Transmission of power at high voltages
Energy Technology Data Exchange (ETDEWEB)
Lane, F J
1963-01-01
High voltage transmission is considered to be concerned with circuits and systems operating at or above 132 kV. While the general examination is concerned with ac transmission, dc systems are also included. The choice of voltage for a system will usually involve hazardous assessments of the future requirements of industry, commerce and a changing population. Experience suggests that, if the estimated economic difference between two voltages is not significant, there is good reason to choose the higher voltage, as this will make the better provision for unexpected future expansion. Two principal functions served by transmission circuits in a supply system are: (a) the transportation of energy in bulk from the generator to the reception point in the distribution system; and (b) the interconnection and integration of the generating plant and associated loads. These functions are considered and various types of system are discussed in terms of practicability, viability, quality and continuity of supply. Future developments requiring transmission voltages up to 750 kV will raise many problems which are in the main empirical. Examples are given of the type of problem envisaged and it is suggested that these can only be partially solved by theory and model operation.
Bottlenecks reduction using superconductors in high voltage transmission lines
Directory of Open Access Journals (Sweden)
Daloub Labib
2016-01-01
Full Text Available Energy flow bottlenecks in high voltage transmission lines known as congestions are one of the challenges facing power utilities in fast developing countries. Bottlenecks occur in selected power lines when transmission systems are operated at or beyond their transfer limits. In these cases, congestions result in preventing new power supply contracts, infeasibility in existing contracts, price spike and market power abuse. The “Superconductor Technology” in electric power transmission cables has been used as a solution to solve the problem of bottlenecks in energy transmission at high voltage underground cables and overhead lines. The increase in demand on power generation and transmission happening due to fast development and linked to the intensive usage of transmission network in certain points, which in turn, lead to often frequent congestion in getting the required power across to where it is needed. In this paper, a bottleneck in high voltage double overhead transmission line with Aluminum Conductor Steel Reinforced was modeled using conductor parameters and replaced by Gap-Type Superconductor to assess the benefit of upgrading to higher temperature superconductor and obtain higher current carrying capacity. This proved to reduce the high loading of traditional aluminum conductors and allow more power transfer over the line using superconductor within the same existing right-of-way, steel towers, insulators and fittings, thus reducing the upgrade cost of building new lines.
Energy Technology Data Exchange (ETDEWEB)
Litzenberger, Wayne; Lava, Val
1994-08-01
References are contained for HVDC systems, converter stations and components, overhead transmission lines, cable transmission, system design and operations, simulation of high voltage direct current systems, high-voltage direct current installations, and flexible AC transmission system (FACTS).
Technical and economic considerations of extra high voltage power transmission
Energy Technology Data Exchange (ETDEWEB)
Kahnt, R
1966-09-01
The reasons for the employment of higher transmission voltages are listed and the points decisive for the selection of three phase ac or dc systems are reviewed. The technical and economic problems arising in three phase extra high voltage transmission are discussed. These include selection of voltage, economical design of power lines, insulation problems, power supply dependability, equipment rating and reactive power and stability problems.
High voltage transmission of electrical energy over long distances
Energy Technology Data Exchange (ETDEWEB)
Tewari, S W
1962-07-01
Technical aspects of ac transmission lines, additional means of improving stability ac transmisson lines, insulation problems, ac transmission by cables, high voltage dc transmission, advantages of dc over ac transmission, disadvantages of dc transmission, use of underground cables for dc transmission, history of the development of conversion equipment; transmission schemes adopted on Gotland Island, Sweden; and economics of ac and dc transmission are discussed.
Technical and economic considerations of extra high voltage power transmission
Energy Technology Data Exchange (ETDEWEB)
Kahnt, R
1966-09-01
The reasons for the employment of higher transmission voltages are listed and the points decisive for the selection of three phase ac or dc systems are reviewed. This is followed by treatment of the technical and economic problems arising in three phase-extra high voltage transmission. These include selection of voltage, economical design of power lines, insulation problems, power supply dependability, equipment rating, and reactive power and stability problems.
Directory of Open Access Journals (Sweden)
Yong Chen
2016-01-01
Full Text Available The Modular Multilevel Converters (MMC have been a spotlight for the high voltage and high power transmission systems. In the VSC-HVDC (High Voltage Direct Current based on Voltage Source Converter transmission system, the energy of DC link is stored in the distributed capacitors, and the difference of capacitors in parameters and charge rates causes capacitor voltage balance which affects the safety and stability of HVDC system. A method of MMC based on the expert system for reducing the frequency of the submodules (SMs of the IGBT switching frequency is proposed. Firstly, MMC with 51 levels for HVDC is designed. Secondly, the nearest level control (NLC for 51-level MMC is introduced. Thirdly, a modified capacitor voltage balancing method based on expert system for MMC-based HVDC transmission system is proposed. Finally, a simulation platform for 51-level Modular Multilevel Converter is constructed by using MATLAB/SIMULINK. The results indicate that the strategy proposed reduces the switching frequency on the premise of keeping submodule voltage basically identical, which greatly reduces the power losses for MMC-HVDC system.
High voltage transmission lines studies with the use of artificial intelligence
Energy Technology Data Exchange (ETDEWEB)
Ekonomou, L. [A.S.PE.T.E. - School of Pedagogical and Technological Education, Department of Electrical Engineering Educators, N. Heraklion, 141 21 Athens (Greece)
2009-12-15
The paper presents an alternative approach for the studies of high voltage transmission lines based on artificial intelligence and more specifically artificial neural networks (ANNs). In contrast to the existing conventional-analytical techniques and simulations which are using in the calculations empirical and/or approximating equations, this approach is based only on actual field data and actual measurements. The proposed approach is applied on high voltage transmission lines in order to calculate the lightning outages, on grounding systems in order to assess the grounding resistance and on high voltage transmission lines' polluted insulators in order to estimate the critical flashover voltage. The obtained results are very close to the actual ones for all three case studies, something which clearly implies that the ANN approach is well working and has an acceptable accuracy, constituting an additional tool of electric engineers. (author)
High voltage transmission lines - what are the hazards
International Nuclear Information System (INIS)
Repacholi, M.H.
1985-01-01
With the increasing use of high voltage alternating current (HVAC) transmission lines there is a growing concern among the public about possible human health effects resulting from exposure to the electric fields associated with these lines. While there is no definitive evidence of such effects, mounting public fear and activism over hypothesized health risks is already causing delays in the licensing and constuction of major power transmission facilities, and is encouraging the formation of regulatory policy. This paper briefly reviews the concerns, biological effects data and standards for HVAC transmission lines
High Voltage Power Transmission for Wind Energy
Kim, Young il
The high wind speeds and wide available area at sea have recently increased the interests on offshore wind farms in the U.S.A. As offshore wind farms become larger and are placed further from the shore, the power transmission to the onshore grid becomes a key feature. Power transmission of the offshore wind farm, in which good wind conditions and a larger installation area than an onshore site are available, requires the use of submarine cable systems. Therefore, an underground power cable system requires unique design and installation challenges not found in the overhead power cable environment. This paper presents analysis about the benefit and drawbacks of three different transmission solutions: HVAC, LCC/VSC HVDC in the grid connecting offshore wind farms and also analyzed the electrical characteristics of underground cables. In particular, loss of HV (High Voltage) subsea power of the transmission cables was evaluated by the Brakelmann's theory, taking into account the distributions of current and temperature.
Radio and television interference caused by corona discharges from high-voltage transmission lines
International Nuclear Information System (INIS)
Sarmadi, M.
1996-01-01
Increase in power utility loads in industrialized countries, as well as developing countries, demands a higher level of transmission line voltage. Radio interference (RI) problems have been determined to be a limiting factor in selecting the size of transmission line conductors. Transmission line noise is primarily caused by corona discharges in the immediate vicinity of the conductor. It has been observed that discharges occur during both half-cycles of the applied voltage, but positive corona is usually predominant at AM radio frequencies range with practical high-voltage and extra high-voltage transmission lines. The corona radio noise effect is highly dependent upon the presence of particles on the surface of the conductor and the increase of the electrical gradient beyond the breakdown value of the air. Therefore, corona radio noise varies significantly with the weather and atmospheric conditions and generally increases by 10 to 30 dB in foul weather
Concept design of the high voltage transmission system for the collider tunnel
International Nuclear Information System (INIS)
Norman, L.S.
1992-03-01
In order to provide electrical service to the Superconducting Super Collider Laboratory (SSCL) 54-mile-circumference collider of 125 MVA at 69 kV or 155 MVA at 138 kV of distributed power, it must be demonstrated that the concept design for a high-voltage transmission system can meet the distribution requirements of the collider electrical system with its cryogenic system's large motor loads and its pulsed power technical systems. It is a practical design, safe for operating personnel and cost-effective. The normal high-voltage transmission techniques of overhead and underground around the 54-mile collider tunnel could not be applied because of technical and physical constraints, or was environmentally unacceptable. The approach taken to solve these problems is the installation of 69-kV or 138-kV exposed solid dielectric transmission cable inside the collider tunnel with the superconducting magnets, cryogenic piping, electrical medium, and low-voltage distribution systems, and electronic/instrumentation wiring systems. This mixed-use approach has never been attempted in a collider tunnel. Research into all aspects of the engineering and installation problems and consultation with transmission cable manufacturers, electrical utilities, and European entities with similar installations -- such as the Channel Tunnel -- demonstrate that the concept design is feasible and practical. This paper presents a history of the evolution of the concept design. Design studies are underway to determine the system configuration and voltages. Included in this report are tunnel transmission cable system considerations and evaluation of solid dielectric high-voltage cable design
Concept design of the high-voltage transmission system for the collider tunnel
International Nuclear Information System (INIS)
Norman, L.S.
1992-01-01
In order to provide electrical service to the Superconducting Super Collider Laboratory (SSCL) 54-mile-circumference collider of 125 MVA at 69 kV or 155 MVA at 138 kV of distributed power, it must be demonstrated that the concept design for a high-voltage transmission system can meet the distribution requirements of the collider electrical system with its cryogenic system's large motor loads and its pulsed power technical systems. It is a practical design, safe for operating personnel and cost-effective. The normal high-voltage transmission techniques of overhead and underground around the 54-mile collider tunnel could not be applied because of technical and physical constraints, or was environmentally unacceptable. The approach taken to solve these problems is the installation of 69-kV or 138-kV exposed solid dielectric transmission cable inside the collider tunnel with the superconducting magnets, cryogenic piping, electrical medium, and low-voltage distribution systems, and electronic/instrumentation wiring systems. This mixed-use approach has never been attempted in a collider tunnel. Research into all aspects of the engineering and installation problems and consultation with transmission cable manufacturers, electrical utilities, and European entities with similar installations-such as the Channel Tunnel-demonstrate that the concept design is feasible and practical. This paper presents a history of the evolution of the concept design. Design studies are underway to determine the system configuration and voltages. Included in this report are tunnel transmission cable system considerations and evaluation of solid dielectric high-voltage cable design
Technical and economic aspects of the transmission of energy at extra high voltages
Energy Technology Data Exchange (ETDEWEB)
Kahnt, R
1967-01-01
The reasons for the employment of higher transmission voltages are listed and the points decisive for the selection of three phase ac or dc systems are reviewed. A treatment of the technical and economic problems arising in three phase extra high voltage transmission is presented. These include selection of voltage, economical design of power lines, insulation problems, power supply dependability, equipment rating and reactive power and stability problems.
Energy Technology Data Exchange (ETDEWEB)
Molburg, J. C.; Kavicky, J. A.; Picel, K. C.
2008-03-03
This report focuses on transmission lines, which operate at voltages of 115 kV and higher. Currently, the highest voltage lines comprising the North American power grid are at 765 kV. The grid is the network of transmission lines that interconnect most large power plants on the North American continent. One transmission line at this high voltage was built near Chicago as part of the interconnection for three large nuclear power plants southwest of the city. Lines at this voltage also serve markets in New York and New England, also very high demand regions. The large power transfers along the West Coast are generally at 230 or 500 kV. Just as there are practical limits to centralization of power production, there are practical limits to increasing line voltage. As voltage increases, the height of the supporting towers, the size of the insulators, the distance between conductors on a tower, and even the width of the right-of-way (ROW) required increase. These design features safely isolate the electric power, which has an increasing tendency to arc to ground as the voltage (or electrical potential) increases. In addition, very high voltages (345 kV and above) are subject to corona losses. These losses are a result of ionization of the atmosphere, and can amount to several megawatts of wasted power. Furthermore, they are a local nuisance to radio transmission and can produce a noticeable hum. Centralized power production has advantages of economies of scale and special resource availability (for instance, hydro resources), but centralized power requires long-distance transfers of power both to reach customers and to provide interconnections for reliability. Long distances are most economically served at high voltages, which require large-scale equipment and impose a substantial footprint on the corridors through which power passes. The most visible components of the transmission system are the conductors that provide paths for the power and the towers that keep these
Proximity effects of high voltage electric power transmission lines on ...
African Journals Online (AJOL)
The proximity effects of high voltage electric power transmission lines on Leyland Cypress (xCupressocyparis leylandii (Dallim. and A.B. Jacks.) Dallim) and Japanese Privet (Ligustrum japonicum Thunb.) growth were examined in a private nursery located in Sakarya, Turkey. Five transect were randomly chosen in both ...
Energy Technology Data Exchange (ETDEWEB)
Frank Hoffmann, PhD; Aspinall, Rik
2012-12-10
Design, Development, and test of the three-port power converter for marine hydrokinetic power transmission. Converter provides ports for AC/DC conversion of hydrokinetic power, battery storage, and a low voltage to high voltage DC port for HVDC transmission to shore. The report covers the design, development, implementation, and testing of a prototype built by PPS.
System for Relay Protection Command Transmission by High-Voltage Lines
Directory of Open Access Journals (Sweden)
D. A. Yenkov
2009-01-01
Full Text Available Development of a system for relay protection command transmission by high-voltage lines is shown in the paper. The paper describes an architecture of the system, main principles of its operation, engineering aspects of the development that is accomplishment of technical requirements, solution of trades-off. Justification of the selected design and an algorithm of the reliable detection of relay protection signals are given in the paper.
Lizcano, Maricela
2017-01-01
High voltage hybrid electric propulsion systems are now pushing new technology development efforts for air transportation. A key challenge in hybrid electric aircraft is safe high voltage distribution and transmission of megawatts of power (>20 MW). For the past two years, a multidisciplinary materials research team at NASA Glenn Research Center has investigated the feasibility of distributing high voltage power on future hybrid electric aircraft. This presentation describes the team's approach to addressing this challenge, significant technical findings, and next steps in GRC's materials research effort for MW power distribution on aircraft.
Rizk, Farouk AM
2014-01-01
Inspired by a new revival of worldwide interest in extra-high-voltage (EHV) and ultra-high-voltage (UHV) transmission, High Voltage Engineering merges the latest research with the extensive experience of the best in the field to deliver a comprehensive treatment of electrical insulation systems for the next generation of utility engineers and electric power professionals. The book offers extensive coverage of the physical basis of high-voltage engineering, from insulation stress and strength to lightning attachment and protection and beyond. Presenting information critical to the design, selec
Ndreko, M.
2017-01-01
The development of large offshore wind power generation in the North Sea has been significantly accelerated in the last years. The large distance from shore in combination with the need for large transmission capacity has raised the interest for the voltage source converter high voltage direct
Market Report : The high-voltage transmission market in Poland
Energy Technology Data Exchange (ETDEWEB)
NONE
2002-06-01
In order to meet the accession requirements for membership to the European Union, Poland is currently restructuring its energy sector, and the initiative to privatise the electric power industry to full competition by 2005 is on course. This report describes the opportunities for foreign investors and suppliers of electrical equipment and services, particularly at this time when power demand is growing, the power grid infrastructure is ageing and obsolete components must be replaced. The total installed capacity in Poland is about 33,000 megawatts. This includes all installations of power plants and combined heat and power plants. An investment of $23 billion is anticipated by 2010 in order to modernize the electricity power industry and to meet the growing energy demand. Polski Siece Elektroenergetyczne, S.A. (PSE) is the state-owned company which controls Poland's high-voltage transmission grid. It operates a 220 kilovolt and 40 kV grid and holds the monopoly on acquiring and transmitting electricity in the country. Poland maintains grid interconnections with several other European countries and is looking to expand its network. Opportunities for Canadian suppliers lie in the areas of high-voltage power transmission equipment and services. Other opportunities lie in commercial prospects in sales of equipment and services. The report includes a section on international competition, and the Canadian position for both private- and public-sector companies. A section on market logistics describes distribution channels, market-entry considerations, import regulations, and export credit risks. A list of key contacts and support services is included with this report. refs., tabs.
Technical and economic data for overhead lines in high-voltage a. c. and d. c. transmission
Energy Technology Data Exchange (ETDEWEB)
1977-11-01
For the study of 'High-power electricity transmission and distribution in densely populated areas' technical and economic data were compiled for high-voltage alternating current and direct current transmission. A modification of the overhead lines for transmitting higher powers is possible as required by means of higher rated transmission voltages, larger conductor cross-sections and a larger number of circuits installed on each mast. For the use of larger partial conductor cross-sections and of bundle conductors with more than 4 partial conductors, and also to use voltages higher than 380 kV, development work is requisite from the points of view of construction, installation, insulators and fittings. Further possible developments result from the use of new materials such as plastic insulators which make possible the use of more versatile shapes for application in heavy pollution, particulary for direct current overhead lines. By using insulating crossarms the width of path can be considerably reduced. Economic efficiency investigations show even today higher cost for such techniques compared with lines of earlier construction.
Directory of Open Access Journals (Sweden)
Yufei Teng
2017-03-01
Full Text Available In order to improve the fault monitoring performance of grounding electrode lines in ultra-high voltage DC (UHVDC transmission systems, a novel fault monitoring approach based on the high-frequency voltage standing-wave ratio (VSWR is proposed in this paper. The VSWR is defined considering a lossless transmission line, and the characteristics of the VSWR under different conditions are analyzed. It is shown that the VSWR equals 1 when the terminal resistance completely matches the characteristic impedance of the line, and when a short circuit fault occurs on the grounding electrode line, the VSWR will be greater than 1. The VSWR will approach positive infinity under metallic earth fault conditions, whereas the VSWR in non-metallic earth faults will be smaller. Based on these analytical results, a fault supervision criterion is formulated. The effectiveness of the proposed VSWR-based fault supervision technique is verified with a typical UHVDC project established in Power Systems Computer Aided Design/Electromagnetic Transients including DC(PSCAD/EMTDC. Simulation results indicate that the proposed strategy can reliably identify the grounding electrode line fault and has strong anti-fault resistance capability.
She, Xu; Chokhawala, Rahul Shantilal; Zhou, Rui; Zhang, Di; Sommerer, Timothy John; Bray, James William
2016-12-13
A voltage source converter based high-voltage direct-current (HVDC) transmission system includes a voltage source converter (VSC)-based power converter channel. The VSC-based power converter channel includes an AC-DC converter and a DC-AC inverter electrically coupled to the AC-DC converter. The AC-DC converter and a DC-AC inverter include at least one gas tube switching device coupled in electrical anti-parallel with a respective gas tube diode. The VSC-based power converter channel includes a commutating circuit communicatively coupled to one or more of the at least one gas tube switching devices. The commutating circuit is configured to "switch on" a respective one of the one or more gas tube switching devices during a first portion of an operational cycle and "switch off" the respective one of the one or more gas tube switching devices during a second portion of the operational cycle.
Homma, Akira
2011-07-01
A novel annular parallel-strip transmission line was devised to construct high-voltage high-speed pulse isolation transformers. The transmission lines can easily realize stable high-voltage operation and good impedance matching between primary and secondary circuits. The time constant for the step response of the transformer was calculated by introducing a simple low-frequency equivalent circuit model. Results show that the relation between the time constant and low-cut-off frequency of the transformer conforms to the theory of the general first-order linear time-invariant system. Results also show that the test transformer composed of the new transmission lines can transmit about 600 ps rise time pulses across the dc potential difference of more than 150 kV with insertion loss of -2.5 dB. The measured effective time constant of 12 ns agreed exactly with the theoretically predicted value. For practical applications involving the delivery of synchronized trigger signals to a dc high-voltage electron gun station, the transformer described in this paper exhibited advantages over methods using fiber optic cables for the signal transfer system. This transformer has no jitter or breakdown problems that invariably occur in active circuit components.
Some problems relating to the transmission of electrical power at very high voltage
Energy Technology Data Exchange (ETDEWEB)
Goldstein, A
1965-01-01
Some of the technical and economic factors which influence the choice of a transmission system, particularly a very high voltage one, are discussed. The stability of transmission overvoltages at mains frequency and their control by means of compensating reactances is described. Overvoltages due to circuit-breaker operation and those of atmospheric origin, and appropriate protective devices, the behaviour of equipment at 750 kV, and problems of testing are included. Finally, the 735 kV network now being installed to carry 5300 MW of hydroelectric power 650 km from the Manicouagan River to Quebec and Montreal is described.
International Nuclear Information System (INIS)
Scalise, D.T.; Fong, E.; Haughian, J.; Prechter, R.
1986-10-01
Specially formulated insulator materials with improved strength and high-voltage properties were developed and used for critical components of the flexible transmission lines to the TFTR neutral beam ion sources. These critical components are plates which support central conductors as they exit the high-voltage power supply and enter the ion source enclosure. Each plate acts both as a high-voltage insulator and as a pressure barrier to the SF 6 insulating gas. The original plate was made of commercial glass-epoxy laminate which limited the plate voltage capacity. The newly developed insulator is made of specially-formulated cycloalphatic Di-epoxide whose isotropic properties exhibit increased arc resistance. It is cast in one piece with skirts which greatly increase the breakdown voltage. This paper discusses the design, fabrication and testing of the new insulator
International Nuclear Information System (INIS)
Shope, S.L.; Mazarakis, M.G.; Frost, C.A.; Poukey, J.W.; Turman, B.N.
1993-01-01
Self Magnetically Insulated Transmission Lines (MITL) adders have been used successfully in a number of Sandia accelerators such as HELIA, HERMES III, and SABRE. Most recently the authors used a MITL adder in the RADLAC/SMILE electron beam accelerator to produce high quality, small radius (r b < 2 cm), 11 to 15 MeV, 50 to 100-kA beams with a small transverse velocity v perpendicular/c = β perpendicular ≤ 0.1. In RADLAC/SMILE, a coaxial MITL passed through the eight, 2 MV vacuum envelopes. The MITL summed the voltages of all eight feeds to a single foilless diode. The experimental results are in good agreement with code simulations. The authors' success with the MITL technology led them to investigate the application to higher energy accelerator designs. They have a conceptual design for a cavity-fed MITL that sums the voltages from 100 identical, inductively-isolated cavities. Each cavity is a toroidal structure that is driven simultaneously by four 8-ohm pulse-forming lines, providing a 1-MV voltage pulse to each of the 100 cavities. The point design accelerator is 100 MV, 500 kA, with a 30-50-ns FWHM output pulse
International Nuclear Information System (INIS)
Shope, S.L.; Mazarakis, M.G.; Frost, C.A.; Poukey, J.W.; Turman, B.N.
1991-01-01
Self Magnetically Insulated Transmission Lines (MITL) adders have been used successfully in a number of Sandia accelerators such as HELIA, HERMES III, and SABRE. Most recently we used at MITL adder in the RADLAC/SMILE electron beam accelerator to produce high quality, small radius (r ρ < 2 cm), 11 to 15 MeV, 50 to 100-kA beams with a small transverse velocity v perpendicular/c = β perpendicular ≤ 0.1. In RADLAC/SMILE, a coaxial MITL passed through the eight, 2 MV vacuum envelopes. The MITL summed the voltages of all eight feeds to a single foilless diode. The experimental results are in good agreement with code simulations. Our success with the MITL technology led us to investigate the application to higher energy accelerator designs. We have a conceptual design for a cavity-fed MITL that sums the voltages from 100 identical, inductively-isolated cavities. Each cavity is a toroidal structure that is driven simultaneously by four 8-ohm pulse-forming lines, providing a 1-MV voltage pulse to each of the 100 cavities. The point design accelerator is 100 MV, 500 kA, with a 30--50 ns FWHM output pulse. 10 refs
Shope, S. L.; Mazarakis, M. G.; Frost, C. A.; Poukey, J. W.; Turman, B. N.
Self Magnetically Insulated Transmission Lines (MITL) adders were used successfully in a number of Sandia accelerators such as HELIA, HERMES III, and SABRE. Most recently we used at MITL adder in the RADLAC/SMILE electron beam accelerator to produce high quality, small radius (r(sub rho) less than 2 cm), 11 - 15 MeV, 50 - 100-kA beams with a small transverse velocity v(perpendicular)/c = beta(perpendicular) less than or equal to 0.1. In RADLAC/SMILE, a coaxial MITL passed through the eight, 2 MV vacuum envelopes. The MITL summed the voltages of all eight feeds to a single foilless diode. The experimental results are in good agreement with code simulations. Our success with the MITL technology led us to investigate the application to higher energy accelerator designs. We have a conceptual design for a cavity-fed MITL that sums the voltages from 100 identical, inductively-isolated cavities. Each cavity is a toroidal structure that is driven simultaneously by four 8-ohm pulse-forming lines, providing a 1-MV voltage pulse to each of the 100 cavities. The point design accelerator is 100 MV, 500 kA, with a 30 - 50 ns FWHM output pulse.
Induced voltages in metallic pipelines near power transmission lines
International Nuclear Information System (INIS)
Grcev, Leonid; Jankov, Voislav; Filiposki, Velimir
2002-01-01
With the continuous development of the electric power system and the pipeline networks used to convey oil or natural gas, cases of close proximity of high voltage structures and metallic pipelines become more and more frequent. Accordingly there is a growing concern about possible hazards resulting from voltages induced in the metallic pipelines by magnetic coupling with nearby power transmission lines. This paper presents a methodology for computation of the induced voltages in buried isolated metallic pipelines. A practical example of computation is also presented. (Author)
High frequency relay protection channels on super high voltage lines
Energy Technology Data Exchange (ETDEWEB)
Mikutskii, G V
1964-08-01
General aspects of high voltage transmission line design are discussed. The relationships between line voltage and length and line dimensions and power losses are explained. Electrical interference in the line is classified under three headings: interference under normal operating conditions, interference due to insulation faults, and interference due to variations in operating conditions of the high-voltage network.
Tian, Liang
This study investigated the processing-structure-properties relationships in an Al/Ca composites using both experiments and modeling/simulation. A particular focus of the project was understanding how the strength and electrical conductivity of the composite are related to its microstructure in the hope that a conducting material with light weight, high strength, and high electrical conductivity can be developed to produce overhead high-voltage power transmission cables. The current power transmission cables (e.g., Aluminum Conductor Steel Reinforced (ACSR)) have acceptable performance for high-voltage AC transmission, but are less well suited for high-voltage DC transmission due to the poorly conducting core materials that support the cable weight. This Al/Ca composite was produced by powder metallurgy and severe plastic deformation by extrusion and swaging. The fine Ca metal powders have been produced by centrifugal atomization with rotating liquid oil quench bath, and a detailed study about the atomization process and powder characteristics has been conducted. The microstructure of Al/Ca composite was characterized by electron microscopy. Microstructure changes at elevated temperature were characterized by thermal analysis and indirect resistivity tests. The strength and electrical conductivity were measured by tensile tests and four-point probe resistivity tests. Predicting the strength and electrical conductivity of the composite was done by micro-mechanics-based analytical modeling. Microstructure evolution was studied by mesoscale-thermodynamics-based phase field modeling and a preliminary atomistic molecular dynamics simulation. The application prospects of this composite was studied by an economic analysis. This study suggests that the Al/Ca (20 vol. %) composite shows promise for use as overhead power transmission cables. Further studies are needed to measure the corrosion resistance, fatigue properties and energized field performance of this composite.
Manitoba Hydro long-term high-voltage transmission line magnetic field monitoring project
International Nuclear Information System (INIS)
Wong, P.S.; Ng, C.K.
2008-01-01
As part of the licensing process to construct a new 230 kV transmission line on an existing right-of-way in Manitoba, an electrical effects study was conducted in 1998. The study was part of the environmental assessment program crucial in obtaining government approval to construct the line. Some residents living adjacent to the new transmission circuit expressed concerns about alleged adverse health effects associated with long-term exposure to magnetic fields from high voltage transmission lines. In order to verify the accuracy of the predicted magnetic field levels submitted to the regulatory body in the the electrical effects study and to instill confidence in the residents of the affected communities, a three-year magnetic monitoring project was conducted between 2003 and 2005 along the right-of-way after the new 230kV transmission line was energized by Manitoba Hydro. This paper described the monitoring program, with reference to location; equipment; data analysis; and discussion of results. It was concluded that the long-term monitoring project demonstrated that the magnetic field prediction methodology was well understood and accurate, and provided valuable long-term magnetic field characteristics at the edge of the right-of-way. In addition, when there is opposition to a transmission line, public consultation and education were found to be the best options to arrive at a solution. 3 refs., 1 tab., 12 figs
Directory of Open Access Journals (Sweden)
POSTOLATI V.M.
2010-08-01
Full Text Available The Transmission Power Lines of new generation are described in the article (single- compact, double-circuit compact, double-circuit Controlled Self-compensating High Voltage Transmission Power Lines (CSHVL. Basic principles of creation, design elements and comparative characteristics of the transmission lines of the new generation are described, the advantages of its are showed. Methodical approaches to the choosing of a new generation of transmission lines and facilities management FACTS are formulated. Methodical approaches to the choice of options for transmission lines 220 kV and facilities management are shown.
High-voltage direct-current circuit breakers
International Nuclear Information System (INIS)
Yoshioka, Y.; Hirasawa, K.
1991-01-01
This paper reports that in 1954 the first high-voltage direct-current (HVDC) transmission system was put into operation between Gotland and the mainland of Sweden. Its system voltage and capacity were 100 kV and 20 MW, respectively. Since then many HVDC transmission systems have been planned, constructed, or commissioned in more than 30 places worldwide, and their total capacity is close to 40 GW. Most systems commissioned to date are two-terminal schemes, and HVDC breakers are not yet used in the high-potential main circuit of those systems, because the system is expected to perform well using only converter/inverter control even at a fault stage of the transmission line. However, even in a two-terminal scheme there are not a few merits in using an HVDC breaker when the system has two parallel transmission lines, that is, when it is a double-circuit system
New schemes for high-voltage pulsed generators based on stepped transmission lines
International Nuclear Information System (INIS)
Bossamykin, V.S.; Gordeev, V.S.; Pavlovskii, A.I.
1993-01-01
Wave processes were analyzed from the point of effective energy delivery in pulsed power systems based on transmission lines. A series of new schemes for the pulsed generators based on multistage stepped transmission lines both with the capacitive and inductive energy storage was found. These devices can provide voltage or current transformation up to 5-10 times due to wave processes if stage's characteristic impedances are in a certain correlation. The schemes suggested can be widely applied in the new powerful pulsed power accelerators. The theoretical conclusions are justified experimentally
High-voltage direct current (HVDC) transmission - a key technology for our power supply
International Nuclear Information System (INIS)
Dorn, J.
2016-01-01
The phasing-out of nuclear power in some countries and the aspirations of reducing carbon dioxide emissions have far-reaching implications for electric power generation in Europe. In the future, renewable electricity generation will account for a considerable share of the energy mix, but this type of production is often far from the load centers. In Germany, for example, large quantities of wind energy are already generated in the north and in the North Sea, but large load centers are located several hundred kilometers south of there. This requires an expansion of the transmission network with innovative solutions. High-voltage direct-current (HVDC) transmission plays an important role, since it brings a number of advantages over conventional AC technology and makes certain requirements feasible, for example Cable transmission over longer distances. The lecture presents the advantages of HVDC, the semiconductors used as well as the basic functions and typical performance of the used converter topopologies. The plant configurations and main components are illustrated using current projects. (rössner) [de
International Nuclear Information System (INIS)
Yamin, H.Y.; Shahidehpour, S.M.
2003-01-01
This paper describes a generalized active/reactive iterative coordination process between GENCOs and the Independent System Operator (ISO) for active (transmission congestion) and reactive (voltage profile) management in the day-ahead market. GENCOs apply priced-based unit commitment without transmission and voltage security constraints, schedule their units and submit their initial bids to the ISO. The ISO executes congestion and voltage profile management for eliminating transmission and voltage profile violations. If violations are not eliminated, the ISO minimizes the transmission and voltage profile violations and sends a signal via the Internet to GENCOs. GENCOs reschedule their units taking into account the ISO signals and submit modified bids to the ISO. The voltage problem is addressed and a linear model is formulated and used in the proposed method. The voltage problem is formulated as a linear programming with a block-angular structure and Dantzig-Wolfe decomposition is applied to generate several smaller problems for a faster and easier solution of large-scale power systems. Two 36 unit GENCOs are used to demonstrate the performance of the proposed generalized active/reactive coordination algorithm. (author)
Insulation co-ordination in high-voltage electric power systems
Diesendorf, W
2015-01-01
Insulation Co-ordination in High-Voltage Electric Power Systems deals with the methods of insulation needed in different circumstances. The book covers topics such as overvoltages and lightning surges; disruptive discharge and withstand voltages; self-restoring and non-self-restoring insulation; lightning overvoltages on transmission lines; and the attenuation and distortion of lightning surges. Also covered in the book are topics such as the switching surge designs of transmission lines, as well as the insulation coordination of high-voltage stations. The text is recommended for electrical en
Voltage control in the future power transmission systems
DEFF Research Database (Denmark)
Qin, Nan
Wind energy in Denmark covers 42% of the total power consumption in 2015, and will share up to 50% by 2020. Consequently, the conventional power plants are decommissioning. Under the progress of the green transition, the national decision leads to underground many overhead lines in the future...... stages. The voltage uncertainty caused by the wind power forecasting errors is estimated, which is applied as a voltage security margin to further constrain the voltage magnitude in the optimization problem. The problem under the uncertainty is therefore converted to a deterministic problem, which...... to ensure a highly reliable transmission, e.g. balancing the generation and the consumption in large geographic regions, the exchange capacities will be enlarged by upgrading the interconnections. The Danish power system, the electricity transportation hub between the Nordic and continental European systems...
Xie, Kai; Huang, An-Feng; Li, Xiao-Ping; Guo, Shi-Zhong; Zhang, Han-Lu
2015-04-01
We proposed a modular high-voltage (HV) bias generator powered by a novel transmitter-sharing inductive coupled wireless power transmission technology, aimed to extend the generator's flexibility and configurability. To solve the problems caused through an uncertain number of modules, a dual-looped self-adaptive control method is proposed that is capable of tracking resonance frequency while maintaining a relatively stable induction voltage for each HV module. The method combines a phase-locked loop and a current feedback loop, which ensures an accurate resonance state and a relatively constant boost ratio for each module, simplifying the architecture of the boost stage and improving the total efficiency. The prototype was built and tested. The input voltage drop of each module is less than 14% if the module number varies from 3 to 10; resonance tracking is completed within 60 ms. The efficiency of the coupling structure reaches up to 95%, whereas the total efficiency approaches 73% for a rated output. Furthermore, this technology can be used in various multi-load wireless power supply applications.
Propagation of disturbances as voltage fluctuations in transmission networks
Directory of Open Access Journals (Sweden)
Albert Hermina
2016-08-01
Full Text Available Significant changes occurred in the power system in Romania in recent years by reducing the power used in the system, the number of classic power sources in operation as well as by implementing renewable energy sources, have determined short circuit power reduction (node rigidity in the points where disturbing users are connected, that in the absence of adequate measures, result in disturbances above acceptable levels. The paper analyzes two power systems areas in which are connected users that cause voltage fluctuation. Disturbances as voltage fluctuations resulting in these nodes may exceed the acceptable values and can spread in the transmission network affecting power quality over large system areas. The analysis conducted reveals the influence of short circuit power in nodes where these users are connected and highlights the fact that in some cases (e.g. lines out of operation for maintenance, shutdown of classic units in the area the disturbances in the transmission network sent to the users at lower voltages may have values above those allowed. Technical Code of existing power transmission network makes no reference to voltage fluctuations, as a rule, in the electricity transmission network was considered that this phenomenon should not exist.
Adaptive Modulation for DFIG and STATCOM With High-Voltage Direct Current Transmission.
Tang, Yufei; He, Haibo; Ni, Zhen; Wen, Jinyu; Huang, Tingwen
2016-08-01
This paper develops an adaptive modulation approach for power system control based on the approximate/adaptive dynamic programming method, namely, the goal representation heuristic dynamic programming (GrHDP). In particular, we focus on the fault recovery problem of a doubly fed induction generator (DFIG)-based wind farm and a static synchronous compensator (STATCOM) with high-voltage direct current (HVDC) transmission. In this design, the online GrHDP-based controller provides three adaptive supplementary control signals to the DFIG controller, STATCOM controller, and HVDC rectifier controller, respectively. The mechanism is to observe the system states and their derivatives and then provides supplementary control to the plant according to the utility function. With the GrHDP design, the controller can adaptively develop an internal goal representation signal according to the observed power system states, therefore, to achieve more effective learning and modulating. Our control approach is validated on a wind power integrated benchmark system with two areas connected by HVDC transmission lines. Compared with the classical direct HDP and proportional integral control, our GrHDP approach demonstrates the improved transient stability under system faults. Moreover, experiments under different system operating conditions with signal transmission delays are also carried out to further verify the effectiveness and robustness of the proposed approach.
Measurements of Voltage Harmonics in 400 kV Transmission Network
Directory of Open Access Journals (Sweden)
Ryszard Pawełek
2014-06-01
Full Text Available The paper deals with the analysis of voltage harmonics measurements performed in the 400 kV transmission network. The voltage was measured by means of three transducers: resistive voltage divider, inductive measuring transformer and capacitive voltage measuring transformer. Instrument errors were estimated for measuring transformers with reference to the harmonic values obtained from the voltage divider.
Yuan, Jiaxin; Zhou, Hang; Gan, Pengcheng; Zhong, Yongheng; Gao, Yanhui; Muramatsu, Kazuhiro; Du, Zhiye; Chen, Baichao
2018-05-01
To develop mechanical circuit breaker in high voltage direct current (HVDC) system, a fault current limiter is required. Traditional method to limit DC fault current is to use superconducting technology or power electronic devices, which is quite difficult to be brought to practical use under high voltage circumstances. In this paper, a novel concept of high voltage DC transmission system fault current limiter (DCSFCL) based on saturable core was proposed. In the DCSFCL, the permanent magnets (PM) are added on both up and down side of the core to generate reverse magnetic flux that offset the magnetic flux generated by DC current and make the DC winding present a variable inductance to the DC system. In normal state, DCSFCL works as a smoothing reactor and its inductance is within the scope of the design requirements. When a fault occurs, the inductance of DCSFCL rises immediately and limits the steepness of the fault current. Magnetic field simulations were carried out, showing that compared with conventional smoothing reactor, DCSFCL can decrease the high steepness of DC fault current by 17% in less than 10ms, which verifies the feasibility and effectiveness of this method.
LED-Based High-Voltage Lines Warning System
Directory of Open Access Journals (Sweden)
Eldar MUSA
2013-04-01
Full Text Available LED-based system, running with the current of high-voltage lines and converting the current flowing through the line into the light by using a toroid transformer, has been developed. The transformer’s primary winding is constituted by the high voltage power line. Toroidal core consists of two equal parts and the secondary windings are evenly placed on these two parts. The system is mounted on the high-voltage lines as a clamp. The secondary winding ends are connected in series by the connector on the clamp. LEDs are supplied by the voltage at the ends of secondary. Current flowing through highvoltage transmission lines is converted to voltage by the toroidal transformer and the light emitting LEDs are supplied with this voltage. The theory of the conversion of the current flowing through the line into the light is given. The system, running with the current of the line and converting the current into the light, has been developed. System has many application areas such as warning high voltage lines (warning winches to not hinder the high-voltage lines when working under the lines, warning planes to not touch the high-voltage lines, remote measurement of high-voltage line currents, and local illumination of the line area
High Voltage Hybrid Electric Propulsion - Multilayered Functional Insulation System (MFIS) NASA-GRC
Lizcano, M.
2017-01-01
High power transmission cables pose a key challenge in future Hybrid Electric Propulsion Aircraft. The challenge arises in developing safe transmission lines that can withstand the unique environment found in aircraft while providing megawatts of power. High voltage AC, variable frequency cables do not currently exist and present particular electrical insulation challenges since electrical arcing and high heating are more prevalent at higher voltages and frequencies. Identifying and developing materials that maintain their dielectric properties at high voltage and frequencies is crucial.
Ontario Hydro's environmental monitoring program for HV [high voltage] transmission line projects
International Nuclear Information System (INIS)
Braekevelt, P.N.
1991-01-01
Responsible monitoring and control of environmental impacts is key to obtaining future needed approvals for new high voltage (HV) transmission line projects. Ontario Hydro's environmental monitoring program was developed as a highly structured, self-imposed monitoring system to relieve government agencies of the responsibility of developing a similar external program. The goal was to be self-policing. The historical development, program structure, standards, priority ratings, documentation, communication and computerization of the program is described. The most effective way to minimize environmental impacts is to avoid sensitive features at the route selection stage, well before any construction takes place. The environmental monitoring program is based on the following blueprint: each crew member is responsible for environmental protection; environmental problems are to be resolved at the lowest level possible; potential concerns should be resolved before they become problems; known problems should be dealt with quickly to minimize impacts; team members should work cooperatively; and formal and regular communication is emphasized
International Nuclear Information System (INIS)
Ekonomou, L; Karampelas, P; Vita, V; Chatzarakis, G E
2011-01-01
One of the most popular methods of protecting high voltage transmission lines against lightning strikes and internal overvoltages is the use of arresters. The installation of arresters in high voltage transmission lines can prevent or even reduce the lines' failure rate. Several studies based on simulation tools have been presented in order to estimate the critical currents that exceed the arresters' rated energy stress and to specify the arresters' installation interval. In this work artificial intelligence, and more specifically a Q-learning artificial neural network (ANN) model, is addressed for evaluating the arresters' failure probability. The aims of the paper are to describe in detail the developed Q-learning ANN model and to compare the results obtained by its application in operating 150 kV Greek transmission lines with those produced using a simulation tool. The satisfactory and accurate results of the proposed ANN model can make it a valuable tool for designers of electrical power systems seeking more effective lightning protection, reducing operational costs and better continuity of service
Ekonomou, L.; Karampelas, P.; Vita, V.; Chatzarakis, G. E.
2011-04-01
One of the most popular methods of protecting high voltage transmission lines against lightning strikes and internal overvoltages is the use of arresters. The installation of arresters in high voltage transmission lines can prevent or even reduce the lines' failure rate. Several studies based on simulation tools have been presented in order to estimate the critical currents that exceed the arresters' rated energy stress and to specify the arresters' installation interval. In this work artificial intelligence, and more specifically a Q-learning artificial neural network (ANN) model, is addressed for evaluating the arresters' failure probability. The aims of the paper are to describe in detail the developed Q-learning ANN model and to compare the results obtained by its application in operating 150 kV Greek transmission lines with those produced using a simulation tool. The satisfactory and accurate results of the proposed ANN model can make it a valuable tool for designers of electrical power systems seeking more effective lightning protection, reducing operational costs and better continuity of service.
Electrical Power Supply to Offshore Oil Installations by High Voltage Direct Current Transmission
Energy Technology Data Exchange (ETDEWEB)
Myhre, Joergen Chr.
2001-07-01
This study was initiated to investigate if it could be feasible to supply offshore oil installations in the North Sea with electrical power from land. A prestudy of alternative converter topologies indicated that the most promising solution would be to investigate a conventional system with reduced synchronous compensator rating. The study starts with a summary of the state of power supply to offshore installations today, and a short review of classical HVDC transmission. It goes on to analyse how a passive network without sources influences the inverter. The transmission, with its current controlled rectifier and large inductance, is simulated as a current source. Under these circumstances the analysis shows that the network frequency has to adapt in order to keep the active and reactive power balance until the controllers are able to react. The concept of firing angle for a thyristor is limited in a system with variable frequency, the actual control parameter is the firing delay time. Sensitivity analysis showed some astonishing consequences. The frequency rises both by an increase in the active and in the reactive load. The voltage falls by an increase in the active load, but rises by an increase in the inductive load. Two different control principles for the system of inverter, synchronous compensator and load are defined. The first takes the reference for the firing delay time from the fundamental voltage at the point of common coupling. The second takes the reference for the firing delay time from the simulated EMF of the synchronous compensator. Of these, the second is the more stable and should be chosen as the basis for a possible control system. Two simulation tools are applied. The first is a quasi-phasor model running on Matlab with Simulink. The other is a time domain model in KREAN. The time domain model is primarily used for the verification of the quasi-phasor model, and shows that quasi-phasors is still a valuable tool for making a quick analysis
International Nuclear Information System (INIS)
1998-01-01
The recommendation on the title subject was addressed to the Dutch Minister of Economic Affairs and concerns the environmental impact of the new high-voltage transmission line (NorNed cable) from Norway to the Eemshaven in Groningen, Netherlands. In planning this power cable the environmental impact on the Wadden Sea has to be taken into account. Therefore an environmental effect report (MER, abbreviated in Dutch) has been drafted by the Dutch cooperative of electric power generating companies, Sep, and commented by the WaddenAdviesRaad
AC transmission, with very high voltages and the 750 kV line
Energy Technology Data Exchange (ETDEWEB)
Bocker, H
1964-01-01
The economic case for adoption of extra-high voltages for transmitting electric power over distances of the order of 1000 km is discussed. Some special technical developments for solving the problems attached to such high voltages are briefly discussed, particularly in the fields of switching and transients suppression. The first 750-kV projects in Canada and Russia are mentioned. Equipment, e.g., bushings, transformers, etc., operating at such voltages are illustrated.
MOSFET-based high voltage short pulse generator for ultrasonic transducer excitation
Hidayat, Darmawan; Setianto, Syafei, Nendi Suhendi; Wibawa, Bambang Mukti
2018-02-01
This paper presents the generation of a high-voltage short pulse for the excitation of high frequency ultrasonic transducers. This is highly required in the purpose of various ultrasonic-based evaluations, particularly when high resolution measurement is necessary. A high voltage (+760 V) DC voltage source was pulsated by an ultrafast switching MOSFET which was driven by a pulse generator circuit consisting of an astable multivibrator, a one-shot multivibrator with Schmitt trigger input and a high current MOSFET driver. The generated pulses excited a 200-kHz and a 1-MHz ultrasonic transducers and tested in the transmission mode propagation to evaluate the performances of the generated pulse. The test results showed the generator were able to produce negative spike pulses up to -760 V voltage with the shortest time-width of 107.1 nanosecond. The transmission-received ultrasonic waves show frequency oscillation at 200 and 961 kHz and their amplitudes varied with the voltage of excitation pulse. These results conclude that the developed pulse generator is applicable to excite transducer for the generation of high frequency ultrasonic waves.
High-voltage test and measuring techniques
Hauschild, Wolfgang
2014-01-01
It is the intent of this book to combine high-voltage (HV) engineering with HV testing technique and HV measuring technique. Based on long-term experience gained by the authors as lecturer and researcher as well as member in international organizations, such as IEC and CIGRE, the book will reflect the state of the art as well as the future trends in testing and diagnostics of HV equipment to ensure a reliable generation, transmission and distribution of electrical energy. The book is intended not only for experts but also for students in electrical engineering and high-voltage engineering.
International Nuclear Information System (INIS)
Mazarakis, M.G.; Poukey, J.W.; Frost, C.A.; Shope, S.L.; Halbleib, J.A.; Turman, B.N.
1993-01-01
During the last ten years the authors have extensively studied the physics and operation of magnetically-immersed electron foilless diodes. Most of these sources were utilized as injectors to high current, high energy linear induction accelerators such as those of the RADLAC family. Recently they have experimentally and theoretically demonstrated that foilless diodes can be successfully coupled to self-magnetically insulated transmission line voltage adders to produce very small high brightness, high definition (no halo) electron beams. The RADLAC/SMILE experience opened the path to a new approach in high brightness, high energy induction accelerators. There is no beam drifting through the device. The voltage addition occurs in a center conductor, and the beam is created at the high voltage end in an applied magnetic field diode. This work was motivated by the remarkable success of the HERMES-III accelerator and the need to produce small radius, high energy, high current electron beams for air propagation studies and flash x-ray radiography. In this paper they present experimental results compared with analytical and numerical simulations in addition to design examples of devices that can produce multikiloamp electron beams of as high as 100 MV energies and radii as small as 1 mm
Voltage dependency of transmission probability of aperiodic DNA molecule
Wiliyanti, V.; Yudiarsah, E.
2017-07-01
Characteristics of electron transports in aperiodic DNA molecules have been studied. Double stranded DNA model with the sequences of bases, GCTAGTACGTGACGTAGCTAGGATATGCCTGA, in one chain and its complements on the other chains has been used. Tight binding Hamiltonian is used to model DNA molecules. In the model, we consider that on-site energy of the basis has a linearly dependency on the applied electric field. Slater-Koster scheme is used to model electron hopping constant between bases. The transmission probability of electron from one electrode to the next electrode is calculated using a transfer matrix technique and scattering matrix method simultaneously. The results show that, generally, higher voltage gives a slightly larger value of the transmission probability. The applied voltage seems to shift extended states to lower energy. Meanwhile, the value of the transmission increases with twisting motion frequency increment.
A high-voltage pulse generator for corona plasma generation
Yan, K.; Heesch, van E.J.M.; Pemen, A.J.M.; Huijbrechts, P.A.H.J.; Gompel, van F.M.; Leuken, van H.E.M.; Matyas, Z.
2002-01-01
This paper discusses a high-voltage pulse generator for producing corona plasma. The generator consists of three resonant charging circuits, a transmission line transformer, and a triggered spark-gap switch. Voltage pulses in the order of 30-100 kV with a rise time of 10-20 ns, a pulse duration of
Prediction of the Voltage Quality in an Overhead Transmission Line with Distributed Parameters
Bulyga Leonid L.; Tarasov Evgeniy V.; Ushakov Vasily Ya.; Kharlov Nikolay N.
2015-01-01
The present work is devoted to investigation of an electrical transmission line with allowance for distributed parameters. From the results of voltage measurements at terminals of an actual transmission line, effective values of the voltage are calculated for every line section. Special attention is given to higher harmonics and asymmetry. Spectral composition of the voltage is presented and changes in values of harmonic components are analyzed. The effect of higher harmonics on the equipment...
A Case Study Of Turkish Transmission System For VoltageDips
DEFF Research Database (Denmark)
Inan, E.; Alboyaci, B.; Bak, Claus Leth
2009-01-01
Power quality problems usually appear in the form of voltage sags, transients and harmonics. From these three broad categories of power quality problems, voltage dips account the most disturbances experienced by industrial customers. Voltage dips generally refer to instantaneous short-duration vo......Power quality problems usually appear in the form of voltage sags, transients and harmonics. From these three broad categories of power quality problems, voltage dips account the most disturbances experienced by industrial customers. Voltage dips generally refer to instantaneous short...... analysis of voltage dip performance of the whole transmission system, is used to compare with results constructed fault statics from SIMPOW DIPS analysis program real data. SIMPOW DIPS software enables to calculate dip frequency for all busses and lines....
International Nuclear Information System (INIS)
Jalilzadeh, S.; Kazemi, A.; Shayeghi, H.; Madavi, M.
2008-01-01
Transmission network expansion planning is an important part of power system planning. Its task is to determine an optimal network configuration according to load growth. It determines where, when and how many new transmission lines should be installed. Up to now, various methods have been presented to solve the static transmission network expansion planning (STNEP) problem, but in all of these methods, the STNEP problem has been solved regardless of voltage level of the lines. In this paper, due to different voltage levels in the transmission network, which cause different annual losses, STNEP has been studied considering the voltage level of the transmission lines and the network loss using the genetic algorithm (GA). Finally, the proposed idea has been examined on Garvers 6 bus network. The results show that considering the loss in a network with different voltage levels decreases the operational costs considerably, and the network satisfies the requirement of delivering electric power more safely and reliably to load centers
Energy Technology Data Exchange (ETDEWEB)
Elizondo, Marcelo A.; Samaan, Nader A.; Makarov, Yuri V.; Holzer, Jesse T.; Vallem, Mallikarjuna R.; Huang, Renke; Vyakaranam, Bharat GNVSR; Ke, Xinda; Pan, Feng
2017-10-02
Voltage and reactive power system control is generally performed following usual patterns of loads, based on off-line studies for daily and seasonal operations. This practice is currently challenged by the inclusion of distributed renewable generation, such as solar. There has been focus on resolving this problem at the distribution level; however, the transmission and sub-transmission levels have received less attention. This paper provides a literature review of proposed methods and solution approaches to coordinate and optimize voltage control and reactive power management, with an emphasis on applications at transmission and sub-transmission level. The conclusion drawn from the survey is that additional research is needed in the areas of optimizing switch shunt actions and coordinating all available resources to deal with uncertain patterns from increasing distributed renewable generation in the operational time frame. These topics are not deeply explored in the literature.
Prediction of the Voltage Quality in an Overhead Transmission Line with Distributed Parameters
Directory of Open Access Journals (Sweden)
Bulyga Leonid L.
2015-01-01
Full Text Available The present work is devoted to investigation of an electrical transmission line with allowance for distributed parameters. From the results of voltage measurements at terminals of an actual transmission line, effective values of the voltage are calculated for every line section. Special attention is given to higher harmonics and asymmetry. Spectral composition of the voltage is presented and changes in values of harmonic components are analyzed. The effect of higher harmonics on the equipment operation is analyzed.
International Nuclear Information System (INIS)
Parthasarathy, S.R.; Roha Tukimin; Wan Saffiey Wan Abdullah; Zulkifli Yusof; Mohd Azizi Mohd Jali
2016-01-01
The paper highlights the study on the Extremely Low Frequency (ELF) Electromagnetic Field (EMF) emission performed at an overhead 275-kV High-Voltage Transmission Lines. The study comprised of assessment at the transmission lines on 3 different cases and locations in Klang Valley, specifically on a vacant land near the transmission line, inside and around the house at the vicinity of the transmission line and the area directly under the transmission line. The instrument setup and measurement protocols during the assessment were adopted from standard measurement method and procedures stipulated under the Institute of Electrical and Electronics Engineers (IEEE) Standard. The results were compared with the standards recommended in the International Commission on Non-Ionizing Radiation Protection (ICNIRP) guidelines. The results showed that the measured field strengths are within the safety limit with the highest measured exposure was 10.8 % and 1.8 % of the permissible exposure limit for the electric and magnetic field respectively. Both the field strengths were found to drop significantly against distance from the transmission lines where closer distances showed higher field strengths. Furthermore, the study revealed that buildings and other object such as trees and shrubs screen out the electric field, resulting in a lower value at indoor measurements and near the stated objects. In addition, higher value of electric and magnetic field strengths were recorded when assessment was being done directly under the transmission line compared to the lateral measurement. (author)
Mathematical modeling of agricultural fires beneath high voltage transmission lines
International Nuclear Information System (INIS)
El-Zohri, Emad H.; Shafey, Hamdy M.; Abdel-Salam, M.; Ahmed, A.
