Matrix method for acoustic levitation simulation.

Science.gov (United States)

Andrade, Marco A B; Perez, Nicolas; Buiochi, Flavio; Adamowski, Julio C

2011-08-01

A matrix method is presented for simulating acoustic levitators. A typical acoustic levitator consists of an ultrasonic transducer and a reflector. The matrix method is used to determine the potential for acoustic radiation force that acts on a small sphere in the standing wave field produced by the levitator. The method is based on the Rayleigh integral and it takes into account the multiple reflections that occur between the transducer and the reflector. The potential for acoustic radiation force obtained by the matrix method is validated by comparing the matrix method results with those obtained by the finite element method when using an axisymmetric model of a single-axis acoustic levitator. After validation, the method is applied in the simulation of a noncontact manipulation system consisting of two 37.9-kHz Langevin-type transducers and a plane reflector. The manipulation system allows control of the horizontal position of a small levitated sphere from -6 mm to 6 mm, which is done by changing the phase difference between the two transducers. The horizontal position of the sphere predicted by the matrix method agrees with the horizontal positions measured experimentally with a charge-coupled device camera. The main advantage of the matrix method is that it allows simulation of non-symmetric acoustic levitators without requiring much computational effort.

Response matrix method for large LMFBR analysis

International Nuclear Information System (INIS)

King, M.J.

1977-06-01

The feasibility of using response matrix techniques for computational models of large LMFBRs is examined. Since finite-difference methods based on diffusion theory have generally found a place in fast-reactor codes, a brief review of their general matrix foundation is given first in order to contrast it to the general strategy of response matrix methods. Then, in order to present the general method of response matrix technique, two illustrative examples are given. Matrix algorithms arising in the application to large LMFBRs are discussed, and the potential of the response matrix method is explored for a variety of computational problems. Principal properties of the matrices involved are derived with a view to application of numerical methods of solution. The Jacobi iterative method as applied to the current-balance eigenvalue problem is discussed

Method of forming a ceramic matrix composite and a ceramic matrix component

Science.gov (United States)

de Diego, Peter; Zhang, James

2017-05-30

A method of forming a ceramic matrix composite component includes providing a formed ceramic member having a cavity, filling at least a portion of the cavity with a ceramic foam. The ceramic foam is deposited on a barrier layer covering at least one internal passage of the cavity. The method includes processing the formed ceramic member and ceramic foam to obtain a ceramic matrix composite component. Also provided is a method of forming a ceramic matrix composite blade and a ceramic matrix composite component.

Interface matrix method in AFEN framework

Energy Technology Data Exchange (ETDEWEB)

Pogosbekyan, Leonid; Cho, Jin Young; Kim, Young Jin [Korea Atomic Energy Research Institute, Taejon (Korea, Republic of)

1998-12-31

In this study, we extend the application of the interface-matrix(IM) method for reflector modeling to Analytic Flux Expansion Nodal (AFEN) method. This include the modifications of the surface-averaged net current continuity and the net leakage balance conditions for IM method in accordance with AFEN formula. AFEN-interface matrix (AFEN-IM) method has been tested against ZION-1 benchmark problem. The numerical result of AFEN-IM method shows 1.24% of maximum error and 0.42% of root-mean square error in assembly power distribution, and 0.006% {Delta} k of neutron multiplication factor. This result proves that the interface-matrix method for reflector modeling can be useful in AFEN method. 3 refs., 4 figs. (Author)

Interface matrix method in AFEN framework

Energy Technology Data Exchange (ETDEWEB)

Pogosbekyan, Leonid; Cho, Jin Young; Kim, Young Jin [Korea Atomic Energy Research Institute, Taejon (Korea, Republic of)

1997-12-31

In this study, we extend the application of the interface-matrix(IM) method for reflector modeling to Analytic Flux Expansion Nodal (AFEN) method. This include the modifications of the surface-averaged net current continuity and the net leakage balance conditions for IM method in accordance with AFEN formula. AFEN-interface matrix (AFEN-IM) method has been tested against ZION-1 benchmark problem. The numerical result of AFEN-IM method shows 1.24% of maximum error and 0.42% of root-mean square error in assembly power distribution, and 0.006% {Delta} k of neutron multiplication factor. This result proves that the interface-matrix method for reflector modeling can be useful in AFEN method. 3 refs., 4 figs. (Author)

Matrix Krylov subspace methods for image restoration

Directory of Open Access Journals (Sweden)

khalide jbilou

2015-09-01

Full Text Available In the present paper, we consider some matrix Krylov subspace methods for solving ill-posed linear matrix equations and in those problems coming from the restoration of blurred and noisy images. Applying the well known Tikhonov regularization procedure leads to a Sylvester matrix equation depending the Tikhonov regularized parameter. We apply the matrix versions of the well known Krylov subspace methods, namely the Least Squared (LSQR and the conjugate gradient (CG methods to get approximate solutions representing the restored images. Some numerical tests are presented to show the effectiveness of the proposed methods.

Transfer matrix representation for periodic planar media

Science.gov (United States)

Parrinello, A.; Ghiringhelli, G. L.

2016-06-01

Sound transmission through infinite planar media characterized by in-plane periodicity is faced by exploiting the free wave propagation on the related unit cells. An appropriate through-thickness transfer matrix, relating a proper set of variables describing the acoustic field at the two external surfaces of the medium, is derived by manipulating the dynamic stiffness matrix related to a finite element model of the unit cell. The adoption of finite element models avoids analytical modeling or the simplification on geometry or materials. The obtained matrix is then used in a transfer matrix method context, making it possible to combine the periodic medium with layers of different nature and to treat both hard-wall and semi-infinite fluid termination conditions. A finite sequence of identical sub-layers through the thickness of the medium can be handled within the transfer matrix method, significantly decreasing the computational burden. Transfer matrices obtained by means of the proposed method are compared with analytical or equivalent models, in terms of sound transmission through barriers of different nature.

Numerical methods in matrix computations

CERN Document Server

Björck, Åke

2015-01-01

Matrix algorithms are at the core of scientific computing and are indispensable tools in most applications in engineering. This book offers a comprehensive and up-to-date treatment of modern methods in matrix computation. It uses a unified approach to direct and iterative methods for linear systems, least squares and eigenvalue problems. A thorough analysis of the stability, accuracy, and complexity of the treated methods is given. Numerical Methods in Matrix Computations is suitable for use in courses on scientific computing and applied technical areas at advanced undergraduate and graduate level. A large bibliography is provided, which includes both historical and review papers as well as recent research papers. This makes the book useful also as a reference and guide to further study and research work. Åke Björck is a professor emeritus at the Department of Mathematics, Linköping University. He is a Fellow of the Society of Industrial and Applied Mathematics.

The J-Matrix Method Developments and Applications

CERN Document Server

Alhaidari, Abdulaziz D; Heller, Eric J; Abdelmonem, Mohamed S

2008-01-01

This volume aims to provide the fundamental knowledge to appreciate the advantages of the J-matrix method and to encourage its use and further development. The J-matrix method is an algebraic method of quantum scattering with substantial success in atomic and nuclear physics. The accuracy and convergence property of the method compares favourably with other successful scattering calculation methods. Despite its thirty-year long history new applications are being found for the J-matrix method. This book gives a brief account of the recent developments and some selected applications of the method in atomic and nuclear physics. New findings are reported in which experimental results are compared to theoretical calculations. Modifications, improvements and extensions of the method are discussed using the language of the J-matrix. The volume starts with a Foreword by the two co-founders of the method, E.J. Heller and H.A. Yamani and it contains contributions from 24 prominent international researchers.

The finite element response matrix method

International Nuclear Information System (INIS)

Nakata, H.; Martin, W.R.

1983-02-01

A new technique is developed with an alternative formulation of the response matrix method implemented with the finite element scheme. Two types of response matrices are generated from the Galerkin solution to the weak form of the diffusion equation subject to an arbitrary current and source. The piecewise polynomials are defined in two levels, the first for the local (assembly) calculations and the second for the global (core) response matrix calculations. This finite element response matrix technique was tested in two 2-dimensional test problems, 2D-IAEA benchmark problem and Biblis benchmark problem, with satisfatory results. The computational time, whereas the current code is not extensively optimized, is of the same order of the well estabilished coarse mesh codes. Furthermore, the application of the finite element technique in an alternative formulation of response matrix method permits the method to easily incorporate additional capabilities such as treatment of spatially dependent cross-sections, arbitrary geometrical configurations, and high heterogeneous assemblies. (Author) [pt

Basic matrix algebra and transistor circuits

CERN Document Server

Zelinger, G

1963-01-01

Basic Matrix Algebra and Transistor Circuits deals with mastering the techniques of matrix algebra for application in transistors. This book attempts to unify fundamental subjects, such as matrix algebra, four-terminal network theory, transistor equivalent circuits, and pertinent design matters. Part I of this book focuses on basic matrix algebra of four-terminal networks, with descriptions of the different systems of matrices. This part also discusses both simple and complex network configurations and their associated transmission. This discussion is followed by the alternative methods of de

Efficient sparse matrix-matrix multiplication for computing periodic responses by shooting method on Intel Xeon Phi

Science.gov (United States)

Stoykov, S.; Atanassov, E.; Margenov, S.

2016-10-01

Many of the scientific applications involve sparse or dense matrix operations, such as solving linear systems, matrix-matrix products, eigensolvers, etc. In what concerns structural nonlinear dynamics, the computations of periodic responses and the determination of stability of the solution are of primary interest. Shooting method iswidely used for obtaining periodic responses of nonlinear systems. The method involves simultaneously operations with sparse and dense matrices. One of the computationally expensive operations in the method is multiplication of sparse by dense matrices. In the current work, a new algorithm for sparse matrix by dense matrix products is presented. The algorithm takes into account the structure of the sparse matrix, which is obtained by space discretization of the nonlinear Mindlin's plate equation of motion by the finite element method. The algorithm is developed to use the vector engine of Intel Xeon Phi coprocessors. It is compared with the standard sparse matrix by dense matrix algorithm and the one developed by Intel MKL and it is shown that by considering the properties of the sparse matrix better algorithms can be developed.

A nodal method based on matrix-response method

International Nuclear Information System (INIS)

Rocamora Junior, F.D.; Menezes, A.

1982-01-01

A nodal method based in the matrix-response method, is presented, and its application to spatial gradient problems, such as those that exist in fast reactors, near the core - blanket interface, is investigated. (E.G.) [pt

Quasi-stationary states of an electron with linearly dependent effective mass in an open nanostructure within transmission coefficient and S-matrix methods

Science.gov (United States)

Seti, Julia; Tkach, Mykola; Voitsekhivska, Oxana

2018-03-01

The exact solutions of the Schrödinger equation for a double-barrier open semiconductor plane nanostructure are obtained by using two different approaches, within the model of the rectangular potential profile and the continuous position-dependent effective mass of the electron. The transmission coefficient and scattering matrix are calculated for the double-barrier nanostructure. The resonance energies and resonance widths of the electron quasi-stationary states are analyzed as a function of the size of the near-interface region between wells and barriers, where the effective mass linearly depends on the coordinate. It is established that, in both methods, the increasing size affects in a qualitatively similar way the spectral characteristics of the states, shifting the resonance energies into the low- or high-energy region and increasing the resonance widths. It is shown that the relative difference of resonance energies and widths of a certain state, obtained in the model of position-dependent effective mass and in the widespread abrupt model in physically correct range of near-interface sizes, does not exceed 0.5% and 5%, respectively, independently of the other geometrical characteristics of the structure.

A wave propagation matrix method in semiclassical theory

International Nuclear Information System (INIS)

Lee, S.Y.; Takigawa, N.

1977-05-01

A wave propagation matrix method is used to derive the semiclassical formulae of the multiturning point problem. A phase shift matrix and a barrier transformation matrix are introduced to describe the processes of a particle travelling through a potential well and crossing a potential barrier respectively. The wave propagation matrix is given by the products of phase shift matrices and barrier transformation matrices. The method to study scattering by surface transparent potentials and the Bloch wave in solids is then applied

A Matrix Splitting Method for Composite Function Minimization

KAUST Repository

Yuan, Ganzhao

2016-12-07

Composite function minimization captures a wide spectrum of applications in both computer vision and machine learning. It includes bound constrained optimization and cardinality regularized optimization as special cases. This paper proposes and analyzes a new Matrix Splitting Method (MSM) for minimizing composite functions. It can be viewed as a generalization of the classical Gauss-Seidel method and the Successive Over-Relaxation method for solving linear systems in the literature. Incorporating a new Gaussian elimination procedure, the matrix splitting method achieves state-of-the-art performance. For convex problems, we establish the global convergence, convergence rate, and iteration complexity of MSM, while for non-convex problems, we prove its global convergence. Finally, we validate the performance of our matrix splitting method on two particular applications: nonnegative matrix factorization and cardinality regularized sparse coding. Extensive experiments show that our method outperforms existing composite function minimization techniques in term of both efficiency and efficacy.

A Matrix Splitting Method for Composite Function Minimization

KAUST Repository

Yuan, Ganzhao; Zheng, Wei-Shi; Ghanem, Bernard

2016-01-01

Composite function minimization captures a wide spectrum of applications in both computer vision and machine learning. It includes bound constrained optimization and cardinality regularized optimization as special cases. This paper proposes and analyzes a new Matrix Splitting Method (MSM) for minimizing composite functions. It can be viewed as a generalization of the classical Gauss-Seidel method and the Successive Over-Relaxation method for solving linear systems in the literature. Incorporating a new Gaussian elimination procedure, the matrix splitting method achieves state-of-the-art performance. For convex problems, we establish the global convergence, convergence rate, and iteration complexity of MSM, while for non-convex problems, we prove its global convergence. Finally, we validate the performance of our matrix splitting method on two particular applications: nonnegative matrix factorization and cardinality regularized sparse coding. Extensive experiments show that our method outperforms existing composite function minimization techniques in term of both efficiency and efficacy.

A Concise Method for Storing and Communicating the Data Covariance Matrix

Energy Technology Data Exchange (ETDEWEB)

Larson, Nancy M [ORNL

2008-10-01

The covariance matrix associated with experimental cross section or transmission data consists of several components. Statistical uncertainties on the measured quantity (counts) provide a diagonal contribution. Off-diagonal components arise from uncertainties on the parameters (such as normalization or background) that figure into the data reduction process; these are denoted systematic or common uncertainties, since they affect all data points. The full off-diagonal data covariance matrix (DCM) can be extremely large, since the size is the square of the number of data points. Fortunately, it is not necessary to explicitly calculate, store, or invert the DCM. Likewise, it is not necessary to explicitly calculate, store, or use the inverse of the DCM. Instead, it is more efficient to accomplish the same results using only the various component matrices that appear in the definition of the DCM. Those component matrices are either diagonal or small (the number of data points times the number of data-reduction parameters); hence, this implicit data covariance method requires far less array storage and far fewer computations while producing more accurate results.

ABCD Matrix Method a Case Study

CERN Document Server

Seidov, Zakir F; Yahalom, Asher

2004-01-01

In the Israeli Electrostatic Accelerator FEL, the distance between the accelerator's end and the wiggler's entrance is about 2.1 m, and 1.4 MeV electron beam is transported through this space using four similar quadrupoles (FODO-channel). The transfer matrix method (ABCD matrix method) was used for simulating the beam transport, a set of programs is written in the several programming languages (MATHEMATICA, MATLAB, MATCAD, MAPLE) and reasonable agreement is demonstrated between experimental results and simulations. Comparison of ABCD matrix method with the direct "numerical experiments" using EGUN, ELOP, and GPT programs with and without taking into account the space-charge effects showed the agreement to be good enough as well. Also the inverse problem of finding emittance of the electron beam at the S1 screen position (before FODO-channel), by using the spot image at S2 screen position (after FODO-channel) as function of quad currents, is considered. Spot and beam at both screens are described as tilted eel...

The finite element response Matrix method

International Nuclear Information System (INIS)

Nakata, H.; Martin, W.R.

1983-01-01

A new method for global reactor core calculations is described. This method is based on a unique formulation of the response matrix method, implemented with a higher order finite element method. The unique aspects of this approach are twofold. First, there are two levels to the overall calculational scheme: the local or assembly level and the global or core level. Second, the response matrix scheme, which is formulated at both levels, consists of two separate response matrices rather than one response matrix as is generally the case. These separate response matrices are seen to be quite beneficial for the criticality eigenvalue calculation, because they are independent of k /SUB eff/. The response matrices are generated from a Galerkin finite element solution to the weak form of the diffusion equation, subject to an arbitrary incoming current and an arbitrary distributed source. Calculational results are reported for two test problems, the two-dimensional International Atomic Energy Agency benchmark problem and a two-dimensional pressurized water reactor test problem (Biblis reactor), and they compare well with standard coarse mesh methods with respect to accuracy and efficiency. Moreover, the accuracy (and capability) is comparable to fine mesh for a fraction of the computational cost. Extension of the method to treat heterogeneous assemblies and spatial depletion effects is discussed

POLLA-NESC, Resonance Parameter R-Matrix to S-Matrix Conversion by Reich-Moore Method

International Nuclear Information System (INIS)

Saussure, G. de; Perez, R.B.

1975-01-01

1 - Description of problem or function: The program transforms a set of r-matrix nuclear resonance parameters into a set of equivalent s-matrix (or Kapur-Peierls) resonance parameters. 2 - Method of solution: The program utilizes the multilevel formalism of Reich and Moore and avoids diagonalization of the level matrix. The parameters are obtained by a direct partial fraction expansion of the Reich-Moore expression of the collision matrix. This approach appears simpler and faster when the number of fission channels is known and small. The method is particularly useful when a large number of levels must be considered because it does not require diagonalization of a large level matrix. 3 - Restrictions on the complexity of the problem: By DIMENSION statements, the program is limited to maxima of 100 levels and 5 channels

An analysis on mode selection by V-I transmission matrix in DBR laser with asymmetric fiber gratings

Science.gov (United States)

Li, Zhuoxuan; Pei, Li; Li, Qi; Ning, Tigang; Liu, Chao; Gao, Song

2013-02-01

The V-I Transmission Matrix Method (VITMM) which is well known in the microwave engineering field was firstly applied to analyze the output spectra of the Distributed Bragg Reflector (DBR) laser, formed by asymmetric fiber gratings as resonator mirrors. One mirror is the uniform Bragg grating and the other is chirped grating. A theoretical model of grating was established, and then a numerical simulation of the mode selection in DBR laser with asymmetric fiber gratings was presented. Simulation results show that VITMM, with calculation error less than 0.1%, could save the calculation time compared to the Rouard method. In the experiment, the setup design of the single-longitudinal-mode laser output at 1544.7 nm was carried out, and the result, which lasted about 10 min, observed on an optical spectrum analyzer, demonstrates the feasibility of VITMM to address the mode output issues of DBR fiber laser.

Research on Matrix-type Packet Loss Compensation Scheme for Wireless Video Transmission on Subway

Directory of Open Access Journals (Sweden)

Fan Qing-Wu

2017-01-01

Full Text Available As the mainstream wireless LAN technology, Wi-Fi can achieve fast data transfer. With the subway moving in a high speed, video data transmission between the metro and the ground is achieved through Wi-Fi technology. This paper aims at solving the Caton problem caused by switching packet loss in the process of playing real-time video on the train terminal, and proposes matrix-type packet loss compensation scheme. Finally, the feasibility of the scheme is verified by experiments.

Matrix-exponential description of radiative transfer

International Nuclear Information System (INIS)

Waterman, P.C.

1981-01-01

By appling the matrix-exponential operator technique to the radiative-transfer equation in discrete form, new analytical solutions are obtained for the transmission and reflection matrices in the limiting cases x >1, where x is the optical depth of the layer. Orthongonality of the eigenvectors of the matrix exponential apparently yields new conditions for determining. Chandrasekhar's characteristic roots. The exact law of reflection for the discrete eigenfunctions is also obtained. Finally, when used in conjuction with the doubling method, the matrix exponential should result in reduction in both computation time and loss of precision

Modeling cometary photopolarimetric characteristics with Sh-matrix method

Science.gov (United States)

Kolokolova, L.; Petrov, D.

2017-12-01

Cometary dust is dominated by particles of complex shape and structure, which are often considered as fractal aggregates. Rigorous modeling of light scattering by such particles, even using parallelized codes and NASA supercomputer resources, is very computer time and memory consuming. We are presenting a new approach to modeling cometary dust that is based on the Sh-matrix technique (e.g., Petrov et al., JQSRT, 112, 2012). This method is based on the T-matrix technique (e.g., Mishchenko et al., JQSRT, 55, 1996) and was developed after it had been found that the shape-dependent factors could be separated from the size- and refractive-index-dependent factors and presented as a shape matrix, or Sh-matrix. Size and refractive index dependences are incorporated through analytical operations on the Sh-matrix to produce the elements of T-matrix. Sh-matrix method keeps all advantages of the T-matrix method, including analytical averaging over particle orientation. Moreover, the surface integrals describing the Sh-matrix elements themselves can be solvable analytically for particles of any shape. This makes Sh-matrix approach an effective technique to simulate light scattering by particles of complex shape and surface structure. In this paper, we present cometary dust as an ensemble of Gaussian random particles. The shape of these particles is described by a log-normal distribution of their radius length and direction (Muinonen, EMP, 72, 1996). Changing one of the parameters of this distribution, the correlation angle, from 0 to 90 deg., we can model a variety of particles from spheres to particles of a random complex shape. We survey the angular and spectral dependencies of intensity and polarization resulted from light scattering by such particles, studying how they depend on the particle shape, size, and composition (including porous particles to simulate aggregates) to find the best fit to the cometary observations.

Analysis of Nonlinear Dynamics by Square Matrix Method

Energy Technology Data Exchange (ETDEWEB)

Yu, Li Hua [Brookhaven National Lab. (BNL), Upton, NY (United States). Energy and Photon Sciences Directorate. National Synchrotron Light Source II

2016-07-25

The nonlinear dynamics of a system with periodic structure can be analyzed using a square matrix. In this paper, we show that because the special property of the square matrix constructed for nonlinear dynamics, we can reduce the dimension of the matrix from the original large number for high order calculation to low dimension in the first step of the analysis. Then a stable Jordan decomposition is obtained with much lower dimension. The transformation to Jordan form provides an excellent action-angle approximation to the solution of the nonlinear dynamics, in good agreement with trajectories and tune obtained from tracking. And more importantly, the deviation from constancy of the new action-angle variable provides a measure of the stability of the phase space trajectories and their tunes. Thus the square matrix provides a novel method to optimize the nonlinear dynamic system. The method is illustrated by many examples of comparison between theory and numerical simulation. Finally, in particular, we show that the square matrix method can be used for optimization to reduce the nonlinearity of a system.

Transformation Matrix for Time Discretization Based on Tustin’s Method

Directory of Open Access Journals (Sweden)

Yiming Jiang

2014-01-01

Full Text Available This paper studies rules in transformation of transfer function through time discretization. A method of using transformation matrix to realize bilinear transform (also known as Tustin’s method is presented. This method can be described as the conversion between the coefficients of transfer functions, which are expressed as transform by certain matrix. For a polynomial of degree n, the corresponding transformation matrix of order n exists and is unique. Furthermore, the transformation matrix can be decomposed into an upper triangular matrix multiplied with another lower triangular matrix. And both have obvious regularity. The proposed method can achieve rapid bilinear transform used in automatic design of digital filter. The result of numerical simulation verifies the correctness of the theoretical results. Moreover, it also can be extended to other similar problems. Example in the last throws light on this point.

An iterative method to invert the LTSn matrix

Energy Technology Data Exchange (ETDEWEB)

Cardona, A.V.; Vilhena, M.T. de [UFRGS, Porto Alegre (Brazil)

1996-12-31

Recently Vilhena and Barichello proposed the LTSn method to solve, analytically, the Discrete Ordinates Problem (Sn problem) in transport theory. The main feature of this method consist in the application of the Laplace transform to the set of Sn equations and solve the resulting algebraic system for the transport flux. Barichello solve the linear system containing the parameter s applying the definition of matrix invertion exploiting the structure of the LTSn matrix. In this work, it is proposed a new scheme to invert the LTSn matrix, decomposing it in blocks and recursively inverting this blocks.

Matrix-based image reconstruction methods for tomography

International Nuclear Information System (INIS)

Llacer, J.; Meng, J.D.

1984-10-01

Matrix methods of image reconstruction have not been used, in general, because of the large size of practical matrices, ill condition upon inversion and the success of Fourier-based techniques. An exception is the work that has been done at the Lawrence Berkeley Laboratory for imaging with accelerated radioactive ions. An extension of that work into more general imaging problems shows that, with a correct formulation of the problem, positron tomography with ring geometries results in well behaved matrices which can be used for image reconstruction with no distortion of the point response in the field of view and flexibility in the design of the instrument. Maximum Likelihood Estimator methods of reconstruction, which use the system matrices tailored to specific instruments and do not need matrix inversion, are shown to result in good preliminary images. A parallel processing computer structure based on multiple inexpensive microprocessors is proposed as a system to implement the matrix-MLE methods. 14 references, 7 figures

Glia and extracellular matrix changes affect extracellular diffusion and volume transmission in the brain in health and disease

Czech Academy of Sciences Publication Activity Database

Vargová, Lýdia; Syková, Eva

2011-01-01

Roč. 59, S1 (2011), S38 ISSN 0894-1491. [European meeting on Glia l Cells in Health and Disease /10./. 13.09.2011-17.09.2011, Prague] Institutional research plan: CEZ:AV0Z50390512; CEZ:AV0Z50390703 Keywords : diffusion * extracellular matrix * extrasynaptic transmission Subject RIV: FH - Neurology

A Golub-Kahan-type reduction method for matrix pairs

NARCIS (Netherlands)

Hochstenbach, M.E.; Reichel, L.; Yu, X.

2015-01-01

We describe a novel method for reducing a pair of large matrices {A;B} to a pair of small matrices {H;K}. The method is an extension of Golub-Kahan bidiagonalization to matrix pairs, and simplifies to the latter method when B is the identity matrix. Applications to Tikhonov regularization of large

A Golub-Kahan-type reduction method for matrix pairs

NARCIS (Netherlands)

Hochstenbach, M.E.; Reichel, L.; Yu, X.

2015-01-01

We describe a novel method for reducing a pair of large matrices {A,B} to a pair of small matrices {H,K}. The method is an extension of Golub–Kahan bidiagonalization to matrix pairs, and simplifies to the latter method when B is the identity matrix. Applications to Tikhonov regularization of large

R-matrix analysis of the /sup 239/Pu neutron cross sections

Energy Technology Data Exchange (ETDEWEB)

Saussure, G. de; Perez, R.B.; Macklin, R.L.

1986-03-01

/sup 239/Pu neutron cross-section data in the resolved resonance region were analyzed with the R-Matrix Bayesian Program SAMMY. Below 30 eV the cross sections computed with the multilevel parameters are consistent with recent fission and transmission measurements as well as with older capture and alpha measurements. Above 30 eV no suitable transmission data were available and only fission cross-section measurements were analyzed. However, since the analysis conserves the complete covariance matrix, the analysis can be updated by the Bayes method as transmission measurements become available. To date, the analysis of the fission measurements has been completed up to 300 eV.

A transaction assessment method for allocation of transmission services

Science.gov (United States)

Banunarayanan, Venkatasubramaniam

The purpose of this research is to develop transaction assessment methods for allocating transmission services that are provided by an area/utility to power transactions. Transmission services are the services needed to deliver, or provide the capacity to deliver, real and reactive power from one or more supply points to one or more delivery points. As the number of transactions increase rapidly in the emerging deregulated environment, accurate quantification of the transmission services an area/utility provides to accommodate a transaction is becoming important, because then appropriate pricing schemes can be developed to compensate for the parties that provide these services. The Allocation methods developed are based on the "Fair Resource Allocation Principle" and they determine for each transaction the following: the flowpath of the transaction (both real and reactive power components), generator reactive power support from each area/utility, real power loss support from each area/utility. Further, allocation methods for distributing the cost of relieving congestion on transmission lines caused by transactions are also developed. The main feature of the proposed methods is representation of actual usage of the transmission services by the transactions. The proposed method is tested extensively on a variety of systems. The allocation methods developed in this thesis for allocation of transmission services to transactions is not only useful in studying the impact of transactions on a transmission system in a multi-transaction case, but they are indeed necessary to meet the criteria set forth by FERC with regard to pricing based on actual usage. The "consistency" of the proposed allocation methods has also been investigated and tested.

Investigation of a matrix converter for contactless power transmission systems; Untersuchung eines Matrixumrichters fuer kontaktlose Energieuebertragungssysteme

Energy Technology Data Exchange (ETDEWEB)

Ecklebe, Andreas

2009-05-22

The publication discusses a three- to two-phase matrix converter for contactless power transmission systems. Based on relevant publications, possible resonance setups for contactless power transmission systems are investigated to begin with. An analysis of relevant parameters shows the differences between the various setups, but it also shows that for an investigation focusing on the feeding converter, simple modelling of the three investigated resonance setups is possible with the aid of a serial oscillating circuit. In consequence, it should be possible to apply the results also to the matrix converter with other serially resonant loads. The second part of the investigation focuses on the matrix converter. After a theoretical description, a combination von high-frequency control - e.g. bulk pulsing - and low-frequency pulsing patterns for setting the harmonics level of the grid currents is presented. The similarity to a conventional H bridge circuit enables an assessment of commutation and the identification of the necessary inverter states. These are characterized in that a bidirectional connection between the input system and each output phase is available at any time. The functioning of the commutation and of the inverter as a whole is proved by simulation in a first step, in which also the dynamic switching characteristics of the power semiconductors is taken into account. Finally, the results of laboratory measurements are presented and compared with the theoretical results. The laboratory setup consists of the power section of the matrix converter with input filters and modular gate drivers, a DSP/FPGA control system, and a contactless power transmission system with a current inverter and load on the secondary side. The investigation thus provides information on the use of the three-to-two phase matrix converter as an interesting alternative for feeding of contactless power transmission systems and other serially resonant loads. (orig.) [German] Diese

Pre-form ceramic matrix composite cavity and method of forming and method of forming a ceramic matrix composite component

Science.gov (United States)

Monaghan, Philip Harold; Delvaux, John McConnell; Taxacher, Glenn Curtis

2015-06-09

A pre-form CMC cavity and method of forming pre-form CMC cavity for a ceramic matrix component includes providing a mandrel, applying a base ply to the mandrel, laying-up at least one CMC ply on the base ply, removing the mandrel, and densifying the base ply and the at least one CMC ply. The remaining densified base ply and at least one CMC ply form a ceramic matrix component having a desired geometry and a cavity formed therein. Also provided is a method of forming a CMC component.

Statistical image reconstruction methods for simultaneous emission/transmission PET scans

International Nuclear Information System (INIS)

Erdogan, H.; Fessler, J.A.

1996-01-01

Transmission scans are necessary for estimating the attenuation correction factors (ACFs) to yield quantitatively accurate PET emission images. To reduce the total scan time, post-injection transmission scans have been proposed in which one can simultaneously acquire emission and transmission data using rod sources and sinogram windowing. However, since the post-injection transmission scans are corrupted by emission coincidences, accurate correction for attenuation becomes more challenging. Conventional methods (emission subtraction) for ACF computation from post-injection scans are suboptimal and require relatively long scan times. We introduce statistical methods based on penalized-likelihood objectives to compute ACFs and then use them to reconstruct lower noise PET emission images from simultaneous transmission/emission scans. Simulations show the efficacy of the proposed methods. These methods improve image quality and SNR of the estimates as compared to conventional methods

Comparison of matrix methods for elastic wave scattering problems

International Nuclear Information System (INIS)

Tsao, S.J.; Varadan, V.K.; Varadan, V.V.

1983-01-01

This article briefly describes the T-matrix method and the MOOT (method of optimal truncation) of elastic wave scattering as they apply to A-D, SH- wave problems as well as 3-D elastic wave problems. Two methods are compared for scattering by elliptical cylinders as well as oblate spheroids of various eccentricity as a function of frequency. Convergence, and symmetry of the scattering cross section are also compared for ellipses and spheroidal cavities of different aspect ratios. Both the T-matrix approach and the MOOT were programmed on an AMDHL 470 computer using double precision arithmetic. Although the T-matrix method and MOOT are not always in agreement, it is in no way implied that any of the published results using MOOT are in error

Tunable electronic transmission gaps in a graphene superlattice

International Nuclear Information System (INIS)

Lu Weitao; Wang Shunjin; Li Wen; Wang Yonglong; Jiang Hua

2012-01-01

The transmission in graphene superlattices with adjustable barrier height is investigated using transfer-matrix method. It is found that one could control the angular range of transmission by changing the ratio of incidence energy and barrier height. The transmission as a function of incidence energy has more than one gaps, due to the appearance of evanescent waves in different barriers. Accordingly, more than one conductivity minimums are induced. The transmission gaps could be controlled by adjusting the incidence angle, the barrier height, and the barrier number, which gives the possibility to construct an energy-dependent wavevector filter.

Refractive index inversion based on Mueller matrix method

Science.gov (United States)

Fan, Huaxi; Wu, Wenyuan; Huang, Yanhua; Li, Zhaozhao

2016-03-01

Based on Stokes vector and Jones vector, the correlation between Mueller matrix elements and refractive index was studied with the result simplified, and through Mueller matrix way, the expression of refractive index inversion was deduced. The Mueller matrix elements, under different incident angle, are simulated through the expression of specular reflection so as to analyze the influence of the angle of incidence and refractive index on it, which is verified through the measure of the Mueller matrix elements of polished metal surface. Research shows that, under the condition of specular reflection, the result of Mueller matrix inversion is consistent with the experiment and can be used as an index of refraction of inversion method, and it provides a new way for target detection and recognition technology.

A numerical method to compute interior transmission eigenvalues

International Nuclear Information System (INIS)

Kleefeld, Andreas

2013-01-01

In this paper the numerical calculation of eigenvalues of the interior transmission problem arising in acoustic scattering for constant contrast in three dimensions is considered. From the computational point of view existing methods are very expensive, and are only able to show the existence of such transmission eigenvalues. Furthermore, they have trouble finding them if two or more eigenvalues are situated closely together. We present a new method based on complex-valued contour integrals and the boundary integral equation method which is able to calculate highly accurate transmission eigenvalues. So far, this is the first paper providing such accurate values for various surfaces different from a sphere in three dimensions. Additionally, the computational cost is even lower than those of existing methods. Furthermore, the algorithm is capable of finding complex-valued eigenvalues for which no numerical results have been reported yet. Until now, the proof of existence of such eigenvalues is still open. Finally, highly accurate eigenvalues of the interior Dirichlet problem are provided and might serve as test cases to check newly derived Faber–Krahn type inequalities for larger transmission eigenvalues that are not yet available. (paper)

Direct determination of scattering time delays using the R-matrix propagation method

International Nuclear Information System (INIS)

Walker, R.B.; Hayes, E.F.

1989-01-01

A direct method for determining time delays for scattering processes is developed using the R-matrix propagation method. The procedure involves the simultaneous generation of the global R matrix and its energy derivative. The necessary expressions to obtain the energy derivative of the S matrix are relatively simple and involve many of the same matrix elements required for the R-matrix propagation method. This method is applied to a simple model for a chemical reaction that displays sharp resonance features. The test results of the direct method are shown to be in excellent agreement with the traditional numerical differentiation method for scattering energies near the resonance energy. However, for sharp resonances the numerical differentiation method requires calculation of the S-matrix elements at many closely spaced energies. Since the direct method presented here involves calculations at only a single energy, one is able to generate accurate energy derivatives and time delays much more efficiently and reliably

Hybrid matrix method for stable numerical analysis of the propagation of Dirac electrons in gapless bilayer graphene superlattices

Science.gov (United States)

Briones-Torres, J. A.; Pernas-Salomón, R.; Pérez-Álvarez, R.; Rodríguez-Vargas, I.

2016-05-01

Gapless bilayer graphene (GBG), like monolayer graphene, is a material system with unique properties, such as anti-Klein tunneling and intrinsic Fano resonances. These properties rely on the gapless parabolic dispersion relation and the chiral nature of bilayer graphene electrons. In addition, propagating and evanescent electron states coexist inherently in this material, giving rise to these exotic properties. In this sense, bilayer graphene is unique, since in most material systems in which Fano resonance phenomena are manifested an external source that provides extended states is required. However, from a numerical standpoint, the presence of evanescent-divergent states in the eigenfunctions linear superposition representing the Dirac spinors, leads to a numerical degradation (the so called Ωd problem) in the practical applications of the standard Coefficient Transfer Matrix (K) method used to study charge transport properties in Bilayer Graphene based multi-barrier systems. We present here a straightforward procedure based in the hybrid compliance-stiffness matrix method (H) that can overcome this numerical degradation. Our results show that in contrast to standard matrix method, the proposed H method is suitable to study the transmission and transport properties of electrons in GBG superlattice since it remains numerically stable regardless the size of the superlattice and the range of values taken by the input parameters: the energy and angle of the incident electrons, the barrier height and the thickness and number of barriers. We show that the matrix determinant can be used as a test of the numerical accuracy in real calculations.

The Matrix Element Method at Next-to-Leading Order

OpenAIRE

Campbell, John M.; Giele, Walter T.; Williams, Ciaran

2012-01-01

This paper presents an extension of the matrix element method to next-to-leading order in perturbation theory. To accomplish this we have developed a method to calculate next-to-leading order weights on an event-by-event basis. This allows for the definition of next-to-leading order likelihoods in exactly the same fashion as at leading order, thus extending the matrix element method to next-to-leading order. A welcome by-product of the method is the straightforward and efficient generation of...

Voltage dependency of transmission probability of aperiodic DNA molecule

Science.gov (United States)

Wiliyanti, V.; Yudiarsah, E.

2017-07-01

Characteristics of electron transports in aperiodic DNA molecules have been studied. Double stranded DNA model with the sequences of bases, GCTAGTACGTGACGTAGCTAGGATATGCCTGA, in one chain and its complements on the other chains has been used. Tight binding Hamiltonian is used to model DNA molecules. In the model, we consider that on-site energy of the basis has a linearly dependency on the applied electric field. Slater-Koster scheme is used to model electron hopping constant between bases. The transmission probability of electron from one electrode to the next electrode is calculated using a transfer matrix technique and scattering matrix method simultaneously. The results show that, generally, higher voltage gives a slightly larger value of the transmission probability. The applied voltage seems to shift extended states to lower energy. Meanwhile, the value of the transmission increases with twisting motion frequency increment.

Hybrid-dimensional modelling of two-phase flow through fractured porous media with enhanced matrix fracture transmission conditions

Science.gov (United States)

Brenner, Konstantin; Hennicker, Julian; Masson, Roland; Samier, Pierre

2018-03-01

In this work, we extend, to two-phase flow, the single-phase Darcy flow model proposed in [26], [12] in which the (d - 1)-dimensional flow in the fractures is coupled with the d-dimensional flow in the matrix. Three types of so called hybrid-dimensional two-phase Darcy flow models are proposed. They all account for fractures acting either as drains or as barriers, since they allow pressure jumps at the matrix-fracture interfaces. The models also permit to treat gravity dominated flow as well as discontinuous capillary pressure at the material interfaces. The three models differ by their transmission conditions at matrix fracture interfaces: while the first model accounts for the nonlinear two-phase Darcy flux conservations, the second and third ones are based on the linear single phase Darcy flux conservations combined with different approximations of the mobilities. We adapt the Vertex Approximate Gradient (VAG) scheme to this problem, in order to account for anisotropy and heterogeneity aspects as well as for applicability on general meshes. Several test cases are presented to compare our hybrid-dimensional models to the generic equi-dimensional model, in which fractures have the same dimension as the matrix, leading to deep insight about the quality of the proposed reduced models.

An improved 4-step commutation method application for matrix converter

DEFF Research Database (Denmark)

Guo, Yu; Guo, Yougui; Deng, Wenlang

2014-01-01

A novel four-step commutation method is proposed for matrix converter cell, 3 phase inputs to 1 phase output in this paper, which is obtained on the analysis of published commutation methods for matrix converter. The first and fourth step can be shorter than the second or third one. The discussed...... method here is implemented by programming in VHDL language. Finally, the novel method in this paper is verified by experiments....

Methods, apparatus, and systems for monitoring transmission systems

Science.gov (United States)

Polk, Robert E [Idaho Falls, ID; Svoboda, John M [Idaho Falls, ID; West, Phillip B [Idaho Falls, ID; Heath, Gail L [Iona, ID; Scott, Clark L [Idaho Falls, ID

2010-08-31

A sensing platform for monitoring a transmission system, and method therefor, may include a sensor that senses one or more conditions relating to a condition of the transmission system and/or the condition of an environment around the transmission system. A control system operatively associated with the sensor produces output data based on an output signal produced by the sensor. A transmitter operatively associated with the control system transmits the output data from the control system.

Widening the Scope of R-matrix Methods

Energy Technology Data Exchange (ETDEWEB)

Thompson, Ian J. [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States); Dimitriou, Paraskevi [IAEA, Vienna (Austria); DeBoer, Richard J. [Nieuwland Science Hall, Notre Dame, IN (United States); Kunieda, Satoshi [Nuclear Data Center (JAEA), Tokai (Japan); Paris, Mark [Los Alamos National Lab. (LANL), Los Alamos, NM (United States); Thompson, Ian [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States); Trkov, Andrej [IAEA, Vienna (Austria)

2016-03-01

A Consultant’s Meeting was held at the IAEA Headquarters, from 7 to 9 December 2015, to discuss the status of R-matrix codes currently used in calculations of charged-particle induced reaction cross sections at low energies. The ultimate goal was to initiate an international effort, coordinated by the IAEA, to evaluate charged-particle induced reactions in the resolved-resonance region. Participants reviewed the capabilities of the codes, the different implementations of R-matrix theory and translatability of the R-matrix parameters, the evaluation methods and suitable data formats for broader dissemination. The details of the presentations and technical discussions, as well as the actions that were proposed to achieve the goal of the meeting are summarized in this report.

Application of the R-matrix method to photoionization of molecules.

Science.gov (United States)

Tashiro, Motomichi

2010-04-07

The R-matrix method has been used for theoretical calculation of electron collision with atoms and molecules for long years. The method was also formulated to treat photoionization process, however, its application has been mostly limited to photoionization of atoms. In this work, we implement the R-matrix method to treat molecular photoionization problem based on the UK R-matrix codes. This method can be used for diatomic as well as polyatomic molecules, with multiconfigurational description for electronic states of both target neutral molecule and product molecular ion. Test calculations were performed for valence electron photoionization of nitrogen (N(2)) as well as nitric oxide (NO) molecules. Calculated photoionization cross sections and asymmetry parameters agree reasonably well with the available experimental results, suggesting usefulness of the method for molecular photoionization.

Three-body forces for electrons by the S-matrix method

International Nuclear Information System (INIS)

Margaritelli, R.

1989-01-01

A electromagnetic three-body potential between eletrons is derived by the S-matrix method. This potential can be compared up to a certain point with other electromagnetic potentials (obtained by other methods) encountered in the literature. However, since the potential derived here is far more complete than others, this turns direct comparison with the potentials found in the literature somewhat difficult. These calculations allow a better understanding of the S-matrix method as applied to problems which involve the calculations of three-body nuclear forces (these calculations are performed in order to understand the 3 He form factor). Furthermore, these results enable us to decide between two discrepant works which derive the two-pion exchange three-body potential, both by the S-matrix method. (author) [pt

Random matrix theory of multi-antenna communications: the Ricean channel

International Nuclear Information System (INIS)

Moustakas, Aris L; Simon, Steven H

2005-01-01

The use of multi-antenna arrays in wireless communications through disordered media promises huge increases in the information transmission rate. It is therefore important to analyse the information capacity of such systems in realistic situations of microwave transmission, where the statistics of the transmission amplitudes (channel) may be coloured. Here, we present an approach that provides analytic expressions for the statistics, i.e. the moments of the distribution, of the mutual information for general Gaussian channel statistics. The mathematical method applies tools developed originally in the context of coherent wave propagation in disordered media, such as random matrix theory and replicas. Although it is valid formally for large antenna numbers, this approach produces extremely accurate results even for arrays with as few as two antennas. We also develop a method to analytically optimize over the input signal distribution, which enables us to calculate analytic capacities when the transmitter has knowledge of the statistics of the channel. The emphasis of this paper is on elucidating the novel mathematical methods used. We do this by analysing a specific case when the channel matrix is a complex Gaussian with arbitrary mean and unit covariance, which is usually called the Ricean channel

Computation of nonuniform transmission lines using the FDTD method

Energy Technology Data Exchange (ETDEWEB)

Miranda, G.C.; Paulino, J.O.S. [Universidade Federal de Minas Gerais, Belo Horizonte, MG (Brazil). School of Engineering

1997-12-31

Calculation of lightning overvoltages on transmission lines has been described. Lightning induced overvoltages are of great significance under certain conditions because of the main characteristics of the phenomena. The lightning channel model is one of the most important parameters essential to obtaining the generated electromagnetic fields. In this study, nonuniform transmission line equations were solved using the finite difference method and the leap-frog scheme, the Finite Difference Time Domain (FDTD) method. The subroutine was interfaced with the Electromagnetic Transients Program (EMTP). Two models were used to represent the characteristic impedance of the nonuniform lines used to model the transmission line towers and the lightning main channel. The advantages of the FDTD method was the much smaller code and faster processing time. 35 refs., 5 figs.

A nodal method based on the response-matrix method

International Nuclear Information System (INIS)

Cunha Menezes Filho, A. da; Rocamora Junior, F.D.

1983-02-01

A nodal approach based on the Response-Matrix method is presented with the purpose of investigating the possibility of mixing two different allocations in the same problem. It is found that the use of allocation of albedo combined with allocation of direct reflection produces good results for homogeneous fast reactor configurations. (Author) [pt

Comparison of three retail data communication and transmission methods

Directory of Open Access Journals (Sweden)

MA Yue

2016-04-01

Full Text Available With the rapid development of retail trade,the type and complexity of data keep increasing,and single data file size has a great difference between each other.How to realize an accurate,real-time and efficient data transmission based on a fixed cost is an important problem.Regarding the problem of effective transmission for business data files,this article implements analysis and comparison on 3 existing data transmission methods,considering the requirements on aspects like function in enterprise data communication system,we get a conclusion that which method can both meet the enterprise daily business development requirement better and have good extension ability.

Theoretical treatment of molecular photoionization based on the R-matrix method

International Nuclear Information System (INIS)

Tashiro, Motomichi

2012-01-01

The R-matrix method was implemented to treat molecular photoionization problem based on the UK R-matrix codes. This method was formulated to treat photoionization process long before, however, its application has been mostly limited to photoionization of atoms. Application of the method to valence photoionization as well as inner-shell photoionization process will be presented.

