
Sample records for transmission lines depending

  1. Minimal inductance for axisymmetric transmission lines with radially dependent anode-cathode gap

    Directory of Open Access Journals (Sweden)

    Eduardo M. Waisman


    Full Text Available We extend the variational calculus technique for inductance minimization of constant gap axisymmetric transmission lines (TL, introduced by Hurricane [J. Appl. Phys. 95, 4503 (2004JAPIAU0021-897910.1063/1.1687986], to the case in which the anode-cathode gap is a linear function of the midgap radius. The full analytic optimal midgap solution curve z(r yielding minimum inductance is obtained in terms of a single parameter ρ_{0}, determined numerically by imposing that z(r goes through prescribed end points. The radius of curvature ρ(r of the optimal curve is obtained everywhere the function is defined, even outside of the end point range, and it is shown that a convenient choice is ρ_{0}=ρ(0. The value of the transmission line inductance is calculated by 1D numerical quadrature. A simple numerical technique is introduced for TL with nonlinear radial gap dependence.

  2. Transmission line capital costs

    International Nuclear Information System (INIS)

    Hughes, K.R.; Brown, D.R.


    The displacement or deferral of conventional AC transmission line installation is a key benefit associated with several technologies being developed with the support of the U.S. Department of Energy's Office of Energy Management (OEM). Previous benefits assessments conducted within OEM have been based on significantly different assumptions for the average cost per mile of AC transmission line. In response to this uncertainty, an investigation of transmission line capital cost data was initiated. The objective of this study was to develop a database for preparing preliminary estimates of transmission line costs. An extensive search of potential data sources identified databases maintained by the Bonneville Power Administration (BPA) and the Western Area Power Administration (WAPA) as superior sources of transmission line cost data. The BPA and WAPA data were adjusted to a common basis and combined together. The composite database covers voltage levels from 13.8 to 765 W, with cost estimates for a given voltage level varying depending on conductor size, tower material type, tower frame type, and number of circuits. Reported transmission line costs vary significantly, even for a given voltage level. This can usually be explained by variation in the design factors noted above and variation in environmental and land (right-of-way) costs, which are extremely site-specific. Cost estimates prepared from the composite database were compared to cost data collected by the Federal Energy Regulatory Commission (FERC) for investor-owned utilities from across the United States. The comparison was hampered because the only design specifications included with the FERC data were voltage level and line length. Working within this limitation, the FERC data were not found to differ significantly from the composite database. Therefore, the composite database was judged to be a reasonable proxy for estimating national average costs

  3. Series Transmission Line Transformer (United States)

    Buckles, Robert A.; Booth, Rex; Yen, Boris T.


    A series transmission line transformer is set forth which includes two or more of impedance matched sets of at least two transmissions lines such as shielded cables, connected in parallel at one end ans series at the other in a cascading fashion. The cables are wound about a magnetic core. The series transmission line transformer (STLT) which can provide for higher impedance ratios and bandwidths, which is scalable, and which is of simpler design and construction.

  4. Kansas Electric Transmission Lines (United States)

    Kansas Data Access and Support Center — This data set is a digital representation of the EletcircTransmission lines for the State of Kansas as maintained by the Kansas Corporation Commission. Data is...

  5. Electric Power Transmission Lines (United States)

    Department of Homeland Security — Transmission Lines are the system of structures, wires, insulators and associated hardware that carry electric energy from one point to another in an electric power...

  6. VT Digital Line Graph Miscellaneous Transmission Lines (United States)

    Vermont Center for Geographic Information — (Link to Metadata) This datalayer is comprised of Miscellaineous Transmission Lines. Digital line graph (DLG) data are digital representations of cartographic...

  7. Coaxial transmission line - Equalization

    International Nuclear Information System (INIS)

    Bonnerue, J.L.; Fremont, Jacques; Haubtmann, Jack; Pillon, Gerard.


    The transmission of electrical signal through a coaxial line is not perfect and signal distortions are increased as much as the frequency spectrum is extended. We have designed and achieved passive filters (named equalizers) with transfer functions which are inverse of coaxial transfer functions. Doing so our attempt is to avoid definitive loss of information in the recorded data. The main feature of our equalization method lies in the fact it could be either an electrical or a numerical correction or both of them. Some examples in the use of this technique are also proposed [fr

  8. Parallel plate transmission line transformer

    NARCIS (Netherlands)

    Voeten, S.J.; Brussaard, G.J.H.; Pemen, A.J.M.


    A Transmission Line Transformer (TLT) can be used to transform high-voltage nanosecond pulses. These transformers rely on the fact that the length of the pulse is shorter than the transmission lines used. This allows connecting the transmission lines in parallel at the input and in series at the

  9. VT Electric Transmission Line Corridors - corridor lines (United States)

    Vermont Center for Geographic Information — (Link to Metadata) The ELTRN layer depicts electric transmission line corridors in Vermont. Various methods have been used to digitize features. The data layer...

  10. Estimation of failure probability of the end induced current depending on uncertain parameters of a transmission line

    International Nuclear Information System (INIS)

    Larbi, M.; Besnier, P.; Pecqueux, B.


    This paper treats about the risk analysis of an EMC default using a statistical approach based on reliability methods. A probability of failure (i.e. probability of exceeding a threshold) of an induced current by crosstalk is computed by taking into account uncertainties on input parameters influencing extreme levels of interference in the context of transmission lines. Results are compared to Monte Carlo simulation (MCS). (authors)

  11. Radio and line transmission 2

    CERN Document Server

    Roddy, Dermot


    Radio and Line Transmission, Volume 2 gives a detailed treatment of the subject as well as an introduction to additional advanced subject matter. Organized into 14 chapters, this book begins by explaining the radio wave propagation, signal frequencies, and bandwidth. Subsequent chapters describe the transmission lines and cables; the aerials; tuned and coupled circuits; bipolar transistor amplifiers; field-effect transistors and circuits; thermionic valve amplifiers; LC oscillators; the diode detectors and modulators; and the superheterodyne receiver. Other chapters explore noise and interfere

  12. Atlas transmission line breakdown analysis

    CERN Document Server

    Nielsen, K E; Ballard, E O; Elizondo, J M; Gribble, R F; McCuistian, B T; Parsons, W M


    The Atlas facility will use 24 radially converging, vertically oriented and tapered, oil insulated, triplate transmission lines between the Marx generators and the central load region. Among the requirements of the transmission lines are low inductance and high reliability. The inter-conductor gap is nominally 2 cm and the lines taper from a height of 1.75 m at the Marx end to 0.32 m at the output end. The aluminum conductors, held together by 20 insulating spacers, are assembled and inserted as a unit into radial oil-filled steel tanks. The negative, high-voltage, center conductor is 2.54-cm thick and the outer ground conductors are 1.59-cm thick. All 24 triplate transmission lines connect to a transition section at near 1 m radius that couples the transmission lines to a disk/conical solid- dielectric-insulated power flow channel transmission line terminating at the load. Peak operating voltage on the lines can be as high as 240 kV with an effective stress time of 0.8 mu s. Testing of small sections of the ...

  13. Transmission of radioiodine through sampling lines

    International Nuclear Information System (INIS)

    Unrein, P.J.; Pelletier, C.A.; Cline, J.E.; Voilleque, P.G.


    An experimental program to measure radioiodine transmission through sampling lines is described. The transmission depends upon both deposition on and resuspension from the walls of the line. The deposition and resuspension processes are themselves controlled by the length, diameter, and material of the line and the conditions under which it is operated. The operating conditions under study are sampling flow rate, temperature and relative humidity. Measurement results have been interpreted in terms of a four-compartment model of radioiodine deposition and resuspension. The model is applied to each of twenty or more segments of the line. Experimental measurements of short-term transmission fractions and the deposition velocities derived from them are presented for six lines. Data on resuspension rates for the same lines were obtained and are also discussed

  14. Coiled transmission line pulse generators (United States)

    McDonald, Kenneth Fox


    Methods and apparatus are provided for fabricating and constructing solid dielectric "Coiled Transmission Line" pulse generators in radial or axial coiled geometries. The pour and cure fabrication process enables a wide variety of geometries and form factors. The volume between the conductors is filled with liquid blends of monomers, polymers, oligomers, and/or cross-linkers and dielectric powders; and then cured to form high field strength and high dielectric constant solid dielectric transmission lines that intrinsically produce ideal rectangular high voltage pulses when charged and switched into matched impedance loads. Voltage levels may be increased by Marx and/or Blumlein principles incorporating spark gap or, preferentially, solid state switches (such as optically triggered thyristors) which produce reliable, high repetition rate operation. Moreover, these Marxed pulse generators can be DC charged and do not require additional pulse forming circuitry, pulse forming lines, transformers, or an a high voltage spark gap output switch. The apparatus accommodates a wide range of voltages, impedances, pulse durations, pulse repetition rates, and duty cycles. The resulting mobile or flight platform friendly cylindrical geometric configuration is much more compact, light-weight, and robust than conventional linear geometries, or pulse generators constructed from conventional components. Installing additional circuitry may accommodate optional pulse shape improvements. The Coiled Transmission Lines can also be connected in parallel to decrease the impedance, or in series to increase the pulse length.

  15. Circuit QED with hybrid metamaterial transmission lines

    Energy Technology Data Exchange (ETDEWEB)

    Ruloff, Stefan; Taketani, Bruno; Wilhelm, Frank [Theoretical Physics, Universitaet des Saarlandes, Saarbruecken (Germany)


    We're working on the theory of metamaterials providing some interesting results. The negative refraction index causes an opposite orientation of the wave vector k and the Poynting vector S of the travelling waves. Hence the metamaterial has a falling dispersion relation ∂ω(k)/∂k < 0 implying that low frequencies correspond to short wavelengths. Metamaterials are simulated by left-handed transmission lines consisting of discrete arrays of series capacitors and parallel inductors to ground. Unusual physics arises when right-and left-handed transmission lines are coupled forming a hybrid metamaterial transmission line. E.g. if a qubit is placed in front of a hybrid metamaterial transmission line terminated in an open circuit, the spontaneous emission rate is weakened or unaffected depending on the transition frequency of the qubit. Some other research interests are the general analysis of metamaterial cavities and the mode structure of hybrid metamaterial cavities for QND readout of multi-qubit operators. Especially the precise answer to the question about the definition of the mode volume of a metamaterial cavity is one of our primary goals.

  16. Magnetically insulated transmission line oscillator (United States)

    Bacon, L.D.; Ballard, W.P.; Clark, M.C.; Marder, B.M.


    A magnetically insulated transmission line oscillator employs self-generated magnetic fields to generate microwave energy. An anode of the oscillator includes slow-wave structures which are formed of a plurality of thin conductive vanes defining cavities therebetween, and a gap is formed between the anode and a cathode of the oscillator. In response to a pulsed voltage applied to the anode and cathode, self-generated magnetic fields are produced in a cross-field orientation with respect to the orientation of the electric field between the anode and the cathode. The cross-field magnetic fields insulate the flow of electrons in the gap and confine the flow of electrons within the gap. 11 figs.

  17. Response analysis on nonuniform transmission line

    Directory of Open Access Journals (Sweden)

    Cvetković Zlata


    Full Text Available Transients on a loss less exponential transmission line with a pure resistance load are presented in this paper. The approach is based on the two-port presentation of the transmission line. Using Picard-Carson's method the transmission line equations are solved. The relationship between source voltage and the load voltage in s-domain is derived. All the results are plotted using program package Mathematica 3.0.

  18. Transmission Line Security Monitor: Final Report

    Energy Technology Data Exchange (ETDEWEB)

    John Svoboda


    The Electric Power Transmission Line Security Monitor System Operational Test is a project funded by the Technical Support Working Group (TSWG). TSWG operates under the Combating Terrorism Technical Support Office that functions under the Department of Defense. The Transmission Line Security Monitor System is based on technology developed by Idaho National Laboratory. The technology provides a means for real-time monitoring of physical threats and/or damage to electrical transmission line towers and conductors as well as providing operational parameters to transmission line operators to optimize transmission line operation. The end use is for monitoring long stretches of transmission lines that deliver electrical power from remote generating stations to cities and industry. These transmission lines are generally located in remote transmission line corridors where security infrastructure may not exist. Security and operational sensors in the sensor platform on the conductors take power from the transmission line and relay security and operational information to operations personnel hundreds of miles away without relying on existing infrastructure. Initiated on May 25, 2007, this project resulted in pre-production units tested in realistic operational environments during 2010. A technology licensee, Lindsey Manufacturing of Azusa California, is assisting in design, testing, and ultimately production. The platform was originally designed for a security monitoring mission, but it has been enhanced to include important operational features desired by electrical utilities.

  19. Microwave transmission-line impedance data

    CERN Document Server

    Gunston, M A R


    A compendium of data for computing the characteristic impedance of transmission lines based on physical dimensions. Covers both conventional structures and unusual geometries, including coaxial, eccentric and elliptic coaxial, twin-wire, wire-above-ground, microstrip and derivatives, stripline, slabline and trough line. Also details numerous configurations of coupled lines.

  20. VT Electric Transmission Line Corridors - substation points (United States)

    Vermont Center for Geographic Information — (Link to Metadata) The ELTRN layer depicts electric transmission line corridors in Vermont. Various methods have been used to digitize features. The data layer...

  1. Transmission Line Resonator Segmented with Series Capacitors

    DEFF Research Database (Denmark)

    Zhurbenko, Vitaliy; Boer, Vincent; Petersen, Esben Thade


    Transmission line resonators are often used as coils in high field MRI. Due to distributed nature of such resonators, coils based on them produce inhomogeneous field. This work investigates application of series capacitors to improve field homogeneity along the resonator. The equations for optimal...... values of evenly distributed capacitors are presented. The performances of the segmented resonator and a regular transmission line resonator are compared....

  2. Signal Transmission on Power Lines

    DEFF Research Database (Denmark)

    Dalby, Arne Brejning


    In the analysis of power-line networks over a large frequency span, the time-domain method used in programs like EMTP (Electromagnetic Time domain Program) can not be used. A more rigorous analysis method must be employed. The correct analysis method (assuming TEM-mode propagation) for multiple....... An approximate analysis method must be usedIn this paper it is shown that an eigenvectormatrix, that is the propagation modes, can be chosen almost arbitrarily if the frequency interval of interest lies below the frequency, where the line length is about 1/3 times the wavelength for the propagation mode...... with the lowest phase velocity. The propagation constants corresponding to the chosen eigenvector matrix (the quasi modes) are found iteratively, which is a much simpler procedure than finding the eigenvalues....

  3. Transmission Line Series Compensation for Wind Energy Transmission

    International Nuclear Information System (INIS)

    Palanichamy, C; Wong, Y C


    Wind energy has demonstrated to be a clean, copious and absolutely renewable source of energy, and the large penetration of it into the power grid indicates that wind energy is considered an effective means of power generation, Transmission of wind energy from remote locations to load centers necessitates long transmission lines. Series compensation is a proven and economical transmission solution to address system power transfer strength, grid stability, and voltage profile issues of long transmission lines. In this paper, a programmable approach to determine the capacitive reactance of series capacitor and optimum location for its placement to achieve maximum power transfer gas been presented. The respective program with sample solutions has been provided for real-time applications. (paper)

  4. Conceptual design for transmission line inspection robot

    International Nuclear Information System (INIS)

    Jalal, M F Abdul; Sahari, K S Mohamed; Anuar, A; Arshad, A D Mohd; Idris, M S


    Power transmission line is used for power distribution purposes due to their cost effective measure compared to underlying cable. However, prolonged exposure to natural weather may cause fatigue stress to the lines as well as induce material failure. Therefore, periodical line inspection is considered uttermost important as a preventive measure to avoid power outage. However, transmission line inspection has always been a high risk and expensive work. Hazardous works that may harm operator as well as routine that requires precise handling can be performed by robots. Various types of robots have been designed and developed for line inspection but only perform well on a straight and continuous line. As these robots encounter an obstacle during the inspection, then the real problem in terms of robot stability and smooth operation arises. In this paper, conceptual design and evaluation for transmission line inspection robot is presented. The inspection robot mobile robot must be able to bypass or avoid obstacles as it travels along the power transmission line.

  5. Composite Based EHV AC Overhead Transmission Lines

    DEFF Research Database (Denmark)

    Sørensen, Thomas Kjærsgaard

    and analysed with regard to the possibilities, limitations and risks widespread application of composite materials on EHV AC overhead transmission lines may present. To form the basis for evaluation of the useability of composite materials, dierent overhead line projects aimed at reducing the environmental...

  6. The LHCb VELO analogue transmission line

    International Nuclear Information System (INIS)

    Bay, A.; Borel, J.; Buytaert, J.; De Laere, S.; Frei, R.; Haefeli, G.; Koppenburg, P.; Locatelli, L.; Schneider, O.; Zehr, F.


    The Vertex Locator is one of the most important sub-detectors of the LHCb experiment, which is devoted to B physics. The signals from the silicon strip sensors are multiplexed at 40 MHz and transported by 60 m copper lines to the counting stations placed in a radiation safe area. This paper describes the development of this long transmission line and its performance.

  7. Transmission Line Adapted Analytical Power Charts Solution (United States)

    Sakala, Japhet D.; Daka, James S. J.; Setlhaolo, Ditiro; Malichi, Alec Pulu


    The performance of a transmission line has been assessed over the years using power charts. These are graphical representations, drawn to scale, of the equations that describe the performance of transmission lines. Various quantities that describe the performance, such as sending end voltage, sending end power and compensation to give zero voltage regulation, may be deduced from the power charts. Usually required values are read off and then converted using the appropriate scales and known relationships. In this paper, the authors revisit this area of circle diagrams for transmission line performance. The work presented here formulates the mathematical model that analyses the transmission line performance from the power charts relationships and then uses them to calculate the transmission line performance. In this proposed approach, it is not necessary to draw the power charts for the solution. However the power charts may be drawn for the visual presentation. The method is based on applying derived equations and is simple to use since it does not require rigorous derivations.

  8. A universal calculation model for the controlled electric transmission line

    International Nuclear Information System (INIS)

    Zivzivadze, O.; Zivzivadze, L.


    Difficulties associated with the development of calculation models are analyzed, and the ways of resolution of these problems are given. A version of the equivalent circuit as a six-pole network, the parameters of which do not depend on the angle of shift Θ between the voltage vectors of circuits is offered. The interrelation between the parameters of the equivalent circuit and the transmission constants of the line was determined. A universal calculation model for the controlled electric transmission line was elaborated. The model allows calculating the stationary modes of lines of such classes at any angle of shift Θ between the circuits. (author)

  9. Electromagnetic analysis using transmission line variables

    CERN Document Server

    Weiner, Maurice


    This book employs a relatively new method for solving electromagnetic problems, one which makes use of a transmission line matrix (TLM). The propagation space is imagined to be filled with this matrix. The propagating fields and physical properties are then mapped onto the matrix. Mathematically, the procedures are identical with the traditional numerical methods; however, the interpretation and physical appeal of the transmission line matrix are far superior. Any change in the matrix has an immediate physical significance. What is also very important is that the matrix becomes a launching pad

  10. Flux Cloning in Josephson Transmission Lines

    International Nuclear Information System (INIS)

    Gulevich, D.R.; Kusmartsev, F.V.


    We describe a novel effect related to the controlled birth of a single Josephson vortex. In this phenomenon, the vortex is created in a Josephson transmission line at a T-shaped junction. The 'baby' vortex arises at the moment when a 'mother' vortex propagating in the adjacent transmission line passes the T-shaped junction. In order to give birth to a new vortex, the mother vortex must have enough kinetic energy. Its motion can also be supported by an externally applied driving current. We determine the critical velocity and the critical driving current for the creation of the baby vortices and briefly discuss the potential applications of the found effect

  11. EC Transmission Line Risk Identification and Analysis

    Energy Technology Data Exchange (ETDEWEB)

    Bigelow, Tim S [ORNL


    The purpose of this document is to assist in evaluating and planning for the cost, schedule, and technical project risks associated with the delivery and operation of the EC (Electron cyclotron) transmission line system. In general, the major risks that are anticipated to be encountered during the project delivery phase associated with the implementation of the Procurement Arrangement for the EC transmission line system are associated with: (1) Undefined or changing requirements (e.g., functional or regulatory requirements) (2) Underperformance of prototype, first unit, or production components during testing (3) Unavailability of qualified vendors for critical components Technical risks associated with the design and operation of the system are also identified.

  12. Tornado risk model for transmission line design

    CSIR Research Space (South Africa)

    Milford, RV


    Full Text Available is in combination with ice loading. The wind load used in most codes of practice and design recommendations for transmission line design have until recently been based almost exclusively on large-scale wind storms, which may include severe storms such as hurricanes...

  13. Nonlinear left-handed transmission line metamaterials

    International Nuclear Information System (INIS)

    Kozyrev, A B; Weide, D W van der


    Metamaterials, exhibiting simultaneously negative permittivity ε and permeability μ, more commonly referred to as left-handed metamaterials (LHMs) and also known as negative-index materials, have received substantial attention in the scientific and engineering communities [1]. Most studies of LHMs (and electromagnetic metamaterials in general) have been in the linear regime of wave propagation and have already inspired new types of microwave circuits and devices. The results of these studies have already been the subject of numerous reviews and books. This review covers a less explored but rapidly developing area of investigation involving media that combine nonlinearity (dependence of the permittivity and permeability on the magnitude of the propagating field) with the anomalous dispersion exhibited by LHM. The nonlinear phenomena in such media will be considered on the example of a model system: the nonlinear left-handed transmission line. These nonlinear phenomena include parametric generation and amplification, harmonic and subharmonic generation as well as modulational instabilities and envelope solitons. (topical review)

  14. Parametric amplifications in the nonlinear transmission line

    Energy Technology Data Exchange (ETDEWEB)

    Kawata, T; Sakai, J; Inoue, H [Toyama Univ., Takaoka (Japan). Faculty of Engineering


    The parametric amplification in a transmission line with nonlinear capacitors is analysed theoretically using the equations of three wave interactions. Since this line has two modes, high frequency and low frequency modes, there may occur some mode coupling phenomena through the resonant interactions. We consider three waves with wave number k sub(j) and frequency in resonance with each other, that is, 1/ + 2/ = 3/ and k/sub 1/ + k/sub 2/ = k/sub 3/, where 0 <= 1/ <= 2/ <= 3/ and k/sub 3/ >= 0. Such conditions are realized in our network and there exist two states: ''forward state'' (each group velocity is positive) and ''backward state'' (one of the group velocities is negative). The coupled equations of three waves has two constant pumps: high frequency (HF) pump and low frequency (LF) pump. Using linear approximations, we examine the possible types of parametric amplification and obtain the power gains depending on the frequency deviation. For only the case of HF pump we get the gain between signals with seme frequency and also get the gain from the low frequency signal to the high frequency signal (''up-conversion'') for the LF pump. The nonlinear analysis gives the exact relation between input and output signals. For the forward state the gain is absolutely suppressed by the ratio of pumping power to input power, while the gain of backward state has no finite maximum and there may appear an ''oscillating state'' if the pumping power is comparatively small.

  15. Coaxial tube array space transmission line characterization

    International Nuclear Information System (INIS)

    Switzer, C.A.; Bents, D.J.


    The coaxial tube array tether/transmission line used to connect an SP-100 nuclear power system to the space station was characterized over the range of reactor-to-platform separation distances of 1 to 10 km. Characterization was done with respect to array performance, physical dimensions and masses. Using a fixed design procedure, a family of designs was generated for the same power level (300 kWe), power loss (1.5 percent), and meteoroid survival probability (99.5 percent over 10 yr). To differentiate between vacuum insulated and gas insulated lines, two different maximum values of the E field were considered: 20 kV/cm (appropriate to vacuum insulation) and 50 kV/cm (compressed SF6). Core conductor, tube, bumper, standoff, spacer and bumper support dimensions, and masses were also calculated. The results of the characterization show mainly how transmission line size and mass scale with reactor-to-platform separation distance

  16. High power RF transmission line component development

    International Nuclear Information System (INIS)

    Hong, B. G.; Hwang, C. K.; Bae, Y. D.; Yoon, J. S.; Wang, S. J.; Gu, S. H.; Yang, J. R.; Hahm, Y. S.; Oh, G. S.; Lee, J. R.; Lee, W. I.; Park, S. H.; Kang, M. S.; Oh, S. H.; Lee, W.I.


    We developed the liquid stub and phase shifter which are the key high RF power transmission line components. They show reliable operation characteristics and increased insulation capability, and reduced the size by using liquid (silicon oil, dielectric constant ε=2.72) instead of gas for insulating dielectric material. They do not have finger stock for the electric contact so the local temperature rise due to irregular contact and RF breakdown due to scratch in conductor are prevented. They can be utilized in broadcasting, radar facility which require high RF power transmission. Moreover, they are key components in RF heating system for fusion reactor. (author)

  17. High power RF transmission line component development

    Energy Technology Data Exchange (ETDEWEB)

    Hong, B. G.; Hwang, C. K.; Bae, Y. D.; Yoon, J. S.; Wang, S. J.; Gu, S. H.; Yang, J. R.; Hahm, Y. S.; Oh, G. S.; Lee, J. R.; Lee, W. I.; Park, S. H.; Kang, M. S.; Oh, S. H.; Lee, W.I


    We developed the liquid stub and phase shifter which are the key high RF power transmission line components. They show reliable operation characteristics and increased insulation capability, and reduced the size by using liquid (silicon oil, dielectric constant {epsilon}=2.72) instead of gas for insulating dielectric material. They do not have finger stock for the electric contact so the local temperature rise due to irregular contact and RF breakdown due to scratch in conductor are prevented. They can be utilized in broadcasting, radar facility which require high RF power transmission. Moreover, they are key components in RF heating system for fusion reactor. (author)

  18. Flux qubit to a transmission line

    Energy Technology Data Exchange (ETDEWEB)

    Haeberlein, Max; Baust, Alexander; Zhong, Ling; Gross, Rudolf [Walther-Meissner-Institut, Bayerische Akademie der Wissenschaften, Garching (Germany); Physik-Department, TU Muenchen, Garching (Germany); Nanosystems Initiative Munich (NIM), Muenchen (Germany); Anderson, Gustav; Wang, Lujun; Eder, Peter; Fischer, Michael; Goetz, Jan; Xie, Edwar; Schwarz, Manuel; Wulschner, Karl Friedrich; Deppe, Frank; Fedorov, Kirill; Huebl, Hans; Menzel, Edwin [Walther-Meissner-Institut, Bayerische Akademie der Wissenschaften, Garching (Germany); Physik-Department, TU Muenchen, Garching (Germany); Marx, Achim [Walther-Meissner-Institut, Bayerische Akademie der Wissenschaften, Garching (Germany)


    Within the last decade, superconducting qubits coupled to microwave resonators have been extensively studied within the framework of quantum electrodynamics. Ultimately, quantum computing seems within reach in such architectures. However, error correction schemes are necessary to achieve the required fidelity in multi-qubit operations, drastically increasing the number of qubits involved. In this work, we couple a flux qubit to a transmission line where it interacts with itinerant microwave photons granting access to all-optical quantum computing. In this approach, travelling photons generate entanglement between two waveguides, containing the qubit information. In this presentation, we show experimental data on flux qubits coupled to transmission lines. Furthermore, we will discuss entanglement generation between two separate paths.

  19. An analytical theory of transmission line shielding

    International Nuclear Information System (INIS)

    Pettersson, Per


    The classical electrogeometric model of shielding failure flashovers on transmission lines is investigated by analytical methods. Most of the basic elements that has appeared in the literature on the subject have been incorporated and put into a comprehensive model. These elements are: tower top geometry, structure height above ground, line insulation, lateral slope of ground, probability distribution of lightning currents, ratio of striking distances to ground wire and earth relative to conductor, and probability distribution of lightning leader approach angle to ground. Departing from a basic idealistic case, the sensitivity of the model to variations in these parameters is studied. Numerical examples are given. 8 refs, 8 figs, 1 tab

  20. Self-Shielding Of Transmission Lines

    Energy Technology Data Exchange (ETDEWEB)

    Christodoulou, Christos [Univ. of New Mexico, Albuquerque, NM (United States)


    The use of shielding to contend with noise or harmful EMI/EMR energy is not a new concept. An inevitable trade that must be made for shielding is physical space and weight. Space was often not as much of a painful design trade in older larger systems as they are in today’s smaller systems. Today we are packing in an exponentially growing number of functionality within the same or smaller volumes. As systems become smaller and space within systems become more restricted, the implementation of shielding becomes more problematic. Often, space that was used to design a more mechanically robust component must be used for shielding. As the system gets smaller and space is at more of a premium, the trades starts to result in defects, designs with inadequate margin in other performance areas, and designs that are sensitive to manufacturing variability. With these challenges in mind, it would be ideal to maximize attenuation of harmful fields as they inevitably couple onto transmission lines without the use of traditional shielding. Dr. Tom Van Doren proposed a design concept for transmission lines to a class of engineers while visiting New Mexico. This design concept works by maximizing Electric field (E) and Magnetic Field (H) field containment between operating transmission lines to achieve what he called “Self-Shielding”. By making the geometric centroid of the outgoing current coincident with the return current, maximum field containment is achieved. The reciprocal should be true as well, resulting in greater attenuation of incident fields. Figure’s 1(a)-1(b) are examples of designs where the current centroids are coincident. Coax cables are good examples of transmission lines with co-located centroids but they demonstrate excellent field attenuation for other reasons and can’t be used to test this design concept. Figure 1(b) is a flex circuit design that demonstrate the implementation of self-shielding vs a standard conductor layout.

  1. Optoelectronic line transmission an introduction to fibre optics

    CERN Document Server

    Tricker, Raymond L


    Optoelectronic Line Transmission: An Introduction to Fibre Optics presents a basic introduction as well as a background reference manual on fiber optic transmission. The book discusses the basic principles of optical line transmission; the advantages and disadvantages of optical fibers and optoelectronic signalling; the practical applications of optoelectronics; and the future of optoelectronics. The text also describes the theories of optical line transmission; fibers and cables for optical transmission; transmitters including light-emitting diodes and lasers; and receivers including photodi

  2. PSpice for filters and transmission lines

    CERN Document Server

    Tobin, Paul


    In this book, PSpice for Filters and Transmission Lines, we examine a range of active and passive filters where each design is simulated using the latest Cadence Orcad V10.5 PSpice capture software. These filters cannot match the very high order digital signal processing (DSP) filters considered in PSpice for Digital Signal Processing, but nevertheless these filters have many uses. The active filters considered were designed using Butterworth and Chebychev approximation loss functions rather than using the 'cookbook approach' so that the final design will meet a given specification in an exact

  3. On the Transmission Line Pulse Measurement Technique


    X. Rodriguez; M. Eduardo; M. Harington


    Transmission Line Pulse is a short pulse (25ns to 150ns) measurement of the current-voltage (I/V) characteristics of the ESD protection built into an integrated circuit. The short TLP pulses are used to simulate the short ESD pulse threats and integrated circuit must tolerate without being damaged. In this work the fundamental principles of how the TLP pulse is generated and used to create I-V characteristic plots will be explored. The measurement will be then used to characterize the I-V cha...

  4. MEMS-based transmission lines for microwave applications (United States)

    Wu, Qun; Fu, Jiahui; Gu, Xuemai; Shi, Huajuan; Lee, Jongchul


    This paper mainly presents a briefly review for recent progress in MEMS-based transmission lines for use in microwave and millimeterwave range. MEMS-based transmission lines including different transmission line structure such as membrane-supported microstrip line microstrip line, coplanar microshield transmission line, LIGA micromachined planar transmission line, micromachined waveguides and coplanar waveguide are discussed. MEMS-based transmission lines are characterized by low propagation loss, wide operation frequency band, low dispersion and high quality factor, in addition, the fabrication is compatible with traditional processing of integrated circuits (IC"s). The emergence of MEMS-based transmission lines provided a solution for miniaturizing microwave system and monolithic microwave integrated circuits.

  5. 49 CFR 192.719 - Transmission lines: Testing of repairs. (United States)


    ... pipe before it is installed. (b) Testing of repairs made by welding. Each repair made by welding in... 49 Transportation 3 2010-10-01 2010-10-01 false Transmission lines: Testing of repairs. 192.719... Transmission lines: Testing of repairs. (a) Testing of replacement pipe. If a segment of transmission line is...

  6. The Transmission Line for the SPIDER experiment

    International Nuclear Information System (INIS)

    Boldrin, Marco; De Lorenzi, Antonio; Recchia, Mauro; Toigo, Vanni; Bonicelli, Tullio; Simon, Muriel


    The 100 keV Ion Source Test facility - Source for the Production of Ions of Deuterium Extracted from RF plasma (SPIDER) - is aimed to test the full scale prototype of the Ion Source for the ITER 1 MeV Neutral Beam Injector (NBI). The SPIDER facility requires the construction of a High Voltage Deck (HVD) and of a High Voltage Transmission Line (TL) respectively to host the Ion Source Power Supplies system polarized at 100 kV and to carry the power and signal conductors to the beam accelerator. In already existing NBI systems with beam energy above 100 keV, the TL is realized with the SF 6 Gas Insulated Line technology. In the SPIDER TL case, the presence of a large inner conductor (half meter diameter), would make the pressurized TL a complex and costly component; therefore a free air insulated solution has been proposed. The paper focuses on the design of this TL, which has to host inside the complex high potential (100 kV) inner electrode a number of power and measuring conductors and has to minimize the Electro Magnetic Interferences (EMI) produced by the frequent grids breakdowns. Finite Element (FE) analyses have been performed to verify the configuration from the electrostatic point of view, to evaluate EMI screening effectiveness and to assess the impact of the relatively high thermal dissipation of power conductors located inside the high potential electrode. Moreover, an experimental test campaign has been carried out on a TL mockup to validate the TL electrostatic configuration under DC voltage. Finally, the paper reports on the status of procurement activities for the Transmission Line.

  7. Survey of transmission line corridors. [Data on delays in transmission line construction

    Energy Technology Data Exchange (ETDEWEB)


    The intent of this study is to determine the extent of delays experienced in planning and constructing transmission lines in the continental United States. The reasons for the delays are identified for each line studied and their effect on the total electrical system is sought. Data was collected for 136 different lines either recently built or currently under study. Statistics were developed for each line in several categories and comparisons of lines delayed were made by company, area served and generation capacity. From the study presented here it was found that: right-of-way acquisition procedures including condemnation and easement negotiation practices delay more projects than local, state and federal regulatory requirements combined; load growth reductions particularly in the east have reduced the impact of regulatory delays; the south, southeast and southwestern areas of the country experience fewer delays in constructing transmission lines than the more populated states, and the cost for corridor delays was responded to for only 17 of the 142 projects surveyed. By far the most costly delay is the expense of condemning land for transmission right-of-way.

  8. Characterization of superconducting transmission line resonators

    Energy Technology Data Exchange (ETDEWEB)

    Goetz, Jan; Summer, Philipp; Meier, Sebastian; Haeberlein, Max; Wulschner, Karl Friedrich; Eder, Peter; Fischer, Michael; Schwarz, Manuel; Deppe, Frank; Fedorov, Kirill; Huebl, Hans; Menzel, Edwin [Walther-Meissner-Institut, Bayerische Akademie der Wissenschaften, Garching (Germany); Physik-Department, TU Muenchen, Garching (Germany); Krawczyk, Marta; Marx, Achim [Walther-Meissner-Institut, Bayerische Akademie der Wissenschaften, Garching (Germany); Baust, Alexander; Xie, Edwar; Zhong, Ling; Gross, Rudolf [Walther-Meissner-Institut, Bayerische Akademie der Wissenschaften, Garching (Germany); Physik-Department, TU Muenchen, Garching (Germany); Nanosystems Initiative Munich (NIM), Muenchen (Germany)


    Superconducting transmission line resonators are widely used in circuit quantum electrodynamics experiments as quantum bus or storage devices. For these applications, long coherence times, which can be linked to the internal quality factor of the resonators, are crucial. Here, we show a systematic study of the internal quality factor of niobium thin film resonators. We analyze different cleaning methods and substrate parameters for coplanar waveguide as well as microstrip geometries. In addition, we investigate the impact of a niobium-aluminum interface which is necessary for galvanically coupled flux qubits made from aluminum. This interface can be avoided by fabricating the complete resonator-qubit structure using Al/AlO{sub x}/Al technology during fabrication.

  9. Transmission line sag calculations using interval mathematics

    Energy Technology Data Exchange (ETDEWEB)

    Shaalan, H. [Institute of Electrical and Electronics Engineers, Washington, DC (United States)]|[US Merchant Marine Academy, Kings Point, NY (United States)


    Electric utilities are facing the need for additional generating capacity, new transmission systems and more efficient use of existing resources. As such, there are several uncertainties associated with utility decisions. These uncertainties include future load growth, construction times and costs, and performance of new resources. Regulatory and economic environments also present uncertainties. Uncertainty can be modeled based on a probabilistic approach where probability distributions for all of the uncertainties are assumed. Another approach to modeling uncertainty is referred to as unknown but bounded. In this approach, the upper and lower bounds on the uncertainties are assumed without probability distributions. Interval mathematics is a tool for the practical use and extension of the unknown but bounded concept. In this study, the calculation of transmission line sag was used as an example to demonstrate the use of interval mathematics. The objective was to determine the change in cable length, based on a fixed span and an interval of cable sag values for a range of temperatures. The resulting change in cable length was an interval corresponding to the interval of cable sag values. It was shown that there is a small change in conductor length due to variation in sag based on the temperature ranges used in this study. 8 refs.

  10. Transmission Delay Modeling of Packet Communication over Digital Subscriber Line

    Directory of Open Access Journals (Sweden)

    Jiri Vodrazka


    Full Text Available Certain multimedia and voice services, such as VoIP, IPTV, etc., are significantly delay sensitive and their performance is influenced by the overall transmission delay and its variance. One of the most common solutions used in access networks are xDSL lines, especially ADSL2+ or VDSL2. Although these subscriber lines also use packet communication, there are several differences and mechanisms, which influence their resulting delay. Their delay characteristics are also dependent on the individual settings of each xDSL provider, therefore we decided to investigate this area for typical commercially available lines in Czech Republic. Based on the measured values and experiments with real ADSL2+ lines we also developed a potential modeling method, which is presented in this article as well. The parameters for packet jitter based on the generalized Pareto distribution were modeled.

  11. Wireless Sensor Network for Electric Transmission Line Monitoring

    Energy Technology Data Exchange (ETDEWEB)

    Alphenaar, Bruce


    Generally, federal agencies tasked to oversee power grid reliability are dependent on data from grid infrastructure owners and operators in order to obtain a basic level of situational awareness. Since there are many owners and operators involved in the day-to-day functioning of the power grid, the task of accessing, aggregating and analyzing grid information from these sources is not a trivial one. Seemingly basic tasks such as synchronizing data timestamps between many different data providers and sources can be difficult as evidenced during the post-event analysis of the August 2003 blackout. In this project we investigate the efficacy and cost effectiveness of deploying a network of wireless power line monitoring devices as a method of independently monitoring key parts of the power grid as a complement to the data which is currently available to federal agencies from grid system operators. Such a network is modeled on proprietary power line monitoring technologies and networks invented, developed and deployed by Genscape, a Louisville, Kentucky based real-time energy information provider. Genscape measures transmission line power flow using measurements of electromagnetic fields under overhead high voltage transmission power lines in the United States and Europe. Opportunities for optimization of the commercial power line monitoring technology were investigated in this project to enable lower power consumption, lower cost and improvements to measurement methodologies. These optimizations were performed in order to better enable the use of wireless transmission line monitors in large network deployments (perhaps covering several thousand power lines) for federal situational awareness needs. Power consumption and cost reduction were addressed by developing a power line monitor using a low power, low cost wireless telemetry platform known as the ''Mote''. Motes were first developed as smart sensor nodes in wireless mesh networking applications

  12. Design of the Yang magnetically-insulated transmission line

    International Nuclear Information System (INIS)

    Gu Yuanchao; Song Shenyi


    The authors have designed a new magnetically insulated transmission line (MITL) for the Yang accelerator. The differences between the existing line and the designing one are given. The electric strength of some special regions on the lines and the inductance of the lines have been calculated. The authors have checked the states of magnetic insulation on the designing line

  13. Thermal Rectification in Graded Nonlinear Transmission Lines

    International Nuclear Information System (INIS)

    Xu Wen; Chen Wei-Zhong; Tao Feng


    We consider heat conduction in a nonlinear inductance-capacitance (LC) transmission line with an inductance gradient by adding white-noise signals. It is found that the heat flux in the direction of inductance decrease is larger than that in the direction of inductance increase. When the low-inductance end is at higher temperature, the phonon density decreases due to conversion to high-frequency phonons, which can not move to the high-inductance end due to its lower cutoff frequency. However, when the high-inductance end is at higher temperature, the loss of phonon density can be compensated for because some high-frequency phonons can move to the low-inductance end dur to its higher cutoff frequency. This leads to the asymmetry of energy transfer. Discussion shows that this asymmetry exists in a particular range of temperatures, and increases with the increase of the difference between heat baths and the inductance gradient. (fundamental areas of phenomenology(including applications))

  14. 77 FR 35366 - Albany-Eugene Transmission Line Rebuild Project (United States)


    ... materials, removing vegetation including danger trees, and revegetating areas disturbed by construction... implement the Proposed Action Alternative, based on the Albany-Eugene Transmission Line Rebuild Project (DOE...

  15. Matching problems in pulse power radial transmission lines

    International Nuclear Information System (INIS)

    Mittag, K.; Brandelik, A.


    In this report we study the power transfer from a generator along a coaxial transmission line followed by a radial transmission line into a load, which in our application is a pseudo-spark plasma of about one millimeter diameter and about 15 cm in length. First the theoretical background based on transmission line theory is described. Then numerical results are presented. The main conclusion is that when matching the pulse power generator to the pseudo-spark plasma, the effect of the impedance transformation caused by the radial transmission line has to be taken into account. The conditions to obtain an optimal match are described. (orig.) [de

  16. Proximity effects of high voltage electric power transmission lines on ...

    African Journals Online (AJOL)



    Aug 18, 2010 ... transmission lines on ornamental plant growth. Zeki Demir ... The effects of proximity to power-line on specific leaf area and seedling dbh were tested .... during vegetation season is about 72% and common wind blow.

  17. Investigation on the variation of channel resistance and contact resistance of SiZnSnO semiconductor depending on Si contents using transmission line method (United States)

    Lee, Byeong Hyeon; Han, Sangmin; Lee, Sang Yeol


    Amorphous silicon-zinc-tin-oxide (a-SZTO) thin film transistors (TFTs) have been fabricated depending on the silicon ratio in channel layers. The a-SZTO TFT exhibited high electrical properties, such as high mobility of 23 cm2 V-1 s-1, subthreshold swing of 0.74 V/decade and ION/OFF of 2.8 × 108, despite of the addition of Si suppressor. The physical mechanism on the change of the sheet resistance and the contact resistance in a-SZTO TFT has been investigated and proposed closely related with the Si ratio. Both resistances were increased as increasing Si ratio, which clearly indicated that the role of Si is a carrier suppressor directly leading to the increase of channel and contact resistances. To explain the role of Si as a carrier suppressor, the conduction band offset mechanism has been also proposed depending on the change of carrier concentration in channel layer and at the interface between electrode and channel layer. 2007.01-2011.12 Senior Researcher at korea institute of science and technology (KOREA). 2008.01-2011.12 Professor at University of Science and Technology (KOREA). 1995.01-2007.12 Professor at Yonsei University (KOREA). 2002.01-2003.12 Inviting Researcher at Los Alamos National Lab (USA). 1993.01-1995.12 Senior Researcher at Electronics and Telecommunications Research Institute (KOREA). 1992.01-1993.01 Research Associate at State University of New York at Buffalo (USA).

  18. A current controlled variable delay superconducting transmission line

    International Nuclear Information System (INIS)

    Anlage, S.M.; Snortland, H.J.; Beasley, M.R.


    The authors present a device concept for a current-controlled variable delay for superconducting transmission line. The device makes use of the change in kinetic inductance of a superconducting transmission line under the application of a DC bias current. The relevant materials parameters and several promising superconducting materials have been identified

  19. Centralized Coordination of Load Shedding & Protection System of Transmission Lines

    DEFF Research Database (Denmark)

    Hoseinzadeh, Bakhtyar; Bak, Claus Leth


    The power system integrity is vulnerable to thermal limit of transmission lines due to overloading and consequently activation of their protection devices following severe contingencies. In this paper, the loading rate of transmission lines is monitored online and is considered in the centralized......, over current protection....

  20. Analysis of some coplanar transmission lines: coplanar coupled lines, coplanar coupled striplines, and coplanar coupled lines with rectangular microshield (United States)

    Yuan, Naichang; He, Jianguo; Yao, Demiao; Dai, Qin; Lin, Weigan


    Two types of coplanar transmission lines, rectangular microshield coplanar coupled lines (RMCCL) and coplanar coupled rectangular microshield lines (CCRML), are proposed for MMIC applications. These are developed from coplanar coupled lines (CCL) and coplanar coupled strip lines (CCS). Analytic formulas are presented for calculating the quasistatic TEM parameters of these coupled lines by means of exact conformal mapping techniques. Numerical results are also presented to illustrate the properties of these coplanar transmission lines.