2011-01-01
This paper presents a mathematical model for agricultural fires based on a multi-phase formulation. The model includes dehydration and pyrolysis of agricultural fuel and pyrolysis products. The model considers a homogeneous distribution of the agricultural solid fuel particles, interacting with the gas flow via source terms. These terms include: drag forces, production of water vapour and pyrolysis products, radiative and convective heat exchange. A multi-phase radiative transfer equation for absorbing-emitting medium is considered to account for the radiative heat exchange between the gas and solid phases of the fire. The main outputs of the present model are most important to study the influence of agricultural fire occurring beneath high voltage transmission lines. The agricultural fire causes a flashover due to the ambient temperature rise and soot accumulation on the insulator of these transmission lines. Numerical results of the present model are obtained for flat grassland fires to study the effects of wind velocity, solid fuel moisture content and ignition length on some selected fire outputs. These outputs include the temperature, velocity, soot volume fraction fields of the gas phase, together with fire propagation rate and flame geometry. The numerical results are compared to the available experimental work in the literature. -- Research highlights: → The model is sensitive to the initial condition of the ignition length affecting the fire propagation rate and width. → The model predicts the effects of both the wind velocity and the fuel moisture content on fire propagation rate, in agreement with the available experimental work in the literature. → The model shows that both the wind velocity and the fuel moisture content are important factors affecting the fire plume thickness, location, and inclination. → The model is able to visualize the flame geometry through tracing radiative heat rates exceeding a threshold value for flame visibility (60 k
Voltage adjusting characteristics in terahertz transmission through Fabry-Pérot-based metamaterials
Directory of Open Access Journals (Sweden)
Jun Luo
2015-10-01
Full Text Available Metallic electric split-ring resonators (SRRs with featured size in micrometer scale, which are connected by thin metal wires, are patterned to form a periodically distributed planar array. The arrayed metallic SRRs are fabricated on an n-doped gallium arsenide (n-GaAs layer grown directly over a semi-insulating gallium arsenide (SI-GaAs wafer. The patterned metal microstructures and n-GaAs layer construct a Schottky diode, which can support an external voltage applied to modify the device properties. The developed architectures present typical functional metamaterial characters, and thus is proposed to reveal voltage adjusting characteristics in the transmission of terahertz waves at normal incidence. We also demonstrate the terahertz transmission characteristics of the voltage controlled Fabry-Pérot-based metamaterial device, which is composed of arrayed metallic SRRs. To date, many metamaterials developed in earlier works have been used to regulate the transmission amplitude or phase at specific frequencies in terahertz wavelength range, which are mainly dominated by the inductance-capacitance (LC resonance mechanism. However, in our work, the external voltage controlled metamaterial device is developed, and the extraordinary transmission regulation characteristics based on both the Fabry-Pérot (FP resonance and relatively weak surface plasmon polariton (SPP resonance in 0.025-1.5 THz range, are presented. Our research therefore shows a potential application of the dual-mode-resonance-based metamaterial for improving terahertz transmission regulation.
Directory of Open Access Journals (Sweden)
Majid Mehrasa
2016-10-01
Full Text Available In this paper, a novel modulation function-based method including analyses of the modulation index and phase is proposed for operation of modular multilevel converters (MMCs in high voltage direct current (HVDC transmission systems. The proposed modulation function-based control technique is developed based on thorough and precise analyses of all MMC voltages and currents in the a-b-c reference frame in which the alternating current (AC-side voltage is the first target to be obtained. Using the AC-side voltage, the combination of the MMC upper and lower arm voltages is achieved as the main structure of the proposed modulation function. The main contribution of this paper is to obtain two very simple new modulation functions to control MMC performance in different operating conditions. The features of the modulation function-based control technique are as follows: (1 this control technique is very simple and can be easily achieved in a-b-c reference frame without the need of using Park transformation; and (2 in addition, the inherent properties of the MMC model are considered in the proposed control technique. Considering these properties leads to constructing a control technique that is robust against MMC parameters changes and also is a very good tracking method for the components of MMC input currents. These features lead to improving the operation of MMC significantly, which can act as a rectifier in the HVDC structure. The simulation studies are conducted through MATLAB/SIMULINK software, and the results obtained verify the effectiveness of the proposed modulation function-based control technique.
International Nuclear Information System (INIS)
Ulmasculov, M R; Sharypov, K A; Shunailov, S A; Shpak, V G; Yalandin, M I; Pedos, M S; Rukin, S N
2017-01-01
Results of testing of a generator based on a solid-state drive and the parallel gyromagnetic nonlinear transmission lines with external bias are presented. Stable rf-modulated high-voltage nanosecond pulses were shaped in each of the four channels in 1 s packets with 1000 Hz repetition frequencies. Pulse amplitude reaches -175 kV, at a modulation depth of rf-oscillations to 50 % and the effective frequency ∼4 GHz. (paper)
Planning aspects of ac extra high voltage lines
Energy Technology Data Exchange (ETDEWEB)
Engelhardt, H
1964-01-01
The technical points arising in any project for application of higher voltages on power grids in Europe are discussed. The cost aspects of two alternative ways of extending the voltage level of existing systems are discussed in detail. The short-circuit current in a high-power system with isolated or grounded neutral point and its relation to the mode of grounding is examined. For a transmission distance of 200 kVm, operating cost for each kWh transmitted are shown on curves for voltages of 220, 380 and 700 kV against transmitted energy. This shows that for any rated voltage there is a range of energy values which can be transmitted economically. Factors to be considered in maintaining, selecting or rejecting transformers and switchgear of other systems for higher voltage purposes are mentioned.
Energy Technology Data Exchange (ETDEWEB)
Spahic, Ervin; Benz, Thomas; Goerner, Raphael; Sass, Florian [ABB AG, Mannheim (Germany)
2012-12-15
In September 2010 the German federal government announced its energy concept for an environmentally friendly, reliable and affordable energy supply. This concept describes a ''path into the era of renewable energy'' up to the year 2050, with electricity production from photovoltaics and wind power taking centre stage. Since the expansion of renewable energy production is mainly taking place in the North (wind power) and the South (PV), this poses a great challenge to the electricity networks. It necessitates the expansion of power transmission systems, notably for transporting electricity generated by wind power in the North to the consumer centres in Western and Southern Germany. However, progress to this end has been very slow. For this reason a technical question now presents itself, namely whether high-voltage direct current technology could possibly offer a solution to the electricity transport problems associated with the energy turnaround.
High-voltage pulsed generator for dynamic fragmentation of rocks.
Kovalchuk, B M; Kharlov, A V; Vizir, V A; Kumpyak, V V; Zorin, V B; Kiselev, V N
2010-10-01
A portable high-voltage (HV) pulsed generator has been designed for rock fragmentation experiments. The generator can be used also for other technological applications. The installation consists of low voltage block, HV block, coaxial transmission line, fragmentation chamber, and control system block. Low voltage block of the generator, consisting of a primary capacitor bank (300 μF) and a thyristor switch, stores pulse energy and transfers it to the HV block. The primary capacitor bank stores energy of 600 J at the maximum charging voltage of 2 kV. HV block includes HV pulsed step up transformer, HV capacitive storage, and two electrode gas switch. The following technical parameters of the generator were achieved: output voltage up to 300 kV, voltage rise time of ∼50 ns, current amplitude of ∼6 kA with the 40 Ω active load, and ∼20 kA in a rock fragmentation regime (with discharge in a rock-water mixture). Typical operation regime is a burst of 1000 pulses with a frequency of 10 Hz. The operation process can be controlled within a wide range of parameters. The entire installation (generator, transmission line, treatment chamber, and measuring probes) is designed like a continuous Faraday's cage (complete shielding) to exclude external electromagnetic perturbations.
High-voltage pulsed generator for dynamic fragmentation of rocks
Kovalchuk, B. M.; Kharlov, A. V.; Vizir, V. A.; Kumpyak, V. V.; Zorin, V. B.; Kiselev, V. N.
2010-10-01
A portable high-voltage (HV) pulsed generator has been designed for rock fragmentation experiments. The generator can be used also for other technological applications. The installation consists of low voltage block, HV block, coaxial transmission line, fragmentation chamber, and control system block. Low voltage block of the generator, consisting of a primary capacitor bank (300 μF) and a thyristor switch, stores pulse energy and transfers it to the HV block. The primary capacitor bank stores energy of 600 J at the maximum charging voltage of 2 kV. HV block includes HV pulsed step up transformer, HV capacitive storage, and two electrode gas switch. The following technical parameters of the generator were achieved: output voltage up to 300 kV, voltage rise time of ˜50 ns, current amplitude of ˜6 kA with the 40 Ω active load, and ˜20 kA in a rock fragmentation regime (with discharge in a rock-water mixture). Typical operation regime is a burst of 1000 pulses with a frequency of 10 Hz. The operation process can be controlled within a wide range of parameters. The entire installation (generator, transmission line, treatment chamber, and measuring probes) is designed like a continuous Faraday's cage (complete shielding) to exclude external electromagnetic perturbations.
Distance protection of multiple-circuit shared tower transmission lines with different voltages
DEFF Research Database (Denmark)
Silva, Filipe Miguel Faria da; Bak, Claus Leth
2017-01-01
Multiple-circuit transmission lines combining different voltage levels in one tower present extra challenges when setting a protection philosophy, as faults between voltage levels are possible. This study presents a detailed theoretical analysis of such combined faults, including the development...... of a formula for estimating the magnitude of the short-circuit current. It is demonstrated that if the faulted phase from the higher voltage level leads the faulted phase from the lower voltage level, a distance relay at the higher voltage level sees the fault in the forward direction, whereas a distance relay...
International Nuclear Information System (INIS)
Martin, M.
1991-01-01
Industrial processes usually require electrical power. This power is used to drive motors, to heat materials, or in electrochemical processes. Often the power requirements of a plant require the electric power to be delivered at high voltage. In this paper high voltage is considered any voltage over 600 V. This voltage could be as high as 138,000 V for some very large facilities. The characteristics of this voltage and the enormous amounts of power being transmitted necessitate special safety considerations. Safety must be considered during the four activities associated with a high voltage electrical system. These activities are: Design; Installation; Operation; and Maintenance
Energy Technology Data Exchange (ETDEWEB)
Goerner, Raphael [ABB AG, Mannheim (Germany). Marketing und Vertrieb, Geschaeftsbereich Grid Systems
2013-06-01
The 'current war' between direct current and alternating current is extended by a new location. In the future, both technologies work together in order to provide a reliable power transmission in Germany and long-term in Europe. This is based on the self-guided high-voltage direct current transmission. In conjunction with direct current circuit breakers (DC circuit breaker) the power circuit breakers may help to make the transmission grids more flexible and to minimize losses.
Advanced High Voltage Power Device Concepts
Baliga, B Jayant
2012-01-01
Advanced High Voltage Power Device Concepts describes devices utilized in power transmission and distribution equipment, and for very high power motor control in electric trains and steel-mills. Since these devices must be capable of supporting more than 5000-volts in the blocking mode, this books covers operation of devices rated at 5,000-V, 10,000-V and 20,000-V. Advanced concepts (the MCT, the BRT, and the EST) that enable MOS-gated control of power thyristor structures are described and analyzed in detail. In addition, detailed analyses of the silicon IGBT, as well as the silicon carbide MOSFET and IGBT, are provided for comparison purposes. Throughout the book, analytical models are generated to give a better understanding of the physics of operation for all the structures. This book provides readers with: The first comprehensive treatment of high voltage (over 5000-volts) power devices suitable for the power distribution, traction, and motor-control markets; Analytical formulations for all the device ...
Lucas, Greg M.; Love, Jeffrey J.; Kelbert, Anna
2018-02-01
Commonly, one-dimensional (1-D) Earth impedances have been used to calculate the voltages induced across electric power transmission lines during geomagnetic storms under the assumption that much of the three-dimensional structure of the Earth gets smoothed when integrating along power transmission lines. We calculate the voltage across power transmission lines in the mid-Atlantic region with both regional 1-D impedances and 64 empirical 3-D impedances obtained from a magnetotelluric survey. The use of 3-D impedances produces substantially more spatial variance in the calculated voltages, with the voltages being more than an order of magnitude different, both higher and lower, than the voltages calculated utilizing regional 1-D impedances. During the March 1989 geomagnetic storm 62 transmission lines exceed 100 V when utilizing empirical 3-D impedances, whereas 16 transmission lines exceed 100 V when utilizing regional 1-D impedances. This demonstrates the importance of using realistic impedances to understand and quantify the impact that a geomagnetic storm has on power grids.
E-beam high voltage switching power supply
Shimer, Daniel W.; Lange, Arnold C.
1997-01-01
A high power, solid state power supply is described for producing a controllable, constant high voltage output under varying and arcing loads suitable for powering an electron beam gun or other ion source. The present power supply is most useful for outputs in a range of about 100-400 kW or more. The power supply is comprised of a plurality of discrete switching type dc-dc converter modules, each comprising a voltage regulator, an inductor, an inverter for producing a high frequency square wave current of alternating polarity, an improved inverter voltage clamping circuit, a step up transformer, and an output rectifier for producing a dc voltage at the output of each module. The inputs to the converter modules are fed from a common dc rectifier/filter and are linked together in parallel through decoupling networks to suppress high frequency input interactions. The outputs of the converter modules are linked together in series and connected to the input of the transmission line to the load through a decoupling and line matching network. The dc-dc converter modules are phase activated such that for n modules, each module is activated equally 360.degree./n out of phase with respect to a successive module. The phased activation of the converter modules, combined with the square current waveforms out of the step up transformers, allows the power supply to operate with greatly reduced output capacitance values which minimizes the stored energy available for discharge into an electron beam gun or the like during arcing. The present power supply also provides dynamic response to varying loads by controlling the voltage regulator duty cycle using simulated voltage feedback signals and voltage feedback loops. Circuitry is also provided for sensing incipient arc currents reflected at the output of the power supply and for simultaneously decoupling the power supply circuitry from the arcing load.
E-beam high voltage switching power supply
International Nuclear Information System (INIS)
Shimer, D.W.; Lange, A.C.
1997-01-01
A high power, solid state power supply is described for producing a controllable, constant high voltage output under varying and arcing loads suitable for powering an electron beam gun or other ion source. The present power supply is most useful for outputs in a range of about 100-400 kW or more. The power supply is comprised of a plurality of discrete switching type dc-dc converter modules, each comprising a voltage regulator, an inductor, an inverter for producing a high frequency square wave current of alternating polarity, an improved inverter voltage clamping circuit, a step up transformer, and an output rectifier for producing a dc voltage at the output of each module. The inputs to the converter modules are fed from a common dc rectifier/filter and are linked together in parallel through decoupling networks to suppress high frequency input interactions. The outputs of the converter modules are linked together in series and connected to the input of the transmission line to the load through a decoupling and line matching network. The dc-dc converter modules are phase activated such that for n modules, each module is activated equally 360 degree/n out of phase with respect to a successive module. The phased activation of the converter modules, combined with the square current waveforms out of the step up transformers, allows the power supply to operate with greatly reduced output capacitance values which minimizes the stored energy available for discharge into an electron beam gun or the like during arcing. The present power supply also provides dynamic response to varying loads by controlling the voltage regulator duty cycle using simulated voltage feedback signals and voltage feedback loops. Circuitry is also provided for sensing incipient arc currents reflected at the output of the power supply and for simultaneously decoupling the power supply circuitry from the arcing load. 7 figs
She, Xu; Chokhawala, Rahul Shantilal; Bray, James William; Sommerer, Timothy John; Zhou, Rui; Zhang, Di
2017-08-29
A high-voltage direct-current (HVDC) transmission system includes an alternating current (AC) electrical source and a power converter channel that includes an AC-DC converter electrically coupled to the electrical source and a DC-AC inverter electrically coupled to the AC-DC converter. The AC-DC converter and the DC-AC inverter each include a plurality of legs that includes at least one switching device. The power converter channel further includes a commutating circuit communicatively coupled to one or more switching devices. The commutating circuit is configured to "switch on" one of the switching devices during a first portion of a cycle of the H-bridge switching circuits and "switch off" the switching device during a second portion of the cycle of the first and second H-bridge switching circuits.
Directory of Open Access Journals (Sweden)
Xingchi Ma
2017-09-01
Full Text Available This work reports the fretting wear behavior of aluminum cable steel reinforced (ACSR conductors for use in high-voltage transmission line. Fretting wear tests of Al wires were conducted on a servo-controlled fatigue testing machine with self-made assistant apparatus, and their fretting process characteristics, friction force, wear damage, and wear surface morphology were detailed analyzed. The results show that the running regime of Al wires changes from a gross slip regime to a mixed regime more quickly as increasing contact load. With increasing amplitudes, gross slip regimes are more dominant under contact loads of lower than 30 N. The maximum friction force is relatively smaller in the NaCl solution than in a dry friction environment. The primary wear mechanisms in dry friction environments are abrasive wear and adhesive wear whereas abrasive wear and fatigue damage are dominant in NaCl solution.
Lucas, Greg M.; Love, Jeffrey J.; Kelbert, Anna
2018-01-01
Commonly, one-dimensional (1-D) Earth impedances have been used to calculate the voltages induced across electric power transmission lines during geomagnetic storms under the assumption that much of the three-dimensional structure of the Earth gets smoothed when integrating along power transmission lines. We calculate the voltage across power transmission lines in the mid-Atlantic region with both regional 1-D impedances and 64 empirical 3-D impedances obtained from a magnetotelluric survey. The use of 3-D impedances produces substantially more spatial variance in the calculated voltages, with the voltages being more than an order of magnitude different, both higher and lower, than the voltages calculated utilizing regional 1-D impedances. During the March 1989 geomagnetic storm 62 transmission lines exceed 100 V when utilizing empirical 3-D impedances, whereas 16 transmission lines exceed 100 V when utilizing regional 1-D impedances. This demonstrates the importance of using realistic impedances to understand and quantify the impact that a geomagnetic storm has on power grids.
Lachugin, V. F.; Panfilov, D. I.; Akhmetov, I. M.; Astashev, M. G.; Shevelev, A. V.
2014-12-01
Problems of functioning of differential current protection systems of phase shifting devices (PSD) with mechanically changed coefficient of transformation of shunt transformer are analyzed. Requirements for devices of protection of PSD with thyristor switch are formulated. Based on use of nonlinear models of series-wound and shunt transformers of PSD modes of operation of major protection during PSD, switching to zero load operation and to operation under load and during short circuit operation were studied for testing PSD with failures. Use of the principle of duplicating by devices of differential current protection (with realization of functions of breaking) of failures of separate pares of PSD with thyristor switch was substantiated. To ensure protection sensitivity to the shunt transformer winding short circuit, in particular, to a short circuit that is not implemented in the current differential protection for PSD with mechanical switch, the differential current protection reacting to the amount of primary ampere-turns of high-voltage and low-voltage winding of this transformer was designed. Studies have shown that the use of differential current cutoff instead of overcurrent protection for the shunt transformer wndings allows one to provide the sensitivity during thyristor failure with the formation of a short circuit. The results of simulation mode for the PSD with switch thyristor designed to be installed as switching point of Voskhod-Tatarskaya-Barabinsk 220 kV transmission line point out the efficiency of the developed solutions that ensure reliable functioning of the PSD.
Study and Experiment on Non-Contact Voltage Sensor Suitable for Three-Phase Transmission Line.
Zhou, Qiang; He, Wei; Xiao, Dongping; Li, Songnong; Zhou, Kongjun
2015-12-30
A voltage transformer, as voltage signal detection equipment, plays an important role in a power system. Presently, more and more electric power systems are adopting potential transformer and capacitance voltage transformers. Transformers are often large in volume and heavyweight, their insulation design is difficult, and an iron core or multi-grade capacitance voltage division structure is generally adopted. As a result, the detection accuracy of transformer is reduced, a huge phase difference exists between detection signal and voltage signal to be measured, and the detection signal cannot accurately and timely reflect the change of conductor voltage signal to be measured. By aiming at the current problems of electric transformation, based on electrostatic induction principle, this paper designed a non-contact voltage sensor and gained detection signal of the sensor through electrostatic coupling for the electric field generated by electric charges of the conductor to be measured. The insulation structure design of the sensor is simple and its volume is small; phase difference of sensor measurement is effectively reduced through optimization design of the electrode; and voltage division ratio and measurement accuracy are increased. The voltage sensor was tested on the experimental platform of simulating three-phase transmission line. According to the result, the designed non-contact voltage sensor can realize accurate and real-time measurement for the conductor voltage. It can be applied to online monitoring for the voltage of three-phase transmission line or three-phase distribution network line, which is in accordance with the development direction of the smart grid.
Directory of Open Access Journals (Sweden)
Suslov V.M.
2005-12-01
Full Text Available The opportunity approached is shown, but more exact as it is usually accepted, the account of sagging of wires at definition of specific potential factors air High-Voltage Power Transmission Lines. The technique of reception of analytical expressions is resulted. For an opportunity of comparison traditional expressions for specific potential factors are resulted also. Communication of the offered and traditional analytical expressions is shown. Offered analytical expressions are not difficult for programming on a personal computer of any class and besides they allow to make an estimation of an error of traditional expressions by means of parallel definition of specific potential factors by both ways.
Influence of current limitation on voltage stability with voltage sourced converter HVDC
DEFF Research Database (Denmark)
Zeni, Lorenzo; Jóhannsson, Hjörtur; Hansen, Anca Daniela
2013-01-01
A first study of voltage stability with relevant amount of Voltage Sourced Converter based High Voltage Direct Current (VSC-HVDC) transmission is presented, with particular focus on the converters’ behaviour when reaching their rated current. The detrimental effect of entering the current...
Technological Aspects: High Voltage
Faircloth, D.C.
2013-12-16
This paper covers the theory and technological aspects of high-voltage design for ion sources. Electric field strengths are critical to understanding high-voltage breakdown. The equations governing electric fields and the techniques to solve them are discussed. The fundamental physics of high-voltage breakdown and electrical discharges are outlined. Different types of electrical discharges are catalogued and their behaviour in environments ranging from air to vacuum are detailed. The importance of surfaces is discussed. The principles of designing electrodes and insulators are introduced. The use of high-voltage platforms and their relation to system design are discussed. The use of commercially available high-voltage technology such as connectors, feedthroughs and cables are considered. Different power supply technologies and their procurement are briefly outlined. High-voltage safety, electric shocks and system design rules are covered.
Cai, Yuanji; Guan, Yonggang; Liu, Weidong
2017-06-01
Transient enclosure voltage (TEV), which is a phenomenon induced by the inner dielectric breakdown of SF6 during disconnector operations in a gas-insulated switchgear (GIS), may cause issues relating to shock hazard and electromagnetic interference to secondary equipment. This is a critical factor regarding the electromagnetic compatibility of ultra-high-voltage (UHV) substations. In this paper, the statistical characteristics of TEV at UHV level are collected from field experiments, and are analyzed and compared to those from a repeated strike process. The TEV waveforms during disconnector operations are recorded by a self-developed measurement system first. Then, statistical characteristics, such as the pulse number, duration of pulses, frequency components, magnitude and single pulse duration, are extracted. The transmission line theory is introduced to analyze the TEV and is validated by the experimental results. Finally, the relationship between the TEV and the repeated strike process is analyzed. This proves that the pulse voltage of the TEV is proportional to the corresponding breakdown voltage. The results contribute to the definition of the standard testing waveform of the TEV, and can aid the protection of electronic devices in substations by minimizing the threat of this phenomenon.
Directory of Open Access Journals (Sweden)
Rui Li
2016-12-01
Full Text Available The AC voltage control of a DC/DC converter based on the modular multilevel converter (MMC is considered under normal operation and during a local DC fault. By actively setting the AC voltage according to the two DC voltages of the DC/DC converter, the modulation index can be near unity, and the DC voltage is effectively utilized to output higher AC voltage. This significantly decreases submodule (SM capacitance and conduction losses of the DC/DC converter, yielding reduced capital cost, volume, and higher efficiency. Additionally, the AC voltage is limited in the controllable range of both the MMCs in the DC/DC converter; thus, over-modulation and uncontrolled currents are actively avoided. The AC voltage control of the DC/DC converter during local DC faults, i.e., standby operation, is also proposed, where only the MMC connected on the faulty cable is blocked, while the other MMC remains operational with zero AC voltage output. Thus, the capacitor voltages can be regulated at the rated value and the decrease of the SM capacitor voltages after the blocking of the DC/DC converter is avoided. Moreover, the fault can still be isolated as quickly as the conventional approach, where both MMCs are blocked and the DC/DC converter is not exposed to the risk of overcurrent. The proposed AC voltage control strategy is assessed in a three-terminal high-voltage direct current (HVDC system incorporating a DC/DC converter, and the simulation results confirm its feasibility.
Technological Aspects: High Voltage
International Nuclear Information System (INIS)
Faircloth, D C
2013-01-01
This paper covers the theory and technological aspects of high-voltage design for ion sources. Electric field strengths are critical to understanding high-voltage breakdown. The equations governing electric fields and the techniques to solve them are discussed. The fundamental physics of high-voltage breakdown and electrical discharges are outlined. Different types of electrical discharges are catalogued and their behaviour in environments ranging from air to vacuum are detailed. The importance of surfaces is discussed. The principles of designing electrodes and insulators are introduced. The use of high-voltage platforms and their relation to system design are discussed. The use of commercially available high-voltage technology such as connectors, feedthroughs and cables are considered. Different power supply technologies and their procurement are briefly outlined. High-voltage safety, electric shocks and system design rules are covered. (author)
Atypical Exit Wound in High-Voltage Electrocution.
Parakkattil, Jamshid; Kandasamy, Shanmugam; Das, Siddhartha; Devnath, Gerard Pradeep; Chaudhari, Vinod Ashok; Shaha, Kusa Kumar
2017-12-01
Electrocution fatality cases are difficult to investigate. High-voltage electrocution burns resemble burns caused by other sources, especially if the person survives for few days. In that case, circumstantial evidence if correlated with the autopsy findings helps in determining the cause and manner of death. In addition, the crime scene findings also help to explain the pattern of injuries observed at autopsy. A farmer came in contact with a high-voltage transmission wire and sustained superficial to deep burns over his body. A charred and deeply scorched area was seen over the face, which was suggestive of the electric entry wound. The exit wound was present over both feet and lower leg and was atypical in the form of a burnt area of peeled blistered skin, charring, and deep scorching. The injuries were correlated with crime scene findings, and the circumstances that lead to his electrocution are discussed here.
Akbar, P. A.; Hakim, D. L.; Sucita, T.
2018-02-01
In this research, testing improvements to the distribution voltage electricity at 150 kV transmission subsystem Bandung Selatan and New Ujungberung using Flexible AC Transmission System (FACTS) technology. One of them is by doing the control of active and reactive power through the power electronics equipment Static Synchronous Compensator (STATCOM). The subsystem is tested because it has a voltage profile are relatively less well when based on the IEEE / ANSI C.84.1 (142.5 - 157.5 kV). This study was conducted by analyzing the Newton-Raphson power flow on the simulator DigSilent Power Factory 15 to determine the profile of the voltage (V) on the system. Bus which has the lowest voltage to be a reference in the installation of STATCOM. From this research is known that the voltage on the conditions of the existing bus 28, as many as 21-23 still below standard buses (142.5 kV), after the installation is done using STATCOM, voltage on the buses improved by increasing the number of tracks that follow the standard / is in the range 142.5 kV -157.5 kV as many as 23-27 buses or 78.6% - 96%, with the optimum mounting on a bus Rancaekek STATCOM II with a capacity of 300 MVA.
Suppressing voltage transients in high voltage power supplies
International Nuclear Information System (INIS)
Lickel, K.F.; Stonebank, R.
1979-01-01
A high voltage power supply for an X-ray tubes includes voltage adjusting means, a high voltage transformer, switch means connected to make and interrupt the primary current of the transformer, and over-voltage suppression means to suppress the voltage transient produced when the current is switched on. In order to reduce the power losses in the suppression means, an impedance is connected in the transformer primary circuit on operation of the switch means and is subsequently short-circuited by a switch controlled by a timer after a period which is automatically adjusted to the duration of the transient overvoltage. (U.K.)
Padmanaban, Sanjeevikumar; Grandi, Gabriele; Blaabjerg, Frede; Wheeler, Patrick; Siano, Pierluigi; Hammami, Manel
2017-01-01
Classical DC-DC converters used in high voltage direct current (HVDC) power transmission systems, lack in terms of efficiency, reduced transfer gain and increased cost with sensor (voltage/current) numbers. Besides, the internal self-parasitic behavior of the power components reduces the output voltage and efficiency of classical HV converters. This paper deals with extra high-voltage (EHV) dc-dc boost converter by the application of voltage-lift technique to overcome the aforementioned defic...
Environmental Audits of High Voltage Objects from the View Point of Investors
International Nuclear Information System (INIS)
Marek Szuba, M.
2007-01-01
The localization of high voltage objects, e.g., overhead transmission lines, under the spatial planning and environmental protection regulations is discussed. The most important elements of the localization procedure concerning high voltage overhead lines are presented. One of the elements of this procedure is the assessment of the investment environmental impact. The environmental audit is an essential document, in which this impact is described. It seems that its scope specified in the Environmental Protection Act is not adjusted to the specificity of line investments. This gives rise to some problems in preparing environmental audits for overhead lines, e.g., possible influence of high voltage lines on the Natura 2000 area zones. Several other related problems are also highlighted in this paper. (author)
Energy Technology Data Exchange (ETDEWEB)
None
1980-01-01
Abstracts of research projects are presented in the following areas: measurements and special facilities; cellular and subcellular studies; physiology; behavior; environmental effects; modeling, scaling and dosimetry; and high voltage direct current. (ACR)
Kind, Dieter
2001-01-01
The second edition of High Voltage Test Techniques has been completely revised. The present revision takes into account the latest international developments in High Voltage and Measurement technology, making it an essential reference for engineers in the testing field.High Voltage Technology belongs to the traditional area of Electrical Engineering. However, this is not to say that the area has stood still. New insulating materials, computing methods and voltage levels repeatedly pose new problems or open up methods of solution; electromagnetic compatibility (EMC) or components and systems al
International Nuclear Information System (INIS)
Kim, Bongjun; Kim, Hyuntak; Nagai, Takuro; Matsui, Yoshio; Horiuchi, Shigeo; Jeong, Daeyeong; Deinhofer, Christian; Gritzner, Gerhard; Kim, Youngmin; Kim, Younjoong
2006-01-01
The thin amorphous-like layer, formed at the interface between a high-T c superconducting (Tl 0.5 , Pb 0.5 )(Sr 0.8 , Ba 0.2 )Ca 2 Cu 3 O y (Tl-1223) film and a Ag substrate during heating at 910 .deg. C, has been examined by using high-voltage high-resolution transmission electron microscopy. The interfacial layer is less than 10 nm in thickness. It contacts the (001) plane of Tl-1223 and the (113) or (133) planes of Ag in most cases. Its composition is similar to that of Tl-1223, except for the inclusion of a substantial amount of Ag. Its formation proceeds by diffusion of Ag into Tl-1223, during which a structure change first occurs at the layer of CuO 2 + Ca planes. The Tl(Pb)O + the Sr(Ba)O layers are then destroyed to cause the total structure to become amorphous-like. Furthermore, we have found that it is formed under an irradiation of highly energetic electrons.
Topologically protected loop flows in high voltage AC power grids
International Nuclear Information System (INIS)
Coletta, T; Delabays, R; Jacquod, Ph; Adagideli, I
2016-01-01
Geographical features such as mountain ranges or big lakes and inland seas often result in large closed loops in high voltage AC power grids. Sizable circulating power flows have been recorded around such loops, which take up transmission line capacity and dissipate but do not deliver electric power. Power flows in high voltage AC transmission grids are dominantly governed by voltage angle differences between connected buses, much in the same way as Josephson currents depend on phase differences between tunnel-coupled superconductors. From this previously overlooked similarity we argue here that circulating power flows in AC power grids are analogous to supercurrents flowing in superconducting rings and in rings of Josephson junctions. We investigate how circulating power flows can be created and how they behave in the presence of ohmic dissipation. We show how changing operating conditions may generate them, how significantly more power is ohmically dissipated in their presence and how they are topologically protected, even in the presence of dissipation, so that they persist when operating conditions are returned to their original values. We identify three mechanisms for creating circulating power flows, (i) by loss of stability of the equilibrium state carrying no circulating loop flow, (ii) by tripping of a line traversing a large loop in the network and (iii) by reclosing a loop that tripped or was open earlier. Because voltages are uniquely defined, circulating power flows can take on only discrete values, much in the same way as circulation around vortices is quantized in superfluids. (paper)
High voltage superconducting switch for power application
International Nuclear Information System (INIS)
Mawardi, O.; Ferendeci, A.; Gattozzi, A.
1983-01-01
This paper reports the development of a novel interrupter which meets the requirements of a high voltage direct current (HVDC) power switch and at the same time doubles as a current limiter. The basic concept of the interrupter makes use of a fast superconducting, high capacity (SHIC) switch that carries the full load current while in the superconducting state and reverts to the normal resistive state when triggered. Typical design parameters are examined for the case of a HVDC transmission line handling 2.5KA at 150KVDC. The result is a power switch with superior performance and smaller size than the ones reported to date
Distance protection of multiple-circuit shared tower transmission lines with different voltages
DEFF Research Database (Denmark)
Silva, Filipe Miguel Faria da; Bak, Claus Leth
2017-01-01
combined faults, being advised to increase the resistive limit of the protection zone, if the network has lower short-circuit power. It is recommended to assure that the fault can only happen for cases where the faulted phase from the higher voltage level leads the faulted phase from the lower voltage......Multiple-circuit transmission lines combining different voltage levels in one tower present extra challenges when setting a protection philosophy, as faults between voltage levels are possible. In this study, the fault loop impedance of combined faults is compared with the fault loop impedance......-phase-to-ground faults. It is also demonstrated that the fault loop impedance of combined faults is more resistive, when compared with equivalent single-phase-to-ground faults. It is concluded that the settings used to protect a line against single-phase-to-ground faults are capable of protecting the line against...
Directory of Open Access Journals (Sweden)
Perić Dragoslav M.
2015-01-01
Full Text Available Switchgear for auxiliary low voltage in substations (SS of extra high voltages (EHV to high voltage (HV - SS EHV/HV kV/kV is of special interest for the functioning of these important SS, as it provides a supply for system of protection and other vital functions of SS. The article addresses several characteristic examples involving MV lines with varying degrees of independence of their supply, and the possible application of direct transformation EHV/LV through special voltage transformers. Auxiliary sources such as inverters and diesel generators, which have limited power and expensive energy, are also used for the supply of switchgear for auxiliary low voltage. Corresponding reliability indices are calculated for all examples including mean expected annual engagement of diesel generators. The applicability of certain solutions of switchgear for auxiliary low voltage SS EHV/HV, taking into account their reliability, feasibility and cost-effectiveness is analyzed too. In particular, the analysis of applications of direct transformation EHV/LV for supply of switchgear for auxiliary low voltage, for both new and existing SS EHV/HV.
Multi-Port High Voltage Gain Modular Power Converter for Offshore Wind Farms
Directory of Open Access Journals (Sweden)
Sen Song
2018-06-01
Full Text Available In high voltage direct current (HVDC power transmission of offshore wind power systems, DC/DC converters are applied to transfer power from wind generators to HVDC terminals, and they play a crucial role in providing a high voltage gain, high efficiency, and high fault tolerance. This paper introduces an innovative multi-port DC/DC converter with multiple modules connected in a scalable matrix configuration, presenting an ultra-high voltage step-up ratio and low voltage/current rating of components simultaneously. Additionally, thanks to the adoption of active clamping current-fed push–pull (CFPP converters as sub-modules (SMs, soft-switching is obtained for all power switches, and the currents of series-connected CFPP converters are auto-balanced, which significantly reduce switching losses and control complexity. Furthermore, owing to the expandable matrix structure, the output voltage and power of a modular converter can be controlled by those of a single SM, or by adjusting the column and row numbers of the matrix. High control flexibility improves fault tolerance. Moreover, due to the flexible control, the proposed converter can transfer power directly from multiple ports to HVDC terminals without bus cable. In this paper, the design of the proposed converter is introduced, and its functions are illustrated by simulation results.
International Nuclear Information System (INIS)
Spassov, Velin
1996-01-01
This document reports my activities as visitor-professor at the Gyrotron Project - INPE Plasma Laboratory. The main objective of my activities was designing, construction and testing a suitable high-voltage pulse generator for plasma applications, and efforts were concentrated on the following points: Design of high-voltage resonant power supply with tunable output (0 - 50 kV) for line-type high voltage pulse generator; design of line-type pulse generator (4 microseconds pulse duration, 0 - 25 kV tunable voltage) for non linear loads such as a gyrotron and P III reactor; design of resonant charging inductance for resonant line-type pulse generator, and design of high resolution synchro instrument for gyrotron frequency measurement. (author)
Transmission Level High Temperature Superconducting Fault Current Limiter
Energy Technology Data Exchange (ETDEWEB)
Stewart, Gary [SuperPower, Inc., Schenectady, NY (United States)
2016-10-05
The primary objective of this project was to demonstrate the feasibility and reliability of utilizing high-temperature superconducting (HTS) materials in a Transmission Level Superconducting Fault Current Limiter (SFCL) application. During the project, the type of high-temperature superconducting material used evolved from 1st generation (1G) BSCCO-2212 melt cast bulk high-temperature superconductors to 2nd generation (2G) YBCO-based high-temperature superconducting tape. The SFCL employed SuperPower's “Matrix” technology, that offers modular features to enable scale up to transmission voltage levels. The SFCL consists of individual modules that contain elements and parallel inductors that assist in carrying the current during the fault. A number of these modules are arranged in an m x n array to form the current-limiting matrix.
Choice of operating voltage for a transmission electron microscope
International Nuclear Information System (INIS)
Egerton, R.F.
2014-01-01
An accelerating voltage of 100–300 kV remains a good choice for the majority of TEM or STEM specimens, avoiding the expense of high-voltage microscopy but providing the possibility of atomic resolution even in the absence of lens-aberration correction. For specimens thicker than a few tens of nm, the image intensity and scattering contrast are likely to be higher than at lower voltage, as is the visibility of ionization edges below 1000 eV (as required for EELS elemental analysis). In thick (>100 nm) specimens, higher voltage ensures less beam broadening and better spatial resolution for STEM imaging and EDX spectroscopy. Low-voltage (e.g. 30 kV) TEM or STEM is attractive for a very thin (e.g. 10 nm) specimen, as it provides higher scattering contrast and fewer problems for valence-excitation EELS. Specimens that are immune to radiolysis suffer knock-on damage at high current densities, and this form of radiation damage can be reduced or avoided by choosing a low accelerating voltage. Low-voltage STEM with an aberration-corrected objective lens (together with a high-angle dark-field detector and/or EELS) offers atomic resolution and elemental identification from very thin specimens. Conventional TEM can provide atomic resolution in low-voltage phase-contrast images but requires correction of chromatic aberration and preferably an electron-beam monochromator. Many non-conducting (e.g. organic) specimens damage easily by radiolysis and radiation damage then determines the TEM image resolution. For bright-field scattering contrast, low kV can provide slightly better dose-limited resolution if the specimen is very thin (a few nm) but considerably better resolution is possible from a thicker specimen, for which higher kV is required. Use of a phase plate in a conventional TEM offers the most dose-efficient way of achieving atomic resolution from beam-sensitive specimens. - Highlights: • 100–300 kV accelerating voltage is suitable for TEM specimens of typical
High-voltage, high-current, solid-state closing switch
Focia, Ronald Jeffrey
2017-08-22
A high-voltage, high-current, solid-state closing switch uses a field-effect transistor (e.g., a MOSFET) to trigger a high-voltage stack of thyristors. The switch can have a high hold-off voltage, high current carrying capacity, and high time-rate-of-change of current, di/dt. The fast closing switch can be used in pulsed power applications.
DEFF Research Database (Denmark)
Padmanaban, Sanjeevi Kumar; Blaabjerg, Frede; Siano, Pierluigi
2016-01-01
This paper presents the control strategies by Proportional-Integral (P-I) and Fuzzy Logic (FL) for a DC-DC boost power converter for high output voltage configuration. Standard DC-DC converters are traditionally used for high voltage direct current (HVDC) power transmission systems. But, lack its...... converter with inbuilt voltage-lift technique and overcome the aforementioned deficiencies. Further, the control strategy is adapted based on proportional-integral (P-I) and fuzzy logic, closed-loop controller to regulate the outputs and ensure the performances. Complete hardware prototype of EHV converter...... performances in terms of efficiency, reduced transfer gain and increased cost with sensor units. Moreover, the internal self-parasitic components reduce the output voltage and efficiency of classical high voltage converters (HVC). This investigation focused on extra high-voltage (EHV) DC-DC boost power...
Energy Technology Data Exchange (ETDEWEB)
Kim, Bongjun; Kim, Hyuntak [Electronics and Tele-Communications Research Institute, Daejeon (Korea, Republic of); Nagai, Takuro; Matsui, Yoshio [National Institute for Materials Science, Tsukuba, Ibaraki (Japan); Horiuchi, Shigeo; Jeong, Daeyeong [Electrotechnology Research Institute, Changwon (Korea, Republic of); Deinhofer, Christian; Gritzner, Gerhard [Johannes Kepler University, Linz (Austria); Kim, Youngmin; Kim, Younjoong [Electron Microscopy Team, Korea Basic Science Institute, Daejeon (Korea, Republic of)
2006-05-15
The thin amorphous-like layer, formed at the interface between a high-T{sub c} superconducting (Tl{sub 0.5}, Pb{sub 0.5})(Sr{sub 0.8}, Ba{sub 0.2})Ca{sub 2}Cu{sub 3}O{sub y} (Tl-1223) film and a Ag substrate during heating at 910 .deg. C, has been examined by using high-voltage high-resolution transmission electron microscopy. The interfacial layer is less than 10 nm in thickness. It contacts the (001) plane of Tl-1223 and the (113) or (133) planes of Ag in most cases. Its composition is similar to that of Tl-1223, except for the inclusion of a substantial amount of Ag. Its formation proceeds by diffusion of Ag into Tl-1223, during which a structure change first occurs at the layer of CuO{sub 2} + Ca planes. The Tl(Pb)O + the Sr(Ba)O layers are then destroyed to cause the total structure to become amorphous-like. Furthermore, we have found that it is formed under an irradiation of highly energetic electrons.
CMOS-compatible high-voltage integrated circuits
Energy Technology Data Exchange (ETDEWEB)
Parpia, Z
1988-01-01
Considerable savings in cost and development time can be achieved if high-voltage ICs (HVICs) are fabricated in an existing low-voltage process. In this thesis, the feasibility of fabricating HVICs in a standard CMOS process is investigated. The high-voltage capabilities of an existing 5-{mu}m CMOS process are first studied. High-voltage n- and p-channel transistors with breakdown voltages of 50 and 190 V, respectively, were fabricated without any modifications to the process under consideration. SPICE models for these transistors are developed, and their accuracy verified by comparison with experimental results. In addition, the effect of the interconnect metallization on the high-voltage performance of these devices is also examined. Polysilicon field plates are found to be effective in preventing premature interconnect induced breakdown in these devices. A novel high-voltage transistor structure, the insulated base transistor (IBT), based on a merged MOS-bipolar concept, is proposed and implemented. In order to enhance the high-voltage device capabilities, an improved CMOS-compatible HVIC process using junction isolation is developed.
Energy Technology Data Exchange (ETDEWEB)
Bugl, Andrea; Ball, Markus; Boehmer, Michael; Doerheim, Sverre; Hoenle, Andreas; Konorov, Igor [Technische Universitaet Muenchen, Garching (Germany); Ketzer, Bernhard [Technische Universitaet Muenchen, Garching (Germany); Helmholtz-Institut fuer Strahlen- und Kernphysik, Bonn (Germany)
2014-07-01
Current measurements in the nano- and picoampere region on high voltage are an important tool to understand charge transfer processes in micropattern gas detectors like the Gas Electron Multiplier (GEM). They are currently used to e.g. optimize the field configuration in a multi-GEM stack to be used in the ALICE TPC after the upgrade of the experiment during the 2nd long shutdown of the LHC. Devices which allow measurements down to 1pA at high voltage up to 6 kV have been developed at TU Muenchen. They are based on analog current measurements via the voltage drop over a switchable shunt. A microcontroller collects 128 digital ADC values and calculates their mean and standard deviation. This information is sent with a wireless transmitting unit to a computer and stored in a root file. A nearly unlimited number of devices can be operated simultaneously and read out by a single receiver. The results can also be displayed on a LCD directly at the device. Battery operation and the wireless readout are important to protect the user from any contact to high voltage. The principle of the device is explained, and systematic studies of their properties are shown.
Facts and feelings : Framing effects in responses to uncertainties about high-voltage power lines
de Vries, G.; de Bruijn, J.A.
2017-01-01
To ensure power supply security, electricity transmission system operators (TSOs) have to upscale high-voltage overhead power lines. However, upscaling frequently meets opposition. Opposition can be caused by uncertainties about risks and benefits and might lead to costly delays (Linder, 1995;
DEFF Research Database (Denmark)
Wickramasinghe, Harith R.; Konstantinou, Georgios; Pou, Josep
2018-01-01
Estimation-based indirect dc-voltage control in MMCs interacts with circulating current control methods. This paper proposes an estimation-based indirect dc-voltage control method for MMC-HVDC systems and analyzes its performance compared to alternative estimations. The interactions between......-state and transient performance is demonstrated using a benchmark MMC-HVDC transmission system, implemented in a real-time digital simulator. The results verify the theoretical evaluations and illustrate the operation and performance of the proposed indirect dc-voltage control method....
Automatic Voltage Control (AVC) of Danish Transmission System - Concept design
DEFF Research Database (Denmark)
Qin, Nan; Abildgaard, Hans; Lund, P.
2014-01-01
For more than 20 years it has been a consistent plan by all Danish governments to turn the Danish power production away from fossil fuels towards renewable energy. The result today is that 37% of the total Danish power consumption was covered by mainly wind energy in 2013 aiming at 50% by 2020......, objectives, constraints, algorithms for optimal power flow and some special functions in particular systems, which inspires the concept design of a Danish AVC system to address the future challenges of voltage control. In the concept, the Danish AVC design is based on a centralized control scheme. All...... the substation loses the telecommunications to the control center. RPCs will be integrated to the AVC system as normative regulators in the later stage. Distributed generation units can be organized as virtual power plants and participate in voltage control at transmission level. Energinet.dk as the Danish TSO...
Temporary over voltages in the high voltage networks
International Nuclear Information System (INIS)
Vukelja, Petar; Naumov, Radomir; Mrvic, Jovan; Minovski, Risto
2001-01-01
The paper treats the temporary over voltages that may arise in the high voltage networks as a result of: ground faults, loss of load, loss of one or two phases and switching operation. Based on the analysis, the measures for their limitation are proposed. (Original)
Transient voltage sharing in series-coupled high voltage switches
Directory of Open Access Journals (Sweden)
Editorial Office
1992-07-01
Full Text Available For switching voltages in excess of the maximum blocking voltage of a switching element (for example, thyristor, MOSFET or bipolar transistor such elements are often coupled in series - and additional circuitry has to be provided to ensure equal voltage sharing. Between each such series element and system ground there is a certain parasitic capacitance that may draw a significant current during high-speed voltage transients. The "open" switch is modelled as a ladder network. Analysis reveals an exponential progression in the distribution of the applied voltage across the elements. Overstressing thus occurs in some of the elements at levels of the total voltage that are significantly below the design value. This difficulty is overcome by grading the voltage sharing circuitry, coupled in parallel with each element, in a prescribed manner, as set out here.
International Nuclear Information System (INIS)
Shen Yongjun; Lei Lecheng; Zhang Xingwang; Zhou Minghua; Zhang Yi
2008-01-01
Fast electrical diagnostics and improvement of electrical circuits for methyl orange (MO) degradation by high voltage pulsed electrical discharge were investigated. To eliminate electromagnetic radiation, several effective methods were employed. RG 218 coaxial cable was substituted for the common transmission lines to transmit high voltage pulses, and multi-lines in parallel were earthed to avoid electromagnetic interference and, additionally, to reduce the stray inductance of the electrical circuit and increase the pulse rise rate to reduce the energy losses in the transmission system. The problem of the differences in the bandwidths of voltage and current probes causing an error in the calculation of energy dissipation was avoided by reducing the bandwidths of voltage and current measurements to the same value. The real discharge current was obtained by subtracting the capacitive current from the total current. The energy per pulse obtained in the reactor before and after improvement of the diagnostics and electrical circuit were 15.5 mJ and 26.8 mJ, respectively, and the energy efficiencies of MO degradation were 1.34 x 10 -9 mol/J and 1.95 x 10 -9 mol/J, respectively
Transmission positron microscopes
International Nuclear Information System (INIS)
Doyama, Masao; Kogure, Yoshiaki; Inoue, Miyoshi; Kurihara, Toshikazu; Yoshiie, Toshimasa; Oshima, Ryuichiro; Matsuya, Miyuki
2006-01-01
Immediate and near-future plans for transmission positron microscopes being built at KEK, Tsukuba, Japan, are described. The characteristic feature of this project is remolding a commercial electron microscope to a positron microscope. A point source of electrons kept at a negative high voltage is changed to a point source of positrons kept at a high positive voltage. Positional resolution of transmission microscopes should be theoretically the same as electron microscopes. Positron microscopes utilizing trapping of positrons have always positional ambiguity due to the diffusion of positrons
Impact of distributed generators on the power loss and voltage profile of sub-transmission network
Directory of Open Access Journals (Sweden)
A.S.O. Ogunjuyigbe
2016-05-01
Full Text Available This paper presents the impact of distributed generator (DG on the power loss and voltage profile of sub-transmission network at different penetration levels (PLs. The various DG technologies are modeled based on their electrical output characteristics. Voltage profile index which allows a single value to represent how well the voltage matches the ideal value is developed. The index allows a fair comparison of the voltage profile obtained from different scenarios. The extent to which DGs affect power losses and voltage profile depend on the type of DG technology, PL and the location in which the DG is connected to the grid. The integration of DGs reduces power losses on the network, however, as the PL increases, the power losses begin to increase. A PL of 50–75% is achieved on 69 kV voltage level and 25–50% penetration on 13.8 kV voltage level without an increase in the power loss. Also more DG can be integrated into the network at point of common connection of higher voltage level compared to the low voltage level.
Vinh, T.
1980-08-01
There is a need for better and more effective lightning protection for transmission and switching substations. In the past, a number of empirical methods were utilized to design systems to protect substations and transmission lines from direct lightning strokes. The need exists for convenient analytical lightning models adequate for engineering usage. In this study, analytical lightning models were developed along with a method for improved analysis of the physical properties of lightning through their use. This method of analysis is based upon the most recent statistical field data. The result is an improved method for predicting the occurrence of sheilding failure and for designing more effective protection for high and extra high voltage substations from direct strokes.
Prediction of breakdown voltages in novel gases for high voltage insulation
International Nuclear Information System (INIS)
Koch, M.
2015-01-01
This thesis submitted to the Swiss Federal Institute of Technology ETH in Zurich examines the use of sulphur hexafluoride (SF_6) and similar gases as important insulation media for high voltage equipment. Due to its superior insulation properties, SF_6 is widely used in gas-insulated switchgear. However, the gas also has a very high global warming potential and the content of SF_6 in the atmosphere is constantly increasing. The search for new insulation gases using classical breakdown experiments is discussed. A model for SF_6 based on the stepped leader model is described. This calculates the breakdown voltages in arbitrary electrode configurations and under standard voltage waveforms. Thus, the thesis provides a method for the prediction of breakdown voltages of arbitrary field configurations under standard voltage waveforms for gases with electron-attaching properties. With this, further gases can be characterized for usage as high voltage insulation media
DEFF Research Database (Denmark)
Xu, Fengda; Guo, Qinglai; Sun, Hongbin
2015-01-01
For an AC/DC coupled transmission system, the change of transmission power on the DC lines will significantly influence the AC systems’ voltage. This paper describes a method to coordinated control the reactive power of power plants and shunt capacitors at DC converter stations nearby, in order t...
Prediction of breakdown voltages in novel gases for high voltage insulation
Energy Technology Data Exchange (ETDEWEB)
Koch, M.
2015-07-01
This thesis submitted to the Swiss Federal Institute of Technology ETH in Zurich examines the use of sulphur hexafluoride (SF{sub 6}) and similar gases as important insulation media for high voltage equipment. Due to its superior insulation properties, SF{sub 6} is widely used in gas-insulated switchgear. However, the gas also has a very high global warming potential and the content of SF{sub 6} in the atmosphere is constantly increasing. The search for new insulation gases using classical breakdown experiments is discussed. A model for SF{sub 6} based on the stepped leader model is described. This calculates the breakdown voltages in arbitrary electrode configurations and under standard voltage waveforms. Thus, the thesis provides a method for the prediction of breakdown voltages of arbitrary field configurations under standard voltage waveforms for gases with electron-attaching properties. With this, further gases can be characterized for usage as high voltage insulation media.
Lobanov, Nikolai R.; Tunningley, Thomas; Linardakis, Peter
2018-04-01
Tandem electrostatic accelerators often require the flexibility to operate at a variety of terminal voltages to accommodate various user requirements. However, the ion beam transmission will only be optimal for a limited range of terminal voltages. This paper describes the operational performance of a novel focusing system that expands the range of terminal voltages for optimal transmission. This is accomplished by controlling the gradient of the entrance of the low-energy tube, providing an additional focusing element. In this specific case it is achieved by applying up to 150 kV to the fifth electrode of the first unit of the accelerator tube. Numerical simulations and beam transmission tests have been performed to confirm the effectiveness of the lens. An analytical expression has been derived describing its focal properties. These tests demonstrate that the entrance lens control eliminates the need to short out sections of the tube for operation at low terminal voltage.
