenta and thymus.

Nectar secretion requires sucrose phosphate synthases and the sugar transporter SWEET9.

Science.gov (United States)

Lin, I Winnie; Sosso, Davide; Chen, Li-Qing; Gase, Klaus; Kim, Sang-Gyu; Kessler, Danny; Klinkenberg, Peter M; Gorder, Molly K; Hou, Bi-Huei; Qu, Xiao-Qing; Carter, Clay J; Baldwin, Ian T; Frommer, Wolf B

2014-04-24

Angiosperms developed floral nectaries that reward pollinating insects. Although nectar function and composition have been characterized, the mechanism of nectar secretion has remained unclear. Here we identify SWEET9 as a nectary-specific sugar transporter in three eudicot species: Arabidopsis thaliana, Brassica rapa (extrastaminal nectaries) and Nicotiana attenuata (gynoecial nectaries). We show that SWEET9 is essential for nectar production and can function as an efflux transporter. We also show that sucrose phosphate synthase genes, encoding key enzymes for sucrose biosynthesis, are highly expressed in nectaries and that their expression is also essential for nectar secretion. Together these data are consistent with a model in which sucrose is synthesized in the nectary parenchyma and subsequently secreted into the extracellular space via SWEET9, where sucrose is hydrolysed by an apoplasmic invertase to produce a mixture of sucrose, glucose and fructose. The recruitment of SWEET9 for sucrose export may have been a key innovation, and could have coincided with the evolution of core eudicots and contributed to the evolution of nectar secretion to reward pollinators.

A novel 5-enolpyruvylshikimate-3-phosphate synthase shows high glyphosate tolerance in Escherichia coli and tobacco plants.

Directory of Open Access Journals (Sweden)

Gaoyi Cao

Full Text Available A key enzyme in the shikimate pathway, 5-enolpyruvylshikimate-3-phosphate synthase (EPSPS is the primary target of the broad-spectrum herbicide glyphosate. Identification of new aroA genes coding for EPSPS with a high level of glyphosate tolerance is essential for the development of glyphosate-tolerant crops. In the present study, the glyphosate tolerance of five bacterial aroA genes was evaluated in the E. coli aroA-defective strain ER2799 and in transgenic tobacco plants. All five aroA genes could complement the aroA-defective strain ER2799, and AM79 aroA showed the highest glyphosate tolerance. Although glyphosate treatment inhibited the growth of both WT and transgenic tobacco plants, transgenic plants expressing AM79 aroA tolerated higher concentration of glyphosate and had a higher fresh weight and survival rate than plants expressing other aroA genes. When treated with high concentration of glyphosate, lower shikimate content was detected in the leaves of transgenic plants expressing AM79 aroA than transgenic plants expressing other aroA genes. These results suggest that AM79 aroA could be a good candidate for the development of transgenic glyphosate-tolerant crops.

Roles of Catalase and Trehalose in the Protection from Hydrogen Peroxide Toxicity in Saccharomyces cerevisiae.

Science.gov (United States)

Nishimoto, Takuto; Watanabe, Takeru; Furuta, Masakazu; Kataoka, Michihiko; Kishida, Masao

2016-01-01

The roles of catalase and trehalose in Saccharomyces cerevisiae subject to hydrogen peroxide (H2O2) treatment were examined by measuring the catalase activity and intracellular trehalose levels in mutants lacking catalase or trehalose synthetase. Intracellular trehalose was elevated but the survival rate after H2O2 treatment remained low in mutants with deletion of the Catalase T gene. On the other hand, deletion of the trehalose synthetase gene increased the catalase activity in mutated yeast to levels higher than those in the wild-type strain, and these mutants exhibited some degree of tolerance to H2O2 treatment. These results suggest that Catalase T is critical in the yeast response to oxidative damage caused by H2O2 treatment, but trehalose also plays a role in protection against H2O2 treatment.

Modified cellulose synthase gene from 'Arabidopsis thaliana' confers herbicide resistance to plants

Energy Technology Data Exchange (ETDEWEB)

Somerville, Chris R.; Scieble, Wolf

2000-10-11

Cellulose synthase ('CS'), a key enzyme in the biosynthesis of cellulose in plants is inhibited by herbicides comprising thiazolidinones such as 5-tert-butyl-carbamoyloxy-3-(3-trifluromethyl) phenyl-4-thiazolidinone (TZ), isoxaben and 2,6-dichlorobenzonitrile (DCB). Two mutant genes encoding isoxaben and TZ-resistant cellulose synthase have been isolated from isoxaben and TZ-resistant Arabidopsis thaliana mutants. When compared with the gene coding for isoxaben or TZ-sensitive cellulose synthase, one of the resistant CS genes contains a point mutation, wherein glycine residue 998 is replaced by an aspartic acid. The other resistant mutation is due to a threonine to isoleucine change at amino acid residue 942. The mutant CS gene can be used to impart herbicide resistance to a plant; thereby permitting the utilization of the herbicide as a single application at a concentration which ensures the complete or substantially complete killing of weeds, while leaving the transgenic crop plant essentially undamaged.

[Optimization of trehalose loading in red blood cells before freeze-drying].

Science.gov (United States)

Zhuang, Yuan; Liu, Jing-Han; Ouyang, Xi-Lin; Chen, Lin-Feng; Che, Ji

2007-04-01

The key points for better protection of trehalose in freeze-drying red blood cells (RBCs) are to resolve non-osmosis of trehalose to red blood cells and to make cytoplasmic trehalose to reach effective concentration. This study was aimed to investigate the regularity of loading RBCs with trehalose, screen out optimal loading condition and evaluate the effect of trehalose on physico-chemical parameters of RBCs during the period of loading. The cytoplasmic trehalose concentration in red blood cells, free hemoglobin and ATP level were determined at different incubation temperatures (4, 22 and 37 degrees C), different trehaolse concentrations (0, 200, 400, 600, 800 and 1000 mmol/L) and different incubation times (2, 4, 6, 8 and 10 hours), the cytoplasmic trehalose, free hemoglobin (FHb), hemoglobin (Hb) and mean corpuscular volume (MCV) in fresh RBCs and RBCs stored for 72 hours at 4 degrees C were compared, when loading condition was ensured. The results showed that with increase of incubation temperature, time and extracellular trehalose concentration, the loading of trehalose in RBCs also increased. Under the optimal loading condition, cytoplasmic trehalose concentration and free hemoglobin level of fresh RBCs and RBCs stored for 72 hours at 4 degrees C were 65.505 +/- 6.314 mmol/L, 66.2 +/- 5.002 mmol/L and 6.567 +/- 2.568 g/L, 16.168 +/- 3.922 g/L respectively. It is concluded that the most optimal condition of loading trehalose is that fresh RBCs incubate in 800 mmol/L trehalose solution for 8 hours at 37 degrees C. This condition can result in a efficient cytoplasmic trehalose concentration. The study provides an important basis for long-term preservation of RBCs.

A multilevel prediction of physiological response to challenge: Interactions among child maltreatment, neighborhood crime, endothelial nitric oxide synthase gene (eNOS), and GABA(A) receptor subunit alpha-6 gene (GABRA6).

Science.gov (United States)

Lynch, Michael; Manly, Jody Todd; Cicchetti, Dante

2015-11-01

Physiological response to stress has been linked to a variety of healthy and pathological conditions. The current study conducted a multilevel examination of interactions among environmental toxins (i.e., neighborhood crime and child maltreatment) and specific genetic polymorphisms of the endothelial nitric oxide synthase gene (eNOS) and GABA(A) receptor subunit alpha-6 gene (GABRA6). One hundred eighty-six children were recruited at age 4. The presence or absence of child maltreatment as well as the amount of crime that occurred in their neighborhood during the previous year were determined at that time. At age 9, the children were brought to the lab, where their physiological response to a cognitive challenge (i.e., change in the amplitude of the respiratory sinus arrhythmia) was assessed and DNA samples were collected for subsequent genotyping. The results confirmed that complex Gene × Gene, Environment × Environment, and Gene × Environment interactions were associated with different patterns of respiratory sinus arrhythmia reactivity. The implications for future research and evidence-based intervention are discussed.

miRNA778 and SUVH6 are involved in phosphate homeostasis in Arabidopsis.

Science.gov (United States)

Wang, Lei; ZengJ, Hou Qing; Song, Jun; Feng, Sheng Jun; Yang, Zhi Min

2015-09-01

microRNAs (miRNAs) play an important role in plant adaptation to phosphate (Pi) starvation. Histone methylation can remodel chromatin structure and mediate gene expression. This study identified Arabidopsis miR778, a Pi-responsive miRNA, and its target gene Su(var) 3-9 homologs 6 (SUVH6) encoding a histone H3 lysine 9 (H3K9) methyltransferase. Overexpression of miR778 moderately enhanced primary and lateral root growth, free phosphate accumulation in shoots, and accumulation of anthocyanin under Pi deficient conditions. miR778 overexpression relieved the arrest of columella cell development under Pi starvation. Conversely, transgenic plants overexpressing a miR778-target mimic (35S::MIM778), that act as a sponge and sequesters miR778, showed opposite phenotypes of 35S::miR778 plants under Pi deficiency. Expression of several Pi deficiency-responsive genes such as miR399, Phosphate Transporter (PHT1;4), Low Phosphate-Resistant1 (LPR1) and Production of Anthocyanin Pigment 1 (PAP1) were elevated in the miR778 overexpressing plants, suggesting that both miR778 and SUVH6 are involved in phosphate homeostasis in plants. This study has provided a basis for further investigation on how SUVH6 regulates its downstream genes through chromatin remodeling and DNA methylation in plants stressed by Pi deficiency. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.

Alpha-tryptophan synthase of Isatis tinctoria: gene cloning and expression.

Science.gov (United States)

Salvini, M; Boccardi, T M; Sani, E; Bernardi, R; Tozzi, S; Pugliesi, C; Durante, M

2008-07-01

Indole producing reaction is a crux in the regulation of metabolite flow through the pathways and the coordination of primary and secondary product biosynthesis in plants. Indole is yielded transiently from indole-3-glycerol phosphate and immediately condensed with serine to give tryptophan, by the enzyme tryptophan synthase (TS). There is evidence that plant TS, like the bacterial complex, functions as an alpha beta heteromer. In few species, e.g. maize, are known enzymes, related with the TS alpha-subunit (TSA), able to catalyse reaction producing indole, which is free to enter the secondary metabolite pathways. In this contest, we searched for TSA and TSA related genes in Isatis tinctoria, a species producing the natural blue dye indigo. The It-TSA cDNA and the full-length exons/introns genomic region were isolated. The phylogenetic analysis indicates that It-TSA is more closely related to Arabidopsis thaliana At-T14E10.210 TSA (95.7% identity at the amino acid level) with respect to A. thaliana At-T10P11.11 TSA1-like (63%), Zea mays indole-3-glycerol phosphate lyase (54%), Z. mays TSA (53%), and Z. mays indole synthase (50%). The It-TSA cDNA was also able to complement an Escherichia coli trpA mutant. To examine the involvement of It-TSA in the biosynthesis of secondary metabolism compounds, It-TSA expression was tested in seedling grown under different light conditions. Semi-quantitative RT-PCR showed an increase in the steady-state level of It-TSA mRNA, paralleled by an increase of indigo and its precursor isatan B. Our results appear to indicate an involvement for It-TSA in indigo precursor synthesis and/or tryptophan biosynthesis.

De novo cloning and annotation of genes associated with immunity, detoxification and energy metabolism from the fat body of the oriental fruit fly, Bactrocera dorsalis.

Directory of Open Access Journals (Sweden)

Wen-Jia Yang

Full Text Available The oriental fruit fly, Bactrocera dorsalis, is a destructive pest in tropical and subtropical areas. In this study, we performed transcriptome-wide analysis of the fat body of B. dorsalis and obtained more than 59 million sequencing reads, which were assembled into 27,787 unigenes with an average length of 591 bp. Among them, 17,442 (62.8% unigenes matched known proteins in the NCBI database. The assembled sequences were further annotated with gene ontology, cluster of orthologous group terms, and Kyoto encyclopedia of genes and genomes. In depth analysis was performed to identify genes putatively involved in immunity, detoxification, and energy metabolism. Many new genes were identified including serpins, peptidoglycan recognition proteins and defensins, which were potentially linked to immune defense. Many detoxification genes were identified, including cytochrome P450s, glutathione S-transferases and ATP-binding cassette (ABC transporters. Many new transcripts possibly involved in energy metabolism, including fatty acid desaturases, lipases, alpha amylases, and trehalose-6-phosphate synthases, were identified. Moreover, we randomly selected some genes to examine their expression patterns in different tissues by quantitative real-time PCR, which indicated that some genes exhibited fat body-specific expression in B. dorsalis. The identification of a numerous transcripts in the fat body of B. dorsalis laid the foundation for future studies on the functions of these genes.

The trehalose utilization gene thuA ortholog in Mesorhizobium loti does not influence competitiveness for nodulation on Lotus spp.

Science.gov (United States)

Ampomah, Osei Yaw; Jensen, John Beck

2014-03-01

Competitiveness for nodulation is a desirable trait in rhizobia strains used as inoculant. In Sinorhizobium meliloti 1021 mutation in either of the trehalose utilization genes thuA or thuB influences its competitiveness for root colonization and nodule occupancy depending on the interacting host. We have therefore investigated whether mutation in the thuA ortholog in Mesorhizobium loti MAFF303099 also leads to a similar competitive phenotype on its hosts. The results show that M. loti thuA mutant Ml7023 was symbiotically effective and was as competitive as the wild type in colonization and nodule occupancy on Lotus corniculatus and Lotus japonicus. The thuA gene in M. loti was not induced during root colonization or in the infection threads unlike in S. meliloti, despite its induction by trehalose and high osmolarity in in vitro assays.

Trehalose and Trehalose-based Polymers for Environmentally Benign, Biocompatible and Bioactive Materials

Directory of Open Access Journals (Sweden)

Mitsuhiro Shibata

2008-08-01

Full Text Available Abstract: Trehalose is a non-reducing disaccharide that is found in many organisms but not in mammals. This sugar plays important roles in cryptobiosis of selaginella mosses, tardigrades (water bears, and other animals which revive with water from a state of suspended animation induced by desiccation. The interesting properties of trehalose are due to its unique symmetrical low-energy structure, wherein two glucose units are bonded face-to-face by 1→1-glucoside links. The Hayashibara Co. Ltd., is credited for developing an inexpensive, environmentally benign and industrial-scale process for the enzymatic conversion of α-1,4-linked polyhexoses to α,α-D-trehalose, which made it easy to explore novel food, industrial, and medicinal uses for trehalose and its derivatives. Trehalosechemistry is a relatively new and emerging field, and polymers of trehalose derivatives appear environmentally benign, biocompatible, and biodegradable. The discriminating properties of trehalose are attributed to its structure, symmetry, solubility, kinetic and thermodynamic stability and versatility. While syntheses of trehalose-based polymer networks can be straightforward, syntheses and characterization of well defined linear polymers with tailored properties using trehalose-based monomers is challenging, and typically involves protection and deprotection of hydroxyl groups to attain desired structural, morphological, biological, and physical and chemical properties in the resulting products. In this review, we will overview known literature on trehalose’s fascinating involvement in cryptobiology; highlight its applications in many fields; and then discuss methods we used to prepare new trehalose-based monomers and polymers and explain their properties.

It takes two to tango: defining an essential second active site in pyridoxal 5'-phosphate synthase.

Directory of Open Access Journals (Sweden)

Cyril Moccand

Full Text Available The prevalent de novo biosynthetic pathway of vitamin B6 involves only two enzymes (Pdx1 and Pdx2 that form an ornate multisubunit complex functioning as a glutamine amidotransferase. The synthase subunit, Pdx1, utilizes ribose 5-phosphate and glyceraldehyde 3-phosphate, as well as ammonia derived from the glutaminase activity of Pdx2 to directly form the cofactor vitamer, pyridoxal 5'-phosphate. Given the fact that a single enzyme performs the majority of the chemistry behind this reaction, a complicated mechanism is anticipated. Recently, the individual steps along the reaction co-ordinate are beginning to be unraveled. In particular, the binding of the pentose substrate and the first steps of the reaction have been elucidated but it is not known if the latter part of the chemistry, involving the triose sugar, takes place in the same or a disparate site. Here, we demonstrate through the use of enzyme assays, enzyme kinetics, and mutagenesis studies that indeed a second site is involved in binding the triose sugar and moreover, is the location of the final vitamin product, pyridoxal 5'-phosphate. Furthermore, we show that product release is triggered by the presence of a PLP-dependent enzyme. Finally, we provide evidence that a single arginine residue of the C terminus of Pdx1 is responsible for coordinating co-operativity in this elaborate protein machinery.

Differential transcriptional regulation of banana sucrose phosphate synthase gene in response to ethylene, auxin, wounding, low temperature and different photoperiods during fruit ripening and functional analysis of banana SPS gene promoter.

Science.gov (United States)

Roy Choudhury, Swarup; Roy, Sujit; Das, Ranjan; Sengupta, Dibyendu N

2008-12-01

Sucrose phosphate synthase (SPS) (EC 2.3.1.14) is the key regulatory component in sucrose formation in banana (Musa acuminata subgroup Cavendish, cv Giant governor) fruit during ripening. This report illustrates differential transcriptional responses of banana SPS gene following ethylene, auxin, wounding, low temperature and different photoperiods during ripening in banana fruit. Whereas ethylene strongly stimulated SPS transcript accumulation, auxin and cold treatment only marginally increased the abundance of SPS mRNA level, while wounding negatively regulated SPS gene expression. Conversely, SPS transcript level was distinctly increased by constant exposure to white light. Protein level, enzymatic activity of SPS and sucrose synthesis were substantially increased by ethylene and increased exposure to white light conditions as compared to other treatments. To further study the transcriptional regulation of SPS in banana fruit, the promoter region of SPS gene was cloned and some cis-acting regulatory elements such as a reverse GCC-box ERE, two ARE motifs (TGTCTC), one LTRE (CCGAA), a GAGA-box (GAGA...) and a GATA-box LRE (GATAAG) were identified along with the TATA and CAAT-box. DNA-protein interaction studies using these cis-elements indicated a highly specific cis-trans interaction in the banana nuclear extract. Furthermore, we specifically studied the light responsive characteristics of GATA-box containing synthetic as well as native banana SPS promoter. Transient expression assays using banana SPS promoter have also indicated the functional importance of the SPS promoter in regulating gene expression. Together, these results provide insights into the transcriptional regulation of banana SPS gene in response to phytohormones and other environmental factors during fruit ripening.

Glucose-6-Phosphate Dehydrogenase: Update and Analysis of New Mutations around the World

Science.gov (United States)

Gómez-Manzo, Saúl; Marcial-Quino, Jaime; Vanoye-Carlo, America; Serrano-Posada, Hugo; Ortega-Cuellar, Daniel; González-Valdez, Abigail; Castillo-Rodríguez, Rosa Angélica; Hernández-Ochoa, Beatriz; Sierra-Palacios, Edgar; Rodríguez-Bustamante, Eduardo; Arreguin-Espinosa, Roberto

2016-01-01

Glucose-6-phosphate dehydrogenase (G6PD) is a key regulatory enzyme in the pentose phosphate pathway which produces nicotinamide adenine dinucleotide phosphate (NADPH) to maintain an adequate reducing environment in the cells and is especially important in red blood cells (RBC). Given its central role in the regulation of redox state, it is understandable that mutations in the gene encoding G6PD can cause deficiency of the protein activity leading to clinical manifestations such as neonatal jaundice and acute hemolytic anemia. Recently, an extensive review has been published about variants in the g6pd gene; recognizing 186 mutations. In this work, we review the state of the art in G6PD deficiency, describing 217 mutations in the g6pd gene; we also compile information about 31 new mutations, 16 that were not recognized and 15 more that have recently been reported. In order to get a better picture of the effects of new described mutations in g6pd gene, we locate the point mutations in the solved three-dimensional structure of the human G6PD protein. We found that class I mutations have the most deleterious effects on the structure and stability of the protein. PMID:27941691

Fatal attraction in glycolysis: how Saccharomyces cerevisiae manages sudden transitions to high glucose

Directory of Open Access Journals (Sweden)

Johan H. van Heerden

2015-02-01

Full Text Available In the model eukaryote Saccharomyces cerevisiae, it has long been known that a functional trehalose pathway is indispensable for transitions to high glucose conditions. Upon addition of glucose, cells with a defect in trehalose 6-phosphate synthase (Tps1, the first committed step in the trehalose pathway, display what we have termed an imbalanced glycolytic state; in this state the flux through the upper part of glycolysis outpaces that through the lower part of glycolysis. As a consequence, the intermediate fructose 1,6-bisphosphate (FBP accumulates at low concentrations of ATP and inorganic phosphate (Pi. Despite significant research efforts, a satisfactory understanding of the regulatory role that trehalose metabolism plays during such transitions has remained infamously unresolved. In a recent study, we demonstrate that the startup of glycolysis exhibits two dynamic fates: a proper, functional, steady state or the imbalanced state described above. Both states are stable, attracting states, and the probability distribution of initial states determines the fate of a yeast cell exposed to glucose. Trehalose metabolism steers the dynamics of glycolysis towards the proper functional state through its ATP hydrolysis activity; a mechanism that ensures that the demand and supply of ATP is balanced with Pi availability under dynamic conditions. [van Heerden et al. Science (2014, DOI: 10.1126/science.1245114.

Expression Patterns, Activities and Carbohydrate-Metabolizing Regulation of Sucrose Phosphate Synthase, Sucrose Synthase and Neutral Invertase in Pineapple Fruit during Development and Ripening

Science.gov (United States)

Zhang, Xiu-Mei; Wang, Wei; Du, Li-Qing; Xie, Jiang-Hui; Yao, Yan-Li; Sun, Guang-Ming

2012-01-01

Differences in carbohydrate contents and metabolizing-enzyme activities were monitored in apical, medial, basal and core sections of pineapple (Ananas comosus cv. Comte de paris) during fruit development and ripening. Fructose and glucose of various sections in nearly equal amounts were the predominant sugars in the fruitlets, and had obvious differences until the fruit matured. The large rise of sucrose/hexose was accompanied by dramatic changes in sucrose phosphate synthase (SPS) and sucrose synthase (SuSy) activities. By contrast, neutral invertase (NI) activity may provide a mechanism to increase fruit sink strength by increasing hexose concentrations. Furthermore, two cDNAs of Ac-sps (accession no. GQ996582) and Ac-ni (accession no. GQ996581) were first isolated from pineapple fruits utilizing conserved amino-acid sequences. Homology alignment reveals that the amino acid sequences contain some conserved function domains. Transcription expression analysis of Ac-sps, Ac-susy and Ac-ni also indicated distinct patterns related to sugar accumulation and composition of pineapple fruits. It suggests that differential expressions of multiple gene families are necessary for sugar metabolism in various parts and developmental stages of pineapple fruit. A cycle of sucrose breakdown in the cytosol of sink tissues could be mediated through both Ac-SuSy and Ac-NI, and Ac-NI could be involved in regulating crucial steps by generating sugar signals to the cells in a temporally and spatially restricted fashion. PMID:22949808

Trehalose prevents adipocyte hypertrophy and mitigates insulin resistance.

Science.gov (United States)

Arai, Chikako; Arai, Norie; Mizote, Akiko; Kohno, Keizo; Iwaki, Kanso; Hanaya, Toshiharu; Arai, Shigeyuki; Ushio, Simpei; Fukuda, Shigeharu

2010-12-01

Trehalose has been shown to evoke lower insulin secretion than glucose in oral saccharide tolerance tests in humans. Given this hypoinsulinemic effect of trehalose, we hypothesized that trehalose suppresses adipocyte hypertrophy by reducing storage of triglyceride and mitigates insulin resistance in mice fed a high-fat diet (HFD). Mice were fed an HFD and given drinking water containing 2.5% saccharide (glucose [Glc], trehalose [Tre], maltose [Mal], high-fructose corn syrup, or fructose [Fru]) ad libitum. After 7 weeks of HFD and saccharide intake, fasting serum insulin levels in the Tre/HFD group were significantly lower than in the Mal/HFD and Glc/HFD groups (P fructose corn syrup/HFD, or Fru/HFD group. Analysis of gene expression in mesenteric adipocytes showed that no statistically significant difference in the expression of monocyte chemoattractant protein-1 (MCP-1) messenger RNA (mRNA) was observed between the Tre/HFD group and the distilled water/standard diet group, whereas a significant increase in the MCP-1 mRNA expression was observed in the Glc/HFD, Mal/HFD, Fru/HFD, and distilled water/HFD groups. Thus, our data indicate that trehalose prevents adipocyte hypertrophy and mitigates insulin resistance in HFD-fed mice by reducing insulin secretion and down-regulating mRNA expression of MCP-1. These findings further suggest that trehalose is a functional saccharide that mitigates insulin resistance. Copyright © 2010 Elsevier Inc. All rights reserved.

Investigation of the metabolic consequences of impregnating spinach leaves with trehalose and applying a pulsed electric field.

Science.gov (United States)

Dymek, Katarzyna; Panarese, Valentina; Herremans, Els; Cantre, Dennis; Schoo, Rick; Toraño, Javier Sastre; Schluepmann, Henriette; Wadso, Lars; Verboven, Pieter; Nicolai, Bart M; Dejmek, Petr; Gómez Galindo, Federico

2016-12-01

The impregnation of leafy vegetables with cryoprotectants using a combination of vacuum impregnation (VI) and pulsed electric fields (PEF) has been proposed by our research group as a method of improving their freezing tolerance and consequently their general quality after thawing. In this study, we have investigated the metabolic consequences of the combination of these unit operations on spinach. The vacuum impregnated spinach leaves showed a drastic decrease in the porosity of the extracellular space. However, at maximum weight gain, randomly located air pockets remained, which may account for oxygen-consuming pathways in the cells being active after VI. The metabolic activity of the impregnated leaves showed a drastic increase that was further enhanced by the application of PEF to the impregnated tissue. Impregnating the leaves with trehalose by VI led to a significant accumulation of trehalose-6-phosphate (T6P), however, this was not further enhanced by PEF. It is suggested that the accumulation of T6P in the leaves may increase metabolic activity, and increase tissue resistance to abiotic stress. Copyright © 2016 Elsevier B.V. All rights reserved.

Developmental delay in a Streptomyces venezuelae glgE null mutant is associated with the accumulation of α-maltose 1-phosphate.

Science.gov (United States)

Miah, Farzana; Bibb, Maureen J; Barclay, J Elaine; Findlay, Kim C; Bornemann, Stephen

2016-07-01

The GlgE pathway is thought to be responsible for the conversion of trehalose into a glycogen-like α-glucan polymer in bacteria. Trehalose is first converted to maltose, which is phosphorylated by maltose kinase Pep2 to give α-maltose 1-phosphate. This is the donor substrate of the maltosyl transferase GlgE that is known to extend α-1,4-linked maltooligosaccharides, which are thought to be branched with α-1,6 linkages. The genome of Streptomyces venezuelae contains all the genes coding for the GlgE pathway enzymes but none of those of related pathways, including glgC and glgA of the glycogen pathway. This provides an opportunity to study the GlgE pathway in isolation. The genes of the GlgE pathway were upregulated at the onset of sporulation, consistent with the known timing of α-glucan deposition. A constructed ΔglgE null mutant strain was viable but showed a delayed developmental phenotype when grown on maltose, giving less cell mass and delayed sporulation. Pre-spore cells and spores of the mutant were frequently double the length of those of the wild-type, implying impaired cross-wall formation, and spores showed reduced tolerance to stress. The mutant accumulated α-maltose 1-phosphate and maltose but no α-glucan. Therefore, the GlgE pathway is necessary and sufficient for polymer biosynthesis. Growth of the ΔglgE mutant on galactose and that of a Δpep2 mutant on maltose were analysed. In both cases, neither accumulation of α-maltose 1-phosphate/α-glucan nor a developmental delay was observed. Thus, high levels of α-maltose 1-phosphate are responsible for the developmental phenotype of the ΔglgE mutant, rather than the lack of α-glucan.

Glycerol, trehalose and glycerol–trehalose mixture effects on thermal stabilization of OCT

Energy Technology Data Exchange (ETDEWEB)

Barreca, D., E-mail: dbarreca@unime.it [Dipartimento di Scienze Chimiche, Università di Messina, Viale F. Stagno d’Alcontres 31, 98166 Messina (Italy); Laganà, G. [Dipartimento di Scienze Chimiche, Università di Messina, Viale F. Stagno d’Alcontres 31, 98166 Messina (Italy); Magazù, S.; Migliardo, F. [Dipartimento di Fisica, Università di Messina, Viale F. Stagno d’Alcontres 31, 98166 Messina (Italy); Bellocco, E. [Dipartimento di Scienze Chimiche, Università di Messina, Viale F. Stagno d’Alcontres 31, 98166 Messina (Italy)

2013-10-16

Highlights: • Trehalose influences both enzymatic activity and conformational changes of enzyme. • The results obtained by INS and QENS show a switching-off of the fast dynamics at very low glycerol content. • The diffusive dynamics is slowing down at very low glycerol concentration. • The mixtures of trehalose/glycerol lose the thermal stabilizing effects of pure compounds. - Abstract: The stabilization effects of trehalose, glycerol and their mixtures on ornithine carbamoyltransferase catalytic activity has been studied as a function of temperature by complementary techniques. The obtained results show that the kinematic viscosities of trehalose (1.0 M) and protein mixture are higher than the one of glycerol plus protein. Changing the trehalose/glycerol ratio, we notice a decrease of the kinematic viscosity values at almost all the analyzed ratio. In particular, the solution composed of 95% trehalose-5% glycerol shows a peculiar behavior. Moreover the trehalose (1.0 M) solution shows the higher OCT thermal stabilization at 343 K, while all the other solutions show minor effects. The smallest stabilizing effect is revealed for the solution that shows the maximum kinematic viscosity. These results support Inelastic Neutron Scattering (INS) and Quasi Elastic Neutron Scattering (QENS) findings, which pointed out a slowing down of the relaxation and diffusive dynamics in some investigated samples.

Endothelial nitric oxide synthase gene polymorphisms associated ...

African Journals Online (AJOL)

STORAGESEVER

2010-05-24

May 24, 2010 ... chronic periodontitis (CP), 31 with gingivitis (G) and 50 healthy controls. Probing depth ..... Periodontal disease in pregnancy I. Prevalence and severity. ... endothelial nitric oxide synthase gene in premenopausal women with.

Overexpression, crystallization and preliminary X-ray analysis of xylulose-5-phosphate/fructose-6-phosphate phosphoketolase from Bifidobacterium breve

International Nuclear Information System (INIS)

Suzuki, Ryuichiro; Kim, Byung-Jun; Shibata, Tsuyoshi; Iwamoto, Yuki; Katayama, Takane; Ashida, Hisashi; Wakagi, Takayoshi; Shoun, Hirofumi; Fushinobu, Shinya; Yamamoto, Kenji

2010-01-01

Xylulose-5-phosphate/fructose-6-phosphate phosphoketolase from B. breve was overexpressed and crystallized. The crystals belonged to the tetragonal space group I422 and diffracted to beyond 1.7 Å resolution. The xylulose-5-phosphate/fructose-6-phosphate phosphoketolase gene from Bifidobacterium breve was cloned and overexpressed in Escherichia coli. The enzyme was purified to homogeneity and crystallized by the sitting-drop vapour-diffusion method. Crystals were obtained at 293 K using 0.05 mM thiamine diphosphate, 0.25 mM MgCl 2 , 24%(w/v) PEG 6000 and 0.1 M Bicine pH 9.0. The crystals belonged to the tetragonal space group I422, with unit-cell parameters a = b = 174.8, c = 163.8 Å, and diffracted to beyond 1.7 Å resolution

Exogenous trehalose improves growth under limiting nitrogen through upregulation of nitrogen metabolism.

Science.gov (United States)

Lin, Yingchao; Zhang, Jie; Gao, Weichang; Chen, Yi; Li, Hongxun; Lawlor, David W; Paul, Matthew J; Pan, Wenjie

2017-12-19

The trehalose (Tre) pathway has strong effects on growth and development in plants through regulation of carbon metabolism. Altering either Tre or trehalose 6-phosphate (T6P) can improve growth and productivity of plants as observed under different water availability. As yet, there are no reports of the effects of modification of Tre orT6P on plant performance under limiting nutrition. Here we report that nitrogen (N) metabolism is positively affected by exogenous application of Tre in nitrogen-deficient growing conditions. Spraying foliage of tobacco (Nicotiana tabacum) with trehalose partially alleviated symptoms of nitrogen deficiency through upregulation of nitrate and ammonia assimilation and increasing activities of nitrate reductase (NR), glycolate oxidase (GO), glutamine synthetase (GS) and glutamine oxoglutarate aminotransferase (GOGAT) with concomitant changes in ammonium (NH 4 + ) and nitrate (NO 3 - ) concentrations, glutamine and amino acids. Chlorophyll and total nitrogen content of leaves and rates of photosynthesis were increased compared to nitrogen-deficient plants without applied Tre. Total plant biomass accumulation was also higher in Tre -fed nitrogen-deficient plants, with a smaller proportion of dry weight partitioned to roots, compared to nitrogen-deficient plants without applied Tre. Consistent with higher nitrogen assimilation and growth, Tre application reduced foliar starch. Minimal effects of Tre feeding were observed on nitrogen-sufficient plants. The data show, for the first time, significant stimulatory effects of exogenous Tre on nitrogen metabolism and growth in plants growing under deficient nitrogen. Under such adverse conditions metabolism is regulated for survival rather than productivity. Application of Tre can alter this regulation towards maintenance of productive functions under low nitrogen. This has implications for considering approaches to modifying the Tre pathway for to improve crop nitrogen-use efficiency and

Overexpressing Exogenous 5-Enolpyruvylshikimate-3-Phosphate Synthase (EPSPS Genes Increases Fecundity and Auxin Content of Transgenic Arabidopsis Plants

Directory of Open Access Journals (Sweden)

Jia Fang

2018-02-01

Full Text Available Transgenic glyphosate-tolerant plants overproducing EPSPS (5-enolpyruvylshikimate-3-phosphate synthase may exhibit enhanced fitness in glyphosate-free environments. If so, introgression of transgenes overexpressing EPSPS into wild relative species may lead to increased competitiveness of crop-wild hybrids, resulting in unpredicted environmental impact. Assessing fitness effects of transgenes overexpressing EPSPS in a model plant species can help address this question, while elucidating how overproducing EPSPS affects the fitness-related traits of plants. We produced segregating T2 and T3Arabidopsis thaliana lineages with or without a transgene overexpressing EPSPS isolated from rice or Agrobacterium (CP4. For each of the three transgenes, we compared glyphosate tolerance, some fitness-related traits, and auxin (indole-3-acetic acid content in transgene-present, transgene-absent, empty vector (EV, and parental lineages in a common-garden experiment. We detected substantially increased glyphosate tolerance in T2 plants of transgene-present lineages that overproduced EPSPS. We also documented significant increases in fecundity, which was associated with increased auxin content in T3 transgene-present lineages containing rice EPSPS genes, compared with their segregating transgene-absent lineages, EV, and parental controls. Our results from Arabidopsis with nine transgenic events provide a strong support to the hypothesis that transgenic plants overproducing EPSPS can benefit from a fecundity advantage in glyphosate-free environments. Stimulated biosynthesis of auxin, an important plant growth hormone, by overproducing EPSPS may play a role in enhanced fecundity of the transgenic Arabidopsis plants. The obtained knowledge is useful for assessing environmental impact caused by introgression of transgenes overproducing EPSPS from any GE crop into populations of its wild relatives.

Overexpressing Exogenous 5-Enolpyruvylshikimate-3-Phosphate Synthase (EPSPS) Genes Increases Fecundity and Auxin Content of Transgenic Arabidopsis Plants.

Science.gov (United States)

Fang, Jia; Nan, Peng; Gu, Zongying; Ge, Xiaochun; Feng, Yu-Qi; Lu, Bao-Rong

2018-01-01

Transgenic glyphosate-tolerant plants overproducing EPSPS (5-enolpyruvylshikimate-3-phosphate synthase) may exhibit enhanced fitness in glyphosate-free environments. If so, introgression of transgenes overexpressing EPSPS into wild relative species may lead to increased competitiveness of crop-wild hybrids, resulting in unpredicted environmental impact. Assessing fitness effects of transgenes overexpressing EPSPS in a model plant species can help address this question, while elucidating how overproducing EPSPS affects the fitness-related traits of plants. We produced segregating T 2 and T 3 Arabidopsis thaliana lineages with or without a transgene overexpressing EPSPS isolated from rice or Agrobacterium ( CP4 ). For each of the three transgenes, we compared glyphosate tolerance, some fitness-related traits, and auxin (indole-3-acetic acid) content in transgene-present, transgene-absent, empty vector (EV), and parental lineages in a common-garden experiment. We detected substantially increased glyphosate tolerance in T 2 plants of transgene-present lineages that overproduced EPSPS. We also documented significant increases in fecundity, which was associated with increased auxin content in T 3 transgene-present lineages containing rice EPSPS genes, compared with their segregating transgene-absent lineages, EV, and parental controls. Our results from Arabidopsis with nine transgenic events provide a strong support to the hypothesis that transgenic plants overproducing EPSPS can benefit from a fecundity advantage in glyphosate-free environments. Stimulated biosynthesis of auxin, an important plant growth hormone, by overproducing EPSPS may play a role in enhanced fecundity of the transgenic Arabidopsis plants. The obtained knowledge is useful for assessing environmental impact caused by introgression of transgenes overproducing EPSPS from any GE crop into populations of its wild relatives.

Deletion of the Glucose-6-Phosphate Dehydrogenase Gene KlZWF1 Affects both Fermentative and Respiratory Metabolism in Kluyveromyces lactis▿

Science.gov (United States)

Saliola, Michele; Scappucci, Gina; De Maria, Ilaria; Lodi, Tiziana; Mancini, Patrizia; Falcone, Claudio

2007-01-01

In Kluyveromyces lactis, the pentose phosphate pathway is an alternative route for the dissimilation of glucose. The first enzyme of the pathway is the glucose-6-phosphate dehydrogenase (G6PDH), encoded by KlZWF1. We isolated this gene and examined its role. Like ZWF1 of Saccharomyces cerevisiae, KlZWF1 was constitutively expressed, and its deletion led to increased sensitivity to hydrogen peroxide on glucose, but unlike the case for S. cerevisiae, the Klzwf1Δ strain had a reduced biomass yield on fermentative carbon sources as well as on lactate and glycerol. In addition, the reduced yield on glucose was associated with low ethanol production and decreased oxygen consumption, indicating that this gene is required for both fermentation and respiration. On ethanol, however, the mutant showed an increased biomass yield. Moreover, on this substrate, wild-type cells showed an additional band of activity that might correspond to a dimeric form of G6PDH. The partial dimerization of the G6PDH tetramer on ethanol suggested the production of an NADPH excess that was negative for biomass yield. PMID:17085636

Virus-induced gene silencing of Withania somnifera squalene synthase negatively regulates sterol and defence-related genes resulting in reduced withanolides and biotic stress tolerance.

Science.gov (United States)

Singh, Anup Kumar; Dwivedi, Varun; Rai, Avanish; Pal, Shaifali; Reddy, Sajjalavarahalli Gangireddy Eswara; Rao, Dodaghatta Krishnarao Venkata; Shasany, Ajit Kumar; Nagegowda, Dinesh A

2015-12-01

Withania somnifera (L.) Dunal is an important Indian medicinal plant that produces withanolides, which are triterpenoid steroidal lactones having diverse biological activities. To enable fast and efficient functional characterization of genes in this slow-growing and difficult-to-transform plant, a virus-induced gene silencing (VIGS) was established by silencing phytoene desaturase (PDS) and squalene synthase (SQS). VIGS of the gene encoding SQS, which provides precursors for triterpenoids, resulted in significant reduction of squalene and withanolides, demonstrating its application in studying withanolides biosynthesis in W. somnifera leaves. A comprehensive analysis of gene expression and sterol pathway intermediates in WsSQS-vigs plants revealed transcriptional modulation with positive feedback regulation of mevalonate pathway genes, and negative feed-forward regulation of downstream sterol pathway genes including DWF1 (delta-24-sterol reductase) and CYP710A1 (C-22-sterol desaturase), resulting in significant reduction of sitosterol, campesterol and stigmasterol. However, there was little effect of SQS silencing on cholesterol, indicating the contribution of sitosterol, campesterol and stigmasterol, but not of cholesterol, towards withanolides formation. Branch-point oxidosqualene synthases in WsSQS-vigs plants exhibited differential regulation with reduced CAS (cycloartenol synthase) and cycloartenol, and induced BAS (β-amyrin synthase) and β-amyrin. Moreover, SQS silencing also led to the down-regulation of brassinosteroid-6-oxidase-2 (BR6OX2), pathogenesis-related (PR) and nonexpressor of PR (NPR) genes, resulting in reduced tolerance to bacterial and fungal infection as well as to insect feeding. Taken together, SQS silencing negatively regulated sterol and defence-related genes leading to reduced phytosterols, withanolides and biotic stress tolerance, thus implicating the application of VIGS for functional analysis of genes related to withanolides

Peculiarities of glucose and glycerol metabolism in Nocardia vaccinii IMB B-7405

Directory of Open Access Journals (Sweden)

T. P. Pirog

2015-04-01

Full Text Available It has been established that in cells of Nocardia vaccinii IMB B-7405 (surfactant producer glucose catabolism is performed through pentose phosphate cycle as well as through gluconate (activi­ty of NAD+-dependent glucose-6- phosphate dehydrogenase and FAD+-dependent glucose dehydrogenase 835 ± 41 and 698 ± 35 nmol∙min-1∙mg-1 of protein respectively. 6-Phosphogluconate formed in the gluconokinase reaction is involved in the pentose phosphate cycle (activity of constitutive NADP+-dependent 6-phosphogluconate dehydrogenase 357 ± 17 nmol∙min-1∙mg-1 of protein. Glyce­rol catabolism to dihydroxyacetonephosphate (the intermediate of glycolysis may be performed in two ways: through glycerol-3-phosphate (glycerol kinase activity 244 ± 12 nmol∙min-1∙mg-1 of protein and through dihydroxyacetone. Replenishment of the C4-dicarboxylic acids pool in N. vaccinii IMV B-7405 grown on glucose and glycerol occurs in the phosphoenolpyruvate(PEPcarboxylase reaction (714–803 nmol∙min-1∙mg-1 of protein. 2-Oxoglutara­te was involved in tricarboxylic acid cycle by alternate pathway with the participation of 2-oxoglutarate synthase. The observed activity of both key enzymes of gluconeogenesis (PEP- carboxykinase and PEP-synthase, trehalose phosphate synthase and NADP+-dependent glutamate dehydrogenase confirmed the ability of IMV B-7405 strain to the synthesis of surface active glyco- and aminolipids, respectively.

PCR cloning of Polyhydroxybutyrate Synthase Gene (phbC) from Aeromonashydrophila

International Nuclear Information System (INIS)

Enan, M. R.; Bashandy, S.A.