Acoustic wave transmission through piezoelectric structured materials.

Science.gov (United States)

Lam, M; Le Clézio, E; Amorín, H; Algueró, M; Holc, Janez; Kosec, Marija; Hladky-Hennion, A C; Feuillard, G

2009-05-01

This paper deals with the transmission of acoustic waves through multilayered piezoelectric materials. It is modeled in an octet formalism via the hybrid matrix of the structure. The theoretical evolution with the angle and frequency of the transmission coefficients of ultrasonic plane waves propagating through a partially depoled PZT plate is compared to finite element calculations showing that both methods are in very good agreement. The model is then used to study a periodic stack of 0.65 PMN-0.35 PT/0.90 PMN-0.10 PT layers. The transmission spectra are interpreted in terms of a dispersive behavior of the critical angles of longitudinal and transverse waves, and band gap structures are analysed. Transmission measurements confirm the theoretical calculations and deliver an experimental validation of the model.

Calculating the albedo characteristics by the method of transmission probabilities

International Nuclear Information System (INIS)

Lukhvich, A.A.; Rakhno, I.L.; Rubin, I.E.

1983-01-01

The possibility to use the method of transmission probabilities for calculating the albedo characteristics of homogeneous and heterogeneous zones is studied. The transmission probabilities method is a numerical method for solving the transport equation in the integrated form. All calculations have been conducted as a one-group approximation for the planes and rods with different optical thicknesses and capture-to-scattering ratios. Above calculations for plane and cylindrical geometries have shown the possibility to use the numerical method of transmission probabilities for calculating the albedo characteristics of homogeneous and heterogeneous zones with high accuracy. In this case the computer time consumptions are minimum even with the cylindrical geometry, if the interpolation calculation of characteristics is used for the neutrons of the first path

A low delay transmission method of multi-channel video based on FPGA

Science.gov (United States)

Fu, Weijian; Wei, Baozhi; Li, Xiaobin; Wang, Quan; Hu, Xiaofei

2018-03-01

In order to guarantee the fluency of multi-channel video transmission in video monitoring scenarios, we designed a kind of video format conversion method based on FPGA and its DMA scheduling for video data, reduces the overall video transmission delay.In order to sace the time in the conversion process, the parallel ability of FPGA is used to video format conversion. In order to improve the direct memory access (DMA) writing transmission rate of PCIe bus, a DMA scheduling method based on asynchronous command buffer is proposed. The experimental results show that this paper designs a low delay transmission method based on FPGA, which increases the DMA writing transmission rate by 34% compared with the existing method, and then the video overall delay is reduced to 23.6ms.

Efficient computation method of Jacobian matrix

International Nuclear Information System (INIS)

Sasaki, Shinobu

1995-05-01

As well known, the elements of the Jacobian matrix are complex trigonometric functions of the joint angles, resulting in a matrix of staggering complexity when we write it all out in one place. This article addresses that difficulties to this subject are overcome by using velocity representation. The main point is that its recursive algorithm and computer algebra technologies allow us to derive analytical formulation with no human intervention. Particularly, it is to be noted that as compared to previous results the elements are extremely simplified throughout the effective use of frame transformations. Furthermore, in case of a spherical wrist, it is shown that the present approach is computationally most efficient. Due to such advantages, the proposed method is useful in studying kinematically peculiar properties such as singularity problems. (author)

Research on Quality Detection Methods for Automotive Transmission

Directory of Open Access Journals (Sweden)

Sheng FU

2014-04-01

Full Text Available Given the problems in intelligent diagnosis methods for automotive transmission, it is difficult to obtain the fault signal features and a large enough sample size to study. To solve these problems, a method integrating order tracking, cepstrum, support vector machine (SVM and extremal curve is proposed in this paper. Order tracking and cepstrum are combined for processing the non- stationary vibration signal emitted by automotive transmission. As conventional intelligent methods cannot produce true results for insufficient samples, a method that combines SVM and extremal curve is presented. Input the vector acquired from the feature signals into the SVM model for the first detection, and then do the second detection by means of extremal curve which in turn can enrich the training samples in SVM model thus making the SVM model be more perfect. Analytical description and experimental studies are presented for the methods of signal processing and quality detection. The experimental results demonstrate the effectiveness and practicability of the proposed method.

Methods for estimating disease transmission rates: Evaluating the precision of Poisson regression and two novel methods

DEFF Research Database (Denmark)

Kirkeby, Carsten Thure; Hisham Beshara Halasa, Tariq; Gussmann, Maya Katrin

2017-01-01

the transmission rate. We use data from the two simulation models and vary the sampling intervals and the size of the population sampled. We devise two new methods to determine transmission rate, and compare these to the frequently used Poisson regression method in both epidemic and endemic situations. For most...... tested scenarios these new methods perform similar or better than Poisson regression, especially in the case of long sampling intervals. We conclude that transmission rate estimates are easily biased, which is important to take into account when using these rates in simulation models....

Risk Analysis Method Based on FMEA for Transmission Line in Lightning Hazards

Directory of Open Access Journals (Sweden)

You-Yuan WANG

2014-05-01

Full Text Available Failure rate of transmission line and reliability of power system are significantly affected by Lightning meteorological factor. In view of the complexity and variability of Lightning meteorological factors, this paper presents lightning trip-out rate model of transmission line in considering distribution of ground flash density and lightning day hours. Meanwhile, presents a failure rate model of transmission line in different condition, and a risk analysis method for transmission line considering multiple risk factors based on risk quantification. This method takes Lightning meteorological factor as the main evaluation standard, and establishes risk degree evaluation system for transmission line including another five evaluation standard. Put forward the risk indicators by quantify the risk factors based on experience date of transmission line in service. Based on the risk indexes comprehensive evaluation is conducted, and the evaluation result closer to practice is achieved, providing basis for transmission line risk warning and maintenance strategy. Through the risk analysis for 220 kV transmission line in a certain power supply bureau, the effectiveness of the proposed method is validated.

METHODS OF POLYMODAL INFORMATION TRANSMISSION

Directory of Open Access Journals (Sweden)

O. O. Basov

2015-03-01

Full Text Available The research results upon the application of the existing information transmission methods in polymodal info communication systems are presented herein. The analysis of the existing commutation ways and multiplexing schemes has revealed that modern means of telecommunication are capable of providing polymodal information delivery with the required quality to the customer correspondent terminal. Under these conditions substantial capacity resource consumption in the data transmission networks with a simultaneous static time multiplexing is required, however, it is easier to achieve the modality synchronization within that kind of an infrastructure. The data networks with a static time multiplexing demand employing more sophisticated supporting algorithms of the guaranteed data blocks delivery quality. However, due to the stochastic data blocks delays modality synchronizing during the off-line processing is more difficult to provide. Nowadays there are objective preconditions for a data networking realization which is invariable to the applied transmission technology. This capability is defined by a wide (person-to-person application of the optical technologies in the transport infrastructure of the polymodal info communication systems. In case of the availability of the customer terminal and networking functioning matching mode it becomes possible to organize channels in the latter which can adaptively select the most effective networking technology according to the current volume allocation and modality types in the messages.

The response-matrix based AFEN method for the hexagonal geometry

International Nuclear Information System (INIS)

Noh, Jae Man; Kim, Keung Koo; Zee, Sung Quun; Joo, Hyung Kook; Cho, Byng Oh; Jeong, Hyung Guk; Cho, Jin Young

1998-03-01

The analytic function expansion nodal (AFEN) method, developed to overcome the limitations caused by the transverse integration, has been successfully to predict the neutron behavior in the hexagonal core as well as rectangular core. In the hexagonal node, the transverse leakage resulted from the transverse integration has some singular terms such as delta-function and step-functions near the node center line. In most nodal methods using the transverse integration, the accuracy of nodal method is degraded because the transverse leakage is approximated as a smooth function across the node center line by ignoring singular terms. However, the AFEN method in which there is no transverse leakage term in deriving nodal coupling equations keeps good accuracy for hexagonal node. In this study, the AFEN method which shows excellent accuracy in the hexagonal core analyses is reformulated as a response matrix form. This form of the AFEN method can be implemented easily to nodal codes based on the response matrix method. Therefore, the Coarse Mesh Rebalance (CMR) acceleration technique which is one of main advantages of the response matrix method can be utilized for the AFEN method. The response matrix based AFEN method has been successfully implemented into the MASTER code and its accuracy and computational efficiency were examined by analyzing the two- and three- dimensional benchmark problem of VVER-440. Based on the results, it can be concluded that the newly formulated AFEN method predicts accurately the assembly powers (within 0.2% average error) as well as the effective multiplication factor (within 0.2% average error) as well as the effective multiplication factor (within 20 pcm error). In addition, the CMR acceleration technique is quite efficient in reducing the computation time of the AFEN method by 8 to 10 times. (author). 22 refs., 1 tab., 4 figs

Analytical techniques for instrument design - matrix methods

International Nuclear Information System (INIS)

Robinson, R.A.

1997-01-01

We take the traditional Cooper-Nathans approach, as has been applied for many years for steady-state triple-axis spectrometers, and consider its generalisation to other inelastic scattering spectrometers. This involves a number of simple manipulations of exponentials of quadratic forms. In particular, we discuss a toolbox of matrix manipulations that can be performed on the 6- dimensional Cooper-Nathans matrix: diagonalisation (Moller-Nielsen method), coordinate changes e.g. from (Δk I ,Δk F to ΔE, ΔQ ampersand 2 dummy variables), integration of one or more variables (e.g. over such dummy variables), integration subject to linear constraints (e.g. Bragg's Law for analysers), inversion to give the variance-covariance matrix, and so on. We show how these tools can be combined to solve a number of important problems, within the narrow-band limit and the gaussian approximation. We will argue that a generalised program that can handle multiple different spectrometers could (and should) be written in parallel to the Monte-Carlo packages that are becoming available. We will also discuss the complementarity between detailed Monte-Carlo calculations and the approach presented here. In particular, Monte-Carlo methods traditionally simulate the real experiment as performed in practice, given a model scattering law, while the Cooper-Nathans method asks the inverse question: given that a neutron turns up in a particular spectrometer configuration (e.g. angle and time of flight), what is the probability distribution of possible scattering events at the sample? The Monte-Carlo approach could be applied in the same spirit to this question

Matrix-based system reliability method and applications to bridge networks

International Nuclear Information System (INIS)

Kang, W.-H.; Song Junho; Gardoni, Paolo

2008-01-01

Using a matrix-based system reliability (MSR) method, one can estimate the probabilities of complex system events by simple matrix calculations. Unlike existing system reliability methods whose complexity depends highly on that of the system event, the MSR method describes any general system event in a simple matrix form and therefore provides a more convenient way of handling the system event and estimating its probability. Even in the case where one has incomplete information on the component probabilities and/or the statistical dependence thereof, the matrix-based framework enables us to estimate the narrowest bounds on the system failure probability by linear programming. This paper presents the MSR method and applies it to a transportation network consisting of bridge structures. The seismic failure probabilities of bridges are estimated by use of the predictive fragility curves developed by a Bayesian methodology based on experimental data and existing deterministic models of the seismic capacity and demand. Using the MSR method, the probability of disconnection between each city/county and a critical facility is estimated. The probability mass function of the number of failed bridges is computed as well. In order to quantify the relative importance of bridges, the MSR method is used to compute the conditional probabilities of bridge failures given that there is at least one city disconnected from the critical facility. The bounds on the probability of disconnection are also obtained for cases with incomplete information

Small-angle tomography algorithm for transmission inspection of acoustic linear array

Directory of Open Access Journals (Sweden)

Soldatov Alexey

2016-01-01

Full Text Available The paper describes the algorithm of reconstruction of tomographic image used in the through-transition method in a small angle sounding of acoustic linear arrays and the results of practical application of the proposed algorithm. In alternate probing of each element of emitting array and simultaneous reception of all elements of the receiving array is a collection of shadow images of the testing zone. The testing zone is divided into small local areas and using the collection of shadow images computed matrix normalized transmission coefficients for each of the small local area. Tomographic image control zone is obtained by submitting the resulting matrix of normalized transmission coefficients in grayscale or colors.

The method of the transfer matrix applied to the study of the electronic properties of the Kronig- Penney model with structural disorder

International Nuclear Information System (INIS)

Miranda S, Anabel; Landauro S, Carlos

2008-01-01

In the present work the transfer matrix method is employed to study the electronic properties of the Kronig-Penney model including disorder in the periodic system. The results show that although the electronic properties are very similar to the corresponding periodic case, disorder in the system produces a decrease of the transmission in the whole range of energies which indicates clearly a reduction of the electronic transport (conductivity) due to the disorder in the system. (author)

Comparison of experimental methods for estimating matrix diffusion coefficients for contaminant transport modeling

Science.gov (United States)

Telfeyan, Katherine; Ware, S. Doug; Reimus, Paul W.; Birdsell, Kay H.

2018-02-01

Diffusion cell and diffusion wafer experiments were conducted to compare methods for estimating effective matrix diffusion coefficients in rock core samples from Pahute Mesa at the Nevada Nuclear Security Site (NNSS). A diffusion wafer method, in which a solute diffuses out of a rock matrix that is pre-saturated with water containing the solute, is presented as a simpler alternative to the traditional through-diffusion (diffusion cell) method. Both methods yielded estimates of effective matrix diffusion coefficients that were within the range of values previously reported for NNSS volcanic rocks. The difference between the estimates of the two methods ranged from 14 to 30%, and there was no systematic high or low bias of one method relative to the other. From a transport modeling perspective, these differences are relatively minor when one considers that other variables (e.g., fracture apertures, fracture spacings) influence matrix diffusion to a greater degree and tend to have greater uncertainty than effective matrix diffusion coefficients. For the same relative random errors in concentration measurements, the diffusion cell method yields effective matrix diffusion coefficient estimates that have less uncertainty than the wafer method. However, the wafer method is easier and less costly to implement and yields estimates more quickly, thus allowing a greater number of samples to be analyzed for the same cost and time. Given the relatively good agreement between the methods, and the lack of any apparent bias between the methods, the diffusion wafer method appears to offer advantages over the diffusion cell method if better statistical representation of a given set of rock samples is desired.

A stochastic method for computing hadronic matrix elements

Energy Technology Data Exchange (ETDEWEB)

Alexandrou, Constantia [Cyprus Univ., Nicosia (Cyprus). Dept. of Physics; The Cyprus Institute, Nicosia (Cyprus). Computational-based Science and Technology Research Center; Dinter, Simon; Drach, Vincent [Deutsches Elektronen-Synchrotron (DESY), Zeuthen (Germany). John von Neumann-Inst. fuer Computing NIC; Jansen, Karl [Cyprus Univ., Nicosia (Cyprus). Dept. of Physics; Deutsches Elektronen-Synchrotron (DESY), Zeuthen (Germany). John von Neumann-Inst. fuer Computing NIC; Hadjiyiannakou, Kyriakos [Cyprus Univ., Nicosia (Cyprus). Dept. of Physics; Renner, Dru B. [Thomas Jefferson National Accelerator Facility, Newport News, VA (United States); Collaboration: European Twisted Mass Collaboration

2013-02-15

We present a stochastic method for the calculation of baryon three-point functions that is more versatile compared to the typically used sequential method. We analyze the scaling of the error of the stochastically evaluated three-point function with the lattice volume and find a favorable signal-to-noise ratio suggesting that our stochastic method can be used efficiently at large volumes to compute hadronic matrix elements.

The transmission probability method in one-dimensional cylindrical geometry

International Nuclear Information System (INIS)

Rubin, I.E.

1983-01-01

The collision probability method widely used in solving the problems of neutron transpopt in a reactor cell is reliable for simple cells with small number of zones. The increase of the number of zones and also taking into account the anisotropy of scattering greatly increase the scope of calculations. In order to reduce the time of calculation the transmission probability method is suggested to be used for flux calculation in one-dimensional cylindrical geometry taking into account the scattering anisotropy. The efficiency of the suggested method is verified using the one-group calculations for cylindrical cells. The use of the transmission probability method allows to present completely angular and spatial dependences is neutrons distributions without the increase in the scope of calculations. The method is especially effective in solving the multi-group problems

Response Matrix Method Development Program at Savannah River Laboratory

International Nuclear Information System (INIS)

Sicilian, J.M.

1976-01-01

The Response Matrix Method Development Program at Savannah River Laboratory (SRL) has concentrated on the development of an effective system of computer codes for the analysis of Savannah River Plant (SRP) reactors. The most significant contribution of this program to date has been the verification of the accuracy of diffusion theory codes as used for routine analysis of SRP reactor operation. This paper documents the two steps carried out in achieving this verification: confirmation of the accuracy of the response matrix technique through comparison with experiment and Monte Carlo calculations; and establishment of agreement between diffusion theory and response matrix codes in situations which realistically approximate actual operating conditions

A high-speed transmission method for large-scale marine seismic prospecting systems

International Nuclear Information System (INIS)

KeZhu, Song; Ping, Cao; JunFeng, Yang; FuMing, Ruan

2012-01-01

A marine seismic prospecting system is a kind of data acquisition and transmission system with large-scale coverage and synchronous multi-node acquisition. In this kind of system, data transmission is a fundamental and difficult technique. In this paper, a high-speed data-transmission method is proposed, its implications and limitations are discussed, and conclusions are drawn. The method we propose has obvious advantages over traditional techniques with respect to long-distance operation, high speed, and real-time transmission. A marine seismic system with four streamers, each 6000 m long and capable of supporting up to 1920 channels, was designed and built based on this method. The effective transmission baud rate of this system was found to reach up to 240 Mbps, while the minimum sampling interval time was as short as 0.25 ms. This system was found to achieve a good synchronization: 83 ns. Laboratory and in situ experiments showed that this marine-prospecting system could work correctly and robustly, which verifies the feasibility and validity of the method proposed in this paper. In addition to the marine seismic applications, this method can also be used in land seismic applications and certain other transmission applications such as environmental or engineering monitoring systems. (paper)

A high-speed transmission method for large-scale marine seismic prospecting systems

Science.gov (United States)

KeZhu, Song; Ping, Cao; JunFeng, Yang; FuMing, Ruan

2012-12-01

A marine seismic prospecting system is a kind of data acquisition and transmission system with large-scale coverage and synchronous multi-node acquisition. In this kind of system, data transmission is a fundamental and difficult technique. In this paper, a high-speed data-transmission method is proposed, its implications and limitations are discussed, and conclusions are drawn. The method we propose has obvious advantages over traditional techniques with respect to long-distance operation, high speed, and real-time transmission. A marine seismic system with four streamers, each 6000 m long and capable of supporting up to 1920 channels, was designed and built based on this method. The effective transmission baud rate of this system was found to reach up to 240 Mbps, while the minimum sampling interval time was as short as 0.25 ms. This system was found to achieve a good synchronization: 83 ns. Laboratory and in situ experiments showed that this marine-prospecting system could work correctly and robustly, which verifies the feasibility and validity of the method proposed in this paper. In addition to the marine seismic applications, this method can also be used in land seismic applications and certain other transmission applications such as environmental or engineering monitoring systems.

Characteristic analysis on UAV-MIMO channel based on normalized correlation matrix.

Science.gov (United States)

Gao, Xi jun; Chen, Zi li; Hu, Yong Jiang

2014-01-01

Based on the three-dimensional GBSBCM (geometrically based double bounce cylinder model) channel model of MIMO for unmanned aerial vehicle (UAV), the simple form of UAV space-time-frequency channel correlation function which includes the LOS, SPE, and DIF components is presented. By the methods of channel matrix decomposition and coefficient normalization, the analytic formula of UAV-MIMO normalized correlation matrix is deduced. This formula can be used directly to analyze the condition number of UAV-MIMO channel matrix, the channel capacity, and other characteristic parameters. The simulation results show that this channel correlation matrix can be applied to describe the changes of UAV-MIMO channel characteristics under different parameter settings comprehensively. This analysis method provides a theoretical basis for improving the transmission performance of UAV-MIMO channel. The development of MIMO technology shows practical application value in the field of UAV communication.

Iterative approach as alternative to S-matrix in modal methods

Science.gov (United States)

Semenikhin, Igor; Zanuccoli, Mauro

2014-12-01

The continuously increasing complexity of opto-electronic devices and the rising demands of simulation accuracy lead to the need of solving very large systems of linear equations making iterative methods promising and attractive from the computational point of view with respect to direct methods. In particular, iterative approach potentially enables the reduction of required computational time to solve Maxwell's equations by Eigenmode Expansion algorithms. Regardless of the particular eigenmodes finding method used, the expansion coefficients are computed as a rule by scattering matrix (S-matrix) approach or similar techniques requiring order of M3 operations. In this work we consider alternatives to the S-matrix technique which are based on pure iterative or mixed direct-iterative approaches. The possibility to diminish the impact of M3 -order calculations to overall time and in some cases even to reduce the number of arithmetic operations to M2 by applying iterative techniques are discussed. Numerical results are illustrated to discuss validity and potentiality of the proposed approaches.

A New Method of Creating Technology/Function Matrix for Systematic Innovation without Expert

Directory of Open Access Journals (Sweden)

Tien-Yuan Cheng

2012-02-01

Full Text Available The technology/function matrix is comprised by specific technologies and functions, and through the technology/function matrix we can known what the technologies with functions have opportunities for innovation of product or technology. However, the technology/function matrix is very difficult to create, because the patents need to be read, analyzed and categorized into the technology/function matrix always more than hundreds or thousands. In this research, I propose a method to create a technology/function matrix just need to execute patent search without reading and analyzing patents. Through the proposed method anyone can create a technology/function matrix in a short time without experts’ help even if there are thousands of thousands of patents need to be read and analyzed.

Matrix completion by deep matrix factorization.

Science.gov (United States)

Fan, Jicong; Cheng, Jieyu

2018-02-01

Conventional methods of matrix completion are linear methods that are not effective in handling data of nonlinear structures. Recently a few researchers attempted to incorporate nonlinear techniques into matrix completion but there still exists considerable limitations. In this paper, a novel method called deep matrix factorization (DMF) is proposed for nonlinear matrix completion. Different from conventional matrix completion methods that are based on linear latent variable models, DMF is on the basis of a nonlinear latent variable model. DMF is formulated as a deep-structure neural network, in which the inputs are the low-dimensional unknown latent variables and the outputs are the partially observed variables. In DMF, the inputs and the parameters of the multilayer neural network are simultaneously optimized to minimize the reconstruction errors for the observed entries. Then the missing entries can be readily recovered by propagating the latent variables to the output layer. DMF is compared with state-of-the-art methods of linear and nonlinear matrix completion in the tasks of toy matrix completion, image inpainting and collaborative filtering. The experimental results verify that DMF is able to provide higher matrix completion accuracy than existing methods do and DMF is applicable to large matrices. Copyright © 2017 Elsevier Ltd. All rights reserved.

Nucleon matrix elements using the variational method in lattice QCD

International Nuclear Information System (INIS)

Dragos, J.; Kamleh, W.; Leinweber, D.B.; Zanotti, J.M.; Rakow, P.E.L.; Young, R.D.; Adelaide Univ., SA

2016-06-01

The extraction of hadron matrix elements in lattice QCD using the standard two- and threepoint correlator functions demands careful attention to systematic uncertainties. One of the most commonly studied sources of systematic error is contamination from excited states. We apply the variational method to calculate the axial vector current g_A, the scalar current g_S and the quark momentum fraction left angle x right angle of the nucleon and we compare the results to the more commonly used summation and two-exponential fit methods. The results demonstrate that the variational approach offers a more efficient and robust method for the determination of nucleon matrix elements.

A New Pseudoinverse Matrix Method For Balancing Chemical Equations And Their Stability

International Nuclear Information System (INIS)

Risteski, Ice B.

2008-01-01

In this work is given a new pseudoniverse matrix method for balancing chemical equations. Here offered method is founded on virtue of the solution of a Diophantine matrix equation by using of a Moore-Penrose pseudoinverse matrix. The method has been tested on several typical chemical equations and found to be very successful for the all equations in our extensive balancing research. This method, which works successfully without any limitations, also has the capability to determine the feasibility of a new chemical reaction, and if it is feasible, then it will balance the equation. Chemical equations treated here possess atoms with fractional oxidation numbers. Also, in the present work are introduced necessary and sufficient criteria for stability of chemical equations over stability of their extended matrices

Chosen interval methods for solving linear interval systems with special type of matrix

Science.gov (United States)

Szyszka, Barbara

2013-10-01

The paper is devoted to chosen direct interval methods for solving linear interval systems with special type of matrix. This kind of matrix: band matrix with a parameter, from finite difference problem is obtained. Such linear systems occur while solving one dimensional wave equation (Partial Differential Equations of hyperbolic type) by using the central difference interval method of the second order. Interval methods are constructed so as the errors of method are enclosed in obtained results, therefore presented linear interval systems contain elements that determining the errors of difference method. The chosen direct algorithms have been applied for solving linear systems because they have no errors of method. All calculations were performed in floating-point interval arithmetic.

Successive Over Relaxation Method Which Uses Matrix Norms for ...

African Journals Online (AJOL)

An algorithm for S.O.R functional iteration which uses matrix norms for the Jacobi iteration matrices rather than the usual Power method, feasible in Newton Operator for the solution of nonlinear system of equations is proposed. We modified the S.O.R. iterative method known as Multiphase S.O.R. method for Newton ...

Force transmissibility versus displacement transmissibility

Science.gov (United States)

Lage, Y. E.; Neves, M. M.; Maia, N. M. M.; Tcherniak, D.

2014-10-01

It is well-known that when a single-degree-of-freedom (sdof) system is excited by a continuous motion of the foundation, the force transmissibility, relating the force transmitted to the foundation to the applied force, equals the displacement transmissibility. Recent developments in the generalization of the transmissibility to multiple-degree-of-freedom (mdof) systems have shown that similar simple and direct relations between both types of transmissibility do not appear naturally from the definitions, as happens in the sdof case. In this paper, the authors present their studies on the conditions under which it is possible to establish a relation between force transmissibility and displacement transmissibility for mdof systems. As far as the authors are aware, such a relation is not currently found in the literature, which is justified by being based on recent developments in the transmissibility concept for mdof systems. Indeed, it does not appear naturally, but the authors observed that the needed link is present when the displacement transmissibility is obtained between the same coordinates where the applied and reaction forces are considered in the force transmissibility case; this implies that the boundary conditions are not exactly the same and instead follow some rules. This work presents a formal derivation of the explicit relation between the force and displacement transmissibilities for mdof systems, and discusses its potential and limitations. The authors show that it is possible to obtain the displacement transmissibility from measured forces, and the force transmissibility from measured displacements, opening new perspectives, for example, in the identification of applied or transmitted forces. With this novel relation, it becomes possible, for example, to estimate the force transmissibility matrix with the structure off its supports, in free boundary conditions, and without measuring the forces. As far as force identification is concerned, this

On a novel matrix method for three-dimensional photoelasticity

International Nuclear Information System (INIS)

Theocaris, P.S.; Gdoutos, E.E.

1978-01-01

A non-destructive method for the photoelastic determination of three-dimensional stress distributions, based on the Mueller and Jones calculi, is developed. The differential equations satisfied by the Stokes and Jones vectors, when a polarized light beam passes through a photoelastic model, presenting rotation of the secondary principal stress directions, are established in matrix form. The Peano-Baker method is used for the solution of these differential equations in a matrix series form, establishing the elements of the Mueller and Jones matrices of the photoelastic model. These matrices are experimentally determined by using different wavelengths in conjunction with Jones' 'equivalence theorem'. The Neumann equations are immediately deduced from the above-mentioned differential equations. (orig.) [de

Nonlinear response matrix methods for radiative transfer

International Nuclear Information System (INIS)

Miller, W.F. Jr.; Lewis, E.E.

1987-01-01

A nonlinear response matrix formalism is presented for the solution of time-dependent radiative transfer problems. The essential feature of the method is that within each computational cell the temperature is calculated in response to the incoming photons from all frequency groups. Thus the updating of the temperature distribution is placed within the iterative solution of the spaceangle transport problem, instead of being placed outside of it. The method is formulated for both grey and multifrequency problems and applied in slab geometry. The method is compared to the more conventional source iteration technique. 7 refs., 1 fig., 4 tabs

Vertical transmission of HIV from mother to child in sub-Saharan Africa: modes of transmission and methods for prevention.

Science.gov (United States)

Santmyire, B R

2001-05-01

The impact of the human immunodeficiency virus (HIV) epidemic in sub-Saharan Africa on future mortality rates of infants, children, and mothers, life expectancy, and economic growth is profound. Vertical transmission of HIV, transmission from mother to child, is a major factor in the increasing rates of HIV infection in sub-Saharan Africa. Vertical transmission of HIV occurs in utero, intrapartum during labor and delivery, and postpartum during breast-feeding. Because of the large numbers of HIV-infected mothers in developing countries, the majority trials regarding prevention of vertical transmission of HIV have been conducted in sub-Saharan Africa. Thus, sub-Saharan Africa has become a human laboratory, which demonstrates both the successes and failures of preventative methods to reduce vertical transmission of HIV. This review summarizes the body of research dedicated to understanding the pathophysiology of vertical transmission of HIV and pharmacology of inhibition of vertical transmission of HIV. While many debate the ethics of conducting trials in developing countries where effective prevention modalities have been slow to be implemented for economic, social and political reasons, studies continue and researchers continue to discover therapies and preventative methods, which may reduce the future devastation of HIV both in sub-Saharan Africa and throughout the world.

Measuring methods of matrix diffusion

International Nuclear Information System (INIS)

Muurinen, A.; Valkiainen, M.

1988-03-01

In Finland the spent nuclear fuel is planned to be disposed of at large depths in crystalline bedrock. The radionuclides which are dissolved in the groundwater may be able to diffuse into the micropores of the porous rock matrix and thus be withdrawn from the flowing water in the fractures. This phenomenon is called matrix diffusion. A review over matrix diffusion is presented in the study. The main interest is directed to the diffusion of non-sorbing species. The review covers diffusion experiments and measurements of porosity, pore size, specific surface area and water permeability

An integrating factor matrix method to find first integrals

International Nuclear Information System (INIS)

Saputra, K V I; Quispel, G R W; Van Veen, L

2010-01-01

In this paper we develop an integrating factor matrix method to derive conditions for the existence of first integrals. We use this novel method to obtain first integrals, along with the conditions for their existence, for two- and three-dimensional Lotka-Volterra systems with constant terms. The results are compared to previous results obtained by other methods.

J-matrix method of scattering in one dimension: The nonrelativistic theory

International Nuclear Information System (INIS)

Alhaidari, A.D.; Bahlouli, H.; Abdelmonem, M.S.

2009-01-01

We formulate a theory of nonrelativistic scattering in one dimension based on the J-matrix method. The scattering potential is assumed to have a finite range such that it is well represented by its matrix elements in a finite subset of a basis that supports a tridiagonal matrix representation for the reference wave operator. Contrary to our expectation, the 1D formulation reveals a rich and highly nontrivial structure compared to the 3D formulation. Examples are given to demonstrate the utility and accuracy of the method. It is hoped that this formulation constitutes a viable alternative to the classical treatment of 1D scattering problem and that it will help unveil new and interesting applications.

A Comparison of Methods for Estimating the Determinant of High-Dimensional Covariance Matrix

KAUST Repository

Hu, Zongliang; Dong, Kai; Dai, Wenlin; Tong, Tiejun

2017-01-01

The determinant of the covariance matrix for high-dimensional data plays an important role in statistical inference and decision. It has many real applications including statistical tests and information theory. Due to the statistical and computational challenges with high dimensionality, little work has been proposed in the literature for estimating the determinant of high-dimensional covariance matrix. In this paper, we estimate the determinant of the covariance matrix using some recent proposals for estimating high-dimensional covariance matrix. Specifically, we consider a total of eight covariance matrix estimation methods for comparison. Through extensive simulation studies, we explore and summarize some interesting comparison results among all compared methods. We also provide practical guidelines based on the sample size, the dimension, and the correlation of the data set for estimating the determinant of high-dimensional covariance matrix. Finally, from a perspective of the loss function, the comparison study in this paper may also serve as a proxy to assess the performance of the covariance matrix estimation.

A Comparison of Methods for Estimating the Determinant of High-Dimensional Covariance Matrix

KAUST Repository

Hu, Zongliang

2017-09-27

The determinant of the covariance matrix for high-dimensional data plays an important role in statistical inference and decision. It has many real applications including statistical tests and information theory. Due to the statistical and computational challenges with high dimensionality, little work has been proposed in the literature for estimating the determinant of high-dimensional covariance matrix. In this paper, we estimate the determinant of the covariance matrix using some recent proposals for estimating high-dimensional covariance matrix. Specifically, we consider a total of eight covariance matrix estimation methods for comparison. Through extensive simulation studies, we explore and summarize some interesting comparison results among all compared methods. We also provide practical guidelines based on the sample size, the dimension, and the correlation of the data set for estimating the determinant of high-dimensional covariance matrix. Finally, from a perspective of the loss function, the comparison study in this paper may also serve as a proxy to assess the performance of the covariance matrix estimation.

A Comparison of Methods for Estimating the Determinant of High-Dimensional Covariance Matrix.

Science.gov (United States)

Hu, Zongliang; Dong, Kai; Dai, Wenlin; Tong, Tiejun

2017-09-21

The determinant of the covariance matrix for high-dimensional data plays an important role in statistical inference and decision. It has many real applications including statistical tests and information theory. Due to the statistical and computational challenges with high dimensionality, little work has been proposed in the literature for estimating the determinant of high-dimensional covariance matrix. In this paper, we estimate the determinant of the covariance matrix using some recent proposals for estimating high-dimensional covariance matrix. Specifically, we consider a total of eight covariance matrix estimation methods for comparison. Through extensive simulation studies, we explore and summarize some interesting comparison results among all compared methods. We also provide practical guidelines based on the sample size, the dimension, and the correlation of the data set for estimating the determinant of high-dimensional covariance matrix. Finally, from a perspective of the loss function, the comparison study in this paper may also serve as a proxy to assess the performance of the covariance matrix estimation.

Nanoscale characterization of the evolution of the twin–matrix orientation in Fe–Mn–C twinning-induced plasticity steel by means of transmission electron microscopy orientation mapping

International Nuclear Information System (INIS)

Albou, A.; Galceran, M.; Renard, K.; Godet, S.; Jacques, P.J.

2013-01-01

The evolution of the orientation relationship between mechanical twins and the surrounding matrix with the degree of plastic deformation has been characterized at the nanoscale in twinning-induced plasticity steel. The recently developed automated crystal orientation mapping in transmission electron microscopy revealed that the ideal twin relationship is retained up to large levels of strain, while large orientation gradients are built up within the matrix. This particular evolution undoubtedly plays a role in the large work hardening rate of these steels.

Improvement of the Convergence of the Invariant Imbedding T-Matrix Method

Science.gov (United States)

Zhai, S.; Panetta, R. L.; Yang, P.

2017-12-01

The invariant imbedding T-matrix method (IITM) is based on an electromagnetic volume integral equation to compute the T-matrix of an arbitrary scattering particle. A free-space Green's function is chosen as the integral kernel and thus each source point is placed in an imaginary vacuum spherical shell extending from the center to that source point. The final T-matrix (of the largest circumscribing sphere) is obtained through an iterative relation that, layer by layer, computes the T-matrix from the particle center to the outermost shell. On each spherical shell surface, an integration of the product of the refractive index 𝜀(𝜃, 𝜑) and vector spherical harmonics must be performed, resulting in the so-called U-matrix, which directly leads to the T-matrix on the spherical surface. Our observations indicate that the matrix size and sparseness are determined by the particular refractive index function 𝜀(𝜃, 𝜑). If 𝜀(𝜃, 𝜑) is an analytic function on the surface, then the matrix elements resulting from the integration decay rapidly, leading to sparse matrix; if 𝜀(𝜃, 𝜑) is not (for example, contains jump discontinuities), then the matrix elements decay slowly, leading to a large dense matrix. The intersection between an irregular scatterer and each spherical shell can leave jump discontinuities in 𝜀(𝜃, 𝜑) distributed over the shell surface. The aforementioned feature is analogous to the Gibbs phenomenon appearing in the orthogonal expansion of non-smooth functions with Hermitian eigenfunctions (complex exponential, Legendre, Bessel,...) where poor convergence speed is a direct consequence of the slow decay rate of the expansion coefficients. Various methods have been developed to deal with this slow convergence in the presence of discontinuities. Among the different approaches the most practical one may be a spectral filter: a filter is applied on the

Novel Direction Of Arrival Estimation Method Based on Coherent Accumulation Matrix Reconstruction

Directory of Open Access Journals (Sweden)

Li Lei

2015-04-01

Full Text Available Based on coherent accumulation matrix reconstruction, a novel Direction Of Arrival (DOA estimation decorrelation method of coherent signals is proposed using a small sample. First, the Signal to Noise Ratio (SNR is improved by performing coherent accumulation operation on an array of observed data. Then, according to the structure characteristics of the accumulated snapshot vector, the equivalent covariance matrix, whose rank is the same as the number of array elements, is constructed. The rank of this matrix is proved to be determined just by the number of incident signals, which realize the decorrelation of coherent signals. Compared with spatial smoothing method, the proposed method performs better by effectively avoiding aperture loss with high-resolution characteristics and low computational complexity. Simulation results demonstrate the efficiency of the proposed method.

Matrix solution to longitudinal impedance of multi-layer circular structures

Energy Technology Data Exchange (ETDEWEB)

Hahn,H.

2008-10-01

A matrix method in which radial wave propagation is treated in analogy to longitudinal transmission lines is presented and applied to finding the longitudinal coupling impedance of axially symmetric multi-layer beam tubes. The method is demonstrated in the case of a Higher Order Mode ferrite absorber with an inserted coated ceramic beam tube. The screening of the ferrite damping properties by the dielectric beam tube is discussed.

Decomposition of spectra in EPR dosimetry using the matrix method

International Nuclear Information System (INIS)

Sholom, S.V.; Chumak, V.V.

2003-01-01

The matrix method of EPR spectra decomposition is developed and adapted for routine application in retrospective EPR dosimetry with teeth. According to this method, the initial EPR spectra are decomposed (using methods of matrix algebra) into several reference components (reference matrices) that are specific for each material. Proposed procedure has been tested on the example of tooth enamel. Reference spectra were a spectrum of an empty sample tube and three standard signals of enamel (two at g=2.0045, both for the native signal and one at g perpendicular =2.0018, g parallel =1.9973 for the dosimetric signal). Values of dosimetric signals obtained using the given method have been compared with data obtained by manual manipulation of spectra, and good coincidence was observed. This allows considering the proposed method as potent for application in routine EPR dosimetry

The time-dependent density matrix renormalisation group method

Science.gov (United States)

Ma, Haibo; Luo, Zhen; Yao, Yao

2018-04-01

Substantial progress of the time-dependent density matrix renormalisation group (t-DMRG) method in the recent 15 years is reviewed in this paper. By integrating the time evolution with the sweep procedures in density matrix renormalisation group (DMRG), t-DMRG provides an efficient tool for real-time simulations of the quantum dynamics for one-dimensional (1D) or quasi-1D strongly correlated systems with a large number of degrees of freedom. In the illustrative applications, the t-DMRG approach is applied to investigate the nonadiabatic processes in realistic chemical systems, including exciton dissociation and triplet fission in polymers and molecular aggregates as well as internal conversion in pyrazine molecule.

Standard test method for translaminar fracture toughness of laminated and pultruded polymer matrix composite materials

CERN Document Server

American Society for Testing and Materials. Philadelphia

2004-01-01

1.1 This test method covers the determination of translaminar fracture toughness, KTL, for laminated and pultruded polymer matrix composite materials of various ply orientations using test results from monotonically loaded notched specimens. 1.2 This test method is applicable to room temperature laboratory air environments. 1.3 Composite materials that can be tested by this test method are not limited by thickness or by type of polymer matrix or fiber, provided that the specimen sizes and the test results meet the requirements of this test method. This test method was developed primarily from test results of various carbon fiber – epoxy matrix laminates and from additional results of glass fiber – epoxy matrix, glass fiber-polyester matrix pultrusions and carbon fiber – bismaleimide matrix laminates (1-4, 6, 7). 1.4 A range of eccentrically loaded, single-edge-notch tension, ESE(T), specimen sizes with proportional planar dimensions is provided, but planar size may be variable and adjusted, with asso...

Ballistic charge carrier transmission through graphene multi-barrier structures in uniform magnetic field

International Nuclear Information System (INIS)

Zubarev, A; Dragoman, D

2014-01-01

We investigate charge carrier transport in graphene multi-barrier structures placed in a uniform magnetic field. The transmission coefficient is found analytically by generalizing the transfer matrix method for the case of graphene regions subjected to a uniform magnetic field. The transmission coefficient through the structure can be modulated by varying the gate voltages, the magnetic field and/or the width of the gated regions. Such a configuration could be used in multiple-valued logic circuits, since it has several output states with discrete and easily selectable transmission/current values. (paper)

A collocation finite element method with prior matrix condensation

International Nuclear Information System (INIS)

Sutcliffe, W.J.

1977-01-01

For thin shells with general loading, sixteen degrees of freedom have been used for a previous finite element solution procedure using a Collocation method instead of the usual variational based procedures. Although the number of elements required was relatively small, nevertheless the final matrix for the simultaneous solution of all unknowns could become large for a complex compound structure. The purpose of the present paper is to demonstrate a method of reducing the final matrix size, so allowing solution for large structures with comparatively small computer storage requirements while retaining the accuracy given by high order displacement functions. Collocation points, a number are equilibrium conditions which must be satisfied independently of the overall compatibility of forces and deflections for a complete structure. (Auth.)

Convergence analysis of modulus-based matrix splitting iterative methods for implicit complementarity problems.

Science.gov (United States)

Wang, An; Cao, Yang; Shi, Quan

2018-01-01

In this paper, we demonstrate a complete version of the convergence theory of the modulus-based matrix splitting iteration methods for solving a class of implicit complementarity problems proposed by Hong and Li (Numer. Linear Algebra Appl. 23:629-641, 2016). New convergence conditions are presented when the system matrix is a positive-definite matrix and an [Formula: see text]-matrix, respectively.

A discrete ordinate response matrix method for massively parallel computers

International Nuclear Information System (INIS)

Hanebutte, U.R.; Lewis, E.E.

1991-01-01

A discrete ordinate response matrix method is formulated for the solution of neutron transport problems on massively parallel computers. The response matrix formulation eliminates iteration on the scattering source. The nodal matrices which result from the diamond-differenced equations are utilized in a factored form which minimizes memory requirements and significantly reduces the required number of algorithm utilizes massive parallelism by assigning each spatial node to a processor. The algorithm is accelerated effectively by a synthetic method in which the low-order diffusion equations are also solved by massively parallel red/black iterations. The method has been implemented on a 16k Connection Machine-2, and S 8 and S 16 solutions have been obtained for fixed-source benchmark problems in X--Y geometry

Convergence Improvement of Response Matrix Method with Large Discontinuity Factors

International Nuclear Information System (INIS)

Yamamoto, Akio

2003-01-01

In the response matrix method, a numerical divergence problem has been reported when extremely small or large discontinuity factors are utilized in the calculations. In this paper, an alternative response matrix formulation to solve the divergence problem is discussed, and properties of iteration matrixes are investigated through eigenvalue analyses. In the conventional response matrix formulation, partial currents between adjacent nodes are assumed to be discontinuous, and outgoing partial currents are converted into incoming partial currents by the discontinuity factor matrix. Namely, the partial currents of the homogeneous system (i.e., homogeneous partial currents) are treated in the conventional response matrix formulation. In this approach, the spectral radius of an iteration matrix for the partial currents may exceed unity when an extremely small or large discontinuity factor is used. Contrary to this, an alternative response matrix formulation using heterogeneous partial currents is discussed in this paper. In the latter approach, partial currents are assumed to be continuous between adjacent nodes, and discontinuity factors are directly considered in the coefficients of a response matrix. From the eigenvalue analysis of the iteration matrix for the one-group, one-dimensional problem, the spectral radius for the heterogeneous partial current formulation does not exceed unity even if an extremely small or large discontinuity factor is used in the calculation; numerical stability of the alternative formulation is superior to the conventional one. The numerical stability of the heterogeneous partial current formulation is also confirmed by the two-dimensional light water reactor core analysis. Since the heterogeneous partial current formulation does not require any approximation, the converged solution exactly reproduces the reference solution when the discontinuity factors are directly derived from the reference calculation

A matrix-inversion method for gamma-source mapping from gamma-count data - 59082

International Nuclear Information System (INIS)

Bull, Richard K.; Adsley, Ian; Burgess, Claire

2012-01-01

Gamma ray counting is often used to survey the distribution of active waste material in various locations. Ideally the output from such surveys would be a map of the activity of the waste. In this paper a simple matrix-inversion method is presented. This allows an array of gamma-count data to be converted to an array of source activities. For each survey area the response matrix is computed using the gamma-shielding code Microshield [1]. This matrix links the activity array to the count array. The activity array is then obtained via matrix inversion. The method was tested on artificially-created arrays of count-data onto which statistical noise had been added. The method was able to reproduce, quite faithfully, the original activity distribution used to generate the dataset. The method has been applied to a number of practical cases, including the distribution of activated objects in a hot cell and to activated Nimonic springs amongst fuel-element debris in vaults at a nuclear plant. (authors)

Neutron Capture and Transmission Measurements and Resonance Parameter Analysis of Niobium

International Nuclear Information System (INIS)

NJ Drindak; JA Burke; G Leinweber; JA Helm; JG Hoole; RC Block; Y Danon; RE Slovacek; BE Moretti; CJ Werner; ME Overberg; SA Kolda; MJ Trbovich; DP Barry

2005-01-01

Epithermal neutron capture and transmission measurements were performed using the time-of-flight method at the RPI linac using metallic Nb samples. The capture measurements were made at the 25-meter flight station with a 16-section sodium iodide multiplicity detector and the transmission measurements at the 25-meter flight station with a Li-6 glass scintillation detector. Resonance parameters were determined for all resonances up to 500eV with a combined analysis of capture and transmission data using the multi-level R-matrix Bayesian code SAMMY. The present results are compared to those presented in ENDF/B-VI, updated through Release 3

A low-rank matrix recovery approach for energy efficient EEG acquisition for a wireless body area network.