  1. TLINES: A Computer Program for Circuits of Transmission Lines. (United States)


    of various lengths are handled by stringing together many short lines, with the assumption that each of the longer lines has a length approximated as...expressed in terms of transmission lines numbered from 2 through CAPM , connected in numerical sequence as in figure 3. Line 1 is a dummy element disconnected...from line 2 and the rest of the circuit. Lines 2 through CAPM can each be set to any impedance the user desires. Line CAPM +1 is a zero-impedance line

  2. High voltage transmission lines - what are the hazards

    International Nuclear Information System (INIS)

    Repacholi, M.H.


    With the increasing use of high voltage alternating current (HVAC) transmission lines there is a growing concern among the public about possible human health effects resulting from exposure to the electric fields associated with these lines. While there is no definitive evidence of such effects, mounting public fear and activism over hypothesized health risks is already causing delays in the licensing and constuction of major power transmission facilities, and is encouraging the formation of regulatory policy. This paper briefly reviews the concerns, biological effects data and standards for HVAC transmission lines

  3. Bottlenecks reduction using superconductors in high voltage transmission lines

    Directory of Open Access Journals (Sweden)

    Daloub Labib


    Full Text Available Energy flow bottlenecks in high voltage transmission lines known as congestions are one of the challenges facing power utilities in fast developing countries. Bottlenecks occur in selected power lines when transmission systems are operated at or beyond their transfer limits. In these cases, congestions result in preventing new power supply contracts, infeasibility in existing contracts, price spike and market power abuse. The “Superconductor Technology” in electric power transmission cables has been used as a solution to solve the problem of bottlenecks in energy transmission at high voltage underground cables and overhead lines. The increase in demand on power generation and transmission happening due to fast development and linked to the intensive usage of transmission network in certain points, which in turn, lead to often frequent congestion in getting the required power across to where it is needed. In this paper, a bottleneck in high voltage double overhead transmission line with Aluminum Conductor Steel Reinforced was modeled using conductor parameters and replaced by Gap-Type Superconductor to assess the benefit of upgrading to higher temperature superconductor and obtain higher current carrying capacity. This proved to reduce the high loading of traditional aluminum conductors and allow more power transfer over the line using superconductor within the same existing right-of-way, steel towers, insulators and fittings, thus reducing the upgrade cost of building new lines.


    Directory of Open Access Journals (Sweden)

    O. O. Hololobova


    Full Text Available Purpose. To conduct an effect research of the electromagnetic field of high-voltage transmission lines (HVTL (750 kV, 50 Hz on the track circuits and continuous automatic cab signalling (CACS with a signal current of 50 Hz in the areas of convergence and intersection with the transmission lines and to propose possible methods to improve noise immunity of CACS. Methodology. The measurements were performed both by means of car-laboratory and directly on rail lines. During the study the electric field strength in the range of industrial frequency directly under the transmission lines and at the distance from it to the railway lines was measured, as well as the time dependence of CACS codes with signal current frequency of 50 Hz directly under the transmission lines and at a distance from it in the absence of the train and its passing. Findings. The root causes analysis of CACS faults and failures was carried out. The effect of the electromagnetic field of high-voltage transmission lines (750 kV, 50 Hz on the track circuit and CACS with signal current of 50 Hz in the areas of convergence and intersection with the transmission line was investigated. Possible methods to improve noise immunity of CACS were considered. Originality. The effect research of transmission lines (750 kV on the operation of the automatic cab signalling on spans Prishib-Burchatsk and Privolnoye-Yelizarovo, Pridneprovsk railway in places of oblique railroads crossing and transmission lines (750 kV, 50 Hz was conducted. Electric field strength in the range of industrial frequency directly under the transmission lines and at a distance from it to the railway line, as well as the time dependences of ALSN codes with signal current frequency of 50 Hz directly under the transmission lines and at a distance from it in the absence of the train and as its passing were measured. It was found that CACS codes in track circuits under transmission lines are strongly distorted, as strength

  5. Transmission Lines Loading Enhancement Using ADPSO Approach


    M. Mahdavi; H. Monsef; A. Bagheri


    Discrete particle swarm optimization (DPSO) is a powerful stochastic evolutionary algorithm that is used to solve the large-scale, discrete and nonlinear optimization problems. However, it has been observed that standard DPSO algorithm has premature convergence when solving a complex optimization problem like transmission expansion planning (TEP). To resolve this problem an advanced discrete particle swarm optimization (ADPSO) is proposed in this paper. The simulation res...

  6. State Estimation-based Transmission line parameter identification

    Directory of Open Access Journals (Sweden)

    Fredy Andrés Olarte Dussán


    Full Text Available This article presents two state-estimation-based algorithms for identifying transmission line parameters. The identification technique used simultaneous state-parameter estimation on an artificial power system composed of several copies of the same transmission line, using measurements at different points in time. The first algorithm used active and reactive power measurements at both ends of the line. The second method used synchronised phasor voltage and current measurements at both ends. The algorithms were tested in simulated conditions on the 30-node IEEE test system. All line parameters for this system were estimated with errors below 1%.

  7. Electrical and Biological Effects of Transmission Lines: A Review.

    Energy Technology Data Exchange (ETDEWEB)

    Lee, Jack M.


    This review describes the electrical properties of a-c and d-c transmission lines and the resulting effects on plants, animals, and people. Methods used by BPA to mitigate undesirable effects are also discussed. Although much of the information in this review pertains to high-voltage transmission lines, information on distribution lines and electrical appliances is included. The electrical properties discussed are electric and magnetic fields and corona: first for alternating-current (a-c) lines, then for direct current (d-c).

  8. Coupled Transmission Lines as Impedance Transformer

    DEFF Research Database (Denmark)

    Jensen, Thomas; Zhurbenko, Vitaliy; Krozer, Viktor


    A theoretical investigation of the use of a coupled line section as an impedance transformer is presented. We show how to properly select the terminations of the coupled line structures for effective matching of real and complex loads in both narrow and wide frequency ranges. The corresponding...... circuit configurations and the design procedures are proposed. Synthesis relations are derived and provided for efficient matching circuit construction. Design examples are given to demonstrate the flexibility and limitations of the design methods and to show their validity for practical applications...


    Energy Technology Data Exchange (ETDEWEB)



    A main magnet chain forms a pair of transmission lines. Pulse-reflection-caused voltage and current differentiation throughout the magnet chain can have adverse effect on main magnet field quality. This effect is associated with magnet system configuration, coupling efficiency, and parasitic parameters. A better understanding of this phenomenon will help us in new design and existing system upgrade. In this paper, we exam the transmission line effect due to different input functions as well as configuration, coupling, and other parameters.

  10. Ground-based transmission line conductor motion sensor

    International Nuclear Information System (INIS)

    Jacobs, M.L.; Milano, U.


    A ground-based-conductor motion-sensing apparatus is provided for remotely sensing movement of electric-power transmission lines, particularly as would occur during the wind-induced condition known as galloping. The apparatus is comprised of a motion sensor and signal-generating means which are placed underneath a transmission line and will sense changes in the electric field around the line due to excessive line motion. The detector then signals a remote station when a conditioning of galloping is sensed. The apparatus of the present invention is advantageous over the line-mounted sensors of the prior art in that it is easier and less hazardous to install. The system can also be modified so that a signal will only be given when particular conditions, such as specific temperature range, large-amplitude line motion, or excessive duration of the line motion, are occurring

  11. Transmission line undergrounding : rate impact investigation and analysis

    International Nuclear Information System (INIS)


    In response to concerns expressed by the residents of Markham, Ontario regarding the possible environmental and health impacts of a proposed 230 kV overhead transmission line, Hydro One Networks Inc. (HONI) has proposed to place the line underground as an alternative. This analysis was prepared to evaluate the potential impacts on transmission rates and consumer prices related to changes in the level of underground construction of transmission lines by HONI, as opposed to overhead construction. The report presents the approach to data collection; cost estimates and projections; the modeling and projecting of HONI's regulated rate base and revenue requirement on a basis that reflects the manner in which its future transmission rates are expected to be established; estimates of the incremental cost of undergrounding reflecting a range of reasonable assumptions; and a comparison of the resulting transmission costs and total customer bill. To address the issue of potential demand in other municipalities for additional undergrounding, the study also examined the cumulative effects of ten years' incremental undergrounding costs (i.e. effects on 2014 rates). It was concluded that if HONI were to implement an undergrounding program beginning in 2005, resulting in the installation of 80 km of underground lines by 2014, and shared costs by all users of HONI's system through the network transmission charges, the 2014 transmission rates would be higher. 5 tabs

  12. Technical dependability of obstetric ultrasound transmission via ISDN. (United States)

    Nores, J; Athanassiou, A; Malone, F D; D'Alton, M E


    To evaluate the dependability of a live telemedicine link for the transmission of obstetric ultrasonograms using a commercial telephone network. We established an integrated services digital network (ISDN), consisting of three dedicated telephone lines from three satellite offices, to our central prenatal diagnostic center. All patients had a sonographic evaluation recorded on videotape by a trained sonographer. A live interactive video telemedicine link was then established, and a perinatologist directed the sonographer through the scan. A report was issued on the basis of the telemedicine examination. The number of calls required to obtain satisfactory real-time images was recorded, as were the reasons for suboptimal transmissions. The first 150 transmissions were excluded from this study. The results in the subsequent 100 patients who agreed to participate were analyzed. We were able to provide obstetric interpretations in all 100 patients scheduled to be examined using the telemedicine link. A single connection was required in 85 cases, two calls in 5 cases, three calls in 8 cases, four calls in 1 case, and five calls in another case. A repeat call was required in 20 cases because of poor image transmission; other repeat calls were caused by failure to connect (5 cases), calls disconnected (2 cases), and no image transmission (2 cases). The provision of telemedicine services for obstetric ultrasonography in the community is feasible, but the need for repeat connections because of technical failures needs to be incorporated into cost and time analyses in order to provide a measure of the system's efficiency.

  13. 49 CFR 192.705 - Transmission lines: Patrolling. (United States)


    ... adjacent to the transmission line right-of-way for indications of leaks, construction activity, and other factors affecting safety and operation. (b) The frequency of patrols is determined by the size of the line, the operating pressures, the class location, terrain, weather, and other relevant factors, but...

  14. Optimal Transmission Line Switching under Geomagnetic Disturbances

    International Nuclear Information System (INIS)

    Lu, Mowen; Nagarajan, Harsha; Yamangil, Emre; Bent, Russell; Backhaus, Scott


    Recently, there have been increasing concerns about how geomagnetic disturbances (GMDs) impact electrical power systems. Geomagnetically-induced currents (GICs) can saturate transformers, induce hot spot heating and increase reactive power losses. These effects can potentially cause catastrophic damage to transformers and severely impact the ability of a power system to deliver power. To address this problem, we develop a model of GIC impacts to power systems that includes 1) GIC thermal capacity of transformers as a function of normal Alternating Current (AC) and 2) reactive power losses as a function of GIC. We also use this model to derive an optimization problem that protects power systems from GIC impacts through line switching, generator dispatch, and load shedding. We then employ state-of-the-art convex relaxations of AC power flow equations to lower bound the objective. We demonstrate the approach on a modified RTS96 system and UIUC 150-bus system and show that line switching is an effective means to mitigate GIC impacts. We also provide a sensitivity analysis of decisions with respect to GMD direction.

  15. Environmental pollution by magnetic field associated with power transmission lines

    Energy Technology Data Exchange (ETDEWEB)

    Hamza, Abdel-Salam H. A.; Ghania, Samy M. [Faculty of Engineering, Zagazig University (Banha Branch), 9-EI-Hakim Be-Amr EI-Ahh Str, EI- Khalafawy, Shoubra, Cairo (Egypt); Mohmoudh, Shaher A. [Ministry of Electricity and Energy (Egypt)


    Environmental pollution has a major effect on human health and other life types. A source of environmental pollution is the magnetic field produced near high and extra high voltage (EHV) transmission lines. Magnetic fields from AC EHV lines have been discussed in this paper. The field profiles and their contribution to environmental pollution are studied, these being under transmission lines with different line system configurations, using the three dimensional approaches. These line system configurations are more commonly used in Egypt and other countries. The obtained results are found to be useful for discussing the comparison of the field densities on the human body and other life types at the ground level under or near the lines. (Author)

  16. Computation of nonuniform transmission lines using the FDTD method

    Energy Technology Data Exchange (ETDEWEB)

    Miranda, G.C.; Paulino, J.O.S. [Universidade Federal de Minas Gerais, Belo Horizonte, MG (Brazil). School of Engineering


    Calculation of lightning overvoltages on transmission lines has been described. Lightning induced overvoltages are of great significance under certain conditions because of the main characteristics of the phenomena. The lightning channel model is one of the most important parameters essential to obtaining the generated electromagnetic fields. In this study, nonuniform transmission line equations were solved using the finite difference method and the leap-frog scheme, the Finite Difference Time Domain (FDTD) method. The subroutine was interfaced with the Electromagnetic Transients Program (EMTP). Two models were used to represent the characteristic impedance of the nonuniform lines used to model the transmission line towers and the lightning main channel. The advantages of the FDTD method was the much smaller code and faster processing time. 35 refs., 5 figs.

  17. Characteristic analysis of coupled transmission lines in stripline-type beam position monitor

    International Nuclear Information System (INIS)

    Suwada, T.


    Signal transmission characteristics in stripline electrodes of a stripline-type beam position monitor (BPM) are discussed on the basis of a coupled-mode analysis in electromagnetically coupled transmission lines. The physical prospect in the calibration procedure of stripline electrodes is improved in terms of signal transmission characteristics in the frequency domain. It is demonstrated that in the signal transmission with electromagnetic coupling between the stripline electrodes, the magnetic- and electric-coupling parameters play an important role depending upon the spatial configuration and mechanical structure of the stripline electrodes. In this report, a theoretical analysis, and experimental investigation into signal transmission characteristics and performance in a standard stripline-type BPM are described in detail on the basis of a coupled-mode analysis in uniform transmission lines

  18. Radio and television interference caused by corona discharges from high-voltage transmission lines

    International Nuclear Information System (INIS)

    Sarmadi, M.


    Increase in power utility loads in industrialized countries, as well as developing countries, demands a higher level of transmission line voltage. Radio interference (RI) problems have been determined to be a limiting factor in selecting the size of transmission line conductors. Transmission line noise is primarily caused by corona discharges in the immediate vicinity of the conductor. It has been observed that discharges occur during both half-cycles of the applied voltage, but positive corona is usually predominant at AM radio frequencies range with practical high-voltage and extra high-voltage transmission lines. The corona radio noise effect is highly dependent upon the presence of particles on the surface of the conductor and the increase of the electrical gradient beyond the breakdown value of the air. Therefore, corona radio noise varies significantly with the weather and atmospheric conditions and generally increases by 10 to 30 dB in foul weather

  19. Mass and loss analysis of a space-type radiation cooled insulated DC transmission line

    International Nuclear Information System (INIS)

    Schwarze, g.E.


    As both the power levels and transmission distances increase such as for large future nuclear power systems, the transmission line becomes an important element in the power chain between the source and load bus. Thus, the transmission line's characteristics must be determined so that the effect of these characteristics on the total power system can be assessed. These design characteristics include the specific mass, percent power loss, size, voltage and power levels, and operating temperatures of the conductor and insulating materials. In a previous paper, the dc transmission line's characteristics of a noninsulated solid cylindrical conductor were determined. In that analysis the expression derived for the transmission line's mass only included the conductor mass and the operating temperature of the line was that of the conductor. In the analysis of this paper, a single layer of insulation is added to the solid cylindrical conductor. In this analysis the dependency of the dc transmission line's mass, loss, and size on the power and voltage levels, conductor and insulation surface temperatures, transmission distance, and conductor and insulation material properties is determined. This analysis can be extended to multi-layers of insulation but the complexity of the analysis increases as the number of layers increase

  20. Atlas transmission line/transition design and fabrication status

    CERN Document Server

    Ballard, E O; Davis, H A; Elizondo, J M; Gribble, R F; Nielsen, K E; Parker, G V; Ricketts, R L; Valdez, G A


    Atlas is a pulsed-power facility under development at Los Alamos National Laboratory to drive high-energy density experiments. Design has been completed for this new generation pulsed-power machine consisting of an azimuthal array of 24, 240-kV Marx modules and transmission lines supplying current to the load region at the machine center. The transmission line consists of a cable header, load protection switch, and tri-plate assembly interfacing to the center transition section. The cable header interface to the Marx module provides a mechanism to remove the Marx module for maintenance without removing other components of the transmission line. The load protection switch provides a mechanism for protecting the load during charging of the Marx in the event of a pre-fire condition. The aluminum tri-plate is a low-inductance transmission line that carries radial current flow from the Marx energy storage system at the machine periphery toward the load. All transmission line components are oil insulated except the...

  1. Kalman filter estimation of RLC parameters for UMP transmission line

    Directory of Open Access Journals (Sweden)

    Mohd Amin Siti Nur Aishah


    Full Text Available This paper present the development of Kalman filter that allows evaluation in the estimation of resistance (R, inductance (L, and capacitance (C values for Universiti Malaysia Pahang (UMP short transmission line. To overcome the weaknesses of existing system such as power losses in the transmission line, Kalman Filter can be a better solution to estimate the parameters. The aim of this paper is to estimate RLC values by using Kalman filter that in the end can increase the system efficiency in UMP. In this research, matlab simulink model is developed to analyse the UMP short transmission line by considering different noise conditions to reprint certain unknown parameters which are difficult to predict. The data is then used for comparison purposes between calculated and estimated values. The results have illustrated that the Kalman Filter estimate accurately the RLC parameters with less error. The comparison of accuracy between Kalman Filter and Least Square method is also presented to evaluate their performances.

  2. Experimental observation on asymmetric energy flux within the forbidden frequency band in the LC transmission line

    International Nuclear Information System (INIS)

    Tao Feng; Chen Weizhong; Pan Junting; Xu Wen; Du Sidan


    We study the energy flux in a nonlinear electrical transmission line consisting of two coupled segments which are identical in structure and different in parameters. The asymmetry of energy flux caused by nonlinear wave has been observed experimentally in the forbidden band of the line. The experiment shows whether the energy can flow through the transmission line depends on the amplitude of the boundary driving voltages, which can be well explained in the theoretical framework of nonlinear supratransmission. The numerical simulation based on Kirchhoff’s laws further verifies the existence of the asymmetric energy flux in the forbidden band.

  3. Application of superconductors to motors, generators, and transmission lines

    International Nuclear Information System (INIS)

    Kirtley, J.L.


    Superconductors are of interest to the designers of electric power equipment because they can carry current without loss, currents that are large enough to make very intense magnetic fields. This means that superconductors, used in suitable applications, can make electric power equipment smaller, lighter, more efficient, and perhaps with better dynamic response. Two specific applications are considered here: electric machinery (motors and generators) and transmission lines. The so-called high-T c superconductors will have beneficial impact on motors, generators, and transmission lines only if conductors with sufficient mechanical properties and current-carrying capabilities can be developed

  4. Tuning of JET transmission line/antenna system during ICRH

    International Nuclear Information System (INIS)

    Oeberg, J.


    The launched toroidal wave spectrum for ICRH and ICRH current drive is controlled by the phasing of the antenna currents. This causes imbalance in the transmission lines, which makes it more difficult to use the full power of the ICRH generators. Further, the generators are sensitive to the amount of reflected power. To reduce the amount of reflected power the transmission lines have to be constantly tuned. To study the tuning three models of the antenna are developed and compared with experimental results. A method is suggested which enables better usage of the generated power using a power correction unit to evenly distribute the power load between the generators. 4 refs, 24 figs

  5. Reconfigurable Wave Velocity Transmission Lines for Phased Arrays (United States)

    Host, Nick; Chen, Chi-Chih; Volakis, John L.; Miranda, Felix


    Phased array antennas showcase many advantages over mechanically steered systems. However, they are also more complex, heavy and most importantly costly. This presentation paper presents a concept which overcomes these detrimental attributes by eliminating all of the phase array backend (including phase shifters). Instead, a wave velocity reconfigurable transmission line is used in a series fed array arrangement to allow phase shifting with one small (100mil) mechanical motion. Different configurations of the reconfigurable wave velocity transmission line are discussed and simulated and experimental results are presented.

  6. Fort Peck-Wolf Point transmission line project, Montana

    International Nuclear Information System (INIS)


    The primary objective of the project is to replace the existing 36-mile Fort Peck-Wolf Point transmission line which has reached the end of its useful service life. Presently, the overall condition of this existing section of the 47-year-old line is poor. Frequent repairs have been required because of the absence of overhead ground wires. The continued maintenance of the line will become more expensive and customer interruptions will persist because of the damage due to lightning. The expense of replacing shell rotted poles, and the concern for the safety of the maintenance personnel because of hazards caused by severe shell rot are also of primary importance. The operational and maintenance problems coupled with power system simulation studies, demonstrate the need for improvements to the Wolf Point area to serve area loads. Western's Wolf Point Substation is an important point of interconnection for the power output from the Fort Peck Dam to area loads as far away as Williston, North Dakota. The proposed transmission line replacement would assure that there will continue to be reliable transmission capacity available to serve area electrical loads, as well as provide a reliable second high-voltage transmission path from the Fort Peck generation to back-up a loss of the Fort Peck-Wolf Point 115-kV Line No. 1

  7. Environmental impact of high voltage aerial transmission lines

    International Nuclear Information System (INIS)

    Silva, R.P.; Mouallen, M.C.; Quintella, S.E.A.


    The identification of environmental impacts caused by the aerial transmission lines and the measures for reducing these impacts are discussed, considering the impact over the soil in different areas, biological effects caused by delayed exposure and visual impacts due to the line structures. A methodology for the impact evaluation and the aspects of the Environmental Impact Studies and Environmental Impact Report are also studied. (C.G.C.). 2 refs, 1 fig

  8. Canby Area Service Project substation and associated transmission line

    International Nuclear Information System (INIS)


    Bonneville Power Administration (BPA) provides power to Surprise Valley Electrification Corporation (SVEC) in Modoc County, California. BPA uses PacificCorp's substation and transmission facilities between Alturas and Canby, California to transfer power to SVEC's Canby Substation. In the next year, SVEC expects increased industrial, agricultural, and residential electric loads on their 69-kV transmission system south of Canby. SVEC's substation can accommodate only about 10 percent of the expected additional electric load. BPA's proposed action is intended to meet SVEC's increasing electric load. BPA proposes to meet SVEC's increasing energy load by tapping into BPA's existing BPA Malin-Warner 230-kV transmission line, and building an 7.9-mile transmission line to a new BPA substation. BPA proposes to build the new substation next to the west side of SVEC's Canby Substation (Figure 1). This new substation will allow SVEC to move the additional power over their existing transmission or distribution lines. This report is the environmental assessment of the potential impact of the proposed project. The assessment determined that no ''environmental impact statement'' is not required

  9. Geometry-Dependent Electrostatics near Contact Lines

    International Nuclear Information System (INIS)

    Chou, Tom


    Long-ranged electrostatic interactions in electrolytes modify contact angles on charged substrates in a scale and geometry-dependent manner. For angles measured at scales smaller than the typical Debye screening length, the wetting geometry near the contact line must be explicitly considered. Using variational and asymptotic methods, we derive new transcendental equations for the contact angle as functions of the electrostatic potential only at the three phase contact line. Analytic expressions are found in certain limits and compared with predictions for contact angles measured with lower resolution. An estimate for electrostatic contributions to line tension is also given

  10. Rigorous theoretical derivation of lumped models to transmission line systems

    International Nuclear Information System (INIS)

    Zhao Jixiang


    By virtue of the negative electric parameter concept, i.e. negative lumped resistance, inductance, conductance and capacitance (N-RLGC), the lumped equivalent models of transmission line systems, including the circuit model, two-port π-network and T-network, are given. We start from the N-segment-ladder-like equivalent networks composed distributed parameters, and achieve the input impedance in the form of a continued fraction. Utilizing the continued fraction theory, the expressions of input impedance are obtained under three kinds of extreme cases, i.e. the load impedances are equal to zero, infinity and characteristic impedance, respectively. When the number of segment N is limited to infinity, they are transformed to lumped elements. Comparison between the distributed model and lumped model of transmission lines, the expression of tanh γd, which is the key term in the transmission line equations, are obtained by RLGC, furthermore, according to input admittance, admittance matrix and ABCD matrix of transmission lines, the lumped equivalent circuit models, π-networks and T-networks have been given. The models are verified in the frequency and time domain, respectively, showing that the models are accurate and efficient. (semiconductor integrated circuits)

  11. Proximity effects of high voltage electric power transmission lines on ...

    African Journals Online (AJOL)

    The proximity effects of high voltage electric power transmission lines on Leyland Cypress (xCupressocyparis leylandii (Dallim. and A.B. Jacks.) Dallim) and Japanese Privet (Ligustrum japonicum Thunb.) growth were examined in a private nursery located in Sakarya, Turkey. Five transect were randomly chosen in both ...

  12. Characteristics of the λ/4 transmission line resonator

    International Nuclear Information System (INIS)

    Hashimoto, Y.; Masuda, H.; Yoshida, K.; Arai, S.; Niki, K.


    Though the spiral cavity is adequate for low frequency operation, mechanical instability becomes serious for such a low frequency as 20 MHz. We have then studied how to shorten the spiral length by using λ/4 transmission line models. Four models with reduced spiral length are presented. (author)

  13. A novel transmission line protection using DOST and SVM

    Directory of Open Access Journals (Sweden)

    M. Jaya Bharata Reddy


    Full Text Available This paper proposes a smart fault detection, classification and location (SFDCL methodology for transmission systems with multi-generators using discrete orthogonal Stockwell transform (DOST. The methodology is based on synchronized current measurements from remote telemetry units (RTUs installed at both ends of the transmission line. The energy coefficients extracted from the transient current signals due to occurrence of different types of faults using DOST are being utilized for real-time fault detection and classification. Support vector machine (SVM has been deployed for locating the fault distance using the extracted coefficients. A comparative study is performed for establishing the superiority of SVM over other popular computational intelligence methods, such as adaptive neuro-fuzzy inference system (ANFIS and artificial neural network (ANN, for more precise and reliable estimation of fault distance. The results corroborate the effectiveness of the suggested SFDCL algorithm for real-time transmission line fault detection, classification and localization.

  14. Airplane Ice Detector Based on a Microwave Transmission Line (United States)

    Ngo, Phong; Arndt, G. Dickey; Carl, James R.


    An electronic instrument that could detect the potentially dangerous buildup of ice on an airplane wing is undergoing development. The instrument is based on a microwave transmission line configured as a capacitance probe: at selected spots, the transmission-line conductors are partly exposed to allow any ice and/or liquid water present at those spots to act as predominantly capacitive electrical loads on the transmission line. These loads change the input impedance of the transmission line, as measured at a suitable excitation frequency. Thus, it should be possible to infer the presence of ice and/or liquid water from measurements of the input impedance and/or electrical parameters related to the input impedance. The sensory transmission line is of the microstrip type and thus thin enough to be placed on an airplane wing without unduly disturbing airflow in flight. The sensory spots are small areas from which the upper layer of the microstrip has been removed to allow any liquid water or ice on the surface to reach the transmission line. The sensory spots are spaced at nominal open-circuit points, which are at intervals of a half wavelength (in the transmission line, not in air) at the excitation frequency. The excitation frequency used in the experiments has been 1 GHz, for which a half wavelength in the transmission line is .4 in. (.10 cm). The figure depicts a laboratory prototype of the instrument. The impedance-related quantities chosen for use in this version of the instrument are the magnitude and phase of the scattering parameter S11 as manifested in the in-phase (I ) and quadrature (Q) outputs of the phase detector. By careful layout of the transmission line (including the half-wavelength sensor spacing), one can ensure that the amplitude and phase of the input to the phase detector keep shifting in the same direction as ice forms on one or more of the sensor areas. Although only one transmission-line sensor strip is used in the laboratory version, in a

  15. Theory and Circuit Model for Lossy Coaxial Transmission Line

    Energy Technology Data Exchange (ETDEWEB)

    Genoni, T. C.; Anderson, C. N.; Clark, R. E.; Gansz-Torres, J.; Rose, D. V.; Welch, Dale Robert


    The theory of signal propagation in lossy coaxial transmission lines is revisited and new approximate analytic formulas for the line impedance and attenuation are derived. The accuracy of these formulas from DC to 100 GHz is demonstrated by comparison to numerical solutions of the exact field equations. Based on this analysis, a new circuit model is described which accurately reproduces the line response over the entire frequency range. Circuit model calculations are in excellent agreement with the numerical and analytic results, and with finite-difference-time-domain simulations which resolve the skindepths of the conducting walls.

  16. Research on the Test of Transmission Line Galloping (United States)

    Zhang, Lichun; Li, Qing; lv, Zhongbin; Ji, Kunpeng; Liu, Bin


    The load of iced transmission line and the load generated by galloping after the conductor are covered by ice all may cause severe circuit faults, such as tripping, conductor breaking, armor clamp damage and even tower collapse, thus severely threatening running safety of power system. The generation and development processes of galloping of power transmission line is very complicated, and numerous factors may influence the galloping excitation, such as environmental factors, terrain factors and structural parameters of power transmission line; in which, the ice covering of conductor is one of necessary factors causing galloping. Therefore, researches on ice covering increasing test of different types of conductors under different meteorological conditions have been conducted in large-sized multi-functional phytotron, thus obtaining the relation curve of ice covering increasing of conductor along with time under different conditions, and analyzing factors influencing increasing of ice covering. The research result shows that under the same ice covering conditions, the increasing of ice covering of conductor with small diameter is relatively rapid; both environmental temperature and wind speed have obvious influence on increasing of ice covering of conductor, and the environmental temperature will decide the type of ice covering of conductor surface. Meanwhile, after wind tunnel tests targeting conductors with different ice covering shapes, pneumatic stability loss characteristics of conductors with different ice shapes have been obtained. Research results have important scientific reference value for revealing the mechanism of galloping of iced power transmission line, and have relatively high engineering practicability value for promoting realization of early warning system for galloping of iced power transmission line.

  17. Upgrading transmission lines with aerial LiDAR technology

    Energy Technology Data Exchange (ETDEWEB)

    Koop, J.E. [Manitoba Hydro, Winnipeg, MB (Canada)


    LiDAR (Light Detection and Ranging) technology is described as an example of techniques used by hydro companies to increase their capacity with existing plants, and within tight budget constraints. LiDAR was chosen by Manitoba Hydro primarily because LiDAR's data collection method offers very fast turn-around time from collection to delivery, and most importantly because of LiDAR's highly accurate ability to map terrain and wire catenary shape in every span. The article describes a case study of the 'Nip and Tuck' method of wire re-tensioning based on LiDAR data, which was used by Manitoba Hydro to create a computer model of Saskatchewan Hydro's transmission line capacity on its 138 kV transmission line between Saskatoon and North Battleford. The model was needed to analyze the existing line conditions in an effort to minimize cascading failures on the 40-year old line. Using the 'Nip and Tuck' technology in combination with LiDAR, SaskPower engineers were able to complete the required modifications to raise transmission wire operating temperatures on the 135 km long line to 66 degree C in only 36 days, and at a cost that was 80 per cent less than the cost would have been using conventional techniques ($232,000 instead of the estimated $1.25 million).

  18. Analytical Model for High Impedance Fault Analysis in Transmission Lines

    Directory of Open Access Journals (Sweden)

    S. Maximov


    Full Text Available A high impedance fault (HIF normally occurs when an overhead power line physically breaks and falls to the ground. Such faults are difficult to detect because they often draw small currents which cannot be detected by conventional overcurrent protection. Furthermore, an electric arc accompanies HIFs, resulting in fire hazard, damage to electrical devices, and risk with human life. This paper presents an analytical model to analyze the interaction between the electric arc associated to HIFs and a transmission line. A joint analytical solution to the wave equation for a transmission line and a nonlinear equation for the arc model is presented. The analytical model is validated by means of comparisons between measured and calculated results. Several cases of study are presented which support the foundation and accuracy of the proposed model.

  19. North Central Transmission Line: Guidelines for the environmental impact statement

    International Nuclear Information System (INIS)


    Guidelines that Manitoba Hydro must follow in the preparation of the environmental impact statement on the proposed North Central Transmission Line (TCTL) project are presented. The project consists of a 138 kV transmission line, two 25 kV distribution lines, and related ancillary structures and facilities. The review process must be sensitive to cultural and community needs and must involve those most directly affected, and should be grounded in the impacted northern communities. The review should include a project background, the proposal, a description of the existing natural and socio-economic environment, and must address employment, education and training, impacts on renewable resource harvesting, environmental impacts, social impacts and economic impacts, legal/jurisdictional issues, infrastructure, mitigation and compensation, and environmental monitoring and follow-up. 1 fig., 20 tabs

  20. Electric and magnetic field reduction by alternative transmission line options

    Energy Technology Data Exchange (ETDEWEB)

    Stewart, J.R. (Power Technologies, Inc., Schenectady, NY (United States)); Dale, S.J. (Oak Ridge National Lab., TN (United States)); Klein, K.W. (Energetics, Inc., Columbia, MD (United States))


    Ground level electric, and more recently magnetic, fields from overhead power transmission lines are increasingly important considerations in right of way specification, with states setting or planning to set edge of right of way limits. Research has been conducted in high phase order power transmission wherein six of twelve phases are used to transmit power in less physical space and with reduced electrical environmental effects than conventional designs. The first magnetic field testing, as reported in this paper, has verified predictive methods for determination of magnetic fields from high phase order lines. Based on these analytical methods, field profiles have been determined for lines of different phase order of comparable power capacity. Potential advantages of high phase order as a means of field mitigation are discussed. 10 refs., 12 figs., 3 tabs.

  1. Environmental impact of the aerial power transmission lines

    International Nuclear Information System (INIS)

    Cristescu, D.; Rusan, R.


    In the last 10-12 years the existence of the high voltage lines existence within populated areas has been more and more contested. The paper tries to complete a blank in the Romanian technical literature by introducing the concept of 'line corridor' which is different from the occupied geometric area and from 'the line disturbed corridor'. The concept is meant to specify the area where the high frequency and 50 Hz electromagnetic pollution exceeds some given limits. The impact of the power transmission lines on the human body, due to the effects of the electric and magnetic fields, is considered. Also, the aspects concerning the visual impact, the acoustic and radio noise and the area expensing by the high voltage lines, are considered. International standards and regulations regarding the limitations of this effects are presented. (author)

  2. Ground-Wave Propagation Effects on Transmission Lines through Error Images

    Directory of Open Access Journals (Sweden)

    Uribe-Campos Felipe Alejandro


    Full Text Available Electromagnetic transient calculation of overhead transmission lines is strongly influenced by the natural resistivity of the ground. This varies from 1-10K (Ω·m depending on several media factors and on the physical composition of the ground. The accuracy on the calculation of a system transient response depends in part in the ground return model, which should consider the line geometry, the electrical resistivity and the frequency dependence of the power source. Up to date, there are only a few reports on the specialized literature about analyzing the effects produced by the presence of an imperfectly conducting ground of transmission lines in a transient state. A broad range analysis of three of the most often used ground-return models for calculating electromagnetic transients of overhead transmission lines is performed in this paper. The behavior of modal propagation in ground is analyzed here into effects of first and second order. Finally, a numerical tool based on relative error images is proposed in this paper as an aid for the analyst engineer to estimate the incurred error by using approximate ground-return models when calculating transients of overhead transmission lines.

  3. Sensor Placement For Structural Monitoring of Transmission Line Towers

    Directory of Open Access Journals (Sweden)

    Benny eRaphael


    Full Text Available Transmission line towers are usually analyzed using linear elastic idealized truss models. Due to the assumptions used in the analysis, there are discrepancies between the actual results obtained from full scale prototype testing and the analytical results. Therefore, design engineers are interested in assessing the actual stress levels in transmission line towers. Since it is costly to place sensors on every member of a tower structure, the best locations for sensors need to be carefully selected. This study evaluates a methodology for sensor placement in transmission line towers. The objective is to find optimal locations for sensors such that the real behavior of the structure can be explained from measurements. The methodology is based on the concepts of entropy and model falsification. Sensor locations are selected based on maximum entropy such that there is maximum separation between model instances that represent different possible combinations of parameter values which have uncertainties. The performance of the proposed algorithm is compared to that of an intuitive method in which sensor locations are selected where the forces are maximum. A typical 220 kV transmission tower is taken as case study in this paper. It is shown that the intuitive method results in much higher number of non-separable models compared to the optimal sensor placement algorithm. Thus the intuitive method results in poor identification of the system.

  4. Geometric quantum discord and Berry phase between two charge qubits coupled by a quantum transmission line

    International Nuclear Information System (INIS)

    Zhu Han-Jie; Zhang Guo-Feng


    Geometric quantum discord (GQD) and Berry phase between two charge qubits coupled by a quantum transmission line are investigated. We show how GQDs evolve and investigate their dependencies on the parameters of the system. We also calculate the energy and the Berry phase and compare them with GQD, finding that there are close connections between them. (general)

  5. 800 kW transmission line research at Leatherhead

    Energy Technology Data Exchange (ETDEWEB)


    The experimental transmission line was installed at Leatherhead to enable the Central Electricity Research Laboratories to study the insulators, fittings, and conductors likely to be needed for ac power transmission at voltages up to the equivalent of 800 kV three-phase. Continuous recording will be made of corona power loss and radio and television interference. For this purpose C.E.R.L. has developed a statistical radio-interference recorder. The instrumentation also includes an automatic corona-loss bridge and data logger.

  6. Simulation of loss electron in vacuum magnetically insulated transmission lines

    International Nuclear Information System (INIS)

    Zhang Pengfei; Li Yongdong; Liu Chunliang; Wang Hongguang; Guo Fan; Yang Hailiang; Qiu Aici; Su Zhaofeng; Sun Jianfeng; Sun Jiang; Gao Yi


    In the beginning of magnetic insulated period, loss electron in coaxial vacuum magnetically insulated transmission line (MITL) strikes anode and the bremsstrahlung photons are generated in the mean time. Based on the self-limited flow model, velocity in direction of energy transport, energy spectrum and angular distribution of loss electron are simulated by PIC code, energy spectrum of bremsstrahlung photons as well calculated though Monte Carlo method. Computational results show that the velocity of loss electron is less than 2.998 x 108 m/s, the angular excursion of electron is not much in a board extent of energy spectrum. These results show an indirect diagnosis of vacuum insulted transmission line working status based on loss electron bremsstrahlung. (authors)

  7. Comparison of Transmission Line Methods for Surface Acoustic Wave Modeling (United States)

    Wilson, William; Atkinson, Gary


    Surface Acoustic Wave (SAW) technology is low cost, rugged, lightweight, extremely low power and can be used to develop passive wireless sensors. For these reasons, NASA is investigating the use of SAW technology for Integrated Vehicle Health Monitoring (IVHM) of aerospace structures. To facilitate rapid prototyping of passive SAW sensors for aerospace applications, SAW models have been developed. This paper reports on the comparison of three methods of modeling SAWs. The three models are the Impulse Response Method (a first order model), and two second order matrix methods; the conventional matrix approach, and a modified matrix approach that is extended to include internal finger reflections. The second order models are based upon matrices that were originally developed for analyzing microwave circuits using transmission line theory. Results from the models are presented with measured data from devices. Keywords: Surface Acoustic Wave, SAW, transmission line models, Impulse Response Method.

  8. Transmission Line for 258 GHz Gyrotron DNP Spectrometry (United States)

    Bogdashov, Alexandr A.; Belousov, Vladimir I.; Chirkov, Alexey V.; Denisov, Gregory G.; Korchagin, Vyacheslav V.; Kornishin, Sergey Yu.; Tai, Evgeny M.


    We describe the design and test results of the transmission line for liquid-state (LS) and solid-state (SS) DNP spectrometers with the second-harmonic 258.6 GHz gyrotron at the Institute of the Biophysical Chemistry Center of Goethe University (Frankfurt). The 13-meter line includes a mode converter, HE11 waveguides, 4 mitre bends, a variable polarizer-attenuator, directional couplers, a water-flow calorimeter and a mechanical switch. A microwave power of about 15 W was obtained in the pure HE11 mode at the spectrometer inputs.

  9. Time-dependent scattering in resonance lines

    International Nuclear Information System (INIS)

    Kunasz, P.B.


    A numerical finite-difference method is presented for the problem of time-dependent line transfer in a finite slab in which material density is sufficiently low that the time of flight between scatterings greatly exceeds the relaxation time of the upper state of the scattering transition. The medium is assumed to scatter photons isotropically, with complete frequency redistribution. Numerical solutions are presented for a homogeneous, time-independent slab illuminated by an externally imposed radiation field which enters the slab at t = 0. Graphical results illustrate relaxation to steady state of trapped internal radiation, emergent energy, and emergent profiles. A review of the literature is also given in which the time-dependent line transfer problem is discussed in the context of recent analytical work

  10. Transmission line analogy for relativistic Poynting-flux jets (United States)

    Lovelace, R. V. E.; Kronberg, P. P.


    Radio emission, polarization and Faraday rotation maps of the radio jet of the galaxy 3C 303 have shown that one knot of this jet carries a galactic-scale electric current and that it is magnetically dominated. We develop the theory of magnetically dominated or Poynting-flux jets by making an analogy of a Poynting jet with a transmission line or waveguide carrying a net current and having a potential drop across it (from the jet's axis to its radius) and a definite impedance which we derive. The electromagnetic energy flow in the jet is the jet impedance times the square of the jet current. The observed current in 3C 303 can be used to calculate the electromagnetic energy flow in this magnetically dominated jet. Time dependent but not necessarily small perturbations of a Poynting-flux jet are described by the `telegrapher's equations'. These predict the propagation speed of disturbances and the effective wave impedance for forward and backward propagating wave components. A localized disturbance of a Poynting jet gives rise to localized dissipation in the jet which may explain the enhanced synchrotron radiation in the knots of the 3C 303 jet, and also in the apparently stationary knot HST-1 in the jet near the nucleus of the nearby galaxy M87. For a relativistic Poynting jet on parsec scales, the reflected voltage wave from an inductive termination or load can lead to a backward propagating wave which breaks down the magnetic insulation of the jet giving |{boldsymbol E}| /|{boldsymbol B}|ge 1. At the threshold for breakdown, |{boldsymbol E}|/|{boldsymbol B}|=1, positive and negative particles are directly accelerated in the {boldsymbol E} × {boldsymbol B} direction which is approximately along the jet axis. Acceleration can occur up to Lorentz factors ˜107. This particle acceleration mechanism is distinct from that in shock waves and that in magnetic field reconnection.

  11. Analytical methods for study of transmission line lightning protection

    International Nuclear Information System (INIS)

    Pettersson, Per.


    Transmission line lightning performance is studied by analytical methods. The elements of shielding failure flashovers and back-flashovers are analysed as functions of incidence, response and insulation. Closed-form approximate expressions are sought to enhance understanding of the phenomena. Probabilistic and wave propagation aspects are particularly studied. The electrogeometric model of lightning attraction to structures is used in combination with the log-normal probability distribution of lightning to ground currents. The log-normality is found to be retained for the currents collected by mast-type as well as line-type structures, but with a change of scale. For both types, exceedingly simple formulas for the number of hits are derived. Simple closed-form expressions for the line outage rates from back- flashovers and shielding failure flashovers are derived in a uniform way as functions of the critical currents. The expressions involve the standardized normal distribution function. System response is analysed by use of Laplace transforms in combination with text-book transmission-line theory. Inversion into time domain is accomplished by an approximate asymptotic method producing closed-form results. The back-flashover problem is analysed in particular. Approximate, image type expressions are derived for shunt admittance of wires above, on and under ground for analyses of fast transients. The derivation parallels that for series impedance, now well-known. 3 refs, 5 figs

  12. Numerical noise analysis for insulator of overhead transmission line (United States)

    Zhang, Yulin; Chen, Yuwen; Huang, Yu


    As an important and complex issue in aero acoustic field, a lot of explorations have been devoted to the wind-induced noise. However, there is still lack of intensive investigations for aerodynamic noise in high-voltage transmission. The overhead transmission line system leads to serious occupational noise exposure in high wind-speed environment, and the noise can even injure the electricians in charge of insulator. By using computational fluid dynamics (CFD) which combined with computational aero acoustics (CAA), this paper predicts the noise generated by insulator of high voltage electricity transmission line which explores in wind environment. The simulation results indicate that the wind velocity, the assembly angle of the insulator and its ribs' distribution are the main contributory factors for the aerodynamic noise. Specifically, when wind velocity is greater than 15m/s, the alteration of noise is not sensitive to the wind velocity; furthermore, when the assembly angle increases from 0°to 60°, the noise decreases gradually, however, if the angle is happening to be 75°or 90°, it would be even greater than that at 0°. In order to inhibit the aerodynamic noise, it is necessary to control the flow blowing across the boundary of the insulator. Consequently, the result indicates that if the outermost rib is shorter than the second one, the noise reduced evidently. This information expects to provide useful help for the extremely suppression of aerodynamic noise, and also supply practical reference material for the design and application of overhead transmission line system.