2006-01-01

Plastic wastes are considered to be severe environmental contaminantscausing waste disposal problems. Widespread use of biodegradable plastics isone of the solutions, but it is limited by high production cost. A polymerasechain reaction (PCR) protocol was developed for the specific for the specificdetection and isolation of full-length gene coding for polyhydroxybutyrate(PBH). (PCR) strategy using (PHB) primers resulted in the amplification of(DNA) fragments with the expected size from all isolated bacteria (PBH)synthase gene was cloned directly from Aeromonas hydrophila genome for thefirst time. The clonec fragment was named (phbCAh) gene exhibits similarly to(PHB) synthase genes of Alcaligenes latus and Pseudomonas oleovorans (97%),Alcaligenes sp. (81%) and Comamonas acidovorans (84%). (author)

Crystalline anhydrous {alpha},{alpha}-trehalose (polymorph {beta}) and crystalline dihydrate {alpha},{alpha}-trehalose: A calorimetric study

Energy Technology Data Exchange (ETDEWEB)

Pinto, Susana S. [Centro de Quimica Estrutural, Complexo Interdisciplinar, Instituto Superior Tecnico, 1049-001 Lisbon (Portugal)]. E-mail: susanapinto@ist.utl.pt; Diogo, Herminio P. [Centro de Quimica Estrutural, Complexo Interdisciplinar, Instituto Superior Tecnico, 1049-001 Lisbon (Portugal)]. E-mail: hdiogo@ist.utl.pt; Moura-Ramos, Joaquim J. [Centro de Quimica-Fisica Molecular, Complexo Interdisciplinar, Instituto Superior Tecnico, 1049-001 Lisbon (Portugal)]. E-mail: mouraramos@ist.utl.pt

2006-09-15

The mean values of the standard massic energy of combustion of crystalline anhydrous {alpha},{alpha}-trehalose (C{sub 12}H{sub 22}O{sub 11}, polymorph {beta}) and crystalline dihydrate {alpha},{alpha}-trehalose (C{sub 12}H{sub 26}O{sub 13}) measured by static-bomb combustion calorimetry in oxygen, at the temperature T=298.15K, are {delta}{sub c}u{sup o}=-(16434.05+/-4.50)J.g{sup -1} and {delta}{sub c}u{sup o}=-(14816.05+/-3.52)J.g{sup -1}, respectively. The standard (p{sup o}=0.1MPa) molar enthalpy of formation of these compounds were derived from the corresponding standard molar enthalpies of combustion, respectively, {delta}{sub f}H{sub m}{sup o} (C{sub 12}H{sub 22}O{sub 11},cr)=-(2240.9+/-3.9)kJ.mol{sup -1}, and {delta}{sub f}H{sub m}{sup o} (C{sub 12}H{sub 26}O{sub 13},cr)=-(2832.6+/-3.6)kJ.mol{sup -1}. The values of the standard enthalpies of formation obtained in this work, together with data on enthalpies of solution at infinite dilution ({delta}{sub sol}H{sup {approx}}) for crystalline dihydrate and amorphous anhydrous trehalose, allow a better insight on the thermodynamic description of the trehalose system which can provide, together with the future research on the subject, a contribution for understanding the metabolism in several organisms, as well as the phase transition between the different polymorphs.

Direct and indirect effects of RNA interference against pyridoxal kinase and pyridoxine 5'-phosphate oxidase genes in Bombyx mori.

Science.gov (United States)

Huang, ShuoHao; Yao, LiLi; Zhang, JianYun; Huang, LongQuan

2016-08-01

Vitamin B6 comprises six interconvertible pyridine compounds (vitamers), among which pyridoxal 5'-phosphate is a coenzyme involved in a high diversity of biochemical reactions. Humans and animals obtain B6 vitamers from diet, and synthesize pyridoxal 5'-phosphate by pyridoxal kinase and pyridoxine 5'-phosphate oxidase. Currently, little is known on how pyridoxal 5'-phosphate biosynthesis is regulated, and pyridoxal 5'-phosphate is supplied to meet their requirement in terms of cofactor. Bombyx mori is a large silk-secreting insect, in which protein metabolism is most active, and the vitamin B6 demand is high. In this study, we successfully down-regulated the gene expression of pyridoxal kinase and pyridoxine 5'-phosphate oxidase by body cavity injection of synthesized double-stranded small interfering RNA to 5th instar larvae of Bombyx mori, and analyzed the gene transcription levels of pyridoxal 5'-phosphate dependent enzymes, phosphoserine aminotransferase and glutamic-oxaloacetic transaminase. Results show that the gene expression of pyridoxal kinase and pyridoxine 5'-phosphate oxidase has a greater impact on the gene transcription of enzymes using pyridoxal 5'-phosphate as a cofactor in Bombyx mori. Our study suggests that pyridoxal 5'-phosphate biosynthesis and dynamic balance may be regulated by genetic networks. Copyright © 2016 Elsevier B.V. All rights reserved.

Organellar and cytosolic localization of four phosphoribosyl diphosphate synthase isozymes in spinach

DEFF Research Database (Denmark)

Krath, Britta N.; Hove-Jensen, Bjarne

1999-01-01

Four cDNAs encoding phosphoribosyl diphosphate (PRPP) synthase were isolated from a spinach (Spinacia oleracea) cDNA library by complementation of an Escherichia coli Δprs mutation. The four gene products produced PRPP in vitro from ATP and ribose-5-phosphate. Two of the enzymes (isozymes 1 and 2...

Endothelial nitric oxide synthase gene polymorphisms associated ...

African Journals Online (AJOL)

Endothelial nitric oxide synthase (NOS3) is involved in key steps of immune response. Genetic factors predispose individuals to periodontal disease. This study's aim was to explore the association between NOS3 gene polymorphisms and clinical parameters in patients with periodontal disease. Genomic DNA was obtained ...

Glucose-6-phosphate dehydrogenase protects Escherichia coli from tellurite-mediated oxidative stress.

Directory of Open Access Journals (Sweden)

Juan M Sandoval

Full Text Available The tellurium oxyanion tellurite induces oxidative stress in most microorganisms. In Escherichia coli, tellurite exposure results in high levels of oxidized proteins and membrane lipid peroxides, inactivation of oxidation-sensitive enzymes and reduced glutathione content. In this work, we show that tellurite-exposed E. coli exhibits transcriptional activation of the zwf gene, encoding glucose 6-phosphate dehydrogenase (G6PDH, which in turn results in augmented synthesis of reduced nicotinamide adenine dinucleotide phosphate (NADPH. Increased zwf transcription under tellurite stress results mainly from reactive oxygen species (ROS generation and not from a depletion of cellular glutathione. In addition, the observed increase of G6PDH activity was paralleled by accumulation of glucose-6-phosphate (G6P, suggesting a metabolic flux shift toward the pentose phosphate shunt. Upon zwf overexpression, bacterial cells also show increased levels of antioxidant molecules (NADPH, GSH, better-protected oxidation-sensitive enzymes and decreased amounts of oxidized proteins and membrane lipids. These results suggest that by increasing NADPH content, G6PDH plays an important role in E. coli survival under tellurite stress.

Altered expression of the caffeine synthase gene in a naturally caffeine-free mutant of Coffea arabica

Directory of Open Access Journals (Sweden)

Mirian Perez Maluf

2009-01-01

Full Text Available In this work, we studied the biosynthesis of caffeine by examining the expression of genes involved in this biosynthetic pathway in coffee fruits containing normal or low levels of this substance. The amplification of gene-specific transcripts during fruit development revealed that low-caffeine fruits had a lower expression of the theobromine synthase and caffeine synthase genes and also contained an extra transcript of the caffeine synthase gene. This extra transcript contained only part of exon 1 and all of exon 3. The sequence of the mutant caffeine synthase gene revealed the substitution of isoleucine for valine in the enzyme active site that probably interfered with enzymatic activity. These findings indicate that the absence of caffeine in these mutants probably resulted from a combination of transcriptional regulation and the presence of mutations in the caffeine synthase amino acid sequence.

Dihydropteroate synthase gene mutations in Pneumocystis and sulfa resistance

DEFF Research Database (Denmark)

Huang, Laurence; Crothers, Kristina; Atzori, Chiara

2004-01-01

in the dihydropteroate synthase (DHPS) gene. Similar mutations have been observed in P. jirovecii. Studies have consistently demonstrated a significant association between the use of sulfa drugs for PCP prophylaxis and DHPS gene mutations. Whether these mutations confer resistance to TMP-SMX or dapsone plus trimethoprim...

Co-expression of peppermint geranyl diphosphate synthase small subunit enhances monoterpene production in transgenic tobacco plants.

Science.gov (United States)

Yin, Jun-Lin; Wong, Woon-Seng; Jang, In-Cheol; Chua, Nam-Hai

2017-02-01

Monoterpenes are important for plant survival and useful to humans. In addition to their function in plant defense, monoterpenes are also used as flavors, fragrances and medicines. Several metabolic engineering strategies have been explored to produce monoterpene in tobacco but only trace amounts of monoterpenes have been detected. We investigated the effects of Solanum lycopersicum 1-deoxy-d-xylulose-5-phosphate synthase (SlDXS), Arabidopsis thaliana geranyl diphosphate synthase 1 (AtGPS) and Mentha × piperita geranyl diphosphate synthase small subunit (MpGPS.SSU) on production of monoterpene and geranylgeranyl diphosphate (GGPP) diversities, and plant morphology by transient expression in Nicotiana benthamiana and overexpression in transgenic Nicotiana tabacum. We showed that MpGPS.SSU could enhance the production of various monoterpenes such as (-)-limonene, (-)-linalool, (-)-α-pinene/β-pinene or myrcene, in transgenic tobacco by elevating geranyl diphosphate synthase (GPS) activity. In addition, overexpression of MpGPS.SSU in tobacco caused early flowering phenotype and increased shoot branching by elevating contents of GA 3 and cytokinins due to upregulated transcript levels of several plastidic 2-C-methyl-d-erythritol-4-phosphate (MEP) pathway genes, geranylgeranyl diphosphate synthases 3 (GGPPS3) and GGPPS4. Our method would allow the identification of new monoterpene synthase genes using transient expression in N. benthamiana and the improvement of monoterpene production in transgenic tobacco plants. © 2016 The Authors. New Phytologist © 2016 New Phytologist Trust.

Functional effect of grapevine 1-deoxy-D-xylulose 5-phosphate synthase substitution K284N on Muscat flavour formation

Science.gov (United States)

Battilana, Juri; Emanuelli, Francesco; Gambino, Giorgio; Gribaudo, Ivana; Gasperi, Flavia; Boss, Paul K.; Grando, Maria Stella

2011-01-01

Grape berries of Muscat cultivars (Vitis vinifera L.) contain high levels of monoterpenols and exhibit a distinct aroma related to this composition of volatiles. A structural gene of the plastidial methyl-erythritol-phosphate (MEP) pathway, 1-deoxy-D-xylulose 5-phosphate synthase (VvDXS), was recently suggested as a candidate gene for this trait, having been co-localized with a major quantitative trait locus for linalool, nerol, and geraniol concentrations in berries. In addition, a structured association study discovered a putative causal single nucleotide polymorphism (SNP) responsible for the substitution of a lysine with an asparagine at position 284 of the VvDXS protein, and this SNP was significantly associated with Muscat-flavoured varieties. The significance of this nucleotide difference was investigated by comparing the monoterpene profiles with the expression of VvDXS alleles throughout berry development in Moscato Bianco, a cultivar heterozygous for the SNP mutation. Although correlation was detected between the VvDXS transcript profile and the accumulation of free monoterpenol odorants, the modulation of VvDXS expression during berry development appears to be independent of nucleotide variation in the coding sequence. In order to assess how the non-synonymous mutation may enhance Muscat flavour, an in vitro characterization of enzyme isoforms was performed followed by in vivo overexpression of each VvDXS allele in tobacco. The results showed that the amino acid non-neutral substitution influences the enzyme kinetics by increasing the catalytic efficiency and also dramatically affects monoterpene levels in transgenic lines. These findings confirm a functional effect of the VvDXS gene polymorphism and may pave the way for metabolic engineering of terpenoid contents in grapevine. PMID:21868399

Carbamoyl-phosphate synthase (ammonia) of rat and axolotl liver: determination of immunological cross-reactivity without purification of the axolotl enzyme

NARCIS (Netherlands)

Lamers, W. H.; de Graaf, A.; Mooren, P. G.; Moorman, A. F.; Charles, R.

1982-01-01

A method has been developed to establish the degree of cross-reactivity of an antiserum raised against purified carbamoyl-phosphate synthase (ammonia) from adult rat liver, toward a homologous enzyme from another species without purification of the latter enzyme. For that purpose the ratio between

Glucose 6-phosphate compartmentation and the control of glycogen synthesis

NARCIS (Netherlands)

Meijer, Alfred

2002-01-01

Using adenovirus-mediated gene transfer into FTO-2B cells, a rat hepatoma cell line, we have overexpressed hexokinase I, (HK I), glucokinase (GK), liver glycogen synthase (LGS), muscle glycogen synthase (MGS), and combinations of each of the two glucose phosphorylating enzymes with each one of the

Small angle neutron scattering study on short and long chain phosphatidylcholine mixture in trehalose solution

Energy Technology Data Exchange (ETDEWEB)

Takahashi, Hiroshi [Department of Physics, Gunma University, Maebashi, Gunma (Japan)

2001-03-01

Trehalose protects cells and proteins against various stresses due to low temperatures or dryness. In order to clarify the molecular mechanism of cryoprotective function of trehalose, we have studied the interaction between trehalose and phosphatidylcholine (PC) which is a main lipid component of cell membranes. In this study, the structural change of a binary PC mixture by the presence of trehalose was investigated by means of small angle neutron scattering. The PC binary mixture studied contains dihexanoyl-PC (diC{sub 6}PC) and dihexadecy-PC (DHPC). The former has short hydrocarbon chains and the latter has long hydrocarbon chains. The scattering profiles from the DHPC/diC{sub 6}PC mixture were changed, depending on trehalose concentrations. This change can be interpreted as suggesting that the presence of trehalose reduces the interfacial area between water and PCs. (author)

Metabolic engineering of the pentose phosphate pathway for enhanced limonene production in the cyanobacterium Synechocysti s sp. PCC 6803.

Science.gov (United States)

Lin, Po-Cheng; Saha, Rajib; Zhang, Fuzhong; Pakrasi, Himadri B

2017-12-13

Isoprenoids are diverse natural compounds, which have various applications as pharmaceuticals, fragrances, and solvents. The low yield of isoprenoids in plants makes them difficult for cost-effective production, and chemical synthesis of complex isoprenoids is impractical. Microbial production of isoprenoids has been considered as a promising approach to increase the yield. In this study, we engineered the model cyanobacterium Synechocystis sp. PCC 6803 for sustainable production of a commercially valuable isoprenoid, limonene. Limonene synthases from the plants Mentha spicata and Citrus limon were expressed in cyanobacteria for limonene production. Production of limonene was two-fold higher with limonene synthase from M. spicata than that from C. limon. To enhance isoprenoid production, computational strain design was conducted by applying the OptForce strain design algorithm on Synechocystis 6803. Based on the metabolic interventions suggested by this algorithm, genes (ribose 5-phosphate isomerase and ribulose 5-phosphate 3-epimerase) in the pentose phosphate pathway were overexpressed, and a geranyl diphosphate synthase from the plant Abies grandis was expressed to optimize the limonene biosynthetic pathway. The optimized strain produced 6.7 mg/L of limonene, a 2.3-fold improvement in productivity. Thus, this study presents a feasible strategy to engineer cyanobacteria for photosynthetic production of isoprenoids.

Occurrence of theobromine synthase genes in purine alkaloid-free species of Camellia plants.

Science.gov (United States)

Ishida, Mariko; Kitao, Naoko; Mizuno, Kouichi; Tanikawa, Natsu; Kato, Misako

2009-02-01

Caffeine (1,3,7-trimethylxanthine) and theobromine (3,7-dimethylxanthine) are purine alkaloids that are present in high concentrations in plants of some species of Camellia. However, most members of the genus Camellia contain no purine alkaloids. Tracer experiments using [8-(14)C]adenine and [8-(14)C]theobromine showed that the purine alkaloid pathway is not fully functional in leaves of purine alkaloid-free species. In five species of purine alkaloid-free Camellia plants, sufficient evidence was obtained to show the occurrence of genes that are homologous to caffeine synthase. Recombinant enzymes derived from purine alkaloid-free species showed only theobromine synthase activity. Unlike the caffeine synthase gene, these genes were expressed more strongly in mature tissue than in young tissue.

Rice calcium-dependent protein kinase OsCPK17 targets plasma membrane intrinsic protein and sucrose phosphate synthase and is required for a proper cold stress response

KAUST Repository

Almadanim, M. Cecília

2017-01-19

Calcium-dependent protein kinases (CDPKs) are involved in plant tolerance mechanisms to abiotic stresses. Although CDPKs are recognized as key messengers in signal transduction, the specific role of most members of this family remains unknown. Here we test the hypothesis that OsCPK17 plays a role in rice cold stress response by analyzing OsCPK17 knockout, silencing, and overexpressing rice lines under low temperature. Altered OsCPK17 gene expression compromises cold tolerance performance, without affecting the expression of key cold stress-inducible genes. A comparative phosphoproteomic approach led to the identification of six potential in vivo OsCPK17 targets, which are associated with sugar and nitrogen metabolism, and with osmotic regulation. To test direct interaction, in vitro kinase assays were performed, showing that the sucrose phosphate synthase OsSPS4, and the aquaporin OsPIP2;1/OsPIP2;6 are phosphorylated by OsCPK17 in a calcium-dependent manner. Altogether, our data indicates that OsCPK17 is required for a proper cold stress response in rice, likely affecting the activity of membrane channels and sugar metabolism.

The bZIP transcription factor HY5 interacts with the promoter of the monoterpene synthase gene QH6 in modulating its rhythmic expression.

Science.gov (United States)

Zhou, Fei; Sun, Tian-Hu; Zhao, Lei; Pan, Xi-Wu; Lu, Shan

2015-01-01

The Artemisia annua L. β-pinene synthase QH6 was previously determined to be circadian-regulated at the transcriptional level, showing a rhythmic fluctuation of steady-state transcript abundances. Here we isolated both the genomic sequence and upstream promoter region of QH6. Different regulatory elements, such as G-box (TGACACGTGGCA, -421 bp from the translation initiation site) which might have effects on rhythmic gene expression, were found. Using the yeast one-hybrid and electrophoretic mobility shift assay (EMSA), we confirmed that the bZIP transcription factor HY5 binds to this motif of QH6. Studies with promoter truncations before and after this motif suggested that this G-box was important for the diurnal fluctuation of the transgenic β-glucuronidase gene (GUS) transcript abundance in Arabidopsis thaliana. GUS gene driven by the promoter region immediately after G-box showed an arrhythmic expression in both light/dark (LD) and constant dark (DD) conditions, whereas the control with G-box retained its fluctuation in both LD and DD. We further transformed A. thaliana with the luciferase gene (LUC) driven by an 1400 bp fragment upstream QH6 with its G-box intact or mutated, respectively. The luciferase activity assay showed that a peak in the early morning disappeared in the mutant. Gene expression analysis also demonstrated that the rhythmic expression of LUC was abolished in the hy5-1 mutant.

Effect of alkylglycerone phosphate synthase on the expression profile of circRNAs in the human thyroid cancer cell line FRO.

Science.gov (United States)

Hou, Shasha; Tan, Jian; Yang, Bing; He, Lu; Zhu, Yu

2018-05-01

Thyroid cancer is a common primary tumor in China. Therefore, it is important to investigate the underlying molecular mechanism of thyroid cancer in order to achieve effective individualized treatments. In our previous study, a positive correlation between the expression of alkylglycerone phosphate synthase (AGPS) and the malignant phenotype of thyroid cancer cell lines was identified. The inactivation of AGPS was able to decrease the malignancy of cancer, and inhibit tumor growth and invasion. However, the function of AGPS on thyroid cancer was unclear. In the present study, it was revealed that AGPS was able to regulate the expression of circular RNAs (circRNAs), which may be the mechanism of its anticancer activity. Therefore, the effects of AGPS silencing and knockout on circRNA expression in the thyroid cancer cell line FRO were investigated using circRNAs microarray, and Gene Ontology and Kyoto Encyclopedia of Genes and Genomes pathway enrichment analyses were performed in order to investigate the underlying molecular mechanism of AGPS for the regulation of thyroid cancer through circRNAs.

2C-Methyl- D- erythritol 2,4-cyclodiphosphate synthase from Stevia rebaudiana Bertoni is a functional gene.

Science.gov (United States)

Kumar, Hitesh; Singh, Kashmir; Kumar, Sanjay

2012-12-01

Stevia [Stevia rebaudiana (Bertoni)] is a perennial herb which accumulates sweet diterpenoid steviol glycosides (SGs) in its leaf tissue. SGs are synthesized by 2C-methyl-D-erythritol 4-phosphate (MEP) pathway. Of the various enzymes of the MEP pathway, 2C-methyl-D-erythritol 2,4-cyclodiphosphate synthase (MDS) (encoded by MDS) catalyzes the cyclization of 4-(cytidine 5' diphospho)-2C-methyl-D-erythritol 2-phosphate into 2C-methyl-D-erythritol 2,4-cyclodiphosphate. Complementation of the MDS knockout mutant strain of Escherichia coli, EB370 with putative MDS of stevia (SrMDS) rescued the lethal mutant, suggesting SrMDS to be a functional gene. Experiments conducted in plant growth chamber and in the field suggested SrMDS to be a light regulated gene. Indole 3-acetic acid (IAA; 50, 100 μM) down-regulated the expression of SrMDS at 4 h of the treatment, whereas, abscisic acid did not modulate its expression. A high expression of SrMDS was observed during the light hours of the day as compared to the dark hours. The present work established functionality of SrMDS and showed the role of light and IAA in regulating expression of SrMDS.

Expression analysis of cellulose synthase and main cytoskeletal protein genes in flax (Linum usitatissimum L.).

Science.gov (United States)

Galinousky, Dmitry; Padvitski, Tsimafei; Bayer, Galina; Pirko, Yaroslav; Pydiura, Nikolay; Anisimova, Natallia; Nikitinskaya, Tatyana; Khotyleva, Liubov; Yemets, Alla; Kilchevsky, Aleksandr; Blume, Yaroslav

2017-08-09

Fiber flax is an important source of natural fiber and a comprehensive model for the plant fiber biogenesis studies. Cellulose-synthase (CesA) and cytoskeletal genes are known to be important for the cell wall biogenesis in general and for the biogenesis of flax fibers in particular. Currently, knowledge about activity of these genes during the plant growth is limited. In this study, we have investigated flax fiber biogenesis by measuring expression of CesA and cytoskeletal genes at two stages of the flax development (seedlings and stems at the rapid growth stage) in several flax subspecies (elongatum, mediterraneum, crepitans). RT-qPCR has been used to quantify the expression of LusСesA1, LusСesA4, LusСesA7, LusСesA6, Actin, and α-Tubulin genes in plant samples. We report that CesA genes responsible for the secondary cell wall synthesis (LusCesA4, LusCesA7) have different expression pattern compared with CesA genes responsible for the primary cell wall synthesis (LusCesA1, LusCesA6): an average expression of LusCesA4 and LusCesA7 genes is relatively high in seedlings and further increases in stems at the rapid growth stage, whereas an average expression of LusCesA1 and LusCesA6 genes decreases. Interestingly, LusCesA1 is the only studied gene with different expression dynamics between the flax subspecies: its expression decreases by 5.2-10.7 folds in elongatum and mediterraneum but does not change in crepitans subspecies when the rapid growth stage and seedlings are compared. The expression of cytoskeleton genes (coding actin and α-tubulin) is relatively stable and significantly higher than the expression of cellulose-synthase genes in all the studied samples. © 2017 International Federation for Cell Biology.

Use of osmolytes during solubilization and reconstitution of phosphate: sugar phosphate antiport from bacteria

International Nuclear Information System (INIS)

Ambudkar, S.V.; Sonna, L.A.; Maloney, P.C.

1986-01-01

Phosphate:2-deoxyglucose 6-phosphate (Pi:2DG6P) antiport was extracted from Streptococcus lactis or Staphylococcus aureus with 1.1% octylglucoside in the presence of 0.37% E. coli lipid and reconstituted by detergent dilution. Because previous work suggested inactivation at an early stage, the authors introduced protein stabilants during solubilization. When 20% glycerol was used, proteoliposomes showed a 20-fold increase in 32 Pi transport. This enhanced recovery required phospholipid plus glycerol, and was found only when both were added together with the detergent. Glycerol protection yielded proteoliposomes in which antiporters retained their normal kinetic properties, and Pi exchange by the streptococcal example gave a maximal rate (200-400 nmol/min per mg protein) and a turnover number (30-50/s) which suggested that inactivation had been avoided. Further study showed that 20% glycerol could be replaced by equally high concentrations of compounds classified as osmolytes polyols (erythritol, xylitol, sorbitol), sugars (glucose, trehalose) and certain amino acids (glycine, proline, but not valine). The authors suggest that osmolytes may be used to fully stabilize chemiosmotic transporters during reconstitution

Functional Disruption of a Chloroplast Pseudouridine Synthase Desensitizes Arabidopsis Plants to Phosphate Starvation

Directory of Open Access Journals (Sweden)

Shan Lu

2017-08-01

Full Text Available Phosphate (Pi deficiency is a common nutritional stress of plants in both agricultural and natural ecosystems. Plants respond to Pi starvation in the environment by triggering a suite of biochemical, physiological, and developmental changes that increase survival and growth. The key factors that determine plant sensitivity to Pi starvation, however, are unclear. In this research, we identified an Arabidopsis mutant, dps1, with greatly reduced sensitivity to Pi starvation. The dps1 phenotypes are caused by a mutation in the previously characterized SVR1 (SUPPRESSION OF VARIAGATION 1 gene, which encodes a chloroplast-localized pseudouridine synthase. The mutation of SVR1 results in defects in chloroplast rRNA biogenesis, which subsequently reduces chloroplast translation. Another mutant, rps5, which contains a mutation in the chloroplast ribosomal protein RPS5 and has reduced chloroplast translation, also displayed decreased sensitivity to Pi starvation. Furthermore, wild type plants treated with lincomycin, a chemical inhibitor of chloroplast translation, showed similar growth phenotypes and Pi starvation responses as dps1 and rps5. These results suggest that impaired chloroplast translation desensitizes plants to Pi starvation. Combined with previously published results showing that enhanced leaf photosynthesis augments plant responses to Pi starvation, we propose that the decrease in responses to Pi starvation in dps1, rps5, and lincomycin-treated plants is due to their reduced demand for Pi input from the environment.

Crystal structure of 3,4-dihydroxy-2-butanone 4-phosphate synthase of riboflavin biosynthesis

Energy Technology Data Exchange (ETDEWEB)

Liao, D.-I.; Calabrese, J.C.; Wawrzak, Z.; Viitanen, P.V.; Jordan, D.B. (DuPont); (NWU)

2010-03-05

3,4-Dihydroxy-2-butanone-4-phosphate synthase catalyzes a commitment step in the biosynthesis of riboflavin. On the enzyme, ribulose 5-phosphate is converted to 3,4-dihydroxy-2-butanone 4-phosphate and formate in steps involving enolization, ketonization, dehydration, skeleton rearrangement, and formate elimination. The enzyme is absent in humans and an attractive target for the discovery of antimicrobials for pathogens incapable of acquiring sufficient riboflavin from their hosts. The homodimer of 23 kDa subunits requires Mg{sup 2+} for activity. The first three-dimensional structure of the enzyme was determined at 1.4 {angstrom} resolution using the multiwavelength anomalous diffraction (MAD) method on Escherichia coli protein crystals containing gold. The protein consists of an {alpha} + {beta} fold having a complex linkage of {beta} strands. Intersubunit contacts are mediated by numerous hydrophobic interactions and three hydrogen bond networks. A proposed active site was identified on the basis of amino acid residues that are conserved among the enzyme from 19 species. There are two well-separated active sites per dimer, each of which comprise residues from both subunits. In addition to three arginines and two threonines, which may be used for recognizing the phosphate group of the substrate, the active site consists of three glutamates, two aspartates, two histidines, and a cysteine which may provide the means for general acid and base catalysis and for coordinating the Mg{sup 2+} cofactor within the active site.

Differentiation of Cannabis subspecies by THCA synthase gene analysis using RFLP.

Science.gov (United States)

Cirovic, Natasa; Kecmanovic, Miljana; Keckarevic, Dusan; Keckarevic Markovic, Milica

2017-10-01

Cannabis sativa subspecies, known as industrial hemp (C. sativa sativa) and marijuana (C. sativa indica) show no evident morphological distinctions, but they contain different levels of psychoactive Δ-9-tetrahidrocanabinol (THC), with considerably higher concentration in marijuana than in hemp. C. sativa subspecies differ in sequence of tetrahydrocannabinolic acid (THCA) synthase gene, responsible for THC production, and only one active copy of the gene, distinctive for marijuana, is capable of producing THC in concentration more then 0,3% in dried plants, usually punishable by the law. Twenty different samples of marijuana that contain THC in concentration more then 0,3% and three varieties of industrial hemp were analyzed for presence of an active copy of THCA synthase gene using in-house developed restriction fragment length polymorphism (RFLP) method All twenty samples of marijuana were positive for the active copy of THCA synthase gene, 16 of them heterozygous. All three varieties of industrial hemp were homozygous for inactive copy. An algorithm for the fast and accurate forensic analysis of samples suspected to be marijuana was constructed, answering the question if an analyzed sample is capable of producing THC in concentrations higher than 0.3%. Copyright © 2017 Elsevier Ltd and Faculty of Forensic and Legal Medicine. All rights reserved.

Cloning and heterologous expression of a novel subgroup of class IV polyhydroxyalkanoate synthase genes from the genus Bacillus.

Science.gov (United States)

Mizuno, Kouhei; Kihara, Takahiro; Tsuge, Takeharu; Lundgren, Benjamin R; Sarwar, Zaara; Pinto, Atahualpa; Nomura, Christopher T

2017-01-01

Many microorganisms harbor genes necessary to synthesize biodegradable plastics known as polyhydroxyalkanoates (PHAs). We surveyed a genomic database and discovered a new cluster of class IV PHA synthase genes (phaRC). These genes are different in sequence and operon structure from any previously reported PHA synthase. The newly discovered PhaRC synthase was demonstrated to produce PHAs in recombinant Escherichia coli.

How the nucleus and mitochondria communicate in energy production during stress: nuclear MtATP6, an early-stress responsive gene, regulates the mitochondrial F₁F₀-ATP synthase complex.

Science.gov (United States)

Moghadam, Ali Asghar; Ebrahimie, Eemaeil; Taghavi, Seyed Mohsen; Niazi, Ali; Babgohari, Mahbobeh Zamani; Deihimi, Tahereh; Djavaheri, Mohammad; Ramezani, Amin

2013-07-01

A small number of stress-responsive genes, such as those of the mitochondrial F1F0-ATP synthase complex, are encoded by both the nucleus and mitochondria. The regulatory mechanism of these joint products is mysterious. The expression of 6-kDa subunit (MtATP6), a relatively uncharacterized nucleus-encoded subunit of F0 part, was measured during salinity stress in salt-tolerant and salt-sensitive cultivated wheat genotypes, as well as in the wild wheat genotypes, Triticum and Aegilops using qRT-PCR. The MtATP6 expression was suddenly induced 3 h after NaCl treatment in all genotypes, indicating an early inducible stress-responsive behavior. Promoter analysis showed that the MtATP6 promoter includes cis-acting elements such as ABRE, MYC, MYB, GTLs, and W-boxes, suggesting a role for this gene in abscisic acid-mediated signaling, energy metabolism, and stress response. It seems that 6-kDa subunit, as an early response gene and nuclear regulatory factor, translocates to mitochondria and completes the F1F0-ATP synthase complex to enhance ATP production and maintain ion homeostasis under stress conditions. These communications between nucleus and mitochondria are required for inducing mitochondrial responses to stress pathways. Dual targeting of 6-kDa subunit may comprise as a mean of inter-organelle communication and save energy for the cell. Interestingly, MtATP6 showed higher and longer expression in the salt-tolerant wheat and the wild genotypes compared to the salt-sensitive genotype. Apparently, salt-sensitive genotypes have lower ATP production efficiency and weaker energy management than wild genotypes; a stress tolerance mechanism that has not been transferred to cultivated genotypes.

Trehalose is a chemical attractant in the establishment of coral symbiosis.

Directory of Open Access Journals (Sweden)

Mary Hagedorn

Full Text Available Coral reefs have evolved with a crucial symbiosis between photosynthetic dinoflagellates (genus Symbiodinium and their cnidarian hosts (Scleractinians. Most coral larvae take up Symbiodinium from their environment; however, the earliest steps in this process have been elusive. Here we demonstrate that the disaccharide trehalose may be an important signal from the symbiont to potential larval hosts. Symbiodinium freshly isolated from Fungia scutaria corals constantly released trehalose (but not sucrose, maltose or glucose into seawater, and released glycerol only in the presence of coral tissue. Spawning Fungia adults increased symbiont number in their immediate area by excreting pellets of Symbiodinium, and when these naturally discharged Symbiodinium were cultured, they also released trehalose. In Y-maze experiments, coral larvae demonstrated chemoattractant and feeding behaviors only towards a chamber with trehalose or glycerol. Concomitantly, coral larvae and adult tissue, but not symbionts, had significant trehalase enzymatic activities, suggesting the capacity to utilize trehalose. Trehalase activity was developmentally regulated in F. scutaria larvae, rising as the time for symbiont uptake occurs. Consistent with the enzymatic assays, gene finding demonstrated the presence of a trehalase enzyme in the genome of a related coral, Acropora digitifera, and a likely trehalase in the transcriptome of F. scutaria. Taken together, these data suggest that adult F. scutaria seed the reef with Symbiodinium during spawning and the exuded Symbiodinium release trehalose into the environment, which acts as a chemoattractant for F. scutaria larvae and as an initiator of feeding behavior- the first stages toward establishing the coral-Symbiodinium relationship. Because trehalose is a fixed carbon compound, this cue would accurately demonstrate to the cnidarian larvae the photosynthetic ability of the potential symbiont in the ambient environment. To our

The bZIP transcription factor HY5 interacts with the promoter of the monoterpene synthase gene QH6 in modulating its rhythmic expression

Directory of Open Access Journals (Sweden)

Fei eZhou

2015-04-01

Full Text Available The Artemisia annua L. β-pinene synthase QH6 was previously determined to be circadian-regulated at the transcriptional level, showing a rhythmic fluctuation of steady-state transcript abundances. Here we isolated both the genomic sequence and upstream promoter region of QH6. Different regulatory elements, such as G-box (TGACACGTGGCA, -421 bp from the translation initiation site which might have effects on rhythmic gene expression, were found. Using the yeast one-hybrid and electrophoretic mobility shift assay (EMSA, we confirmed that the bZIP transcription factor HY5 binds to this motif of QH6. Studies with promoter truncations before and after this motif suggested that this G-box was important for the diurnal fluctuation of the transgenic β-glucuronidase gene (GUS transcript abundance in Arabidopsis thaliana. GUS gene driven by the promoter region immediately after G-box showed an arrhythmic expression in both light/dark (LD and constant dark (DD conditions, whereas the control with G-box retained its fluctuation in both LD and DD. We further transformed A. thaliana with the luciferase gene (LUC driven by an 1400 bp fragment upstream QH6 with its G-box intact or mutated, respectively. The luciferase activity assay showed that a peak in the early morning disappeared in the mutant. Gene expression analysis also demonstrated that the rhythmic expression of LUC was abolished in the hy5-1 mutant.

Strengthening Triterpene Saponins Biosynthesis by Over-Expression of Farnesyl Pyrophosphate Synthase Gene and RNA Interference of Cycloartenol Synthase Gene in Panax notoginseng Cells

Directory of Open Access Journals (Sweden)

Yan Yang

2017-04-01

Full Text Available To conform to the multiple regulations of triterpene biosynthesis, the gene encoding farnesyl pyrophosphate synthase (FPS was transformed into Panax notoginseng (P. notoginseng cells in which RNA interference (RNAi of the cycloartenol synthase (CAS gene had been accomplished. Transgenic cell lines showed both higher expression levels of FPS and lower expression levels of CAS compared to the wild-type (WT cells. In the triterpene and phytosterol analysis, transgenic cell lines provided a higher accumulation of total triterpene saponins, and a lower amount of phytosterols in comparison with the WT cells. Compared with the cells in which RNAi of the CAS gene was achieved, the cells with simultaneously over-expressed FPS and silenced CAS showed higher triterpene contents. These results demonstrate that over-expression of FPS can break the rate-limiting reaction catalyzed by FPS in the triterpene saponins biosynthetic pathway; and inhibition of CAS expression can decrease the synthesis metabolic flux of the phytosterol branch. Thus, more precursors flow in the direction of triterpene synthesis, and ultimately promote the accumulation of P. notoginseng saponins. Meanwhile, silencing and over-expressing key enzyme genes simultaneously is more effective than just manipulating one gene in the regulation of saponin biosynthesis.

Threonine phosphorylation of rat liver glycogen synthase

International Nuclear Information System (INIS)

Arino, J.; Arro, M.; Guinovart, J.J.

1985-01-01

32 P-labeled glycogen synthase specifically immunoprecipitated from 32 P-phosphate incubated rat hepatocytes contains, in addition to [ 32 P] phosphoserine, significant levels of [ 32 P] phosphothreonine. When the 32 P-immunoprecipitate was cleaved with CNBr, the [ 32 P] phosphothreonine was recovered in the large CNBr fragment (CB-2, Mapp 28 Kd). Homogeneous rat liver glycogen synthase was phosphorylated by all the protein kinases able to phosphorylate CB-2 in vitro. After analysis of the immunoprecipitated enzyme for phosphoaminoacids, it was observed that only casein kinase II was able to phosphorylate on threonine and 32 P-phosphate was only found in CB-2. These results demonstrate that rat liver glycogen synthase is phosphorylated at threonine site(s) contained in CB-2 and strongly indicate that casein kinase II may play a role in the ''in vivo'' phosphorylation of liver glycogen synthase. This is the first protein kinase reported to phosphorylate threonine residues in liver glycogen synthase

Data mining and pathway analysis of glucose-6-phosphate dehydrogenase with natural language processing

Science.gov (United States)

Chen, Long; Zhang, Chunhua; Wang, Yanling; Li, Yuqian; Han, Qiaoqiao; Yang, Huixin; Zhu, Yuechun

2017-01-01

Human glucose-6-phosphate dehydrogenase (G6PD) is a crucial enzyme in the pentose phosphate pathway, and serves an important role in biosynthesis and the redox balance. G6PD deficiency is a major cause of neonatal jaundice and acute hemolyticanemia, and recently, G6PD has been associated with diseases including inflammation and cancer. The aim of the present study was to conduct a search of the National Center for Biotechnology Information PubMed library for articles discussing G6PD. Genes that were identified to be associated with G6PD were recorded, and the frequency at which each gene appeared was calculated. Gene ontology (GO), pathway and network analyses were then performed. A total of 98 G6PD-associated genes and 33 microRNAs (miRNAs) that potentially regulate G6PD were identified. The 98 G6PD-associated genes were then sub-classified into three functional groups by GO analysis, followed by analysis of function, pathway, network, and disease association. Out of the 47 signaling pathways identified, seven were significantly correlated with G6PD-associated genes. At least two out of four independent programs identified the 33 miRNAs that were predicted to target G6PD. miR-1207-5P, miR-1 and miR-125a-5p were predicted by all four software programs to target G6PD. The results of the present study revealed that dysregulation of G6PD was associated with cancer, autoimmune diseases, and oxidative stress-induced disorders. These results revealed the potential roles of G6PD-regulated signaling and metabolic pathways in the etiology of these diseases. PMID:28627690

In vivo activity of released cell wall lipids of Mycobacterium bovis bacillus Calmette-Guérin is due principally to trehalose mycolates.

Science.gov (United States)

Geisel, Rachel E; Sakamoto, Kaori; Russell, David G; Rhoades, Elizabeth R

2005-04-15

The hallmark of Mycobacterium-induced pathology is granulomatous inflammation at the site of infection. Mycobacterial lipids are potent immunomodulators that contribute to the granulomatous response and are released in appreciable quantities by intracellular bacilli. Previously we investigated the granulomagenic nature of the peripheral cell wall lipids of Mycobacterium bovis bacillus Calmette-Guérin (BCG) by coating the lipids onto 90-microm diameter microspheres that were mixed into Matrigel matrix with syngeneic bone marrow-derived macrophages and injected i.p. into mice. These studies demonstrated that BCG lipids elicit proinflammatory cytokines and recruit leukocytes. In the current study we determined the lipids responsible for this proinflammatory effect. BCG-derived cell wall lipids were fractionated and purified by liquid chromatography and preparative TLC. The isolated fractions including phosphatidylinositol dimannosides, cardiolipin, phosphatidylglycerol, phosphatidylethanolamine, trehalose monomycolate, trehalose dimycolate, and mycoside B. Trehalose dimycolate, when delivered to bone marrow-derived murine macrophages, induced the greatest secretion of IL-1beta, IL-6, and TNF-alpha in vitro. Trehalose dimycolate similarly induced the greatest secretion of these proinflammatory cytokines in ex vivo matrices over the course of 12 days. Trehalose monomycolate and dimycolate also induced profound neutrophil recruitment in vivo. Experiments with TLR2 or TLR4 gene-deficient mice revealed no defects in responses to trehalose mycolates, although MyD88-deficient mice manifested significantly reduced cell recruitment and cytokine production. These results demonstrate that the trehalose mycolates, particularly trehalose dimycolate, are the most bioactive lipids in the BCG extract, inducing a proinflammatory cascade that influences granuloma formation.

Trehalose in glycerol-free freezing extender enhances post-thaw survival of boar spermatozoa

Science.gov (United States)

ATHURUPANA, Rukmali; TAKAHASHI, Daisen; IOKI, Sumire; FUNAHASHI, Hiroaki

2015-01-01

Cryopreservation of boar semen is still considered suboptimal due to lower fertility as compared with fresh samples when glycerol, a permeating cryoprotectant, is used. Trehalose is a non-permeable cryoprotectant and nonreducing disaccharide known to stabilize proteins and biologic membranes. The aim of this study was to evaluate the cryosurvival and in vitro penetrability of boar spermatozoa when glycerol was replaced with trehalose in a freezing extender. Ejaculated Berkshire semen samples were diluted in egg yolk-based freezing extender containing glycerol (100 mM) or trehalose (0, 50, 100, 150, 200 and 250 mM) and cryopreserved using a straw freezing procedure. Thawed samples were analyzed for motility, viability, mitochondrial membrane potential (MMP), and acrosome integrity. In experiment 2, penetrability of spermatozoa cryopreserved with 100 mM glycerol or trehalose was examined. Replacement of cryoprotectant glycerol (100 mM) with trehalose had no effect on sperm viability, but replacing it with 100 mM trehalose improved motility, MMP and acrosome integrity significantly. Sperm motility and MMP were considerably higher in 100 mM trehalose, whereas the acrosome integrity was substantially higher in 100–250 mM trehalose. The in vitro penetration rate was also significantly higher in spermatozoa cryopreserved with trehalose (61.3%) than in those cryopreserved with glycerol (43.6%). In conclusion, 100 mM non-permeable trehalose can be used to replace glycerol, a permeating cryoprotectant, for maintenance of better post-thaw quality of boar spermatozoa. PMID:25754239

SCREENING OF 6-PYRUVOYL-TETRAHYDROPTERIN SYNTHASE ACTIVITY DEFICIENCY AMONG HYPERP HENYLALANINEMIC PATIENTS

Directory of Open Access Journals (Sweden)

DURDI QUJEQ

1999-10-01

Full Text Available A deficiency of the phenylalanine hydroxylase activity or its cofactor tetrahydrobiopterin may"nlead to hyperphenylalamnemia and as a result, loss of IQ, poor school performance, and"nbehavior problems occurs. Deficiency in 6-pyruvoyl-tetrahydropterin synthase activity is the"nmajor cause of tetrahydrobiopterin deficient phenylketonuria. In this study, blood specimens"nfrom 165 healthy volunteers and 127 children with phenylketonuria were used to determine"nthe 6-pyruvoyl-tetrahydropterin synthase activity. It was found that the activity of 6-"npyruvoyl- tetrahydropterin synthase was decreased in comparison with control [23.46 +/-"n2.94, (mean +/- SD, mmol/ ml/h, n=I27 vs. 127.63 +/- 4.52, n=165, p<0.05]. Results of"nthis study indicate that examination of 6-pyruvoyl-tetrahydropterin synthase activity is helpful"nand may lead to the diagnosis cause of hyperphenylalaninemia.