Science.gov (United States)

Majumdar, Angshul; Gogna, Anupriya; Ward, Rabab

2014-08-25

We address the problem of acquiring and transmitting EEG signals in Wireless Body Area Networks (WBAN) in an energy efficient fashion. In WBANs, the energy is consumed by three operations: sensing (sampling), processing and transmission. Previous studies only addressed the problem of reducing the transmission energy. For the first time, in this work, we propose a technique to reduce sensing and processing energy as well: this is achieved by randomly under-sampling the EEG signal. We depart from previous Compressed Sensing based approaches and formulate signal recovery (from under-sampled measurements) as a matrix completion problem. A new algorithm to solve the matrix completion problem is derived here. We test our proposed method and find that the reconstruction accuracy of our method is significantly better than state-of-the-art techniques; and we achieve this while saving sensing, processing and transmission energy. Simple power analysis shows that our proposed methodology consumes considerably less power compared to previous CS based techniques.

Discrete-ordinate method with matrix exponential for a pseudo-spherical atmosphere: Vector case

International Nuclear Information System (INIS)

Doicu, A.; Trautmann, T.

2009-01-01

The paper is devoted to the extension of the matrix-exponential formalism for the scalar radiative transfer to the vector case. Using basic results of the theory of matrix-exponential functions we provide a compact and versatile formulation of the vector radiative transfer. As in the scalar case, we operate with the concept of the layer equation incorporating the level values of the Stokes vector. The matrix exponentials which enter in the expression of the layer equation are computed by using the matrix eigenvalue method and the Pade approximation. A discussion of the computational efficiency of the proposed method for both an aerosol-loaded atmosphere as well as a cloudy atmosphere is also provided

Proper comparison among methods using a confusion matrix

CSIR Research Space (South Africa)

Salmon

2015-07-01

Full Text Available -1 IGARSS 2015, Milan, Italy, 26-31 July 2015 Proper comparison among methods using a confusion matrix 1,2 B.P. Salmon, 2,3 W. Kleynhans, 2,3 C.P. Schwegmann and 1J.C. Olivier 1School of Engineering and ICT, University of Tasmania, Australia 2...

A nonlinearity compensation method for a matrix converter drive

DEFF Research Database (Denmark)

Lee, Kyo-Beum; Blaabjerg, Frede

2005-01-01

converter model using the direction of current. The proposed method does not need any additional hardware or complicated software and it is easy to realize by applying the algorithm to the conventional vector control. The proposed compensation method is applied for high-performance induction motor drives...... using a 3-kW matrix converter system without a speed sensor. Experimental results show the proposed method provides good compensating characteristics....

A Predictive-Control-Based Over-Modulation Method for Conventional Matrix Converters

DEFF Research Database (Denmark)

Zhang, Guanguan; Yang, Jian; Sun, Yao

2018-01-01

To increase the voltage transfer ratio of the matrix converter and improve the input/output current performance simultaneously, an over-modulation method based on predictive control is proposed in this paper, where the weighting factor is selected by an automatic adjusting mechanism, which is able...... to further enhance the system performance promptly. This method has advantages like the maximum voltage transfer ratio can reach 0.987 in the experiments; the total harmonic distortion of the input and output current are reduced, and the losses in the matrix converter are decreased. Moreover, the specific...

Method for analysis of averages over transmission energy of resonance neutrons

International Nuclear Information System (INIS)

Komarov, A.V.; Luk'yanov, A.A.

1981-01-01

Experimental data on transmissions on iron specimens in different energy groups have been analyzed on the basis of an earlier developed theoretical model for the description of resonance neutron averages in transmission energy, as the functions of specimen thickness and mean resonance parameters. The parameter values obtained agree with the corresponding data evaluated in the theory of mean neutron cross sections. The method suggested for the transmission description permits to reproduce experimental results for any thicknesses of specimens [ru

The Visual Matrix Method: Imagery and Affect in a Group-Based Research Setting

Directory of Open Access Journals (Sweden)

Lynn Froggett

2015-07-01

Full Text Available The visual matrix is a method for researching shared experience, stimulated by sensory material relevant to a research question. It is led by imagery, visualization and affect, which in the matrix take precedence over discourse. The method enables the symbolization of imaginative and emotional material, which might not otherwise be articulated and allows "unthought" dimensions of experience to emerge into consciousness in a participatory setting. We describe the process of the matrix with reference to the study "Public Art and Civic Engagement" (FROGGETT, MANLEY, ROY, PRIOR & DOHERTY, 2014 in which it was developed and tested. Subsequently, examples of its use in other contexts are provided. Both the matrix and post-matrix discussions are described, as is the interpretive process that follows. Theoretical sources are highlighted: its origins in social dreaming; the atemporal, associative nature of the thinking during and after the matrix which we describe through the Deleuzian idea of the rhizome; and the hermeneutic analysis which draws from object relations theory and the Lorenzerian tradition of scenic understanding. The matrix has been conceptualized as a "scenic rhizome" to account for its distinctive quality and hybrid origins in research practice. The scenic rhizome operates as a "third" between participants and the "objects" of contemplation. We suggest that some of the drawbacks of other group-based methods are avoided in the visual matrix—namely the tendency for inter-personal dynamics to dominate the event. URN: http://nbn-resolving.de/urn:nbn:de:0114-fqs150369

Analytical techniques for instrument design - Matrix methods

International Nuclear Information System (INIS)

Robinson, R.A.

1997-01-01

The authors take the traditional Cooper-Nathans approach, as has been applied for many years for steady-state triple-axis spectrometers, and consider its generalization to other inelastic scattering spectrometers. This involves a number of simple manipulations of exponentials of quadratic forms. In particular, they discuss a toolbox of matrix manipulations that can be performed on the 6-dimensional Cooper-Nathans matrix. They show how these tools can be combined to solve a number of important problems, within the narrow-band limit and the gaussian approximation. They will argue that a generalized program that can handle multiple different spectrometers could (and should) be written in parallel to the Monte-Carlo packages that are becoming available. They also discuss the complementarity between detailed Monte-Carlo calculations and the approach presented here. In particular, Monte-Carlo methods traditionally simulate the real experiment as performed in practice, given a model scattering law, while the Cooper-Nathans method asks the inverse question: given that a neutron turns up in a particular spectrometer configuration (e.g. angle and time of flight), what is the probability distribution of possible scattering events at the sample? The Monte-Carlo approach could be applied in the same spirit to this question

Comparison of Experimental Methods for Estimating Matrix Diffusion Coefficients for Contaminant Transport Modeling

Energy Technology Data Exchange (ETDEWEB)

Telfeyan, Katherine Christina [Los Alamos National Lab. (LANL), Los Alamos, NM (United States); Ware, Stuart Douglas [Los Alamos National Lab. (LANL), Los Alamos, NM (United States); Reimus, Paul William [Los Alamos National Lab. (LANL), Los Alamos, NM (United States); Birdsell, Kay Hanson [Los Alamos National Lab. (LANL), Los Alamos, NM (United States)

2017-11-06

Diffusion cell and diffusion wafer experiments were conducted to compare methods for estimating matrix diffusion coefficients in rock core samples from Pahute Mesa at the Nevada Nuclear Security Site (NNSS). A diffusion wafer method, in which a solute diffuses out of a rock matrix that is pre-saturated with water containing the solute, is presented as a simpler alternative to the traditional through-diffusion (diffusion cell) method. Both methods yielded estimates of matrix diffusion coefficients that were within the range of values previously reported for NNSS volcanic rocks. The difference between the estimates of the two methods ranged from 14 to 30%, and there was no systematic high or low bias of one method relative to the other. From a transport modeling perspective, these differences are relatively minor when one considers that other variables (e.g., fracture apertures, fracture spacings) influence matrix diffusion to a greater degree and tend to have greater uncertainty than diffusion coefficients. For the same relative random errors in concentration measurements, the diffusion cell method yields diffusion coefficient estimates that have less uncertainty than the wafer method. However, the wafer method is easier and less costly to implement and yields estimates more quickly, thus allowing a greater number of samples to be analyzed for the same cost and time. Given the relatively good agreement between the methods, and the lack of any apparent bias between the methods, the diffusion wafer method appears to offer advantages over the diffusion cell method if better statistical representation of a given set of rock samples is desired.

Novel image analysis methods for quantification of in situ 3-D tendon cell and matrix strain.

Science.gov (United States)

Fung, Ashley K; Paredes, J J; Andarawis-Puri, Nelly

2018-01-23

Macroscopic tendon loads modulate the cellular microenvironment leading to biological outcomes such as degeneration or repair. Previous studies have shown that damage accumulation and the phases of tendon healing are marked by significant changes in the extracellular matrix, but it remains unknown how mechanical forces of the extracellular matrix are translated to mechanotransduction pathways that ultimately drive the biological response. Our overarching hypothesis is that the unique relationship between extracellular matrix strain and cell deformation will dictate biological outcomes, prompting the need for quantitative methods to characterize the local strain environment. While 2-D methods have successfully calculated matrix strain and cell deformation, 3-D methods are necessary to capture the increased complexity that can arise due to high levels of anisotropy and out-of-plane motion, particularly in the disorganized, highly cellular, injured state. In this study, we validated the use of digital volume correlation methods to quantify 3-D matrix strain using images of naïve tendon cells, the collagen fiber matrix, and injured tendon cells. Additionally, naïve tendon cell images were used to develop novel methods for 3-D cell deformation and 3-D cell-matrix strain, which is defined as a quantitative measure of the relationship between matrix strain and cell deformation. The results support that these methods can be used to detect strains with high accuracy and can be further extended to an in vivo setting for observing temporal changes in cell and matrix mechanics during degeneration and healing. Copyright © 2017. Published by Elsevier Ltd.

Novel method of optical image registration in wide wavelength range using matrix of piezoelectric crystals

Science.gov (United States)

Pigarev, Aleksey V.; Bazarov, Timur O.; Fedorov, Vladimir V.; Ryabushkin, Oleg A.

2018-02-01

Most modern systems of the optical image registration are based on the matrices of photosensitive semiconductor heterostructures. However, measurement of radiation intensities up to several MW/cm2 -level using such detectors is a great challenge because semiconductor elements have low optical damage threshold. Reflecting or absorbing filters that can be used for attenuation of radiation intensity, as a rule, distort beam profile. Furthermore, semiconductor based devices have relatively narrow measurement wavelength bandwidth. We introduce a novel matrix method of optical image registration. This approach doesn't require any attenuation when measuring high radiation intensities. A sensitive element is the matrix made of thin transparent piezoelectric crystals that absorb just a small part of incident optical power. Each crystal element has its own set of intrinsic (acoustic) vibration modes. These modes can be exited due to the inverse piezoelectric effect when the external electric field is applied to the crystal sample providing that the field frequency corresponds to one of the vibration mode frequencies. Such piezoelectric resonances (PR) can be observed by measuring the radiofrequency response spectrum of the crystal placed between the capacitor plates. PR frequencies strongly depend on the crystal temperature. Temperature calibration of PR frequencies is conducted in the uniform heating conditions. In the case a crystal matrix is exposed to the laser radiation the incident power can be obtained separately for each crystal element by measuring its PR frequency kinetics providing that the optical absorption coefficient is known. The operating wavelength range of such sensor is restricted by the transmission bandwidth of the applied crystals. A plane matrix constituting of LiNbO3 crystals was assembled in order to demonstrate the possibility of application of the proposed approach. The crystal elements were placed between two electrodes forming a capacitor which

Sound transmission through triple-panel structures lined with poroelastic materials

OpenAIRE

Liu, Y

2015-01-01

In this paper, previous theories on the prediction of sound transmission loss for a double-panel structure lined with poroelastic materials are extended to address the problem of a triple-panel structure. Six typical configurations are considered for a triple-panel structure based on the method of coupling the porous layers to the facing panels which determines critically the sound insulation performance of the system. The transfer matrix method is employed to solve the system by applying app...

Another method for a global fit of the Cabibbo-Kobayashi-Maskawa matrix

International Nuclear Information System (INIS)

Dita, Petre

2005-01-01

Recently we proposed a novel method for doing global fits on the entries of the Cabibbo-Kobayashi-Maskawa matrix. The new used ingredients were a clear relationship between the entries of the CKM matrix and the experimental data, as well as the use of the necessary and sufficient condition the data have to satisfy in order to find a unitary matrix compatible with them. This condition writes as -1 ≤ cosδ ≤1 where δ is the phase that accounts for CP violation. Numerical results are provided for the CKM matrix entries, the mixing angles between generations and all the angles of the standard unitarity triangle. (author)

The Dirac operator on a finite domain and the R-matrix method

International Nuclear Information System (INIS)

Grant, I P

2008-01-01

Relativistic effects in electron-atom collisions and photo-excitation and -ionization processes increase in importance as the atomic number of the target atom grows and spin-dependent effects increase. A relativistic treatment in which electron motion is described using the Dirac Hamiltonian is then desirable. A version of the popular nonrelativistic R-matrix package incorporating terms from the Breit-Pauli Hamiltonian has been used for modelling such processes for some years. The fully relativistic Dirac R-matrix method has been less popular, but is becoming increasingly relevant for applications to heavy ion targets, where the need to use relativistic wavefunctions is more obvious. The Dirac R-matrix method has been controversial ever since it was first proposed by Goertzel (1948 Phys. Rev. 73 1463-6), and it is therefore important to confirm that recent elaborate and costly applications of the method, such as, Badnell et al (2004 J. Phys. B: At. Mol. Phys. 37 4589) and Ballance and Griffin (2007 J. Phys. B: At. Mol. Opt. Phys. 40 247-58), rest on secure foundations. The first part of this paper analyses the structure of the two-point boundary-value problem for the Dirac operator on a finite domain, from which we construct a unified derivation of the Schroedinger (nonrelativistic) and Dirac (relativistic) R-matrix methods. Suggestions that the usual relativistic theory is not well founded are shown to be without foundation

A transfer-matrix method for spatially modulated structures

International Nuclear Information System (INIS)

Surda, A.

1991-03-01

A cluster transfer-matrix method convenient for calculation of spatially modulated structures of a wide class of lattice-gas models is developed. The method formulates the problem of calculation of the partition function in terms of non-linear mapping of effective multi-site fields. It is applied to a lattice-gas model qualitatively describing the system of oxygen atoms in the basal planes of high-temperature superconductors. The properties of an incommensurate structure occurring at intermediate temperatures are discussed in detail. (author). 21 refs, 15 figs

Optimization of MIMO Systems Capacity Using Large Random Matrix Methods

Directory of Open Access Journals (Sweden)

Philippe Loubaton

2012-11-01

Full Text Available This paper provides a comprehensive introduction of large random matrix methods for input covariance matrix optimization of mutual information of MIMO systems. It is first recalled informally how large system approximations of mutual information can be derived. Then, the optimization of the approximations is discussed, and important methodological points that are not necessarily covered by the existing literature are addressed, including the strict concavity of the approximation, the structure of the argument of its maximum, the accuracy of the large system approach with regard to the number of antennas, or the justification of iterative water-filling optimization algorithms. While the existing papers have developed methods adapted to a specific model, this contribution tries to provide a unified view of the large system approximation approach.

Research on Condition Assessment Method of Transmission Tower Under the Action of Strong Wind

Science.gov (United States)

Huang, Ren-mou; An, Li-qiang; Zhang, Rong-lun; Wu, Jiong; Liang, Ya-feng

2018-03-01

Transmission towers are often subjected to the external damage of severe weather like strong wind and so on, which may cause the collapse due to the yield and fracture of the tower material. Aiming this issue, an assessment method was proposed in this paper to assess the operation condition of transmission towers under strong wind. With a reasonable assess index system established firstly, then the internal force of the tower material was solved and its stability was determined through the mechanical analysis of the transmission tower finite element model. Meanwhile, the condition risk level of the tower was finally determined by considering the difference among the influences of other factors like corrosion and loose of members, slope on the transmission tower through the analytic hierarchy process. The assessment method was applied to assess the wind-induced collapse of towers in 110kV Bao Yi II line in Wenchang City, Hainan Province, of which the result proves the method can assess the condition of transmission tower under strong wind and of guiding significance for improving the windproof capability of transmission towers.

Solution of the Multigroup-Diffusion equation by the response matrix method

International Nuclear Information System (INIS)

Oliveira, C.R.E.

1980-10-01

A preliminary analysis of the response matrix method is made, considering its application to the solution of the multigroup diffusion equations. The one-dimensional formulation is presented and used to test some flux expansions, seeking the application of the method to the two-dimensional problem. This formulation also solves the equations that arise from the integro-differential synthesis algorithm. The slow convergence of the power method, used to solve the eigenvalue problem, and its acceleration by means of the Chebyshev polynomial method, are also studied. An algorithm for the estimation of the dominance ratio is presented, based on the residues of two successive iteration vectors. This ratio, which is not known a priori, is fundamental for the efficiency of the method. Some numerical problems are solved, testing the 1D formulation of the response matrix method, its application to the synthesis algorithm and also, at the same time, the algorithm to accelerate the source problem. (Author) [pt

A pedagogical derivation of the matrix element method in particle physics data analysis

Science.gov (United States)

Sumowidagdo, Suharyo

2018-03-01

The matrix element method provides a direct connection between the underlying theory of particle physics processes and detector-level physical observables. I am presenting a pedagogically-oriented derivation of the matrix element method, drawing from elementary concepts in probability theory, statistics, and the process of experimental measurements. The level of treatment should be suitable for beginning research student in phenomenology and experimental high energy physics.

A Practical Radiosity Method for Predicting Transmission Loss in Urban Environments

Directory of Open Access Journals (Sweden)

Liang Ming

2004-01-01

Full Text Available The ability to predict transmission loss or field strength distribution is crucial for determining coverage in planning personal communication systems. This paper presents a practical method to accurately predict entire average transmission loss distribution in complicated urban environments. The method uses a 3D propagation model based on radiosity and a simplified city information database including surfaces of roads and building groups. Narrowband validation measurements with line-of-sight (LOS and non-line-of-sight (NLOS cases at 1800 MHz give excellent agreement in urban environments.

Comparison of cluster-based and source-attribution methods for estimating transmission risk using large HIV sequence databases.

Science.gov (United States)

Le Vu, Stéphane; Ratmann, Oliver; Delpech, Valerie; Brown, Alison E; Gill, O Noel; Tostevin, Anna; Fraser, Christophe; Volz, Erik M

2018-06-01

Phylogenetic clustering of HIV sequences from a random sample of patients can reveal epidemiological transmission patterns, but interpretation is hampered by limited theoretical support and statistical properties of clustering analysis remain poorly understood. Alternatively, source attribution methods allow fitting of HIV transmission models and thereby quantify aspects of disease transmission. A simulation study was conducted to assess error rates of clustering methods for detecting transmission risk factors. We modeled HIV epidemics among men having sex with men and generated phylogenies comparable to those that can be obtained from HIV surveillance data in the UK. Clustering and source attribution approaches were applied to evaluate their ability to identify patient attributes as transmission risk factors. We find that commonly used methods show a misleading association between cluster size or odds of clustering and covariates that are correlated with time since infection, regardless of their influence on transmission. Clustering methods usually have higher error rates and lower sensitivity than source attribution method for identifying transmission risk factors. But neither methods provide robust estimates of transmission risk ratios. Source attribution method can alleviate drawbacks from phylogenetic clustering but formal population genetic modeling may be required to estimate quantitative transmission risk factors. Copyright © 2017 The Authors. Published by Elsevier B.V. All rights reserved.

Discrete-ordinate method with matrix exponential for a pseudo-spherical atmosphere: Scalar case

International Nuclear Information System (INIS)

Doicu, A.; Trautmann, T.

2009-01-01

We present a discrete-ordinate algorithm using the matrix-exponential solution for pseudo-spherical radiative transfer. Following the finite-element technique we introduce the concept of layer equation and formulate the discrete radiative transfer problem in terms of the level values of the radiance. The layer quantities are expressed by means of matrix exponentials, which are computed by using the matrix eigenvalue method and the Pade approximation. These solution methods lead to a compact and versatile formulation of the radiative transfer. Simulated nadir and limb radiances for an aerosol-loaded atmosphere and a cloudy atmosphere are presented along with a discussion of the model intercomparisons and timings

Direct closed-form covariance matrix and finite alphabet constant-envelope waveforms for planar array beampatterns

KAUST Repository

Ahmed, Sajid

2016-11-24

Various examples of methods and systems are provided for direct closed-form finite alphabet constant-envelope waveforms for planar array beampatterns. In one example, a method includes defining a waveform covariance matrix based at least in part upon a two-dimensional fast Fourier transform (2D-FFT) analysis of a frequency domain matrix Hf associated with a planar array of antennas. Symbols can be encoded based upon the waveform covariance matrix and the encoded symbols can be transmitted via the planar array of antennas. In another embodiment, a system comprises an N x M planar array of antennas and transmission circuitry configured to transmit symbols via a two-dimensional waveform beampattern defined based at least in part upon a 2D-FFT analysis of a frequency domain matrix Hf associated with the planar array of antennas.

Modelling of packet traffic with matrix analytic methods

DEFF Research Database (Denmark)

Andersen, Allan T.

1995-01-01

BISDN network. The heuristic formula did not seem to yield substantially better results than already available approximations. Finally, some results for the finite capacity BMAP/G/1 queue have been obtained. The steady state probability vector of the embedded chain is found by a direct method where...... process. A heuristic formula for the tail behaviour of a single server queue fed by a superposition of renewal processes has been evaluated. The evaluation was performed by applying Matrix Analytic methods. The heuristic formula has applications in the Call Admission Control (CAC) procedure of the future...

Graphene-Reinforced Aluminum Matrix Composites: A Review of Synthesis Methods and Properties

Science.gov (United States)

Chen, Fei; Gupta, Nikhil; Behera, Rakesh K.; Rohatgi, Pradeep K.

2018-03-01

Graphene-reinforced aluminum (Gr-Al) matrix nanocomposites (NCs) have attracted strong interest from both research and industry in high-performance weight-sensitive applications. Due to the vastly different bonding characteristics of the Al matrix (metallic) and graphene (in-plane covalent + inter-plane van der Waals), the graphene phase has a general tendency to agglomerate and phase separate in the metal matrix, which is detrimental for the mechanical and chemical properties of the composite. Thus, synthesis of Gr-Al NCs is extremely challenging. This review summarizes the different methods available to synthesize Gr-Al NCs and the resulting properties achieved in these NCs. Understanding the effect of processing parameters on the realized properties opens up the possibility of tailoring the synthesis methods to achieve the desired properties for a given application.

Graphene-Reinforced Aluminum Matrix Composites: A Review of Synthesis Methods and Properties

Science.gov (United States)

Chen, Fei; Gupta, Nikhil; Behera, Rakesh K.; Rohatgi, Pradeep K.

2018-06-01

Graphene-reinforced aluminum (Gr-Al) matrix nanocomposites (NCs) have attracted strong interest from both research and industry in high-performance weight-sensitive applications. Due to the vastly different bonding characteristics of the Al matrix (metallic) and graphene (in-plane covalent + inter-plane van der Waals), the graphene phase has a general tendency to agglomerate and phase separate in the metal matrix, which is detrimental for the mechanical and chemical properties of the composite. Thus, synthesis of Gr-Al NCs is extremely challenging. This review summarizes the different methods available to synthesize Gr-Al NCs and the resulting properties achieved in these NCs. Understanding the effect of processing parameters on the realized properties opens up the possibility of tailoring the synthesis methods to achieve the desired properties for a given application.

Energy-dependent applications of the transfer matrix method

International Nuclear Information System (INIS)

Oeztunali, O.I.; Aronson, R.

1975-01-01

The transfer matrix method is applied to energy-dependent neutron transport problems for multiplying and nonmultiplying media in one-dimensional plane geometry. Experimental cross sections are used for total, elastic, and inelastic scattering and fission. Numerical solutions are presented for the problem of a unit point isotropic source in an infinite medium of water and for the problem of the critical 235 U slab with finite water reflectors. No iterations were necessary in this method. Numerical results obtained are consistent with physical considerations and compare favorably with the moments method results for the problem of the unit point isotropic source in an infinite water medium. (U.S.)

Modeling the formation of cell-matrix adhesions on a single 3D matrix fiber.

Science.gov (United States)

Escribano, J; Sánchez, M T; García-Aznar, J M

2015-11-07

Cell-matrix adhesions are crucial in different biological processes like tissue morphogenesis, cell motility, and extracellular matrix remodeling. These interactions that link cell cytoskeleton and matrix fibers are built through protein clutches, generally known as adhesion complexes. The adhesion formation process has been deeply studied in two-dimensional (2D) cases; however, the knowledge is limited for three-dimensional (3D) cases. In this work, we simulate different local extracellular matrix properties in order to unravel the fundamental mechanisms that regulate the formation of cell-matrix adhesions in 3D. We aim to study the mechanical interaction of these biological structures through a three dimensional discrete approach, reproducing the transmission pattern force between the cytoskeleton and a single extracellular matrix fiber. This numerical model provides a discrete analysis of the proteins involved including spatial distribution, interaction between them, and study of the different phenomena, such as protein clutches unbinding or protein unfolding. Copyright © 2015 Elsevier Ltd. All rights reserved.

Comparative Study of Inference Methods for Bayesian Nonnegative Matrix Factorisation

DEFF Research Database (Denmark)

Brouwer, Thomas; Frellsen, Jes; Liò, Pietro

2017-01-01

In this paper, we study the trade-offs of different inference approaches for Bayesian matrix factorisation methods, which are commonly used for predicting missing values, and for finding patterns in the data. In particular, we consider Bayesian nonnegative variants of matrix factorisation and tri......-factorisation, and compare non-probabilistic inference, Gibbs sampling, variational Bayesian inference, and a maximum-a-posteriori approach. The variational approach is new for the Bayesian nonnegative models. We compare their convergence, and robustness to noise and sparsity of the data, on both synthetic and real...

Secured Economic Dispatch Algorithm using GSDF Matrix

Directory of Open Access Journals (Sweden)

Slimane SOUAG

2014-02-01

Full Text Available In this paper we present a new method for solving the secured power flow problem by the economic dispatch using DC power flow method and Generation Shift Distribution Factor (GSDF. A graphical interface in LabVIEW has been created as a virtual instrument. Hence the DC power flow reduces the power flow problem to a set of linear equations, which make the iterative calculation very fast and the GSFD matrix present the effects of single and multiple generator MW change on the transmission line. The effectiveness of the method developed is identified through its application to an IEEE-14 bus test system. The calculation results show excellent performance of the proposed method, in regard to computation time and quality of results.

Time-domain numerical computations of electromagnetic fields in cylindrical co-ordinates using the transmission line matrix: evaluation of radiaion losses from a charge bunch passing through a pill-box resonator

International Nuclear Information System (INIS)

Sarma, J.; Robson, P.N.

1979-01-01

The two dimensional transmission line matrix (TLM) numerical method has been adapted to compute electromagnetic field distributions in cylindrical co-ordinates and it is applied to evaluate the radiation loss from a charge bunch passing through a 'pill-box' resonator. The computer program has been developed to calculate not only the total energy loss to the resonator but also that component of it which exists in the TM 010 mode. The numerically computed results are shown to agree very well with the analytically derived values as found in the literature which, therefore, established the degree of accuracy that is obtained with the TLM method. The particular features of computational simplicity, numerical stability and the inherently time-domain solutions produced by the TLM method are cited as additional, attractive reasons for using this numerical procedure in solving such problems. (Auth.)

Multiple resonance compensation for betatron coupling and its equivalence with matrix method

CERN Document Server

De Ninno, G

1999-01-01

Analyses of betatron coupling can be broadly divided into two categories: the matrix approach that decouples the single-turn matrix to reveal the normal modes and the hamiltonian approach that evaluates the coupling in terms of the action of resonances in perturbation theory. The latter is often regarded as being less exact but good for physical insight. The common opinion is that the correction of the two closest sum and difference resonances to the working point is sufficient to reduce the off-axis terms in the 4X4 single-turn matrix, but this is only partially true. The reason for this is explained, and a method is developed that sums to infinity all coupling resonances and, in this way, obtains results equivalent to the matrix approach. The two approaches is discussed with reference to the dynamic aperture. Finally, the extension of the summation method to resonances of all orders is outlined and the relative importance of a single resonance compared to all resonances of a given order is analytically desc...

A Literature Study of Matrix Element Influenced to the Result of Analysis Using Absorption Atomic Spectroscopy Method (AAS)

International Nuclear Information System (INIS)

Tyas-Djuhariningrum

2004-01-01

The gold sample analysis can be deviated more than >10% to those thrue value caused by the matrix element. So that the matrix element character need to be study in order to reduce the deviation. In rock samples, the matrix elements can cause self quenching, self absorption and ionization process, so there is a result analysis error. In the rock geochemical process, the elements of the same group at the periodic system have the tendency to be together because of their same characteristic. In absorption Atomic Spectroscopy analysis, the elements associate can absorb primer energy with similar wave length so that it can cause deviation in the result interpretation. The aim of study is to predict matrix element influences from rock sample with application standard method for reducing deviation. In quantitative way, assessment of primer light intensity that will be absorbed is proportional to the concentration atom in the sample that relationship between photon intensity with concentration in part per million is linier (ppm). These methods for eliminating matrix elements influence consist of three methods : external standard method, internal standard method, and addition standard method. External standard method for all matrix element, internal standard method for elimination matrix element that have similar characteristics, addition standard methods for elimination matrix elements in Au, Pt samples. The third of standard posess here accuracy are about 95-97%. (author)

A method to compute the inverse of a complex n-block tridiagonal quasi-hermitian matrix

International Nuclear Information System (INIS)

Godfrin, Elena

1990-01-01

This paper presents a method to compute the inverse of a complex n-block tridiagonal quasi-hermitian matrix using adequate partitions of the complete matrix. This type of matrix is very usual in quantum mechanics and, more specifically, in solid state physics (e.g., interfaces and superlattices), when the tight-binding approximation is used. The efficiency of the method is analyzed comparing the required CPU time and work-area for different usual techniques. (Author)

Reactor calculation in coarse mesh by finite element method applied to matrix response method

International Nuclear Information System (INIS)

Nakata, H.

1982-01-01

The finite element method is applied to the solution of the modified formulation of the matrix-response method aiming to do reactor calculations in coarse mesh. Good results are obtained with a short running time. The method is applicable to problems where the heterogeneity is predominant and to problems of evolution in coarse meshes where the burnup is variable in one same coarse mesh, making the cross section vary spatially with the evolution. (E.G.) [pt

NLTE steady-state response matrix method.

Science.gov (United States)

Faussurier, G.; More, R. M.

2000-05-01

A connection between atomic kinetics and non-equilibrium thermodynamics has been recently established by using a collisional-radiative model modified to include line absorption. The calculated net emission can be expressed as a non-local thermodynamic equilibrium (NLTE) symmetric response matrix. In the paper, this connection is extended to both cases of the average-atom model and the Busquet's model (RAdiative-Dependent IOnization Model, RADIOM). The main properties of the response matrix still remain valid. The RADIOM source function found in the literature leads to a diagonal response matrix, stressing the absence of any frequency redistribution among the frequency groups at this order of calculation.

Betweenness-Based Method to Identify Critical Transmission Sectors for Supply Chain Environmental Pressure Mitigation.

Science.gov (United States)

Liang, Sai; Qu, Shen; Xu, Ming

2016-02-02

To develop industry-specific policies for mitigating environmental pressures, previous studies primarily focus on identifying sectors that directly generate large amounts of environmental pressures (a.k.a. production-based method) or indirectly drive large amounts of environmental pressures through supply chains (e.g., consumption-based method). In addition to those sectors as important environmental pressure producers or drivers, there exist sectors that are also important to environmental pressure mitigation as transmission centers. Economy-wide environmental pressure mitigation might be achieved by improving production efficiency of these key transmission sectors, that is, using less upstream inputs to produce unitary output. We develop a betweenness-based method to measure the importance of transmission sectors, borrowing the betweenness concept from network analysis. We quantify the betweenness of sectors by examining supply chain paths extracted from structural path analysis that pass through a particular sector. We take China as an example and find that those critical transmission sectors identified by betweenness-based method are not always identifiable by existing methods. This indicates that betweenness-based method can provide additional insights that cannot be obtained with existing methods on the roles individual sectors play in generating economy-wide environmental pressures. Betweenness-based method proposed here can therefore complement existing methods for guiding sector-level environmental pressure mitigation strategies.

Support vector machine based fault classification and location of a long transmission line

Directory of Open Access Journals (Sweden)

Papia Ray

2016-09-01

Full Text Available This paper investigates support vector machine based fault type and distance estimation scheme in a long transmission line. The planned technique uses post fault single cycle current waveform and pre-processing of the samples is done by wavelet packet transform. Energy and entropy are obtained from the decomposed coefficients and feature matrix is prepared. Then the redundant features from the matrix are taken out by the forward feature selection method and normalized. Test and train data are developed by taking into consideration variables of a simulation situation like fault type, resistance path, inception angle, and distance. In this paper 10 different types of short circuit fault are analyzed. The test data are examined by support vector machine whose parameters are optimized by particle swarm optimization method. The anticipated method is checked on a 400 kV, 300 km long transmission line with voltage source at both the ends. Two cases were examined with the proposed method. The first one is fault very near to both the source end (front and rear and the second one is support vector machine with and without optimized parameter. Simulation result indicates that the anticipated method for fault classification gives high accuracy (99.21% and least fault distance estimation error (0.29%.

Polynomial two-parameter eigenvalue problems and matrix pencil methods for stability of delay-differential equations

NARCIS (Netherlands)

Jarlebring, E.; Hochstenbach, M.E.

2009-01-01

Several recent methods used to analyze asymptotic stability of delay-differential equations (DDEs) involve determining the eigenvalues of a matrix, a matrix pencil or a matrix polynomial constructed by Kronecker products. Despite some similarities between the different types of these so-called

A multi-stage stochastic transmission expansion planning method

International Nuclear Information System (INIS)

Akbari, Tohid; Rahimikian, Ashkan; Kazemi, Ahad

2011-01-01

Highlights: → We model a multi-stage stochastic transmission expansion planning problem. → We include available transfer capability (ATC) in our model. → Involving this criterion will increase the ATC between source and sink points. → Power system reliability will be increased and more money can be saved. - Abstract: This paper presents a multi-stage stochastic model for short-term transmission expansion planning considering the available transfer capability (ATC). The ATC can have a huge impact on the power market outcomes and the power system reliability. The transmission expansion planning (TEP) studies deal with many uncertainties, such as system load uncertainties that are considered in this paper. The Monte Carlo simulation method has been applied for generating different scenarios. A scenario reduction technique is used for reducing the number of scenarios. The objective is to minimize the sum of investment costs (IC) and the expected operation costs (OC). The solution technique is based on the benders decomposition algorithm. The N-1 contingency analysis is also done for the TEP problem. The proposed model is applied to the IEEE 24 bus reliability test system and the results are efficient and promising.

Agar/gelatin bilayer gel matrix fabricated by simple thermo-responsive sol-gel transition method.

Science.gov (United States)

Wang, Yifeng; Dong, Meng; Guo, Mengmeng; Wang, Xia; Zhou, Jing; Lei, Jian; Guo, Chuanhang; Qin, Chaoran

2017-08-01

We present a simple and environmentally-friendly method to generate an agar/gelatin bilayer gel matrix for further biomedical applications. In this method, the thermally responsive sol-gel transitions of agar and gelatin combined with the different transition temperatures are exquisitely employed to fabricate the agar/gelatin bilayer gel matrix and achieve separate loading for various materials (e.g., drugs, fluorescent materials, and nanoparticles). Importantly, the resulting bilayer gel matrix provides two different biopolymer environments (a polysaccharide environment vs a protein environment) with a well-defined border, which allows the loaded materials in different layers to retain their original properties (e.g., magnetism and fluorescence) and reduce mutual interference. In addition, the loaded materials in the bilayer gel matrix exhibit an interesting release behavior under the control of thermal stimuli. Consequently, the resulting agar/gelatin bilayer gel matrix is a promising candidate for biomedical applications in drug delivery, controlled release, fluorescence labeling, and bio-imaging. Copyright © 2017 Elsevier B.V. All rights reserved.

A Normalized Transfer Matrix Method for the Free Vibration of Stepped Beams: Comparison with Experimental and FE(3D Methods

Directory of Open Access Journals (Sweden)

Tamer Ahmed El-Sayed

2017-01-01

Full Text Available The exact solution for multistepped Timoshenko beam is derived using a set of fundamental solutions. This set of solutions is derived to normalize the solution at the origin of the coordinates. The start, end, and intermediate boundary conditions involve concentrated masses and linear and rotational elastic supports. The beam start, end, and intermediate equations are assembled using the present normalized transfer matrix (NTM. The advantage of this method is that it is quicker than the standard method because the size of the complete system coefficient matrix is 4 × 4. In addition, during the assembly of this matrix, there are no inverse matrix steps required. The validity of this method is tested by comparing the results of the current method with the literature. Then the validity of the exact stepped analysis is checked using experimental and FE(3D methods. The experimental results for stepped beams with single step and two steps, for sixteen different test samples, are in excellent agreement with those of the three-dimensional finite element FE(3D. The comparison between the NTM method and the finite element method results shows that the modal percentage deviation is increased when a beam step location coincides with a peak point in the mode shape. Meanwhile, the deviation decreases when a beam step location coincides with a straight portion in the mode shape.

Workshop report on large-scale matrix diagonalization methods in chemistry theory institute

Energy Technology Data Exchange (ETDEWEB)

Bischof, C.H.; Shepard, R.L.; Huss-Lederman, S. [eds.

1996-10-01

The Large-Scale Matrix Diagonalization Methods in Chemistry theory institute brought together 41 computational chemists and numerical analysts. The goal was to understand the needs of the computational chemistry community in problems that utilize matrix diagonalization techniques. This was accomplished by reviewing the current state of the art and looking toward future directions in matrix diagonalization techniques. This institute occurred about 20 years after a related meeting of similar size. During those 20 years the Davidson method continued to dominate the problem of finding a few extremal eigenvalues for many computational chemistry problems. Work on non-diagonally dominant and non-Hermitian problems as well as parallel computing has also brought new methods to bear. The changes and similarities in problems and methods over the past two decades offered an interesting viewpoint for the success in this area. One important area covered by the talks was overviews of the source and nature of the chemistry problems. The numerical analysts were uniformly grateful for the efforts to convey a better understanding of the problems and issues faced in computational chemistry. An important outcome was an understanding of the wide range of eigenproblems encountered in computational chemistry. The workshop covered problems involving self- consistent-field (SCF), configuration interaction (CI), intramolecular vibrational relaxation (IVR), and scattering problems. In atomic structure calculations using the Hartree-Fock method (SCF), the symmetric matrices can range from order hundreds to thousands. These matrices often include large clusters of eigenvalues which can be as much as 25% of the spectrum. However, if Cl methods are also used, the matrix size can be between 10{sup 4} and 10{sup 9} where only one or a few extremal eigenvalues and eigenvectors are needed. Working with very large matrices has lead to the development of

Simplified method to solve sound transmission through structures lined with elastic porous material.

Science.gov (United States)

Lee, J H; Kim, J

2001-11-01

An approximate analysis method is developed to calculate sound transmission through structures lined with porous material. Because the porous material has both the solid phase and fluid phase, three wave components exist in the material, which makes the related analysis very complicated. The main idea in developing the approximate method is very simple: modeling the porous material using only the strongest of the three waves, which in effect idealizes the material as an equivalent fluid. The analysis procedure has to be conducted in two steps. In the first step, sound transmission through a flat double panel with a porous liner of infinite extents, which has the same cross sectional construction as the actual structure, is solved based on the full theory and the strongest wave component is identified. In the second step sound transmission through the actual structure is solved modeling the porous material as an equivalent fluid while using the actual geometry of the structure. The development and validation of the method are discussed in detail. As an application example, the transmission loss through double walled cylindrical shells with a porous core is calculated utilizing the simplified method.

Wave attenuation over the Great Barrier Reef matrix

NARCIS (Netherlands)

Gallop, S.; Young, I.; Ranasinghe, Ranasinghe W M R J B; Durrant, T.; Haigh, I.; Mynett, Arthur

2015-01-01

This is the first large-scale study of the influence of an offshore reef matrix on wave transmission. The focus was on the Great Barrier Reef (GBR), Australia, utilizing a 16 yr-record of wave height, from seven satellite altimeters. Within the GBR matrix, wave height is not strongly dependent on

Linking healthcare associated norovirus outbreaks: a molecular epidemiologic method for investigating transmission

Directory of Open Access Journals (Sweden)

Andrews Nick

2006-07-01

Full Text Available Abstract Background Noroviruses are highly infectious pathogens that cause gastroenteritis in the community and in semi-closed institutions such as hospitals. During outbreaks, multiple units within a hospital are often affected, and a major question for control programs is: are the affected units part of the same outbreak or are they unrelated transmission events? In practice, investigators often assume a transmission link based on epidemiological observations, rather than a systematic approach to tracing transmission. Here, we present a combined molecular and statistical method for assessing: 1 whether observed clusters provide evidence of local transmission and 2 the probability that anecdotally|linked outbreaks truly shared a transmission event. Methods 76 healthcare associated outbreaks were observed in an active and prospective surveillance scheme of 15 hospitals in the county of Avon, England from April 2002 to March 2003. Viral RNA from 64 out of 76 specimens from distinct outbreaks was amplified by reverse transcription-PCR and was sequenced in the polymerase (ORF 1 and capsid (ORF 2 regions. The genetic diversity, at the nucleotide level, was analysed in relation to the epidemiological patterns. Results Two out of four genetic and epidemiological clusters of outbreaks were unlikely to have occurred by chance alone, thus suggesting local transmission. There was anecdotal epidemiological evidence of a transmission link among 5 outbreaks pairs. By combining this epidemiological observation with viral sequence data, the evidence of a link remained convincing in 3 of these pairs. These results are sensitive to prior beliefs of the strength of epidemiological evidence especially when the outbreak strains are common in the background population. Conclusion The evidence suggests that transmission between hospitals units does occur. Using the proposed criteria, certain hypothesized transmission links between outbreaks were supported while

An interlaboratory comparison of methods for measuring rock matrix porosity

International Nuclear Information System (INIS)

Rasilainen, K.; Hellmuth, K.H.; Kivekaes, L.; Ruskeeniemi, T.; Melamed, A.; Siitari-Kauppi, M.

1996-09-01

An interlaboratory comparison study was conducted for the available Finnish methods of rock matrix porosity measurements. The aim was first to compare different experimental methods for future applications, and second to obtain quality assured data for the needs of matrix diffusion modelling. Three different versions of water immersion techniques, a tracer elution method, a helium gas through-diffusion method, and a C-14-PMMA method were tested. All methods selected for this study were established experimental tools in the respective laboratories, and they had already been individually tested. Rock samples for the study were obtained from a homogeneous granitic drill core section from the natural analogue site at Palmottu. The drill core section was cut into slabs that were expected to be practically identical. The subsamples were then circulated between the different laboratories using a round robin approach. The circulation was possible because all methods were non-destructive, except the C-14-PMMA method, which was always the last method to be applied. The possible effect of drying temperature on the measured porosity was also preliminarily tested. These measurements were done in the order of increasing drying temperature. Based on the study, it can be concluded that all methods are comparable in their accuracy. The selection of methods for future applications can therefore be based on practical considerations. Drying temperature seemed to have very little effect on the measured porosity, but a more detailed study is needed for definite conclusions. (author) (4 refs.)

Mass spectrometer and method with improved ion transmission

International Nuclear Information System (INIS)

Douglas, D.J.; French, J.B.

1992-01-01

This invention relates to a mass analyzer, and to a method of operating a mass analyzer, of the kind in which ions are transmitted through a first rod set for focussing and separation from an accompanying gas, before passing through a mass filter rod set which which permits transmission only of ions of a selected mass to charge ratio. (author). 19 figs

Efficient Tridiagonal Preconditioner for the Matrix-Free Truncated Newton Method

Czech Academy of Sciences Publication Activity Database

Lukšan, Ladislav; Vlček, Jan

2014-01-01

Roč. 235, 25 May (2014), s. 394-407 ISSN 0096-3003 R&D Projects: GA ČR GA13-06684S Institutional support: RVO:67985807 Keywords : unconstrained optimization * large scale optimization * matrix-free truncated Newton method * preconditioned conjugate gradient method * preconditioners obtained by the directional differentiation * numerical algorithms Subject RIV: BA - General Mathematics Impact factor: 1.551, year: 2014

Method of computer algebraic calculation of the matrix elements in the second quantization language

International Nuclear Information System (INIS)

Gotoh, Masashi; Mori, Kazuhide; Itoh, Reikichi

1995-01-01

An automated method by the algebraic programming language REDUCE3 for specifying the matrix elements expressed in second quantization language is presented and then applied to the case of the matrix elements in the TDHF theory. This program works in a very straightforward way by commuting the electron creation and annihilation operator (a † and a) until these operators have completely vanished from the expression of the matrix element under the appropriate elimination conditions. An improved method using singlet generators of unitary transformations in the place of the electron creation and annihilation operators is also presented. This improvement reduces the time and memory required for the calculation. These methods will make programming in the field of quantum chemistry much easier. 11 refs., 1 tab

A massively parallel discrete ordinates response matrix method for neutron transport

International Nuclear Information System (INIS)

Hanebutte, U.R.; Lewis, E.E.

1992-01-01

In this paper a discrete ordinates response matrix method is formulated with anisotropic scattering for the solution of neutron transport problems on massively parallel computers. The response matrix formulation eliminates iteration on the scattering source. The nodal matrices that result from the diamond-differenced equations are utilized in a factored form that minimizes memory requirements and significantly reduces the number of arithmetic operations required per node. The red-black solution algorithm utilizes massive parallelism by assigning each spatial node to one or more processors. The algorithm is accelerated by a synthetic method in which the low-order diffusion equations are also solved by massively parallel red-black iterations. The method is implemented on a 16K Connection Machine-2, and S 8 and S 16 solutions are obtained for fixed-source benchmark problems in x-y geometry

On the use of transition matrix methods with extended ensembles.

Science.gov (United States)

Escobedo, Fernando A; Abreu, Charlles R A

2006-03-14

Different extended ensemble schemes for non-Boltzmann sampling (NBS) of a selected reaction coordinate lambda were formulated so that they employ (i) "variable" sampling window schemes (that include the "successive umbrella sampling" method) to comprehensibly explore the lambda domain and (ii) transition matrix methods to iteratively obtain the underlying free-energy eta landscape (or "importance" weights) associated with lambda. The connection between "acceptance ratio" and transition matrix methods was first established to form the basis of the approach for estimating eta(lambda). The validity and performance of the different NBS schemes were then assessed using as lambda coordinate the configurational energy of the Lennard-Jones fluid. For the cases studied, it was found that the convergence rate in the estimation of eta is little affected by the use of data from high-order transitions, while it is noticeably improved by the use of a broader window of sampling in the variable window methods. Finally, it is shown how an "elastic" window of sampling can be used to effectively enact (nonuniform) preferential sampling over the lambda domain, and how to stitch the weights from separate one-dimensional NBS runs to produce a eta surface over a two-dimensional domain.