76 FR 70721 - Voltage Coordination on High Voltage Grids; Notice of Staff Workshop
2011-11-15
... DEPARTMENT OF ENERGY Federal Energy Regulatory Commission [Docket No. AD12-5-000] Voltage Coordination on High Voltage Grids; Notice of Staff Workshop Take notice that the Federal Energy Regulatory Commission will hold a Workshop on Voltage Coordination on High Voltage Grids on Thursday, December 1, 2011...
Directory of Open Access Journals (Sweden)
Amiri RABIE
2009-12-01
Full Text Available Voltage Source Converter (VSC based HVDC transmission technology hasbeen selected as the basis for several recent projects due to its controllability,compact modular design, ease of system interface, and low environmentalimpact. This paper investigates the dynamic performance of a 200MW,±100kV VSC-HVDC transmission system under some faulted conditionsusing MATLAB/Simulink. Simulation results confirm the satisfactoryperformance of the proposed system under active and reactive powervariations and fault conditions.
International Nuclear Information System (INIS)
Ferguson, S.W.; Callis, R.W.; Cary, W.P.; Phelps, D.A.; Ponce, D.; Baity, F.W.; Barber, G.
1995-01-01
The performance of the high voltage rf components of the DIII-D Fast Wave Current Drive System (FWCD) have been evaluated under various conditions of insulator configuration, insulator material, insulating gas and gas pressure. The insulator materials that have been investigated are alumina, steatite, pyrex, quartz, and teflon. The results of this evaluation are discussed in this paper. Additionally a rf high potter was developed to aid in the evaluation of rf high voltage components. The high potter consists of a 50 Ω, 1/4 wavelength cavity with a variable position short and a 50 ohm matched tap at one end of the cavity. With this configuration rf voltages were generated in excess of 100 kVp in the frequency range 30 to 60 MHz
International Nuclear Information System (INIS)
Ferguson, S.W.; Callis, R.W.; Cary, W.P.; Phelps, D.A.; Ponce, D.; Baity, F.W.; Barber, G.
1995-12-01
The performance of the high voltage rf components of the DIII-D Fast Wave Current Drive System (FWCD) have been evaluated under various conditions of insulator configuration, insulator material, insulating gas and gas pressure. The insulator materials that have been investigated are alumina, steatite, pyrex, quartz, and teflon. The results of this evaluation are discussed in this paper. Additionally a rf high potter was developed to aid in the evaluation of rf high voltage components. The high potter consists of a 50 Ω, 1/4 wavelength cavity with a variable position short and a 50 ohm matched tap at one end of the cavity. With this configuration rf voltages were generated in excess of 100 kVp in the frequency range 30 to 60 MHz
Design issues of the High Voltage platform and feedthrough for the ITER NBI Ion Source
International Nuclear Information System (INIS)
Boldrin, M.; Palma, M. Dalla; Milani, F.
2009-01-01
In the ITER heating Neutral Beam Injector (NBI), a High Voltage air-insulated platform (named High Voltage Deck, HVD) will be installed to host the Ion Source and Extractor Power supply system and associated diagnostics referred to -1 MV DC potential. All power and control cables are routed from the HVD via a feedthrough (HV bushing) to the gas insulated transmission line which feeds the Injector. The paper focuses on insulation and mechanical issues for both HVD and HV bushing which are very special components, far from the present industrial standards as far as voltage (-1 MV DC) and dimensions are concerned. For this purpose, a preliminary design of the HVD has been carried out as concerns the mechanical structure and external shield. Then, the structure has been verified with a seismic analysis applying the seismic load excitation specified for the ITER construction site (Cadarache) and carrying out verifications according to relevant international standards. As regards the HV bushing design, proposals for the complex inner conductor structure and for interfaces to the HVD and transmission line are outlined; alternative installation layouts (aside or underneath the HVD) are compared from both mechanical and electrical points of view.
Environmental impact of high voltage aerial transmission lines
International Nuclear Information System (INIS)
Silva, R.P.; Mouallen, M.C.; Quintella, S.E.A.
1989-01-01
The identification of environmental impacts caused by the aerial transmission lines and the measures for reducing these impacts are discussed, considering the impact over the soil in different areas, biological effects caused by delayed exposure and visual impacts due to the line structures. A methodology for the impact evaluation and the aspects of the Environmental Impact Studies and Environmental Impact Report are also studied. (C.G.C.). 2 refs, 1 fig
The Design of Integrated Information System for High Voltage Metering Lab
Ma, Yan; Yang, Yi; Xu, Guangke; Gu, Chao; Zou, Lida; Yang, Feng
2018-01-01
With the development of smart grid, intelligent and informatization management of high-voltage metering lab become increasingly urgent. In the paper we design an integrated information system, which automates the whole transactions from accepting instruments, make experiments, generating report, report signature to instrument claims. Through creating database for all the calibrated instruments, using two-dimensional code, integrating report templates in advance, establishing bookmarks and online transmission of electronical signatures, our manual procedures reduce largely. These techniques simplify the complex process of account management and report transmission. After more than a year of operation, our work efficiency improves about forty percent averagely, and its accuracy rate and data reliability are much higher as well.
On-site voltage measurement with capacitive sensors on high voltage systems
Wu, L.; Wouters, P.A.A.F.; Heesch, van E.J.M.; Steennis, E.F.
2011-01-01
In Extra/High-Voltage (EHV/HV) power systems, over-voltages occur e.g. due to transients or resonances. At places where no conventional voltage measurement devices can be installed, on-site measurement of these occurrences requires preferably non intrusive sensors, which can be installed with little
Offshore Transmission Technology
Energy Technology Data Exchange (ETDEWEB)
NONE
2012-10-15
The purpose of this document is to give an overview of offshore electricity transmission technologies. In particular this document is concerned with the use of High Voltage Direct Current (HVDC) systems and more specifically with the development of Voltage Source Converter (VSC) technology. This report outlines the current state of the main technology groups required for offshore HVDC transmission as well as giving examples of offshore projects (both current and future). Finally some indications of likely unit costs for HV assets are given.
Ionization smoke detectors - the high-voltage issues
International Nuclear Information System (INIS)
Anon.
1992-01-01
Production of high-voltage ionization smoke detectors ceased in 1978 following the development of lower voltage models which used much smaller amounts of radioactive material. Despite this fact, thousands of high-voltage detectors are still in use today in many large UK companies. The major users argue that there is no reason to stop using their detectors if they are still fit for their purpose - many could last for another 15 to 20 years if properly maintained. But pressure has been mounting on businesses to replace all their high-voltage detectors with new low-voltage models within the next couple of years. This could place a huge financial burden on the companies concerned, with costs possibly running into millions of pounds. Traditionally, the major detector installers offered cleaning and maintenance services for high-voltage detectors to their customers but these have now been withdrawn. The installers give no clear reasons for this decision except that the detectors are outmoded and should be disposed of as soon as possible. Most users would agree that conversion to low-voltage types is inevitable but their main worry is the financial strain of replacing all their detectors - and associated equipment - in one go. They would prefer to phase out their high-voltage detectors in stages over a number of years to spread the costs of conversion. The problems of maintenance is discussed. A dual voltage fire alarm panel which allows the high-voltage detectors to be phased out is mentioned. (Author)
High-frequency high-voltage high-power DC-to-DC converters
Wilson, T. G.; Owen, H. A.; Wilson, P. M.
1982-09-01
A simple analysis of the current and voltage waveshapes associated with the power transistor and the power diode in an example current-or-voltage step-up (buck-boost) converter is presented. The purpose of the analysis is to provide an overview of the problems and design trade-offs which must be addressed as high-power high-voltage converters are operated at switching frequencies in the range of 100 kHz and beyond. Although the analysis focuses on the current-or-voltage step-up converter as the vehicle for discussion, the basic principles presented are applicable to other converter topologies as well.
High voltage engineering fundamentals
Kuffel, E; Hammond, P
1984-01-01
Provides a comprehensive treatment of high voltage engineering fundamentals at the introductory and intermediate levels. It covers: techniques used for generation and measurement of high direct, alternating and surge voltages for general application in industrial testing and selected special examples found in basic research; analytical and numerical calculation of electrostatic fields in simple practical insulation system; basic ionisation and decay processes in gases and breakdown mechanisms of gaseous, liquid and solid dielectrics; partial discharges and modern discharge detectors; and over
HVDC transmission preferred to 750 kV ac
Energy Technology Data Exchange (ETDEWEB)
1965-06-25
It is unlikely that there will be a need in Britain for ac transmission voltages above 400 kV. But with the growing load density in the large conurbations with no possibility of local generation, high voltage dc transmission is likely to be most useful. It was concluded that by 1971 the 400 kV supergrid would be nation-wide and 6,200 circuit miles should be in service. With the expansion to accommodate the large new generating stations, the 400 kV supergrid would become an extremely high power distribution network rather than a transmission system. A higher voltage for transmission is outside the rational limit of speculation for a country the size of Britain.
30 CFR 75.804 - Underground high-voltage cables.
2010-07-01
... AND HEALTH MANDATORY SAFETY STANDARDS-UNDERGROUND COAL MINES Underground High-Voltage Distribution § 75.804 Underground high-voltage cables. (a) Underground high-voltage cables used in resistance... 30 Mineral Resources 1 2010-07-01 2010-07-01 false Underground high-voltage cables. 75.804 Section...
High-voltage engineering and testing
Ryan, Hugh M
2013-01-01
This 3rd edition of High Voltage Engineering Testing describes strategic developments in the field and reflects on how they can best be managed. All the key components of high voltage and distribution systems are covered including electric power networks, UHV and HV. Distribution systems including HVDC and power electronic systems are also considered.
Modular high voltage power supply for chemical analysis
Stamps, James F [Livermore, CA; Yee, Daniel D [Dublin, CA
2008-07-15
A high voltage power supply for use in a system such as a microfluidics system, uses a DC-DC converter in parallel with a voltage-controlled resistor. A feedback circuit provides a control signal for the DC-DC converter and voltage-controlled resistor so as to regulate the output voltage of the high voltage power supply, as well as, to sink or source current from the high voltage supply.
High voltage designing of 300.000 Volt
International Nuclear Information System (INIS)
Hutapea, Sumihar.
1978-01-01
Some methods of designing a.c and d.c high voltage supplies are discussed. A high voltage supply for the Gama Research Centre accelerator is designed using transistor pulse generators. High voltage transformers being made using radio transistor ferrits as a core are also discussed. (author)
30 CFR 75.813 - High-voltage longwalls; scope.
2010-07-01
... 30 Mineral Resources 1 2010-07-01 2010-07-01 false High-voltage longwalls; scope. 75.813 Section... AND HEALTH MANDATORY SAFETY STANDARDS-UNDERGROUND COAL MINES Underground High-Voltage Distribution High-Voltage Longwalls § 75.813 High-voltage longwalls; scope. Sections 75.814 through 75.822 of this...
International Nuclear Information System (INIS)
Liu, Yingyi; Yuan, Haiwen; Yang, Qinghua; Cui, Yong
2011-01-01
The research in the field of corona discharge, which is one of the key technologies, can help us to realize ultra-high-voltage (UHV) power transmission. This paper proposes a new sampling resistance sensor to measure the dc UHV corona current in a wide band. By designing the structural and distributed parameters of the sensor, the UHV dielectric breakdown performance and the wide-band measuring characteristics of the sensor are satisfied. A high-voltage discharge test shows that the designed sensor can work under a 1200 kV dc environment without the occurrence of corona discharge. A frequency characteristic test shows that the measuring bandwidth of the sensor can be improved from the current 4.5 to 20 MHz. The test results in an actual dc UHV transmission line demonstrate that the sensor can accurately measure the corona current under the dc UHV environment
Modelling of long High Voltage AC Cables in the Transmission System
DEFF Research Database (Denmark)
Gudmundsdottir, Unnur Stella
: conductor-insulation (with or without SC layers)-conductor-insulation(-conductor-insulation), whereas a transmission line single core XLPE cable will normally have the configuration: conductor-SC layerinsulation-SC layer-conductor-SC layer-conductor-insulation. Furthermore the existing cable models use......, EMTDC/PSCAD is provided. A typical HV AC underground power cable is formed by 4 main layers, namely; Conductor-Insulation-Screen-Insulation. In addition to these main layers, the cable also has semiconductive screens, swelling tapes and metal foil. For high frequency modelling in EMT-based software......-SC layer-solid hollow conductor) is implemented in the model. These improvements result in a more correct series impedance and hence a more correct damping of the simulations. Even though the series impedance is more correct, it does still not include the proximity effect and high frequency oscillations...
Computer controlled high voltage system
Energy Technology Data Exchange (ETDEWEB)
Kunov, B; Georgiev, G; Dimitrov, L [and others
1996-12-31
A multichannel computer controlled high-voltage power supply system is developed. The basic technical parameters of the system are: output voltage -100-3000 V, output current - 0-3 mA, maximum number of channels in one crate - 78. 3 refs.
High voltage distributions in RPCs
International Nuclear Information System (INIS)
Inoue, Y.; Muranishi, Y.; Nakamura, M.; Nakano, E.; Takahashi, T.; Teramoto, Y.
1996-01-01
High voltage distributions on the inner surfaces of RPCs electrodes were calculated by using a two-dimensional resistor network model. The calculated result shows that the surface resistivity of the electrodes should be high, compared to their volume resistivity, to get a uniform high voltage over the surface. Our model predicts that the rate capabilities of RPCs should be inversely proportional to the thickness of the electrodes if the ratio of surface-to-volume resistivity is low. (orig.)
Directory of Open Access Journals (Sweden)
Sanjeevikumar Padmanaban
2017-01-01
Full Text Available Classical DC-DC converters used in high voltage direct current (HVDC power transmission systems, lack in terms of efficiency, reduced transfer gain and increased cost with sensor (voltage/current numbers. Besides, the internal self-parasitic behavior of the power components reduces the output voltage and efficiency of classical HV converters. This paper deals with extra high-voltage (EHV dc-dc boost converter by the application of voltage-lift technique to overcome the aforementioned deficiencies. The control strategy is based on classical proportional-integral (P-I and fuzzy logic closed-loop controller to get high and stable output voltage. Complete hardware prototype of EHV is implemented and experimental tasks are carried out with digital signal processor (DSP TMS320F2812. The control algorithms P-I, fuzzy logic and the pulse-width modulation (PWM signals for N-channel MOSFET device are performed by the DSP. The experimental results provided show good conformity with developed hypothetical predictions. Additionally, the presented study confirms that the fuzzy logic controller provides better performance than classical P-I controller under different perturbation conditions.
International Nuclear Information System (INIS)
Ehrler, F.; Blanco, R.; Leys, R.; Perić, I.
2016-01-01
High-voltage CMOS (HVCMOS) pixel sensors are depleted active pixel sensors implemented in standard commercial CMOS processes. The sensor element is the n-well/p-substrate diode. The sensor electronics are entirely placed inside the n-well which is at the same time used as the charge collection electrode. High voltage is used to deplete the part of the substrate around the n-well. HVCMOS sensors allow implementation of complex in-pixel electronics. This, together with fast signal collection, allows a good time resolution, which is required for particle tracking in high energy physics. HVCMOS sensors will be used in Mu3e experiment at PSI and are considered as an option for both ATLAS and CLIC (CERN). Radiation tolerance and time walk compensation have been tested and results are presented. - Highlights: • High-voltage CMOS sensors will be used in Mu3e experiment at PSI (Switzerland). • HVCMOS sensors are considered as an option for ATLAS (LHC/CERN) and CLIC (CERN). • Efficiency of more than 95% (99%) has been measured with (un-)irradiated chips. • The time resolution measured in the beam tests is nearly 100 ns. • We plan to improve time resolution and efficiency by using high-resistive substrate.
Energy Technology Data Exchange (ETDEWEB)
Ehrler, F., E-mail: felix.ehrler@student.kit.edu; Blanco, R.; Leys, R.; Perić, I.
2016-07-11
High-voltage CMOS (HVCMOS) pixel sensors are depleted active pixel sensors implemented in standard commercial CMOS processes. The sensor element is the n-well/p-substrate diode. The sensor electronics are entirely placed inside the n-well which is at the same time used as the charge collection electrode. High voltage is used to deplete the part of the substrate around the n-well. HVCMOS sensors allow implementation of complex in-pixel electronics. This, together with fast signal collection, allows a good time resolution, which is required for particle tracking in high energy physics. HVCMOS sensors will be used in Mu3e experiment at PSI and are considered as an option for both ATLAS and CLIC (CERN). Radiation tolerance and time walk compensation have been tested and results are presented. - Highlights: • High-voltage CMOS sensors will be used in Mu3e experiment at PSI (Switzerland). • HVCMOS sensors are considered as an option for ATLAS (LHC/CERN) and CLIC (CERN). • Efficiency of more than 95% (99%) has been measured with (un-)irradiated chips. • The time resolution measured in the beam tests is nearly 100 ns. • We plan to improve time resolution and efficiency by using high-resistive substrate.
Development of an environmental high-voltage electron microscope for reaction science.
Tanaka, Nobuo; Usukura, Jiro; Kusunoki, Michiko; Saito, Yahachi; Sasaki, Katuhiro; Tanji, Takayoshi; Muto, Shunsuke; Arai, Shigeo
2013-02-01
Environmental transmission electron microscopy and ultra-high resolution electron microscopic observation using aberration correctors have recently emerged as topics of great interest. The former method is an extension of the so-called in situ electron microscopy that has been performed since the 1970s. Current research in this area has been focusing on dynamic observation with atomic resolution under gaseous atmospheres and in liquids. Since 2007, Nagoya University has been developing a new 1-MV high voltage (scanning) transmission electron microscope that can be used to observe nanomaterials under conditions that include the presence of gases, liquids and illuminating lights, and it can be also used to perform mechanical operations to nanometre-sized areas as well as electron tomography and elemental analysis by electron energy loss spectroscopy. The new instrument has been used to image and analyse various types of samples including biological ones.
Outline of new extra high voltage research equipment at Kumatori research laboratories
Energy Technology Data Exchange (ETDEWEB)
Hohki, S; Ikeda, G
1965-01-01
Following up the construction in 1939 of an ehv research laboratory, another new research laboratory was established at Kumatori with a ground area of 142,000 square meters. As the first stage of this construction plan, the new research equipment was installed in November 1963 and began operation. The laboratory consists of comprehensive ehv research equipment and facilities relating to atomic energy. The former includes a 6000-kV impulse voltage generator, a 1650-kV alternating current testing transformer, a 300-m overhead transmission test line, a tower strength testing facility, and other various high-power test facilities. Studies on a 400- to 500-kV overhead power transmission system and other new transmission systems are currently being conducted. The details of the construction of the ehv research equipment together with the research policy for future ehv engineering are given.
A High-Voltage Level Tolerant Transistor Circuit
Annema, Anne J.; Geelen, Godefridus Johannes Gertrudis Maria
2001-01-01
A high-voltage level tolerant transistor circuit, comprising a plurality of cascoded transistors, including a first transistor (T1) operatively connected to a high-voltage level node (3) and a second transistor (T2) operatively connected to a low-voltage level node (2). The first transistor (T1)
Advances in high voltage power switching with GTOs
International Nuclear Information System (INIS)
Podlesak, T.F.
1990-01-01
The control of high voltage at high power, particularly opening switches, has been difficult in the past. Using gate turnoff thyristors (GTOs) arranged in series enables large currents to be switched at high voltage. The authors report a high voltage opening switch has been successfully demonstrated. This switch uses GTOs in series and successfully operates at voltages higher than the rated voltage of the individual devices. It is believed that this is the first time this has been successfully demonstrated, in that GTOs have been operated in series before, but always in a manner as to not exceed the voltage capability of the individual devices. In short, the devices have not worked together, sharing the voltage, but one device has been operated using several backup devices. Of particular interest is how well the individual devices share the voltage applied to them. Equal voltage sharing between devices is absolutely essential, in order to not exceed the voltage rating of any of the devices in the series chain. This is accomplished at high (microsecond) switching speeds. Thus, the system is useful for high frequency applications as well as high power, making for a flexible circuit system element. This demonstration system is rated at 5 KV and uses 1 KV devices. A larger 24 KV system is under design and will use 4.5 KV devices. In order to design the 24 KV switch, the safe operating area of the large devices must be known thoroughly
High voltage direct current transmission converters, systems and DC grids
Jovcic, Dragan
2015-01-01
This comprehensive reference guides the reader through all HVDC technologies, including LCC (Line Commutated Converter), 2-level VSC and VSC HVDC based on modular multilevel converters (MMC) for an in-depth understanding of converters, system level design, operating principles and modeling. Written in a tutorial style, the book also describes the key principles of design, control, protection and operation of DC transmission grids, which will be substantially different from the practice with AC transmission grids. The first dedicated reference to the latest HVDC technologies and DC grid developments; this is an essential resource for graduate students and researchers as well as engineers and professionals working on the design, modeling and operation of DC grids and HVDC.
International Nuclear Information System (INIS)
Onufriyev, Valery V.
2001-01-01
It is well known that the rise of arc from the dense glow discharge is connected with the thermion and secondary processes on the cathode surface (Granovsky, 1971; Leob, 1953; Engel, 1935). First model of breakdown of the cathode layer is connected with the increase of the cathode temperature in consequence of the ion bombardment that leads to the grows its thermo-emissive current. Other model shows the main role of the secondary effects on the cathode surface-the increase of the secondary ion emission coefficient--γ i with the grows of glow discharge voltage. But the author of this investigation work of breakdown in Cs vapor (a transmission the glow discharge into self-maintaining arc discharge) discovered the next peculiarity: the value of breakdown voltage is constant when the values of vapor temperature (its pressure p cs ) and cathode temperature T k is constant too (U b =constant with T k =constant and p cs =constant) and it is not a statistical value (Onufryev, Grishin, 1996) (that was observed in gas glow discharges other authors (Granovsky, 1971; Leob, 1953; Engel, 1935)). The investigations of thermion high voltage high temperature diode (its breakdown characteristics in closed state and voltage-current characteristics in disclosed state) showed that the value of the breakdown voltage is depended on the vapor pressure in inter-electrode gap (IEG)-p cs and cathode temperature-T k and is independent on IEG length--Δ ieg . On this base it was settled that the main role in transition of glow discharge to self-maintaining arc discharge plays an ion cathode layer but more exactly--the region of excited atoms--''Aston glow.''
Onufriyev, Valery. V.
2001-02-01
It is well known that the rise of arc from the dense glow discharge is connected with the thermion and secondary processes on the cathode surface (Granovsky, 1971; Leob, 1953; Engel, 1935). First model of breakdown of the cathode layer is connected with the increase of the cathode temperature in consequence of the ion bombardment that leads to the grows its thermo-emissive current. Other model shows the main role of the secondary effects on the cathode surface-the increase of the secondary ion emission coefficient-γi with the grows of glow discharge voltage. But the author of this investigation work of breakdown in Cs vapor (a transmission the glow discharge into self-maintaining arc discharge) discovered the next peculiarity: the value of breakdown voltage is constant when the values of vapor temperature (its pressure pcs) and cathode temperature Tk is constant too (Ub=constant with Tk=constant and pcs=constant) and it is not a statistical value (Onufryev, Grishin, 1996) (that was observed in gas glow discharges other authors (Granovsky, 1971; Leob, 1953; Engel, 1935)). The investigations of thermion high voltage high temperature diode (its breakdown characteristics in closed state and voltage-current characteristics in disclosed state) showed that the value of the breakdown voltage is depended on the vapor pressure in inter-electrode gap (IEG)-pcs and cathode temperature-Tk and is independent on IEG length-Δieg. On this base it was settled that the main role in transition of glow discharge to self-maintaining arc discharge plays an ion cathode layer but more exactly-the region of excited atoms-``Aston glow.'' .
New trends in the development of high voltage technology
Energy Technology Data Exchange (ETDEWEB)
Aleksandrov, G N
1964-07-01
The question is raised as to what type of transmission should be developed to transfer power over long distances from the eastern to the western part of Russia, and what principles should be utilized to combine power transmission into single power system in the USSR. Aleksandrov indicates the need for higher voltage power transmission, and stresses that ac is more economical than dc. The author compares +-750 kV dc with 1000 kV ac. The economic comparison is conducted for the same level of insulation, and it is stated that it will result in the same amount of power transmitted. New insulation materials are mentioned, and wider use of fiberglass and other plastics is predicted.
75 FR 63826 - Transmission Infrastructure Program-TransWest Express Transmission Project Capacity
2010-10-18
... Administration (Western), a Federal power marketing administration of the United States Department of Energy (DOE... operates an integrated 17,000 circuit mile, high-voltage transmission system across 15 western states... transmission lines and related facilities with at least one terminus in Western's marketing area, that deliver...
Coiled transmission line pulse generators
McDonald, Kenneth Fox
2010-11-09
Methods and apparatus are provided for fabricating and constructing solid dielectric "Coiled Transmission Line" pulse generators in radial or axial coiled geometries. The pour and cure fabrication process enables a wide variety of geometries and form factors. The volume between the conductors is filled with liquid blends of monomers, polymers, oligomers, and/or cross-linkers and dielectric powders; and then cured to form high field strength and high dielectric constant solid dielectric transmission lines that intrinsically produce ideal rectangular high voltage pulses when charged and switched into matched impedance loads. Voltage levels may be increased by Marx and/or Blumlein principles incorporating spark gap or, preferentially, solid state switches (such as optically triggered thyristors) which produce reliable, high repetition rate operation. Moreover, these Marxed pulse generators can be DC charged and do not require additional pulse forming circuitry, pulse forming lines, transformers, or an a high voltage spark gap output switch. The apparatus accommodates a wide range of voltages, impedances, pulse durations, pulse repetition rates, and duty cycles. The resulting mobile or flight platform friendly cylindrical geometric configuration is much more compact, light-weight, and robust than conventional linear geometries, or pulse generators constructed from conventional components. Installing additional circuitry may accommodate optional pulse shape improvements. The Coiled Transmission Lines can also be connected in parallel to decrease the impedance, or in series to increase the pulse length.
Parallel plate transmission line transformer
Voeten, S.J.; Brussaard, G.J.H.; Pemen, A.J.M.
2011-01-01
A Transmission Line Transformer (TLT) can be used to transform high-voltage nanosecond pulses. These transformers rely on the fact that the length of the pulse is shorter than the transmission lines used. This allows connecting the transmission lines in parallel at the input and in series at the
High Efficiency Power Converter for Low Voltage High Power Applications
DEFF Research Database (Denmark)
Nymand, Morten
The topic of this thesis is the design of high efficiency power electronic dc-to-dc converters for high-power, low-input-voltage to high-output-voltage applications. These converters are increasingly required for emerging sustainable energy systems such as fuel cell, battery or photo voltaic based......, and remote power generation for light towers, camper vans, boats, beacons, and buoys etc. A review of current state-of-the-art is presented. The best performing converters achieve moderately high peak efficiencies at high input voltage and medium power level. However, system dimensioning and cost are often...
A plasma switch synchronous closing operations in high-voltage networks
International Nuclear Information System (INIS)
Mourente, P.
1984-01-01
Overvoltages and overcurrent arising in energizing or in fast reclosing operations are a concerning problem in high-voltage networks. Reduction of overvoltages and overcurrents is possible using the synchronous closing technique. Some attempts have been done to perform the synchronous closing with conventional circuit-breakers. But since the requirements to synchronous closing and to current interruption are very contradictory this technique is not yet a common practice. Three simple cases may be used as examples to show the benefits of synchronous closing; energizaton of grounded star capacitor bank; back-to-back switching of large capacitor banks; and fast reclosing on transmission lines
International Nuclear Information System (INIS)
Frick, G.; Osswald, F.; Heusch, B.
1996-01-01
Preliminary investigations showed clearly that, because of the discrete electrode structure of the Vivitron, important overvoltage leading to insulator damage can appear in case of a spark. The first high voltage tests showed damage connected with such events. This fact leads to a severe voltage limitation. This work describes, at first, studies made to understand the effects of transients and the associated over-voltage appearing in the Vivitron. Then we present the high voltage tests made with full size Vivitron components using the CN 6 MV machine as a pilot machine. Extensive field calculations were made. These involve simulations of static stresses and transient overvoltages, on insulating boards and electrodes. This work gave us the solutions for arrangements and modifications in the machine. After application, the Vivitron runs now without any sparks and damage at 20 MV. In the same manner, we tested column insulators of a new design and so we will find out how to get to higher voltages. Electric field calculation around the tie bars connecting the discrete electrodes together showed field enhancements when the voltages applied on the discrete electrodes are not equally distributed. This fact is one of the sources of discharges and voltage limitations. A scenario of a spark event is described and indications are given how to proceed towards higher voltages, in the 30 MV range. (orig.)
Electric transmission technology
International Nuclear Information System (INIS)
Shah, K.R.
1990-01-01
Electric transmission technology has matured and can transmit bulk power more reliably and economically than the technology 10 years ago.In 1882, Marcel Depres transmitted 15 kW electric power at 2 kV, using a constant direct current; present transmission voltages have risen to ± 600 kV direct current (DC) and 765 kV alternating current (AC), and it is now possible to transmit bulk electric power at voltages as high as ± 1000 kV DC and 1500 kV AC. Affordable computer systems are now available to optimize transmission reliably. New materials have reduced the bulk of insulation for lines and equipment. New conducting materials and configurations have reduced losses in transmission. Advances in line structures and conductor motion, understanding of flashover characteristics of insulators and air-gaps and electrical performance of lines have resulted in more compact urban transmission lines. (author). 15 refs., 7 tabs., 11 figs
Single-phased Fault Location on Transmission Lines Using Unsynchronized Voltages
Directory of Open Access Journals (Sweden)
ISTRATE, M.
2009-10-01
Full Text Available The increased accuracy into the fault's detection and location makes it easier for maintenance, this being the reason to develop new possibilities for a precise estimation of the fault location. In the field literature, many methods for fault location using voltages and currents measurements at one or both terminals of power grids' lines are presented. The double-end synchronized data algorithms are very precise, but the current transformers can limit the accuracy of these estimations. The paper presents an algorithm to estimate the location of the single-phased faults which uses only voltage measurements at both terminals of the transmission lines by eliminating the error due to current transformers and without introducing the restriction of perfect data synchronization. In such conditions, the algorithm can be used with the actual equipment of the most power grids, the installation of phasor measurement units with GPS system synchronized timer not being compulsory. Only the positive sequence of line parameters and sources are used, thus, eliminating the incertitude in zero sequence parameter estimation. The algorithm is tested using the results of EMTP-ATP simulations, after the validation of the ATP models on the basis of registered results in a real power grid.
A 600kV 15mA Cockcroft-Walton high-voltage power supply with high stability and low-ripple voltage
International Nuclear Information System (INIS)
Su Tongling; Zhang Yimin; Chen Shangwen; Liu Yantong; Lv Huiyi; Liu Jiangtao
2006-01-01
A Cockcroft-Walton high-voltage power supply with high stability and low-ripple voltage has been developed. This power supply has been operated in a ns pulse neutron generator. The maximum non-load voltage is 600kV while the working voltage and load current are 550kV and 15mA, respectively. The tested results indicate that when the power supply is operated at 300kV, 6.7mA and the input voltage varies +/-10%, the long-term stability of the output voltage is S=(0.300-1.006)x10 -3 . The ripple voltage is δU P-P =6.2V at 300kV, 6.8-8.3mA and the ratio of δU P-P to the output voltage V H is δU P-P /V H =2.1x10 -5
High voltage electricity installations a planning perspective
Jay, Stephen Andrew
2006-01-01
The presence of high voltage power lines has provoked widespread concern for many years. High Voltage Electricity Installations presents an in-depth study of policy surrounding the planning of high voltage installations, discussing the manner in which they are percieved by the public, and the associated environmental issues. An analysis of these concerns, along with the geographical, environmental and political influences that shape their expression, is presented. Investigates local planning policy in an area of the energy sector that is of highly topical environmental and public concern Cover
Proximity effects of high voltage electric power transmission lines on ...
African Journals Online (AJOL)
Yomi
2010-08-18
Aug 18, 2010 ... transmission lines on ornamental plant growth. Zeki Demir ... The effects of proximity to power-line on specific leaf area and seedling dbh were tested .... during vegetation season is about 72% and common wind blow.
Xu, Kaili
Wyoming is by far the largest coal producing state in the US, but local utilization is extremely low. As much as 92% of Wyoming's coal is shipped to the other states and is mainly consumed by their electricity producers. Coal accounts for more than 50% of the US electricity generation and is one of the least expensive energy sources. Wyoming could utilize its coal better by exporting electricity instead of exporting the coal only in its raw form. Natural gas is another important energy resource in Wyoming but local utilization is even lower. As a result of the development in coalbed methane fields, natural gas production in Wyoming is almost in pace with its coal production. In addition to constructing more new pipelines, new transmission lines should be considered as an alternative way of exporting this energy. Because of their enormous electricity market sizes and high electricity prices, California, Texas and Illinois are chosen to be the target markets for Wyoming's electricity. The proposed transmission schemes use High Voltage DC (HVDC) lines, which are suitable for long distance and cross-system power transmission. Technical and economic feasibilities are studied in details. The Wyoming-California scheme has a better return of investment than both the Wyoming-Texas and the Wyoming-Illinois schemes. A major drawback of HVDC transmission is the high level of harmonics generated by the converters. Elaborate filtering is required at both the AC and the DC sides. A novel pulse-multiplication method is proposed in the thesis to reduce the harmonics from the converter source. By introducing an averaging inductor, the proposed method uses less thyristors to achieve the same high-pulse operation as the existing series scheme. The reduction of thyristors makes the switching circuit more reliable and easier to control and maintain. Harmonic analysis shows that the harmonic level can be reduced to about one third of the original system. The proposed method is also
Atlas transmission line breakdown analysis
Nielsen, K E; Ballard, E O; Elizondo, J M; Gribble, R F; McCuistian, B T; Parsons, W M
1999-01-01
The Atlas facility will use 24 radially converging, vertically oriented and tapered, oil insulated, triplate transmission lines between the Marx generators and the central load region. Among the requirements of the transmission lines are low inductance and high reliability. The inter-conductor gap is nominally 2 cm and the lines taper from a height of 1.75 m at the Marx end to 0.32 m at the output end. The aluminum conductors, held together by 20 insulating spacers, are assembled and inserted as a unit into radial oil-filled steel tanks. The negative, high-voltage, center conductor is 2.54-cm thick and the outer ground conductors are 1.59-cm thick. All 24 triplate transmission lines connect to a transition section at near 1 m radius that couples the transmission lines to a disk/conical solid- dielectric-insulated power flow channel transmission line terminating at the load. Peak operating voltage on the lines can be as high as 240 kV with an effective stress time of 0.8 mu s. Testing of small sections of the ...
High Efficiency Power Converter for Low Voltage High Power Applications
DEFF Research Database (Denmark)
Nymand, Morten
The topic of this thesis is the design of high efficiency power electronic dc-to-dc converters for high-power, low-input-voltage to high-output-voltage applications. These converters are increasingly required for emerging sustainable energy systems such as fuel cell, battery or photo voltaic based...
High Voltage Seismic Generator
Bogacz, Adrian; Pala, Damian; Knafel, Marcin
2015-04-01
This contribution describes the preliminary result of annual cooperation of three student research groups from AGH UST in Krakow, Poland. The aim of this cooperation was to develop and construct a high voltage seismic wave generator. Constructed device uses a high-energy electrical discharge to generate seismic wave in ground. This type of device can be applied in several different methods of seismic measurement, but because of its limited power it is mainly dedicated for engineering geophysics. The source operates on a basic physical principles. The energy is stored in capacitor bank, which is charged by two stage low to high voltage converter. Stored energy is then released in very short time through high voltage thyristor in spark gap. The whole appliance is powered from li-ion battery and controlled by ATmega microcontroller. It is possible to construct larger and more powerful device. In this contribution the structure of device with technical specifications is resented. As a part of the investigation the prototype was built and series of experiments conducted. System parameter was measured, on this basis specification of elements for the final device were chosen. First stage of the project was successful. It was possible to efficiently generate seismic waves with constructed device. Then the field test was conducted. Spark gap wasplaced in shallowborehole(0.5 m) filled with salt water. Geophones were placed on the ground in straight line. The comparison of signal registered with hammer source and sparker source was made. The results of the test measurements are presented and discussed. Analysis of the collected data shows that characteristic of generated seismic signal is very promising, thus confirms possibility of practical application of the new high voltage generator. The biggest advantage of presented device after signal characteristics is its size which is 0.5 x 0.25 x 0.2 m and weight approximately 7 kg. This features with small li-ion battery makes
Voltage generators of high voltage high power accelerators
International Nuclear Information System (INIS)
Svinin, M.P.
1981-01-01
High voltage electron accelerators are widely used in modern radiation installations for industrial purposes. In the near future further increasing of their power may be effected, which enables to raise the efficiency of the radiation processes known and to master new power-consuming production in industry. Improvement of HV generators by increasing their power and efficiency is one of many scientific and engineering aspects the successful solution of which provides further development of these accelerators and their technical parameters. The subject is discussed in detail. (author)
Highly efficient solutions for smart and bulk power transmission of 'green energy'
Energy Technology Data Exchange (ETDEWEB)
Breuer, Wilfried; Retzmann, Dietmar; Uecker, Karl
2010-09-15
Environmental constraints, loss minimization and CO2 reduction will play an increasingly more important role in future. Security and sustainability of power supply as well as economic efficiency needs application of advanced technologies. Innovative solutions with HVDC (High Voltage Direct Current) and FACTS (Flexible AC Transmission Systems) have the potential to cope with these challenges. They provide the features which are necessary to avoid technical problems in power systems, they increase the transmission capacity and system stability very efficiently and help prevent cascading outages. Furthermore, they are essential for Grid Access of Renewable Energy Sources such as Hydro, Wind and Solar-Energy.
Facts and feelings: Framing effects in responses to uncertainties about high-voltage power lines
de Vries, G.; de Bruijn, J.A.
2017-01-01
To ensure power supply security, electricity transmission system operators (TSOs) have to upscale high-voltage overhead power lines. However, upscaling frequently meets opposition. Opposition can be caused by uncertainties about risks and benefits and might lead to costly delays (Linder, 1995; Wiedemann, Boerner,& Claus, 2016). To minimize opposition, TSOs and related public services need to respond to these uncertainties in a credible and convincing (effective) way. Effective risk commun...
Physicochemical assessment criteria for high-voltage pulse capacitors
Energy Technology Data Exchange (ETDEWEB)
Darian, L. A., E-mail: LDarian@rambler.ru; Lam, L. Kh. [National Research University, Moscow Power Engineering Institute (Russian Federation)
2016-12-15
In the paper, the applicability of decomposition products of internal insulation of high-voltage pulse capacitors is considered (aging is the reason for decomposition products of internal insulation). Decomposition products of internal insulation of high-voltage pulse capacitors can be used to evaluate their quality when in operation and in service. There have been three generations of markers of aging of insulation as in the case with power transformers. The area of applicability of markers of aging of insulation for power transformers has been studied and the area can be extended to high-voltage pulse capacitors. The research reveals that there is a correlation between the components and quantities of markers of aging of the first generation (gaseous decomposition products of insulation) dissolved in insulating liquid and the remaining life of high-voltage pulse capacitors. The application of markers of aging to evaluate the remaining service life of high-voltage pulse capacitor is a promising direction of research, because the design of high-voltage pulse capacitors keeps stability of markers of aging of insulation in high-voltage pulse capacitors. It is necessary to continue gathering statistical data concerning development of markers of aging of the first generation. One should also carry out research aimed at estimation of the remaining life of capacitors using markers of the second and the third generation.
Physicochemical assessment criteria for high-voltage pulse capacitors
International Nuclear Information System (INIS)
Darian, L. A.; Lam, L. Kh.
2016-01-01
In the paper, the applicability of decomposition products of internal insulation of high-voltage pulse capacitors is considered (aging is the reason for decomposition products of internal insulation). Decomposition products of internal insulation of high-voltage pulse capacitors can be used to evaluate their quality when in operation and in service. There have been three generations of markers of aging of insulation as in the case with power transformers. The area of applicability of markers of aging of insulation for power transformers has been studied and the area can be extended to high-voltage pulse capacitors. The research reveals that there is a correlation between the components and quantities of markers of aging of the first generation (gaseous decomposition products of insulation) dissolved in insulating liquid and the remaining life of high-voltage pulse capacitors. The application of markers of aging to evaluate the remaining service life of high-voltage pulse capacitor is a promising direction of research, because the design of high-voltage pulse capacitors keeps stability of markers of aging of insulation in high-voltage pulse capacitors. It is necessary to continue gathering statistical data concerning development of markers of aging of the first generation. One should also carry out research aimed at estimation of the remaining life of capacitors using markers of the second and the third generation.
Time isolation high-voltage impulse generator
International Nuclear Information System (INIS)
Chodorow, A.M.
1975-01-01
Lewis' high-voltage impulse generator is analyzed in greater detail, demonstrating that voltage between adjacent nodes can be equalized by proper selection of parasitic impedances. This permits improved TEM mode propagation to a matched load, with more faithful source waveform preservation
International Nuclear Information System (INIS)
Ghoudjehbaklou, H.; Danai, B.
2001-01-01
Reactive power dispatch for voltage profile modification has been of interest to power utilities. Usually local bus voltages can be altered by changing generator voltages, reactive shunts, ULTC transformers and SVCs. Determination of optimum values for control parameters, however, is not simple for modern power system networks. Heuristic and rather intelligent algorithms have to be sought. In this paper a new algorithm is proposed that is based on a variant of a genetic algorithm combined with simulated annealing updates. In this algorithm a fuzzy multi-objective a approach is used for the fitness function of the genetic algorithm. This fuzzy multi-objective function can efficiently modify the voltage profile in order to minimize transmission lines losses, thus reducing the operating costs. The reason for such a combination is to utilize the best characteristics of each method and overcome their deficiencies. The proposed algorithm is much faster than the classical genetic algorithm and cna be easily integrated into existing power utilities software. The proposed algorithm is tested on an actual system model of 1284 buses, 799 lines, 1175 fixed and ULTC transformers, 86 generators, 181 controllable shunts and 425 loads
Detecting Faults In High-Voltage Transformers
Blow, Raymond K.
1988-01-01
Simple fixture quickly shows whether high-voltage transformer has excessive voids in dielectric materials and whether high-voltage lead wires too close to transformer case. Fixture is "go/no-go" indicator; corona appears if transformer contains such faults. Nests in wire mesh supported by cap of clear epoxy. If transformer has defects, blue glow of corona appears in mesh and is seen through cap.
Nested high voltage generator/particle accelerator
International Nuclear Information System (INIS)
Adler, R.J.
1992-01-01
This patent describes a modular high voltage particle accelerator having an emission axis and an emission end, the accelerator. It comprises: a plurality of high voltage generators in nested adjacency to form a nested stack, each the generator comprising a cup-like housing having a base and a tubular sleeve extending from the base, a primary transformer winding encircling the nested stack; a secondary transformer winding between each adjacent pair of housings, magnetically linked to the primary transformer winding through the gaps; a power supply respective to each of the secondary windings converting alternating voltage from its respective secondary winding to d.c. voltage, the housings at the emission end forming a hollow throat for particle acceleration, a vacuum seal at the emission end of the throat which enables the throat to be evacuated; a particle source in the thrond power means to energize the primary transformer winding
Discussion - a high voltage DC generator
International Nuclear Information System (INIS)
Bhagwat, P.V.; Singh, Jagir; Hattangadi, V.A.
1993-01-01
One of the requirements for a high power ion source is a high voltage, high current DC generator. The high voltage, high current generator, DISCATRON, presently under development in our laboratory is a rotating disc type electrostatic generator similar in design to the one reported by A. Isoya et al. (1985). It is compact and rugged electrostatic DC generator based on the principle of induction charging by pellet chains used in the pelletron accelerator. It is, basically, a constant-current device with little stored energy, so that, in case of a breakdown, damage to the equipment connected to the output terminals is minimal. Since the present generator is only a proto-type, meant for a study of the practical difficulties that would be encountered in its manufacture, the output voltage and current specified has been kept quite modest viz., 300 kV at 500 μA, maximum. Some results of the preliminary tests carried out with this generator are described. (author). 4 figs
High voltage investigations for ITER coils
International Nuclear Information System (INIS)
Fink, S.; Fietz, W.H.
2006-01-01
The superconducting ITER magnets will be excited with high voltage during operation and fast discharge. Because the coils are complex systems the internal voltage distribution can differ to a large extent from the ideal linear voltage distribution. In case of fast excitations internal voltages between conductor and radial plate of a TF coil can be even higher than the terminal voltage of 3.5 kV to ground which appears during a fast discharge without a fault. Hence the determination of the transient voltage distribution is important for a proper insulation co-ordination and will provide a necessary basis for the verification of the individual insulation design and the choice of test voltages and waveforms. Especially the extent of internal overvoltages in case of failures, e. g. malfunction of discharge units and / or arcing is of special interest. Transient calculations for the ITER TF coil system have been performed for fast discharge and fault scenarios to define test voltages for ITER TF. The conductor and radial plate insulation of the ITER TF Model Coil were exposed at room temperature to test voltages derived from the results from these calculations. Breakdown appeared during the highest AC voltage step. A fault scenario for the TF fast discharge system is presented where one fault triggers a second fault, leading to considerable voltage stress. In addition a FEM model of Poloidal Field Coil 3 for the determination of the parameters of a detailed network model is presented in order to prepare detailed investigations of the transient voltage behaviour of the PF coils. (author)
Pulok, Md Kamrul Hasan
Intelligent and effective monitoring of power system stability in control centers is one of the key issues in smart grid technology to prevent unwanted power system blackouts. Voltage stability analysis is one of the most important requirements for control center operation in smart grid era. With the advent of Phasor Measurement Unit (PMU) or Synchrophasor technology, real time monitoring of voltage stability of power system is now a reality. This work utilizes real-time PMU data to derive a voltage stability index to monitor the voltage stability related contingency situation in power systems. The developed tool uses PMU data to calculate voltage stability index that indicates relative closeness of the instability by producing numerical indices. The IEEE 39 bus, New England power system was modeled and run on a Real-time Digital Simulator that stream PMU data over the Internet using IEEE C37.118 protocol. A Phasor data concentrator (PDC) is setup that receives streaming PMU data and stores them in Microsoft SQL database server. Then the developed voltage stability monitoring (VSM) tool retrieves phasor measurement data from SQL server, performs real-time state estimation of the whole network, calculate voltage stability index, perform real-time ranking of most vulnerable transmission lines, and finally shows all the results in a graphical user interface. All these actions are done in near real-time. Control centers can easily monitor the systems condition by using this tool and can take precautionary actions if needed.
International Nuclear Information System (INIS)
Volkov, M. S.; Gusev, Yu. P.; Monakov, Yu. V.; Cho, Gvan Chun
2016-01-01
The insertion of current-limiting reactors into electrical equipment operating at a voltage of 110 and 220 kV produces a change in the parameters of the transient recovery voltages at the contacts of the circuit breakers for disconnecting short circuits, which could be the reason for the increase in the duration of the short circuit, damage to the electrical equipment and losses in the power system. The results of mathematical modeling of the transients, caused by tripping of the short circuit in a reactive electric power transmission line are presented, and data are given on the negative effect of a current-limiting resistor on the rate of increase and peak value of the transient recovery voltages. Methods of ensuring the standard requirements imposed on the parameters of the transient recovery voltages when using current-limiting reactors in the high-voltage electrical equipment of power plants and substations are proposed and analyzed
High Voltage in Noble Liquids for High Energy Physics
Energy Technology Data Exchange (ETDEWEB)
Rebel, B. [Fermilab; Bernard, E. [Yale U.; Faham, C. H. [LBL, Berkeley; Ito, T. M. [Los Alamos; Lundberg, B. [Maryland U.; Messina, M. [Columbia U.; Monrabal, F. [Valencia U., IFIC; Pereverzev, S. P. [LLNL, Livermore; Resnati, F. [Zurich, ETH; Rowson, P. C. [SLAC; Soderberg, M. [Fermilab; Strauss, T. [Bern U.; Tomas, A. [Imperial Coll., London; Va' vra, J. [SLAC; Wang, H. [UCLA
2014-08-22
A workshop was held at Fermilab November 8-9, 2013 to discuss the challenges of using high voltage in noble liquids. The participants spanned the fields of neutrino, dark matter, and electric dipole moment physics. All presentations at the workshop were made in plenary sessions. This document summarizes the experiences and lessons learned from experiments in these fields at developing high voltage systems in noble liquids.
Shimer, Daniel W.; Lange, Arnold C.
1995-01-01
A high-power power supply produces a controllable, constant high voltage output under varying and arcing loads. The power supply includes a voltage regulator, an inductor, an inverter for producing a high frequency square wave current of alternating polarity, an improved inverter voltage clamping circuit, a step up transformer, an output rectifier for producing a dc voltage at the output of each module, and a current sensor for sensing output current. The power supply also provides dynamic response to varying loads by controlling the voltage regulator duty cycle and circuitry is provided for sensing incipient arc currents at the output of the power supply to simultaneously decouple the power supply circuitry from the arcing load. The power supply includes a plurality of discrete switching type dc--dc converter modules.
Shimer, D.W.; Lange, A.C.
1995-05-23
A high-power power supply produces a controllable, constant high voltage output under varying and arcing loads. The power supply includes a voltage regulator, an inductor, an inverter for producing a high frequency square wave current of alternating polarity, an improved inverter voltage clamping circuit, a step up transformer, an output rectifier for producing a dc voltage at the output of each module, and a current sensor for sensing output current. The power supply also provides dynamic response to varying loads by controlling the voltage regulator duty cycle and circuitry is provided for sensing incipient arc currents at the output of the power supply to simultaneously decouple the power supply circuitry from the arcing load. The power supply includes a plurality of discrete switching type dc--dc converter modules. 5 Figs.
High voltage pulse generator. [Patent application
Fasching, G.E.
1975-06-12
An improved high-voltage pulse generator is described which is especially useful in ultrasonic testing of rock core samples. An N number of capacitors are charged in parallel to V volts and at the proper instance are coupled in series to produce a high-voltage pulse of N times V volts. Rapid switching of the capacitors from the paralleled charging configuration to the series discharging configuration is accomplished by using silicon-controlled rectifiers which are chain self-triggered following the initial triggering of the first rectifier connected between the first and second capacitors. A timing and triggering circuit is provided to properly synchronize triggering pulses to the first SCR at a time when the charging voltage is not being applied to the parallel-connected charging capacitors. The output voltage can be readily increased by adding additional charging networks. The circuit allows the peak level of the output to be easily varied over a wide range by using a variable autotransformer in the charging circuit.
OPC Server and BridgeView Application for High Voltage Power Supply Lecroy 1458
Swoboda, D; CERN. Geneva
2000-01-01
Abstract The aim of this project was to develop an OPC server to communicate over an RS232 serial line. This communication media is commonly used with commercial instruments. The development was made for a High Voltage power supply in the context of the Alice [1] experiment. In addition, the structured modular concept will allow changing the transmission media or power supply type with little effort. The high voltage power supply should be accessible remotely through a network. OPC[2] is an acronym for OLE[3] for Process Control. OPC is based on the DCOM [3] communication protocol, which allows communication with any computer running a Windows based OS. This standard is widely used in industry to access device data through Windows applications. The concept is based on the client-server architecture. The hardware and the software architecture are described. Subsequently details of the implemented programs are given with emphasis on the possibility to replace parts of the software in order to use differ...
Electric field analysis of extra high voltage (EHV) underground cables using finite element method
DEFF Research Database (Denmark)
Kumar, Mantosh; Bhaskar, Mahajan Sagar; Padmanaban, Sanjeevikumar
2017-01-01
used for the insulator due electrical, thermal or environmental stress. Most of these problems are related to the electric field stress on the insulation of the underground cables. The objective of the electric field analysis by using different numerical techniques is to find electric field stress...... electric field stress and other parameters of EHV underground cables with given boundary conditions using 2-D electric field analysis software package (IES-ELECTRO module) which is based on the finite element method (FEM).......Transmission and Distribution of electric power through underground cables is a viable alternative to overhead lines, particularly in residential or highly populated areas. The electrical stresses are consequences of regular voltages and over voltages and the thermal stresses are related to heat...
76 FR 72203 - Voltage Coordination on High Voltage Grids; Notice of Reliability Workshop Agenda
2011-11-22
... DEPARTMENT OF ENERGY Federal Energy Regulatory Commission [Docket No. AD12-5-000] Voltage Coordination on High Voltage Grids; Notice of Reliability Workshop Agenda As announced in the Notice of Staff..., from 9 a.m. to 4:30 p.m. to explore the interaction between voltage control, reliability, and economic...
High Voltage Homemade Capacitor Charger for Plasma Focus System
International Nuclear Information System (INIS)
Abdul Halim Baijan; Azaman Ahmad; Rokiah Mohd Sabri; Siti Aiasah Hashim; Mohd Rizal Md Chulan; Wah, L.K.; Azhar Ahmad; Rosli Che Ros; Mohd Faiz Mohd Zin
2015-01-01
A high voltage capacitor charger has been designed and built to replace a high voltage charger type General Atomics CCDs Power Supply which was damaged. The fabrication design was using materials which were easily available in the local market. Among the main components of the high-voltage charger is a transformer for neon lights, variable transformer rated 0 - 240 V 1 KVA, and 240 V transformer isolator. The results of experiments that have been conducted shows that a homemade capacitor charger was able to charge high voltage capacitors up to the required voltage of which was 12 kV. However the time taken for charging is quite long, up to more than 6 minutes. (author)
30 CFR 77.704-1 - Work on high-voltage lines.
2010-07-01
... 30 Mineral Resources 1 2010-07-01 2010-07-01 false Work on high-voltage lines. 77.704-1 Section 77... MINES Grounding § 77.704-1 Work on high-voltage lines. (a) No high-voltage line shall be regarded as... provided in § 77.103) that such high-voltage line has been deenergized and grounded. Such qualified person...