Lineage-Specific Expansion of the Chalcone Synthase Gene Family in Rosids.

Directory of Open Access Journals (Sweden)

Kattina Zavala

Full Text Available Rosids are a monophyletic group that includes approximately 70,000 species in 140 families, and they are found in a variety of habitats and life forms. Many important crops such as fruit trees and legumes are rosids. The evolutionary success of this group may have been influenced by their ability to produce flavonoids, secondary metabolites that are synthetized through a branch of the phenylpropanoid pathway where chalcone synthase is a key enzyme. In this work, we studied the evolution of the chalcone synthase gene family in 12 species belonging to the rosid clade. Our results show that the last common ancestor of the rosid clade possessed six chalcone synthase gene lineages that were differentially retained during the evolutionary history of the group. In fact, of the six gene lineages that were present in the last common ancestor, 7 species retained 2 of them, whereas the other 5 only retained one gene lineage. We also show that one of the gene lineages was disproportionately expanded in species that belonged to the order Fabales (soybean, barrel medic and Lotus japonicas. Based on the available literature, we suggest that this gene lineage possesses stress-related biological functions (e.g., response to UV light, pathogen defense. We propose that the observed expansion of this clade was a result of a selective pressure to increase the amount of enzymes involved in the production of phenylpropanoid pathway-derived secondary metabolites, which is consistent with the hypothesis that suggested that lineage-specific expansions fuel plant adaptation.

Neurospora tryptophan synthase: N-terminal analysis and the sequence of the pyridoxal phosphate active site peptide

International Nuclear Information System (INIS)

Pratt, M.L.; Hsu, P.Y.; DeMoss, J.A.

1986-01-01

Tryptophan synthase (TS), which catalyzes the final step of tryptophan biosynthesis, is a multifunctional protein requiring pyridoxal phosphate (B6P) for two of its three distinct enzyme activities. TS from Neurospora has a blocked N-terminal, is a homodimer of 150 KDa and binds one mole of B6P per mole of subunit. The authors shown the N-terminal residue to be acyl-serine. The B6P-active site of holoenzyme was labelled by reduction of the B6P-Schiff base with [ 3 H]-NaBH 4 , and resulted in a proportionate loss of activity in the two B6P-requiring reactions. SDS-polyacrylamide gel electrophoresis of CNBr-generated peptides showed the labelled, active site peptide to be 6 KDa. The sequence of this peptide, purified to apparent homogeneity by a combination of C-18 reversed phase and TSK gel filtration HPLC is: gly-arg-pro-gly-gln-leu-his-lys-ala-glu-arg-leu-thr-glu-tyr-ala-gly-gly-ala-gln-ile-xxx-leu-lys-arg-glu-asp-leu-asn-his-xxx-gly-xxx-his-/sub ***/-ile-asn-asn-ala-leu. Although four residues (xxx, /sub ***/) are unidentified, this peptide is minimally 78% homologous with the corresponding peptide from yeast TS, in which residue (/sub ***/) is the lysine that binds B6P

Crystal Structure and Substrate Specificity of D-Galactose-6-Phosphate Isomerase Complexed with Substrates

Science.gov (United States)

Lee, Jung-Kul; Pan, Cheol-Ho

2013-01-01

D-Galactose-6-phosphate isomerase from Lactobacillus rhamnosus (LacAB; EC 5.3.1.26), which is encoded by the tagatose-6-phosphate pathway gene cluster (lacABCD), catalyzes the isomerization of D-galactose-6-phosphate to D-tagatose-6-phosphate during lactose catabolism and is used to produce rare sugars as low-calorie natural sweeteners. The crystal structures of LacAB and its complex with D-tagatose-6-phosphate revealed that LacAB is a homotetramer of LacA and LacB subunits, with a structure similar to that of ribose-5-phosphate isomerase (Rpi). Structurally, LacAB belongs to the RpiB/LacAB superfamily, having a Rossmann-like αβα sandwich fold as has been identified in pentose phosphate isomerase and hexose phosphate isomerase. In contrast to other family members, the LacB subunit also has a unique α7 helix in its C-terminus. One active site is distinctly located at the interface between LacA and LacB, whereas two active sites are present in RpiB. In the structure of the product complex, the phosphate group of D-tagatose-6-phosphate is bound to three arginine residues, including Arg-39, producing a different substrate orientation than that in RpiB, where the substrate binds at Asp-43. Due to the proximity of the Arg-134 residue and backbone Cα of the α6 helix in LacA to the last Asp-172 residue of LacB with a hydrogen bond, a six-carbon sugar-phosphate can bind in the larger pocket of LacAB, compared with RpiB. His-96 in the active site is important for ring opening and substrate orientation, and Cys-65 is essential for the isomerization activity of the enzyme. Two rare sugar substrates, D-psicose and D-ribulose, show optimal binding in the LacAB-substrate complex. These findings were supported by the results of LacA activity assays. PMID:24015281

Crystal structure and substrate specificity of D-galactose-6-phosphate isomerase complexed with substrates.

Directory of Open Access Journals (Sweden)

Woo-Suk Jung

Full Text Available D-Galactose-6-phosphate isomerase from Lactobacillus rhamnosus (LacAB; EC 5.3.1.26, which is encoded by the tagatose-6-phosphate pathway gene cluster (lacABCD, catalyzes the isomerization of D-galactose-6-phosphate to D-tagatose-6-phosphate during lactose catabolism and is used to produce rare sugars as low-calorie natural sweeteners. The crystal structures of LacAB and its complex with D-tagatose-6-phosphate revealed that LacAB is a homotetramer of LacA and LacB subunits, with a structure similar to that of ribose-5-phosphate isomerase (Rpi. Structurally, LacAB belongs to the RpiB/LacAB superfamily, having a Rossmann-like αβα sandwich fold as has been identified in pentose phosphate isomerase and hexose phosphate isomerase. In contrast to other family members, the LacB subunit also has a unique α7 helix in its C-terminus. One active site is distinctly located at the interface between LacA and LacB, whereas two active sites are present in RpiB. In the structure of the product complex, the phosphate group of D-tagatose-6-phosphate is bound to three arginine residues, including Arg-39, producing a different substrate orientation than that in RpiB, where the substrate binds at Asp-43. Due to the proximity of the Arg-134 residue and backbone Cα of the α6 helix in LacA to the last Asp-172 residue of LacB with a hydrogen bond, a six-carbon sugar-phosphate can bind in the larger pocket of LacAB, compared with RpiB. His-96 in the active site is important for ring opening and substrate orientation, and Cys-65 is essential for the isomerization activity of the enzyme. Two rare sugar substrates, D-psicose and D-ribulose, show optimal binding in the LacAB-substrate complex. These findings were supported by the results of LacA activity assays.

Light and Fungal Elicitor Induce 3-Deoxy-d-arabino-Heptulosonate 7-Phosphate Synthase mRNA in Suspension Cultured Cells of Parsley (Petroselinum crispum L.) 1

Science.gov (United States)

Henstrand, John M.; McCue, Kent F.; Brink, Kent; Handa, Avtar K.; Herrmann, Klaus M.; Conn, Eric E.

1992-01-01

Light and fungal elicitor induce mRNA encoding 3-deoxy-d-arabino-heptulosonate 7-phosphate (DAHP) synthase in suspension cultured cells of parsley (Petroselinum crispum L.). The kinetics and dose response of mRNA accumulation were similar for DAHP synthase and phenylalanine ammonia-lyase (PAL). Six micrograms of elicitor from Phytophthora megasperma f. glycinia gave a detectable induction within 1 hour. Induction of DAHP synthase and PAL mRNAs by light was transient, reaching maximal levels at 4 hours and returning to pretreatment levels after 24 hours. Our data suggest that either light or fungal elicitor transcriptionally activate DAHP synthase. A coordinate regulation for key enzymes in the synthesis of primary and secondary metabolites is indicated. ImagesFigure 1 PMID:16668708

The polyketide components of waxes and the Cer-cqu gene cluster encoding a novel polyketide synthase, the β-diketone synthase, DKS

DEFF Research Database (Denmark)

von Wettstein, Penny

2017-01-01

The primary function of the outermost, lipophilic layer of plant aerial surfaces, called the cuticle, is preventing non-stomatal water loss. Its exterior surface is often decorated with wax crystals, imparting a blue-grey color. Identification of the barley Cer-c, -q and -u genes forming the 101 kb...... Cer-cqu gene cluster encoding a novel polyketide synthase-the β-diketone synthase (DKS), a lipase/carboxyl transferase, and a P450 hydroxylase, respectively, establishes a new, major pathway for the synthesis of plant waxes. The major product is a β-diketone (14,16-hentriacontane) aliphatic that forms...

Role of thyroid hormones in the normal and glucocorticosteroid hormone-induced evolution of carbamoyl-phosphate synthase (ammonia) activity in axolotl liver

NARCIS (Netherlands)

Lamers, W. H.; Vink, C.; Charles, R.

1978-01-01

1. In axolotl liver, the activity of carbamoyl-phosphate synthase (ammonia), expressed per mg liver protein, decreases to a minimum at 5 months of age, then increases to a maximum at 8 months of age which is followed by a decrease again. The initial decrease between 3 and 5 months of age appears to

Trehalose diester glycolipids are superior to the monoesters in binding to Mincle, activation of macrophages invitro and adjuvant activity invivo

DEFF Research Database (Denmark)

Huber, Alexandra; Kallerup, Rie S.; Korsholm, Karen S.

2016-01-01

The T-cell adjuvanticity of mycobacterial cord factor trehalose 6,6'-dimycolate (TDM) is well established. The identification of the C-type lectin Mincle on innate immune cells as the receptor for TDM and its synthetic analogue trehalose 6,6'-dibehenate (TDB) has raised interest in development...... of synthetic Mincle ligands as novel adjuvants. Trehalose mono- (TMXs) and diesters (TDXs) with symmetrically shortened acyl chains [denoted by X: arachidate (A), stearate (S), palmitate (P), and myristate (M)] were tested. Upon stimulation of murine macrophages, G-CSF secretion and NO production were strongly...... activity of trehalose diesters. Overall, immune activation in vitro and in vivo by trehalose esters of simple fatty acids requires two acyl chains of length and involves Mincle....

Essential histidyl residues at the active site(s) of sucrose-phosphate synthase from Prosopis juliflora.

Science.gov (United States)

Sinha, A K; Pathre, U V; Sane, P V

1998-11-10

Chemical modification of sucrose-phosphate synthase (EC 2.4.1.14) from Prosopis juliflora by diethyl pyrocarbonate (DEP) and photo-oxidation in the presence of rose bengal (RB) which modify the histidyl residues of the protein resulted in the inactivation of the enzyme activity. This inactivation was dependent on the concentration of the modifying reagent and the time of incubation and followed pseudo-first order kinetics. For both the reagents, the inactivation was maximum at pH 7.5, which is consistent with the involvement and presence of histidine residues at the active site of the enzyme. Substrates, UDPG and F6P protected the enzyme against the inactivation by the modifying reagents suggesting that the histidine residues may be involved in the binding of these substrates and are essential for the catalytic activity. Specificity of DEP was indicated by an increase in absorbance at 240 nm along with concomitant inactivation of the enzyme and reactivation of the modified enzyme by hydroxylamine. These results strongly suggest the presence of histidine residue(s) at or near the active site of the enzyme.

Isolation and characterization of a copalyl diphosphate synthase gene promoter from Salvia miltiorrhiza

Directory of Open Access Journals (Sweden)

Piotr Szymczyk

2016-09-01

Full Text Available The promoter, 5' UTR, and 34-nt 5' fragments of protein encoding region of the Salvia miltiorrhiza copalyl diphosphate synthase gene were cloned and characterized. No tandem repeats, miRNA binding sites, or CpNpG islands were observed in the promoter, 5' UTR, or protein encoding fragments. The entire isolated promoter and 5' UTR is 2235 bp long and contains repetitions of many cis-active elements, recognized by homologous transcription factors, found in Arabidopsis thaliana and other plant species. A pyrimidine-rich fragment with only 6 non-pyrimidine bases was localized in the 33-nt stretch from nt 2185 to 2217 in the 5' UTR. The observed cis-active sequences are potential binding sites for trans-factors that could regulate spatio-temporal CPS gene expression in response to biotic and abiotic stress conditions. Obtained results are initially verified by in silico and co-expression studies based on A. thaliana microarray data. The quantitative RT-PCR analysis confirmed that the entire 2269-bp copalyl diphosphate synthase gene fragment has the promoter activity. Quantitative RT-PCR analysis was used to study changes in CPS promoter activity occurring in response to the application of four selected biotic and abiotic regulatory factors; auxin, gibberellin, salicylic acid, and high-salt concentration.

Nitric oxide synthase gene G298 allele

International Nuclear Information System (INIS)

Nagib El-Kilany, Galal E.; Nayel, Ehab; Hazzaa, Sahar

2004-01-01

Background: Nitric oxide (NO) has an important effect on blood pressure, arterial wall, and the basal release of endothelial NO in hypertension (HPN) may be reduced. Until now, there is no solid data revealing the potential role of the polymorphism of the nitric oxide synthase gene (NOS) in patients with HPN and microvascular angina. Aim: The aim of the present study is to investigate the gene of endothelial nitric oxide synthase (eNOS), as the polymorphism of this gene may be a putative candidate for HPN and initiate the process of atherosclerosis. Methods: Sixty participants were recruited for this study; 50 were hypertensive patients complaining of chest pain [30 of them have electrocardiogram (EKG) changes of ischemia], 20 had isolated HPN, and 10 healthy volunteers served as control. All patients underwent stress myocardial perfusion imaging (MPI) and coronary angiography. Genotyping of eNOS for all patients and controls was performed. The linkages between HPN, microvascular angina and eNOS gene polymorphism were investigated. Results: MPI and coronary angiography revealed that 15 patients had chest pain with true ischemia and reversible myocardial perfusion defects (multiple and mild) but normal epicardial coronary arteries (microvascular angina), while 15 patients had significant coronary artery disease (CAD), and 20 hypertensive patients showed normal perfusion scan and coronary angiography. The prevalence of the NOS G 298 allele was higher in the hypertensive group with microvascular angina (documented by MPI) than it was among the control participants (P<.005). The eNOS allele was significantly higher in the hypertensive group than in the control participants, but there was no significant difference in homozygote mutants among hypertensive participants, x-syndrome and patients with CAD. Conclusion: eNOS gene polymorphism is proved to be an important etiology in microvascular angina (x-syndrome) among hypertensive patients. In addition, the eNOS mutant

A novel 5-enolpyruvylshikimate-3-phosphate synthase from Rahnella aquatilis with significantly reduced glyphosate sensitivity.

Directory of Open Access Journals (Sweden)

Ri-He Peng

Full Text Available The 5-enolpyruvylshikimate-3-phosphate synthase (EPSPS; EC 2.5.1.19 is a key enzyme in the shikimate pathway for the production of aromatic amino acids and chorismate-derived secondary metabolites in plants, fungi, and microorganisms. It is also the target of the broad-spectrum herbicide glyphosate. Natural glyphosate resistance is generally thought to occur within microorganisms in a strong selective pressure condition. Rahnella aquatilis strain GR20, an antagonist against pathogenic agrobacterial strains of grape crown gall, was isolated from the rhizosphere of grape in glyphosate-contaminated vineyards. A novel gene encoding EPSPS was identified from the isolated bacterium by complementation of an Escherichia coli auxotrophic aroA mutant. The EPSPS, named AroA(R. aquatilis, was expressed and purified from E. coli, and key kinetic values were determined. The full-length enzyme exhibited higher tolerance to glyphosate than the E. coli EPSPS (AroA(E. coli, while retaining high affinity for the substrate phosphoenolpyruvate. Transgenic plants of AroA(R. aquatilis were also observed to be more resistant to glyphosate at a concentration of 5 mM than that of AroA(E. coli. To probe the sites contributing to increased tolerance to glyphosate, mutant R. aquatilis EPSPS enzymes were produced with the c-strand of subdomain 3 and the f-strand of subdomain 5 (Thr38Lys, Arg40Val, Arg222Gln, Ser224Val, Ile225Val, and Gln226Lys substituted by the corresponding region of the E. coli EPSPS. The mutant enzyme exhibited greater sensitivity to glyphosate than the wild type R. aquatilis EPSPS with little change of affinity for its first substrate, shikimate-3-phosphate (S3P and phosphoenolpyruvate (PEP. The effect of the residues on subdomain 5 on glyphosate resistance was more obvious.

Characterization and evolutionary analysis of ent-kaurene synthase like genes from the wild rice species Oryza rufipogon.

Science.gov (United States)

Toyomasu, Tomonobu; Miyamoto, Koji; Shenton, Matthew R; Sakai, Arisa; Sugawara, Chizu; Horie, Kiyotaka; Kawaide, Hiroshi; Hasegawa, Morifumi; Chuba, Masaru; Mitsuhashi, Wataru; Yamane, Hisakazu; Kurata, Nori; Okada, Kazunori

2016-11-18

Cultivated rice (Oryza sativa) possesses various labdane-related diterpene synthase genes, homologs of ent-copalyl diphosphate synthase (CPS) and ent-kaurene synthase (KS) that are responsible for the biosynthesis of phytohormone gibberellins. The CPS homologs and KS like (KSL) homologs successively converted geranylgeranyl diphosphate to cyclic diterpene hydrocarbons via ent-copalyl diphosphate or syn-copalyl diphosphate in O. sativa. Consequently, a variety of labdane-related diterpenoids, including phytoalexin phytocassanes, momilactones and oryzalexins, have been identified from cultivated rice. Our previous report indicated that the biosynthesis of phytocassanes and momilactones is conserved in Oryza rufipogon, the progenitor of Asian cultivated rice. Moreover, their biosynthetic gene clusters, containing OsCPS2 and OsKSL7 for phytocassane biosynthesis and OsCPS4 and OsKSL4 for momilactone biosynthesis, are also present in the O. rufipogon genome. We herein characterized O. rufipogon homologs of OsKSL5, OsKSL6, OsKSL8 responsible for oryzalexin S biosynthesis, and OsKSL10 responsible for oryzalexins A-F biosynthesis, to obtain more evolutionary insight into diterpenoid biosynthesis in O. sativa. Our phytoalexin analyses showed that no accumulation of oryzalexins was detected in extracts from O. rufipogon leaf blades. In vitro functional analyses indicated that unlike OsKSL10, O. rufipogon KSL10 functions as an ent-miltiradiene synthase, which explains the lack of accumulation of oryzalexins A-F in O. rufipogon. The different functions of KSL5 and KSL8 in O. sativa japonica to those in indica are conserved in each type of O. rufipogon, while KSL6 functions (ent-isokaurene synthases) are well conserved. Our study suggests that O. sativa japonica has evolved distinct specialized diterpenoid metabolism, including the biosynthesis of oryzalexins. Copyright © 2016 Elsevier Inc. All rights reserved.

About the role of trehalose in plants

Directory of Open Access Journals (Sweden)

Tjaša GORJANC

2018-04-01

Full Text Available Trehalose is an important disaccharide which takes a major role of a stress protector in many organisms, including green algae and lower plants. It has long been thought that trehalose functions in higher plants are marginal and that they have been overtaken by sucrose. In the last years it has been discovered that trehalose takes on a lot of important physiological roles in vascular plants metabolism. It is an important signal metabolite of sucrose availability and maintains sucrose concentrations within an appropriate range. It also contributes to starch synthesis and degradation and to synthesis of organic acids. Trehalose-sucrose nexus was found to be very important in plant interactions with pathogenic organisms and herbivorous insects. Furthermore, trehalose is involved in response of plant to abiotic stressors such as drought, cold, salinity and hypoxia. It contributes in regulation of stomatal conductivity where it interacts with abscisic acid. All this makes trehalose an important primary metabolite which significantly influences plant growth and development such as induction of flowering and stimulation of photosynthesis.

Novel class III phosphoribosyl diphosphate synthase: structure and properties of the tetrameric, phosphate-activated, non-allosterically inhibited enzyme from Methanocaldococcus jannaschii

DEFF Research Database (Denmark)

Kadziola, Anders; Jepsen, Clemens H; Johansson, Eva

2005-01-01

The prs gene encoding phosphoribosyl diphosphate (PRPP) synthase of the hyperthermophilic autotrophic methanogenic archaeon Methanocaldococcus jannaschii has been cloned and expressed in Escherichia coli. Subsequently, M.jannaschii PRPP synthase has been purified, characterised, crystallised, and...

Interrupted thymidylate synthase gene of bacteriophages T2 and T6 and other potential self-splicing introns in the T-even bacteriophages

International Nuclear Information System (INIS)

Chu, F.K.; Maley, F.; Martinez, J.; Maley, G.F.

1987-01-01

Southern hybridization analyses of procaryotic DNA from Escherchia coli, λ bacteriophage, and T1 to T7 phages were carried out. The hybridization probes used consisted of DNA restriction fragments derived from the T4 phage intron-containing thymidylate synthase gene (td) and short synthetic oligodeoxynucleotides defining specific exon and intron regions of the gene. It was shown that intact as well as restricted DNA from the T-even phages hybridized not only to both T4 phage td intron- and exon-specific probes but also to probes defining the td 5' (exon I-intron) and 3' (intron-exon II) presplice junctions. These data strongly suggest that, analogous to the T4 phage, only the T2 and T6 phages among the procaryotes tested contain interrupted td genes. The td intervening sequence in each phage is roughly 1 kilobase pair (kb) in size and interrupts the td gene at a site analogous to that in the T4 phage. This was confirmed by data from Northern (RNA) hybridization analysis of td-specific in vitro transcripts of these phage DNAs. [α- 32 P]GTP in vitro labeling of total RNA from T4 phage-infected cells produced five species of labeled RNAs that were 1, 0.9, 0.83, 0.75, and 0.6 kb in size. Only the 1-, 0.9-, and 0.75-kb species were labeled in RNA from T2- or T6-infected cells. The commonly present 1-kb RNA is the excised td intron, which exists in both linear and circular forms in the respective T-even-phage-infected cells, while the 0.6-kb RNA unique to T4 may be the excised intron derived from the ribonucleotide reductase small subunit gene (nrdB) of the phage. The remaining labeled RNA species are likely candidates for other self-splicing introns

Genetics Home Reference: glucose-6-phosphate dehydrogenase deficiency

Science.gov (United States)

... deficiency Encyclopedia: Glucose-6-phosphate dehydrogenase test Encyclopedia: Hemolytic anemia Encyclopedia: Newborn jaundice Health Topic: Anemia Health Topic: G6PD Deficiency Health Topic: Newborn Screening Genetic and Rare Diseases Information Center (1 link) Glucose-6-phosphate dehydrogenase ...

Cloning and characterization of novel methylsalicylic acid synthase gene involved in the biosynthesis of isoasperlactone and asperlactone in Aspergillus westerdijkiae

International Nuclear Information System (INIS)

Bacha, N.; Dao, H.P.; Mathieu, F.; Liboz, T.; Lebrihi, A.; Atoui, A.; O'Callaghan, J.; Dobson, A.D.W.; Puel, O.

2008-01-01

Aspergillus westerdijkiae is the main producer of several biologically active polyketide metabolites including isoasperlactone and asperlactone. A 5298 bp polyketide synthase gene ''aomsas'' has been cloned in Aspergillus westerdijkiae by using gene walking approach and RACE-PCR. The predicted amino acid sequence of aomsas shows an identity of 40-56% with different methylsalicylic acid synthase genes found in Byssochlamys nivea, P. patulum, A. terreus and Streptomyces viridochromogenes. Based on the reverse transcription PCR and kinetic secondary metabolites production studies, aomsas expression was found to be associated with the biosynthesis of isoasperlactone and asperlactone. Moreover an aomsas knockout mutant ''aomsas'' of A. westerdijkiae, not only lost the capacity to produce isoasperlactone and asperlactone, but also 6-methylsalicylic acid. The genetically complemented mutant aomsas restored the biosynthesis of all the missing metabolites. Chemical complementation through the addition of 6-methylsalicylic acid, aspyrone and diepoxide to growing culture of aomsas mutant revealed that these compounds play intermediate roles in the biosynthesis of asperlactone and isoasperlactone. (author)

Trehalose maintains bioactivity and promotes sustained release of BMP-2 from lyophilized CDHA scaffolds for enhanced osteogenesis in vitro and in vivo.

Directory of Open Access Journals (Sweden)

Jun Zhao

Full Text Available Calcium phosphate (Ca-P scaffolds have been widely employed as a supportive matrix and delivery system for bone tissue engineering. Previous studies using osteoinductive growth factors loaded Ca-P scaffolds via passive adsorption often experience issues associated with easy inactivation and uncontrolled release. In present study, a new delivery system was fabricated using bone morphogenetic protein-2 (BMP-2 loaded calcium-deficient hydroxyapatite (CDHA scaffold by lyophilization with addition of trehalose. The in vitro osteogenesis effects of this formulation were compared with lyophilized BMP-2/CDHA construct without trehalose and absorbed BMP-2/CDHA constructs with or without trehalose. The release characteristics and alkaline phosphatase (ALP activity analyses showed that addition of trehalose could sufficiently protect BMP-2 bioactivity during lyophilization and achieve sustained BMP-2 release from lyophilized CDHA construct in vitro and in vivo. However, absorbed BMP-2/CDHA constructs with or without trehalose showed similar BMP-2 bioactivity and presented a burst release. Quantitative real-time PCR (RT-qPCR and enzyme-linked immunosorbent assay (ELISA demonstrated that lyophilized BMP-2/CDHA construct with trehalose (lyo-tre-BMP-2 promoted osteogenic differentiation of bone marrow stromal cells (bMSCs significantly and this formulation could preserve over 70% protein bioactivity after 5 weeks storage at 25°C. Micro-computed tomography, histological and fluorescent labeling analyses further demonstrated that lyo-tre-BMP-2 formulation combined with bMSCs led to the most percentage of new bone volume (38.79% ± 5.32% and area (40.71% ± 7.14% as well as the most percentage of fluorochrome stained bone area (alizarin red S: 2.64% ± 0.44%, calcein: 6.08% ± 1.37% and mineral apposition rate (4.13 ± 0.62 µm/day in critical-sized rat cranial defects healing. Biomechanical tests also indicated the maximum stiffness (118.17 ± 15.02 Mpa and

The effect of 60Co γ-rays on the contents of paramylon and trehalose in Euglena gracilis

International Nuclear Information System (INIS)

Furuta, M.; Maruyama, A.; Nakazawa, M.; Ueda, M.; Miyatake, K.; Kato, A.; Enomoto, T.

2003-01-01

Full text: It is reported that the non-reducing disaccharide trehalose is accumulated in various organisms and protects biomolecules against various environmental stresses including heat shock, osmotic shock, and oxidative stresses. Euglena (Euglena gracilis) is photosynthetic unicellular organisms which is classified both as animal and as plant because of its motility. In our previous study, it was shown that salt stress causes degradation of paramylon, the reserve carbohydrate of Euglena, and trehalose, the degraded product of paramylon, accumulated simultaneously to maintain the osmotic pressure of Euglena cells. Euglena is known to be radiation-resistant more than Escherichia coli and other bacteria. Therefore, we have investigated whether or not the same phenomenon could be observed in Euglena after 60 Co-gamma irradiation. Exposure of the native Z strain and chloroplast-deficient SM-ZK strain of Euglena to a dose of 500 kGy induced significant paramylon degradation and trehalose accumulation during the incubation in the Koren-Hunter culture medium containing glucose as carbon source after the irradiation. Forty percent of the paramylon was degraded within 10-hr incubation after the irradiation but accumulated trehalose content was about one sixth of that by salt stress. Trehlose accumulation disappeared when the irradiated cells were incubated in phosphate buffer but it recovered when glucose is added to the buffer to the same concentration as K-H media. These results suggest that trehalose accumulation in irradiated Euglena cells plays a role in protecting cellular constituents from oxidative damage caused by gamma-irradiation independently of the response to salt stress

Chromosomal localization of the human and mouse hyaluronan synthase genes

Energy Technology Data Exchange (ETDEWEB)

Spicer, A.P.; McDonald, J.A. [Mayo Clinic Scottsdale, AZ (United States); Seldin, M.F. [Univ. of California Davis, CA (United States)] [and others

1997-05-01

We have recently identified a new vertebrate gene family encoding putative hyaluronan (HA) synthases. Three highly conserved related genes have been identified, designated HAS1, HAS2, and HAS3 in humans and Has1, Has2, and Has3 in the mouse. All three genes encode predicted plasma membrane proteins with multiple transmembrane domains and approximately 25% amino acid sequence identity to the Streptococcus pyogenes HA synthase, HasA. Furthermore, expression of any one HAS gene in transfected mammalian cells leads to high levels of HA biosynthesis. We now report the chromosomal localization of the three HAS genes in human and in mouse. The genes localized to three different positions within both the human and the mouse genomes. HAS1 was localized to the human chromosome 19q13.3-q13.4 boundary and Has1 to mouse Chr 17. HAS2 was localized to human chromosome 8q24.12 and Has2 to mouse Chr 15. HAS3 was localized to human chromosome 16q22.1 and Has3 to mouse Chr 8. The map position for HAS1 reinforces the recently reported relationship between a small region of human chromosome 19q and proximal mouse chromosome 17. HAS2 mapped outside the predicted critical region delineated for the Langer-Giedion syndrome and can thus be excluded as a candidate gene for this genetic syndrome. 33 refs., 2 figs.

Optimization of ATP synthase function in mitochondria and chloroplasts via the adenylate kinase equilibrium

Directory of Open Access Journals (Sweden)

Abir U Igamberdiev

2015-01-01

Full Text Available The bulk of ATP synthesis in plants is performed by ATP synthase, the main bioenergetics engine of cells, operating both in mitochondria and in chloroplasts. The reaction mechanism of ATP synthase has been studied in detail for over half a century; however, its optimal performance depends also on the steady delivery of ATP synthase substrates and the removal of its products. For mitochondrial ATP synthase, we analyze here the provision of stable conditions for (i the supply of ADP and Mg2+, supported by adenylate kinase (AK equilibrium in the intermembrane space, (ii the supply of phosphate via membrane transporter in symport with H+, and (iii the conditions of outflow of ATP by adenylate transporter carrying out the exchange of free adenylates. We also show that, in chloroplasts, AK equilibrates adenylates and governs Mg2+ contents in the stroma, optimizing ATP synthase and Calvin cycle operation, and affecting the import of inorganic phosphate in exchange with triose phosphates. It is argued that chemiosmosis is not the sole component of ATP synthase performance, which also depends on AK-mediated equilibrium of adenylates and Mg2+, adenylate transport and phosphate release and supply.

Reconstructed ancestral Myo-inositol-3-phosphate synthases indicate that ancestors of the Thermococcales and Thermotoga species were more thermophilic than their descendants.

Science.gov (United States)

Butzin, Nicholas C; Lapierre, Pascal; Green, Anna G; Swithers, Kristen S; Gogarten, J Peter; Noll, Kenneth M

2013-01-01

The bacterial genomes of Thermotoga species show evidence of significant interdomain horizontal gene transfer from the Archaea. Members of this genus acquired many genes from the Thermococcales, which grow at higher temperatures than Thermotoga species. In order to study the functional history of an interdomain horizontally acquired gene we used ancestral sequence reconstruction to examine the thermal characteristics of reconstructed ancestral proteins of the Thermotoga lineage and its archaeal donors. Several ancestral sequence reconstruction methods were used to determine the possible sequences of the ancestral Thermotoga and Archaea myo-inositol-3-phosphate synthase (MIPS). These sequences were predicted to be more thermostable than the extant proteins using an established sequence composition method. We verified these computational predictions by measuring the activities and thermostabilities of purified proteins from the Thermotoga and the Thermococcales species, and eight ancestral reconstructed proteins. We found that the ancestral proteins from both the archaeal donor and the Thermotoga most recent common ancestor recipient were more thermostable than their descendants. We show that there is a correlation between the thermostability of MIPS protein and the optimal growth temperature (OGT) of its host, which suggests that the OGT of the ancestors of these species of Archaea and the Thermotoga grew at higher OGTs than their descendants.

Reconstructed ancestral Myo-inositol-3-phosphate synthases indicate that ancestors of the Thermococcales and Thermotoga species were more thermophilic than their descendants.

Directory of Open Access Journals (Sweden)

Nicholas C Butzin

Full Text Available The bacterial genomes of Thermotoga species show evidence of significant interdomain horizontal gene transfer from the Archaea. Members of this genus acquired many genes from the Thermococcales, which grow at higher temperatures than Thermotoga species. In order to study the functional history of an interdomain horizontally acquired gene we used ancestral sequence reconstruction to examine the thermal characteristics of reconstructed ancestral proteins of the Thermotoga lineage and its archaeal donors. Several ancestral sequence reconstruction methods were used to determine the possible sequences of the ancestral Thermotoga and Archaea myo-inositol-3-phosphate synthase (MIPS. These sequences were predicted to be more thermostable than the extant proteins using an established sequence composition method. We verified these computational predictions by measuring the activities and thermostabilities of purified proteins from the Thermotoga and the Thermococcales species, and eight ancestral reconstructed proteins. We found that the ancestral proteins from both the archaeal donor and the Thermotoga most recent common ancestor recipient were more thermostable than their descendants. We show that there is a correlation between the thermostability of MIPS protein and the optimal growth temperature (OGT of its host, which suggests that the OGT of the ancestors of these species of Archaea and the Thermotoga grew at higher OGTs than their descendants.

The Eucalyptus terpene synthase gene family.

Science.gov (United States)

Külheim, Carsten; Padovan, Amanda; Hefer, Charles; Krause, Sandra T; Köllner, Tobias G; Myburg, Alexander A; Degenhardt, Jörg; Foley, William J

2015-06-11

Terpenoids are abundant in the foliage of Eucalyptus, providing the characteristic smell as well as being valuable economically and influencing ecological interactions. Quantitative and qualitative inter- and intra- specific variation of terpenes is common in eucalypts. The genome sequences of Eucalyptus grandis and E. globulus were mined for terpene synthase genes (TPS) and compared to other plant species. We investigated the relative expression of TPS in seven plant tissues and functionally characterized five TPS genes from E. grandis. Compared to other sequenced plant genomes, Eucalyptus grandis has the largest number of putative functional TPS genes of any sequenced plant. We discovered 113 and 106 putative functional TPS genes in E. grandis and E. globulus, respectively. All but one TPS from E. grandis were expressed in at least one of seven plant tissues examined. Genomic clusters of up to 20 genes were identified. Many TPS are expressed in tissues other than leaves which invites a re-evaluation of the function of terpenes in Eucalyptus. Our data indicate that terpenes in Eucalyptus may play a wider role in biotic and abiotic interactions than previously thought. Tissue specific expression is common and the possibility of stress induction needs further investigation. Phylogenetic comparison of the two investigated Eucalyptus species gives insight about recent evolution of different clades within the TPS gene family. While the majority of TPS genes occur in orthologous pairs some clades show evidence of recent gene duplication, as well as loss of function.

[Optimization on trehalose loading technique as protective conditioning for lyophilization of human platelets].

Science.gov (United States)

Liu, Jing-Han; Zhou, Jun; Ouyang, Xi-Lin; Li, Xi-Jin; Lu, Fa-Qiang

2005-08-01

This study was aimed to further optimize trehalose loading technique including loading temperature, loading time, loading solution and loading concentration of trehalose, based on the established parameters. Loading efficiency in plasma was compared with that in buffer at 37 degrees C; the curves of intracellular trehalose concentration versus loading time at 37 degrees C and 16 degrees C were measured; curves of mean platelet volume (MPV) versus loading time and loading concentration were investigated and compared. According to results obtained, the loaing time, loading temperature, loading solution and trehalose concentration were ascertained for high loading efficiency of trehalose into human platelet. The results showed that the loading efficiency in plasma was markedly higher than that in buffer at 37 degrees C, the loading efficiency in plasma at 37 degrees C was significantly higher than that at 16 degrees C and reached 19.51% after loading for 4 hours, but 6.16% at 16 degrees C. MPV at 16 degrees C was increased by 43.2% than that at 37 degrees C, but had no distinct changes with loading time and loading concentration. In loading at 37 degrees C, MPV increased with loading time and loading concentration positively. Loading time and loading concentration displayed synergetic effect on MPV. MPV increased with loading time and concentration while trehalose loading concentration was above 50 mmol/L. It is concluded that the optimization parameters of trehalose loading technique are 37 degrees C (temperature), 4 hours (leading time), plasma (loading solution), 50 mmol/L (feasible trehalose concentration). The trehalose concentration can be adjusted to meet the requirement of lyophilization.

Structure of dimeric, recombinant Sulfolobus solfataricus phosphoribosyl diphosphate synthase

DEFF Research Database (Denmark)

Andersen, Rune W.; Lo Leggio, Leila; Hove-Jensen, Bjarne

2015-01-01

The enzyme 5-phosphoribosyl-1-α-diphosphate (PRPP) synthase (EC 2.7.6.1) catalyses the Mg2+-dependent transfer of a diphosphoryl group from ATP to the C1 hydroxyl group of ribose 5-phosphate resulting in the production of PRPP and AMP. A nucleotide sequence specifying Sulfolobus solfataricus PRPP...

The Polyketide Components of Waxes and the Cer-cqu Gene Cluster Encoding a Novel Polyketide Synthase, the β-Diketone Synthase, DKS.

Science.gov (United States)

von Wettstein-Knowles, Penny

2017-07-10

The primary function of the outermost, lipophilic layer of plant aerial surfaces, called the cuticle, is preventing non-stomatal water loss. Its exterior surface is often decorated with wax crystals, imparting a blue-grey color. Identification of the barley Cer-c , -q and -u genes forming the 101 kb Cer-cqu gene cluster encoding a novel polyketide synthase-the β-diketone synthase (DKS), a lipase/carboxyl transferase, and a P450 hydroxylase, respectively, establishes a new, major pathway for the synthesis of plant waxes. The major product is a β-diketone (14,16-hentriacontane) aliphatic that forms long, thin crystalline tubes. A pathway branch leads to the formation of esterified alkan-2-ols.

Gene Cloning of Iranian Leishmania major Mannose-1-Phosphate Guanyltransferase

Directory of Open Access Journals (Sweden)

R Salehi

2009-07-01

Full Text Available "nBackground: Leishmania is an obligatory intracellular protozoan parasite, which infects human be­ings when infected sand fly vector takes a blood meal.  Most efforts are towards designing an effective vaccine to prevent leishmaniasis. In this way, development of candidate antigen for vaccine has spe­cial im­portant. In this study, we cloned mannose-1-phosphate guanyltransferase gene of Iranian L .major in pET32a expression vector. "nMethods: Primers based on L. major mannose-1-phosphate guanyltransferase sequence gene was de­signed and synthesized. DNA of Leishmania promastigotes was extracted and PCR reaction was done. PCR product was cloned into pTZ57R and sub cloned into pET32a expression vector. "nResults: Recombinant plasmid containing 1140 bp as L. major mannose-1-phosphate guanyltrans­ferase gene was extracted and confirmed by restriction analysis. PCR product was sequenced and de­posited to GenBank. There were some differences in amino acid sequences between Iranian L. major mannose-1-phosphate guanyltransferase and others previously accepted in GenBank "nConclusion: We amplified and cloned Iranian L. major mannose-1-phosphate guanyltransferase successfully.

Transformation of trehalose synthase gene (TPS Gene) into corn ...

African Journals Online (AJOL)

ARL

2011-11-02

Nov 2, 2011 ... With water resources increasingly diminishing, drought has become the upmost .... six to seven leaf stage, DNA was extracted for molecule detection and the .... condition of drought stress, and their electrolyte leakage rate was ...

Genome mining of the sordarin biosynthetic gene cluster from Sordaria araneosa Cain ATCC 36386: characterization of cycloaraneosene synthase and GDP-6-deoxyaltrose transferase.

Science.gov (United States)

Kudo, Fumitaka; Matsuura, Yasunori; Hayashi, Takaaki; Fukushima, Masayuki; Eguchi, Tadashi

2016-07-01

Sordarin is a glycoside antibiotic with a unique tetracyclic diterpene aglycone structure called sordaricin. To understand its intriguing biosynthetic pathway that may include a Diels-Alder-type [4+2]cycloaddition, genome mining of the gene cluster from the draft genome sequence of the producer strain, Sordaria araneosa Cain ATCC 36386, was carried out. A contiguous 67 kb gene cluster consisting of 20 open reading frames encoding a putative diterpene cyclase, a glycosyltransferase, a type I polyketide synthase, and six cytochrome P450 monooxygenases were identified. In vitro enzymatic analysis of the putative diterpene cyclase SdnA showed that it catalyzes the transformation of geranylgeranyl diphosphate to cycloaraneosene, a known biosynthetic intermediate of sordarin. Furthermore, a putative glycosyltransferase SdnJ was found to catalyze the glycosylation of sordaricin in the presence of GDP-6-deoxy-d-altrose to give 4'-O-demethylsordarin. These results suggest that the identified sdn gene cluster is responsible for the biosynthesis of sordarin. Based on the isolated potential biosynthetic intermediates and bioinformatics analysis, a plausible biosynthetic pathway for sordarin is proposed.

Isolation and expression of the Pneumocystis carinii thymidylate synthase gene

DEFF Research Database (Denmark)

Edman, U; Edman, J C; Lundgren, B

1989-01-01

The thymidylate synthase (TS) gene from Pneumocystis carinii has been isolated from complementary and genomic DNA libraries and expressed in Escherichia coli. The coding sequence of TS is 891 nucleotides, encoding a 297-amino acid protein of Mr 34,269. The deduced amino acid sequence is similar...

Optimization of fermentation conditions for trehalose production by a ...

African Journals Online (AJOL)

user

2012-02-16

Feb 16, 2012 ... The culture conditions for the production of trehalose by Rhodotorula sp. strain were optimized. The optimum ... INTRODUCTION. Trehalose is a ..... Water interplay in trehalose ... In: Prescott DM (Ed.), Methods in Cell Biology.

Silencing of the pentose phosphate pathway genes influences DNA replication in human fibroblasts.