IMPACT OF MATRIX INVERSION ON THE COMPLEXITY OF THE FINITE ELEMENT METHOD

Directory of Open Access Journals (Sweden)

M. Sybis

2016-04-01

Full Text Available Purpose. The development of a wide construction market and a desire to design innovative architectural building constructions has resulted in the need to create complex numerical models of objects having increasingly higher computational complexity. The purpose of this work is to show that choosing a proper method for solving the set of equations can improve the calculation time (reduce the complexity by a few levels of magnitude. Methodology. The article presents an analysis of the impact of matrix inversion algorithm on the deflection calculation in the beam, using the finite element method (FEM. Based on the literature analysis, common methods of calculating set of equations were determined. From the found solutions the Gaussian elimination, LU and Cholesky decomposition methods have been implemented to determine the effect of the matrix inversion algorithm used for solving the equations set on the number of computational operations performed. In addition, each of the implemented method has been further optimized thereby reducing the number of necessary arithmetic operations. Findings. These optimizations have been performed on the use of certain properties of the matrix, such as symmetry or significant number of zero elements in the matrix. The results of the analysis are presented for the division of the beam to 5, 50, 100 and 200 nodes, for which the deflection has been calculated. Originality. The main achievement of this work is that it shows the impact of the used methodology on the complexity of solving the problem (or equivalently, time needed to obtain results. Practical value. The difference between the best (the less complex and the worst (the most complex is in the row of few orders of magnitude. This result shows that choosing wrong methodology may enlarge time needed to perform calculation significantly.

Simulation methods of nuclear electromagnetic pulse effects in integrated circuits

International Nuclear Information System (INIS)

Cheng Jili; Liu Yuan; En Yunfei; Fang Wenxiao; Wei Aixiang; Yang Yuanzhen

2013-01-01

In the paper the ways to compute the response of transmission line (TL) illuminated by electromagnetic pulse (EMP) were introduced firstly, which include finite-difference time-domain (FDTD) and trans-mission line matrix (TLM); then the feasibility of electromagnetic topology (EMT) in ICs nuclear electromagnetic pulse (NEMP) effect simulation was discussed; in the end, combined with the methods computing the response of TL, a new method of simulate the transmission line in IC illuminated by NEMP was put forward. (authors)

A comparison of companion matrix methods to find roots of a trigonometric polynomial

Science.gov (United States)

Boyd, John P.

2013-08-01

A trigonometric polynomial is a truncated Fourier series of the form fN(t)≡∑j=0Naj cos(jt)+∑j=1N bj sin(jt). It has been previously shown by the author that zeros of such a polynomial can be computed as the eigenvalues of a companion matrix with elements which are complex valued combinations of the Fourier coefficients, the "CCM" method. However, previous work provided no examples, so one goal of this new work is to experimentally test the CCM method. A second goal is introduce a new alternative, the elimination/Chebyshev algorithm, and experimentally compare it with the CCM scheme. The elimination/Chebyshev matrix (ECM) algorithm yields a companion matrix with real-valued elements, albeit at the price of usefulness only for real roots. The new elimination scheme first converts the trigonometric rootfinding problem to a pair of polynomial equations in the variables (c,s) where c≡cos(t) and s≡sin(t). The elimination method next reduces the system to a single univariate polynomial P(c). We show that this same polynomial is the resultant of the system and is also a generator of the Groebner basis with lexicographic ordering for the system. Both methods give very high numerical accuracy for real-valued roots, typically at least 11 decimal places in Matlab/IEEE 754 16 digit floating point arithmetic. The CCM algorithm is typically one or two decimal places more accurate, though these differences disappear if the roots are "Newton-polished" by a single Newton's iteration. The complex-valued matrix is accurate for complex-valued roots, too, though accuracy decreases with the magnitude of the imaginary part of the root. The cost of both methods scales as O(N3) floating point operations. In spite of intimate connections of the elimination/Chebyshev scheme to two well-established technologies for solving systems of equations, resultants and Groebner bases, and the advantages of using only real-valued arithmetic to obtain a companion matrix with real-valued elements

A Control Method of Current Type Matrix Converter for Plasma Control Coil Power Supply

International Nuclear Information System (INIS)

Shimada, K.; Matsukawa, M.; Kurihara, K.; Jun-ichi Itoh

2006-01-01

In exploration to a tokamak fusion reactor, the control of plasma instabilities of high β plasma such as neoclassical tearing mode (NTM), resistive wall mode (RWM) etc., is the key issue for steady-state sustainment. One of the proposed methods to avoid suppressing RWM is that AC current having a phase to work for reduction the RWM growth is generated in a coil (sector coil) equipped spirally on the plasma vacuum vessel. To stabilize RWM, precise and fast real-time feedback control of magnetic field with proper amplitude and frequency is necessary. This implies that an appropriate power supply dedicated for such an application is expected to be developed. A matrix converter as one of power supply candidates for this purpose could provide a solution The matrix converter, categorized in an AC/AC direct converter composed of nine bi-directional current switches, has a great feature that a large energy storage element is unnecessary in comparison with a standard existing AC/AC indirect converter, which is composed of an AC/DC converter and a DC/AC inverter. It is also advantageous in cost and size of its applications. Fortunately, a voltage type matrix converter has come to be available at the market recently, while a current type matrix converter, which is advantageous for fast control of the large-inductance coil current, has been unavailable. On the background above mentioned, we proposed a new current type matrix converter and its control method applicable to a power supply with fast response for suppressing plasma instabilities. Since this converter is required with high accuracy control, the gate control method is adopted to three-phase switching method using middle phase to reduce voltage and current waveforms distortion. The control system is composed of VME-bus board with DSP (Digital Signal Processor) and FPGA (Field Programmable Gate Array) for high speed calculation and control. This paper describes the control method of a current type matrix converter

The method of fundamental solutions for computing acoustic interior transmission eigenvalues

Science.gov (United States)

Kleefeld, Andreas; Pieronek, Lukas

2018-03-01

We analyze the method of fundamental solutions (MFS) in two different versions with focus on the computation of approximate acoustic interior transmission eigenvalues in 2D for homogeneous media. Our approach is mesh- and integration free, but suffers in general from the ill-conditioning effects of the discretized eigenoperator, which we could then successfully balance using an approved stabilization scheme. Our numerical examples cover many of the common scattering objects and prove to be very competitive in accuracy with the standard methods for PDE-related eigenvalue problems. We finally give an approximation analysis for our framework and provide error estimates, which bound interior transmission eigenvalue deviations in terms of some generalized MFS output.

Matrix Methods for Solving Hartree-Fock Equations in Atomic Structure Calculations and Line Broadening

Directory of Open Access Journals (Sweden)

Thomas Gomez

2018-04-01

Full Text Available Atomic structure of N-electron atoms is often determined by solving the Hartree-Fock equations, which are a set of integro-differential equations. The integral part of the Hartree-Fock equations treats electron exchange, but the Hartree-Fock equations are not often treated as an integro-differential equation. The exchange term is often approximated as an inhomogeneous or an effective potential so that the Hartree-Fock equations become a set of ordinary differential equations (which can be solved using the usual shooting methods. Because the Hartree-Fock equations are an iterative-refinement method, the inhomogeneous term relies on the previous guess of the wavefunction. In addition, there are numerical complications associated with solving inhomogeneous differential equations. This work uses matrix methods to solve the Hartree-Fock equations as an integro-differential equation. It is well known that a derivative operator can be expressed as a matrix made of finite-difference coefficients; energy eigenvalues and eigenvectors can be obtained by using linear-algebra packages. The integral (exchange part of the Hartree-Fock equation can be approximated as a sum and written as a matrix. The Hartree-Fock equations can be solved as a matrix that is the sum of the differential and integral matrices. We compare calculations using this method against experiment and standard atomic structure calculations. This matrix method can also be used to solve for free-electron wavefunctions, thus improving how the atoms and free electrons interact. This technique is important for spectral line broadening in two ways: it improves the atomic structure calculations, and it improves the motion of the plasma electrons that collide with the atom.

Strategy BMT Al-Ittihad Using Matrix IE, Matrix SWOT 8K, Matrix SPACE and Matrix TWOS

Directory of Open Access Journals (Sweden)

Nofrizal Nofrizal

2018-03-01

Full Text Available This research aims to formulate and select BMT Al-Ittihad Rumbai strategy to face the changing of business environment both from internal environment such as organization resources, finance, member and external business such as competitor, economy, politics and others. This research method used Analysis of EFAS, IFAS, IE Matrix, SWOT-8K Matrix, SPACE Matrix and TWOS Matrix. our hope from this research it can assist BMT Al-Ittihad in formulating and selecting strategies for the sustainability of BMT Al-Ittihad in the future. The sample in this research is using purposive sampling technique that is the manager and leader of BMT Al-IttihadRumbaiPekanbaru. The result of this research shows that the position of BMT Al-Ittihad using IE Matrix, SWOT-8K Matrix and SPACE Matrix is in growth position, stabilization and aggressive. The choice of strategy after using TWOS Matrix is market penetration, market development, vertical integration, horizontal integration, and stabilization (careful.

The current matrix elements from HAL QCD method

Science.gov (United States)

Watanabe, Kai; Ishii, Noriyoshi

2018-03-01

HAL QCD method is a method to construct a potential (HAL QCD potential) that reproduces the NN scattering phase shift faithful to the QCD. The HAL QCD potential is obtained from QCD by eliminating the degrees of freedom of quarks and gluons and leaving only two particular hadrons. Therefor, in the effective quantum mechanics of two nucleons defined by HAL QCD potential, the conserved current consists not only of the nucleon current but also an extra current originating from the potential (two-body current). Though the form of the two-body current is closely related to the potential, it is not straight forward to extract the former from the latter. In this work, we derive the the current matrix element formula in the quantum mechanics defined by the HAL QCD potential. As a first step, we focus on the non-relativistic case. To give an explicit example, we consider a second quantized non-relativistic two-channel coupling model which we refer to as the original model. From the original model, the HAL QCD potential for the open channel is constructed by eliminating the closed channel in the elastic two-particle scattering region. The current matrix element formula is derived by demanding the effective quantum mechanics defined by the HAL QCD potential to respond to the external field in the same way as the original two-channel coupling model.

A Globally Convergent Matrix-Free Method for Constrained Equations and Its Linear Convergence Rate

Directory of Open Access Journals (Sweden)

Min Sun

2014-01-01

Full Text Available A matrix-free method for constrained equations is proposed, which is a combination of the well-known PRP (Polak-Ribière-Polyak conjugate gradient method and the famous hyperplane projection method. The new method is not only derivative-free, but also completely matrix-free, and consequently, it can be applied to solve large-scale constrained equations. We obtain global convergence of the new method without any differentiability requirement on the constrained equations. Compared with the existing gradient methods for solving such problem, the new method possesses linear convergence rate under standard conditions, and a relax factor γ is attached in the update step to accelerate convergence. Preliminary numerical results show that it is promising in practice.

A 2D/1D coupling neutron transport method based on the matrix MOC and NEM methods

International Nuclear Information System (INIS)

Zhang, H.; Zheng, Y.; Wu, H.; Cao, L.

2013-01-01

A new 2D/1D coupling method based on the matrix MOC method (MMOC) and nodal expansion method (NEM) is proposed for solving the three-dimensional heterogeneous neutron transport problem. The MMOC method, used for radial two-dimensional calculation, constructs a response matrix between source and flux with only one sweep and then solves the linear system by using the restarted GMRES algorithm instead of the traditional trajectory sweeping process during within-group iteration for angular flux update. Long characteristics are generated by using the customization of commercial software AutoCAD. A one-dimensional diffusion calculation is carried out in the axial direction by employing the NEM method. The 2D and ID solutions are coupled through the transverse leakage items. The 3D CMFD method is used to ensure the global neutron balance and adjust the different convergence properties of the radial and axial solvers. A computational code is developed based on these theories. Two benchmarks are calculated to verify the coupling method and the code. It is observed that the corresponding numerical results agree well with references, which indicates that the new method is capable of solving the 3D heterogeneous neutron transport problem directly. (authors)

A 2D/1D coupling neutron transport method based on the matrix MOC and NEM methods

Energy Technology Data Exchange (ETDEWEB)

Zhang, H.; Zheng, Y.; Wu, H.; Cao, L. [School of Nuclear Science and Technology, Xi' an Jiaotong University, No. 28, Xianning West Road, Xi' an, Shaanxi 710049 (China)

2013-07-01

A new 2D/1D coupling method based on the matrix MOC method (MMOC) and nodal expansion method (NEM) is proposed for solving the three-dimensional heterogeneous neutron transport problem. The MMOC method, used for radial two-dimensional calculation, constructs a response matrix between source and flux with only one sweep and then solves the linear system by using the restarted GMRES algorithm instead of the traditional trajectory sweeping process during within-group iteration for angular flux update. Long characteristics are generated by using the customization of commercial software AutoCAD. A one-dimensional diffusion calculation is carried out in the axial direction by employing the NEM method. The 2D and ID solutions are coupled through the transverse leakage items. The 3D CMFD method is used to ensure the global neutron balance and adjust the different convergence properties of the radial and axial solvers. A computational code is developed based on these theories. Two benchmarks are calculated to verify the coupling method and the code. It is observed that the corresponding numerical results agree well with references, which indicates that the new method is capable of solving the 3D heterogeneous neutron transport problem directly. (authors)

Quantitative evaluation of the matrix effect in bioanalytical methods based on LC-MS: A comparison of two approaches.

Science.gov (United States)

Rudzki, Piotr J; Gniazdowska, Elżbieta; Buś-Kwaśnik, Katarzyna

2018-06-05

Liquid chromatography coupled to mass spectrometry (LC-MS) is a powerful tool for studying pharmacokinetics and toxicokinetics. Reliable bioanalysis requires the characterization of the matrix effect, i.e. influence of the endogenous or exogenous compounds on the analyte signal intensity. We have compared two methods for the quantitation of matrix effect. The CVs(%) of internal standard normalized matrix factors recommended by the European Medicines Agency were evaluated against internal standard normalized relative matrix effects derived from Matuszewski et al. (2003). Both methods use post-extraction spiked samples, but matrix factors require also neat solutions. We have tested both approaches using analytes of diverse chemical structures. The study did not reveal relevant differences in the results obtained with both calculation methods. After normalization with the internal standard, the CV(%) of the matrix factor was on average 0.5% higher than the corresponding relative matrix effect. The method adopted by the European Medicines Agency seems to be slightly more conservative in the analyzed datasets. Nine analytes of different structures enabled a general overview of the problem, still, further studies are encouraged to confirm our observations. Copyright © 2018 Elsevier B.V. All rights reserved.

Evaluation of the streaming-matrix method for discrete-ordinates duct-streaming calculations

International Nuclear Information System (INIS)

Clark, B.A.; Urban, W.T.; Dudziak, D.J.

1983-01-01

A new deterministic streaming technique called the Streaming Matrix Hybrid Method (SMHM) is applied to two realistic duct-shielding problems. The results are compared to standard discrete-ordinates and Monte Carlo calculations. The SMHM shows promise as an alternative deterministic streaming method to standard discrete-ordinates

Quantum propagation and confinement in 1D systems using the transfer-matrix method

International Nuclear Information System (INIS)

Pujol, Olivier; Carles, Robert; Pérez, José-Philippe

2014-01-01

The aim of this article is to provide some Matlab scripts to the teaching community in quantum physics. The scripts are based on the transfer-matrix formalism and offer a very efficient and versatile tool to solve problems of a physical object (electron, proton, neutron, etc) with one-dimensional (1D) stationary potential energy. Resonant tunnelling through a multiple-barrier or confinement in wells of various shapes is particularly analysed. The results are quantitatively discussed with semiconductor heterostructures, harmonic and anharmonic molecular vibrations, or neutrons in a gravity field. Scripts and other examples (hydrogen-like ions and transmission by a smooth variation of potential energy) are available freely at http://www-loa.univ-lille1.fr/~pujol in three languages: English, French and Spanish. (paper)

Characterization of matrix damage in ion-irradiated reactor vessel steel

International Nuclear Information System (INIS)

Fujii, Katsuhiko; Fukuya, Koji

2004-01-01

Exact nature of the matrix damage, that is one of radiation-induced nano-scale microstructural features causing radiation embrittlement of reactor vessel, in irradiated commercial steels has not been clarified yet by direct characterization using transmission electron microscopy (TEM). We designed a new preparation method of TEM observation samples and applied it to the direct TEM observation of the matrix damage in the commercial steel samples irradiated by ions. The simulation irradiation was carried out by 3 MeV Ni 2+ ion to a dose of 1 dpa at 290degC. Thin foil specimens for TEM observation were prepared using the modified focused ion beam method. A weak-beam TEM study was carried out for the observation of matrix damage in the samples. Results of this first detailed observation of the matrix damage in the irradiated commercial steel show that it is consisted of small dislocation loops. The observed and analyzed dislocation loops have Burgers vectors b = a , and a mean image size and the number density are 2.5 nm and about 1 x 10 22 m -3 , respectively. In this experiment, all of the observed dislocation loops were too small to determine the vacancy or interstitial nature of the dislocation loops directly. Although it is an indirect method, post-irradiation annealing was used to infer the loop nature. Most of dislocation loops were stable after the annealing at 400degC for 30 min. This result suggests that their nature is interstitial. (author)

R-matrix analysis of the 239Pu cross sections up to 1 keV

International Nuclear Information System (INIS)

Derrien, H.; de Saussure, G.; Perez, R.B.; Larson, N.M.; Macklin, R.L.

1986-06-01

The results are reported of an R-matrix resonance analysis of the 239 Pu neutron cross sections up to 1 keV. After a description of the method of analysis the nearly 1600 resonance parameters obtained are listed and extensive graphical and numerical comparisons between calculated and measured cross-section and transmission date are presented. 47 refs., 47 figs., 8 tabs

A Lexicographic Method for Matrix Games with Payoffs of Triangular Intuitionistic Fuzzy Numbers

Directory of Open Access Journals (Sweden)

Jiang-Xia Nan

2010-09-01

Full Text Available The intuitionistic fuzzy set (IF-set has not been applied to matrix game problems yet since it was introduced by K.T.Atanassov. The aim of this paper is to develop a methodology for solving matrix games with payoffs of triangular intuitionistic fuzzy numbers (TIFNs. Firstly the concept of TIFNs and their arithmetic operations and cut sets are introduced as well as the ranking order relations. Secondly the concept of solutions for matrix games with payoffs of TIFNs is defined. A lexicographic methodology is developed to determine the solutions of matrix games with payoffs of TIFNs for both Players through solving a pair of bi-objective linear programming models derived from two new auxiliary intuitionistic fuzzy programming models. The proposed method is illustrated with a numerical example.

Sample preparation technique for transmission electron microscopy anodized Al-Li-SiC metal matrix composite

International Nuclear Information System (INIS)

Shahid, M.; Thomson, G.E.

1997-01-01

Along with improved mechanical properties, metal matrix composites (MMC) have a disadvantage of enhanced corrosion susceptibility in aggressive environments. Recent studies on corrosion behaviour of an Al-alloy 8090/SiC MMC, revealed considerably high corrosion rates of the MMC in near neutral solutions containing chloride ions. Anodizing is one of the potential surface treatment for the MMC to provide protective coating against corrosion. The surface and cross section of the anodized MMC can easily be observed using scanning electron microscope. The anodizing behaviour of the MMC can be understood further if the anodized cross section in examined under transmission electron microscope (TEM). However, it is relatively difficult to prepare small (3 mm diameter) electron transparent specimens of the MMC supporting an anodic film. In the present study a technique has been developed for preparing thin electron transparent specimens of the anodized MMC. This technique employed conventional ion beam thinning process but the preparation of small discs was a problem. A MMMC consisting of Al-alloy 8090 with 20 % (by weight) SiC particulate with an average size of 5 Mu m, was anodized and observed in TEM after preparing the samples using the above mentioned techniques. (author)

Radiation-induced transmission spectral variations of Ce3+-doped heavy germanate glasses

International Nuclear Information System (INIS)

Yang Yunxia; Baccaro, S.; Cecilia, A.; Rao Jinhua; Zhang Junbiao; Xia Fang; Chen Guorong

2005-01-01

Radiation-induced transmission spectral variations of Ce 3+ -doped heavy germanate glasses used as scintillating materials are presented. Glass matrix contains mainly GeO 2 , BaO and Gd 2 O 3 with a density higher than 5 g/cm 3 . Glasses are melted in the different atmosphere. The transmission spectra of glasses before and after radiation treatments are measured and compared. Unlike exhibiting the monotonous deterioration effect on the glass matrix, radiation plays the radiation protection role, even making enhanced transmission of Ce 3+ -doped glasses, depending upon glass melting atmosphere and radiation dose. Radiation-induced reducing and oxidizing mechanism is proposed to explain phenomena

Location of Faults in Power Transmission Lines Using the ARIMA Method

Directory of Open Access Journals (Sweden)

Danilo Pinto Moreira de Souza

2017-10-01

Full Text Available One of the major problems in transmission lines is the occurrence of failures that affect the quality of the electric power supplied, as the exact localization of the fault must be known for correction. In order to streamline the work of maintenance teams and standardize services, this paper proposes a method of locating faults in power transmission lines by analyzing the voltage oscillographic signals extracted at the line monitoring terminals. The developed method relates time series models obtained specifically for each failure pattern. The parameters of the autoregressive integrated moving average (ARIMA model are estimated in order to adjust the voltage curves and calculate the distance from the initial fault localization to the terminals. Simulations of the failures are performed through the ATPDraw ® (5.5 software and the analyses were completed using the RStudio ® (1.0.143 software. The results obtained with respect to the failures, which did not involve earth return, were satisfactory when compared with widely used techniques in the literature, particularly when the fault distance became larger in relation to the beginning of the transmission line.

The Split Coefficient Matrix method for hyperbolic systems of gasdynamic equations

Science.gov (United States)

Chakravarthy, S. R.; Anderson, D. A.; Salas, M. D.

1980-01-01

The Split Coefficient Matrix (SCM) finite difference method for solving hyperbolic systems of equations is presented. This new method is based on the mathematical theory of characteristics. The development of the method from characteristic theory is presented. Boundary point calculation procedures consistent with the SCM method used at interior points are explained. The split coefficient matrices that define the method for steady supersonic and unsteady inviscid flows are given for several examples. The SCM method is used to compute several flow fields to demonstrate its accuracy and versatility. The similarities and differences between the SCM method and the lambda-scheme are discussed.

Invariant Imbedding T-Matrix Method for Axial Symmetric Hydrometeors with Extreme Aspect Ratios

Science.gov (United States)

Pelissier, C.; Clune, T.; Kuo, K. S.; Munchak, S. J.; Adams, I. S.

2017-12-01

The single-scattering properties (SSPs) of hydrometeors are the fundamental quantities for physics-based precipitation retrievals. Thus, efficient computation of their electromagnetic scattering is of great value. Whereas the semi-analytical T-Matrix methods are likely the most efficient for nonspherical hydrometeors with axial symmetry, they are not suitable for arbitrarily shaped hydrometeors absent of any significant symmetry, for which volume integral methods such as those based on Discrete Dipole Approximation (DDA) are required. Currently the two leading T-matrix methods are the Extended Boundary Condition Method (EBCM) and the Invariant Imbedding T-matrix Method incorporating Lorentz-Mie Separation of Variables (IITM+SOV). EBCM is known to outperform IITM+SOV for hydrometeors with modest aspect ratios. However, in cases when aspect ratios become extreme, such as needle-like particles with large height to diameter values, EBCM fails to converge. Such hydrometeors with extreme aspect ratios are known to be present in solid precipitation and their SSPs are required to model the radiative responses accurately. In these cases, IITM+SOV is shown to converge. An efficient, parallelized C++ implementation for both EBCM and IITM+SOV has been developed to conduct a performance comparison between EBCM, IITM+SOV, and DDSCAT (a popular implementation of DDA). We present the comparison results and discuss details. Our intent is to release the combined ECBM & IITM+SOV software to the community under an open source license.

NewIn-situ synthesis method of magnesium matrix composites reinforced with TiC particulates

Directory of Open Access Journals (Sweden)

Zhang Xiuqing

2006-12-01

Full Text Available Magnesium matrix composites reinforced with TiC particulates was prepared using a new in-situ synthesis method of remelting and dilution technique. And measurements were performed on the composites. The results of x ray diffraction (XRD analysis confirmed that TiC particulates were synthesized during the sintering process, and they retained in magnesium matrix composites after the remelting and dilution processing. From the microstructure characterization and electron probe microanalysis (EPMA, we could see that fine TiC particulates distributed uniformly in the matrix material.

Character expansion methods for matrix models of dually weighted graphs

International Nuclear Information System (INIS)

Kazakov, V.A.; Staudacher, M.; Wynter, T.

1996-01-01

We consider generalized one-matrix models in which external fields allow control over the coordination numbers on both the original and dual lattices. We rederive in a simple fashion a character expansion formula for these models originally due to Itzykson and Di Francesco, and then demonstrate how to take the large N limit of this expansion. The relationship to the usual matrix model resolvent is elucidated. Our methods give as a by-product an extremely simple derivation of the Migdal integral equation describing the large N limit of the Itzykson-Zuber formula. We illustrate and check our methods by analysing a number of models solvable by traditional means. We then proceed to solve a new model: a sum over planar graphs possessing even coordination numbers on both the original and the dual lattice. We conclude by formulating equations for the case of arbitrary sets of even, self-dual coupling constants. This opens the way for studying the deep problem of phase transitions from random to flat lattices. (orig.). With 4 figs

Transfer matrix in 1D Schroedinger problems with constant and position-dependent mass

International Nuclear Information System (INIS)

Perez-Alvarez, R.; Rodriguez-Coppola, H.

1987-10-01

We consider the transfer matrix method for obtaining properties of standard wells and barriers in one-dimensional Schroedinger problems with constant and position-dependent mass. We report the formulae for the energy levels of a well and the transmission coefficient of a barrier. We demonstrate the continuity between virtual bound states and bound states in a well of position-dependent mass and the relation between the zero energy gap states of a periodic potential problem with the corresponding energies of the non-periodic ones with transmission coefficient equal to one. The calculations were carried out for a wide class of potential profiles. (author). 30 refs, 2 figs

Linear programming models and methods of matrix games with payoffs of triangular fuzzy numbers

CERN Document Server

Li, Deng-Feng

2016-01-01

This book addresses two-person zero-sum finite games in which the payoffs in any situation are expressed with fuzzy numbers. The purpose of this book is to develop a suite of effective and efficient linear programming models and methods for solving matrix games with payoffs in fuzzy numbers. Divided into six chapters, it discusses the concepts of solutions of matrix games with payoffs of intervals, along with their linear programming models and methods. Furthermore, it is directly relevant to the research field of matrix games under uncertain economic management. The book offers a valuable resource for readers involved in theoretical research and practical applications from a range of different fields including game theory, operational research, management science, fuzzy mathematical programming, fuzzy mathematics, industrial engineering, business and social economics. .

Risk Evaluation on UHV Power Transmission Construction Project Based on AHP and FCE Method

OpenAIRE

Huiru Zhao; Sen Guo

2014-01-01

Ultra high voltage (UHV) power transmission construction project is a high-tech power grid construction project which faces many risks and uncertainty. Identifying the risk of UHV power transmission construction project can help mitigate the risk loss and promote the smooth construction. The risk evaluation on “Zhejiang-Fuzhou” UHV power transmission construction project was performed based on analytic hierarchy process (AHP) and fuzzy comprehensive evaluation (FCE) method in this paper. Afte...

Algebraic method for analysis of nonlinear systems with a normal matrix

International Nuclear Information System (INIS)

Konyaev, Yu.A.; Salimova, A.F.

2014-01-01

A promising method has been proposed for analyzing a class of quasilinear nonautonomous systems of differential equations whose matrix can be represented as a sum of nonlinear normal matrices, which makes it possible to analyze stability without using the Lyapunov functions [ru

Transmission properties of one-dimensional ternary plasma photonic crystals

International Nuclear Information System (INIS)

Shiveshwari, Laxmi; Awasthi, S. K.

2015-01-01

Omnidirectional photonic band gaps (PBGs) are found in one-dimensional ternary plasma photonic crystals (PPC) composed of single negative metamaterials. The band characteristics and transmission properties are investigated through the transfer matrix method. We show that the proposed structure can trap light in three-dimensional space due to the elimination of Brewster's angle transmission resonance allowing the existence of complete PBG. The results are discussed in terms of incident angle, layer thickness, dielectric constant of the dielectric material, and number of unit cells (N) for TE and TM polarizations. It is seen that PBG characteristics is apparent even in an N ≥ 2 system, which is weakly sensitive to the incident angle and completely insensitive to the polarization. Finite PPC could be used for multichannel transmission filter without introducing any defect in the geometry. We show that the locations of the multichannel transmission peaks are in the allowed band of the infinite structure. The structure can work as a single or multichannel filter by varying the number of unit cells. Binary PPC can also work as a polarization sensitive tunable filter

Transmission properties of one-dimensional ternary plasma photonic crystals

Energy Technology Data Exchange (ETDEWEB)

Shiveshwari, Laxmi [Department of Physics, K. B. Womens' s College, Hazaribagh 825 301 (India); Awasthi, S. K. [Department of Physics and Material Science and Engineering, Jaypee Institute of Information Technology, Noida 201 304 (India)

2015-09-15

Omnidirectional photonic band gaps (PBGs) are found in one-dimensional ternary plasma photonic crystals (PPC) composed of single negative metamaterials. The band characteristics and transmission properties are investigated through the transfer matrix method. We show that the proposed structure can trap light in three-dimensional space due to the elimination of Brewster's angle transmission resonance allowing the existence of complete PBG. The results are discussed in terms of incident angle, layer thickness, dielectric constant of the dielectric material, and number of unit cells (N) for TE and TM polarizations. It is seen that PBG characteristics is apparent even in an N ≥ 2 system, which is weakly sensitive to the incident angle and completely insensitive to the polarization. Finite PPC could be used for multichannel transmission filter without introducing any defect in the geometry. We show that the locations of the multichannel transmission peaks are in the allowed band of the infinite structure. The structure can work as a single or multichannel filter by varying the number of unit cells. Binary PPC can also work as a polarization sensitive tunable filter.

Improved determination of hadron matrix elements using the variational method

International Nuclear Information System (INIS)

Dragos, J.; Kamleh, W.; Leinweber, D.B.; Zanotti, J.M.; Rakow, P.E.L.; Young, R.D.; Adelaide Univ.

2015-11-01

The extraction of hadron form factors in lattice QCD using the standard two- and three-point correlator functions has its limitations. One of the most commonly studied sources of systematic error is excited state contamination, which occurs when correlators are contaminated with results from higher energy excitations. We apply the variational method to calculate the axial vector current g A and compare the results to the more commonly used summation and two-exponential fit methods. The results demonstrate that the variational approach offers a more efficient and robust method for the determination of nucleon matrix elements.

Application of differential transformation method for solving dengue transmission mathematical model

Science.gov (United States)

Ndii, Meksianis Z.; Anggriani, Nursanti; Supriatna, Asep K.

2018-03-01

The differential transformation method (DTM) is a semi-analytical numerical technique which depends on Taylor series and has application in many areas including Biomathematics. The aim of this paper is to employ the differential transformation method (DTM) to solve system of non-linear differential equations for dengue transmission mathematical model. Analytical and numerical solutions are determined and the results are compared to that of Runge-Kutta method. We found a good agreement between DTM and Runge-Kutta method.

Legendre Wavelet Operational Matrix Method for Solution of Riccati Differential Equation

Directory of Open Access Journals (Sweden)

S. Balaji

2014-01-01

Full Text Available A Legendre wavelet operational matrix method (LWM is presented for the solution of nonlinear fractional-order Riccati differential equations, having variety of applications in quantum chemistry and quantum mechanics. The fractional-order Riccati differential equations converted into a system of algebraic equations using Legendre wavelet operational matrix. Solutions given by the proposed scheme are more accurate and reliable and they are compared with recently developed numerical, analytical, and stochastic approaches. Comparison shows that the proposed LWM approach has a greater performance and less computational effort for getting accurate solutions. Further existence and uniqueness of the proposed problem are given and moreover the condition of convergence is verified.

Hydraulic transmissivity determination for the groundwater exploration using vertical electric sounding method in comparison to the traditional methods

International Nuclear Information System (INIS)

Arshad, M.; Shakoor, A.; Ahmad, M.

2013-01-01

An important aquifer characteristic, transmissivity significantly contributes to the development of local and regional groundwater resources and solute transport management. Estimation of this property allows quantitative prediction of the hydraulic response and solute transport of the aquifer to recharge and pumping. This study presents the three techniques, used to compare transmissivity determination by Vertical Electric Sounding (VES) over the traditional techniques. The validation of VES was compared with the old widely used methods such as grain size distribution and pumping test techniques. Grain size distribution analysis was carried out to determine transmissivity. Pumping test was performed to determine transmissivity using the type curves solution for unconfined aquifer and taking into account the delayed yield. In resistivity imaging survey, the soil layers were detected through interpretation of resistivity data. Formation factor for each layer was determined with the relation of aquifer soil resistivity and ground water resistivity. The estimated transmissivities though grain size distribution, pumping test and resistivity survey were 0.588, 0.578 and 0.756m/sup 2//min, respectively. The results emphasized the potential of the resistivity survey for aquifer transmissivity determination. (author)

Matrix-variational method: an efficient approach to bound state eigenproblems

International Nuclear Information System (INIS)

Gerck, E.; d'Oliveira, A.B.

1978-11-01

A new matrix-variational method for solving the radial Schroedinger equation is described. It consists in obtaining an adjustable matrix formulation for the boundary value differential equation, using a set of three functions that obey the boundary conditions. These functions are linearly combined at every three adjacents points to fit the true unknown eigenfunction by a variational technique. With the use of a new class of central differences, the exponential differences, tridiagonal or bidiagonal matrices are obtained. In the bidiagonal case, closed form expressions for the eigenvalues are given for the Coulomb, harmonic, linear, square-root and logarithmic potentials. The values obtained are within 0.1% of the true numerical value. The eigenfunction can be calculated using the eigenvectors to reconstruct the linear combination of the set functions [pt

Response matrix method and its application to SCWR single channel stability analysis

International Nuclear Information System (INIS)

Zhao, Jiyun; Tseng, K.J.; Tso, C.P.

2011-01-01

To simulate the reactor system dynamic features during density wave oscillations (DWO), both the non-linear method and the linear method can be used. Although some transient information is lost through model linearization, the high computational efficiency and relatively accurate results make the linear analysis methodology attractive, especially for prediction of the onset of instability. In the linear stability analysis, the system models are simplified through linearization of the complex non-linear differential equations, and then, the linear differential equations are generally solved in the frequency domain through Laplace transformation. In this paper, a system response matrix method was introduced by directly solving the differential equations in the time domain. By using a system response matrix method, the complicated transfer function derivation, which must be done in the frequency domain method, can be avoided. Using the response matrix method, a model was developed and applied to the single channel or parallel channel type instability analyses of the typical proposed SCWR design. The sensitivity of the decay ratio (DR) to the axial mesh size was analyzed and it was found that the DR is not sensitive to mesh size once sufficient number of axial nodes is applied. To demonstrate the effects of the inlet orificing to the stability feature for the supercritical condition, the sensitivity of the stability to inlet orifice coefficient was conducted for hot channel. It is clearly shown that a higher inlet orifice coefficient will make the system more stable. The susceptibility of stability to operating parameters such as mass flow rate, power and system pressure was also performed. And the measure to improve the SCWR stability sensitivity to operating parameters was investigated. It was found that the SCWR stability sensitivity feature can be improved by carefully managing the inlet orifices and choosing proper operating parameters. (author)

Efficient Data Gathering Methods in Wireless Sensor Networks Using GBTR Matrix Completion

Directory of Open Access Journals (Sweden)

Donghao Wang

2016-09-01

Full Text Available To obtain efficient data gathering methods for wireless sensor networks (WSNs, a novel graph based transform regularized (GBTR matrix completion algorithm is proposed. The graph based transform sparsity of the sensed data is explored, which is also considered as a penalty term in the matrix completion problem. The proposed GBTR-ADMM algorithm utilizes the alternating direction method of multipliers (ADMM in an iterative procedure to solve the constrained optimization problem. Since the performance of the ADMM method is sensitive to the number of constraints, the GBTR-A2DM2 algorithm obtained to accelerate the convergence of GBTR-ADMM. GBTR-A2DM2 benefits from merging two constraint conditions into one as well as using a restart rule. The theoretical analysis shows the proposed algorithms obtain satisfactory time complexity. Extensive simulation results verify that our proposed algorithms outperform the state of the art algorithms for data collection problems in WSNs in respect to recovery accuracy, convergence rate, and energy consumption.

Research on atmospheric transmission distortion of Gauss laser using multiple phase screen method

Science.gov (United States)

Zhang, Yizhuo; Wang, Qiushi; Gu, Haidong

2018-02-01

The laser beam is attenuated, broadened, defocused and may even be deflected from its initial propagation direction as it propagates through the atmosphere. It leads to the decrease of the laser intensity of the receiving surface. Gauss beam is the fundamental components of all possible laser waveforms. Therefore, research on the transmission of the Gauss laser has far-reaching consequences in optical communication, weaponry, target designation, ranging, remote sensing and other applications that require transmission of laser beams through the atmosphere. In this paper, we propose a laboratory simulation method using multi-phase screen to calculate the effects of atmospheric turbulence. Theoretical analysis of Gauss laser transmission in the atmosphere is given. By calculating the propagation of the Gauss beam TEM00, the far field intensity and phase distribution is shown. By the given method, the optical setup is presented and used for optimizing the adaptive optics algorithm.

A method for the estimation of dual transmissivities from slug tests

Science.gov (United States)

Wolny, Filip; Marciniak, Marek; Kaczmarek, Mariusz

2018-03-01

Aquifer homogeneity is usually assumed when interpreting the results of pumping and slug tests, although aquifers are essentially heterogeneous. The aim of this study is to present a method of determining the transmissivities of dual-permeability water-bearing formations based on slug tests such as the pressure-induced permeability test. A bi-exponential rate-of-rise curve is typically observed during many of these tests conducted in heterogeneous formations. The work involved analyzing curves deviating from the exponential rise recorded at the Belchatow Lignite Mine in central Poland, where a significant number of permeability tests have been conducted. In most cases, bi-exponential movement was observed in piezometers with a screen installed in layered sediments, each with a different hydraulic conductivity, or in fissured rock. The possibility to identify the flow properties of these geological formations was analyzed. For each piezometer installed in such formations, a set of two transmissivity values was calculated piecewise based on the interpretation algorithm of the pressure-induced permeability test—one value for the first (steeper) part of the obtained rate-of-rise curve, and a second value for the latter part of the curve. The results of transmissivity estimation for each piezometer are shown. The discussion presents the limitations of the interpretational method and suggests future modeling plans.

Performance Analysis of Video Transmission Using Sequential Distortion Minimization Method for Digital Video Broadcasting Terrestrial

Directory of Open Access Journals (Sweden)

Novita Astin

2016-12-01

Full Text Available This paper presents about the transmission of Digital Video Broadcasting system with streaming video resolution 640x480 on different IQ rate and modulation. In the video transmission, distortion often occurs, so the received video has bad quality. Key frames selection algorithm is flexibel on a change of video, but on these methods, the temporal information of a video sequence is omitted. To minimize distortion between the original video and received video, we aimed at adding methodology using sequential distortion minimization algorithm. Its aim was to create a new video, better than original video without significant loss of content between the original video and received video, fixed sequentially. The reliability of video transmission was observed based on a constellation diagram, with the best result on IQ rate 2 Mhz and modulation 8 QAM. The best video transmission was also investigated using SEDIM (Sequential Distortion Minimization Method and without SEDIM. The experimental result showed that the PSNR (Peak Signal to Noise Ratio average of video transmission using SEDIM was an increase from 19,855 dB to 48,386 dB and SSIM (Structural Similarity average increase 10,49%. The experimental results and comparison of proposed method obtained a good performance. USRP board was used as RF front-end on 2,2 GHz.

ECAP – New consolidation method for production of aluminium matrix composites with ceramic reinforcement

Directory of Open Access Journals (Sweden)

Mateja Šnajdar Musa

2013-06-01

Full Text Available Aluminium based metal matrix composites are rapidly developing group of materials due to their unique combination of properties that include low weight, elevated strength, improved wear and corrosion resistance and relatively good ductility. This combination of properties is a result of mixing two groups of materials with rather different properties with aluminium as ductile matrix and different oxides and carbides added as reinforcement. Al2O3, SiC and ZrO2 are the most popular choices of reinforcement material. One of the most common methods for producing this type of metal matrix composites is powder metallurgy since it has many variations and also is relatively low-cost method. Many different techniques of compacting aluminium and ceramic powders have been previously investigated. Among those techniques equal channel angular pressing (ECAP stands out due to its beneficial influence on the main problem that arises during powder compaction and that is a non-uniform distribution of reinforcement particles. This paper gives an overview on ECAP method principles, advantages and produced powder composite properties.

A model-based clustering method to detect infectious disease transmission outbreaks from sequence variation.

Directory of Open Access Journals (Sweden)

Rosemary M McCloskey

2017-11-01

Full Text Available Clustering infections by genetic similarity is a popular technique for identifying potential outbreaks of infectious disease, in part because sequences are now routinely collected for clinical management of many infections. A diverse number of nonparametric clustering methods have been developed for this purpose. These methods are generally intuitive, rapid to compute, and readily scale with large data sets. However, we have found that nonparametric clustering methods can be biased towards identifying clusters of diagnosis-where individuals are sampled sooner post-infection-rather than the clusters of rapid transmission that are meant to be potential foci for public health efforts. We develop a fundamentally new approach to genetic clustering based on fitting a Markov-modulated Poisson process (MMPP, which represents the evolution of transmission rates along the tree relating different infections. We evaluated this model-based method alongside five nonparametric clustering methods using both simulated and actual HIV sequence data sets. For simulated clusters of rapid transmission, the MMPP clustering method obtained higher mean sensitivity (85% and specificity (91% than the nonparametric methods. When we applied these clustering methods to published sequences from a study of HIV-1 genetic clusters in Seattle, USA, we found that the MMPP method categorized about half (46% as many individuals to clusters compared to the other methods. Furthermore, the mean internal branch lengths that approximate transmission rates were significantly shorter in clusters extracted using MMPP, but not by other methods. We determined that the computing time for the MMPP method scaled linearly with the size of trees, requiring about 30 seconds for a tree of 1,000 tips and about 20 minutes for 50,000 tips on a single computer. This new approach to genetic clustering has significant implications for the application of pathogen sequence analysis to public health, where

Wireless data signal transmission system

DEFF Research Database (Denmark)

2014-01-01

The present invention relates to a method for providing a radio frequency signal for transmission, a system for providing a radio frequency signal for transmission and a method for wireless data transmission between a transmitter and a receiver.......The present invention relates to a method for providing a radio frequency signal for transmission, a system for providing a radio frequency signal for transmission and a method for wireless data transmission between a transmitter and a receiver....

Fast mean and variance computation of the diffuse sound transmission through finite-sized thick and layered wall and floor systems

Science.gov (United States)

Decraene, Carolina; Dijckmans, Arne; Reynders, Edwin P. B.

2018-05-01

A method is developed for computing the mean and variance of the diffuse field sound transmission loss of finite-sized layered wall and floor systems that consist of solid, fluid and/or poroelastic layers. This is achieved by coupling a transfer matrix model of the wall or floor to statistical energy analysis subsystem models of the adjacent room volumes. The modal behavior of the wall is approximately accounted for by projecting the wall displacement onto a set of sinusoidal lateral basis functions. This hybrid modal transfer matrix-statistical energy analysis method is validated on multiple wall systems: a thin steel plate, a polymethyl methacrylate panel, a thick brick wall, a sandwich panel, a double-leaf wall with poro-elastic material in the cavity, and a double glazing. The predictions are compared with experimental data and with results obtained using alternative prediction methods such as the transfer matrix method with spatial windowing, the hybrid wave based-transfer matrix method, and the hybrid finite element-statistical energy analysis method. These comparisons confirm the prediction accuracy of the proposed method and the computational efficiency against the conventional hybrid finite element-statistical energy analysis method.

Methods for the visualization and analysis of extracellular matrix protein structure and degradation.

Science.gov (United States)

Leonard, Annemarie K; Loughran, Elizabeth A; Klymenko, Yuliya; Liu, Yueying; Kim, Oleg; Asem, Marwa; McAbee, Kevin; Ravosa, Matthew J; Stack, M Sharon

2018-01-01

This chapter highlights methods for visualization and analysis of extracellular matrix (ECM) proteins, with particular emphasis on collagen type I, the most abundant protein in mammals. Protocols described range from advanced imaging of complex in vivo matrices to simple biochemical analysis of individual ECM proteins. The first section of this chapter describes common methods to image ECM components and includes protocols for second harmonic generation, scanning electron microscopy, and several histological methods of ECM localization and degradation analysis, including immunohistochemistry, Trichrome staining, and in situ zymography. The second section of this chapter details both a common transwell invasion assay and a novel live imaging method to investigate cellular behavior with respect to collagen and other ECM proteins of interest. The final section consists of common electrophoresis-based biochemical methods that are used in analysis of ECM proteins. Use of the methods described herein will enable researchers to gain a greater understanding of the role of ECM structure and degradation in development and matrix-related diseases such as cancer and connective tissue disorders. © 2018 Elsevier Inc. All rights reserved.

A result-driven minimum blocking method for PageRank parallel computing

Science.gov (United States)

Tao, Wan; Liu, Tao; Yu, Wei; Huang, Gan

2017-01-01

Matrix blocking is a common method for improving computational efficiency of PageRank, but the blocking rules are hard to be determined, and the following calculation is complicated. In tackling these problems, we propose a minimum blocking method driven by result needs to accomplish a parallel implementation of PageRank algorithm. The minimum blocking just stores the element which is necessary for the result matrix. In return, the following calculation becomes simple and the consumption of the I/O transmission is cut down. We do experiments on several matrixes of different data size and different sparsity degree. The results show that the proposed method has better computational efficiency than traditional blocking methods.