Directory of Open Access Journals (Sweden)
Chih-Lung Shen
2016-10-01
Full Text Available This paper presents a novel interleaved converter (NIC with extra-high voltage gain to process the power of low-voltage renewable-energy generators such as photovoltaic (PV panel, wind turbine, and fuel cells. The NIC can boost a low input voltage to a much higher voltage level to inject renewable energy to DC bus for grid applications. Since the NIC has two circuit branches in parallel at frond end to share input current, it is suitable for high power applications. In addition, the NIC is controlled in an interleaving pattern, which has the advantages that the NIC has lower input current ripple, and the frequency of the ripple is twice the switching frequency. Two coupled inductors and two switched capacitors are incorporated to achieve a much higher voltage gain than conventional high step-up converters. The proposed NIC has intrinsic features such as leakage energy totally recycling and low voltage stress on power semiconductor. Thorough theoretical analysis and key parameter design are presented in this paper. A prototype is built for practical measurements to validate the proposed NIC.
2011-12-21
...-circuit, high-voltage direct current (HVDC) transmission line that would collect power generated by wind...-voltage alternating current into HVDC using voltage sourced converters. Each offshore converter platform... transmission grid at up to seven locations where AWC terrestrial converter stations would convert the HVDC...
International Nuclear Information System (INIS)
Ubisch, H. von.
1980-06-01
The power-transmission lines utilizing system voltages of 800 kV, are justified by the long distances of transmission. The lines interfere in the landscape and may also affect human beings. The voltage is put in relation to alternative ways of energy transmission and thereafter to lower voltages and other electrical phenomena which have similar biological effects in the society. Possible causal connections are examined and available protective measures are pointed out. The general picture will simplify the appraisement of the biological observations and the relevance and validity of the postulates of environmental damage. The position taken to the question by all parties will thus be facilitated. (GB)
Complete low power controller for high voltage power systems
International Nuclear Information System (INIS)
Sumner, R.; Blanar, G.
1997-01-01
The MHV100 is a custom CMOS integrated circuit, developed for the AMS experiment. It provides complete control for a single channel high voltage (HV) generator and integrates all the required digital communications, D to A and A to D converters, the analog feedback loop and output drivers. This chip has been designed for use in both distributed high voltage systems or for low cost single channel high voltage systems. The output voltage and current range is determined by the external components
Energy Technology Data Exchange (ETDEWEB)
Christodoulou, C.A.; Fotis, G.P.; Gonos, I.F.; Stathopulos, I.A. [National Technical University of Athens, School of Electrical and Computer Engineering, High Voltage Laboratory, 9 Iroon Politechniou St., Zografou Campus, 157 80 Athens (Greece); Ekonomou, L. [A.S.PE.T.E. - School of Pedagogical and Technological Education, Department of Electrical Engineering Educators, N. Heraklion, 141 21 Athens (Greece)
2010-02-15
The use of transmission line surge arresters to improve the lightning performance of transmission lines is becoming more common. Especially in areas with high soil resistivity and ground flash density, surge arresters constitute the most effective protection mean. In this paper a methodology for assessing the surge arrester failure rate based on the electrogeometrical model is presented. Critical currents that exceed arresters rated energy stress were estimated by the use of a simulation tool. The methodology is applied on operating Hellenic transmission lines of 150 kV. Several case studies are analyzed by installing surge arresters on different intervals, in relation to the region's tower footing resistance and the ground flash density. The obtained results are compared with real records of outage rate showing the effectiveness of the surge arresters in the reduction of the recorded failure rate. The presented methodology can be proved valuable to the studies of electric power systems designers intending in a more effective lightning protection, reducing the operational costs and providing continuity of service. (author)
PC-based control of a high-voltage injector
International Nuclear Information System (INIS)
Constantin, F.
1998-01-01
The stability of high voltage injectors is one of the major problems in any accelerator system. Most of the troubles encountered in the normal operation of an accelerator are connected with the ion source and associated high voltage platforms, regardless of the source or high voltage generator type. The quality of the ion beam injected in the accelerator strongly depends on the power supplies used in the injector and on the ability to control the non-electrical parameters (gas-flow, temperature, etc.). A wide used method in controlling is based on optical links between high-voltage platform and computer, the adjustments being more or less automated. Although the method mentioned above can be still useful in injector control, a different approach is presented in this work, i.e., the computer itself is placed inside the high-voltage terminal. Only one optical link is still necessary to connect this computer with an user-friendly host at ground potential. Requirements: - varying and monitoring the filament current; - gas flow control in the ion source; - reading the vacuum values; - current and voltage control for the anodic, magnet, extraction, suppression and lens' sources. Even in the high voltage terminal there are compartments with different voltages regardless the floating ground. In our injector the extraction voltage is applied on the top of the ion source including the filament and the anodic voltage. The extraction voltage is of maximum 30 kV. In this situation a second optical link is required to transfer the control for the anodic and magnet source power supply assuming the dedicated computer on the floating ground. One PC is placed inside the high voltage terminal and one PC outside the injector. The optical link (more precisely two optical wires) connects the serial ports. The inside computer is equipped with two multipurpose ADC/DAC and digital I/O card. They permit to read or output DC levels ranging between 0 to 10 volts or TTL signals. The filament
High voltage generator circuit with low power and high efficiency applied in EEPROM
International Nuclear Information System (INIS)
Liu Yan; Zhang Shilin; Zhao Yiqiang
2012-01-01
This paper presents a low power and high efficiency high voltage generator circuit embedded in electrically erasable programmable read-only memory (EEPROM). The low power is minimized by a capacitance divider circuit and a regulator circuit using the controlling clock switch technique. The high efficiency is dependent on the zero threshold voltage (V th ) MOSFET and the charge transfer switch (CTS) charge pump. The proposed high voltage generator circuit has been implemented in a 0.35 μm EEPROM CMOS process. Measured results show that the proposed high voltage generator circuit has a low power consumption of about 150.48 μW and a higher pumping efficiency (83.3%) than previously reported circuits. This high voltage generator circuit can also be widely used in low-power flash devices due to its high efficiency and low power dissipation. (semiconductor integrated circuits)
Energy Technology Data Exchange (ETDEWEB)
Savic, M.S.
1986-07-01
The switching off and on of small capacitive currents charging busbar capacitances, connection conductors and open circuit breakers with disconnectors causes high-frequency transients in high-voltage networks. In low voltage circuits, these transient processes induce dangerous overvoltages for the electronic equipment in the substation. A modified construction of the disconnector with a damping resistor was investigated. Digital simulation of the transient process in a high-voltage network during the arcing period between the disconnector contacts with and without damping resistor were performed. A significant decrease of the arcing duration and the decrease of the electromagnetic field magnitude in the vicinity of the operating disconnector were noticed. In the low voltage circuit protected with the surge arrester, the overvoltage magnitude was not affected by the damping resistor due to the arrester protection effect.
Experimental validation of prototype high voltage bushing
Shah, Sejal; Tyagi, H.; Sharma, D.; Parmar, D.; M. N., Vishnudev; Joshi, K.; Patel, K.; Yadav, A.; Patel, R.; Bandyopadhyay, M.; Rotti, C.; Chakraborty, A.
2017-08-01
Prototype High voltage bushing (PHVB) is a scaled down configuration of DNB High Voltage Bushing (HVB) of ITER. It is designed for operation at 50 kV DC to ensure operational performance and thereby confirming the design configuration of DNB HVB. Two concentric insulators viz. Ceramic and Fiber reinforced polymer (FRP) rings are used as double layered vacuum boundary for 50 kV isolation between grounded and high voltage flanges. Stress shields are designed for smooth electric field distribution. During ceramic to Kovar brazing, spilling cannot be controlled which may lead to high localized electrostatic stress. To understand spilling phenomenon and precise stress calculation, quantitative analysis was performed using Scanning Electron Microscopy (SEM) of brazed sample and similar configuration modeled while performing the Finite Element (FE) analysis. FE analysis of PHVB is performed to find out electrical stresses on different areas of PHVB and are maintained similar to DNB HV Bushing. With this configuration, the experiment is performed considering ITER like vacuum and electrical parameters. Initial HV test is performed by temporary vacuum sealing arrangements using gaskets/O-rings at both ends in order to achieve desired vacuum and keep the system maintainable. During validation test, 50 kV voltage withstand is performed for one hour. Voltage withstand test for 60 kV DC (20% higher rated voltage) have also been performed without any breakdown. Successful operation of PHVB confirms the design of DNB HV Bushing. In this paper, configuration of PHVB with experimental validation data is presented.
Mueller, Ulf Philipp; Wienholt, Lukas; Kleinhans, David; Cussmann, Ilka; Bunke, Wolf-Dieter; Pleßmann, Guido; Wendiggensen, Jochen
2018-02-01
There are several power grid modelling approaches suitable for simulations in the field of power grid planning. The restrictive policies of grid operators, regulators and research institutes concerning their original data and models lead to an increased interest in open source approaches of grid models based on open data. By including all voltage levels between 60 kV (high voltage) and 380kV (extra high voltage), we dissolve the common distinction between transmission and distribution grid in energy system models and utilize a single, integrated model instead. An open data set for primarily Germany, which can be used for non-linear, linear and linear-optimal power flow methods, was developed. This data set consists of an electrically parameterised grid topology as well as allocated generation and demand characteristics for present and future scenarios at high spatial and temporal resolution. The usability of the grid model was demonstrated by the performance of exemplary power flow optimizations. Based on a marginal cost driven power plant dispatch, being subject to grid restrictions, congested power lines were identified. Continuous validation of the model is nescessary in order to reliably model storage and grid expansion in progressing research.
30 CFR 75.811 - High-voltage underground equipment; grounding.
2010-07-01
...-voltage equipment supplying power to such equipment receiving power from resistance grounded systems shall... 30 Mineral Resources 1 2010-07-01 2010-07-01 false High-voltage underground equipment; grounding... COAL MINE SAFETY AND HEALTH MANDATORY SAFETY STANDARDS-UNDERGROUND COAL MINES Underground High-Voltage...
Directory of Open Access Journals (Sweden)
Fuangpian Phanupong
2016-01-01
Full Text Available Nowadays, using of High Voltage Direct Current (HVDC transmission to maximize the transmission efficiency, bulk power transmission, connection of renewable power source from wind farm to the grid is of prime concern for the utility. However, due to the high electric field stress from Direct Current (DC line, the corona discharge can easily be occurred at the conductor surface leading to transmission loss. Therefore, the polarity effect of DC lines on corona inception and breakdown voltage should be investigated. In this work, the effect of DC polarity and Alternating Current (AC field stress on corona inception voltage and corona discharge is investigated on various test objects, such as High Voltage (HV needle, needle at ground plane, internal defect, surface discharge, underground cable without cable termination, cable termination with simulated defect and bare overhead conductor. The corona discharge is measured by partial discharge measurement device with high-frequency current transformer. Finally, the relationship between supply voltage and discharge intensity on each DC polarity and AC field stress can be successfully determined.
High-voltage nanosecond pulse shaper
International Nuclear Information System (INIS)
Kapishnikov, N.K.; Muratov, V.M.; Shatanov, A.A.
1987-01-01
A high-voltage pulse shaper with an output of up to 250 kV, a base duration of ∼ 10 nsec, and a repetition frequency of 50 pulses/sec is described. The described high-voltage nanosecond pulse shaper is designed for one-orbit extraction of an electron beam from a betatron. A diagram of the pulse shaper, which employs a single-stage generator is shown. The shaping element is a low-inductance capacitor bank of series-parallel KVI-3 (2200 pF at 10 kV) or K15-10 (4700 pF at 31.5 kV) disk ceramic capacitors. Four capacitors are connected in parallel and up to 25 are connected in series
High voltage performance of BARC-TIFR Pelletron Accelerator
Energy Technology Data Exchange (ETDEWEB)
Surendran, P.; Ansari, Q.N.; Nair, J.P., E-mail: surendra@tifr.res.in [Nuclear Physics Division, Bhabha Atomic Research Centre, Mumbai (India); and others
2014-07-01
The 14 UD Pelletron Accelerator at TIFR, Mumbai is operational since its inception in 1988. It was decided to impart enough time for high voltage conditioning to achieve higher operational voltage. Prior to this, comprehensive works such as replacing all the sputter ion pumps and Titanium sublimation pumps across the accelerator tube with new or refurbished ones and replacement of Alumina balls in the SF{sub 6} drier with fresh balls were carried out. High voltage conditioning of each module was done. Further conditioning of two modules at a time in overlapping mode improved the terminal voltage. As a result of this rigorous conditioning Terminal voltage of 12.6 MV was achieved and beam has been delivered to users at 12 MV terminal. Details of this effort will be presented in this paper. (author)
High voltage performance of BARC-TIFR Pelletron Accelerator
International Nuclear Information System (INIS)
Surendran, P.; Ansari, Q.N.; Nair, J.P.
2014-01-01
The 14 UD Pelletron Accelerator at TIFR, Mumbai is operational since its inception in 1988. It was decided to impart enough time for high voltage conditioning to achieve higher operational voltage. Prior to this, comprehensive works such as replacing all the sputter ion pumps and Titanium sublimation pumps across the accelerator tube with new or refurbished ones and replacement of Alumina balls in the SF_6 drier with fresh balls were carried out. High voltage conditioning of each module was done. Further conditioning of two modules at a time in overlapping mode improved the terminal voltage. As a result of this rigorous conditioning Terminal voltage of 12.6 MV was achieved and beam has been delivered to users at 12 MV terminal. Details of this effort will be presented in this paper. (author)
PV source based high voltage gain current fed converter
Saha, Soumya; Poddar, Sahityika; Chimonyo, Kudzai B.; Arunkumar, G.; Elangovan, D.
2017-11-01
This work involves designing and simulation of a PV source based high voltage gain, current fed converter. It deals with an isolated DC-DC converter which utilizes boost converter topology. The proposed converter is capable of high voltage gain and above all have very high efficiency levels as proved by the simulation results. The project intends to produce an output of 800 V dc from a 48 V dc input. The simulation results obtained from PSIM application interface were used to analyze the performance of the proposed converter. Transformer used in the circuit steps up the voltage as well as to provide electrical isolation between the low voltage and high voltage side. Since the converter involves high switching frequency of 100 kHz, ultrafast recovery diodes are employed in the circuitry. The major application of the project is for future modeling of solar powered electric hybrid cars.
Study on Communication Methods for Electric Power High-voltage Equipment Monitoring System
Directory of Open Access Journals (Sweden)
Jia Yu Chen
2018-02-01
Full Text Available Real-time monitoring of high-voltage equipment in substations is beneficial for early detection of faults. The use of wireless sensor networks to build monitoring system is an effective way, but the data collection is a difficult task. The author introduces a real-time monitoring system based on ZIGBEE and mobile communication technology. The system includes multiple monitoring points and terminal platforms. Each monitoring point consists of a number of sensor nodes to form a ZIGBEE network, detecting relevant parameters, coordinator node data collected one by one, known as linear transmission, and finally to the monitoring platform through the mobile communication network. This paper presents a fusion algorithm for monitoring cell data acquisition to reduce the amount of data uploaded to the base station. In addition, multi-hop routing algorithm based on opportunistic routing is proposed to balance network energy and improve network transmission rate and efficiency.
30 CFR 77.804 - High-voltage trailing cables; minimum design requirements.
2010-07-01
... OF UNDERGROUND COAL MINES Surface High-Voltage Distribution § 77.804 High-voltage trailing cables; minimum design requirements. (a) High-voltage trailing cables used in resistance grounded systems shall be... 30 Mineral Resources 1 2010-07-01 2010-07-01 false High-voltage trailing cables; minimum design...
Highly efficient solutions for smart and bulk power transmission of 'green energy'
Energy Technology Data Exchange (ETDEWEB)
Breuer, Wilfried; Retzmann, Dietmar; Uecker, Karl
2010-09-15
Environmental constraints, loss minimization and CO2 reduction will play an increasingly more important role in future. Security and sustainability of power supply as well as economic efficiency needs application of advanced technologies. Innovative solutions with HVDC (High Voltage Direct Current) and FACTS (Flexible AC Transmission Systems) have the potential to cope with these challenges. They provide the features which are necessary to avoid technical problems in power systems, they increase the transmission capacity and system stability very efficiently and help prevent cascading outages. Furthermore, they are essential for Grid Access of Renewable Energy Sources such as Hydro, Wind and Solar-Energy.
High Voltage AC underground cable systems for power transmission
DEFF Research Database (Denmark)
Bak, Claus Leth; Silva, Filipe Miguel Faria da
2016-01-01
researching electrical engineering topics related to using underground cables for power transmission at EHV level and including the 420 kV level. The research topics were laid down by ET/AAU and Energinet.dk in the DANPAC (DANish Power systems with AC Cables) research project. The main topics are discussed...... on the basis of 39 references published by ET/AAU and Energinet.dk. Part I of the paper explains the events that lead to the research project, reactive power compensation, modelling for transient studies, including field measurements and improvements to the existing models, and temporary overvoltages due...... to resonances. Part II covers transient phenomena, harmonics in cables, system modelling for different phenomena, main and backup protections in cable-based networks, online fault detection and future trends....
High Voltage AC underground cable systems for power transmission
DEFF Research Database (Denmark)
Bak, Claus Leth; Silva, Filipe Miguel Faria da
2016-01-01
researching electrical engineering topics related to using underground cables for power transmission at EHV level and including the 420 kV level. The research topics were laid down by ET/AAU and Energinet.dk in the DANPAC (DANish Power systems with Ac Cables) research project. The main topics are discussed...... on the basis of 39 references published by ET/AAU and Energinet.dk. Part I of the paper explains the events that lead to the research project, reactive power compensation, modelling for transient studies, including field measurements and improvements to the existing models, and temporary overvoltages due...... to resonances. Part II covers transient phenomena, harmonics in cables, system modelling for different phenomena, main and backup protections in cable-based networks, online fault detection and future trends....
Tesla’s high voltage and high frequency generators with oscillatory circuits
Directory of Open Access Journals (Sweden)
Cvetić Jovan M.
2016-01-01
Full Text Available The principles that represent the basics of the work of the high voltage and high frequency generator with oscillating circuits will be discussed. Until 1891, Tesla made and used mechanical generators with a large number of extruded poles for the frequencies up to about 20 kHz. The first electric generators based on a new principle of a weakly coupled oscillatory circuits he used for the wireless signal transmission, for the study of the discharges in vacuum tubes, the wireless energy transmission, for the production of the cathode rays, that is x-rays and other experiments. Aiming to transfer the signals and the energy to any point of the surface of the Earth, in the late of 19th century, he had discovered and later patented a new type of high frequency generator called a magnifying transmitter. He used it to examine the propagation of electromagnetic waves over the surface of the Earth in experiments in Colorado Springs in the period 1899-1900. Tesla observed the formation of standing electromagnetic waves on the surface of the Earth by measuring radiated electric field from distant lightning thunderstorm. He got the idea to generate the similar radiation to produce the standing waves. On the one hand, signal transmission, i.e. communication at great distances would be possible and on the other hand, with more powerful and with at least three magnifying transmitters the wireless transmission of energy without conductors at any point of the Earth surface could also be achieved. The discovery of the standing waves on the surface of the Earth and the invention of the magnifying transmitter he claimed his greatest inventions. Less than two years later, at the end of 1901, he designed and started to build a much stronger magnifying transmitter on Long Island near New York City (the Wardenclyffe tower wishing to become a world telecommunication center. During the tower construction, he elaborated the plans for an even stronger transmitter based on
The high voltage homopolar generator
Price, J. H.; Gully, J. H.; Driga, M. D.
1986-11-01
System and component design features of proposed high voltage homopolar generator (HVHPG) are described. The system is to have an open circuit voltage of 500 V, a peak output current of 500 kA, 3.25 MJ of stored inertial energy and possess an average magnetic-flux density of 5 T. Stator assembly components are discussed, including the stator, mount structure, hydrostatic bearings, main and motoring brushgears and rotor. Planned operational procedures such as monitoring the rotor to full speed and operation with a superconducting field coil are delineated.
International Nuclear Information System (INIS)
Noor Azman, N.Z.; Siddiqui, S.A.; Hart, R.; Low, I.M.
2013-01-01
The effect of particle size, filler loadings and x-ray tube voltage on the x-ray transmission in WO 3 -epoxy composites has been investigated using the mammography unit and a general radiography unit. Results indicate that nano-sized WO 3 has a better ability to attenuate the x-ray beam generated by lower tube voltages (25–35 kV) when compared to micro-sized WO 3 of the same filler loading. However, the effect of particle size on x-ray transmission was negligible at the higher x-ray tube voltages (40–120 kV). - Highlights: ► Investigated the effect of particle size of WO 3 on the x-ray attenuation ability. ► Nano-sized WO 3 has a better ability to attenuate lower x-ray energies (22–49 kV p ). ► Particle size has negligible effect at the higher x-ray energy range (40–120 kV p ).
Fabrication of 4H-SiC Schottky barrier diodes with high breakdown voltages
Kum, B H; Shin, M W; Park, J D
1999-01-01
This paper discusses the fabrication and the breakdown characteristics of 4H-SiC Schottky barrier diodes (SBDs). Optimal processing conditions for the ohmic contacts were extracted using the transmission-line method (TLM) and were applied to the device fabrication. The Ti/4H-SiC SBDs with Si sub x B sub y passivation showed a maximum reverse breakdown voltage of 268 V with a forward current density as high as 70 mA/cm sup 2 at a forward voltage of 2 V. The breakdown of the Pt. 4H-SiC SBDs without any passivation occurred at near 110 V. It is concluded that the breakdown enhancement in the Ti/4H-SiC SBDs can be attributed to the passivation; otherwise, excess surface charge near the edge of the Schottky contact would lead to electric fields of sufficient magnitude to cause field emission.
Solid-state high voltage modulator and its application to rf source high voltage power supplies
International Nuclear Information System (INIS)
Tooker, J.F.; Huynh, P.; Street, R.W.
2009-01-01
A solid-state high voltage modulator is described in which series-connected insulated-gate bipolar transistors (IGBTs) are switched at a fixed frequency by a pulse width modulation (PWM) regulator, that adjusts the pulse width to control the voltage out of an inductor-capacitor filter network. General Atomics proposed the HV power supply (HVPS) topology of multiple IGBT modulators connected to a common HVdc source for the large number of 1 MW klystrons in the linear accelerator of the Accelerator Production of Tritium project. The switching of 24 IGBTs to obtain 20 kVdc at 20 A for short pulses was successfully demonstrated. This effort was incorporated into the design of a -70 kV, 80 A, IGBT modulator, and in a short-pulse test 12 IGBTs regulated -5 kV at 50 A under PWM control. These two tests confirm the practicality of solid-state IGBT modulators to regulate high voltage at reasonable currents. Tokamaks such as ITER require large rf heating and current drive systems with multiple rf sources. A HVPS topology is presented that readily adapts to the three rf heating systems on ITER. To take advantage of the known economy of scale for power conversion equipment, a single HVdc source feeds multiple rf sources. The large power conversion equipment, which is located outside, converts the incoming utility line voltage directly to the HVdc needed for the class of rf sources connected to it, to further reduce cost. The HVdc feeds a set of IGBT modulators, one for each rf source, to independently control the voltage applied to each source, maximizing operational flexibility. Only the modulators are indoors, close to the rf sources, minimizing the use of costly near-tokamak floor space.
Development of a compact generator for gigawatt, nanosecond high-voltage pulses
Energy Technology Data Exchange (ETDEWEB)
Zhou, Lin, E-mail: zhoulin-2003@163.com; Jiang, Zhanxing; Liang, Chuan; Li, Mingjia; Wang, Wenchuan; Li, Zhenghong [Institute of Nuclear Physics and Chemistry, China Academy of Engineering Physics, P.O. Box 919-226, Mianyang 621999 (China)
2016-03-15
A compact generator producing 2.2-ns 1.5 GW high-voltage pulses was developed. The generator employed a 27.6 Ω, 0.9 ns pulse-forming-line (PFL), which was charged by an iron core transformer with a turn ratio of 2:33.5 and a coefficient of 0.94. A 1.2 μF, 20 kV capacitor and a hydrogen thyratron were used in the primary circuit. When the thyratron closed at 14.5 kV, 3.4% of the energy stored in the capacitor was delivered to the PFL in 850 ns, producing a peak voltage of up to ∼500 kV. In addition, the principle of triple resonance transformation was employed by adding a 50 pF tuning capacitor and a 1.15 mH inductor between the transformer and the PFL, which led to a significant reduction of the duration and peak value of the transformer voltage without reducing that in the PFL. Meanwhile, an adjustable self-break oil switch was applied. By using transmission lines with impedance overmatched to that of the PFL, the generator delivered a 512 kV pulse across an electron beam diode, generating radiation with a dose of 20 mR/pulse at 20 cm ahead of the diode. The generator provides an excellent ultra-short radiation pulse source for the studies on radiation physics.
High voltage capacitor design and the determination of solid dielectric voltage breakdown
International Nuclear Information System (INIS)
Hutapea, S.
1976-01-01
The value of the external field intensity serves as an electrical insulating material and is a physical characteristic of the substance. Capacitor discharge in the dielectric medium are experimentally investigated. The high voltage power supply and other instrument needed are briefly discussed. Capacitors with working voltage of 30.000 volt and the plastic being used for dielectrics in the capacitors are also discussed. (author)
International Nuclear Information System (INIS)
Wang, Jia; Cao, Zhongyue; Pan, Fuping; Wang, Fuguo; Liang, Aimin; Zhang, Junyan
2015-01-01
Highlights: • a-C:H films deposited by high frequency unipolar pulse PECVD. • The film structures can be adjusted by bias voltage. • More graphitic structures form at high bias voltage. • The mechanical and tribological properties are improved by these structures. - Abstract: Amorphous hydrogenated carbon (a-C:H) films were prepared by high frequency unipolar pulse plasma-enhanced chemical vapor deposition in CH 4 , Ar, and H 2 atmosphere with the bias voltage in the range of −800 –−1600 V. The microstructures and mechanical properties of a-C:H films were investigated via high resolution transmission electron microscope (HRTEM), Raman spectroscopy, and Nanoindenter. The results reveal that the curved and straight graphitic microstructures appear in amorphous carbon matrix, and their contents increase obviously with the bias voltage. At the same time, the corresponding hardness decreases and elastic recovery increases, however even in such a case films still possess excellent mechanical properties. According to the tribological property characterization, we believe that the bias voltage also influences their tribological performances significantly, the higher the bias voltage finally gets, the lower the friction coefficient and wear rate occur. These results indicate that the microstructures of a-C:H films can be tuned efficiently by bias voltage and the films with good mechanical and tribological properties can be obtained at a higher range.
Energy Technology Data Exchange (ETDEWEB)
Wang, Jia; Cao, Zhongyue; Pan, Fuping [State Key Laboratory of Solid Lubrication, Lanzhou Institute of Chemical Physics, Chinese Academy of Sciences, Lanzhou 730000 (China); University of Chinese Academy of Sciences, Beijing 100049 (China); Wang, Fuguo, E-mail: fgwang@licp.cas.cn [State Key Laboratory of Solid Lubrication, Lanzhou Institute of Chemical Physics, Chinese Academy of Sciences, Lanzhou 730000 (China); Liang, Aimin [State Key Laboratory of Solid Lubrication, Lanzhou Institute of Chemical Physics, Chinese Academy of Sciences, Lanzhou 730000 (China); Zhang, Junyan, E-mail: zhangjunyan@licp.cas.cn [State Key Laboratory of Solid Lubrication, Lanzhou Institute of Chemical Physics, Chinese Academy of Sciences, Lanzhou 730000 (China)
2015-11-30
Highlights: • a-C:H films deposited by high frequency unipolar pulse PECVD. • The film structures can be adjusted by bias voltage. • More graphitic structures form at high bias voltage. • The mechanical and tribological properties are improved by these structures. - Abstract: Amorphous hydrogenated carbon (a-C:H) films were prepared by high frequency unipolar pulse plasma-enhanced chemical vapor deposition in CH{sub 4}, Ar, and H{sub 2} atmosphere with the bias voltage in the range of −800 –−1600 V. The microstructures and mechanical properties of a-C:H films were investigated via high resolution transmission electron microscope (HRTEM), Raman spectroscopy, and Nanoindenter. The results reveal that the curved and straight graphitic microstructures appear in amorphous carbon matrix, and their contents increase obviously with the bias voltage. At the same time, the corresponding hardness decreases and elastic recovery increases, however even in such a case films still possess excellent mechanical properties. According to the tribological property characterization, we believe that the bias voltage also influences their tribological performances significantly, the higher the bias voltage finally gets, the lower the friction coefficient and wear rate occur. These results indicate that the microstructures of a-C:H films can be tuned efficiently by bias voltage and the films with good mechanical and tribological properties can be obtained at a higher range.
Energy Technology Data Exchange (ETDEWEB)
1979-08-01
Research on power delivery alternatives is reported. The first phase of this work was to develop a model of overhead transmission systems in the range of 362 to 1200 kV ac, and +-400 to +-800 kV dc. Such systems included transmission from generation to load and inter-connection of two large integrated systems, with and without the existence of an underlying lower voltage network in either case. This phase has been completed. The second and third phases involved application of the model to electric systems within selected regions of the US, and the entire US, respectively, dealing with real situations and including projected expansion to year 1987. The potential benefits and costs of using higher than existing transmission voltages were to be evaluated on this basis. Additionally, the most advantageous new voltage was to be determined taking into account direct and indirect benefits and costs. The results of the second and third phases are presented.
Directory of Open Access Journals (Sweden)
P. Balachennaiah
2016-06-01
Full Text Available This paper proposes a Firefly algorithm based technique to optimize the control variables for simultaneous optimization of real power loss and voltage stability limit of the transmission system. Mathematically, this issue can be formulated as nonlinear equality and inequality constrained optimization problem with an objective function integrating both real power loss and voltage stability limit. Transformers taps, unified power flow controller and its parameters have been included as control variables in the problem formulation. The effectiveness of the proposed algorithm has been tested on New England 39-bus system. Simulation results obtained with the proposed algorithm are compared with the real coded genetic algorithm for single objective of real power loss minimization and multi-objective of real power loss minimization and voltage stability limit maximization. Also, a classical optimization method known as interior point successive linear programming technique is considered here to compare the results of firefly algorithm for single objective of real power loss minimization. Simulation results confirm the potentiality of the proposed algorithm in solving optimization problems.
30 CFR 77.807-1 - High-voltage powerlines; clearances above ground.
2010-07-01
... OF UNDERGROUND COAL MINES Surface High-Voltage Distribution § 77.807-1 High-voltage powerlines; clearances above ground. High-voltage powerlines located above driveways, haulageways, and railroad tracks...
Directory of Open Access Journals (Sweden)
Yu-En Wu
2016-09-01
Full Text Available In this study, a novel, non-isolated, cascade-type, single-switch, high step-up DC/DC converter was developed for green energy systems. An integrated coupled inductor and voltage lift circuit were applied to simplify the converter structure and satisfy the requirements of high efficiency and high voltage gain ratios. In addition, the proposed structure is controllable with a single switch, which effectively reduces the circuit cost and simplifies the control circuit. With the leakage inductor energy recovery function and active voltage clamp characteristics being present, the circuit yields optimizable conversion efficiency and low component voltage stress. After the operating principles of the proposed structure and characteristics of a steady-state circuit were analyzed, a converter prototype with 450 W, 40 V of input voltage, 400 V of output voltage, and 95% operating efficiency was fabricated. The Renesas MCU RX62T was employed to control the circuits. Experimental results were analyzed to validate the feasibility and effectiveness of the proposed system.
Directory of Open Access Journals (Sweden)
Chih-Lung Shen
2013-01-01
Full Text Available A self-oscillating high-voltage generator is proposed to supply voltage for a suspension system in order to control the damping force of an electrorheological (ER fluid shock absorber. By controlling the output voltage level of the generator, the damping force in the ER fluid shock absorber can be adjusted immediately. The shock absorber is part of the suspension system. The high-voltage generator drives a power transistor based on self-excited oscillation, which converts dc to ac. A high-frequency transformer with high turns ratio is used to increase the voltage. In addition, the system uses the car battery as dc power supply. By regulating the duty cycle of the main switch in the buck converter, the output voltage of the buck converter can be linearly adjusted so as to obtain a specific high voltage for ER. The driving system is self-excited; that is, no additional external driving circuit is required. Thus, it reduces cost and simplifies system structure. A prototype version of the actual product is studied to measure and evaluate the key waveforms. The feasibility of the proposed system is verified based on experimental results.
Effect of a Cooling Step Treatment on a High-Voltage GaN LED During ICP Dry Etching
Lin, Yen-Sheng; Hsiao, Sheng-Yu; Tseng, Chun-Lung; Shen, Ching-Hsing; Chiang, Jung-Sheng
2017-02-01
In this study, a lower dislocation density for a GaN surface and a reduced current path are observed at the interface of a SiO2 isolation sidewall, using high-resolution transmission electron microscopy. This is grown using a 3-min cooling step treatment during inductivity coupled plasma dry etching. The lower forward voltage is measured, the leakage current decreases from 53nA to 32nA, and the maximum output power increases from 354.8 W to 357.2 W for an input current of 30 mA. The microstructure and the optoelectronic properties of high-voltage light-emitting-diodes is proven to be affected by the cooling step treatment, which allows enough time to release the thermal energy of the SiO2 isolation well.
IBM-PC based high voltage controller [Paper No.: L7
International Nuclear Information System (INIS)
Mondal, N.K.; Kalmani, S.D.
1993-01-01
A simple IBM-PC/XT based high voltage controller is designed for C.A.E.N. high voltage supply unit, which is being used for testing the prototype detector for future accelerator experiment. The high voltage output of the supply unit can be remotely programmed. The V-set Lemo connectors at the rear panel provides the remote control facility. Similarly V-mon and I-mon can be used for remotely monitoring the voltage set and the current drawn from the supply unit. The controller described here sets the high voltage through V-set and monitors the voltage set, through V-mon at a pre-determined time interval. The monitoring is a background job and is done as an interrupt service routine of IRQ3. A simple menu driven software package used is written in Q-Basic and MASM. (author). 1 fig
Optical control system for high-voltage terminals
International Nuclear Information System (INIS)
Bicek, J.J.
1978-01-01
An optical control system for the control of devices in the terminal of an electrostatic accelerator includes a laser that is modulated by a series of preselected codes produced by an encoder. A photodiode receiver is placed in the laser beam at the high-voltage terminal of an electrostatic accelerator. A decoder connected to the photodiode decodes the signals to provide control impulses for a plurality of devices at the high voltage of the terminal
High-voltage pulse generator for electron gun power supply
International Nuclear Information System (INIS)
Korenev, S.A.; Enchevich, I.B.; Mikhov, M.K.
1987-01-01
High-voltage pulse generator with combined capacitive and inductive energy storages for electron gun power supply is described. Hydrogen thyratron set in a short magnetic lense is a current breaker. Times of current interruption in thyratrons are in the range from 100 to 300 ns. With 1 kV charging voltage of capacitive energy storage 25 kV voltage pulse is obtained in the load. The given high-voltage pulse generator was used for supply of an electron gun generating 10-30 keV low-energy electron beam
21 CFR 892.1700 - Diagnostic x-ray high voltage generator.
2010-04-01
... 21 Food and Drugs 8 2010-04-01 2010-04-01 false Diagnostic x-ray high voltage generator. 892.1700... (CONTINUED) MEDICAL DEVICES RADIOLOGY DEVICES Diagnostic Devices § 892.1700 Diagnostic x-ray high voltage generator. (a) Identification. A diagnostic x-ray high voltage generator is a device that is intended to...
30 CFR 75.705-1 - Work on high-voltage lines.
2010-07-01
... 30 Mineral Resources 1 2010-07-01 2010-07-01 false Work on high-voltage lines. 75.705-1 Section 75... AND HEALTH MANDATORY SAFETY STANDARDS-UNDERGROUND COAL MINES Grounding § 75.705-1 Work on high-voltage lines. (a) Section 75.705 specifically prohibits work on energized high-voltage lines underground; (b...
Emira, Ahmed A.; Abdelghany, Mohamed A.; Elsayed, Mohannad Yomn; Elshurafa, Amro M; Salama, Khaled N.
2014-01-01
Various embodiments of a high voltage charge pump are described. One embodiment is a charge pump circuit that comprises a plurality of switching stages each including a clock input, a clock input inverse, a clock output, and a clock output inverse. The circuit further comprises a plurality of pumping capacitors, wherein one or more pumping capacitors are coupled to a corresponding switching stage. The circuit also comprises a maximum selection circuit coupled to a last switching stage among the plurality of switching stages, the maximum selection circuit configured to filter noise on the output clock and the output clock inverse of the last switching stage, the maximum selection circuit further configured to generate a DC output voltage based on the output clock and the output clock inverse of the last switching stage.
Emira, Ahmed A.
2014-10-09
Various embodiments of a high voltage charge pump are described. One embodiment is a charge pump circuit that comprises a plurality of switching stages each including a clock input, a clock input inverse, a clock output, and a clock output inverse. The circuit further comprises a plurality of pumping capacitors, wherein one or more pumping capacitors are coupled to a corresponding switching stage. The circuit also comprises a maximum selection circuit coupled to a last switching stage among the plurality of switching stages, the maximum selection circuit configured to filter noise on the output clock and the output clock inverse of the last switching stage, the maximum selection circuit further configured to generate a DC output voltage based on the output clock and the output clock inverse of the last switching stage.
Hybrid AC-High Voltage DC Grid Stability and Controls
Yu, Jicheng
The growth of energy demands in recent years has been increasing faster than the expansion of transmission facility construction. This tendency cooperating with the continuous investing on the renewable energy resources drives the research, development, and construction of HVDC projects to create a more reliable, affordable, and environmentally friendly power grid. Constructing the hybrid AC-HVDC grid is a significant move in the development of the HVDC techniques; the form of dc system is evolving from the point-to-point stand-alone dc links to the embedded HVDC system and the multi-terminal HVDC (MTDC) system. The MTDC is a solution for the renewable energy interconnections, and the MTDC grids can improve the power system reliability, flexibility in economic dispatches, and converter/cable utilizing efficiencies. The dissertation reviews the HVDC technologies, discusses the stability issues regarding the ac and HVDC connections, proposes a novel power oscillation control strategy to improve system stability, and develops a nonlinear voltage droop control strategy for the MTDC grid. To verify the effectiveness the proposed power oscillation control strategy, a long distance paralleled AC-HVDC transmission test system is employed. Based on the PSCAD/EMTDC platform simulation results, the proposed power oscillation control strategy can improve the system dynamic performance and attenuate the power oscillations effectively. To validate the nonlinear voltage droop control strategy, three droop controls schemes are designed according to the proposed nonlinear voltage droop control design procedures. These control schemes are tested in a hybrid AC-MTDC system. The hybrid AC-MTDC system, which is first proposed in this dissertation, consists of two ac grids, two wind farms and a five-terminal HVDC grid connecting them. Simulation studies are performed in the PSCAD/EMTDC platform. According to the simulation results, all the three design schemes have their unique salient
Modular High Voltage Power Supply
Energy Technology Data Exchange (ETDEWEB)
Newell, Matthew R. [Los Alamos National Lab. (LANL), Los Alamos, NM (United States)
2017-05-18
The goal of this project is to develop a modular high voltage power supply that will meet the needs of safeguards applications and provide a modular plug and play supply for use with standard electronic racks.
Voltage control of cavity magnon polariton
Energy Technology Data Exchange (ETDEWEB)
Kaur, S., E-mail: kaurs3@myumanitoba.ca; Rao, J. W.; Gui, Y. S.; Hu, C.-M., E-mail: hu@physics.umanitoba.ca [Department of Physics and Astronomy, University of Manitoba, Winnipeg, Manitoba R3T 2N2 (Canada); Yao, B. M. [Department of Physics and Astronomy, University of Manitoba, Winnipeg, Manitoba R3T 2N2 (Canada); National Laboratory for Infrared Physics, Chinese Academy of Sciences, Shanghai 200083 (China)
2016-07-18
We have experimentally investigated the microwave transmission of the cavity-magnon-polariton (CMP) generated by integrating a low damping magnetic insulator onto a 2D microwave cavity. The high tunability of our planar cavity allows the cavity resonance frequency to be precisely controlled using a DC voltage. By appropriately tuning the voltage and magnetic bias, we can observe the cavity photon magnon coupling and the magnetic coupling between a magnetostatic mode and the generated CMP. The dispersion of the generated CMP was measured by either tuning the magnetic field or the applied voltage. This electrical control of CMP may open up avenues for designing advanced on-chip microwave devices that utilize light-matter interaction.
A compact 100 kV high voltage glycol capacitor.
Wang, Langning; Liu, Jinliang; Feng, Jiahuai
2015-01-01
A high voltage capacitor is described in this paper. The capacitor uses glycerol as energy storage medium, has a large capacitance close to 1 nF, can hold off voltages of up to 100 kV for μs charging time. Allowing for low inductance, the capacitor electrode is designed as coaxial structure, which is different from the common structure of the ceramic capacitor. With a steady capacitance at different frequencies and a high hold-off voltage of up to 100 kV, the glycol capacitor design provides a potential substitute for the ceramic capacitors in pulse-forming network modulator to generate high voltage pulses with a width longer than 100 ns.
30 CFR 77.704-2 - Repairs to energized high-voltage lines.
2010-07-01
... 30 Mineral Resources 1 2010-07-01 2010-07-01 false Repairs to energized high-voltage lines. 77.704... UNDERGROUND COAL MINES Grounding § 77.704-2 Repairs to energized high-voltage lines. An energized high-voltage... repairs will be performed on power circuits with a phase-to-phase nominal voltage no greater than 15,000...
Directory of Open Access Journals (Sweden)
Mohammed Hassan Dervish
2018-01-01
Full Text Available Although it is difficult to imagine life without electricity, there are compiling confirmations show thatexposure to magnetic fields correlated electricity and radio frequencies pose magnificent hazards to human health. The most economist method to transfer electricity from power generation stations to users is by measures of high power transmission lines, buoyed by big transmission towers. The cables laced between the towers radiate magnetic and electric fields. In this research study, the magnetic field at ground level under 400 kV network lines extended in residential places have been conducted in two ways, mathematical calculation and practical measurement then the obtained results analyzed and compared with the international standards reference values. the reason of chose this type of transmission line is frequently using. The results indicate that they fall within the safe limiter commended by the WorldHealth Organization. the strength of radiation increasing with high of sea level and moisture ratiobecause of air ionization.
Void formation in NiTi shape memory alloys by medium-voltage electron irradiation
International Nuclear Information System (INIS)
Schlossmacher, P.; Stober, T.
1995-01-01
In-situ electron irradiation experiments of NiTi shape memory alloys, using high-voltage transmission electron microscopes, result in amorphization of the intermetallic compound. In all of these experiments high-voltages more than 1.0 MeV had to be applied in order to induce the crystalline-to-amorphous transformation. To their knowledge no irradiation effects of medium-voltage electrons of e.g. 0.5 MeV have been reported in the literature. In this contribution, the authors describe void formation in two different NiTi shape memory alloys, resulting from in-situ electron irradiation, using a 300 kV electron beam in a transmission electron microscope. First evidence is presented that void formation is correlated with the total oxygen content of the alloys
Multiple High Voltage Pulse Stressing of Polymer Thick Film Resistors
Directory of Open Access Journals (Sweden)
Busi Rambabu
2014-01-01
Full Text Available The purpose of this paper is to study high voltage interactions in polymer thick film resistors, namely, polyvinyl chloride- (PVC- graphite thick film resistors, and their applications in universal trimming of these resistors. High voltages in the form of impulses for various pulse durations and with different amplitudes have been applied to polymer thick film resistors and we observed the variation of resistance of these resistors with high voltages. It has been found that the resistance of polymer thick film resistors decreases in the case of higher resistivity materials and the resistance of polymer thick film resistor increases in the case of lower resistivity materials when high voltage impulses are applied to them. It has been also found that multiple high voltage pulse (MHVP stressing can be used to trim the polymer thick film resistors either upwards or downwards.
Low cost photomultiplier high-voltage readout system
International Nuclear Information System (INIS)
Oxoby, G.J.; Kunz, P.F.
1976-10-01
The Large Aperture Solenoid Spectrometer (LASS) at Stanford Linear Accelerator Center (SLAC) requires monitoring over 300 voltages. This data is recorded on magnetic tapes along with the event data. It must also be displayed so that operators can easily monitor and adjust the voltages. A low-cost high-voltage readout system has been implemented to offer stand-alone digital readout capability as well as fast data transfer to a host computer. The system is flexible enough to permit use of a DVM or ADC and commercially available analogue multiplexers
AN OVERVIEW OF HIGH VOLTAGE DIELECTRIC MATERIAL FOR TRAVELING WAVE KICKER MAGNET APPLICATION
International Nuclear Information System (INIS)
ZHANG, W.; SANDBERG, J.; TUOZZOLO, J.; CASSEL, R.; DUCIMETIERE, L.; JENSEN, C.; BARNES, M.; WAIT, G.; WANG, J.
2002-01-01
Pulsed high power fast kickers are being used to change beam trajectories in particle accelerators. The fast rise and fall time of pulse waveform demands a transmission line structure for the kicker deflector design. The ideal design will be parallel metal plates. However, it uses very long straight sections to achieve the required deflection. In accelerators with constrained straight sections, high permeability materials such as ferrite have to be used to gain deflection efficiency. The transmission line kicker magnet is also referred as traveling wave kicker magnet. Its construction is based on distributed 1-C cells along the longitudinal direction. The magnetic cells and capacitive cells are interleaved to simulate the characteristic impedance of a transmission line to minimize pulse reflection, and provide adequate frequency bandwidth to transmit the kicker pulse with fast rise and fall time. The magnetic cells are usually made of ferrite ceramics, but the capacitive cells have been made with different materials. For traveling wave kickers with higher impedance, the parallel plate vacuum capacitor has been used in CERN and KEK design. Others have used ceramic capacitors, printed circuit boards, and high permittivity ceramics as the capacitive cell. The high dielectric material has the advantage of compactness for low impedance kicker magnet construction. It continues to be very attractive for future kicker magnet applications. The high voltage phenomena associated with high dielectric ceramic materials have been widely reported in many industrial application areas. Their implication in the traveling wave magnet application has to be well understood. In this presentation, the areas requiring further quantitative study will be outlined
Design & Fabrication of a High-Voltage Photovoltaic Cell
Energy Technology Data Exchange (ETDEWEB)
Felder, Jennifer; /North Carolina State U. /SLAC
2012-09-05
Silicon photovoltaic (PV) cells are alternative energy sources that are important in sustainable power generation. Currently, applications of PV cells are limited by the low output voltage and somewhat low efficiency of such devices. In light of this fact, this project investigates the possibility of fabricating high-voltage PV cells on float-zone silicon wafers having output voltages ranging from 50 V to 2000 V. Three designs with different geometries of diffusion layers were simulated and compared in terms of metal coverage, recombination, built-in potential, and conduction current density. One design was then chosen and optimized to be implemented in the final device design. The results of the simulation serve as a feasibility test for the design concept and provide supportive evidence of the effectiveness of silicon PV cells as high-voltage power supplies.
Micro controller application as x-ray machine's high voltage controller
International Nuclear Information System (INIS)
Wiranto Budi Santoso; Beny Syawaludin
2010-01-01
The micro controller application as x-ray machine's high voltage controller has been carried out. The purpose of this micro controller application is to give an accurate high voltage supply to the x-ray tube so that the x ray machine could produce the result as expected. The micro controller based X-ray machine's high voltage controller receives an input voltage from the keypad. This input value is displayed in the LCD (Liquid Crystal Display) screen. Then micro controller uses this input data to drive the stepper motor. The stepper motor adjusts the high voltage auto transformer's output according to the input value. The micro controller is programmed using BASCOM-B051 compiler. The test results show that the stepper motor could rotate according to an input value. (author)
Integrated differential high-voltage transmitting circuit for CMUTs
DEFF Research Database (Denmark)
Llimos Muntal, Pere; Larsen, Dennis Øland; Farch, Kjartan
2015-01-01
In this paper an integrated differential high-voltage transmitting circuit for capacitive micromachined ultrasonic transducers (CMUTs) used in portable ultrasound scanners is designed and implemented in a 0.35 μm high-voltage process. Measurements are performed on the integrated circuit in order...... to assess its performance. The circuit generates pulses at differential voltage levels of 60V, 80V and 100 V, a frequency up to 5MHz and a measured driving strength of 1.75 V/ns with the CMUT connected. The total on-chip area occupied by the transmitting circuit is 0.18 mm2 and the power consumption...
High-voltage pulse generator synchronous with LINAC
International Nuclear Information System (INIS)
Muto, M.; Hiratsuka, Yoshio; Niimura, Nobuo
1974-01-01
High-voltage pulse generator (H.V. Flip-Flop) No.2, an improved type of No.1, is described, which is used in the structural analysis of transient phenomena in materials through the neutron TOF with a Linac. The method of producing positive and negative high-voltage pulses synchronous with the Linac is identical with that in No.1. However, No.2 has outstanding features as follows: (1) The rise time of output pulses is reduced to 0.3 msec, due to the improvement of switching circuit and the winding of a step-up transformer; (2) The widths of positive and negative pulses are variable up to maximum 8 and 16 frames, respectively (One frame = 10 msec); (3) The distribution of TOF signals from a BF 3 counter to a time analyzer is possible even in the negative voltage duration. The panel is provided with the switches for choosing pulse width and the frame for analysis, as well as the dials for setting positive/negative pulse voltage values and the respective indicating meters. (Mori, K)
30 CFR 18.54 - High-voltage continuous mining machines.
2010-07-01
... 30 Mineral Resources 1 2010-07-01 2010-07-01 false High-voltage continuous mining machines. 18.54... and Design Requirements § 18.54 High-voltage continuous mining machines. (a) Separation of high... ground. (e) Onboard ungrounded, three-phase power circuit. A continuous mining machine designed with an...
Mohammad, A.; Mahmood, A.; Chin, K. T.; Danquah, M. K.; van Stratan, S.
2017-06-01
Conductive polymer had opened a new era of engineering for microelectronics and semiconductor applications. However, it is still a challenge for high voltage applications due to lower electrical conductivity compare to metals. This results tremendous energy losses during transmission and restricts its usage. In order to address such problem a novel method was investigated using nano silver particle doped iodothiophene since silver is the highest electrical conductive material. The experiments were carried out to study the organometallic diffusion behaviour of nanosilver doped iodothiophene with different concentration of iodothiophene. Five different mixing ratio between nanosilver and the solution of iodothiophene dissolved in diethyl ether were used which are 1:1.25, 1:1.5, 1:2.5, 1:3 and l:5. It was revealed that there is an effective threshold concentration of which the nano silver evenly distributed and there was no coagulation observed. These parameters laid the foundation of better doping process between the nano silver and the polymer significantly which would contribute developing conductive polymer towards high voltage application for industries that are vulnerable to corrosive environment.
DEFF Research Database (Denmark)
Irnawan, Roni; Silva, Filipe Miguel Faria da; Bak, Claus Leth
2017-01-01
This paper deals with a radial offshore multi-terminal HVDC (MTDC) transmission system which is formed by interconnection several existing offshore wind farm (OWF) HVDC links with a shore-to-shore (StS) HVDC link. A challenge arises when deciding the steady-state DC voltage operating level...
High-Voltage, Low-Power BNC Feedthrough Terminator
Bearden, Douglas
2012-01-01
This innovation is a high-voltage, lowpower BNC (Bayonet Neill-Concelman) feedthrough that enables the user to terminate an instrumentation cable properly while connected to a high voltage, without the use of a voltage divider. This feedthrough is low power, which will not load the source, and will properly terminate the instrumentation cable to the instrumentation, even if the cable impedance is not constant. The Space Shuttle Program had a requirement to measure voltage transients on the orbiter bus through the Ground Lightning Measurement System (GLMS). This measurement has a bandwidth requirement of 1 MHz. The GLMS voltage measurement is connected to the orbiter through a DC panel. The DC panel is connected to the bus through a nonuniform cable that is approximately 75 ft (approximately equal to 23 m) long. A 15-ft (approximately equal to 5-m), 50-ohm triaxial cable is connected between the DC panel and the digitizer. Based on calculations and simulations, cable resonances and reflections due to mismatched impedances of the cable connecting the orbiter bus and the digitizer causes the output not to reflect accurately what is on the bus. A voltage divider at the DC panel, and terminating the 50-ohm cable properly, would eliminate this issue. Due to implementation issues, an alternative design was needed to terminate the cable properly without the use of a voltage divider. Analysis shows how the cable resonances and reflections due to the mismatched impedances of the cable connecting the orbiter bus and the digitizer causes the output not to reflect accurately what is on the bus. After simulating a dampening circuit located at the digitizer, simulations were performed to show how the cable resonances were dampened and the accuracy was improved significantly. Test cables built to verify simulations were accurate. Since the dampening circuit is low power, it can be packaged in a BNC feedthrough.
High-Capacity Cathode Material with High Voltage for Li-Ion Batteries.
Shi, Ji-Lei; Xiao, Dong-Dong; Ge, Mingyuan; Yu, Xiqian; Chu, Yong; Huang, Xiaojing; Zhang, Xu-Dong; Yin, Ya-Xia; Yang, Xiao-Qing; Guo, Yu-Guo; Gu, Lin; Wan, Li-Jun
2018-03-01
Electrochemical energy storage devices with a high energy density are an important technology in modern society, especially for electric vehicles. The most effective approach to improve the energy density of batteries is to search for high-capacity electrode materials. According to the concept of energy quality, a high-voltage battery delivers a highly useful energy, thus providing a new insight to improve energy density. Based on this concept, a novel and successful strategy to increase the energy density and energy quality by increasing the discharge voltage of cathode materials and preserving high capacity is proposed. The proposal is realized in high-capacity Li-rich cathode materials. The average discharge voltage is increased from 3.5 to 3.8 V by increasing the nickel content and applying a simple after-treatment, and the specific energy is improved from 912 to 1033 Wh kg -1 . The current work provides an insightful universal principle for developing, designing, and screening electrode materials for high energy density and energy quality. © 2018 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
International Nuclear Information System (INIS)
Na, Byung Hoon; Ju, Gun Wu; Cho, Yong Chul; Lee, Yong Tak; Choi, Hee Ju; Jeon, Jin Myeong; Lee, Soo Kyung; Park, Yong Hwa; Park, Chang Young
2015-01-01
In this paper, we propose a transmission type electro-absorption modulator (EAM) operating at 850 nm having low operating voltage and high absorption change with low insertion loss using a novel three step asymmetric coupled quantum well (3 ACQW) structure which can be used as an optical image shutter for high-definition (HD) three dimensional (3D) imaging. Theoretical calculations show that the exciton red shift of 3 ACQW structure is more than two times larger than that of rectangular quantum well (RQW) structure while maintaining high absorption change. The EAM having coupled cavities with 3 ACQW structure shows a wide spectral bandwidth and high amplitude modulation at a bias voltage of only -8V, which is 41% lower in operating voltage than that of RQW, making the proposed EAM highly attractive as an optical image shutter for HD 3D imaging applications
International Nuclear Information System (INIS)
Hinshelwood, D. D.; Schumer, J. W.; Allen, R. J.; Commisso, R. J.; Jackson, S. L.; Murphy, D. P.; Phipps, D.; Swanekamp, S. B.; Weber, B. V.; Ottinger, P. F.; Apruzese, J. P.; Cooperstein, G.; Young, F. C.