Science.gov (United States)

Fornalewicz, Karolina; Wieczorek, Aneta; Węgrzyn, Grzegorz; Łyżeń, Robert

2017-11-30

Previous reports and our recently published data indicated that some enzymes of glycolysis and the tricarboxylic acid cycle can affect the genome replication process by changing either the efficiency or timing of DNA synthesis in human normal cells. Both these pathways are connected with the pentose phosphate pathway (PPP pathway). The PPP pathway supports cell growth by generating energy and precursors for nucleotides and amino acids. Therefore, we asked if silencing of genes coding for enzymes involved in the pentose phosphate pathway may also affect the control of DNA replication in human fibroblasts. Particular genes coding for PPP pathway enzymes were partially silenced with specific siRNAs. Such cells remained viable. We found that silencing of the H6PD, PRPS1, RPE genes caused less efficient enterance to the S phase and decrease in efficiency of DNA synthesis. On the other hand, in cells treated with siRNA against G6PD, RBKS and TALDO genes, the fraction of cells entering the S phase was increased. However, only in the case of G6PD and TALDO, the ratio of BrdU incorporation to DNA was significantly changed. The presented results together with our previously published studies illustrate the complexity of the influence of genes coding for central carbon metabolism on the control of DNA replication in human fibroblasts, and indicate which of them are especially important in this process. Copyright © 2017 Elsevier B.V. All rights reserved.

Water structure around trehalose

Energy Technology Data Exchange (ETDEWEB)

Pagnotta, S.E. [Dipartimento di Fisica ' E. Amaldi' , Universita di Roma Tre, Via della Vasca Navale 84, 00146 Roma (Italy); CNISM-CNR, Unita di Roma Tre, Via della Vasca Navale 84, 00146 Roma (Italy)], E-mail: pagnotta@fis.uniroma3.it; Ricci, M.A.; Bruni, F. [Dipartimento di Fisica ' E. Amaldi' , Universita di Roma Tre, Via della Vasca Navale 84, 00146 Roma (Italy); McLain, S. [ISIS Facility, Rutherford Appleton Laboratories, Chilton, Didcot, Oxon OX11 0QX (United Kingdom); Magazu, S. [Dipartimento di Fisica, Universita di Messina, C. da Papardo 31, 98166 Messina (Italy)

2008-04-18

A diluted solution of trehalose in water has been investigated by means of neutron diffraction with isotopic H/D substitution of the water hydrogens. Data have been analyzed in terms of site-site radial distribution functions, via the EPSR simulation code. This is the first time that the capabilities of this data refinement method are tested against neutron diffraction data of a complex carbohydrate molecule. A small perturbation of water hydration shell and short hydrogen bonds between trehalose oxygens and water hydrogens has been evidenced.

Trehalose preincubation increases mesenchymal (CD271+ stem cells post-cryopreservation viability

Directory of Open Access Journals (Sweden)

Indra Kusuma

2016-10-01

Full Text Available Background: Dimethyl sulfoxide (Me2SO is a common cryoprotective agent widely used in cell preservation system. Me2SO is currently known to cause epigenetic changes which are  critical in stem cells development and cellular differentiation. Therefore, it is imperative to develop cryopreservation techniques that protect cellular functions and avert Me2SO adverse effect. Trehalose was able to protect organism in extreme condition such as dehydration and cold. This study aimed to verify the protective effect of trehalose preincubation procedure in cryopreservation.Methods: The study was conducted using experimental design. Thawed mesenchymal (CD271+ stem cells from YARSI biorepository were used for the experiment. Trehalose preincubation was performed for 1 hour, internalized trehalose was confirmed by FTIR-ATR measurement. Three groups consisted of (1 cryopreserved without trehalose preincubation, (2 cryopreserved with trehalose preincubation, and (3 did not undergo cryopreservation were evaluated after 24 hours in LN2 for viability in culture. The absorbance from each group was measured at 450 nm. The analysis performed using paired student t test.Results: Viability of thawed mesenchymal (CD271+ stem cells that undergo trehalose preincubation prior cryopreservation was significantly higher (p<0.05 compared to group without trehalose preincubation. Higher viability observed between group with trehalose preincubation compared with controlled group suggests protection to trypsinization. Mesenchymal (CD271+ stem cells incubated for 1 hour in 100 mM trehalose supplemented medium  results in 15%  trehalose loading efficiency.Conclusion: These findings confirm the protective effect of trehalose preincubation in cryopreservation. Future research should be directed to elucidate the trehalose internalization mechanism and eventually the protective mechanism of trehalose in mammalian cell cryopreservation.

Optimization of trehalose production by a novel strain Brevibacterium sp. SY361.

Science.gov (United States)

Wang, Lei; Huang, Rui; Gu, Guanbin; Fang, Hongying

2008-10-01

Trehalose production by a novel strain of Brevibacterium sp. SY361 was optimized in submerged fermentation. Different chemical and physical parameters such as carbon and nitrogen sources, inoculum level, initial pH, incubation temperature, aeration and time-course of fermentation, were studied in order to increase trehalose productivity. An optimal production medium containing 3% (w/v) glucose, 0.9% (v/v) corn steep liquor, 0.5% (w/v) KH(2)PO(4) and 0.4% (w/v) MgSO(4).7 H(2)O was found suitable for trehalose production. An optimal volume of medium in a 500 ml flask was 80 ml. The optimal levels of other parameters were 4.0% (v/v) of inoculum, initial pH of 6.0, incubation temperature of 28-32 degrees C and time-course of 60 h. Optimized parameters gave a maximum trehalose of 12.2 mg/ml with a conversion rate of 58.4%. (c) 2008 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Gene structure, phylogeny and expression profile of the sucrose synthase gene family in cacao (Theobroma cacao L.).

Science.gov (United States)

Li, Fupeng; Hao, Chaoyun; Yan, Lin; Wu, Baoduo; Qin, Xiaowei; Lai, Jianxiong; Song, Yinghui

2015-09-01

In higher plants, sucrose synthase (Sus, EC 2.4.1.13) is widely considered as a key enzyme involved in sucrose metabolism. Although, several paralogous genes encoding different isozymes of Sus have been identified and characterized in multiple plant genomes, to date detailed information about the Sus genes is lacking for cacao. This study reports the identification of six novel Sus genes from economically important cacao tree. Analyses of the gene structure and phylogeny of the Sus genes demonstrated evolutionary conservation in the Sus family across cacao and other plant species. The expression of cacao Sus genes was investigated via real-time PCR in various tissues, different developmental phases of leaf, flower bud and pod. The Sus genes exhibited distinct but partially redundant expression profiles in cacao, with TcSus1, TcSus5 and TcSus6, being the predominant genes in the bark with phloem, TcSus2 predominantly expressing in the seed during the stereotype stage. TcSus3 and TcSus4 were significantly detected more in the pod husk and seed coat along the pod development, and showed development dependent expression profiles in the cacao pod. These results provide new insights into the evolution, and basic information that will assist in elucidating the functions of cacao Sus gene family.

ROS and trehalose regulate sclerotial development in Rhizoctonia solani AG-1 IA.

Science.gov (United States)

Wang, Chenjiaozi; Pi, Lei; Jiang, Shaofeng; Yang, Mei; Shu, Canwei; Zhou, Erxun

2018-05-01

Rhizoctonia solani AG-1 IA is the causal agent of rice sheath blight (RSB) and causes severe economic losses in rice-growing regions around the world. The sclerotia play an important role in the disease cycle of RSB. In this study, we report the effects of reactive oxygen species (ROS) and trehalose on the sclerotial development of R. solani AG-1 IA. Correlation was found between the level of ROS in R. solani AG-1 IA and sclerotial development. Moreover, we have shown the change of ROS-related enzymatic activities and oxidative burst occurs at the sclerotial initial stage. Six genes related to the ROS scavenging system were quantified in different sclerotial development stages by using quantitative RT-PCR technique, thereby confirming differential gene expression. Fluorescence microscopy analysis of ROS content in mycelia revealed that ROS were predominantly produced at the hyphal branches during the sclerotial initial stage. Furthermore, exogenous trehalose had a significant inhibitory effect on the activities of ROS-related enzymes and oxidative burst and led to a reduction in sclerotial dry weight. Taken together, the findings suggest that ROS has a promoting effect on the development of sclerotia, whereas trehalose serves as an inhibiting factor to sclerotial development in R. solani AG-1 IA. Copyright © 2018 British Mycological Society. Published by Elsevier Ltd. All rights reserved.

Pedigree analysis of glucose-6 phosphate dehydrogenase (G6PD deficiency of a Javanese Chinese family in Indonesia

Directory of Open Access Journals (Sweden)

IDG Ugrasena

2017-02-01

Full Text Available The molecular and pedigree analyses in a Javanese Chinese family were carried oul on glucose-6-phosphate dehydrogenase deficiencies. By method of  MPTP scanning without the sequencing steps, those variants could be confirmed. Two out of three sons were clinically jaundiced at birth due to G6PD deficiency and identified to have a G to T nucleotide change al 1376th nucleotide 01 the G6PD gene (GI376T, corresponding to G6PD Canton. Another son was also identified to have a C to T nucleotide change at 1311st nucleotide 01 the G6PD gene (CI311T, corresponding to a Silent mutation. Their father was normal, but their mother obsorved to have the heleromutation 01 G1376T (G6PD Canton and C1311T (a Silent mutation.

Osmotic stress induced by sodium chloride, sucrose or trehalose improves cryotolerance and developmental competence of porcine oocytes

DEFF Research Database (Denmark)

Lin, Lin; Kragh, Peter Michael; Purup, Stig

2009-01-01

Cl with those of concentrated solutions of two non-permeable osmotic agents, namely sucrose and trehalose, on the cryotolerance and developmental competence of porcine oocytes. In Experiment 1, porcine in vitro-matured cumulus-oocyte complexes (COCs; n = 1200) were exposed to 588 mOsmol NaCl, sucrose...... or trehalose solutions for 1 h, allowed to recover for a further 1 h, vitrified, warmed and subjected to parthenogenetic activation. Both Day 2 (where Day 0 is the day of activation) cleavage and Day 7 blastocyst rates were significantly increased after NaCl, sucrose and trehalose osmotic treatments compared...... with untreated controls (cleavage: 46 ± 5%, 44 ± 7%, 45 ± 4% and 26 ± 6%, respectively; expanded blastocyst rate: 6 ± 1%, 6 ± 2%, 7 ± 2% and 1 ± 1%, respectively). In Experiment 2, COCs (n = 2000) were treated with 588 mOsmol NaCl, sucrose or trehalose, then used as recipients for SCNT (Day 0). Cleavage rates...

The cryoprotective effect of trehalose supplementation on boar spermatozoa quality.

Science.gov (United States)

Hu, Jian-Hong; Li, Qing-Wang; Li, Gang; Jiang, Zhong-Liang; Bu, Shu-hai; Yang, Hai; Wang, Li-Qiang

2009-05-01

In order to improve boar sperm quality during frozen-thawed process, the influence of the presence of trehalose on success of cryopreservation of boar sperm were investigated. We evaluated freeze-thawing tolerance of boar spermatozoa in a base cooling extender with the addition of different trehalose concentrations (0, 25, 50, 100 and 200mmol/l), and tried to determine the optimum concentration of trehalose. We chose sperm motility, acrosome integrity, membrane integrity and cryocapacitation as parameters to evaluate cryopreservation capacity of boar spermatozoa. We obtained the best results for 100mmol/l trehalose-supplemented extenders, with values of 49.89% for motility, 66.52% for acrosome integrity and 44.61% for membrane integrity, while freeze-thawing tolerance was diminished significantly for 200mmol/l of trehalose. Before and after capacitation, the CTC score for semen diluted by extender containing 100mmol/l trehalose was 3.68% and 43.82%, respectively. In conclusion, trehalose could confer a greater cryoprotective capacity to boar spermatozoa. Trehalose-supplementation with 100mmol/l concentration in basic extender could significantly improve sperm motility, membrane integrity and acrosome integrity parameters, and reduce boar spermatozoa cryocapacitation during the cryopreservation process.

Trehalose protects against ocular surface disorders in experimental murine dry eye through suppression of apoptosis.

Science.gov (United States)

Chen, Wei; Zhang, Xiaobo; Liu, Mimi; Zhang, Jingna; Ye, Ya; Lin, Ying; Luyckx, Jacques; Qu, Jia

2009-09-01

The disaccharide trehalose is a key element involved in anhydrobiosis (the capability of surviving almost complete dehydration) in many organisms. Its presence also confers resistance to desiccation and high osmolarity in bacterial and human cells by protecting proteins and membranes from denaturation. The present study used a novel murine dry eye model induced by controlled low-humidity air velocity to determine whether topically applied trehalose could heal ocular surface epithelial disorders caused by ocular surface desiccation. In addition, the efficacy of 87.6 mM trehalose eyedrops was compared with that of 20% serum, the efficacy of which has been well documented. Mice ocular surface epithelial disorders were induced by exposure of murine eyes to continuous controlled low-humidity air velocity in an intelligently controlled environmental system (ICES) for 21 days, which accelerated the tear evaporation. The mice were then randomized into three groups: the control group received PBS (0.01 M) treatment; a second group received 87.6 mM trehalose eyedrops treatment; and the third group received mice serum eyedrops treatment. Each treatment was administered as a 10 microl dose every 6 h for 14 days. The resultant changes in corneal barrier function and histopathologic examination of cornea and conjunctiva were analyzed and the level of apoptosis on the ocular surface was assessed using active caspase-3. After 14 days of treatment, the corneal fluorescein staining area, the ruffling and desquamating cells on the apical corneal epithelium, as well as the apoptotic cells on ocular surface epithelium had significantly reduced in eyes treated with trehalose compared with those treated with serum and PBS. In contrast, after 14 days of treatment, improvements in the thickness of the corneal epithelium, the squamous metaplasia in conjunctival epithelium and the number of goblet cells of the conjunctiva were less marked in eyes treated with trehalose compared with serum

Association of Endothelial Nitric Oxide Synthase Gene Polymorphisms With Acute Rejection in Liver Transplant Recipients.

Science.gov (United States)

Azarpira, Negar; Namazi, Soha; Malahi, Sayan; Kazemi, Kourosh

2016-06-01

Polymorphisms of the endothelial nitric oxide synthase gene have been associated with altered endothelial nitric oxide synthase activity. The purpose of this study was to investigate the relation between endothelial nitric oxide synthase -786T/C and 894G/T polymorphism and their haplotypes on the occurrence of acute rejection episodes in liver transplant recipients. We conducted a case control study in which 100 liver transplant recipients and 100 healthy controls were recruited from Shiraz Transplant Center. The patients used triple therapy including tacrolimus, mycophenolate mofetil, and prednisolone for immunosuppression maintenance. DNA was extracted from peripheral blood and endothelial nitric oxide synthase polymorphisms were determined by polymerase chain reaction and restriction fragment length polymorphism. Patients included 60 men and 40 women (mean age, 32.35 ± 10.2 y). There was a significant association of endothelial nitric oxide synthase 894G/T and acute rejection episode. The GT* gen-otype and acute rejection episodes had a significant association (odds ratio, 2.42; 95% confidence interval, 0.97-6.15; P = .03). The GG and GT* genotype and T* allele frequency were significantly different between patients and control subjects (P = .001). Haplotype TT* was higher in recipients than control subjects (odds ratio, 2.17; 95% confidence interval, 1.12-4.25; P = .01). Haplotype TG was higher in the control group (odds ratio, 0.62; 95% confidence interval, 0.40-0.96; P = .02). Our results suggest a relation between different endothelial nitric oxide synthase geno-types and risk of acute rejection episodes. However, further study is necessary to determine genetic susceptibility for transplant patients.

Artificial Citrate Operon Confers Mineral Phosphate Solubilization Ability to Diverse Fluorescent Pseudomonads

Science.gov (United States)

Adhikary, Hemanta; Sanghavi, Paulomi B.; Macwan, Silviya R.; Archana, Gattupalli; Naresh Kumar, G.

2014-01-01

Citric acid is a strong acid with good cation chelating ability and can be very efficient in solubilizing mineral phosphates. Only a few phosphate solubilizing bacteria and fungi are known to secrete citric acids. In this work, we incorporated artificial citrate operon containing NADH insensitive citrate synthase (gltA1) and citrate transporter (citC) genes into the genome of six-plant growth promoting P. fluorescens strains viz., PfO-1, Pf5, CHAO1, P109, ATCC13525 and Fp315 using MiniTn7 transposon gene delivery system. Comprehensive biochemical characterization of the genomic integrants and their comparison with plasmid transformants of the same operon in M9 minimal medium reveals the highest amount of ∼7.6±0.41 mM citric and 29.95±2.8 mM gluconic acid secretion along with ∼43.2±3.24 mM intracellular citrate without affecting the growth of these P. fluorescens strains. All genomic integrants showed enhanced citric and gluconic acid secretion on Tris-Cl rock phosphate (TRP) buffered medium, which was sufficient to release 200–1000 µM Pi in TRP medium. This study demonstrates that MPS ability could be achieved in natural fluorescent pseudomonads by incorporation of artificial citrate operon not only as plasmid but also by genomic integration. PMID:25259527

Plasmid linkage of the D-tagatose 6-phosphate pathway in Streptococcus lactis: effect on lactose and galactose metabolism.

Science.gov (United States)

Crow, V L; Davey, G P; Pearce, L E; Thomas, T D

1983-01-01

The three enzymes of the D-tagatose 6-phosphate pathway (galactose 6-phosphate isomerase, D-tagatose 6-phosphate kinase, and tagatose 1,6-diphosphate aldolase) were absent in lactose-negative (Lac-) derivatives of Streptococcus lactis C10, H1, and 133 grown on galactose. The lactose phosphoenolpyruvate-dependent phosphotransferase system and phospho-beta-galactosidase activities were also absent in Lac- derivatives of strains H1 and 133 and were low (possibly absent) in C10 Lac-. In all three Lac- derivatives, low galactose phosphotransferase system activity was found. On galactose, Lac- derivatives grew more slowly (presumably using the Leloir pathway) than the wild-type strains and accumulated high intracellular concentrations of galactose 6-phosphate (up to 49 mM); no intracellular tagatose 1,6-diphosphate was detected. The data suggest that the Lac phenotype is plasmid linked in the three strains studied, with the evidence being more substantial for strain H1. A Lac- derivative of H1 contained a single plasmid (33 megadaltons) which was absent from the Lac- mutant. We suggest that the genes linked to the lactose plasmid in S. lactis are more numerous than previously envisaged, coding for all of the enzymes involved in lactose metabolism from initial transport to the formation of triose phosphates via the D-tagatose 6-phosphate pathway. Images PMID:6294064

Structure of human farnesyl pyrophosphate synthase in complex with an aminopyridine bisphosphonate and two molecules of inorganic phosphate

Energy Technology Data Exchange (ETDEWEB)

Park, Jaeok [McGill University, 3655 Promenade Sir William Osler, Montreal, QC H3G 1Y6 (Canada); Lin, Yih-Shyan [McGill University, 801 Rue Sherbrooke Ouest, Montreal, QC H3A 0B8 (Canada); Tsantrizos, Youla S. [McGill University, 3655 Promenade Sir William Osler, Montreal, QC H3G 1Y6 (Canada); McGill University, 801 Rue Sherbrooke Ouest, Montreal, QC H3A 0B8 (Canada); McGill University, 3649 Promenade Sir William Osler, Montreal, QC H3G 0B1 (Canada); Berghuis, Albert M., E-mail: albert.berghuis@mcgill.ca [McGill University, 3655 Promenade Sir William Osler, Montreal, QC H3G 1Y6 (Canada); McGill University, 3649 Promenade Sir William Osler, Montreal, QC H3G 0B1 (Canada); McGill University, 3775 Rue University, Montreal, QC H3A 2B4 (Canada)

2014-02-19

A co-crystal structure of human farnesyl pyrophosphate synthase in complex with an aminopyridine bisphosphonate, YS0470, and two molecules of inorganic phosphate has been determined. The identity of the phosphate ligands was confirmed by anomalous diffraction data. Human farnesyl pyrophosphate synthase (hFPPS) produces farnesyl pyrophos@@phate, an isoprenoid essential for a variety of cellular processes. The enzyme has been well established as the molecular target of the nitrogen-containing bisphosphonates (N-BPs), which are best known for their antiresorptive effects in bone but are also known for their anticancer properties. Crystal structures of hFPPS in ternary complexes with a novel bisphosphonate, YS0470, and the secondary ligands inorganic phosphate (P{sub i}), inorganic pyrophosphate (PP{sub i}) and isopentenyl pyrophosphate (IPP) have recently been reported. Only the co-binding of the bisphosphonate with either PP{sub i} or IPP resulted in the full closure of the C-@@terminal tail of the enzyme, a conformational change that is required for catalysis and that is also responsible for the potent in vivo efficacy of N-BPs. In the present communication, a co-crystal structure of hFPPS in complex with YS0470 and two molecules of P{sub i} is reported. The unusually close proximity between these ligands, which was confirmed by anomalous diffraction data, suggests that they interact with one another, with their anionic charges neutralized in their bound state. The structure also showed the tail of the enzyme to be fully disordered, indicating that simultaneous binding of two P{sub i} molecules with a bisphosphonate cannot induce the tail-closing conformational change in hFPPS. Examination of homologous FPPSs suggested that this ligand-dependent tail closure is only conserved in the mammalian proteins. The prevalence of P{sub i}-bound hFPPS structures in the PDB raises a question regarding the in vivo relevance of P{sub i} binding to the function of the enzyme.

Platelet-derived growth factor (PDGF) stimulates glycogen synthase activity in 3T3 cells

International Nuclear Information System (INIS)

Chan, C.P.; Bowen-Pope, D.F.; Ross, R.; Krebs, E.G.

1986-01-01

Hormonal regulation of glycogen synthase, an enzyme that can be phosphorylated on multiple sites, is often associated with changes in its phosphorylation state. Enzyme activation is conventionally monitored by determining the synthase activity ratio [(activity in the absence of glucose 6-P)/(activity in the presence of glucose 6-P)]. Insulin causes an activation of glycogen synthase with a concomitant decrease in its phosphate content. In a previous report, the authors showed that epidermal growth factor (EGF) increases the glycogen synthase activity ratio in Swiss 3T3 cells. The time and dose-dependency of this response was similar to that of insulin. Their recent results indicate that PDGF also stimulates glycogen synthase activity. Enzyme activation was maximal after 30 min. of incubation with PDGF; the time course observed was very similar to that with insulin and EGF. At 1 ng/ml (0.03nM), PDGF caused a maximal stimulation of 4-fold in synthase activity ratio. Half-maximal stimulation was observed at 0.2 ng/ml (6 pM). The time course of changes in enzyme activity ratio closely followed that of 125 I-PDGF binding. The authors data suggest that PDGF, as well as EFG and insulin, may be important in regulating glycogen synthesis through phosphorylation/dephosphorylation mechanisms

Trehalose lipid biosurfactants produced by the actinomycetes Tsukamurella spumae and T. pseudospumae.

Science.gov (United States)

Kügler, Johannes H; Muhle-Goll, Claudia; Kühl, Boris; Kraft, Axel; Heinzler, Raphael; Kirschhöfer, Frank; Henkel, Marius; Wray, Victor; Luy, Burkhard; Brenner-Weiss, Gerald; Lang, Siegmund; Syldatk, Christoph; Hausmann, Rudolf

2014-11-01

Actinomycetales are known to produce various secondary metabolites including products with surface-active and emulsifying properties known as biosurfactants. In this study, the nonpathogenic actinomycetes Tsukamurella spumae and Tsukamurella pseudospumae are described as producers of extracellular trehalose lipid biosurfactants when grown on sunflower oil or its main component glyceryltrioleate. Crude extracts of the trehalose lipids were purified using silica gel chromatography. The structure of the two trehalose lipid components (TL A and TL B) was elucidated using a combination of matrix-assisted laser desorption/ionization time-of-flight/time-of-flight/tandem mass spectroscopy (MALDI-ToF-ToF/MS/MS) and multidimensional NMR experiments. The biosurfactants were identified as 1-α-glucopyranosyl-1-α-glucopyranosid carrying two acyl chains varying of C4 to C6 and C16 to C18 at the 2' and 3' carbon atom of one sugar unit. The trehalose lipids produced demonstrate surface-active behavior and emulsifying capacity. Classified as risk group 1 organisms, T. spumae and T. pseudospumae hold potential for the production of environmentally friendly surfactants.

Dissecting Tissue-Specific Transcriptomic Responses from Leaf and Roots under Salt Stress in Petunia hybrida Mitchell

Science.gov (United States)

Villarino, Gonzalo H.; Hu, Qiwen; Scanlon, Michael J.; Mueller, Lukas; Mattson, Neil S.

2017-01-01

One of the primary objectives of plant biotechnology is to increase resistance to abiotic stresses, such as salinity. Salinity is a major abiotic stress and increasing crop resistant to salt continues to the present day as a major challenge. Salt stress disturbs cellular environment leading to protein misfolding, affecting normal plant growth and causing agricultural losses worldwide. The advent of state-of-the-art technologies such as high throughput mRNA sequencing (RNA-seq) has revolutionized whole-transcriptome analysis by allowing, with high precision, to measure changes in gene expression. In this work, we used tissue-specific RNA-seq to gain insight into the Petunia hybrida transcriptional responses under NaCl stress using a controlled hydroponic system. Roots and leaves samples were taken from a continuum of 48 h of acute 150 mM NaCl. This analysis revealed a set of tissue and time point specific differentially expressed genes, such as genes related to transport, signal transduction, ion homeostasis as well as novel and undescribed genes, such as Peaxi162Scf00003g04130 and Peaxi162Scf00589g00323 expressed only in roots under salt stress. In this work, we identified early and late expressed genes in response to salt stress while providing a core of differentially express genes across all time points and tissues, including the trehalose-6-phosphate synthase 1 (TPS1), a glycosyltransferase reported in salt tolerance in other species. To test the function of the novel petunia TPS1 allele, we cloned and showed that TPS1 is a functional plant gene capable of complementing the trehalose biosynthesis pathway in a yeast tps1 mutant. The list of candidate genes to enhance salt tolerance provided in this work constitutes a major effort to better understand the detrimental effects of salinity in petunia with direct implications for other economically important Solanaceous species. PMID:28771200

Dissecting Tissue-Specific Transcriptomic Responses from Leaf and Roots under Salt Stress in Petunia hybrida Mitchell

Directory of Open Access Journals (Sweden)

Gonzalo H. Villarino

2017-08-01

Full Text Available One of the primary objectives of plant biotechnology is to increase resistance to abiotic stresses, such as salinity. Salinity is a major abiotic stress and increasing crop resistant to salt continues to the present day as a major challenge. Salt stress disturbs cellular environment leading to protein misfolding, affecting normal plant growth and causing agricultural losses worldwide. The advent of state-of-the-art technologies such as high throughput mRNA sequencing (RNA-seq has revolutionized whole-transcriptome analysis by allowing, with high precision, to measure changes in gene expression. In this work, we used tissue-specific RNA-seq to gain insight into the Petunia hybrida transcriptional responses under NaCl stress using a controlled hydroponic system. Roots and leaves samples were taken from a continuum of 48 h of acute 150 mM NaCl. This analysis revealed a set of tissue and time point specific differentially expressed genes, such as genes related to transport, signal transduction, ion homeostasis as well as novel and undescribed genes, such as Peaxi162Scf00003g04130 and Peaxi162Scf00589g00323 expressed only in roots under salt stress. In this work, we identified early and late expressed genes in response to salt stress while providing a core of differentially express genes across all time points and tissues, including the trehalose-6-phosphate synthase 1 (TPS1, a glycosyltransferase reported in salt tolerance in other species. To test the function of the novel petunia TPS1 allele, we cloned and showed that TPS1 is a functional plant gene capable of complementing the trehalose biosynthesis pathway in a yeast tps1 mutant. The list of candidate genes to enhance salt tolerance provided in this work constitutes a major effort to better understand the detrimental effects of salinity in petunia with direct implications for other economically important Solanaceous species.

Synergistic Effect of Trehalose and Saccharose Pretreatment on ...

African Journals Online (AJOL)

maintenance of lyophilized human red blood cell (RBC) quality. Methods: RBCs were pre-treated with trehalose and saccharose, and then lyophilized and .... different concentrations of trehalose and saccharose as described above.

Glucose-6-phosphate mediates activation of the carbohydrate responsive binding protein (ChREBP)

International Nuclear Information System (INIS)

Li, Ming V.; Chen, Weiqin; Harmancey, Romain N.; Nuotio-Antar, Alli M.; Imamura, Minako; Saha, Pradip; Taegtmeyer, Heinrich; Chan, Lawrence

2010-01-01

Carbohydrate response element binding protein (ChREBP) is a Mondo family transcription factor that activates a number of glycolytic and lipogenic genes in response to glucose stimulation. We have previously reported that high glucose can activate the transcriptional activity of ChREBP independent of the protein phosphatase 2A (PP2A)-mediated increase in nuclear entry and DNA binding. Here, we found that formation of glucose-6-phosphate (G-6-P) is essential for glucose activation of ChREBP. The glucose response of GAL4-ChREBP is attenuated by D-mannoheptulose, a potent hexokinase inhibitor, as well as over-expression of glucose-6-phosphatase (G6Pase); kinetics of activation of GAL4-ChREBP can be modified by exogenously expressed GCK. Further metabolism of G-6-P through the two major glucose metabolic pathways, glycolysis and pentose-phosphate pathway, is not required for activation of ChREBP; over-expression of glucose-6-phosphate dehydrogenase (G6PD) diminishes, whereas RNAi knockdown of the enzyme enhances, the glucose response of GAL4-ChREBP, respectively. Moreover, the glucose analogue 2-deoxyglucose (2-DG), which is phosphorylated by hexokinase, but not further metabolized, effectively upregulates the transcription activity of ChREBP. In addition, over-expression of phosphofructokinase (PFK) 1 and 2, synergistically diminishes the glucose response of GAL4-ChREBP. These multiple lines of evidence support the conclusion that G-6-P mediates the activation of ChREBP.

Functional analyses of cellulose synthase genes in flax (Linum usitatissimum) by virus-induced gene silencing.

Science.gov (United States)

Chantreau, Maxime; Chabbert, Brigitte; Billiard, Sylvain; Hawkins, Simon; Neutelings, Godfrey

2015-12-01

Flax (Linum usitatissimum) bast fibres are located in the stem cortex where they play an important role in mechanical support. They contain high amounts of cellulose and so are used for linen textiles and in the composite industry. In this study, we screened the annotated flax genome and identified 14 distinct cellulose synthase (CESA) genes using orthologous sequences previously identified. Transcriptomics of 'primary cell wall' and 'secondary cell wall' flax CESA genes showed that some were preferentially expressed in different organs and stem tissues providing clues as to their biological role(s) in planta. The development for the first time in flax of a virus-induced gene silencing (VIGS) approach was used to functionally evaluate the biological role of different CESA genes in stem tissues. Quantification of transcript accumulation showed that in many cases, silencing not only affected targeted CESA clades, but also had an impact on other CESA genes. Whatever the targeted clade, inactivation by VIGS affected plant growth. In contrast, only clade 1- and clade 6-targeted plants showed modifications in outer-stem tissue organization and secondary cell wall formation. In these plants, bast fibre number and structure were severely impacted, suggesting that the targeted genes may play an important role in the establishment of the fibre cell wall. Our results provide new fundamental information about cellulose biosynthesis in flax that should facilitate future plant improvement/engineering. © 2015 Society for Experimental Biology, Association of Applied Biologists and John Wiley & Sons Ltd.

Multi-substrate terpene synthases: their occurrence and physiological significance

Directory of Open Access Journals (Sweden)

Leila Pazouki

2016-07-01

Full Text Available Terpene synthases are responsible for synthesis of a large number of terpenes in plants using substrates provided by two distinct metabolic pathways, the mevalonate-dependent pathway that is located in cytosol and has been suggested to be responsible for synthesis of sesquiterpenes (C15, and 2-C-methyl-D-erythritol-4-phosphate pathway located in plastids and suggested to be responsible for the synthesis of hemi- (C5, mono- (C10 and diterpenes (C20. Recent advances in characterization of genes and enzymes responsible for substrate and end product biosynthesis as well as efforts in metabolic engineering have demonstrated existence of a number of multi-substrate terpene synthases. This review summarizes the progress in the characterization of such multi-substrate terpene synthases and suggests that the presence of multi-substrate use might have been significantly underestimated. Multi-substrate use could lead to important changes in terpene product profiles upon substrate profile changes under perturbation of metabolism in stressed plants as well as under certain developmental stages. We therefore argue that multi-substrate use can be significant under physiological conditions and can result in complicate modifications in terpene profiles.

Concomitant changes in radiation resistance and trehalose levels during life stages of Drosophila melanogaster suggest radio-protective function of trehalose.

Science.gov (United States)

Paithankar, Jagdish Gopal; Raghu, Shamprasad Varija; Patil, Rajashekhar K

2018-04-20

During development, various life stages of Drosophila melanogaster (D. melanogaster) show different levels of resistance to gamma irradiation, with the early pupal stage being the most radiation sensitive. This provides us an opportunity to explore the biochemical basis of such variations. The present study was carried out to understand the mechanisms underlying radiation resistance during life stages of D. melanogaster. Homogenates from all the life stages of D. melanogaster were prepared at stipulated age. These homogenates were used for the determination of (1) enzymatic antioxidants: superoxide dismutase (SOD), catalase, D. melanogaster glutathione peroxidase (DmGPx), and glutathione S-transferase (GST); (2) reducing non-enzymatic antioxidants: total antioxidant capacity (TAC), reduced glutathione (GSH) and non-reducing non-enzymatic antioxidant trehalose; and (3) levels of protein carbonyl (PC) content. Age-dependent changes in radiation resistance and associated biochemical changes were also studied in young (2 d) and old (20 and 30 d) flies. TAC and GSH were found high in the early pupal stage, whereas catalase and DmGPx were found to increase in the early pupal stage. The non-feeding third instar (NFTI) larvae were found to have high levels of SOD and GST, besides NFTI larvae showed high levels of trehalose. A remarkable decrease was observed in radiation resistance and trehalose levels during the early pupal stage. The PC level was the highest during early pupal stage and was the lowest in NFTI larvae. Older flies showed high level of PC compared with young flies. In vitro increments in trehalose concentration correspond to reduced formation of PCs, suggesting a protective role of trehalose against free radicals. A strong correlation between levels of trehalose and PC formation suggests amelioration of proteome damage due to ionizing radiation (IR). Stages with high trehalose levels showed protected proteome and high radiation resistance, suggesting a

Preservation of carbon dioxide clathrate hydrate in the presence of trehalose under freezer conditions.

Science.gov (United States)

Nagashima, Hironori D; Takeya, Satoshi; Uchida, Tsutomu; Ohmura, Ryo

2016-01-19

To investigate the preservation of CO2 clathrate hydrate in the presence of sugar for the novel frozen dessert, mass fractions of CO2 clathrate hydrate in CO2 clathrate hydrate samples coexisting with trehalose were intermittently measured. The samples were prepared from trehalose aqueous solution with trehalose mass fractions of 0.05 and 0.10 at 3.0 MPa and 276.2 K. The samples having particle sizes of 1.0 mm and 5.6-8.0 mm were stored at 243.2 K and 253.2 K for three weeks under atmospheric pressure. The mass fractions of CO2 clathrate hydrate in the samples were 0.87-0.97 before the preservation, and CO2 clathrate hydrate still remained 0.56-0.76 in the mass fractions for 5.6-8.0 mm samples and 0.37-0.55 for 1.0 mm samples after the preservation. The preservation in the trehalose system was better than in the sucrose system and comparable to that in the pure CO2 clathrate hydrate system. This comparison indicates that trehalose is a more suitable sugar for the novel frozen carbonated dessert using CO2 clathrate hydrate than sucrose in terms of CO2 concentration in the dessert. It is inferred that existence of aqueous solution in the samples is a significant factor of the preservation of CO2 clathrate hydrate in the presence of sugar.

Identifying the catalytic components of cellulose synthase and the maize mixed-linkage beta-glucan synthase

Energy Technology Data Exchange (ETDEWEB)

Nicholas C Carpita

2009-04-20

Five specific objectives of this project are to develop strategies to identify the genes that encode the catalytic components of "mixed-linkage" (1→3),(1→4)-beta-D-glucans in grasses, to determine the protein components of the synthase complex, and determine the biochemical mechanism of synthesis. We have used proteomic approaches to define intrinsic and extrinsic polypeptides of Golgi membranes that are associated with polysaccharide synthesis and trafficking. We were successful in producing recombinant catalytic domains of cellulose synthase genes and discovered that they dimerize upon concentration, indicating that two CesA proteins form the catalytic unit. We characterized a brittle stalk2 mutant as a defect in a COBRA-like protein that results in compromised lignin-cellulose interactions that decrease tissue flexibility. We used virus-induced gene silencing of barley cell wall polysaccharide synthesis by BSMV in an attempt to silence specific members of the cellulose synthase-like gene family. However, we unexpectedly found that regardless of the specificity of the target gene, whole gene interaction networks were silenced. We discovered the cause to be an antisense transcript of the cellulose synthase gene initiated small interfering RNAs that spread silencing to related genes.

The promoter activities of sucrose phosphate synthase genes in rice, OsSPS1 and OsSPS11, are controlled by light and circadian clock, but not by sucrose

Directory of Open Access Journals (Sweden)

Madoka eYonekura

2013-03-01

Full Text Available Although sucrose plays a role in sugar sensing and its signaling pathway, little is known about the regulatory mechanisms of the expressions of plant sucrose-related genes. Our previous study on the expression of the sucrose phosphate synthase gene family in rice (OsSPSs suggested the involvement of sucrose sensing and/or circadian rhythm in the transcriptional regulation of OsSPS. To examine whether the promoters of OsSPSs can be controlled by sugars and circadian clock, we produced transgenic rice plants harboring a promoter–luciferase construct for OsSPS1 or OsSPS11 and analyzed the changes in the promoter activities by monitoring bioluminescence from intact transgenic plants in real time. Transgenic plants fed sucrose, glucose, or mannitol under continuous light conditions showed no changes in bioluminescence intensity; meanwhile, the addition of sucrose increased the concentration of sucrose in the plants, and the mRNA levels of OsSPS remained constant. These results suggest that these OsSPS promoters may not be regulated by sucrose levels in the tissues. Next, we investigated the changes in the promoter activities under 12-h light/12-h dark cycles and continuous light conditions. Under the light–dark cycle, both OsSPS1 and OsSPS11 promoter activities were low in the dark and increased rapidly after the beginning of the light period. When the transgenic rice plants were moved to the continuous light condition, both POsSPS1::LUC and POsSPS11::LUC reporter plants exhibited circadian bioluminescence rhythms; bioluminescence peaked during the subjective day with a 27-h period: in the early morning as for OsSPS1 promoter and midday for OsSPS11 promoter. These results indicate that these OsSPS promoters are controlled by both light illumination and circadian clock and that the regulatory mechanism of promoter activity differs between the 2 OsSPS genes.

CHARACTERIZATION OF 0.58 kb DNA STILBENE SYNTHASE ENCODING GENE FRAGMENT FROM MELINJO PLANT (Gnetum gnemon

Directory of Open Access Journals (Sweden)

Tri Joko Raharjo

2011-12-01

Full Text Available Resveratrol is a potent anticancer agent resulted as the main product of enzymatic reaction between common precursor in plants and Stilbene Synthase enzyme, which is expressed by sts gene. Characterization of internal fragment of Stilbene Synthase (STS encoding gene from melinjo plant (Gnetum gnemon L. has been carried out as part of a larger work to obtain a full length of Stilbene Synthase encoding gene of the plant. RT-PCR (Reverse Transcriptase Polymerase Chain Reaction was performed using two degenerated primers to amplify the gene fragment. Ten published STS conserved amino acid sequences from various plant species from genebank were utilized to construct a pair of GGF2 (5' GTTCCACCTGCGAAGCAGCC 3' and GGR2 (5' CTGGATCGCACATCC TGGTG 3' primers. Both designed primers were predicted to be in the position of 334-354 and 897-916 kb of the gene respectively. Total RNA isolated from melinjo leaves was used as template for the RT-PCR amplification process using two-step technique. A collection of 0.58 DNA fragments was generated from RT-PCR amplification and met the expected results. The obtained DNA fragments were subsequently isolated, refined and sequenced. A nucleotide sequence analysis was accomplished by comparing it to the existed sts genes available in genebank. Homology analysis of the DNA fragments with Arachis hypogaea L00952 sts gene showed high similarity level. Taken together, the results are evidence that the amplified fragment obtained in this study is part of melinjo sts gene

Myo-inositol phosphate synthase expression in the European eel (Anguilla anguilla) and Nile tilapia (Oreochromis niloticus): effect of seawater acclimation.

Science.gov (United States)

Kalujnaia, Svetlana; Hazon, Neil; Cramb, Gordon

2016-08-01

A single MIPS gene (Isyna1/Ino1) exists in eel and tilapia genomes with a single myo-d-inositol 3-phosphate synthase (MIPS) transcript identified in all eel tissues, although two MIPS spliced variants [termed MIPS(s) and MIPS(l)] are found in all tilapia tissues. The larger tilapia transcript [MIPS(l)] results from the inclusion of the 87-nucleotide intron between exons 5 and 6 in the genomic sequence. In most tilapia tissues, the MIPS(s) transcript exhibits much higher abundance (generally >10-fold) with the exception of white skeletal muscle and oocytes, in which the MIPS(l) transcript predominates. SW acclimation resulted in large (6- to 32-fold) increases in mRNA expression for both MIPS(s) and MIPS(l) in all tilapia tissues tested, whereas in the eel, changes in expression were limited to a more modest 2.5-fold increase and only in the kidney. Western blots identified a number of species- and tissue-specific immunoreactive MIPS proteins ranging from 40 to 67 kDa molecular weight. SW acclimation failed to affect the abundance of any immunoreactive protein in any tissue tested from the eel. However, a major 67-kDa immunoreactive protein (presumed to be MIPS) found in tilapia tissues exhibited 11- and 54-fold increases in expression in gill and fin samples from SW-acclimated fish. Immunohistochemical investigations revealed specific immunoreactivity in the gill, fin, skin, and intestine taken from only SW-acclimated tilapia. Immunofluorescence indicated that MIPS was expressed within gill chondrocytes and epithelial cells of the primary filaments, basal epithelial cell layers of the skin and fin, the cytosol of columnar intestinal epithelial and mucous cells, as well as unknown entero-endocrine-like cells. Copyright © 2016 the American Physiological Society.

Cloning and characterization of ATP synthase CF1 α gene from ...

African Journals Online (AJOL)

ATP synthase CF1 α subunit protein is a key enzyme for energy metabolism in plant kingdom, and plays an important role in multiple cell processes. In this study, the complete atpA gene (accession no. JN247444) was cloned from sweet potato (Ipomoea batatas L. Lam) by reverse transcriptasepolymerase chain reaction ...

Glucose-6-Phosphate Dehydrogenase (G6PD) deficiency in patients ...

African Journals Online (AJOL)

This is a study of Glucose-6-phosphate dehydrogenase(G6PD) deficiency in sickle cell anaemia patients attending the haematology clinic of the Jos University Teaching Hospital (JUTH), Jos- Nigeria. The prevalence of G6PD deficiency among the 130 sickle cell anaemia patients studied was found to be 18.5%. G6PD ...