  13. Chameleon's behavior of modulable nonlinear electrical transmission line (United States)

    Togueu Motcheyo, A. B.; Tchinang Tchameu, J. D.; Fewo, S. I.; Tchawoua, C.; Kofane, T. C.


    We show that modulable discrete nonlinear transmission line can adopt Chameleon's behavior due to the fact that, without changing its appearance structure, it can become alternatively purely right or left handed line which is different to the composite one. Using a quasidiscrete approximation, we derive a nonlinear Schrödinger equation, that predicts accurately the carrier frequency threshold from the linear analysis. It appears that the increasing of the linear capacitor in parallel in the series branch induced the selectivity of the filter in the right-handed region while it increases band pass filter in the left-handed region. Numerical simulations of the nonlinear model confirm the forward wave in the right handed line and the backward wave in the left handed one.

  14. Cyber Risk Assessment of Transmission Lines in Smart Grids

    Directory of Open Access Journals (Sweden)

    Xuan Liu


    Full Text Available The increasing use of information technologies in power systems has increased the risk of power systems to cyber-attacks. In this paper, we assess the risk of transmission lines being overloaded due to cyber-based false data injection attacks. The cyber risk assessment is formulated as bilevel optimization problems that determine the maximum line flows under false data injection attacks. We propose efficient techniques to reduce the computation complexity of solving the bilevel problems. Specifically, primary and secondary filtering techniques are employed to identify the lines whose flows will never exceed their limits, which can significantly reduce computation burden. A special feasibility cut-based acceleration technique is introduced to further reduce the computation burden. The simulation results on the IEEE 30-bus, IEEE 118-bus, IEEE 300-bus and IEEE 2383-bus systems verify the proposed risk assessment model and the effectiveness of the proposed filtering and acceleration techniques.

  15. Development of Live-working Robot for Power Transmission Lines (United States)

    Yan, Yu; Liu, Xiaqing; Ren, Chengxian; Li, Jinliang; Li, Hui


    Dream-I, the first reconfigurable live-working robot for power transmission lines successfully developed in China, has the functions of autonomous walking on lines and accurately positioning. This paper firstly described operation task and object of the robot; then designed a general platform, an insulator replacement end and a drainage plate bolt fastening end of the robot, presented a control system of the robot, and performed simulation analysis on operation plan of the robot; and finally completed electrical field withstand voltage tests in a high voltage hall as well as online test and trial on actual lines. Experimental results show that by replacing ends of manipulators, the robot can fulfill operation tasks of live replacement of suspension insulators and live drainage plate bolt fastening.

  16. Frequency Dependent Losses in Transmission Cable Conductors

    DEFF Research Database (Denmark)

    Olsen, Rasmus Schmidt; Holbøll, Joachim; Guðmundsdóttir, Unnur Stella


    , such as thermal conditions in and around the cable, as well as the heat generated in conductors, screens, armours etc., taking into account proximity and skin effects. The work performed and presented in this paper is concerned with an improved determination of the losses generated in the conductor, by means...... of better calculation of the AC resistance of transmission cable conductors, in particular regarding higher frequencies. In this way, also losses under harmonics can be covered. Furthermore, the model is suitable for modelling of transient attenuation in high voltage cables. The AC resistance is calculated...... based on the current density distribution in different conductor designs by means of the Finite Element Method (FEM). The obtained results and methods are compared to available standards (IEC publication 60287-1-1)....

  17. Electric Utility Transmission and Distribution Line Engineering Program

    Energy Technology Data Exchange (ETDEWEB)

    Peter McKenny


    Economic development in the United States depends on a reliable and affordable power supply. The nation will need well educated engineers to design a modern, safe, secure, and reliable power grid for our future needs. An anticipated shortage of qualified engineers has caused considerable concern in many professional circles, and various steps are being taken nationwide to alleviate the potential shortage and ensure the North American power system's reliability, and our world-wide economic competitiveness. To help provide a well-educated and trained workforce which can sustain and modernize the nation's power grid, Gonzaga University's School of Engineering and Applied Science has established a five-course (15-credit hour) Certificate Program in Transmission and Distribution (T&D) Engineering. The program has been specifically designed to provide working utility engineering professionals with on-line access to advanced engineering courses which cover modern design practice with an industry-focused theoretical foundation. A total of twelve courses have been developed to-date and students may select any five in their area of interest for the T&D Certificate. As each course is developed and taught by a team of experienced engineers (from public and private utilities, consultants, and industry suppliers), students are provided a unique opportunity to interact directly with different industry experts over the eight weeks of each course. Course material incorporates advanced aspects of civil, electrical, and mechanical engineering disciplines that apply to power system design and are appropriate for graduate engineers. As such, target students for the certificate program include: (1) recent graduates with a Bachelor of Science Degree in an engineering field (civil, mechanical, electrical, etc.); (2) senior engineers moving from other fields to the utility industry (i.e. paper industry to utility engineering or project management positions); and (3) regular

  18. Study on Tower Models for EHV Transmission Line

    Directory of Open Access Journals (Sweden)

    Xu Bao-Qing


    Full Text Available Lightning outage accident is one of the main factors that threat seriously the safe and reliable operation of power system. So it is very important to establish reasonable transmission tower model and evaluate the impulse response characteristic of lightning wave traveling on the transmission tower properly for determining reliable lightning protection performance. With the help of Electromagnetic Transient Program (EMTP, six 500kV tower models are built. Aiming at one line to one transformer operating mode of 500kV substation, the intruding wave overvoltage under different tower models is calculated. The effect of tower model on intruding overvoltage has been studied. The results show that different tower models can result in great differences to the calculation results. Hence, reasonable selection of the tower model in the calculation of back- strike intruding wave is very important.

  19. Research on Line Patrol Strategy of 110kV Transmission Line after Lightning Strike

    Directory of Open Access Journals (Sweden)

    Li Mingjun


    Full Text Available Lightning faults occupy in the majority of instantaneous fault and reclosing can usually be successful, so power supply can be restored without immediate patrol in many cases. Firstly, this paper introduces the lightning fault positioning and identifying method. Then test electrical performance of insulators after lightning strike from 110kV lines. Data shows that lightning strike has little effect on the electric performance of insulator. Finally, illustrating disposal process of the 110 kV transmission line after lightning fault, certifying that the power supply reliability be ensured without line patrol.

  20. Induced voltages in metallic pipelines near power transmission lines

    International Nuclear Information System (INIS)

    Grcev, Leonid; Jankov, Voislav; Filiposki, Velimir


    With the continuous development of the electric power system and the pipeline networks used to convey oil or natural gas, cases of close proximity of high voltage structures and metallic pipelines become more and more frequent. Accordingly there is a growing concern about possible hazards resulting from voltages induced in the metallic pipelines by magnetic coupling with nearby power transmission lines. This paper presents a methodology for computation of the induced voltages in buried isolated metallic pipelines. A practical example of computation is also presented. (Author)

  1. Multistage linear electron acceleration using pulsed transmission lines

    International Nuclear Information System (INIS)

    Miller, R.B.; Prestwich, K.R.; Poukey, J.W.; Epstein, B.G.; Freeman, J.R.; Sharpe, A.W.; Tucker, W.K.; Shope, S.L.


    A four-stage linear electron accelerator is described which uses pulsed radial transmission lines as the basic accelerating units. An annular electron beam produced by a foilless diode is guided through the accelerator by a strong axial magnetic field. Synchronous firing of the injector and the acccelerating modules is accomplished with self-breaking oil switches. The device has accelerated beam currents of 25 kA to kinetic energies of 9 MV, with 90% current transport efficiency. The average accelerating gradient is 3 MV/m

  2. Microparticle-initiated losses in magnetically insulated transmission lines

    International Nuclear Information System (INIS)

    Gray, E.W.; Stinnett, R.W.


    The author's discuss the effects of high and hypervelocity microparticles in magnetically-insulated transmission lines (MITLs) and how they may be a possible source for ion production near the anode in early stages of the voltage pulse, and current carriers during and after the power pulse, resulting in power flow losses. Early losses in the voltage pulse, due to microparticles, are estimated to be approximately 0.3 mA/cm/sup 2/. Blistering of the electrode surface, thought to be due to H/sup -/ bombardment, was also observed and appears to be consistent with losses due to negative ions previously reported by one of the authors

  3. Quality factor of a transmission line coupled coplanar waveguide resonator

    Energy Technology Data Exchange (ETDEWEB)

    Besedin, Ilya [National University for Science and Technology (MISiS), Moscow (Russian Federation); National Research Nuclear University MEPhI (Moscow Engineering Physics Institute), Moscow (Russian Federation); Menushenkov, Alexey P. [National Research Nuclear University MEPhI (Moscow Engineering Physics Institute), Moscow (Russian Federation)


    We investigate analytically the coupling of a coplanar waveguide resonator to a coplanar waveguide feedline. Using a conformal mapping technique we obtain an expression for the characteristic mode impedances and coupling coefficients of an asymmetric multi-conductor transmission line. Leading order terms for the external quality factor and frequency shift are calculated. The obtained analytical results are relevant for designing circuit-QED quantum systems and frequency division multiplexing of superconducting bolometers, detectors and similar microwave-range multi-pixel devices. (orig.)

  4. Measurement-Based Transmission Line Parameter Estimation with Adaptive Data Selection Scheme

    DEFF Research Database (Denmark)

    Li, Changgang; Zhang, Yaping; Zhang, Hengxu


    Accurate parameters of transmission lines are critical for power system operation and control decision making. Transmission line parameter estimation based on measured data is an effective way to enhance the validity of the parameters. This paper proposes a multi-point transmission line parameter...

  5. Efficient production of hot plasmas through multiple-wire implosion in transmission line generators

    International Nuclear Information System (INIS)

    Bloomberg, H.W.


    Model equations for the implosion of multiple-wire arrays mounted across the electrodes of a transmission line generator are used to obtain an expression for the energy-coupling efficiency. For a useful class of imploding loads, the efficiency is shown to depend on a single dimensionless parameter. Furthermore, the efficiency curve has a maximum, and this permits an explicit optimization of the wire load parameters in terms of the machine parameters

  6. Doppler-shifted neutral beam line shape and beam transmission

    International Nuclear Information System (INIS)

    Kamperschroer, J.H.; Grisham, L.R.; Kokatnur, N.; Lagin, L.J.; Newman, R.A.; O'Connor, T.E.; Stevenson, T.N.; von Halle, A.


    Analysis of Doppler-shifted Balmer-α line emission from the TFTR neutral beam injection systems has revealed that the line shape is well approximated by the sum of two Gaussians, or, alternatively, by a Lorentzian. For the sum of two Gaussians, the broad portion of the distribution contains 40% of the beam power and has a divergence five times that of the narrow part. Assuming a narrow 1/e- divergence of 1.3 degrees (based on fits to the beam shape on the calorimeter), the broad part has a divergence of 6.9 degrees. The entire line shape is also well approximated by a Lorentzian with a half-maximum divergence of 0.9 degrees. Up to now, fusion neutral beam modelers have assumed a single Gaussian velocity distribution, at the extraction plane, in each direction perpendicular to beam propagation. This predicts a beam transmission efficiency from the ion source to the calorimeter of 97%. Waterflow calorimetry data, however, yield a transmission efficiency of ∼75%, a value in rough agreement with predictions of the Gaussian or Lorentzian models presented here. The broad wing of the two Gaussian distribution also accurately predicts the loss in the neutralizer. An average angle of incidence for beam loss at the exit of the neutralizer is 2.2 degrees, rather than the 4.95 degrees subtended by the center of the ion source. This average angle of incidence, which is used in computing power densities on collimators, is shown to be a function of beam divergence

  7. Wild Horse 69-kV transmission line environmental assessment

    International Nuclear Information System (INIS)


    Hill County Electric Cooperative Inc. (Hill County) proposes to construct and operate a 69-kV transmission line from its North Gildford Substation in Montana north to the Canadian border. A vicinity project area map is enclosed as a figure. TransCanada Power Corporation (TCP), a Canadian power-marketing company, will own and construct the connecting 69-kV line from the international border to Express Pipeline's pump station at Wild Horse, Alberta. This Environmental Assessment is prepared for the Department of Energy (DOE) as lead federal agency to comply with the requirements of the National Environmental Policy Act (NEPA), as part of DOE's review and approval process of the applications filed by Hill County for a DOE Presidential Permit and License to Export Electricity to a foreign country. The purpose of the proposed line is to supply electric energy to a crude oil pump station in Canada, owned by Express Pipeline Ltd. (Express). The pipeline would transport Canadian-produced oil from Hardisty, Alberta, Canada, to Caster, Wyoming. The Express Pipeline is scheduled to be constructed in 1996--97 and will supply crude oil to refineries in Wyoming and the midwest

  8. Wild Horse 69-kV transmission line environmental assessment

    Energy Technology Data Exchange (ETDEWEB)



    Hill County Electric Cooperative Inc. (Hill County) proposes to construct and operate a 69-kV transmission line from its North Gildford Substation in Montana north to the Canadian border. A vicinity project area map is enclosed as a figure. TransCanada Power Corporation (TCP), a Canadian power-marketing company, will own and construct the connecting 69-kV line from the international border to Express Pipeline`s pump station at Wild Horse, Alberta. This Environmental Assessment is prepared for the Department of Energy (DOE) as lead federal agency to comply with the requirements of the National Environmental Policy Act (NEPA), as part of DOE`s review and approval process of the applications filed by Hill County for a DOE Presidential Permit and License to Export Electricity to a foreign country. The purpose of the proposed line is to supply electric energy to a crude oil pump station in Canada, owned by Express Pipeline Ltd. (Express). The pipeline would transport Canadian-produced oil from Hardisty, Alberta, Canada, to Caster, Wyoming. The Express Pipeline is scheduled to be constructed in 1996--97 and will supply crude oil to refineries in Wyoming and the midwest.

  9. Transmission line properties of long strings of superconducting magnets

    International Nuclear Information System (INIS)

    Shafer, R.E.


    The purpose of this paper is to discuss the electrical characteristics of a long string of superconducting magnets, such as in a superconducting storage ring or accelerator. As the magnets have a shunt capacitance to ground as well as a series inductance, travelling waves can propagate along the string, as in a transmission line. As the string is of finite length, standing waves can also exist. In accelerator quality superconducting magnets, considerable effort has been devoted to minimizing ac losses, the net result being that the magnet string has a high Q precisely at the frequencies which are important for the standing and travelling waves. The magnitude of these effects are estimated, and the solution to be used at Fermilab will be discussed

  10. A modular restoration tower for electric power line transmission

    Energy Technology Data Exchange (ETDEWEB)

    Nicolazzi, L.C.; Pereira, J.C.; Leonel, C.E.L.; Rocha, G.B.; Bianchezzi, V.; Mendes, F. [Universidade Federal Santa Catarina (UFSC), Florianopolis, SC (Brazil). Dept. de Engenharia Mecanica], Emails:,; Luz, R.L. [ELETROSUL Centrais Eletricas S.A., Florianopolis, SC (Brazil)], Email:


    The main target of this R and D project is to develop an restoration tower for electric energy lines transmission. Whereas these towers should present the main features like transport facility, easiest assembling associated with a low cost of manufacture, it was applied the single-column tower concepts supported by stays, modularized, framed and articulated at the base. The concepts used for this development was a design methodology. From the different definition situations of load, numerical models have been developed focusing the design to the best of structural element arrangements of its modules. Then, tests were performed in laboratory to determine the module structural performance for different work load situations. These tests served to identify inconsistencies in the numerical models and proposed adjustments in its design to improve its performance on the strength and stability. (author)

  11. Mathematical modeling of agricultural fires beneath high voltage transmission lines

    International Nuclear Information System (INIS)

    El-Zohri, Emad H.; Shafey, Hamdy M.; Abdel-Salam, M.; Ahmed, A.


    This paper presents a mathematical model for agricultural fires based on a multi-phase formulation. The model includes dehydration and pyrolysis of agricultural fuel and pyrolysis products. The model considers a homogeneous distribution of the agricultural solid fuel particles, interacting with the gas flow via source terms. These terms include: drag forces, production of water vapour and pyrolysis products, radiative and convective heat exchange. A multi-phase radiative transfer equation for absorbing-emitting medium is considered to account for the radiative heat exchange between the gas and solid phases of the fire. The main outputs of the present model are most important to study the influence of agricultural fire occurring beneath high voltage transmission lines. The agricultural fire causes a flashover due to the ambient temperature rise and soot accumulation on the insulator of these transmission lines. Numerical results of the present model are obtained for flat grassland fires to study the effects of wind velocity, solid fuel moisture content and ignition length on some selected fire outputs. These outputs include the temperature, velocity, soot volume fraction fields of the gas phase, together with fire propagation rate and flame geometry. The numerical results are compared to the available experimental work in the literature. -- Research highlights: → The model is sensitive to the initial condition of the ignition length affecting the fire propagation rate and width. → The model predicts the effects of both the wind velocity and the fuel moisture content on fire propagation rate, in agreement with the available experimental work in the literature. → The model shows that both the wind velocity and the fuel moisture content are important factors affecting the fire plume thickness, location, and inclination. → The model is able to visualize the flame geometry through tracing radiative heat rates exceeding a threshold value for flame visibility (60 k

  12. Tailoring of electron flow current in magnetically insulated transmission lines

    Directory of Open Access Journals (Sweden)

    J. P. Martin


    Full Text Available It is desirable to optimize (minimizing both the inductance and electron flow the magnetically insulated vacuum sections of low impedance pulsed-power drivers. The goal of low inductance is understandable from basic efficiency arguments. The goal of low electron flow results from two observations: (1 flowing electrons generally do not deliver energy to (or even reach most loads, and thus constitute a loss mechanism; (2 energetic electrons deposited in a small area can cause anode damage and anode plasma formation. Low inductance and low electron flow are competing goals; an optimized system requires a balance of the two. While magnetically insulated systems are generally forgiving, there are times when optimization is crucial. For example, in large pulsed-power drivers used to energize high energy density physics loads, the electron flow as a fraction of total current is small, but that flow often reaches the anode in relatively small regions. If the anode temperature becomes high enough to desorb gas, the resulting plasma initiates a gap closure process that can impact system performance. Magnetic-pressure driven (z pinches and material equation of state loads behave like a fixed inductor for much of the drive pulse. It is clear that neither fixed gap nor constant-impedance transmission lines are optimal for driving inductive loads. This work shows a technique for developing the optimal impedance profile for the magnetically insulated section of a high-current driver. Particle-in-cell calculations are used to validate the impedance profiles developed in a radial disk magnetically insulated transmission line geometry. The input parameters are the spacing and location of the minimum gap, the effective load inductance, and the desired electron flow profile. The radial electron flow profiles from these simulations are in good agreement with theoretical predictions when driven at relatively high voltage (i.e., V≥2  MV.

  13. Lossy transmission line model of hydrofractured well dynamics

    Energy Technology Data Exchange (ETDEWEB)

    Patzek, T.W. [Department of Materials Science and Mineral Engineering, University of California at Berkeley, Berkeley, CA (United States); De, A. [Earth Sciences Division, Lawrence Berkeley National Laboratory, Berkeley, CA (United States)


    The real-time detection of hydrofracture growth is crucial to the successful operation of water, CO{sub 2} or steam injection wells in low-permeability reservoirs and to the prevention of subsidence and well failure. In this paper, we describe propagation of very low frequency (1-10 to 100 Hz) Stoneley waves in a fluid-filled wellbore and their interactions with the fundamental wave mode in a vertical hydrofracture. We demonstrate that Stoneley-wave loses energy to the fracture and the energy transfer from the wellbore to the fracture opening is most efficient in soft rocks. We conclude that placing the wave source and receivers beneath the injection packer provides the most efficient means of hydrofracture monitoring. We then present the lossy transmission line model of wellbore and fracture for the detection and characterization of fracture state and volume. We show that this model captures the wellbore and fracture geometry, the physical properties of injected fluid and the wellbore-fracture system dynamics. The model is then compared with experimentally measured well responses. The simulated responses are in good agreement with published experimental data from several water injection wells with depths ranging from 1000 ft to 9000 ft. Hence, we conclude that the transmission line model of water injectors adequately captures wellbore and fracture dynamics. Using an extensive data set for the South Belridge Diatomite waterfloods, we demonstrate that even for very shallow wells the fracture size and state can be adequately recognized at wellhead. Finally, we simulate the effects of hydrofracture extension on the transient response to a pulse signal generated at wellhead. We show that hydrofracture extensions can indeed be detected by monitoring the wellhead pressure at sufficiently low frequencies.

  14. Evaluation of Fibre Lifetime in Optical Ground Wire Transmission Lines (United States)

    Grunvalds, R.; Ciekurs, A.; Porins, J.; Supe, A.


    In the research, measurements of polarisation mode dispersion of two OPGWs (optical ground wire transmission lines), in total four fibres, have been carried out, and the expected lifetime of the infrastructure has been assessed on the basis of these measurements. The cables under consideration were installed in 1995 and 2011, respectively. Measurements have shown that polarisation mode dispersion values for cable installed in 1995 are four times higher than that for cable installed in 2011, which could mainly be explained by technological differences in fibre production and lower fibre polarisation mode dispersion requirements in 1995 due to lack of high-speed (over 10 Gbit/s) optical transmission systems. The calculation methodology of non-refusal work and refusal probabilities, using the measured polarisation mode dispersion parameters, is proposed in the paper. Based on reliability calculations, the expected lifetime is then predicted, showing that all measured fibres most likely will be operational within minimum theoretical service life of 25 years accepted by the industry.

  15. Electrostatic induction under the Tanashi test transmission line

    Energy Technology Data Exchange (ETDEWEB)

    Kitani, Y; Yokata, S


    Experimental results are given on the electrostatic voltage induced in small and medium-sized motorcars under the Tanashi 800 kV Test Transmission Line, which is of horizontal arrangement, 200 m span, four bundle conductors and average height of 13.52 m. The induced voltage was measured between 1600 and 3000 V under the line voltage of 520 kV. The voltage and current were measured with four kinds of model motorcars in air and water, and results of the measurements are compared with those of actual measurements with good agreements. The values of capacity and leakage resistance, whose parallel circuit was considered to represent an equivalent circuit of the motorcar, were measured with a Maxwell-Wien bridge at frequencies between 30 and 1000 c/s. It was found that the values at 60 c/s were measured to be approximately six or seven times higher than its values at 1000 c/s, and that new tires have higher conductivities than the old ones, reducing the electrostatic induction voltage by a large amount.

  16. Polar On-Line Acquisition Relay and Transmission System (POLARATS)

    Energy Technology Data Exchange (ETDEWEB)

    Yuracko, K.


    POLARATS (Polar On-Line Acquisition Relay And Transmission System) is being developed by YAHSGS LLC (YAHSGS) and Oak Ridge National Laboratory (ORNL) to provide remote, unattended monitoring of environmental parameters under harsh environmental conditions. In particular, instrumental design and engineering is oriented towards protection of human health in the Arctic, and with the additional goal of advancing Arctic education and research. POLARATS will obtain and transmit environmental data from hardened monitoring devices deployed in locations important to understanding atmospheric and aquatic pollutant migration as it is biomagnified in Arctic food chains. An Internet- and personal computer (PC)-based educational module will provide real time sensor data, on-line educational content, and will be integrated with workbooks and textbooks for use in middle and high school science programs. The educational elements of POLARATS include an Internet-based educational module that will instruct students in the use of the data and how those data fit into changing Arctic environments and food chains. POLARATS will: (1) Enable students, members of the community, and scientific researchers to monitor local environmental conditions in real time over the Internet; and (2) Provide additional educational benefits through integration with middle- and high-school science curricula. Information will be relayed from POLARATS devices to classrooms and libraries along with custom-designed POLARATS teaching materials that will be integrated into existing curricula to enhance the educational benefits realized from the information obtained.

  17. Overhead Transmission Lines Deicing under Different Incentive Displacement

    Directory of Open Access Journals (Sweden)

    Qing He


    Full Text Available Overhead transmission line icing is one of the main factors affecting safety and reliability of power grid. This paper proposed an excitation deicing method of iced wire and theoretically revealed the ice removal mechanism under displacement excitation conditions, by taking the LGJ-70/10 glaze icing wire as the 3D model and analyzing and studying its dynamic response under the effect of displacement excitation. The simulation results show that the stress of wire icing area is enlarged with the increase of excitation displacement and frequency. Through the comparison of the compression strength experimental results on a series of different iced wires in low temperature environment, the authors found out that the stress generated from the wire icing area is greater than the crushing strength of the ice within the scope of the calculation parameters, which proved the validity and the feasibility of the method, and finally the suitable excitation displacement is determined. Following studies show that, as far as possible, it is necessary to reduce the incentive displacement and also to select the appropriate constraint length in order to avoid the line jumping that may be caused by large span ice shedding.

  18. Structural health monitoring of compression connectors for overhead transmission lines (United States)

    Wang, Hong; Wang, Jy-An John; Swindeman, Joseph P.; Ren, Fei; Chan, John


    Two-stage aluminum conductor steel-reinforced (ACSR) compression connectors are extensively used in US overhead transmission lines. The connectors are made by crimping a steel sleeve onto a steel core and an aluminum sleeve over electrical conducting aluminum strands. The connectors are designed to operate at temperatures up to 125°C, but their performance is increasingly degrading because of overloading of lines. Currently, electric utilities conduct routine line inspections using thermal and electrical measurements, but these methods do not provide information about the structural integrity of connectors. In this work, structural health monitoring (SHM) of compression connectors was studied using electromechanical impedance (EMI) analysis. Lead zirconate titanate (PZT)-5A was identified as a smart material for SHM. A flexible high-temperature bonding layer was used to address challenges in PZT integration due to a significant difference in the coefficients of thermal expansion of PZT and the aluminum substrate. The steel joint on the steel core was investigated because it is responsible for the ultimate tensile strength of the connector. Tensile testing was used to induce structural damage to the joint, or steel core pullout, and thermal cycling introduced additional structural perturbations. EMI measurements were conducted between the tests. The root mean square deviation (RMSD) of EMI was identified as a damage index. The use of steel joints has been shown to enable SHM under simulated conditions. The EMI signature is sensitive to variations in structural conditions. RMSD can be correlated to the structural health of a connector and has potential for use in the SHM and structural integrity evaluation.

  19. Optimal Value of Series Capacitors for Uniform Field Distribution in Transmission Line MRI Coils

    DEFF Research Database (Denmark)

    Zhurbenko, Vitaliy


    Transmission lines are often used as coils in high field magnetic resonance imaging (MRI). Due to the distributed nature of transmission lines, coils based on them produce inhomogeneous field. This work investigates application of series capacitors to improve field homogeneity along the coil....... The equations for optimal values of evenly distributed capacitors are derived and expressed in terms of the implemented transmission line parameters.The achieved magnetic field homogeneity is estimated under quasistatic approximation and compared to the regular transmission line resonator. Finally, a more...... practical case of a microstrip line coil with two series capacitors is considered....

  20. Reference-dependent Preferences and the Transmission of Monetary Policy

    DEFF Research Database (Denmark)

    Gaffeo, Edoardo; Petrella, Ivan; Pfajfar, Damjan

    depends on deviations of their consumption from a reference level below which aversion to loss is displayed. In line with the theory developed by Kahneman and Tversky (1979), losses in consumption utility loom larger than gains. This implies state-dependent degrees of real rigidity and elasticity...

  1. Reduction of the visual impact of overhead transmission line systems through utilisation of line surge arresters as lightning protection

    DEFF Research Database (Denmark)

    Sørensen, Thomas Kjærsgaard; Holbøll, Joachim


    with the Technical University of Denmark, on how to lessen the visual impact of 400 kV overhead line transmission systems. In this paper omission of shield wires combined with installation of a suitable number of line surge arresters is investigated as a possible alternative to transmission lines equipped...... with shielding wires thereby reducing tower height, allowing more compact designs of towers thus minimizing the visual environment impact of the lines. Omission of shield wires in the system and instead utilizing a larger number of surge arresters in the (upper) phases of an overhead line without reduction...... will be investigated by transient simulations on a 400 kV line with either shield wires or line surge arresters. These simulations will also be used to estimate number and location of the line surge arresters in the line to ensure a satisfactory performance of the line when omitting shield wires in the tower top...

  2. Improved Field Homogeneity for Transmission Line MRI Coils Using Series Capacitors

    DEFF Research Database (Denmark)

    Zhurbenko, Vitaliy; Dong, Yunfeng


    High field magnetic resonance imaging (MRI) systems often use short sections of transmission lines for generating and sensing alternating magnetic fields. Due to distributed nature of transmission lines, the generated field is inhomogeneous. This work investigates the application of series capaci...... capacitors to improve the field homogeneity. The resulting magnetic field distribution is estimated analytically and evaluated numerically. The results are compared to a case of a conventional transmission line coil realization....

  3. Energy losses in magnetically insulated transmission lines due to microparticles

    International Nuclear Information System (INIS)

    Gray, E.W.; Stinnett, R.W.


    We discuss the effects of high-velocity and hypervelocity microparticles in the magnetically insulated transmission lines of multiterawatt accelerators used for particle beam fusion and radiation effects simulation. These microparticles may be a possible source for plasma production near the anode and cathode in early stages of the voltage pulse, and current carriers during and after the power pulse, resulting in power flow losses. Losses in the current pulse, due to microparticles, are estimated to be approximately 12 mA/cm 2 (0.3 kA) as a lower limit, and --0.3 A/cm 2 (7.2 kA) for microparticle initiated, anode plasma positive ion transport. We have calculated the velocities reached by these microparticles and the effects on them of Van der Waals forces. Field emission from the particles and their effects on cathode and anode plasma formation have been examined. Particle collision with the electrodes is also examined in terms of plasma production, as in the electron deposition in the particles in transit across the anode-cathode gap. Blistering of the electrode surface, thought to be due to H - bombardment was also observed and appears to be consistent with losses due to negative ions previously reported by J. P. VanDevender, R. W. Stinnett, and R. J. Anderson [App. Phys. Lett. 38, 229 (1981)

  4. Requirements for self-magnetically insulated transmission lines

    Directory of Open Access Journals (Sweden)

    J. Pace VanDevender


    Full Text Available Self-magnetically insulated transmission lines (MITLs connect pulsed-power drivers with a load. Although the technology was originally developed in the 1970s and is widely used today in super power generators, failure of the technology is the principal limitation on the power that can be delivered to an experiment. We address issues that are often overlooked, rejected after inadequate simulations, or covered by overly conservative assumptions: (i electron retrapping in coupling MITLs to loads, (ii the applicability of collisionless versus collisional electron flow, (iii power transport efficiency as a function of the geometry at the beginning of the MITL, (iv gap closure and when gap closure can be neglected, and (v the role of negative ions in causing anode plasmas and enhancing current losses. We suggest a practical set of conservative design requirements for self-magnetically insulated electron flow based on the results discussed in this paper and on previously published results. The requirements are not necessarily severe constraints in all MITL applications; however, each of the 18 suggested requirements should be examined in the design of a MITL and in the investigation of excessive losses.

  5. Dielectric window development for the ITER ICRF vacuum transmission line

    International Nuclear Information System (INIS)

    Heikinheimo, L.; Heikkinen, J.; Hytoenen, Y.


    A vacuum window block design is presented for the ITER (International Thermonuclear Experimental Reactor) ion cyclotron radio frequency heating vacuum transmission line. The vacuum windows in various auxiliaries of the present fusion facilities and in future fusion reactors are essential and most vulnerable components, as they provide ultimate vacuum and tritium containment. Various existing windows, e.g. those at the ASDEX Upgrade tokamak (IPP, Garching), Tore Supra (CEA, Cadarache), and at JET Tokamak (Euratom, Culham), have provided a starting point for the present work, but the large size, remote handling and cooling requirements, as well as the strong neutron radiation in the fusion reactors have called a new design, where new material combinations for the dielectric and conductor have deemed to be necessary. Conventional and well tested design solutions have been chosen wherever possible. A preprototype construction has been launched to test the design principles, in particular the joining of the ceramics to a titanium conductor by brazing which has not been possible so far in this size and geometry. First results of the preprototype tests are reported here. The present final report is a combination of the results achieved with the support of two different projects; an industrial project funded by EFET and a NET Research and Design project funded by the Euratom/TEKES within the Euratom fusion programme. (orig.)

  6. Magnetic insulation in triplate and coaxial vacuum transmission lines. Report PIFR-1009

    International Nuclear Information System (INIS)

    Di Capua, M.; Pellinen, D.G.


    An experimental investigation was made of magnetically insulated transmission lines for use in an electron beam fusion accelerator. The magnetically insulated vacuum transmission lines would transfer the power pulses from many modules to a single diode region or multiple diodes to generate currents on the order of 100 MA. This approach may allow present limits on power flow through dielectric vacuum interfaces to be overcome. We have investigated symmetric parallel plate (triplate) transmission lines with a wave impedance of 24 Ω and a spacing of 1.9 cm, and coaxial transmission lines (coax) with a wave impedance of 42 Ω and a spacing of 2.9 cm

  7. Voltage dependency of transmission probability of aperiodic DNA molecule (United States)

    Wiliyanti, V.; Yudiarsah, E.


    Characteristics of electron transports in aperiodic DNA molecules have been studied. Double stranded DNA model with the sequences of bases, GCTAGTACGTGACGTAGCTAGGATATGCCTGA, in one chain and its complements on the other chains has been used. Tight binding Hamiltonian is used to model DNA molecules. In the model, we consider that on-site energy of the basis has a linearly dependency on the applied electric field. Slater-Koster scheme is used to model electron hopping constant between bases. The transmission probability of electron from one electrode to the next electrode is calculated using a transfer matrix technique and scattering matrix method simultaneously. The results show that, generally, higher voltage gives a slightly larger value of the transmission probability. The applied voltage seems to shift extended states to lower energy. Meanwhile, the value of the transmission increases with twisting motion frequency increment.

  8. The Evaluation Method of the Lightning Strike on Transmission Lines Aiming at Power Grid Reliability (United States)

    Wen, Jianfeng; Wu, Jianwei; Huang, Liandong; Geng, Yinan; Yu, zhanqing


    Lightning protection of power system focuses on reducing the flashover rate, only distinguishing by the voltage level, without considering the functional differences between the transmission lines, and being lack of analysis the effect on the reliability of power grid. This will lead lightning protection design of general transmission lines is surplus but insufficient for key lines. In order to solve this problem, the analysis method of lightning striking on transmission lines for power grid reliability is given. Full wave process theory is used to analyze the lightning back striking; the leader propagation model is used to describe the process of shielding failure of transmission lines. The index of power grid reliability is introduced and the effect of transmission line fault on the reliability of power system is discussed in detail.

  9. Recent progress of the improved magnetically insulated transmission line oscillator. (United States)

    Fan, Yu-Wei; Zhong, Hui-Huang; Li, Zhi-Qiang; Shu, Ting; Zhang, Jian-De; Liu, Jin-Liang; Yang, Jian-Hua; Zhang, Jun; Yuan, Cheng-Wei; Luo, Ling


    The improved magnetically insulated transmission line oscillator (MILO) is a gigawatt-class L-band high power microwave tube driven by a 550 kV, 57 kA, 50 ns electron beam. It has allowed us to generate 2.4 GW pulse of 22 ns duration. The recent progress of the improved MILO is presented in this paper. First, a field shaper cathode is introduced into the improved MILO to avoid the cathode flares in the triple point region. The experimental results show that the cathode flares are avoided, so the lifetime of the velvet cathode is longer than that of the taper cathode. Furthermore, the shot-to-shot reproducibility is better than that of the taper cathode. Second, In order to prolong the pulse duration and increase the radiated microwave power, a self-built 600 kV, 10 Omega, 80 ns pulser: SPARK-03 is employed to drive the improved MILO. Simulation and experimental investigation are performed. In simulation, when the improved MILO is driven by a 600 kV, 57 kA electron beam, high-power microwave is generated with output power of 4.15 GW, frequency of 1.76 GHz, and relevant power conversion efficiency of 12.0%. In experiments, when the diode voltage is 550 kV and current is 54 kA, the measured results are that the radiated microwave power is above 3.1 GW, the pulse duration is above 40 ns, the microwave frequency is about 1.755 GHz, and the power conversion efficiency is about 10.4%.

  10. Theoretical investigation of dielectric corona pre-ionization TEA nitrogen laser based on transmission line method (United States)

    Bahrampour, Alireza; Fallah, Robabeh; Ganjovi, Alireza A.; Bahrampour, Abolfazl


    This paper models the dielectric corona pre-ionization, capacitor transfer type of flat-plane transmission line traveling wave transverse excited atmospheric pressure nitrogen laser by a non-linear lumped RLC electric circuit. The flat-plane transmission line and the pre-ionizer dielectric are modeled by a lumped linear RLC and time-dependent non-linear RC circuit, respectively. The main discharge region is considered as a time-dependent non-linear RLC circuit where its resistance value is also depends on the radiated pre-ionization ultra violet (UV) intensity. The UV radiation is radiated by the resistance due to the surface plasma on the pre-ionizer dielectric. The theoretical predictions are in a very good agreement with the experimental observations. The electric circuit equations (including the ionization rate equations), the equations of laser levels population densities and propagation equation of laser intensities, are solved numerically. As a result, the effects of pre-ionizer dielectric parameters on the electrical behavior and output laser intensity are obtained.

  11. Long-distance pulse propagation on high-frequency dissipative nonlinear transmission lines/resonant tunneling diode line cascaded maps

    International Nuclear Information System (INIS)

    Klofai, Yerima; Essimbi, B Z; Jaeger, D


    Pulse propagation on high-frequency dissipative nonlinear transmission lines (NLTLs)/resonant tunneling diode line cascaded maps is investigated for long-distance propagation of short pulses. Applying perturbative analysis, we show that the dynamics of each line is reduced to an expanded Korteweg-de Vries-Burgers equation. Moreover, it is found by computer experiments that the soliton developed in NLTLs experiences an exponential amplitude decay on the one hand and an exponential amplitude growth on the other. As a result, the behavior of a pulse in special electrical networks made of concatenated pieces of lines is closely similar to the transmission of information in optical/electrical communication systems.

  12. Long-distance pulse propagation on high-frequency dissipative nonlinear transmission lines/resonant tunneling diode line cascaded maps

    Energy Technology Data Exchange (ETDEWEB)

    Klofai, Yerima [Department of Physics, Higher Teacher Training College, University of Maroua, PO Box 46 Maroua (Cameroon); Essimbi, B Z [Department of Physics, Faculty of Science, University of Yaounde 1, PO Box 812 Yaounde (Cameroon); Jaeger, D, E-mail: [ZHO, Optoelectronik, Universitaet Duisburg-Essen, D-47048 Duisburg (Germany)


    Pulse propagation on high-frequency dissipative nonlinear transmission lines (NLTLs)/resonant tunneling diode line cascaded maps is investigated for long-distance propagation of short pulses. Applying perturbative analysis, we show that the dynamics of each line is reduced to an expanded Korteweg-de Vries-Burgers equation. Moreover, it is found by computer experiments that the soliton developed in NLTLs experiences an exponential amplitude decay on the one hand and an exponential amplitude growth on the other. As a result, the behavior of a pulse in special electrical networks made of concatenated pieces of lines is closely similar to the transmission of information in optical/electrical communication systems.

  13. Nonlinear Seismic Behavior of Different Boundary Conditions of Transmission Line Systems under Earthquake Loading

    Directory of Open Access Journals (Sweden)

    Li Tian


    Full Text Available Nonlinear seismic behaviors of different boundary conditions of transmission line system under earthquake loading are investigated in this paper. The transmission lines are modeled by cable element accounting for the nonlinearity of the cable. For the suspension type, three towers and two span lines with spring model (Model 1 and three towers and four span lines’ model (Model 2 are established, respectively. For the tension type, three towers and two span lines’ model (Model 3 and three towers and four span lines’ model (Model 4 are created, respectively. The frequencies of the transmission towers and transmission lines of the suspension type and tension type are calculated, respectively. The responses of the suspension type and tension type are investigated using nonlinear time history analysis method, respectively. The results show that the responses of the transmission tower and transmission line of the two models of the suspension type are slightly different. However, the responses of transmission tower and transmission line of the two models of the tension type are significantly different. Therefore, in order to obtain accurate results, a reasonable model should be considered. The results could provide a reference for the seismic analysis of the transmission tower-line system.

  14. Explanation of the Inverse Doppler Effect Observed in Nonlinear Transmission Lines

    International Nuclear Information System (INIS)

    Kozyrev, Alexander B.; Weide, Daniel W. van der


    The theory of the inverse Doppler effect recently observed in magnetic nonlinear transmission lines is developed. We explain the crucial role of the backward spatial harmonic in the occurrence of an inverse Doppler effect and draw analogies of the magnetic nonlinear transmission line to the backward wave oscillator

  15. Risk Analysis Method Based on FMEA for Transmission Line in Lightning Hazards

    Directory of Open Access Journals (Sweden)

    You-Yuan WANG


    Full Text Available Failure rate of transmission line and reliability of power system are significantly affected by Lightning meteorological factor. In view of the complexity and variability of Lightning meteorological factors, this paper presents lightning trip-out rate model of transmission line in considering distribution of ground flash density and lightning day hours. Meanwhile, presents a failure rate model of transmission line in different condition, and a risk analysis method for transmission line considering multiple risk factors based on risk quantification. This method takes Lightning meteorological factor as the main evaluation standard, and establishes risk degree evaluation system for transmission line including another five evaluation standard. Put forward the risk indicators by quantify the risk factors based on experience date of transmission line in service. Based on the risk indexes comprehensive evaluation is conducted, and the evaluation result closer to practice is achieved, providing basis for transmission line risk warning and maintenance strategy. Through the risk analysis for 220 kV transmission line in a certain power supply bureau, the effectiveness of the proposed method is validated.


    Directory of Open Access Journals (Sweden)

    V. I. Vanko


    Full Text Available This article describes aerodynamic losses of damping, or aerodynamic instability, which we observe in experiments and in engineering practice. As applied to industrial high-voltage lines this phenomenon is usually called galloping (dancing of phase line wires. This phenolmenon can be explained by Lyapunov’s instability of equilibrium state of wires profile (cross-section. In addition to known condition of Grauert-den-Hartog’s instability there was obtained practical condition of instability, which depends only on stationary aerodynamic profile’s factor – dimensionless coefficient of head resistance and lift coefficient, and also on their derivative with respect to the angle of attack.There was suggested an effective numerical-analytical method of investigation of stability for equilibrium of profile’s state in flow, which was developed at the department “Applied mathematics” of Bauman MSTU. This method allows to determine the stationary aerodynamics characteristics of profile by numerical simulation of profile flow under different angles of attack by vortex element method and later on the application of analytical conditions of stability and Lyapunov’s instability of equilibrium positions. The obtained results during the investigation of rhombic and square profiles stability, as well as general profile of iced wire, and their comparisons with the known experiments’ results in aerodynamic tubes indicate the precision of developed methods and algorithms. The usage of mesh-free Lagrange method of vortex elements and software for their realization allows to solve also dual problems of aerohydroelasticity and to carry out direct numerical simulation of profile movement in flow. In this article the investigations’ results of different authors in this field were taken into account.

  17. Millimeter-Gap Magnetically Insulated Transmission Line Power Flow Experiments

    Energy Technology Data Exchange (ETDEWEB)

    Hutsel, Brian Thomas [Sandia National Lab. (SNL-NM), Albuquerque, NM (United States); Stoltzfus, Brian S. [Sandia National Lab. (SNL-NM), Albuquerque, NM (United States); Fowler, William E. [Sandia National Lab. (SNL-NM), Albuquerque, NM (United States); LeChien, Keith R. [Sandia National Lab. (SNL-NM), Albuquerque, NM (United States); Mazarakis, Michael G. [Sandia National Lab. (SNL-NM), Albuquerque, NM (United States); Moore, James K. [Sandia National Lab. (SNL-NM), Albuquerque, NM (United States); Mulville, Thomas D. [Sandia National Lab. (SNL-NM), Albuquerque, NM (United States); Savage, Mark E. [Sandia National Lab. (SNL-NM), Albuquerque, NM (United States); Stygar, William A. [Sandia National Lab. (SNL-NM), Albuquerque, NM (United States); McKenney, John L. [Sandia National Lab. (SNL-NM), Albuquerque, NM (United States); Jones, Peter A. [Sandia National Lab. (SNL-NM), Albuquerque, NM (United States); MacRunnels, Diego J. [Sandia National Lab. (SNL-NM), Albuquerque, NM (United States); Long, Finis W. [Sandia National Lab. (SNL-NM), Albuquerque, NM (United States); Porter, John L. [Sandia National Lab. (SNL-NM), Albuquerque, NM (United States)


    An experiment platform has been designed to study vacuum power flow in magnetically insulated transmission lines (MITLs). The platform was driven by the 400-GW Mykonos-V accelerator. The experiments conducted quantify the current loss in a millimeter-gap MITL with respect to vacuum conditions in the MITL for two different gap distances, 1.0 and 1.3 mm. The current loss for each gap was measured for three different vacuum pump down times. As a ride along experiment, multiple shots were conducted with each set of hardware to determine if there was a conditioning effect to increase current delivery on subsequent shots. The experiment results revealed large differences in performance for the 1.0 and 1.3 mm gaps. The 1.0 mm gap resulted in current loss of 40%-60% of peak current. The 1.3 mm gap resulted in current losses of less than 5% of peak current. Classical MITL models that neglect plasma expansion predict that there should be zero current loss, after magnetic insulation is established, for both of these gaps. The experiments result s indicate that the vacuum pressure or pump down time did not have a significant effect on the measured current loss at vacuum pressures between 1e-4 and 1e-5 Torr. Additionally, there was not repeatable evidence of a conditioning effect that reduced current loss for subsequent full-energy shots on a given set of hardware. It should be noted that the experiments conducted likely did not have large loss contributions due to ion emission from the anode due to the relatively small current densi-ties (25-40 kA/cm) in the MITL that limited the anode temperature rise due to ohmic heating. The results and conclusions from these experiments may have limited applicability to MITLs of high current density (>400 kA/cm) used in the convolute and load region of the Z which experience temperature increases of >400° C and generate ion emission from anode surfaces.