2011-01-01
A pinch-reflex ion diode is fielded on the pulsed-power machine Mercury (R. J. Allen, et al., 15th IEEE Intl. Pulsed Power Conf., Monterey, CA, 2005, p. 339), which has an inductive voltage adder (IVA) architecture and a magnetically insulated transmission line (MITL). Mercury is operated in positive polarity resulting in layered MITL flow as emitted electrons are born at a different potential in each of the adder cavities. The usual method for estimating the voltage by measuring the bound current in the cathode and anode of the MITL is not accurate with layered flow, and the interaction of the MITL flow with a pinched-beam ion diode load has not been studied previously. Other methods for determining the diode voltage are applied, ion diode performance is experimentally characterized and evaluated, and circuit and particle-in-cell (PIC) simulations are performed. Results indicate that the ion diode couples efficiently to the machine operating at a diode voltage of about 3.5 MV and a total current of about 325 kA, with an ion current of about 70 kA of which about 60 kA is proton current. It is also found that the layered flow impedance of the MITL is about half the vacuum impedance.
First high-voltage measurements using Ca{sup +} ions at the ALIVE experiment
Energy Technology Data Exchange (ETDEWEB)
König, K., E-mail: kkoenig@ikp.tu-darmstadt.de [Technische Universität Darmstadt, Institut für Kernphysik (Germany); Geppert, Ch. [Universität Mainz, Institut für Kernchemie (Germany); Krämer, J.; Maaß, B. [Technische Universität Darmstadt, Institut für Kernphysik (Germany); Otten, E. W. [Universität Mainz, Institut für Physik (Germany); Ratajczyk, T.; Nörtershäuser, W. [Technische Universität Darmstadt, Institut für Kernphysik (Germany)
2017-11-15
Many physics experiments depend on accurate high-voltage measurements to determine for example the exact retardation potential of an electron spectrometer as in the KATRIN experiment or the acceleration voltage of the ions at ISOL facilities. Until now only precision high-voltage dividers can be used to measure voltages up to 65 kV with an accuracy of 1 ppm. However, these dividers need frequent calibration and cross-checking and the direct traceability is not given. In this article we will describe the status of an experiment which aims to measure high voltages using collinear laser spectroscopy and which has the potential to provide a high-voltage standard and hence, a calibration source for precision high-voltage dividers on the 1 ppm level.
High voltage holding in the negative ion sources with cesium deposition
Energy Technology Data Exchange (ETDEWEB)
Belchenko, Yu.; Abdrashitov, G.; Ivanov, A.; Sanin, A.; Sotnikov, O., E-mail: O.Z.Sotnikov@inp.nsk.su [Budker Institute of Nuclear Physics, Siberian Branch of Russian Academy of Sciences, Novosibirsk (Russian Federation)
2016-02-15
High voltage holding of the large surface-plasma negative ion source with cesium deposition was studied. It was found that heating of ion-optical system electrodes to temperature >100 °C facilitates the source conditioning by high voltage pulses in vacuum and by beam shots. The procedure of electrode conditioning and the data on high-voltage holding in the negative ion source with small cesium seed are described. The mechanism of high voltage holding improvement by depletion of cesium coverage is discussed.
High voltage switches having one or more floating conductor layers
Werne, Roger W.; Sampayan, Stephen; Harris, John Richardson
2015-11-24
This patent document discloses high voltage switches that include one or more electrically floating conductor layers that are isolated from one another in the dielectric medium between the top and bottom switch electrodes. The presence of the one or more electrically floating conductor layers between the top and bottom switch electrodes allow the dielectric medium between the top and bottom switch electrodes to exhibit a higher breakdown voltage than the breakdown voltage when the one or more electrically floating conductor layers are not present between the top and bottom switch electrodes. This increased breakdown voltage in the presence of one or more electrically floating conductor layers in a dielectric medium enables the switch to supply a higher voltage for various high voltage circuits and electric systems.
Distance Protection of Cross-Bonded Transmission Cable-Systems
DEFF Research Database (Denmark)
Bak, Claus Leth; F. Jensen, Christian
2014-01-01
In this paper the problems of protecting a cross-bonded cable system using distance protection are analysed. The combination of the desire to expand the high voltage transmission grid and the public's opinion towards new installations of overhead lines (OHL), more and more transmission cable syst...
A compact, all solid-state LC high voltage generator.
Fan, Xuliang; Liu, Jinliang
2013-06-01
LC generator is widely applied in the field of high voltage generation technology. A compact and all solid-state LC high voltage generator based on saturable pulse transformer is proposed in this paper. First, working principle of the generator is presented. Theoretical analysis and circuit simulation are used to verify the design of the generator. Experimental studies of the proposed LC generator with two-stage main energy storage capacitors are carried out. And the results show that the proposed LC generator operates as expected. When the isolation inductance is 27 μH, the output voltage is 1.9 times larger than the charging voltage on single capacitor. The multiplication of voltages is achieved. On the condition that the primary energy storage capacitor is charged to 857 V, the output voltage of the generator can reach to 59.5 kV. The step-up ratio is nearly 69. When self breakdown gas gap switch is used as main switch, the rise time of the voltage pulse on load resistor is 8.7 ns. It means that the series-wound inductance in the discharging circuit is very small in this system. This generator can be employed in two different applications.
Recycling potential for low voltage and high voltage high rupturing capacity fuse links.
Psomopoulos, Constantinos S; Barkas, Dimitrios A; Kaminaris, Stavros D; Ioannidis, George C; Karagiannopoulos, Panagiotis
2017-12-01
Low voltage and high voltage high-rupturing-capacity fuse links are used in LV and HV installations respectively, protecting mainly the LV and HV electricity distribution and transportation networks. The Waste Electrical and Electronic Equipment Directive (2002/96/EC) for "Waste of electrical and electronic equipment" is the main related legislation and as it concerns electrical and electronic equipment, it includes electric fuses. Although, the fuse links consist of recyclable materials, only small scale actions have been implemented for their recycling around Europe. This work presents the possibilities for material recovery from this specialized industrial waste for which there are only limited volume data. Furthermore, in order to present the huge possibilities and environmental benefits, it presents the potential for recycling of HRC fuses used by the Public Power Corporation of Greece, which is the major consumer for the country, but one of the smallest ones in Europe and globally, emphasizing in this way in the issue. According to the obtained results, fuse recycling could contribute to the effort for minimize the impacts on the environment through materials recovery and reduction of the wastes' volume disposed of in landfills. Copyright © 2017 Elsevier Ltd. All rights reserved.
30 CFR 18.53 - High-voltage longwall mining systems.
2010-07-01
...-starter enclosure, with the exception of a controller on a high-voltage shearer, the disconnect device...) shielding between the primary and secondary windings. The shielding must be connected to equipment ground by... with a disconnect device installed to deenergize all high-voltage power conductors extending from the...
Experimental and simulational study of the operation conditions for a high transmission mass filter
International Nuclear Information System (INIS)
Ayesh, A. I.; Lassesson, A.; Brown, S. A.; Dunbar, A. D. F.; Kaufmann, M.; Partridge, J. G.; Reichel, R.; Lith, J. van
2007-01-01
The operation conditions of a double pulsed field mass filter were studied using both experiment and simulation. The mass filter consists of two pairs of parallel plates and operates on the time-of-flight principle. The study showed that the ions' beam deflection angle is a critical factor in optimizing the mass filter transmission efficiency. This angle is dependent on the accelerating voltage, ion mass, and horizontal velocity of the ions. The optimum operating conditions for the mass filter were found and used to study the mass distribution of palladium ions produced by a magnetron sputtering source. The study shows that this mass filter is suitable for technological applications because of its high transmission and wide mass range
DEFF Research Database (Denmark)
Ni, Ronggang; Xu, Dianguo; Blaabjerg, Frede
2017-01-01
relationship with the magnetic field distortion. Position estimation errors caused by higher order harmonic inductances and voltage harmonics generated by the SVPWM are also discussed. Both simulations and experiments are carried out based on a commercial PMSM to verify the superiority of the proposed method......Rotor position estimated with high-frequency (HF) voltage injection methods can be distorted by voltage errors due to inverter nonlinearities, motor resistance, and rotational voltage drops, etc. This paper proposes an improved HF square-wave voltage injection algorithm, which is robust to voltage...... errors without any compensations meanwhile has less fluctuation in the position estimation error. The average position estimation error is investigated based on the analysis of phase harmonic inductances, and deduced in the form of the phase shift of the second-order harmonic inductances to derive its...
30 CFR 75.705-2 - Repairs to energized surface high-voltage lines.
2010-07-01
... 30 Mineral Resources 1 2010-07-01 2010-07-01 false Repairs to energized surface high-voltage lines... Repairs to energized surface high-voltage lines. An energized high-voltage surface line may be repaired... on power circuits with a phase-to-phase nominal voltage no greater than 15,000 volts; (3) Such...
Monitoring of high voltage supply using the Controller Area Network protocol
Energy Technology Data Exchange (ETDEWEB)
Luz, Igo Amauri dos S.; Farias, Paulo Cesar M.A.; Guedes, Germano P. [Universidade Estadual de Feira de Santana (UEFS), BA (Brazil)
2011-07-01
Full text: In recent years, experimental physics has made great progress in the investigation of the phenomenology of neutrinos, with significant contribution from experiments using nuclear reactors as source of particles. In this context, The Neutrinos Angra Project proposes the use of an anti-neutrinos detector with ability to monitor parameters related to the activity of nuclear reactors. One of the tasks defined in the project is the development of a system to control and to monitor the high voltage supply units used by the photomultiplier tubes (PMTs) of the detector. The solution proposed in this work is based on the use of microcontrollers, from Microchip PIC family to adjust the operating point of the high voltage supply units and to acquire the current and output voltage data. Analysis of these data allows the effective control of the gain of the PMTs and to identify anomalous operational conditions. In this work is proposed the study of the Controller Area Network (CAN) protocol and the implementation of a laboratory network to reproduce the typical operations of data acquisition and information transfer between the nodes. The development of this network is divided in two stages. The first part consisted of the setup of a CAN network, using the PIC18F2680 microcontroller, which has the CAN protocol internally implemented. This network serves as a reduced model of the final system, allowing simulation of typical situations of data acquisition and transmission between the nodes and a computer. In the second part of the work, the PIC18F4550 microcontroller was associated with the external CAN controller MCP2515 to develop a CAN/USB converter. This converter provides a new communication channel between network nodes and the computer, in addition to the RS232 interface. (author)
Wilson, P. M.; Wilson, T. G.; Owen, H. A., Jr.
Dc to dc converters which operate reliably and efficiently at switching frequencies high enough to effect substantial reductions in the size and weight of converter energy storage elements are studied. A two winding current or voltage stepup (buck boost) dc-to-dc converter power stage submodule designed to operate in the 2.5-kW range, with an input voltage range of 110 to 180 V dc, and an output voltage of 250 V dc is emphasized. In order to assess the limitations of present day component and circuit technologies, a design goal switching frequency of 10 kHz was maintained. The converter design requirements represent a unique combination of high frequency, high voltage, and high power operation. The turn off dynamics of the primary circuit power switching transistor and its associated turn off snubber circuitry are investigated.
High Input Voltage, Silicon Carbide Power Processing Unit Performance Demonstration
Bozak, Karin E.; Pinero, Luis R.; Scheidegger, Robert J.; Aulisio, Michael V.; Gonzalez, Marcelo C.; Birchenough, Arthur G.
2015-01-01
A silicon carbide brassboard power processing unit has been developed by the NASA Glenn Research Center in Cleveland, Ohio. The power processing unit operates from two sources: a nominal 300 Volt high voltage input bus and a nominal 28 Volt low voltage input bus. The design of the power processing unit includes four low voltage, low power auxiliary supplies, and two parallel 7.5 kilowatt (kW) discharge power supplies that are capable of providing up to 15 kilowatts of total power at 300 to 500 Volts (V) to the thruster. Additionally, the unit contains a housekeeping supply, high voltage input filter, low voltage input filter, and master control board, such that the complete brassboard unit is capable of operating a 12.5 kilowatt Hall effect thruster. The performance of the unit was characterized under both ambient and thermal vacuum test conditions, and the results demonstrate exceptional performance with full power efficiencies exceeding 97%. The unit was also tested with a 12.5kW Hall effect thruster to verify compatibility and output filter specifications. With space-qualified silicon carbide or similar high voltage, high efficiency power devices, this would provide a design solution to address the need for high power electric propulsion systems.
International Nuclear Information System (INIS)
Hao, Yu; Rouxinol, Francisco; LaHaye, M. D.
2014-01-01
We present the design of a reflective stop-band filter based on quasi-lumped elements that can be utilized to introduce large dc and low-frequency voltage biases into a low-loss superconducting coplanar waveguide (CPW) cavity. Transmission measurements of the filter are seen to be in good agreement with simulations and demonstrate insertion losses greater than 20 dB in the range of 3–10 GHz. Moreover, transmission measurements of the CPW's fundamental mode demonstrate that loaded quality factors exceeding 10 5 can be achieved with this design for dc voltages as large as 20 V and for the cavity operated in the single-photon regime. This makes the design suitable for use in a number of applications including qubit-coupled mechanical systems and circuit QED
International Nuclear Information System (INIS)
Hafiz Tehzeeb ul Hassan
2003-01-01
In Pakistan power network comprises of 500KV, 220KV, 132KV, 66KV and 33KV transmission lines and 11KV power distribution systems. Number of insulators are used in connected units in the shape of strings with transmission line as per insulation requirements with proper design according to the various kinds of pollution stresses. The transmission lines are passing from or near polluted areas and very dusty plains of Punjab and Sindh provinces. Practices are being used in these transmission lines for removal of accumulated contamination of insulators by periodic cleaning twice a year or de-energized transmission lines. Even then discontinuation of supply takes place in the polluted areas in foggy weather. Special technique of using water repellent (Room Temperature Vulcanizing) silicone coating/paint has been introduced on high voltage disc Insulators to minimize the outage in power net work in Pakistan. Especially in high pollution areas near chemical factories and near brick kilns etc comparison study of coated and uncoated disc Insulators have been carried out by ESDD (Equal Salt Deposit Density) measurement in salt fog chamber. (author)
A low knee voltage and high breakdown voltage of 4H-SiC TSBS employing poly-Si/Ni Schottky scheme
Kim, Dong Young; Seok, Ogyun; Park, Himchan; Bahng, Wook; Kim, Hyoung Woo; Park, Ki Cheol
2018-02-01
We report a low knee voltage and high breakdown voltage 4H-SiC TSBS employing poly-Si/Ni dual Schottky contacts. A knee voltage was significantly improved from 0.75 to 0.48 V by utilizing an alternative low work-function material of poly-Si as an anode electrode. Also, reverse breakdown voltage was successfully improved from 901 to 1154 V due to a shrunk low-work-function Schottky region by a proposed self-align etching process between poly-Si and SiC. SiC TSBS with poly-Si/Ni dual Schottky scheme is a suitable structure for high-efficiency rectification and high-voltage blocking operation.
Application of high voltage electric field (HVEF) drying technology in potato chips
International Nuclear Information System (INIS)
Bai, Yaxiang; Shi, Hua; Yang, Yaxin
2013-01-01
In order to improve the drying efficiency and qualities of vegetable by high voltage electric field (HVEF), potato chips as a representative of vegetable was dried using a high voltage electric drying systems at 20°C. The shrinkage rate, water absorption and rehydration ratio of dried potato chips were measured. The results indicated that the drying rate of potato chips was significantly improved in the high voltage electric drying systems. The shrinkage rate of potato chips dried by high voltage electric field was 1.1% lower than that by oven drying method. And the rehydration rate of high voltage electric field was 24.6% higher than that by oven drying method. High voltage electric field drying is very advantageous and can be used as a substitute for traditional drying method.
X-ray spectral meter of high voltages for X-ray apparatuses
International Nuclear Information System (INIS)
Zubkov, I.P.; Larchikov, Yu.V.
1993-01-01
Design of the X-ray spectral meter of high voltages (XRSMHV) for medical X-ray apparatuses permitting to conduct the voltage measurements without connection to current circuits. The XRSMHV consists of two main units: the detector unit based on semiconductor detector and the LP4900B multichannel analyzer (Afora, Finland). The XRSMYV was tested using the pilot plant based on RUM-20 X-ray diagnostic apparatus with high-voltage regulator. It was shown that the developed XRSMHV could be certify in the range of high constant voltages form 40 up to 120 kV with the basic relative error limits ±0.15%. The XRSMHV is used at present as the reference means for calibration of high-voltage medical X-ray equipment
An implantable neurostimulator with an integrated high-voltage inductive power-recovery frontend
International Nuclear Information System (INIS)
Wang Yuan; Zhang Xu; Liu Ming; Li Peng; Chen Hongda
2014-01-01
This paper present a highly-integrated neurostimulator with an on-chip inductive power-recovery frontend and high-voltage stimulus generator. In particular, the power-recovery frontend includes a high-voltage full-wave rectifier (up to 100 V AC input), high-voltage series regulators (24/5 V outputs) and a linear regulator (1.8/3.3 V output) with bandgap voltage reference. With the high voltage output of the series regulator, the proposed neurostimulator could deliver a considerably large current in high electrode-tissue contact impedance. This neurostimulator has been fabricated in a CSMC 1 μm 5/40/700 V BCD process and the total silicon area including pads is 5.8 mm 2 . Preliminary tests are successful as the neurostimulator shows good stability under a 13.56 MHz AC supply. Compared to previously reported works, our design has advantages of a wide induced voltage range (26–100 V), high output voltage (up to 24 V) and high-level integration, which are suitable for implantable neurostimulators. (semiconductor integrated circuits)
High voltage diagnostics on electrical insulation of supersonducting magnets
International Nuclear Information System (INIS)
Irmisch, M.
1995-12-01
The high voltage (HV) performance of superconducting magnets of large dimensions, e.g. as needed in fusion reactors, is a challange in the field of high voltage technology, i.e. especially in the field of cryogenic high voltage components and with respect to questions of HV insulation diagnostics at low temperature. By using the development of POLO - a superconducting prototype coil of a tokamak poloidal field coil - as an example, this work deals with special problems of how to get use of conventional HV test techniques for diagnostics under special cryogenic boundary conditions. As a first approach to gain experience in the field of phase resolved partial discharge (PRPD) measurements during operation of a superconductive coil, the POLO coil was subject to several high voltage tests. Compared with DC insulation resistance measurements and capacitive impulse voltage discharges to the coil, the AC PD measurements have been the only way to observe special characteristics of the electrical insulation with respect to the cooling down of the coil from 300 K to 4.2 K. The PRPD measurement technique thereby has proofed as a suitable diagnostic tool. This work can serve as basic data to be comparable within further projects of electrical insulation diagnostics at cryogenic temperatures. (orig.)
Precision High-Voltage DC Dividers and Their Calibration
Czech Academy of Sciences Publication Activity Database
Dragounová, Naděžda
2005-01-01
Roč. 54, č. 5 (2005), s. 1911-1915 ISSN 0018-9456 R&D Projects: GA AV ČR KSK1048102; GA ČR GA202/03/0889 Keywords : calibration * dc voltage * high voltage (HV) Subject RIV: JA - Electronics ; Optoelectronics, Electrical Engineering Impact factor: 0.665, year: 2005
Directory of Open Access Journals (Sweden)
Jonathan Mapelli
2010-05-01
Full Text Available Signal elaboration in the cerebellum mossy fiber input pathway presents controversial aspects, especially concerning gain regulation and the spot-like (rather than beam-like appearance of granular-to-molecular layer transmission. By using voltage-sensitive dye (VSD imaging in rat cerebellar slices (Mapelli et al., 2010, we found that mossy fiber bursts optimally excited the granular layer above ~50 Hz and the overlaying molecular layer above ~100 Hz, thus generating a cascade of high-pass filters. NMDA receptors enhanced transmission in the granular, while GABA-A receptors depressed transmission in both the granular and molecular layer. Burst transmission gain was controlled through a dynamic frequency-dependent involvement of these receptors. Moreover, while high-frequency transmission was enhanced along vertical lines connecting the granular to molecular layer, no high-frequency enhancement was observed along the parallel fiber axis in the molecular layer. This was probably due to the stronger effect of Purkinje cell GABA-A receptor-mediated inhibition occurring along the parallel fibers than along the granule cell axon ascending branch. The consequent amplification of burst responses along vertical transmission lines could explain the spot-like activation of Purkinje cells observed following punctuate stimulation in vivo .
Transmission line component testing for the ITER Ion Cyclotron Heating and Current Drive System
Goulding, Richard; Bell, G. L.; Deibele, C. E.; McCarthy, M. P.; Rasmussen, D. A.; Swain, D. W.; Barber, G. C.; Barbier, C. N.; Cambell, I. H.; Moon, R. L.; Pesavento, P. V.; Fredd, E.; Greenough, N.; Kung, C.
2014-10-01
High power RF testing is underway to evaluate transmission line components for the ITER Ion Cyclotron Heating and Current Drive System. The transmission line has a characteristic impedance Z0 = 50 Ω and a nominal outer diameter of 305 mm. It is specified to carry up to 6 MW at VSWR = 1.5 for 3600 s pulses, with transient voltages up to 40 kV. The transmission line is actively cooled, with turbulent gas flow (N2) used to transfer heat from the inner to outer conductor, which is water cooled. High voltage and high current testing of components has been performed using resonant lines generating steady state voltages of 35 kV and transient voltages up to 60 kV. A resonant ring, which has operated with circulating power of 6 MW for 1 hr pulses, is being used to test high power, low VSWR operation. Components tested to date include gas barriers, straight sections of various lengths, and 90 degree elbows. Designs tested include gas barriers fabricated from quartz and aluminum nitride, and transmission lines with quartz and alumina inner conductor supports. The latest results will be presented. This manuscript has been authored by UT-Battelle, LLC, under Contract No. DE-AC05-00OR22725 with the U.S. Department of Energy.
Process engineering of high voltage alginate encapsulation of mesenchymal stem cells
International Nuclear Information System (INIS)
Gryshkov, Oleksandr; Pogozhykh, Denys; Zernetsch, Holger; Hofmann, Nicola; Mueller, Thomas; Glasmacher, Birgit
2014-01-01
Encapsulation of stem cells in alginate beads is promising as a sophisticated drug delivery system in treatment of a wide range of acute and chronic diseases. However, common use of air flow encapsulation of cells in alginate beads fails to produce beads with narrow size distribution, intact spherical structure and controllable sizes that can be scaled up. Here we show that high voltage encapsulation (≥ 15 kV) can be used to reproducibly generate spherical alginate beads (200–400 μm) with narrow size distribution (± 5–7%) in a controlled manner under optimized process parameters. Flow rate of alginate solution ranged from 0.5 to 10 ml/h allowed producing alginate beads with a size of 320 and 350 μm respectively, suggesting that this approach can be scaled up. Moreover, we found that applied voltages (15–25 kV) did not alter the viability and proliferation of encapsulated mesenchymal stem cells post-encapsulation and cryopreservation as compared to air flow. We are the first who employed a comparative analysis of electro-spraying and air flow encapsulation to study the effect of high voltage on alginate encapsulated cells. This report provides background in application of high voltage to encapsulate living cells for further medical purposes. Long-term comparison and work on alginate–cell interaction within these structures will be forthcoming. - Highlights: • High voltage alginate encapsulation of mesenchymal stem cells (MSCs) was designed. • Reproducible and spherical alginate beads were generated via high voltage. • Air flow encapsulation was utilized as a comparative approach to high voltage. • High voltage did not alter the viability and proliferation of encapsulated MSCs. • High voltage encapsulation can be scaled up and applied in cell-based therapy
High voltage power network construction
Harker, Keith
2018-01-01
This book examines the key requirements, considerations, complexities and constraints relevant to the task of high voltage power network construction, from design, finance, contracts and project management to installation and commissioning, with the aim of providing an overview of the holistic end to end construction task in a single volume.
High Bandwidth Zero Voltage Injection Method for Sensorless Control of PMSM
DEFF Research Database (Denmark)
Ge, Xie; Lu, Kaiyuan; Kumar, Dwivedi Sanjeet
2014-01-01
High frequency signal injection is widely used in PMSM sensorless control system for low speed operations. The conventional voltage injection method often needs filters to obtain particular harmonic component in order to estimate the rotor position; or it requires several voltage pulses to be inj......High frequency signal injection is widely used in PMSM sensorless control system for low speed operations. The conventional voltage injection method often needs filters to obtain particular harmonic component in order to estimate the rotor position; or it requires several voltage pulses...... in a fast current regulation performance. Injection of zero voltage also minimizes the inverter voltage error effects caused by the dead-time....
Characteristics and Breakdown Behaviors of Polysilicon Resistors for High Voltage Applications
Directory of Open Access Journals (Sweden)
Xiao-Yu Tang
2015-01-01
Full Text Available With the rapid development of the power integrated circuit technology, polysilicon resistors have been widely used not only in traditional CMOS circuits, but also in the high voltage applications. However, there have been few detailed reports about the polysilicon resistors’ characteristics, like voltage and temperature coefficients and breakdown behaviors which are critical parameters of high voltage applications. In this study, we experimentally find that the resistance of the polysilicon resistor with a relatively low doping concentration shows negative voltage and temperature coefficients, while that of the polysilicon resistor with a high doping concentration has positive voltage and temperature coefficients. Moreover, from the experimental results of breakdown voltages of the polysilicon resistors, it could be deduced that the breakdown of polysilicon resistors is thermally rather than electrically induced. We also proposed to add an N-type well underneath the oxide to increase the breakdown voltage in the vertical direction when the substrate is P-type doped.
Energy Technology Data Exchange (ETDEWEB)
Barbosa, Flavio Bittencourt; Furtado, Jose G. de Melo [Centro de Pesquisas de Energia Eletrica (CEPEL), Rio de Janeiro, RJ (Brazil); Nobrega, Maria C. de S. [Universidade Federal do Rio de Janeiro (COPPE/UFRJ), RJ (Brazil). Coordenacao dos Programas de Pos-Graduacao de Engenharia
2008-07-01
In this work is studied the electrothermal behavior of varistor ceramic blocks used in high voltage surge arresters of transmission and distribution lines, relating this behavior to microstructural characteristics of the studied varistor ceramics. We studied blocks of zinc oxide varistors with nominal voltage of 4.0 kV, by and voltage-capacitance characterization curves, reference voltage test, impulse residual voltage, polarization tests and induced degradation tests. On the other hand, the microstructural characterization was made by scanning electron microscopy and energy-dispersive spectroscopy. The obtained results allow to correlate the behavior of the resistive component of the leakage current with the microstructural characteristics of the studied varistors, specially in pre-breakdown region. (author)
Digitally Programmable High-Q Voltage Mode Universal Filter
Directory of Open Access Journals (Sweden)
D. Singh
2013-12-01
Full Text Available A new low-voltage low-power CMOS current feedback amplifier (CFA is presented in this paper. This is used to realize a novel digitally programmable CFA (DPCFA using transistor arrays and MOS switches. The proposed realizations nearly allow rail-to-rail swing capability at all the ports. Class-AB output stage ensures low power dissipation and high current drive capability. The proposed CFA/ DPCFA operates at supply voltage of ±0.75 V and exhibits bandwidth better than 95 MHz. An application of the DPCFA to realize a novel voltage mode high-Q digitally programmable universal filter (UF is given. Performances of all the proposed circuits are verified by PSPICE simulation using TSMC 0.25μm technology parameters.
Energy Technology Data Exchange (ETDEWEB)
NONE
2003-12-01
Houilleres du Bassin de Lorraine (HBL) decided to sell their high voltage electricity network to RTE. This takeover by RTE, the French transmission system operator, corresponds to the public service mission entrusted to it by the law of February 10, 2000, concerning the rational distribution of an electricity service in France and the local servicing of customers through the public transmission system.
30 CFR 75.802 - Protection of high-voltage circuits extending underground.
2010-07-01
...-Voltage Distribution § 75.802 Protection of high-voltage circuits extending underground. (a) Except as... 30 Mineral Resources 1 2010-07-01 2010-07-01 false Protection of high-voltage circuits extending... which shall be grounded through a suitable resistor at the source transformers, and a grounding circuit...
Development of high voltage PEEK wire with radiation-resistance and cryogenic characteristics
International Nuclear Information System (INIS)
Fujita, T.; Hirata, T.; Araki, S.; Ohara, H.; Nishimura, H.
1989-01-01
High voltage electric wires insulated with highly-refined polyetheretherketone (PEEK) have been developed for the wiring in fusion reactors, where the wire is required to withstand high voltage under high vacuum up to 10 -5 Torr. The PEEK wires having the advantages of PEEK resin including superior radiation resistance and cryogenic characteristics are usable over a wide range of temperature and in radiation fields. The results of withstand voltage tests proved that the PEEK wires exceeding 0.8 mm in insulation thickness withstand such specified high voltage conditions as 24 kV for 1 minutes by 10 times and 6.6 kV for 110 hours. The results also revealed that the withstand voltage is improved by providing a jacket layer over the insulation and decreased by periodical voltage charge, by bending of the specimen and by water in the conductor. This paper deal with the withstand voltage test results under varied conditions of the PEEK wires. (author)
Directory of Open Access Journals (Sweden)
B. I. Kuznetsov
2018-04-01
Full Text Available Purpose. Development and field experimental research of layout of the single-circuit active screening system of the magnetic field generated by group of high voltage transmission lines in residential area is given. Methodology. Mathematical model of magnetic field, generated by group of high voltage transmission lines in residential area, based of the experimental values of magnetic field flux density in given points on the basis of optimization problem solving is improved. The objective of the synthesis of the single circuit active screening system is to determine their number, configuration, spatial arrangement, wiring diagrams and compensation cables currents, setting algorithm of the control systems as well as the resulting value of the magnetic flux density at the points of the protected space. Synthesis of the full-scale model of active screening system is reduced to the problem of multiobjective nonlinear programming with constraints in which calculation of the objective functions and constraints are carried out on the basis of the Maxwell equations solutions in the quasi-stationary approximation. The problem is solved by a stochastic multiswarm multi-agent particles optimization. Results. The single-circuit active screening system synthesis results for reduction of a magnetic field generated by group of high voltage transmission lines in residential area is given. Field experimental researches of the single-circuit active screening system of the magnetic field generated by group of high voltage transmission lines in residential area with various control algorithms is given. Originality. For the first time out the development and field experimental studies of the single-circuit active screening system of the magnetic field generated by group of high voltage transmission lines in residential area are carried out. Practical value. Practical recommendations on reasonable choice of the spatial arrangement of compensating cables of single
Copper wire theft and high voltage electrical burns
Francis, Eamon C; Shelley, Odhran P
2014-01-01
High voltage electrical burns are uncommon. However in the midst of our economic recession we are noticing an increasing number of these injuries. Copper wire is a valuable commodity with physical properties as an excellent conductor of electricity making it both ubiquitous in society and prized on the black market. We present two consecutive cases referred to the National Burns Unit who sustained life threatening injuries from the alleged theft of high voltage copper wire and its omnipresenc...
Reghu, T; Mandloi, V; Shrivastava, Purushottam
2016-04-01
The design and development of a compact high voltage, high peak power, high frequency transformer for a converter type modulator of klystron amplifiers is presented. The transformer has been designed to operate at a frequency of 20 kHz and at a flux swing of ±0.6 T. Iron (Fe) based nanocrystalline material has been selected as a core for the construction of the transformer. The transformer employs a specially designed solid Teflon bobbin having 120 kV insulation for winding the high voltage secondary windings. The flux swing of the core has been experimentally found by plotting the hysteresis loop at actual operating conditions. Based on the design, a prototype transformer has been built which is per se a unique combination of high voltage, high frequency, and peak power specifications. The transformer was able to provide 58 kV (pk-pk) at the secondary with a peak power handling capability of 700 kVA. The transformation ratio was 1:17. The performance of the transformer is also presented and discussed.
An Integrated Chip High-Voltage Power Receiver for Wireless Biomedical Implants
Directory of Open Access Journals (Sweden)
Vijith Vijayakumaran Nair
2015-06-01
Full Text Available In near-field wireless-powered biomedical implants, the receiver voltage largely overrides the compliance of low-voltage power receiver systems. To limit the induced voltage, generally, low-voltage topologies utilize limiter circuits, voltage clippers or shunt regulators, which are power-inefficient methods. In order to overcome the voltage limitation and improve power efficiency, we propose an integrated chip high-voltage power receiver based on the step down approach. The topology accommodates voltages as high as 30 V and comprises a high-voltage semi-active rectifier, a voltage reference generator and a series regulator. Further, a battery management circuit that enables safe and reliable implant battery charging based on analog control is proposed and realized. The power receiver is fabricated in 0.35-μm high-voltage Bipolar-CMOS-DMOStechnology based on the LOCOS0.35-μm CMOS process. Measurement results indicate 83.5% power conversion efficiency for a rectifier at 2.1 mA load current. The low drop-out regulator based on the current buffer compensation and buffer impedance attenuation scheme operates with low quiescent current, reduces the power consumption and provides good stability. The topology also provides good power supply rejection, which is adequate for the design application. Measurement results indicate regulator output of 4 ± 0.03 V for input from 5 to 30 V and 10 ± 0.05 V output for input from 11 to 30 V with load current 0.01–100 mA. The charger circuit manages the charging of the Li-ion battery through all if the typical stages of the Li-ion battery charging profile.
Energy Technology Data Exchange (ETDEWEB)
Yan, Pengfei; Zheng, Jianming; Kuppan, Saravanan; Li, Qiuyan; Lv, Dongping; Xiao, Jie; Chen, Guoying; Zhang, Jiguang; Wang, Chong M.
2015-11-10
Immersion of a solid into liquid often leads to the modification of both the structure and chemistry of surface of the solid, which subsequently affects the chemical and physical properties of the system. For the case of the rechargeable lithium ion battery, such a surface modification is termed as solid electrolyte interphase (SEI) layer, which has been perceived to play critical role for the stable operation of the batteries. However, the structure and chemical composition of SEI layer and its spatial distribution and dependence on the battery operating condition remain unclear. By using aberration corrected scanning transmission electron microscopy coupled with ultra-high sensitive energy dispersive x-ray spectroscopy, we probed the structure and chemistry of SEI layer on several high voltage cathodes. We show that layer-structured cathodes, when cycled at a high cut off voltage, can form a P-rich SEI layer on their surface, which is a direct evidence of Li-salt (LiPF6) decomposition. Our systematical investigations indicate such cathode/Li-salt side reaction shows strong dependence on structure of the cathode materials, operating voltage and temperature, indicating the feasibility of SEI engineering. These findings provide us valuable insights into the complex interface between the high-voltage cathode and the electrolyte.
International Nuclear Information System (INIS)
Thaker, Urmil; Saurabh Kumar; Amal, S.; Baruah, U.K.; Bhatt, Animesh
2015-01-01
A High Voltage center tapped transformer for high frequency application had been designed, fabricated, and tested. It was designed as a part of 200 kV HVDC Test Generator. The High Frequency operation of transformer increases power density. Therefore it is possible to reduce power supply volume. The step up ratio in High Voltage transformer is limited due to stray capacitance and leakage inductance. The limit was overcome by winding multi secondary outputs. Switching frequency of transformer was 15.8 kHz. Input and output voltages of transformer were 270V and 16.5kV-0V-16.5kV respectively. Power rating of transformer is 7kVA. High Voltage transformer with various winding and core arrangement was fabricated to check variation in electrical characteristics. The transformer used a ferrite core (E Type) and nylon insulated primary and secondary bobbins. Two set of E-E geometry cores had been stacked in order to achieve the estimated core volume. Compared with traditional high voltage transformer, this transformer had good thermal behavior, good line insulation properties and a high power density. In this poster, design procedures, development stages and test results of high voltage and high frequency transformer are presented. Results of various parameters such as transformer loss, temperature rise, insulation properties, impedance of primary and secondary winding, and voltage regulation are discussed. (author)
Innovation of High Voltage Supply Adjustment Device on Diagnostic X-Ray Machine
International Nuclear Information System (INIS)
Sujatno; Wiranto Budi Santoso
2010-01-01
Innovation of high voltage supply adjustment device on diagnostic x-ray machine has been carried out. The innovation is conducted by utilizing an electronic circuit as a high voltage adjustment device. Usually a diagnostic x-ray machine utilizes a transformer or an auto-transformer as a high voltage supply adjustment device. A high power diagnostic x-ray machine needs a high power transformer which has big physical dimension. Therefore a box control where the transformer is located has to have big physical dimension. Besides, the price of the transformer is expensive and hardly found in local markets. In this innovation, the transformer is replaced by an electronic circuit. The main component of the electronic circuit is Triac BTA-40. As adjustment device, the triac is controlled by a variable resistor which is coupled by a stepper motor. A step movement of stepper motor varies a value of resistor. The resistor value determines the triac gate voltage. Furthermore the triac will open according to the value of electrical current flowing to the gate. When the gate is open, electrical voltage and current will flow from cathode to anode of the triac. The value of these electrical voltage and current depend on gate open condition. Then this triac output voltage is feed to diagnostic x-ray machine high voltage supply. Therefore the high voltage value of diagnostic x-ray machine is adjusted by the output voltage of the electronic circuit. By using this electronic circuit, the physical dimension of diagnostic x-ray machine box control and the price of the equipment can be reduced. (author)
Energy Technology Data Exchange (ETDEWEB)
Sayers, D P
1960-05-01
After briefly tracing the history of electricity transmission, trends in high voltage transmission and experiments being conducted on 650 kV are discussed. 5000 miles of the U.K. grid are operated at 132 kV and 1000 at 275 kV, ultimately to provide a super grid at 380 kV. Problems are insulation, radio interference and the cost of underground lines (16 times that of overhead lines). Also considered are the economics of the grid as a means of transporting energy and as a means of spreading the peak load over the power stations in the most efficient manner. Finally, the question of amenities is discussed.
A Four-Phase High Voltage Conversion Ratio Bidirectional DC-DC Converter for Battery Applications
Directory of Open Access Journals (Sweden)
Li-Kun Xue
2015-06-01
Full Text Available This study presents a four-phase interleaved high voltage conversion ratio bidirectional DC-DC converter circuit based on coupled inductors and switched capacitors, which can eliminate the defects of conventional high voltage conversion ratio bidirectional DC-DC converters in terms of high-voltage/current stress, less efficiency and low-power limitation. Parallel channels are used to reduce current stress at the low-voltage side and series connected switched capacitors are used to enlarge voltage conversion ratio, reduce voltage stress and achieve auto current sharing. This paper proposes the operation principle, feature analysis and optimization design considerations. On this basis the objectives of high voltage conversion ratio, low voltage/current stress, high power density, high efficiency and high-power applications can be achieved. Some experimental results based on a 500 W prototype converter (24 V to 48 V at low-voltage side, 400 V at high-voltage side are given to verify the theoretical analysis and the effectiveness of the proposed converter.
Copper wire theft and high voltage electrical burns.
Francis, Eamon C; Shelley, Odhran P
2014-01-01
High voltage electrical burns are uncommon. However in the midst of our economic recession we are noticing an increasing number of these injuries. Copper wire is a valuable commodity with physical properties as an excellent conductor of electricity making it both ubiquitous in society and prized on the black market. We present two consecutive cases referred to the National Burns Unit who sustained life threatening injuries from the alleged theft of high voltage copper wire and its omnipresence on an international scale.
Temperature Stabilized Characterization of High Voltage Power Supplies
Krarup, Ole
2017-01-01
High precision measurements of the masses of nuclear ions in the ISOLTRAP experiment relies on an MR-ToF. A major source of noise and drift is the instability of the high voltage power supplies employed. Electrical noise and temperature changes can broaden peaks in time-of-flight spectra and shift the position of peaks between runs. In this report we investigate how the noise and drift of high-voltage power supplies can be characterized. Results indicate that analog power supplies generally have better relative stability than digitally controlled ones, and that the high temperature coefficients of all power supplies merit efforts to stabilize them.
Energy Technology Data Exchange (ETDEWEB)
Radtke, U. [PreussenElektra AG, Hannover (Germany)
1998-12-31
High-voltage DC transmission is a world-wide established technology for low-cost transmission of large amounts of electricity over long distances. Thanks to HVDC transmission, large amounts of electricity can now for the first time also be transmitted over long distances via ocean cable, something that cannot be done with AC power cables. HVDC transmission is independent of grid frequencies and can link grids of different frequency and different quality of frequency. Interconnected grids coupled via DC circuits can exploit additional technical and economic advantages such as mutual supply of power reserves, balancing of peak load, and modulation of active and reactive power. (orig.) [Deutsch] Die Hochspannungs-Gleichstromuebertragung (HGUe) ist eine weltweit etablierte Technik zur kostenguenstigen Uebertragung grosser elektrischer Leistungen ueber grosse Entfernungen. Sie schafft erstmals die Moeglichkeit, auch mittels Seekabel grosse Leistungen ueber Entfernungen zu uebertragen, die mit der Drehstromtechnik nicht moeglich sind. HGUeist unabhaengig von den Netzfrequenzen und kann Netze unterschiedlicher Frequenz und Frequenzguete miteinander verbinden. Ueber Gleichstromkreise gekuppelte Verbundnetze koennen zusaetzliche technische und wirtschaftliche Vorteile wie gegenseitige Bereitstellung von Kraftwerksreserven, Spitzenlastausgleich sowie Wirk- und Blindleistungsmodulation nutzt. (orig.)
A High Voltage Swing 1.9 GHz PA in Standard CMOS
Aartsen, W.A.J.; Annema, Anne J.; Nauta, Bram
2002-01-01
A circuit technique for RF power amplifiers that reliably handle voltage peaks well above the nominal supply voltage is presented. To achieve this high-voltage tolerance the circuit implements switched-cascode transistors that yield reliable operation for voltages up to 7V at RF frequencies in a
High voltage series protection of neutral injectors with crossed-field tubes
International Nuclear Information System (INIS)
Hofmann, G.A.; Thomas, D.G.
1976-01-01
High voltage neutral beam injectors for fusion machines require either parallel or series protection schemes to limit fault currents in case of arcing to safe levels. The protection device is usually located between the high voltage supply and beam injector and either crowbars (parallel protection) or disconnects (series protection) the high voltage supply when a fault occurs. Because of its isolating property, series protection is preferred. The Hughes crossed-field tube is uniquely suited for series protection schemes. The tube can conduct 40 A continuously upon application of voltage (approximately 300 V) and a static magnetic field (approximately 100 G). It is also capable of interrupting currents of 1000 A within 10 μs and withstand voltage of more than 120 kV. Experiments were performed to simulate the duty of a crossed-field tube as a series protection element in a neutral injector circuit under fault conditions. Results of on-switching tests under high and low voltage and interruption of fault currents are presented. An example of a possible protection circuit with crossed-field tubes is discussed
High-voltage pixel sensors for ATLAS upgrade
Energy Technology Data Exchange (ETDEWEB)
Perić, I., E-mail: ivan.peric@ziti.uni-heidelberg.de [Heidelberg University, Institute of Computer Engineering, Mannheim (Germany); Kreidl, C.; Fischer, P. [Heidelberg University, Institute of Computer Engineering, Mannheim (Germany); Bompard, F.; Breugnon, P.; Clemens, J.-C.; Fougeron, D.; Liu, J.; Pangaud, P.; Rozanov, A.; Barbero, M. [CPPM, Marseille (France); Feigl, S.; Capeans, M.; Ferrere, D.; Pernegger, H.; Ristic, B. [CERN, Geneve (Switzerland); Muenstermann, D.; Gonzalez Sevilla, S.; La Rosa, A.; Miucci, A. [University of Geneve (Switzerland); and others
2014-11-21
The high-voltage (HV-) CMOS pixel sensors offer several good properties: a fast charge collection by drift, the possibility to implement relatively complex CMOS in-pixel electronics and the compatibility with commercial processes. The sensor element is a deep n-well diode in a p-type substrate. The n-well contains CMOS pixel electronics. The main charge collection mechanism is drift in a shallow, high field region, which leads to a fast charge collection and a high radiation tolerance. We are currently evaluating the use of the high-voltage detectors implemented in 180 nm HV-CMOS technology for the high-luminosity ATLAS upgrade. Our approach is replacing the existing pixel and strip sensors with the CMOS sensors while keeping the presently used readout ASICs. By intelligence we mean the ability of the sensor to recognize a particle hit and generate the address information. In this way we could benefit from the advantages of the HV sensor technology such as lower cost, lower mass, lower operating voltage, smaller pitch, smaller clusters at high incidence angles. Additionally we expect to achieve a radiation hardness necessary for ATLAS upgrade. In order to test the concept, we have designed two HV-CMOS prototypes that can be readout in two ways: using pixel and strip readout chips. In the case of the pixel readout, the connection between HV-CMOS sensor and the readout ASIC can be established capacitively.
High-voltage short-fall pulse generator
International Nuclear Information System (INIS)
Dolbilov, G.V.; Fateev, A.A.; Petrov, V.A.
1986-01-01
Powerful high-voltage pulses with short fall times and relatively low afterpulse amplitude are required for the deflection systems of accelerators. A generator is described that provides, into a 75-ohm load, a voltage pulse of up to 100 kV with a fall time of less than 1 nsec and a relative afterpulse amplitude of less than or equal to 15%. The generator employs a short-circuited ferrite-filled line in which shock waves are formed. A magnetic section is used to increase power. The switch is a TGI1-2500/50 thyratron. The main causes of afterpulses and methods for reducing their amplitude are examined
Copper wire theft and high voltage electrical burns
Francis, Eamon C; Shelley, Odhran P
2014-01-01
High voltage electrical burns are uncommon. However in the midst of our economic recession we are noticing an increasing number of these injuries. Copper wire is a valuable commodity with physical properties as an excellent conductor of electricity making it both ubiquitous in society and prized on the black market. We present two consecutive cases referred to the National Burns Unit who sustained life threatening injuries from the alleged theft of high voltage copper wire and its omnipresence on an international scale. PMID:25356371
Microparticles in high-voltage accelerator tubes
International Nuclear Information System (INIS)
Griffith, G.L.; Eastham, D.A.
1979-01-01
Microparticles with radii greater than 2 μm have been observed in a high voltage vacuum accelerator tube. The charge acquired by most of the particles is similar to the contact charging of a conducting sphere on a plane. (author)
High voltage and high specific capacity dual intercalating electrode Li-ion batteries
West, William C. (Inventor); Blanco, Mario (Inventor)
2010-01-01
The present invention provides high capacity and high voltage Li-ion batteries that have a carbonaceous cathode and a nonaqueous electrolyte solution comprising LiF salt and an anion receptor that binds the fluoride ion. The batteries can comprise dual intercalating electrode Li ion batteries. Methods of the present invention use a cathode and electrode pair, wherein each of the electrodes reversibly intercalate ions provided by a LiF salt to make a high voltage and high specific capacity dual intercalating electrode Li-ion battery. The present methods and systems provide high-capacity batteries particularly useful in powering devices where minimizing battery mass is important.
Response analysis on nonuniform transmission line
Directory of Open Access Journals (Sweden)
Cvetković Zlata
2005-01-01
Full Text Available Transients on a loss less exponential transmission line with a pure resistance load are presented in this paper. The approach is based on the two-port presentation of the transmission line. Using Picard-Carson's method the transmission line equations are solved. The relationship between source voltage and the load voltage in s-domain is derived. All the results are plotted using program package Mathematica 3.0.
An inverted-geometry, high voltage polarized electron gun with UHV load lock
International Nuclear Information System (INIS)
Breidenbach, M.; Foss, M.; Hodgson, J.; Kulikov, A.; Odian, A.; Putallaz, G.; Rogers, H.; Schindler, R.; Skarpaas, K.; Zolotorev, M.
1994-01-01
The design of a high voltage electron source with a GaAs photocathode and a load lock system is described. The inverted high voltage structure of the gun permits a compact and simple design. Test results demonstrate that the load lock system provides a reliable way to achieve high quantum efficiency of the photocathode in a high voltage device. ((orig.))
Integrated reconfigurable high-voltage transmitting circuit for CMUTs
DEFF Research Database (Denmark)
Llimos Muntal, Pere; Larsen, Dennis Øland; Jørgensen, Ivan Harald Holger
2015-01-01
In this paper a high-voltage transmitting circuit aimed for capacitive micromachined ultrasonic transducers (CMUTs) used in scanners for medical applications is designed and implemented in a 0.35 μm high-voltage CMOS process. The transmitting circuit is reconfigurable externally making it able...... to drive a wide variety of CMUTs. The transmitting circuit can generate several pulse shapes with voltages up to 100 V, maximum pulse range of 50 V, frequencies up to 5 MHz and different driving slew rates. Measurements are performed on the circuit in order to assess its functionality and power consumption...... performance. The design occupies an on-chip area of 0.938 mm2 and the power consumption of a 128-element transmitting circuit array that would be used in an portable ultrasound scanner is found to be a maximum of 181 mW....
STUDY ON PERFORMANCE OF 21M 132kV TRANSMISSION TOWER WITH MEDIUM WIND INTENSITY
V. LAKSHMI; A. RAJAGOPALA RAO
2012-01-01
Electric Power is today playing an increasingly important role in the life of the community. In the electric power system the production and transmission of power are two predominant factors. For the purpose of transmission of electricity towers are the main medium with some wires at required distances and altitudes. The remotehydroelectric power plants have given rise to the need for extra high voltage. Prior to 1950, 150 kV electric transmission lines were considered and still higher voltag...
Transmission line pulse system for avalanche characterization of high power semiconductor devices
Riccio, Michele; Ascione, Giovanni; De Falco, Giuseppe; Maresca, Luca; De Laurentis, Martina; Irace, Andrea; Breglio, Giovanni
2013-05-01
Because of the increasing in power density of electronic devices for medium and high power application, reliabilty of these devices is of great interest. Understanding the avalanche behaviour of a power device has become very important in these last years because it gives an indication of the maximum energy ratings which can be seen as an index of the device ruggedness. A good description of this behaviour is given by the static IV blocking characteristc. In order to avoid self heating, very relevant in high power devices, very short pulses of current have to be used, whose value can change from few milliamps up to tens of amps. The most used method to generate short pulses is the TLP (Transmission Line Pulse) test, which is based on charging the equivalent capacitance of a transmission line to high value of voltage and subsequently discharging it onto a load. This circuit let to obtain very short square pulses but it is mostly used for evaluate the ESD capability of semiconductor and, in this environment, it generates pulses of low amplitude which are not high enough to characterize the avalanche behaviour of high power devices . Advanced TLP circuit able to generate high current are usually very expensive and often suffer of distorption of the output pulse. In this article is proposed a simple, low cost circuit, based on a boosted-TLP configuration, which is capable to produce very square pulses of about one hundreds of nanosecond with amplitude up to some tens of amps. A prototype is implemented which can produce pulses up to 20A of amplitude with 200 ns of duration which can characterize power devices up to 1600V of breakdown voltage. Usage of microcontroller based logic make the circuit very flexible. Results of SPICE simulation are provided, together with experimental results. To prove the effectiveness of the circuit, the I-V blocking characteristics of two commercial devices, namely a 600V PowerMOS and a 1200V Trench-IGBT, are measured at different
The research of high voltage switchgear detecting unit
Ji, Tong; Xie, Wei; Wang, Xiaoqing; Zhang, Jinbo
2017-07-01
In order to understand the status of the high voltage switch in the whole life circle, you must monitor the mechanical and electrical parameters that affect device health. So this paper gives a new high voltage switchgear detecting unit based on ARM technology. It can measure closing-opening mechanical wave, storage motor current wave and contactor temperature to judge the device’s health status. When something goes wrong, it can be on alert and give some advice. The practice showed that it can meet the requirements of circuit breaker mechanical properties temperature online detection.
Design of auto-control high-voltage control system of pulsed neutron generator
International Nuclear Information System (INIS)
Lv Juntao
2008-01-01
It is difficult to produce multiple anode controlling time sequences under different logging mode for the high-voltage control system of the conventional pulsed neutron generator. It is also difficult realize sequential control among anode high-voltage, filament power supply and target voltage to make neutron yield stable. To these problems, an auto-control high-voltage system of neutron pulsed generator was designed. It not only can achieve anode high-voltage double blast time sequences, which can measure multiple neutron blast time sequences such as Σ, activated spectrum, etc. under inelastic scattering mode, but also can realize neutron generator real-time measurement of multi-state parameters and auto-control such as target voltage pulse width modulation (PWM), filament current, anode current, etc., there by it can produce stable neutron yield and realize stable and accurate measurement of the pulsed neutron full spectral loging tool. (authors)
High voltage switch triggered by a laser-photocathode subsystem
Chen, Ping; Lundquist, Martin L.; Yu, David U. L.
2013-01-08
A spark gap switch for controlling the output of a high voltage pulse from a high voltage source, for example, a capacitor bank or a pulse forming network, to an external load such as a high gradient electron gun, laser, pulsed power accelerator or wide band radar. The combination of a UV laser and a high vacuum quartz cell, in which a photocathode and an anode are installed, is utilized as triggering devices to switch the spark gap from a non-conducting state to a conducting state with low delay and low jitter.
Guinea_WADC00320_ADBG_Guinea_Electricity_Transmission_Network
United Nations Cartographic Section — Data for medium and high voltage transmission lines were compiled for the AICD study led by the World Bank. A variety of sources were consulted, including regional...
Offshore VSC-HVDC Networks : Impact on Transient Stability of AC Transmission Systems
van der Meer, A.A.
2017-01-01
The transition towards a sustainable society calls for the massive deployment of renewable energy sources such as large wind parks located far offshore. High-voltage direct current transmission based on voltage sourced converter technology (VSC-HVDC) offers a wide range of technological benefits
Wireless data transmission from inside electromagnetic fields.