Crystallization of Trehalose in Frozen Solutions and its Phase Behavior during Drying

Energy Technology Data Exchange (ETDEWEB)

Sundaramurthi, Prakash; Patapoff, Thomas W.; Suryanarayanan, Raj (Genentech); (UMM)

2015-02-19

To study the crystallization of trehalose in frozen solutions and to understand the phase transitions during the entire freeze-drying cycle. Aqueous trehalose solution was cooled to -40 C in a custom-designed sample holder. The frozen solution was warmed to -18 C and annealed, and then dried in the sample chamber of the diffractometer. XRD patterns were continuously collected during cooling, annealing and drying. After cooling, hexagonal ice was the only crystalline phase observed. However, upon annealing, crystallization of trehalose dihydrate was evident. Seeding the frozen solution accelerated the solute crystallization. Thus, phase separation of the lyoprotectant was observed in frozen solutions. During drying, dehydration of trehalose dihydrate yielded a substantially amorphous anhydrous trehalose. Crystallization of trehalose, as trehalose dihydrate, was observed in frozen solutions. The dehydration of the crystalline trehalose dihydrate to substantially amorphous anhydrate occurred during drying. Therefore, analyzing the final lyophile will not reveal crystallization of the lyoprotectant during freeze-drying. The lyoprotectant crystallization can only become evident by continuous monitoring of the system during the entire freeze-drying cycle. In light of the phase separation of trehalose in frozen solutions, its ability to serve as a lyoprotectant warrants further investigation.

Differences in the roles of a glutamine amidotransferase subunit of pyridoxal 5'-phosphate synthase between Bacillus circulans and Bacillus subtilis.

Science.gov (United States)

Itagaki, Shiori; Haga, Minami; Oikawa, Yuji; Sakoda, Ayaka; Ohke, Yoshie; Sawada, Hiroshi; Eguchi, Tadashi; Tamegai, Hideyuki

2013-01-01

BtrC2 of the butirosin producer Bacillus circulans is a non-catalytic subunit of 2-deoxy-scyllo-inosose (DOI) synthase that is involved in butirosin biosynthesis, and also a homolog of glutamine amidotransferase subunit (PdxT) of pyridoxal 5'-phosphate (PLP) synthase of Bacillus subtilis. BtrC2 has been found to have functions in B. circulans both in primary and secondary metabolism. In this study, we investigated the properties of PdxT of B. subtilis in order to determine whether the property of enzyme stabilization is universal among PdxT homologs. Complementation with PdxT in the btrC2 disruptant of B. circulans restored the growth and short-term production of antibiotics, but long-term production of antibiotics cannot be restored. Additionally, PdxT did not bind physically with or stabilize BtrC. Our results indicate that the function of BtrC2 in secondary metabolism is specific properties, not universal among PdxT homologs.

MCK1 is a novel regulator of myo-inositol phosphate synthase (MIPS that is required for inhibition of inositol synthesis by the mood stabilizer valproate.

Directory of Open Access Journals (Sweden)

Wenxi Yu

Full Text Available Myo-inositol, the precursor of all inositol compounds, is essential for the viability of eukaryotes. Identifying the factors that regulate inositol homeostasis is of obvious importance to understanding cell function and the pathologies underlying neurological and metabolic resulting from perturbation of inositol metabolism. The current study identifies Mck1, a GSK3 homolog, as a novel positive regulator of inositol de novo synthesis in yeast. Mck1 was required for normal activity of myo-inositol phosphate synthase (MIPS, which catalyzes the rate-limiting step of inositol synthesis. mck1Δ cells exhibited a 50% decrease in MIPS activity and a decreased rate of incorporation of [13C6]glucose into [13C6]-inositol-3-phosphate and [13C6]-inositol compared to WT cells. mck1Δ cells also exhibited decreased growth in the presence of the inositol depleting drug valproate (VPA, which was rescued by supplementation of inositol. However, in contrast to wild type cells, which exhibited more than a 40% decrease in MIPS activity in the presence of VPA, the drug did not significantly decrease MIPS activity in mck1Δ cells. These findings indicate that VPA-induced MIPS inhibition is Mck1-dependent, and suggest a model that unifies two current hypotheses of the mechanism of action of VPA-inositol depletion and GSK3 inhibition.

MCK1 is a novel regulator of myo-inositol phosphate synthase (MIPS) that is required for inhibition of inositol synthesis by the mood stabilizer valproate.

Science.gov (United States)

Yu, Wenxi; Daniel, Joshua; Mehta, Dhara; Maddipati, Krishna Rao; Greenberg, Miriam L

2017-01-01

Myo-inositol, the precursor of all inositol compounds, is essential for the viability of eukaryotes. Identifying the factors that regulate inositol homeostasis is of obvious importance to understanding cell function and the pathologies underlying neurological and metabolic resulting from perturbation of inositol metabolism. The current study identifies Mck1, a GSK3 homolog, as a novel positive regulator of inositol de novo synthesis in yeast. Mck1 was required for normal activity of myo-inositol phosphate synthase (MIPS), which catalyzes the rate-limiting step of inositol synthesis. mck1Δ cells exhibited a 50% decrease in MIPS activity and a decreased rate of incorporation of [13C6]glucose into [13C6]-inositol-3-phosphate and [13C6]-inositol compared to WT cells. mck1Δ cells also exhibited decreased growth in the presence of the inositol depleting drug valproate (VPA), which was rescued by supplementation of inositol. However, in contrast to wild type cells, which exhibited more than a 40% decrease in MIPS activity in the presence of VPA, the drug did not significantly decrease MIPS activity in mck1Δ cells. These findings indicate that VPA-induced MIPS inhibition is Mck1-dependent, and suggest a model that unifies two current hypotheses of the mechanism of action of VPA-inositol depletion and GSK3 inhibition.

Trehalose degradation and glucose efflux precede cell ejection during germination of heat-resistant ascospores of Talaromyces macrosporus

NARCIS (Netherlands)

Dijksterhuis, Jan; van Driel, Kenneth G A; Sanders, Mark G; Molenaar, Douwe; Houbraken, Jos A M P; Samson, Rob A; Kets, Edwin P W

Talaromyces macrosporus forms ascospores that survive pasteurization treatments. Ascospores were dense (1.3 g ml(-1)), relatively dry [0.6 g H(2)O (g dry weight)(-1)] and packed with trehalose (9-17% fresh weight). Trehalose was degraded to glucose monomers between 30 and 100 min after heat

Escherichia coli rpiA gene encoding ribose phosphate isomerase A

DEFF Research Database (Denmark)

Hove-Jensen, Bjarne; Maigaard, Marianne

1993-01-01

The rpiA gene encoding ribose phosphate isomerase A was cloned from phage 1A2(471) of the Kohara gene library. Subcloning, restriction, and complementation analyses revealed an 1,800-bp SspI-generated DNA fragment that contained the entire control and coding sequences. This DNA fragment was seque......The rpiA gene encoding ribose phosphate isomerase A was cloned from phage 1A2(471) of the Kohara gene library. Subcloning, restriction, and complementation analyses revealed an 1,800-bp SspI-generated DNA fragment that contained the entire control and coding sequences. This DNA fragment...

Rational engineering of Lactobacillus acidophilus NCFM maltose phosphorylase into either trehalose or kojibiose dual specificity phosphorylase

DEFF Research Database (Denmark)

Nakai, Hiroyuki; Petersen, B.O.; Westphal, Y.

2010-01-01

. LaMP has about 35 and 26% amino acid sequence identity with GH65 trehalose phosphorylase (TP) and kojibiose phosphorylase (KP) from Thermoanaerobacter brockii ATCC35047. The structure of L. brevis MP and multiple sequence alignment identified (alpha/alpha)(6)-barrel loop 3 that forms the rim...... group of the glucose moiety at subsite +1, by corresponding segments from Ser426-Ala431 in TP and Thr419-Phe427 in KP, thus conferred LaMP with phosphorolytic activity towards trehalose and kojibiose, respectively. Two different loop 3 LaMP variants catalysed the formation of trehalose and kojibiose...

Prerequisite for highly efficient isoprenoid production by cyanobacteria discovered through the over-expression of 1-deoxy-d-xylulose 5-phosphate synthase and carbon allocation analysis.

Science.gov (United States)

Kudoh, Kai; Kawano, Yusuke; Hotta, Shingo; Sekine, Midori; Watanabe, Takafumi; Ihara, Masaki

2014-07-01

Cyanobacteria have recently been receiving considerable attention owing to their potential as photosynthetic producers of biofuels and biomaterials. Here, we focused on the production of isoprenoids by cyanobacteria, and aimed to provide insight into metabolic engineering design. To this end, we examined the over-expression of a key enzyme in 2-C-methyl-d-erythritol 4-phosphate (MEP) pathway, 1-deoxy-d-xylulose 5-phosphate synthase (DXS) in the cyanobacterium Synechocystis sp. PCC6803. In the DXS-over-expression strain (Dxs_ox), the mRNA and protein levels of DXS were 4-times and 1.5-times the levels in the wild-type (WT) strain, respectively. The carotenoid content of the Dxs_ox strain (8.4 mg/g dry cell weight [DCW]) was also up to 1.5-times higher than that in the WT strain (5.6 mg/g DCW), whereas the glycogen content dramatically decreased to an undetectable level. These observations suggested that the carotenoid content in the Dxs_ox strain was increased by consuming glycogen, which is a C-storage compound in cyanobacteria. We also quantified the total sugar (145 and 104 mg/g DCW), total fatty acids (31 and 24 mg/g DCW) and total protein (200 and 240 mg/g DCW) content in the WT and Dxs_ox strains, respectively, which were much higher than the carotenoid content. In particular, approximately 54% of the proteins were phycobiliproteins. This study demonstrated the major destinations of carbon flux in cyanobacteria, and provided important insights into metabolic engineering. Target yield can be improved through optimization of gene expression, the DXS protein stabilization, cell propagation depression and restriction of storage compound synthesis. Copyright © 2013 The Society for Biotechnology, Japan. Published by Elsevier B.V. All rights reserved.

Functional mitochondrial ATP synthase proteolipid gene produced by recombination of parental genes in a petunia somatic hybrid

International Nuclear Information System (INIS)

Rothenberg, M.; Hanson, M.R.

1988-01-01

A novel ATP synthase subunit 9 gene (atp9) was identified in the mitochondrial genome of a Petunia somatic hybrid line (13-133) which was produced from a fusion between Petunia lines 3688 and 3704. The novel gene was generated by intergenomic recombination between atp9 genes from the two parental plant lines. The entire atp9 coding region is represented on the recombinant gene. Comparison of gene sequences using electrophoresis and autoradiography, indicate that the 5' transcribed region is contributed by an atp9 gene from 3704 and the 3' transcribed region is contributed by an atp9 gene from 3688. The recombinant atp9 gene is transcriptionally active. The location of the 5' and 3' transcript termini are conserved with respect to the parental genes, resulting in the production of hybrid transcripts

Fructose 6-phosphate phosphoketolase activity in wild-type strains of Lactobacillus, isolated from the intestinal tract of pigs.

Science.gov (United States)

Bolado-Martínez, E; Acedo-Félix, E; Peregrino-Uriarte, A B; Yepiz-Plascencia, G

2012-01-01

Phosphoketolases are key enzymes of the phosphoketolase pathway of heterofermentative lactic acid bacteria, which include lactobacilli. In heterofermentative lactobacilli xylulose 5-phosphate phosphoketolase (X5PPK) is the main enzyme of the phosphoketolase pathway. However, activity of fructose 6-phosphate phosphoketolase (F6PPK) has always been considered absent in lactic acid bacteria. In this study, the F6PPK activity was detected in 24 porcine wild-type strains of Lactobacillus reuteri and Lactobacillus mucosae, but not in the Lactobacillus salivarius or in L. reuteri ATCC strains. The activity of F6PPK increased after treatment of the culture at low-pH and diminished after porcine bile-salts stress conditions in wild-type strains of L. reuteri. Colorimetric quantification at 505 nm allowed to differentiate between microbial strains with low activity and without the activity of F6PPK. Additionally, activity of F6PPK and the X5PPK gene expression levels were evaluated by real time PCR, under stress and nonstress conditions, in 3 L. reuteri strains. Although an exact correlation, between enzyme activity and gene expression was not obtained, it remains possible that the xpk gene codes for a phosphoketolase with dual substrate, at least in the analyzed strains of L. reuteri.

A real-time PCR assay for the relative quantification of the tetrahydrocannabinolic acid (THCA) synthase gene in herbal Cannabis samples.

Science.gov (United States)

Cascini, Fidelia; Passerotti, Stella; Martello, Simona

2012-04-10

In this study, we wanted to investigate whether or not the tetrahydrocannabinolic acid (THCA) synthase gene, which codes for the enzyme involved in the biosynthesis of THCA, influences the production and storage of tetrahydrocannabinol (THC) in a dose-dependent manner. THCA is actually decarboxylated to produce THC, the main psychoactive component in the Cannabis plant. Assuming as the research hypothesis a correlation between the gene copy number and the production of THC, gene quantification could be useful in forensics in order to complement or replace chemical analysis for the identification and classification of seized Cannabis samples, thus distinguishing the drug-type from the fibre-type varieties. A real-time PCR assay for the relative quantification of the THCA synthase gene was then validated on Cannabis samples; some were seized from the illegal drug market and others were derived from experimental cultivation. In order to determine the gene copy number to compare high vs. low potency plants, we chose the ΔΔCt method for TaqMan reactions. The assay enabled single plants with zero, one, and two copies of the gene to be distinguished. As a result of this first part of the research on the THCA synthase gene (the second part will cover a study of gene expression), we found no correlation between THCA synthase gene copy number and the content of THC in the herbal Cannabis samples tested. Copyright © 2011 Elsevier Ireland Ltd. All rights reserved.

Glucose-6-phosphate dehydrogenase (G6PD)-deficient infants: Enzyme activity and gene variants as risk factors for phototherapy in the first week of life.

Science.gov (United States)

Wong, Fei-Liang; Ithnin, Azlin; Othman, Ainoon; Cheah, Fook-Choe

2017-07-01

Glucose-6-phosphate dehydrogenase (G6PD) deficiency is a recognised cause of severe neonatal hyperbilirubinaemia, and identifying which infants are at risk could optimise care and resources. In this study, we determined if G6PD enzyme activity (EA) and certain gene variants were associated with neonatal hyperbilirubinaemia requiring phototherapy during the first week after birth. Newborn infants with G6PD deficiency and a group with normal results obtained by the fluorescent spot test were selected for analyses of G6PD EA and the 10 commonly encountered G6PD mutations in this region, relating these with whether the infants required phototherapy before discharge from the hospital in the first week. A total of 222 infants with mean gestation and birth weight of 38.3 ± 1.8 weeks and 3.02 ± 0.48 kg, respectively, were enrolled. Of these, n = 121 were deficient with EA ≤6.76 U/g Hb, and approximately half (43%) received phototherapy in the first week after birth. The mean EA level was 3.7 U/g Hb. The EA had good accuracy in predicting phototherapy use, with area under the receiver-operating-characteristic curve of 0.81 ± 0.05. Infants on phototherapy more commonly displayed World Health Organization Class II mutations (deficiency in EA and mutation at c.1388G>A (adjusted odds ratio, 1.5 and 5.7; 95% confidence interval: 1.31-1.76 and 1.30-25.0, respectively) were independent risk factors for phototherapy. Low G6PD EA (G6PD gene variant, c.1388G>A, are risk factors for the need of phototherapy in newborn infants during the first week after birth. © 2017 Paediatrics and Child Health Division (The Royal Australasian College of Physicians).

Mutation of Cellulose Synthase Gene Improves the Nutritive Value of Rice Straw

Directory of Open Access Journals (Sweden)

Yanjing Su

2012-06-01

Full Text Available Rice straw is an important roughage resource for ruminants in many rice-producing countries. In this study, a rice brittle mutant (BM, mutation in OsCesA4, encoding cellulose synthase and its wild type (WT were employed to investigate the effects of a cellulose synthase gene mutation on rice straw morphological fractions, chemical composition, stem histological structure and in situ digestibility. The morphological fractions investigation showed that BM had a higher leaf sheath proportion (43.70% vs 38.21%, p0.05 was detected in neutral detergent fiber (NDFom and ADL contents for both strains. Histological structure observation indicated that BM stems had fewer sclerenchyma cells and a thinner sclerenchyma cell wall than WT. The results of in situ digestion showed that BM had higher DM, NDFom, cellulose and hemicellulose disappearance at 24 or 48 h of incubation (p<0.05. The effective digestibility of BM rice straw DM and NDFom was greater than that of WT (31.4% vs 26.7% for DM, 29.1% vs 24.3% for NDFom, p<0.05, but the rate of digestion of the slowly digested fraction of BM rice straw DM and NDF was decreased. These results indicated that the mutation in the cellulose synthase gene could improve the nutritive value of rice straw for ruminants.

Structural basis for phosphatidylinositol-phosphate biosynthesis

Science.gov (United States)

Clarke, Oliver B.; Tomasek, David; Jorge, Carla D.; Dufrisne, Meagan Belcher; Kim, Minah; Banerjee, Surajit; Rajashankar, Kanagalaghatta R.; Shapiro, Lawrence; Hendrickson, Wayne A.; Santos, Helena; Mancia, Filippo

2015-10-01

Phosphatidylinositol is critical for intracellular signalling and anchoring of carbohydrates and proteins to outer cellular membranes. The defining step in phosphatidylinositol biosynthesis is catalysed by CDP-alcohol phosphotransferases, transmembrane enzymes that use CDP-diacylglycerol as donor substrate for this reaction, and either inositol in eukaryotes or inositol phosphate in prokaryotes as the acceptor alcohol. Here we report the structures of a related enzyme, the phosphatidylinositol-phosphate synthase from Renibacterium salmoninarum, with and without bound CDP-diacylglycerol to 3.6 and 2.5 Å resolution, respectively. These structures reveal the location of the acceptor site, and the molecular determinants of substrate specificity and catalysis. Functional characterization of the 40%-identical ortholog from Mycobacterium tuberculosis, a potential target for the development of novel anti-tuberculosis drugs, supports the proposed mechanism of substrate binding and catalysis. This work therefore provides a structural and functional framework to understand the mechanism of phosphatidylinositol-phosphate biosynthesis.

Trehalose degradation and glucose efflux precede cell ejection during germination of heat-resistant acospores of Talaromyces macrosporus

NARCIS (Netherlands)

Dijksterhuis, J.; Driel, van K.G.A.; Sanders, M.G.; Molenaar, D.; Houbraken, J.A.M.P.; Samson, R.A.; Kets, E.P.W.

2002-01-01

Talaromyces macrosporus forms ascospores that survive pasteurization treatments. Ascospores were dense (1.3 g ml-1), relatively dry [0.6 g H2O (g dry weight)-1] and packed with trehalose (9-17␏resh weight). Trehalose was degraded to glucose monomers between 30 and 100 min after heat activation of

Comprehensive Genomic Identification and Expression Analysis of the Phosphate Transporter (PHT) Gene Family in Apple.

Science.gov (United States)

Sun, Tingting; Li, Mingjun; Shao, Yun; Yu, Lingyan; Ma, Fengwang

2017-01-01

Elemental phosphorus (Pi) is essential to plant growth and development. The family of phosphate transporters (PHTs) mediates the uptake and translocation of Pi inside the plants. Members include five sub-cellular phosphate transporters that play different roles in Pi uptake and transport. We searched the Genome Database for Rosaceae and identified five clusters of phosphate transporters in apple ( Malus domestica ), including 37 putative genes. The MdPHT1 family contains 14 genes while MdPHT2 has two, MdPHT3 has seven, MdPHT4 has 11, and MdPHT5 has three. Our overview of this gene family focused on structure, chromosomal distribution and localization, phylogenies, and motifs. These genes displayed differential expression patterns in various tissues. For example, expression was high for MdPHT1;12, MdPHT3;6 , and MdPHT3;7 in the roots, and was also increased in response to low-phosphorus conditions. In contrast, MdPHT4;1, MdPHT4;4 , and MdPHT4;10 were expressed only in the leaves while transcript levels of MdPHT1;4, MdPHT1;12 , and MdPHT5;3 were highest in flowers. In general, these 37 genes were regulated significantly in either roots or leaves in response to the imposition of phosphorus and/or drought stress. The results suggest that members of the PHT family function in plant adaptations to adverse growing environments. Our study will lay a foundation for better understanding the PHT family evolution and exploring genes of interest for genetic improvement in apple.

SLC37A1 and SLC37A2 are phosphate-linked, glucose-6-phosphate antiporters.

Directory of Open Access Journals (Sweden)

Chi-Jiunn Pan

Full Text Available Blood glucose homeostasis between meals depends upon production of glucose within the endoplasmic reticulum (ER of the liver and kidney by hydrolysis of glucose-6-phosphate (G6P into glucose and phosphate (P(i. This reaction depends on coupling the G6P transporter (G6PT with glucose-6-phosphatase-α (G6Pase-α. Only one G6PT, also known as SLC37A4, has been characterized, and it acts as a P(i-linked G6P antiporter. The other three SLC37 family members, predicted to be sugar-phosphate:P(i exchangers, have not been characterized functionally. Using reconstituted proteoliposomes, we examine the antiporter activity of the other SLC37 members along with their ability to couple with G6Pase-α. G6PT- and mock-proteoliposomes are used as positive and negative controls, respectively. We show that SLC37A1 and SLC37A2 are ER-associated, P(i-linked antiporters, that can transport G6P. Unlike G6PT, neither is sensitive to chlorogenic acid, a competitive inhibitor of physiological ER G6P transport, and neither couples to G6Pase-α. We conclude that three of the four SLC37 family members are functional sugar-phosphate antiporters. However, only G6PT/SLC37A4 matches the characteristics of the physiological ER G6P transporter, suggesting the other SLC37 proteins have roles independent of blood glucose homeostasis.

Glass transition temperature of dried lens tissue pretreated with trehalose, maltose, or cyclic tetrasaccharide.

Science.gov (United States)

Kawata, Tetsuhiro; Matsuo, Toshihiko; Uchida, Tetsuya

2014-01-01

Glass transition temperature is a main indicator for amorphous polymers and biological macromolecules as materials, and would be a key for understanding the role of trehalose in protecting proteins and cells against desiccation. In this study, we measured the glass transition temperature by differential scanning calorimetry of dried lens tissues as a model of a whole biological tissue to know the effect of pretreatment by trehalose and other sugars. Isolated porcine lenses were incubated with saline, 100 or 1000 mM concentration of trehalose, maltose, or cyclic tetrasaccharide dissolved in saline at room temperature for 150 minutes. The solutions were removed and all samples were dried at room temperature in a desiccator until no weight change. The dried tissues were ground into powder and placed in a measuring pan for differential scanning calorimetry. The glass transition temperature of the dried lens tissues, as a mean and standard deviation, was 63.0 ± 6.4°C (n = 3) with saline pretreatment; 53.0 ± 0.8°C and 56.3 ± 2.7°C (n = 3), respectively, with 100 and 1000 mM trehalose pretreatment; 56.0 ± 1.6°C and 55.8 ± 1.1°C (n = 3), respectively, with 100 and 1000 mM maltose pretreatment; 60.0 ± 8.8°C and 59.2 ± 6.3°C (n = 3), respectively, with 100 and 1000 mM cyclic tetrasaccharide pretreatment. The glass transition temperature appeared lower, although not significantly, with trehalose and maltose pretreatments than with saline and cyclic tetrasaccharide pretreatments (P > 0.05, Kruskal-Wallis test). The glass transition temperature of the dried lens tissues with trehalose pretreatment appeared more noticeable on the thermogram, compared with other pretreatments. The glass transition temperature was measured for the first time in the dried lens tissues as an example of a whole biological tissue and might provide a basis for tissue preservation in the dried condition.

Different functions of the insect soluble and membrane-bound trehalase genes in chitin biosynthesis revealed by RNA interference.

Directory of Open Access Journals (Sweden)

Jie Chen

Full Text Available BACKGROUND: Trehalase, an enzyme that hydrolyzes trehalose to yield two glucose molecules, plays a pivotal role in various physiological processes. In recent years, trehalase proteins have been purified from several insect species and are divided into soluble (Tre-1 and membrane-bound (Tre-2 trehalases. However, no functions of the two trehalases in chitin biosynthesis in insects have yet been reported. PRINCIPAL FINDINGS: The membrane-bound trehalase of Spodoptera exigua (SeTre-2 was characterized in our laboratory previously. In this study, we cloned the soluble trehalase gene (SeTre-1 and investigated the tissue distribution and developmental expression pattern of the two trehalase genes. SeTre-1 was expressed highly in cuticle and Malpighian tubules, while SeTre-2 was expressed in tracheae and fat body. In the midgut, the two trehalase genes were expressed in different locations. Additionally, the expression profiles of both trehalase mRNAs and their enzyme activities suggest that they may play different roles in chitin biosynthesis. The RNA interference (RNAi of either SeTre-1 or SeTre-2 was gene-specific and effective, with efficiency rates up to 83% at 72 h post injection. After RNAi of SeTre-1 and SeTre-2, significant higher mortality rates were observed during the larva-pupa stage and pupa-adult stage, and the lethal phenotypes were classified and analyzed. Additionally, the change trends of concentration of trehalose and glucose appeared reciprocally in RNAi-mutants. Moreover, knockdown of SeTre-1 gene largely inhibited the expression of chitin synthase gene A (CHSA and reduced the chitin content in the cuticle to two-thirds relative to the control insects. The chitin synthase gene B (CHSB expression, however, was inhibited more by the injection of dsRNA for SeTre-2, and the chitin content in the midgut decreased by about 25%. CONCLUSIONS: SeTre-1 plays a major role in CHSA expression and chitin synthesis in the cuticle, and SeTre-2

Characterization of three chalcone synthase-like genes from apple (Malus x domestica Borkh.).

Science.gov (United States)

Yahyaa, Mosaab; Ali, Samah; Davidovich-Rikanati, Rachel; Ibdah, Muhammad; Shachtier, Alona; Eyal, Yoram; Lewinsohn, Efraim; Ibdah, Mwafaq

2017-08-01

Apple (Malus x domestica Brokh.) is a widely cultivated deciduous tree species of significant economic importance. Apple leaves accumulate high levels of flavonoids and dihydrochalcones, and their formation is dependent on enzymes of the chalcone synthase family. Three CHS genes were cloned from apple leaves and expressed in Escherichia coli. The encoded recombinant enzymes were purified and functionally characterized. In-vitro activity assays indicated that MdCHS1, MdCHS2 and MdCHS3 code for proteins exhibiting polyketide synthase activity that accepted either p-dihydrocoumaroyl-CoA, p-coumaroyl-CoA, or cinnamoyl-CoA as starter CoA substrates in the presence of malonyl-CoA, leading to production of phloretin, naringenin chalcone, and pinocembrin chalcone. MdCHS3 coded a chalcone-dihydrochalcone synthase enzyme with narrower substrate specificity than the previous ones. The apparent Km values of MdCHS3 for p-dihydrocoumaryl-CoA and p-coumaryl-CoA were both 5.0 μM. Expression analyses of MdCHS genes varied according to tissue type. MdCHS1, MdCHS2 and MdCHS3 expression levels were associated with the levels of phloretin accumulate in the respective tissues. Copyright © 2017 Elsevier Ltd. All rights reserved.

Optimization of extraction parameters for trehalose from beer waste ...

African Journals Online (AJOL)

ajl yemi

2011-12-19

Dec 19, 2011 ... medicine, and cosmetics industries (Cesàro et al., 2008). High-intensity pulsed .... at 630 nm and trehalose concentration was determined by the trehalose .... Besides, more pulse number would lead to higher resonance.

Cloning and sequence analysis of chitin synthase gene fragments of Demodex mites*

OpenAIRE

Zhao, Ya-e; Wang, Zheng-hang; Xu, Yang; Xu, Ji-ru; Liu, Wen-yan; Wei, Meng; Wang, Chu-ying

2012-01-01

To our knowledge, few reports on Demodex studied at the molecular level are available at present. In this study our group, for the first time, cloned, sequenced and analyzed the chitin synthase (CHS) gene fragments of Demodex folliculorum, Demodex brevis, and Demodex canis (three isolates from each species) from Xi’an China, by designing specific primers based on the only partial sequence of the CHS gene of D. canis from Japan, retrieved from GenBank. Results show that amplification was succe...

Lyoluminescence characteristics of trehalose dihydrate

Energy Technology Data Exchange (ETDEWEB)

Raman, Anand E-mail: anandr@apsara.barc.ernet.in; Oommen, Issac K.; Sharma, D.N

2001-03-01

Lyoluminescence (LL) of trehalose dihydrate showed a linear gamma ray sensitivity in the dose range 0.1-5x10{sup 2} Gy. At increased sample weight dissolved, the LL/mg showed a reduction when the microcontroller based integrated measurement system was used. The LL/mg was found to be independent of the sample weight when the instantaneous peak output observed by the electrometer amplifier on dissolution of the phosphor was taken as a measure of LL yield. The LL spectral measurement of trehalose dihydrate in luminol solution (LL sensitizer) confirms an energy transfer from the radiation induced free radicals to luminol molecule to produce light.

Lyoluminescence characteristics of trehalose dihydrate

International Nuclear Information System (INIS)

Raman, Anand; Oommen, Issac K.; Sharma, D.N.

2001-01-01

Lyoluminescence (LL) of trehalose dihydrate showed a linear gamma ray sensitivity in the dose range 0.1-5x10 2 Gy. At increased sample weight dissolved, the LL/mg showed a reduction when the microcontroller based integrated measurement system was used. The LL/mg was found to be independent of the sample weight when the instantaneous peak output observed by the electrometer amplifier on dissolution of the phosphor was taken as a measure of LL yield. The LL spectral measurement of trehalose dihydrate in luminol solution (LL sensitizer) confirms an energy transfer from the radiation induced free radicals to luminol molecule to produce light

Sesquiterpene Synthase-3-Hydroxy-3-Methylglutaryl Coenzyme A Synthase Fusion Protein Responsible for Hirsutene Biosynthesis in Stereum hirsutum.

Science.gov (United States)

Flynn, Christopher M; Schmidt-Dannert, Claudia

2018-06-01

The wood-rotting mushroom Stereum hirsutum is a known producer of a large number of namesake hirsutenoids, many with important bioactivities. Hirsutenoids form a structurally diverse and distinct class of sesquiterpenoids. No genes involved in hirsutenoid biosynthesis have yet been identified or their enzymes characterized. Here, we describe the cloning and functional characterization of a hirsutene synthase as an unexpected fusion protein of a sesquiterpene synthase (STS) with a C-terminal 3-hydroxy-3-methylglutaryl-coenzyme A (3-hydroxy-3-methylglutaryl-CoA) synthase (HMGS) domain. Both the full-length fusion protein and truncated STS domain are highly product-specific 1,11-cyclizing STS enzymes with kinetic properties typical of STSs. Complementation studies in Saccharomyces cerevisiae confirmed that the HMGS domain is also functional in vivo Phylogenetic analysis shows that the hirsutene synthase domain does not form a clade with other previously characterized sesquiterpene synthases from Basidiomycota. Comparative gene structure analysis of this hirsutene synthase with characterized fungal enzymes reveals a significantly higher intron density, suggesting that this enzyme may be acquired by horizontal gene transfer. In contrast, the HMGS domain is clearly related to other fungal homologs. This STS-HMGS fusion protein is part of a biosynthetic gene cluster that includes P450s and oxidases that are expressed and could be cloned from cDNA. Finally, this unusual fusion of a terpene synthase to an HMGS domain, which is not generally recognized as a key regulatory enzyme of the mevalonate isoprenoid precursor pathway, led to the identification of additional HMGS duplications in many fungal genomes, including the localization of HMGSs in other predicted sesquiterpenoid biosynthetic gene clusters. IMPORTANCE Hirsutenoids represent a structurally diverse class of bioactive sesquiterpenoids isolated from fungi. Identification of their biosynthetic pathways will provide

Protective effects of trehalose on the corneal epithelial cells.

Science.gov (United States)

Aragona, Pasquale; Colosi, Pietro; Rania, Laura; Colosi, Francesca; Pisani, Antonina; Puzzolo, Domenico; Micali, Antonio

2014-01-01

Aim of the present work was to evaluate the effects of the trehalose on the corneal epithelium undergoing alcohol delamination. Twelve patients undergoing laser subepithelial keratomileusis (LASEK) were consecutively included in the study. The right eyes were pretreated with 3% trehalose eye drops, whilst left eyes were used as control. Epithelial specimens were processed for cells vitality assessment, apoptosis, and light and transmission electron microscopy; a morphometric analysis was performed in both groups. In both trehalose-untreated eyes (TUE) and trehalose-treated eyes (TTE), the percentage of vital cells was similar and no apoptotic cells were observed. In TUE, the corneal epithelium showed superficial cells with reduced microfolds, wing cells with vesicles and dilated intercellular spaces, and dark basal cells with vesicles and wide clefts. In TTE, superficial and wing cells were better preserved, and basal cells were generally clear with intracytoplasmatic vesicles. The morphometric analysis showed statistically significant differences between the two groups: the TTE epithelial height was higher, the basal cells showed larger area and clearer cytoplasm. The distribution of desmosomes and hemidesmosomes was significantly different between the groups. Trehalose administration better preserved morphological and morphometric features of alcohol-treated corneal epithelium, when compared to controls.

Effect of trehalose addition on volatiles responsible for strawberry aroma.

Science.gov (United States)

Kopjar, Mirela; Hribar, Janez; Simcic, Marjan; Zlatić, Emil; Pozrl, Tomaz; Pilizota, Vlasta

2013-12-01

Aroma is one of the most important quality properties of food products and has a great influence on quality and acceptability of foods. Since it is very difficult to control, in this study the effect of addition of trehalose (3, 5 and 10%) to freeze-dried strawberry cream fillings was investigated as a possible means for retention of some of the aroma compounds responsible for the strawberry aroma. In samples with added trehalose, higher amounts of fruity esters were determined. Increase of trehalose content did not cause a proportional increase in the amount of fruity esters. However, results of our research showed that trehalose addition did not have the same effect on both gamma-decalactone and furaneol.

Gene silencing of mannose 6-phosphate reductase in the parasitic weed Orobanche aegyptiaca through the production of homologous dsRNA sequences in the host plant.

Science.gov (United States)

Aly, Radi; Cholakh, Hila; Joel, Daniel M; Leibman, Diana; Steinitz, Benjamin; Zelcer, Aaron; Naglis, Anna; Yarden, Oded; Gal-On, Amit

2009-08-01

Orobanche spp. (broomrape) are parasitic plants which subsist on the roots of a wide range of hosts, including tomato, causing severe losses in yield quality and quantity. Large amounts of mannitol accumulate in this parasitic weed during development. Mannose 6-phosphate reductase (M6PR) is a key enzyme in mannitol biosynthesis, and it has been suggested that mannitol accumulation may be very important for Orobanche development. Therefore, the Orobanche M6PR gene is a potential target for efforts to control this parasite. Transgenic tomato plants were produced bearing a gene construct containing a specific 277-bp fragment from Orobanche aegyptiaca M6PR-mRNA, in an inverted-repeat configuration. M6PR-siRNA was detected in three independent transgenic tomato lines in the R1 generation, but was not detected in the parasite. Quantitative RT-PCR analysis showed that the amount of endogenous M6PR mRNA in the tubercles and underground shoots of O. aegyptiaca grown on transgenic host plants was reduced by 60%-80%. Concomitant with M6PR mRNA suppression, there was a significant decrease in mannitol level and a significant increase in the percentage of dead O. aegyptiaca tubercles on the transgenic host plants. The detection of mir390, which is involved with cytoplasmic dsRNA processing, is the first indication of the existence of gene-silencing mechanisms in Orobanche spp. Gene silencing mechanisms are probably involved with the production of decreased levels of M6PR mRNA in the parasites grown on the transformed tomato lines.

Unchanged gene expression of glycogen synthase in muscle from patients with NIDDM following sulphonylurea-induced improvement of glycaemic control

DEFF Research Database (Denmark)

Vestergaard, H; Lund, S; Bjørbaek, C

1995-01-01

We have previously shown that the mRNA expression of muscle glycogen synthase is decreased in non-insulin-dependent diabetic (NIDDM) patients; the objective of the present protocol was to examine whether the gene expression of muscle glycogen synthase in NIDDM is affected by chronic sulphonylurea...... as enhanced beta-cell responses to an oral glucose load. During euglycaemic, hyperinsulinaemic clamp (2 mU x kg-1 x min-1) in combination with indirect calorimetry, a 35% (p=0.005) increase in whole-body insulin-stimulated glucose disposal rate, predominantly due to an increased non-oxidative glucose....... In conclusion, improved blood glucose control in gliclazide-treated obese NIDDM patients has no impact on the gene expression of muscle glycogen synthase....

[Development of specific and degenerated primers to CesA genes encoding flax (Linum usitatissimum L.) cellulose synthase].

Science.gov (United States)

Grushetskaia, Z E; Lemesh, V A; Khotyleva, L V

2010-01-01

Cellulose synthase catalytic subunit genes, CesA, have been discovered in several higher plant species, and it has been shown that the CesA gene family has multiple members. HVR2 fragment of these genes determine the class specificity of the CESA protein and its participation in the primary or secondary cell wall synthesis. The aim of this study was development of specific and degenerated primers to flax CesA gene fragments leading to obtaining the class specific HVR2 region of the gene. Two pairs of specific primers to the certain fragments of CesA-1 and CesA-6 genes and one pair of degenerated primers to HVR2 region of all flax CesA genes were developed basing on comparison of six CesA EST sequences of flax and full cDNA sequences of Arabidopsis, poplar, maize and cotton plants, obtained from GenBank. After amplification of flax cDNA, the bands of expected size were detected (201 and 300 b.p. for the CesA-1 and CesA-6, and 600 b.p. for the HVR2 region of CesA respectively). The developed markers can be used for cloning and sequencing of flax CesA genes, identifying their number in flax genome, tissue and stage specificity.

Screening of Glucose-6-Phosphate Dehydrogenase Deficiency in Cord Blood

Directory of Open Access Journals (Sweden)

Can Acipayam

2014-02-01

Aim: Glucose-6-phosphate dehydrogenase deficiency is an important factor in etiology of pathologic neonatal jaundice. The aim of this study was to indicate the significance of screening glucose-6-phosphate dehydrogenase deficiency in the cord blood of neonates and the frequency of this deficiency in the etiology of neonatal hyperbilirubinemia. Material and Method: The study was performed consecutive 1015 neonates were included. Five hundred fifty six (54.8% of them were male and 459 (45.2% were female. The following parameters were recorded: Gender, birth weight, birth height, head circumference and gestational age. The glucose-6-phosphate dehydrogenase level of neonates were measured with quantitative method in cord blood. Also, hemoglobine, hematocrite, red blood cell count and blood group were measured. The following parameters were recorded in cases with jaundice: exchange transfusion, phototherapy, physiologic and pathologic jaundice, peak bilirubin day, maximum bilirubin level, total bilirubin level at the first day of jaundice, beginning time of jaundice. Results: Enzyme deficiency was detected in 133 (13.1% of neonates and 76 (57% of them were male, 57 (43% were female. Significant difference was detected in low glucose-6-phosphate dehydrogenase enzyme level with jaundice group for total bilirubin level at the first day of jaundice, maximum total bilirubin level and pathologic jaundice (p<0.05. Discussion: The ratio of glucose-6-phosphate dehydrogenase deficiency was found in Edirne in this study and this ratio was higher than other studies conducted in our country. For this reason, glucose-6-phosphate dehydrogenase enzyme level in cord blood of neonates should be measured routinely and high risk neonates should be followed up for hyperbilirubinemia and parents should be informed in our region.

Carbohydrate metabolism in Agaricus bisporus (Lange) Imbach: metabolism of [14C] labelled sugars by sporophores and mycelium

International Nuclear Information System (INIS)

Hammond, J.B.W.; Nichols, R.

1977-01-01

When growing sporophores and vegetative mycelium of Agaricus bisporus had been supplied with [ 14 C] labelled hexoses for varying periods of time, the major compounds labelled in both forms were mannitol, trehalose, glutamate, alanine and an unidentified substance. Mannitol was strongly labelled after application of [ 14 C] fructose but only weakly when [ 14 C] glucose was applied. The relative rates of oxidation by sporophores of labelled mannitol, trehalose, glucose and fructose were assessed by measuring 14 CO 2 production. Glucose and trehalose were the most rapidly oxidized substrates. Glucosephosphatase isomerase (E.C. 5.3.1.9) was extracted from sporohores and assayed. The conversion of glucose-6-phosphate to fructose-6-phosphate by the enzyme was competitively inhibited in vitro by 6-phosphogluconate. The control of mannitol synthesis and the functions of mannitol and trehalose are discussed. (author)

Functional analysis of the Phycomyces carRA gene encoding the enzymes phytoene synthase and lycopene cyclase.

Directory of Open Access Journals (Sweden)

Catalina Sanz

Full Text Available Phycomyces carRA gene encodes a protein with two domains. Domain R is characterized by red carR mutants that accumulate lycopene. Domain A is characterized by white carA mutants that do not accumulate significant amounts of carotenoids. The carRA-encoded protein was identified as the lycopene cyclase and phytoene synthase enzyme by sequence homology with other proteins. However, no direct data showing the function of this protein have been reported so far. Different Mucor circinelloides mutants altered at the phytoene synthase, the lycopene cyclase or both activities were transformed with the Phycomyces carRA gene. Fully transcribed carRA mRNA molecules were detected by Northern assays in the transformants and the correct processing of the carRA messenger was verified by RT-PCR. These results showed that Phycomyces carRA gene was correctly expressed in Mucor. Carotenoids analysis in these transformants showed the presence of ß-carotene, absent in the untransformed strains, providing functional evidence that the Phycomyces carRA gene complements the M. circinelloides mutations. Co-transformation of the carRA cDNA in E. coli with different combinations of the carotenoid structural genes from Erwinia uredovora was also performed. Newly formed carotenoids were accumulated showing that the Phycomyces CarRA protein does contain lycopene cyclase and phytoene synthase activities. The heterologous expression of the carRA gene and the functional complementation of the mentioned activities are not very efficient in E. coli. However, the simultaneous presence of both carRA and carB gene products from Phycomyces increases the efficiency of these enzymes, presumably due to an interaction mechanism.

Glucose and fructose 6-phosphate cycle in humans

International Nuclear Information System (INIS)

Karlander, S.; Roovete, A.; Vranic, M.; Efendic, S.