  18. On increasing the spectral efficiency and transmissivity in the data transmission channel on the spacecraft-ground tracking station line (United States)

    Andrianov, M. N.; Kostenko, V. I.; Likhachev, S. F.


    The algorithms for achieving a practical increase in the rate of data transmission on the space-craft-ground tracking station line has been considered. This increase is achieved by applying spectral-effective modulation techniques, the technology of orthogonal frequency compression of signals using millimeterrange radio waves. The advantages and disadvantages of each of three algorithms have been revealed. A significant advantage of data transmission in the millimeter range has been indicated.

  19. Prediction of the Voltage Quality in an Overhead Transmission Line with Distributed Parameters


    Bulyga Leonid L.; Tarasov Evgeniy V.; Ushakov Vasily Ya.; Kharlov Nikolay N.


    The present work is devoted to investigation of an electrical transmission line with allowance for distributed parameters. From the results of voltage measurements at terminals of an actual transmission line, effective values of the voltage are calculated for every line section. Special attention is given to higher harmonics and asymmetry. Spectral composition of the voltage is presented and changes in values of harmonic components are analyzed. The effect of higher harmonics on the equipment...

  20. Prediction of the Voltage Quality in an Overhead Transmission Line with Distributed Parameters

    Directory of Open Access Journals (Sweden)

    Bulyga Leonid L.


    Full Text Available The present work is devoted to investigation of an electrical transmission line with allowance for distributed parameters. From the results of voltage measurements at terminals of an actual transmission line, effective values of the voltage are calculated for every line section. Special attention is given to higher harmonics and asymmetry. Spectral composition of the voltage is presented and changes in values of harmonic components are analyzed. The effect of higher harmonics on the equipment operation is analyzed.

  1. Planning Electric Transmission Lines: A Review of Recent Regional Transmission Plans

    Energy Technology Data Exchange (ETDEWEB)

    Eto, Joseph H. [Lawrence Berkeley National Lab. (LBNL), Berkeley, CA (United States)


    The first Quadrennial Energy Review (QER) recommends that the U.S. Department of Energy (DOE) conduct a national review of transmission plans and assess the barriers and incentives to their implementation. DOE tasked Lawrence Berkeley National Laboratory (LBNL) to prepare two reports to support the agency’s response to this recommendation. This report reviews regional transmission plans and regional transmission planning processes that have been directed by Federal Energy Regulatory Commission (FERC) Order Nos. 890 and 1000. We focus on the most recent regional transmission plans (those issued in 2015 and through approximately mid-year 2016) and current regional transmission planning processes. A companion report focuses on non-plan-related factors that affect transmission projects.

  2. Design of Miniaturized 10dB Wideband Branch Line Coupler Using Dual and T-Shape Transmission Lines

    Directory of Open Access Journals (Sweden)

    M. Kumar


    Full Text Available This paper presents a design mechanism of miniaturized wideband branch line coupler (BLC with loose coupling of 10 dB. Dual transmission lines are used as a feed network which provides a size reduction of 32% with a fractional bandwidth (FBW of 60% for 10±0.5 dB coupling but return loss performance is found to be poor in the operating band. For further improvement of return loss performance as well as for size reduction of the BLC, a T- shape transmission lines are used instead of series quarter wavelength transmission lines, and hence the overall size reduction of around 44% with FBW of 50.4% is achieved. The return loss and isolation performance is found to be les than 15 dB in the entire operating band (2.5–4.1 GHz with respect to design frequency 3G Hz. The proposed BLC is analyzed, fabricated and tested.

  3. Performance Evaluation on Transmission Tower-Line System with Passive Friction Dampers Subjected to Wind Excitations

    Directory of Open Access Journals (Sweden)

    Bo Chen


    Full Text Available The vibration control and performance evaluation on a transmission-tower line system by using friction dampers subjected to wind excitations are carried out in this study. The three-dimensional finite element (FE model of a transmission tower is firstly constructed. A two-dimensional lumped mass model of a transmission tower is developed for dynamic analysis. The analytical model of transmission tower-line system is proposed by taking the dynamic interaction between the tower and the transmission lines into consideration. The mechanical model of passive friction damper is presented by involving the effects of damper axial stiffness. The equation of motion of the transmission tower-line system incorporated with the friction dampers disturbed by wind excitations is established. A real transmission tower-line system is taken as an example to examine the feasibility and reliability of the proposed control approach. An extensive parameter study is carried out to find the optimal parameters of friction damper and to assess the effects of slipping force axial stiffness and hysteresis loop on control performance. The work on an example structure indicates that the application of friction dampers with optimal parameters could significantly reduce wind-induced responses of the transmission tower-line system.

  4. Dynamic Model for the Z Accelerator Vacuum Section Based on Transmission Line Code%Dynamic Model for the Z Accelerator Vacuum Section Based on Transmission Line Code

    Institute of Scientific and Technical Information of China (English)

    呼义翔; 雷天时; 吴撼宇; 郭宁; 韩娟娟; 邱爱慈; 王亮平; 黄涛; 丛培天; 张信军; 李岩; 曾正中; 孙铁平


    The transmission-line-circuit model of the Z accelerator, developed originally by W. A. STYGAR, P. A. CORCORAN, et al., is revised. The revised model uses different calculations for the electron loss and flow impedance in the magnetically insulated transmission line system of the Z accelerator before and after magnetic insulation is established. By including electron pressure and zero electric field at the cathode, a closed set of equations is obtained at each time step, and dynamic shunt resistance (used to represent any electron loss to the anode) and flow impedance are solved, which have been incorporated into the transmission line code for simulations of the vacuum section in the Z accelerator. Finally, the results are discussed in comparison with earlier findings to show the effectiveness and limitations of the model.

  5. Ultrasound transmission spectroscopy: in-line sizing of nanoparticles

    NARCIS (Netherlands)

    Neer, P.L.M.J. van; Volker, A.W.F.; Pierre, G.; Bouvet, F.; Crozat, S.


    Nanoparticles are increasingly used in a number of applications, e.g. coatings or paints. To optimize nanoparticle production in-line quantitative measurements of their size distribution and concentration are needed. Ultrasound-based methods are especially suited for in-line particle sizing. These

  6. Simulation of 6 1/8 inch rigid coaxial RF transmission line

    International Nuclear Information System (INIS)

    Soni, Atul; Pande, M.M.; Rao, M.K.V.; Handu, V.K.


    A radio frequency (RF) transmission line has been designed based upon rigid coaxial 6 1/8 , 50-ohm line for coupling the RF power from its source to 400 KeV radio frequency quadrupole (RFQ) accelerator. Simulation and analysis have been carried out to evaluate various RF parameters of the line. (author)

  7. Research on UAV Intelligent Obstacle Avoidance Technology During Inspection of Transmission Line (United States)

    Wei, Chuanhu; Zhang, Fei; Yin, Chaoyuan; Liu, Yue; Liu, Liang; Li, Zongyu; Wang, Wanguo

    Autonomous obstacle avoidance of unmanned aerial vehicle (hereinafter referred to as UAV) in electric power line inspection process has important significance for operation safety and economy for UAV intelligent inspection system of transmission line as main content of UAV intelligent inspection system on transmission line. In the paper, principles of UAV inspection obstacle avoidance technology of transmission line are introduced. UAV inspection obstacle avoidance technology based on particle swarm global optimization algorithm is proposed after common obstacle avoidance technologies are studied. Stimulation comparison is implemented with traditional UAV inspection obstacle avoidance technology which adopts artificial potential field method. Results show that UAV inspection strategy of particle swarm optimization algorithm, adopted in the paper, is prominently better than UAV inspection strategy of artificial potential field method in the aspects of obstacle avoidance effect and the ability of returning to preset inspection track after passing through the obstacle. An effective method is provided for UAV inspection obstacle avoidance of transmission line.

  8. 75 FR 66750 - Albany-Eugene Transmission Line Rebuild Project (United States)


    ... physically worn and structurally unsound in places. The wood transmission poles have lasted beyond the... access roads, developing staging areas for storage of materials, removing and replacing existing wood... construction activities. The existing structures would be replaced with structures of similar design within or...

  9. Simulation of longitudinal differential protection of transmission lines with additional stabilization and APU system

    Directory of Open Access Journals (Sweden)

    Rajić Tomislav D.


    Full Text Available This paper explains the algorithm for the longitudinal differential protection of transmission lines with automatic reclosing. Classic stabilization is not sufficient for avoiding of unnecessary operations caused by saturation of current transformer. This problem can occur during the fault plased outside of the protected zone of the transmission line. It is shown how unnecessary operation can occur during the outside fault whithout using of additional stabilization. The different types of faults were simulated and comparison of relay operations with and without additional stabilization is presented. The simulations were performed on the three-phase model of the transmission line formed by using of MATLAB/Simulink program.

  10. Active Power Flow Optimization of Industrial Power Supply with Regard to the Transmission Line Conductor Heating

    Directory of Open Access Journals (Sweden)

    Leyzgold D.Yu.


    Full Text Available This article studies the problem of the transmission line conductor heating effect on the active power flows optimization in the local segment of industrial power supply. The purpose is to determine the optimal generation rating of the distributed power sources, in which the power flow values will correspond to the minimum active power losses in the power supply. The timeliness is the need to define the most appropriate rated power values of distributed sources which will be connected to current industrial power supply. Basing on the model of active power flow optimization, authors formulate the description of the nonlinear transportation problem considering the active power losses depending on the transmission line conductor heating. Authors proposed a new approach to the heating model parameters definition based on allowable current loads and nominal parameters of conductors as part of the optimization problem. Analysis of study results showed that, despite the relatively small active power losses reduction to the tune 0,45% due to accounting of the conductors heating effect for the present configuration of power supply, there are significant fluctuations in the required generation rating in nodes of the network to 9,32% within seasonal changes in the outer air temperature. This fact should be taken into account when selecting the optimum power of distributed generation systems, as exemplified by an arbitrary network configuration.

  11. Capacitive Coupling in Double-Circuit Transmission Lines

    Directory of Open Access Journals (Sweden)

    Zdenka Benesova


    Full Text Available The paper describes an algorithm for calculation of capacitances and charges on conductors in systems with earth wires and in double-circuit overhead lines with respect to phase arrangement. A balanced voltage system is considered. A suitable transposition of individual conductors enables to reduce the electric and magnetic fields in vicinity of overhead lines and to limit the inductive and capacitive linkage. The procedure is illustrated on examples the results of which lead to particular recommendations for designers.

  12. Design of Chebychev’s Low Pass Filters Using Nonuniform Transmission Lines

    Directory of Open Access Journals (Sweden)

    Said Attamimi


    Full Text Available Transmission lines are utilized in many applications to convey energy as well as information. Nonuniform transmission lines (NTLs are obtained through variation of the characteristic quantities along the axial direction. Such NTLs can be used to design network elements, like matching circuits, delay equalizers, filters, VLSI interconnections, etc. In this work, NTLs were analyzed with a numerical method based on the implementation of method of moment. In order to approximate the voltage and current distribution along the transmission line, a sum of basis functions with unknown amplitudes was introduced. As basis function, a constant function was used. In this work, we observed several cases such as lossless and lossy uniform transmission lines with matching and arbitrary load. These cases verified the algorithm developed in this work. The second example consists of nonuniform transmission lines in the form of abruptly changing transmission lines. This structure was used to design a Chebychev’s low pass filter. The calculated reflection and transmission factors of the filters showed some coincidences with the measurements.

  13. Compton scattering of photons from electrons in magnetically insulated transmission lines

    International Nuclear Information System (INIS)

    Brower, K.L.; VanDevender, J.P.


    Self-magnetically insulated transmission lines are used for power transport between the vacuum insulator and the diode in high current particle accelerators. Since the efficiency of the power transport depends on the details of the initial line geometry, i.e., the injector, the dependence of the electron canonical momentum distribution on the injector geometry should reveal the loss mechanism. We propose to study that dependence experimentally through a Compton scattering diagnostic. The spectrum of scattered light reveals the electron velocity distribution perpendicular to the direction of flow. The design of the diagnostic is in progress. Our preliminary analysis is based on the conservation of energy and canonical momentum for a single electron in the anti E and anti B fields determined from 2-D calculations. For the Mite accelerator with power flow along Z, the normalized canonical momentum, μ, is in the range - 0.7 < μ less than or equal to 0. For anti k/sub i/ parallel to circumflex Y, and anti k/sub s/ circumflex X, our analysis indicates that the scattered photons have 1.1 eV less than or equal to h nu/sub s/ < 5.6 eV for ruby laser scattering and can be detected with PM tubes

  14. World's longest underwater line part of new dc transmission link

    Energy Technology Data Exchange (ETDEWEB)


    The world's seventh dc transmission system including the world's longest underwater power cable is now operative. The system, linking the Italian Mainland with Sardinia, was designed and engineered by the English Electric Co. Ltd. It will ensure a constant power supply for Sardinia and allow export of 200 MW of power to the Tuscany area in Italy. Proving test began on the link in Decmeber and continued until full demand is made on it from Italy.

  15. Using ice melting and ice rolling technologies to remove ice from sub-transmission and transmission lines at Manitoba Hydro

    International Nuclear Information System (INIS)

    Farias, A. R.


    Development of an of an Ice Storm Management program by Manitoba Hydro to reduce ice storm damage to its 8 kV feeders to 115 kV transmission lines, is discussed. The program consists of the de-icing of overhead lines, either by ice melting, or ice rolling. Ice melting involves the placement of a three-phase short at a calculated point. The term ice rolling denotes a process of mechanically stripping the ice from conductors. The most recent major ice storm experienced by Manitoba Hydro was in the winter of 1997/1998. During the period from February 6 to February 17, 1998, a total of 83 'ice melt' procedures were performed to melt the ice from 2,628 km of overhead line (7,883 km of conductor), in addition to 'ice rolling'. This paper describes Manitoba Hydro's 25-years' experience with ice melting and it also describes the advantages and disadvantages of both ice melting and ice rolling. Although not a panacea to combat the effects of ice storms, ice melting was found to be the most effective way of removing ice from overhead transmission and sub-transmission lines. Ice rolling was also found to be effective. Other tools that have been found to be useful by various utilities in combating ice storm damage include improved structure and line design, system design that provide more redundancies and emergency sources, and standby generators at critical load points

  16. A distributed parameter model of transmission line transformer for high voltage nanosecond pulse generation. (United States)

    Li, Jiangtao; Zhao, Zheng; Li, Longjie; He, Jiaxin; Li, Chenjie; Wang, Yifeng; Su, Can


    A transmission line transformer has potential advantages for nanosecond pulse generation including excellent frequency response and no leakage inductance. The wave propagation process in a secondary mode line is indispensable due to an obvious inside transient electromagnetic transition in this scenario. The equivalent model of the transmission line transformer is crucial for predicting the output waveform and evaluating the effects of magnetic cores on output performance. However, traditional lumped parameter models are not sufficient for nanosecond pulse generation due to the natural neglect of wave propagations in secondary mode lines based on a lumped parameter assumption. In this paper, a distributed parameter model of transmission line transformer was established to investigate wave propagation in the secondary mode line and its influential factors through theoretical analysis and experimental verification. The wave propagation discontinuity in the secondary mode line induced by magnetic cores is emphasized. Characteristics of the magnetic core under a nanosecond pulse were obtained by experiments. Distribution and formation of the secondary mode current were determined for revealing essential wave propagation processes in secondary mode lines. The output waveform and efficiency were found to be affected dramatically by wave propagation discontinuity in secondary mode lines induced by magnetic cores. The proposed distributed parameter model was proved more suitable for nanosecond pulse generation in aspects of secondary mode current, output efficiency, and output waveform. In depth, comprehension of underlying mechanisms and a broader view of the working principle of the transmission line transformer for nanosecond pulse generation can be obtained through this research.

  17. Self-limiting current for magnetically insulated coaxial vacuum transmission lines

    International Nuclear Information System (INIS)

    Bergeron, K.D.


    Existing cold fluid theories for magnetic insulation are analyzed and applied to the transmission line configuration. The relevance of these results to the propagating short pulse problem, and to DC operation, are discussed

  18. An ME-PC Enhanced HDMR Method for Efficient Statistical Analysis of Multiconductor Transmission Line Networks

    KAUST Repository

    Yucel, Abdulkadir C.; Bagci, Hakan; Michielssen, Eric


    An efficient method for statistically characterizing multiconductor transmission line (MTL) networks subject to a large number of manufacturing uncertainties is presented. The proposed method achieves its efficiency by leveraging a high

  19. Frequency Selective Properties of Coaxial Transmission Lines Loaded with Combined Artificial Inclusions

    Directory of Open Access Journals (Sweden)

    Francisco Falcone


    Full Text Available The properties of a modified coaxial transmission line by periodic inclusions will be discussed. The introduction of split ring resonators, conductor stubs, air gaps, and combination of these gives rise to new frequency selective properties, such as stopband or passband behavior, observable in planar as well as volumetric metamaterial structures. These results envisage new potential applications and implementation of devices in coaxial transmission line technology.

  20. TEr azimuthal modes for a biconic transmission line in the small-gap limit

    International Nuclear Information System (INIS)

    Johnson, W.A.; Mendel, C.W. Jr.; Seidel, D.B.


    Azimuthally asymmetric modes in a biconic transmission line with a small-gap angle may be approximated by ''transmission-line-like'' modes. It is shown that the errors in these approximations are second order in the gap angle and approximate error bounds are provided. As an example demonstrating the application of this analysis in biconic structures, an analysis to characterize of the electromagnetic waves in the vacuum feed of the Particle Beam Fusion Accelerator II is provided

  1. Analytical study for the ability of nonlinear transmission lines to generate solitons

    International Nuclear Information System (INIS)

    Mostafa, S.I.


    The ability of the nonlinear transmission lines (NLTL) has been studied analytically, in this paper to generate solitons and to cause waveform spreading. This can be achieved by balancing nonlinearity and dispersion. A new technique of improved tanh method (ITM) and improved sech methods (ISM) is applied to the nonlinear partial differential equation that describes the NLTL. It is found that the parameters of the transmission line play an important role in controlling the shape of the soliton.

  2. PSPICE simulation of bipolar pulse converter based on short-circuited coaxial transmission line

    International Nuclear Information System (INIS)

    Shi Lei; Fan Yajun


    The operating principle of the bipolar pulse converter based on short-circuited coaxial transmission line type is given. The output bipolar pulses are simulated by using PSPICE program on condition of different electric length and different impedance of the short-circuited coaxial transmission line. The bipolar pulses are generated by using unipolar pulse with pulse width of 2 ns in experiment, the experimental result fit well with the simulation result. (authors)

  3. Large field-of-view transmission line resonator for high field MRI

    DEFF Research Database (Denmark)

    Zhurbenko, Vitaliy; Johannesson, Kristjan Sundgaard; Boer, Vincent


    Transmission line resonators is often a preferable choice for coils in high field magnetic resonance imaging (MRI), because they provide a number of advantages over traditional loop coils. The size of such resonators, however, is limited to shorter than half a wavelength due to high standing wave....... Achieved magnetic field distribution is compared to the conventional transmission line resonator. Imaging experiments are performed using 7 Tesla MRI system. The developed resonator is useful for building coils with large field-of-view....

  4. Induction effect of an electromagnetic pulse on transmission line

    International Nuclear Information System (INIS)

    Pazirandeh, A.; Maleki, P.; Sardari, D.


    Ever increasing demand for and vital importance of communication systems and power transmission to our industries, transportation to work, hospitals, and many other important places deemed necessary to have safety based design considerations. Many natural phenomena and man-made devices may generate powerful and intensive EMP, which is very harmful to the safe mode operation of electrical and communicational systems. In this paper we have calculated induced electric field and power induction due to lightening, nuclear explosion and similar events to the aerial and underground cables

  5. Analysis of Power Network for Line Reactance Variation to Improve Total Transmission Capacity

    Directory of Open Access Journals (Sweden)

    Ikram Ullah


    Full Text Available The increasing growth in power demand and the penetration of renewable distributed generations in competitive electricity market demands large and flexible capacity from the transmission grid to reduce transmission bottlenecks. The bottlenecks cause transmission congestion, reliability problems, restrict competition, and limit the maximum dispatch of low cost generations in the network. The electricity system requires efficient utilization of the current transmission capability to improve the Available Transfer Capability (ATC. To improve the ATC, power flow among the lines can be managed by using Flexible AC Transmission System (FACTS devices as power flow controllers, which alter the parameters of power lines. It is important to place FACTS devices on suitable lines to vary the reactance for improving Total Transmission Capacity (TTC of the network and provide flexibility in the power flow. In this paper a transmission network is analyzed based on line parameters variation to improve TTC of the interconnected system. Lines are selected for placing FACTS devices based on real power flow Performance Index (PI sensitivity factors. TTC is computed using the Repeated Power Flow (RPF method using the constraints of lines thermal limits, bus voltage limits and generator limits. The reactance of suitable lines, selected on the basis of PI sensitivity factors are changed to divert the power flow to other lines with enough transfer capacity available. The improvement of TTC using line reactance variation is demonstrated with three IEEE test systems with multi-area networks. The results show the variation of the selected lines’ reactance in improving TTC for all the test networks with defined contingency cases.

  6. Recent TWOQUICK particle simulations of one- and two- stage transmission lines and diodes on PBFA and SABRE

    International Nuclear Information System (INIS)

    Poukey, J.W.; Cuneo, M.E.; Lockner, T.R.


    This paper presents recent particle simulation studies of the pulsed-power machines PBFA and SABRE. The code used is the 2-D electromagnetic TWOQUICK. For SABRE we emphasize the single-stage case and compare with experiment. Here the voltage adder, magnetically-insulated-transmission-line (MITL), and proton applied-B extraction diode are all included in the fully time-dependent simulations. Results include vacuum wave precursor effects vs. cathode turn-on threshold, and the sheath-retrapping benefits of diode undermatching. For PBFA we emphasize the 2-stage case and compare with experiments using lithium ions. Here we include the transmission lines and MITLs feeding the 2-stage barrel diode. Results show that good operation is critically dependent on careful B-field shaping in the feeds and diode

  7. Density dependence of line intensities and application to plasma diagnostics

    International Nuclear Information System (INIS)

    Masai, Kuniaki.


    Electron density dependence of spectral lines are discussed in view of application to density diagnostics of plasmas. The dependence arises from competitive level population processes, radiative and collisional transitions from the excited states. Results of the measurement on tokamak plasmas are presented to demonstrate the usefulness of line intensity ratios for density diagnostics. Also general characteristics related to density dependence are discussed with atomic-number scaling for H-like and He-like systems to be helpful for application to higher density plasmas. (author)

  8. California-Oregon 500-kV transmission line development of design criteria

    International Nuclear Information System (INIS)

    Simpson, K.D.


    The California-Oregon Transmission Project (COTP) encompassed the design and construction of a third 500-kV ac intertie between California and the Pacific Northwest Transmission system. Sargent ampersand Lundy's (S ampersand L) scope of work in the COTP includes the design of approximately 150 miles of new single-circuit, 500-kV transmission line from southern Oregon to the vicinity of Redding, California. This paper presents the development of the design criteria for this segment of the project, which crosses diverse topographic and climatic regions. This project is an example of the increasing utilization of computers in transmission line engineering. Almost all aspects of design involved the use of the computer. Also, the development of the design criteria for this project coincided with an early release of the TLWorkstation software package by EPRI. TLWorkstation is an engineering workstation containing a family of programs for various aspects of transmission line design. This engineering software allows for increasing refinement in the design and economic optimization of transmission lines and is becoming an important design tool for transmission engineers

  9. Controlling the transmission line shape of molecular t-stubs and potential thermoelectric applications

    DEFF Research Database (Denmark)

    Stadler, Robert; Markussen, Troels


    Asymmetric line shapes can occur in the transmission function describing electron transport in the vicinity of a minimum caused by quantum interference effects. Such asymmetry can be used to increase the thermoelectric efficiency of molecular junctions. So far, however, asymmetric line shapes hav...... calculations for a variety of t-stub molecules and also address their suitability for thermoelectric applications....

  10. E-Textile Embroidered Metamaterial Transmission Line for Signal Propagation Control

    Directory of Open Access Journals (Sweden)

    Bahareh Moradi


    Full Text Available In this paper, the utilization of common fabrics for the manufacturing of e-textile metamaterial transmission lines is investigated. In order to filter and control the signal propagation in the ultra-high frequency (UHF range along the e-textile, a conventional metamaterial transmission line was compared with embroidered metamaterial particles. The proposed design was based on a transmission line loaded with one or several split-ring resonators (SRR on a felt substrate. To explore the relations between physical parameters and filter performance characteristics, theoretical models based on transmission matrices’ description of the filter constituent components were proposed. Excellent agreement between theoretical prediction, electromagnetic simulations, and measurement were found. Experimental results showed stop-band levels higher than −30 dB for compact embroidered metamaterial e-textiles. The validated results confirmed embroidery as a useful technique to obtain customized electromagnetic properties, such as filtering, on wearable applications.

  11. E-Textile Embroidered Metamaterial Transmission Line for Signal Propagation Control. (United States)

    Moradi, Bahareh; Fernández-García, Raul; Gil, Ignacio


    In this paper, the utilization of common fabrics for the manufacturing of e-textile metamaterial transmission lines is investigated. In order to filter and control the signal propagation in the ultra-high frequency (UHF) range along the e-textile, a conventional metamaterial transmission line was compared with embroidered metamaterial particles. The proposed design was based on a transmission line loaded with one or several split-ring resonators (SRR) on a felt substrate. To explore the relations between physical parameters and filter performance characteristics, theoretical models based on transmission matrices' description of the filter constituent components were proposed. Excellent agreement between theoretical prediction, electromagnetic simulations, and measurement were found. Experimental results showed stop-band levels higher than -30 dB for compact embroidered metamaterial e-textiles. The validated results confirmed embroidery as a useful technique to obtain customized electromagnetic properties, such as filtering, on wearable applications.

  12. Line Capacity Expansion and Transmission Switching in Power Systems With Large-Scale Wind Power

    DEFF Research Database (Denmark)

    Villumsen, Jonas Christoffer; Bronmo, Geir; Philpott, Andy B.


    In 2020 electricity production from wind power should constitute nearly 50% of electricity demand in Denmark. In this paper we look at optimal expansion of the transmission network in order to integrate 50% wind power in the system, while minimizing total fixed investment cost and expected cost...... of power generation. We allow for active switching of transmission elements to reduce congestion effects caused by Kirchhoff's voltage law. Results show that actively switching transmission lines may yield a better utilization of transmission networks with large-scale wind power and increase wind power...

  13. submitter Superconducting transmission lines – Sustainable electric energy transfer with higher public acceptance?

    CERN Document Server

    Thomas, Heiko; Chervyakov, Alexander; Stückrad, Stefan; Salmieri, Delia; Rubbia, Carlo


    Despite the extensive research and development investments into superconducting science and technology, both at the fundamental and at the applied levels, many benefits of superconducting transmission lines (SCTL) remain unknown to the public and decision makers at large. This paper aims at informing about the progress in this important research field. Superconducting transmission lines have a tremendous size advantage and lower total electrical losses for high capacity transmission plus a number of technological advantages compared to solutions based on standard conductors. This leads to a minimized environmental impact and enables an overall more sustainable transmission of electric energy. One of the direct benefits may be an increased public acceptance due to the low visual impact with a subsequent reduction of approval time. The access of remote renewable energy (RE) sources with high-capacity transmission is rendered possible with superior efficiency. That not only translates into further reducing $CO_2...

  14. Novel pulse amplifying circuits based on transmission lines of different characteristic impedance

    International Nuclear Information System (INIS)

    Belloni, F.; Doria, D.; Lorusso, A.; Nassisi, V.


    Two novel circuits used to amplify electric pulses by the coupling of transmission lines of different characteristic impedance are described. The circuits are intended for doubling voltage pulses and for doubling current pulses. The former is composed by a R 0 transmission line closed on a set of two 2R 0 storage lines connected in parallel, while the latter is composed by a R 0 transmission line closed on a set of two R 0 /2 storage lines connected in series. The length of every storage line is half of input-pulse length. In both circuits, one storage line is characterized by an open extremity and the other line by a closed extremity. Connecting opportunely the storage lines to suitable load resistors, 4R 0 and R 0 /4, for the circuit having parallel and series connected lines, respectively, a twice of the output pulse intensity is obtained. Such devices are very suitable to generate high intensity voltage and/or current peaks which are very interesting in the field of the accelerators. Both circuit behaviours have been theoretically studied and verified by computer simulations

  15. Transmission Characteristics of an OFDM signal for Power Line Communication System with High Bit Rate (United States)

    Mori, Akira; Watanabe, Yosuke; Tokuda, Masamitsu; Kawamoto, Koji

    In this paper, we measured what influence the sinusoidal transmission characteristics of the electric power line with various forms gave to the transmission characteristic of OFDM (Orthogonal Frequency Division Multiplexing) signal through PLC (power line communication system) modem. We classified the electric power line transmission line with various forms in a real environment into two basic elements, which are an outlet type branch and a switch type branch. Next, PHY rate (Physical rate) is measured for each basic element connected with the PLC modem. At this time, the transmission characteristics of the electric power line are simulated from measured data. OFDM sending and receiving systems are composed on the computer, and the PHY rate is simulated. By comparing with measured and calculated values, it is revealed that PHY rate of PLC modem is most affected in the case of the power line transmission characteristics having broad band and high level attenuation and group delay variation, and is not affected in the case of that having narrow band attenuation and group delay variation.

  16. Transmission Lines or Poles, Electric - VOLUSIA COUNTY MAJOR POWER LINES (Arcs) (United States)

    NSGIC Local Govt | GIS Inventory — Volusia County Power Line data was aggregated by using parcel data and visual inspection of 2005 aerial photography to determine centerline of Power Lines Right of...

  17. Radiating nonuniform transmission-line systems and the partial element equivalent circuit method

    CERN Document Server

    Nitsch, Juergen; Wollenberg, Gunter


    High frequencies of densely packed modern electronic equipment turn even the smallest piece of wire into a transmission line with signal retardation, dispersion, attenuation, and distortion. In electromagnetic environments with high-power microwave or ultra-wideband sources, transmission lines pick up noise currents generated by external electromagnetic fields. These are superimposed on essential signals, the lines acting not only as receiving antennas but radiating parts of the signal energy into the environment. This book is outstanding in its originality. While many textbooks rephrase

  18. High temperature superconducting Josephson transmission lines for pulse and step sharpening

    International Nuclear Information System (INIS)

    Martens, J.S.; Wendt, J.R.; Hietala, V.M.; Ginley, D.S.; Ashby, C.I.H.; Plut, T.A.; Vawter, G.A.; Tigges, C.P.; Siegal, M.P.; Hou, S.Y.; Phillips, J.M.; Hohenwarter, G.K.G.


    An increasing number of high speed digital and other circuit applications require very narrow impulses or rapid pulse edge transitions. Shock wave transmission lines using series or shunt Josephson junctions are one way to generate these signals. Using two different high temperature superconducting Josephson junction processes (step-edge and electron beam defined nanobridges), such transmission lines have been constructed and tested at 77 K. Shock wave lines with approximately 60 YBaCuO nanobridges, have generated steps with fall times of about 10 ps. With step-edge junctions (with higher figures of merit but lower uniformity), step transition times have been reduced to an estimated 1 ps

  19. Terawatt power division and combination using self-magnetically insulated transmission lines

    International Nuclear Information System (INIS)

    Crow, J.T.; Peterson, G.D.


    Self-magnetically insulated transmission lines are necessary for the efficient transport of the terawatt pulses used in electron and ion accelerators. For some applications it is desirable to divide one transmission line into two, or to combine outputs of two or more lines into one, by means of self-magnetically insulated convolutes. Tests have been made on a coaxial-to-triaxial convolute in which connections between negative inner and outer lines are made by pins passing through holes in the intermediate positive conductor. Measurements in the 2 MV, 400 kA, 40 ns pulse Mite facility indicate virtually 100% current transport through the convolute and the ability to vary the division of current between the inner and outer lines of the triax by choice of inner line impedance. These measurements, and results obtained with this convolute connected to the ion diode for which it was designed, will be presented

  20. Data transmission through power line of smart transmitter

    International Nuclear Information System (INIS)

    Kim, Jong Hyun; Kang, Hyun Gook; Seong, Poong Hyun


    In this study, the method to use the phase shift keying (PSK) communication technique in smart transmitter is presented. In nuclear applications, smart transmitters for various parameters are expected to improve the accuracy of measurement and to reduce the load of calibration work. The capability of communication in field level is the most important merit of the smart transmitter. The most popular method is using of digital and analog techniques simultaneously - transmitting measurements from the field at 4-20mA while modulating the current to carry digital information in both directions over the same twisted pairs. Conventional smart transmitters use the frequency shift keying (FSK) method for digital communication. Generally, however, the FSK method has the speed limit at 1200 bps. Amount of information to transmit becomes increasing as the processing technique is improved. The PSK method is noticeable alternative for high speed digital communication, but it has non-zero DC component. In order to use the PSK method in the field transmission with smart transmitter, the method to remove the DC component is studied in this work

  1. Remote Control System of the TJ-II Microwave Transmission Lines Mirrors

    International Nuclear Information System (INIS)

    Lopez Sanchez, A.; Fernandez, A.; Cappa, A.; Gama, J. de la; Olivares, J.; Garcia, R.; Chamorro, M.


    The ECRH system of the TJ-II stellarator has two gyrotrons, which deliver a maximum power of 300 kW each at a frequency of 53.2 GHz. Another 28 GHz gyrotron will be used to heat the plasma by electron Bernstein waves (EBWH). The microwave power is transmitted from the gyrotrons to the vacuum chamber by two quasi-optical transmission lines for ECRH and a corrugated waveguide for EBWH. All transmission lines have an internal movable mirror inside the vacuum chamber to focus the beam and to be able to change the launching angle. The control of the beam polarization is very important and the lines have two corrugated mirrors, which actuate as polarizers. In this report the control system of the position of these three internal mirrors and the polarizers of the EBWH transmission line is described. (Author) 20 refs

  2. Advanced high-speed protection for transmission lines with different configurations

    Energy Technology Data Exchange (ETDEWEB)

    Tholomier, D.; Naisani, P. [Areva T and D Automation Canada Inc., Monteal, PQ (Canada); Apostolov, A. [Omicron Electronics, Houston, TX (United States)


    Power substations and transmission lines require intelligent (microprocessor-based) electronic devices (IED) for data acquisition, protection, metering, and control. This paper presented a universal transmission line protection relay with segregated phase differential protection as the main function and multiple backup protection functions, including 3 zone distance protection. It described features allowing the application of the IED to multi-terminal lines, mutual coupled lines, charging current compensation, transformer inrush current detection, breaker and a half and ring bus substation configurations. GPS synchronized current differential protection offers reliable protection for transmission and distribution circuits. The security of the protection relay can be improved significantly by combining it with fallback techniques to cover loss of GPS synchronizing, and by including non-differential elements as back-up during route switching and channel failures. 7 figs.

  3. Analysis of transmission lines loaded with pairs of coupled resonant elements and application to sensors

    International Nuclear Information System (INIS)

    Naqui, J.; Su, L.; Mata, J.; Martín, F.


    This paper is focused on the analysis of transmission lines loaded with pairs of magnetically coupled resonators. We have considered two different structures: (i) a microstrip line loaded with pairs of stepped impedance resonators (SIRs), and (ii) a coplanar waveguide (CPW) transmission line loaded with pairs of split ring resonators (SRRs). In both cases, the line exhibits a single resonance frequency (transmission zero) if the resonators are identical (symmetric structure with regard to the line axis), and this resonance is different to the one of the line loaded with a single resonator due to inter-resonator coupling. If the structures are asymmetric, inter-resonator coupling enhances the distance between the two split resonance frequencies that arise. In spite that the considered lines and loading resonators are very different and are described by different lumped element equivalent circuit models, the phenomenology associated to the effects of coupling is exactly the same, and the resonance frequencies are given by identical expressions. The reported lumped element circuit models of both structures are validated by comparing the circuit simulations with extracted parameters with both electromagnetic simulations and experimental data. These structures can be useful for the implementation of microwave sensors based on symmetry properties. - Highlights: • Magnetic-coupling between resonant elements affects transmission properties. • Inter-resonant coupling enhances the distance of two resonant frequencies. • The structures are useful for sensors and comparators, etc

  4. Cultural-resource survey report: Hoover Dam Powerplant Modification Project II. Associated transmission-line facility

    International Nuclear Information System (INIS)

    Queen, R.L.


    The Bureau of Reclamation (Reclamation) is proposing to modify or install additional transmission facilities between the Hoover Dam hydroelectric plant and the Western Area Power Authority substation near Boulder City, Nevada. Reclamation has completed cultural resource investigations to identify historic or prehistoric resources in the project area that might be affected during construction of the transmission line. Four possible transmission corridors approximately 50 feet wide and between 9.5 and 11.5 miles long were investigated. The proposed transmission lines either parallel or replace existing transmission lines. The corridors generally have undergone significant disturbance from past transmission line construction. A Class II sampling survey covering approximately 242 acres was conducted. Access or construction roads have not been identified and surveys of these areas will have to be completed in the future. No historic or prehistoric archeological sites were encountered within the four corridor right-of-ways. It is believed that the probability for prehistoric sites is very low. Four historic period sites were recorded that are outside, but near, the proposed corridor. These sites are not individually eligible for the National Register of Historic Places, but may be associated with the construction of Hoover Dam and contribute to a historic district or multiple property resource area focusing on the dam and its construction

  5. Marys Lake 69/115-kV transmission line upgrade and substation expansion projects

    Energy Technology Data Exchange (ETDEWEB)



    Western Area Power Administration (Western) and the Platte River Power Authority (Platte River) propose to upgrade portions of the existing electric transmission and substation system that serves the Town of Estes Park, Colorado. The existing transmission lines between the Estes Power Plant Switchyard and the Marys Lake Substation include a 115,000 volt (115-kV) line and 69,000 volt (69-kV) line. Approximately one mile is a double-circuit 115/69-kV line on steel lattice structures, and approximately two miles consists of separate single-circuit 115-kV and a 69-kV lines, constructed on wood H-Frame structures. Both lines were constructed in 1951 by the US Bureau of Reclamation. The existing transmission lines are on rights-of-way (ROW) that vary from 75 feet to 120 feet and are owned by Western. There are 48 landowners adjacent to the existing ROW. All of the houses were built adjacent to the existing ROW after the transmission lines were constructed. Upgrading the existing 69-kV transmission line between the Marys Lake Substation and the Estes Power Plant Switchyard to 115-kV and expanding the Marys Lake Substation was identified as the most effective way in which to improve electric service to Estes Park. The primary purpose and need of the proposed project is to improve the reliability of electric service to the Town of Estes Park. Lack of reliability has been a historical concern, and reliability will always be less than desired until physical improvements are made to the electrical facilities serving Estes Park.

  6. Marys Lake 69/115-kV transmission line upgrade and substation expansion projects

    International Nuclear Information System (INIS)


    Western Area Power Administration (Western) and the Platte River Power Authority (Platte River) propose to upgrade portions of the existing electric transmission and substation system that serves the Town of Estes Park, Colorado. The existing transmission lines between the Estes Power Plant Switchyard and the Marys Lake Substation include a 115,000 volt (115-kV) line and 69,000 volt (69-kV) line. Approximately one mile is a double-circuit 115/69-kV line on steel lattice structures, and approximately two miles consists of separate single-circuit 115-kV and a 69-kV lines, constructed on wood H-Frame structures. Both lines were constructed in 1951 by the US Bureau of Reclamation. The existing transmission lines are on rights-of-way (ROW) that vary from 75 feet to 120 feet and are owned by Western. There are 48 landowners adjacent to the existing ROW. All of the houses were built adjacent to the existing ROW after the transmission lines were constructed. Upgrading the existing 69-kV transmission line between the Marys Lake Substation and the Estes Power Plant Switchyard to 115-kV and expanding the Marys Lake Substation was identified as the most effective way in which to improve electric service to Estes Park. The primary purpose and need of the proposed project is to improve the reliability of electric service to the Town of Estes Park. Lack of reliability has been a historical concern, and reliability will always be less than desired until physical improvements are made to the electrical facilities serving Estes Park

  7. Manitoba Hydro long-term high-voltage transmission line magnetic field monitoring project

    International Nuclear Information System (INIS)

    Wong, P.S.; Ng, C.K.


    As part of the licensing process to construct a new 230 kV transmission line on an existing right-of-way in Manitoba, an electrical effects study was conducted in 1998. The study was part of the environmental assessment program crucial in obtaining government approval to construct the line. Some residents living adjacent to the new transmission circuit expressed concerns about alleged adverse health effects associated with long-term exposure to magnetic fields from high voltage transmission lines. In order to verify the accuracy of the predicted magnetic field levels submitted to the regulatory body in the the electrical effects study and to instill confidence in the residents of the affected communities, a three-year magnetic monitoring project was conducted between 2003 and 2005 along the right-of-way after the new 230kV transmission line was energized by Manitoba Hydro. This paper described the monitoring program, with reference to location; equipment; data analysis; and discussion of results. It was concluded that the long-term monitoring project demonstrated that the magnetic field prediction methodology was well understood and accurate, and provided valuable long-term magnetic field characteristics at the edge of the right-of-way. In addition, when there is opposition to a transmission line, public consultation and education were found to be the best options to arrive at a solution. 3 refs., 1 tab., 12 figs

  8. Tracing overhead transmission line corridors with regard to environmental and spatial qualities

    Directory of Open Access Journals (Sweden)

    Alenka Cof


    Full Text Available The article deals with possibilities for running the proposed overhead transmission line Okroglo-Italian border. The Slovene and Italian methods are shown as methods enabling consideration of environmental and spatial impact within the process of planning overhead transmission line corridors. The Slovene method consists of analyses of attractiveness and vulnerability, whereby the first considers those functional and economic factors that affect spatial attractiveness for overhead transmission lines. Thus we can assess the level of economic and functional suitability of alternative routes of the proposed 400 kilovolt overhead transmission line from transformation station Okroglo (Slovenia to Srednje, Golo Brdo and Vrtojba, three potential contact points on the Slovene–Italian border. In accordance with stipulations of the Law on spatial management vulnerability models were prepared, which were used to simulate the development’s potential negative environmental effects and to analyse suitability, which implies harmonisation of development and protection demands. Their result is a possible corridor that can be developed without significant conflicts. The Italian procedure was developed to trace the transmission line corridor from the Slovenian border to the transformation station in Udine. It was also applied on the Slovenian side. Three groups of factors were considered in the procedure: exclusion, repulsion, and attraction. The much simpler procedure enables comparisons, since it uses the same or at least similar spatial data. In conclusion a short commentary is added about the corridor concept as a planning tool.

  9. Pressure control of a pneumatic control system with a long transmission line

    International Nuclear Information System (INIS)

    Jang, Ji Seong; Lee, Kwang Kuk; Choi, Myung Soo


    In this study, a robust controller to control pressure in a pneumatic pressure vessel with a long transmission line is proposed. Frequency response of transmission line using compressible fluid is changed by the flowing state of the fluid. So, if a fixed gain controller designed based on a model supposed the flowing state to a specific state, the performance of the control system could be degraded because of the modelling error. The controller designed in this study is composed of two parts. One is a feedback controller to improve a feedback characteristics and to compensate the influence of the variation of transfer characteristics of a transmission line owing to the change of flowing state and the other is a feed forward controller to regulate command following performance. The experimental results with the designed controller show that the robustness of the control system is achieved regardless of the change of the model of the transmission line. Therefore, the designed controller can be utilized for the performance improvement of a pressure control system with a long transmission line using compressible fluid

  10. RF and microwave noise suppression in a transmission line using Fe-Si-Al/Ni-Zn magnetic composite films

    International Nuclear Information System (INIS)

    Lee, J. W.; Hong, Y. K.; Kim, K.; Joo, J.; Yoon, Y. W.; Kim, S. W.; Kim, Y. B.; Kim, K. Y.