An Efficient Local Correlation Matrix Decomposition Approach for the Localization Implementation of Ensemble-Based Assimilation Methods

Science.gov (United States)

Zhang, Hongqin; Tian, Xiangjun

2018-04-01

Ensemble-based data assimilation methods often use the so-called localization scheme to improve the representation of the ensemble background error covariance (Be). Extensive research has been undertaken to reduce the computational cost of these methods by using the localized ensemble samples to localize Be by means of a direct decomposition of the local correlation matrix C. However, the computational costs of the direct decomposition of the local correlation matrix C are still extremely high due to its high dimension. In this paper, we propose an efficient local correlation matrix decomposition approach based on the concept of alternating directions. This approach is intended to avoid direct decomposition of the correlation matrix. Instead, we first decompose the correlation matrix into 1-D correlation matrices in the three coordinate directions, then construct their empirical orthogonal function decomposition at low resolution. This procedure is followed by the 1-D spline interpolation process to transform the above decompositions to the high-resolution grid. Finally, an efficient correlation matrix decomposition is achieved by computing the very similar Kronecker product. We conducted a series of comparison experiments to illustrate the validity and accuracy of the proposed local correlation matrix decomposition approach. The effectiveness of the proposed correlation matrix decomposition approach and its efficient localization implementation of the nonlinear least-squares four-dimensional variational assimilation are further demonstrated by several groups of numerical experiments based on the Advanced Research Weather Research and Forecasting model.

Matrix algebra for linear models

CERN Document Server

Gruber, Marvin H J

2013-01-01

Matrix methods have evolved from a tool for expressing statistical problems to an indispensable part of the development, understanding, and use of various types of complex statistical analyses. This evolution has made matrix methods a vital part of statistical education. Traditionally, matrix methods are taught in courses on everything from regression analysis to stochastic processes, thus creating a fractured view of the topic. Matrix Algebra for Linear Models offers readers a unique, unified view of matrix analysis theory (where and when necessary), methods, and their applications. Written f

Study and comparison of some methods for calculating the transmission factor of a potential barrier in quantum mechanics (1963); Etude et comparaison de quelques methodes de calcul du facteur de transmission d'une barriere de potentiel en mecanique quantique (1963)

Energy Technology Data Exchange (ETDEWEB)

Jamet, P [Commissariat a l' Energie Atomique, Saclay (France). Centre d' Etudes Nucleaires

1964-07-01

The author formulates two accurate methods for the calculation of the transmission coefficient of a one-dimensional potential barrier. The principles of these methods are. expressed in a symmetrical form with respect to the two sides of the potential barrier; this constitutes a proof of the fact that the transmission coefficient is path direction independent. The numerical application is carried out on several examples and the results are compared to those provided by the WKB method. (author) [French] L'auteur formule deux methodes exactes pour calculer le coefficient de transmission d'une barriere de potentiel unidimensionnelle. Les principes de ces methodes s'enoncent sous forme symetrique par rapport aux deux cotes de la barriere de potentiel, ce qui constitue une demonstration du fait que le coefficient de transmission est independant du sens de parcours. L'application numerique est faite sur quelques exemples et les resultats sont compares a ceux fournis par la methode B KW. (auteur)

Matrix-type multiple reciprocity boundary element method for solving three-dimensional two-group neutron diffusion equations

International Nuclear Information System (INIS)

Itagaki, Masafumi; Sahashi, Naoki.

1997-01-01

The multiple reciprocity boundary element method has been applied to three-dimensional two-group neutron diffusion problems. A matrix-type boundary integral equation has been derived to solve the first and the second group neutron diffusion equations simultaneously. The matrix-type fundamental solutions used here satisfy the equation which has a point source term and is adjoint to the neutron diffusion equations. A multiple reciprocity method has been employed to transform the matrix-type domain integral related to the fission source into an equivalent boundary one. The higher order fundamental solutions required for this formulation are composed of a series of two types of analytic functions. The eigenvalue itself is also calculated using only boundary integrals. Three-dimensional test calculations indicate that the present method provides stable and accurate solutions for criticality problems. (author)

A projection-adapted cross entropy (PACE) method for transmission network planning

Energy Technology Data Exchange (ETDEWEB)

Eshragh, Ali; Filar, Jerzy [University of South Australia, School of Mathematics and Statistics, Mawson Lakes, SA (Australia); Nazar, Asef [University of South Australia, Institute for Sustainable Systems Technologies, School of Mathematics and Statistics, Mawson Lakes, SA (Australia)

2011-06-15

In this paper, we propose an adaptation of the cross entropy (CE) method called projection-adapted CE (PACE) to solve a transmission expansion problem that arises in management of national and provincial electricity grids. The aim of the problem is to find an expansion policy that is both economical and operational from the technical perspective. Often, the transmission network expansion problem is mathematically formulated as a mixed integer nonlinear program that is very challenging algorithmically. The challenge originates from the fact that a global optimum should be found despite the presence, of possibly a huge number, of local optima. The PACE method shows promise in solving global optimization problems regardless of continuity or other assumptions. In our approach, we sample the integer variables using the CE mechanism, and solve LPs to obtain matching continuous variables. Numerical results, on selected test systems, demonstrate the potential of this approach. (orig.)

Roundtrip matrix method for calculating the leaky resonant modes of open nanophotonic structures

DEFF Research Database (Denmark)

de Lasson, Jakob Rosenkrantz; Kristensen, Philip Trøst; Mørk, Jesper

2014-01-01

We present a numerical method for calculating quasi-normal modes of open nanophotonic structures. The method is based on scattering matrices and a unity eigenvalue of the roundtrip matrix of an internal cavity, and we develop it in detail with electromagnetic fields expanded on Bloch modes...

Calculating Relativistic Transition Matrix Elements for Hydrogenic Atoms Using Monte Carlo Methods

Science.gov (United States)

Alexander, Steven; Coldwell, R. L.

2015-03-01

The nonrelativistic transition matrix elements for hydrogen atoms can be computed exactly and these expressions are given in a number of classic textbooks. The relativistic counterparts of these equations can also be computed exactly but these expressions have been described in only a few places in the literature. In part, this is because the relativistic equations lack the elegant simplicity of the nonrelativistic equations. In this poster I will describe how variational Monte Carlo methods can be used to calculate the energy and properties of relativistic hydrogen atoms and how the wavefunctions for these systems can be used to calculate transition matrix elements.

Solving Eigenvalue response matrix equations with Jacobian-Free Newton-Krylov methods

International Nuclear Information System (INIS)

Roberts, Jeremy A.; Forget, Benoit

2011-01-01

The response matrix method for reactor eigenvalue problems is motivated as a technique for solving coarse mesh transport equations, and the classical approach of power iteration (PI) for solution is described. The method is then reformulated as a nonlinear system of equations, and the associated Jacobian is derived. A Jacobian-Free Newton-Krylov (JFNK) method is employed to solve the system, using an approximate Jacobian coupled with incomplete factorization as a preconditioner. The unpreconditioned JFNK slightly outperforms PI, and preconditioned JFNK outperforms both PI and Steffensen-accelerated PI significantly. (author)

A hybrid Planning Method for Transmission Network in a Deregulated Enviroment

DEFF Research Database (Denmark)

Xu, Zhao; Dong, Zhaoyang; Poulsen, Kit

2006-01-01

The reconstruction of power industries has brought fundamental changes to both power system operation and planning. This paper presents a new planning method using a multi-objective optimization (MOOP) technique, as well as human knowledge, to expand the transmission network in open-access scheme...

A hybrid Boundary Element Unstructured Transmission-line (BEUT) method for accurate 2D electromagnetic simulation

Energy Technology Data Exchange (ETDEWEB)

Simmons, Daniel, E-mail: daniel.simmons@nottingham.ac.uk; Cools, Kristof; Sewell, Phillip

2016-11-01

Time domain electromagnetic simulation tools have the ability to model transient, wide-band applications, and non-linear problems. The Boundary Element Method (BEM) and the Transmission Line Modeling (TLM) method are both well established numerical techniques for simulating time-varying electromagnetic fields. The former surface based method can accurately describe outwardly radiating fields from piecewise uniform objects and efficiently deals with large domains filled with homogeneous media. The latter volume based method can describe inhomogeneous and non-linear media and has been proven to be unconditionally stable. Furthermore, the Unstructured TLM (UTLM) enables modelling of geometrically complex objects by using triangular meshes which removes staircasing and unnecessary extensions of the simulation domain. The hybridization of BEM and UTLM which is described in this paper is named the Boundary Element Unstructured Transmission-line (BEUT) method. It incorporates the advantages of both methods. The theory and derivation of the 2D BEUT method is described in this paper, along with any relevant implementation details. The method is corroborated by studying its correctness and efficiency compared to the traditional UTLM method when applied to complex problems such as the transmission through a system of Luneburg lenses and the modelling of antenna radomes for use in wireless communications. - Graphical abstract:.

METHODICAL APPROACHES TO THE CHOICE OF THE NEW GENERATION OF HIGH-VOLTAGE POWER TRANSMISSION LINE 220 kV OPTIONS

Directory of Open Access Journals (Sweden)

POSTOLATI V.M.

2010-08-01

Full Text Available The Transmission Power Lines of new generation are described in the article (single- compact, double-circuit compact, double-circuit Controlled Self-compensating High Voltage Transmission Power Lines (CSHVL. Basic principles of creation, design elements and comparative characteristics of the transmission lines of the new generation are described, the advantages of its are showed. Methodical approaches to the choosing of a new generation of transmission lines and facilities management FACTS are formulated. Methodical approaches to the choice of options for transmission lines 220 kV and facilities management are shown.

Synthesizing (ZrAl3 + AlN)/Mg-Al composites by a 'matrix exchange' method

Science.gov (United States)

Gao, Tong; Li, Zengqiang; Hu, Kaiqi; Han, Mengxia; Liu, Xiangfa

2018-06-01

A method named 'matrix exchange' to synthesize ZrAl3 and AlN reinforced Mg-Al composite was developed in this paper. By inserting Al-10ZrN master alloy into Mg matrix and reheating the cooled ingot to 550 °C, Al and Mg atoms diffuse to the opposite side. As a result, liquid melt occurs once the interface areas reach to proper compositions. Then dissolved Al atoms react with ZrN, leading to the in-situ formation of ZrAl3 and AlN particles, while the Al matrix is finally replaced by Mg. This study provides a new insight for preparing Mg composites.

A simple and inclusive method to determine the habit plane in transmission electron microscope based on accurate measurement of foil thickness

International Nuclear Information System (INIS)

Qiu, Dong; Zhang, Mingxing

2014-01-01

A simple and inclusive method is proposed for accurate determination of the habit plane between bicrystals in transmission electron microscope. Whilst this method can be regarded as a variant of surface trace analysis, the major innovation lies in the improved accuracy and efficiency of foil thickness measurement, which involves a simple tilt of the thin foil about a permanent tilting axis of the specimen holder, rather than cumbersome tilt about the surface trace of the habit plane. Experimental study has been done to validate this proposed method in determining the habit plane between lamellar α 2 plates and γ matrix in a Ti–Al–Nb alloy. Both high accuracy (± 1°) and high precision (± 1°) have been achieved by using the new method. The source of the experimental errors as well as the applicability of this method is discussed. Some tips to minimise the experimental errors are also suggested. - Highlights: • An improved algorithm is formulated to measure the foil thickness. • Habit plane can be determined with a single tilt holder based on the new algorithm. • Better accuracy and precision within ± 1° are achievable using the proposed method. • The data for multi-facet determination can be collected simultaneously

A reduced-scaling density matrix-based method for the computation of the vibrational Hessian matrix at the self-consistent field level

International Nuclear Information System (INIS)

Kussmann, Jörg; Luenser, Arne; Beer, Matthias; Ochsenfeld, Christian

2015-01-01

An analytical method to calculate the molecular vibrational Hessian matrix at the self-consistent field level is presented. By analysis of the multipole expansions of the relevant derivatives of Coulomb-type two-electron integral contractions, we show that the effect of the perturbation on the electronic structure due to the displacement of nuclei decays at least as r −2 instead of r −1 . The perturbation is asymptotically local, and the computation of the Hessian matrix can, in principle, be performed with O(N) complexity. Our implementation exhibits linear scaling in all time-determining steps, with some rapid but quadratic-complexity steps remaining. Sample calculations illustrate linear or near-linear scaling in the construction of the complete nuclear Hessian matrix for sparse systems. For more demanding systems, scaling is still considerably sub-quadratic to quadratic, depending on the density of the underlying electronic structure

DANTE, Activation Analysis Neutron Spectra Unfolding by Covariance Matrix Method

International Nuclear Information System (INIS)

Petilli, M.

1981-01-01

1 - Description of problem or function: The program evaluates activation measurements of reactor neutron spectra and unfolds the results for dosimetry purposes. Different evaluation options are foreseen: absolute or relative fluxes and different iteration algorithms. 2 - Method of solution: A least-square fit method is used. A correlation between available data and their uncertainties has been introduced by means of flux and activity variance-covariance matrices. Cross sections are assumed to be constant, i.e. with variance-covariance matrix equal to zero. The Lagrange multipliers method has been used for calculating the solution. 3 - Restrictions on the complexity of the problem: 9 activation experiments can be analyzed. 75 energy groups are accepted

Matrix removal in state of the art sample preparation methods for serum by charged aerosol detection and metabolomics-based LC-MS.

Science.gov (United States)

Schimek, Denise; Francesconi, Kevin A; Mautner, Anton; Libiseller, Gunnar; Raml, Reingard; Magnes, Christoph

2016-04-07

Investigations into sample preparation procedures usually focus on analyte recovery with no information provided about the fate of other components of the sample (matrix). For many analyses, however, and particularly those using liquid chromatography-mass spectrometry (LC-MS), quantitative measurements are greatly influenced by sample matrix. Using the example of the drug amitriptyline and three of its metabolites in serum, we performed a comprehensive investigation of nine commonly used sample clean-up procedures in terms of their suitability for preparing serum samples. We were monitoring the undesired matrix compounds using a combination of charged aerosol detection (CAD), LC-CAD, and a metabolomics-based LC-MS/MS approach. In this way, we compared analyte recovery of protein precipitation-, liquid-liquid-, solid-phase- and hybrid solid-phase extraction methods. Although all methods provided acceptable recoveries, the highest recovery was obtained by protein precipitation with acetonitrile/formic acid (amitriptyline 113%, nortriptyline 92%, 10-hydroxyamitriptyline 89%, and amitriptyline N-oxide 96%). The quantification of matrix removal by LC-CAD showed that the solid phase extraction method (SPE) provided the lowest remaining matrix load (48-123 μg mL(-1)), which is a 10-40 fold better matrix clean-up than the precipitation- or hybrid solid phase extraction methods. The metabolomics profiles of eleven compound classes, comprising 70 matrix compounds showed the trends of compound class removal for each sample preparation strategy. The collective data set of analyte recovery, matrix removal and matrix compound profile was used to assess the effectiveness of each sample preparation method. The best performance in matrix clean-up and practical handling of small sample volumes was showed by the SPE techniques, particularly HLB SPE. CAD proved to be an effective tool for revealing the considerable differences between the sample preparation methods. This detector can

A Synthetic Approach to the Transfer Matrix Method in Classical and Quantum Physics

Science.gov (United States)

Pujol, O.; Perez, J. P.

2007-01-01

The aim of this paper is to propose a synthetic approach to the transfer matrix method in classical and quantum physics. This method is an efficient tool to deal with complicated physical systems of practical importance in geometrical light or charged particle optics, classical electronics, mechanics, electromagnetics and quantum physics. Teaching…

Current matrix element in HAL QCD's wavefunction-equivalent potential method

Science.gov (United States)

Watanabe, Kai; Ishii, Noriyoshi

2018-04-01

We give a formula to calculate a matrix element of a conserved current in the effective quantum mechanics defined by the wavefunction-equivalent potentials proposed by the HAL QCD collaboration. As a first step, a non-relativistic field theory with two-channel coupling is considered as the original theory, with which a wavefunction-equivalent HAL QCD potential is obtained in a closed analytic form. The external field method is used to derive the formula by demanding that the result should agree with the original theory. With this formula, the matrix element is obtained by sandwiching the effective current operator between the left and right eigenfunctions of the effective Hamiltonian associated with the HAL QCD potential. In addition to the naive one-body current, the effective current operator contains an additional two-body term emerging from the degrees of freedom which has been integrated out.

Exact solution of some linear matrix equations using algebraic methods

Science.gov (United States)

Djaferis, T. E.; Mitter, S. K.

1977-01-01

A study is done of solution methods for Linear Matrix Equations including Lyapunov's equation, using methods of modern algebra. The emphasis is on the use of finite algebraic procedures which are easily implemented on a digital computer and which lead to an explicit solution to the problem. The action f sub BA is introduced a Basic Lemma is proven. The equation PA + BP = -C as well as the Lyapunov equation are analyzed. Algorithms are given for the solution of the Lyapunov and comment is given on its arithmetic complexity. The equation P - A'PA = Q is studied and numerical examples are given.

Theory of reflection reflection and transmission of electromagnetic, particle and acoustic waves

CERN Document Server

Lekner, John

2016-01-01

This book deals with the reflection of electromagnetic and particle waves by interfaces. The interfaces can be sharp or diffuse. The topics of the book contain absorption, inverse problems, anisotropy, pulses and finite beams, rough surfaces, matrix methods, numerical methods,  reflection of particle waves and neutron reflection. Exact general results are presented, followed by long wave reflection, variational theory, reflection amplitude equations of the Riccati type, and reflection of short waves. The Second Edition of the Theory of Reflection is an updated and much enlarged revision of the 1987 monograph. There are new chapters on periodically stratified media, ellipsometry, chiral media, neutron reflection and reflection of acoustic waves. The chapter on anisotropy is much extended, with a complete treatment of the reflection and transmission properties of arbitrarily oriented uniaxial crystals. The book gives a systematic and unified treatment reflection and transmission of electromagnetic and particle...

Stage-structured transmission of phocine distemper virus in the Dutch 2002 outbreak

Science.gov (United States)

Klepac, Petra; Pomeroy, Laura W.; Bjørnstad, Ottar N.; Kuiken, Thijs; Osterhaus, Albert D.M.E.; Rijks, Jolianne M.

2009-01-01

Heterogeneities in transmission among hosts can be very important in shaping infectious disease dynamics. In mammals with strong social organization, such heterogeneities are often structured by functional stage: juveniles, subadults and adults. We investigate the importance of such stage-related heterogeneities in shaping the 2002 phocine distemper virus (PDV) outbreak in the Dutch Wadden Sea, when more than 40 per cent of the harbour seals were killed. We do this by comparing the statistical fit of a hierarchy of models with varying transmission complexity: homogeneous versus heterogeneous mixing and density- versus frequency-dependent transmission. We use the stranding data as a proxy for incidence and use Poisson likelihoods to estimate the ‘who acquires infection from whom’ (WAIFW) matrix. Statistically, the model with strong heterogeneous mixing and density-dependent transmission was found to best describe the transmission dynamics. However, patterns of incidence support a model of frequency-dependent transmission among adults and juveniles. Based on the maximum-likelihood WAIFW matrix estimates, we use the next-generation formalism to calculate an R0 between 2 and 2.5 for the Dutch 2002 PDV epidemic. PMID:19364743

Newton's method for solving a quadratic matrix equation with special coefficient matrices

International Nuclear Information System (INIS)

Seo, Sang-Hyup; Seo, Jong Hyun; Kim, Hyun-Min

2014-01-01

We consider the iterative method for solving a quadratic matrix equation with special coefficient matrices which arises in the quasi-birth-death problem. In this paper, we show that the elementwise minimal positive solvents to quadratic matrix equations can be obtained using Newton's method. We also prove that the convergence rate of the Newton iteration is quadratic if the Fréchet derivative at the elementwise minimal positive solvent is nonsingular. However, if the Fréchet derivative is singular, the convergence rate is at least linear. Numerical experiments of the convergence rate are given.(This is summarized a paper which is to appear in Honam Mathematical Journal.)

R-matrix analysis of 235U neutron transmission and cross sections in the energy range 0 to 2.25 keV

International Nuclear Information System (INIS)

Leal, L.C.; Derrien, H.; Larson, N.M.; Wright, R.Q.

1997-11-01

This document describes a new R-matrix analysis of 235 U cross section data in the energy range from 0 to 2,250 eV. The analysis was performed with the computer code SAMMY, that has recently been updated to permit, for the first time, inclusion of both differential and integral data within the analysis process. Fourteen differential data sets and six integral quantities were used in this evaluation: two measurements of fission plus capture, one of fission plus absorption, six of fission alone, two of transmission, and one of eta, plus standard values of thermal cross sections for fission, capture, and scattering, and of K1 and the Westcott g-factors for both fission and absorption. An excellent representation was obtained for the high-resolution transmission, fission, and capture cross-section data as well as for the integral quantities. The result is a single set of resonance parameters spanning the entire range up to 2,250 eV, a decided improvement over the present ENDF/VI evaluation, in which eleven discrete resonance parameter sets are required to cover that same energy range. This new evaluation is expected to greatly improve predictability of the criticality safety margins for nuclear systems in which 235 U is present

Analytical methods for study of transmission line lightning protection

International Nuclear Information System (INIS)

Pettersson, Per.

1993-04-01

Transmission line lightning performance is studied by analytical methods. The elements of shielding failure flashovers and back-flashovers are analysed as functions of incidence, response and insulation. Closed-form approximate expressions are sought to enhance understanding of the phenomena. Probabilistic and wave propagation aspects are particularly studied. The electrogeometric model of lightning attraction to structures is used in combination with the log-normal probability distribution of lightning to ground currents. The log-normality is found to be retained for the currents collected by mast-type as well as line-type structures, but with a change of scale. For both types, exceedingly simple formulas for the number of hits are derived. Simple closed-form expressions for the line outage rates from back- flashovers and shielding failure flashovers are derived in a uniform way as functions of the critical currents. The expressions involve the standardized normal distribution function. System response is analysed by use of Laplace transforms in combination with text-book transmission-line theory. Inversion into time domain is accomplished by an approximate asymptotic method producing closed-form results. The back-flashover problem is analysed in particular. Approximate, image type expressions are derived for shunt admittance of wires above, on and under ground for analyses of fast transients. The derivation parallels that for series impedance, now well-known. 3 refs, 5 figs

A matrix structured LED backlight system with 2D-DHT local dimming method

Science.gov (United States)

Liu, Jia; Li, Yang; Du, Sidan

To reduce the number of the drivers in the conventional local dimming method for LCDs, a novel LED backlight local dimming system is proposed in this paper. The backlight of this system is generated by 2D discrete Hadamard transform and its matrix structured LED modules. Compared with the conventional 2D local dimming method, the proposed method costs much fewer drivers but with little degradation.

Description of elastic scattering in U-matrix method

International Nuclear Information System (INIS)

Edneral, V.F.; Troshin, S.M.; Tyurin, N.E.; Khrustalev, O.A.

1975-01-01

The elastic pp-scattering has been analyzed using a generalized reaction matrix (the U-matrix). A good agreement has been reached with the experimental total cross sections for the (pp) reaction beginning with an energy of 30 GeV and for the dsub(t)(dt)(pp) for four ISR energies [ru

A Brief Research Review for Improvement Methods the Wettability between Ceramic Reinforcement Particulate and Aluminium Matrix Composites

Science.gov (United States)

Razzaq, Alaa Mohammed; Majid, Dayang Laila Abang Abdul; Ishak, M. R.; B, Uday M.

2017-05-01

The development of new methods for addition fine ceramic powders to Al aluminium alloy melts, which would lead to more uniform distribution and effective incorporation of the reinforcement particles into the aluminium matrix alloy. Recently the materials engineering research has moved to composite materials from monolithic, adapting to the global need for lightweight, low cost, quality, and high performance advanced materials. Among the different methods, stir casting is one of the simplest ways of making aluminium matrix composites. However, it suffers from poor distribution and combination of the reinforcement ceramic particles in the metal matrix. These problems become significantly effect to reduce reinforcement size, more agglomeration and tendency with less wettability for the ceramic particles in the melt process. Many researchers have carried out different studies on the wettability between the metal matrix and dispersion phase, which includes added wettability agents, fluxes, preheating the reinforcement particles, coating the reinforcement particles, and use composting techniques. The enhancement of wettability of ceramic particles by the molten matrix alloy and the reinforcement particles distribution improvement in the solidified matrix is the main objective for many studies that will be discussed in this paper.

Transmission eigenvalues

Science.gov (United States)

Cakoni, Fioralba; Haddar, Houssem

2013-10-01

In inverse scattering theory, transmission eigenvalues can be seen as the extension of the notion of resonant frequencies for impenetrable objects to the case of penetrable dielectrics. The transmission eigenvalue problem is a relatively late arrival to the spectral theory of partial differential equations. Its first appearance was in 1986 in a paper by Kirsch who was investigating the denseness of far-field patterns for scattering solutions of the Helmholtz equation or, in more modern terminology, the injectivity of the far-field operator [1]. The paper of Kirsch was soon followed by a more systematic study by Colton and Monk in the context of developing the dual space method for solving the inverse scattering problem for acoustic waves in an inhomogeneous medium [2]. In this paper they showed that for a spherically stratified media transmission eigenvalues existed and formed a discrete set. Numerical examples were also given showing that in principle transmission eigenvalues could be determined from the far-field data. This first period of interest in transmission eigenvalues was concluded with papers by Colton et al in 1989 [3] and Rynne and Sleeman in 1991 [4] showing that for an inhomogeneous medium (not necessarily spherically stratified) transmission eigenvalues, if they existed, formed a discrete set. For the next seventeen years transmission eigenvalues were ignored. This was mainly due to the fact that, with the introduction of various sampling methods to determine the shape of an inhomogeneous medium from far-field data, transmission eigenvalues were something to be avoided and hence the fact that transmission eigenvalues formed at most a discrete set was deemed to be sufficient. In addition, questions related to the existence of transmission eigenvalues or the structure of associated eigenvectors were recognized as being particularly difficult due to the nonlinearity of the eigenvalue problem and the special structure of the associated transmission

On the generalized eigenvalue method for energies and matrix elements in lattice field theory

Energy Technology Data Exchange (ETDEWEB)

Blossier, Benoit [Deutsches Elektronen-Synchrotron (DESY), Zeuthen (Germany)]|[Paris-XI Univ., 91 - Orsay (France). Lab. de Physique Theorique; Morte, Michele della [CERN, Geneva (Switzerland). Physics Dept.]|[Mainz Univ. (Germany). Inst. fuer Kernphysik; Hippel, Georg von; Sommer, Rainer [Deutsches Elektronen-Synchrotron (DESY), Zeuthen (Germany); Mendes, Tereza [Deutsches Elektronen-Synchrotron (DESY), Zeuthen (Germany)]|[Sao Paulo Univ. (Brazil). IFSC

2009-02-15

We discuss the generalized eigenvalue problem for computing energies and matrix elements in lattice gauge theory, including effective theories such as HQET. It is analyzed how the extracted effective energies and matrix elements converge when the time separations are made large. This suggests a particularly efficient application of the method for which we can prove that corrections vanish asymptotically as exp(-(E{sub N+1}-E{sub n}) t). The gap E{sub N+1}-E{sub n} can be made large by increasing the number N of interpolating fields in the correlation matrix. We also show how excited state matrix elements can be extracted such that contaminations from all other states disappear exponentially in time. As a demonstration we present numerical results for the extraction of ground state and excited B-meson masses and decay constants in static approximation and to order 1/m{sub b} in HQET. (orig.)

On the generalized eigenvalue method for energies and matrix elements in lattice field theory

International Nuclear Information System (INIS)

Blossier, Benoit; Mendes, Tereza; Sao Paulo Univ.

2009-02-01

We discuss the generalized eigenvalue problem for computing energies and matrix elements in lattice gauge theory, including effective theories such as HQET. It is analyzed how the extracted effective energies and matrix elements converge when the time separations are made large. This suggests a particularly efficient application of the method for which we can prove that corrections vanish asymptotically as exp(-(E N+1 -E n ) t). The gap E N+1 -E n can be made large by increasing the number N of interpolating fields in the correlation matrix. We also show how excited state matrix elements can be extracted such that contaminations from all other states disappear exponentially in time. As a demonstration we present numerical results for the extraction of ground state and excited B-meson masses and decay constants in static approximation and to order 1/m b in HQET. (orig.)

Optimized Signaling Method for High-Speed Transmission Channels with Higher Order Transfer Function

Science.gov (United States)

Ševčík, Břetislav; Brančík, Lubomír; Kubíček, Michal

2017-08-01

In this paper, the selected results from testing of optimized CMOS friendly signaling method for high-speed communications over cables and printed circuit boards (PCBs) are presented and discussed. The proposed signaling scheme uses modified concept of pulse width modulated (PWM) signal which enables to better equalize significant channel losses during data high-speed transmission. Thus, the very effective signaling method to overcome losses in transmission channels with higher order transfer function, typical for long cables and multilayer PCBs, is clearly analyzed in the time and frequency domain. Experimental results of the measurements include the performance comparison of conventional PWM scheme and clearly show the great potential of the modified signaling method for use in low power CMOS friendly equalization circuits, commonly considered in modern communication standards as PCI-Express, SATA or in Multi-gigabit SerDes interconnects.

A generalized transmission method for gamma-efficiency determinations in soil samples

International Nuclear Information System (INIS)

Bolivar, J.P.; Garcia-Tenorio, R.; Garcia-Leon, M.

1994-01-01

In this paper, a generalization of the γ-ray transmission method which is useful for measurements on soil samples, for example, is presented. The correction factor, f, is given, which is a function of the apparent density of the soil and the γ-ray energy. With this method, the need for individual determinations of f, for each energy and apparent soil density is avoided. Although the method has been developed for soils, the general philosophy can be applied to other sample matrices, such as water or vegetables for example. (author)

Determination of Dispersion Curves for Composite Materials with the Use of Stiffness Matrix Method

Directory of Open Access Journals (Sweden)

Barski Marek

2017-06-01

Full Text Available Elastic waves used in Structural Health Monitoring systems have strongly dispersive character. Therefore it is necessary to determine the appropriate dispersion curves in order to proper interpretation of a received dynamic response of an analyzed structure. The shape of dispersion curves as well as number of wave modes depends on mechanical properties of layers and frequency of an excited signal. In the current work, the relatively new approach is utilized, namely stiffness matrix method. In contrast to transfer matrix method or global matrix method, this algorithm is considered as numerically unconditionally stable and as effective as transfer matrix approach. However, it will be demonstrated that in the case of hybrid composites, where mechanical properties of particular layers differ significantly, obtaining results could be difficult. The theoretical relationships are presented for the composite plate of arbitrary stacking sequence and arbitrary direction of elastic waves propagation. As a numerical example, the dispersion curves are estimated for the lamina, which is made of carbon fibers and epoxy resin. It is assumed that elastic waves travel in the parallel, perpendicular and arbitrary direction to the fibers in lamina. Next, the dispersion curves are determined for the following laminate [0°, 90°, 0°, 90°, 0°, 90°, 0°, 90°] and hybrid [Al, 90°, 0°, 90°, 0°, 90°, 0°], where Al is the aluminum alloy PA38 and the rest of layers are made of carbon fibers and epoxy resin.

A novel method for morphological pleomorphism and heterogeneity quantitative measurement: Named cell feature level co-occurrence matrix.

Science.gov (United States)

Saito, Akira; Numata, Yasushi; Hamada, Takuya; Horisawa, Tomoyoshi; Cosatto, Eric; Graf, Hans-Peter; Kuroda, Masahiko; Yamamoto, Yoichiro

2016-01-01

Recent developments in molecular pathology and genetic/epigenetic analysis of cancer tissue have resulted in a marked increase in objective and measurable data. In comparison, the traditional morphological analysis approach to pathology diagnosis, which can connect these molecular data and clinical diagnosis, is still mostly subjective. Even though the advent and popularization of digital pathology has provided a boost to computer-aided diagnosis, some important pathological concepts still remain largely non-quantitative and their associated data measurements depend on the pathologist's sense and experience. Such features include pleomorphism and heterogeneity. In this paper, we propose a method for the objective measurement of pleomorphism and heterogeneity, using the cell-level co-occurrence matrix. Our method is based on the widely used Gray-level co-occurrence matrix (GLCM), where relations between neighboring pixel intensity levels are captured into a co-occurrence matrix, followed by the application of analysis functions such as Haralick features. In the pathological tissue image, through image processing techniques, each nucleus can be measured and each nucleus has its own measureable features like nucleus size, roundness, contour length, intra-nucleus texture data (GLCM is one of the methods). In GLCM each nucleus in the tissue image corresponds to one pixel. In this approach the most important point is how to define the neighborhood of each nucleus. We define three types of neighborhoods of a nucleus, then create the co-occurrence matrix and apply Haralick feature functions. In each image pleomorphism and heterogeneity are then determined quantitatively. For our method, one pixel corresponds to one nucleus feature, and we therefore named our method Cell Feature Level Co-occurrence Matrix (CFLCM). We tested this method for several nucleus features. CFLCM is showed as a useful quantitative method for pleomorphism and heterogeneity on histopathological image

The Evaluation Method of the Lightning Strike on Transmission Lines Aiming at Power Grid Reliability

Science.gov (United States)

Wen, Jianfeng; Wu, Jianwei; Huang, Liandong; Geng, Yinan; Yu, zhanqing

2018-01-01

Lightning protection of power system focuses on reducing the flashover rate, only distinguishing by the voltage level, without considering the functional differences between the transmission lines, and being lack of analysis the effect on the reliability of power grid. This will lead lightning protection design of general transmission lines is surplus but insufficient for key lines. In order to solve this problem, the analysis method of lightning striking on transmission lines for power grid reliability is given. Full wave process theory is used to analyze the lightning back striking; the leader propagation model is used to describe the process of shielding failure of transmission lines. The index of power grid reliability is introduced and the effect of transmission line fault on the reliability of power system is discussed in detail.

Analysis of a wavelength selectable cascaded DFB laser based on the transfer matrix method

International Nuclear Information System (INIS)

Xie Hongyun; Chen Liang; Shen Pei; Sun Botao; Wang Renqing; Xiao Ying; You Yunxia; Zhang Wanrong

2010-01-01

A novel cascaded DFB laser, which consists of two serial gratings to provide selectable wavelengths, is presented and analyzed by the transfer matrix method. In this method, efficient facet reflectivity is derived from the transfer matrix built for each serial section and is then used to simulate the performance of the novel cascaded DFB laser through self-consistently solving the gain equation, the coupled wave equation and the current continuity equations. The simulations prove the feasibility of this kind of wavelength selectable laser and a corresponding designed device with two selectable wavelengths of 1.51 μm and 1.53 μm is realized by experiments on InP-based multiple quantum well structure. (semiconductor devices)

Harmonic Resonance in Power Transmission Systems due to the Addition of Shunt Capacitors

Science.gov (United States)

Patil, Hardik U.

Shunt capacitors are often added in transmission networks at suitable locations to improve the voltage profile. In this thesis, the transmission system in Arizona is considered as a test bed. Many shunt capacitors already exist in the Arizona transmission system and more are planned to be added. Addition of these shunt capacitors may create resonance conditions in response to harmonic voltages and currents. Such resonance, if it occurs, may create problematic issues in the system. It is main objective of this thesis to identify potential problematic effects that could occur after placing new shunt capacitors at selected buses in the Arizona network. Part of the objective is to create a systematic plan for avoidance of resonance issues. For this study, a method of capacitance scan is proposed. The bus admittance matrix is used as a model of the networked transmission system. The calculations on the admittance matrix were done using Matlab. The test bed is the actual transmission system in Arizona; however, for proprietary reasons, bus names are masked in the thesis copy intended for the public domain. The admittance matrix was obtained from data using the PowerWorld Simulator after equivalencing the 2016 summer peak load (planning case). The full Western Electricity Coordinating Council (WECC) system data were used. The equivalencing procedure retains only the Arizona portion of the WECC. The capacitor scan results for single capacitor placement and multiple capacitor placement cases are presented. Problematic cases are identified in the form of 'forbidden response. The harmonic voltage impact of known sources of harmonics, mainly large scale HVDC sources, is also presented. Specific key results for the study indicated include: (1) The forbidden zones obtained as per the IEEE 519 standard indicates the bus 10 to be the most problematic bus. (2) The forbidden zones also indicate that switching values for the switched shunt capacitor (if used) at bus 3 should be

Microstructural analysis and mechanical characterization of aluminum matrix nanocomposites reinforced with uncoated and Cu-coated alumina particles

Energy Technology Data Exchange (ETDEWEB)

Beygi, H., E-mail: hossein.beygi@stu-mail.um.ac.ir; Sajjadi, S.A.; Zebarjad, S.M.

2014-06-01

Aluminum matrix composites used in the aerospace, military and automotive industries are typically fabricated by a stir casting method. However, when nanoparticles are used for reinforcement, fabrication of composite materials by this method leads to the formation of a large number of structural defects. In this study, copper coating of alumina reinforcement particles is investigated as a technique for improving the structure of Al-Al{sub 2}O{sub 3} composites. Microstructural investigations by optical microscopy (OM), scanning electron microscopy (SEM) equipped with energy dispersion spectroscopy (EDS) and transmission electron microscopy (TEM) showed that the alumina particles were coated uniformly with copper shells. Copper coating of the reinforcing particles significantly increased their wettability in the molten aluminum alloy, strengthened the matrix-particle interfaces and improved the distribution of reinforcing particles within the matrix. Due to these microstructural improvements, the hardness, compressive strength, yield stress, tensile strength and elongation of the composites were enhanced by copper coating of the alumina particles.

Microstructural analysis and mechanical characterization of aluminum matrix nanocomposites reinforced with uncoated and Cu-coated alumina particles

International Nuclear Information System (INIS)

Beygi, H.; Sajjadi, S.A.; Zebarjad, S.M.

2014-01-01

Aluminum matrix composites used in the aerospace, military and automotive industries are typically fabricated by a stir casting method. However, when nanoparticles are used for reinforcement, fabrication of composite materials by this method leads to the formation of a large number of structural defects. In this study, copper coating of alumina reinforcement particles is investigated as a technique for improving the structure of Al-Al 2 O 3 composites. Microstructural investigations by optical microscopy (OM), scanning electron microscopy (SEM) equipped with energy dispersion spectroscopy (EDS) and transmission electron microscopy (TEM) showed that the alumina particles were coated uniformly with copper shells. Copper coating of the reinforcing particles significantly increased their wettability in the molten aluminum alloy, strengthened the matrix-particle interfaces and improved the distribution of reinforcing particles within the matrix. Due to these microstructural improvements, the hardness, compressive strength, yield stress, tensile strength and elongation of the composites were enhanced by copper coating of the alumina particles

Rigorous theoretical derivation of lumped models to transmission line systems

International Nuclear Information System (INIS)

Zhao Jixiang

2012-01-01

By virtue of the negative electric parameter concept, i.e. negative lumped resistance, inductance, conductance and capacitance (N-RLGC), the lumped equivalent models of transmission line systems, including the circuit model, two-port π-network and T-network, are given. We start from the N-segment-ladder-like equivalent networks composed distributed parameters, and achieve the input impedance in the form of a continued fraction. Utilizing the continued fraction theory, the expressions of input impedance are obtained under three kinds of extreme cases, i.e. the load impedances are equal to zero, infinity and characteristic impedance, respectively. When the number of segment N is limited to infinity, they are transformed to lumped elements. Comparison between the distributed model and lumped model of transmission lines, the expression of tanh γd, which is the key term in the transmission line equations, are obtained by RLGC, furthermore, according to input admittance, admittance matrix and ABCD matrix of transmission lines, the lumped equivalent circuit models, π-networks and T-networks have been given. The models are verified in the frequency and time domain, respectively, showing that the models are accurate and efficient. (semiconductor integrated circuits)

A Comparison of Surface Acoustic Wave Modeling Methods

Science.gov (United States)

Wilson, W. c.; Atkinson, G. M.

2009-01-01

Surface Acoustic Wave (SAW) technology is low cost, rugged, lightweight, extremely low power and can be used to develop passive wireless sensors. For these reasons, NASA is investigating the use of SAW technology for Integrated Vehicle Health Monitoring (IVHM) of aerospace structures. To facilitate rapid prototyping of passive SAW sensors for aerospace applications, SAW models have been developed. This paper reports on the comparison of three methods of modeling SAWs. The three models are the Impulse Response Method a first order model, and two second order matrix methods; the conventional matrix approach, and a modified matrix approach that is extended to include internal finger reflections. The second order models are based upon matrices that were originally developed for analyzing microwave circuits using transmission line theory. Results from the models are presented with measured data from devices.

Alternating optimization method based on nonnegative matrix factorizations for deep neural networks

OpenAIRE

Sakurai, Tetsuya; Imakura, Akira; Inoue, Yuto; Futamura, Yasunori

2016-01-01

The backpropagation algorithm for calculating gradients has been widely used in computation of weights for deep neural networks (DNNs). This method requires derivatives of objective functions and has some difficulties finding appropriate parameters such as learning rate. In this paper, we propose a novel approach for computing weight matrices of fully-connected DNNs by using two types of semi-nonnegative matrix factorizations (semi-NMFs). In this method, optimization processes are performed b...

Numerical Methods Application for Reinforced Concrete Elements-Theoretical Approach for Direct Stiffness Matrix Method

Directory of Open Access Journals (Sweden)

Sergiu Ciprian Catinas

2015-07-01

Full Text Available A detailed theoretical and practical investigation of the reinforced concrete elements is due to recent techniques and method that are implemented in the construction market. More over a theoretical study is a demand for a better and faster approach nowadays due to rapid development of the calculus technique. The paper above will present a study for implementing in a static calculus the direct stiffness matrix method in order capable to address phenomena related to different stages of loading, rapid change of cross section area and physical properties. The method is a demand due to the fact that in our days the FEM (Finite Element Method is the only alternative to such a calculus and FEM are considered as expensive methods from the time and calculus resources point of view. The main goal in such a method is to create the moment-curvature diagram in the cross section that is analyzed. The paper above will express some of the most important techniques and new ideas as well in order to create the moment curvature graphic in the cross sections considered.

Intercomparison of the GOS approach, superposition T-matrix method, and laboratory measurements for black carbon optical properties during aging

International Nuclear Information System (INIS)

He, Cenlin; Takano, Yoshi; Liou, Kuo-Nan; Yang, Ping; Li, Qinbin; Mackowski, Daniel W.

2016-01-01

We perform a comprehensive intercomparison of the geometric-optics surface-wave (GOS) approach, the superposition T-matrix method, and laboratory measurements for optical properties of fresh and coated/aged black carbon (BC) particles with complex structures. GOS and T-matrix calculations capture the measured optical (i.e., extinction, absorption, and scattering) cross sections of fresh BC aggregates, with 5–20% differences depending on particle size. We find that the T-matrix results tend to be lower than the measurements, due to uncertainty in theoretical approximations of realistic BC structures, particle property measurements, and numerical computations in the method. On the contrary, the GOS results are higher than the measurements (hence the T-matrix results) for BC radii 100 nm. We find good agreement (differences 100 nm. We find small deviations (≤10%) in asymmetry factors computed from the two methods for most BC coating structures and sizes, but several complex structures have 10–30% differences. This study provides the foundation for downstream application of the GOS approach in radiative transfer and climate studies. - Highlights: • The GOS and T-matrix methods capture laboratory measurements of BC optical properties. • The GOS results are consistent with the T-matrix results for BC optical properties. • BC optical properties vary remarkably with coating structures and sizes during aging.

Generalized transmission line method to study the far-zone radiation of antennas under a multilayer structure

CERN Document Server

Wu, Xuan Hui

2008-01-01

This book gives a step-by-step presentation of a generalized transmission line method to study the far-zone radiation of antennas under a multilayer structure. Normally, a radiation problem requires a full wave analysis which may be time consuming. The beauty of the generalized transmission line method is that it transforms the radiation problem for a specific type of structure, say the multilayer structure excited by an antenna, into a circuit problem that can be efficiently analyzed. Using the Reciprocity Theorem and far-field approximation, the method computes the far-zone radiation due to

A photoemission moments model using density functional and transfer matrix methods applied to coating layers on surfaces: Theory

Science.gov (United States)

Jensen, Kevin L.; Finkenstadt, Daniel; Shabaev, Andrew; Lambrakos, Samuel G.; Moody, Nathan A.; Petillo, John J.; Yamaguchi, Hisato; Liu, Fangze

2018-01-01

Recent experimental measurements of a bulk material covered with a small number of graphene layers reported by Yamaguchi et al. [NPJ 2D Mater. Appl. 1, 12 (2017)] (on bialkali) and Liu et al. [Appl. Phys. Lett. 110, 041607 (2017)] (on copper) and the needs of emission models in beam optics codes have lead to substantial changes in a Moments model of photoemission. The changes account for (i) a barrier profile and density of states factor based on density functional theory (DFT) evaluations, (ii) a Drude-Lorentz model of the optical constants and laser penetration depth, and (iii) a transmission probability evaluated by an Airy Transfer Matrix Approach. Importantly, the DFT results lead to a surface barrier profile of a shape similar to both resonant barriers and reflectionless wells: the associated quantum mechanical transmission probabilities are shown to be comparable to those recently required to enable the Moments (and Three Step) model to match experimental data but for reasons very different than the assumption by conventional wisdom that a barrier is responsible. The substantial modifications of the Moments model components, motivated by computational materials methods, are developed. The results prepare the Moments model for use in treating heterostructures and discrete energy level systems (e.g., quantum dots) proposed for decoupling the opposing metrics of performance that undermine the performance of advanced light sources like the x-ray Free Electron Laser. The consequences of the modified components on quantum yield, emittance, and emission models needed by beam optics codes are discussed.

Development of spectral history methods for pin-by-pin core analysis method using three-dimensional direct response matrix

International Nuclear Information System (INIS)

Mitsuyasu, T.; Ishii, K.; Hino, T.; Aoyama, M.

2009-01-01

Spectral history methods for pin-by-pin core analysis method using the three-dimensional direct response matrix have been developed. The direct response matrix is formalized by four sub-response matrices in order to respond to a core eigenvalue k and thus can be recomposed at each outer iteration in the core analysis. For core analysis, it is necessary to take into account the burn-up effect related to spectral history. One of the methods is to evaluate the nodal burn-up spectrum obtained using the out-going neutron current. The other is to correct the fuel rod neutron production rates obtained the pin-by-pin correction. These spectral history methods were tested in a heterogeneous system. The test results show that the neutron multiplication factor error can be reduced by half during burn-up, the nodal neutron production rates errors can be reduced by 30% or more. The root-mean-square differences between the relative fuel rod neutron production rate distributions can be reduced within 1.1% error. This means that these methods can accurately reflect the effects of intra- and inter-assembly heterogeneities during burn-up and can be used for core analysis. Core analysis with the DRM method was carried out for an ABWR quarter core and it was found that both thermal power and coolant-flow distributions were smoothly converged. (authors)

The fusion rate in the transmission resonance model

International Nuclear Information System (INIS)

Jaendel, M.