1986-01-01

We have determined the rate of glucose cycling by comparing turnovers of [2- 3 H]- and [6- 3 H]glucose under basal conditions and during a glucose infusion. Moreover, the activity of the fructose 6-phosphate cycle was assessed by comparing [3- 3 H]- and [6- 3 H]glucose. The study included eight lean subjects with normal glucose tolerance. They participated in two randomly performed investigations. In one experiment [2- 3 H]- and [6- 3 H]glucose were given simultaneously, while in the other only [3- 3 H]glucose was given. The basal rate of glucose cycling was 0.32 +/- 0.08 mg X kg-1 X min-1 or 17% of basal glucose production (P less than 0.005). During glucose infusion the activity of endogenous glucose cycling did not change but since glucose production was suppressed it amounted to 130% of glucose production. The basal fructose 6-phosphate cycle could be detected only in three subjects and was suppressed during glucose infusion. In conclusion, the glucose cycle is active in healthy humans both in basal conditions and during moderate hyperglycemia. In some subjects, the fructose 6-phosphate cycle also appears to be active. Thus it is preferable to use [6- 3 H]glucose rather than [3- 3 H]glucose when measuring glucose production and particularly when assessing glucose cycle

Overexpression of Thellungiella halophila H+-pyrophosphatase Gene Improves Low Phosphate Tolerance in Maize

Science.gov (United States)

Pei, Laming; Wang, Jiemin; Li, Kunpeng; Li, Yongjun; Li, Bei; Gao, Feng; Yang, Aifang

2012-01-01

Low phosphate availability is a major constraint on plant growth and agricultural productivity. Engineering a crop with enhanced low phosphate tolerance by transgenic technique could be one way of alleviating agricultural losses due to phosphate deficiency. In this study, we reported that transgenic maize plants that overexpressed the Thellungiella halophila vacuolar H+-pyrophosphatase gene (TsVP) were more tolerant to phosphate deficit stress than the wild type. Under phosphate sufficient conditions, transgenic plants showed more vigorous root growth than the wild type. When phosphate deficit stress was imposed, they also developed more robust root systems than the wild type, this advantage facilitated phosphate uptake, which meant that transgenic plants accumulated more phosphorus. So the growth and development in the transgenic maize plants were not damaged as much as in the wild type plants under phosphate limitation. Overexpression of TsVP increased the expression of genes involved in auxin transport, which indicated that the development of larger root systems in transgenic plants might be due in part to enhanced auxin transport which controls developmental events in plants. Moreover, transgenic plants showed less reproductive development retardation and a higher grain yield per plant than the wild type plants when grown in a low phosphate soil. The phenotypes of transgenic maize plants suggested that the overexpression of TsVP led to larger root systems that allowed transgenic maize plants to take up more phosphate, which led to less injury and better performance than the wild type under phosphate deficiency conditions. This study describes a feasible strategy for improving low phosphate tolerance in maize and reducing agricultural losses caused by phosphate deficit stress. PMID:22952696

Genome sequence of Halorhabdus tiamatea, the first archaeon isolated from a deep-sea anoxic brine lake.

KAUST Repository

Antunes, Andre

2011-09-01

We present the draft genome of Halorhabdus tiamatea, the first member of the Archaea ever isolated from a deep-sea anoxic brine. Genome comparison with Halorhabdus utahensis revealed some striking differences, including a marked increase in genes associated with transmembrane transport and putative genes for a trehalose synthase and a lactate dehydrogenase.

Genome sequence of Halorhabdus tiamatea, the first archaeon isolated from a deep-sea anoxic brine lake.

KAUST Repository

Antunes, Andre; Alam, Intikhab; Bajic, Vladimir B.; Stingl, Ulrich

2011-01-01

We present the draft genome of Halorhabdus tiamatea, the first member of the Archaea ever isolated from a deep-sea anoxic brine. Genome comparison with Halorhabdus utahensis revealed some striking differences, including a marked increase in genes associated with transmembrane transport and putative genes for a trehalose synthase and a lactate dehydrogenase.

Nano-sized calcium phosphate (CaP) carriers for non-viral gene deilvery

Energy Technology Data Exchange (ETDEWEB)

Lee, Donghyun, E-mail: dhlee@cau.ac.kr [Department of Biomedical Engineering, Division of Integrative Engineering, Chung-Ang University, 221 Heukseok-Dong, Dongjak-Gu, Seoul 156-756 (Korea, Republic of); Upadhye, Kalpesh [Department of Bioengineering, University of Pittsburgh, Pittsburgh, PA 15260 (United States); Kumta, Prashant N., E-mail: pkumta@pitt.edu [Department of Bioengineering, University of Pittsburgh, Pittsburgh, PA 15260 (United States); Department of Mechanical Engineering and Materials Sceince, University of Pittsburgh, Pittsburgh, PA 15260 (United States); Department of Chemical and Petroleum Engineering, University of Pittsburgh, Pittsburgh, PA 15260 (United States); Center for Complex Engineered Multifunctional Materials, University of Pittsburgh, Pittsburgh, PA 15261 (United States)

2012-02-25

Highlights: Black-Right-Pointing-Pointer Nanostructured calcium phosphates (NanoCaPs): comprehensive review. Black-Right-Pointing-Pointer Non viral gene delivery mechanisms: detailed mechanisms are outlined. Black-Right-Pointing-Pointer Barriers to non-viral gene delivery: detailed barriers are discussed. - Abstract: Gene therapy has garnered much interest due to the potential for curing multiple inherited and/or increases in the acquired diseases. As a result, there has been intense activity from multiple research groups for developing effective delivery methods and carriers, which is a critical step in advancing gene delivery technologies. In order for the carriers to effectively deliver the genetic payloads, multiple extracellular and intracellular barriers need to be overcome. Although overcoming these challenges to improve the effectiveness is critical, the development of safe gene delivery agents is even more vital to assure its use in clinical applications. The development of safe and effective strategies has therefore been a major challenge impeding gene therapy progress. In this regard, calcium phosphate (CaP) based nano-particles has been considered as one of the candidate non-viral gene delivery vehicles, but has been plagued by inconsistent and low transfection efficiencies limiting its progress. There has been major research effort to improve the consistency and effectiveness of CaP based vectors. Currently, it is therefore thought that by controlling the various synthesis factors such as Ca/P ratio, mode of mixing, and type of calcium phosphate phase, such variability and inefficiency could be modulated. This review attempts to provide a comprehensive analysis of the current research activity in the development of CaP based ceramic and polymer-ceramic hybrid systems for non-viral gene delivery. Preliminary transfection results of hydroxyapatite (HA or NanoCaPs), amorphous calcium phosphate (ACP) and brushite phases are also compared to assess the

Trehalose Alters Subcellular Trafficking and the Metabolism of the Alzheimer-associated Amyloid Precursor Protein.

Science.gov (United States)

Tien, Nguyen T; Karaca, Ilker; Tamboli, Irfan Y; Walter, Jochen

2016-05-13

The disaccharide trehalose is commonly considered to stimulate autophagy. Cell treatment with trehalose could decrease cytosolic aggregates of potentially pathogenic proteins, including mutant huntingtin, α-synuclein, and phosphorylated tau that are associated with neurodegenerative diseases. Here, we demonstrate that trehalose also alters the metabolism of the Alzheimer disease-related amyloid precursor protein (APP). Cell treatment with trehalose decreased the degradation of full-length APP and its C-terminal fragments. Trehalose also reduced the secretion of the amyloid-β peptide. Biochemical and cell biological experiments revealed that trehalose alters the subcellular distribution and decreases the degradation of APP C-terminal fragments in endolysosomal compartments. Trehalose also led to strong accumulation of the autophagic marker proteins LC3-II and p62, and decreased the proteolytic activation of the lysosomal hydrolase cathepsin D. The combined data indicate that trehalose decreases the lysosomal metabolism of APP by altering its endocytic vesicular transport. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.

A single dose of a DNA vaccine encoding apa coencapsulated with 6,6'-trehalose dimycolate in microspheres confers long-term protection against tuberculosis in Mycobacterium bovis BCG-primed mice.

Science.gov (United States)

Carlétti, Dyego; Morais da Fonseca, Denise; Gembre, Ana Flávia; Masson, Ana Paula; Weijenborg Campos, Lívia; Leite, Luciana C C; Rodrigues Pires, Andréa; Lannes-Vieira, Joseli; Lopes Silva, Célio; Bonato, Vânia Luiza Deperon; Horn, Cynthia

2013-08-01

Mycobacterium bovis BCG prime DNA (Mycobacterium tuberculosis genes)-booster vaccinations have been shown to induce greater protection against tuberculosis (TB) than BCG alone. This heterologous prime-boost strategy is perhaps the most realistic vaccination for the future of TB infection control, especially in countries where TB is endemic. Moreover, a prime-boost regimen using biodegradable microspheres seems to be a promising immunization to stimulate a long-lasting immune response. The alanine proline antigen (Apa) is a highly immunogenic glycoprotein secreted by M. tuberculosis. This study investigated the immune protection of Apa DNA vaccine against intratracheal M. tuberculosis challenge in mice on the basis of a heterologous prime-boost regimen. BALB/c mice were subcutaneously primed with BCG and intramuscularly boosted with a single dose of plasmid carrying apa and 6,6'-trehalose dimycolate (TDM) adjuvant, coencapsulated in microspheres (BCG-APA), and were evaluated 30 and 70 days after challenge. This prime-boost strategy (BCG-APA) resulted in a significant reduction in the bacterial load in the lungs, thus leading to better preservation of the lung parenchyma, 70 days postinfection compared to BCG vaccinated mice. The profound effect of this heterologous prime-boost regimen in the experimental model supports its development as a feasible strategy for prevention of TB.

Protective Effects of Trehalose on the Corneal Epithelial Cells

Directory of Open Access Journals (Sweden)

Pasquale Aragona

2014-01-01

Full Text Available Purpose. Aim of the present work was to evaluate the effects of the trehalose on the corneal epithelium undergoing alcohol delamination. Methods. Twelve patients undergoing laser subepithelial keratomileusis (LASEK were consecutively included in the study. The right eyes were pretreated with 3% trehalose eye drops, whilst left eyes were used as control. Epithelial specimens were processed for cells vitality assessment, apoptosis, and light and transmission electron microscopy; a morphometric analysis was performed in both groups. Results. In both trehalose-untreated eyes (TUE and trehalose-treated eyes (TTE, the percentage of vital cells was similar and no apoptotic cells were observed. In TUE, the corneal epithelium showed superficial cells with reduced microfolds, wing cells with vesicles and dilated intercellular spaces, and dark basal cells with vesicles and wide clefts. In TTE, superficial and wing cells were better preserved, and basal cells were generally clear with intracytoplasmatic vesicles. The morphometric analysis showed statistically significant differences between the two groups: the TTE epithelial height was higher, the basal cells showed larger area and clearer cytoplasm. The distribution of desmosomes and hemidesmosomes was significantly different between the groups. Conclusions. Trehalose administration better preserved morphological and morphometric features of alcohol-treated corneal epithelium, when compared to controls.

Hexose-6-phosphate dehydrogenase contributes to skeletal muscle homeostasis independent of 11β-hydroxysteroid dehydrogenase type 1.

LENUS (Irish Health Repository)

Semjonous, Nina M

2011-01-01

Glucose-6-phosphate (G6P) metabolism by the enzyme hexose-6-phosphate dehydrogenase (H6PDH) within the sarcoplasmic reticulum lumen generates nicotinamide adenine dinucleotide phosphate (reduced) to provide the redox potential for the enzyme 11β-hydroxysteroid dehydrogenase type 1 (11β-HSD1) to activate glucocorticoid (GC). H6PDH knockout (KO) mice have a switch in 11β-HSD1 activity, resulting in GC inactivation and hypothalamic-pituitary-adrenal axis activation. Importantly, H6PDHKO mice develop a type II fiber myopathy with abnormalities in glucose metabolism and activation of the unfolded protein response (UPR). GCs play important roles in muscle physiology, and therefore, we have examined the importance of 11β-HSD1 and GC metabolism in mediating aspects of the H6PDHKO myopathy. To achieve this, we examined 11β-HSD1\\/H6PDH double-KO (DKO) mice, in which 11β-HSD1 mediated GC inactivation is negated. In contrast to H6PDHKO mice, DKO mice GC metabolism and hypothalamic-pituitary-adrenal axis set point is similar to that observed in 11β-HSD1KO mice. Critically, in contrast to 11β-HSD1KO mice, DKO mice phenocopy the salient features of the H6PDHKO, displaying reduced body mass, muscle atrophy, and vacuolation of type II fiber-rich muscle, fasting hypoglycemia, increased muscle glycogen deposition, and elevated expression of UPR genes. We propose that muscle G6P metabolism through H6PDH may be as important as changes in the redox environment when considering the mechanism underlying the activation of the UPR and the ensuing myopathy in H6PDHKO and DKO mice. These data are consistent with an 11β-HSD1-independent function for H6PDH in which sarcoplasmic reticulum G6P metabolism and nicotinamide adenine dinucleotide phosphate-(oxidized)\\/nicotinamide adenine dinucleotide phosphate (reduced) redox status are important for maintaining muscle homeostasis.

Analysis of Human Bradykinin Receptor Gene and Endothelial Nitric Oxide Synthase Gene Polymorphisms in End-Stage Renal Disease Among Malaysians

Directory of Open Access Journals (Sweden)

R. Vasudevan

2014-06-01

Full Text Available The aim of this study was to determine the association of the c.894G>T; p.Glu298Asp polymorphism and the variable number tandem repeat (VNTR polymorphism of the endothelial nitric oxide synthase (eNOS gene and c.181C>T polymorphism of the bradykinin type 2 receptor gene (B2R in Malaysian end-stage renal disease (ESRD subjects.

Expression of an (E-β-farnesene synthase gene from Asian peppermint in tobacco affected aphid infestation

Directory of Open Access Journals (Sweden)

Xiudao Yu

2013-10-01

Full Text Available Aphids are major agricultural pests that cause significant yield losses in crop plants each year. (E-β-farnesene (EβF is the main or only component of an alarm pheromone involved in chemical communication within aphid species and particularly in the avoidance of predation. EβF also occurs in the essential oil of some plant species, and is catalyzed by EβF synthase. By using oligonucleotide primers designed from the known sequence of an EβF synthase gene from black peppermint (Mentha × piperita, two cDNA sequences, MaβFS1 and MaβFS2, were isolated from Asian peppermint (Mentha asiatica. Expression pattern analysis showed that the MaβFS1 gene exhibited higher expression in flowers than in roots, stems and leaves at the transcriptional level. Overexpression of MaβFS1 in tobacco plants resulted in emission of pure EβF ranging from 2.62 to 4.85 ng d− 1 g− 1 of fresh tissue. Tritrophic interactions involving peach aphids (Myzus persicae, and predatory lacewing (Chrysopa septempunctata larvae demonstrated that transgenic tobacco expressing MaβFS1 had lower aphid infestation. This result suggested that the EβF synthase gene from Asian peppermint could be a good candidate for genetic engineering of agriculturally important crop plants.

[Interspecific polymorphism of the glucosyltransferase domain of the sucrose synthase gene in the genus Malus and related species of Rosaceae].

Science.gov (United States)

Boris, K V; Kochieva, E Z; Kudryavtsev, A M

2014-12-01

The sequences that encode the main functional glucosyltransferase domain of sucrose synthase genes have been identified for the first time in 14 species of the genus Malus and related species of the family Rosaceae, and their polymorphism was investigated. Single nucleotide substitutions leading to amino acid substitutions in the protein sequence, including the conservative transmembrane motif sequence common to all sucrose synthase genes of higher plants, were detected in the studied sequences.

Prevalence of glucose-6-phosphate dehydrogenase deficiency in ...

African Journals Online (AJOL)

Background: Glucose-6-phosphate dehydrogenase (G6PD) is a house keeping enzyme which catalyzes the first step in the hexose monophosphate pathway of glucose metabolism. G6PD deficiency is the commonest hemolytic X-linked genetic disease, which affects approximately 400 million people worldwide.

IDENTIFICATION AND CHARACTERIZATION OF THE SUCROSE SYNTHASE 2 GENE (Sus2 IN DURUM WHEAT

Directory of Open Access Journals (Sweden)

Mariateresa eVolpicella

2016-03-01

Full Text Available Sucrose transport is the central system for the allocation of carbon resources in vascular plants. Sucrose synthase, which reversibly catalyzes sucrose synthesis and cleavage, represents a key enzyme in the control of the flow of carbon into starch biosynthesis. In the present study the genomic identification and characterization of the Sus2-2A and Sus2-2B genes coding for sucrose synthase in durum wheat (cultivars Ciccio and Svevo is reported. The genes were analyzed for their expression in different tissues and at different seed maturation stages, in four tetraploid wheat genotypes (Svevo, Ciccio, Primadur and 5-BIL42. The activity of the encoded proteins was evaluated by specific activity assays on endosperm extracts and their structure established by modelling approaches. The combined results of SUS2 expression and activity levels were then considered in the light of their possible involvement in starch yield.

Trehalose During Two Stress Responsesin Acanthamoeba: DifferentiationBetween Encystation and Pseudocyst Formation

Czech Academy of Sciences Publication Activity Database

Bínová, E.; Bína, David; Ashford, D.; Thomas-Oates, J.; Nohýnková, E.

2017-01-01

Roč. 168, č. 6 (2017), s. 649-662 ISSN 1434-4610 Institutional support: RVO:60077344 Keywords : Trehalose Acanthamoeba * Acanthamoeba * cyst - pseudocyst Subject RIV: CE - Biochemistry OBOR OECD: Biochemistry and molecular biology Impact factor: 2.794, year: 2016

[Cellulose synthase genes that control the fiber formation of flax (Linum usitatissimum L.)].

Science.gov (United States)

Galinovskiĭ, D V; Anisimova, N V; Raĭskiĭ, A P; Leont'ev, V N; Titok, V V; Hotyleva, L V

2014-01-01

Four cellulose synthase genes were identified by analysis of their class-specific regions (CSRII) in plants of fiber flax during the "rapid growth" stage. These genes were designated as LusCesA1, LusCesA4, LusCesA7 and LusCesA9. LusCesA4, LusCesA7, and LusCesA9 genes were expressed in the stem; LusCesA1 and LusCesA4 genes were expressed in the apex part of plants, and the LusCesA4 gene was expressed in the leaves of fiber flax. The expression of the LusCesA7 and LusCesA9 genes was specific to the stems of fiber flax. These genes may influence the quality of the flax fiber.

Heterooligomeric phosphoribosyl diphosphate synthase of Saccharomyces cerevisiae

DEFF Research Database (Denmark)

Hove-Jensen, Bjarne

2004-01-01

The yeast Saccharomyces cerevisiae contains five phosphoribosyl diphosphate (PRPP) synthase-homologous genes (PRS1-5), which specify PRPP synthase subunits 1-5. Expression of the five S. cerevisiae PRS genes individually in an Escherichia coli PRPP-less strain (Deltaprs) showed that a single PRS...

Reduced methylation of the thromboxane synthase gene is correlated with its increased vascular expression in preeclampsia.

Science.gov (United States)

Mousa, Ahmad A; Strauss, Jerome F; Walsh, Scott W

2012-06-01

Preeclampsia is characterized by increased thromboxane and decreased prostacyclin levels, which predate symptoms, and can explain some of the clinical manifestations of preeclampsia, including hypertension and thrombosis. In this study, we examined DNA methylation of the promoter region of the thromboxane synthase gene (TBXAS1) and the expression of thromboxane synthase in systemic blood vessels of normal pregnant and preeclamptic women. Thromboxane synthase is responsible for the synthesis of thromboxane A(2), a potent vasoconstrictor and activator of platelets. We also examined the effect of experimentally induced DNA hypomethylation on the expression of thromboxane synthase in a neutrophil-like cell line (HL-60 cells) and in cultured vascular smooth muscle and endothelial cells. We found that DNA methylation of the TBXAS1 promoter was decreased and thromboxane synthase expression was increased in omental arteries of preeclamptic women as compared with normal pregnant women. Increased thromboxane synthase expression was observed in vascular smooth muscles cells, endothelial cells, and infiltrating neutrophils. Experimentally induced DNA hypomethylation only increased expression of thromboxane synthase in the neutrophil-like cell line, whereas tumor necrosis factor-α, a neutrophil product, increased its expression in cultured vascular smooth muscle cells. Our study suggests that epigenetic mechanisms and release of tumor necrosis factor-α by infiltrating neutrophils could contribute to the increased expression of thromboxane synthase in maternal systemic blood vessels, contributing to the hypertension and coagulation abnormalities associated with preeclampsia.

Two apparent glucose-6-phosphate dehydrogenase variants in normal XY males: G6PD Alabama.

Science.gov (United States)

Prchal, J T; Hall, K; Csepreghy, M; Lilly, M; Berkow, R; Scott, C W

1988-03-01

A six-year-old black boy who had transient hemolysis after a viral infection was found to have mildly decreased red cell glucose-6-phosphate dehydrogenase (G6PD) activity (1.25 IU/g hemoglobin). Two G6PD bands, both slightly faster than normal G6PD B, were seen on electrophoresis in both the propositus as well as in his maternal grandfather. This is an unexpected finding, since the G6PD gene is located on the long arm of the X chromosome that is subject to X-chromosome inactivation, and available evidence indicates that it is present as a single functional copy in the human genome. The obvious possibility of duplication of the X chromosome was eliminated by cytogenetic analysis with G-banding. G6PD duplication is unlikely, since peripheral blood granulocytes, platelets, and lymphocytes; cultured skin and bone marrow fibroblasts; and Epstein-Barr virus-stimulated lymphocytes yielded only a single electrophoretic band with mobility identical to the slower band seen in crude red blood cell hemolysate. Study of partially purified red blood cell hemolysate G6PD also yielded a single band with identical mobility. Kinetic studies of the enzyme in the propositus and in three generations of his family identified a unique, previously unpublished G6PD mutant that is herein designated G6PD Alabama. Red blood cells were separated by density gradient into a reticulocyte-enriched, an intermediate, and a dense, older portion. Two distinct enzyme bands were identified on electrophoresis of hemolysate from the reticulocyte-enriched portion, but not from the other two portions. It is postulated that two transcriptional products of the mutant G6PD gene exist; one with a short half-life and detectable only in young red blood cells, and another with a longer half-life present in all cells. The existence of two distinct mutant genes in the genome or a unique post-translational form of the mutant G6PD detected only in reticulocytes cannot be excluded.

Importance of glucose-6-phosphate dehydrogenase (G6PDH) for vanillin tolerance in Saccharomyces cerevisiae.

Science.gov (United States)

Nguyen, Trinh Thi My; Kitajima, Sakihito; Izawa, Shingo

2014-09-01

Vanillin is derived from lignocellulosic biomass and, as one of the major biomass conversion inhibitors, inhibits yeast growth and fermentation. Vanillin was recently shown to induce the mitochondrial fragmentation and formation of mRNP granules such as processing bodies and stress granules in Saccharomyces cerevisiae. Furfural, another major biomass conversion inhibitor, also induces oxidative stress and is reduced in an NAD(P)H-dependent manner to its less toxic alcohol derivative. Therefore, the pentose phosphate pathway (PPP), through which most NADPH is generated, plays a role in tolerance to furfural. Although vanillin also induces oxidative stress and is reduced to vanillyl alcohol in a NADPH-dependent manner, the relationship between vanillin and PPP has not yet been investigated. In the present study, we examined the importance of glucose-6-phosphate dehydrogenase (G6PDH), which catalyzes the rate-limiting NADPH-producing step in PPP, for yeast tolerance to vanillin. The growth of the null mutant of G6PDH gene (zwf1Δ) was delayed in the presence of vanillin, and vanillin was efficiently reduced in the culture of wild-type cells but not in the culture of zwf1Δ cells. Furthermore, zwf1Δ cells easily induced the activation of Yap1, an oxidative stress responsive transcription factor, mitochondrial fragmentation, and P-body formation with the vanillin treatment, which indicated that zwf1Δ cells were more susceptible to vanillin than wild type cells. These findings suggest the importance of G6PDH and PPP in the response of yeast to vanillin. Copyright © 2014 The Society for Biotechnology, Japan. Published by Elsevier B.V. All rights reserved.

daf-16/FoxO promotes gluconeogenesis and trehalose synthesis during starvation to support survival.

Science.gov (United States)

Hibshman, Jonathan D; Doan, Alexander E; Moore, Brad T; Kaplan, Rebecca Ew; Hung, Anthony; Webster, Amy K; Bhatt, Dhaval P; Chitrakar, Rojin; Hirschey, Matthew D; Baugh, L Ryan

2017-10-24

daf-16 /FoxO is required to survive starvation in Caenorhabditis elegans , but how daf-16I FoxO promotes starvation resistance is unclear. We show that daf-16 /FoxO restructures carbohydrate metabolism by driving carbon flux through the glyoxylate shunt and gluconeogenesis and into synthesis of trehalose, a disaccharide of glucose. Trehalose is a well-known stress protectant, capable of preserving membrane organization and protein structure during abiotic stress. Metabolomic, genetic, and pharmacological analyses confirm increased trehalose synthesis and further show that trehalose not only supports survival as a stress protectant but also serves as a glycolytic input. Furthermore, we provide evidence that metabolic cycling between trehalose and glucose is necessary for this dual function of trehalose. This work demonstrates that daf-16 /FoxO promotes starvation resistance by shifting carbon metabolism to drive trehalose synthesis, which in turn supports survival by providing an energy source and acting as a stress protectant.

daf-16/FoxO promotes gluconeogenesis and trehalose synthesis during starvation to support survival

Science.gov (United States)

Hibshman, Jonathan D; Doan, Alexander E; Moore, Brad T; Kaplan, Rebecca EW; Hung, Anthony; Webster, Amy K; Bhatt, Dhaval P; Chitrakar, Rojin; Hirschey, Matthew D

2017-01-01

daf-16/FoxO is required to survive starvation in Caenorhabditis elegans, but how daf-16IFoxO promotes starvation resistance is unclear. We show that daf-16/FoxO restructures carbohydrate metabolism by driving carbon flux through the glyoxylate shunt and gluconeogenesis and into synthesis of trehalose, a disaccharide of glucose. Trehalose is a well-known stress protectant, capable of preserving membrane organization and protein structure during abiotic stress. Metabolomic, genetic, and pharmacological analyses confirm increased trehalose synthesis and further show that trehalose not only supports survival as a stress protectant but also serves as a glycolytic input. Furthermore, we provide evidence that metabolic cycling between trehalose and glucose is necessary for this dual function of trehalose. This work demonstrates that daf-16/FoxO promotes starvation resistance by shifting carbon metabolism to drive trehalose synthesis, which in turn supports survival by providing an energy source and acting as a stress protectant. PMID:29063832

Selection of reference genes for gene expression studies in pig tissues using SYBR green qPCR

DEFF Research Database (Denmark)

Hillig, Ann-Britt Nygaard; Jørgensen, Claus Bøttcher; Cirera, Susanna

2007-01-01

-microglobulin (B2M), glyceraldehyde-3-phosphate dehydrogenase (GAPDH), hydroxymethylbilane synthase (HMBS), hypoxanthine phosphoribosyltransferase I (HPRT I), ribosomal protein L4 (RPL4), succinate dehydrogenase complex subunit A (SDHA), TATA box binding protein (TPB) and tyrosine 3-monooxygenase/tryptophan 5......-monooxygenase activation protein zeta polypeptide (YWHAZ). The stability of these reference genes in different pig tissues was investigated using the geNorm application. The range of expression stability in the genes analysed was (from the most stable to the least stable): ACTB/RPL4, TBP, HPRT, HMBS, YWHAZ...

Structural Basis for Substrate Specificity in Phosphate Binding (beta/alpha)8-Barrels: D-Allulose 6-Phosphate 3-Epimerase from Escherichia coli K-12

Energy Technology Data Exchange (ETDEWEB)

Chan,K.; Fedorov, A.; Almo, S.; Gerlt, J.

2008-01-01

Enzymes that share the ({beta}/{alpha})8-barrel fold catalyze a diverse range of reactions. Many utilize phosphorylated substrates and share a conserved C-terminal ({beta}/a)2-quarter barrel subdomain that provides a binding motif for the dianionic phosphate group. We recently reported functional and structural studies of d-ribulose 5-phosphate 3-epimerase (RPE) from Streptococcus pyogenes that catalyzes the equilibration of the pentulose 5-phosphates d-ribulose 5-phosphate and d-xylulose 5-phosphate in the pentose phosphate pathway [J. Akana, A. A. Fedorov, E. Fedorov, W. R. P. Novack, P. C. Babbitt, S. C. Almo, and J. A. Gerlt (2006) Biochemistry 45, 2493-2503]. We now report functional and structural studies of d-allulose 6-phosphate 3-epimerase (ALSE) from Escherichia coli K-12 that catalyzes the equilibration of the hexulose 6-phosphates d-allulose 6-phosphate and d-fructose 6-phosphate in a catabolic pathway for d-allose. ALSE and RPE prefer their physiological substrates but are promiscuous for each other's substrate. The active sites (RPE complexed with d-xylitol 5-phosphate and ALSE complexed with d-glucitol 6-phosphate) are superimposable (as expected from their 39% sequence identity), with the exception of the phosphate binding motif. The loop following the eighth {beta}-strand in ALSE is one residue longer than the homologous loop in RPE, so the binding site for the hexulose 6-phosphate substrate/product in ALSE is elongated relative to that for the pentulose 5-phosphate substrate/product in RPE. We constructed three single-residue deletion mutants of the loop in ALSE, ?T196, ?S197 and ?G198, to investigate the structural bases for the differing substrate specificities; for each, the promiscuity is altered so that d-ribulose 5-phosphate is the preferred substrate. The changes in kcat/Km are dominated by changes in kcat, suggesting that substrate discrimination results from differential transition state stabilization. In both ALSE and RPE, the

The encapsulation and intracellular delivery of trehalose using a thermally responsive nanocapsule

Energy Technology Data Exchange (ETDEWEB)

Zhang Wujie; He Xiaoming [Department of Mechanical Engineering, University of South Carolina, 300 Main Street, Columbia, SC 29208 (United States); Rong Jianhua; Wang Qian [Department of Chemistry and Biochemistry, University of South Carolina, 631 Sumter Street, Columbia, SC 29208 (United States)], E-mail: xmhe@sc.edu

2009-07-08

The thermally responsive wall permeability of an empty core-shell structured Pluronic nanocapsule (together with its temperature dependent size and surface charge) was successfully utilized for encapsulation, intracellular delivery, and controlled release of trehalose, a highly hydrophilic small (M{sub W} = 342 D) molecule (a disaccharide of glucose) that is exceptional for long-term stabilization of biologicals (particularly at ambient temperatures). It was found that trehalose can be physically encapsulated in the nanocapsule using a soaking-freeze-drying-heating procedure. The nanocapsule is capable of physically withholding trehalose with negligible release in hours for cellular uptake at 37 deg. C when its wall permeability is low. A quick release of the encapsulated sugar can be achieved by thermally cycling the nanocapsule between 37 and 22 deg. C (or lower). A significant amount of trehalose (up to 0.3 M) can be delivered into NIH 3T3 fibroblasts by incubating the cells with the trehalose-encapsulated nanocapsules at 37 deg. C for 40 min. Moreover, cytotoxicity of the nanocapsule for the purpose of intracellular delivery of trehalose was found to be negligible. Altogether, the thermally responsive nanocapsule is effective for intracellular delivery of trehalose, which is critical for the long-term stabilization of mammalian cells at ambient temperatures and the eventual success of modern cell-based medicine.

Functional analysis of the cellulose synthase-like genes CSLD1, CSLD2 and CSLD4 in tip-growing arabidopsis cells

DEFF Research Database (Denmark)

Bernal Giraldo, Adriana Jimena; Yoo, Cheol-Min; Mutwil, Marek

2008-01-01

A reverse genetic approach was used to investigate the functions of three members of the cellulose synthase superfamily in Arabidopsis (Arabidopsis thaliana), CELLULOSE SYNTHASE-LIKE D1 (CSLD1), CSLD2, and CSLD4. CSLD2 is required for normal root hair growth but has a different role from that pre......A reverse genetic approach was used to investigate the functions of three members of the cellulose synthase superfamily in Arabidopsis (Arabidopsis thaliana), CELLULOSE SYNTHASE-LIKE D1 (CSLD1), CSLD2, and CSLD4. CSLD2 is required for normal root hair growth but has a different role from...... for insertions in these genes were partially rescued by reduced temperature growth. However, this was not the case for a double mutant homozygous for insertions in both CSLD2 and CSLD3, suggesting that there may be partial redundancy in the functions of these genes. Mutants in CSLD1 and CSLD4 had a defect...

Characterization of trehalose aqueous solutions by neutron spin echo

CERN Document Server

Branca, C; Magazù, S; Maisano, G; Mangione, A; Pappas, C; Triolo, A

2002-01-01

The present work reports neutron spin-echo (NSE) results on aqueous mixtures of trehalose, a naturally occurring disaccharide of glucose, which shows an extraordinary bioprotective effectiveness against dehydration and freezing. The aim of the work is to furnish new results on the dynamics of the trehalose/water system on the nano- and picosecond scales. (orig.)

Characterization of trehalose aqueous solutions by neutron spin echo

Energy Technology Data Exchange (ETDEWEB)

Branca, C.; Faraone, A.; Magazu' , S.; Maisano, G.; Mangione, A. [Dipartimento di Fisica and INFM, Universita di Messina, PO Box 55, 98166 Messina (Italy); Pappas, C.; Triolo, A. [Hahn-Meitner-Institut, BENSC (NI), Glienicker Strasse, 14109 Berlin (Germany)

2002-07-01

The present work reports neutron spin-echo (NSE) results on aqueous mixtures of trehalose, a naturally occurring disaccharide of glucose, which shows an extraordinary bioprotective effectiveness against dehydration and freezing. The aim of the work is to furnish new results on the dynamics of the trehalose/water system on the nano- and picosecond scales. (orig.)

The Cer-cqu gene cluster determines three key players in a β-diketone synthase polyketide pathway synthesizing aliphatics in epicuticular waxes

DEFF Research Database (Denmark)

Schneider, Lizette Marais; Adamski, Nikolai M.; Christensen, Caspar Elo

2016-01-01

identification of mutants in their synthesis or transport. The present study discloses three such Eceriferum (cer) genes in barley - Cer-c, Cer-q and Cer-u - known to be tightly linked and functioning in a biochemical pathway forming dominating amounts of β-diketone and hydroxy-β-diketones plus some esterified...... alkan-2-ols. These aliphatics are present in many Triticeae as well as dicotyledons such as Eucalyptus and Dianthus. Recently developed genomic resources and mapping populations in barley defined these genes to a small region on chromosome arm 2HS. Exploiting Cer-c and -u potential functions pinpointed...... five candidates, of which three were missing in apparent cer-cqu triple mutants. Sequencing more than 50 independent mutants for each gene confirmed their identification. Cer-c is a chalcone synthase-like polyketide synthase, designated diketone synthase (DKS), Cer-q is a lipase/carboxyl transferase...

Identification and molecular characterization of nitric oxide synthase (NOS) gene in the intertidal copepod Tigriopus japonicus.

Science.gov (United States)

Jeong, Chang-Bum; Kang, Hye-Min; Seo, Jung Soo; Park, Heum Gi; Rhee, Jae-Sung; Lee, Jae-Seong

2016-02-10

In copepods, no information has been reported on the structure or molecular characterization of the nitric oxide synthase (NOS) gene. In the intertidal copepod Tigriopus japonicus, we identified a NOS gene that is involved in immune responses of vertebrates and invertebrates. In silico analyses revealed that nitric oxide (NO) synthase domains, such as the oxygenase and reductase domains, are highly conserved in the T. japonicus NOS gene. The T. japonicus NOS gene was highly transcribed in the nauplii stages, implying that it plays a role in protecting the host during the early developmental stages. To examine the involvement of the T. japonicus NOS gene in the innate immune response, the copepods were exposed to lipopolysaccharide (LPS) and two Vibrio sp. After exposure to different concentrations of LPS and Vibrio sp., T. japonicus NOS transcription was significantly increased over time in a dose-dependent manner, and the NO/nitrite concentration increased as well. Taken together, our findings suggest that T. japonicus NOS transcription is induced in response to an immune challenge as part of the conserved innate immunity. Copyright © 2015 Elsevier B.V. All rights reserved.

Synthesis of alkyl-ether glycerophospholipids in rat glomerular mesangial cells: evidence for alkyldihydroxyacetone phosphate synthase activity

International Nuclear Information System (INIS)

Zanglis, A.; Lianos, E.A.

1987-01-01

We studied the ability of rat glomerular mesangial cells and their microsomal fractions to incorporate 1-[ 14 C]hexadecanol to glycerophospholipids via an O-alkyl ether linkage and assessed the presence and activity of the required enzyme: alkyl-dihydroxy acetone phosphate synthase. Suspensions of cultured mesangial cells incorporated 1-[ 14 C]hexadecanol to the phosphatidyl ethanolamine and phosphatidyl choline lipid pools, via a bond resistant to acid and base hydrolysis. When cell homogenates or microsomal fractions were incubated with palmitoyl-DHAP and 1-[ 14 C]hexadecanol, alkyl-DHAP and 1-O-alkyl glycerol were formed (alkyl:hexadecyl). The activity of the enzyme responsible for the O-alkyl product formation was calculated to be 2.5 +/- 0.3 and 544 +/- 50 pmoles/min/mg protein for mesangial cell homogenates and mesangial cell microsomes, respectively. These observations provide evidence that mesangial cells may elaborate either linked lipid precursors de novo for the biosynthesis of O-alkyl glycerophospholipids

High polyhydroxybutyrate production in Pseudomonas extremaustralis is associated with differential expression of horizontally acquired and core genome polyhydroxyalkanoate synthase genes.

Directory of Open Access Journals (Sweden)

Mariela V Catone

Full Text Available Pseudomonas extremaustralis produces mainly polyhydroxybutyrate (PHB, a short chain length polyhydroxyalkanoate (sclPHA infrequently found in Pseudomonas species. Previous studies with this strain demonstrated that PHB genes are located in a genomic island. In this work, the analysis of the genome of P. extremaustralis revealed the presence of another PHB cluster phbFPX, with high similarity to genes belonging to Burkholderiales, and also a cluster, phaC1ZC2D, coding for medium chain length PHA production (mclPHA. All mclPHA genes showed high similarity to genes from Pseudomonas species and interestingly, this cluster also showed a natural insertion of seven ORFs not related to mclPHA metabolism. Besides PHB, P. extremaustralis is able to produce mclPHA although in minor amounts. Complementation analysis demonstrated that both mclPHA synthases, PhaC1 and PhaC2, were functional. RT-qPCR analysis showed different levels of expression for the PHB synthase, phbC, and the mclPHA synthases. The expression level of phbC, was significantly higher than the obtained for phaC1 and phaC2, in late exponential phase cultures. The analysis of the proteins bound to the PHA granules showed the presence of PhbC and PhaC1, whilst PhaC2 could not be detected. In addition, two phasin like proteins (PhbP and PhaI associated with the production of scl and mcl PHAs, respectively, were detected. The results of this work show the high efficiency of a foreign gene (phbC in comparison with the mclPHA core genome genes (phaC1 and phaC2 indicating that the ability of P. extremaustralis to produce high amounts of PHB could be explained by the different expression levels of the genes encoding the scl and mcl PHA synthases.

Glucose-6-phosphate reduces calcium accumulation in rat brain endoplasmic reticulum

Directory of Open Access Journals (Sweden)

Jeffrey Thomas Cole

2012-04-01

Full Text Available Brain cells expend large amounts of energy sequestering calcium (Ca2+, while loss of Ca2+ compartmentalization leads to cell damage or death. Upon cell entry, glucose is converted to glucose-6-phosphate (G6P, a parent substrate to several metabolic major pathways, including glycolysis. In several tissues, G6P alters the ability of the endoplasmic reticulum to sequester Ca2+. This led to the hypothesis that G6P regulates Ca2+ accumulation by acting as an endogenous ligand for sarco-endoplasmic reticulum calcium ATPase (SERCA. Whole brain ER microsomes were pooled from adult male Sprague-Dawley rats. Using radio-isotopic assays, 45Ca2+ accumulation was quantified following incubation with increasing amounts of G6P, in the presence or absence of thapsigargin, a potent SERCA inhibitor. To qualitatively assess SERCA activity, the simultaneous release of inorganic phosphate (Pi coupled with Ca2+ accumulation was quantified. Addition of G6P significantly and decreased Ca2+ accumulation in a dose-dependent fashion (1-10 mM. The reduction in Ca2+ accumulation was not significantly different that seen with addition of thapsigargin. Addition of glucose-1-phosphate or fructose-6-phosphate, or other glucose metabolic pathway intermediates, had no effect on Ca2+ accumulation. Further, the release of Pi was markedly decreased, indicating G6P-mediated SERCA inhibition as the responsible mechanism for reduced Ca2+ uptake. Simultaneous addition of thapsigargin and G6P did decrease inorganic phosphate in comparison to either treatment alone, which suggests that the two treatments have different mechanisms of action. Therefore, G6P may be a novel, endogenous regulator of SERCA activity. Additionally, pathological conditions observed during disease states that disrupt glucose homeostasis, may be attributable to Ca2+ dystasis caused by altered G6P regulation of SERCA activity

Quantitative transcription dynamic analysis reveals candidate genes and key regulators for ethanol tolerance in Saccharomyces cerevisiae

Directory of Open Access Journals (Sweden)

Ma Menggen

2010-06-01

Full Text Available Abstract Background Derived from our lignocellulosic conversion inhibitor-tolerant yeast, we generated an ethanol-tolerant strain Saccharomyces cerevisiae NRRL Y-50316 by enforced evolutionary adaptation. Using a newly developed robust mRNA reference and a master equation unifying gene expression data analyses, we investigated comparative quantitative transcription dynamics of 175 genes selected from previous studies for an ethanol-tolerant yeast and its closely related parental strain. Results A highly fitted master equation was established and applied for quantitative gene expression analyses using pathway-based qRT-PCR array assays. The ethanol-tolerant Y-50316 displayed significantly enriched background of mRNA abundance for at least 35 genes without ethanol challenge compared with its parental strain Y-50049. Under the ethanol challenge, the tolerant Y-50316 responded in consistent expressions over time for numerous genes belonging to groups of heat shock proteins, trehalose metabolism, glycolysis, pentose phosphate pathway, fatty acid metabolism, amino acid biosynthesis, pleiotropic drug resistance gene family and transcription factors. The parental strain showed repressed expressions for many genes and was unable to withstand the ethanol stress and establish a viable culture and fermentation. The distinct expression dynamics between the two strains and their close association with cell growth, viability and ethanol fermentation profiles distinguished the tolerance-response from the stress-response in yeast under the ethanol challenge. At least 82 genes were identified as candidate and key genes for ethanol-tolerance and subsequent fermentation under the stress. Among which, 36 genes were newly recognized by the present study. Most of the ethanol-tolerance candidate genes were found to share protein binding motifs of transcription factors Msn4p/Msn2p, Yap1p, Hsf1p and Pdr1p/Pdr3p. Conclusion Enriched background of transcription abundance

Comparison of Spectrophotometry, Chromate Inhibition, and Cytofluorometry Versus Gene Sequencing for Detection of Heterozygously Glucose-6-Phosphate Dehydrogenase-Deficient Females.

Science.gov (United States)

Peters, Anna L; Veldthuis, Martijn; van Leeuwen, Karin; Bossuyt, Patrick M M; Vlaar, Alexander P J; van Bruggen, Robin; de Korte, Dirk; Van Noorden, Cornelis J F; van Zwieten, Rob

2017-11-01

Glucose-6-phosphate dehydrogenase (G6PD) deficiency is the most common enzyme deficiency worldwide. Detection of heterozygously deficient females can be difficult as residual activity in G6PD-sufficient red blood cells (RBCs) can mask deficiency. In this study, we compared accuracy of 4 methods for detection of G6PD deficiency in females. Blood samples from females more than 3 months of age were used for spectrophotometric measurement of G6PD activity and for determination of the percentage G6PD-negative RBCs by cytofluorometry. An additional sample from females suspected to have G6PD deficiency based on the spectrophotometric G6PD activity was used for measuring chromate inhibition and sequencing of the G6PD gene. Of 165 included females, 114 were suspected to have heterozygous deficiency. From 75 females, an extra sample was obtained. In this group, mutation analysis detected 27 heterozygously deficient females. The sensitivity of spectrophotometry, cytofluorometry, and chromate inhibition was calculated to be 0.52 (confidence interval [CI]: 0.32-0.71), 0.85 (CI: 0.66-0.96), and 0.96 (CI: 0.71-1.00, respectively, and the specificity was 1.00 (CI: 0.93-1.00), 0.88 (CI: 0.75-0.95), and 0.98 (CI: 0.89-1.00), respectively. Heterozygously G6PD-deficient females with a larger percentage of G6PD-sufficient RBCs are missed by routine methods measuring total G6PD activity. However, the majority of these females can be detected with both chromate inhibition and cytofluorometry.