    Radio-frequency (RF) and microwave noise suppression by using magnetic composite films on a microstrip line (MSL) was studied in the frequency range from 50 MHz to 13.5 GHz. The MSL was composed of a Cu transmission line, dielectric materials, and a Cu substrate. The Fe-Si-Al/Ni-Zn magnetic composite films were placed on the MSL, and the reflection and the transmission characteristics were investigated. We observed that RF and microwave noise suppression caused by the Fe-Si-Al/Ni-Zn magnetic composite films varied with the concentration ratio of the sendust (Fe-Si-Al) and the Ni-Zn ferrite. The frequency dependence of the power loss due to the composite films on the MSL was measured and the power loss increased at higher frequencies with increasing concentration of the sendust in the composites. The electromagnetic interference shielding efficiencies of the magnetic composite films in the far-field region are also discussed.

  11. Research on Poppers Used as Electrical Connectors in High Speed Textile Transmission Lines

    Directory of Open Access Journals (Sweden)

    Leśnikowski Jacek


    Full Text Available This paper presents results of research on poppers used as electrical connectors connecting fragments of textile signal lines. These lines can be used in intelligent clothing for connecting electronic modules implemented in it. Intelligent (smart clothing can be used, among others, in the health monitoring of the elderly, newborn babies, or people working in hazardous conditions, for example, firefighters and soldiers. The aim of the present study was to examine the usefulness of poppers, widely used in clothing, as electrical connectors connecting parts of the textile signal lines designed for transmission of high-speed digital signals. The paper presents examples of measured parameters characterizing transmission properties of two fragments of the coplanar, textile transmission line connected to each other using conventional poppers. The presented measurement results contain the so-called s parameters, characteristic impedance of the poppers, and eye measurements characterizing distortions of digital signals passing through the tested line. In the article, the effect of temperature and humidity of air surrounding the tested poppers on their characteristic impedance was also presented. This property and its stability are important in signal lines designed for high-speed data transmission.

  12. Coupling and corona effects research plan for transmission lines. Final report

    Energy Technology Data Exchange (ETDEWEB)

    Bridges, J E; Formanek, V C


    Concern has arisen over the possible effects of electric and magnetic fields produced by EHV-UHV transmission lines. Past and ongoing research concerning the electric and magnetic field effects from EHV-UHV transmission lines was reviewed as it pertains to the following areas: (1) electromagnetic interference, (2) acoustic noise, (3) generation of gaseous effluents, and (4) safety considerations of induced voltages and currents. The intent of this review was to identify the short and long range research projects required to address these areas. The research plan identifies and gives priority to twenty programs in corona and coupling effects. In the case of the corona effects, a number of programs were recommended for acoustic noise and electromagnetic interference to delineate improved power line design criteria in terms of social, meteorological, geographical and cost constraints. Only one project is recommended in the case of ozone generation, because the results of comprehensive analyses, laboratory studies and field measurements have demonstrated that power lines do not contribute significant quantities of ozone. In the case of the coupling effects, a number of programs are recommended for HVAC transmission lines to improve the theoretically developed design guidelines by considering practical constraints. For HVDC transmission lines, programs are suggested to engender a better theoretical understanding and practical measurements capability for the coupling mechanisms of the dc electric and magnetic field with nearby objects. The interrelationship of the programs and their role in a long-term research plan is also discussed.

  13. Analysis of behaviour of overhead telecommunications or electric lines illuminated by a nuclear electromagnetic pulse: limitations of use for the transmission line theory

    International Nuclear Information System (INIS)

    Scotto, M.; Jecko, B.


    The illumination of overhead lines by a nuclear electromagnetic pulse (NEMP) in presence of a perfectly conducting ground gives rise to a scattering problem leading to phenomena both studied here in time and frequency domains. This problem is resolved with the help of an integral equation established in space-time domain and making possible (without approximation) the determination of the time dependence of the current induced on each point of the wire structure. Moreover, the passage in frequency domain allows to express a transfer function defined in one point of the excited line, pointing out its spectral characteristics. Results clearly show the insufficiency of the classic transmission line theory concealing some phenomena which are described here and for which an interpretation is proposed [fr

  14. Transmission Line Analysis of the Superconducting Quadrupole Chains of the LHC Collider at CERN

    CERN Document Server

    Dahlerup-Petersen, K


    Key information for determination of fundamental design features of magnet powering and protection circuits can be retrieved from the results of transmission line calculations of the superconducting magnet chains in a particle accelerator. Modelling and simulation of the behaviour of long magnet strings provide important data for the expected electrical behaviour and performances under all operating conditions. The presented results of a transmission line study concerns the sixteen superconducting main quadrupole chains QF/QD of CERN's future LHC collider. The paper details the elaboration of the synthesized electrical model of the individual quadrupoles and the associated lumped transmission line. It presents results on the current ripple for a given converter voltage output characteristics, the magnet excitation, leakage and earth currents during the ramping procedure, the impedance resonance spectrum and the need for individual magnet damping and the propagation, reflection, superposition and damping of th...

  15. A test of a 2 Tesla superconducting transmission line magnet system

    International Nuclear Information System (INIS)

    Piekarz, Henryk; Carcagno, Ruben; Claypool, Brad; Foster, George W.; Hays, Steven L.; Huang, Yuenian; Kashikhin, Vladimir; Malamud, Ernest; Mazur, Peter O.; Nehring, Roger; Oleck, Andrew; Rabehl, Roger; Schlabach, Phil; Sylvester, Cosmore; Velev, Gueorgui; Volk, James; Wake, Masayoshi


    Superconducting transmission line magnet test system for an injector accelerator of a staged VLHC proton-proton colliding beam accelerator has been built and operated at Fermilab. The 1.5 m long, twin-aperture, combined function dipole magnet of 2 Tesla field is excited by a single turn 100 kA transmission line superconductor. The 100 kA dc current is generated using dc-dc switching converters powered by a bulk 240 kW supply. A pair of horizontally placed conventional leads facilitates transfer of this current to the magnet transmission line superconductor operating at liquid helium temperature. Fabrication of magnet components and magnet assembly work are described. The magnet test system and its operation are presented, and the performance is summarized

  16. A test of a 2 Tesla superconducting transmission line magnet system

    Energy Technology Data Exchange (ETDEWEB)

    Piekarz, Henryk; Carcagno, Ruben; Claypool, Brad; Foster, George W.; Hays, Steven L.; Huang, Yuenian; Kashikhin, Vladimir; Malamud, Ernest; Mazur, Peter O.; Nehring,; Oleck, Andrew; Rabehl, Roger; Schlabach, Phil; Sylvester, Cosmore; Velev, Gueorgui; Volk, James; /Fermilab; Wake, Masayoshi; /KEK, Tsukuba


    Superconducting transmission line magnet test system for an injector accelerator of a staged VLHC proton-proton colliding beam accelerator has been built and operated at Fermilab. The 1.5 m long, twin-aperture, combined function dipole magnet of 2 Tesla field is excited by a single turn 100 kA transmission line superconductor. The 100 kA dc current is generated using dc-dc switching converters powered by a bulk 240 kW supply. A pair of horizontally placed conventional leads facilitates transfer of this current to the magnet transmission line superconductor operating at liquid helium temperature. Fabrication of magnet components and magnet assembly work are described. The magnet test system and its operation are presented, and the performance is summarized.

  17. Experimental analysis of a TEM plane transmission line for DNA studies at 900 MHz EM fields

    International Nuclear Information System (INIS)

    Belloni, F; Doria, D; Lorusso, A; Nassisi, V; Velardi, L; Alifano, P; Monaco, C; Tala, A; Tredici, M; Raino, A


    A suitable plane transmission line was developed and its behaviour analysed at 900 MHz radiofrequency fields to study DNA mutability and the repair of micro-organisms. In this work, utilizing such a device, we investigated the behaviour of DNA mutability and repair of Escherichia coli strains. The transmission line was very simple and versatile in changing its characteristic resistance and field intensity by varying its sizes. In the absence of cell samples inside the transmission line, the relative modulation of the electric and/or magnetic field was ±31% with respect to the mean values, allowing the processing of more samples at different exposure fields in a single run. A slight decrease in spontaneous mutability to rifampicin-resistance of the E. coli JC411 strain was demonstrated in mismatch-repair proficient samples exposed to the radio-frequency fields during their growth on solid medium

  18. Development of an accurate transmission line fault locator using the global positioning system satellites (United States)

    Lee, Harry


    A highly accurate transmission line fault locator based on the traveling-wave principle was developed and successfully operated within B.C. Hydro. A transmission line fault produces a fast-risetime traveling wave at the fault point which propagates along the transmission line. This fault locator system consists of traveling wave detectors located at key substations which detect and time tag the leading edge of the fault-generated traveling wave as if passes through. A master station gathers the time-tagged information from the remote detectors and determines the location of the fault. Precise time is a key element to the success of this system. This fault locator system derives its timing from the Global Positioning System (GPS) satellites. System tests confirmed the accuracy of locating faults to within the design objective of +/-300 meters.

  19. High voltage transmission lines studies with the use of artificial intelligence

    Energy Technology Data Exchange (ETDEWEB)

    Ekonomou, L. [A.S.PE.T.E. - School of Pedagogical and Technological Education, Department of Electrical Engineering Educators, N. Heraklion, 141 21 Athens (Greece)


    The paper presents an alternative approach for the studies of high voltage transmission lines based on artificial intelligence and more specifically artificial neural networks (ANNs). In contrast to the existing conventional-analytical techniques and simulations which are using in the calculations empirical and/or approximating equations, this approach is based only on actual field data and actual measurements. The proposed approach is applied on high voltage transmission lines in order to calculate the lightning outages, on grounding systems in order to assess the grounding resistance and on high voltage transmission lines' polluted insulators in order to estimate the critical flashover voltage. The obtained results are very close to the actual ones for all three case studies, something which clearly implies that the ANN approach is well working and has an acceptable accuracy, constituting an additional tool of electric engineers. (author)

  20. Non-Linear Transmission Line (NLTL) Microwave Source Lecture Notes the United States Particle Accelerator School

    Energy Technology Data Exchange (ETDEWEB)

    Russell, Steven J. [Los Alamos National Laboratory; Carlsten, Bruce E. [Los Alamos National Laboratory


    We will quickly go through the history of the non-linear transmission lines (NLTLs). We will describe how they work, how they are modeled and how they are designed. Note that the field of high power, NLTL microwave sources is still under development, so this is just a snap shot of their current state. Topics discussed are: (1) Introduction to solitons and the KdV equation; (2) The lumped element non-linear transmission line; (3) Solution of the KdV equation; (4) Non-linear transmission lines at microwave frequencies; (5) Numerical methods for NLTL analysis; (6) Unipolar versus bipolar input; (7) High power NLTL pioneers; (8) Resistive versus reactive load; (9) Non-lineaer dielectrics; and (10) Effect of losses.

  1. Calculation of large ion densities under HVdc transmission lines by the finite difference method

    International Nuclear Information System (INIS)

    Suda, Tomotaka; Sunaga, Yoshitaka


    A calculation method for large ion densities (charged aerosols) under HVdc transmission lines was developed considering both the charging mechanism of aerosols by small ions and the drifting process by wind. Large ion densities calculated by this method agreed well with the ones measured under the Shiobara HVdc test line on the lateral profiles at ground level up to about 70m downwind from the line. Measured values decreased more quickly than calculated ones farther downwind from the line. Considering the effect of point discharge from ground cover (earth corona) improved the agreement in the farther downwind region

  2. Discrete PSO algorithm based optimization of transmission lines loading in TNEP problem

    International Nuclear Information System (INIS)

    Shayeghi, H.; Mahdavi, M.; Bagheri, A.


    Transmission network expansion planning (TNEP) is a basic part of power system planning that determines where, when and how many new transmission lines should be added to the network. Up till now, various methods have been presented to solve the static transmission network expansion planning (STNEP) problem. But in all of these methods, lines adequacy rate has not been considered at the end of planning horizon, i.e. expanded network misses adequacy after some times and needs to be expanded again. In this paper, expansion planning has been implemented by merging lines loading parameter in the STNEP and inserting investment cost into the fitness function constraints using discrete particle swarm optimization (DPSO) algorithm. Expanded network will possess a maximum adequacy to provide load demand and also the transmission lines overloaded later. The proposed idea has been tested on the Garvers network and an actual transmission network of the Azerbaijan regional electric company, Iran, and the results are compared with the decimal codification genetic algorithm (DCGA) technique. The results evaluation shows that the network will possess maximum efficiency economically. Also, it is shown that precision and convergence speed of the proposed DPSO based method for the solution of the STNEP problem is superior to DCGA approach.

  3. Implementation of the frequency dependent line model in a real-time power system simulator

    Directory of Open Access Journals (Sweden)

    Reynaldo Iracheta-Cortez


    Full Text Available In this paper is described the implementation of the frequency-dependent line model (FD-Line in a real-time digital power system simulator. The main goal with such development is to describe a general procedure to incorporate new realistic models of power system components in modern real-time simulators based on the Electromagnetic Transients Program (EMTP. In this procedure are described, firstly, the steps to obtain the time domain solution of the differential equations that models the electromagnetic behavior in multi-phase transmission lines with frequency dependent parameters. After, the algorithmic solution of the FD-Line model is implemented in Simulink environment, through an S-function programmed in C language, for running off-line simulations of electromagnetic transients. This implementation allows the free assembling of the FD Line model with any element of the Power System Blockset library and also, it can be used to build any network topology. The main advantage of having a power network built in Simulink is that can be executed in real-time by means of the commercial eMEGAsim simulator. Finally, several simulation cases are presented to validate the accuracy and the real-time performance of the FD-Line model.

  4. [Accuracy of attenuation coefficient obtained by 137Cs single-transmission scanning in PET: comparison with conventional germanium line source]. (United States)

    Matsumoto, Keiichi; Kitamura, Keishi; Mizuta, Tetsuro; Shimizu, Keiji; Murase, Kenya; Senda, Michio


    Transmission scanning can be successfully performed with a Cs-137 single-photon-emitting point source for three-dimensional PET imaging. This method was effective for postinjection transmission scanning because of differences in physical energy. However, scatter contamination in the transmission data lowers measured attenuation coefficients. The purpose of this study was to investigate the accuracy of the influence of object scattering by measuring the attenuation coefficients on the transmission images. We also compared the results with the conventional germanium line source method. Two different types of PET scanner, the SET-3000 G/X (Shimadzu Corp.) and ECAT EXACT HR(+) (Siemens/CTI) , were used. For the transmission scanning, the SET-3000 G/X and ECAT HR(+) were the Cs-137 point source and Ge-68/Ga-68 line source, respectively. With the SET-3000 G/X, we performed transmission measurement at two energy gate settings, the standard 600-800 keV as well as 500-800 keV. The energy gate setting of the ECAT HR(+) was 350-650 keV. The effects of scattering in a uniform phantom with different cross-sectional areas ranging from 201 cm(2) to 314 cm(2) to 628 cm(2) (apposition of the two 20 cm diameter phantoms) and 943 cm(2) (stacking of the three 20 cm diameter phantoms) were acquired without emission activity. First, we evaluated the attenuation coefficients of the two different types of transmission scanning using region of interest (ROI) analysis. In addition, we evaluated the attenuation coefficients with and without segmentation for Cs-137 transmission images using the same analysis. The segmentation method was a histogram-based soft-tissue segmentation process that can also be applied to reconstructed transmission images. In the Cs-137 experiment, the maximum underestimation was 3% without segmentation, which was reduced to less than 1% with segmentation at the center of the largest phantom. In the Ge-68/Ga-68 experiment, the difference in mean attenuation

  5. Accuracy of attenuation coefficient obtained by 137Cs single-transmission scanning in PET. Comparison with conventional germanium line source

    International Nuclear Information System (INIS)

    Matsumoto, Keiichi; Shimizu, Keiji; Senda, Michio; Kitamura, Keishi; Mizuta, Tetsuro; Murase, Kenya


    Transmission scanning can be successfully performed with a Cs-137 single-photon-emitting point source for three-dimensional PET imaging. This method was effective for postinjection transmission scanning because of differences in physical energy. However, scatter contamination in the transmission data lowers measured attenuation coefficients. The purpose of this study was to investigate the accuracy of the influence of object scattering by measuring the attenuation coefficients on the transmission images. We also compared the results with the conventional germanium line source method. Two different types of PET scanner, the SET-3000 G/X (Shimadzu Corp.) and ECAT EXACT HR + (Siemens/CTI), were used. For the transmission scanning, the SET-3000 G/X and ECAT HR + were the Cs-137 point source and Ge-68/Ga-68 line source, respectively. With the SET-3000 G/X, we performed transmission measurement at two energy gate settings, the standard 600-800 keV as well as 500-800 keV. The energy gate setting of the ECAT HR 2 + was 350-650 keV. The effects of scattering in a uniform phantom with different cross-sectional areas ranging from 201 cm 2 to 314 cm 2 to 628 cm 2 (apposition of the two 20 cm diameter phantoms) and 943 cm 2 (stacking of the three 20 cm diameter phantoms) were acquired without emission activity. First, we evaluated the attenuation coefficients of the two different types of transmission scanning using region of interest (ROI) analysis. In addition, we evaluated the attenuation coefficients with and without segmentation for Cs-137 transmission images using the same analysis. The segmentation method was a histogram-based soft-tissue segmentation process that can also be applied to reconstructed transmission images. In the Cs-137 experiment, the maximum underestimation was 3% without segmentation, which was reduced to less than 1% with segmentation at the center of the largest phantom. In the Ge-68/Ga-68 experiment, the difference in mean attenuation coefficients

  6. Circuit simulation of exponential transmission line for petawatt Z-pinch plasma drivers

    International Nuclear Information System (INIS)

    Zeng Zhengzhong


    It was demonstrated, based on the PSPICE circuit simulation, that the sectioning number for the circuit simulation of an exponential transmission line should be determined as twice the line's one-way electromagnetic wave transport time(electric length) divided by the wave-front of input pulse, owing to elimination of the wave reflections caused by artificial impedance discontinuity in the line's circuit simulation model, which employs a serial and sectional transmission line with impedances constant in each section but stair-step-varied between sections, and with total electric length the same as that of the exponential line under simulation. A pulse of 112.2 ns wave-front propagates through an exponential water transmission line of 1 234.2 ns one-way transport time will give the best sectioning number of 22, when the constant impedance of each section is given by the geometric mean of the two ends' impedances of the corresponding section on the exponential line under simulation. This sectioning rule is equivalent to the statement that the two-way transport time of each section should be equal to the input pulse's wave-front. (authors)

  7. Using technique vibration diagnostics for assessing the quality of power transmission line supports repairs

    Directory of Open Access Journals (Sweden)

    Cherpakov Aleksander


    Full Text Available The considered method for assessing the quality of the repair work to restore the rack supports of transmission lines is based on the method of vibration diagnostics. Power transmission line supports with a symmetrical destruction of the protective layer of concrete in the ground in violation of the construction section were chosen as an object. Finite element modelling package Ansys was used in assessing the quality of repair work. The example of evaluating the quality of repair using the relative adhesion defective area design criteria in the analysis of natural vibration frequencies is given.

  8. New schemes for high-voltage pulsed generators based on stepped transmission lines

    International Nuclear Information System (INIS)

    Bossamykin, V.S.; Gordeev, V.S.; Pavlovskii, A.I.


    Wave processes were analyzed from the point of effective energy delivery in pulsed power systems based on transmission lines. A series of new schemes for the pulsed generators based on multistage stepped transmission lines both with the capacitive and inductive energy storage was found. These devices can provide voltage or current transformation up to 5-10 times due to wave processes if stage's characteristic impedances are in a certain correlation. The schemes suggested can be widely applied in the new powerful pulsed power accelerators. The theoretical conclusions are justified experimentally

  9. Environmental impacts of power plants and transmission lines in power system planning

    International Nuclear Information System (INIS)

    Miracapillo, C.; Moreschini, G.; Rome Univ. 'La Sapienza'


    This paper deals with a criterion to assess the environmental impacts of power plants and transmission lines in power system planning. First, the effects of hydro-plants, thermal plants and transmission lines are reviewed. Then, a number of methods for the evaluation of the environmental impacts of civil and industrial plants are described. A new criterion is proposed to introduce the evaluation of the environmental impact and related costs into methods for power system planning. Finally, the criterion is applied to a simple case

  10. Transmission-line-circuit model of an 85-TW, 25-MA pulsed-power accelerator


    B. T. Hutsel; P. A. Corcoran; M. E. Cuneo; M. R. Gomez; M. H. Hess; D. D. Hinshelwood; C. A. Jennings; G. R. Laity; D. C. Lamppa; R. D. McBride; J. K. Moore; A. Myers; D. V. Rose; S. A. Slutz; W. A. Stygar


    We have developed a physics-based transmission-line-circuit model of the Z pulsed-power accelerator. The 33-m-diameter Z machine generates a peak electrical power as high as 85 TW, and delivers as much as 25 MA to a physics load. The circuit model is used to design and analyze experiments conducted on Z. The model consists of 36 networks of transmission-line-circuit elements and resistors that represent each of Zs 36 modules. The model of each module includes a Marx generator, intermediate-en...

  11. Transmission line component testing for the ITER Ion Cyclotron Heating and Current Drive System (United States)

    Goulding, Richard; Bell, G. L.; Deibele, C. E.; McCarthy, M. P.; Rasmussen, D. A.; Swain, D. W.; Barber, G. C.; Barbier, C. N.; Cambell, I. H.; Moon, R. L.; Pesavento, P. V.; Fredd, E.; Greenough, N.; Kung, C.


    High power RF testing is underway to evaluate transmission line components for the ITER Ion Cyclotron Heating and Current Drive System. The transmission line has a characteristic impedance Z0 = 50 Ω and a nominal outer diameter of 305 mm. It is specified to carry up to 6 MW at VSWR = 1.5 for 3600 s pulses, with transient voltages up to 40 kV. The transmission line is actively cooled, with turbulent gas flow (N2) used to transfer heat from the inner to outer conductor, which is water cooled. High voltage and high current testing of components has been performed using resonant lines generating steady state voltages of 35 kV and transient voltages up to 60 kV. A resonant ring, which has operated with circulating power of 6 MW for 1 hr pulses, is being used to test high power, low VSWR operation. Components tested to date include gas barriers, straight sections of various lengths, and 90 degree elbows. Designs tested include gas barriers fabricated from quartz and aluminum nitride, and transmission lines with quartz and alumina inner conductor supports. The latest results will be presented. This manuscript has been authored by UT-Battelle, LLC, under Contract No. DE-AC05-00OR22725 with the U.S. Department of Energy.

  12. Magnetically insulated transmission line used for relativistic electron beam injection into SPAC-VI

    International Nuclear Information System (INIS)

    Tsuzuki, Tetsuya; Narihara, Kazumichi; Tomita, Yukihiro; Mohri, Akihiro.


    For the purpose to inject the electron beam with energy of about 1.5 MeV and current of about 100 kA into the SPAC-6 (torus device), a magnetically insulated transmission line was designed and constructed. The motion of electrons in the line was theoretically analyzed. The requirements for the design of the transmission line were as follows-: (a) condition of magnetic insulation, (b) suppression against reverse gas flow from the beam source to the torus, (c) care to minimize the influence of strong torus magnetic field, (d) reduction of inductance and (e) safety engineering measures, e.g., separation valve in the MITL between the beam source and the SPAC-6. The transmission line of 2.4 m long was designed and constructed. The wave forms of electric potential and current were measured. The transmission efficiency of current along the axis and the efficiency as a function of current at the end of the line were also measured. The reason of the loss of current is discussed. (J.P.N.)

  13. Analysis of a malaria model with mosquito-dependent transmission ...

    Indian Academy of Sciences (India)

    model for the spread of malaria in human and mosquito population. ... tures, high humidity and water bodies allow mosquito and parasites to reproduce. The ... understand the main parameters in the transmission of the disease and to develop ...

  14. Weld-Windsor 115-kV Transmission Line Project, Weld County, Colorado

    International Nuclear Information System (INIS)


    The Western Area Power Administration is proposing to rebuild a 3.0 mile segment of the existing Flatiron-Weld 115-kV transmission line in Weld County. The line would be reconductored with new conductor on new wood pole double circuit structures. The new structures would support a double circuit transmission line configuration. The first circuit would be owned by Western and the second by Public Service Company of Colorado (PSCO). Alternatives considered included no action, constructing PSCO's circuit on new right-of-way, and reconductoring Western's existing line on the same structures. The proposed action was selected because it provided an opportunity to share structures with PSCO and, overall, would minimize costs and environmental impacts. The environmental assessment identifies minor effects on existing natural or human resources and minor benefits for agricultural operations

  15. Method of selecting optimum cross arm lengths for a 750 kV transmission line

    Energy Technology Data Exchange (ETDEWEB)

    Aleksandrov, G N; Olorokov, V P


    A method is presented, based on both technical and economic considerations, for selecting cross arm lengths for intermediate poles of power transmission lines according to the effects of internal overvoltage, methods from probability theory and mathematical statistics employed. The problem of optimum pole size is considered in terms of the effect of internal overvoltages for a prescribed maximum level of 2.1 PU currently used in the USSR for the design of 750 kV lines.

  16. Temperature dependence of dynamical permeability characterization of magnetic thin films using shorted microstrip line probe

    International Nuclear Information System (INIS)

    Li, Xiling; Li, Chengyi; Chai, Guozhi


    A temperature dependence microwave permeability characterization system of magnetic thin film up to 10 GHz is designed and fabricated. This system can be used at temperatures ranging from room temperature to 200 °C, and is based on a shorted microstrip probe, which is made by microwave printed circuit board. Without contacting the magnetic thin films to the probe, the microwave permeability of the film can be detected without any limitations of sample size and with almost the same accuracy, as shown by comparison with the results obtained from a shorted microstrip transmission-line fixture. The complex permeability can be deduced by an analytical approach from the measured reflection coefficient of a strip line ( S 11 ) with and without a ferromagnetic film material on it. The procedures are the same with the shorted microstrip transmission-line method. The microwave permeability of an oblique deposited CoZr thin film was investigated with this probe. The results show that the room temperature dynamic permeability of the CoZr film is in good agreement with the results obtained from the established short-circuited microstrip perturbation method. The temperature dependence permeability results fit well with the Landau–Lifshitz–Gilbert equation. Development of the temperature-dependent measurement of the magnetic properties of magnetic thin film may be useful for the high-frequency application of magnetic devices at high temperatures. (paper)

  17. The 12th 735-kV transmission line project: Hydro-Quebec network

    International Nuclear Information System (INIS)


    Hydro-Quebec is proposing to construct a 735-kV transmission line from the Chissibi station near the LG3 hydroelectric power plant to the Jacques-Cartier station near Quebec City. The width of the right-of-way will generally be 90 m and it is intended to install the line in two stages. The Chissibi-Chibougamau section should enter service in 1993 and the Chibougamau-Cartier section in 1994. The cost of the line is estimated at $1.21 billion, of which $900 million is for line construction and $310 million for station equipment. Prospective corridors for the line route have been selected, portions of which enable twinning with Hydro-Quebec's existing 9th 735-kV line. A series of hearings on the environmental and other impacts of the power line project was held by the Bureau d'audiences publiques sur l'environnement and results are summarized along with the views of the Bureau. The summary describes the justification for the project, the choice of the transmission line route, the evaluation of the impacts of the project on the natural and human environments, health effects due to magnetic fields, and effects on the economic development of northern Quebec. Recommendations are given for mitigating the impacts of the project. 13 refs., 8 figs., 2 tabs

  18. Canby Area Service Project substation and associated transmission line. Environmental Assessment

    Energy Technology Data Exchange (ETDEWEB)


    Bonneville Power Administration (BPA) provides power to Surprise Valley Electrification Corporation (SVEC) in Modoc County, California. BPA uses PacificCorp`s substation and transmission facilities between Alturas and Canby, California to transfer power to SVEC`s Canby Substation. In the next year, SVEC expects increased industrial, agricultural, and residential electric loads on their 69-kV transmission system south of Canby. SVEC`s substation can accommodate only about 10 percent of the expected additional electric load. BPA`s proposed action is intended to meet SVEC`s increasing electric load. BPA proposes to meet SVEC`s increasing energy load by tapping into BPA`s existing BPA Malin-Warner 230-kV transmission line, and building an 7.9-mile transmission line to a new BPA substation. BPA proposes to build the new substation next to the west side of SVEC`s Canby Substation (Figure 1). This new substation will allow SVEC to move the additional power over their existing transmission or distribution lines. This report is the environmental assessment of the potential impact of the proposed project. The assessment determined that no ``environmental impact statement`` is not required.

  19. Canby Area Service Project : Substation and Associated Transmission Line : Environmental Assessment.

    Energy Technology Data Exchange (ETDEWEB)

    United States. Bonneville Power Administration.


    Bonneville Power Administration (BPA) provides power to Surprise Valley Electrification Corporation (SVEC) in Modoc County, California. BPA uses PacificCorp's substation and transmission facilities between Alturas and Canby, California to transfer power to SVEC's Canby Substation. In the next year, SVEC expects increased industrial, agricultural, and residential electric loads on their 69-kV transmission system south of Canby. SVEC's substation can accommodate only about 10 percent of the expected additional electric load. BPA's proposed action is intended to meet SVEC's increasing electric load. BPA proposes to meet SVEC's increasing energy load by tapping into BPA's existing BPA Malin-Warner 230-kV transmission line, and building an 7.9-mile transmission line to a new BPA substation. BPA proposes to build the new substation next to the west side of SVEC's Canby Substation (Figure 1). This new substation will allow SVEC to move the additional power over their existing transmission or distribution lines. This report is the environmental assessment of the potential impact of the proposed project. The assessment determined that no environmental impact statement'' is not required.

  20. Sound Transmission Through Multi-Panel Structures Lined with Elastic Porous Materials (United States)

    Bolton, J. S.; Shiau, N.-M.; Kang, Y. J.


    Theory and measurements related to sound transmission through double panels lined with elastic porous media are presented. The information has application to the design of noise control barriers and to the optimization of aircraft fuselage transmission loss, for example. The major difference between the work described here and earlier research in this field relates to the treatment of the porous material that is used to line the cavity between the two panels of the double panel structure. Here we have used the porous material theory proposed by Biot since it takes explicit account of all the wave types known to propagate in elastic porous materials. As a result, it is possible to use the theory presented here to calculate the transmission loss of lined double panels at arbitrary angles of incidence; results calculated over a range of incidence angles may then be combined to yield the random incidence transmission loss. In this paper, the equations governing wave propagation in an elastic porous material are first considered briefly and then the general forms for the stresses and displacements within the porous material are given. Those solutions are expressed in terms of a number of constants that can be determined by application of appropriate boundary conditions. The boundary conditions required to model double panels having linings that are either directly attached to the facing panels or separated?!from them by air gaps are presented and discussed. Measurements of the random incidence transmission loss of aluminium double-panel structures lined with polyurethane foam are presented and have been found to be in good agreement with theoretical predictions. Both the theoretical predictions and the measured results have shown that the method by which an elastic porous lining material is attached to the facing panels can have a profound influence on the transmission loss of the panel system. It has been found, for example, that treatments in which the lining material

  1. Measuring the complex permittivity tensor of uniaxial biological materials with coplanar waveguide transmission line (United States)

    A simple and accurate technique is described for measuring the uniaxial permittivity tensor of biological materials with a coplanar waveguide transmission-line configuration. Permittivity tensor results are presented for several chicken and beef fresh meat samples at 2.45 GHz....

  2. Design of the ITER Electron Cyclotron Heating and Current Drive Waveguide Transmission Line (United States)

    Bigelow, T. S.; Rasmussen, D. A.; Shapiro, M. A.; Sirigiri, J. R.; Temkin, R. J.; Grunloh, H.; Koliner, J.


    The ITER ECH transmission line system is designed to deliver the power, from twenty-four 1 MW 170 GHz gyrotrons and three 1 MW 127.5 GHz gyrotrons, to the equatorial and upper launchers. The performance requirements, initial design of components and layout between the gyrotrons and the launchers is underway. Similar 63.5 mm ID corrugated waveguide systems have been built and installed on several fusion experiments; however, none have operated at the high frequency and long-pulse required for ITER. Prototype components are being tested at low power to estimate ohmic and mode conversion losses. In order to develop and qualify the ITER components prior to procurement of the full set of 24 transmission lines, a 170 GHz high power test of a complete prototype transmission line is planned. Testing of the transmission line at 1-2 MW can be performed with a modest power (˜0.5 MW) tube with a low loss (10-20%) resonant ring configuration. A 140 GHz long pulse, 400 kW gyrotron will be used in the initial tests and a 170 GHz gyrotron will be used when it becomes available. Oak Ridge National Laboratory, managed by UT-Battelle, LLC, for the U.S. Dept. of Energy under contract DE-AC05-00OR22725.

  3. Optical modeling of fiber organic photovoltaic structures using a transmission line method. (United States)

    Moshonas, N; Stathopoulos, N A; O'Connor, B T; Bedeloglu, A Celik; Savaidis, S P; Vasiliadis, S


    An optical model has been developed and evaluated for the calculation of the external quantum efficiency of cylindrical fiber photovoltaic structures. The model is based on the transmission line theory and has been applied on single and bulk heterojunction fiber-photovoltaic cells. Using this model, optimum design characteristics have been proposed for both configurations, and comparison with experimental results has been assessed.

  4. Multiwavelet packet entropy and its application in transmission line fault recognition and classification. (United States)

    Liu, Zhigang; Han, Zhiwei; Zhang, Yang; Zhang, Qiaoge


    Multiwavelets possess better properties than traditional wavelets. Multiwavelet packet transformation has more high-frequency information. Spectral entropy can be applied as an analysis index to the complexity or uncertainty of a signal. This paper tries to define four multiwavelet packet entropies to extract the features of different transmission line faults, and uses a radial basis function (RBF) neural network to recognize and classify 10 fault types of power transmission lines. First, the preprocessing and postprocessing problems of multiwavelets are presented. Shannon entropy and Tsallis entropy are introduced, and their difference is discussed. Second, multiwavelet packet energy entropy, time entropy, Shannon singular entropy, and Tsallis singular entropy are defined as the feature extraction methods of transmission line fault signals. Third, the plan of transmission line fault recognition using multiwavelet packet entropies and an RBF neural network is proposed. Finally, the experimental results show that the plan with the four multiwavelet packet energy entropies defined in this paper achieves better performance in fault recognition. The performance with SA4 (symmetric antisymmetric) multiwavelet packet Tsallis singular entropy is the best among the combinations of different multiwavelet packets and the four multiwavelet packet entropies.

  5. Full Scale Experimental Study on the Air Insulation of 765kV Transmission Lines

    Energy Technology Data Exchange (ETDEWEB)

    Kim, Jong Boo; Shin, Jeong Woon; Cho, Sung Bae; Chang, Sung Chil; Kwak, Joo Shik [Korea Electric Power Research Institute, Taejon (Korea, Republic of); Kim, Ik Soo; Lee, Heyoung Ho; Kang, Young Sik; Lee, Hong Sik; Choi, Beyoung Joo; Kim, Young Bae [Korea Electrotechnology Research Institute, Changwon (Korea, Republic of)


    Design and construction of testing yard. Technical specification of impulse voltage generator which was installed in testing yard. Corrosion and statistical analysis of test data. Test object setup and test results of flashover characteristic in various paths. Recommended optimum air clearance of 765kV transmission lines. (author). 163 refs., figs.

  6. Lightning Protection Performance Assessment of Transmission Line Based on ATP model Automatic Generation

    Directory of Open Access Journals (Sweden)

    Luo Hanwu


    Full Text Available This paper presents a novel method to solve the initial lightning breakdown current by combing ATP and MATLAB simulation software effectively, with the aims to evaluate the lightning protection performance of transmission line. Firstly, the executable ATP simulation model is generated automatically according to the required information such as power source parameters, tower parameters, overhead line parameters, grounding resistance and lightning current parameters, etc. through an interface program coded by MATLAB. Then, the data are extracted from the generated LIS files which can be obtained by executing the ATP simulation model, the occurrence of transmission lie breakdown can be determined by the relative data in LIS file. The lightning current amplitude should be reduced when the breakdown occurs, and vice the verse. Thus the initial lightning breakdown current of a transmission line with given parameters can be determined accurately by continuously changing the lightning current amplitude, which is realized by a loop computing algorithm that is coded by MATLAB software. The method proposed in this paper can generate the ATP simulation program automatically, and facilitates the lightning protection performance assessment of transmission line.

  7. Lagrangian and Hamiltonian Formulation of Transmission Line Systems with Boundary Energy Flow

    NARCIS (Netherlands)

    Jeltsema, Dimitri; Schaft, Arjan J. van der

    The classical Lagrangian and Hamiltonian formulation of an electrical transmission line is reviewed and extended to allow for varying boundary conditions, The method is based on the definition of an infinite-dimensional analogue of the affine Lagrangian and Hamiltonian input-output systems

  8. Fuzzy-Wavelet Based Double Line Transmission System Protection Scheme in the Presence of SVC (United States)

    Goli, Ravikumar; Shaik, Abdul Gafoor; Tulasi Ram, Sankara S.


    Increasing the power transfer capability and efficient utilization of available transmission lines, improving the power system controllability and stability, power oscillation damping and voltage compensation have made strides and created Flexible AC Transmission (FACTS) devices in recent decades. Shunt FACTS devices can have adverse effects on distance protection both in steady state and transient periods. Severe under reaching is the most important problem of relay which is caused by current injection at the point of connection to the system. Current absorption of compensator leads to overreach of relay. This work presents an efficient method based on wavelet transforms, fault detection, classification and location using Fuzzy logic technique which is almost independent of fault impedance, fault distance and fault inception angle. The proposed protection scheme is found to be fast, reliable and accurate for various types of faults on transmission lines with and without Static Var compensator at different locations and with various incidence angles.

  9. Transmission Line Ampacity Improvements of AltaLink Wind Plant Overhead Tie-Lines Using Weather-Based Dynamic Line Rating

    Energy Technology Data Exchange (ETDEWEB)

    Bhattarai, Bishnu P.; Gentle, Jake P.; Hill, Porter; McJunkin, Tim; Myers, Kurt S.; Abbound, Alex; Renwick, Rodger; Hengst, David


    Abstract—Overhead transmission lines (TLs) are conventionally given seasonal ratings based on conservative environmental assumptions. Such an approach often results in underutilization of the line ampacity as the worst conditions prevail only for a short period over a year/season. We presents dynamic line rating (DLR) as an enabling smart grid technology that adaptively computes ratings of TLs based on local weather conditions to utilize additional headroom of existing lines. In particular, general line ampacity state solver utilizes measured weather data for computing the real-time thermal rating of the TLs. The performance of the presented method is demonstrated from a field study of DLR technology implementation on four TL segments at AltaLink, Canada. The performance is evaluated and quantified by comparing the existing static and proposed dynamic line ratings, and the potential benefits of DLR for enhanced transmission assets utilization. For the given line segments, the proposed DLR results in real-time ratings above the seasonal static ratings for most of the time; up to 95.1% of the time, with a mean increase of 72% over static rating.

  10. Progress on corrugated waveguide components suitable for ITER ECH&CD transmission lines

    Directory of Open Access Journals (Sweden)

    Murphy C.J.


    Full Text Available The 2 MW cw requirement for ITER EC transmission lines has led GA to design a number of new and modified components, namely power monitors and polarizers to meet this requirement. In addition, the ITER transmission lines may require sliding joints or bellows to accommodate the thermal expansion of the lines and/or vessel motion. The ex-vessel sections of the EC launchers require double seal waveguides, miter bends and possibly double seal sliding joints to assure tritium retention in this region. GA has developed designs for many of these components and some of them have already been tested at high power at the JAEA RF Test Stand. Thermal analyses of the standard GA power monitor miter bend show that our standard design is suitable for 1 MW cw operation when the H-field is in the plane of the miter bend. For 2 MW cw operation a modified design, which also requires H-plane orientation, has been developed and a prototype has been fabricated and is ready for testing. For long pulse/cw operation, a 2 MW calorimetric miter bend with thermally isolated mirror has been designed and a prototype has been fabricated. Since the mirror is thermally isolated, calorimetry on the mirror cooling water can provide a measure of absorbed power. Such a miter bend, when made in a double seal version, could be useful for monitoring total power at the end of an EC transmission line just before the in-vessel section of an EC launcher. A mode analyzer using an all metal water-cooled beam splitter is being developed for use in measuring in real time the HE11 and higher order mode content or total power in EC transmission lines. Such a high power diagnostic can be very useful in optimizing the alignment of the MOU output into a transmission line and in monitoring the HE11 mode purity at various locations in a transmission line. Prior to making a 63.5 mm 170 GHz version suitable for use on ITER, several prototype 31.75 mm 110 GHz versions have been fabricated and tested at

  11. Visual impact of overhead power transmission lines and dielectric and corona effects constraints on insulation coordination

    International Nuclear Information System (INIS)

    Deponti, F.; Fini, G.P.; Porrino, A.; Rosa, F.


    In assessing overhead power transmission line design and planning criteria for the optimization of visual impact, safety and the reduction of electro magnetic disturbance effects, this paper reviews the research findings of ENEL, the Italian Electricity Board. The on-going research activities involve theoretical calculations and laboratory performance tests to determine the best compact configurations for 380 kV lines. The parameters under examination include: insulator spacing, sizing and salt fog resistivity; allowable overvoltages; maximum line length; behaviour in lightning conditions; radio and acoustics disturbances

  12. Sidney-North Yuma 230-kV Transmission Line Project, Colorado and Nebraska

    Energy Technology Data Exchange (ETDEWEB)


    This report describes the need for a 230-kV overhead transmission line to supply power from Sidney, Nebraska to eastern Colorado. The alternative scenario compared to construction of the line is No Action. Rejected alternatives include underground lines and different routing paths, with a possible extension to the Sterling area. Both scenarios are evaluated for environmental effects, cost, and consequences for the eastern Colorado region. The proposed route is determined to be the environmentally preferred choice. 120 refs., 6 figs., 13 tabs. (MHB)

  13. Broadband Impedance Transformer Based on Asymmetric Coupled Transmission Lines in Nonhomogeneous Medium

    DEFF Research Database (Denmark)

    Zhurbenko, Vitaliy; Krozer, Viktor; Meincke, Peter


    A new broadband quarter-wavelength impedance transformer based on an asymmetric coupled line section is presented. The bandwidth of the coupled line transformer is extended with the help of an interconnecting transmission line. An analytical model for the transformer is developed. The analysis...... of the structure reveals that a fractional bandwidth of more than 100% at –20 dB reflection level can be achieved with such a structure. An experimental transformer circuit has been designed, fabricated and tested. Theoretical and experimental results are fair agreement and confirm the established theory...

  14. Analysis of a Malaria Model with Mosquito-Dependent Transmission ...

    Indian Academy of Sciences (India)

    In this paper, we discuss an ordinary differential equation mathematical model for the spread of malaria in human and mosquito population. We suppose the human population to act as a reservoir. Both the species follow a logistic population model. The transmission coefficient or the interaction coefficient of humans is ...

  15. Phase transitions in transmission lines with long-range fluctuating correlated disorder

    International Nuclear Information System (INIS)

    Lazo, E.; Diez, E.


    In this work we study the localization properties of the disordered classical dual transmission lines, when the values of capacitances {C j } and inductances {L j } fluctuate in phase in the form C j =C 0 +bsin(2πx j ) and L j =L 0 +bsin(2πx j ), where b is the fluctuation amplitude. {x j } is a disordered long-range correlated sequence obtained using the Fourier filtering method which depends on the correlation exponent α. To obtain the transition point in the thermodynamic limit, we study the critical behavior of the participation number D. To do so, we calculate the linear relationship between ln(D) versus ln(N), the relative fluctuation η D and the Binder cumulant B D . The critical value obtained with these three methods is totally coincident between them. In addition, we calculate the critical behavior of the normalized localization length Λ(b) as a function of the system size N. With these data we build the phase diagram (b,α), which separates the extended states from the localized states. A final result of our work is the disappearance of the conduction bands when we introduce a finite number of impurities in random sites. This process can serve as a mechanism of secure communication, since a little alteration of the original sequence of capacitances and inductances, can destroy the band of extended states

  16. Transmission line transformer for reliable and low-jitter triggering of a railgap switch. (United States)

    Verma, Rishi; Mishra, Ekansh; Sagar, Karuna; Meena, Manraj; Shyam, Anurag


    The performance of railgap switch critically relies upon multichannel breakdown between the extended electrodes (rails) in order to ensure distributed current transfer along electrode length and to minimize the switch inductance. The initiation of several simultaneous arc channels along the switch length depends on the gap triggering technique and on the rate at which the electric field changes within the gap. This paper presents design, construction, and output characteristics of a coaxial cable based three-stage transmission line transformer (TLT) that is capable of initiating multichannel breakdown in a high voltage, low inductance railgap switch. In each stage three identical lengths of URM67 coaxial cables have been used in parallel and they have been wounded in separate cassettes to enhance the isolation of the output of transformer from the input. The cascaded output impedance of TLT is ~50 Ω. Along with multi-channel formation over the complete length of electrode rails, significant reduction in jitter (≤2 ns) and conduction delay (≤60 ns) has been observed by the realization of large amplitude (~80 kV), high dV/dt (~6 kV/ns) pulse produced by the indigenously developed TLT based trigger generator. The superior performance of TLT over conventional pulse transformer for railgap triggering application has been compared and demonstrated experimentally.