1992-01-01

Resonant transmission of deuterons through a chain of target deuterons in a metal matrix has been suggested as an explanation for the cold fusion phenomena. In this paper the fusion rate in such transmission resonance models is estimated, and the basic physical constraints are discussed. The dominating contribution to the fusion yield is found to come from metastable states. The fusion rate is well described by the Wentzel-Kramer-Brillouin approximation and appears to be much too small to explain the experimental anomalies

A transmission probability method for calculation of neutron flux distributions in hexagonal geometry

International Nuclear Information System (INIS)

Wasastjerna, F.; Lux, I.

1980-03-01

A transmission probability method implemented in the program TPHEX is described. This program was developed for the calculation of neutron flux distributions in hexagonal light water reactor fuel assemblies. The accuracy appears to be superior to diffusion theory, and the computation time is shorter than that of the collision probability method. (author)

Protocol independent transmission method in software defined optical network

Science.gov (United States)

Liu, Yuze; Li, Hui; Hou, Yanfang; Qiu, Yajun; Ji, Yuefeng

2016-10-01

With the development of big data and cloud computing technology, the traditional software-defined network is facing new challenges (e.i., ubiquitous accessibility, higher bandwidth, more flexible management and greater security). Using a proprietary protocol or encoding format is a way to improve information security. However, the flow, which carried by proprietary protocol or code, cannot go through the traditional IP network. In addition, ultra- high-definition video transmission service once again become a hot spot. Traditionally, in the IP network, the Serial Digital Interface (SDI) signal must be compressed. This approach offers additional advantages but also bring some disadvantages such as signal degradation and high latency. To some extent, HD-SDI can also be regard as a proprietary protocol, which need transparent transmission such as optical channel. However, traditional optical networks cannot support flexible traffics . In response to aforementioned challenges for future network, one immediate solution would be to use NFV technology to abstract the network infrastructure and provide an all-optical switching topology graph for the SDN control plane. This paper proposes a new service-based software defined optical network architecture, including an infrastructure layer, a virtualization layer, a service abstract layer and an application layer. We then dwell on the corresponding service providing method in order to implement the protocol-independent transport. Finally, we experimentally evaluate that proposed service providing method can be applied to transmit the HD-SDI signal in the software-defined optical network.

A Numerical Matrix-Based method in Harmonic Studies in Wind Power Plants

DEFF Research Database (Denmark)

Dowlatabadi, Mohammadkazem Bakhshizadeh; Hjerrild, Jesper; Kocewiak, Łukasz Hubert

2016-01-01

In the low frequency range, there are some couplings between the positive- and negative-sequence small-signal impedances of the power converter due to the nonlinear and low bandwidth control loops such as the synchronization loop. In this paper, a new numerical method which also considers...... these couplings will be presented. The numerical data are advantageous to the parametric differential equations, because analysing the high order and complex transfer functions is very difficult, and finally one uses the numerical evaluation methods. This paper proposes a numerical matrix-based method, which...

A prestorage method to measure neutron transmission of ultracold neutron guides

International Nuclear Information System (INIS)

Blau, B.; Daum, M.; Fertl, M.; Geltenbort, P.; Göltl, L.; Henneck, R.; Kirch, K.; Knecht, A.; Lauss, B.; Schmidt-Wellenburg, P.; Zsigmond, G.

2016-01-01

There are worldwide efforts to search for physics beyond the Standard Model of particle physics. Precision experiments using ultracold neutrons (UCN) require very high intensities of UCN. Efficient transport of UCN from the production volume to the experiment is therefore of great importance. We have developed a method using prestored UCN in order to quantify UCN transmission in tubular guides. This method simulates the final installation at the Paul Scherrer Institute's UCN source where neutrons are stored in an intermediate storage vessel serving three experimental ports. This method allowed us to qualify UCN guides for their intended use and compare their properties.

An ME-PC Enhanced HDMR Method for Efficient Statistical Analysis of Multiconductor Transmission Line Networks

KAUST Repository

Yucel, Abdulkadir C.; Bagci, Hakan; Michielssen, Eric

2015-01-01

An efficient method for statistically characterizing multiconductor transmission line (MTL) networks subject to a large number of manufacturing uncertainties is presented. The proposed method achieves its efficiency by leveraging a high

Morphology and dispersion of FeCo alloy nanoparticles dispersed in a matrix of IR pyrolized polyvinyl alcohol

Science.gov (United States)

Vasilev, A. A.; Dzidziguri, E. L.; Muratov, D. G.; Zhilyaeva, N. A.; Efimov, M. N.; Karpacheva, G. P.

2018-04-01

Metal-carbon nanocomposites consisting of FeCo alloy nanoparticles dispersed in a carbon matrix were synthesized by the thermal decomposition method of a precursor based on polyvinyl alcohol and metals salts. The synthesized powders were investigated by X-ray diffraction (XRD), X-ray fluorescent spectrometry (XRFS), transmission electron microscopy (TEM) and scanning electron microscopy (SEM). Surface characteristics of materials were measured by BET-method. The morphology and dispersity of metal nanoparticles were studied depending on the metals ratio in the composite.

The augmented lagrange multipliers method for matrix completion from corrupted samplings with application to mixed Gaussian-impulse noise removal.

Directory of Open Access Journals (Sweden)

Fan Meng

Full Text Available This paper studies the problem of the restoration of images corrupted by mixed Gaussian-impulse noise. In recent years, low-rank matrix reconstruction has become a research hotspot in many scientific and engineering domains such as machine learning, image processing, computer vision and bioinformatics, which mainly involves the problem of matrix completion and robust principal component analysis, namely recovering a low-rank matrix from an incomplete but accurate sampling subset of its entries and from an observed data matrix with an unknown fraction of its entries being arbitrarily corrupted, respectively. Inspired by these ideas, we consider the problem of recovering a low-rank matrix from an incomplete sampling subset of its entries with an unknown fraction of the samplings contaminated by arbitrary errors, which is defined as the problem of matrix completion from corrupted samplings and modeled as a convex optimization problem that minimizes a combination of the nuclear norm and the l(1-norm in this paper. Meanwhile, we put forward a novel and effective algorithm called augmented Lagrange multipliers to exactly solve the problem. For mixed Gaussian-impulse noise removal, we regard it as the problem of matrix completion from corrupted samplings, and restore the noisy image following an impulse-detecting procedure. Compared with some existing methods for mixed noise removal, the recovery quality performance of our method is dominant if images possess low-rank features such as geometrically regular textures and similar structured contents; especially when the density of impulse noise is relatively high and the variance of Gaussian noise is small, our method can outperform the traditional methods significantly not only in the simultaneous removal of Gaussian noise and impulse noise, and the restoration ability for a low-rank image matrix, but also in the preservation of textures and details in the image.

Quantum mechanics in matrix form

CERN Document Server

Ludyk, Günter

2018-01-01

This book gives an introduction to quantum mechanics with the matrix method. Heisenberg's matrix mechanics is described in detail. The fundamental equations are derived by algebraic methods using matrix calculus. Only a brief description of Schrödinger's wave mechanics is given (in most books exclusively treated), to show their equivalence to Heisenberg's matrix  method. In the first part the historical development of Quantum theory by Planck, Bohr and Sommerfeld is sketched, followed by the ideas and methods of Heisenberg, Born and Jordan. Then Pauli's spin and exclusion principles are treated. Pauli's exclusion principle leads to the structure of atoms. Finally, Dirac´s relativistic quantum mechanics is shortly presented. Matrices and matrix equations are today easy to handle when implementing numerical algorithms using standard software as MAPLE and Mathematica.

Comparison of matrix exponential methods for fuel burnup calculations

International Nuclear Information System (INIS)

Oh, Hyung Suk; Yang, Won Sik

1999-01-01

Series expansion methods to compute the exponential of a matrix have been compared by applying them to fuel depletion calculations. Specifically, Taylor, Pade, Chebyshev, and rational Chebyshev approximations have been investigated by approximating the exponentials of bum matrices by truncated series of each method with the scaling and squaring algorithm. The accuracy and efficiency of these methods have been tested by performing various numerical tests using one thermal reactor and two fast reactor depletion problems. The results indicate that all the four series methods are accurate enough to be used for fuel depletion calculations although the rational Chebyshev approximation is relatively less accurate. They also show that the rational approximations are more efficient than the polynomial approximations. Considering the computational accuracy and efficiency, the Pade approximation appears to be better than the other methods. Its accuracy is better than the rational Chebyshev approximation, while being comparable to the polynomial approximations. On the other hand, its efficiency is better than the polynomial approximations and is similar to the rational Chebyshev approximation. In particular, for fast reactor depletion calculations, it is faster than the polynomial approximations by a factor of ∼ 1.7. (author). 11 refs., 4 figs., 2 tabs

An Efficient GPU General Sparse Matrix-Matrix Multiplication for Irregular Data

DEFF Research Database (Denmark)

Liu, Weifeng; Vinter, Brian

2014-01-01

General sparse matrix-matrix multiplication (SpGEMM) is a fundamental building block for numerous applications such as algebraic multigrid method, breadth first search and shortest path problem. Compared to other sparse BLAS routines, an efficient parallel SpGEMM algorithm has to handle extra...... irregularity from three aspects: (1) the number of the nonzero entries in the result sparse matrix is unknown in advance, (2) very expensive parallel insert operations at random positions in the result sparse matrix dominate the execution time, and (3) load balancing must account for sparse data in both input....... Load balancing builds on the number of the necessary arithmetic operations on the nonzero entries and is guaranteed in all stages. Compared with the state-of-the-art GPU SpGEMM methods in the CUSPARSE library and the CUSP library and the latest CPU SpGEMM method in the Intel Math Kernel Library, our...

Calculation of the fast multiplication factor by the fission matrix method

International Nuclear Information System (INIS)

Naumov, V.A.; Rozin, S.G.; Ehl'perin, T.I.

1976-01-01

A variation of the Monte Carlo method to calculate an effective breeding factor of a nuclear reactor is described. The evaluation procedure of reactivity perturbations by the Monte Carlo method in the first order perturbation theory is considered. The method consists in reducing an integral neutron transport equation to a set of linear algebraic equations. The coefficients of this set are elements of a fission matrix. The fission matrix being a Grin function of the neutron transport equation, is evaluated by the Monte Carlo method. In the program realizing the suggested algorithm, the game for initial neutron energy of a fission spectrum and then for the region of neutron birth, ΔVsub(f)sup(i)has been played in proportion to the product of Σsub(f)sup(i)ΔVsub(f)sup(i), where Σsub(f)sup(i) is a macroscopic cross section in the region numbered at the birth energy. Further iterations of a space distribution of neutrons in the system are performed by the generation method. In the adopted scheme of simulation of neutron histories the emission of secondary neutrons is controlled by weights; it occurs at every collision and not only in the end on the history. The breeding factor is calculated simultaneously with the space distribution of neutron worth in the system relative to the fission process and neutron flux. Efficiency of the described procedure has been tested on the calculation of the breeding factor for the Godiva assembly, simulating a fast reactor with a hard spectrum. A high accuracy of calculations at moderate number of zones in the core and reasonable statistics has been stated

Teaching Improvement Model Designed with DEA Method and Management Matrix

Science.gov (United States)

Montoneri, Bernard

2014-01-01

This study uses student evaluation of teachers to design a teaching improvement matrix based on teaching efficiency and performance by combining management matrix and data envelopment analysis. This matrix is designed to formulate suggestions to improve teaching. The research sample consists of 42 classes of freshmen following a course of English…

Two-Stage Design Method for Enhanced Inductive Energy Transmission with Q-Constrained Planar Square Loops.

Directory of Open Access Journals (Sweden)

Akaa Agbaeze Eteng

Full Text Available Q-factor constraints are usually imposed on conductor loops employed as proximity range High Frequency Radio Frequency Identification (HF-RFID reader antennas to ensure adequate data bandwidth. However, pairing such low Q-factor loops in inductive energy transmission links restricts the link transmission performance. The contribution of this paper is to assess the improvement that is reached with a two-stage design method, concerning the transmission performance of a planar square loop relative to an initial design, without compromise to a Q-factor constraint. The first stage of the synthesis flow is analytical in approach, and determines the number and spacing of turns by which coupling between similar paired square loops can be enhanced with low deviation from the Q-factor limit presented by an initial design. The second stage applies full-wave electromagnetic simulations to determine more appropriate turn spacing and widths to match the Q-factor constraint, and achieve improved coupling relative to the initial design. Evaluating the design method in a test scenario yielded a more than 5% increase in link transmission efficiency, as well as an improvement in the link fractional bandwidth by more than 3%, without violating the loop Q-factor limit. These transmission performance enhancements are indicative of a potential for modifying proximity HF-RFID reader antennas for efficient inductive energy transfer and data telemetry links.

Empirical method for matrix effects correction in liquid samples

International Nuclear Information System (INIS)

Vigoda de Leyt, Dora; Vazquez, Cristina

1987-01-01

A simple method for the determination of Cr, Ni and Mo in stainless steels is presented. In order to minimize the matrix effects, the conditions of liquid system to dissolve stainless steels chips has been developed. Pure element solutions were used as standards. Preparation of synthetic solutions with all the elements of steel and also mathematic corrections are avoided. It results in a simple chemical operation which simplifies the method of analysis. The variance analysis of the results obtained with steel samples show that the three elements may be determined from the comparison with the analytical curves obtained with the pure elements if the same parameters in the calibration curves are used. The accuracy and the precision were checked against other techniques using the British Chemical Standards of the Bureau of Anlysed Samples Ltd. (England). (M.E.L.) [es

Love waves in functionally graded piezoelectric materials by stiffness matrix method.

Science.gov (United States)

Ben Salah, Issam; Wali, Yassine; Ben Ghozlen, Mohamed Hédi

2011-04-01

A numerical matrix method relative to the propagation of ultrasonic guided waves in functionally graded piezoelectric heterostructure is given in order to make a comparative study with the respective performances of analytical methods proposed in literature. The preliminary obtained results show a good agreement, however numerical approach has the advantage of conceptual simplicity and flexibility brought about by the stiffness matrix method. The propagation behaviour of Love waves in a functionally graded piezoelectric material (FGPM) is investigated in this article. It involves a thin FGPM layer bonded perfectly to an elastic substrate. The inhomogeneous FGPM heterostructure has been stratified along the depth direction, hence each state can be considered as homogeneous and the ordinary differential equation method is applied. The obtained solutions are used to study the effect of an exponential gradient applied to physical properties. Such numerical approach allows applying different gradient variation for mechanical and electrical properties. For this case, the obtained results reveal opposite effects. The dispersive curves and phase velocities of the Love wave propagation in the layered piezoelectric film are obtained for electrical open and short cases on the free surface, respectively. The effect of gradient coefficients on coupled electromechanical factor, on the stress fields, the electrical potential and the mechanical displacement are discussed, respectively. Illustration is achieved on the well known heterostructure PZT-5H/SiO(2), the obtained results are especially useful in the design of high-performance acoustic surface devices and accurately prediction of the Love wave propagation behaviour. Copyright © 2010 Elsevier B.V. All rights reserved.

The nuclear reaction matrix

International Nuclear Information System (INIS)

Krenciglowa, E.M.; Kung, C.L.; Kuo, T.T.S.; Osnes, E.; and Department of Physics, State University of New York at Stony Brook, Stony Brook, New York 11794)

1976-01-01

Different definitions of the reaction matrix G appropriate to the calculation of nuclear structure are reviewed and discussed. Qualitative physical arguments are presented in support of a two-step calculation of the G-matrix for finite nuclei. In the first step the high-energy excitations are included using orthogonalized plane-wave intermediate states, and in the second step the low-energy excitations are added in, using harmonic oscillator intermediate states. Accurate calculations of G-matrix elements for nuclear structure calculations in the Aapprox. =18 region are performed following this procedure and treating the Pauli exclusion operator Q 2 /sub p/ by the method of Tsai and Kuo. The treatment of Q 2 /sub p/, the effect of the intermediate-state spectrum and the energy dependence of the reaction matrix are investigated in detail. The present matrix elements are compared with various matrix elements given in the literature. In particular, close agreement is obtained with the matrix elements calculated by Kuo and Brown using approximate methods

The classical r-matrix method for nonlinear sigma-model

OpenAIRE

Sevostyanov, Alexey

1995-01-01

The canonical Poisson structure of nonlinear sigma-model is presented as a Lie-Poisson r-matrix bracket on coadjoint orbits. It is shown that the Poisson structure of this model is determined by some `hidden singularities' of the Lax matrix.

New computational method for non-LTE, the linear response matrix

International Nuclear Information System (INIS)

Fournier, K.B.; Grasiani, F.R.; Harte, J.A.; Libby, S.B.; More, R.M.; Zimmerman, G.B.

1998-01-01

My coauthors have done extensive theoretical and computational calculations that lay the ground work for a linear response matrix method to calculate non-LTE (local thermodynamic equilibrium) opacities. I will give briefly review some of their work and list references. Then I will describe what has been done to utilize this theory to create a computational package to rapidly calculate mild non-LTE emission and absorption opacities suitable for use in hydrodynamic calculations. The opacities are obtained by performing table look-ups on data that has been generated with a non-LTE package. This scheme is currently under development. We can see that it offers a significant computational speed advantage. It is suitable for mild non-LTE, quasi-steady conditions. And it offers a new insertion path for high-quality non-LTE data. Currently, the linear response matrix data file is created using XSN. These data files could be generated by more detailed and rigorous calculations without changing any part of the implementation in the hydro code. The scheme is running in Lasnex and is being tested and developed

Determination of the transmission coefficients for quantum structures using FDTD method.

Science.gov (United States)

Peng, Yangyang; Wang, Xiaoying; Sui, Wenquan

2011-12-01

The purpose of this work is to develop a simple method to incorporate quantum effect in traditional finite-difference time-domain (FDTD) simulators. Witch could make it possible to co-simulate systems include quantum structures and traditional components. In this paper, tunneling transmission coefficient is calculated by solving time-domain Schrödinger equation with a developed FDTD technique, called FDTD-S method. To validate the feasibility of the method, a simple resonant tunneling diode (RTD) structure model has been simulated using the proposed method. The good agreement between the numerical and analytical results proves its accuracy. The effectness and accuracy of this approach makes it a potential method for analysis and design of hybrid systems includes quantum structures and traditional components.

The Influence of the Mounting Errors in RodToothed Transmissions

Directory of Open Access Journals (Sweden)

M. Yu. Sachkov

2015-01-01

Full Text Available In the paper we consider an approximate transmission. The work is aimed at development of gear-powered transmission on parallel axes, which is RF patent-protected. The paper justifies a relevance of the synthesis of new kinds of engagement with the simplified geometry of the contacting condition. A typical solution for powered mechanisms received by F. L. Livinin and his disciples is characterized.The paper describes the arrangement of the coordinate systems used to obtain the function of the position of the gear-powered transmission consisting of two wheels with fifteen leads. For them, also the coordinates of the contact points are obtained, and errors of function of the position in tooth changeover are calculated. To obtain the function position was used a method of matrix transformation and equality of radius and unit normal vectors at the contact point. This transmission can be used in mechanical and instrumentation engineering, and other sectors of the economy. Both reducers and multipliers can be made on its basis. It has high manufacturability (with no special equipment required for its production, and a displacement function is close to linear.This article describes the influence of the axle spacing error on the quality of the transmission characteristics. The paper presents the graphic based relationships and tabular estimates for nominal axle spacing and offsets within 0.2 mm. This error of axle spacing is significant for gearing. From the results of this work we can say that the transmission is almost insensitive to errors of axle spacing. Engagement occurs without an exit of contact point on the lead edge. To solve the obtained system of equations, the numerical methods of the software MathCAD package have been applied.In the future, the authors expect to consider other possible manufacturing and mounting errors of gear-powered transmission (such as the error of the step, misalignment, etc. to assess their impact on the quality

Shielding Effectiveness Analysis and Modification of the Coupling Effect Transmission Line Method on Cavities with Multi-Sided Apertures

Directory of Open Access Journals (Sweden)

Tao Hu

2018-04-01

Full Text Available Because the traditional transmission line method treats electromagnetic waves as excitation sources and the cavity as a rectangular waveguide whose terminal is shorted, the transmission line method can only calculate shielding effectiveness in the center line of the cavity with apertures on one side. In this paper, the aperture coupling effect of different sides was analyzed based on vector analysis. According to the field intensity distribution of different transport modes in the rectangular waveguide, the calculation model of cavity shielding effectiveness in any position is proposed, which can solve the question of the calculation model of shielding effectiveness in any position in the traditional method of equivalent transmission methods. Further expansion of the equivalent transmission lines model is adopted to study the shielding effectiveness of different aperture cavities, and the coupling effect rule of the incident angle, the number of apertures, and the size of the cavity is obtained, which can provide the technical support for the design of electromagnetic shielding cavities for electronic equipment.

Parallel R-matrix computation

International Nuclear Information System (INIS)

Heggarty, J.W.

1999-06-01

response to the challenge of achieving parallel R-matrix computation. The primary objective was to develop parallel codes, targeted at multicomputers, that are capable of performing R-matrix calculations hitherto intractable using classic supercomputers. In particular, Fortran implementations of two internal region methods (the R-matrix Floquet method and the two-dimensional R-matrix propagation method) and three external region methods (the Light-Walker propagation method, the Baluja, Burke and Morgan propagation method and the Variable Phase Method) from four widely utilised R-matrix packages were investigated to ascertain whether, in these cases, parallel R-matrix computation was practicable and, if so, to determine the most effective way to port such codes to contemporary multicomputers. When attempting to develop the parallel codes, a number of computer aided automatic parallelization tools were investigated. These were found to be inadequate. Consequently, a parallelization approach was developed to provide simple guidelines for manual parallelization. This parallelization approach proved effective and efficient parallel versions of the five R-matrix codes were successfully developed. (author)

Novel edge treatment method for improving the transmission reconstruction quality in Tomographic Gamma Scanning.

Science.gov (United States)

Han, Miaomiao; Guo, Zhirong; Liu, Haifeng; Li, Qinghua

2018-05-01

Tomographic Gamma Scanning (TGS) is a method used for the nondestructive assay of radioactive wastes. In TGS, the actual irregular edge voxels are regarded as regular cubic voxels in the traditional treatment method. In this study, in order to improve the performance of TGS, a novel edge treatment method is proposed that considers the actual shapes of these voxels. The two different edge voxel treatment methods were compared by computing the pixel-level relative errors and normalized mean square errors (NMSEs) between the reconstructed transmission images and the ideal images. Both methods were coupled with two different interative algorithms comprising Algebraic Reconstruction Technique (ART) with a non-negativity constraint and Maximum Likelihood Expectation Maximization (MLEM). The results demonstrated that the traditional method for edge voxel treatment can introduce significant error and that the real irregular edge voxel treatment method can improve the performance of TGS by obtaining better transmission reconstruction images. With the real irregular edge voxel treatment method, MLEM algorithm and ART algorithm can be comparable when assaying homogenous matrices, but MLEM algorithm is superior to ART algorithm when assaying heterogeneous matrices. Copyright © 2018 Elsevier Ltd. All rights reserved.

Transmission fingerprints in quasiperiodic magnonic multilayers

Energy Technology Data Exchange (ETDEWEB)

Coelho, I.P. [Departamento de Ensino Superior, Instituto Federal de Educacao, Ciencia e Tecnologia do Maranhao, Imperatriz-MA 65919-050 (Brazil); Departamento de Fisica, Universidade Federal do Rio Grande do Norte, Natal-RN 59072-970 (Brazil); Vasconcelos, M.S. [Escola de Ciencias e Tecnologia, Universidade Federal do Rio Grande do Norte, Natal-RN 59072-970 (Brazil); Bezerra, C.G., E-mail: cbezerra@dfte.ufrn.br [Departamento de Fisica, Universidade Federal do Rio Grande do Norte, Natal-RN 59072-970 (Brazil)

2011-12-15

In this paper we investigated the influence of mirror symmetry on the transmission spectra of quasiperiodic magnonic multilayers arranged according to Fibonacci, Thue-Morse and double period quasiperiodic sequences. We consider that the multilayers composed of two simple cubic Heisenberg ferromagnets with bulk exchange constants J{sub A} and J{sub B} and spin quantum numbers S{sub A} and S{sub B}, respectively. The multilayer structure is surrounded by two semi-infinite slabs of a third Heisenberg ferromagnetic material with exchange constant J{sub C} and spin quantum number S{sub C}. For simplicity, the lattice constant has the same value a in each material, corresponding to epitaxial growth at the interfaces. The transfer matrix treatment was used for the exchange-dominated regime, taking into account the random phase approximation (RPA). Our numerical results illustrate the effects of mirror symmetry on (i) transmission spectra and (ii) transmission fingerprints. - Highlights: > We model quasiperiodic magnetic multilayers presenting mirror symmetry. > We investigated the allowed and forbidden bands of magnonic transmission. > Transmission return maps show the influence of mirror symmetry. > Mirror symmetry has no effect on the Fibonacci case. > Mirror symmetry does have effect on the Thue-Morse and double period cases.

Transmission fingerprints in quasiperiodic magnonic multilayers

International Nuclear Information System (INIS)

Coelho, I.P.; Vasconcelos, M.S.; Bezerra, C.G.

2011-01-01

In this paper we investigated the influence of mirror symmetry on the transmission spectra of quasiperiodic magnonic multilayers arranged according to Fibonacci, Thue-Morse and double period quasiperiodic sequences. We consider that the multilayers composed of two simple cubic Heisenberg ferromagnets with bulk exchange constants J A and J B and spin quantum numbers S A and S B , respectively. The multilayer structure is surrounded by two semi-infinite slabs of a third Heisenberg ferromagnetic material with exchange constant J C and spin quantum number S C . For simplicity, the lattice constant has the same value a in each material, corresponding to epitaxial growth at the interfaces. The transfer matrix treatment was used for the exchange-dominated regime, taking into account the random phase approximation (RPA). Our numerical results illustrate the effects of mirror symmetry on (i) transmission spectra and (ii) transmission fingerprints. - Highlights: → We model quasiperiodic magnetic multilayers presenting mirror symmetry. → We investigated the allowed and forbidden bands of magnonic transmission. → Transmission return maps show the influence of mirror symmetry. → Mirror symmetry has no effect on the Fibonacci case. → Mirror symmetry does have effect on the Thue-Morse and double period cases.

Sound transmission through triple-panel structures lined with poroelastic materials

Science.gov (United States)

Liu, Yu

2015-03-01

In this paper, previous theories on the prediction of sound transmission loss for a double-panel structure lined with poroelastic materials are extended to address the problem of a triple-panel structure. Six typical configurations are considered for a triple-panel structure based on the method of coupling the porous layers to the facing panels which determines critically the sound insulation performance of the system. The transfer matrix method is employed to solve the system by applying appropriate types of boundary conditions for these configurations. The transmission loss of the triple-panel structures in a diffuse sound field is calculated as a function of frequency and compared with that of corresponding double-panel structures. Generally, the triple-panel structure with poroelastic linings has superior acoustic performance to the double-panel counterpart, remarkably in the mid-high frequency range and possibly at low frequencies, by selecting appropriate configurations in which those with two air gaps in the structure exhibit the best overall performance over the entire frequency range. The poroelastic lining significantly lowers the cut-on frequency above which the triple-panel structure exhibits noticeably higher transmission loss. Compared with a double-panel structure, the wider range of system parameters for a triple-panel structure due to the additional partition provides more design space for tuning the sound insulation performance. Despite the increased structural complexity, the triple-panel structure lined with poroelastic materials has the obvious advantages in sound transmission loss while without the penalties in weight and volume, and is hence a promising replacement for the widely used double-panel sandwich structure.

A Study of Transmission Control Method for Distributed Parameters Measurement in Large Factories and Storehouses

Directory of Open Access Journals (Sweden)

Shujing Su

2015-01-01

Full Text Available For the characteristics of parameters dispersion in large factories, storehouses, and other applications, a distributed parameter measurement system is designed that is based on the ring network. The structure of the system and the circuit design of the master-slave node are described briefly. The basic protocol architecture about transmission communication is introduced, and then this paper comes up with two kinds of distributed transmission control methods. Finally, the reliability, extendibility, and control characteristic of these two methods are tested through a series of experiments. Moreover, the measurement results are compared and discussed.

Radiation safety assessment of cobalt 60 external beam radiotherapy using the risk-matrix method

International Nuclear Information System (INIS)

Dumenigo, C; Vilaragut, J.J.; Ferro, R.; Guillen, A.; Ramirez, M.L.; Ortiz Lopez, P.; Rodriguez, M.; McDonnell, J.D.; Papadopulos, S.; Pereira, P.P.; Goncalvez, M.; Morales, J.; Larrinaga, E.; Lopez Morones, R.; Sanchez, R.; Delgado, J.M.; Sanchez, C.; Somoano, F.

2008-01-01

External beam radiotherapy is the only practice in which humans are placed directly in a radiation beam with the intention to deliver a very high dose. This is why safety in radiotherapy is very critical, and is a matter of interest to both radiotherapy departments and regulatory bodies. Accidental exposures have occurred throughout the world, thus showing the need for systematic safety assessments, capable to identify preventive measures and to minimize consequences of accidental exposure. Risk-matrix is a systematic approach which combines the relevant event features to assess the overall risk of each particular event. Once an event sequence is identified, questions such as how frequent the event, how severe the potential consequences and how reliable the existing safety measures are answered in a risk-matrix table. The ultimate goal is to achieve that the overall risk for events with severe consequences should always be low o very low. In the present study, the risk-matrix method has been applied to an hypothetical radiotherapy department, which could be equivalent to an upper level hospital of the Ibero American region, in terms of safety checks and preventive measures. The application of the method has identified 76 event sequences and revealed that the hypothetical radiotherapy department is sufficiently protected (low risk) against them, including 23 event sequences with severe consequences. The method has revealed that the risk of these sequences could grow to high level if certain specific preventive measures were degraded with time. This study has identified these preventive measures, thus facilitating a rational allocation of resources in regular controls to detect any loss of reliability. The method has proven to have an important practical value and is affordable at hospital level. The elaborated risk-matrix can be easily adapted to local circumstances, in terms of existing controls and safety measures. This approach can help hospitals to identify

Optimized Projection Matrix for Compressive Sensing

Directory of Open Access Journals (Sweden)

Jianping Xu

2010-01-01

Full Text Available Compressive sensing (CS is mainly concerned with low-coherence pairs, since the number of samples needed to recover the signal is proportional to the mutual coherence between projection matrix and sparsifying matrix. Until now, papers on CS always assume the projection matrix to be a random matrix. In this paper, aiming at minimizing the mutual coherence, a method is proposed to optimize the projection matrix. This method is based on equiangular tight frame (ETF design because an ETF has minimum coherence. It is impossible to solve the problem exactly because of the complexity. Therefore, an alternating minimization type method is used to find a feasible solution. The optimally designed projection matrix can further reduce the necessary number of samples for recovery or improve the recovery accuracy. The proposed method demonstrates better performance than conventional optimization methods, which brings benefits to both basis pursuit and orthogonal matching pursuit.

A method of mobile video transmission based on J2ee

Science.gov (United States)

Guo, Jian-xin; Zhao, Ji-chun; Gong, Jing; Chun, Yang

2013-03-01

As 3G (3rd-generation) networks evolve worldwide, the rising demand for mobile video services and the enormous growth of video on the internet is creating major new revenue opportunities for mobile network operators and application developers. The text introduced a method of mobile video transmission based on J2ME, giving the method of video compressing, then describing the video compressing standard, and then describing the software design. The proposed mobile video method based on J2EE is a typical mobile multimedia application, which has a higher availability and a wide range of applications. The users can get the video through terminal devices such as phone.

Methods for converging correlation energies within the dielectric matrix formalism

Science.gov (United States)

Dixit, Anant; Claudot, Julien; Gould, Tim; Lebègue, Sébastien; Rocca, Dario

2018-03-01

Within the dielectric matrix formalism, the random-phase approximation (RPA) and analogous methods that include exchange effects are promising approaches to overcome some of the limitations of traditional density functional theory approximations. The RPA-type methods however have a significantly higher computational cost, and, similarly to correlated quantum-chemical methods, are characterized by a slow basis set convergence. In this work we analyzed two different schemes to converge the correlation energy, one based on a more traditional complete basis set extrapolation and one that converges energy differences by accounting for the size-consistency property. These two approaches have been systematically tested on the A24 test set, for six points on the potential-energy surface of the methane-formaldehyde complex, and for reaction energies involving the breaking and formation of covalent bonds. While both methods converge to similar results at similar rates, the computation of size-consistent energy differences has the advantage of not relying on the choice of a specific extrapolation model.

Matrix mineralogy of the Lance CO3 carbonaceous chondrite - A transmission electron microscope study

Science.gov (United States)

Keller, Lindsay P.; Buseck, Peter R.

1990-01-01

Results are presented on electron microprobe analyses of three CO chondrites, all of which are falls: Lance, Kainsaz, and Warrenton. The TEM mineralogy results of Lance chondrite show that Fe-rich matrix olivines have been altered to Fe-bearing serpentine and Fe(3+) oxide; matrix metal was also altered to produce Fe(3+) oxides, leaving the residual metal enriched in Ni. Olivine grains in Lance's matrix contain channels along their 100-line and 001-line directions; the formation and convergence of such channels resulted in a grain-size reduction of the olivine. A study of Kainsaz and Warrenton showed that these meteorites do not contain phyllosilicates in their matrices, although both contain Fe(3+) oxide between olivine grains. It is suggested that, prior to its alteration, Lance probably resembled Kainsaz, an unaltered CO3 chondrite.

Towards a many-body theory for the combined elastic and inelastic transmission through a single molecule

International Nuclear Information System (INIS)

Petrov, E.G.

2006-01-01

Based on the nonequilibrium density matrix method, a unified approach to describe tunnel and sequential components of the current mediated by a molecule embedded in between the electrodes is proposed. It is shown that inelastic hopping processes not only form a sequential current component but simultaneously lead to molecular recharge. As the efficiency of a tunnel transmission depends strongly on a charge state of the molecule, the inelastic transfer processes can modify the elastic tunnel transmission via the alternation of the number of extra electrons at the molecule. Detailed analysis of the current-voltage characteristics has been carried out for a molecule with a single reaction level. The analytic expressions have been derived for both sequential (inelastic) and tunnel (elastic) current components, and the role of molecular recharge in the formation of specific transmission channels has been clarified

Efficient design of multituned transmission line NMR probes: the electrical engineering approach.

Science.gov (United States)

Frydel, J A; Krzystyniak, M; Pienkowski, D; Pietrzak, M; de Sousa Amadeu, N; Ratajczyk, T; Idzik, K; Gutmann, T; Tietze, D; Voigt, S; Fenn, A; Limbach, H H; Buntkowsky, G

2011-01-01

Transmission line-based multi-channel solid state NMR probes have many advantages regarding the cost of construction, number of RF-channels, and achievable RF-power levels. Nevertheless, these probes are only rarely employed in solid state-NMR-labs, mainly owing to the difficult experimental determination of the necessary RF-parameters. Here, the efficient design of multi-channel solid state MAS-NMR probes employing transmission line theory and modern techniques of electrical engineering is presented. As technical realization a five-channel ((1)H, (31)P, (13)C, (2)H and (15)N) probe for operation at 7 Tesla is described. This very cost efficient design goal is a multi port single coil transmission line probe based on the design developed by Schaefer and McKay. The electrical performance of the probe is determined by measuring of Scattering matrix parameters (S-parameters) in particular input/output ports. These parameters are compared to the calculated parameters of the design employing the S-matrix formalism. It is shown that the S-matrix formalism provides an excellent tool for examination of transmission line probes and thus the tool for a rational design of these probes. On the other hand, the resulting design provides excellent electrical performance. From a point of view of Nuclear Magnetic Resonance (NMR), calibration spectra of particular ports (channels) are of great importance. The estimation of the π/2 pulses length for all five NMR channels is presented. Copyright © 2011 Elsevier Inc. All rights reserved.

A Matrix-Based Proactive Data Relay Algorithm for Large Distributed Sensor Networks.

Science.gov (United States)

Xu, Yang; Hu, Xuemei; Hu, Haixiao; Liu, Ming

2016-08-16

In large-scale distributed sensor networks, sensed data is required to be relayed around the network so that one or few sensors can gather adequate relative data to produce high quality information for decision-making. In regards to very high energy-constraint sensor nodes, data transmission should be extremely economical. However, traditional data delivery protocols are potentially inefficient relaying unpredictable sensor readings for data fusion in large distributed networks for either overwhelming query transmissions or unnecessary data coverage. By building sensors' local model from their previously transmitted data in three matrixes, we have developed a novel energy-saving data relay algorithm, which allows sensors to proactively make broadcast decisions by using a neat matrix computation to provide balance between transmission and energy-saving. In addition, we designed a heuristic maintenance algorithm to efficiently update these three matrices. This can easily be deployed to large-scale mobile networks in which decisions of sensors are based on their local matrix models no matter how large the network is, and the local models of these sensors are updated constantly. Compared with some traditional approaches based on our simulations, the efficiency of this approach is manifested in uncertain environment. The results show that our approach is scalable and can effectively balance aggregating data with minimizing energy consumption.

Matrix elements and few-body calculations within the unitary correlation operator method

International Nuclear Information System (INIS)

Roth, R.; Hergert, H.; Papakonstantinou, P.

2005-01-01

We employ the unitary correlation operator method (UCOM) to construct correlated, low-momentum matrix elements of realistic nucleon-nucleon interactions. The dominant short-range central and tensor correlations induced by the interaction are included explicitly by an unitary transformation. Using correlated momentum-space matrix elements of the Argonne V18 potential, we show that the unitary transformation eliminates the strong off-diagonal contributions caused by the short-range repulsion and the tensor interaction and leaves a correlated interaction dominated by low-momentum contributions. We use correlated harmonic oscillator matrix elements as input for no-core shell model calculations for few-nucleon systems. Compared to the bare interaction, the convergence properties are dramatically improved. The bulk of the binding energy can already be obtained in very small model spaces or even with a single Slater determinant. Residual long-range correlations, not treated explicitly by the unitary transformation, can easily be described in model spaces of moderate size allowing for fast convergence. By varying the range of the tensor correlator we are able to map out the Tjon line and can in turn constrain the optimal correlator ranges. (orig.)

Matrix elements and few-body calculations within the unitary correlation operator method

International Nuclear Information System (INIS)

Roth, R.; Hergert, H.; Papakonstantinou, P.; Neff, T.; Feldmeier, H.

2005-01-01

We employ the unitary correlation operator method (UCOM) to construct correlated, low-momentum matrix elements of realistic nucleon-nucleon interactions. The dominant short-range central and tensor correlations induced by the interaction are included explicitly by an unitary transformation. Using correlated momentum-space matrix elements of the Argonne V18 potential, we show that the unitary transformation eliminates the strong off-diagonal contributions caused by the short-range repulsion and the tensor interaction and leaves a correlated interaction dominated by low-momentum contributions. We use correlated harmonic oscillator matrix elements as input for no-core shell model calculations for few-nucleon systems. Compared to the bare interaction, the convergence properties are dramatically improved. The bulk of the binding energy can already be obtained in very small model spaces or even with a single Slater determinant. Residual long-range correlations, not treated explicitly by the unitary transformation, can easily be described in model spaces of moderate size allowing for fast convergence. By varying the range of the tensor correlator we are able to map out the Tjon line and can in turn constrain the optimal correlator ranges

Hamiltonian formalism, quantization and S matrix for supergravity. [S matrix, canonical constraints

Energy Technology Data Exchange (ETDEWEB)

Fradkin, E S; Vasiliev, M A [AN SSSR, Moscow. Fizicheskij Inst.

1977-12-05

The canonical formalism for supergravity is constructed. The algebra of canonical constraints is found. The correct expression for the S matrix is obtained. Usual 'covariant methods' lead to an incorrect S matrix in supergravity since a new four-particle interaction of ghostfields survives in the Lagrangian expression of the S matrix.

A Simple DTC-SVM method for Matrix Converter Drives Using a Deadbeat Scheme

DEFF Research Database (Denmark)

Lee, Kyo-Beum; Blaabjerg, Frede; Lee, Kwang-Won

2005-01-01

In this paper, a simple direct torque control (DTC) method for sensorless matrix converter drives is proposed, which is characterized by a simple structure, minimal torque ripple and unity input power factor. Also a good sensorless speed-control performance in the low speed operation is obtained,...

Charge-constrained auxiliary-density-matrix methods for the Hartree–Fock exchange contribution

DEFF Research Database (Denmark)

Merlot, Patrick; Izsak, Robert; Borgoo, Alex

2014-01-01

Three new variants of the auxiliary-density-matrix method (ADMM) of Guidon, Hutter, and VandeVondele [J. Chem. Theory Comput. 6, 2348 (2010)] are presented with the common feature thatthey have a simplified constraint compared with the full orthonormality requirement of the earlier ADMM1 method. ....... All ADMM variants are tested for accuracy and performance in all-electron B3LYP calculations with several commonly used basis sets. The effect of the choice of the exchange functional for the ADMM exchange–correction term is also investigated....

Transmission character of general function photonic crystals

Science.gov (United States)

Wu, Xiang-Yao; Zhang, Bo-Jun; Yang, Jing-Hai; Zhang, Si-Qi; Liu, Xiao-Jing; Wang, Jing; Ba, Nuo; Hua, Zhong; Yin, Xin-Guo

2012-08-01

In the paper, we present a new general function photonic crystals (GFPCs), whose refractive index of medium is a arbitrary function of space position. Unlike conventional photonic crystals (PCs), whose structure grows from two mediums A and B, with different constant refractive indexes na and nb. Based on the Fermat principle, we give the motion equations of light in one-dimensional GFPCs, and calculate its transfer matrix, which is different from the conventional PCs. We choose the linearity refractive index function for two mediums A and B, and find the transmissivity of one-dimensional GFPCs can be much larger or smaller than 1 for different slope linearity refractive index functions, which are different from the transmissivity of conventional PCs (its transmissivity is in the range of 0 and 1). Otherwise, we study the effect of different incident angles, the number of periods and optical thickness on the transmissivity, and obtain some new results different from the conventional PCs.

Evaluation of Mechanical Properties of Nonsteroidal Anti-Inflammatory Matrix Type Transdermal Therapeutic Systems

Directory of Open Access Journals (Sweden)

Antonoaea Paula

2017-06-01

Full Text Available Objective: Transdermal therapeutic systems (TTSs represent an intensely studied alternative to oral delivery of non-steroid anti-inflammatory drugs (NSAIDs in the treatment of rheumatic diseases due to its ability of avoiding the side effects of the oral route. This study aims to present the evaluation of the mechanical properties of three NSAIDs (meloxicam, tenoxicam and indomethacin individually included in four type of polymeric matrixes, as part of new formulations development process. Methods: 12 products in form of TTS matrixes were prepared by solvent casting evaporation technique, using hydroxypropyl methylcellulose (HPMC 15000, HPMC E5 and/or ethylcellulose as matrix-forming polymers. Each of the resulted products was evaluated by determining the water vapor absorption, desorption or transmission in controlled atmosphere humidity (evaluation of porosity; the elongation capacity, tensile strength and bioadhesiveness (evaluation of mechanical properties. Results: The analysis of three groups of the experimental data expressed as averages on each group was necessary, in order to identify the parameters which statistically are critically influenced by the ingredients associated in the TTSs matrix compositions. Analysis by normality tests, variance and correlation tests (Anova, Pearson enabled evaluation of the effect of NSAID type vs. the effect of polymer matrix type on the parameters of the NSAID TTS matrix. Conclusions: Meloxicam incorporated in the structure of HPMC 15000 polymeric matrix favors its viscoelastic structure. Ethylcellulose functions as plasticizer and supports the matrix bioadhesiveness. HPMC E5 does not meet the requirements for TTS preparation in the used experimental conditions.

Vibration analysis of pipes conveying fluid by transfer matrix method

International Nuclear Information System (INIS)

Li, Shuai-jun; Liu, Gong-min; Kong, Wei-tao

2014-01-01

Highlights: • A theoretical study on vibration analysis of pipes with FSI is presented. • Pipelines with high fluid pressure and velocity can be solved by developed method. • Several pipeline schemes are discussed to illustrate the application of the method. • The proposed method is easier to apply compared to most existing procedures. • Influence laws of structural and fluid parameters on FSI of pipe are analyzed. -- Abstract: Considering the effects of pipe wall thickness, fluid pressure and velocity, a developed 14-equation model is presented, which describes the fluid–structure interaction behavior of pipelines. The transfer matrix method has been used for numerical modeling of both hydraulic and structural equations. Based on these models and algorithms, several pipeline schemes are presented to illustrate the application of the proposed method. Furthermore, the influence laws of supports, structural properties and fluid parameters on the dynamic response and natural frequencies of pipeline are analyzed, which shows using the optimal supports and structural properties is beneficial to reduce vibration of pipelines

A pseudospectral matrix method for time-dependent tensor fields on a spherical shell

International Nuclear Information System (INIS)

Brügmann, Bernd

2013-01-01

We construct a pseudospectral method for the solution of time-dependent, non-linear partial differential equations on a three-dimensional spherical shell. The problem we address is the treatment of tensor fields on the sphere. As a test case we consider the evolution of a single black hole in numerical general relativity. A natural strategy would be the expansion in tensor spherical harmonics in spherical coordinates. Instead, we consider the simpler and potentially more efficient possibility of a double Fourier expansion on the sphere for tensors in Cartesian coordinates. As usual for the double Fourier method, we employ a filter to address time-step limitations and certain stability issues. We find that a tensor filter based on spin-weighted spherical harmonics is successful, while two simplified, non-spin-weighted filters do not lead to stable evolutions. The derivatives and the filter are implemented by matrix multiplication for efficiency. A key technical point is the construction of a matrix multiplication method for the spin-weighted spherical harmonic filter. As example for the efficient parallelization of the double Fourier, spin-weighted filter method we discuss an implementation on a GPU, which achieves a speed-up of up to a factor of 20 compared to a single core CPU implementation

Computing wave functions in multichannel collisions with non-local potentials using the R-matrix method

Science.gov (United States)

Bonitati, Joey; Slimmer, Ben; Li, Weichuan; Potel, Gregory; Nunes, Filomena

2017-09-01

The calculable form of the R-matrix method has been previously shown to be a useful tool in approximately solving the Schrodinger equation in nuclear scattering problems. We use this technique combined with the Gauss quadrature for the Lagrange-mesh method to efficiently solve for the wave functions of projectile nuclei in low energy collisions (1-100 MeV) involving an arbitrary number of channels. We include the local Woods-Saxon potential, the non-local potential of Perey and Buck, a Coulomb potential, and a coupling potential to computationally solve for the wave function of two nuclei at short distances. Object oriented programming is used to increase modularity, and parallel programming techniques are introduced to reduce computation time. We conclude that the R-matrix method is an effective method to predict the wave functions of nuclei in scattering problems involving both multiple channels and non-local potentials. Michigan State University iCER ACRES REU.