Genetic Evidence for the Physiological Significance of the d-Tagatose 6-Phosphate Pathway of Lactose and d-Galactose Degradation in Staphylococcus aureus1

Science.gov (United States)

Bissett, Donald L.; Anderson, Richard L.

1974-01-01

Mutants of Staphylococcus aureus were isolated which were unable to utilize d-galactose or lactose, but which were able to utilize all other carbohydrates tested. Growth of the mutants on a peptone-containing medium was inhibited by d-galactose. Of those mutants selected for further study, one (tagI2) was missing d-galactose 6-phosphate isomerase, one (tagK3) was missing d-tagatose 6-phosphate kinase, and one (tagA4) was missing d-tagatose 1, 6-diphosphate aldolase. Each of these mutants accumulated the substrate of the missing enzyme intracellularly. Spontaneous revertants of each of the mutants simultaneously regained their ability to utilize d-galactose and lactose, lost their sensitivity to d-galactose, regained the missing enzymatic activities, and no longer accumulated intermediates of the d-tagatose 6-phosphate pathway. These data support our previous contention that the physiologically significant route for the metabolism of d-galactose and the d-galactosyl moiety of lactose in S. aureus is the d-tagatose 6-phosphate pathway. Furthermore, a mutant constitutive for all three enzymes of this pathway was isolated, indicating that the products of the tagI, tagK, and tagA genes are under common genetic control. This conclusion was supported by the demonstration that d-galactose 6-phosphate isomerase, d-tagatose 6-phosphate kinase, and d-tagatose 1, 6-diphosphate aldolase are coordinately induced in the parental strain. PMID:4277494

Citric acid production and citrate synthase genes in distinct strains of ...

African Journals Online (AJOL)

Citric acid is an important organic acid, multifunctional with a wide array of uses. The objectives of this study were the isolation and selection strains of the genus Aspergillus, investigating the solubilization of phosphate of these isolates, verifying the expression rate of genes involved in the identification of isolates, and ...

Development of intron length polymorphism markers in genes encoding diketide-CoA synthase and curcumin synthase for discriminating Curcuma species.

Science.gov (United States)

Kita, Tomoko; Komatsu, Katsuko; Zhu, Shu; Iida, Osamu; Sugimura, Koji; Kawahara, Nobuo; Taguchi, Hiromu; Masamura, Noriya; Cai, Shao-Qing

2016-03-01

Various Curcuma rhizomes have been used as medicines or spices in Asia since ancient times. It is very difficult to distinguish them morphologically, especially when they are boiled and dried, which causes misidentification leading to a loss of efficacy. We developed a method for discriminating Curcuma species by intron length polymorphism markers in genes encoding diketide-CoA synthase and curcumin synthase. This method could apply to identification of not only fresh plants but also samples of crude drugs or edible spices. By applying this method to Curcuma specimens and samples, and constructing a dendrogram based on these markers, seven Curcuma species were clearly distinguishable. Moreover, Curcuma longa specimens were geographically distinguishable. On the other hand, Curcuma kwangsiensis (gl type) specimens also showed intraspecies polymorphism, which may have occurred as a result of hybridization with other Curcuma species. The molecular method we developed is a potential tool for global classification of the genus Curcuma. Copyright © 2015 Elsevier Ltd. All rights reserved.

Molecular cloning and expression levels of the monoterpene synthase gene (ZMM1 in Cassumunar ginger (Zingiber montanum (Koenig Link ex Dietr.

Directory of Open Access Journals (Sweden)

Bua-In Saowaluck

2014-01-01

Full Text Available Cassumunar ginger (Zingiber montanum (Koenig Link ex Dietr. is a native Thai herb with a high content and large variety of terpenoids in its essential oil. Improving the essential oil content and quality of cassumunar ginger is difficult for a breeder due to its clonally propagated nature. In this research, we describe the isolation and expression level of the monoterpene synthase gene that controls the key step of essential oil synthesis in this plant and evaluate the mechanical wounding that may influence the transcription level of the monoterpene synthase gene. To isolate the gene, the selected clones from DNA derived from young leaves were sequenced and analyzed and the monoterpene synthase gene from cassumunar ginger (ZMM1 was identified. The ZMM1 CDS containing 1 773 bp (KF500399 is predicted to encode a protein of 590 amino acids. The deduced amino acid sequence is 40-74% identical with known sequences of other angiosperm monoterpene synthases belonging to the isoprenoid biosynthesis C1 superfamily. A transcript of ZMM1 was detected almost exclusively in the leaves and was related to leaf wounding. The results of this research offer insight into the control of monoterpene synthesis in this plant. This finding can be applied to breeding programs or crop management of cassumunar ginger for better yield and quality of essential oil.

Glucose-6-phosphate dehydrogenase deficiency; the single most ...

African Journals Online (AJOL)

Introduction: Glucose- 6-phosphate dehydrogenase deficiency is the most common enzymatic disorder of the red cell and an important risk factor for neonatal jaundice. Methodology: The aim of the study was to determine the incidence of G-6-PD deficiency among jaundiced neonates, and describe the associated morbidity ...

Thermoresponsive microgels containing trehalose as soft matrices for 3D cell culture.

Science.gov (United States)

Burek, Małgorzata; Waśkiewicz, Sylwia; Lalik, Anna; Student, Sebastian; Bieg, Tadeusz; Wandzik, Ilona

2017-01-31

A series of thermoresponsive glycomicrogels with trehalose in the cross-links or with trehalose in the cross-links and as pending moieties was synthesized. These materials were obtained by surfactant-free precipitation copolymerization of N-isopropylacrylamide and various amounts of trehalose monomers. The resultant particles showed a spherical shape and a submicrometer hydrodynamic size with a narrow size distribution. At 25 °C, glycomicrogels in solutions with physiological ionic strength formed stable colloids, which further gelled upon heating to physiological temperature forming a macroscopic hydrogel with an interconnected porous structure. These extremely soft matrices with dynamic storage modulus in the range of 9-70 Pa were examined in 3D culture systems for HeLa cell culture in comparison to traditional 2D mode. They showed relatively low syneresis over time, especially when glycomicrogels with a high content of hydrophilic trehalose were used as building blocks. An incorporated pending trehalose composed of two α,α'-1,1'-linked d-glucose moieties was used with the intention of providing multivalent interactions with glucose transporters (GLUTs) expressed on the cell surface. A better cell viability was observed when a soft hydrogel with the highest content of trehalose and the lowest syneresis was used as a matrix compared to a 2D control assay.

Cloning and expression of pineapple sucrosephosphate synthase ...

African Journals Online (AJOL)

A 1132-base pairs (bp) polymerase-chain-reaction product of sucrose-phosphate synthase (SPS) (EC 2.3.1.14) from pineapple (Ananas comosus cv. Comte de paris) fruit was cloned and nominated as Ac- SPS1. The sequence encodes a putative 377 amino acids protein containing two serine conserved features that had ...

NMR Study on the Interaction of Trehalose with Lactose and Its Effect on the Hydrogen Bond Interaction in Lactose

Directory of Open Access Journals (Sweden)

Eric Morssing Vilén

2013-08-01

Full Text Available Trehalose, a well-known stress-protector of biomolecules, has been investigated for its effect on the mobility, hydration and hydrogen bond interaction of lactose using diffusion-ordered NMR spectroscopy and NMR of hydroxy protons. In ternary mixtures of trehalose, lactose and water, the two sugars have the same rate of diffusion. The chemical shifts, temperature coefficients, vicinal coupling constants and ROE of the hydroxy protons in trehalose, lactose and sucrose were measured for the disaccharides alone in water/acetone-d6 solutions as well as in mixtures. The data indicated that addition of trehalose did not change significantly the strength of the hydrogen bond interaction between GlcOH3 and GalO5' in lactose. Small upfield shifts were however measured for all hydroxy protons when the sugar concentration was increased. The chemical shift of the GlcOH3 signal in lactose showed less change, attributed to the spatial proximity to GalO5'. Chemical exchange between hydroxy protons of lactose and trehalose was observed in the ROESY NMR spectra. Similar effects were observed with sucrose indicating no specific effect of trehalose at the concentrations investigated (73 to 763 mg/mL and suggesting that it is the concentration of hydroxy groups more than the type of sugars which is guiding intermolecular interactions.

Intact molecular characterization of cord factor (trehalose 6,6'-dimycolate) from nine species of mycobacteria by MALDI-TOF mass spectrometry.

Science.gov (United States)

Fujita, Yukiko; Naka, Takashi; McNeil, Michael R; Yano, Ikuya

2005-10-01

Cord factor (trehalose 6,6'-dimycolate, TDM) is an unique glycolipid with a trehalose and two molecules of mycolic acids in the mycobacterial cell envelope. Since TDM consists of two molecules of very long branched-chain 3-hydroxy fatty acids, the molecular mass ranges widely and in a complex manner. To characterize the molecular structure of TDM precisely and simply, an attempt was made to determine the mycolic acid subclasses of TDM and the molecular species composition of intact TDM by matrix-assisted laser desorption/ionization time-of-flight (MALDI-TOF) mass spectrometry for the first time. The results showed that less than 1 microg mycolic acid methyl ester of TDM from nine representative species of mycobacteria and TDM from the same species was sufficient to obtain well-resolved mass spectra composed of pseudomolecular ions [M+Na]+. Although the mass ion distribution was extremely diverse, the molecular species of each TDM was identified clearly by constructing a molecular ion matrix consisting of the combination of two molecules of mycolic acids. The results showed a marked difference in the molecular structure of TDM among mycobacterial species and subspecies. TDM from Mycobacterium tuberculosis (H37Rv and Aoyama B) showed a distinctive mass pattern and consisted of over 60 molecular ions with alpha-, methoxy- and ketomycolate. TDM from Mycobacterium bovis BCG Tokyo 172 similarly showed over 35 molecular ions, but that from M. bovis BCG Connaught showed simpler molecular ion clusters consisting of less than 35 molecular species due to a complete lack of methoxymycolate. Mass ions due to TDM from M. bovis BCG Connaught and Mycobacterium kansasii showed a biphasic distribution, but the two major peaks of TDM from M. kansasii were shifted up two or three carbon units higher compared with M. bovis BCG Connaught. Within the rapid grower group, in TDM consisting of alpha-, keto- and wax ester mycolate from Mycobacterium phlei and Mycobacterium flavescens, the

Germacrene A Synthase in Yarrow (Achillea millefolium Is an Enzyme with Mixed Substrate Specificity: Gene Cloning, Functional Characterization and Expression Analysis

Directory of Open Access Journals (Sweden)

Leila ePazouki

2015-03-01

Full Text Available Terpenoid synthases constitute a highly diverse gene family producing a wide range of cyclic and acyclic molecules consisting of isoprene (C5 residues. Often a single terpene synthase produces a spectrum of molecules of given chain length, but some terpene synthases can use multiple substrates, producing products of different chain length. Only a few such enzymes has been characterized, but the capacity for multiple-substrate use can be more widespread than previously thought. Here we focused on germacrene A synthase (GAS that is a key cytosolic enzyme in the sesquiterpene lactone biosynthesis pathway in the important medicinal plant Achillea millefolium (AmGAS. The full length encoding gene was heterologously expressed in Escherichia coli BL21 (DE3, functionally characterized, and its in vivo expression was analyzed. The recombinant protein catalyzed formation of germacrene A with the C15 substrate farnesyl diphosphate (FDP, while acyclic monoterpenes were formed with the C10 substrate geranyl diphosphate (GDP and cyclic monoterpenes with the C10 substrate neryl diphosphate (NDP. Although monoterpene synthesis has been assumed to be confined exclusively to plastids, AmGAS can potentially synthesize monoterpenes in cytosol when GDP or NDP become available. AmGAS enzyme had high homology with GAS sequences from other Asteraceae species, suggesting that multi-substrate use can be more widespread among germacrene A synthases than previously thought. Expression studies indicated that AmGAS was expressed in both autotrophic and heterotrophic plant compartments with the highest expression levels in leaves and flowers. To our knowledge, this is the first report on the cloning and characterization of germacrene A synthase coding gene in A. millefolium, and multi-substrate use of GAS enzymes.

The cellulose synthase companion proteins act non-redundantly with CELLULOSE SYNTHASE INTERACTING1/POM2 and CELLULOSE SYNTHASE 6

OpenAIRE

Endler, Anne; Schneider, Rene; Kesten, Christopher; Lampugnani, Edwin R.; Persson, Staffan

2016-01-01

Cellulose is a cell wall constituent that is essential for plant growth and development, and an important raw material for a range of industrial applications. Cellulose is synthesized at the plasma membrane by massive cellulose synthase (CesA) complexes that track along cortical microtubules in elongating cells of Arabidopsis through the activity of the protein CELLULOSE SYNTHASE INTERACTING1 (CSI1). In a recent study we identified another family of proteins that also are associated with the ...

Natural variation in monoterpene synthesis in kiwifruit: transcriptional regulation of terpene synthases by NAC and ETHYLENE-INSENSITIVE3-like transcription factors.

Science.gov (United States)

Nieuwenhuizen, Niels J; Chen, Xiuyin; Wang, Mindy Y; Matich, Adam J; Perez, Ramon Lopez; Allan, Andrew C; Green, Sol A; Atkinson, Ross G

2015-04-01

Two kiwifruit (Actinidia) species with contrasting terpene profiles were compared to understand the regulation of fruit monoterpene production. High rates of terpinolene production in ripe Actinidia arguta fruit were correlated with increasing gene and protein expression of A. arguta terpene synthase1 (AaTPS1) and correlated with an increase in transcript levels of the 2-C-methyl-D-erythritol 4-phosphate pathway enzyme 1-deoxy-D-xylulose-5-phosphate synthase (DXS). Actinidia chinensis terpene synthase1 (AcTPS1) was identified as part of an array of eight tandemly duplicated genes, and AcTPS1 expression and terpene production were observed only at low levels in developing fruit. Transient overexpression of DXS in Nicotiana benthamiana leaves elevated monoterpene synthesis by AaTPS1 more than 100-fold, indicating that DXS is likely to be the key step in regulating 2-C-methyl-D-erythritol 4-phosphate substrate flux in kiwifruit. Comparative promoter analysis identified potential NAC (for no apical meristem [NAM], Arabidopsis transcription activation factor [ATAF], and cup-shaped cotyledon [CUC])-domain transcription factor) and ETHYLENE-INSENSITIVE3-like transcription factor (TF) binding sites in the AaTPS1 promoter, and cloned members of both TF classes were able to activate the AaTPS1 promoter in transient assays. Electrophoretic mobility shift assays showed that AaNAC2, AaNAC3, and AaNAC4 bind a 28-bp fragment of the proximal NAC binding site in the AaTPS1 promoter but not the A. chinensis AcTPS1 promoter, where the NAC binding site was mutated. Activation could be restored by reintroducing multiple repeats of the 12-bp NAC core-binding motif. The absence of NAC transcriptional activation in ripe A. chinensis fruit can account for the low accumulation of AcTPS1 transcript, protein, and monoterpene volatiles in this species. These results indicate the importance of NAC TFs in controlling monoterpene production and other traits in ripening fruits. © 2015 American

Trehalose improves cell proliferation and dehydration tolerance of human HaCaT cells

Directory of Open Access Journals (Sweden)

Lee Kyung Eun

2015-01-01

Full Text Available Trehalose is a disaccharide molecule that serves as a natural osmotic regulator in halophilic microorganisms and plants but not in mammals. We observed that human HaCaT cells supplied with trehalose improved cell proliferation and extended viability under dehydration. In HaCaT cells, in response to increasing concentrations of exogenous trehalose, the levels of heat shock protein (HSP 70 increased and matrix metalloproteinase (MMP 1 decreased. Proteome analysis of trehalose-treated HaCaT cells revealed remarkable increases in the levels of proteins involved in cell signaling and the cell cycle, including p21 activated kinase I, Sec I family domain protein and elongation factor G. Moreover, the proteins for cell stress resistance, tryptophan hydroxylase, serine/cysteine proteinase inhibitors and vitamin D receptors were also increased. In addition, the proteins responsible for the maintenance of the cytoskeleton and cellular structures including procollagen-lysine dioxygenase, vinculin and ezrin were increased. Proteomic data revealed that trehalose affected HaCaT cells by inducing the proteins involved in cell proliferation. These results suggest that trehalose improves the proliferation and dehydration tolerance of HaCaT cells by inducing proteins involved in cell growth and dehydration protection.

Relationship of trehalose accumulation with ethanol fermentation in industrial Saccharomyces cerevisiae yeast strains.

Science.gov (United States)

Wang, Pin-Mei; Zheng, Dao-Qiong; Chi, Xiao-Qin; Li, Ou; Qian, Chao-Dong; Liu, Tian-Zhe; Zhang, Xiao-Yang; Du, Feng-Guang; Sun, Pei-Yong; Qu, Ai-Min; Wu, Xue-Chang

2014-01-01

The protective effect and the mechanisms of trehalose accumulation in industrial Saccharomyces cerevisiae strains were investigated during ethanol fermentation. The engineered strains with more intercellular trehalose achieved significantly higher fermentation rates and ethanol yields than their wild strain ZS during very high gravity (VHG) fermentation, while their performances were not different during regular fermentation. The VHG fermentation performances of these strains were consistent with their growth capacity under osmotic stress and ethanol stress, the key stress factors during VHG fermentation. These results suggest that trehalose accumulation is more important for VHG fermentation of industrial yeast strains than regular one. The differences in membrane integrity and antioxidative capacity of these strains indicated the possible mechanisms of trehalose as a protectant under VHG condition. Therefore, trehalose metabolic engineering may be a useful strategy for improving the VHG fermentation performance of industrial yeast strains. Copyright © 2013 Elsevier Ltd. All rights reserved.

Lyoluminescence and ESR correlation studies of trehalose dihydrate

Energy Technology Data Exchange (ETDEWEB)

Raman, Anand E-mail: anandr@apsara.barc.ernet.in; Oommen, Issac K.; Gundu Rao, T.K.; Sharma, D.N

2002-07-01

ESR studies of irradiated lyoluminescence (LL) phosphor, trehalose dihydrate showed a linear free radical growth up to a dose of 11 kGy. The LL output measured under oxygen equilibrated conditions showed an extension of the dosimetric response from 0.6 to 6 kGy. ESR spectral analysis indicates the formation of two radical species viz., 'a' and 'b' and their involvement in the LL process. The estimated free radical concentrations of radicals 'a' and 'b' were found to be 6.81x10{sup 15} and 1.35x10{sup 16} g{sup -1}, respectively, for a gamma dose of 10.8 kGy.

Protein preparation and preliminary X-ray crystallographic analysis of a putative glucosamine 6-phosphate deaminase from Streptococcus mutants

Energy Technology Data Exchange (ETDEWEB)

Hu, Guan-Jing; Li, Lan-Fen; Li, Dan; Liu, Cong [National Laboratory of Protein Engineering and Plant Genetic Engineering, College of Life Sciences, Peking University, Beijing 100871 (China); Wei, Shi-Cheng, E-mail: kqsc-wei@bjmu.edu.cn [Peking University School of Stomatology, Beijing 100081 (China); Liang, Yu-He, E-mail: kqsc-wei@bjmu.edu.cn; Su, Xiao-Dong [National Laboratory of Protein Engineering and Plant Genetic Engineering, College of Life Sciences, Peking University, Beijing 100871 (China)

2007-09-01

A glucosamine 6-phosphate deaminase homologue from S. mutans was expressed, purified and crystallized. Diffraction data have been collected to 2.4 Å resolution. The SMU.636 protein from Streptococcus mutans is a putative glucosamine 6-phosphate deaminase with 233 residues. The smu.636 gene was PCR-amplified from S. mutans genomic DNA and cloned into the expression vector pET-28a(+). The resultant His-tagged fusion protein was expressed in Escherichia coli and purified to homogeneity in two steps. Crystals of the fusion protein were obtained by the hanging-drop vapour-diffusion method. The crystals diffracted to 2.4 Å resolution and belong to space group P2{sub 1}2{sub 1}2{sub 1}, with unit-cell parameters a = 53.83, b = 82.13, c = 134.70 Å.

Protein preparation and preliminary X-ray crystallographic analysis of a putative glucosamine 6-phosphate deaminase from Streptococcus mutants

International Nuclear Information System (INIS)

Hu, Guan-Jing; Li, Lan-Fen; Li, Dan; Liu, Cong; Wei, Shi-Cheng; Liang, Yu-He; Su, Xiao-Dong

2007-01-01

A glucosamine 6-phosphate deaminase homologue from S. mutans was expressed, purified and crystallized. Diffraction data have been collected to 2.4 Å resolution. The SMU.636 protein from Streptococcus mutans is a putative glucosamine 6-phosphate deaminase with 233 residues. The smu.636 gene was PCR-amplified from S. mutans genomic DNA and cloned into the expression vector pET-28a(+). The resultant His-tagged fusion protein was expressed in Escherichia coli and purified to homogeneity in two steps. Crystals of the fusion protein were obtained by the hanging-drop vapour-diffusion method. The crystals diffracted to 2.4 Å resolution and belong to space group P2 1 2 1 2 1 , with unit-cell parameters a = 53.83, b = 82.13, c = 134.70 Å

Manipulation of saponin biosynthesis by RNA interference-mediated silencing of β-amyrin synthase gene expression in soybean.

Science.gov (United States)

Takagi, Kyoko; Nishizawa, Keito; Hirose, Aya; Kita, Akiko; Ishimoto, Masao

2011-10-01

Soybean seeds contain substantial amount of diverse triterpenoid saponins that influence the seed quality, although little is known about the physiologic functions of saponins in plants. We now describe the modification of saponin biosynthesis by RNA interference (RNAi)-mediated gene silencing targeted to β-amyrin synthase, a key enzyme in the synthesis of a common aglycon of soybean saponins. We identified two putative β-amyrin synthase genes in soybean that manifested distinct expression patterns with regard to developmental stage and tissue specificity. Given that one of these genes, GmBAS1, was expressed at a much higher level than the other (GmBAS2) in various tissues including the developing seeds, we constructed two RNAi vectors that encode self-complementary hairpin RNAs corresponding to the distinct regions of GmBAS1 under the control of a seed-specific promoter derived from the soybean gene for the α' subunit of the seed storage protein β-conglycinin. These vectors were introduced independently into soybean. Six independent transgenic lines exhibited a stable reduction in seed saponin content, with the extent of saponin deficiency correlating with the β-amyrin synthase mRNA depletion. Although some transgenic lines produced seeds almost devoid of saponins, no abnormality in their growth was apparent and the antioxidant activity of their seeds was similar to that of control seeds. These results suggest that saponins are not required for seed development and survival, and that soybean seeds may therefore be amenable to the modification of triterpenoid saponin content and composition through molecular biologic approaches.

Trehalose upregulates progranulin expression in human and mouse models of GRN haploinsufficiency: a novel therapeutic lead to treat frontotemporal dementia.

Science.gov (United States)

Holler, Christopher J; Taylor, Georgia; McEachin, Zachary T; Deng, Qiudong; Watkins, William J; Hudson, Kathryn; Easley, Charles A; Hu, William T; Hales, Chadwick M; Rossoll, Wilfried; Bassell, Gary J; Kukar, Thomas

2016-06-24

Progranulin (PGRN) is a secreted growth factor important for neuronal survival and may do so, in part, by regulating lysosome homeostasis. Mutations in the PGRN gene (GRN) are a common cause of frontotemporal lobar degeneration (FTLD) and lead to disease through PGRN haploinsufficiency. Additionally, complete loss of PGRN in humans leads to neuronal ceroid lipofuscinosis (NCL), a lysosomal storage disease. Importantly, Grn-/- mouse models recapitulate pathogenic lysosomal features of NCL. Further, GRN variants that decrease PGRN expression increase the risk of developing Alzheimer's disease (AD) and Parkinson's disease (PD). Together these findings demonstrate that insufficient PGRN predisposes neurons to degeneration. Therefore, compounds that increase PGRN levels are potential therapeutics for multiple neurodegenerative diseases. Here, we performed a cell-based screen of a library of known autophagy-lysosome modulators and identified multiple novel activators of a human GRN promoter reporter including several common mTOR inhibitors and an mTOR-independent activator of autophagy, trehalose. Secondary cellular screens identified trehalose, a natural disaccharide, as the most promising lead compound because it increased endogenous PGRN in all cell lines tested and has multiple reported neuroprotective properties. Trehalose dose-dependently increased GRN mRNA as well as intracellular and secreted PGRN in both mouse and human cell lines and this effect was independent of the transcription factor EB (TFEB). Moreover, trehalose rescued PGRN deficiency in human fibroblasts and neurons derived from induced pluripotent stem cells (iPSCs) generated from GRN mutation carriers. Finally, oral administration of trehalose to Grn haploinsufficient mice significantly increased PGRN expression in the brain. This work reports several novel autophagy-lysosome modulators that enhance PGRN expression and identifies trehalose as a promising therapeutic for raising PGRN levels to treat

a Theoretical Analysis of Physical Properties of Aqueous Trehalose with Borax

Science.gov (United States)

Sahara; Aniya, Masaru

2013-07-01

The temperature and composition dependence of the viscosity of aqueous trehalose and aqueous trehalose-borax mixtures has been investigated by means of the Bond Strength-Coordination Number Fluctuation (BSCNF) model. The result indicates that the variation in the fragility of the system is very small in the composition range analyzed. The values of the materials parameters determined are consistent with those of the trehalose-water-lithium iodide system which were analyzed in a previous study. Based on the analysis of the obtained parameters of the BSCNF model, the physical interpretation of the WLF parameters reported in a previous study is reconfirmed.

Functional genomic analysis supports conservation of function among cellulose synthase-like a gene family members and suggests diverse roles of mannans in plants

DEFF Research Database (Denmark)

Liepman, Aaron H; Nairn, C Joseph; Willats, William G T

2007-01-01

from Arabidopsis (Arabidopsis thaliana), guar (Cyamopsis tetragonolobus), and Populus trichocarpa catalyze beta-1,4-mannan and glucomannan synthase reactions in vitro. Mannan polysaccharides and homologs of CslA genes appear to be present in all lineages of land plants analyzed to date. In many plants......, the CslA genes are members of extended multigene families; however, it is not known whether all CslA proteins are glucomannan synthases. CslA proteins from diverse land plant species, including representatives of the mono- and dicotyledonous angiosperms, gymnosperms, and bryophytes, were produced...... they are prevalent at cell junctions and in buds. Taken together, these results demonstrate that members of the CslA gene family from diverse plant species encode glucomannan synthases and support the hypothesis that mannans function in metabolic networks devoted to other cellular processes in addition to cell wall...

Aldosterone synthase gene is not a major susceptibility gene for progression of chronic kidney disease in patients with autosomal dominant polycystic kidney disease

Directory of Open Access Journals (Sweden)

Gnanasambandan Ramanathan

2017-01-01

Full Text Available Autosomal dominant polycystic kidney disease (ADPKD is the most common heritable kidney disease and is characterized by bilateral renal cysts. Hypertension is a frequent cause of chronic kidney disease (CKD and mortality in patients with ADPKD. The aldosterone synthase gene polymorphisms of the renin-angiotensin-aldosterone system have been extensively studied as hypertension candidate genes. The present study is aimed to investigate the potential modifier effect of CYP11B2 gene on the progression of CKD in ADPKD. One hundred and two ADPKD patients and 106 healthy controls were recruited based on Ravine inclusion and exclusion criteria. The three tag-SNPs within CYP11B2 gene (rs3802230, rs4543, and rs4544 were genotyped using FRET-based KASPar method. Cochran-Armitage trend test was used to assess the potential associations between these polymorphisms and CKD stages. Mantel- Haenszel stratified analysis was used to explore confounding and interaction effects of these polymorphisms. Of the three tag-SNPs genotyped, rs4544 polymorphism was monomorphic and rs3802230 deviated Hardy-Weinberg equilibrium. The CYP11B2 tag-SNPs did not show significant association with ADPKD or CKD. Further, these polymorphisms did not exhibit confounding effect on the relationship between CKD progression and hypertension. Our results suggest that aldosterone synthase gene is not a major susceptibility gene for progression of CKD in South Indian ADPKD patients.

Natural Variation in Monoterpene Synthesis in Kiwifruit: Transcriptional Regulation of Terpene Synthases by NAC and ETHYLENE-INSENSITIVE3-Like Transcription Factors1

Science.gov (United States)

Nieuwenhuizen, Niels J.; Chen, Xiuyin; Wang, Mindy Y.; Matich, Adam J.; Perez, Ramon Lopez; Allan, Andrew C.; Green, Sol A.; Atkinson, Ross G.

2015-01-01

Two kiwifruit (Actinidia) species with contrasting terpene profiles were compared to understand the regulation of fruit monoterpene production. High rates of terpinolene production in ripe Actinidia arguta fruit were correlated with increasing gene and protein expression of A. arguta terpene synthase1 (AaTPS1) and correlated with an increase in transcript levels of the 2-C-methyl-d-erythritol 4-phosphate pathway enzyme 1-deoxy-d-xylulose-5-phosphate synthase (DXS). Actinidia chinensis terpene synthase1 (AcTPS1) was identified as part of an array of eight tandemly duplicated genes, and AcTPS1 expression and terpene production were observed only at low levels in developing fruit. Transient overexpression of DXS in Nicotiana benthamiana leaves elevated monoterpene synthesis by AaTPS1 more than 100-fold, indicating that DXS is likely to be the key step in regulating 2-C-methyl-d-erythritol 4-phosphate substrate flux in kiwifruit. Comparative promoter analysis identified potential NAC (for no apical meristem [NAM], Arabidopsis transcription activation factor [ATAF], and cup-shaped cotyledon [CUC])-domain transcription factor) and ETHYLENE-INSENSITIVE3-like transcription factor (TF) binding sites in the AaTPS1 promoter, and cloned members of both TF classes were able to activate the AaTPS1 promoter in transient assays. Electrophoretic mobility shift assays showed that AaNAC2, AaNAC3, and AaNAC4 bind a 28-bp fragment of the proximal NAC binding site in the AaTPS1 promoter but not the A. chinensis AcTPS1 promoter, where the NAC binding site was mutated. Activation could be restored by reintroducing multiple repeats of the 12-bp NAC core-binding motif. The absence of NAC transcriptional activation in ripe A. chinensis fruit can account for the low accumulation of AcTPS1 transcript, protein, and monoterpene volatiles in this species. These results indicate the importance of NAC TFs in controlling monoterpene production and other traits in ripening fruits. PMID:25649633

Neonatal jaundice and glucose-6-phosphate dehydrogenase

OpenAIRE

Leite, Amauri Antiquera [UNESP

2010-01-01

A deficiência de glicose-6-fosfato desidrogenase em neonatos pode ser a responsável pela icterícia neonatal. Este comentário científico é decorrente do relato sobre o tema publicado neste fascículo e que preocupa diversos autores de outros países em relação às complicações em neonatos de hiperbilirrubinemia, existindo inclusive proposições de alguns autores em incluir o teste para identificar a deficiência de glicose-6-fosfato desidrogenase nos recém-nascidos.Glucose-6-phosphate dehydrogenase...

Effect of 60 Co gamma radiation on trehalose level of Saccharomyces boulardii cells

International Nuclear Information System (INIS)

Santos, Raquel Gouvea dos; Neves, Maria Jose; Duarte, Rinaldo; Nicoli, Jacques R.

1996-01-01

The medicine Floratil used for diarrhea treatment is composed by lyophilized yeast cells of Saccharomyces boulardii. The action mechanism of this product is unknown. The efficacy of S. boulardii depends on its viability. The increase in the trehalose level in S. cerevisiae cells submitted to a previous sub-lethal level heat shock results in resistance to a lethal shock. The aim of this work was to study weather the cell trehalose level is involved also in the resistance of gamma irradiation. It was noted that the yeast cells surviving to gamma irradiation had more trehalose level than control cells. Apparently there is a positive correlation between of trehalose level and gamma irradiation resistance of S.boulardii cells. (author)

Complementation of the amylose-free starch mutant of potato (Solanum tuberosum.) by the gene encoding granule-bound starch synthase

NARCIS (Netherlands)

van der Leij, E.R.; Visser, R.G.E.; OOSTERHAVEN, K; VANDERKOP, DAM; Jacobsen, E.; Feenstra, W.

1991-01-01

Agrobacterium rhizogenes-mediated introduction of the wild-type allele of the gene encoding granule-bound starch synthase (GBSS) into the amylose-free starch mutant amf of potato leads to restoration of GBSS activity and amylose synthesis, which demonstrates that Amf is the structural gene for GBSS.

Cloning and Functional Characterization of a Gene for Capsanthin-Capsorubin Synthase from Tiger Lily (Lilium lancifolium Thunb. ‘Splendens’)

OpenAIRE

Jeknić, Zoran; Morré, Jeffrey T.; Jeknić, Stevan; Jevremović, Slađana; Subotić, Angelina; Chen, Tony H.H.

2012-01-01

The orange color of tiger lily (Lolium lancifolium ‘Splendens’) flowers is due, primarily, to the accumulation of two κ-xanthophylls, capsanthin and capsorubin. An enzyme, known as capsanthin-capsorubin synthase (CCS), catalyzes the conversion of antheraxanthin and violaxanthin into capsanthin and capsorubin, respectively. We cloned the gene for capsanthin-capsorubin synthase (Llccs) from flower tepals of L. lancifolium by the rapid amplification of cDNA ends (RACE) with a heterologous non-de...

Prevalence of Sickle Cell Trait and Glucose 6 Phosphate ...

African Journals Online (AJOL)

Blood donation from sickle cell trait (SCT) and glucose-6-phosphate dehydrogenase (G6PD)-deficient donors might alter the quality of the donated blood during processing, storage or in the recipients' circulatory system. The aim of this study was to determine the prevalence of SCT and G6PD deficiency among blood ...

Insect biofuel cells using trehalose included in insect hemolymph leading to an insect-mountable biofuel cell.

Science.gov (United States)

Shoji, Kan; Akiyama, Yoshitake; Suzuki, Masato; Hoshino, Takayuki; Nakamura, Nobuhumi; Ohno, Hiroyuki; Morishima, Keisuke

2012-12-01

In this paper, an insect biofuel cell (BFC) using trehalose included in insect hemolymph was developed. The insect BFC is based on trehalase and glucose oxidase (GOD) reaction systems which oxidize β-glucose obtained by hydrolyzing trehalose. First, we confirmed by LC-MS that a sufficient amount of trehalose was present in the cockroach hemolymph (CHL). The maximum power density obtained using the insect BFC was 6.07 μW/cm(2). The power output was kept more than 10 % for 2.5 h by protecting the electrodes with a dialysis membrane. Furthermore, the maximum power density was increased to 10.5 μW/cm(2) by using an air diffusion cathode. Finally, we succeeded in driving a melody integrated circuit (IC) and a piezo speaker by connecting five insect BFCs in series. The results indicate that the insect BFC is a promising insect-mountable battery to power environmental monitoring micro-tools.

Effects of 3% trehalose as an adjuvant treatment after LASIK

Directory of Open Access Journals (Sweden)

Mateo Orobia AJ

2017-02-01

Full Text Available Antonio J Mateo Orobia,1–3 Paula Casas Pascual,1,4 José Á Cristóbal Bescós,1 Diana Perez García,1,4 Carlos Peiro Embid,1,4 M Ángeles del Buey Sayas,1,4 Valentyna Korobko Kulikova,1 Noelia Lafuente Ojeda5 1Department of Ophthalmology, Hospital Quirón, 2Department of Ophthalmology, Hospital Universitario Miguel Servet, 3Instituto de Investigación Sanitaria de Aragón (IIS, 4Department of Ophthalmology, Hospital Clínico Universitario Lozano-Blesa, 5Department of Anesthesiology, Hospital Universitario Miguel Servet, Zaragoza, Spain Purpose: To evaluate the effect of 3% trehalose as an adjuvant in the standard treatment after laser-assisted in situ keratomileusis.Design: Interventional prospective comparative single-blind study.Setting: Department of Ophthalmology, Hospital Quirón Zaragoza, Spain.Methods: A total of 26 eyes (13 patients were included, of which 12 eyes (group 1 received conventional treatment with lubricant drops of hyaluronic acid (0.15% and 14 eyes (group 2 received, additionally, an ophthalmic solution of 3% trehalose. Pre- and postoperative quality-of-life tests and vital stains, tear breakup time, and osmolarity measurements were made.Results: We obtained statistically significant differences between the groups in the Symptom Assessment in Dry Eye test in all visits with respect to severity, and in the postoperative day 1 visit with respect to frequency, in all cases favoring the trehalose treatment. The values of osmolarity were not significantly different between groups. However, we did find significant differences in the Oxford scale in day 90 for the trehalose treatment (P<0.001, and in the National Eye Institute scale in day 30 (P=0.02.Conclusion: The results of this exploratory study indicate that the adjuvant treatment with 3% trehalose could be superior with respect to the standard treatment, with improvements in the objective and subjective parameters of tear quality. Keywords: dry eye syndrome, trehalose

Mutations in the dihydropteroate synthase gene of Pneumocystis jiroveci isolates from Portuguese patients with Pneumocystis pneumonia

DEFF Research Database (Denmark)

Costa, M C; Helweg-Larsen, J; Lundgren, Bettina

2003-01-01

The aim of this study was to evaluate the frequency of mutations of the P. jiroveci dihydropteroate synthase (DHPS) gene in an immunocompromised Portuguese population and to investigate the possible association between DHPS mutations and sulpha exposure. In the studied population, DHPS gene...... mutations were not significantly more frequent in patients exposed to sulpha drugs compared with patients not exposed (P=0.390). The results of this study suggest that DHPS gene mutations are frequent in the Portuguese immunocompromised population but do not seem associated with previous sulpha exposure...

Inhibition of Alzheimer amyloid {beta} aggregation by polyvalent trehalose

Energy Technology Data Exchange (ETDEWEB)

Miura, Yoshiko; You, Chouga [School of Materials Science, Japan Advanced Institute of Science and Technology, 1-1 Asahidai, Nomi, Ishikawa 923-1292 (Japan); Ohnishi, Reiko [Department of Molecular Design and Engineering, Graduate School of Engineering, Nagoya University, Furo-cho, Chikusa-ku, Nagoya 464-8603 (Japan)], E-mail: miuray@jaist.ac.jp

2008-04-15

A glycopolymer carrying trehalose was found to suppress the formation of amyloid fibrils from the amyloid {beta} peptide (1-42) (A{beta}), as evaluated by thioflavin T assay and atomic force microscopy. Glycopolymers carrying sugar alcohols also changed the aggregation properties of A{beta}, and the inhibitory effect depended on the type of sugar and alkyl side chain. Neutralization activity was confirmed by in vitro assay using HeLa cells. The glycopolymer carrying trehalose strongly inhibited amyloid formation and neutralized cytotoxicity.

Sensitive, specific radioisotope assay for L-glutamine-D-fructose-6- phosphat aminotransferase

International Nuclear Information System (INIS)

Callahan, M.; Tourian, A.; Hung, W.Y.

1981-01-01

A sensitive and specific radioassay for L-glutamine-D-fructose-6-phosphate aminotransferase (EC 5.3.1.19) activity is presented. Picomoles of product are measurable, and the assay can be applied to systems having limited quantities of available protein, particularly in extracts of either cell or organ cultures. The assay is at least 10,000 times more sensitive under K 1 concentrations of fructose 6-phosphate than the modified Elson-Morgan colorimetric assay and 20 times more sensitive under saturating conditions of fructose 6-phosphate. As little as 0.5 μg of cell-extract protein will yield measurable product. In contrast, 280 μg of crude-extract protein from colon is required with the modified Elson-Morgan colorimetric assay

Ancient horizontal gene transfer from bacteria enhances biosynthetic capabilities of fungi.

Directory of Open Access Journals (Sweden)

Imke Schmitt

Full Text Available Polyketides are natural products with a wide range of biological functions and pharmaceutical applications. Discovery and utilization of polyketides can be facilitated by understanding the evolutionary processes that gave rise to the biosynthetic machinery and the natural product potential of extant organisms. Gene duplication and subfunctionalization, as well as horizontal gene transfer are proposed mechanisms in the evolution of biosynthetic gene clusters. To explain the amount of homology in some polyketide synthases in unrelated organisms such as bacteria and fungi, interkingdom horizontal gene transfer has been evoked as the most likely evolutionary scenario. However, the origin of the genes and the direction of the transfer remained elusive.We used comparative phylogenetics to infer the ancestor of a group of polyketide synthase genes involved in antibiotic and mycotoxin production. We aligned keto synthase domain sequences of all available fungal 6-methylsalicylic acid (6-MSA-type PKSs and their closest bacterial relatives. To assess the role of symbiotic fungi in the evolution of this gene we generated 24 6-MSA synthase sequence tags from lichen-forming fungi. Our results support an ancient horizontal gene transfer event from an actinobacterial source into ascomycete fungi, followed by gene duplication.Given that actinobacteria are unrivaled producers of biologically active compounds, such as antibiotics, it appears particularly promising to study biosynthetic genes of actinobacterial origin in fungi. The large number of 6-MSA-type PKS sequences found in lichen-forming fungi leads us hypothesize that the evolution of typical lichen compounds, such as orsellinic acid derivatives, was facilitated by the gain of this bacterial polyketide synthase.