  17. Rolled-up transmission line structure for a radiofrequency integrated circuit (RFIC) (United States)

    Li, Xiuling; Huang, Wen


    A rolled-up transmission line structure for a radiofrequency integrated circuit (RFIC) comprises a multilayer sheet in a rolled configuration comprising multiple turns about a longitudinal axis, where the multilayer sheet comprises a conductive pattern layer on a strain-relieved layer. The conductive pattern layer comprises a first conductive film and a second conductive film separated from the first conductive film in a rolling direction. In the rolled configuration, the first conductive film surrounds the longitudinal axis, and the second conductive film surrounds the first conductive film. The first conductive film serves as a signal line and the second conductive film serves as a conductive shield for the rolled-up transmission line structure.

  18. Comparative study of aerial transmission lines and underground isolated on gas

    International Nuclear Information System (INIS)

    Quesada Jimenez, Marco Esteban


    A comparison was made of aerial power lines and underground isolated on gas. Growing electric demand has given way to debate the lines transmission. Multiple discussions have generated about its application, however, the energy must be supplied and this process leads to the search for more efficient methods. The theory has covered the most important design criteria of the airlines and an introduction to the little known transport lines isolated on gas. The process of manufacturing, installation and operation are studied within the scope of the project. Count information is included in the main aspects of calculation relating to power transmission. Besides, the planning of the optimal route nominal calculations, load flow and power losses are focused as well as magnetic field strengths and finally economic analysis. (author) [es

  19. Microscopic simulation model of superconducting transmission lines for standard microwave CAD programs

    International Nuclear Information System (INIS)

    Hoefer, G.J.; Kratz, H.A.


    Superconducting lines are very promising candidates for fast signal transmission in integrated circuits, because of their low losses and dispersion, which result in large usable bandwidths. Coplanar waveguides are of special interest, since only one superconducting layer is needed for their implementation. This requirement fits well the present day capabilities of the high temperature superconductor technology. At present, the major drawback of this type of transmission line is the lack of accurate and fast CAD models including the special properties of superconducting electrodes. In the following we will briefly describe the essentials of a model for the case of superconducting lines. For a complete description the reader is referenced to. The model has been proven to be useful in conjunction with commercially available microwave CAD programs. (orig.)

  20. A Pilot Directional Protection for HVDC Transmission Line Based on Relative Entropy of Wavelet Energy

    Directory of Open Access Journals (Sweden)

    Sheng Lin


    Full Text Available On the basis of analyzing high-voltage direct current (HVDC transmission system and its fault superimposed circuit, the direction of the fault components of the voltage and the current measured at one end of transmission line is certified to be different for internal faults and external faults. As an estimate of the differences between two signals, relative entropy is an effective parameter for recognizing transient signals in HVDC transmission lines. In this paper, the relative entropy of wavelet energy is applied to distinguish internal fault from external fault. For internal faults, the directions of fault components of voltage and current are opposite at the two ends of the transmission line, indicating a huge difference of wavelet energy relative entropy; for external faults, the directions are identical, indicating a small difference. The simulation results based on PSCAD/EMTDC show that the proposed pilot protection system acts accurately for faults under different conditions, and its performance is not affected by fault type, fault location, fault resistance and noise.

  1. Application of reliability based design concepts to transmission line structure foundations. Part 2

    International Nuclear Information System (INIS)

    DiGioia, A.M. Jr.; Rojas-Gonzalez, L.F.


    The application of reliability based design (RBD) methods to transmission line structure foundations has developed somewhat more slowly than that for the other structural components in line systems. In a previous paper, a procedure was proposed for the design of transmission line structures foundations using a probability based load and resistance factor design (LRFD) format. This procedure involved the determination of a foundation strength factor, φ F , which was used as a multiplier of the calculated nominal design strength to estimate the five percent exclusion limit strength required in the calculated nominal design strength to estimate the five percent exclusion limit strength required in the LRFD equation. Statistical analyses of results from full-scale load tests were used to obtain φ F values applicable to various nominal design strength equations and for drilled shafts subjected to uplift loads. These results clearly illustrated the significant economic benefits of conducting more detailed subsurface investigations for the design of transmission line structure foundations. A design example was also presented. In this paper the proposed procedure is extended to laterally load drilled shafts

  2. Location of Faults in Power Transmission Lines Using the ARIMA Method

    Directory of Open Access Journals (Sweden)

    Danilo Pinto Moreira de Souza


    Full Text Available One of the major problems in transmission lines is the occurrence of failures that affect the quality of the electric power supplied, as the exact localization of the fault must be known for correction. In order to streamline the work of maintenance teams and standardize services, this paper proposes a method of locating faults in power transmission lines by analyzing the voltage oscillographic signals extracted at the line monitoring terminals. The developed method relates time series models obtained specifically for each failure pattern. The parameters of the autoregressive integrated moving average (ARIMA model are estimated in order to adjust the voltage curves and calculate the distance from the initial fault localization to the terminals. Simulations of the failures are performed through the ATPDraw ® (5.5 software and the analyses were completed using the RStudio ® (1.0.143 software. The results obtained with respect to the failures, which did not involve earth return, were satisfactory when compared with widely used techniques in the literature, particularly when the fault distance became larger in relation to the beginning of the transmission line.

  3. Experimental study of the Fermi–Pasta–Ulam recurrence in a bi-modal electrical transmission line

    International Nuclear Information System (INIS)

    Farota, Abdou K; Faye, Mansour M


    We report on the experimental observation of the Fermi–Pasta–Ulam (FPU) recurrence in an experimental bi-modal nonlinear transmission line. The FPU recurrence is observed in the two transmission modes known as the low frequency mode and the high frequency mode. In each case, a spectrum analysis is performed in order to study the waves along the line. (paper)

  4. Long-Haul Dense Space Division Multiplexed Transmission over Low-Crosstalk Heterogeneous 32-Core Transmission Line Using Partial Recirculating Loop System

    DEFF Research Database (Denmark)

    Mizuno, Takayuki; Shibahara, Kohki; Ye, Feihong


    In this paper, we present long-haul 32-core dense space division multiplexed (DSDM) unidirectional transmission over a single-mode multicore transmission line. We developed a low-crosstalk heterogeneous 32-core fiber with a square lattice arrangement, and a novel partial recirculating loop system...

  5. Quasi-Optical Transmission Lines for ECRH on TJ-II Stellarator

    International Nuclear Information System (INIS)

    Fernandez, A.; Likin, K.; Martin, R.; Cappa, A.; Cepero, J.R.


    Two mirror lines are used to transmit ht microwave power from the powerful microwave generators to the TJ-II plasmas. Both lines have been tested at nominal power level and they are now in operation. This paper is devoted to the final design of the transmission lines and their testing. Before starting operation at high power level measurements of the wave beam parameters at low power level were made. Two horn antennae were designed to simulate the gyrotron output. Numerical simulations of the far field radiation pattern of the antennae were made, a computer code based on Huygens diffraction theory was developed to simulate the propagation of the beam along a mirror line. A comparison of the theoretical and the experimental results is also presented here. (Author)

  6. Environmental Assessment of the Gering-Stegall 115-kV Transmission Line Consolidation Project, Scotts Bluff County, Nebraska

    Energy Technology Data Exchange (ETDEWEB)



    The Department of Energy (DOE), Western Area Power Administration (Western) proposes to consolidate segments of two transmission lines near the Gering Substation in Gering, Nebraska. The transmission lines are both located in Scotts Bluff County, Nebraska. The transmission lines are both located in Scotts Bluff County, Nebraska, within the city of Gering. Presently, there are three parallel 115-kilovolt (kV) transmission lines on separate rights-of-way (ROW) that terminate at the Gering Substation. The project would include dismantling the Archer-Gering wood-pole transmission line and rebuilding the remaining two lines on single-pole steel double circuit structures. The project would consolidate the Gering-Stegall North and Gering-Stegall South 115-kV transmission lines on to one ROW for a 1.33-mile segment between the Gering Substation and a point west of the Gering Landfill. All existing wood-pole H-frame structures would be removed, and the Gering-Stegall North and South ROWs abandoned. Western is responsible for the design, construction, operation, and maintenance of the line. Western prepared an environmental assessment (EA) that analyzed the potential environmental impacts of the proposed construction, operation, and maintenance of the 115-kV transmission line consolidation. Based on the analyses in the EA, the DOE finds that the proposed action is not a major Federal action significantly affecting the quality of the human environment, within the meaning of the National Environmental Policy Act of 1969 (NEPA).

  7. Environmental Assessment of the Gering-Stegall 115-kV Transmission Line Consolidation Project, Scotts Bluff County, Nebraska

    International Nuclear Information System (INIS)


    The Department of Energy (DOE), Western Area Power Administration (Western) proposes to consolidate segments of two transmission lines near the Gering Substation in Gering, Nebraska. The transmission lines are both located in Scotts Bluff County, Nebraska. The transmission lines are both located in Scotts Bluff County, Nebraska, within the city of Gering. Presently, there are three parallel 115-kilovolt (kV) transmission lines on separate rights-of-way (ROW) that terminate at the Gering Substation. The project would include dismantling the Archer-Gering wood-pole transmission line and rebuilding the remaining two lines on single-pole steel double circuit structures. The project would consolidate the Gering-Stegall North and Gering-Stegall South 115-kV transmission lines on to one ROW for a 1.33-mile segment between the Gering Substation and a point west of the Gering Landfill. All existing wood-pole H-frame structures would be removed, and the Gering-Stegall North and South ROWs abandoned. Western is responsible for the design, construction, operation, and maintenance of the line. Western prepared an environmental assessment (EA) that analyzed the potential environmental impacts of the proposed construction, operation, and maintenance of the 115-kV transmission line consolidation. Based on the analyses in the EA, the DOE finds that the proposed action is not a major Federal action significantly affecting the quality of the human environment, within the meaning of the National Environmental Policy Act of 1969 (NEPA)

  8. Stress Analysis of Boom of Special Mobile Crane for Plain Region in Transmission Line (United States)

    Qin, Jian; Shao, Tao; Chen, Jun; Wan, Jiancheng; Li, Zhonghuan; Jiang, Ming


    Basis of the boom force analysis of special mobile crane for plain region in transmission line, the load type of boom design is confirmed. According to the different combinations of boom sections, the composite pattern of the different boom length is obtained to suit the actual conditions of boom overlapping. The large deformation model is employed with FEM to simulate the stress distribution of boom, and the calculation results are checked. The performance curves of rated load with different arm length and different working range are obtained, which ensures the lifting capacity of special mobile crane meeting the requirement of tower erection of transmission line. The proposed FEM of boom of mobile crane would provide certain guiding and reference to the boom design.

  9. On-line nuclear ash gauge for coal based on gamma-ray transmission techniques

    International Nuclear Information System (INIS)

    Rizk, R.A.M.; El-Kateb, A.H.; Abdul-Kader, A.M.


    Developments and applications of on-line nuclear gauges in the coal industry are highly requested. A nuclear ash gauge for coal, based on γ-ray transmission techniques is developed. Single and dual energy γ-ray beams are used to determine the ash content of coal. The percentage ash content as a function of the γ-ray intensities transmitted through coal samples is measured and sensitivity curves are obtained. An empirical formulation relating the ash content values to the γ-ray intensities is derived. Preliminary results show that both single and dual energy γ-ray transmission techniques can be used to give a rapid on-line estimation of the ash concentration values in coal with low cost and reasonable accuracy, but the dual one is much preferable. (author)

  10. Conducting properties of classical transmission lines with Ornstein-Uhlenbeck type disorder

    International Nuclear Information System (INIS)

    Lazo, E.; Diez, E.


    In this work we study the behavior of bands of extended states and localized states which appear in classical disordered electrical transmission lines, when we use a ternary map and the Ornstein-Uhlenbeck process to generate the long-range correlated disorder, instead of using the Fourier filtering method. By performing finite-size scaling we obtain the asymptotic value of the map parameter b in the thermodynamic limit in a selected range of values of the parameters γ and C of the Ornstein-Uhlenbeck process. With these data we obtain the phase diagrams which separate the localized states from the extended states. These are the fundamental results of this article. - Highlights: → We study disordered classical transmission lines. → We use the Ornstein-Uhlenbeck process to generate long-range correlated disorder. → We obtain the phase diagram of the transition in the thermodynamic limit.

  11. Broadband microwave frequency doubler based on left-handed nonlinear transmission lines

    International Nuclear Information System (INIS)

    Huang Jie; Gu Wenwen; Zhao Qian


    A bandwidth microwave second harmonic generator is successfully designed using composite right/left-handed nonlinear transmission lines (CRLH NLTLs) in a GaAs monolithic microwave integrated circuit (MMIC) technology. The structure parameters of CRLH NLTLs, e.g. host transmission line, rectangular spiral inductor, and nonlinear capacitor, have a great impact on the second harmonic performance enhancement in terms of second harmonic frequency, output power, and conversion efficiency. It has been experimentally demonstrated that the second harmonic frequency is determined by the anomalous dispersion of CRLH NLTLs and can be significantly improved by effectively adjusting these structure parameters. A good agreement between the measured and simulated second harmonic performances of Ka-band CRLH NLTLs frequency multipliers is successfully achieved, which further validates the design approach of frequency multipliers on CRLH NLTLs and indicates the potentials of CRLH NLTLs in terms of the generation of microwave and millimeter-wave signal source. (paper)

  12. Effect of kicker circuit inductance on the transmission-line discharging

    International Nuclear Information System (INIS)

    Feng Deren; Wang Xiangqi; Shang Lei; Pei Yuanji; Fan Kuanjun


    Circuit inductance exists at discharging circuit of transmission-line, it includes the inductance at the main switch of thyratron when conducts, the linking inductance between the linking cables, the matching resistance inductance and the load inductance. When a long pulse is generated by transmission-line, the circuit inductance can be omitted. However, when the pulse is short (such as shorter than 200 ns), especially when ferromagnetic core kicker acts as the load, the effect is obvious. The short pulse current is needed in order to generate long time interval synchronous radiation light pulses by using online assembly of pulse convex orbit and DC convex orbit. This paper analyses the effect and presents several experimental results. It also supposes two practical cases to decrease the rise time of the pulse

  13. Fractional analysis for nonlinear electrical transmission line and nonlinear Schroedinger equations with incomplete sub-equation (United States)

    Fendzi-Donfack, Emmanuel; Nguenang, Jean Pierre; Nana, Laurent


    We use the fractional complex transform with the modified Riemann-Liouville derivative operator to establish the exact and generalized solutions of two fractional partial differential equations. We determine the solutions of fractional nonlinear electrical transmission lines (NETL) and the perturbed nonlinear Schroedinger (NLS) equation with the Kerr law nonlinearity term. The solutions are obtained for the parameters in the range (0<α≤1) of the derivative operator and we found the traditional solutions for the limiting case of α =1. We show that according to the modified Riemann-Liouville derivative, the solutions found can describe physical systems with memory effect, transient effects in electrical systems and nonlinear transmission lines, and other systems such as optical fiber.

  14. Rényi entropies of electrical transmission lines with Fibonacci distribution of inductances

    Energy Technology Data Exchange (ETDEWEB)

    Lazo, E., E-mail: [Departamento de Física, Facultad de Ciencias, Universidad de Tarapacá, Arica (Chile); Mellado, F. [Departamento de Física, Facultad de Ciencias, Universidad de Tarapacá, Arica (Chile); Escuela Universitaria de Ingeniería Eléctrica-Electrónica, Universidad de Tarapacá, Arica (Chile); Saavedra, E. [Departamento de Física, Facultad de Ciencias, Universidad de Tarapacá, Arica (Chile)


    We study classical dual transmission lines with constant capacitances C{sub j}=C{sub 0}, ∀j, when we distribute two inductance values L{sub A} and L{sub B} according to the Fibonacci sequence. Using the electric current function I{sub j}(ω), we study the normalized localization length Λ(ω), the Rényi entropies R{sub m}(ω) and the normalized information length β(ω). We found three kinds of behavior of the I{sub j}(ω) function: localized, extended and intermediate. In addition, it is found that the transmission line with Fibonacci distribution of inductances shows a behavior characteristic of quasi-periodic systems, namely, a self-similar frequency spectrum, where each subband is divided into three subbands, but the number of global subbands is greater than four.

  15. Definition of a matrix of the generalized parameters asymmetrical multiphase transmission lines

    Directory of Open Access Journals (Sweden)

    Suslov V.M.


    Full Text Available Idle time, without introduction of wave characteristics, algorithm of definition of a matrix of the generalized parameters asymmetrical multiphase transmission lines is offered. Definition of a matrix of parameters is based on a matrix primary specific of parameters of line and simple iterative procedure. The amount of iterations of iterative procedure is determined by a set error of performance of the resulted matrix ratio between separate blocks of a determined matrix. The given error is connected by close image of with a margin error determined matrix.

  16. Transmission line theory for long plasma production by radio frequency discharges between parallel-plate electrodes

    International Nuclear Information System (INIS)

    Nonaka, S.


    In order to seek for a radio frequency (RF) eigen-mode of waves in producing a plasma between a pair of long dielectric-covered parallel-plate RF electrodes, this paper analyzed all normal modes propagating along the electrodes by solving Maxwell's equations. The result showed that only an odd surface wave mode will produce the plasma in usual experimental conditions, which will become a basic transmission line theory when use of such long electrodes for on-line mass-production of amorphous silicon solar cells

  17. Study of electric and magnetic fields on transmission lines using a computer simulation program

    International Nuclear Information System (INIS)

    Robelo Mojica, Nelson


    A study was conducted to determine and reduce levels of electric and magnetic fields with different configurations used by the Instituto Costarricense de Electricidad in power transmission lines in Costa Rica. The computer simulation program PLS-CADD with EPRI algorithm has been used to obtain field values close to those actual to lines easements that have worked to date. Different configurations have been compared on equal terms and the lowest levels of electric and magnetic fields are determined. The most appropriate configuration of the tower has been obtained and therefore has decreased exposure to electromagnetic fields people, without affecting the energy demand of the population. (author) [es

  18. The Experimental Verification of Gaussian Beam Coupling for ECH Transmission Line at 400 GHz

    Directory of Open Access Journals (Sweden)

    Choe Mun Seok


    Full Text Available We design a quasi-optical transmission line system for a 400 GHz gyrotron beam. The 400GHz Gaussian beam is injected to a corrugated waveguide bounced from a quasi-optical mirror. From detailed 2D field patterns of the output beam emitted from the corrugated waveguide, we analyze the mode contents and the source of non-ideal beam expansion

  19. System for Relay Protection Command Transmission by High-Voltage Lines

    Directory of Open Access Journals (Sweden)

    D. A. Yenkov


    Full Text Available Development of a system for relay protection command transmission by high-voltage lines is shown in the paper. The paper describes an architecture of the system, main principles of its operation, engineering aspects of the development that is accomplishment of technical requirements, solution of trades-off. Justification of the selected design and an algorithm of the reliable detection of relay protection signals are given in the paper.

  20. Sound transmission through triple-panel structures lined with poroelastic materials (United States)

    Liu, Yu


    In this paper, previous theories on the prediction of sound transmission loss for a double-panel structure lined with poroelastic materials are extended to address the problem of a triple-panel structure. Six typical configurations are considered for a triple-panel structure based on the method of coupling the porous layers to the facing panels which determines critically the sound insulation performance of the system. The transfer matrix method is employed to solve the system by applying appropriate types of boundary conditions for these configurations. The transmission loss of the triple-panel structures in a diffuse sound field is calculated as a function of frequency and compared with that of corresponding double-panel structures. Generally, the triple-panel structure with poroelastic linings has superior acoustic performance to the double-panel counterpart, remarkably in the mid-high frequency range and possibly at low frequencies, by selecting appropriate configurations in which those with two air gaps in the structure exhibit the best overall performance over the entire frequency range. The poroelastic lining significantly lowers the cut-on frequency above which the triple-panel structure exhibits noticeably higher transmission loss. Compared with a double-panel structure, the wider range of system parameters for a triple-panel structure due to the additional partition provides more design space for tuning the sound insulation performance. Despite the increased structural complexity, the triple-panel structure lined with poroelastic materials has the obvious advantages in sound transmission loss while without the penalties in weight and volume, and is hence a promising replacement for the widely used double-panel sandwich structure.

  1. Efficient design of multituned transmission line NMR probes: the electrical engineering approach. (United States)

    Frydel, J A; Krzystyniak, M; Pienkowski, D; Pietrzak, M; de Sousa Amadeu, N; Ratajczyk, T; Idzik, K; Gutmann, T; Tietze, D; Voigt, S; Fenn, A; Limbach, H H; Buntkowsky, G


    Transmission line-based multi-channel solid state NMR probes have many advantages regarding the cost of construction, number of RF-channels, and achievable RF-power levels. Nevertheless, these probes are only rarely employed in solid state-NMR-labs, mainly owing to the difficult experimental determination of the necessary RF-parameters. Here, the efficient design of multi-channel solid state MAS-NMR probes employing transmission line theory and modern techniques of electrical engineering is presented. As technical realization a five-channel ((1)H, (31)P, (13)C, (2)H and (15)N) probe for operation at 7 Tesla is described. This very cost efficient design goal is a multi port single coil transmission line probe based on the design developed by Schaefer and McKay. The electrical performance of the probe is determined by measuring of Scattering matrix parameters (S-parameters) in particular input/output ports. These parameters are compared to the calculated parameters of the design employing the S-matrix formalism. It is shown that the S-matrix formalism provides an excellent tool for examination of transmission line probes and thus the tool for a rational design of these probes. On the other hand, the resulting design provides excellent electrical performance. From a point of view of Nuclear Magnetic Resonance (NMR), calibration spectra of particular ports (channels) are of great importance. The estimation of the π/2 pulses length for all five NMR channels is presented. Copyright © 2011 Elsevier Inc. All rights reserved.

  2. Implementation of a microcomputer based distance relay for parallel transmission lines

    International Nuclear Information System (INIS)

    Phadke, A.G.; Jihuang, L.


    Distance relaying for parallel transmission lines is a difficult application problem with conventional phase and ground distance relays. It is known that for cross-country faults involving dissimilar phases and ground, three phase tripping may result. This paper summarizes a newly developed microcomputer based relay which is capable of classifying the cross-country fault correctly. The paper describes the principle of operation and results of laboratory tests of this relay

  3. Thermal fluctuations in resonant motion of fluxons on a Josephson transmission line: Theory and experiment

    DEFF Research Database (Denmark)

    Jørgensen, E.; Koshelets, V. P.; Monaco, Roberto


    The radiation emission from long and narrow Josephson tunnel junctions dc-current biased on zero-field steps has been ascribed to resonant motion of fluxons on the transmission line. Within this dynamic model a theoretical expression for the radiation linewidth is derived from a full statistical ...... treatment of thermal fluctuations in the fluxon velocity. The result appears to be very general and is corroborated by experimental determination of linewidth and frequency of radiation emitted from overlap Nb-I-Pb junctions....

  4. Transmission line model for coupled rectangular double split‐ring resonators

    DEFF Research Database (Denmark)

    Yan, Lei; Tang, Meng; Krozer, Viktor


    In this work, a model based on a coupled transmission line formulation is developed for microstrip rectangular double split‐ring resonators (DSRRs). This model allows using the physical dimensions of the DSRRs as an input avoiding commonly used extraction of equivalent parameters. The model inclu...... simulations of the DSRR structures. © 2011 Wiley Periodicals, Inc. Microwave Opt Technol Lett 53:1311–1315, 2011; View this article online at DOI 10.1002/mop.25988...

  5. Termination for a superconducting power transmission line including a horizontal cryogenic bushing (United States)

    Minati, Kurt F.; Morgan, Gerry H.; McNerney, Andrew J.; Schauer, Felix


    A termination for a superconducting power transmission line is disclosed which is comprised of a standard air entrance insulated vertical bushing with an elbow, a horizontal cryogenic bushing linking the pressurized cryogenic cable environment to the ambient temperature bushing and a stress cone which terminates the cable outer shield and transforms the large radial voltage gradient in the cable dielectric into a much lower radial voltage gradient in the high density helium coolant at the cold end of the cryogenic bushing.

  6. Critical parameters affecting the design of high frequency transmission lines in standard CMOS technology

    KAUST Repository

    Al Attar, Talal


    Different structures of transmission lines were designed and fabricated in standard CMOS technology to estimate some critical parameters including the RMS value of the surface roughness and the loss tangent. The input impedances for frequencies up to 50 GHz were modeled and compared with measurements. The results demonstrated a strong correlation between the used model with the proposed coefficients and the measured results, attesting the robustness of the model and the reliability of the incorporated coefficients values.

  7. Critical parameters affecting the design of high frequency transmission lines in standard CMOS technology

    KAUST Repository

    Al Attar, Talal; Alshehri, Abdullah; Almansouri, Abdullah Saud Mohammed; Al-Turki, Abdullah Turki


    Different structures of transmission lines were designed and fabricated in standard CMOS technology to estimate some critical parameters including the RMS value of the surface roughness and the loss tangent. The input impedances for frequencies up to 50 GHz were modeled and compared with measurements. The results demonstrated a strong correlation between the used model with the proposed coefficients and the measured results, attesting the robustness of the model and the reliability of the incorporated coefficients values.

  8. Sound transmission through triple-panel structures lined with poroelastic materials


    Liu, Y


    In this paper, previous theories on the prediction of sound transmission loss for a double-panel structure lined with poroelastic materials are extended to address the problem of a triple-panel structure. Six typical configurations are considered for a triple-panel structure based on the method of coupling the porous layers to the facing panels which determines critically the sound insulation performance of the system. The transfer matrix method is employed to solve the system by applying app...

  9. Transmission-line-circuit model of an 85-TW, 25-MA pulsed-power accelerator (United States)

    Hutsel, B. T.; Corcoran, P. A.; Cuneo, M. E.; Gomez, M. R.; Hess, M. H.; Hinshelwood, D. D.; Jennings, C. A.; Laity, G. R.; Lamppa, D. C.; McBride, R. D.; Moore, J. K.; Myers, A.; Rose, D. V.; Slutz, S. A.; Stygar, W. A.; Waisman, E. M.; Welch, D. R.; Whitney, B. A.


    We have developed a physics-based transmission-line-circuit model of the Z pulsed-power accelerator. The 33-m-diameter Z machine generates a peak electrical power as high as 85 TW, and delivers as much as 25 MA to a physics load. The circuit model is used to design and analyze experiments conducted on Z. The model consists of 36 networks of transmission-line-circuit elements and resistors that represent each of Zs 36 modules. The model of each module includes a Marx generator, intermediate-energy-storage capacitor, laser-triggered gas switch, pulse-forming line, self-break water switches, and tri-plate transmission lines. The circuit model also includes elements that represent Zs water convolute, vacuum insulator stack, four parallel outer magnetically insulated vacuum transmission lines (MITLs), double-post-hole vacuum convolute, inner vacuum MITL, and physics load. Within the vacuum-transmission-line system the model conducts analytic calculations of current loss. To calculate the loss, the model simulates the following processes: (i) electron emission from MITL cathode surfaces wherever an electric-field threshold has been exceeded; (ii) electron loss in the MITLs before magnetic insulation has been established; (iii) flow of electrons emitted by the outer-MITL cathodes after insulation has been established; (iv) closure of MITL anode-cathode (AK) gaps due to expansion of cathode plasma; (v) energy loss to MITL conductors operated at high lineal current densities; (vi) heating of MITL-anode surfaces due to conduction current and deposition of electron kinetic energy; (vii) negative-space-charge-enhanced ion emission from MITL anode surfaces wherever an anode-surface-temperature threshold has been exceeded; and (viii) closure of MITL AK gaps due to expansion of anode plasma. The circuit model is expected to be most accurate when the fractional current loss is small. We have performed circuit simulations of 52 Z experiments conducted with a variety of accelerator

  10. Transmission-line-circuit model of an 85-TW, 25-MA pulsed-power accelerator

    Directory of Open Access Journals (Sweden)

    B. T. Hutsel


    Full Text Available We have developed a physics-based transmission-line-circuit model of the Z pulsed-power accelerator. The 33-m-diameter Z machine generates a peak electrical power as high as 85 TW, and delivers as much as 25 MA to a physics load. The circuit model is used to design and analyze experiments conducted on Z. The model consists of 36 networks of transmission-line-circuit elements and resistors that represent each of Zs 36 modules. The model of each module includes a Marx generator, intermediate-energy-storage capacitor, laser-triggered gas switch, pulse-forming line, self-break water switches, and tri-plate transmission lines. The circuit model also includes elements that represent Zs water convolute, vacuum insulator stack, four parallel outer magnetically insulated vacuum transmission lines (MITLs, double-post-hole vacuum convolute, inner vacuum MITL, and physics load. Within the vacuum-transmission-line system the model conducts analytic calculations of current loss. To calculate the loss, the model simulates the following processes: (i electron emission from MITL cathode surfaces wherever an electric-field threshold has been exceeded; (ii electron loss in the MITLs before magnetic insulation has been established; (iii flow of electrons emitted by the outer-MITL cathodes after insulation has been established; (iv closure of MITL anode-cathode (AK gaps due to expansion of cathode plasma; (v energy loss to MITL conductors operated at high lineal current densities; (vi heating of MITL-anode surfaces due to conduction current and deposition of electron kinetic energy; (vii negative-space-charge-enhanced ion emission from MITL anode surfaces wherever an anode-surface-temperature threshold has been exceeded; and (viii closure of MITL AK gaps due to expansion of anode plasma. The circuit model is expected to be most accurate when the fractional current loss is small. We have performed circuit simulations of 52 Z experiments conducted with a

  11. Assessment of surge arrester failure rate and application studies in Hellenic high voltage transmission lines

    Energy Technology Data Exchange (ETDEWEB)

    Christodoulou, C.A.; Fotis, G.P.; Gonos, I.F.; Stathopulos, I.A. [National Technical University of Athens, School of Electrical and Computer Engineering, High Voltage Laboratory, 9 Iroon Politechniou St., Zografou Campus, 157 80 Athens (Greece); Ekonomou, L. [A.S.PE.T.E. - School of Pedagogical and Technological Education, Department of Electrical Engineering Educators, N. Heraklion, 141 21 Athens (Greece)


    The use of transmission line surge arresters to improve the lightning performance of transmission lines is becoming more common. Especially in areas with high soil resistivity and ground flash density, surge arresters constitute the most effective protection mean. In this paper a methodology for assessing the surge arrester failure rate based on the electrogeometrical model is presented. Critical currents that exceed arresters rated energy stress were estimated by the use of a simulation tool. The methodology is applied on operating Hellenic transmission lines of 150 kV. Several case studies are analyzed by installing surge arresters on different intervals, in relation to the region's tower footing resistance and the ground flash density. The obtained results are compared with real records of outage rate showing the effectiveness of the surge arresters in the reduction of the recorded failure rate. The presented methodology can be proved valuable to the studies of electric power systems designers intending in a more effective lightning protection, reducing the operational costs and providing continuity of service. (author)

  12. Simulation Analysis of Transmission-Line Impedance Transformers for Petawatt-Class Pulsed Power Accelerators

    International Nuclear Information System (INIS)

    Hu Yixiang; Qiu Aici; Sun Fengju; Huang Tao; Cong Peitian; Wang Liangping; Zeng Jiangtao; Li Yan; Zhang Xinjun; Lei Tianshi


    Based on the transmission line code TLCODE, a 1D circuit model for a transmission-line impedance transformer was developed and the simulation results were compared with those in the literature. The model was used to quantify the efficiencies of voltage-transport, energy-transport and power-transport for a transmission-line impedance transformer as functions of ψ (the ratio of the output impedance to the input impedance of the transformer) and Γ (the ratio of the pulse width to the one-way transit time of the transformer) under a large scale of m (the coefficient of the generalized exponential impedance profile). Simulation results suggest that with the increase in Γ, from 0 to ∞, the power transport efficiency first increases and then decreases. The maximum power transport efficiency can reach 90% or even higher for an exponential impedance profile (m = 1). With a consideration of dissipative loss in the dielectric and electrodes of the transformer, two representative designs of the water-insulated transformer are investigated for the next generation of petawatt-class z-pinch drivers. It is found that the dissipative losses in the electrodes are negligibly small, below 0.1%, but the dissipative loss in the water dielectric is about 1% to 4%. (fusion engineering)

  13. Fiber Bragg Grating Sensor for Fault Detection in Radial and Network Transmission Lines

    Directory of Open Access Journals (Sweden)

    Mehdi Shadaram


    Full Text Available In this paper, a fiber optic based sensor capable of fault detection in both radial and network overhead transmission power line systems is investigated. Bragg wavelength shift is used to measure the fault current and detect fault in power systems. Magnetic fields generated by currents in the overhead transmission lines cause a strain in magnetostrictive material which is then detected by Fiber Bragg Grating (FBG. The Fiber Bragg interrogator senses the reflected FBG signals, and the Bragg wavelength shift is calculated and the signals are processed. A broadband light source in the control room scans the shift in the reflected signal. Any surge in the magnetic field relates to an increased fault current at a certain location. Also, fault location can be precisely defined with an artificial neural network (ANN algorithm. This algorithm can be easily coordinated with other protective devices. It is shown that the faults in the overhead transmission line cause a detectable wavelength shift on the reflected signal of FBG and can be used to detect and classify different kind of faults. The proposed method has been extensively tested by simulation and results confirm that the proposed scheme is able to detect different kinds of fault in both radial and network system.

  14. Modeling particle emission and power flow in pulsed-power driven, nonuniform transmission lines

    Directory of Open Access Journals (Sweden)

    Nichelle Bruner


    Full Text Available Pulsed-power driven x-ray radiographic systems are being developed to operate at higher power in an effort to increase source brightness and penetration power. Essential to the design of these systems is a thorough understanding of electron power flow in the transmission line that couples the pulsed-power driver to the load. In this paper, analytic theory and fully relativistic particle-in-cell simulations are used to model power flow in several experimental transmission-line geometries fielded on Sandia National Laboratories’ upgraded Radiographic Integrated Test Stand [IEEE Trans. Plasma Sci. 28, 1653 (2000ITPSBD0093-381310.1109/27.901250]. Good agreement with measured electrical currents is demonstrated on a shot-by-shot basis for simulations which include detailed models accounting for space-charge-limited electron emission, surface heating, and stimulated particle emission. Resonant cavity modes related to the transmission-line impedance transitions are also shown to be excited by electron power flow. These modes can drive oscillations in the output power of the system, degrading radiographic resolution.

  15. Losses at magnetic nulls in pulsed-power transmission line systems

    International Nuclear Information System (INIS)

    Mendel, C.W. Jr.; Pointon, T.D.; Savage, M.E.; Seidel, D.B.; Magne, I.; Vezinet, R.


    Pulsed-power systems operating in the terawatt regime must deal with large electron flows in vacuum transmission lines. In most parts of these transmission lines the electrons are constrained by the self-magnetic field to flow parallel to the conductors. In very low impedance systems, such as those used to drive Z-pinch radiation sources, the currents from multiple transmission lines are added together. This addition necessarily involves magnetic nulls that connect the positive and negative electrodes. The resultant local loss of magnetic insulation results in electron losses at the anode in the vicinity of the nulls. The lost current due to the magnetic null might or might not be appreciable. In some cases the lost current due to the null is not large, but is spatially localized, and may create a gas and plasma release from the anode that can lead to an excessive loss, and possibly to catastrophic damage to the hardware. In this paper we describe an analytic model that uses one geometric parameter (aside from straightforward hardware size measurements) that determines the loss to the anode, and the extent of the loss region when the driving source and load are known. The parameter can be calculated in terms of the magnetic field in the region of the null calculated when no electron flow is present. The model is compared to some experimental data, and to simulations of several different hardware geometries, including some cases with multiple nulls, and unbalanced feeds

  16. Alleviation SSR and Low Frequency Power Oscillations in Series Compensated Transmission Line using SVC Supplementary Controllers (United States)

    Kumar, Sanjiv; Kumar, Narendra


    In this work, supplementary sub-synchronous damping controllers (SSDC) are proposed for damping sub-synchronous oscillations in power systems with series compensated transmission lines. Series compensation have extensively been used as effective means of increasing the power transfer capability of a transmission lines and improving transient stability limits of power systems. Series compensation with transmission lines may cause sub-synchronous resonance (SSR). The eigenvalue investigation tool is used to ascertain the existence of SSR. It is shown that the addition of supplementary controller is able to stabilize all unstable modes for T-network model. Eigenvalue investigation and time domain transient simulation of detailed nonlinear system are considered to investigate the performance of the controllers. The efficacies of the suggested supplementary controllers are compared on the IEEE first benchmark model for computer simulations of SSR by means of time domain simulation in Matlab/Simulink environment. Supplementary SSDC are considered in order to compare effectiveness of SSDC during higher loading in alleviating the small signal stability problem.

  17. Smart patch integration development of compression connector structural health monitoring in overhead transmission lines (United States)

    Wang, Hong; Wang, Jy-An J.; Ren, Fei; Chan, John


    Integration of smart patches into full-tension splice connectors in overhead power transmission lines was investigated. Lead zirconate titanate (PZT) -5A was used as a smart material and an aluminum beam was used as a host structure. Negative electrode termination was examined by using copper adhesive tape and direct bonding methods. Various commercial adhesives were studied for PZT integration onto the host structure. Aluminum beam specimens with integrated PZT smart patches were tested under thermal cycling at a temperature of 125°C, which is the higher-end temperature experienced by in-service aluminum conductor steel-reinforced cables. Electromechanical impedance (EMI) measurements were conducted at room temperature, and the root mean square deviation (RMSD) of the conductance signals was used to analyze the EMI data. It has been shown that the negative electrode method has an important effect on the performance of the integrated PZT. The PZT displayed more susceptibility to cracking when copper tape was used than when direct bonding was used. The reliability of PZT in direct bonding depended on the adhesives used in bonding layers. Although a hard alumina-based adhesive can lead to cracking of the PZT, a high-temperature epoxy with adequate flexibility, such as Duralco 4538D, can provide the desired performance under target thermal cycling conditions. The RMSD parameter can characterize conductance signatures effectively. It also was demonstrated that RMSD can be used to quantify the fatigue of the PZT integration system, although RMSD is used primarily as a damage index in monitoring structural health.

  18. Advanced Design of the First Quasi-optical Transmission Line for ECRH at TJ-II

    International Nuclear Information System (INIS)

    Fernandez, A.; Likin, K.; Martin, R.


    TJ-II plasma start-up and heating are made by electron cyclotron resonance waves at the second harmonic of the electron cyclotron frequency. The microwave power of the gyrotrons is transmitted by two quasi-optical transmission lines. The first line launches the microwave power under fixed injection geometry, i. e. there is no a possibility to change the launching angle the wave polarization. Due to the long distance between the last focusing mirror and the center TJ-II vessel the beam is quite wide at plasma border. The second line has a moveable mirror installed inside the TJ-II vessel. To get high absorption efficiency and a narrow energy deposition profile the internal mirror focuses the wave beam at plasma center. The beam width is about 2 cm. To get more flexibility in experiments on heating and current drive the first transmission line needs to be upgraded. The designs is presented in this report. It includes and internal mirror to focus the beam and to change the injection angle. A polarizer consisting in two corrugated mirrors will be incorporated to get any wave polarization. Two mirrors with an array of coupling holes and calorimetric measurements of the energy absorbed in the barrier window will permit the estimation of the microwave power launched the TJ-II. (Author) 13 refs

  19. Distance protection of multiple-circuit shared tower transmission lines with different voltages

    DEFF Research Database (Denmark)

    Silva, Filipe Miguel Faria da; Bak, Claus Leth


    combined faults, being advised to increase the resistive limit of the protection zone, if the network has lower short-circuit power. It is recommended to assure that the fault can only happen for cases where the faulted phase from the higher voltage level leads the faulted phase from the lower voltage......Multiple-circuit transmission lines combining different voltage levels in one tower present extra challenges when setting a protection philosophy, as faults between voltage levels are possible. In this study, the fault loop impedance of combined faults is compared with the fault loop impedance......-phase-to-ground faults. It is also demonstrated that the fault loop impedance of combined faults is more resistive, when compared with equivalent single-phase-to-ground faults. It is concluded that the settings used to protect a line against single-phase-to-ground faults are capable of protecting the line against...

  20. Accurate fault location algorithm on power transmission lines with use of two-end unsynchronized measurements

    Directory of Open Access Journals (Sweden)

    Mohamed Dine


    Full Text Available This paper presents a new approach to fault location on power transmission lines. This approach uses two-end unsynchronised measurements of the line and benefits from the advantages of digital technology and numerical relaying, which are available today and can easily be applied for off-line analysis. The approach is to modify the apparent impedance method using a very simple first-order formula. The new method is independent of fault resistance, source impedances and pre-fault currents. In addition, the data volume communicated between relays is sufficiently small enough to be transmitted easily using a digital protection channel. The proposed approach is tested via digital simulation using MATLand the applied test results corroborate the superior performance of the proposed approach.

  1. Study on the Extremely Low Frequency (ELF) Electromagnetic Field (EMF) emission from overhead High-Voltage Transmission Lines

    International Nuclear Information System (INIS)

    Parthasarathy, S.R.; Roha Tukimin; Wan Saffiey Wan Abdullah; Zulkifli Yusof; Mohd Azizi Mohd Jali


    The paper highlights the study on the Extremely Low Frequency (ELF) Electromagnetic Field (EMF) emission performed at an overhead 275-kV High-Voltage Transmission Lines. The study comprised of assessment at the transmission lines on 3 different cases and locations in Klang Valley, specifically on a vacant land near the transmission line, inside and around the house at the vicinity of the transmission line and the area directly under the transmission line. The instrument setup and measurement protocols during the assessment were adopted from standard measurement method and procedures stipulated under the Institute of Electrical and Electronics Engineers (IEEE) Standard. The results were compared with the standards recommended in the International Commission on Non-Ionizing Radiation Protection (ICNIRP) guidelines. The results showed that the measured field strengths are within the safety limit with the highest measured exposure was 10.8 % and 1.8 % of the permissible exposure limit for the electric and magnetic field respectively. Both the field strengths were found to drop significantly against distance from the transmission lines where closer distances showed higher field strengths. Furthermore, the study revealed that buildings and other object such as trees and shrubs screen out the electric field, resulting in a lower value at indoor measurements and near the stated objects. In addition, higher value of electric and magnetic field strengths were recorded when assessment was being done directly under the transmission line compared to the lateral measurement. (author)

  2. CRPP's Evacuated Waveguide Proposal for JET-EP ECRH Transmission Line

    International Nuclear Information System (INIS)

    Henderson, M. A.; Alberti, S.; Goodman, T. P.; Hogge, J.-P.; Porte, L.; Tran, M. Q.


    The goal of this document is to provide a detailed description of the preliminary design and technical information of a proposed evacuated transmission lines for JET . EP ECRH system. Three waveguide diameters (31.75mm, 45mm and 63.5mm) were studied and compared to the base design of the 87mm waveguide/quasi.optical proposal (WG87-QO). This report concentrates on only the 45mm waveguide diameter (WG45). This size represents an optimization between the flexibility of the smaller diameter and the low loss of the larger. For simplicity only the WG45 will be compared with the WG87-QO, but the other diameters (31.75 and 63.5 mm) should be kept under consideration for a final evacuated waveguide line. The characteristics of the 63.5 mm waveguide system can be found in the report which was distributed in September. After an introduction of the history and motivation for this study a general overview of the proposal is presented. Sections 4 and 5 describe the elements to be used in the proposed line including the overall transmission losses for the line. Section 6 offers a cost comparison of the two proposaIs. The 7th section is a brief description of an alternative launcher design using the waveguide inserted into the launcher port. The 8th section describes the ca1ibration and conditioning process to be performed after the line is insta1led and how the torus displacements wi1l be handled. The 9th section describes the proposed schedule for purchasing and insta1lation of the waveguide lines. Sections II and 12 include a conclusion and summary of the proposal. (author)

  3. Artificial neural networks to estimate the EMF ELF on car travelling near power transmission line

    Energy Technology Data Exchange (ETDEWEB)

    Al-Sayegh, O.A.; Qabazard, A.M. [Kuwait Inst. for Scientific Research, Safat (Kuwait). advanced Systems Division of Environment and Urban


    An artificial neural network (ANN) was developed to determine the electromagnetic field (EMF) and extremely low frequency (ELF) intensity on a vehicle body at different distances from a high tension power line and at varying power loads. EMF radiated emissions from ELF source power transmission lines can produce interference in the electric components in vehicles traveling at variable speed near the power lines. The passengers in the vehicle may also experience EMF-related health problems. Although EMF has been recently categorized as a new form of pollution, the situation has been largely ignored by the industry. Typically, electromagnetic fields at different frequencies show the fastest growing environmental influences. All populations are now exposed to varying degrees of EMF and the levels will continue to increase as technology advances. The purpose of this work was to promote discussion and help find design solutions to manufacture a new device for measuring the EMF at variable speed. In this study, a set of near field measurements outside the vehicle were used to train ANN. Estimations of the EMF ELF for various distances from the high tension power line were presented. It was determined that the most important factors affecting the electric field model include exposure conditions; size, shape and position of the exposed body in the field; and, surface charge density. The EMF ELF was found to increase near sagging areas of the overhead power transmission line. The EMF ELF was found to be proportional to the total amps flowing through the line at the time of measurement. 14 refs., 3 figs.