Huertas, José Ignacio; Barraza, Roberto; Echeverry, Julian Mauricio
2010-01-01
This paper describes analytical and experimental work developed to evaluate the effects of the electromagnetic fields produced by high-voltage lines (400 kV) on wireless data transmission at the 900MHz band. In this work the source of the data transmission is located inside the electromagnetic field and the reception station is located at different distances from the power lines. Different atmospheric conditions are considered.
BEHAVIOUR OF BACKFILL MATERIALS FOR ELECTRICAL GROUNDING SYSTEMS UNDER HIGH VOLTAGE CONDITIONS
Directory of Open Access Journals (Sweden)
S. C. LIM
2015-06-01
Full Text Available Backfill materials like Bentonite and cement are effective in lowering grounding resistance of electrodes for a considerable period. During lightning, switching impulses and earth fault occurrences in medium and high voltage networks, the grounding system needs to handle extremely high currents either for a short duration or prolonged period respectively. This paper investigates the behaviour of bentonite, cement and sand under impulse and alternating high voltage (50Hz conditions. Fulguritic-formation was observed in all materials under alternating high voltage. The findings reveal that performance of grounding systems under high voltage conditions may significantly change from the outcomes anticipated at design stage.
High frequency breakdown voltage
International Nuclear Information System (INIS)
Chu, Thanh Duy.
1992-03-01
This report contains information about the effect of frequency on the breakdown voltage of an air gap at standard pressure and temperature, 76 mm Hg and O degrees C, respectively. The frequencies of interest are 47 MHz and 60 MHz. Additionally, the breakdown in vacuum is briefly considered. The breakdown mechanism is explained on the basis of collision and ionization. The presence of the positive ions produced by ionization enhances the field in the gap, and thus determines the breakdown. When a low-frequency voltage is applied across the gap, the breakdown mechanism is the same as that caused by the DC or static voltage. However, when the frequency exceeds the first critical value f c , the positive ions are trapped in the gap, increasing the field considerably. This makes the breakdown occur earlier; in other words, the breakdown voltage is lowered. As the frequency increases two decades or more, the second critical frequency, f ce , is reached. This time the electrons start being trapped in the gap. Those electrons that travel multiple times across the gap before reaching the positive electrode result in an enormous number of electrons and positive ions being present in the gap. The result is a further decrease of the breakdown voltage. However, increasing the frequency does not decrease the breakdown voltage correspondingly. In fact, the associated breakdown field intensity is almost constant (about 29 kV/cm).The reason is that the recombination rate increases and counterbalances the production rate, thus reducing the effect of the positive ions' concentration in the gap. The theory of collision and ionization does not apply to the breakdown in vacuum. It seems that the breakdown in vacuum is primarily determined by the irregularities on the surfaces of the electrodes. Therefore, the effect of frequency on the breakdown, if any, is of secondary importance
High voltage calibration of the TANSY-KM5 neutron detectors
International Nuclear Information System (INIS)
Grosshoeg, G.; Belle, P. van; Wilson, D.
1996-11-01
We have developed a procedure for the high voltage calibration of the TANSY neutron detectors. The procedure is based on the work done during the construction of the spectrometer. A program is written for the measurement of the sensitivity of the neutron detectors as a function of the high voltage. The data are transferred to a PC for evaluation. We use a Cobalt source for the calibration. With the PC the voltage corresponding to the effective Compton edge is found. The voltage settings for the neutron detectors are calculated and stored in a file suitable for input to a program that is used to control the instrument. A measurement is reported that shows that the reproducibility of the measurement is good. 4 refs
Lithium-Ion Electrolytes with Improved Safety Tolerance to High Voltage Systems
Smart, Marshall C. (Inventor); Bugga, Ratnakumar V. (Inventor); Prakash, Surya G. (Inventor); Krause, Frederick C. (Inventor)
2015-01-01
The invention discloses various embodiments of electrolytes for use in lithium-ion batteries, the electrolytes having improved safety and the ability to operate with high capacity anodes and high voltage cathodes. In one embodiment there is provided an electrolyte for use in a lithium-ion battery comprising an anode and a high voltage cathode. The electrolyte has a mixture of a cyclic carbonate of ethylene carbonate (EC) or mono-fluoroethylene carbonate (FEC) co-solvent, ethyl methyl carbonate (EMC), a flame retardant additive, a lithium salt, and an electrolyte additive that improves compatibility and performance of the lithium-ion battery with a high voltage cathode. The lithium-ion battery is charged to a voltage in a range of from about 2.0 V (Volts) to about 5.0 V (Volts).
A microcontroller application as X-ray machine's high voltage controller
International Nuclear Information System (INIS)
Wiranto Budi Santoso; Beny Syawaludin
2010-01-01
A micro controller application as x-ray machine's high voltage controller has been carried out. The purpose of this micro controller application is to give an accurate high voltage supply to the x-ray tube so that the x-ray machine could produce the result as expected. The micro controller based X-ray machine's high voltage controller receives an input voltage from the keypad. This input value is displayed in the LCD (Liquid Crystal Display) screen. Then micro controller uses this input data to drive a stepper motor. The stepper motor adjusts the high voltage auto transformer's output according to the input value. The micro controller is programmed using BASCOM-8051 compiler. The test results show that the stepper motor could rotate according to an input value (author)
Advances in high voltage engineering
Haddad, A
2005-01-01
This book addresses the very latest research and development issues in high voltage technology and is intended as a reference source for researchers and students in the field, specifically covering developments throughout the past decade. This unique blend of expert authors and comprehensive subject coverage means that this book is ideally suited as a reference source for engineers and academics in the field for years to come.
Compact, Lightweight, High Voltage Propellant Isolators, Phase II
National Aeronautics and Space Administration — TA&T, Inc. proposes an enabling fabrication process for high voltage isolators required in high power solar electric and nuclear electric propulsion (SEP and...
Li, Jiangtao; Zhao, Zheng; Li, Longjie; He, Jiaxin; Li, Chenjie; Wang, Yifeng; Su, Can
2017-09-01
A transmission line transformer has potential advantages for nanosecond pulse generation including excellent frequency response and no leakage inductance. The wave propagation process in a secondary mode line is indispensable due to an obvious inside transient electromagnetic transition in this scenario. The equivalent model of the transmission line transformer is crucial for predicting the output waveform and evaluating the effects of magnetic cores on output performance. However, traditional lumped parameter models are not sufficient for nanosecond pulse generation due to the natural neglect of wave propagations in secondary mode lines based on a lumped parameter assumption. In this paper, a distributed parameter model of transmission line transformer was established to investigate wave propagation in the secondary mode line and its influential factors through theoretical analysis and experimental verification. The wave propagation discontinuity in the secondary mode line induced by magnetic cores is emphasized. Characteristics of the magnetic core under a nanosecond pulse were obtained by experiments. Distribution and formation of the secondary mode current were determined for revealing essential wave propagation processes in secondary mode lines. The output waveform and efficiency were found to be affected dramatically by wave propagation discontinuity in secondary mode lines induced by magnetic cores. The proposed distributed parameter model was proved more suitable for nanosecond pulse generation in aspects of secondary mode current, output efficiency, and output waveform. In depth, comprehension of underlying mechanisms and a broader view of the working principle of the transmission line transformer for nanosecond pulse generation can be obtained through this research.
Energy Technology Data Exchange (ETDEWEB)
Krieger, A., E-mail: kriegea@uni-mainz.d [Institut fuer Kernchemie, Johannes Gutenberg, Universitaet Mainz, Fritz-Strassmann-Weg 2, 55128 Mainz (Germany); Geppert, Ch. [Institut fuer Kernchemie, Johannes Gutenberg, Universitaet Mainz, Fritz-Strassmann-Weg 2, 55128 Mainz (Germany); GSI Helmholtzzentrum fuer Schwerionenforschung, 64291 Darmstadt (Germany); Catherall, R. [CERN, CH-1211 Geneve 23 (Switzerland); Hochschulz, F. [Institut fuer Kernphysik, Universitaet Muenster, 48149 Muenster (Germany); Kraemer, J.; Neugart, R. [Institut fuer Kernchemie, Johannes Gutenberg, Universitaet Mainz, Fritz-Strassmann-Weg 2, 55128 Mainz (Germany); Rosendahl, S. [Institut fuer Kernphysik, Universitaet Muenster, 48149 Muenster (Germany); Schipper, J.; Siesling, E. [CERN, CH-1211 Geneve 23 (Switzerland); Weinheimer, Ch. [Institut fuer Kernphysik, Universitaet Muenster, 48149 Muenster (Germany); Yordanov, D.T. [Max-Planck-Institut fuer Kernphysik, 69117 Heidelberg (Germany); Noertershaeuser, W. [Institut fuer Kernchemie, Johannes Gutenberg, Universitaet Mainz, Fritz-Strassmann-Weg 2, 55128 Mainz (Germany); GSI Helmholtzzentrum fuer Schwerionenforschung, 64291 Darmstadt (Germany)
2011-03-11
A high-voltage divider with accuracy at the ppm level and collinear laser spectroscopy were used to calibrate the high-voltage installation at the radioactive ion beam facility ISOLDE at CERN. The accurate knowledge of this voltage is particularly important for collinear laser spectroscopy measurements. Beam velocity measurements using frequency-comb based collinear laser spectroscopy agree with the new calibration. Applying this, one obtains consistent results for isotope shifts of stable magnesium isotopes measured using collinear spectroscopy and laser spectroscopy on laser-cooled ions in a trap. The long-term stability and the transient behavior during recovery from a voltage dropout were investigated for the different power supplies currently applied at ISOLDE.
Fast response double series resonant high-voltage DC-DC converter
International Nuclear Information System (INIS)
Lee, S S; Iqbal, S; Kamarol, M
2012-01-01
In this paper, a novel double series resonant high-voltage dc-dc converter with dual-mode pulse frequency modulation (PFM) control scheme is proposed. The proposed topology consists of two series resonant tanks and hence two resonant currents flow in each switching period. Moreover, it consists of two high-voltage transformer with the leakage inductances are absorbed as resonant inductor in the series resonant tanks. The secondary output of both transformers are rectified and mixed before supplying to load. In the resonant mode operation, the series resonant tanks are energized alternately by controlling two Insulated Gate Bipolar Transistor (IGBT) switches with pulse frequency modulation (PFM). This topology operates in discontinuous conduction mode (DCM) with all IGBT switches operating in zero current switching (ZCS) condition and hence no switching loss occurs. To achieve fast rise in output voltage, a dual-mode PFM control during start-up of the converter is proposed. In this operation, the inverter is started at a high switching frequency and as the output voltage reaches 90% of the target value, the switching frequency is reduced to a value which corresponds to the target output voltage. This can effectively reduce the rise time of the output voltage and prevent overshoot. Experimental results collected from a 100-W laboratory prototype are presented to verify the effectiveness of the proposed system.
Technical Training Seminar: Low-Voltage Differential Signaling (LVDS): Technology and Applications
Monique Duval
2004-01-01
Tuesday 26 October TECHNICAL TRAINING SEMINAR from 14:00 to 16:30, Auditorium 40-SS-C01 Low-Voltage Differential Signaling (LVDS): Technology and Applications Herbert Eisenring, Kai Peters / NATIONAL SEMICONDUCTOR (Europe) National Semiconductor pioneered the Low-Voltage Differential Signaling (LVDS) technology, and is a recognized leader in high speed differential products and design tools. National Semiconductor offers a wide range of innovative, affordable interconnect solutions including serializer-deserializers (SerDes), drivers-receivers-transceivers, crosspoint switches and clock drivers. LVDS is a new technology addressing the needs of todays high performance data transmission applications, and the LVDS standard is becoming the most popular differential data transmission standard in the industry. This Technical Training Seminar will present National Semiconductor existing and future products, and some applications relevant to the activities carried out at CERN. 14:00 - 14:15 Presentation of Nati...
Technical Training Seminar: Low-Voltage Differential Signaling (LVDS): Technology and Applications
Monique Duval
2004-01-01
Tuesday 26 October TECHNICAL TRAINING SEMINAR from 14:00 to 16:30, Auditorium 40-SS-C01 Low-Voltage Differential Signaling (LVDS): Technology and Applications Herbert Eisenring, Kai Peters / NATIONAL SEMICONDUCTOR (Europe) National Semiconductor pioneered the Low-Voltage Differential Signaling (LVDS) technology, and is a recognized leader in high speed differential products and design tools. National Semiconductor offers a wide range of innovative, affordable interconnect solutions including serializer-deserializers (SerDes), drivers-receivers-transceivers, crosspoint switches and clock drivers. LVDS is a new technology addressing the needs of todays high performance data transmission applications, and the LVDS standard is becoming the most popular differential data transmission standard in the industry. This Technical Training Seminar will present National Semiconductor existing and future products, and some applications relevant to the activities carried out at CERN. 14:00 - 14:15 Presentation of Nat...
Advances in high voltage insulation and arc interruption in SF6 and vacuum
Maller, V N
1982-01-01
Advances in High Voltage Insulation and Arc Interruption in SF6 and Vacuum deals with high voltage breakdown and arc extinction in sulfur hexafluoride (SF6) and high vacuum, with special emphasis on the application of these insulating media in high voltage power apparatus and devices. The design and developmental aspects of various high voltage power apparatus using SF6 and high vacuum are highlighted. This book is comprised of eight chapters and opens with a discussion on electrical discharges in SF6 and high vacuum, along with the properties and handling of SF6 gas. The following chapters fo
Regional study on investment for transmission infrastructure in China based on the State Grid data
Wei, Wendong; Wu, Xudong; Wu, Xiaofang; Xi, Qiangmin; Ji, Xi; Li, Guoping
2017-03-01
Transmission infrastructure is an integral component of safeguarding the stability of electricity delivery. However, existing studies of transmission infrastructure mostly rely on a simple review of the network, while the analysis of investments remains rudimentary. This study conducted the first regionally focused analysis of investments in transmission infrastructure in China to help optimize its structure and reduce investment costs. Using State Grid data, the investment costs, under various voltages, for transmission lines and transformer substations are calculated. By analyzing the regional profile of cumulative investment in transmission infrastructure, we assess correlations between investment, population, and economic development across the regions. The recent development of ultra-high-voltage transmission networks will provide policy-makers new options for policy development.
Adell, Philippe C.; Mojarradi, Mohammad; DelCastillo, Linda Y.; Vo, Tuan A.
2011-01-01
A paper discusses the successful development of a miniaturized radiation hardened high-voltage switching module operating at 2.5 kV suitable for space application. The high-voltage architecture was designed, fabricated, and tested using a commercial process that uses a unique combination of 0.25 micrometer CMOS (complementary metal oxide semiconductor) transistors and high-voltage lateral DMOS (diffusion metal oxide semiconductor) device with high breakdown voltage (greater than 650 V). The high-voltage requirements are achieved by stacking a number of DMOS devices within one module, while two modules can be placed in series to achieve higher voltages. Besides the high-voltage requirements, a second generation prototype is currently being developed to provide improved switching capabilities (rise time and fall time for full range of target voltages and currents), the ability to scale the output voltage to a desired value with good accuracy (few percent) up to 10 kV, to cover a wide range of high-voltage applications. In addition, to ensure miniaturization, long life, and high reliability, the assemblies will require intensive high-voltage electrostatic modeling (optimized E-field distribution throughout the module) to complete the proposed packaging approach and test the applicability of using advanced materials in a space-like environment (temperature and pressure) to help prevent potential arcing and corona due to high field regions. Finally, a single-event effect evaluation would have to be performed and single-event mitigation methods implemented at the design and system level or developed to ensure complete radiation hardness of the module.
System for high-voltage control detectors with large number photomultipliers
International Nuclear Information System (INIS)
Donskov, S.V.; Kachanov, V.A.; Mikhajlov, Yu.V.
1985-01-01
A simple and inexpensive on-line system for hihg-voltage control which is designed for detectors with a large number of photomultipliers is developed and manufactured. It has been developed for the GAMC type hodoscopic electromagnetic calorimeters, comprising up to 4 thousand photomultipliers. High voltage variation is performed by a high-speed potentiometer which is rotated by a microengine. Block-diagrams of computer control electronics are presented. The high-voltage control system has been used for five years in the IHEP and CERN accelerator experiments. The operation experience has shown that it is quite simple and convenient in operation. In case of about 6 thousand controlled channels in both experiments no potentiometer and microengines failures were observed
Design and realization of high voltage disconnector condition monitoring system
Shi, Jinrui; Xu, Tianyang; Yang, Shuixian; Li, Buoyang
2017-08-01
The operation status of the high voltage disconnector directly affects the safe and stable operation of the power system. This article uses the wireless frequency hopping communication technology of the communication module to achieve the temperature acquisition of the switch contacts and high voltage bus, to introduce the current value of the loop in ECS, and judge the operation status of the disconnector by considering the ambient temperature, calculating the temperature rise; And through the acquisition of the current of drive motor in the process of switch closing and opening, and fault diagnosis of the disconnector by analyzing the change rule of the drive motor current, the condition monitoring of the high voltage disconnector is realized.
Current-voltage characteristic of a resonant tunneling diode under electromagnetic radiation
Directory of Open Access Journals (Sweden)
N Hatefi Kargan
2013-09-01
Full Text Available In this paper, current-voltage characteristic of a resonant tunneling diode under electromagnetic radiation has been calculated and compared with the results when there is no electromagnetic radiation. For calculating current -voltage characteristic, it is required to calculate the transmission coefficient of electrons from the well and barrier structures of this device. For calculating the transmission coefficient of electrons at the presence of electromagnetic radiation, Finite Difference Time Domain (FDTD method has been used and when there is no electromagnetic radiation Transfer Matrix Method (TMM and finite diffirence time domain method have been used. The results show that the presence of electromagnetic radiation causes resonant states other than principal resonant state (without presence of electromagnetic radiation to appear on the transmition coefficient curve where they are in distances from the principal peak and from each other. Also, the presence of electromagnetic radiation causes peaks other than principal peak to appear on the current-voltage characteristics of the device. Under electromagnetic radiation, the number of peaks on the current-voltage curve is smaller than the number of peaks on the current-voltage transmission coefficient. This is due to the fact that current-voltage curve is the result of integration on the energy of electrons, Thus, the sharper and low height peaks on the transmission coefficient do not appear on the current-voltage characteristic curve.
Self-aligned photolithography for the fabrication of fully transparent high-voltage devices
Zhang, Yonghui; Mei, Zengxia; Huo, Wenxing; Wang, Tao; Liang, Huili; Du, Xiaolong
2018-05-01
High-voltage devices, working in the range of hundreds of volts, are indispensable elements in the driving or readout circuits for various kinds of displays, integrated microelectromechanical systems and x-ray imaging sensors. However, the device performances are found hardly uniform or repeatable due to the misalignment issue, which are extremely common for offset drain high-voltage devices. To resolve this issue, this article reports a set of self-aligned photolithography technology for the fabrication of high-voltage devices. High-performance fully-transparent high-voltage thin film transistors, diodes and logic inverters are successfully fabricated with this technology. Unlike other self-aligned routes, opaque masks are introduced on the backside of the transparent substrate to facilitate proximity exposure method. The photolithography process is simulated and analyzed with technology computer aided design simulation to explain the working principle of the proximity exposure method. The substrate thickness is found to be vital for the implementation of this technology based on both simulation and experimental results. The electrical performance of high-voltage devices is dependent on the offset length, which can be delicately modulated by changing the exposure dose. The presented self-aligned photolithography technology is proved to be feasible in high-voltage circuits, demonstrating its huge potential in practical industrial applications.
Design Comparison of Autonomous High Voltage Driving System for DEAP Actuator
DEFF Research Database (Denmark)
Huang, Lina; Pittini, Riccardo; Zhang, Zhe
2014-01-01
As a new type of smart material, the Dielectric Electro Active Polymer (DEAP) is introduced in terms of configuration, working principle and potential applications. The design of an autonomous high voltage driving system for DEAP actuator is investigated. The system configuration and the design...... methodology of a high voltage converter are discussed in detail. Based on the heating valve application, three different high voltage converter solutions have been proposed. The different proposals have been compared in terms of energy loss, volume and cost. Finally, the design selection suggestions...
Enhanced Local Grid Voltage Support Method for High Penetration of Distributed Generators
DEFF Research Database (Denmark)
Demirok, Erhan; Sera, Dezso; Rodriguez, Pedro
2011-01-01
Grid voltage rise and thermal loading of network components are the most remarkable barriers to allow high number of distributed generator (DG) connections on the medium voltage (MV) and low voltage (LV) electricity networks. The other barriers such as grid power quality (harmonics, voltage...
Multi-Period Optimization for Voltage Control System in Transmission Grids
DEFF Research Database (Denmark)
Qin, Nan; Chen, Si; Liu, Chengxi
2015-01-01
Automatic Voltage Control (AVC) systems maintain the voltage in an acceptable range and minimize the power loss of the grid by coordinately regulating the controllable components. Switchable shunts and tap-able transformers are expected to be operated as few times as possible. This paper proposes...
High-voltage switching for in-flight capture of keV antiprotons in a Penning trap
International Nuclear Information System (INIS)
Fei, X.; Davisson, R.; Gabrielse, G.
1987-01-01
The recently observed in-flight capture of keV antiprotons and protons in a Penning trap requires that the -3-kV potentials on electrodes of a Penning trap near 4.2 K be switched on and off with switching times less than 20 ns. These rapidly switched potentials are applied via transmission lines which are not terminated at the trap, thereby avoiding unacceptable heat load on the helium Dewar. Simple high-voltage switching circuits are constructed using krytrons and reed relays. A krytron provides the rapid switching and stays on just long enough for a reed relay to kick in and maintain the switched state indefinitely
Computer applications: Automatic control system for high-voltage accelerator
International Nuclear Information System (INIS)
Bryukhanov, A.N.; Komissarov, P.Yu.; Lapin, V.V.; Latushkin, S.T.. Fomenko, D.E.; Yudin, L.I.
1992-01-01
An automatic control system for a high-voltage electrostatic accelerator with an accelerating potential of up to 500 kV is described. The electronic apparatus on the high-voltage platform is controlled and monitored by means of a fiber-optic data-exchange system. The system is based on CAMAC modules that are controlled by a microprocessor crate controller. Data on accelerator operation are represented and control instructions are issued by means of an alphanumeric terminal. 8 refs., 6 figs
High-voltage variable-duration pulse generator
International Nuclear Information System (INIS)
Anisimova, T.E.; Akkuratov, E.V.; Gromovenko, V.M.; Nikonov, Yu.P.; Malinin, A.N.
1988-01-01
A high-voltage generator is described that allows pulse duration tau to be varied within wide limits and has high efficiency (at least 50% for tau = 0.5 tau/sub max/) and an amplitude of up to 5 kV, a repetition frequency of up to 200 Hz,and a variable duration of 0-30 μsec. The generator is used in the controller of an electron accelerator
Considering system non-linearity in transmission pricing
International Nuclear Information System (INIS)
Oloomi-Buygi, M.; Salehizadeh, M. Reza
2008-01-01
In this paper a new approach for transmission pricing is presented. The contribution of a contract on power flow of a transmission line is used as extent-of-use criterion for transmission pricing. In order to determine the contribution of each contract on power flow of each transmission line, first the contribution of each contract on each voltage angle is determined, which is called voltage angle decomposition. To this end, DC power flow is used to compute a primary solution for voltage angle decomposition. To consider the impacts of system non-linearity on voltage angle decomposition, a method is presented to determine the share of different terms of sine argument in sine value. Then the primary solution is corrected in different iterations of decoupled Newton-Raphson power flow using the presented sharing method. The presented approach is applied to a 4-bus test system and IEEE 30-bus test system and the results are analyzed. (author)
High-voltage polymeric insulated cables
Energy Technology Data Exchange (ETDEWEB)
Ross, A
1987-01-01
Reviews developments in high-voltage (here defined as 25 kV, 66 kV and 132 kV) polymeric insulated cables in the UK over the period 1979-1986, with particular reference to the experience of the Eastern Electricity Board. Outlines the background to the adoption of XPLE-insulated solid cable, and the design, testing, terminations, jointing and costs of 25 kV, 66 kV and 132 kV cables.
Low Voltage, High-Q SOI MEMS Varactors for RF Applications
DEFF Research Database (Denmark)
Yalcinkaya, Arda Deniz; Jensen, Søren; Hansen, Ole
2003-01-01
A micro electromechanical tunable capacitor with a low control voltage, a wide tuning range and high electrical quality factor is presented with detailed characterizations. A 50μm thick single-crystalline silicon layer was etched using deep reactive ion etching (DRIE) for obtaining high-aspect ra...... is a suitable passive component to be used in band-pass filtering, voltage controlled oscillator or impedance matching applications on the very high frequency(VHF) and ultra high frequency (UHF) bands....
High voltage short plus generation based on avalanche circuit
International Nuclear Information System (INIS)
Hu Yuanfeng; Yu Xiaoqi
2006-01-01
Simulate the avalanche circuit in series with PSPICE module, design the high voltage short plus generation circuit by avalanche transistor in series for the sweep deflection circuit of streak camera. The output voltage ranges 1.2 KV into 50 ohm load. The rise time of the circuit is less than 3 ns. (authors)
On-chip high-voltage generator design design methodology for charge pumps
Tanzawa, Toru
2016-01-01
This book provides various design techniques for switched-capacitor on-chip high-voltage generators, including charge pump circuits, regulators, level shifters, references, and oscillators. Readers will see these techniques applied to system design in order to address the challenge of how the on-chip high-voltage generator is designed for Flash memories, LCD drivers, and other semiconductor devices to optimize the entire circuit area and power efficiency with a low voltage supply, while minimizing the cost. This new edition includes a variety of useful updates, including coverage of power efficiency and comprehensive optimization methodologies for DC-DC voltage multipliers, modeling of extremely low voltage Dickson charge pumps, and modeling and optimum design of AC-DC switched-capacitor multipliers for energy harvesting and power transfer for RFID.
Energy Technology Data Exchange (ETDEWEB)
Erofeev, E. V., E-mail: erofeev@micran.ru [Tomsk State University of Control Systems and Radioelectronics, Research Institute of Electrical-Communication Systems (Russian Federation); Fedin, I. V.; Kutkov, I. V. [Research and Production Company “Micran” (Russian Federation); Yuryev, Yu. N. [National Research Tomsk Polytechnic University, Institute of Physics and Technology (Russian Federation)
2017-02-15
High-electron-mobility transistors (HEMTs) based on AlGaN/GaN epitaxial heterostructures are a promising element base for the fabrication of high voltage electronic devices of the next generation. This is caused by both the high mobility of charge carriers in the transistor channel and the high electric strength of the material, which makes it possible to attain high breakdown voltages. For use in high-power switches, normally off-mode GaN transistors operating under enhancement conditions are required. To fabricate normally off GaN transistors, one most frequently uses a subgate region based on magnesium-doped p-GaN. However, optimization of the p-GaN epitaxial-layer thickness and the doping level makes it possible to attain a threshold voltage of GaN transistors close to V{sub th} = +2 V. In this study, it is shown that the use of low temperature treatment in an atomic hydrogen flow for the p-GaN-based subgate region before the deposition of gate-metallization layers makes it possible to increase the transistor threshold voltage to V{sub th} = +3.5 V. The effects under observation can be caused by the formation of a dipole layer on the p-GaN surface induced by the effect of atomic hydrogen. The heat treatment of hydrogen-treated GaN transistors in a nitrogen environment at a temperature of T = 250°C for 12 h reveals no degradation of the transistor’s electrical parameters, which can be caused by the formation of a thermally stable dipole layer at the metal/p-GaN interface as a result of hydrogenation.
International Nuclear Information System (INIS)
Erofeev, E. V.; Fedin, I. V.; Kutkov, I. V.; Yuryev, Yu. N.
2017-01-01
High-electron-mobility transistors (HEMTs) based on AlGaN/GaN epitaxial heterostructures are a promising element base for the fabrication of high voltage electronic devices of the next generation. This is caused by both the high mobility of charge carriers in the transistor channel and the high electric strength of the material, which makes it possible to attain high breakdown voltages. For use in high-power switches, normally off-mode GaN transistors operating under enhancement conditions are required. To fabricate normally off GaN transistors, one most frequently uses a subgate region based on magnesium-doped p-GaN. However, optimization of the p-GaN epitaxial-layer thickness and the doping level makes it possible to attain a threshold voltage of GaN transistors close to V_t_h = +2 V. In this study, it is shown that the use of low temperature treatment in an atomic hydrogen flow for the p-GaN-based subgate region before the deposition of gate-metallization layers makes it possible to increase the transistor threshold voltage to V_t_h = +3.5 V. The effects under observation can be caused by the formation of a dipole layer on the p-GaN surface induced by the effect of atomic hydrogen. The heat treatment of hydrogen-treated GaN transistors in a nitrogen environment at a temperature of T = 250°C for 12 h reveals no degradation of the transistor’s electrical parameters, which can be caused by the formation of a thermally stable dipole layer at the metal/p-GaN interface as a result of hydrogenation.
Restoration of Low-Voltage Distribution Systems with Inverter-Interfaced DG Units
DEFF Research Database (Denmark)
Dietmannsberger, Markus; Wang, Xiongfei; Blaabjerg, Frede
2018-01-01
-area voltage collapse. This paper proposes a restoration strategy from zero voltage conditions for inverter-interfaced DG under islanded conditions. In the approach, a flexible and scalable Master DG inverter concept is introduced for distributed generations, where no communication is needed and an outage......The increasing share of distributed generation (DG) offers new chances in grid restoration of low-voltage distribution grids. Instead of relying on the transmission or high- and medium-voltage levels, establishing islanding operation in low-voltage grids might be a good option after a wide...... of the Master can be balanced by other DG inverters. The control strategy ensures the tracking of nominal values of the system voltage and frequency without zero steady-state error. The influences of non-controllable DG are also taken into account in the strategy with an effective countermeasure developed...
Sub-nm 3D observation of human hair melanin by high-voltage STEM.
Imai, Takehito; Higuchi, Kimitaka; Yamamoto, Yuta; Arai, Shigeo; Nakano, Takashi; Tanaka, Nobuo
2016-04-01
The ultrastructure of melanin granules in human hair was studied using 1,000 kV high-voltage scanning transmission electron microscopy to successfully reconstruct three-dimensional images of the whole melanin granule. It was revealed that the melanin granule was composed of a membrane-like outer structure that included many spherical vesicles, and an inner matrix containing a sheet-like structure in the elongated direction of the melanin granule and a sheet-like arrays structure in the cross direction. The outer structure of the melanin granule was maintained even after exposure to hair-bleaching agents to decompose the melanin granule, suggesting that the outer structure was a highly robust structure and composition compared with the inner matrix . © The Author 2015. Published by Oxford University Press on behalf of The Japanese Society of Microscopy. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.
Alternative approaches to transmission investment
Energy Technology Data Exchange (ETDEWEB)
Welch, J.L. [International Transmission Co., Detroit, MI (United States)
2004-07-01
The International Transmission Company (ITC) is an independent power transmission company that owns, operates and maintains the high voltage transmission system in southeastern Michigan. The company's current focus is on investing in the transmission infrastructure to improve reliability, relieve congestion, improve access to generation and reduce energy costs for consumers. There is a need for investment in power transmission. Trends indicate that power transactions are on the rise while transmission investment is lagging because pricing protocols are inadequate and there is no regional tariff mechanism to allocate the benefits of new investment. The presentation reviewed the applicability of FTRs to transmission owners and the pitfalls of participant funding pricing. It also outlined the regional benefit allocation mechanism (RBAM) with an illustrative example. It was concluded that existing pricing policies must be improved to address the growing need for transmission investment. RBAM is needed to help investors recover costs from project beneficiaries. figs.
Environmental and biotechnological applications of high-voltage pulsed discharges in water
International Nuclear Information System (INIS)
Sato, Masayuki
2008-01-01
A high-voltage pulse has wide application in fields such as chemistry, physics and biology and their combinations. The high-voltage pulse forms two kinds of physical processes in water, namely (a) a pulsed electric field (PEF) in the parallel electrode configuration and (b) plasma generation by a pulsed discharge in the water phase with a concentrated electric field. The PEF can be used for inactivation of bacteria in liquid foods as a non-thermal process, and the underwater plasma is applicable not only for the decomposition of organic materials in water but also for biological treatment of wastewater. These discharge states are controlled mainly by the applied pulse voltage and the electrode shape. Some examples of environmental and biotechnological applications of a high-voltage pulse are reviewed.
High-voltage test and training of plastic streamer tubes for the DELPHI hadron calorimeter
International Nuclear Information System (INIS)
Alekseev, G.D.; Cellar, S.; Khomenko, B.A.; Korytov, A.V.; Kulinich, P.A.; Micelmacher, G.V.; Sedykh, Yu.V.; Toledo, R.
1987-01-01
The results of high-voltage test and training of plastic streamer tubes of the DELPHI hadron calorimeter are presented. The testing technique is considered in detail. The equipment for high-voltage training consists of a mini-computer, CAMAC-electronics, a controllable high-voltage supply and a digital ampermeter. The experimental results shows that high-voltage training of streamer tubes improves their characteristics. The value of dark current decreased up to 1 μA. The operational voltage range increased by a value more than 300 V
LIMIT SOLUTIONS OF EQUATIONS OF A DC HIGH-VOLTAGE CASCADE GENERATOR
Directory of Open Access Journals (Sweden)
V. O. Brzhezitsky
2015-04-01
Full Text Available In the paper the issue of calculating the high voltage cascade mode oscillator with a nonlinear load using the analytical method under different conditions of selection values of its components is presented. The peculiarity of the method of the study is that during multivariate calculations output parameters load generator remain unchanged. For high-voltage cascade direct current power found conditions under which can be significantly reduced high capacity capacitors cascade generator. The calculations show that acceptable for practical applications of high-voltage characteristics of cascade generators can be achieved with substantial reduction of the volume of their constituents, and thus substantial decline in their value.
A novel high voltage start up circuit for an integrated switched mode power supply
Energy Technology Data Exchange (ETDEWEB)
Hu Hao; Chen Xingbi, E-mail: huhao21@uestc.edu.c [State Key Laboratory of Electronic Thin Films and Integrated Devices, University of Electronic Science and Technology of China, Chengdu 610054 (China)
2010-09-15
A novel high voltage start up circuit for providing an initial bias voltage to an integrated switched mode power supply (SMPS) is presented. An enhanced mode VDMOS transistor, the gate of which is biased by a floating p-island, is used to provide start up current and sustain high voltage. An NMOS transistor having a high source to ground breakdown voltage is included to extend the bias voltage range to the SMPS. Simulation results indicate that the high voltage start up circuit can start and restart as designed. The proposed structure is believed to be more energy saving and cost-effective compared with other solutions. (semiconductor devices)
International Nuclear Information System (INIS)
Dudka, A; Galayko, D; Basset, P; Cottone, F; Blokhina, E
2013-01-01
This paper reports on an electrostatic Vibration Energy Harvester (e-VEH) system, for which the energy conversion process is initiated with a low bias voltage and is compatible with wideband stochastic external vibrations. The system employs the auto-synchronous conditioning circuit topology with the use of a novel dedicated integrated low-power high-voltage switch that is needed to connect the charge pump and flyback – two main parts of the used conditioning circuit. The proposed switch is designed and implemented in AMS035HV CMOS technology. Thanks to the proposed switch device, which is driven with a low-voltage ground-referenced logic, the e-VEH system may operate within a large voltage range, from a pre-charge low voltage up to several tens volts. With such a high-voltage e-VEH operation, it is possible to obtain a strong mechanical coupling and a high rate of vibration energy conversion. The used transducer/resonator device is fabricated with a batch-processed MEMS technology. When excited with stochastic vibrations having an acceleration level of 0.8 g rms distributed in the band 110–170 Hz, up to 0.75 μW of net electrical power has been harvested with our system. This work presents an important milestone in the challenge of designing a fully integrated smart conditioning interface for the capacitive e-VEHs
High-voltage therapy of carcinoma of the prostate
International Nuclear Information System (INIS)
Schnorr, D.; Kelly, L.U.; Guddat, H.M.; Schubert, J.; Gorski, J.; Schorcht, J.; Mau, S.; Wehnert, J.; Medizinische Akademie, Dresden
1983-01-01
High-voltage therapy is becoming increasingly important as a form of individual differential therapy of carcinoma of the prostate. Around 40% of all patients with a diagnosis of carcinoma of the prostate can be treated with high-voltage therapy. The precondition is the absence of bone and soft tissue metastases and of juxtaregional lymph node metastases. Individual carcinoma therapy is based on pre therapeutic tumor classification according to the TNM system. The 5-year survival rates are presented from a retrospective study carried out using primary radiation monotherapy and a combined hormone and radiation therapy; these figures were calculated by the life-table method. The study revealed no significant differences between the two forms of therapy as regards 5-year survival rates. The 5-year survival rates of all patients of the classifications T 0 -T 3 N/sub x/-N 2 M 0 irradiated (n: 198) (72% +- 11% for hormone plus radiation therapy and 74% +- 11% for radiation monotherapy) did not differ greatly from those of a normal male population of the same age (77%). High-voltage therapy of carcinoma of the prostate can thus be classified as a curative method of treatment. (author)
Ionization processes in combined high-voltage nanosecond - laser discharges in inert gas
Starikovskiy, Andrey; Shneider, Mikhail; PU Team
2016-09-01
Remote control of plasmas induced by laser radiation in the atmosphere is one of the challenging issues of free space communication, long-distance energy transmission, remote sensing of the atmosphere, and standoff detection of trace gases and bio-threat species. Sequences of laser pulses, as demonstrated by an extensive earlier work, offer an advantageous tool providing access to the control of air-plasma dynamics and optical interactions. The avalanche ionization induced in a pre-ionized region by infrared laser pulses where investigated. Pre-ionization was created by an ionization wave, initiated by high-voltage nanosecond pulse. Then, behind the front of ionization wave extra avalanche ionization was initiated by the focused infrared laser pulse. The experiment was carried out in argon. It is shown that the gas pre-ionization inhibits the laser spark generation under low pressure conditions.
High voltage pulsed cable design: a practical example
International Nuclear Information System (INIS)
Kewish, R.W. Jr.; Boicourt, G.P.
1979-01-01
The design of optimum high voltage pulse cable is difficult because very little emperical data are available on performance in pulsed applications. This paper follows the design and testing of one high voltage pulse cable, 40/100 trigger cable. The design was based on an unproven theory and the impressive outcome lends support to the theory. The theory is outlined and it is shown that there exists an inductance which gives a cable of minimum size for a given maximum stress. Test results on cable manufactured according to the design are presented and compared with the test results on the cable that 40/100 replaces
High voltage pulsed cable design: a practical example
Energy Technology Data Exchange (ETDEWEB)
Kewish, R.W. Jr.; Boicourt, G.P.
1979-01-01
The design of optimum high voltage pulse cable is difficult because very little emperical data are available on performance in pulsed applications. This paper follows the design and testing of one high voltage pulse cable, 40/100 trigger cable. The design was based on an unproven theory and the impressive outcome lends support to the theory. The theory is outlined and it is shown that there exists an inductance which gives a cable of minimum size for a given maximum stress. Test results on cable manufactured according to the design are presented and compared with the test results on the cable that 40/100 replaces.
DEFF Research Database (Denmark)
Kliem, Mathias; Høgsberg, Jan Becker; Wang, Qian
2017-01-01
The effect of nanoclay on various material properties like damping and strength of typical thermoset polymers, such as epoxy and vinyl ester, was investigated. Different environmental conditions typical for high-voltage transmission pylons made of composite materials were taken into account. Resin...... samples were prepared with various clay weight fractions ranging from 0% to 3%. Scanning electron microscopy, transmission electron microscopy, X-ray diffraction and rheological analysis were used to study the morphology and the structure of the nanocomposites. For all nanoclay-modified thermoset polymers......, the morphology was found to be of exfoliated structure mainly. Static, uniaxial tensile tests showed that the addition of nanoclay to thermoset polymers led to a beneficial effect on the stiffness, whereas the tensile strength and ductility significantly decreased. When exposed to different environmental...
Transmission line capital costs
International Nuclear Information System (INIS)
Hughes, K.R.; Brown, D.R.
1995-05-01
The displacement or deferral of conventional AC transmission line installation is a key benefit associated with several technologies being developed with the support of the U.S. Department of Energy's Office of Energy Management (OEM). Previous benefits assessments conducted within OEM have been based on significantly different assumptions for the average cost per mile of AC transmission line. In response to this uncertainty, an investigation of transmission line capital cost data was initiated. The objective of this study was to develop a database for preparing preliminary estimates of transmission line costs. An extensive search of potential data sources identified databases maintained by the Bonneville Power Administration (BPA) and the Western Area Power Administration (WAPA) as superior sources of transmission line cost data. The BPA and WAPA data were adjusted to a common basis and combined together. The composite database covers voltage levels from 13.8 to 765 W, with cost estimates for a given voltage level varying depending on conductor size, tower material type, tower frame type, and number of circuits. Reported transmission line costs vary significantly, even for a given voltage level. This can usually be explained by variation in the design factors noted above and variation in environmental and land (right-of-way) costs, which are extremely site-specific. Cost estimates prepared from the composite database were compared to cost data collected by the Federal Energy Regulatory Commission (FERC) for investor-owned utilities from across the United States. The comparison was hampered because the only design specifications included with the FERC data were voltage level and line length. Working within this limitation, the FERC data were not found to differ significantly from the composite database. Therefore, the composite database was judged to be a reasonable proxy for estimating national average costs
Perales, Mico; Yang, Mei-huan; Wu, Cheng-liang; Hsu, Chin-wei; Chao, Wei-sheng; Chen, Kun-hsien; Zahuranec, Terry
2016-03-01
Continuing improvements in the cost and power of laser diodes have been critical in launching the emerging fields of power over fiber (PoF), and laser power beaming. Laser power is transmitted either over fiber (for PoF), or through free space (power beaming), and is converted to electricity by photovoltaic cells designed to efficiently convert the laser light. MH GoPower's vertical multi-junction (VMJ) PV cell, designed for high intensity photovoltaic applications, is fueling the emergence of this market, by enabling unparalleled photovoltaic receiver flexibility in voltage, cell size, and power output. Our research examined the use of the VMJ PV cell for laser power transmission applications. We fully characterized the performance of the VMJ PV cell under various laser conditions, including multiple near IR wavelengths and light intensities up to tens of watts per cm2. Results indicated VMJ PV cell efficiency over 40% for 9xx nm wavelengths, at laser power densities near 30 W/cm2. We also investigated the impact of the physical dimensions (length, width, and height) of the VMJ PV cell on its performance, showing similarly high performance across a wide range of cell dimensions. We then evaluated the VMJ PV cell performance within the power over fiber application, examining the cell's effectiveness in receiver packages that deliver target voltage, intensity, and power levels. By designing and characterizing multiple receivers, we illustrated techniques for packaging the VMJ PV cell for achieving high performance (> 30%), high power (> 185 W), and target voltages for power over fiber applications.
Kumano, Teruhisa
As known well, two of the fundamental processes which give rise to voltage collapse in power systems are the on load tap changers of transformers and dynamic characteristics of loads such as induction machines. It has been well established that, comparing among these two, the former makes slower collapse while the latter makes faster. However, in realistic situations, the load level of each induction machine is not uniform and it is well expected that only a part of loads collapses first, followed by collapse process of each load which did not go into instability during the preceding collapses. In such situations the over all equivalent collapse behavior viewed from bulk transmission level becomes somewhat different from the simple collapse driven by one aggregated induction machine. This paper studies the process of cascaded voltage collapse among many induction machines by time simulation, where load distribution on a feeder line is modeled by several hundreds of induction machines and static impedance loads. It is shown that in some cases voltage collapse really cascades among induction machines, where the macroscopic load dynamics viewed from upper voltage level makes slower collapse than expected by the aggregated load model. Also shown is the effects of machine protection of induction machines, which also makes slower collapse.
Analysis of a back flashover across insulator strings on a 115 kV transmission line tower by PSCAD
Directory of Open Access Journals (Sweden)
Worakit Anekthanasuwan
2015-09-01
Full Text Available Lightning striking on a transmission tower induces high ground potential rise and high voltage at tower arms in which potential is normally at ground level, and subsequently causes overvoltage across an insulator string. If this overvoltage is higher than the withstanding voltage of the insulator string according to the v-t (voltage-time curve, back flashover phenomena will occur and this event may cause outage. The main objective of this paper is to study the factors influencing the back flashover phenomena. The computer program PSCAD/EMTDC (Power System Computer Aided Design/Electromagnetic Transients including DC is used to simulate lightning striking on a transmission tower 115kV. Lightning current, transmission towers, ground resistance, insulator strings and back flashover phenomena are modeled. Main simulations are lightning striking on different towers, different soil resistivity, different lightning current magnitudes and wave shapes, different locations, and different phase angles of source voltage. Simulation results show that the higher tower encounters higher induced voltage. A back flashover occurs at the top tower arm easier than at the middle and lower arms. The higher soil resistivity induces higher voltage. The larger lightning current magnitude impacts on higher induced voltage. The longer rise time of lightning current generates lower induced voltage. Lightning strikes directly on tower generate higher voltage than that of striking on overhead ground wires.
30 CFR 75.803 - Fail safe ground check circuits on high-voltage resistance grounded systems.
2010-07-01
... High-Voltage Distribution § 75.803 Fail safe ground check circuits on high-voltage resistance grounded systems. [Statutory Provisions] On and after September 30, 1970, high-voltage, resistance grounded systems... 30 Mineral Resources 1 2010-07-01 2010-07-01 false Fail safe ground check circuits on high-voltage...
Contribution to high voltage matrix switches reliability
International Nuclear Information System (INIS)
Lausenaz, Yvan
2000-01-01
Nowadays, power electronic equipment requirements are important, concerning performances, quality and reliability. On the other hand, costs have to be reduced in order to satisfy the market rules. To provide cheap, reliability and performances, many standard components with mass production are developed. But the construction of specific products must be considered following these two different points: in one band you can produce specific components, with delay, over-cost problems and eventuality quality and reliability problems, in the other and you can use standard components in a adapted topologies. The CEA of Pierrelatte has adopted this last technique of power electronic conception for the development of these high voltage pulsed power converters. The technique consists in using standard components and to associate them in series and in parallel. The matrix constitutes high voltage macro-switch where electrical parameters are distributed between the synchronized components. This study deals with the reliability of these structures. It brings up the high reliability aspect of MOSFETs matrix associations. Thanks to several homemade test facilities, we obtained lots of data concerning the components we use. The understanding of defects propagation mechanisms in matrix structures has allowed us to put forwards the necessity of robust drive system, adapted clamping voltage protection, and careful geometrical construction. All these reliability considerations in matrix associations have notably allowed the construction of a new matrix structure regrouping all solutions insuring reliability. Reliable and robust, this product has already reaches the industrial stage. (author) [fr
Study of a phase-to-ground fault on a 400 kV overhead transmission line
Iagăr, A.; Popa, G. N.; Diniş, C. M.
2018-01-01
Power utilities need to supply their consumers at high power quality level. Because the faults that occur on High-Voltage and Extra-High-Voltage transmission lines can cause serious damages in underlying transmission and distribution systems, it is important to examine each fault in detail. In this work we studied a phase-to-ground fault (on phase 1) of 400 kV overhead transmission line Mintia-Arad. Indactic® 650 fault analyzing system was used to record the history of the fault. Signals (analog and digital) recorded by Indactic® 650 were visualized and analyzed by Focus program. Summary of fault report allowed evaluation of behavior of control and protection equipment and determination of cause and location of the fault.
High voltage system design for the IUCF 300 KV electron cooling system
International Nuclear Information System (INIS)
Bertuccio, T.; Brown, B.; Donica, G.; Ellison, T.; Friesel, D.L.
1985-01-01
A summary of the electron beam high voltage system design for the IUCF Cooler now under construction, is presented. There are extremely stringent regulation requirements (about 10ppm) on the main high voltage power supply (-300 kVDC, 15 mA), and less stringent requirements on the gun anode power supply, in order to achieve the regulation needed to store beams in the IUCF Cooler with very low momentum spreads (Δp/p approx. = 2 x 10 -5 ). An overview of the main high voltage power supply (HVPS) specifications and design, as well as provisions and plans to improve the regulation are discussed. The electron collection system, modeled after the FNAL collector which was able to collect between 99.9% and 99.99% of the electron beam, is discussed along with the requirements of the associated power supplies. The designs of the high voltage acceleration structures and high voltage platform are discussed, as well as practical design considerations based upon experience with the Fermilab 120 keV electron cooling system
A high-voltage triggered pseudospark discharge experiment
International Nuclear Information System (INIS)
Ramaswamy, K.; Destler, W.W.; Rodgers, J.
1996-01-01
The design and execution of a pulsed high-voltage (350 endash 400 keV) triggered pseudospark discharge experiment is reported. Experimental studies were carried out to obtain an optimal design for stable and reliable pseudospark operation in a high-voltage regime (approx-gt 350 kV). Experiments were performed to determine the most suitable fill gas for electron-beam formation. The pseudospark discharge is initiated by a trigger mechanism involving a flashover between the trigger electrode and hollow cathode housing. Experimental results characterizing the electron-beam energy using the range-energy method are reported. Source size imaging was carried out using an x-ray pinhole camera and a novel technique using Mylar as a witness plate. It was experimentally determined that strong pinching occurred later in time and was associated with the lower-energy electrons. copyright 1996 American Institute of Physics
Constant potential high-voltage generator
International Nuclear Information System (INIS)
Resnick, T.A.; Dupuis, W.A.; Palermo, T.
1980-01-01
An X-ray tube voltage generator with automatic stabilization circuitry is disclosed. The generator includes a source of pulsating direct current voltage such as from a rectified 3 phase transformer. This pulsating voltage is supplied to the cathode and anode of an X-ray tube and forms an accelerating potential for electrons within that tube. The accelerating potential is stabilized with a feedback signal which is provided by a feedback network. The network includes an error signal generator which compares an instantaneous accelerating potential with a preferred reference accelerating potential and generates an error function. This error function is transmitted to a control tube grid which in turn causes the voltage difference between X-ray tube cathode and anode to stabilize and thereby reduce the error function. In this way stabilized accelerating potentials are realized and uniform X-ray energy distributions produced. (Auth.)
Excitation of voltage oscillations in an induction voltage adder
Directory of Open Access Journals (Sweden)
Nichelle Bruner
2009-07-01
Full Text Available The induction voltage adder is an accelerator architecture used in recent designs of pulsed-power driven x-ray radiographic systems such as Sandia National Laboratories’ Radiographic Integrated Test Stand (RITS, the Atomic Weapons Establishment’s planned Hydrus Facility, and the Naval Research Laboratory’s Mercury. Each of these designs relies on magnetic insulation to prevent electron loss across the anode-cathode gap in the vicinity of the adder as well as in the coaxial transmission line. Particle-in-cell simulations of the RITS adder and transmission line show that, as magnetic insulation is being established during a pulse, some electron loss occurs across the gap. Sufficient delay in the cavity pulse timings provides an opportunity for high-momentum electrons to deeply penetrate the cavities of the adder cells where they can excite radio-frequency resonances. These oscillations may be amplified in subsequent gaps, resulting in oscillations in the output power. The specific modes supported by the RITS-6 accelerator and details of the mechanism by which they are excited are presented in this paper.
30 CFR 57.12071 - Movement or operation of equipment near high-voltage powerlines.
2010-07-01
... 30 Mineral Resources 1 2010-07-01 2010-07-01 false Movement or operation of equipment near high-voltage powerlines. 57.12071 Section 57.12071 Mineral Resources MINE SAFETY AND HEALTH ADMINISTRATION...-voltage powerlines. When equipment must be moved or operated near energized high-voltage powerlines (other...
An Inexpensive Source of High Voltage
Saraiva, Carlos
2012-01-01
As a physics teacher I like recycling old apparatus and using them for demonstrations in my classes. In physics laboratories in schools, sources of high voltage include induction coils or electronic systems that can be bought from companies that sell lab equipment. But these sources can be very expensive. In this article, I will explain how you…
International Nuclear Information System (INIS)
Peixoto, J.G.P.; Selbach, H.J.; Kramer, H.M.; Lange, B.
2001-04-01
In Working Group 3 of Sub-committee 62C of the international electrotechnical commission (IEC) a new project is underway [1] with the objective of specifying requirements for the performance characteristics of instruments for the non-invasive measurement of the X-ray tube voltage in diagnostic radiology. In this draft the X-ray tube voltage is specified in terms of the practical peak voltage [2]. The objective of the present work is to perform a tentative type test, based on the ''Requirements for Instruments for Non-invasive Measurements of the X-ray Tube Voltage'' defined in the IEC draft, with a commercially available non-invasive high-voltage meter. The instrument was modified so that the practical peak voltage can be measured. It is shown that the instrument, with the modifications made, is suitable for the non-invasive measurement of the practical peak voltage between 50 kV and 150 kV within the required limits of variation of the response. (orig.)
Two types of photomultiplier voltage dividers for high and changing count rates
International Nuclear Information System (INIS)
Reiter, W.L.; Stengl, G.
1980-01-01
We report on the design of two types of voltage distribution circuits for high stability photomultiplier operation. 'Type A' voltage divider is an ohmic voltage divider with high bleeder current (up to 10 mA) and the resistor chain split at one of the last dynodes, usually the dynode where the analog signal is derived from. This simple constructive measure improves the stability of the dynode voltage by a factor of 5 compared with an unsplit conventional resistor chain. 'Type B' is a novel active voltage divider using cold cathode tubes ar regulating elements. This voltage divider exhibits excellent temperature stability (about 10 -4 / 0 C). With 'type B' an equal stability compared with conventional ohmic dividers can be achieved at a bleeder current smaller by one order of magnitude. Of course both concepts, 'type A' and 'type B', can be combined. (orig.)
The role of facts and HVDC in the future pan-European transmission system development
L'Abbate, A.; Migliavacca, G.; Hager, U.; Rehtanz, C.; Ruberg, S.; Lopes Ferreira, H.M.; Fulli, G.; Purvins, A.