Crystallization and preliminary crystallographic analysis of mannosyl-3-phosphoglycerate synthase from Rubrobacter xylanophilus

International Nuclear Information System (INIS)

Sá-Moura, Bebiana; Albuquerque, Luciana; Empadinhas, Nuno; Costa, Milton S. da; Pereira, Pedro José Barbosa; Macedo-Ribeiro, Sandra

2008-01-01

The enzyme mannosyl-3-phosphoglycerate synthase from R. xylanophilus has been expressed, purified and crystallized. The crystals belong to the hexagonal space group P6 5 22 and diffract to 2.2 Å resolution. Rubrobacter xylanophilus is the only Gram-positive bacterium known to synthesize the compatible solute mannosylglycerate (MG), which is commonly found in hyperthermophilic archaea and some thermophilic bacteria. Unlike the salt-dependent pattern of accumulation observed in (hyper)thermophiles, in R. xylanophilus MG accumulates constitutively. The synthesis of MG in R. xylanophilus was tracked from GDP-mannose and 3-phosphoglycerate, but the genome sequence of the organism failed to reveal any of the genes known to be involved in this pathway. The native enzyme was purified and its N-terminal sequence was used to identify the corresponding gene (mpgS) in the genome of R. xylanophilus. The gene encodes a highly divergent mannosyl-3-phosphoglycerate synthase (MpgS) without relevant sequence homology to known mannosylphosphoglycerate synthases. In order to understand the specificity and enzymatic mechanism of this novel enzyme, it was expressed in Escherichia coli, purified and crystallized. The crystals thus obtained belonged to the hexagonal space group P6 5 22 and contained two protein molecules per asymmetric unit. The structure was solved by SIRAS using a mercury derivative

Glycogen Synthase Kinase-3 regulates IGFBP-1 gene transcription through the Thymine-rich Insulin Response Element

Directory of Open Access Journals (Sweden)

Marquez Rodolfo

2004-09-01

Full Text Available Abstract Background Hepatic expression of several gene products involved in glucose metabolism, including phosphoenolpyruvate carboxykinase (PEPCK, glucose-6-phosphatase (G6Pase and insulin-like growth factor binding protein-1 (IGFBP-1, is rapidly and completely inhibited by insulin. This inhibition is mediated through the regulation of a DNA element present in each of these gene promoters, that we call the Thymine-rich Insulin Response Element (TIRE. The insulin signalling pathway that results in the inhibition of these gene promoters requires the activation of phosphatidylinositol 3-kinase (PI 3-kinase. However, the molecules that connect PI 3-kinase to these gene promoters are not yet fully defined. Glycogen Synthase Kinase 3 (GSK-3 is inhibited following activation of PI 3-kinase. We have shown previously that inhibitors of GSK-3 reduce the activity of two TIRE-containing gene promoters (PEPCK and G6Pase, whose products are required for gluconeogenesis. Results In this report we demonstrate that in H4IIE-C3 cells, four distinct classes of GSK-3 inhibitor mimic the effect of insulin on a third TIRE-containing gene, IGFBP-1. We identify the TIRE as the minimum requirement for inhibition by these agents, and demonstrate that the target of GSK-3 is unlikely to be the postulated TIRE-binding protein FOXO-1. Importantly, overexpression of GSK-3 in cells reduces the insulin regulation of TIRE activity as well as endogenous IGFBP-1 expression. Conclusions These results implicate GSK-3 as an intermediate in the pathway from the insulin receptor to the TIRE. Indeed, this is the first demonstration of an absolute requirement for GSK-3 inhibition in insulin regulation of gene transcription. These data support the potential use of GSK-3 inhibitors in the treatment of insulin resistant states such as Type 2 diabetes mellitus, but suggest that it will be important to identify all TIRE-containing genes to assess potential side effects of these agents.

The biosynthetic origin of irregular monoterpenes in Lavandula: isolation and biochemical characterization of a novel cis-prenyl diphosphate synthase gene, lavandulyl diphosphate synthase.

Science.gov (United States)

Demissie, Zerihun A; Erland, Lauren A E; Rheault, Mark R; Mahmoud, Soheil S

2013-03-01

Lavender essential oils are constituted predominantly of regular monoterpenes, for example linalool, 1,8-cineole, and camphor. However, they also contain irregular monoterpenes including lavandulol and lavandulyl acetate. Although the majority of genes responsible for the production of regular monoterpenes in lavenders are now known, enzymes (including lavandulyl diphosphate synthase (LPPS)) catalyzing the biosynthesis of irregular monoterpenes in these plants have not been described. Here, we report the isolation and functional characterization of a novel cis-prenyl diphosphate synthase cDNA, termed Lavandula x intermedia lavandulyl diphosphate synthase (LiLPPS), through a homology-based cloning strategy. The LiLPPS ORF, encoding for a 305-amino acid long protein, was expressed in Escherichia coli, and the recombinant protein was purified by nickel-nitrilotriacetic acid affinity chromatography. The approximately 34.5-kDa bacterially produced protein specifically catalyzed the head-to-middle condensation of two dimethylallyl diphosphate units to LPP in vitro with apparent Km and kcat values of 208 ± 12 μm and 0.1 s(-1), respectively. LiLPPS is a homodimeric enzyme with a sigmoidal saturation curve and Hill coefficient of 2.7, suggesting a positive co-operative interaction among its catalytic sites. LiLPPS could be used to modulate the production of lavandulol and its derivatives in plants through metabolic engineering.

Bioinformatics analysis of the phytoene synthase gene in cabbage (Brassica oleracea var. capitata)

Science.gov (United States)

Sun, Bo; Jiang, Min; Xue, Shengling; Zheng, Aihong; Zhang, Fen; Tang, Haoru

2018-04-01

Phytoene Synthase (PSY) is an important enzyme in carotenoid biosynthesis. Here, the Brassica oleracea var. capitata PSY (BocPSY) gene sequences were obtained from Brassica database (BRAD), and preformed for bioinformatics analysis. The BocPSY1, BocPSY2 and BocPSY3 genes mapped to chromosomes 2,3 and 9, and contains an open reading frame of 1,248 bp, 1,266 bp and 1,275 bp that encodes a 415, 421, 424 amino acid protein, respectively. Subcellular localization predicted all BocPSY genes were in the chloroplast. The conserved domain of the BocPSY protein is PLN02632. Homology analysis indicates that the levels of identity among BocPSYs were all more than 85%, and the PSY protein is apparently conserved during plant evolution. The findings of the present study provide a molecular basis for the elucidation of PSY gene function in cabbage.

Nicotianamine synthase overexpression positively modulates iron homeostasis-related genes in high iron rice

Directory of Open Access Journals (Sweden)

Meng eWang

2013-05-01

Full Text Available Nearly one-third of the world population, mostly women and children, suffer from iron malnutrition and its consequences, such as anemia or impaired mental development. Biofortification of rice, which is a staple crop for nearly half of the world’s population, can significantly contribute in alleviating iron deficiency. NFP rice (transgenic rice expressing nicotianamine synthase, ferritin and phytase genes has a more than six-fold increase in iron content in polished rice grains, resulting from the synergistic action of nicotianamine synthase (NAS and ferritin transgenes. We investigated iron homeostasis in NFP plants by analyzing the expression of 28 endogenous rice genes known to be involved in the homeostasis of iron and other metals, in iron-deficient and iron-sufficient conditions. RNA was collected from different tissues (roots, flag leaves, grains and at three developmental stages during grain filling. NFP plants showed increased sensitivity to iron-deficiency conditions and changes in the expression of endogenous genes involved in nicotianamine (NA metabolism, in comparison to their non-transgenic siblings. Elevated transcript levels were detected in NFP plants for several iron transporters. In contrast, expression of OsYSL2, which encodes a member of Yellow Stripe-like protein family, and a transporter of the NA-Fe(II complex was reduced in NFP plants under low iron conditions, indicating that expression of OsYSL2 is regulated by the endogenous iron status. Expression of the transgenes did not significantly affect overall iron homeostasis in NFP plants, which establishes the engineered push-pull mechanism as a suitable strategy to increase rice endosperm iron content.

Influence of free radicals generated by gamma irradiation on the trehalose levels in Saccharomyces boulardii leaven cells

International Nuclear Information System (INIS)

Martins, Flaviano dos Santos; Vianna, Cristina Roscoe; Minas Gerais Univ, Belo Horizonte, MG; Neves, Maria Jose

2002-01-01

Lyophilized cells of yeast Saccharomyces boulardii were submit to the gamma irradiation ( 60 Cobalt). It was noted that the yeast cells surviving to gamma irradiation had more trehalose than control cells. The incubation of cells with H 2 0 2 induces the synthesis of trehalose but the exposition to CdCl 2 induces the accumulation of trehalose only in low concentrations. Apparently there is a positive correlation between of trehalose level and gamma irradiation resistance of S. boulardii cells. It was not observed any correlation with the level of trehalose determined and the oxidative stress tested. (author)

Neonatal screening for sickle cell disease, Glucose-6-PhosphateDehydrogenase deficiency and Alpha-Thalassemia in Qatif and Al-Hasa

International Nuclear Information System (INIS)

Nasserullah, Z.; Srair, Hussain Abu; Al-Jame, A.; Mokhtar, M.; Al-Qatari, G.; Al-Naim, S.; Al-Aqib, A.

1998-01-01

Screening programs to determine the frequency of sickle cell,glucose-6-phosphate dehydrogenase deficiency and alpha-thalassemia gene areavailable in Saudi Arabia, although not used frequently. Greater use of theseprograms will decrease the morbidity and mortality of Saudi children affectedby these disorders. Neonatal hemoglobin electrophoresis andglucose-6-dehydrogenase fluorescent spot tests were performed on new bornbabies delivered between December 1992 and December 1993 at the Qatif CentralHospital and at the King Fahd Hospital in Al-Hasa. Cord blood samples werecollected from babies born in these two hospitals. Babies born in otherhospitals had blood collected in their first visit to Qatif primary carecenters at the time of vaccination. All specimens were sent to Dammam CentralLaboratory. The diagnosis of sickle cell and alpha-thalassemia was based oncellulose acetate electrophoresis and confirmed by agar gel electrophoresisand glucose-6-phosphate dehydrgenase was confirmed by fluorescent spot test.A total of 12,220 infants, including 11,313 Saudis (92.6%), were screenedover a 12-month period. The common phenotype detected in these infantsincluded AF, SFA, SFA Bart's, FS and FS Bart's. In Saudi infants, homozygoussickle cell disease was detected in 2.35% and 1.08% in Qatif and Al-Hasa,respectively. The frequencies of sickle cell gene were 0.1545% and 0.1109% inQatif and Al-Hasa. Alpha-thalassemia genes based on an elevated level of HbBart's were 28% and 16.3% in Qatif and Al-Hasa. The screening for G6PDdeficiency revealed a high prevalence of 30.6% and 14.7% in Qatif andAl-Hasa. In the non-Saudi infants the frequencies were low. The outcome ofthis study indicates that the Saudi populations in Qatif and Al-Hasa are atrisk for hemoglobinopathies and G6PD. Neonatal screening programs areessential and cost effective and should be maintained as a routine practice.(author)

Expression analysis of a heat-inducible, Myo-inositol-1-phosphate synthase (MIPS) gene from wheat and the alternatively spliced variants of rice and Arabidopsis.

Science.gov (United States)

Khurana, Neetika; Chauhan, Harsh; Khurana, Paramjit

2012-01-01

Molecular dissection and a deeper analysis of the heat stress response mechanism in wheat have been poorly understood so far. This study delves into the molecular basis of action of TaMIPS, a heat stress-inducible enzyme that was identified through PCR-select subtraction technology, which is named here as TaMIPS2. MIPS (L-Myo-inositol-phosphate synthase) is important for the normal growth and development in plants. Expression profiling showed that TaMIPS2 is expressed during different developing seed stages upon heat stress. Also, the transcript levels increase in unfertilized ovaries and significant amounts are present during the recovery period providing evidence that MIPS is crucial for its role in heat stress recovery and flower development. Alternatively spliced forms from rice and Arabidopsis were also identified and their expression analysis revealed that apart from heat stress, some of the spliced variants were also inducible by drought, NaCl, Cold, ABA, BR, SA and mannitol. In silico promoter analysis revealed various cis-elements that could contribute for the differential regulation of MIPS in different plant systems. Phylogenetic analysis indicated that MIPS are highly conserved among monocots and dicots and TaMIPS2 grouped specifically with monocots. Comparative analyses was undertaken by different experimental approaches, i.e., semi-quantitative RT-PCR, quantitative RT-PCR, Genevestigator as a reference expression tool and motif analysis to predict the possible function of TaMIPS2 in regulating the different aspects of plant development under abiotic stress in wheat.

Bioinformatics Prediction of Polyketide Synthase Gene Clusters from Mycosphaerella fijiensis.

Science.gov (United States)

Noar, Roslyn D; Daub, Margaret E

2016-01-01

Mycosphaerella fijiensis, causal agent of black Sigatoka disease of banana, is a Dothideomycete fungus closely related to fungi that produce polyketides important for plant pathogenicity. We utilized the M. fijiensis genome sequence to predict PKS genes and their gene clusters and make bioinformatics predictions about the types of compounds produced by these clusters. Eight PKS gene clusters were identified in the M. fijiensis genome, placing M. fijiensis into the 23rd percentile for the number of PKS genes compared to other Dothideomycetes. Analysis of the PKS domains identified three of the PKS enzymes as non-reducing and two as highly reducing. Gene clusters contained types of genes frequently found in PKS clusters including genes encoding transporters, oxidoreductases, methyltransferases, and non-ribosomal peptide synthases. Phylogenetic analysis identified a putative PKS cluster encoding melanin biosynthesis. None of the other clusters were closely aligned with genes encoding known polyketides, however three of the PKS genes fell into clades with clusters encoding alternapyrone, fumonisin, and solanapyrone produced by Alternaria and Fusarium species. A search for homologs among available genomic sequences from 103 Dothideomycetes identified close homologs (>80% similarity) for six of the PKS sequences. One of the PKS sequences was not similar (< 60% similarity) to sequences in any of the 103 genomes, suggesting that it encodes a unique compound. Comparison of the M. fijiensis PKS sequences with those of two other banana pathogens, M. musicola and M. eumusae, showed that these two species have close homologs to five of the M. fijiensis PKS sequences, but three others were not found in either species. RT-PCR and RNA-Seq analysis showed that the melanin PKS cluster was down-regulated in infected banana as compared to growth in culture. Three other clusters, however were strongly upregulated during disease development in banana, suggesting that they may encode

Bioinformatics Prediction of Polyketide Synthase Gene Clusters from Mycosphaerella fijiensis.

Directory of Open Access Journals (Sweden)

Roslyn D Noar

Full Text Available Mycosphaerella fijiensis, causal agent of black Sigatoka disease of banana, is a Dothideomycete fungus closely related to fungi that produce polyketides important for plant pathogenicity. We utilized the M. fijiensis genome sequence to predict PKS genes and their gene clusters and make bioinformatics predictions about the types of compounds produced by these clusters. Eight PKS gene clusters were identified in the M. fijiensis genome, placing M. fijiensis into the 23rd percentile for the number of PKS genes compared to other Dothideomycetes. Analysis of the PKS domains identified three of the PKS enzymes as non-reducing and two as highly reducing. Gene clusters contained types of genes frequently found in PKS clusters including genes encoding transporters, oxidoreductases, methyltransferases, and non-ribosomal peptide synthases. Phylogenetic analysis identified a putative PKS cluster encoding melanin biosynthesis. None of the other clusters were closely aligned with genes encoding known polyketides, however three of the PKS genes fell into clades with clusters encoding alternapyrone, fumonisin, and solanapyrone produced by Alternaria and Fusarium species. A search for homologs among available genomic sequences from 103 Dothideomycetes identified close homologs (>80% similarity for six of the PKS sequences. One of the PKS sequences was not similar (< 60% similarity to sequences in any of the 103 genomes, suggesting that it encodes a unique compound. Comparison of the M. fijiensis PKS sequences with those of two other banana pathogens, M. musicola and M. eumusae, showed that these two species have close homologs to five of the M. fijiensis PKS sequences, but three others were not found in either species. RT-PCR and RNA-Seq analysis showed that the melanin PKS cluster was down-regulated in infected banana as compared to growth in culture. Three other clusters, however were strongly upregulated during disease development in banana, suggesting that

Glucose-6-Phosphate Dehydrogenase Enhances Antiviral Response through Downregulation of NADPH Sensor HSCARG and Upregulation of NF-κB Signaling

Directory of Open Access Journals (Sweden)

Yi-Hsuan Wu

2015-12-01

Full Text Available Glucose-6-phosphate dehydrogenase (G6PD-deficient cells are highly susceptible to viral infection. This study examined the mechanism underlying this phenomenon by measuring the expression of antiviral genes—tumor necrosis factor alpha (TNF-α and GTPase myxovirus resistance 1 (MX1—in G6PD-knockdown cells upon human coronavirus 229E (HCoV-229E and enterovirus 71 (EV71 infection. Molecular analysis revealed that the promoter activities of TNF-α and MX1 were downregulated in G6PD-knockdown cells, and that the IκB degradation and DNA binding activity of NF-κB were decreased. The HSCARG protein, a nicotinamide adenine dinucleotide phosphate (NADPH sensor and negative regulator of NF-κB, was upregulated in G6PD-knockdown cells with decreased NADPH/NADP+ ratio. Treatment of G6PD-knockdown cells with siRNA against HSCARG enhanced the DNA binding activity of NF-κB and the expression of TNF-α and MX1, but suppressed the expression of viral genes; however, the overexpression of HSCARG inhibited the antiviral response. Exogenous G6PD or IDH1 expression inhibited the expression of HSCARG, resulting in increased expression of TNF-α and MX1 and reduced viral gene expression upon virus infection. Our findings suggest that the increased susceptibility of the G6PD-knockdown cells to viral infection was due to impaired NF-κB signaling and antiviral response mediated by HSCARG.

The rice terpene synthase gene OsTPS19 functions as an (S)-limonene synthase in planta, and its overexpression leads to enhanced resistance to the blast fungus Magnaporthe oryzae.

Science.gov (United States)

Chen, Xujun; Chen, Hao; Yuan, Joshua S; Köllner, Tobias G; Chen, Yuying; Guo, Yufen; Zhuang, Xiaofeng; Chen, Xinlu; Zhang, Yong-Jun; Fu, Jianyu; Nebenführ, Andreas; Guo, Zejian; Chen, Feng

2018-03-06

Rice blast disease, caused by the fungus Magnaporthe oryzae, is the most devastating disease of rice. In our ongoing characterization of the defence mechanisms of rice plants against M. oryzae, a terpene synthase gene OsTPS19 was identified as a candidate defence gene. Here, we report the functional characterization of OsTPS19, which is up-regulated by M. oryzae infection. Overexpression of OsTPS19 in rice plants enhanced resistance against M. oryzae, while OsTPS19 RNAi lines were more susceptible to the pathogen. Metabolic analysis revealed that the production of a monoterpene (S)-limonene was increased and decreased in OsTPS19 overexpression and RNAi lines, respectively, suggesting that OsTPS19 functions as a limonene synthase in planta. This notion was further supported by in vitro enzyme assays with recombinant OsTPS19, in which OsTPS19 had both sesquiterpene activity and monoterpene synthase activity, with limonene as a major product. Furthermore, in a subcellular localization experiment, OsTPS19 was localized in plastids. OsTPS19 has a highly homologous paralog, OsTPS20, which likely resulted from a recent gene duplication event. We found that the variation in OsTPS19 and OsTPS20 enzyme activities was determined by a single amino acid in the active site cavity. The expression of OsTPS20 was not affected by M. oryzae infection. This indicates functional divergence of OsTPS19 and OsTPS20. Lastly, (S)-limonene inhibited the germination of M. oryzae spores in vitro. OsTPS19 was determined to function as an (S)-limonene synthase in rice and plays a role in defence against M. oryzae, at least partly, by inhibiting spore germination. © 2018 The Authors. Plant Biotechnology Journal published by Society for Experimental Biology and The Association of Applied Biologists and John Wiley & Sons Ltd.

Evaluation on the effectiveness of 2-deoxyglucose-6-phosphate phosphatase (DOGR1) gene as a selectable marker for oil palm (Elaeis guineensis Jacq.) embryogenic calli transformation mediated by Agrobacterium tumefaciens

Science.gov (United States)

Izawati, Abang Masli Dayang; Masani, Mat Yunus Abdul; Ismanizan, Ismail; Parveez, Ghulam Kadir Ahmad

2015-01-01

DOGR1, which encodes 2-deoxyglucose-6-phosphate phosphatase, has been used as a selectable marker gene to produce transgenic plants. In this study, a transformation vector, pBIDOG, which contains the DOGR1 gene, was transformed into oil palm embryogenic calli (EC) mediated by Agrobacterium tumefaciens strain LBA4404. Transformed EC were exposed to 400 mg l-1 2-deoxyglucose (2-DOG) as the selection agent. 2-DOG resistant tissues were regenerated into whole plantlets on various regeneration media containing the same concentration of 2-DOG. The plantlets were later transferred into soil and grown in a biosafety screenhouse. PCR and subsequently Southern blot analyses were carried out to confirm the integration of the transgene in the plantlets. A transformation efficiency of about 1.0% was obtained using DOGR1 gene into the genome of oil palm. This result demonstrates the potential of using combination of DOGR1 gene and 2-DOG for regenerating transgenic oil palm. PMID:26442041

Identification of a Fungal 1,8-Cineole Synthase from Hypoxylon sp. with Specificity Determinants in Common with the Plant Synthases*

Science.gov (United States)

Shaw, Jeffrey J.; Berbasova, Tetyana; Sasaki, Tomoaki; Jefferson-George, Kyra; Spakowicz, Daniel J.; Dunican, Brian F.; Portero, Carolina E.; Narváez-Trujillo, Alexandra; Strobel, Scott A.

2015-01-01

Terpenes are an important and diverse class of secondary metabolites widely produced by fungi. Volatile compound screening of a fungal endophyte collection revealed a number of isolates in the family Xylariaceae, producing a series of terpene molecules, including 1,8-cineole. This compound is a commercially important component of eucalyptus oil used in pharmaceutical applications and has been explored as a potential biofuel additive. The genes that produce terpene molecules, such as 1,8-cineole, have been little explored in fungi, providing an opportunity to explore the biosynthetic origin of these compounds. Through genome sequencing of cineole-producing isolate E7406B, we were able to identify 11 new terpene synthase genes. Expressing a subset of these genes in Escherichia coli allowed identification of the hyp3 gene, responsible for 1,8-cineole biosynthesis, the first monoterpene synthase discovered in fungi. In a striking example of convergent evolution, mutational analysis of this terpene synthase revealed an active site asparagine critical for water capture and specificity during cineole synthesis, the same mechanism used in an unrelated plant homologue. These studies have provided insight into the evolutionary relationship of fungal terpene synthases to those in plants and bacteria and further established fungi as a relatively untapped source of this important and diverse class of compounds. PMID:25648891

AJS1669, a novel small-molecule muscle glycogen synthase activator, improves glucose metabolism and reduces body fat mass in mice

Science.gov (United States)

Nakano, Kazuhiro; Takeshita, Sen; Kawasaki, Noriko; Miyanaga, Wataru; Okamatsu, Yoriko; Dohi, Mizuki; Nakagawa, Tadakiyo

2017-01-01

Impaired glycogen synthesis and turnover are common in insulin resistance and type 2 diabetes. As glycogen synthase (GS) is a key enzyme involved in the synthetic process, it presents a promising therapeutic target for the treatment of type 2 diabetes. In the present study, we identified a novel, potent and orally available GS activator AJS1669 {sodium 2-[[5-[[4-(4,5-difluoro-2-methylsulfanyl-phenyl) phenoxy] methyl]furan-2-carbonyl]-(2-furylmethyl)amino] acetate}. In vitro, we performed a glycogen synthase 1 (GYS1) activation assay for screening GS activators and identified that the activity of AJS1669 was further potentiated in the presence of glucose-6-phosphate (G6P). In vivo, we used ob/ob mice to evaluate the novel anti-diabetic effects of AJS1669 by measuring basal blood glucose levels, glucose tolerance and body fat mass index. Repeated administration of AJS1669 over 4 weeks reduced blood glucose and hemoglobin A1c (HbA1c) levels in ob/ob mice. AJS1669 also improved glucose tolerance in a dose-dependent manner, and decreased body fat mass. The mRNA levels of genes involved in mitochondrial fatty acid oxidation and mitochondrial biogenesis were elevated in skeletal muscle tissue following AJS1669 treatment. Hepatic tissue of treated mice also exhibited elevated expression of genes associated with fatty acid oxidation. In contrast to ob/ob mice, in C57Bl/6 mice AJS1669 administration did not alter body weight or reduce glucose levels. These results demonstrate that pharmacological agents that activate GYS1, the main GS subtype found in skeletal muscle, have potential for use as novel treatments for diabetes that improve glucose metabolism in skeletal muscle. PMID:28290602

Analysis of MaACS2, a stress-inducible ACC Synthase Gene in Musa acuminata AAA Group Cultivar Pisang Ambon

Directory of Open Access Journals (Sweden)

Resnanti Utami Handayani

2014-07-01

Full Text Available Ethylene has an important function in plant growth and development. Ethylene production generally increases in response to pathogen attacks and other environmental stress conditions. The synthesis of this phytohormone is regulated by two enzymes, ACC synthase (ACS and ACC oxidase (ACO. ACC synthase is encoded by a multigene that regulates the production of ACC, after which this precursor is converted into ethylene by ACO. Pisang Ambon (Musa sp. AAA group, a banana cultivar originating from Indonesia, has nine ACS genes (MaACS 1-9 and one ACO gene (MaACO. One of the banana ACS genes, MaACS2, is stress-inducible. In this research, we have investigated the expression profile of MaACS2 in the roots and leaf tissues of infected tissue culture plants. Quantification of gene expression was analyzed using Real-Time PCR (qPCR using Ma18srRNA and MaGAPDH as reference genes. The results showed nine-to ten fold higher MaACS2 expression levels in the infected roots tissues compared to the uninfected roots tissues. However, MaACS2 expression in the leaves was only detected in infected tissue.

Dephosphorylation of 2-deoxyglucose 6-phosphate and 2-deoxyglucose export from cultured astrocytes.

Science.gov (United States)

Forsyth, R J; Bartlett, K; Eyre, J

1996-03-01

Neurotransmitter-stimulated mobilization of astrocyte glycogen has been proposed as a basis for local energy homeostasis in brain. However, uncertainty remains over the fate of astrocyte glycogen. Upon transfer of cultured astrocytes pre-loaded with [2-3H]2-deoxyglucose 6-phosphate at non-tracer concentrations to a glucose-free, 2-deoxyglucose-free medium, rapid dephosphorylation of a proportion of the intracellular 2-deoxyglucose 6-phosphate pool and export of 2-deoxyglucose to the extracellular fluid occurs. Astrocytes show very low, basal rates of gluconeogenesis from pyruvate (approx. 1 nmol mg protein-1 h-1). Astrocytes in vivo may be capable of physiologically significant glucose export from glucose-6-phosphate. The low gluconeogenic activity in astrocytes suggests that the most likely source of glucose-6-phosphate may be glycogen. These findings support the hypothesis that export, as glucose, to adjacent neurons may be one of the possible fate(s) of astrocytic glycogen. Such export of glycogen as glucose occurring in response to increases in neuronal activity could contribute to energy homeostasis on a paracrine scale within brain.

Parallel evolution of the glycogen synthase 1 (muscle) gene Gys1 between Old World and New World fruit bats (Order: Chiroptera).

Science.gov (United States)

Fang, Lu; Shen, Bin; Irwin, David M; Zhang, Shuyi

2014-10-01

Glycogen synthase, which catalyzes the synthesis of glycogen, is especially important for Old World (Pteropodidae) and New World (Phyllostomidae) fruit bats that ingest high-carbohydrate diets. Glycogen synthase 1, encoded by the Gys1 gene, is the glycogen synthase isozyme that functions in muscles. To determine whether Gys1 has undergone adaptive evolution in bats with carbohydrate-rich diets, in comparison to insect-eating sister bat taxa, we sequenced the coding region of the Gys1 gene from 10 species of bats, including two Old World fruit bats (Pteropodidae) and a New World fruit bat (Phyllostomidae). Our results show no evidence for positive selection in the Gys1 coding sequence on the ancestral Old World and the New World Artibeus lituratus branches. Tests for convergent evolution indicated convergence of the sequences and one parallel amino acid substitution (T395A) was detected on these branches, which was likely driven by natural selection.

Conformation analysis of trehalose. Molecular dynamics simulation and molecular mechanics

International Nuclear Information System (INIS)

Donnamaira, M.C.; Howard, E.I.; Grigera, J.R.

1992-09-01

Conformational analysis of the disaccharide trehalose is done by molecular dynamics and molecular mechanics. In spite of the different force fields used in each case, comparison between the molecular dynamics trajectories of the torsional angles of glycosidic linkage and energy conformational map shows a good agreement between both methods. By molecular dynamics it is observed a moderate mobility of the glycosidic linkage. The demands of computer time is comparable in both cases. (author). 6 refs, 4 figs

The Aspergillus niger MADS-box transcription factor RlmA is required for cell wall reinforcement in response to cell wall stress.

NARCIS (Netherlands)

Damveld, R.A.; Arentshorst, M.; Franken, A.; Vankuyk, P.A.; Klis, F.M.; van den Hondel, C.A.; Ram, A.F.

2005-01-01

In Aspergillus niger, the genes coding for glutamine:fructose-6-phosphate amidotransferase (gfaA) and ¿-1,3-glucan synthase (agsA) are induced in response to cell wall stress. In silico analysis of the promoter region of the two genes revealed the presence of putative DNA binding sites for

Uptake and metabolism of carbohydrates by Bradyrhizobium japonicum bacteroids

International Nuclear Information System (INIS)

Salminen, S.O.; Streeter, J.G.

1987-01-01

Bradyrhizobium japonicum bacteroids were isolated anaerobically and were supplied with 14 C-labeled trehalose, sucrose, UDP-glucose, glucose, or fructose under low O 2 (2% in the gas phase). Uptake and conversion of 14 C to CO 2 were measured at intervals up to 90 minutes. Of the five compounds studied, UDP-glucose was most rapidly absorbed but it was very slowly metabolized. Trehalose was the sugar most rapidly converted to CO 2 , and fructose was respired at a rate of at least double that of glucose. Sucrose and glucose were converted to CO 2 at a very low but measurable rate ( 2 at a rate 30 times greater than the conversion of carbon Number 6 to CO 2 , indicating high activity of the pentose phosphate pathway. Enzymes of the Entner-Doudoroff pathway were not detected in bacteroids, but very low activities of sucrose synthase and phosphofructokinase were demonstrated. Although metabolism of sugars by B. japonicum bacteroids was clearly demonstrated, the rate of sugar uptake was only 1/30 to 1/50 the rate of succinate uptake. The overall results support the view that, although bacteroids metabolize sugars, the rates are very low and are inadequate to support nitrogenase

Isolation and Characterization of Three New Monoterpene Synthases from Artemisia annua

Science.gov (United States)

Ruan, Ju-Xin; Li, Jian-Xu; Fang, Xin; Wang, Ling-Jian; Hu, Wen-Li; Chen, Xiao-Ya; Yang, Chang-Qing

2016-01-01

Artemisia annua, an annual herb used in traditional Chinese medicine, produces a wealth of monoterpenes and sesquiterpenes, including the well-known sesquiterpene lactone artemisinin, an active ingredient in the treatment for malaria. Here we report three new monoterpene synthases of A. annua. From a glandular trichome cDNA library, monoterpene synthases of AaTPS2, AaTPS5, and AaTPS6, were isolated and characterized. The recombinant proteins of AaTPS5 and AaTPS6 produced multiple products with camphene and 1,8-cineole as major products, respectively, and AaTPS2 produced a single product, β-myrcene. Although both Mg2+ and Mn2+ were able to support their catalytic activities, altered product spectrum was observed in the presence of Mn2+ for AaTPS2 and AaTPS5. Analysis of extracts of aerial tissues and root of A. annua with gas chromatography–mass spectrometry detected more than 20 monoterpenes, of which the three enzymes constituted more than 1/3 of the total. Mechanical wounding induced the expression of all three monoterpene synthase genes, and transcript levels of AaTPS5 and AaTPS6 were also elevated after treatments with phytohormones of methyl jasmonate, salicylic acid, and gibberellin, suggesting a role of these monoterpene synthases in plant–environment interactions. The three new monoterpene synthases reported here further our understanding of molecular basis of monoterpene biosynthesis and regulation in plant. PMID:27242840

Isolation and characterization of three new monoterpene synthases from Artemisia annua

Directory of Open Access Journals (Sweden)

Ju-Xin eRuan

2016-05-01

Full Text Available Artemisia annua, an annual herb used in traditional Chinese medicine, produces a wealth of monoterpenes and sesquiterpenes, including the well-known sesquiterpene lactone artemisinin, an active ingredient in the treatment for malaria. Here we report three new monoterpene synthases of A. annua. From a glandular trichome cDNA library, monoterpene synthases of AaTPS2, AaTPS5 and AaTPS6, were isolated and characterized. The recombinant proteins of AaTPS5 and AaTPS6 produced multiple products with camphene and 1,8-cineole as major products, respectively, and AaTPS2 produced a single product, β-myrcene. Although both Mg2+ and Mn2+ were able to support their catalytic activities, altered product spectrum was observed in the presence of Mn2+ for AaTPS2 and AaTPS5. Analysis of extracts of aerial tissues and root of A. annua with gas chromatography-mass spectrometry (GC-MS detected more than 20 monoterpenes, of which the three enzymes constituted more than 1/3 of the total. Mechanical wounding induced the expression of all three monoterpene synthase genes, and transcript levels of AaTPS5 and AaTPS6 were also elevated after treatments with phytohormones of methyl jasmonate (MeJA, salicylic acid (SA and gibberellin (GA, suggesting a role of these monoterpene synthases in plant-environment interactions. The three new monoterpene synthases reported here further our understanding of molecular basis of monoterpene biosynthesis and regulation in plant.

Differential accumulation of β-carotene and tissue specific expression of phytoene synthase (MaPsy) gene in banana (Musa sp) cultivars.

Science.gov (United States)

Dhandapani, R; Singh, V P; Arora, A; Bhattacharya, R C; Rajendran, Ambika

2017-12-01

An experiment was conducted with twelve major Indian banana cultivars to investigate the molecular relationship between the differential accumulation of β-carotene in peel and pulp of the banana fruit and carotenoid biosynthetic pathway genes. The high performance liquid chromatography showed that all banana cultivars accumulated two-three fold more β-carotene in non-edible portion of the banana fruit. However, Nendran , a famous orange fleshed cultivar of South India, had high β-carotene content (1362 µg/100 g) in edible pulp. The gene encoding Musa accuminata phytoene synthase ( MaPsy ) was successfully amplified using a pair of degenerate primers designed from Oncidium orchid. The deduced amino acid sequences shared a high level of identity to phytoene synthase gene from other plants. Gene expression analysis confirmed the presence of two isoforms ( MaPsy1 and MaPsy2 ) of MaPsy gene in banana fruits. Presence of two isoforms of MaPsy gene in peel and one in pulp confirmed the differential accumulation of β-carotene in banana fruits. However, Nendran accumulated more β-carotene in edible pulp due to presence of both the isoforms of MaPsy gene. Thus, carotenoid accumulation is a tissue specific process strongly dependent on differential expression pattern of two isoforms of MaPsy gene in banana.

Elucidating the role of osmotic, ionic and major salt responsive transcript components towards salinity tolerance in contrasting chickpea (Cicer arietinum L.) genotypes.

Science.gov (United States)

Singh, Jogendra; Singh, Vijayata; Sharma, P C

2018-05-01

The growth of chickpea ( Cicer arietinum L.) is extremely hampered by salt stress. Understanding of physio-biochemical and molecular attributes along with morphological traits contributing to the salinity tolerance is important for developing salt tolerant chickpea varieties. To explore these facts, two genotypes CSG8962 and HC5 with contrasting salt tolerance were evaluated in the salinity stress (Control and 120 mM NaCl) conditions. CSG8962 maintained lower Na/K ratio in root and shoot, trammeled Na translocation to the shoots from roots compared to HC5 which ascribed to better exclusion of salt from its roots and compartmentation in the shoot. In chickpea, salt stress specifically induced genes/sequences involved at several levels in the salt stress signaling pathway. Higher induction of trehalose 6 phosphate synthase and protein kinase genes pertaining to the osmotic and signaling modules, respectively, were evident in CSG8962 compared to HC5. Further transcripts of late embryogenesis abundant, non-specific lipid transfer protein, HI and 219 genes/sequences were also highly induced in CSG8962 compared to HC5 which emphasizes the better protection of cellular membranous network and membrane-bound macromolecules under salt stress. This further suppressed the stress enhanced electrolyte leakage, loss of turgidity, promoted the higher compatible solute accumulation and maintained better cellular ion homoeostasis in CSG8962 compared to HC5. Our study further adds to the importance of these genes in salt tolerance by comparing their behavior in contrasting chickpea genotypes.

Phylogenetic Relationship of Phosphate Solubilizing Bacteria according to 16S rRNA Genes

Directory of Open Access Journals (Sweden)

Mohammad Bagher Javadi Nobandegani

2015-01-01

Full Text Available Phosphate solubilizing bacteria (PSB can convert insoluble form of phosphorous to an available form. Applications of PSB as inoculants increase the phosphorus uptake by plant in the field. In this study, isolation and precise identification of PSB were carried out in Malaysian (Serdang oil palm field (University Putra Malaysia. Identification and phylogenetic analysis of 8 better isolates were carried out by 16S rRNA gene sequencing in which as a result five isolates belong to the Beta subdivision of Proteobacteria, one isolate was related to the Gama subdivision of Proteobacteria, and two isolates were related to the Firmicutes. Bacterial isolates of 6upmr, 2upmr, 19upmnr, 10upmr, and 24upmr were identified as Alcaligenes faecalis. Also, bacterial isolates of 20upmnr and 17upmnr were identified as Bacillus cereus and Vagococcus carniphilus, respectively, and bacterial isolates of 31upmr were identified as Serratia plymuthica. Molecular identification and characterization of oil palm strains as the specific phosphate solubilizer can reduce the time and cost of producing effective inoculate (biofertilizer in an oil palm field.

Trehalose, glycogen and ethanol metabolism in the gcr1 mutant of Saccharomyces cerevisiae

DEFF Research Database (Denmark)

Seker, Tamay; Hamamci, H.

2003-01-01

Since Gcr1p is pivotal in controlling the transcription of glycolytic enzymes and trehalose metabolism seems to be one of the control points of glycolysis, we examined trehalose and glycogen synthesis in response to 2 % glucose pulse during batch growth in gcr1 (glucose regulation-1) mutant lacking...... fully functional glycolytic pathway and in the wild-type strain. An increase in both trehalose and glycogen stores was observed 1 and 2 h after the pulse followed by a steady decrease in both the wild-type and the gcr1 mutant. The accumulation was faster while the following degradation was slower in gcr......1 cells compared to wild-type ones. Although there was no distinct glucose consumption in the mutant cells it seemed that the glucose repression mechanism is similar in gcr1 mutant and in wild-type strain at least with respect to trehalose and glycogen metabolism....

Transcriptional profiling of extracellular amino acid sensing in Saccharomyces cerevisiae and the role of Stp1p and Stp2p

DEFF Research Database (Denmark)

Eckert-Boulet, Nadine; Nielsen, P.S.; Friis, Carsten

2004-01-01

Tdh1p and glucokinase (Glk1p), shows increased transcription levels in either or both of the mutants. Also, most of the structural genes involved in trehalose and glycogen synthesis and a few genes in the glyoxylate cycle and the pentose phosphate pathway are derepressed in the ssy1 and stp1 stp2...

Five novel glucose-6-phosphate dehydrogenase deficiency haplotypes correlating with disease severity

Directory of Open Access Journals (Sweden)

Dallol Ashraf

2012-09-01

Full Text Available Abstract Background Glucose-6-phosphate dehydrogenase (G6PD, EC 1.1.1.49 deficiency is caused by one or more mutations in the G6PD gene on chromosome X. An association between enzyme levels and gene haplotypes remains to be established. Methods In this study, we determined G6PD enzyme levels and sequenced the coding region, including the intron-exon boundaries, in a group of individuals (163 males and 86 females who were referred to the clinic with suspected G6PD deficiency. The sequence data were analysed by physical linkage analysis and PHASE haplotype reconstruction. Results All previously reported G6PD missense changes, including the AURES, MEDITERRANEAN, A-, SIBARI, VIANGCHAN and ANANT, were identified in our cohort. The AURES mutation (p.Ile48Thr was the most common variant in the cohort (30% in males patients followed by the Mediterranean variant (p.Ser188Phe detectable in 17.79% in male patients. Variant forms of the A- mutation (p.Val68Met, p.Asn126Asp or a combination of both were detectable in 15.33% of the male patients. However, unique to this study, several of such mutations co-existed in the same patient as shown by physical linkage in males or PHASE haplotype reconstruction in females. Based on 6 non-synonymous variants of G6PD, 13 different haplotypes (13 in males, 8 in females were identified. Five of these were previously unreported (Jeddah A, B, C, D and E and were defined by previously unreported combinations of extant mutations where patients harbouring these haplotypes exhibited severe G6PD deficiency. Conclusions Our findings will help design a focused population screening approach and provide better management for G6PD deficiency patients.

D-glucose-6-phosphate dehydrogenase (Entner-Doudoroff enzyme) from Pseudomonas fluorescens

International Nuclear Information System (INIS)

Lessmann, D.; Schimz, K.L.; Kurz, G.

1975-01-01

The existence of two different D-glucose-6-phosphate dehydrogenases in Pseudomonas fluorescens has been demonstrated. Based on their different specificity and their different metabolic regulation one enzyme is appointed to the Entner-Doudoroff pathway and the other to the hexose monophosphate pathway. A procedure is described for the isolation of that D-glucose-6-phosphate dehydrogenase which forms part of the Entner-Doudoroff pathway (Entner-Doudoroff enzyme). A 950-fold purification was achieved with an overall yield of 44%. The final preparation, having a specific activity of about 300μmol NADH formed per min per mg protein, was shown to be homogeneous. The molecular weight of the Entner-Doudoroff enzyme has been determined to be 220,000 by gel permeation chromatography, and that of the other enzyme (Zwischenferment) has been shown to be 265,000. The pI of the Entner-Doudoroff enzyme has been shown to be 5.24 and that of the Zwischenferment 4.27. The Entner-Doudoroff enzyme is stable in the range of pH 6 to 10.5 and shows its maximal acivity at pH 8.9. The Entner-Doudoroff enzyme showed specificity for NAD + as well as for NADP + and exhibited homotropic effects for D-glucose 6-phosphate. It is inhibited by ATP which acts as a negative allosteric effector. Other nucleoside triphosphates as well as ADP are also inhibitory. The enzyme catalyzes the transfer of the axial hydrogen at carbon-1 of β-D-glucopyranose 6-phosphate to the si face of carbon-4 of the nicotinamide ring and must be classified as B-side stereospecific dehydrogenase. (orig.) [de

Erythrocyte glucose-6-phosphate dehydrogenase from Brazilian opossum Didelphis marsupialis

Directory of Open Access Journals (Sweden)

Barretto O.C. de O.

2006-01-01

Full Text Available In a comparative study of erythrocyte metabolism of vertebrates, the specific activity of glucose-6-phosphate dehydrogenase (G6PD of the Brazilian opossum Didelphis marsupialis in a hemolysate was shown to be high, 207 ± 38 IU g-1 Hb-1 min-1 at 37ºC, compared to the human erythrocyte activity of 12 ± 2 IU g-1 Hb-1 min-1 at 37ºC. The apparent high specific activity of the mixture led us to investigate the physicochemical properties of the opossum enzyme. We report that reduced glutathione (GSH in the erythrocytes was only 50% higher than in human erythrocytes, a value lower than expected from the high G6PD activity since GSH is maintained in a reduced state by G6PD activity. The molecular mass, determined by G-200 Sephadex column chromatography at pH 8.0, was 265 kDa, which is essentially the same as that of human G6PD (260 kDa. The Michaelis-Menten constants (Km: 55 µM for glucose-6-phosphate and nicotinamide adenine dinucleotide phosphate (Km: 3.3 µM were similar to those of the human enzyme (Km: 50-70 and Km: 2.9-4.4, respectively. A 450-fold purification of the opossum enzyme was achieved and the specific activity of the purified enzyme, 90 IU/mg protein, was actually lower than the 150 IU/mg protein observed for human G6PD. We conclude that G6PD after purification from the hemolysate of D. marsupialis does not have a high specific activity. Thus, it is quite probable that the red cell hyperactivity reported may be explained by increased synthesis of G6PD molecules per unit of hemoglobin or to reduced inactivation in the RBC hemolysate.

Identification of valid reference genes for the normalization of RT qPCR gene expression data in human brain tissue