  4. Flatiron-Erie 115kV transmission line project, Larimer, Weld and Boulder Counties, Colorado

    International Nuclear Information System (INIS)


    Western Area Power Administration (Western) proposes to uprate its existing 115-kV Flatiron-Erie transmission line. The line is located in Larimer, Weld and Boulder Counties, Colorado, and passes through the City of Longmont. The line connects Flatiron Substation and several of the substations supplying Longmont. It is a single circuit 115-kV line, 31.5 miles long, and was built in 1950-51 on a 75-foot wide right-of-way (ROW) using wood H-frame structures. Western proposes to build 27 new structures along the line, to replace or modify 45 of the existing structures and to remote 11 of them. Many of these additions and changes would involve structures that are approximately 5 to 15 feet taller than the existing ones. The existing conductors and ground wires would remain in place. The purpose of these actions would be to allow the power carrying capability of the line to be increased and to replace deteriorating/structural members. Western would be the sole participant in the proposed project. This report gives an analysis of the study area environment and the development of alternative routes. An assessment is presented of the impacts of the primary alternative routes. The environmental consequences of this project are addressed

  5. 55-TW magnetically insulated transmission-line system: Design, simulations, and performance

    Directory of Open Access Journals (Sweden)

    W. A. Stygar


    Full Text Available We describe herein a system of self-magnetically insulated vacuum transmission lines (MITLs that operated successfully at 20 MA, 3 MV, and 55 TW. The system delivered the electromagnetic-power pulse generated by the Z accelerator to a physics-package load on over 1700 Z shots. The system included four levels that were electrically in parallel. Each level consisted of a water flare, vacuum-insulator stack, vacuum flare, and 1.3-m-radius conical outer MITL. The outputs of the four outer MITLs were connected in parallel by a 7.6-cm-radius 12-post double-post-hole vacuum convolute. The convolute added the currents of the four outer MITLs, and delivered the combined current to a single 6-cm-long inner MITL. The inner MITL delivered the current to the load. The total initial inductance of the stack-MITL system was 11 nH. A 300-element transmission-line-circuit model of the system has been developed using the tl code. The model accounts for the following: (i impedance and electrical length of each of the 300 circuit elements, (ii electron emission from MITL-cathode surfaces wherever the electric field has previously exceeded a constant threshold value, (iii Child-Langmuir electron loss in the MITLs before magnetic insulation is established, (iv MITL-flow-electron loss after insulation, assuming either collisionless or collisional electron flow, (v MITL-gap closure, (vi energy loss to MITL conductors operated at high lineal current densities, (vii time-dependent self-consistent inductance of an imploding z-pinch load, and (viii load resistance, which is assumed to be constant. Simulations performed with the tl model demonstrate that the nominal geometric outer-MITL-system impedance that optimizes overall performance is a factor of ∼3 greater than the convolute-load impedance, which is consistent with an analytic model of an idealized MITL-load system. Power-flow measurements demonstrate that, until peak current, the Z stack-MITL system

  6. Seismic Response of Power Transmission Tower-Line System Subjected to Spatially Varying Ground Motions

    Directory of Open Access Journals (Sweden)

    Li Tian


    Full Text Available The behavior of power transmission tower-line system subjected to spatially varying base excitations is studied in this paper. The transmission towers are modeled by beam elements while the transmission lines are modeled by cable elements that account for the nonlinear geometry of the cables. The real multistation data from SMART-1 are used to analyze the system response subjected to spatially varying ground motions. The seismic input waves for vertical and horizontal ground motions are also generated based on the Code for Design of Seismic of Electrical Installations. Both the incoherency of seismic waves and wave travel effects are accounted for. The nonlinear time history analytical method is used in the analysis. The effects of boundary conditions, ground motion spatial variations, the incident angle of the seismic wave, coherency loss, and wave travel on the system are investigated. The results show that the uniform ground motion at all supports of system does not provide the most critical case for the response calculations.

  7. Common raven occurrence in relation to energy transmission line corridors transiting human-altered sagebrush steppe (United States)

    Coates, Peter S.; Howe, Kristy B.; Casazza, Michael L.; Delehanty, David J.


    Energy-related infrastructure and other human enterprises within sagebrush steppe of the American West often results in changes that promote common raven (Corvus corax; hereafter, raven) populations. Ravens, a generalist predator capable of behavioral innovation, present a threat to many species of conservation concern. We evaluate the effects of detailed features of an altered landscape on the probability of raven occurrence using extensive raven survey (n= 1045) and mapping data from southern Idaho, USA. We found nonlinear relationships between raven occurrence and distances to transmission lines, roads, and facilities. Most importantly, raven occurrence was greater with presence of transmission lines up to 2.2 km from the corridor.We further explain variation in raven occurrence along anthropogenic features based on the amount of non-native vegetation and cover type edge, such that ravens select fragmented sagebrush stands with patchy, exotic vegetative introgression. Raven occurrence also increased with greater length of edge formed by the contact of big sagebrush (Artemisia tridentate spp.) with non-native vegetation cover types. In consideration of increasing alteration of sagebrush steppe, these findings will be useful for planning energy transmission corridor placement and other management activities where conservation of sagebrush obligate species is a priority.

  8. A hybrid Boundary Element Unstructured Transmission-line (BEUT) method for accurate 2D electromagnetic simulation

    Energy Technology Data Exchange (ETDEWEB)

    Simmons, Daniel, E-mail:; Cools, Kristof; Sewell, Phillip


    Time domain electromagnetic simulation tools have the ability to model transient, wide-band applications, and non-linear problems. The Boundary Element Method (BEM) and the Transmission Line Modeling (TLM) method are both well established numerical techniques for simulating time-varying electromagnetic fields. The former surface based method can accurately describe outwardly radiating fields from piecewise uniform objects and efficiently deals with large domains filled with homogeneous media. The latter volume based method can describe inhomogeneous and non-linear media and has been proven to be unconditionally stable. Furthermore, the Unstructured TLM (UTLM) enables modelling of geometrically complex objects by using triangular meshes which removes staircasing and unnecessary extensions of the simulation domain. The hybridization of BEM and UTLM which is described in this paper is named the Boundary Element Unstructured Transmission-line (BEUT) method. It incorporates the advantages of both methods. The theory and derivation of the 2D BEUT method is described in this paper, along with any relevant implementation details. The method is corroborated by studying its correctness and efficiency compared to the traditional UTLM method when applied to complex problems such as the transmission through a system of Luneburg lenses and the modelling of antenna radomes for use in wireless communications. - Graphical abstract:.

  9. Mode and climatic factors effect on energy losses in transient heat modes of transmission lines (United States)

    Bigun, A. Ya; Sidorov, O. A.; Osipov, D. S.; Girshin, S. S.; Goryunov, V. N.; Petrova, E. V.


    Electrical energy losses increase in modern grids. The losses are connected with an increase in consumption. Existing models of electric power losses estimation considering climatic factors do not allow estimating the cable temperature in real time. Considering weather and mode factors in real time allows to meet effectively and safely the consumer’s needs to minimize energy losses during transmission, to use electric power equipment effectively. These factors increase an interest in the evaluation of the dynamic thermal mode of overhead transmission lines conductors. The article discusses an approximate analytic solution of the heat balance equation in the transient operation mode of overhead lines based on the least squares method. The accuracy of the results obtained is comparable with the results of solving the heat balance equation of transient thermal mode with the Runge-Kutt method. The analysis of mode and climatic factors effect on the cable temperature in a dynamic thermal mode is presented. The calculation of the maximum permissible current for variation of weather conditions is made. The average electric energy losses during the transient process are calculated with the change of wind, air temperature and solar radiation. The parameters having the greatest effect on the transmission capacity are identified.

  10. Simplified method to solve sound transmission through structures lined with elastic porous material. (United States)

    Lee, J H; Kim, J


    An approximate analysis method is developed to calculate sound transmission through structures lined with porous material. Because the porous material has both the solid phase and fluid phase, three wave components exist in the material, which makes the related analysis very complicated. The main idea in developing the approximate method is very simple: modeling the porous material using only the strongest of the three waves, which in effect idealizes the material as an equivalent fluid. The analysis procedure has to be conducted in two steps. In the first step, sound transmission through a flat double panel with a porous liner of infinite extents, which has the same cross sectional construction as the actual structure, is solved based on the full theory and the strongest wave component is identified. In the second step sound transmission through the actual structure is solved modeling the porous material as an equivalent fluid while using the actual geometry of the structure. The development and validation of the method are discussed in detail. As an application example, the transmission loss through double walled cylindrical shells with a porous core is calculated utilizing the simplified method.

  11. Quantifying siting difficulty: a case study of US transmission line siting

    Energy Technology Data Exchange (ETDEWEB)

    Vajjhala, S.P. [Resources for the Future, Washington DC (United States); Fischbeck, P.S. [Carnegie Mellon University, Pittsburgh, PA (United States). Departments of Social and Decision Sciences and Engineering and Public Policy


    The worldwide demand for new energy infrastructures has been paralleled in recent years by the increasing difficulty of siting major facilities. Siting difficulty is the subject of widespread discussion, but because of the complexity of the problem, potential solutions are not obvious or well understood. This paper presents a two-step policy-level framework that first develops an empirical measure of siting difficulty and then qualitatively assesses its major causes. The approach is based on the creation and aggregation of four siting indicators that are independent of the common causes and localized effects of siting problems. The proposed framework is demonstrated for the case of US transmission line siting. Results of the analyses reveal significant variations in state siting difficulty and industry experts' perceptions of its dominant causes, with implications for the long-term success of Regional Transmission Organizations (RTOs) and knowledge transfer among siting professionals in the deregulated industry. (author)

  12. Transmission-line resonators for the study of individual two-level tunneling systems (United States)

    Brehm, Jan David; Bilmes, Alexander; Weiss, Georg; Ustinov, Alexey V.; Lisenfeld, Jürgen


    Parasitic two-level tunneling systems (TLS) emerge in amorphous dielectrics and constitute a serious nuisance for various microfabricated devices, where they act as a source of noise and decoherence. Here, we demonstrate a new test bed for the study of TLS in various materials which provides access to properties of individual TLS as well as their ensemble response. We terminate a superconducting transmission-line resonator with a capacitor that hosts TLS in its dielectric. By tuning TLS via applied mechanical strain, we observe the signatures of individual TLS strongly coupled to the resonator in its transmission characteristics and extract the coupling components of their dipole moments and energy relaxation rates. The strong and well-defined coupling to the TLS bath results in pronounced resonator frequency fluctuations and excess phase noise, through which we can study TLS ensemble effects such as spectral diffusion, and probe theoretical models of TLS interactions.

  13. Sound transmission through double panel constructions lined with elastic porous materials (United States)

    Bolton, J. S.; Green, E. R.


    Attention is given to a theory governing one-dimensional wave motion in elastic porous materials which is capable of reproducing experimental transmission measurements for unfaced polyurethane foam layers. Calculations of the transmission loss of fuselage-like foam-lined double panels are presented and it is shown that the foam/panel boundary conditions have a large effect on the panel performance; a hybrid arrangement whereby the foam is bonded directly to one panel and separated from the other by a thin air gap appears to be the most advantageous under practical circumstances. With this configuratiom, the mass-air-mass resonance is minimized and increased low-frequency performance is offered.

  14. Regional analysis assessment of landslide hazard and zoning map for transmission line route selection using GIS

    International Nuclear Information System (INIS)

    Baharuddin, I N Z; Omar, R C; Usman, F; Mejan, M A; Halim, M K Abd; Zainol, M A; Zulkarnain, M S


    The stability of ground as foundation for infrastructure development is always associated with geology and geomorphology aspects. Failure to carefully analyze these aspects may induce ground instability such subsidence and landslide which eventually can cause catastrophe to the infrastructure i.e. instability of transmission tower. However, in some cases such as the study area this is unavoidable. A GIS system for analysis of route was favoured to perform optimal route predictions based selection by incorporating multiple influence factors into its analysis by incorporating the Landslide Hazard Map (LHM) that was produced on basis of slope map, aspect map, land use map and geological map with the help of ArcGIS using weighted overlay method. Based on LHM it is safe to conclude that the proposed route for Ulu Jelai- Neggiri-Lebir-LILO transmission line has very low risk in term of landslides.

  15. Improved superconductor for transmission line applications, phase I. Final report, January 1, 1975--June 30, 1975

    International Nuclear Information System (INIS)

    Braginski, A.I.; Mauser, S.F.; Roland, G.W.; Burghardt, R.R.; Daniel, M.R.; Janocko, M.A.


    The analysis of an existing superconducting power transmission cable design indicated that economic benefits in the area of refrigeration can be derived from the substitution of Nb 3 Ge superconductor for the presently planned Nb 3 Sn. However, the cost of Nb 3 Ge must be comparable to that of Nb 3 Sn, which is achievable when preparing Nb 3 Ge by the chemical vapor deposition. Alternatively, technical benefits can be obtained. The most essential and prerequisite requirement is that the Nb 3 Ge critical current density be improved significantly over the present state-of-the art. Other properties of Nb 3 Ge are generally suitable for the transmission line application and/or require only moderate improvements. (auth)

  16. Stability of a line receiver (0-T) preamplifier, connected to a capacitive detector via a transmission line

    CERN Document Server

    Battistoni, G; Fedyakin, N; Ramaioli, P; Shuvalov, R S


    We analyze the stability of a line receiver (0-T) preamplifier proposed to readout the ionization signal of the ATLAS LAr electromagnetic calorimeter. The transport of detector signal to the preamplifier input via a cable is analyzed on the basis of classical theory of wave propagation in transmission lines. It is shown that the analysis of stability can be reduced to the examination of zeros of the expression Z sub i sub n +Z sub D sub C , where Z sub i sub n is the input impedance of the 0-T and Z sub D sub C is the impedance of the detector plus cable, as seen by the preamplifier. An experimental method to measure the preamplifier input impedance in a range 1-200 MHz is described. The stability function Z sub i sub n +Z sub D sub C was built by using the combination of experimental data (Z sub i sub n) and calculations (Z sub D sub C) and was used to analyze the stability of two versions of 0-T preamplifier at different experimental conditions. It is illustrated that if the vector end of this semiempirical...


    Energy Technology Data Exchange (ETDEWEB)

    Heng, Kevin; Lavie, Baptiste [University of Bern, Physics Institute, Center for Space and Habitability, Sidlerstrasse 5, CH-3012 Bern (Switzerland); Wyttenbach, Aurélien; Ehrenreich, David; Lovis, Christophe [Observatoire de l’Université de Genève, 51 chemin des Maillettes, CH-1290 Sauverny (Switzerland); Sing, David K., E-mail: [Astrophysics Group, School of Physics, University of Exeter, Stocker Road, Exeter EX4 4QL (United Kingdom)


    We present a theory for interpreting the sodium lines detected in transmission spectra of exoplanetary atmospheres. Previous analyses employed the isothermal approximation and dealt only with the transit radius. By recognizing the absorption depth and the transit radius as being independent observables, we develop a theory for jointly interpreting both quantities, which allows us to infer the temperatures and number densities associated with the sodium lines. We are able to treat a non-isothermal situation with a constant temperature gradient. Our novel diagnostics take the form of simple-to-use algebraic formulae and require measurements of the transit radii (and their corresponding absorption depths) at line center and in the line wing for both sodium lines. We apply our diagnostics to the HARPS data of HD 189733b, confirm the upper atmospheric heating reported by Huitson et al., derive a temperature gradient of 0.4376 ± 0.0154 K km{sup −1}, and find densities ∼1–10{sup 4} cm{sup −3}.

  18. Distance protection of multiple-circuit shared tower transmission lines with different voltages

    DEFF Research Database (Denmark)

    Silva, Filipe Miguel Faria da; Bak, Claus Leth


    Multiple-circuit transmission lines combining different voltage levels in one tower present extra challenges when setting a protection philosophy, as faults between voltage levels are possible. This study presents a detailed theoretical analysis of such combined faults, including the development...... of a formula for estimating the magnitude of the short-circuit current. It is demonstrated that if the faulted phase from the higher voltage level leads the faulted phase from the lower voltage level, a distance relay at the higher voltage level sees the fault in the forward direction, whereas a distance relay...

  19. Numerical study of electron-leakage power loss in a tri-plate transmission line

    International Nuclear Information System (INIS)

    Barker, R.J.; Goldstein, S.A.


    Numerical simulations have been conducted using NRL's DIODE2D computer code to model the steady-state behavior of electron flow in a radial diode and in its adjacent tri-plate transmission line (TTL). Particular attention was paid to the magnitude of the electron current flowing from the cathode to the anode surface in the TTL. A quantitative value for this effective power loss is given. The electron current is restricted mainly to the transition region in the TTL into which there is seepage of the B/sub z/ that is imposed in the diode gap. This finding highlights the importance of that region to diode designers

  20. Multi-scale modelling of supercapacitors: From molecular simulations to a transmission line model (United States)

    Pean, C.; Rotenberg, B.; Simon, P.; Salanne, M.


    We perform molecular dynamics simulations of a typical nanoporous-carbon based supercapacitor. The organic electrolyte consists in 1-ethyl-3-methylimidazolium and hexafluorophosphate ions dissolved in acetonitrile. We simulate systems at equilibrium, for various applied voltages. This allows us to determine the relevant thermodynamic (capacitance) and transport (in-pore resistivities) properties. These quantities are then injected in a transmission line model for testing its ability to predict the charging properties of the device. The results from this macroscopic model are in good agreement with non-equilibrium molecular dynamics simulations, which validates its use for interpreting electrochemical impedance experiments.

  1. Transmission line analysis of beam deflection in a BPM stripline kicker

    International Nuclear Information System (INIS)

    Caporaso, G.J.; Chen, Yu Ju; Poole, B.


    In the usual treatment of impedances of beamline structures the electromagnetic response is computed under the assumption that the source charge trajectory is parallel to the propagation axis and is unaffected by the wake of the structure. For high energy beams of relatively low current this is generally a valid assumption. Under certain conditions the assumption of a parallel source charge trajectory is no longer valid and the effects of the changing trajectory must be included in the analysis. Here the usual transmission line analysis that has been applied to BPM type transverse kickers is extended to include the self-consistent motion of the beam in the structure

  2. A short model excitation of an asymmetric force free superconducting transmission line magnet

    Energy Technology Data Exchange (ETDEWEB)

    Wake, M.; Sato, H.; /KEK, Tsukuba; Carcagno, R.; Foster, W.; Hays, S.; Kashikhin, V.; Oleck, A.; Piekarz, H.; Rabehl, R,; /Fermilab


    A short model of asymmetric force free magnet with single beam aperture was tested at Fermilab together with the excitation test of VLHC transmission line magnet. The design concept of asymmetric force free superconducting magnet was verified by the test. The testing reached up to 104 kA current and no indication of force imbalance was observed. Since the model magnet length was only 10cm, A 0.75m model was constructed and tested at KEK with low current to ensure the validity of the design. The cool down and the excitation at KEK were also successful finding very small thermal contraction of the conductor and reasonable field homogeneity.

  3. Direct measurement of the quantum state of the electromagnetic field in a superconducting transmission line

    International Nuclear Information System (INIS)

    Melo, F. de; Aolita, L.; Davidovich, L.; Toscano, F.


    We propose an experimental procedure to directly measure the state of an electromagnetic field inside a resonator, corresponding to a superconducting transmission line, coupled to a Cooper-pair box (CPB). The measurement protocol is based on the use of a dispersive interaction between the field and the CPB, and the coupling to an external classical field that is tuned to resonance with either the field or the CPB. We present a numerical simulation that demonstrates the feasibility of this protocol, which is within reach of present technology

  4. Two-Port Representation of a Linear Transmission Line in the Time Domain. (United States)


    which is a rational function. To use the Prony procedure it is necessary to inverse transform the admittance functions. For the transmission line, most...impulse is a constant, the inverse transform of Y0(s) contains an impulse of value ._ Therefore, if we were to numerically inverse transform Yo(s), we...would remove this im- pulse and inverse transform Y-(S) Y (S) 1’LR+C~ (23) The prony procedure would then be applied to the result. Of course, an impulse

  5. Note: Electrical detection and quantification of spin rectification effect enabled by shorted microstrip transmission line technique

    International Nuclear Information System (INIS)

    Soh, Wee Tee; Ong, C. K.; Peng, Bin; Chai, Guozhi


    We describe a shorted microstrip method for the sensitive quantification of Spin Rectification Effect (SRE). SRE for a Permalloy (Ni 80 Fe 20 ) thin film strip sputtered onto SiO 2 substrate is demonstrated. Our method obviates the need for simultaneous lithographic patterning of the sample and transmission line, therefore greatly simplifying the SRE measurement process. Such a shorted microstrip method can allow different contributions to SRE (anisotropic magnetoresistance, Hall effect, and anomalous Hall effect) to be simultaneously determined. Furthermore, SRE signals from unpatterned 50 nm thick Permalloy films of area dimensions 5 mm × 10 mm can even be detected

  6. Probability of extreme interference levels computed from reliability approaches: application to transmission lines with uncertain parameters

    International Nuclear Information System (INIS)

    Larbi, M.; Besnier, P.; Pecqueux, B.


    This paper deals with the risk analysis of an EMC default using a statistical approach. It is based on reliability methods from probabilistic engineering mechanics. A computation of probability of failure (i.e. probability of exceeding a threshold) of an induced current by crosstalk is established by taking into account uncertainties on input parameters influencing levels of interference in the context of transmission lines. The study has allowed us to evaluate the probability of failure of the induced current by using reliability methods having a relative low computational cost compared to Monte Carlo simulation. (authors)

  7. Design and optimization of the PBFA II vacuum interface and transmission lines for light ion fusion

    International Nuclear Information System (INIS)

    Mc Daniel, D.H.; Stinnett, R.W.; Gray, E.W.; Mattis, R.E.


    The PBFA II vacuum insulator was originally designed for optimum coupling to a proton ion diode with minimum inductance. In July 1983 it was decided that lithium ions at 30 MeV would be the baseline for PBFA II. This requires the use of Plasma Opening Switches (POS) and vacuum inductor to reach 30 MV. To achieve this, the vacuum magnetically insulated transmission lines had to be redesigned as an inductive energy store. To gain optimum coupling to this vacuum inductor, the output impedance of the water section was increased by the use of a water-dielectric transformer. The calculations leading to the final design are discussed

  8. Equivalent circuit modeling of space charge dominated magnetically insulated transmission lines

    Energy Technology Data Exchange (ETDEWEB)

    Hiraoka, Kazuki; Nakajima, Mitsuo; Horioka, Kazuhiko


    A new equivalent circuit model for space charge dominated MITLs (Magnetically Insulated Transmission Lines) was developed. MITLs under high power operation are dominated with space charge current flowing between anode and cathode. Conventional equivalent circuit model does not account for space charge effects on power flow. The model was modified to discuss the power transportation through the high power MITLs. With this model, it is possible to estimate the effects of space charge current on the power flow efficiency, without using complicated particle code simulations. (author). 3 figs., 3 refs.

  9. Multiband Slot-Based Dual Composite Right/Left-Handed Transmission Line

    Directory of Open Access Journals (Sweden)

    E. Abdo-Sanchez


    Full Text Available A dual Composite Right-/Left-Handed Transmission Line (CRLH TL implementation that presents multiband behaviour is proposed in this contribution. The artificial TL is realized by loading a host microstrip line with alternate rectangular stubs and slots. The required series and shunt immittances are respectively provided by the slot and the stub. Due to the distributed nature of these immittances, the resultant phase response presents theoretically infinite RH and LH alternate bands, thus being appropriate for multiband applications. The design methodology is described with the help of a proposed TLs-based equivalent circuit and highlights the simplicity for balance condition. Full wave simulated results of the dispersion characteristics and frequency response of a unit-cell and a three-cells structure are presented.

  10. Resilience of electricity grids against transmission line overloads under wind power injection at different nodes. (United States)

    Schiel, Christoph; Lind, Pedro G; Maass, Philipp


    A steadily increasing fraction of renewable energy sources for electricity production requires a better understanding of how stochastic power generation affects the stability of electricity grids. Here, we assess the resilience of an IEEE test grid against single transmission line overloads under wind power injection based on the dc power flow equations and a quasi-static grid response to wind fluctuations. Thereby we focus on the mutual influence of wind power generation at different nodes. We find that overload probabilities vary strongly between different pairs of nodes and become highly affected by spatial correlations of wind fluctuations. An unexpected behaviour is uncovered: for a large number of node pairs, increasing wind power injection at one node can increase the power threshold at the other node with respect to line overloads in the grid. We find that this seemingly paradoxical behaviour is related to the topological distance of the overloaded line from the shortest path connecting the wind nodes. In the considered test grid, it occurs for all node pairs, where the overloaded line belongs to the shortest path.

  11. Thermal analysis of a transmission line for Traveling Wave Tube TWT

    International Nuclear Information System (INIS)

    Chbiki, Mounir; Laraqi, Najib; Jarno, Jean-François; Herrewyn, Jacques; Silva Botelho, Tony da


    A new analytical method has been developed to study the delay line of Traveling Waves Tubes (TWT). Our study is focused on the analysis of the hot lines shrinking phenomenon. In the studied case, unlike brazed configuration, the contact areas are not perfect, resulting in a diminution of the heat transfer process. In this work, we highlight the influence of the macro-constriction on the heat transfer rate in the various parts of a TWT the geometry of which is also relatively complex. We propose in this work an analytical study of the thermal behavior of a transmission line in established regime. First, we determine the individual thermal resistance of each component. Secondly, we estimate the global resistance of the device according to the geometrical parameters and the respective conductivities of the various elements of this line. In this analytical model, we proceed to parametric studies in order to determine the geometrical configurations that will provide the lowest global thermal resistance. We will emphasize the potential gain according to the used materials and the increase of contact areas.

  12. Influence of nonuniform external magnetic fields and anode--cathode shaping on magnetic insulation in coaxial transmission lines

    International Nuclear Information System (INIS)

    Mostrom, M.A.


    Coaxial transmission lines, used to transfer the high voltage pulse into the diode region of a relativistic electron beam generator, have been studied using the two-dimensional time-dependent fully relativistic and electromagnetic particle simulation code CCUBE. A simple theory of magnetic insulation that agrees well with simulation results for a straight cylindrical coax in a uniform external magnetic field is used to interpret the effects of anode--cathode shaping and nonuniform external magnetic fields. Loss of magnetic insulation appears to be minimized by satisfying two conditions: (1) the cathode surface should follow a flux surface of the external magnetic field; (2) the anode should then be shaped to insure that the magnetic insulation impedance, including transients, is always greater than the effective load impedance wherever there is an electron flow in the anode--cathode gap

  13. Origin of spin-dependent asymmetries in electron transmission through ultrathin ferromagnetic films

    International Nuclear Information System (INIS)

    Gokhale, M.P.; Mills, D.L.


    We present theoretical calculations of exchange asymmetries in the transmission of electrons through ultrathin films of ferromagnetic Fe. The results account nicely for the magnitude of the asymmetries observed by Pappas et al. in photoemission studies of Cu covered by an ultrathin film of Fe. We argue that exchange asymmetry in the transmissivity of the Fe film, rather than the spin dependence of the electron mean free path, is responsible for the effects reported by these authors

  14. Secure and Time-Aware Communication of Wireless Sensors Monitoring Overhead Transmission Lines. (United States)

    Mazur, Katarzyna; Wydra, Michal; Ksiezopolski, Bogdan


    Existing transmission power grids suffer from high maintenance costs and scalability issues along with a lack of effective and secure system monitoring. To address these problems, we propose to use Wireless Sensor Networks (WSNs) as a technology to achieve energy efficient, reliable, and low-cost remote monitoring of transmission grids. With WSNs, smart grid enables both utilities and customers to monitor, predict and manage energy usage effectively and react to possible power grid disturbances in a timely manner. However, the increased application of WSNs also introduces new security challenges, especially related to privacy, connectivity, and security management, repeatedly causing unpredicted expenditures. Monitoring the status of the power system, a large amount of sensors generates massive amount of sensitive data. In order to build an effective Wireless Sensor Network (WSN) for a smart grid, we focus on designing a methodology of efficient and secure delivery of the data measured on transmission lines. We perform a set of simulations, in which we examine different routing algorithms, security mechanisms and WSN deployments in order to select the parameters that will not affect the delivery time but fulfill their role and ensure security at the same time. Furthermore, we analyze the optimal placement of direct wireless links, aiming at minimizing time delays, balancing network performance and decreasing deployment costs.

  15. Big George to Carter Mountain 115-kV transmission line project, Park and Hot Springs Counties, Wyoming. Environmental Assessment

    Energy Technology Data Exchange (ETDEWEB)


    The Western Area Power Administration (Western) is proposing to rebuild, operate, and maintain a 115-kilovolt (kV) transmission line between the Big George and Carter Mountain Substations in northwest Wyoming (Park and Hot Springs Counties). This environmental assessment (EA) was prepared in compliance with the National Environmental Policy Act (NEPA) and the regulations of the Council on Environmental Quality (CEQ) and the Department of Energy (DOE). The existing Big George to Carter Mountain 69-kV transmission line was constructed in 1941 by the US Department of Interior, Bureau of Reclamation, with 1/0 copper conductor on wood-pole H-frame structures without an overhead ground wire. The line should be replaced because of the deteriorated condition of the wood-pole H-frame structures. Because the line lacks an overhead ground wire, it is subject to numerous outages caused by lightning. The line will be 54 years old in 1995, which is the target date for line replacement. The normal service life of a wood-pole line is 45 years. Under the No Action Alternative, no new transmission lines would be built in the project area. The existing 69-kV transmission line would continue to operate with routine maintenance, with no provisions made for replacement.

  16. Commissioning of the 28 GHz ECRH power transmission line for the TJ-II stellarator

    Energy Technology Data Exchange (ETDEWEB)

    Martínez-Fernández, J., E-mail: [Laboratorio Nacional de Fusión (LNF), Centro de Investigaciones Tecnológicas, Medioambientales y Tecnológicas (CIEMAT), Av/Complutense 40, 28040 Madrid (Spain); Cappa, Á. [Laboratorio Nacional de Fusión (LNF), Centro de Investigaciones Tecnológicas, Medioambientales y Tecnológicas (CIEMAT), Av/Complutense 40, 28040 Madrid (Spain); Chirkov, A. [Institute of Applied Physics, Russian Academy of Sciences, Nizhny Novgorod (Russian Federation); Ros, A.; Tolkachev, A.; Catalán, G.; Soleto, A.; Redondo, M. [Laboratorio Nacional de Fusión (LNF), Centro de Investigaciones Tecnológicas, Medioambientales y Tecnológicas (CIEMAT), Av/Complutense 40, 28040 Madrid (Spain); Doane, J.L.; Anderson, J.P. [General Atomics, P.O. Box 85608, San Diego, CA 92186-5608 (United States)


    Highlights: • The 28 GHz power transmission line of the TJ-II stellarator is described. • Mismatch and alignment problems are covered, presenting infrared measurements. • Beam distortion in the matching optics unit led to unwanted modes in the waveguide. • After a redesign distortion was eliminated and coupling maximized. • Final measurements suggest finer alignment must be performed. - Abstract: The commissioning of the 28 GHz power transmission line of the TJ-II stellarator, designed for the excitation of electron Bernstein waves (EBW) through the O-X-B mode conversion process, is presented in this paper. Based upon a comprehensive set of thermal measurements, its purpose is to go into details about the several problems that arouse during the whole process, namely higher order modes excitation because of the wider beam size and alignment mismatches at the waveguide mouth. All these drawbacks may have prevented the correct O-X mode conversion, thus providing a reasonable explanation for the unsuccessful EBW heating experiments.

  17. Support vector machine based fault classification and location of a long transmission line

    Directory of Open Access Journals (Sweden)

    Papia Ray


    Full Text Available This paper investigates support vector machine based fault type and distance estimation scheme in a long transmission line. The planned technique uses post fault single cycle current waveform and pre-processing of the samples is done by wavelet packet transform. Energy and entropy are obtained from the decomposed coefficients and feature matrix is prepared. Then the redundant features from the matrix are taken out by the forward feature selection method and normalized. Test and train data are developed by taking into consideration variables of a simulation situation like fault type, resistance path, inception angle, and distance. In this paper 10 different types of short circuit fault are analyzed. The test data are examined by support vector machine whose parameters are optimized by particle swarm optimization method. The anticipated method is checked on a 400 kV, 300 km long transmission line with voltage source at both the ends. Two cases were examined with the proposed method. The first one is fault very near to both the source end (front and rear and the second one is support vector machine with and without optimized parameter. Simulation result indicates that the anticipated method for fault classification gives high accuracy (99.21% and least fault distance estimation error (0.29%.

  18. Transmission-Line Readout with Good Time and Space Resolutions for Planacon MCP-PMTs

    CERN Document Server

    Tang, F; Byrum, K; Drake, G; Ertley, C; Frisch, H; Genat, J-F; May, E


    With commercially-available multi-anode microchannel plate photomultiplier tubes (MCP-PMT) and electronics, resolutions significantly better than 10 psec have been achieved in small systems with a few readout channels[1,2]. For large-scale time-of-flight systems used in particle physics, which may cover tens of square meters, a solution must be found with a manageable number of electronics channels and low total power consumption on the readout electronics without degrading the system timing resolution. We present here the design of a transmission-line readout for a Photonis Planacon MCP-PMT that has these characteristics. The tube, which is 5 cm square, is characterized by signal pulse rise times in the order of 200 psec and transit time spreads (TTS) in the order of 25 psec[1, 2]. The model 85011-011 MCP has 1024 anode pads laid out in an array of 32 by 32 on the back of the tube. The proposed readout is implemented on a Rogers 4350B printed circuit board with 32 parallel 50-ohm transmission lines on 1.6 mm...

  19. A novel structure of transmission line pulse transformer with mutually coupled windings. (United States)

    Yu, Binxiong; Su, Jiancang; Li, Rui; Zhao, Liang; Zhang, Xibo; Wang, Junjie


    A novel structure of transmission line transformer (TLT) with mutually coupled windings is described in this paper. All transmission lines except the first stage of the transformer are wound on a common ferrite core for the TLT with this structure. A referral method was introduced to analyze the TLT with this structure, and an analytic expression of the step response was derived. It is shown that a TLT with this structure has a significantly slower droop rate than a TLT with other winding structures and the number of ferrite cores needed is largely reduced. A four-stage TLT with this structure was developed, whose input and output impedance were 4.2 Ω and 67.7 Ω, respectively. A frequency response test of the TLT was carried out. The test results showed that pulse response time of the TLT is several nanoseconds. The TLT described in this paper has the potential to be used as a rectangle pulse transformer with very fast response time.

  20. A transmission line model for propagation in elliptical core optical fibers (United States)

    Georgantzos, E.; Papageorgiou, C.; Boucouvalas, A. C.


    The calculation of mode propagation constants of elliptical core fibers has been the purpose of extended research leading to many notable methods, with the classic step index solution based on Mathieu functions. This paper seeks to derive a new innovative method for the determination of mode propagation constants in single mode fibers with elliptic core by modeling the elliptical fiber as a series of connected coupled transmission line elements. We develop a matrix formulation of the transmission line and the resonance of the circuits is used to calculate the mode propagation constants. The technique, used with success in the case of cylindrical fibers, is now being extended for the case of fibers with elliptical cross section. The advantage of this approach is that it is very well suited to be able to calculate the mode dispersion of arbitrary refractive index profile elliptical waveguides. The analysis begins with the deployment Maxwell's equations adjusted for elliptical coordinates. Further algebraic analysis leads to a set of equations where we are faced with the appearance of harmonics. Taking into consideration predefined fixed number of harmonics simplifies the problem and enables the use of the resonant circuits approach. According to each case, programs have been created in Matlab, providing with a series of results (mode propagation constants) that are further compared with corresponding results from the ready known Mathieu functions method.

  1. A transmission line model for propagation in elliptical core optical fibers

    International Nuclear Information System (INIS)

    Georgantzos, E.; Boucouvalas, A. C.; Papageorgiou, C.


    The calculation of mode propagation constants of elliptical core fibers has been the purpose of extended research leading to many notable methods, with the classic step index solution based on Mathieu functions. This paper seeks to derive a new innovative method for the determination of mode propagation constants in single mode fibers with elliptic core by modeling the elliptical fiber as a series of connected coupled transmission line elements. We develop a matrix formulation of the transmission line and the resonance of the circuits is used to calculate the mode propagation constants. The technique, used with success in the case of cylindrical fibers, is now being extended for the case of fibers with elliptical cross section. The advantage of this approach is that it is very well suited to be able to calculate the mode dispersion of arbitrary refractive index profile elliptical waveguides. The analysis begins with the deployment Maxwell’s equations adjusted for elliptical coordinates. Further algebraic analysis leads to a set of equations where we are faced with the appearance of harmonics. Taking into consideration predefined fixed number of harmonics simplifies the problem and enables the use of the resonant circuits approach. According to each case, programs have been created in Matlab, providing with a series of results (mode propagation constants) that are further compared with corresponding results from the ready known Mathieu functions method

  2. A two-dimensional uniplanar transmission-line metamaterial with a negative index of refraction

    International Nuclear Information System (INIS)

    Elek, Francis; Eleftheriades, George V


    A uniplanar transmission-line (TL) network has been loaded with lumped elements (chip or printed), enabling one to achieve a two-dimensional (2D) uniplanar negative-refractive-index (NRI) metamaterial. The metamaterial consists of a 2D array of unit cells, composed of TL sections connected in series and loaded in a specified manner. The unit cell dimensions can be designed to be much smaller than the operating wavelength, enabling one to identify the structure as an effective medium, with a negative index of refraction. This NRI metamaterial supports transverse electric (TE) waves, as opposed to related previous work on NRI-TL media that supported transverse magnetic (TM) waves. The dispersion characteristics are calculated using a simple, fast 2D loaded TL model with periodic (Bloch) boundary conditions. Subsequently the dispersion relation is simplified in the homogeneous limit, thus allowing one to identify effective permittivities and permeabilities, which are shown to be simultaneously negative. Simulations demonstrating the negative refraction of a plane wave on an interface between such a NRI uniplanar metamaterial and a commensurate positive-refractive-index (PRI) metamaterial verify the validity of the proposed concept and theory. A fully printed unit cell is presented at microwave frequencies (∼10 GHz) along with a prescription for synthesizing an isotropic 3D transmission line NRI metamaterial based on this unit cell

  3. Method and apparatus for magnetic resonance imaging and spectroscopy using microstrip transmission line coils (United States)

    Zhang, Xiaoliang; Ugurbil, Kamil; Chen, Wei


    Apparatus and method for MRI imaging using a coil constructed of microstrip transmission line (MTL coil) are disclosed. In one method, a target is positioned to be imaged within the field of a main magnetic field of a magnet resonance imaging (MRI) system, a MTL coil is positioned proximate the target, and a MRI image is obtained using the main magnet and the MTL coil. In another embodiment, the MRI coil is used for spectroscopy. MRI imaging and spectroscopy coils are formed using microstrip transmission line. These MTL coils have the advantageous property of good performance while occupying a relatively small space, thus allowing MTL coils to be used inside restricted areas more easily than some other prior art coils. In addition, the MTL coils are relatively simple to construct of inexpensive components and thus relatively inexpensive compared to other designs. Further, the MTL coils of the present invention can be readily formed in a wide variety of coil configurations, and used in a wide variety of ways. Further, while the MTL coils of the present invention work well at high field strengths and frequencies, they also work at low frequencies and in low field strengths as well.

  4. Research on the correlation between corona current spectrum and audible noise spectrum of HVDC transmission line (United States)

    Liu, Yingyi; Zhou, Lijuan; Liu, Yuanqing; Yuan, Haiwen; Ji, Liang


    Audible noise is closely related to corona current on a high voltage direct current (HVDC) transmission line. In this paper, we measured a large amount of audible noise and corona current waveforms simultaneously based on the largest outdoor HVDC corona cage all over the world. By analyzing the experimental data, the related statistical regularities between a corona current spectrum and an audible noise spectrum were obtained. Furthermore, the generation mechanism of audible noise was analyzed theoretically, and the related mathematical expression between the audible noise spectrum and the corona current spectrum, which is suitable for all of these measuring points in the space, has been established based on the electro-acoustic conversion theory. Finally, combined with the obtained mathematical relation, the internal reasons for these statistical regularities appearing in measured corona current and audible noise data were explained. The results of this paper not only present the statistical association regularities between the corona current spectrum and the audible noise spectrum on a HVDC transmission line, but also reveal the inherent reasons of these associated rules.

  5. Cryogenic Fiber Optic Sensors for Superconducting Magnets and Power Transmission Lines in High Energy Physics Applications

    CERN Document Server

    AUTHOR|(CDS)2081689; Bajko, Marta

    In the framework of the Luminosity upgrade of the Large Hadron Collider (HL - LHC), a remarkable R&D effort is now ongoing at the European Organization for Nuclear Research (CERN) in order to develop a new generation of accelerator magnets and superconducting power transmission lines. The magnet technology will be based on Nb$_{3}$Sn enabling to operate in the 11 - 13 T range. In parallel, in order to preserve the power converters from the increasing radiation level, high power transmission lines are foreseen to feed the magnets from free - radiation zones. These will be based on high temperature superconductors cooled down with helium gas in the range 5 - 30 K. The new technologies will require advanced design and fabrication approaches as well as adapted instrumentation for monitoring both the R&D phase and operation. Resistive sensors have been used so far for voltage, temperature and strain monitoring but their integration still suffers from the number of electrical wires and the complex compensat...

  6. Impedance of an annular-cathode indented-anode electron diode terminating a coaxial magnetically insulated transmission line

    International Nuclear Information System (INIS)

    Sanford, T.W.L.; Poukey, J.W.; Wright, T.P.; Bailey, J.; Heath, C.E.; Mock, R.; Spence, P.W.; Fockler, J.; Kishi, H.


    The impedance of a diode having an annular cathode and indented anode that terminates a coaxial MITL (magnetically insulated transmission line) is measured and compared with a semiempirical model developed from calculations made using the magIc code. The measurements were made on the 16-Ω electron accelerator HELIA (high-energy linear induction accelerator) operating at 3 MV. The model agrees with the measurements within the 10% measuring error and shows that the diode operates in either a load- or line-dominated regime depending on AK (anode-cathode) gap spacing. In the load-dominated regime, which corresponds to small AK gaps, the diode impedance is controlled by an effective anode-cathode gap, and the flow is approximately axial. In the line-dominated regime, which corresponds to large AK gaps, the impedance is independent of the AK gap and corresponds to the impedance associated with the minimum current solution of the MITL, with the flow becoming more radial as the AK gap is increased

  7. Impact of SSSC on Measured Impedance in Single Phase to Ground Fault Condition on 220 kV Transmission Line

    Directory of Open Access Journals (Sweden)

    Mohamed ZELLAGUI


    Full Text Available This paper presents and compares the impact of SSSC on measured impedance for single phase to ground fault condition. The presence of Static Synchronous SSSC on a transmission line has a great influence on the ZRelay in distance protection. The protection of the high voltage 220 kV single circuit transmission line in eastern Algerian electrical transmission networks is affected in the case with resistance fault RF. The paper investigate the effect of Static Synchronous Series Compensator (SSSC on the measured impedance (Relay taking into account the distance fault point (n and fault resistance (RF. The resultants simulation is performed in MATLAB software environment.