2010-01-01
The present paper focuses on FACTS (Flexible Alternating Current Transmission System) and HVDC (High Voltage Direct Current) transmission technologies. Particular attention is paid to different specific technical, economic and environmental features of these power electronics-based devices. Final
International Nuclear Information System (INIS)
Li, Zhen-hua; Li, Hong-bin; Zhang, Zhi
2013-01-01
Electronic transformers are widely used in power systems because of their wide bandwidth and good transient performance. However, as an emerging technology, the failure rate of electronic transformers is higher than that of traditional transformers. As a result, the calibration period needs to be shortened. Traditional calibration methods require the power of transmission line be cut off, which results in complicated operation and power off loss. This paper proposes an online calibration system which can calibrate electronic current transformers without power off. In this work, the high accuracy standard current transformer and online operation method are the key techniques. Based on the clamp-shape iron-core coil and clamp-shape air-core coil, a combined clamp-shape coil is designed as the standard current transformer. By analyzing the output characteristics of the two coils, the combined clamp-shape coil can achieve verification of the accuracy. So the accuracy of the online calibration system can be guaranteed. Moreover, by employing the earth potential working method and using two insulating rods to connect the combined clamp-shape coil to the high voltage bus, the operation becomes simple and safe. Tests in China National Center for High Voltage Measurement and field experiments show that the proposed system has a high accuracy of up to 0.05 class
Li, Zhen-hua; Li, Hong-bin; Zhang, Zhi
2013-07-01
Electronic transformers are widely used in power systems because of their wide bandwidth and good transient performance. However, as an emerging technology, the failure rate of electronic transformers is higher than that of traditional transformers. As a result, the calibration period needs to be shortened. Traditional calibration methods require the power of transmission line be cut off, which results in complicated operation and power off loss. This paper proposes an online calibration system which can calibrate electronic current transformers without power off. In this work, the high accuracy standard current transformer and online operation method are the key techniques. Based on the clamp-shape iron-core coil and clamp-shape air-core coil, a combined clamp-shape coil is designed as the standard current transformer. By analyzing the output characteristics of the two coils, the combined clamp-shape coil can achieve verification of the accuracy. So the accuracy of the online calibration system can be guaranteed. Moreover, by employing the earth potential working method and using two insulating rods to connect the combined clamp-shape coil to the high voltage bus, the operation becomes simple and safe. Tests in China National Center for High Voltage Measurement and field experiments show that the proposed system has a high accuracy of up to 0.05 class.
Determining the mode of high voltage breakdowns in vacuum devices
International Nuclear Information System (INIS)
Miller, H.C.; Furno, E.J.; Sturtz, J.P.
1980-01-01
Devices were constructed which were essentially vacuum diodes equipped with windows allowing observation of high voltage breakdowns. The waveform of the applied voltage was photographed, and the x-ray output was monitored to investigate electrical breakdown in these vacuum diodes. Results indicate that breakdowns may be divided into two types: (1) vacuum (interelectrode) breakdown - characterized by a diffuse moderately bright discharge, a relative slow and smooth voltage collapse, and a large burst of x-rays, and (2) surface (insulator) flashover - characterized by a bright discharge with a very bright filamentary core, a relatively fast and noisy voltage collapse and no x-ray burst. Useful information concerning the type of breakdown in a vacuum device can be obtained by monitoring the voltage (current) waveform and the x-ray output
Cermet insert high voltage holdoff for ceramic/metal vacuum devices
Ierna, William F.
1987-01-01
An improved metal-to-ceramic seal is provided wherein the ceramic body of the seal contains an integral region of cermet material in electrical contact with the metallic member, e.g., an electrode, of the seal. The seal is useful in high voltage vacuum devices, e.g., vacuum switches, and increases the high-voltage holdoff capabilities of such devices. A method of fabricating such seals is also provided.
High-voltage integrated transmitting circuit with differential driving for CMUTs
DEFF Research Database (Denmark)
Llimos Muntal, Pere; Larsen, Dennis Øland; Færch, Kjartan Ullitz
2016-01-01
In this paper, a high-voltage integrated differential transmitting circuit for capacitive micromachined ultrasonic transducers (CMUTs) used in portable ultrasound scanners is presented. Due to its application, area and power consumption are critical and need to be minimized. The circuitry...... is designed and implemented in AMS 0.35 μ m high-voltage process. Measurements are performed on the fabricated integrated circuit in order to assess its performance. The transmitting circuit consists of a low-voltage control logic, pulse-triggered level shifters and a differential output stage that generates...... conditions is 0.936 mW including the load. The integrated circuits measured prove to be consistent and robust to local process variations by measurements....
A high voltage gain quasi Z-source isolated DC/DC converter
DEFF Research Database (Denmark)
Siwakoti, Yam P.; Blaabjerg, Frede; Loh, Poh Chiang
2014-01-01
A compact quasi-Z-source DC/DC converter is presented with high voltage gain, isolated output, and improved efficiency. The improvements in size and performance were achieved by using a square wave inverter with only two output switches driving an isolating transformer in push-pull mode, followed...... by a voltage doubling output rectifier. The converter is well-suited to applications requiring a high voltage gain, especially renewable energy sources such as photovoltaic and fuel-cell power supplies. To demonstrate the converter's performance a prototype designed to output 400 V at 500 W was constructed...
Electronic Current Transducer (ECT) for high voltage dc lines
Houston, J. M.; Peters, P. H., Jr.; Summerayes, H. R., Jr.; Carlson, G. J.; Itani, A. M.
1980-02-01
The development of a bipolar electronic current transducer (ECT) for measuring the current in a high voltage dc (HVDC) power line at line potential is discussed. The design and construction of a free standing ECT for use on a 400 kV line having a nominal line current of 2000 A is described. Line current is measured by a 0.0001 ohm shunt whose voltage output is sampled by a 14 bit digital data link. The high voltage interface between line and ground is traversed by optical fibers which carry digital light signals as far as 300 m to a control room where the digital signal is converted back to an analog representation of the shunt voltage. Two redundant electronic and optical data links are used in the prototype. Power to operate digital and optical electronics and temperature controlling heaters at the line is supplied by a resistively and capacitively graded 10 stage cascade of ferrite core transformers located inside the hollow, SF6 filled, porcelain support insulator. The cascade is driven by a silicon controlled rectifier inverter which supplies about 100 W of power at 30 kHz.
Local Dynamic Reactive Power for Correction of System Voltage Problems
Energy Technology Data Exchange (ETDEWEB)
Kueck, John D [ORNL; Rizy, D Tom [ORNL; Li, Fangxing [ORNL; Xu, Yan [ORNL; Li, Huijuan [University of Tennessee, Knoxville (UTK); Adhikari, Sarina [ORNL; Irminger, Philip [ORNL
2008-12-01
Distribution systems are experiencing outages due to a phenomenon known as local voltage collapse. Local voltage collapse is occurring in part because modern air conditioner compressor motors are much more susceptible to stalling during a voltage dip than older motors. These motors can stall in less than 3 cycles (.05s) when a fault, such as on the sub-transmission system, causes voltage to sag to 70 to 60%. The reasons for this susceptibility are discussed in the report. During the local voltage collapse, voltages are depressed for a period of perhaps one or two minutes. There is a concern that these local events are interacting together over larger areas and may present a challenge to system reliability. An effective method of preventing local voltage collapse is the use of voltage regulation from Distributed Energy Resources (DER) that can supply or absorb reactive power. DER, when properly controlled, can provide a rapid correction to voltage dips and prevent motor stall. This report discusses the phenomenon and causes of local voltage collapse as well as the control methodology we have developed to counter voltage sag. The problem is growing because of the use of low inertia, high efficiency air conditioner (A/C) compressor motors and because the use of electric A/C is growing in use and becoming a larger percentage of system load. A method for local dynamic voltage regulation is discussed which uses reactive power injection or absorption from local DER. This method is independent, rapid, and will not interfere with conventional utility system voltage control. The results of simulations of this method are provided. The method has also been tested at the ORNL s Distributed Energy Communications and Control (DECC) Laboratory using our research inverter and synchronous condenser. These systems at the DECC Lab are interconnected to an actual distribution system, the ORNL distribution system, which is fed from TVA s 161kV sub-transmission backbone. The test results
Impact of Cyber Attacks on High Voltage DC Transmission Damping Control
Directory of Open Access Journals (Sweden)
Rui Fan
2018-04-01
Full Text Available Hybrid AC/HVDC (AC-HVDC grids have evolved to become huge cyber-physical systems that are vulnerable to cyber attacks because of the wide attack surface and increasing dependence on intelligent electronic devices, computing resources and communication networks. This paper, for the first time, studies the impact of cyber attacks on HVDC transmission oscillation damping control.Three kinds of cyber attack models are considered: timing attack, replay attack and false data injection attack. Followed by a brief introduction of the HVDC model and conventional oscillation damping control method, the design of three attack models is described in the paper. These attacks are tested on a modified IEEE New England 39-Bus AC-HVDC system. Simulation results have shown that all three kinds of attacks are capable of driving the AC-HVDC system into large oscillations or even unstable conditions.
BANSHEE: High-voltage repetitively pulsed electron-beam driver
International Nuclear Information System (INIS)
VanHaaften, F.
1992-01-01
BANSHEE (Beam Accelerator for a New Source of High-Energy Electrons) this is a high-voltage modulator is used to produce a high-current relativistic electron beam for high-power microwave tube development. The goal of the BANSHEE research is first to achieve a voltage pulse of 700--750 kV with a 1-μs pulse width driving a load of ∼100 Ω, the pulse repetition frequency (PRF) of a few hertz. The ensuing goal is to increase the pulse amplitude to a level approaching 1 MV. We conducted tests using half the modulator with an output load of 200 Ω, up to a level of ∼650 kV at a PRF of 1 Hz and 525 kV at a PRF of 5 Hz. We then conducted additional testing using the complete system driving a load of ∼100 Ω
High-voltage nanosecond Marx generator with quasi-rectangular pulses
International Nuclear Information System (INIS)
Bulan, V.V.; Grabovskij, E.V.; Gribov, A.N.; Luzhnov, V.G.
1999-01-01
The automated high-voltage nanosecond generator, forming single pulses of any polarity on the load of 17 Ohm with polarity voltage from 100 up to 300 kV at the semiheight of 80 ns and the front of 7 ns is described. The generator is assembled on the basis of low-inductive capacitors, which by discharge form the pulse, close by form to rectangular one [ru
Switching phenomena in high-voltage circuit breakers
International Nuclear Information System (INIS)
Nakanishi, K.
1991-01-01
The topics covered in this book include: general problems concerning current interruption, the physical arc model, and miscellaneous types of modern switching apparatus, such as gas circuit breakers, gas-insulated switch-gear, vacuum circuit breakers and high-voltage direct-current circuit breakers
High voltage high brightness electron accelerator with MITL voltage adder coupled to foilless diode
International Nuclear Information System (INIS)
Mazarakis, M.G.; Poulkey, J.W.; Rovang, D.
1995-01-01
The design and analysis of a high brightness electron beam experiment under construction at Sandia National Laboratory is presented. The beam energy is 12 MeV, the current 35-40 kA, the rms radius 0.5 mm, and the pulse duration FWHM 40 ns. The accelerator is SABRE a pulsed inductive voltage adder, and the electron source is a magnetically immersed foilless diode. This experiment has as its goal to stretch the technology to the edge and produce the highest possible electron current in a submillimeter radius beam
High voltage isolation transformer
Clatterbuck, C. H.; Ruitberg, A. P. (Inventor)
1985-01-01
A high voltage isolation transformer is provided with primary and secondary coils separated by discrete electrostatic shields from the surfaces of insulating spools on which the coils are wound. The electrostatic shields are formed by coatings of a compound with a low electrical conductivity which completely encase the coils and adhere to the surfaces of the insulating spools adjacent to the coils. Coatings of the compound also line axial bores of the spools, thereby forming electrostatic shields separating the spools from legs of a ferromagnetic core extending through the bores. The transformer is able to isolate a high constant potential applied to one of its coils, without the occurrence of sparking or corona, by coupling the coatings, lining the axial bores to the ferromagnetic core and by coupling one terminal of each coil to the respective coating encasing the coil.
The Investigation of Field Plate Design in 500 V High Voltage NLDMOS
Directory of Open Access Journals (Sweden)
Donghua Liu
2015-01-01
Full Text Available This paper presents a 500 V high voltage NLDMOS with breakdown voltage (VBD improved by field plate technology. Effect of metal field plate (MFP and polysilicon field plate (PFP on breakdown voltage improvement of high voltage NLDMOS is studied. The coeffect of MFP and PFP on drain side has also been investigated. A 500 V NLDMOS is demonstrated with a 37 μm drift length and optimized MFP and PFP design. Finally the breakdown voltage 590 V and excellent on-resistance performance (Rsp = 7.88 ohm * mm2 are achieved.
Prototype high voltage bushing: Configuration to its operational demonstration
Energy Technology Data Exchange (ETDEWEB)
Shah, Sejal, E-mail: sshah@iter-india.org [ITER-India, Institute for Plasma Research, Bhat, Gandhinagar 382428 (India); Sharma, D. [Institute for Plasma Research, Bhat, Gandhinagar 382428 (India); Parmar, D.; Tyagi, H.; Joshi, K.; Shishangiya, H.; Bandyopadhyay, M.; Rotti, C.; Chakraborty, A. [ITER-India, Institute for Plasma Research, Bhat, Gandhinagar 382428 (India)
2016-12-15
High Voltage Bushing (HVB) is the key component of Diagnostic Neutral Beam (DNB) system of ITER as it provides access to high voltage electrical, hydraulic, gas and diagnostic feedlines to the beam source with isolation from grounded vessel. HVB also provides primary vacuum confinement for the DNB system. Being Safety Important Class (SIC) component of ITER, it involves several configurational, technological and operational challenges. To ensure its operational performance & reliability, particularly electrostatic behavior, half scale down Prototype High Voltage Bushing (PHVB) is designed considering same design criteria of DNB HVB. Design optimization has been carried out followed by finite element (FE) analysis to obtain DNB HVB equivalent electric stress on different parts of PHVB, taking into account all design, manufacturing & space constraints. PHVB was tested up to 60 kV without breakdown, which validates its design for the envisaged operation of 50 kV DC. This paper presents the design of PHVB, FEA validation, manufacturing constraints, experimental layout with interfacing auxiliary systems and operational results related to functional performance.
The 100 kV Faraday cage (High Voltage Deck) for the SPIDER experiment
International Nuclear Information System (INIS)
Boldrin, Marco; Grando, Luca; Pesce, Alberto; Recchia, Mauro; Toigo, Vanni; Gutierrez, Daniel; Simon, Muriel; Faoro, Giovanni; Guion, Andrea; Maggiora, Edoardo; Pedron, Diego; Roman, Anita; Decamps, Hans
2015-01-01
Highlights: • A 100 keV experiment is under construction to optimize ITER NBI Ion Source. • The Ion Source Power Supplies are hosted inside a wide −100 kVdc Faraday cage (HVD). • The paper reports on the design solutions of the HVD. • Electrostatic and electromagnetic analyses are presented. • Procurement activities status is reported. - Abstract: In order to optimize the design and operation of the Ion Source for the ITER Neutral Beam Injector (NBI), a dedicated 100 keV Ion Source, identified as Source for the Production of Ions of Deuterium Extracted from RF plasma (SPIDER), is under construction in the Neutral Beam Test Facility, at the Consorzio RFX premises, in Padua, Italy. The Ion Source, polarized at −112 kVdc voltage, will produce negative ions (Deuterium D"− or Hydrogen H"−) which, extracted from the Plasma Grid with an extraction voltage up to 12 keV, are accelerated up to 100 keV by the 100 kVdc Power Supply (100 kV PS). The required Ion Source and the Extraction Power Supplies (ISEPS) system and the associated diagnostics are hosted inside a High Voltage Deck (HVD), a −100 kVdc air-insulated Faraday cage. These power supplies and various diagnostics and control equipment are connected to the Ion Source by means of a High Voltage Transmission Line (TL). The HVD (procurement started mid 2013; delivery on site in the second half of 2014) will consist of a wide structure (13 m (L) × 11 m (W) × 5 m (H)), designed to support the weight of the ISEPS components, mounted on supporting insulators and clad with a conductive metal sheet in order to reduce the electromagnetic interference (EMI). The paper reports on the design solutions of the HVD focusing on insulation, mechanical, thermal and EMI issues. The details of the main HVD interfaces with the TL and with insulating transformer are also described. Finite Element (FE) analyses have been performed, on the one hand, to verify the configuration from the electrostatic point of view and
The 100 kV Faraday cage (High Voltage Deck) for the SPIDER experiment
Energy Technology Data Exchange (ETDEWEB)
Boldrin, Marco, E-mail: marco.boldrin@igi.cnr.it [Consorzio RFX (CNR, ENEA, INFN, Università di Padova, Acciaierie Venete S.p.A.), Corso Stati Uniti 4, 35127 Padova (Italy); Grando, Luca; Pesce, Alberto; Recchia, Mauro; Toigo, Vanni [Consorzio RFX (CNR, ENEA, INFN, Università di Padova, Acciaierie Venete S.p.A.), Corso Stati Uniti 4, 35127 Padova (Italy); Gutierrez, Daniel; Simon, Muriel [Fusion for Energy, c/o Josep Pla 2, 08019 Barcelona (Spain); Faoro, Giovanni; Guion, Andrea; Maggiora, Edoardo; Pedron, Diego [COELME – Costruzioni Elettromeccaniche S.p.A., via G. Galilei no. 1/2, 30036 S. Maria di Sala, Venezia (Italy); Roman, Anita [Studio di Ingegneria RS s.r.l., Viale dell’Arcella 1, 35153 Padova (Italy); Decamps, Hans [ITER Organization, Route de Vinon-sur-Verdon, CS 90 046, 13067 St. Paul Lez Durance Cedex (France)
2015-10-15
Highlights: • A 100 keV experiment is under construction to optimize ITER NBI Ion Source. • The Ion Source Power Supplies are hosted inside a wide −100 kVdc Faraday cage (HVD). • The paper reports on the design solutions of the HVD. • Electrostatic and electromagnetic analyses are presented. • Procurement activities status is reported. - Abstract: In order to optimize the design and operation of the Ion Source for the ITER Neutral Beam Injector (NBI), a dedicated 100 keV Ion Source, identified as Source for the Production of Ions of Deuterium Extracted from RF plasma (SPIDER), is under construction in the Neutral Beam Test Facility, at the Consorzio RFX premises, in Padua, Italy. The Ion Source, polarized at −112 kVdc voltage, will produce negative ions (Deuterium D{sup −} or Hydrogen H{sup −}) which, extracted from the Plasma Grid with an extraction voltage up to 12 keV, are accelerated up to 100 keV by the 100 kVdc Power Supply (100 kV PS). The required Ion Source and the Extraction Power Supplies (ISEPS) system and the associated diagnostics are hosted inside a High Voltage Deck (HVD), a −100 kVdc air-insulated Faraday cage. These power supplies and various diagnostics and control equipment are connected to the Ion Source by means of a High Voltage Transmission Line (TL). The HVD (procurement started mid 2013; delivery on site in the second half of 2014) will consist of a wide structure (13 m (L) × 11 m (W) × 5 m (H)), designed to support the weight of the ISEPS components, mounted on supporting insulators and clad with a conductive metal sheet in order to reduce the electromagnetic interference (EMI). The paper reports on the design solutions of the HVD focusing on insulation, mechanical, thermal and EMI issues. The details of the main HVD interfaces with the TL and with insulating transformer are also described. Finite Element (FE) analyses have been performed, on the one hand, to verify the configuration from the electrostatic point of
The electric strength of high-voltage transformers insulation at effect of partial dischargers
International Nuclear Information System (INIS)
Khoshravan, E.; Zeraatparvar, A.; Gashimov, A.M.; Mehdizadeh, R.N.
2001-01-01
Full text : In paper the change of electric strength of high-voltage transformers insulation at the effect of partial discharges with space charge accumulation was investigated. It is revealed that the effect of partial discharges of insulation materials results the reduction of their pulsing electric strength which can restore the own initial value at releasing of saved charge the volume of a material under condition of absence the ineversible structural changes in it. Researches of high-voltage transformers insulation's non-failure operation conditions show, that at increasing of insulation work time in a strong electrical field the reduction of average breakdown voltages with simultaneous increasing of spread in discharge voltage values takes place. It authentically testifies to reduction of short-time discharge voltage of insulation materials during their electrical aging. As the basic reason of insulation electrical aging the partial discharges occurring in gas cavities inside insulation were considered. It is known that the space charges will be formed in insulation elements of high-voltage devices which effects in dielectrical property of these elements including the electric strength and the space charge formation can occur also at partial discharges in an alternating voltage while the service of high-voltage transformers. In the given work the experiments in revealing separate influence partial discharges in pulsing electric strength of insulation materials at presence and at absence inside them the space charge were spent
Energy harvesting in high voltage measuring techniques
International Nuclear Information System (INIS)
Żyłka, Pawel; Doliński, Marcin
2016-01-01
The paper discusses selected problems related to application of energy harvesting (that is, generating electricity from surplus energy present in the environment) to supply autonomous ultra-low-power measurement systems applicable in high voltage engineering. As a practical example of such implementation a laboratory model of a remote temperature sensor is presented, which is self-powered by heat generated in a current-carrying busbar in HV- switchgear. Presented system exploits a thermoelectric harvester based on a passively cooled Peltier module supplying micro-power low-voltage dc-dc converter driving energy-efficient temperature sensor, microcontroller and a fibre-optic transmitter. Performance of the model in laboratory simulated conditions are presented and discussed. (paper)
Theoretical investigation of a photoconductively switched high-voltage spark gap
Broks, B.H.P.; Hendriks, J.; Brok, W.J.M.; Brussaard, G.J.H.; Mullen, van der J.J.A.M.
2006-01-01
In this contribution, a photoconductively switched high-voltage spark gap with an emphasis on theswitching behavior is modeled. It is known experimentally that not all of the voltage that is present at the input of the spark gap is switched, but rather a fraction of it drops across the spark gap.
30 CFR 75.812-2 - High-voltage power centers and transformers; record of examination.
2010-07-01
... 30 Mineral Resources 1 2010-07-01 2010-07-01 false High-voltage power centers and transformers; record of examination. 75.812-2 Section 75.812-2 Mineral Resources MINE SAFETY AND HEALTH ADMINISTRATION... High-Voltage Distribution § 75.812-2 High-voltage power centers and transformers; record of examination...
Summary of transient high-voltage calculations for the FRX-C experiment
International Nuclear Information System (INIS)
Kewish, R.W. Jr.; Rej, D.J.
1982-06-01
Calculations of the electrical circuit equations are performed over a wide range of parameters corresponding to the FRX-C field-reversed THETA-pinch experiment at Los Alamos. Without any plasma or external damping, serious voltage doubling and quadrupling of the main capacitor bank charge voltage are observed. These oscillating high voltages are found to be adequately suppressed by the strategic placement of external snubber circuitry. On the other hand, no doubling of the THETA-pinch preionization bank charge voltage is found. Calculations of the equations for the z-pinch preionization circuit are also performed
High voltage pulse system for the streamer chamber supply of the GIBS spectrometer
International Nuclear Information System (INIS)
Aksinenko, V.D.; Glagoleva, N.S.; Dement'ev, E.A.; Kaminskij, N.I.; Matyushin, A.T.; Matyushin, V.T.; Rozhnyatovskaya, S.A.; Ryakhovskij, V.N.; Nurgozhin, N.N.; Khusainov, E.K.
1987-01-01
Results of development and testing of high voltage pulse system HVPS for the streamer chamber supply of the GIBS spectrometer are presented. HVPS consists of the following basic blocks: nanosecond pulse high voltage generator, high voltage charging supply, trigger generator, chamber parameter control devices, gas-oil vacuuming supply systems, auxiliary and fire-prevention devices. The system blocks are described. Experimental results of HVPC testing are presented. HVPC provides a reliable (10 5 operations) of streamer chamber supply with high voltage pulse parameters: amplitude - 500 kV, amplitude instability (0.5-1.5)%, pulse duration - 12 ns, delay time - 500 ns, delay instability (2.5-5)%, mean frequency of output a signals - 0.1 Hz
Design of high voltage power supply of miniature X-ray tube based on resonant Royer
International Nuclear Information System (INIS)
Liu Xiyao; Zeng Guoqiang; Tan Chengjun; Luo Qun; Gong Chunhui; Huang Rui
2013-01-01
Background: In recent years, X rays are widely used in various fields. With the rapid development of national economy, the demand of high quality, high reliability, and high stability miniature X-ray tube has grown rapidly. As an important core component of miniature X-ray tube, high voltage power supply has attracted wide attention. Purpose: To match miniature, the high voltage power supply should be small, lightweight, good quality, etc. Based on the basic performance requirements of existing micro-X-ray tube high voltage power supply, this paper designs an output from 0 to -30 kV adjustable miniature X-ray tube voltage DC power supply. Compared to half-bridge and full-bridge switching-mode power supply, its driving circuit is simple. With working on the linear condition, it has no switching noise. Methods: The main circuit makes use of DC power supply to provide the energy. The resonant Royer circuit supplies sine wave which drives to the high frequency transformer's primary winding with resultant sine-like high voltage appearing across the secondary winding. Then, the voltage doubling rectifying circuit would achieve further boost. In the regulator circuit, a feedback control resonant transistor base current is adopted. In order to insulate air, a silicone rubber is used for high pressure part packaging, and the output voltage is measured by the dividing voltage below -5 kV. Results: The stability of circuit is better than 0.2%/6 h and the percent of the output ripple voltage is less than 0.3%. Keeping the output voltage constant, the output current can reach 57 μA by changing the size of load resistor. This high voltage power supply based on resonant Royer can meet the requirement of miniature X-ray tube. Conclusions: The circuit can satisfy low noise, low ripple, low power and high voltage regulator power supply design. However, its efficiency is not high enough because of the linear condition. In the next design, to further reduce power consumption, we
Optically triggered high voltage switch network and method for switching a high voltage
El-Sharkawi, Mohamed A.; Andexler, George; Silberkleit, Lee I.
1993-01-19
An optically triggered solid state switch and method for switching a high voltage electrical current. A plurality of solid state switches (350) are connected in series for controlling electrical current flow between a compensation capacitor (112) and ground in a reactive power compensator (50, 50') that monitors the voltage and current flowing through each of three distribution lines (52a, 52b and 52c), which are supplying three-phase power to one or more inductive loads. An optical transmitter (100) controlled by the reactive power compensation system produces light pulses that are conveyed over optical fibers (102) to a switch driver (110') that includes a plurality of series connected optical triger circuits (288). Each of the optical trigger circuits controls a pair of the solid state switches and includes a plurality of series connected resistors (294, 326, 330, and 334) that equalize or balance the potential across the plurality of trigger circuits. The trigger circuits are connected to one of the distribution lines through a trigger capacitor (340). In each switch driver, the light signals activate a phototransistor (300) so that an electrical current flows from one of the energy reservoir capacitors through a pulse transformer (306) in the trigger circuit, producing gate signals that turn on the pair of serially connected solid state switches (350).
Optically triggered high voltage switch network and method for switching a high voltage
Energy Technology Data Exchange (ETDEWEB)
El-Sharkawi, Mohamed A. (Renton, WA); Andexler, George (Everett, WA); Silberkleit, Lee I. (Mountlake Terrace, WA)
1993-01-19
An optically triggered solid state switch and method for switching a high voltage electrical current. A plurality of solid state switches (350) are connected in series for controlling electrical current flow between a compensation capacitor (112) and ground in a reactive power compensator (50, 50') that monitors the voltage and current flowing through each of three distribution lines (52a, 52b and 52c), which are supplying three-phase power to one or more inductive loads. An optical transmitter (100) controlled by the reactive power compensation system produces light pulses that are conveyed over optical fibers (102) to a switch driver (110') that includes a plurality of series connected optical triger circuits (288). Each of the optical trigger circuits controls a pair of the solid state switches and includes a plurality of series connected resistors (294, 326, 330, and 334) that equalize or balance the potential across the plurality of trigger circuits. The trigger circuits are connected to one of the distribution lines through a trigger capacitor (340). In each switch driver, the light signals activate a phototransistor (300) so that an electrical current flows from one of the energy reservoir capacitors through a pulse transformer (306) in the trigger circuit, producing gate signals that turn on the pair of serially connected solid state switches (350).
Microwave integrated circuit for Josephson voltage standards
Holdeman, L. B.; Toots, J.; Chang, C. C. (Inventor)
1980-01-01
A microwave integrated circuit comprised of one or more Josephson junctions and short sections of microstrip or stripline transmission line is fabricated from thin layers of superconducting metal on a dielectric substrate. The short sections of transmission are combined to form the elements of the circuit and particularly, two microwave resonators. The Josephson junctions are located between the resonators and the impedance of the Josephson junctions forms part of the circuitry that couples the two resonators. The microwave integrated circuit has an application in Josephson voltage standards. In this application, the device is asymmetrically driven at a selected frequency (approximately equal to the resonance frequency of the resonators), and a d.c. bias is applied to the junction. By observing the current voltage characteristic of the junction, a precise voltage, proportional to the frequency of the microwave drive signal, is obtained.
The measurement of vacuum at high voltage terminal of the FOTIA facility at BARC
International Nuclear Information System (INIS)
Kansara, M.J.; Sapna, P.; Subrahmanyam, N.B.V.; Bhatt, J.P.; Gupta, S.K.; Singh, P.
2003-01-01
Full text: In FOTIA, the ion beams accelerated by the low energy tube are injected into the high-energy accelerating tube using the 180 deg folding magnet. In order to have maximum transmission through the magnet chamber the vacuum in this section should be in the range of 10 -8 Torr. The chamber is very narrow (14 mm x 24 mm) and offers low conductance to the vacuum system. For maintaining the required UHV inside this chamber and associated beam lines inside the high voltage terminal at 6 MV, a sputter ion pump (120 litres/sec) is used. However, the control of the ion pump and measurement of the vacuum in the chamber has to be done from the control consol located at ground potential. This has been accomplished through a fibre optic data telemetry system, which offers electrical isolation of 6 MV. This fibre optic system is integrated to the main control system of the FOTIA. For controlling and monitoring the ion pump DOUT and ADC modules of the CAMAC system are used to provide interfacing signals to the fibre optic system. For the measurement of the vacuum, the gauge output provided by the ion pump is converted to a suitable light signal (1 kHz to 10 kHz) and is transmitted to the fibre optic link box (located at ground). At ground level this light signal is converted back to a voltage signal and transmitted to ADC module of the CAMAC system. This voltage signal is calibrated against the vacuum measured in the terminal, which is available in the control room via computer connected to the CAMAC system. In this paper, details of the above system will be presented
30 CFR 77.807-3 - Movement of equipment; minimum distance from high-voltage lines.
2010-07-01
... high-voltage lines. 77.807-3 Section 77.807-3 Mineral Resources MINE SAFETY AND HEALTH ADMINISTRATION... WORK AREAS OF UNDERGROUND COAL MINES Surface High-Voltage Distribution § 77.807-3 Movement of equipment; minimum distance from high-voltage lines. When any part of any equipment operated on the surface of any...
Dinzi, R.; Hamonangan, TS; Fahmi, F.
2018-02-01
In the current distribution system, a large-capacity distribution transformer supplies loads to remote locations. The use of 220/380 V network is nowadays less common compared to 20 kV network. This results in losses due to the non-optimal distribution transformer, which neglected the load location, poor consumer profile, and large power losses along the carrier. This paper discusses how high voltage distribution systems (HVDS) can be a better system used in distribution networks than the currently used distribution system (Low Voltage Distribution System, LVDS). The proposed change of the system into the new configuration is done by replacing a large-capacity distribution transformer with some smaller-capacity distribution transformers and installed them in positions that closest to the load. The use of high voltage distribution systems will result in better voltage profiles and fewer power losses. From the non-technical side, the annual savings and payback periods on high voltage distribution systems will also be the advantage.
Accelerator System Development at High Voltage Engineering
International Nuclear Information System (INIS)
Klein, M. G.; Gottdang, A.; Haitsma, R. G.; Mous, D. J. W.
2009-01-01
Throughout the years, HVE has continuously extended the capabilities of its accelerator systems to meet the rising demands from a diverse field of applications, among which are deep level ion implantation, micro-machining, neutron production for biomedical research, isotope production or accelerator mass spectrometry. Characteristic for HVE accelerators is the coaxial construction of the all solid state power supply around the acceleration tubes. With the use of solid state technology, the accelerators feature high stability and very low ripple. Terminal voltages range from 1 to 6 MV for HVE Singletrons and Tandetrons. The high-current versions of these accelerators can provide ion beams with powers of several kW. In the last years, several systems have been built with terminal voltages of 1.25 MV, 2 MV and 5 MV. Recently, the first system based on a 6 MV Tandetron has passed the factory tests. In this paper we describe the characteristics of the HVE accelerator systems and present as example recent systems.
A Novel Quasi-SEPIC High-Voltage Boost DC-DC Converter
DEFF Research Database (Denmark)
Siwakoti, Yam Prasad; N. Soltani, Mohsen; Blaabjerg, Frede
2017-01-01
This paper proposes a modified coupled-inductor SEPIC dc-dc converter for low power and high voltage gain applications such as for piezoelectric drive systems. The converter uses the same components as of SEPIC converter with an additional diode. Compared to conventional topologies with similar...... voltage gain expression, the proposed topology uses less components to achieve same or even higher voltage gain. This helps to design a very compact and light weight converter with higher power density at lower cost. Due to brevity, the principle of operation, theoretical analysis and comparison supported...
AUTHOR|(CDS)2081689; Bajko, Marta
In the framework of the Luminosity upgrade of the Large Hadron Collider (HL - LHC), a remarkable R&D effort is now ongoing at the European Organization for Nuclear Research (CERN) in order to develop a new generation of accelerator magnets and superconducting power transmission lines. The magnet technology will be based on Nb$_{3}$Sn enabling to operate in the 11 - 13 T range. In parallel, in order to preserve the power converters from the increasing radiation level, high power transmission lines are foreseen to feed the magnets from free - radiation zones. These will be based on high temperature superconductors cooled down with helium gas in the range 5 - 30 K. The new technologies will require advanced design and fabrication approaches as well as adapted instrumentation for monitoring both the R&D phase and operation. Resistive sensors have been used so far for voltage, temperature and strain monitoring but their integration still suffers from the number of electrical wires and the complex compensat...
Erbrink, J.J.
2011-01-01
High-voltage transformers have tap changers to regulate the voltage in the high-voltage network when the load changes. Those tap changers are subject to different degradation mechanisms and need regular maintenance. Various defects, like contact degradation, often remain undetected and the
High-power high-voltage pulse generator for supplying electrostatic precipitators of dust
International Nuclear Information System (INIS)
Radu, A.; Martin, D.
1992-01-01
The study and development of an experimental high voltage generator specialized in the supply of electrostatic precipitators are presented. The main parameters of the pulse generator are: U = -30 kV, I = 8.8 A, τ = 120μs, f r = 150 Hz. The pulse generator was tested on a laboratory electrostatic precipitator with nominal capacitance C = 25 nF, biased at -40 kV by means of a separate high voltage rectifier. The experimental results will be used for the creation of a more powerful pulse generator, a prototype for the supply of a real industrial electrostatic precipitator: U = -50 kV, I = 313 A, τ = 100μs, f r = 300 Hz, C = 100 nF. (Author)
International Nuclear Information System (INIS)
Suprapto; Djasiman
2002-01-01
The improvement capacity of Cockcroft-Walton high voltage source from 300 kV/20 mA to 500 kV/mA has been carrying out. To improve the capacity of high voltage source was done by means of increasing the stage number of voltage multiplier from 11 to 18 and its output voltage measuring resistance. Each stage of voltage multiplier consists of 2 capacitors and 2 circuits of high voltage diode. This voltage multiplier is constructed using main components of high voltage capacitor and high voltage diode each of 0.22 μF/50 kV and UF 5408 respectively. To avoid stray discharge and corona it was provided with high voltage electrode and corona ring. The test result indicated that the output voltage obtained from 16 stages was 350 kV according to operating condition of 25 MΩ resistive load and first stage voltage of 28.5 kV with oscillator frequency of 24 Hz. That condition requires anode voltage and current of 5.5 kV and 2.5 A respectively. The no load test for 16 stages indicates 400 kV of output voltage and 28.5 kV first stage voltage. Efficiency of high voltage source was 48 % at 6.75 kW of output power. The expected test of 500 kV with 18 stages of voltage multiplier can not be carried out because of some restrictive of loading system. From the test result can be predicted that the output voltage of 500 kV with 18 stages of voltage multiplier requires 31.2 kV of first stage voltage. Then the expected high voltage source of Cockcroft-Walton is capable as accelerating voltage source for Electron Beam Machine with energy of 500 kV. (author)
Ultra Fast, High Rep Rate, High Voltage Spark Gap Pulser
1995-07-01
current rise time. The spark gap was designed to have a coaxial geometry reducing its inductance. Provisions were made to pass flowing gas between the...ULTRA FAST, HIGH REP RATE, HIGH VOLTAGE SPARK GAP PULSER Robert A. Pastore Jr., Lawrence E. Kingsley, Kevin Fonda, Erik Lenzing Electrophysics and...Modeling Branch AMSRL-PS-EA Tel.: (908)-532-0271 FAX: (908)-542-3348 U.S. Army Research Laboratory Physical Sciences Directorate Ft. Monmouth
GECM-Based Voltage Stability Assessment Using Wide-Area Synchrophasors
Directory of Open Access Journals (Sweden)
Heng-Yi Su
2017-10-01
Full Text Available Voltage instability is a crucial issue in the secure operation of power grids. Several methods for voltage stability assessment were presented. Some of them are highly computationally intensive, while others are reported not to work properly under all circumstances. This paper proposes a new methodology based on the generator equivalent circuit model (GECM and the phasor measurement unit (PMU technology for online voltage stability monitoring of a power grid. First, the proposed methodology utilizes synchronized phasor (synchrophasor measurements to determine the impedance parameters of a transmission grid by means of the recursive least squares (RLS algorithm. Furthermore, it incorporates the dynamic models of generators to handle the cases with generator reactive power limit violations. After that, an enhanced voltage stability index with GECMs incorporated is developed for reliable and accurate voltage stability assessment. The proposed methodology was first demonstrated on several standard IEEE power systems, and then applied to a practical power system, the Taiwan power (Taipower system. The test results demonstrate the flexibility and effectiveness of the proposed methodology.
A high voltage ratio and low ripple interleaved DC-DC converter for fuel cell applications.
Chang, Long-Yi; Chao, Kuei-Hsiang; Chang, Tsang-Chih
2012-01-01
This paper proposes a high voltage ratio and low ripple interleaved boost DC-DC converter, which can be used to reduce the output voltage ripple. This converter transfers the low DC voltage of fuel cell to high DC voltage in DC link. The structure of the converter is parallel with two voltage-doubler boost converters by interleaving their output voltages to reduce the voltage ripple ratio. Besides, it can lower the current stress for the switches and inductors in the system. First, the PSIM software was used to establish a proton exchange membrane fuel cell and a converter circuit model. The simulated and measured results of the fuel cell output characteristic curve are made to verify the correctness of the established simulation model. In addition, some experimental results are made to validate the effectiveness in improving output voltage ripple of the proposed high voltage ratio interleaved boost DC-DC converters.
Multi-cell DC-DC converter with high step-down voltage ratio
Tibola, G.; Duarte, J.L.; Blinov, A.
2015-01-01
The use of high voltage allows a power processing system to operate with low currents, improving efficiency. Nevertheless, final applications usually require low voltage inlet, which can be provided using modular multilevel converters submodules, for instance. However, every submodule's gate-unit
A nanosecond high voltage pulse device for accelerator time analytical system
International Nuclear Information System (INIS)
Lou Binqiao; Ding Furong; Xue Zhihua; Wang Xuemei; Shen Dingyu
2002-01-01
A nanosecond high voltage pulse device has been designed. The pulse rise time is 10 ns. The pulse voltage reached 16000 V. This device has been used to accelerator time analytical system, its resolution time is less than 0.8%
Energy Technology Data Exchange (ETDEWEB)
Maxson, Jared; Bazarov, Ivan; Dunham, Bruce; Dobbins, John; Liu, Xianghong; Smolenski, Karl [Cornell Laboratory for Accelerator-Based Sciences and Education, Cornell University, Ithaca, New York 14853 (United States)
2014-09-15
A new high voltage photoemission gun has been constructed at Cornell University which features a segmented insulator and a movable anode, allowing the cathode-anode gap to be adjusted. In this work, we describe the gun's overall mechanical and high voltage design, the surface preparation of components, as well as the clean construction methods. We present high voltage conditioning data using a 50 mm cathode-anode gap, in which the conditioning voltage exceeds 500 kV, as well as at smaller gaps. Finally, we present simulated emittance results obtained from a genetic optimization scheme using voltage values based on the conditioning data. These results indicate that for charges up to 100 pC, a 30 mm gap at 400 kV has equal or smaller 100% emittance than a 50 mm gap at 450 kV, and also a smaller core emittance, when placed as the source for the Cornell energy recovery linac photoinjector with bunch length constrained to be <3 ps rms. For 100 pC up to 0.5 nC charges, the 50 mm gap has larger core emittance than the 30 mm gap, but conversely smaller 100% emittance.
The high voltage divider - a tool for comparison of measurement equipment in diagnostic radiology
International Nuclear Information System (INIS)
Slavchev, A.; Litchev, A.; Constantinov, B.
2004-01-01
The high voltage divider (HVD) is designed for control and analysis of the characteristics of the X-ray generator. The low voltage analogous signals produced by the divider are proportional to the high voltage (kVp) applied to the x-ray tube by a ratio 1:1000 or 1:10000 and can be measured with external test devices like storage oscilloscope (or digital multimeter). The exposure duration and the wave form may be visualized, too. Apart of this invasive way the high voltage also may be measured non-invasively by means of appropriate devices as well as indirectly through calculations. Since the invasive method of measurement with the high voltage divider is distinguished by a high accuracy, it may be utilized as an effective tool for calibration of different devices and for comparison of the measurement methods. (authors)
Moyer, Rachael M.
Following a proposal for the installation of high voltage power lines in northwest Arkansas, a controversial policy debate emerged. Proponents of the transmission line argue that such an installation is inevitable and necessary to efficiently and reliably support the identified electric load in the region. Opponents claim that the lines will degrade the natural environment and hamper the tourism-based local economy in affected regions, notably in Ozark Mountain areas. This study seeks to understand how local policy elites perceive the benefits and risks associated with proposed transmission lines, which is a critical step in comprehending the formation and changes of related government policies. First, based upon the dual process theory of judgment, this study systematically investigates the triadic relationships between (a) more profound personal value predispositions, (b) affects and feelings, and (c) perceived benefits and risks related to the proposed installation of high voltage power lines among local policy elites in the state of Arkansas. Next, this study focuses more specifically on the role of value predispositions, specific emotional dimensions of affect heuristics, and perceptions pertaining to high voltage power line risks and benefits. Using original data collected from a statewide Internet survey of 420 local leaders and key policymakers about their opinions on the related issues, other factors claimed by previous literature, including trust, knowledge level, and demographic characteristics are considered. Analytical results suggest that grid-group cultural predispositions, as deeply held core values within local policy elites' individual belief systems, both directly and indirectly -- through affective feelings -- shape perceived utility associated with the installation of high voltage power lines. Recognizing that risk perceptions factor into policy decisions, some practical considerations for better designing policy addressing controversial issues
Risk Evaluation on UHV Power Transmission Construction Project Based on AHP and FCE Method
Huiru Zhao; Sen Guo
2014-01-01
Ultra high voltage (UHV) power transmission construction project is a high-tech power grid construction project which faces many risks and uncertainty. Identifying the risk of UHV power transmission construction project can help mitigate the risk loss and promote the smooth construction. The risk evaluation on “Zhejiang-Fuzhou” UHV power transmission construction project was performed based on analytic hierarchy process (AHP) and fuzzy comprehensive evaluation (FCE) method in this paper. Afte...
Hybrid HVDC (H2VDC System Using Current and Voltage Source Converters
Directory of Open Access Journals (Sweden)
José Rafael Lebre
2018-05-01
Full Text Available This paper presents an analysis of a new high voltage DC (HVDC transmission system, which is based on current and voltage source converters (CSC and VSC in the same circuit. This proposed topology is composed of one CSC (rectifier and one or more VSCs (inverters connected through an overhead transmission line in a multiterminal configuration. The main purpose of this Hybrid HVDC (H2VDC, as it was designed, is putting together the best benefits of both types of converters in the same circuit: no commutation failure and system’s black start capability in the VSC side, high power converter capability and low cost at the rectifier side, etc. A monopole of the H2VDC system with one CSC and two VSCs—here, the VSC is the Modular Multilevel Converter (MMC considered with full-bridge submodules—in multiterminal configuration is studied. The study includes theoretical analyses, development of the CSC and VSCs control philosophies and simulations. The H2VDC system’s behavior is analyzed by computational simulations considering steady-state operation and short-circuit conditions at the AC and DC side. The obtained results and conclusions show a promising system for very high-power multiterminal HVDC transmission.
30 CFR 56.12071 - Movement or operation of equipment near high-voltage power lines.
2010-07-01
...-voltage power lines. 56.12071 Section 56.12071 Mineral Resources MINE SAFETY AND HEALTH ADMINISTRATION... NONMETAL MINES Electricity § 56.12071 Movement or operation of equipment near high-voltage power lines. When equipment must be moved or operated near energized high-voltage powerlines (other than trolley...
DEFF Research Database (Denmark)
Liu, Hongzhi; Chen, Zhe
2012-01-01
This paper describes fault ride-through and grid support of offshore wind farms based on permanent magnet synchronous generator (PMSG) wind turbines connected to the onshore AC network through two alternative transmission systems: high voltage AC (HVAC) or high voltage DC (HVDC) based on voltage...... source converters (VSC). The proposed configurations of the PMSG-based offshore wind farm and VSC-based HVDC are given as well as their control strategies under both steady state and fault state. The PMSG-based offshore wind farm is integrated into a test power transmission system via either HVAC or VSC...
Serially Connected Micro Amorphous Silicon Solar Cells for Compact High-Voltage Sources
Directory of Open Access Journals (Sweden)
Jiyoon Nam
2016-01-01
Full Text Available We demonstrate a compact amorphous silicon (a-Si solar module to be used as high-voltage power supply. In comparison with the organic solar module, the main advantages of the a-Si solar module are its compatibility with photolithography techniques and relatively high power conversion efficiency. The open circuit voltage of a-Si solar cells can be easily controlled by serially interconnecting a-Si solar cells. Moreover, the a-Si solar module can be easily patterned by photolithography in any desired shapes with high areal densities. Using the photolithographic technique, we fabricate a compact a-Si solar module with noticeable photovoltaic characteristics as compared with the reported values for high-voltage power supplies.
Modeling and application of VSC-HVDC in the European transmission system
International Nuclear Information System (INIS)
L'Abatte, A.; Fulli, G.
2010-01-01
This paper investigated the potential technical, environmental, and economic impacts of voltage source converter (VSC) based high voltage direct current (HVDC) technologies on the European power system, with particular emphasis on enhancing the attainable transmission capacity in specific applications. To this end, an original steady-state model of the VSC-HVDC was presented and tested. A techno-economic analysis of the potential impact of VSC-HVDC on liberalized power systems in Europe was performed to determine the feasibility of such investment compared to building conventional high voltage alternating current (HVAC) transmission infrastructures. The land use and environmental impact of HVDC may be lower than HVAC technologies. VSC-HVDC offers several advantages over conventional HVDC, including flexibility and range of power control, compactness and modularity of converter stations, easier expandability for multi-terminal configurations, and greater environmental friendliness. The relative disadvantages of the VSC-HVDC include a greater expense and higher converter losses. When replacing existing HVAC lines, some targeted VSC-HVDC installations were shown to be technologically and economically feasible, particularly when installed on lines between regions with a high electricity price differential, although less profitable than building new HVAC lines. VSC-HVDC can be a more feasible option when socio-political and environmental restraints curtail the extension of the HVAC transmission system. 29 refs., 6 tabs., 4 figs.
On some aspects of high voltage electron microscopy
International Nuclear Information System (INIS)
Jouffrey, B.; Trinquier, J.
1987-01-01
The present paper deals with high voltage electron microscopy (HVEM). It is an overview on this domain due to the pionneer work of G. Dupouy which has permitted to perform a new kind of electron microscopy. Since this time, HVEM has shown its interest in high resolution, irradiations, chemical analysis, in situ experiments
Directory of Open Access Journals (Sweden)
I. I. Zabenkov
2012-01-01
Full Text Available Continuous measurement function of relative noise and interference level in the information transmission channel is considered as an important one for controlling parameters of high-frequency signal. The present paper simulates an algorithm for measuring signal-noise ratio in the transmission channel of high-voltage lines which is used in the digital equipment for transmission of relay protection and emergency automation commands of "Strela" complex.
An Estimation Method of System Voltage Sag Profile using Recorded Sag Data
Tanaka, Kazuyuki; Sakashita, Tadashi
The influence of voltage sag to electric equipment has become big issues because of wider utilization of voltage sensitive devices. In order to reduce the influence of voltage sag appearing at each customer side, it is necessary to recognize the level of receiving voltage drop due to lightning faults for transmission line. However it is hard to measure directly those sag level at every load node. In this report, a new method of efficiently estimating system voltage sag profile is proposed based on symmetrical coordinate. In the proposed method, limited recorded sag data is used as the estimation condition which is recorded at each substation in power systems. From the point of view that the number of the recorded node is generally far less than those of the transmission route, a fast solution method is developed to calculate only recorder faulted voltage by applying reciprocity theorem for Y matrix. Furthermore, effective screening process is incorporated, in which the limited candidate of faulted transmission line can be chosen. Demonstrative results are presented using the IEEJ East10 standard system and actual 1700 bus system. The results show that estimation accuracy is sufficiently acceptable under less computation labor.
Transmission Line Series Compensation for Wind Energy Transmission
International Nuclear Information System (INIS)
Palanichamy, C; Wong, Y C
2015-01-01
Wind energy has demonstrated to be a clean, copious and absolutely renewable source of energy, and the large penetration of it into the power grid indicates that wind energy is considered an effective means of power generation, Transmission of wind energy from remote locations to load centers necessitates long transmission lines. Series compensation is a proven and economical transmission solution to address system power transfer strength, grid stability, and voltage profile issues of long transmission lines. In this paper, a programmable approach to determine the capacitive reactance of series capacitor and optimum location for its placement to achieve maximum power transfer gas been presented. The respective program with sample solutions has been provided for real-time applications. (paper)
Xin, Encheng; Ju, Yong; Yuan, Haiwen
2016-10-20
A space charge density wireless measurement system based on the idea of distributed measurement is proposed for collecting and monitoring the space charge density in an ultra-high-voltage direct-current (UHVDC) environment. The proposed system architecture is composed of a number of wireless nodes connected with space charge density sensors and a base station. The space charge density sensor based on atmospheric ion counter method is elaborated and developed, and the ARM microprocessor and Zigbee radio frequency module are applied. The wireless network communication quality and the relationship between energy consumption and transmission distance in the complicated electromagnetic environment is tested. Based on the experimental results, the proposed measurement system demonstrates that it can adapt to the complex electromagnetic environment under the UHVDC transmission lines and can accurately measure the space charge density.
[Influence of high-voltage electric burn on the microcirculation of heart in rabbit].
Zhang, Qing-fu; Zhou, Hui-min; Wang, Che-jiang; Shao, Hong-bo
2012-06-01
To study the influence of high-voltage electric burn on the microcirculation of heart in rabbit. One-hundred and twenty New Zealand rabbits of clean grade were divided into control group (C) and electric burn group (EB) according to the random number table, with 60 rabbits in each group. Rabbits in EB group were subjected to high-voltage electric burn (the electrical current flow into the left foreleg at the lateral side of proximal end and out from the corresponding site of the right hind leg) with voltage regulator and experimental transformer. Rabbits in C group were sham injured with the same devices without electrification. At 15 minutes before injury, and 5 minutes, 1, 2, 4, 8 hour (s) post injury (PIM or PIH), ten rabbits in each group were chosen to examine the cardiac apex microcirculation hemoperfusion (CAMH) with laser Doppler hemoperfusion image instrument. The morphologic changes of microvessels of left ventricular wall tissues of 2 rabbits from each of the 10 rabbits collected at above-mentioned time points were observed with light microscope and transmission electron microscope. Auricular vein blood of rabbit was harvested at above-mentioned time points for the determination of aspartate amino transferase (AST), lactate dehydrogenase (LDH), hydroxybutyrate dehydrogenase (HBDH), creatine kinase (CK), and creatine kinase isozyme MB (CK-MB) by full-automatic biochemical analyzer. Data were processed with two-factor analysis of variance and LSD test. (1) The differences between C group and EB group in detection results were statistically significant, with F values from 425.991 to 3046.834, P values all below 0.01. Only the data within EB group were comparable. (2) At PIM 5, the CAMH value of rabbits in EB group was (1.96 ± 0.09) V, which was lower than that at 15 minutes before injury [(4.34 ± 0.35) V, P electric burn can bring damage to the microvessels of heart in rabbits and change blood flow of microcirculation, which should be given adequate
A new VME-based high voltage power supply for large photomultiplier systems
International Nuclear Information System (INIS)
Neumaier, S.; Hubbeling, T.; Kolb, B.W.; Purschke, M.L.; Ippolitov, M.; Blume, C.; Bohne, E.M.; Bucher, D.; Claussen, A.; Peitzmann, T.; Schepers, G.; Schlagheck, H.
1995-01-01
We describe a new high voltage power supply, developed for the leadglass calorimeter of the WA98 experiment at CERN. The high voltage is produced for each of the 10,080 photomultiplier tubes of the detector individually, by the same number of active bases with on-board Greinacher voltage multipliers. The full VME-based HV controller system, which addresses each base via bus cables once per second, is miniaturized and fits into a single VME crate. The main advantages of this approach are the low heat dissipation, the considerably reduced amount of cabling and cost, as well as the high stability and low noise of the system. (orig.)