On the Numerical Behavior of Matrix Splitting Iteration Methods for Solving Linear Systems

Czech Academy of Sciences Publication Activity Database

Bai, Z.-Z.; Rozložník, Miroslav

2015-01-01

Roč. 53, č. 4 (2015), s. 1716-1737 ISSN 0036-1429 R&D Projects: GA ČR GA13-06684S Institutional support: RVO:67985807 Keywords : matrix splitting * stationary iteration method * backward error * rounding error analysis Subject RIV: BA - General Mathematics Impact factor: 1.899, year: 2015

Distance descending ordering method: An O(n) algorithm for inverting the mass matrix in simulation of macromolecules with long branches

Science.gov (United States)

Xu, Xiankun; Li, Peiwen

2017-11-01

Fixman's work in 1974 and the follow-up studies have developed a method that can factorize the inverse of mass matrix into an arithmetic combination of three sparse matrices-one of them is positive definite and needs to be further factorized by using the Cholesky decomposition or similar methods. When the molecule subjected to study is of serial chain structure, this method can achieve O (n) time complexity. However, for molecules with long branches, Cholesky decomposition about the corresponding positive definite matrix will introduce massive fill-in due to its nonzero structure. Although there are several methods can be used to reduce the number of fill-in, none of them could strictly guarantee for zero fill-in for all molecules according to our test, and thus cannot obtain O (n) time complexity by using these traditional methods. In this paper we present a new method that can guarantee for no fill-in in doing the Cholesky decomposition, which was developed based on the correlations between the mass matrix and the geometrical structure of molecules. As a result, the inverting of mass matrix will remain the O (n) time complexity, no matter the molecule structure has long branches or not.

Matrix-operator method for calculation of dynamics of intense beams of charged particles

International Nuclear Information System (INIS)

Kapchinskij, M.I.; Korenev, I.L.; Rinskij, L.A.

1989-01-01

Calculation algorithm for particle dynamics in high-current cyclic and linear accelerators is suggested. Particle movement in six-dimensional phase space is divided into coherent and incoherent components. Incoherent movement is described by envelope method; particle cluster is considered to be even-charged by tri-axial ellipsoid. Coherent movement is described in para-axial approximation; each structure element of the accelerator transport channel is characterized by six-dimensional matrix of phase coordinate transformation of cluster centre and by shift vector resulting from deviation of focusing element parameters from calculated values. Effect of space charge reflected forces is taken into account in the element matrix. Algorithm software is realized using well-known TRANSPORT program

Addressable Inverter Matrix Tests Integrated-Circuit Wafer

Science.gov (United States)

Buehler, Martin G.

1988-01-01

Addressing elements indirectly through shift register reduces number of test probes. With aid of new technique, complex test structure on silicon wafer tested with relatively small number of test probes. Conserves silicon area by reduction of area devoted to pads. Allows thorough evaluation of test structure characteristics and of manufacturing process parameters. Test structure consists of shift register and matrix of inverter/transmission-gate cells connected to two-by-ten array of probe pads. Entire pattern contained in square area having only 1.6-millimeter sides. Shift register is conventional static CMOS device using inverters and transmission gates in master/slave D flip-flop configuration.

Analysis of Crystallographic Structure of a Japanese Sword by the Pulsed Neutron Transmission Method

Science.gov (United States)

Kino, K.; Ayukawa, N.; Kiyanagi, Y.; Uchida, T.; Uno, S.; Grazzi, F.; Scherillo, A.

We measured two-dimensional transmission spectra of pulsed neutron beams for a Japanese sword sample. Atom density, crystalline size, and preferred orientation of crystals were obtained using the RITS code. The position dependence of the atomic density is consistent with the shape of the sample. The crystalline size is very small and shows position dependence, which is understood by the unique structure of Japanese swords. The preferred orientation has strong position dependence. Our study shows the usefulness of the pulsed neutron transmission method for cultural metal artifacts.

A Novel Method of Autonomous Inspection for Transmission Line based on Cable Inspection Robot LiDAR Data

Directory of Open Access Journals (Sweden)

Xinyan Qin

2018-02-01

Full Text Available With the growth of the national economy, there is increasing demand for electricity, which forces transmission line corridors to become structurally complicated and extend to complex environments (e.g., mountains, forests. It is a great challenge to inspect transmission line in these regions. To address these difficulties, a novel method of autonomous inspection for transmission line is proposed based on cable inspection robot (CIR LiDAR data, which mainly includes two steps: preliminary inspection and autonomous inspection. In preliminary inspection, the position and orientation system (POS data is used for original point cloud dividing, ground point filtering, and structured partition. A hierarchical classification strategy is established to identify the classes and positions of the abnormal points. In autonomous inspection, CIR can autonomously reach the specified points through inspection planning. These inspection targets are imaged with PTZ (pan, tilt, zoom cameras by coordinate transformation. The feasibility and effectiveness of the proposed method are verified by test site experiments and actual line experiments, respectively. The proposed method greatly reduces manpower and improves inspection accuracy, providing a theoretical basis for intelligent inspection of transmission lines in the future.

Hartree--Fock density matrix equation

International Nuclear Information System (INIS)

Cohen, L.; Frishberg, C.

1976-01-01

An equation for the Hartree--Fock density matrix is discussed and the possibility of solving this equation directly for the density matrix instead of solving the Hartree--Fock equation for orbitals is considered. Toward that end the density matrix is expanded in a finite basis to obtain the matrix representative equation. The closed shell case is considered. Two numerical schemes are developed and applied to a number of examples. One example is given where the standard orbital method does not converge while the method presented here does

The establishment of the method of three dimension volumetric fusion of emission and transmission images for PET imaging

International Nuclear Information System (INIS)

Zhang Xiangsong; He Zuoxiang

2004-01-01

Objective: To establish the method of three dimension volumetric fusion of emission and transmission images for PET imaging. Methods: The volume data of emission and transmission images acquired with Siemens ECAT HR + PET scanner were transferred to PC computer by local area network. The PET volume data were converted into 8 bit byte type, and scaled to the range of 0-255. The data coordinates of emission and transmission images were normalized by three-dimensional coordinate conversion in the same way. The images were fused with the mode of alpha-blending. The accuracy of image fusion was confirmed by its clinical application in 13 cases. Results: The three dimension volumetric fusion of emission and transmission images clearly displayed the silhouette and anatomic configuration in chest, including chest wall, lung, heart, mediastinum, et al. Forty-eight lesions in chest in 13 cases were accurately located by the image fusion. Conclusions: The volume data of emission and transmission images acquired with Siemens ECAT HR + PET scanner have the same data coordinate. The three dimension fusion software can conveniently used for the three dimension volumetric fusion of emission and transmission images, and also can correctly locate the lesions in chest

A Novel Method to Implement the Matrix Pencil Super Resolution Algorithm for Indoor Positioning

Directory of Open Access Journals (Sweden)

Tariq Jamil Saifullah Khanzada

2011-10-01

Full Text Available This article highlights the estimation of the results for the algorithms implemented in order to estimate the delays and distances for the indoor positioning system. The data sets for the transmitted and received signals are captured at a typical outdoor and indoor area. The estimation super resolution algorithms are applied. Different state of art and super resolution techniques based algorithms are applied to avail the optimal estimates of the delays and distances between the transmitted and received signals and a novel method for matrix pencil algorithm is devised. The algorithms perform variably at different scenarios of transmitted and received positions. Two scenarios are experienced, for the single antenna scenario the super resolution techniques like ESPRIT (Estimation of Signal Parameters via Rotational Invariance Technique and theMatrix Pencil algorithms give optimal performance compared to the conventional techniques. In two antenna scenario RootMUSIC and Matrix Pencil algorithm performed better than other algorithms for the distance estimation, however, the accuracy of all the algorithms is worst than the single antenna scenario. In all cases our devised Matrix Pencil algorithm achieved the best estimation results.

A transfer matrix method for the analysis of fractal quantum potentials

International Nuclear Information System (INIS)

Monsoriu, Juan A; Villatoro, Francisco R; Marin, Maria J; UrchueguIa, Javier F; Cordoba, Pedro Fernandez de

2005-01-01

The scattering properties of quantum particles on a sequence of potentials converging towards a fractal one are obtained by means of the transfer matrix method. The reflection coefficients for both the fractal potential and finite periodic potential are calculated and compared. It is shown that the reflection coefficient for the fractal potential has a self-similar structure associated with the fractal distribution of the potential whose degree of self-similarity has been quantified by means of the correlation function

A transfer matrix method for the analysis of fractal quantum potentials

Energy Technology Data Exchange (ETDEWEB)

Monsoriu, Juan A [Departamento de Fisica Aplicada, Universidad Politecnica de Valencia, E-46022 Valencia (Spain); Villatoro, Francisco R [Departamento de Lenguajes y Ciencias de la Computacion, Universidad de Malaga, E-29071 Malaga (Spain); Marin, Maria J [Departamento de Termodinamica, Universitat de Valencia, E-46100 Burjassot (Spain); UrchueguIa, Javier F [Departamento de Fisica Aplicada, Universidad Politecnica de Valencia, E-46022 Valencia (Spain); Cordoba, Pedro Fernandez de [Departamento de Matematica Aplicada, Universidad Politecnica de Valencia, E-46022 Valencia (Spain)

2005-07-01

The scattering properties of quantum particles on a sequence of potentials converging towards a fractal one are obtained by means of the transfer matrix method. The reflection coefficients for both the fractal potential and finite periodic potential are calculated and compared. It is shown that the reflection coefficient for the fractal potential has a self-similar structure associated with the fractal distribution of the potential whose degree of self-similarity has been quantified by means of the correlation function.

Carbonate fuel cell matrix

Science.gov (United States)

Farooque, Mohammad; Yuh, Chao-Yi

1996-01-01

A carbonate fuel cell matrix comprising support particles and crack attenuator particles which are made platelet in shape to increase the resistance of the matrix to through cracking. Also disclosed is a matrix having porous crack attenuator particles and a matrix whose crack attenuator particles have a thermal coefficient of expansion which is significantly different from that of the support particles, and a method of making platelet-shaped crack attenuator particles.

A Secondary Voltage Control Method for an AC/DC Coupled Transmission System Based on Model Predictive Control

DEFF Research Database (Denmark)

Xu, Fengda; Guo, Qinglai; Sun, Hongbin

2015-01-01

For an AC/DC coupled transmission system, the change of transmission power on the DC lines will significantly influence the AC systems’ voltage. This paper describes a method to coordinated control the reactive power of power plants and shunt capacitors at DC converter stations nearby, in order t...

Non-negative Matrix Factorization for Binary Data

DEFF Research Database (Denmark)

Larsen, Jacob Søgaard; Clemmensen, Line Katrine Harder

We propose the Logistic Non-negative Matrix Factorization for decomposition of binary data. Binary data are frequently generated in e.g. text analysis, sensory data, market basket data etc. A common method for analysing non-negative data is the Non-negative Matrix Factorization, though...... this is in theory not appropriate for binary data, and thus we propose a novel Non-negative Matrix Factorization based on the logistic link function. Furthermore we generalize the method to handle missing data. The formulation of the method is compared to a previously proposed method (Tome et al., 2015). We compare...... the performance of the Logistic Non-negative Matrix Factorization to Least Squares Non-negative Matrix Factorization and Kullback-Leibler (KL) Non-negative Matrix Factorization on sets of binary data: a synthetic dataset, a set of student comments on their professors collected in a binary term-document matrix...

Extending the Matrix Element Method beyond the Born approximation: calculating event weights at next-to-leading order accuracy

International Nuclear Information System (INIS)

Martini, Till; Uwer, Peter

2015-01-01

In this article we illustrate how event weights for jet events can be calculated efficiently at next-to-leading order (NLO) accuracy in QCD. This is a crucial prerequisite for the application of the Matrix Element Method in NLO. We modify the recombination procedure used in jet algorithms, to allow a factorisation of the phase space for the real corrections into resolved and unresolved regions. Using an appropriate infrared regulator the latter can be integrated numerically. As illustration, we reproduce differential distributions at NLO for two sample processes. As further application and proof of concept, we apply the Matrix Element Method in NLO accuracy to the mass determination of top quarks produced in e"+e"− annihilation. This analysis is relevant for a future Linear Collider. We observe a significant shift in the extracted mass depending on whether the Matrix Element Method is used in leading or next-to-leading order.

A new method to determine in situ the transmission of a neutron-guide system at a reactor source

CERN Document Server

Haan, V O D; Gommers, R M; Labohm, F; Well, A A V; De Leege, P F A; Schebetov, A; Pusenkov, V

2002-01-01

In this paper, a description of a new method to determine the transmission of neutron guides after they are installed in a beam-tube at a reactor source is given. The method is based on activation measurements of gold foils at the entrance of the beam-tube and at the exit of the neutron guides compared to Monte-Carlo calculations. In this method, a quality factor is defined as the ratio between the actual transmission and the theoretical maximum attainable transmission. This method is used to determine the quality of an optimised neutron-guide system developed for beam-tube R2 of the HOR. The HOR is a pool-type nuclear research reactor at the Interfaculty Reactor Institute of the Delft University of Technology. It is shown that the quality factors of the newly installed neutron guides are between 0.49 and 0.63.

A new method to determine in situ the transmission of a neutron-guide system at a reactor source

International Nuclear Information System (INIS)

Haan, V.O. de; Gibcus, H.P.M.; Gommers, R.M.; Labohm, F.; Well, A.A. van; Leege, P.F.A. de; Schebetov, A.; Pusenkov, V.

2002-01-01

In this paper, a description of a new method to determine the transmission of neutron guides after they are installed in a beam-tube at a reactor source is given. The method is based on activation measurements of gold foils at the entrance of the beam-tube and at the exit of the neutron guides compared to Monte-Carlo calculations. In this method, a quality factor is defined as the ratio between the actual transmission and the theoretical maximum attainable transmission. This method is used to determine the quality of an optimised neutron-guide system developed for beam-tube R2 of the HOR. The HOR is a pool-type nuclear research reactor at the Interfaculty Reactor Institute of the Delft University of Technology. It is shown that the quality factors of the newly installed neutron guides are between 0.49 and 0.63

Low-complexity video encoding method for wireless image transmission in capsule endoscope.

Science.gov (United States)

Takizawa, Kenichi; Hamaguchi, Kiyoshi

2010-01-01

This paper presents a low-complexity video encoding method applicable for wireless image transmission in capsule endoscopes. This encoding method is based on Wyner-Ziv theory, in which side information available at a transmitter is treated as side information at its receiver. Therefore complex processes in video encoding, such as estimation of the motion vector, are moved to the receiver side, which has a larger-capacity battery. As a result, the encoding process is only to decimate coded original data through channel coding. We provide a performance evaluation for a low-density parity check (LDPC) coding method in the AWGN channel.

Development of a Java Package for Matrix Programming

OpenAIRE

Lim, Ngee-Peng; Ling, Maurice HT; Lim, Shawn YC; Choi, Ji-Hee; Teo, Henry BK

2003-01-01

We had assembled a Java package, known as MatrixPak, of four classes for the purpose of numerical matrix computation. The classes are matrix, matrix_operations, StrToMatrix, and MatrixToStr; all of which are inherited from java.lang.Object class. Class matrix defines a matrix as a two-dimensional array of float types, and contains the following mathematical methods: transpose, adjoint, determinant, inverse, minor and cofactor. Class matrix_operations contains the following mathematical method...

Photonic band gaps and defects in two dimensions: Studies of the transmission coefficient

International Nuclear Information System (INIS)

Sigalas, M.; Soukoulis, C.M.; Economou, E.N.; Chan, C.T.; Ho, K.M.

1993-01-01

Using the transfer-matrix technique for the propagation of electromagnetic waves in dielectric structures, we calculate the transmission coefficient versus the frequency of the incident wave for different polarizations in two-dimensional periodic and/or random arrangements of dielectric cylinders. This technique has been applied to cases where the plane-wave method fails or becomes too time consuming, such as when the dielectric constant is frequency dependent or has a nonzero imaginary part, and when defects are present in an otherwise periodic system. For all the cases studied, the results compared well with experiment

The R-matrix theory

International Nuclear Information System (INIS)

Descouvemont, P; Baye, D

2010-01-01

The different facets of the R-matrix method are presented pedagogically in a general framework. Two variants have been developed over the years: (i) The 'calculable' R-matrix method is a calculational tool to derive scattering properties from the Schroedinger equation in a large variety of physical problems. It was developed rather independently in atomic and nuclear physics with too little mutual influence. (ii) The 'phenomenological' R-matrix method is a technique to parametrize various types of cross sections. It was mainly (or uniquely) used in nuclear physics. Both directions are explained by starting from the simple problem of scattering by a potential. They are illustrated by simple examples in nuclear and atomic physics. In addition to elastic scattering, the R-matrix formalism is applied to inelastic and radiative-capture reactions. We also present more recent and more ambitious applications of the theory in nuclear physics.

Leakage localisation method in a water distribution system based on sensitivity matrix: methodology and real test

OpenAIRE

Pascual Pañach, Josep

2010-01-01

Leaks are present in all water distribution systems. In this paper a method for leakage detection and localisation is presented. It uses pressure measurements and simulation models. Leakage localisation methodology is based on pressure sensitivity matrix. Sensitivity is normalised and binarised using a common threshold for all nodes, so a signatures matrix is obtained. A pressure sensor optimal distribution methodology is developed too, but it is not used in the real test. To validate this...

A new method for the measurement of the polarization characteristics of ferromagnetic films on ultracold neutrons

International Nuclear Information System (INIS)

Taran, Yu.V.

1985-01-01

A new method has been developed for measuring the polarization characteristics of ferromagnetic films on ultracold neutrons (UCN) by single-, double- and triple-transmission of UCN beam through one and the same film. To realize the method an installation has been proposed consisting of the two UCN storage traps connected with a mirror neutron guide. An investigated film is placed in the slit in the middle of the neutron guide. On both sides of the film a spin-flipper is installed bottle is equiped with three neutron values which permit filling in the bottle with UCN and allow oneto let UCN out to the neutron guide or detector. The neutrons once let out from one bottle into the neutron guide are caught by the other. The film can be moved out of the neutron guide or rotated. By manipulating with spin-flippers and the film one may take the integral polarization parameters of the film: transmission, polarizing and analysing efficiencies, so-called S-factor, which is the fourth independent linear combination of the elements of the square 2x2 transmission matrix of the film. The measurement parameters help to restore the film transmission matrix. Then a comparison is drawn with the theoretical models of UCN depolarization on transmission through a ferromagnetic film

Adaptation of chemical methods of analysis to the matrix of pyrite-acidified mining lakes

International Nuclear Information System (INIS)

Herzsprung, P.; Friese, K.

2000-01-01

Owing to the unusual matrix of pyrite-acidified mining lakes, the analysis of chemical parameters may be difficult. A number of methodological improvements have been developed so far, and a comprehensive validation of methods is envisaged. The adaptation of the available methods to small-volume samples of sediment pore waters and the adaptation of sensitivity to the expected concentration ranges is an important element of the methods applied in analyses of biogeochemical processes in mining lakes [de

Producing accurate wave propagation time histories using the global matrix method

International Nuclear Information System (INIS)

Obenchain, Matthew B; Cesnik, Carlos E S

2013-01-01

This paper presents a reliable method for producing accurate displacement time histories for wave propagation in laminated plates using the global matrix method. The existence of inward and outward propagating waves in the general solution is highlighted while examining the axisymmetric case of a circular actuator on an aluminum plate. Problems with previous attempts to isolate the outward wave for anisotropic laminates are shown. The updated method develops a correction signal that can be added to the original time history solution to cancel the inward wave and leave only the outward propagating wave. The paper demonstrates the effectiveness of the new method for circular and square actuators bonded to the surface of isotropic laminates, and these results are compared with exact solutions. Results for circular actuators on cross-ply laminates are also presented and compared with experimental results, showing the ability of the new method to successfully capture the displacement time histories for composite laminates. (paper)

Polychoric/Tetrachoric Matrix or Pearson Matrix? A methodological study

Directory of Open Access Journals (Sweden)

Dominguez Lara, Sergio Alexis

2014-04-01

Full Text Available The use of product-moment correlation of Pearson is common in most studies in factor analysis in psychology, but it is known that this statistic is only applicable when the variables related are in interval scale and normally distributed, and when are used in ordinal data may to produce a distorted correlation matrix . Thus is a suitable option using polychoric/tetrachoric matrices in item-level factor analysis when the items are in level measurement nominal or ordinal. The aim of this study was to show the differences in the KMO, Bartlett`s Test and Determinant of the Matrix, percentage of variance explained and factor loadings in depression trait scale of Depression Inventory Trait - State and the Neuroticism dimension of the short form of the Eysenck Personality Questionnaire -Revised, regarding the use of matrices polychoric/tetrachoric matrices and Pearson. These instruments was analyzed with different extraction methods (Maximum Likelihood, Minimum Rank Factor Analysis, Unweighted Least Squares and Principal Components, keeping constant the rotation method Promin were analyzed. Were observed differences regarding sample adequacy measures, as well as with respect to the explained variance and the factor loadings, for solutions having as polychoric/tetrachoric matrix. So it can be concluded that the polychoric / tetrachoric matrix give better results than Pearson matrices when it comes to item-level factor analysis using different methods.

Numerical analysis in electromagnetics the TLM method

CERN Document Server

Saguet, Pierre

2013-01-01

The aim of this book is to give a broad overview of the TLM (Transmission Line Matrix) method, which is one of the "time-domain numerical methods". These methods are reputed for their significant reliance on computer resources. However, they have the advantage of being highly general.The TLM method has acquired a reputation for being a powerful and effective tool by numerous teams and still benefits today from significant theoretical developments. In particular, in recent years, its ability to simulate various situations with excellent precision, including complex materials, has been

A Matrix-Based Proactive Data Relay Algorithm for Large Distributed Sensor Networks

Directory of Open Access Journals (Sweden)

Yang Xu

2016-08-01

Full Text Available In large-scale distributed sensor networks, sensed data is required to be relayed around the network so that one or few sensors can gather adequate relative data to produce high quality information for decision-making. In regards to very high energy-constraint sensor nodes, data transmission should be extremely economical. However, traditional data delivery protocols are potentially inefficient relaying unpredictable sensor readings for data fusion in large distributed networks for either overwhelming query transmissions or unnecessary data coverage. By building sensors’ local model from their previously transmitted data in three matrixes, we have developed a novel energy-saving data relay algorithm, which allows sensors to proactively make broadcast decisions by using a neat matrix computation to provide balance between transmission and energy-saving. In addition, we designed a heuristic maintenance algorithm to efficiently update these three matrices. This can easily be deployed to large-scale mobile networks in which decisions of sensors are based on their local matrix models no matter how large the network is, and the local models of these sensors are updated constantly. Compared with some traditional approaches based on our simulations, the efficiency of this approach is manifested in uncertain environment. The results show that our approach is scalable and can effectively balance aggregating data with minimizing energy consumption.

Extending the Matrix Element Method beyond the Born approximation: calculating event weights at next-to-leading order accuracy

Energy Technology Data Exchange (ETDEWEB)

Martini, Till; Uwer, Peter [Humboldt-Universität zu Berlin, Institut für Physik,Newtonstraße 15, 12489 Berlin (Germany)

2015-09-14

In this article we illustrate how event weights for jet events can be calculated efficiently at next-to-leading order (NLO) accuracy in QCD. This is a crucial prerequisite for the application of the Matrix Element Method in NLO. We modify the recombination procedure used in jet algorithms, to allow a factorisation of the phase space for the real corrections into resolved and unresolved regions. Using an appropriate infrared regulator the latter can be integrated numerically. As illustration, we reproduce differential distributions at NLO for two sample processes. As further application and proof of concept, we apply the Matrix Element Method in NLO accuracy to the mass determination of top quarks produced in e{sup +}e{sup −} annihilation. This analysis is relevant for a future Linear Collider. We observe a significant shift in the extracted mass depending on whether the Matrix Element Method is used in leading or next-to-leading order.

Infrared optical constants of liquid palm oil and palm oil biodiesel determined by the combined ellipsometry-transmission method.

Science.gov (United States)

Wang, C C; Tan, J Y; Ma, Y Q; Liu, L H

2017-06-20

The optical constants of vegetable oils and biodiesels are the basic input parameters in the study of the thermal radiation transfer and monitoring the productivity of vegetable oils converting to biodiesels. In this work, a combined ellipsometry-transmission method is presented to obtain the optical constants of palm oil and palm oil biodiesel between 20°C and 150°C in the spectral range 600-4100  cm -1 and to study the temperature effect on the optical constants. In the combined method, a modified ellipsometry method is used to measure the optical constants of palm oil and palm oil biodiesel for the whole researched wave bands. For the weak absorption regions in which the ellipsometry method cannot give precise absorption indices, the transmission method is conducted to get the absorption indices using the refractive indices obtained by the proposed ellipsometry method. Deionized water and methanol are taken as examples to verify the combined ellipsometry-transmission method. It is shown that the combined method can overcome the deficiencies of the traditional ellipsometry and transmission method, which can be used for the measurements of both strong and weak absorption wave bands. The experimental analyses indicate that temperature exerts a noticeable influence on the infrared optical constants of palm oil and palm oil biodiesel. With the increase of temperature, the refractive indices at certain wavenumbers decrease nearly linearly, and the amplitudes of dominant absorption peaks show a decreasing trend. The absorption peaks located around 3550  cm -1 show blueshift trends as temperature increases. Comparing these two kinds of oils, palm oil presents larger values in refractive indices and dominant absorption peaks.

ASTM and VAMAS activities in titanium matrix composites test methods development

Science.gov (United States)

Johnson, W. S.; Harmon, D. M.; Bartolotta, P. A.; Russ, S. M.

1994-01-01

Titanium matrix composites (TMC's) are being considered for a number of aerospace applications ranging from high performance engine components to airframe structures in areas that require high stiffness to weight ratios at temperatures up to 400 C. TMC's exhibit unique mechanical behavior due to fiber-matrix interface failures, matrix cracks bridged by fibers, thermo-viscoplastic behavior of the matrix at elevated temperatures, and the development of significant thermal residual stresses in the composite due to fabrication. Standard testing methodology must be developed to reflect the uniqueness of this type of material systems. The purpose of this paper is to review the current activities in ASTM and Versailles Project on Advanced Materials and Standards (VAMAS) that are directed toward the development of standard test methodology for titanium matrix composites.

Method and apparatus for executing an asynchronous clutch-to-clutch shift in a hybrid transmission

Science.gov (United States)

Demirovic, Besim; Gupta, Pinaki; Kaminsky, Lawrence A.; Naqvi, Ali K.; Heap, Anthony H.; Sah, Jy-Jen F.

2014-08-12

A hybrid transmission includes first and second electric machines. A method for operating the hybrid transmission in response to a command to execute a shift from an initial continuously variable mode to a target continuously variable mode includes increasing torque of an oncoming clutch associated with operating in the target continuously variable mode and correspondingly decreasing a torque of an off-going clutch associated with operating in the initial continuously variable mode. Upon deactivation of the off-going clutch, torque outputs of the first and second electric machines and the torque of the oncoming clutch are controlled to synchronize the oncoming clutch. Upon synchronization of the oncoming clutch, the torque for the oncoming clutch is increased and the transmission is operated in the target continuously variable mode.

Analysis of Off Gas From Disintegration Process of Graphite Matrix by Electrochemical Method

International Nuclear Information System (INIS)

Tian Lifang; Wen Mingfen; Chen Jing

2010-01-01

Using electrochemical method with salt solutions as electrolyte, some gaseous substances (off gas) would be generated during the disintegration of graphite from high-temperature gas-cooled reactor fuel elements. The off gas is determined to be composed of H 2 , O 2 , N 2 , CO 2 and NO x by gas chromatography. Only about 1.5% graphite matrix is oxidized to CO 2 . Compared to the direct burning-graphite method, less off gas,especially CO 2 , is generated in the disintegration process of graphite by electrochemical method and the treatment of off gas becomes much easier. (authors)

New Multi-HAzard and MulTi-RIsk Assessment MethodS for Europe (MATRIX): A research program towards mitigating multiple hazards and risks in Europe

Science.gov (United States)

Fleming, K. M.; Zschau, J.; Gasparini, P.; Modaressi, H.; Matrix Consortium

2011-12-01

Scientists, engineers, civil protection and disaster managers typically treat natural hazards and risks individually. This leads to the situation where the frequent causal relationships between the different hazards and risks, e.g., earthquakes and volcanos, or floods and landslides, are ignored. Such an oversight may potentially lead to inefficient mitigation planning. As part of their efforts to confront this issue, the European Union, under its FP7 program, is supporting the New Multi-HAzard and MulTi-RIsK Assessment MethodS for Europe or MATRIX project. The focus of MATRIX is on natural hazards, in particular earthquakes, landslides, volcanos, wild fires, storms and fluvial and coastal flooding. MATRIX will endeavour to develop methods and tools to tackle multi-type natural hazards and risks within a common framework, focusing on methodologies that are suited to the European context. The work will involve an assessment of current single-type hazard and risk assessment methodologies, including a comparison and quantification of uncertainties and harmonization of single-type methods, examining the consequence of cascade effects within a multi-hazard environment, time-dependent vulnerability, decision making and support for multi-hazard mitigation and adaption, and a series of test cases. Three test sites are being used to assess the methods developed within the project (Naples, Cologne, and the French West Indies), as well as a "virtual city" based on a comprehensive IT platform that will allow scenarios not represented by the test cases to be examined. In addition, a comprehensive dissemination program that will involve national platforms for disaster management, as well as various outreach activities, will be undertaken. The MATRIX consortium consists of ten research institutions (nine European and one Canadian), an end-user (i.e., one of the European national platforms for disaster reduction) and a partner from industry.

Aspects of fabrication aluminium matrix heterophase composites by suspension method

Science.gov (United States)

Dolata, A. J.; Dyzia, M.

2012-05-01

Composites with an aluminium alloy matrix (AlMMC) exhibit several advantageous properties such as good strength, stiffness, low density, resistance and dimensional stability to elevated temperatures, good thermal expansion coefficient and particularly high resistance to friction wear. Therefore such composites are more and more used in modern engineering constructions. Composites reinforced with hard ceramic particles (Al2O3, SiC) are gradually being implemented into production in automotive or aircraft industries. Another application of AlMMC is in the electronics industry, where the dimensional stability and capacity to absorb and remove heat is used in radiators. However the main problems are still: a reduction of production costs, developing methods of composite material tests and final product quality assessment, standardisation, development of recycling and mechanical processing methods. AlMMC production technologies, based on liquid-phase methods, and the shaping of products by casting methods, belong to the cheapest production methods. Application of a suspension method for the production of composites with heterophase reinforcement may turn out to be a new material and technological solution. The article presents the material and technological aspects of the transfer procedures for the production of composite suspensions from laboratory scale to a semi-industrial scale.

Aspects of fabrication aluminium matrix heterophase composites by suspension method

International Nuclear Information System (INIS)

Dolata, A J; Dyzia, M

2012-01-01

Composites with an aluminium alloy matrix (AlMMC) exhibit several advantageous properties such as good strength, stiffness, low density, resistance and dimensional stability to elevated temperatures, good thermal expansion coefficient and particularly high resistance to friction wear. Therefore such composites are more and more used in modern engineering constructions. Composites reinforced with hard ceramic particles (Al 2 O 3 , SiC) are gradually being implemented into production in automotive or aircraft industries. Another application of AlMMC is in the electronics industry, where the dimensional stability and capacity to absorb and remove heat is used in radiators. However the main problems are still: a reduction of production costs, developing methods of composite material tests and final product quality assessment, standardisation, development of recycling and mechanical processing methods. AlMMC production technologies, based on liquid-phase methods, and the shaping of products by casting methods, belong to the cheapest production methods. Application of a suspension method for the production of composites with heterophase reinforcement may turn out to be a new material and technological solution. The article presents the material and technological aspects of the transfer procedures for the production of composite suspensions from laboratory scale to a semi-industrial scale.

Efficient improvement of virtual crack extension method by a derivative of the finite element stiffness matrix

International Nuclear Information System (INIS)

Ishikawa, H.; Nakano, S.; Yuuki, R.; Chung, N.Y.

1991-01-01

In the virtual crack extension method, the stress intensity factor, K, is obtained from the converged value of the energy release rate by the difference of the finite element stiffness matrix when some crack extension are taken. Instead of the numerical difference of the finite element stiffness, a new method to use a direct dirivative of the finite element stiffness matrix with respect to crack length is proposed. By the present method, the results of some example problems, such as uniform tension problems of a square plate with a center crack and a rectangular plate with an internal slant crack, are obtained with high accuracy and good efficiency. Comparing with analytical results, the present values of the stress intensity factors of the problems are obtained with the error that is less than 0.6%. This shows the numerical assurance of the usefulness of the present method. A personal computer program for the analysis is developed

Simplified LCA and matrix methods in identifying the environmental aspects of a product system.

Science.gov (United States)

Hur, Tak; Lee, Jiyong; Ryu, Jiyeon; Kwon, Eunsun

2005-05-01

In order to effectively integrate environmental attributes into the product design and development processes, it is crucial to identify the significant environmental aspects related to a product system within a relatively short period of time. In this study, the usefulness of life cycle assessment (LCA) and a matrix method as tools for identifying the key environmental issues of a product system were examined. For this, a simplified LCA (SLCA) method that can be applied to Electrical and Electronic Equipment (EEE) was developed to efficiently identify their significant environmental aspects for eco-design, since a full scale LCA study is usually very detailed, expensive and time-consuming. The environmentally responsible product assessment (ERPA) method, which is one of the matrix methods, was also analyzed. Then, the usefulness of each method in eco-design processes was evaluated and compared using the case studies of the cellular phone and vacuum cleaner systems. It was found that the SLCA and the ERPA methods provided different information but they complemented each other to some extent. The SLCA method generated more information on the inherent environmental characteristics of a product system so that it might be useful for new design/eco-innovation when developing a completely new product or method where environmental considerations play a major role from the beginning. On the other hand, the ERPA method gave more information on the potential for improving a product so that it could be effectively used in eco-redesign which intends to alleviate environmental impacts of an existing product or process.

Quantization of an electromagnetic field in two-dimensional photonic structures based on the scattering matrix formalism ( S-quantization)

Science.gov (United States)

Ivanov, K. A.; Nikolaev, V. V.; Gubaydullin, A. R.; Kaliteevski, M. A.

2017-10-01

Based on the scattering matrix formalism, we have developed a method of quantization of an electromagnetic field in two-dimensional photonic nanostructures ( S-quantization in the two-dimensional case). In this method, the fields at the boundaries of the quantization box are expanded into a Fourier series and are related with each other by the scattering matrix of the system, which is the product of matrices describing the propagation of plane waves in empty regions of the quantization box and the scattering matrix of the photonic structure (or an arbitrary inhomogeneity). The quantization condition (similarly to the onedimensional case) is formulated as follows: the eigenvalues of the scattering matrix are equal to unity, which corresponds to the fact that the set of waves that are incident on the structure (components of the expansion into the Fourier series) is equal to the set of waves that travel away from the structure (outgoing waves). The coefficients of the matrix of scattering through the inhomogeneous structure have been calculated using the following procedure: the structure is divided into parallel layers such that the permittivity in each layer varies only along the axis that is perpendicular to the layers. Using the Fourier transform, the Maxwell equations have been written in the form of a matrix that relates the Fourier components of the electric field at the boundaries of neighboring layers. The product of these matrices is the transfer matrix in the basis of the Fourier components of the electric field. Represented in a block form, it is composed by matrices that contain the reflection and transmission coefficients for the Fourier components of the field, which, in turn, constitute the scattering matrix. The developed method considerably simplifies the calculation scheme for the analysis of the behavior of the electromagnetic field in structures with a two-dimensional inhomogeneity. In addition, this method makes it possible to obviate

Matrix pencil method-based reference current generation for shunt active power filters

DEFF Research Database (Denmark)

Terriche, Yacine; Golestan, Saeed; Guerrero, Josep M.

2018-01-01

response and works well under distorted and unbalanced voltage. Moreover, the proposed method can estimate the voltage phase accurately; this property enables the algorithm to compensate for both power factor and current unbalance. The effectiveness of the proposed method is verified using simulation...... are using the discrete Fourier transform (DFT) in the frequency domain or the instantaneous p–q theory and the synchronous reference frame in the time domain. The DFT, however, suffers from the picket-fence effect and spectral leakage. On the other hand, the DFT takes at least one cycle of the nominal...... frequency. The time-domain methods show a weakness under voltage distortion, which requires prior filtering techniques. The aim of this study is to present a fast yet effective method for generating the RCC for SAPFs. The proposed method, which is based on the matrix pencil method, has a fast dynamic...

A Matrix Method Based on the Fibonacci Polynomials to the Generalized Pantograph Equations with Functional Arguments

Directory of Open Access Journals (Sweden)

Ayşe Betül Koç

2014-01-01

Full Text Available A pseudospectral method based on the Fibonacci operational matrix is proposed to solve generalized pantograph equations with linear functional arguments. By using this method, approximate solutions of the problems are easily obtained in form of the truncated Fibonacci series. Some illustrative examples are given to verify the efficiency and effectiveness of the proposed method. Then, the numerical results are compared with other methods.

Space power transmission

Energy Technology Data Exchange (ETDEWEB)

Kuribayashi, Shizuma [Mitsubishi Heavy Industries, Ltd., Tokyo, (Japan)

1989-10-05

There being a conception to utilize solar energy by use of a space power station (SPS), a method to bring that universal grace to mankind is wireless energy transmission. The wireless energy transmission is regarded to be microwave transmission or laser beam transmission. The microwave transmission is to transmit 2.45GHz band microwave from the SPS to a receiving station on the ground to meet power demand on earth. The microwave, as small in attenuation in atmosphere and resistant against rain and cloud, is made candidate and, however, problematic in influence on organism, necessary large area of receiving antenna and many other points to be studied. While the laser transmission, as more convergent of beam than the microwave transmission, is advantageous with enabling the receiving area to be small and, however, disadvantageous with being not resistant against dust, rain and cloud, if used for the energy transmission between the space and earth. 2 refs., 2 figs.

On matrix diffusion: formulations, solution methods and qualitative effects

Science.gov (United States)

Carrera, Jesús; Sánchez-Vila, Xavier; Benet, Inmaculada; Medina, Agustín; Galarza, Germán; Guimerà, Jordi

Matrix diffusion has become widely recognized as an important transport mechanism. Unfortunately, accounting for matrix diffusion complicates solute-transport simulations. This problem has led to simplified formulations, partly motivated by the solution method. As a result, some confusion has been generated about how to properly pose the problem. One of the objectives of this work is to find some unity among existing formulations and solution methods. In doing so, some asymptotic properties of matrix diffusion are derived. Specifically, early-time behavior (short tests) depends only on φm2RmDm / Lm2, whereas late-time behavior (long tracer tests) depends only on φmRm, and not on matrix diffusion coefficient or block size and shape. The latter is always true for mean arrival time. These properties help in: (a) analyzing the qualitative behavior of matrix diffusion; (b) explaining one paradox of solute transport through fractured rocks (the apparent dependence of porosity on travel time); (c) discriminating between matrix diffusion and other problems (such as kinetic sorption or heterogeneity); and (d) describing identifiability problems and ways to overcome them. RésuméLa diffusion matricielle est un phénomène reconnu maintenant comme un mécanisme de transport important. Malheureusement, la prise en compte de la diffusion matricielle complique la simulation du transport de soluté. Ce problème a conduit à des formulations simplifiées, en partie à cause de la méthode de résolution. Il s'en est suivi une certaine confusion sur la façon de poser correctement le problème. L'un des objectifs de ce travail est de trouver une certaine unité parmi les formulations et les méthodes de résolution. C'est ainsi que certaines propriétés asymptotiques de la diffusion matricielle ont été dérivées. En particulier, le comportement à l'origine (expériences de traçage courtes) dépend uniquement du terme φm2RmDm / Lm2, alors que le comportement à long terme

A method of applying two-pump system in automatic transmissions for energy conservation

Directory of Open Access Journals (Sweden)

Peng Dong

2015-06-01

Full Text Available In order to improve the hydraulic efficiency, modern automatic transmissions tend to apply electric oil pump in their hydraulic system. The electric oil pump can support the mechanical oil pump for cooling, lubrication, and maintaining the line pressure at low engine speeds. In addition, the start–stop function can be realized by means of the electric oil pump; thus, the fuel consumption can be further reduced. This article proposes a method of applying two-pump system (one electric oil pump and one mechanical oil pump in automatic transmissions based on the forward driving simulation. A mathematical model for calculating the transmission power loss is developed. The power loss transfers to heat which requires oil flow for cooling and lubrication. A leakage model is developed to calculate the leakage of the hydraulic system. In order to satisfy the flow requirement, a flow-based control strategy for the electric oil pump is developed. Simulation results of different driving cycles show that there is a best combination of the size of electric oil pump and the size of mechanical oil pump with respect to the optimal energy conservation. Besides, the two-pump system can also satisfy the requirement of the start–stop function. This research is extremely valuable for the forward design of a two-pump system in automatic transmissions with respect to energy conservation and start–stop function.

Large-N limit of the two-Hermitian-matrix model by the hidden BRST method

International Nuclear Information System (INIS)

Alfaro, J.

1993-01-01

This paper discusses the large-N limit of the two-Hermitian-matrix model in zero dimensions, using the hidden Becchi-Rouet-Stora-Tyutin method. A system of integral equations previously found is solved, showing that it contained the exact solution of the model in leading order of large N

The fitness for purpose of analytical methods applied to fluorimetric uranium determination in water matrix

International Nuclear Information System (INIS)

Grinman, Ana; Giustina, Daniel; Mondini, Julia; Diodat, Jorge

2008-01-01

Full text: This paper describes the steps which should be followed by a laboratory in order to validate the fluorimetric method for natural uranium in water matrix. The validation of an analytical method is a necessary requirement prior accreditation under Standard norm ISO/IEC 17025, of a non normalized method. Different analytical techniques differ in a sort of variables to be validated. Depending on the chemical process, measurement technique, matrix type, data fitting and measurement efficiency, a laboratory must set up experiments to verify reliability of data, through the application of several statistical tests and by participating in Quality Programs (QP) organized by reference laboratories such as the National Institute of Standards and Technology (NIST), National Physics Laboratory (NPL), or Environmental Measurements Laboratory (EML). However, the participation in QP not only involves international reference laboratories, but also, the national ones which are able to prove proficiency to the Argentinean Accreditation Board. The parameters that the ARN laboratory had to validate in the fluorimetric method to fit in accordance with Eurachem guide and IUPAC definitions, are: Detection Limit, Quantification Limit, Precision, Intra laboratory Precision, Reproducibility Limit, Repeatability Limit, Linear Range and Robustness. Assays to fit the above parameters were designed on the bases of statistics requirements, and a detailed data treatment is presented together with the respective tests in order to show the parameters validated. As a final conclusion, the uranium determination by fluorimetry is a reliable method for direct measurement to meet radioprotection requirements in water matrix, within its linear range which is fixed every time a calibration is carried out at the beginning of the analysis. The detection limit ( depending on blank standard deviation and slope) varies between 3 ug U and 5 ug U which yields minimum detectable concentrations (MDC) of

Gold-coated iron nanoparticles in transparent Si3N4 matrix thin films

Science.gov (United States)

Sánchez-Marcos, J.; Céspedes, E.; Jiménez-Villacorta, F.; Muñoz-Martín, A.; Prieto, C.

2013-06-01

A new method to prepare thin films containing gold-coated iron nanoparticles is presented. The ternary Fe-Au-Si3N4 system prepared by sequential sputtering has revealed a progressive variation of microstructures from Au/Fe/Au/Si3N4 multilayers to iron nanoparticles. Microstructural characterization by transmission electron microscopy, analysis of the magnetic properties and probing of the iron short-range order by X-ray absorption spectroscopy confirm the existence of a gold-coated iron nanoparticles of 1-2 nm typical size for a specific range of iron and gold contents per layer in the transparent silicon nitride ceramic matrix.

Elimination of matrix effect in quantitative analysis of elements using x-ray fluorescence

International Nuclear Information System (INIS)

Sampaio, R.V.

1973-07-01

The emission-transmission method of Leroux and Mahmud, an experimental technique for compensating matrix effects in photon excited X-ray fluorescence analysis, was used to determine the concentration of lead and antimony in pellets of galalith. The effect of interfering elements was studied by adding various concentrations of mercury and tin to the respective pellets. To illustrate possible environmental applications, a number of pellets was prepared from leaves of almond trees located in different regions of Rio de Janeiro. Lead concentrations were determined for the dried leaf material and showed values ranging from 50 to 145 parts per million [pt

Blind Measurement Selection: A Random Matrix Theory Approach

KAUST Repository

Elkhalil, Khalil

2016-12-14

This paper considers the problem of selecting a set of $k$ measurements from $n$ available sensor observations. The selected measurements should minimize a certain error function assessing the error in estimating a certain $m$ dimensional parameter vector. The exhaustive search inspecting each of the $n\\\\choose k$ possible choices would require a very high computational complexity and as such is not practical for large $n$ and $k$. Alternative methods with low complexity have recently been investigated but their main drawbacks are that 1) they require perfect knowledge of the measurement matrix and 2) they need to be applied at the pace of change of the measurement matrix. To overcome these issues, we consider the asymptotic regime in which $k$, $n$ and $m$ grow large at the same pace. Tools from random matrix theory are then used to approximate in closed-form the most important error measures that are commonly used. The asymptotic approximations are then leveraged to select properly $k$ measurements exhibiting low values for the asymptotic error measures. Two heuristic algorithms are proposed: the first one merely consists in applying the convex optimization artifice to the asymptotic error measure. The second algorithm is a low-complexity greedy algorithm that attempts to look for a sufficiently good solution for the original minimization problem. The greedy algorithm can be applied to both the exact and the asymptotic error measures and can be thus implemented in blind and channel-aware fashions. We present two potential applications where the proposed algorithms can be used, namely antenna selection for uplink transmissions in large scale multi-user systems and sensor selection for wireless sensor networks. Numerical results are also presented and sustain the efficiency of the proposed blind methods in reaching the performances of channel-aware algorithms.

Thermal and mechanical behavior of metal matrix and ceramic matrix composites

Science.gov (United States)

Kennedy, John M. (Editor); Moeller, Helen H. (Editor); Johnson, W. S. (Editor)

1990-01-01

The present conference discusses local stresses in metal-matrix composites (MMCs) subjected to thermal and mechanical loads, the computational simulation of high-temperature MMCs' cyclic behavior, an analysis of a ceramic-matrix composite (CMC) flexure specimen, and a plasticity analysis of fibrous composite laminates under thermomechanical loads. Also discussed are a comparison of methods for determining the fiber-matrix interface frictional stresses of CMCs, the monotonic and cyclic behavior of an SiC/calcium aluminosilicate CMC, the mechanical and thermal properties of an SiC particle-reinforced Al alloy MMC, the temperature-dependent tensile and shear response of a graphite-reinforced 6061 Al-alloy MMC, the fiber/matrix interface bonding strength of MMCs, and fatigue crack growth in an Al2O3 short fiber-reinforced Al-2Mg matrix MMC.

Applying the response matrix method for solving coupled neutron diffusion and transport problems

International Nuclear Information System (INIS)

Sibiya, G.S.

1980-01-01

The numerical determination of the flux and power distribution in the design of large power reactors is quite a time-consuming procedure if the space under consideration is to be subdivided into very fine weshes. Many computing methods applied in reactor physics (such as the finite-difference method) require considerable computing time. In this thesis it is shown that the response matrix method can be successfully used as an alternative approach to solving the two-dimension diffusion equation. Furthermore it is shown that sufficient accuracy of the method is achieved by assuming a linear space dependence of the neutron currents on the boundaries of the geometries defined for the given space. (orig.) [de

Improved parallel solution techniques for the integral transport matrix method

Energy Technology Data Exchange (ETDEWEB)

Zerr, R. Joseph, E-mail: rjz116@psu.edu [Department of Mechanical and Nuclear Engineering, The Pennsylvania State University, University Park, PA (United States); Azmy, Yousry Y., E-mail: yyazmy@ncsu.edu [Department of Nuclear Engineering, North Carolina State University, Burlington Engineering Laboratories, Raleigh, NC (United States)

2011-07-01

Alternative solution strategies to the parallel block Jacobi (PBJ) method for the solution of the global problem with the integral transport matrix method operators have been designed and tested. The most straightforward improvement to the Jacobi iterative method is the Gauss-Seidel alternative. The parallel red-black Gauss-Seidel (PGS) algorithm can improve on the number of iterations and reduce work per iteration by applying an alternating red-black color-set to the subdomains and assigning multiple sub-domains per processor. A parallel GMRES(m) method was implemented as an alternative to stationary iterations. Computational results show that the PGS method can improve on the PBJ method execution time by up to 10´ when eight sub-domains per processor are used. However, compared to traditional source iterations with diffusion synthetic acceleration, it is still approximately an order of magnitude slower. The best-performing cases are optically thick because sub-domains decouple, yielding faster convergence. Further tests revealed that 64 sub-domains per processor was the best performing level of sub-domain division. An acceleration technique that improves the convergence rate would greatly improve the ITMM. The GMRES(m) method with a diagonal block pre conditioner consumes approximately the same time as the PBJ solver but could be improved by an as yet undeveloped, more efficient pre conditioner. (author)

Improved parallel solution techniques for the integral transport matrix method

International Nuclear Information System (INIS)

Zerr, R. Joseph; Azmy, Yousry Y.

2011-01-01

Alternative solution strategies to the parallel block Jacobi (PBJ) method for the solution of the global problem with the integral transport matrix method operators have been designed and tested. The most straightforward improvement to the Jacobi iterative method is the Gauss-Seidel alternative. The parallel red-black Gauss-Seidel (PGS) algorithm can improve on the number of iterations and reduce work per iteration by applying an alternating red-black color-set to the subdomains and assigning multiple sub-domains per processor. A parallel GMRES(m) method was implemented as an alternative to stationary iterations. Computational results show that the PGS method can improve on the PBJ method execution time by up to 10´ when eight sub-domains per processor are used. However, compared to traditional source iterations with diffusion synthetic acceleration, it is still approximately an order of magnitude slower. The best-performing cases are optically thick because sub-domains decouple, yielding faster convergence. Further tests revealed that 64 sub-domains per processor was the best performing level of sub-domain division. An acceleration technique that improves the convergence rate would greatly improve the ITMM. The GMRES(m) method with a diagonal block pre conditioner consumes approximately the same time as the PBJ solver but could be improved by an as yet undeveloped, more efficient pre conditioner. (author)

A new version of transfer matrix method for multibody systems

Energy Technology Data Exchange (ETDEWEB)

Rui, Xiaoting, E-mail: ruixt@163.net [Nanjing University of Science and Technology, Institute of Launch Dynamics (China); Bestle, Dieter, E-mail: bestle@b-tu.de [Brandenburg University of Technology, Engineering Mechanics and Vehicle Dynamics (Germany); Zhang, Jianshu, E-mail: zhangdracpa@sina.com; Zhou, Qinbo, E-mail: zqb912-new@163.com [Nanjing University of Science and Technology, Institute of Launch Dynamics (China)

2016-10-15

In order to avoid the global dynamics equations and increase the computational efficiency for multibody system dynamics (MSD), the transfer matrix method of multibody system (MSTMM) has been developed and applied very widely in research and engineering in recent 20 years. It differs from ordinary methods in multibody system dynamics with respect to the feature that there is no need for a global dynamics equation, and it uses low-order matrices for high computational efficiency. For linear systems, MSTMM is exact even if continuous elements like beams are involved. The discrete time MSTMM, however, has to use local linearization. In order to release the method from such approximations, a new version of MSTMM is presented in this paper where translational and angular accelerations, on the one hand, and internal forces and moments, on the other hand, are used as state variables. Already linear relationships among these quantities are utilized, which results in new element transfer matrices and algorithms making the study of multibody systems as simple as the study of single bodies. The proposed approach also allows combining MSTMM with any general numerical integration procedure. Some numerical examples of MSD are given to demonstrate the proposed method.

Intervention methods to control the transmission of noroviruses and other enteric and respiratory viruses

NARCIS (Netherlands)

Tuladhar, E.

2014-01-01

Intervention methods to control the transmission of noroviruses and other enteric and respiratory viruses

Era Tuladhar

Abstract

Human noroviruses are the leading cause of acute and outbreak associated gastroenteritis worldwide. The outbreaks

Method and apparatus for evaluating structural weakness in polymer matrix composites

Science.gov (United States)

Wachter, Eric A.; Fisher, Walter G.

1996-01-01

A method and apparatus for evaluating structural weaknesses in polymer matrix composites is described. An object to be studied is illuminated with laser radiation and fluorescence emanating therefrom is collected and filtered. The fluorescence is then imaged and the image is studied to determine fluorescence intensity over the surface of the object being studied and the wavelength of maximum fluorescent intensity. Such images provide a map of the structural integrity of the part being studied and weaknesses, particularly weaknesses created by exposure of the object to heat, are readily visible in the image.

Analytic matrix elements with shifted correlated Gaussians

DEFF Research Database (Denmark)

Fedorov, D. V.

2017-01-01

Matrix elements between shifted correlated Gaussians of various potentials with several form-factors are calculated analytically. Analytic matrix elements are of importance for the correlated Gaussian method in quantum few-body physics.......Matrix elements between shifted correlated Gaussians of various potentials with several form-factors are calculated analytically. Analytic matrix elements are of importance for the correlated Gaussian method in quantum few-body physics....

Immobilization of cellulase using porous polymer matrix

International Nuclear Information System (INIS)

Kumakura, M.; Kaetsu, I.

1984-01-01

A new method is discussed for the immobilization of cellulase using porous polymer matrices, which were obtained by radiation polymerization of hydrophilic monomers. In this method, the immobilized enzyme matrix was prepared by enzyme absorbtion in the porous polymer matrix and drying treatment. The enzyme activity of the immobilized enzyme matrix varied with monomer concentration, cooling rate of the monomer solution, and hydrophilicity of the polymer matrix, takinn the change of the nature of the porous structure in the polymer matrix. The leakage of the enzymes from the polymer matrix was not observed in the repeated batch enzyme reactions

Method of transmission of dynamic multibit digital images from micro-unmanned aerial vehicles

Science.gov (United States)

Petrov, E. P.; Kharina, N. L.

2018-01-01

In connection with successful usage of nanotechnologies in remote sensing great attention is paid to the systems in micro-unmanned aerial vehicles (MUAVs) capable to provide high spatial resolution of dynamic multibit digital images (MDI). Limited energy resources on board the MUAV do not allow transferring a large amount of video information in the shortest possible time. It keeps back the broad development of MUAV. The search for methods to shorten the transmission time of dynamic MDIs from MUAV over the radio channel leads to the methods of MDI compression without computational operations onboard the MUAV. The known compression codecs of video information can not be applied because of the limited energy resources. In this paper we propose a method for reducing the transmission time of dynamic MDIs without computational operations and distortions onboard the MUAV. To develop the method a mathematical apparatus of the theory of conditional Markov processes with discrete arguments was used. On its basis a mathematical model for the transformation of the MDI represented by binary images (BI) in the MDI, consisting of groups of neighboring BIs (GBI) transmitted by multiphase (MP) signals, is constructed. The algorithm for multidimensional nonlinear filtering of MP signals is synthesized, realizing the statistical redundancy of the MDI to compensate for the noise stability losses caused by the use of MP signals.

Generation of a non-transmissive Borna disease virus vector lacking both matrix and glycoprotein genes.

Science.gov (United States)

Fujino, Kan; Yamamoto, Yusuke; Daito, Takuji; Makino, Akiko; Honda, Tomoyuki; Tomonaga, Keizo

2017-09-01

Borna disease virus (BoDV), a prototype of mammalian bornavirus, is a non-segmented, negative strand RNA virus that often causes severe neurological disorders in infected animals, including horses and sheep. Unique among animal RNA viruses, BoDV transcribes and replicates non-cytopathically in the cell nucleus, leading to establishment of long-lasting persistent infection. This striking feature of BoDV indicates its potential as an RNA virus vector system. It has previously been demonstrated by our team that recombinant BoDV (rBoDV) lacking an envelope glycoprotein (G) gene develops persistent infections in transduced cells without loss of the viral genome. In this study, a novel non-transmissive rBoDV, rBoDV ΔMG, which lacks both matrix (M) and G genes in the genome, is reported. rBoDV-ΔMG expressing green fluorescence protein (GFP), rBoDV ΔMG-GFP, was efficiently generated in Vero/MG cells stably expressing both BoDV M and G proteins. Infection with rBoDV ΔMG-GFP was persistently maintained in the parent Vero cells without propagation within cell culture. The optimal ratio of M and G for efficient viral particle production by transient transfection of M and G expression plasmids into cells persistently infected with rBoDV ΔMG-GFP was also demonstrated. These findings indicate that the rBoDV ΔMG-based BoDV vector may provide an extremely safe virus vector system and could be a novel strategy for investigating the function of M and G proteins and the host range of bornaviruses. © 2017 The Societies and John Wiley & Sons Australia, Ltd.

A New Real Time Lyapunov Based Controller for Power Quality Improvement in Unified Power Flow Controllers Using Direct Matrix Converters

Directory of Open Access Journals (Sweden)

Joaquim Monteiro

2017-06-01

Full Text Available This paper proposes a Direct Matrix Converter operating as a Unified Power Flow Controller (DMC-UPFC with an advanced control method for UPFC, based on the Lyapunov direct method, presenting good results in power quality assessment. This control method is used for real-time calculation of the appropriate matrix switching state, determining which switching state should be applied in the following sampling period. The control strategy takes into account active and reactive power flow references to choose the vector converter closest to the optimum. Theoretical principles for this new real-time vector modulation and control applied to the DMC-UPFC with input filter are established. The method needs DMC-UPFC dynamic equations to be solved just once in each control cycle, to find the required optimum vector, in contrast to similar control methods that need 27 vector estimations per control cycle. The designed controller’s performance was evaluated using Matlab/Simulink software. Controllers were also implemented using a digital signal processing (DSP system and matrix hardware. Simulation and experimental results show decoupled transmission line active (P and reactive (Q power control with zero theoretical error tracking and fast response. Output currents and voltages show small ripple and low harmonic content.

Development of quartz particulate reinforced AA6063 aluminum matrix composites via friction stir processing

Directory of Open Access Journals (Sweden)

S. Joyson Abraham

2016-12-01

Full Text Available Friction stir processing (FSP has been accepted as a potential method to produce aluminum matrix composites (AMCs without the drawbacks of liquid metallurgy methods. The present work focuses on the development of AMCs reinforced with quartz (SiO2 particles using FSP. Grooves with various dimensions were machined on AA6063 plates and compacted with quartz particles. A single pass FSP was carried out using a combination of optimized process parameters. The volume fraction of quartz particles in the AMCs was varied from 0 to 18 vol.% in steps of 6 vol.%. The developed AA6063/Quartz AMCs were characterized using optical, scanning and transmission electron microscopy. The quartz particles were distributed uniformly in the aluminum matrix irrespective of the location within the stir zone. The grains of the AA6063 were extensively refined by the combination of thermomechanical effect of FSP and the pinning effect of quartz particles. The dispersion of the quartz particles improved the microhardness and wear resistance of the AMCs. The role of quartz particles on the worn surface and wear debris is reported.

Study on the Seismic Response of a Portal Frame Structure Based on the Transfer Matrix Method of Multibody System

Directory of Open Access Journals (Sweden)

Jianguo Ding

2014-11-01

Full Text Available Portal frame structures are widely used in industrial building design but unfortunately are often damaged during an earthquake. As a result, a study on the seismic response of this type of structure is important to both human safety and future building designs. Traditionally, finite element methods such as the ANSYS and MIDAS have been used as the primary methods of computing the response of such a structure during an earthquake; however, these methods yield low calculation efficiencies. In this paper, the mechanical model of a single-story portal frame structure with two spans is constructed based on the transfer matrix method of multibody system (MS-TMM; both the transfer matrix of the components in the model and the total transfer matrix equation of the structure are derived, and the corresponding MATLAB program is compiled to determine the natural period and seismic response of the structure. The results show that the results based on the MS-TMM are similar to those obtained by ANSYS, but the calculation time of the MS-TMM method is only 1/20 of that of the ANSYS method. Additionally, it is shown that the MS-TMM method greatly increases the calculation efficiency while maintaining accuracy.

Drawing a different picture with pencil lead as matrix-assisted laser desorption/ionization matrix for fullerene derivatives.

Science.gov (United States)

Nye, Leanne C; Hungerbühler, Hartmut; Drewello, Thomas

2018-02-01

Inspired by reports on the use of pencil lead as a matrix-assisted laser desorption/ionization matrix, paving the way towards matrix-free matrix-assisted laser desorption/ionization, the present investigation evaluates its usage with organic fullerene derivatives. Currently, this class of compounds is best analysed using the electron transfer matrix trans-2-[3-(4-tert-butylphenyl)-2-methyl-2-propenylidene] malononitrile (DCTB), which was employed as the standard here. The suitability of pencil lead was additionally compared to direct (i.e. no matrix) laser desorption/ionization-mass spectrometry. The use of (DCTB) was identified as the by far gentler method, producing spectra with abundant molecular ion signals and much reduced fragmentation. Analytically, pencil lead was found to be ineffective as a matrix, however, appears to be an extremely easy and inexpensive method for producing sodium and potassium adducts.

A spot-matching method using cumulative frequency matrix in 2D gel images

Science.gov (United States)

Han, Chan-Myeong; Park, Joon-Ho; Chang, Chu-Seok; Ryoo, Myung-Chun

2014-01-01

A new method for spot matching in two-dimensional gel electrophoresis images using a cumulative frequency matrix is proposed. The method improves on the weak points of the previous method called ‘spot matching by topological patterns of neighbour spots’. It accumulates the frequencies of neighbour spot pairs produced through the entire matching process and determines spot pairs one by one in order of higher frequency. Spot matching by frequencies of neighbour spot pairs shows a fairly better performance. However, it can give researchers a hint for whether the matching results can be trustworthy or not, which can save researchers a lot of effort for verification of the results. PMID:26019609

A self-consistent nodal method in response matrix formalism for the multigroup diffusion equations

International Nuclear Information System (INIS)

Malambu, E.M.; Mund, E.H.

1996-01-01

We develop a nodal method for the multigroup diffusion equations, based on the transverse integration procedure (TIP). The efficiency of the method rests upon the convergence properties of a high-order multidimensional nodal expansion and upon numerical implementation aspects. The discrete 1D equations are cast in response matrix formalism. The derivation of the transverse leakage moments is self-consistent i.e. does not require additional assumptions. An outstanding feature of the method lies in the linear spatial shape of the local transverse leakage for the first-order scheme. The method is described in the two-dimensional case. The method is validated on some classical benchmark problems. (author)

Efficient propagation of the hierarchical equations of motion using the matrix product state method

Science.gov (United States)

Shi, Qiang; Xu, Yang; Yan, Yaming; Xu, Meng

2018-05-01

We apply the matrix product state (MPS) method to propagate the hierarchical equations of motion (HEOM). It is shown that the MPS approximation works well in different type of problems, including boson and fermion baths. The MPS method based on the time-dependent variational principle is also found to be applicable to HEOM with over one thousand effective modes. Combining the flexibility of the HEOM in defining the effective modes and the efficiency of the MPS method thus may provide a promising tool in simulating quantum dynamics in condensed phases.

Power-efficient method for IM-DD optical transmission of multiple OFDM signals.

Science.gov (United States)

Effenberger, Frank; Liu, Xiang

2015-05-18

We propose a power-efficient method for transmitting multiple frequency-division multiplexed (FDM) orthogonal frequency-division multiplexing (OFDM) signals in intensity-modulation direct-detection (IM-DD) optical systems. This method is based on quadratic soft clipping in combination with odd-only channel mapping. We show, both analytically and experimentally, that the proposed approach is capable of improving the power efficiency by about 3 dB as compared to conventional FDM OFDM signals under practical bias conditions, making it a viable solution in applications such as optical fiber-wireless integrated systems where both IM-DD optical transmission and OFDM signaling are important.

Elementary matrix theory

CERN Document Server

Eves, Howard

1980-01-01

The usefulness of matrix theory as a tool in disciplines ranging from quantum mechanics to psychometrics is widely recognized, and courses in matrix theory are increasingly a standard part of the undergraduate curriculum.This outstanding text offers an unusual introduction to matrix theory at the undergraduate level. Unlike most texts dealing with the topic, which tend to remain on an abstract level, Dr. Eves' book employs a concrete elementary approach, avoiding abstraction until the final chapter. This practical method renders the text especially accessible to students of physics, engineeri

Hyperfine electron-nuclear interactions in the frame of the Density Functional and of the Density Matrix Methods

International Nuclear Information System (INIS)

Pavlov, R.L.; Pavlov, L.I.; Raychev, P.P.; Garistov, V.P.; Dimitrova-Ivanovich, M.

2002-01-01

The matrix elements and expectation values of the hyperfine interaction operators are presented in a form suitable for numerical implementation in density matrix methods. The electron-nuclear spin-spin (dipolar and contact) interactions are considered, as well as the interaction between nuclear spin and electron-orbital motions. These interactions from the effective Breit-Pauli Hamiltonian determine the hyperfine structure in ESR spectra and contribute to chemical shifts in NMR. Applying the Wigner-Eckart theorem in the irreducible tensor-operator technique and the spin-space separation scheme, the matrix elements and expectation values of these relativistic corrections are expressed in analytical form. The final results are presented as products, or sums of products, of factors determined by the spin and (or) angular momentum symmetry and a spatial part determined by the action of the symmetrized tensor-operators on the normalized matrix or function of the spin or charge distribution.

PREDICTION OF RESERVOIR FLOW RATE OF DEZ DAM BY THE PROBABILITY MATRIX METHOD

Directory of Open Access Journals (Sweden)

Mohammad Hashem Kanani

2012-12-01

Full Text Available The data collected from the operation of existing storage reservoirs, could offer valuable information for the better allocation and management of fresh water rates for future use to mitigation droughts effect. In this paper the long-term Dez reservoir (IRAN water rate prediction is presented using probability matrix method. Data is analyzed to find the probability matrix of water rates in Dez reservoir based on the previous history of annual water entrance during the past and present years(40 years. The algorithm developed covers both, the overflow and non-overflow conditions in the reservoir. Result of this study shows that in non-overflow conditions the most exigency case is equal to 75%. This means that, if the reservoir is empty (the stored water is less than 100 MCM this year, it would be also empty by 75% next year. The stored water in the reservoir would be less than 300 MCM by 85% next year if the reservoir is empty this year. This percentage decreases to 70% next year if the water of reservoir is less than 300 MCM this year. The percentage also decreases to 5% next year if the reservoir is full this year. In overflow conditions the most exigency case is equal to 75% again. The reservoir volume would be less than 150 MCM by 90% next year, if it is empty this year. This percentage decreases to 70% if its water volume is less than 300 MCM and 55% if the water volume is less than 500 MCM this year. Result shows that too, if the probability matrix of water rates to a reservoir is multiplied by itself repeatedly; it converges to a constant probability matrix, which could be used to predict the long-term water rate of the reservoir. In other words, the probability matrix of series of water rates is changed to a steady probability matrix in the course of time, which could reflect the hydrological behavior of the watershed and could be easily used for the long-term prediction of water storage in the down stream reservoirs.

A method of signal transmission path analysis for multivariate random processes

International Nuclear Information System (INIS)

Oguma, Ritsuo

1984-04-01

A method for noise analysis called ''STP (signal transmission path) analysis'' is presentd as a tool to identify noise sources and their propagation paths in multivariate random proceses. Basic idea of the analysis is to identify, via time series analysis, effective network for the signal power transmission among variables in the system and to make use of its information to the noise analysis. In the present paper, we accomplish this through two steps of signal processings; first, we estimate, using noise power contribution analysis, variables which have large contribution to the power spectrum of interest, and then evaluate the STPs for each pair of variables to identify STPs which play significant role for the generated noise to transmit to the variable under evaluation. The latter part of the analysis is executed through comparison of partial coherence function and newly introduced partial noise power contribution function. This paper presents the procedure of the STP analysis and demonstrates, using simulation data as well as Borssele PWR noise data, its effectiveness for investigation of noise generation and propagation mechanisms. (author)

Parallel Programming Application to Matrix Algebra in the Spectral Method for Control Systems Analysis, Synthesis and Identification

Directory of Open Access Journals (Sweden)

V. Yu. Kleshnin

2016-01-01

Full Text Available The article describes the matrix algebra libraries based on the modern technologies of parallel programming for the Spectrum software, which can use a spectral method (in the spectral form of mathematical description to analyse, synthesise and identify deterministic and stochastic dynamical systems. The developed matrix algebra libraries use the following technologies for the GPUs: OmniThreadLibrary, OpenMP, Intel Threading Building Blocks, Intel Cilk Plus for CPUs nVidia CUDA, OpenCL, and Microsoft Accelerated Massive Parallelism.The developed libraries support matrices with real elements (single and double precision. The matrix dimensions are limited by 32-bit or 64-bit memory model and computer configuration. These libraries are general-purpose and can be used not only for the Spectrum software. They can also find application in the other projects where there is a need to perform operations with large matrices.The article provides a comparative analysis of the libraries developed for various matrix operations (addition, subtraction, scalar multiplication, multiplication, powers of matrices, tensor multiplication, transpose, inverse matrix, finding a solution of the system of linear equations through the numerical experiments using different CPU and GPU. The article contains sample programs and performance test results for matrix multiplication, which requires most of all computational resources in regard to the other operations.

A study of methods of prediction and measurement of the transmission sound through the walls of light aircraft

Science.gov (United States)

Forssen, B.; Wang, Y. S.; Crocker, M. J.

1981-12-01

Several aspects were studied. The SEA theory was used to develop a theoretical model to predict the transmission loss through an aircraft window. This work mainly consisted of the writing of two computer programs. One program predicts the sound transmission through a plexiglass window (the case of a single partition). The other program applies to the case of a plexiglass window window with a window shade added (the case of a double partition with an air gap). The sound transmission through a structure was measured in experimental studies using several different methods in order that the accuracy and complexity of all the methods could be compared. Also, the measurements were conducted on the simple model of a fuselage (a cylindrical shell), on a real aircraft fuselage, and on stiffened panels.

Method of measuring blood flow by radiation

International Nuclear Information System (INIS)

Gildenberg, P.L.

1977-01-01

A method of measuring relative blood flow through at least a part of the body using penetrating radiation comprises transmitting a plurality of rays at an initial angle or initial mean angle through a planar slice of the body to define a first set of rays, transmitting a plurality of further sets of rays at angles or mean angles different from each other and from the initial angle or initial mean angle through the same planar slice of the body to define by the intersection of all such rays a two-dimensional matrix of elements of the body in the slice, measuring for each ray emerging from the body a number of over the period of time at least equal to a pulse interval representing the momentary sum of the transmissions or absorptions of the element of the body intersected by the ray, determining from the momentary signals momentary signals a difference signal representing the maximum difference between the momentary signals for each ray over the period of time, deriving sets of discrete difference signals corresponding to the sets of rays, the difference signals being indicative of the transmission or absorption of blood flowing through each element of the body in the matrix, and calculating from the difference signals resultant signals representing the transmissions or absorptions due to blood flow in the elements of the matrix. These resultant signals may be visually depicted on a cathode ray tube display, as a digital print-out, or as a photograph. 30 claims, 8 figures

Voltage Balancing Method on Expert System for 51-Level MMC in High Voltage Direct Current Transmission

Directory of Open Access Journals (Sweden)

Yong Chen

2016-01-01

Full Text Available The Modular Multilevel Converters (MMC have been a spotlight for the high voltage and high power transmission systems. In the VSC-HVDC (High Voltage Direct Current based on Voltage Source Converter transmission system, the energy of DC link is stored in the distributed capacitors, and the difference of capacitors in parameters and charge rates causes capacitor voltage balance which affects the safety and stability of HVDC system. A method of MMC based on the expert system for reducing the frequency of the submodules (SMs of the IGBT switching frequency is proposed. Firstly, MMC with 51 levels for HVDC is designed. Secondly, the nearest level control (NLC for 51-level MMC is introduced. Thirdly, a modified capacitor voltage balancing method based on expert system for MMC-based HVDC transmission system is proposed. Finally, a simulation platform for 51-level Modular Multilevel Converter is constructed by using MATLAB/SIMULINK. The results indicate that the strategy proposed reduces the switching frequency on the premise of keeping submodule voltage basically identical, which greatly reduces the power losses for MMC-HVDC system.

Sintering by infiltration of loose mixture of powders, a method for metal matrix composite elaboration

International Nuclear Information System (INIS)

Constantinescu, V.; Orban, R.; Colan, H.

1993-01-01

Starting from the observation that Sintering by Infiltration of Loose Mixture of Powders confers large possibilities for both complex shaped and of large dimensions Particulate Reinforced Metal Matrix Composite components elaboration, its mechanism comparative with those of the classical melt infiltration was investigated. Appropriate measures in order to prevent an excessive hydrostatic flow of the melt and, consequently, reinforcement particle dispersion, as well as to promote wetting in both infiltration and liquid phase sintering stages of the process were established as necessary. Some experimental results in the method application to the fusion tungsten carbide and diamond reinforced metal matrix composite elaboration are, also, presented. (orig.)

The Matrix Method of Representation, Analysis and Classification of Long Genetic Sequences

Directory of Open Access Journals (Sweden)

Ivan V. Stepanyan

2017-01-01

Full Text Available The article is devoted to a matrix method of comparative analysis of long nucleotide sequences by means of presenting each sequence in the form of three digital binary sequences. This method uses a set of symmetries of biochemical attributes of nucleotides. It also uses the possibility of presentation of every whole set of N-mers as one of the members of a Kronecker family of genetic matrices. With this method, a long nucleotide sequence can be visually represented as an individual fractal-like mosaic or another regular mosaic of binary type. In contrast to natural nucleotide sequences, artificial random sequences give non-regular patterns. Examples of binary mosaics of long nucleotide sequences are shown, including cases of human chromosomes and penicillins. The obtained results are then discussed.

Bulk metallic glass matrix composites

International Nuclear Information System (INIS)

Choi-Yim, H.; Johnson, W.L.

1997-01-01

Composites with a bulk metallic glass matrix were synthesized and characterized. This was made possible by the recent development of bulk metallic glasses that exhibit high resistance to crystallization in the undercooled liquid state. In this letter, experimental methods for processing metallic glass composites are introduced. Three different bulk metallic glass forming alloys were used as the matrix materials. Both ceramics and metals were introduced as reinforcement into the metallic glass. The metallic glass matrix remained amorphous after adding up to a 30 vol% fraction of particles or short wires. X-ray diffraction patterns of the composites show only peaks from the second phase particles superimposed on the broad diffuse maxima from the amorphous phase. Optical micrographs reveal uniformly distributed particles in the matrix. The glass transition of the amorphous matrix and the crystallization behavior of the composites were studied by calorimetric methods. copyright 1997 American Institute of Physics

Measurement of the top quark mass in the dilepton final state using the matrix element method

Energy Technology Data Exchange (ETDEWEB)

Grohsjean, Alexander [Ludwig Maximilian Univ., Munich (Germany)

2008-12-15

The top quark, discovered in 1995 by the CDF and D0 experiments at the Fermilab Tevatron Collider, is the heaviest known fundamental particle. The precise knowledge of its mass yields important constraints on the mass of the yet-unobserved Higgs boson and allows to probe for physics beyond the Standard Model. The first measurement of the top quark mass in the dilepton channel with the Matrix Element method at the D0 experiment is presented. After a short description of the experimental environment and the reconstruction chain from hits in the detector to physical objects, a detailed review of the Matrix Element method is given. The Matrix Element method is based on the likelihood to observe a given event under the assumption of the quantity to be measured, e.g. the mass of the top quark. The method has undergone significant modifications and improvements compared to previous measurements in the lepton+jets channel: the two undetected neutrinos require a new reconstruction scheme for the four-momenta of the final state particles, the small event sample demands the modeling of additional jets in the signal likelihood, and a new likelihood is designed to account for the main source of background containing tauonic Z decay. The Matrix Element method is validated on Monte Carlo simulated events at the generator level. For the measurement, calibration curves are derived from events that are run through the full D0 detector simulation. The analysis makes use of the Run II data set recorded between April 2002 and May 2008 corresponding to an integrated luminosity of 2.8 fb^-1. A total of 107 t$\\bar{t}$ candidate events with one electron and one muon in the final state are selected. Applying the Matrix Element method to this data set, the top quark mass is measured to be m_top^{Run IIa} = 170.6 ± 6.1(stat.)_-1.5^+2.1(syst.)GeV; m_top^{Run IIb} = 174.1 ± 4.4(stat.)_-1.8^+2.5(syst.)GeV; m

Library designs for generic C++ sparse matrix computations of iterative methods

Energy Technology Data Exchange (ETDEWEB)

Pozo, R.

1996-12-31

A new library design is presented for generic sparse matrix C++ objects for use in iterative algorithms and preconditioners. This design extends previous work on C++ numerical libraries by providing a framework in which efficient algorithms can be written *independent* of the matrix layout or format. That is, rather than supporting different codes for each (element type) / (matrix format) combination, only one version of the algorithm need be maintained. This not only reduces the effort for library developers, but also simplifies the calling interface seen by library users. Furthermore, the underlying matrix library can be naturally extended to support user-defined objects, such as hierarchical block-structured matrices, or application-specific preconditioners. Utilizing optimized kernels whenever possible, the resulting performance of such framework can be shown to be competitive with optimized Fortran programs.

Immersion transmission ellipsometry (ITE): a new method for the precise determination of the 3D indicatrix of thin films

Science.gov (United States)

Jung, C. C.; Stumpe, J.

2005-02-01

The new method of immersion transmission ellipsometry (ITE) [1] has been developed. It allows the highly accurate determination of the absolute three-dimensional (3D) refractive indices of anisotropic thin films. The method is combined with conventional ellipsometry in transmission and reflection, and the thickness determination of anisotropic films solely by optical methods also becomes more accurate. The method is applied to the determination of the 3D refractive indices of thin spin-coated films of an azobenzene-containing liquid-crystalline copolymer. The development of the anisotropy in these films by photo-orientation and subsequent annealing is demonstrated. Depending on the annealing temperature, oblate or prolate orders are generated.

Transmission Electron Microscopy Specimen Preparation Method for Multiphase Porous Functional Ceramics

DEFF Research Database (Denmark)

Zhang, Wei; Kuhn, Luise Theil; Jørgensen, Peter Stanley

2013-01-01

An optimum method is proposed to prepare thin foil transmission electron microscopy (TEM) lamellae of multiphase porous functional ceramics: prefilling the pore space of these materials with an epoxy resin prior to focused ion beam milling. Several advantages of epoxy impregnation are demonstrated...... by successful preparation of TEM specimens that maintain the structural integrity of the entire lamella. Feasibility of the TEM alignment procedure is demonstrated, and ideal TEM analyses are illustrated on solid oxide fuel cell and solid oxide electrolysis cell materials. Some potential drawbacks of the TEM...

A transmission line model for propagation in elliptical core optical fibers

Science.gov (United States)

Georgantzos, E.; Papageorgiou, C.; Boucouvalas, A. C.

2015-12-01

The calculation of mode propagation constants of elliptical core fibers has been the purpose of extended research leading to many notable methods, with the classic step index solution based on Mathieu functions. This paper seeks to derive a new innovative method for the determination of mode propagation constants in single mode fibers with elliptic core by modeling the elliptical fiber as a series of connected coupled transmission line elements. We develop a matrix formulation of the transmission line and the resonance of the circuits is used to calculate the mode propagation constants. The technique, used with success in the case of cylindrical fibers, is now being extended for the case of fibers with elliptical cross section. The advantage of this approach is that it is very well suited to be able to calculate the mode dispersion of arbitrary refractive index profile elliptical waveguides. The analysis begins with the deployment Maxwell's equations adjusted for elliptical coordinates. Further algebraic analysis leads to a set of equations where we are faced with the appearance of harmonics. Taking into consideration predefined fixed number of harmonics simplifies the problem and enables the use of the resonant circuits approach. According to each case, programs have been created in Matlab, providing with a series of results (mode propagation constants) that are further compared with corresponding results from the ready known Mathieu functions method.

A transmission line model for propagation in elliptical core optical fibers

International Nuclear Information System (INIS)

Georgantzos, E.; Boucouvalas, A. C.; Papageorgiou, C.

2015-01-01

The calculation of mode propagation constants of elliptical core fibers has been the purpose of extended research leading to many notable methods, with the classic step index solution based on Mathieu functions. This paper seeks to derive a new innovative method for the determination of mode propagation constants in single mode fibers with elliptic core by modeling the elliptical fiber as a series of connected coupled transmission line elements. We develop a matrix formulation of the transmission line and the resonance of the circuits is used to calculate the mode propagation constants. The technique, used with success in the case of cylindrical fibers, is now being extended for the case of fibers with elliptical cross section. The advantage of this approach is that it is very well suited to be able to calculate the mode dispersion of arbitrary refractive index profile elliptical waveguides. The analysis begins with the deployment Maxwell’s equations adjusted for elliptical coordinates. Further algebraic analysis leads to a set of equations where we are faced with the appearance of harmonics. Taking into consideration predefined fixed number of harmonics simplifies the problem and enables the use of the resonant circuits approach. According to each case, programs have been created in Matlab, providing with a series of results (mode propagation constants) that are further compared with corresponding results from the ready known Mathieu functions method

Knowledge Transmission versus Social Transformation: A Critical Analysis of Purpose in Elementary Social Studies Methods Textbooks

Science.gov (United States)

Butler, Brandon M.; Suh, Yonghee; Scott, Wendy

2015-01-01

In this article, the authors investigate the extent to which 9 elementary social studies methods textbooks present the purpose of teaching and learning social studies. Using Stanley's three perspectives of teaching social studies for knowledge transmission, method of intelligence, and social transformation; we analyze how these texts prepare…

Investigation of noise in gear transmissions by the method of mathematical smoothing of experiments

Science.gov (United States)

Sheftel, B. T.; Lipskiy, G. K.; Ananov, P. P.; Chernenko, I. K.

1973-01-01

A rotatable central component smoothing method is used to analyze rotating gear noise spectra. A matrix is formulated in which the randomized rows correspond to various tests and the columns to factor values. Canonical analysis of the obtained regression equation permits the calculation of optimal speed and load at a previous assigned noise level.

Efficiency criterion for teleportation via channel matrix, measurement matrix and collapsed matrix

Directory of Open Access Journals (Sweden)

Xin-Wei Zha

Full Text Available In this paper, three kinds of coefficient matrixes (channel matrix, measurement matrix, collapsed matrix associated with the pure state for teleportation are presented, the general relation among channel matrix, measurement matrix and collapsed matrix is obtained. In addition, a criterion for judging whether a state can be teleported successfully is given, depending on the relation between the number of parameter of an unknown state and the rank of the collapsed matrix. Keywords: Channel matrix, Measurement matrix, Collapsed matrix, Teleportation

Numerical method to calculate the quantum transmission, resonance and eigenvalue energies: application to a biased multibarrier systems

Energy Technology Data Exchange (ETDEWEB)

Maiz, F., E-mail: fethimaiz@gmail.com [University of Cartage, Nabeul Engineering Preparatory Institute, Merazka, 8000 Nabeul (Tunisia); King Khalid University, Faculty of Science, Physics Department, PO Box 9004, Abha 61413 (Saudi Arabia)

2015-04-15

A novel method to calculate the quantum transmission, resonance and eigenvalue energies forming the sub-bands structure of non-symmetrical, non-periodical semiconducting heterostructure potential has been proposed in this paper. The method can be applied on a multilayer system with varying thickness of the layer and effective mass of electrons and holes. Assuming an approximated effective mass and using Bastard's boundary conditions, Schrödinger equation at each media is solved and then using a confirmed recurrence method, the transmission and reflection coefficients and the energy quantification condition are expressed. They are simple combination of coupled equations. Schrödinger's equation solutions are Airy functions or plane waves, depending on the electrical potential energy slope. To illustrate the feasibility of the proposed method, the N barriers – (N−1) wells structure for N=3, 5, 8, 9, 17 and 35 are studied. All results show very good agreements with previously published results obtained from applying different methods on similar systems.

Analytical modeling of a sandwiched plate piezoelectric transformer-based acoustic-electric transmission channel.

Science.gov (United States)

Lawry, Tristan J; Wilt, Kyle R; Scarton, Henry A; Saulnier, Gary J

2012-11-01

The linear propagation of electromagnetic and dilatational waves through a sandwiched plate piezoelectric transformer (SPPT)-based acoustic-electric transmission channel is modeled using the transfer matrix method with mixed-domain two-port ABCD parameters. This SPPT structure is of great interest because it has been explored in recent years as a mechanism for wireless transmission of electrical signals through solid metallic barriers using ultrasound. The model we present is developed to allow for accurate channel performance prediction while greatly reducing the computational complexity associated with 2- and 3-dimensional finite element analysis. As a result, the model primarily considers 1-dimensional wave propagation; however, approximate solutions for higher-dimensional phenomena (e.g., diffraction in the SPPT's metallic core layer) are also incorporated. The model is then assessed by comparing it to the measured wideband frequency response of a physical SPPT-based channel from our previous work. Very strong agreement between the modeled and measured data is observed, confirming the accuracy and utility of the presented model.

Method of selecting optimum cross arm lengths for a 750 kV transmission line

Energy Technology Data Exchange (ETDEWEB)

Aleksandrov, G N; Olorokov, V P

1965-01-01

A method is presented, based on both technical and economic considerations, for selecting cross arm lengths for intermediate poles of power transmission lines according to the effects of internal overvoltage, methods from probability theory and mathematical statistics employed. The problem of optimum pole size is considered in terms of the effect of internal overvoltages for a prescribed maximum level of 2.1 PU currently used in the USSR for the design of 750 kV lines.

Neutrinoless double-β decay matrix elements in large shell-model spaces with the generator-coordinate method

Science.gov (United States)

Jiao, C. F.; Engel, J.; Holt, J. D.

2017-11-01

We use the generator-coordinate method (GCM) with realistic shell-model interactions to closely approximate full shell-model calculations of the matrix elements for the neutrinoless double-β decay of 48Ca, 76Ge, and 82Se. We work in one major shell for the first isotope, in the f5 /2p g9 /2 space for the second and third, and finally in two major shells for all three. Our coordinates include not only the usual axial deformation parameter β , but also the triaxiality angle γ and neutron-proton pairing amplitudes. In the smaller model spaces our matrix elements agree well with those of full shell-model diagonalization, suggesting that our Hamiltonian-based GCM captures most of the important valence-space correlations. In two major shells, where exact diagonalization is not currently possible, our matrix elements are only slightly different from those in a single shell.

Improved Riccati Transfer Matrix Method for Free Vibration of Non-Cylindrical Helical Springs Including Warping

Directory of Open Access Journals (Sweden)

A.M. Yu

2012-01-01

Full Text Available Free vibration equations for non-cylindrical (conical, barrel, and hyperboloidal types helical springs with noncircular cross-sections, which consist of 14 first-order ordinary differential equations with variable coefficients, are theoretically derived using spatially curved beam theory. In the formulation, the warping effect upon natural frequencies and vibrating mode shapes is first studied in addition to including the rotary inertia, the shear and axial deformation influences. The natural frequencies of the springs are determined by the use of improved Riccati transfer matrix method. The element transfer matrix used in the solution is calculated using the Scaling and Squaring method and Pad'e approximations. Three examples are presented for three types of springs with different cross-sectional shapes under clamped-clamped boundary condition. The accuracy of the proposed method has been compared with the FEM results using three-dimensional solid elements (Solid 45 in ANSYS code. Numerical results reveal that the warping effect is more pronounced in the case of non-cylindrical helical springs than that of cylindrical helical springs, which should be taken into consideration in the free vibration analysis of such springs.

Retrieval of the projected potential by inversion from the scattering matrix in electron-crystal scattering

International Nuclear Information System (INIS)

Allen, L.J.; Spargo, A.E.C.; Leeb, H.

1998-01-01

The retrieval of a unique crystal potential from the scattering matrix S in high energy transmission electron diffraction is discussed. It is shown that, in general, data taken at a single orientation are not sufficient to determine all the elements of S. Additional measurements with tilted incident beam are required for the determination of the whole S-matrix. An algorithm for the extraction of the crystal potential from the S-matrix measured at a single energy and thickness is presented. The limiting case of thin crystals is discussed. Several examples with simulated data are considered

Accurate single-scattering simulation of ice cloud using the invariant-imbedding T-matrix method and the physical-geometric optics method

Science.gov (United States)

Sun, B.; Yang, P.; Kattawar, G. W.; Zhang, X.

2017-12-01

The ice cloud single-scattering properties can be accurately simulated using the invariant-imbedding T-matrix method (IITM) and the physical-geometric optics method (PGOM). The IITM has been parallelized using the Message Passing Interface (MPI) method to remove the memory limitation so that the IITM can be used to obtain the single-scattering properties of ice clouds for sizes in the geometric optics regime. Furthermore, the results associated with random orientations can be analytically achieved once the T-matrix is given. The PGOM is also parallelized in conjunction with random orientations. The single-scattering properties of a hexagonal prism with height 400 (in units of lambda/2*pi, where lambda is the incident wavelength) and an aspect ratio of 1 (defined as the height over two times of bottom side length) are given by using the parallelized IITM and compared to the counterparts using the parallelized PGOM. The two results are in close agreement. Furthermore, the integrated single-scattering properties, including the asymmetry factor, the extinction cross-section, and the scattering cross-section, are given in a completed size range. The present results show a smooth transition from the exact IITM solution to the approximate PGOM result. Because the calculation of the IITM method has reached the geometric regime, the IITM and the PGOM can be efficiently employed to accurately compute the single-scattering properties of ice cloud in a wide spectral range.

The Virasoro algebra in integrable hierarchies and the method of matrix models

International Nuclear Information System (INIS)

Semikhatov, A.M.

1992-01-01

The action of the Virasoro algebra on hierarchies of nonlinear integrable equations, and also the structure and consequences of Virasoro constraints on these hierarchies, are studied. It is proposed that a broad class of hierarchies, restricted by Virasoro constraints, can be defined in terms of dressing operators hidden in the structure of integrable systems. The Virasoro-algebra representation constructed on the dressing operators displays a number of analogies with structures in conformal field theory. The formulation of the Virasoro constraints that stems from this representation makes it possible to translate into the language of integrable systems a number of concepts from the method of the 'matrix models' that describe nonperturbative quantum gravity, and, in particular, to realize a 'hierarchical' version of the double scaling limit. From the Virasoro constraints written in terms of the dressing operators generalized loop equations are derived, and this makes it possible to do calculations on a reconstruction of the field-theoretical description. The reduction of the Kadomtsev-Petviashvili (KP) hierarchy, subject to Virasoro constraints, to generalized Korteweg-deVries (KdV) hierarchies is implemented, and the corresponding representation of the Virasoro algebra on these hierarchies is found both in the language of scalar differential operators and in the matrix formalism of Drinfel'd and Sokolov. The string equation in the matrix formalism does not replicate the structure of the scalar string equation. The symmetry algebras of the KP and N-KdV hierarchies restricted by Virasoro constraints are calculated: A relationship is established with algebras from the family W ∞ (J) of infinite W-algebras

The Green's matrix and the boundary integral equations for analysis of time-harmonic dynamics of elastic helical springs.

Science.gov (United States)

Sorokin, Sergey V

2011-03-01

Helical springs serve as vibration isolators in virtually any suspension system. Various exact and approximate methods may be employed to determine the eigenfrequencies of vibrations of these structural elements and their dynamic transfer functions. The method of boundary integral equations is a meaningful alternative to obtain exact solutions of problems of the time-harmonic dynamics of elastic springs in the framework of Bernoulli-Euler beam theory. In this paper, the derivations of the Green's matrix, of the Somigliana's identities, and of the boundary integral equations are presented. The vibrational power transmission in an infinitely long spring is analyzed by means of the Green's matrix. The eigenfrequencies and the dynamic transfer functions are found by solving the boundary integral equations. In the course of analysis, the essential features and advantages of the method of boundary integral equations are highlighted. The reported analytical results may be used to study the time-harmonic motion in any wave guide governed by a system of linear differential equations in a single spatial coordinate along its axis. © 2011 Acoustical Society of America