Yang, Qi; Huang, Jie; Li, Yejing; Wang, Yi; Qiu, Jiliang; Zhang, Jienan; Yu, Huigen; Yu, Xiqian; Li, Hong; Chen, Liquan
2018-06-01
Surface modification of LiCoO2 with the ultrathin film of solid state electrolyte of Li1.4Al0.4Ti1.6(PO4)3 (LATP) has been realized by a new and facile solution-based method. The coated LiCoO2 reveals enhanced structural and electrochemical stability at high voltage (4.5 V vs Li+/Li) in half-cell with liquid electrolyte. Transmission electron microscopy (TEM) images show that a dense LATP coating layer is covered on the surface of LiCoO2 uniformly with thickness of less than 20 nm. The LATP coating layer is proven to be able to prevent the direct contact between the cathode and the electrolyte effectively and thus to suppress the side reactions of liquid electrolyte with LiCoO2 surface at high charging voltage. As a result, dissolution of Co3+ has been largely suppressed over prolonged cycling as indicated by the X-ray photoelectron spectroscopy (XPS) measurements. Due to this surface passivating feature, the electrochemical performance of 0.5 wt% LATP modified LiCoO2 has also been evaluated in an all solid lithium battery with poly(ethylene oxide)-based polymer electrolyte. The cell exhibits 93% discharge capacity retention of the initial discharge capacity after 50 cycles at the charging cut-off voltage of 4.2 V, suggesting that the LATP coating layer is effective to suppress the oxidation of PEO at high voltage.
30 CFR 77.807-2 - Booms and masts; minimum distance from high-voltage lines.
2010-07-01
...-voltage lines. 77.807-2 Section 77.807-2 Mineral Resources MINE SAFETY AND HEALTH ADMINISTRATION... WORK AREAS OF UNDERGROUND COAL MINES Surface High-Voltage Distribution § 77.807-2 Booms and masts; minimum distance from high-voltage lines. The booms and masts of equipment operated on the surface of any...
SSP Technology Investigation of a High-Voltage DC-DC Converter
Pappas, J. A.; Grady, W. M.; George, Patrick J. (Technical Monitor)
2002-01-01
The goal of this project was to establish the feasibility of a high-voltage DC-DC converter based on a rod-array triggered vacuum switch (RATVS) for the Space Solar Power system. The RATVS has many advantages over silicon and silicon-carbide devices. The RATVS is attractive for this application because it is a high-voltage device that has already been demonstrated at currents in excess of the requirement for an SSP device and at much higher per-device voltages than existing or near-term solid state switching devices. The RATVS packs a much higher specific power rating than any solid-state device and it is likely to be more tolerant of its surroundings in space. In addition, pursuit of an RATVS-based system would provide NASA with a nearer-term and less expensive power converter option for the SSP.
Cermet insert high voltage holdoff improvement for ceramic/metal vacuum devices
Ierna, W.F.
1986-03-11
An improved metal-to-ceramic seal is provided wherein the ceramic body of the seal contains an integral region of cermet material in electrical contact with the metallic member, e.g., an electrode, of the seal. The seal is useful in high voltage vacuum devices, e.g., vacuum switches, and increases the high-voltage holdoff capabilities of such devices. A method of fabricating such seals is also provided.
Directory of Open Access Journals (Sweden)
Chih-Lung Shen
2015-09-01
Full Text Available In this paper, an integrated three-voltage-booster DC-DC (direct current to direct current converter is proposed to achieve high voltage gain for renewable-energy generation systems. The proposed converter integrates three voltage-boosters into one power stage, which is composed of an active switch, a coupled-inductor, five diodes, and five capacitors. As compared with conventional high step-up converters, it has a lower component count. In addition, the features of leakage-energy recycling and switching loss reduction can be accomplished for conversion efficiency improvement. While the active switch is turned off, the converter can inherently clamp the voltage across power switch and suppress voltage spikes. Moreover, the reverse-recovery currents of all diodes can be alleviated by leakage inductance. A 200 W prototype operating at 100 kHz switching frequency with 36 V input and 400 V output is implemented to verify the theoretical analysis and to demonstrate the feasibility of the proposed high step-up DC-DC converter.
High Voltage Coil Current Sensor for DC-DC Converters Employing DDCC
Directory of Open Access Journals (Sweden)
M. Drinovsky
2015-12-01
Full Text Available Current sensor is an integral part of every switching converter. It is used for over-current protection, regulation and in case of multiphase converters for balancing. A new high voltage current sensor for coil-based current sensing in DC-DC converters is presented. The sensor employs DDCC with high voltage input stage and gain trimming. The circuit has been simulated and implemented in 0.35 um BCD technology as part of a multiphase DC-DC converter where its function has been verified. The circuit is able to sustain common mode voltage on the input up to 40 V, it occupies 0.387*0.345 mm2 and consumes 3.2 mW typically.
High Voltage Surface Degradation on Carbon Blacks in Lithium Ion Batteries
DEFF Research Database (Denmark)
Younesi, Reza
In order to increase the power density of Li-ion batteries, much research is focused on developing cathode materials that can operate at high voltages above 4.5 V with a high capacity, high cycling stability, and rate capability. However, at high voltages all the components of positive electrodes...... including carbon black (CB) additives have a potential risk of degradation. Though the weight percentage of CB in commercial batteries is generally very small, the volumetric amount and thus the surface area of CB compose a rather large part of a cathode due to its small particle size (≈ 50 nm) and high...
Directory of Open Access Journals (Sweden)
Qiang Jiaxi
2013-01-01
Full Text Available Batteries, as the main or assistant power source of EV (Electric Vehicle, are usually connected in series with high voltage to improve the drivability and energy efficiency. Today, more and more batteries are connected in series with high voltage, if there is any fault in high voltage system (HVS, the consequence is serious and dangerous. Therefore, it is necessary to monitor the electric parameters of HVS to ensure the high voltage safety and protect personal safety. In this study, a high voltage safety monitor system is developed to solve this critical issue. Four key electric parameters including precharge, contact resistance, insulation resistance, and remaining capacity are monitored and analyzed based on the equivalent models presented in this study. The high voltage safety controller which integrates the equivalent models and control strategy is developed. By the help of hardware-in-loop system, the equivalent models integrated in the high voltage safety controller are validated, and the online electric parameters monitor strategy is analyzed and discussed. The test results indicate that the high voltage safety monitor system designed in this paper is suitable for EV application.
Jiaxi, Qiang; Lin, Yang; Jianhui, He; Qisheng, Zhou
2013-01-01
Batteries, as the main or assistant power source of EV (Electric Vehicle), are usually connected in series with high voltage to improve the drivability and energy efficiency. Today, more and more batteries are connected in series with high voltage, if there is any fault in high voltage system (HVS), the consequence is serious and dangerous. Therefore, it is necessary to monitor the electric parameters of HVS to ensure the high voltage safety and protect personal safety. In this study, a high voltage safety monitor system is developed to solve this critical issue. Four key electric parameters including precharge, contact resistance, insulation resistance, and remaining capacity are monitored and analyzed based on the equivalent models presented in this study. The high voltage safety controller which integrates the equivalent models and control strategy is developed. By the help of hardware-in-loop system, the equivalent models integrated in the high voltage safety controller are validated, and the online electric parameters monitor strategy is analyzed and discussed. The test results indicate that the high voltage safety monitor system designed in this paper is suitable for EV application.
A new high-voltage level-shifting circuit for half-bridge power ICs
International Nuclear Information System (INIS)
Kong Moufu; Chen Xingbi
2013-01-01
In order to reduce the chip area and improve the reliability of HVICs, a new high-voltage level-shifting circuit with an integrated low-voltage power supply, two PMOS active resistors and a current mirror is proposed. The integrated low-voltage power supply not only provides energy for the level-shifting circuit and the logic circuit, but also provides voltage signals for the gates and sources of the PMOS active resistors to ensure that they are normally-on. The normally-on PMOS transistors do not, therefore, need to be fabricated in the depletion process. The current mirror ensures that the level-shifting circuit has a constant current, which can reduce the process error of the high-voltage devices of the circuit. Moreover, an improved RS trigger is also proposed to improve the reliability of the circuit. The proposed level-shifting circuit is analyzed and confirmed by simulation with MEDICI, and the simulation results show that the function is achieved well. (semiconductor integrated circuits)
Tao, Jiayou; Liu, Nishuang; Rao, Jiangyu; Ding, Longwei; Al Bahrani, Majid Raissan; Li, Luying; Su, Jun; Gao, Yihua
2014-11-01
Asymmetric supercapacitors (ASCs) based on free-standing membranes with high energy density and high output voltage are reported. MnO2 nanowire/carbon nanotube (CNT) composites and MoO3 nanobelt/CNT composites are selected as the anode and the cathode materials of the devices, respectively. The ASC has a high volumetric capacitance of 50.2 F cm-3 at a scan rate of 2 mV s-1 and a high operation voltage window of 2.0 V. Especially, after a middle layer with an inner-connection structure was inserted between the anode and the cathode, the output voltage of the whole device can achieve 4.0 V. The full cell of series ASCs (SASC) with an inner-connection middle layer has a high energy density of 28.6 mW h cm-3 at a power density of 261.4 mW cm-3, and exhibits excellent cycling performance of 99.6% capacitance retention over 10 000 cycles. This strategy of designing the hybridized structure for SASCs provides a promising route for next-generation SCs with high energy density and high output voltage.Asymmetric supercapacitors (ASCs) based on free-standing membranes with high energy density and high output voltage are reported. MnO2 nanowire/carbon nanotube (CNT) composites and MoO3 nanobelt/CNT composites are selected as the anode and the cathode materials of the devices, respectively. The ASC has a high volumetric capacitance of 50.2 F cm-3 at a scan rate of 2 mV s-1 and a high operation voltage window of 2.0 V. Especially, after a middle layer with an inner-connection structure was inserted between the anode and the cathode, the output voltage of the whole device can achieve 4.0 V. The full cell of series ASCs (SASC) with an inner-connection middle layer has a high energy density of 28.6 mW h cm-3 at a power density of 261.4 mW cm-3, and exhibits excellent cycling performance of 99.6% capacitance retention over 10 000 cycles. This strategy of designing the hybridized structure for SASCs provides a promising route for next-generation SCs with high energy density and high
Application of Multipoint DC Voltage Control in VSC-MTDC System
Directory of Open Access Journals (Sweden)
Yang Xi
2013-01-01
Full Text Available The voltage-source-converter- (VSC- based multiterminal VSC-HVDC power transmission system (VSC-MTDC is an ideal approach to connect wind farm with power grid. Analyzing the characteristics of doubly fed induction generators as well as the basic principle and the control strategy of VSC-MTDC, a multiterminal DC voltage control strategy suitable for wind farm connected with VSC-MTDC is proposed. By use of PSCAD/EMTDC, the proposed control strategy is simulated, and simulation results show that using the proposed control strategy the conversion between constant power control mode and constant DC voltage control mode can be automatically implemented; thus the DC voltage stability control and reliable power output of wind farm can be ensured after the fault-caused outage of converter station controlled by constant DC voltage and under other faults. The simulation result shows that the model can fulfill multiterminal power transmission and fast response control.
30 CFR 77.803 - Fail safe ground check circuits on high-voltage resistance grounded systems.
2010-07-01
... circuits on high-voltage resistance grounded systems. On and after September 30, 1971, all high-voltage... 30 Mineral Resources 1 2010-07-01 2010-07-01 false Fail safe ground check circuits on high-voltage resistance grounded systems. 77.803 Section 77.803 Mineral Resources MINE SAFETY AND HEALTH ADMINISTRATION...
Poisson simulation for high voltage terminal of test stand for 1MV electrostatic accelerator
Energy Technology Data Exchange (ETDEWEB)
Park, Sae-Hoon; Kim, Jeong-Tae; Kwon, Hyeok-Jung; Cho, Yong-Sub [Korea Atomic Energy Research Institute, Daejeon (Korea, Republic of); Kim, Yu-Seok [Dongguk Univ.., Gyeongju (Korea, Republic of)
2014-10-15
KOMAC provide ion beam to user which energy range need to expand to MeV range and develop 1 MV electrostatic accelerator. The specifications of the electrostatic accelerator are 1MV acceleration voltage, 10 mA peak current and variable gas ion. We are developing test stand before set up 1 MV electrostatic accelerator. The test stand voltage is 300 kV and operating time is 8 hours. The test stand is consist of 300 kV high voltage terminal, DC-AC-DC inverter, power supply device inside terminal, 200MHz RF power, 5 kV extraction power supply, 300 kV accelerating tube and vacuum system.. The beam measurement system and beam dump will be installed next to accelerating tube. Poisson code simulation results of the high voltage terminal are presented in this paper. Poisson code has been used to calculate the electric field for high voltage terminal. The results of simulation were verified with reasonable results. The poisson code structure could be apply to the high voltage terminal of the test stand.
Poisson simulation for high voltage terminal of test stand for 1MV electrostatic accelerator
International Nuclear Information System (INIS)
Park, Sae-Hoon; Kim, Jeong-Tae; Kwon, Hyeok-Jung; Cho, Yong-Sub; Kim, Yu-Seok
2014-01-01
KOMAC provide ion beam to user which energy range need to expand to MeV range and develop 1 MV electrostatic accelerator. The specifications of the electrostatic accelerator are 1MV acceleration voltage, 10 mA peak current and variable gas ion. We are developing test stand before set up 1 MV electrostatic accelerator. The test stand voltage is 300 kV and operating time is 8 hours. The test stand is consist of 300 kV high voltage terminal, DC-AC-DC inverter, power supply device inside terminal, 200MHz RF power, 5 kV extraction power supply, 300 kV accelerating tube and vacuum system.. The beam measurement system and beam dump will be installed next to accelerating tube. Poisson code simulation results of the high voltage terminal are presented in this paper. Poisson code has been used to calculate the electric field for high voltage terminal. The results of simulation were verified with reasonable results. The poisson code structure could be apply to the high voltage terminal of the test stand
Mass impregnation plant speeds high voltage cable production
Energy Technology Data Exchange (ETDEWEB)
1965-05-07
A mass impregnation and continuous sheath extrusion plant that will eliminate the long period of vacuum treatment usually required for high voltage oil-filled cables is among the latest techniques included in the new factory at Pirelli General's Eastleigh works. The new factory is said to be the first in Europe designed solely for the manufacture of the full range of oil-filled cables. Possible future increases of system voltages to about 750-kV ac or 1000-kV dc have been taken into account in the design of the works, so that only a small amount of modification and new plant will be involved.
Uv laser triggering of high-voltage gas switches
International Nuclear Information System (INIS)
Woodworth, J.R.; Frost, C.A.; Green, T.A.
1982-01-01
Two different techniques are discussed for uv laser triggering of high-voltage gas switches using a KrF laser (248 nm) to create an ionized channel through the dielectric gas in a spark gap. One technique uses an uv laser to induce breakdown in SF 6 . For this technique, we present data that demonstrate a 1-sigma jitter of +- 150 ps for a 0.5-MV switch at 80% of its self-breakdown voltage using a low-divergence KrF laser. The other scheme uses additives to the normal dielectric gas, such as tripropylamine, which are selected to undergo resonant two-step ionization in the uv laser field
Increasing break-down strength of the support colomn of high-voltage accelerators
International Nuclear Information System (INIS)
Rezvykh, K.A.; Romanov, V.A.
1981-01-01
Calculation results of strength of electric field of the EG-2.5 electrostatic accelerator for the support colomn with electrodes of circular and elliptical transverse cross sections are presented. Conducted is the choice of constructing the column under the condition that the dimensions of the tank, high-voltage electrode, step between the sections and internal diameter of the colomn electrodes are not changed. The potential at the high-voltage electrode equals 2.5 MV while the average longitudinal gradient of the colomn field equals 1.25 MV/m. The support insulation colomn of the high-voltage accelerator screened by rings with transverse cross section in the form of orientation oval in some accelerators promotes obtaining higher operating voltage and at the same time increase of operation reliability at the rest unchanged dimensions of the plant because the probability of break-down between the support colomn and the tank wall decreases. The latter is especially significant for most high-energy accelerators as well as for accelerators used in national economy [ru
Apparatus with a cooled X-ray source and a high voltage generator
Energy Technology Data Exchange (ETDEWEB)
1977-02-01
Apparatus, especially for a dental application, with an X-ray source and a high voltage generator, whereby the X-ray source and a high voltage generator are contained in a housing, which is filled with a coolant medium, characterised by the housing being divided into two chambers, whereby the X-ray source is in the first chamber and the high voltage generator is in the second chamber and between the chambers a dividing wall is placed for the screening of the X-ray irradiation from the first chamber from the second, whereby at least one of the walls of the second chamber is elastic to accommodate the expansion of the coolant medium.
Marzocchi, Badder
2017-01-01
The CMS Electromagnetic Calorimeter is made of scintillating lead tungstate crystals, using avalanche photodiodes (APD) as photo-detectors in the barrel part. The high voltage system, consisting of 1224 channels, biases groups of 50 APD pairs, each at a voltage of about 380 V. The APD gain dependence on the voltage is 3pct/V. A stability of better than 60 mV is needed to have negligible impact on the calorimeter energy resolution. Until 2015 manual calibrations were performed yearly. A new calibration system was deployed recently, which satisfies the requirement of low disturbance and high precision. The system is discussed in detail and first operational experience is presented.
Energy Technology Data Exchange (ETDEWEB)
Borchard, Ludwig O. [Transnet freight rail, (Technology Management), Braamfontein (South Africa); Lehmann, Michael [Technische Univ. Dresden (Germany). Professur Elektrische Bahnen
2009-04-15
Raising the nominal voltage of electric railway systems implies many advantages, therefore several concepts can be presented and compared. Detailed studies on two systems with high contact line voltages were performed for the upgrade of the 1 AC 50 kV railway line in South Africa. Finally requirements for high voltage locomotives are derived and illustrated by examples. (orig.)
Design considerations and data for gas-insulated high voltage structures
International Nuclear Information System (INIS)
Hopkins, D.B.
1975-11-01
This paper is intended to benefit the person faced with the occasional task of designing gas insulated high-voltage structures or spark gaps and who must decide upon the proper geometry, spacings, gas type, and pressure for reliable voltage-holding. An approach is presented along with a summary of how various factors affect voltage breakdown. The design procedures described apply to situations where the influence of nearby insulators is negligible. The accuracy of the data is estimated to be within 10 to 15 percent, a value usually attained in practice only when one follows the cautionary advice discussed in the paragraphs on materials preparation, gas properties, and conditioning
Multiplex Outputs ns Grade High-voltage Fast Pulse Generator Study
International Nuclear Information System (INIS)
Wang Xin; Chen Kenan
2009-01-01
Using a double-grid hydrogen thyratron, a fast pulse generator with four outputs, high-voltage, low jitter, was made to use at special occasion.In this paper, the basic structure of pulser, switching theory and double-grid driving of hydrogen thyratron was introduced, and also, the effects of grids driving pulses characteristics, the delay between too grids driving, the reservoir heater voltage and cathode heater voltage on the output are carefully examined in experiments. The pulse generator with four outputs was made to producing pulses with amplitude up to 4 kV, rise-time less than 15 ns and jitter less than 3 ns. (authors)
Weterings, W
1999-01-01
Large high-voltage devices operate in particle accelerators to steer charged particles in the desired direction. Solid and hollow rods of sintered alumina are used as insulating supports and high-voltage feedthroughs to power the electrodes of these electrostatic systems. The performance of the systems is often limited by voltage breakdown along the surface of the ceramic insulator (so-called surface flashover) or discharge between feedthrough and vacuum tank, which can lead to significant disruptions in terms of overall machine efficiency. Available results on the influence of the mechanical preparation, thermal history and particular cleaning techniques on commercially obtainable alumina samples have been studied in order to investigate possibilities for better preparation methodology of the insulating supports. Also the influence of the relative position of the feedthrough inside the vacuum tank on the high-voltage breakdown behaviour has been studied. This paper describes the theoretical and practical bac...
Lachugin, V. F.; Kulikov, A. L.; Platonov, P. S.; Vucolov, V. Yu.
2017-12-01
The specifics of generation of the signals of current and voltage in the circuits of a directional element of wave relay protection during short circuit (SC) in overhead power transmission lines are considered. The computing method of transient processes in the protection circuits, including frequency filters, that attenuate the parameters of currents and voltages of the mode taking into account the higher harmonic components and probable deviations of the frequency of transmission line from the rated value is presented. It is revealed that it is advisable to implement the measuring circuits of the directional elements of wave relay protection with the three-section filter attenuating the frequencies from 45 to 55 Hz and the low pass filter with cutoff frequency that does not exceed 1 kHz.
Li-Ion Electrolytes with Improved Safety and Tolerance to High-Voltage Systems
Smart, Marshall C.; Bugga, Ratnakumar V.; Prakash, Surya; Krause, Frederick C.
2013-01-01
Given that lithium-ion (Li-ion) technology is the most viable rechargeable energy storage device for near-term applications, effort has been devoted to improving the safety characteristics of this system. Therefore, extensive effort has been devoted to developing nonflammable electrolytes to reduce the flammability of the cells/battery. A number of promising electrolytes have been developed incorporating flame-retardant additives, and have been shown to have good performance in a number of systems. However, these electrolyte formulations did not perform well when utilizing carbonaceous anodes with the high-voltage materials. Thus, further development was required to improve the compatibility. A number of Li-ion battery electrolyte formulations containing a flame-retardant additive [i.e., triphenyl phosphate (TPP)] were developed and demonstrated in high-voltage systems. These electrolytes include: (1) formulations that incorporate varying concentrations of the flame-retardant additive (from 5 to 15%), (2) the use of mono-fluoroethylene carbonate (FEC) as a co-solvent, and (3) the use of LiBOB as an electrolyte additive intended to improve the compatibility with high-voltage systems. Thus, improved safety has been provided without loss of performance in the high-voltage, high-energy system.
High voltage bus and auxiliary heater control system for an electric or hybrid vehicle
Murty, Balarama Vempaty
2000-01-01
A control system for an electric or hybrid electric vehicle includes a vehicle system controller and a control circuit having an electric immersion heater. The heater is electrically connected to the vehicle's high voltage bus and is thermally coupled to a coolant loop containing a heater core for the vehicle's climate control system. The system controller responds to cabin heat requests from the climate control system by generating a pulse width modulated signal that is used by the control circuit to operate the heater at a duty cycle appropriate for the amount of cabin heating requested. The control system also uses the heater to dissipate excess energy produced by an auxiliary power unit and to provide electric braking when regenerative braking is not desirable and manual braking is not necessary. The control system further utilizes the heater to provide a safe discharge of a bank of energy storage capacitors following disconnection of the battery or one of the high voltage connectors used to transmit high voltage operating power to the various vehicle systems. The control circuit includes a high voltage clamping circuit that monitors the voltage on the bus and operates the heater to clamp down the bus voltage when it exceeds a pre-selected maximum voltage. The control system can also be used to phase in operation of the heater when the bus voltage exceeds a lower threshold voltage and can be used to phase out the auxiliary power unit charging and regenerative braking when the battery becomes fully charged.
Development of an intelligent high-voltage direct-current power supply for nuclear detectors
International Nuclear Information System (INIS)
Zhao Xiuliang
1997-01-01
The operation and performances of a new type direct-current high-voltage power supply are described. The power supply with intelligent feature is controlled by a single-chip microcomputer (8031), and various kinds of output voltage can be preset. The output-voltage is monitored and regulated by the single-chip microcomputer and displayed by LED. The output voltage is stable when the load current is within the allowable limits
Optimization of a high voltage power supply for a nitrogen laser
International Nuclear Information System (INIS)
Baly, L.; Garcia, M.A.; Martin, J.L.
1997-01-01
In the present paper the optimization of a high voltage switching power supply for a compact TEA nitrogen laser is described. Taking as criterion the recovering of the charging voltage in a 95% of the maximal voltage, the relationships between the recovering rate coefficient, the recovering time and the maximal repetition frequency were obtained. Using an experimental set-up the power supply optimal values of turns in the primary transformer coil N p= 35 and excitation pulse frequency f exc= 25.5 kHz was determined
Intense neutron source: high-voltage power supply specifications
International Nuclear Information System (INIS)
Riedel, A.A.
1980-08-01
This report explains the need for and sets forth the electrical, mechanical and safety specifications for a high-voltage power supply to be used with the intense neutron source. It contains sufficient information for a supplier to bid on such a power supply
High Voltage GaN Schottky Rectifiers
Energy Technology Data Exchange (ETDEWEB)
CAO,X.A.; CHO,H.; CHU,S.N.G.; CHUO,C.-C.; CHYI,J.-I.; DANG,G.T.; HAN,JUNG; LEE,C.-M.; PEARTON,S.J.; REN,F.; WILSON,R.G.; ZHANG,A.P.
1999-10-25
Mesa and planar GaN Schottky diode rectifiers with reverse breakdown voltages (V{sub RB}) up to 550V and >2000V, respectively, have been fabricated. The on-state resistance, R{sub ON}, was 6m{Omega}{center_dot} cm{sup 2} and 0.8{Omega}cm{sup 2}, respectively, producing figure-of-merit values for (V{sub RB}){sup 2}/R{sub ON} in the range 5-48 MW{center_dot}cm{sup -2}. At low biases the reverse leakage current was proportional to the size of the rectifying contact perimeter, while at high biases the current was proportional to the area of this contact. These results suggest that at low reverse biases, the leakage is dominated by the surface component, while at higher biases the bulk component dominates. On-state voltages were 3.5V for the 550V diodes and {ge}15 for the 2kV diodes. Reverse recovery times were <0.2{micro}sec for devices switched from a forward current density of {approx}500A{center_dot}cm{sup -2} to a reverse bias of 100V.
An integrated low-voltage rated HTS DC power system with multifunctions to suit smart grids
Energy Technology Data Exchange (ETDEWEB)
Jin, Jian Xun, E-mail: jxjin@uestc.edu.cn [Center of Applied Superconductivity, School of Electrical Engineering and Automation, Tianjin University, Tianjin 300072 (China); Center of Applied Superconductivity and Electrical Engineering, School of Automation Engineering, University of Electronic Science and Technology of China, Chengdu 611731 (China); Chen, Xiao Yuan [School of Engineering, Sichuan Normal University, Chengdu 610101 (China); Qu, Ronghai; Fang, Hai Yang [School of Electrical and Electronic Engineering, Huazhong University of Science and Technology, Wuhan 430074 (China); Xin, Ying [Center of Applied Superconductivity, School of Electrical Engineering and Automation, Tianjin University, Tianjin 300072 (China)
2015-03-15
Highlights: • A novel LVDC HTS power transmission network is presented. • An integrated power system is achieved by using HTS DC cable and SMES. • DC superconducting cable is verified to achieve self-acting fault current limitation. • SMES is verified to achieve fast-response buffering effect under a power fluctuation. • SMES is verified to achieve favorable load voltage protection effect under a fault. - Abstract: A low-voltage rated DC power transmission network integrated with superconducting cables (SCs) and superconducting magnetic energy storage (SMES) devices has been studied with analytic results presented. In addition to the properties of loss-less and high current transportation capacity, the effectively integrated system is formed with a self-acting fault current limitation feature of the SC and a buffering effect of the SMES to power fluctuations. The results obtained show that the integrated system can achieve high-quality power transmission under common power fluctuation conditions with an advanced self-protection feature under short circuit conditions, which is identified to suit especially the smart grid applications.
Application of Low Voltage High Resistance Grounding in Nuclear Power Plants
Directory of Open Access Journals (Sweden)
Choong-Koo Chang
2016-02-01
Full Text Available Most nuclear power plants now utilize solid grounded low voltage systems. For safety and reliability reasons, the low voltage (LV high resistance grounding (HRG system is also increasingly used in the pulp and paper, petroleum and chemical, and semiconductor industries. Fault detection is easiest and fastest with a solidly grounded system. However, a solidly grounded system has many limitations such as severe fault damage, poor reliability on essential circuits, and electrical noise caused by the high magnitude of ground fault currents. This paper will briefly address the strengths and weaknesses of LV grounding systems. An example of a low voltage HRG system in the LV system of a nuclear power plant will be presented. The HRG system is highly recommended for LV systems of nuclear power plants if sufficient considerations are provided to prevent nuisance tripping of ground fault relays and to avoid the deterioration of system reliability.
Directory of Open Access Journals (Sweden)
Armando L. Figueroa-Acevedo
2015-02-01
Full Text Available The design of an interregional high-voltage transmission system in the US is a revolutionary technological concept that will likely play a significant role in the planning and operation of future electric power systems. Historically, the primary justification for building interregional high-voltage transmission lines in the US and around the world has been based on economic and reliability criteria. Today, the implementation renewable portfolio standards, carbon emission regulations, the improvements in the performance of power electronic systems, and unused benefits associated with capacity exchange during times of non-coincident peak demand, are driving the idea of designing an interregional high-voltage transmission system in the US. However, there exist challenges related to technical, economic, public policy, and environmental factors that hinder the implementation of such a complex infrastructure. The natural skepticism from many sectors of the society, in regards to how will the system be operated, how much will it cost, and the environmental impact that it could potentially create are among the most significant challenges to its rapid implementation. This publication aims at illustrating the technological, environmental, economic, and policy challenges that interregional HV transmission systems face today in the US, looking specifically at the Clean Line Rock Island project in Iowa.
Directory of Open Access Journals (Sweden)
D. Maurath
2008-05-01
Full Text Available This paper presents novel circuit concepts for integrated rectifiers and voltage converting interfaces for energy harvesting micro-generators. In the context of energy harvesting, usually only small voltages are supplied by vibration-driven generators. Therefore, rectification with minimum voltage losses and low reverse currents is an important issue. This is realized by novel integrated rectifiers which were fabricated and are presented in this article. Additionally, there is a crucial need for dynamic load adaptation as well as voltage up-conversion. A circuit concept is presented, which is able to obtain both requirements. This generator interface adapts its input impedance for an optimal energy transfer efficiency. Furthermore, this generator interface provides implicit voltage up-conversion, whereas the generator output energy is stored on a buffer, which is connected to the output of the voltage converting interface. As simulations express, this fully integrated converter is able to boost ac-voltages greater than |0.35 V| to an output dc-voltage of 2.0 V–2.5 V. Thereby, high harvesting efficiencies above 80% are possible within the entire operational range.
250 kV 6 mA compact Cockcroft-Walton high-voltage power supply
Energy Technology Data Exchange (ETDEWEB)
Ma, Zhan-Wen; Su, Xiao-Dong; Wei, Zhen; Huang, Zhi-Wu; Miao, Tian-You; Su, Tong-Ling [School of Nuclear Science and Technology, Lanzhou University, Lanzhou 730000 (China); Lu, Xiao-Long; Wang, Jun-Run; Yao, Ze-En, E-mail: zeyao@lzu.edu.cn [School of Nuclear Science and Technology, Lanzhou University, Lanzhou 730000 (China); Engineering Research Center for Neutron Application, Ministry of Education, Lanzhou University, Lanzhou 730000 (China)
2016-08-15
A compact power supply system for a compact neutron generator has been developed. A 4-stage symmetrical Cockcroft-Walton circuit is adopted to produce 250 kV direct current high-voltage. A 2-stage 280 kV isolation transformer system is used to drive the ion source power supply. For a compact structure, safety, and reliability during the operation, the Cockcroft-Walton circuit and the isolation transformer system are enclosed in an epoxy vessel containing the transformer oil whose size is about ∅350 mm × 766 mm. Test results indicate that the maximum output voltage of the power supply is 282 kV, and the stability of the output voltage is better than 0.63% when the high voltage power supply is operated at 250 kV, 6.9 mA with the input voltage varying ±10%.
Absolute Determination of High DC Voltages by Means of Frequency Measurement
Peier, Dirk; Schulz, Bernd
1983-01-01
A novel absolute measuring procedure is presented for the definition of fixed points of the voltage in the 100 kV range. The method is based on transit time measurements with accelerated electrons. By utilizing the selective interaction of a monoenergetic electron beam with the electromagnetic field of a special cavity resonator, the voltage is referred to fundamental constants and the base unit second. Possible balance voltages are indicated by a current detector. Experimental investigations are carried out with resonators in the normal conducting range. With a copper resonator operating at the temperature of boiling nitrogen (77 K), the relative uncertainty of the voltage points is estimated to be +/- 4 × 10-4. The technically realizable uncertainty can be reduced to +/- 1 × 10-5 by the proposed application of a superconducting niobium resonator. Thus this measuring device becomes suitable as a primary standard for the high-voltage range.
Directory of Open Access Journals (Sweden)
Sheng Lin
2015-07-01
Full Text Available On the basis of analyzing high-voltage direct current (HVDC transmission system and its fault superimposed circuit, the direction of the fault components of the voltage and the current measured at one end of transmission line is certified to be different for internal faults and external faults. As an estimate of the differences between two signals, relative entropy is an effective parameter for recognizing transient signals in HVDC transmission lines. In this paper, the relative entropy of wavelet energy is applied to distinguish internal fault from external fault. For internal faults, the directions of fault components of voltage and current are opposite at the two ends of the transmission line, indicating a huge difference of wavelet energy relative entropy; for external faults, the directions are identical, indicating a small difference. The simulation results based on PSCAD/EMTDC show that the proposed pilot protection system acts accurately for faults under different conditions, and its performance is not affected by fault type, fault location, fault resistance and noise.
Piezoelectric self sensing actuators for high voltage excitation
International Nuclear Information System (INIS)
Grasso, E; Totaro, N; Janocha, H; Naso, D
2013-01-01
Self sensing techniques allow the use of a piezoelectric transducer simultaneously as an actuator and as a sensor. Such techniques are based on knowledge of the transducer behaviour and on measurements of electrical quantities, in particular voltage and charge. Past research work has mainly considered the linear behaviour of piezoelectric transducers, consequently restricting the operating driving voltages to low values. In this work a new self sensing technique is proposed which is able to perform self sensing reconstruction both at low and at high driving voltages. This technique, in fact, makes use of a hysteretic model to describe the nonlinear piezoelectric capacitance necessary for self sensing reconstruction. The capacitance can be measured and identified at the antiresonances of a vibrating structure with a good approximation. After providing a mathematical background to deal with the main aspects of self sensing, this technique is compared theoretically and experimentally to a typical linear one by using an aluminum plate with one bonded self sensing transducer and a positive position feedback (PPF) controller to verify the performance in self sensing based vibration control. (paper)
TiN coated aluminum electrodes for DC high voltage electron guns
International Nuclear Information System (INIS)
Mamun, Md Abdullah A.; Elmustafa, Abdelmageed A.; Taus, Rhys; Forman, Eric; Poelker, Matthew
2015-01-01
Preparing electrodes made of metals like stainless steel, for use inside DC high voltage electron guns, is a labor-intensive and time-consuming process. In this paper, the authors report the exceptional high voltage performance of aluminum electrodes coated with hard titanium nitride (TiN). The aluminum electrodes were comparatively easy to manufacture and required only hours of mechanical polishing using silicon carbide paper, prior to coating with TiN by a commercial vendor. The high voltage performance of three TiN-coated aluminum electrodes, before and after gas conditioning with helium, was compared to that of bare aluminum electrodes, and electrodes manufactured from titanium alloy (Ti-6Al-4V). Following gas conditioning, each TiN-coated aluminum electrode reached −225 kV bias voltage while generating less than 100 pA of field emission (<10 pA) using a 40 mm cathode/anode gap, corresponding to field strength of 13.7 MV/m. Smaller gaps were studied to evaluate electrode performance at higher field strength with the best performing TiN-coated aluminum electrode reaching ∼22.5 MV/m with field emission less than 100 pA. These results were comparable to those obtained from our best-performing electrodes manufactured from stainless steel, titanium alloy and niobium, as reported in references cited below. The TiN coating provided a very smooth surface and with mechanical properties of the coating (hardness and modulus) superior to those of stainless steel, titanium-alloy, and niobium electrodes. These features likely contributed to the improved high voltage performance of the TiN-coated aluminum electrodes
Decomposition of Composite Electric Field in a Three-Phase D-Dot Voltage Transducer Measuring System
Directory of Open Access Journals (Sweden)
Xueqi Hu
2016-10-01
Full Text Available In line with the wider application of non-contact voltage transducers in the engineering field, transducers are required to have better performance for different measuring environments. In the present study, the D-dot voltage transducer is further improved based on previous research in order to meet the requirements for long-distance measurement of electric transmission lines. When measuring three-phase electric transmission lines, problems such as synchronous data collection and composite electric field need to be resolved. A decomposition method is proposed with respect to the superimposed electric field generated between neighboring phases. The charge simulation method is utilized to deduce the decomposition equation of the composite electric field and the validity of the proposed method is verified by simulation calculation software. With the deduced equation as the algorithm foundation, this paper improves hardware circuits, establishes a measuring system and constructs an experimental platform for examination. Under experimental conditions, a 10 kV electric transmission line was tested for steady-state errors, and the measuring results of the transducer and the high-voltage detection head were compared. Ansoft Maxwell Stimulation Software was adopted to obtain the electric field intensity in different positions under transmission lines; its values and the measuring values of the transducer were also compared. Experimental results show that the three-phase transducer is characterized by a relatively good synchronization for data measurement, measuring results with high precision, and an error ratio within a prescribed limit. Therefore, the proposed three-phase transducer can be broadly applied and popularized in the engineering field.
High-voltage measurements on the 5 ppm relative uncertainty level with collinear laser spectroscopy
Krämer, J.; König, K.; Geppert, Ch; Imgram, P.; Maaß, B.; Meisner, J.; Otten, E. W.; Passon, S.; Ratajczyk, T.; Ullmann, J.; Nörtershäuser, W.
2018-04-01
We present the results of high-voltage collinear laser spectroscopy measurements on the 5 ppm relative uncertainty level using a pump and probe scheme at the 4s ^2S1/2 → 4p ^2P3/2 transition of {\\hspace{0pt}}40Ca+ involving the 3d ^2D5/2 metastable state. With two-stage laser interaction and a reference measurement we can eliminate systematic effects such as differences in the contact potentials due to different electrode materials and thermoelectric voltages, and the unknown starting potential of the ions in the ion source. Voltage measurements were performed between -5 kV and -19 kV and parallel measurements with stable high-voltage dividers calibrated to 5 ppm relative uncertainty were used as a reference. Our measurements are compatible with the uncertainty limits of the high-voltage dividers and demonstrate an unprecedented (factor of 20) increase in the precision of direct laser-based high-voltage measurements.
75 FR 17529 - High-Voltage Continuous Mining Machine Standard for Underground Coal Mines
2010-04-06
... High-Voltage Continuous Mining Machine Standard for Underground Coal Mines AGENCY: Mine Safety and... of high-voltage continuous mining machines in underground coal mines. It also revises MSHA's design...-- Underground Coal Mines III. Section-by-Section Analysis A. Part 18--Electric Motor-Driven Mine Equipment and...
High Efficiency Single Output ZVS-ZCS Voltage Doubled Flyback Converter
Kaliyaperumal, Deepa; Saju, Hridya Merin; Kumar, M. Vijaya
2016-06-01
A switch operating at high switching frequency increases the switching losses of the converter resulting in lesser efficiency. Hence this paper proposes a new topology which has resonant switches [zero voltage switching (ZVS)] in the primary circuit to eliminate the above said disadvantages, and voltage doubler zero current switching (ZCS) circuit in the secondary to double the output voltage, and hence the output power, power density and efficiency. The design aspects of the proposed topology for a single output of 5 V at 50 kHz, its simulation and hardware results are discussed in detail. The analysis of the results obtained from a 2.5 W converter reveals the superiority of the proposed converter.
International Nuclear Information System (INIS)
Wang Yongshun; Rui Li; Adnan Ghaffar; Wang Zaixing; Liu Chunjuan
2015-01-01
In order to improve the reverse voltage capacity and low junction temperature characteristics of the traditional silicon-based Schottky diode, a Schottky diode with high reverse voltage capacity and high junction temperature was fabricated using ion implantation, NiPt60 sputtering, silicide-forming and other major technologies on an N-type silicon epitaxial layer of 10.6–11.4 μm and (2.2–2.4) × 10 15 cm −3 doping concentration. The measurement results show that the junction temperature of the Schottky diode fabricated can reach 175 °C, that is 50 °C higher than that of the traditional one; the reverse voltage capacity V R can reach 112 V, that is 80 V higher than that of the traditional one; the leakage current is only 2 μA and the forward conduction voltage drop is V F = 0.71 V at forward current I F = 3 A. (semiconductor devices)
Krieger, A.; Catherall, R.; Hochschulz, F.; Kramer, J.; Neugart, R.; Rosendahl, S.; Schipper, J.; Siesling, E.; Weinheimer, Ch.; Yordanov, D.T.; Nortershauser, W.
2011-01-01
A high-voltage divider with accuracy at the ppm level and collinear laser spectroscopy were used to calibrate the highvoltage installation at the radioactive ion beam facility ISOLDE at CERN. The accurate knowledge of this voltage is particularly important for collinear laser spectroscopy measurements. Beam velocity measurements using frequencycomb based collinear laser spectroscopy agree with the new calibration. Applying this, one obtains consistent results for isotope shifts of stable magnesium isotopes measured using collinear spectroscopy and laser spectroscopy on laser-cooled ions in a trap. The long-term stability and the transient behavior during recovery from a voltage dropout were investigated for the different power supplies currently applied at ISOLDE.
ELABORATION OF HIGH-VOLTAGE PULSE INSTALLATIONS AND PROVIDING THEIR OPERATION PROTECTIVE MEASURES
Directory of Open Access Journals (Sweden)
А. М. Hashimov
2016-01-01
Full Text Available The article presents design engineering methods for the high-voltage pulse installations of technological purpose for disinfection of drinking water, sewage, and edible liquids by high field micro- and nanosecond pulsing exposure. Designing potentialities are considered of the principal elements of the high-voltage part and the discharge circuit of the installations towards assuring the best efficient on-load utilization of the source energy and safe operation of the high-voltage equipment. The study shows that for disinfection of drinking water and sewage it is expedient to apply microsecond pulse actions causing the electrohydraulic effect in aqueous media with associated complex of physical processes (ultraviolet emission, generation of ozone and atomic oxygen, mechanical compression waves, etc. having detrimental effect on life activity of the microorganisms. In case of disinfecting edible liquids it is recommended to use the nanosecond pulses capable of straight permeating the biological cell nucleus, inactivating it. Meanwhile, the nutritive and biological values of the foodstuffs are saved and their organoleptic properties are improved. It is noted that in elaboration process of high-frequency pulse installations special consideration should be given to issues of the operating personnel safety discipline and securing conditions for the entire installation uninterrupted performance. With this objective in view the necessary requirements should be fulfilled on shielding the high- and low-voltage installation parts against high-frequency electromagnetic emissions registered by special differential sensors. Simultaneously, the abatement measures should be applied on the high-voltage equipment operational noise level. The authors offer a technique for noise abatement to admissible levels (lower than 80 dB A by means of coating the inside surface with shielded enclosure of densely-packed abutting sheets of porous electro-acoustic insulating
Solar photovoltaic charging of high voltage nickel metal hydride batteries using DC power conversion
Kelly, Nelson A.; Gibson, Thomas L.
There are an increasing number of vehicle choices available that utilize batteries and electric motors to reduce tailpipe emissions and increase fuel economy. The eventual production of electricity and hydrogen in a renewable fashion, such as using solar energy, can achieve the long-term vision of having no tailpipe environmental impact, as well as eliminating the dependence of the transportation sector on dwindling supplies of petroleum for its energy. In this report we will demonstrate the solar-powered charging of the high-voltage nickel-metal hydride (NiMH) battery used in the GM 2-mode hybrid system. In previous studies we have used low-voltage solar modules to produce hydrogen via the electrolysis of water and to directly charge lithium-ion battery modules. Our strategy in the present work was to boost low-voltage PV voltage to over 300 V using DC-DC converters in order to charge the high-voltage NiMH battery, and to regulate the battery charging using software to program the electronic control unit supplied with the battery pack. A protocol for high-voltage battery charging was developed, and the solar to battery charging efficiency was measured under a variety of conditions. We believe this is the first time such high-voltage batteries have been charged using solar energy in order to prove the concept of efficient, solar-powered charging for battery-electric vehicles.
Investigation of multimodule buck–boost inverter-based HVDC transmission system
Directory of Open Access Journals (Sweden)
Ahmed A. Elserougi
2015-01-01
Full Text Available In high voltage direct current (HVDC systems, the semiconductor devices have to be connected in series to obtain the required high-voltage ratings. This study proposes a new HVDC configuration, namely, multimodule buck–boost inverter for HVDC transmission applications which avoids series connection of large number of semiconductor switches. In addition, it provides a blocking capability against DC side faults. The proposed configuration consists of several simple buck–boost converters which are assembled together to meet the requirements of high-voltage high-power applications. This paper studies the dynamic performance of the proposed system under different operating conditions, and the results were satisfactory. The main advantages of the proposed configuration are: (i pure sinusoidal output which minimises/eliminates the requirements for supplementary AC filters and offers an inherent suppression to the common mode voltages, (ii very low dv/dt stresses and (iii complete blocking capability of AC side contributions during DC side faults. This study discusses the system architecture, passive components selections, voltage and current ratings of its semiconductor devices and the required controllers. A comparison between the proposed configuration and other existing HVDC technologies is also presented in this study.
Design of full digital 50 kV electronic gun high voltage power supply
International Nuclear Information System (INIS)
Ge Lei; Shang Lei
2014-01-01
The design of full digital electronic gun high voltage power supply based on DSP was introduced in this paper. This power supply has innovations of full digital feedback circuit and PID closed-loop control mode. The application of high frequency resonant converter circuit reduces the size of the resonant element and transformer. The current-coupling distributed high voltage transformer and rectifier circuit were employed in this power supply. By this way, the power supply efficiency is improved and the number of distributed parameters is reduced, and the rectifier circuit could work under the oil-free environment. This power supply has been used in electronic grid-control high voltage system of the irradiation accelerator. (authors)
Index-based reactive power compensation scheme for voltage regulation
Dike, Damian Obioma
2008-10-01
Increasing demand for electrical power arising from deregulation and the restrictions posed to the construction of new transmission lines by environment, socioeconomic, and political issues had led to higher grid loading. Consequently, voltage instability has become a major concern, and reactive power support is vital to enhance transmission grid performance. Improved reactive power support to distressed grid is possible through the application of relatively unfamiliar emerging technologies of "Flexible AC Transmission Systems (FACTS)" devices and "Distributed Energy Resources (DERS)." In addition to these infrastructure issues, a lack of situational awareness by system operators can cause major power outages as evidenced by the August 14, 2003 widespread North American blackout. This and many other recent major outages have highlighted the inadequacies of existing power system indexes. In this work, a novel "Index-based reactive compensation scheme" appropriate for both on-line and off-line computation of grid status has been developed. A new voltage stability index (Ls-index) suitable for long transmission lines was developed, simulated, and compared to the existing two-machine modeled L-index. This showed the effect of long distance power wheeling amongst regional transmission organizations. The dissertation further provided models for index modulated voltage source converters (VSC) and index-based load flow analysis of both FACTS and microgrid interconnected power systems using the Newton-Raphson's load flow model incorporated with multi-FACTS devices. The developed package has been made user-friendly through the embodiment of interactive graphical user interface and implemented on the IEEE 14, 30, and 300 bus systems. The results showed reactive compensation has system wide-effect, provided readily accessible system status indicators, ensured seamless DERs interconnection through new islanding modes and enhanced VSC utilization. These outcomes may contribute
MAGY: An innovative high voltage-low current power supply for gyrotron
International Nuclear Information System (INIS)
Siravo, Ugo; Alex, Juergen; Bader, Michael; Carpita, Mauro; Fasel, Damien; Gavin, Serge; Perez, Albert
2011-01-01
From the electrical point of view, the body and the anode of high power gyrotrons behave as capacitive loads. A highly dynamic power supply is, therefore, hard to achieve. The MAGY concept (Modulator for the Anode of a triode type GYrotron) embodies an innovative solution to manage the capacitive current ensuring a very low ripple on the output voltage. It consists of a series of independent, bi-directional and regulated DC sources. Compared to existing topologies, this solution requires a smaller number of power modules. It avoids internal high frequency modulation and simultaneously offers high resolution of the output voltage and a wide range of operating scenarios.
Stop wheeling and start dealing. Resolving the transmission dilemma
International Nuclear Information System (INIS)
Ruff, L.E.
1996-01-01
The author distinguishes the role of a Gridco that owns actual transmission assets from that of a Poolco that must dispatch generation and transmission optimally to meet time- and space-differentiated customer demands. He contends that present wheeling orders that convert high-voltage wires of generation and transmission companies into 'open access' transmission providers while maintaining their control of dispatch are skewed; rather, the Poolco must charge the same prices for comparable transmission services provided to any customer. Transmission plant must always be dispatched in a least-cost fashion; contracts-for-differences enable customers to hedge against extreme price fluctuations that may arise. Poolco payments should be made to an independent Gridco as compensation for providing its physical grid; necessary revenues must be recovered from Poolco customers. 6 figs
Stop wheeling and start dealing. Resolving the transmission dilemma
Energy Technology Data Exchange (ETDEWEB)
Ruff, L.E. [Putnam, Hayes and Bartlett, Inc., Washington, DC (United States)
1996-12-31
The author distinguishes the role of a Gridco that owns actual transmission assets from that of a Poolco that must dispatch generation and transmission optimally to meet time- and space-differentiated customer demands. He contends that present wheeling orders that convert high-voltage wires of generation and transmission companies into `open access` transmission providers while maintaining their control of dispatch are skewed; rather, the Poolco must charge the same prices for comparable transmission services provided to any customer. Transmission plant must always be dispatched in a least-cost fashion; contracts-for-differences enable customers to hedge against extreme price fluctuations that may arise. Poolco payments should be made to an independent Gridco as compensation for providing its physical grid; necessary revenues must be recovered from Poolco customers. 6 figs.
A novel on-chip high to low voltage power conversion circuit
International Nuclear Information System (INIS)
Wang Hui; Wang Songlin; Mou Zaixin; Guo Baolong; Lai Xinquan; Ye Qiang; Li Xianrui
2009-01-01
A novel power supply transform technique for high voltage IC based on the TSMC 0.6 μm BCD process is achieved. An adjustable bandgap voltage reference is presented which is different from the traditional power supply transform technique. It can be used as an internal power supply for high voltage IC by using the push-pull output stage to enhance its load capability. High-order temperature compensated circuit is designed to ensure the precision of the reference. Only 0.01 mm 2 area is occupied using this novel power supply technique. Compared with traditional technique, 50% of the area is saved, 40% quiescent power loss is decreased, and the temperature coefficient of the reference is only 4.48 ppm/deg. C. Compared with the traditional LDO (low dropout) regulator, this power conversion architecture does not need external output capacitance and decreases the chip-pin and external components, so the PCB area and design cost are also decreased. The testing results show that this circuit works well.
A novel on-chip high to low voltage power conversion circuit
Energy Technology Data Exchange (ETDEWEB)
Wang Hui; Wang Songlin; Mou Zaixin; Guo Baolong [Institute of Mechano-electronic Engineering, Xidian University, Xi' an 71007 (China); Lai Xinquan; Ye Qiang; Li Xianrui, E-mail: whui94@126.co [Institute of Electronic CAD, Xidian University, Xi' an 710071 (China)
2009-03-15
A novel power supply transform technique for high voltage IC based on the TSMC 0.6 mum BCD process is achieved. An adjustable bandgap voltage reference is presented which is different from the traditional power supply transform technique. It can be used as an internal power supply for high voltage IC by using the push-pull output stage to enhance its load capability. High-order temperature compensated circuit is designed to ensure the precision of the reference. Only 0.01 mm{sup 2} area is occupied using this novel power supply technique. Compared with traditional technique, 50% of the area is saved, 40% quiescent power loss is decreased, and the temperature coefficient of the reference is only 4.48 ppm/deg. C. Compared with the traditional LDO (low dropout) regulator, this power conversion architecture does not need external output capacitance and decreases the chip-pin and external components, so the PCB area and design cost are also decreased. The testing results show that this circuit works well.
High-voltage pulsed life of multistressed polypropylene capacitor dielectric
International Nuclear Information System (INIS)
Laghari, J.R.
1992-01-01
High-voltage polypropylene capacitors were aged under singular as well as simultaneous multiple stresses (electrical, thermal, and radiation) at the University of Buffalo's 2 MW thermal nuclear reactor. These stresses were combined neutron-gamma radiation with a total dose of 1.6 x 10 6 rad, electrical stress at 40 V rms /μm, and thermal stress at 90 degrees C. After exposure, the polypropylene dielectric was tested for life (number of pulses to fail) under high-voltage high-repetition-rate (100 pps) pulses. Pulsed life data were also compared with ac life data. Results show that radiation stress causes the most degradation in life, either acting alone or in combination with other stresses. The largest reduction in life occurs when polypropylene is aged under simultaneous multiple stresses (electrical, thermal, and radiation). In this paper, it is shown that pulsed life can be equivalently compared with ac life
DEFF Research Database (Denmark)
Marra, Francesco; Tarek Fawzy, Y.; Bülo, Thorsten
2012-01-01
to be established. In the long term, these solutions should also aim to allow further more PV installed capacity, while meeting the power quality requirements. In this paper, different concepts of energy storage are proposed to ensure the voltage quality requirements in a LV grid with high PV penetration...
The Transmission Line for the SPIDER experiment
International Nuclear Information System (INIS)
Boldrin, Marco; De Lorenzi, Antonio; Recchia, Mauro; Toigo, Vanni; Bonicelli, Tullio; Simon, Muriel
2011-01-01
The 100 keV Ion Source Test facility - Source for the Production of Ions of Deuterium Extracted from RF plasma (SPIDER) - is aimed to test the full scale prototype of the Ion Source for the ITER 1 MeV Neutral Beam Injector (NBI). The SPIDER facility requires the construction of a High Voltage Deck (HVD) and of a High Voltage Transmission Line (TL) respectively to host the Ion Source Power Supplies system polarized at 100 kV and to carry the power and signal conductors to the beam accelerator. In already existing NBI systems with beam energy above 100 keV, the TL is realized with the SF 6 Gas Insulated Line technology. In the SPIDER TL case, the presence of a large inner conductor (half meter diameter), would make the pressurized TL a complex and costly component; therefore a free air insulated solution has been proposed. The paper focuses on the design of this TL, which has to host inside the complex high potential (100 kV) inner electrode a number of power and measuring conductors and has to minimize the Electro Magnetic Interferences (EMI) produced by the frequent grids breakdowns. Finite Element (FE) analyses have been performed to verify the configuration from the electrostatic point of view, to evaluate EMI screening effectiveness and to assess the impact of the relatively high thermal dissipation of power conductors located inside the high potential electrode. Moreover, an experimental test campaign has been carried out on a TL mockup to validate the TL electrostatic configuration under DC voltage. Finally, the paper reports on the status of procurement activities for the Transmission Line.