  8. Measurement of borders in power transmission lines; Medicao de fronteira em linhas de transmissao

    Energy Technology Data Exchange (ETDEWEB)

    Doria, Celso [Bandeirante Energia S.A., Sao Paulo, SP (Brazil)


    The creation of Bandeirantes Energia S/A, which is a energy distributor company and at the same time one of the four originated companies from the division of ELETROPAULO Eletricidade S/A, generated the need of consumed energy measurements. Different from a previous situation, which had been accomplished in the 230, 345 and 440 Kv transformer stations. With the aggravating of having been created two distribution companies by this division, which later possessed transmission lines in common finishing a border scenery of 88/138 kv in connection with CTEEP, EPTE, Furnas in station terminals and ELETROPAULO Metropolitana in transmission lines. In order to measure the consumed energy it has been necessary to install meters in all energy entrance subsystems, but there were certain cases for which part of the energy had been absorbed by other distribution company, some times before the connection with Bandeirantes some times after this connection to have been done. For these cases, it has been necessary to install meters at de middle of the line, it means installed meters at the border between the two companies. In February of 1999, they were initiate the studies of viability for these measurements implantation in all of the interface points among Bandeirantes and the other concessionaires, based on the premise that from 01/01/2000 on all the consumed energy by the company should be measured. In the end of May of 1999, with the design final definitions the studies were finished, after that, it has been started the equipment purchases and the actions to hire companies to execute these activities. Finally, in the last week of August of 1999 the construction activities were initiated and the circuits were energized in December of that year.

  9. An improved DPSO with mutation based on similarity algorithm for optimization of transmission lines loading

    International Nuclear Information System (INIS)

    Shayeghi, H.; Mahdavi, M.; Bagheri, A.


    Static transmission network expansion planning (STNEP) problem acquires a principal role in power system planning and should be evaluated carefully. Up till now, various methods have been presented to solve the STNEP problem. But only in one of them, lines adequacy rate has been considered at the end of planning horizon and the problem has been optimized by discrete particle swarm optimization (DPSO). DPSO is a new population-based intelligence algorithm and exhibits good performance on solution of the large-scale, discrete and non-linear optimization problems like STNEP. However, during the running of the algorithm, the particles become more and more similar, and cluster into the best particle in the swarm, which make the swarm premature convergence around the local solution. In order to overcome these drawbacks and considering lines adequacy rate, in this paper, expansion planning has been implemented by merging lines loading parameter in the STNEP and inserting investment cost into the fitness function constraints using an improved DPSO algorithm. The proposed improved DPSO is a new conception, collectivity, which is based on similarity between the particle and the current global best particle in the swarm that can prevent the premature convergence of DPSO around the local solution. The proposed method has been tested on the Garver's network and a real transmission network in Iran, and compared with the DPSO based method for solution of the TNEP problem. The results show that the proposed improved DPSO based method by preventing the premature convergence is caused that with almost the same expansion costs, the network adequacy is increased considerably. Also, regarding the convergence curves of both methods, it can be seen that precision of the proposed algorithm for the solution of the STNEP problem is more than DPSO approach.

  10. Study and Experiment on Non-Contact Voltage Sensor Suitable for Three-Phase Transmission Line. (United States)

    Zhou, Qiang; He, Wei; Xiao, Dongping; Li, Songnong; Zhou, Kongjun


    A voltage transformer, as voltage signal detection equipment, plays an important role in a power system. Presently, more and more electric power systems are adopting potential transformer and capacitance voltage transformers. Transformers are often large in volume and heavyweight, their insulation design is difficult, and an iron core or multi-grade capacitance voltage division structure is generally adopted. As a result, the detection accuracy of transformer is reduced, a huge phase difference exists between detection signal and voltage signal to be measured, and the detection signal cannot accurately and timely reflect the change of conductor voltage signal to be measured. By aiming at the current problems of electric transformation, based on electrostatic induction principle, this paper designed a non-contact voltage sensor and gained detection signal of the sensor through electrostatic coupling for the electric field generated by electric charges of the conductor to be measured. The insulation structure design of the sensor is simple and its volume is small; phase difference of sensor measurement is effectively reduced through optimization design of the electrode; and voltage division ratio and measurement accuracy are increased. The voltage sensor was tested on the experimental platform of simulating three-phase transmission line. According to the result, the designed non-contact voltage sensor can realize accurate and real-time measurement for the conductor voltage. It can be applied to online monitoring for the voltage of three-phase transmission line or three-phase distribution network line, which is in accordance with the development direction of the smart grid.

  11. Nanoporous metal film: An energy-dependent transmission device for electron waves

    International Nuclear Information System (INIS)

    Grech, S.; Degiovanni, A.; Lapena, L.; Morin, R.


    We measure electron transmission through free-standing ultrathin nanoporous gold films, using the coherent electron beam emitted by sharp field emission tips in a low energy electron projection microscope setup. Transmission coefficient versus electron wavelength plots show periodic oscillations between 75 and 850 eV. These oscillations result from the energy dependence of interference between paths through the gold and paths through the nanometer-sized pores of the film. We reveal that these films constitute high transmittance quantum devices acting on electron waves through a wavelength-dependent complex transmittance defined by the porosity and the thickness of the film.

  12. Aerodynamic instability of cables in transmission power lines; Inestabilidad aerodinamica en cables de lineas de transmision

    Energy Technology Data Exchange (ETDEWEB)

    Lopez Lopez, Alberto; Vilar Rojas, Jorge Ivan; Munoz Black, Celso J. [Instituto de Investigaciones Electricas, Cuernavaca (Mexico)


    One of the aerodynamic instabilities of transmission power lines cables is galloping, which consists in the appearance of important cable vibrations, mainly when the wind hits orthogonally the power line. In some cases the maximum amplitude that occurs reaches several meters, even when the wind velocities in a region are well below the value used for the mechanical design of the power lines. In general terms, galloping is associated with particular climatic conditions such as low temperatures and high humidities. In these conditions a coating of ice that adheres to the cable is formed, changing its transverse cross section, propitiating the galloping, although some authors have reported galloping without ice. These climatic conditions are presented mainly in the Northern part of our country and in the high regions of the mountain zones; nevertheless, the galloping phenomenon has been reported in few cases by Comision Federal de Electricidad (CFE). The possible expansion of the power lines in these regions of the country leads to prevent the measures needed to diminish the appearance of this phenomenon. In this paper mention is made in particular of the solution adopted to the galloping problem that has appeared in the transmission power line of Salamayuca to Reforma, Ciudad Juarez, Chihuahua (CFE,1991). [Espanol] Una de las inestabilidades aerodinamicas que se presentan en los cables de lineas de transmision es el galopeo, el cual consiste en la aparicion de vibraciones importantes de los cables, sobre todo cuando el flujo del viento incide ortogonalmente a la linea. En algunos casos las amplitudes maximas que se presentan llegan a ser de varios metros, aun cuando las velocidades del viento en una region esten muy por debajo del valor empleado para el diseno mecanico de las lineas. Generalmente, el galopeo se asocia con condiciones climaticas particulares como son las bajas temperaturas y altas humedades. En estas condiciones se forma una cubierta de hielo que se

  13. Aerodynamic instability of cables in transmission power lines; Inestabilidad aerodinamica en cables de lineas de transmision

    Energy Technology Data Exchange (ETDEWEB)

    Lopez Lopez, Alberto; Vilar Rojas, Jorge Ivan; Munoz Black, Celso J [Instituto de Investigaciones Electricas, Cuernavaca (Mexico)


    One of the aerodynamic instabilities of transmission power lines cables is galloping, which consists in the appearance of important cable vibrations, mainly when the wind hits orthogonally the power line. In some cases the maximum amplitude that occurs reaches several meters, even when the wind velocities in a region are well below the value used for the mechanical design of the power lines. In general terms, galloping is associated with particular climatic conditions such as low temperatures and high humidities. In these conditions a coating of ice that adheres to the cable is formed, changing its transverse cross section, propitiating the galloping, although some authors have reported galloping without ice. These climatic conditions are presented mainly in the Northern part of our country and in the high regions of the mountain zones; nevertheless, the galloping phenomenon has been reported in few cases by Comision Federal de Electricidad (CFE). The possible expansion of the power lines in these regions of the country leads to prevent the measures needed to diminish the appearance of this phenomenon. In this paper mention is made in particular of the solution adopted to the galloping problem that has appeared in the transmission power line of Salamayuca to Reforma, Ciudad Juarez, Chihuahua (CFE,1991). [Espanol] Una de las inestabilidades aerodinamicas que se presentan en los cables de lineas de transmision es el galopeo, el cual consiste en la aparicion de vibraciones importantes de los cables, sobre todo cuando el flujo del viento incide ortogonalmente a la linea. En algunos casos las amplitudes maximas que se presentan llegan a ser de varios metros, aun cuando las velocidades del viento en una region esten muy por debajo del valor empleado para el diseno mecanico de las lineas. Generalmente, el galopeo se asocia con condiciones climaticas particulares como son las bajas temperaturas y altas humedades. En estas condiciones se forma una cubierta de hielo que se


    Directory of Open Access Journals (Sweden)



    Full Text Available The Transmission Power Lines of new generation are described in the article (single- compact, double-circuit compact, double-circuit Controlled Self-compensating High Voltage Transmission Power Lines (CSHVL. Basic principles of creation, design elements and comparative characteristics of the transmission lines of the new generation are described, the advantages of its are showed. Methodical approaches to the choosing of a new generation of transmission lines and facilities management FACTS are formulated. Methodical approaches to the choice of options for transmission lines 220 kV and facilities management are shown.

  15. Single-phased Fault Location on Transmission Lines Using Unsynchronized Voltages

    Directory of Open Access Journals (Sweden)



    Full Text Available The increased accuracy into the fault's detection and location makes it easier for maintenance, this being the reason to develop new possibilities for a precise estimation of the fault location. In the field literature, many methods for fault location using voltages and currents measurements at one or both terminals of power grids' lines are presented. The double-end synchronized data algorithms are very precise, but the current transformers can limit the accuracy of these estimations. The paper presents an algorithm to estimate the location of the single-phased faults which uses only voltage measurements at both terminals of the transmission lines by eliminating the error due to current transformers and without introducing the restriction of perfect data synchronization. In such conditions, the algorithm can be used with the actual equipment of the most power grids, the installation of phasor measurement units with GPS system synchronized timer not being compulsory. Only the positive sequence of line parameters and sources are used, thus, eliminating the incertitude in zero sequence parameter estimation. The algorithm is tested using the results of EMTP-ATP simulations, after the validation of the ATP models on the basis of registered results in a real power grid.

  16. A surface acoustic wave electric field strength meter for environmental studies of HV transmission lines

    International Nuclear Information System (INIS)

    Grandolfo, M.; Ranghiasci, C.; Verona, E.


    In recent years, there has been a significant increase in concern over the health and safety aspects of high voltage transmission lines (HVTL). The majority of research has focused on effects directly or indirectly involved with the central nervous system, including physiological, ultrastructural, and biochemical alterations, changes in blood composition, behaviour, reproduction, and development. Several recent epidemiological reports have presented preliminary data suggesting an increase in the incidence of cancer among children and adults exposed to magnetic fields through living close to various types of electrical power lines or devices. With the increase in environmental concerns there has been a concomitant consideration of biological effects and health implications related to presently existing HVTL and those planned in the future. It was concluded that the electric and magnetic field strengths and the electrical discharges are the most important electrophysical factors. Thus, it has been deemed necessary to develop measuring means to determine the field strengths in areas surrounding electric installations, in particular at ground level. In the present paper an electric field meter, based on the use of a surface acoustic wave (SAW) delay line, is presented and the experimental results obtained are discussed

  17. Multipactor threshold calculation of coaxial transmission lines in microwave applications with nonstationary statistical theory

    International Nuclear Information System (INIS)

    Lin, S.; Li, Y.; Liu, C.; Wang, H.; Zhang, N.; Cui, W.; Neuber, A.


    This paper presents a statistical theory for the initial onset of multipactor breakdown in coaxial transmission lines, taking both the nonuniform electric field and random electron emission velocity into account. A general numerical method is first developed to construct the joint probability density function based on the approximate equation of the electron trajectory. The nonstationary dynamics of the multipactor process on both surfaces of coaxial lines are modelled based on the probability of various impacts and their corresponding secondary emission. The resonant assumption of the classical theory on the independent double-sided and single-sided impacts is replaced by the consideration of their interaction. As a result, the time evolutions of the electron population for exponential growth and absorption on both inner and outer conductor, in response to the applied voltage above and below the multipactor breakdown level, are obtained to investigate the exact mechanism of multipactor discharge in coaxial lines. Furthermore, the multipactor threshold predictions of the presented model are compared with experimental results using measured secondary emission yield of the tested samples which shows reasonable agreement. Finally, the detailed impact scenario reveals that single-surface multipactor is more likely to occur with a higher outer to inner conductor radius ratio

  18. Cross Talk Analysis on Multiple Coupled Transmission Lines; (The calculation of transfer functions on multiple coupled tansmission lines in an inhomogeneous dielectric medium)

    DEFF Research Database (Denmark)

    Dalby, Arne Brejning


    A flow graph relating voltages and the forward and reflected propagation modes (¿ TEM) on multiple coupled transmission lines in an inhomogeneous dielectric medium is presented. This flow graph directy gives the different transfer functions, including S-parameters, in matrix form needed to calcul......A flow graph relating voltages and the forward and reflected propagation modes (¿ TEM) on multiple coupled transmission lines in an inhomogeneous dielectric medium is presented. This flow graph directy gives the different transfer functions, including S-parameters, in matrix form needed...

  19. Numerical Calculation of Transient Thermal Characteristics in Gas-Insulated Transmission Lines

    Directory of Open Access Journals (Sweden)

    Hongtao Li


    Full Text Available For further knowledge of the thermal characteristics in gas-insulated transmission lines (GILs installed above ground, a finite-element model coupling fluid field and thermal field is established, in which the corresponding assumptions and boundary conditions are given.  Transient temperature rise processes of the GIL under the conditions of variable ambient temperature, wind velocity and solar radiation are respectively investigated. Equivalent surface convective heat transfer coefficient and heat flux boundary conditions are updated in the analysis process. Unlike the traditional finite element methods (FEM, the variability of the thermal properties with temperature is considered. The calculation results are validated by the tests results reported in the literature. The conclusion provides method and theory basis for the knowledge of transient temperature rise characteristics of GILs in open environment.

  20. Chebyshev approximations for the transmission integral for one single line in Moessbauer spectroscopy

    International Nuclear Information System (INIS)

    Flores-Lamas, H.


    An analytic expansion, to arbitrary accuracy, of the transmission integral (TI) for a single Moessbauer line is presented. This serves for calculating the effective thickness (T a ) of an absorber in Moessbauer spectroscopy even for T a >10. The new analytic expansion arises from substituting in the TI expression the exponential function by a Chebyshev polynomials series. A very fast converging series for TI is obtained and used as a test function in a least squares fit to a simulated spectrum. The test yields satisfactory results. The area and height parameters calculated were found to be in good agreement with earlier results. The present analytic method assumes that the source and absorber widths are different. ((orig.))

  1. Experimental research on Ku-band magnetically insulated transmission line oscillator

    Energy Technology Data Exchange (ETDEWEB)

    Jiang, Tao; Zhang, Jiande; He, Juntao; Li, Zhiqiang; Ling, Junpu [College of Optoelectric Science and Engineering, National University of Defense Technology, Hunan 410073 (China)


    An improved Ku-band magnetically insulated transmission line oscillator is proposed and investigated experimentally. In the particle-in-cell simulation, the Ku-band MILO generates the microwave with a power of 1.62 GW and a frequency of 13 GHz at the input voltage of 474 kV. The device is fabricated based on the simulation results, and an experiment system is designed. In the preliminary experiments, output microwave with frequency of 13.02 GHz, power of 150 MW, and pulse width of 17 ns is generated, under the diode voltage of 450 kV. Analysis on the experiment results shows that plasma produced due to the large current hitting to the outside of the collection tank is the essential cause for the low amplitude of the microwave power and short pulse width.

  2. Performance evaluation of a lossy transmission lines based diode detector at cryogenic temperature. (United States)

    Villa, E; Aja, B; de la Fuente, L; Artal, E


    This work is focused on the design, fabrication, and performance analysis of a square-law Schottky diode detector based on lossy transmission lines working under cryogenic temperature (15 K). The design analysis of a microwave detector, based on a planar gallium-arsenide low effective Schottky barrier height diode, is reported, which is aimed for achieving large input return loss as well as flat sensitivity versus frequency. The designed circuit demonstrates good sensitivity, as well as a good return loss in a wide bandwidth at Ka-band, at both room (300 K) and cryogenic (15 K) temperatures. A good sensitivity of 1000 mV/mW and input return loss better than 12 dB have been achieved when it works as a zero-bias Schottky diode detector at room temperature, increasing the sensitivity up to a minimum of 2200 mV/mW, with the need of a DC bias current, at cryogenic temperature.

  3. Design and manufacture of the RF power supply and RF transmission line for SANAEM project Prometheus (United States)

    Turemen, G.; Ogur, S.; Ahiska, F.; Yasatekin, B.; Cicek, E.; Ozbey, A.; Kilic, I.; Unel, G.; Alacakir, A.


    A 1-5 MeV proton beamline is being built by the Turkish Atomic Energy Authority in collaboration with a number of graduate students from different universities. The primary goal of the project, is to acquire the design ability and manufacturing capability of all the components locally. SPP will be an accelerator and beam diagnostics test facility and it will also serve the detector development community with its low beam current. This paper discusses the design and construction of the RF power supply and the RF transmission line components such as its waveguide converters and its circulator. Additionally low and high power RF test results are presented to compare the performances of the locally produced components to the commercially available ones.

  4. Time Domain Analysis of Graphene Nanoribbon Interconnects Based on Transmission Line ‎Model

    Directory of Open Access Journals (Sweden)

    S. Haji Nasiri


    Full Text Available Time domain analysis of multilayer graphene nanoribbon (MLGNR interconnects, based on ‎transmission line modeling (TLM using a six-order linear parametric expression, has been ‎presented for the first time. We have studied the effects of interconnect geometry along with ‎its contact resistance on its step response and Nyquist stability. It is shown that by increasing ‎interconnects dimensions their propagation delays are increased and accordingly the system ‎becomes relatively more stable. In addition, we have compared time responses and Nyquist ‎stabilities of MLGNR and SWCNT bundle interconnects, with the same external dimensions. ‎The results show that under the same conditions, the propagation delays for MLGNR ‎interconnects are smaller than those of SWCNT bundle interconnects are. Hence, SWCNT ‎bundle interconnects are relatively more stable than their MLGNR rivals.‎

  5. Pollutant Dispersion Modeling in Natural Streams Using the Transmission Line Matrix Method

    Directory of Open Access Journals (Sweden)

    Safia Meddah


    Full Text Available Numerical modeling has become an indispensable tool for solving various physical problems. In this context, we present a model of pollutant dispersion in natural streams for the far field case where dispersion is considered longitudinal and one-dimensional in the flow direction. The Transmission Line Matrix (TLM, which has earned a reputation as powerful and efficient numerical method, is used. The presented one-dimensional TLM model requires a minimum input data and provides a significant gain in computing time. To validate our model, the results are compared with observations and experimental data from the river Severn (UK. The results show a good agreement with experimental data. The model can be used to predict the spatiotemporal evolution of a pollutant in natural streams for effective and rapid decision-making in a case of emergency, such as accidental discharges in a stream with a dynamic similar to that of the river Severn (UK.

  6. Joint interval reliability for Markov systems with an application in transmission line reliability

    International Nuclear Information System (INIS)

    Csenki, Attila


    We consider Markov reliability models whose finite state space is partitioned into the set of up states U and the set of down states D . Given a collection of k disjoint time intervals I l =[t l ,t l +x l ], l=1,...,k, the joint interval reliability is defined as the probability of the system being in U for all time instances in I 1 union ... union I k . A closed form expression is derived here for the joint interval reliability for this class of models. The result is applied to power transmission lines in a two-state fluctuating environment. We use the Linux versions of the free packages Maxima and Scilab in our implementation for symbolic and numerical work, respectively

  7. Joint interval reliability for Markov systems with an application in transmission line reliability

    Energy Technology Data Exchange (ETDEWEB)

    Csenki, Attila [School of Computing and Mathematics, University of Bradford, Bradford, West Yorkshire, BD7 1DP (United Kingdom)]. E-mail:


    We consider Markov reliability models whose finite state space is partitioned into the set of up states {sub U} and the set of down states {sub D}. Given a collection of k disjoint time intervals I{sub l}=[t{sub l},t{sub l}+x{sub l}], l=1,...,k, the joint interval reliability is defined as the probability of the system being in {sub U} for all time instances in I{sub 1} union ... union I{sub k}. A closed form expression is derived here for the joint interval reliability for this class of models. The result is applied to power transmission lines in a two-state fluctuating environment. We use the Linux versions of the free packages Maxima and Scilab in our implementation for symbolic and numerical work, respectively.

  8. Sound transmission through double cylindrical shells lined with porous material under turbulent boundary layer excitation (United States)

    Zhou, Jie; Bhaskar, Atul; Zhang, Xin


    This paper investigates sound transmission through double-walled cylindrical shell lined with poroelastic material in the core, excited by pressure fluctuations due to the exterior turbulent boundary layer (TBL). Biot's model is used to describe the sound wave propagating in the porous material. Three types of constructions, bonded-bonded, bonded-unbonded and unbonded-unbonded, are considered in this study. The power spectral density (PSD) of the inner shell kinetic energy is predicted for two turbulent boundary layer models, different air gap depths and three types of polyimide foams, respectively. The peaks of the inner shell kinetic energy due to shell resonance, hydrodynamic coincidence and acoustic coincidence are discussed. The results show that if the frequency band over the ring frequency is of interest, an air gap, even if very thin, should exist between the two elastic shells for better sound insulation. And if small density foam has a high flow resistance, a superior sound insulation can still be maintained.

  9. Experimental and numerical assessment of EPS wind action on long span transmission line conductors

    Energy Technology Data Exchange (ETDEWEB)

    Paluch, M.J. [PPGE, Universidade de Passo Fundo (UPF), Passo Fundo, RS (Brazil); Cappellari, T.T.O. [Caixa Economica Federal, UFRGS, Porto Alegre, RS (Brazil); Riera, J.D. [LDEC, PPGEC, Universidade Federal do Rio Grande do Sul (UFRGS), Porto Alegre, RS (Brazil)


    The paper presents a thorough evaluation of the action of extended pressure system (EPS) winds on a long span transmission line crossing of a water way, which was monitored during a period of about a year for the determination of its fluctuating response. Additionally, a numerical model and ensuing analysis of the cable crossing subjected to stationary turbulent wind is presented and compared with the experimental observations. In fact, the former serve to complement the experimental findings by supplying information that could not be directly measured in the field. The latter, in turn, constitute a confirmation of the Monte Carlo full simulation analysis of the cable crossing, which includes a 3D model of the structural system as well as a 3D model of the stationary wind field. One important result of the studies is that full three-dimensional models of both the cable crossing and the wind fields are needed to correctly evaluate the structural response. (author)

  10. Glass fiber -reinforced plastic tapered poles for transmission and distribution lines: development and experimental study

    International Nuclear Information System (INIS)

    Ibrahim, S.; Burachysnsky, V.; Polyzois, D.


    A research project to develop lightweight poles for use in power transmission and distribution lines and involving the use of glass fiber-reinforced plastic using the filament winding process is described. Twelve full scale specimen poles were designed, fabricated and subjected to cantilever bending to test failure modes. The test parameters included fiber orientation, ratio of longitudinal-to-circumferential fiber, and the number of layers. Results showed that local buckling was the most dominant failure mode, attributable to the high radius-to-thickness ratio of the specimen poles. Overall, however, these fiber-reinforced plastic poles compared favourably to wooden poles in carrying capacity with significant weight reduction. Lateral displacement at ultimate loads did not exceed the acceptable limit of 10 per cent of the specimen free length. 7 refs., 3 tabs., 2 figs

  11. Typical Motion and Extinction Characteristics of the Secondary Arcs Associated with Half-Wavelength Transmission Lines

    International Nuclear Information System (INIS)

    Cong Haoxi; Li Qingmin; Xing Jinyuan; Li Jinsong


    Secondary arc discharge is a complicated physical phenomenon and one of the key fundamental issues associated with ultra high voltage (UHV) half-wavelength transmission lines (HWTL). With the establishment of a physical simulation platform for the HWTLs, experiments were carried out regarding the motion and extinction characteristics of secondary arcs. The cathode arc root and the anode arc root were found to show an obvious polarity effect while the arc column was moving in a spiral, due to their different motion mechanisms. The extinction behavior was also recorded and experiments were designed with different compensation conditions. Results show that the arcing time can be greatly reduced if there exists an electrical compensation network. The research provides fundamentals for understanding the physics involved, especially the motion and extinction mechanisms of the secondary arcs. (low temperature plasma)

  12. Power charging and discharging characteristics of smes connected to artificial transmission line

    International Nuclear Information System (INIS)

    Nitta, T.; Okada, T.; Shirai, Y.


    To consider the characteristics of SMES and to investigate problems on the operations of SMES in power systems, we carried out some experiments on an experimental network. In the network, a small superconducting magnet is connected to a small synchronous generator through a double thyristorized converter and transformers. The generator is connected to the regional power system through artifitial transmission lines, AC power into or out of SMES and reactive power are controlled. Furthermore, a computer simulation program is made for the experimental system. The results of the simulation are compared with those of the experiments. For the experiments and the simulation, the harmonics current-flow, power-flow, characteristics of the generator and so on, are discussed

  13. Effect of feeders in 3D modeling of low impedance multilayer CPW transmission line (United States)

    Zaini, R. I.; Kyabaggu, P. B. K.; Sinulingga, E. P.


    Improved characteristics with low dissipation loss MMICs are highly desirable for wireless communications. However, the current industrial MMIC design is mainly based on microstrip concept which suffered from parasitic and unwanted phenomenon especially at higher frequency (>20 GHz). On the other hand, for future wireless technology, higher frequency operation is required and on-wafer microwave characterizations as well as precise modeling of 3D Multilayer CPW components are vital. This project concerns with understanding of the microwave characteristics behavior of Multilayer CPW components in MMIC applications. Feeder effect as unwanted parts in the characteristics has been investigated to determine its relation with the half wavelength resonance of the Multilayer CPW Low Impedance Transmission Line.

  14. Design of a Wireless Sensor Module for Monitoring Conductor Galloping of Transmission Lines. (United States)

    Huang, Xinbo; Zhao, Long; Chen, Guimin


    Conductor galloping may cause flashovers and even tower collapses. The available conductor galloping monitoring methods often employ acceleration sensors to measure the conductor translations without considering the conductor twist. In this paper, a new sensor for monitoring conductor galloping of transmission lines based on an inertial measurement unit and wireless communication is proposed. An inertial measurement unit is used for collecting the accelerations and angular rates of a conductor, which are further transformed into the corresponding geographic coordinate frame using a quaternion transformation to reconstruct the galloping of the conductor. Both the hardware design and the software design are described in details. The corresponding test platforms are established, and the experiments show the feasibility and accuracy of the proposed monitoring sensor. The field operation of the proposed sensor in a conductor spanning 734 m also shows its effectiveness.

  15. Simplified microstrip discontinuity modeling using the transmission line matrix method interfaced to microwave CAD (United States)

    Thompson, James H.; Apel, Thomas R.


    A technique for modeling microstrip discontinuities is presented which is derived from the transmission line matrix method of solving three-dimensional electromagnetic problems. In this technique the microstrip patch under investigation is divided into an integer number of square and half-square (triangle) subsections. An equivalent lumped-element model is calculated for each subsection. These individual models are then interconnected as dictated by the geometry of the patch. The matrix of lumped elements is then solved using either of two microwave CAD software interfaces with each port properly defined. Closed-form expressions for the lumped-element representation of the individual subsections is presented and experimentally verified through the X-band frequency range. A model demonstrating the use of symmetry and block construction of a circuit element is discussed, along with computer program development and CAD software interface.

  16. Ontario Hydro's environmental monitoring program for HV [high voltage] transmission line projects

    International Nuclear Information System (INIS)

    Braekevelt, P.N.


    Responsible monitoring and control of environmental impacts is key to obtaining future needed approvals for new high voltage (HV) transmission line projects. Ontario Hydro's environmental monitoring program was developed as a highly structured, self-imposed monitoring system to relieve government agencies of the responsibility of developing a similar external program. The goal was to be self-policing. The historical development, program structure, standards, priority ratings, documentation, communication and computerization of the program is described. The most effective way to minimize environmental impacts is to avoid sensitive features at the route selection stage, well before any construction takes place. The environmental monitoring program is based on the following blueprint: each crew member is responsible for environmental protection; environmental problems are to be resolved at the lowest level possible; potential concerns should be resolved before they become problems; known problems should be dealt with quickly to minimize impacts; team members should work cooperatively; and formal and regular communication is emphasized

  17. Optimized transmission-line impedance transformers for petawatt-class pulsed-power accelerators

    Directory of Open Access Journals (Sweden)

    D. R. Welch


    Full Text Available We have developed 1D analytic and 2D fully electromagnetic models of radial transmission-line impedance transformers. The models have been used to quantify the power-transport efficiency and pulse sharpening of such transformers as a function of voltage pulse width and impedance profile. For the cases considered, we find that in the limit as Γ→0 (where Γ is the ratio of the pulse width to the one-way transit time of the transformer, the transport efficiency is maximized when the impedance profile is exponential. As Γ increases from zero, the optimum profile gradually deviates from an exponential. A numerical procedure is presented that determines the optimum profile for a given pulse shape and width. The procedure can be applied to optimize the design of impedance transformers used in petawatt-class pulsed-power accelerators.

  18. MCD 80: A modular coupling system for power line carrier transmission

    Energy Technology Data Exchange (ETDEWEB)

    Fischer, B; Mayer, M


    Power line carrier (PLC) links are of great importance to power supply utilities. The communications equipment is linked to the H.V. system by a coupling device. Brown Boveri have developed a new modular coupling system MCD 80 which is compact, programmable and economical. The benefit of years of experience in the field went into its development. With the new system, optimum PLC couplings, R.F. through-connections and junction networks are possible for all H.V. transmission systems. A general look at the subject of PLC couplings is followed by a closer look at the main components, such as the programmable high pass coupling unit, band pass coupling unit, hybrid, separating filter, R.F. junction network and attenuator. Some typical examples are described.

  19. Characteristics of a four element gyromagnetic nonlinear transmission line array high power microwave source

    Energy Technology Data Exchange (ETDEWEB)

    Johnson, J. M., E-mail:; Reale, D. V.; Garcia, R. S.; Cravey, W. H.; Neuber, A. A.; Dickens, J. C.; Mankowski, J. J. [Center for Pulsed Power and Power Electronics Department of Electrical and Computer Engineering, Texas Tech University, Lubbock, Texas 79409 (United States); Krile, J. T. [Department of Electromagnetics and Sensor Systems, Naval Surface Warfare Center - Dahlgren Division, Dahlgren, Virginia 22448 (United States)


    In this paper, a solid-state four element array gyromagnetic nonlinear transmission line high power microwave system is presented as well as a detailed description of its subsystems and general output capabilities. This frequency agile S-band source is easily adjusted from 2-4 GHz by way of a DC driven biasing magnetic field and is capable of generating electric fields of 7.8 kV/m at 10 m correlating to 4.2 MW of RF power with pulse repetition frequencies up to 1 kHz. Beam steering of the array at angles of ±16.7° is also demonstrated, and the associated general radiation pattern is detailed.

  20. Power electron beam front shortening in magnetically insulated transmission line with inner coaxial dielectric insert

    International Nuclear Information System (INIS)

    Galstjan, E.A.; Kazanskiy, L.N.


    By now the technology of high-power high-current relativistic electron beams with microsecond duration has been developed. The same technology is used in high-power electric pulse generation. However at present the high-power beams of subnanosecond duration are necessary for some investigations and applications. The maximum power parameter achieved by means of the usual technology is limited by a value in the range of 100-300 MW. For this reason a search for new ways to generate high-power REB (relativistic electron beam) is a topical problem. It is obvious that this problem may be reduced to the generation of pulses with a subnanosecond front duration. There are many methods to shorten a pulse duration to its front duration for instance, by using parts of short-circuited transmission lines

  1. Fretting Wear Behaviors of Aluminum Cable Steel Reinforced (ACSR Conductors in High-Voltage Transmission Line

    Directory of Open Access Journals (Sweden)

    Xingchi Ma


    Full Text Available This work reports the fretting wear behavior of aluminum cable steel reinforced (ACSR conductors for use in high-voltage transmission line. Fretting wear tests of Al wires were conducted on a servo-controlled fatigue testing machine with self-made assistant apparatus, and their fretting process characteristics, friction force, wear damage, and wear surface morphology were detailed analyzed. The results show that the running regime of Al wires changes from a gross slip regime to a mixed regime more quickly as increasing contact load. With increasing amplitudes, gross slip regimes are more dominant under contact loads of lower than 30 N. The maximum friction force is relatively smaller in the NaCl solution than in a dry friction environment. The primary wear mechanisms in dry friction environments are abrasive wear and adhesive wear whereas abrasive wear and fatigue damage are dominant in NaCl solution.

  2. Design of a 2 Tesla transmission line magnet for the VLHC

    CERN Document Server

    Foster, G W; Novitski, I


    A prototype of the transmission line magnet for the Very Large Hadron Collider is being designed at Fermilab. This is a single-turn warm iron superconducting magnet in a "Double-C" configuration. Iron poles form a high quality alternating-gradient magnet field in two 20 mm height beam gaps. Simple magnet construction and manufacturing processes and a room temperature iron yoke give a significant reduction in magnet cost. Open beam gaps simplify magnetic measurements and vacuum chamber installation. The magnet mechanical stability was investigated for several mechanical models. A high field quality over the whole range (0.1 T-2.0 T) of field variation was calculated using correcting holes in the iron poles. The magnet optimization was carried out by POISSON, OPERA 2D and ANSYS codes. The results of magnet design and model tests are presented. (6 refs).

  3. Measurements of a crenelated iron pole tip for the VLHC transmission line magnet

    CERN Document Server

    Di Marco, J; Kashikhin, V V; Makarov, A A; Schlabach, P; MacKay, W W


    The Very Large Hadron Collider (VLHC) is under conceptual design in Fermilab. One option under development is a 2-Tesla warm iron 2-in-1 single turn superferric magnet built around an 80 kA superconducting transmission line. A normal-conducting test stand was built to optimize the iron lamination shape for this magnet. It uses a water- cooled copper winding to provide the 100 kA-turns needed to generate 2 Tesla fields in both 20 mm air gaps of the magnet. A magnetic measurement facility has been set up for magnetic field mapping, which includes a flat measurement coil, precision stage for coil motion and integrator. Results from a first test of the "crenelation" technique to mitigate the saturation sextupole in iron magnets are described and future plans are discussed. (5 refs).

  4. Grandy Brook Station to Hope Brook Station transmission line, environmental impact statement

    Energy Technology Data Exchange (ETDEWEB)


    Newfoundland and Labrador Hydro proposes to construct a 138kW transmission line to provide power and energy requirements of the Hope Brook Gold Mine. The proposed route runs approximately 33 km adjacent to Route 480, requiring a cleared right-of-way approximately 30 m wide, with access provided by an all terrain vehicle trail. Concerns were expressed about possible adverse effects on terrestrial and aquatic habitat, water resources, resource utilization, wildlife, and historic resources. This document provides a description of the project and the rationale; the baseline environmental conditions; the environmental protection plan agreed to by Hydro, including mitigation measures and predicted impacts; rehabilitation measures; monitoring; and public involvement. Hydro's studies concluded there would be no significant impact on the environment, including the La Poile caribou herd or the raptors affected. 33 refs., 5 figs., 3 tabs.

  5. Adapting AC Lines to DC Grids for Large-Scale Renewable Power Transmission

    Directory of Open Access Journals (Sweden)

    D. Marene Larruskain


    Full Text Available All over the world, governments of different countries are nowadays promoting the use of clean energies in order to achieve sustainable energy systems. In this scenario, since the installed capacity is continuously increasing, renewable sources can play an important role. Notwithstanding that, some important problems may appear when connecting these sources to the grid, being the overload of distribution lines one of the most relevant. In fact, renewable generation is usually connected to the nearest AC grid, although this HV system may not have been designed considering distributed generation. In the particular case of large wind farms, the electrical grid has to transmit all the power generated by wind energy and, as a consequence, the AC system may get overloaded. It is therefore necessary to determine the impact of wind power transmission so that appropriate measures can be taken. Not only are these measures influenced by the amount of power transmitted, but also by the quality of the transmitted power, due to the output voltage fluctuation caused by the highly variable nature of wind. When designing a power grid, although AC systems are usually the most economical solution because of its highly proven technology, HVDC may arise in some cases (e.g. offshore wind farms as an interesting alternative, offering some added values such as lower losses and better controllability. This way, HVDC technology can solve most of the aforementioned problems and has a good potential for future use. Additionally, the fast development of power electronics based on new and powerful semiconductor devices allow the spread of innovative technologies, such as VSC-HVDC, which can be applied to create DC grids. This paper focuses on the main aspects involved in adapting the existing overhead AC lines to DC grids, with the objective of improving the transmission of distributed renewable energy to the centers of consumption.

  6. Radiation loss of planar surface plasmon polaritons transmission lines at microwave frequencies. (United States)

    Xu, Zhixia; Li, Shunli; Yin, Xiaoxing; Zhao, Hongxin; Liu, Leilei


    Radiation loss of a typical spoof surface plasmon polaritons (SSPPs) transmission line (TL) is investigated in this paper. A 325 mm-long SSPPs TL is designed and fabricated. Simulated results show that radiation loss contributes more to transmission loss than dielectric loss and conductor loss from 2 GHz to 10 GHz. Radiation loss of the SSPPs TL could be divided into two parts, one is caused by the input mode converter, and the other is caused by the corrugated metallic strip. This paper explains mechanisms of radiation loss from different parts, designs a loaded SSPPs TL with a series of resistors to absorb electromagnetic energy on corrugated metallic strip, and then discriminates radiation loss from the input mode converter, proposes the concept of average radiation length (ARL) to evaluate radiation loss from SSPPs of finite length, and concludes that radiation loss is mainly caused by corrugated structure of finite length at low frequency band and by the input mode converter at high frequency band. To suppress radiation loss, a mixed slow wave TL based on the combination of coplanar waveguides (CPWs) and SSPPs is presented. The designed structure, sample fabrication and experimental verification are discussed.

  7. Detectors on Edge Nodes against False Data Injection on Transmission Lines of Smart Grid

    Directory of Open Access Journals (Sweden)

    Peng Xun


    Full Text Available False data injection (FDI attack is a hot topic in large-scale Cyber-Physical Systems (CPSs, which can cause bad state estimation of controllers. In this paper, we focus on FDI detection on transmission lines of the smart grid. We propose a novel and effective detection framework to identify FDI attacks. Different from the previous methods, there are multi-tier detectors which utilize edge nodes such as the programmable logic controllers (PLCs instead of the central controller to detect attacks. The proposed framework can decrease the transmission time of data to reduce the latency of decisions because many sensory data need not be transmitted to the central controller for detection. We also develop a detection algorithm which utilizes classifiers based on machine learning to identify FDI. The training process is split from every edge node and is placed on the central node. The detectors are lightweight and are properly adopted in our detection framework. Our simulation experiments show that the proposed detection framework can provide better detection results than the existing detection approaches.

  8. Wideband Isolation by Frequency Conversion in a Josephson-Junction Transmission Line (United States)

    Ranzani, Leonardo; Kotler, Shlomi; Sirois, Adam J.; DeFeo, Michael P.; Castellanos-Beltran, Manuel; Cicak, Katarina; Vale, Leila R.; Aumentado, José


    Nonreciprocal transmission and isolation at microwave frequencies are important in many practical applications. In particular, compact isolators are useful in protecting sensitive quantum circuits operating at cryogenic temperatures from amplifier backaction and other environmental noise such as black-body radiation from higher temperature stages. However, the size of commercial cryogenic isolators limits the ability to measure multiple quantum circuits because of space constraints in typical dilution refrigerator systems. Furthermore, isolators usually require the use of ferrite components that cannot be integrated at the chip level and, since they also need large biasing magnetic fields, are incompatible with superconducting quantum circuits. In this work we show one way to accomplish isolation in a superconducting chip-scale device, a traveling-wave unidirectional frequency converter based on a parametrically pumped superconducting Josephson-junction transmission line, demonstrating better than 4.8 dB of inferred signal isolation from 6.6 to 11.4 GHz, with a maximum of 12 dB at 9.5 GHz. By using frequency diplexing techniques a conventional isolator could be implemented over this bandwidth.

  9. Continuous monitoring of a dam flush in a shallow river using two crossing ultrasonic transmission lines

    International Nuclear Information System (INIS)

    Kawanisi, Kiyosi; Razaz, Mahdi; Yano, Jyunki; Ishikawa, Kazuhiko


    Continuous measurements of streamflow and water temperature were carried out in a shallow gravel-bed river during dam flushing operations using a new shallow acoustic system with two crossing transmission lines. The fluvial acoustic system (FAS) was equipped with four 25 kHz broadband omnidirectional transducers. The reciprocal sound transmissions were performed between the two pairs of acoustic stations, located on both sides of the river. The four-station FAS enabled the measurement of the stream direction in addition to the depth- and range-averaged sound speed, and therefore water velocity. Discharge values computed from FAS reports were compared to those estimated by the moving-boat acoustic Doppler current profiler (ADCP) and rating curve (RC) methods. FAS estimates were in good agreement with ADCP and RC estimates over a range of 50 to 180 m 3 s −1 . The temperature gradients induced strong sound scattering for the 25 kHz FAS. The fine suspended sediment particles also induced a gradual decrease in the signal-to-noise ratio of the FAS. Nevertheless, the FAS has been proved to be a reliable and accurate technique for the continuous measurement of cross-sectional average velocity/water temperature. (paper)

  10. Use-Dependent Inhibition of Synaptic Transmission by the Secretion of Intravesicularly Accumulated Antipsychotic Drugs

    DEFF Research Database (Denmark)

    Tischbirek, Carsten H.; Wenzel, Eva M.; Zheng, Fang


    Tischbirek et al. find that weak-base antipsychotic drugs are accumulated in synaptic vesicles and are secreted upon exocytosis, leading to increased extracellular drug concentrations following neuronal activity. The secretion of the drugs in turn inhibits synaptic transmission in a use-dependent...

  11. Calculation of Voltages in Electric Power Transmission Lines During Historic Geomagnetic Storms: An Investigation Using Realistic Earth Impedances (United States)

    Lucas, Greg M.; Love, Jeffrey J.; Kelbert, Anna


    Commonly, one-dimensional (1-D) Earth impedances have been used to calculate the voltages induced across electric power transmission lines during geomagnetic storms under the assumption that much of the three-dimensional structure of the Earth gets smoothed when integrating along power transmission lines. We calculate the voltage across power transmission lines in the mid-Atlantic region with both regional 1-D impedances and 64 empirical 3-D impedances obtained from a magnetotelluric survey. The use of 3-D impedances produces substantially more spatial variance in the calculated voltages, with the voltages being more than an order of magnitude different, both higher and lower, than the voltages calculated utilizing regional 1-D impedances. During the March 1989 geomagnetic storm 62 transmission lines exceed 100 V when utilizing empirical 3-D impedances, whereas 16 transmission lines exceed 100 V when utilizing regional 1-D impedances. This demonstrates the importance of using realistic impedances to understand and quantify the impact that a geomagnetic storm has on power grids.

  12. Calculation of voltages in electric power transmission lines during historic geomagnetic storms: An investigation using realistic earth impedances (United States)

    Lucas, Greg M.; Love, Jeffrey J.; Kelbert, Anna


    Commonly, one-dimensional (1-D) Earth impedances have been used to calculate the voltages induced across electric power transmission lines during geomagnetic storms under the assumption that much of the three-dimensional structure of the Earth gets smoothed when integrating along power transmission lines. We calculate the voltage across power transmission lines in the mid-Atlantic region with both regional 1-D impedances and 64 empirical 3-D impedances obtained from a magnetotelluric survey. The use of 3-D impedances produces substantially more spatial variance in the calculated voltages, with the voltages being more than an order of magnitude different, both higher and lower, than the voltages calculated utilizing regional 1-D impedances. During the March 1989 geomagnetic storm 62 transmission lines exceed 100 V when utilizing empirical 3-D impedances, whereas 16 transmission lines exceed 100 V when utilizing regional 1-D impedances. This demonstrates the importance of using realistic impedances to understand and quantify the impact that a geomagnetic storm has on power grids.

  13. Multi-band Microwave Antennas and Devices based on Generalized Negative-Refractive-Index Transmission Lines (United States)

    Ryan, Colan Graeme Matthew

    Focused on the quad-band generalized negative-refractive-index transmission line (G-NRI-TL), this thesis presents a variety of novel printed G-NRI-TL multi-band microwave device and antenna prototypes. A dual-band coupled-line coupler, an all-pass G-NRI-TL bridged-T circuit, a dual-band metamaterial leaky-wave antenna, and a multi-band G-NRI-TL resonant antenna are all new developments resulting from this research. In addition, to continue the theme of multi-band components, negative-refractive-index transmission lines are used to create a dual-band circularly polarized transparent patch antenna and a two-element wideband decoupled meander antenna system. High coupling over two independently-specified frequency bands is the hallmark of the G-NRI-TL coupler: it is 0.35lambda0 long but achieves approximately -3 dB coupling over both bands with a maximum insertion loss of 1 dB. This represents greater design flexibility than conventional coupled-line couplers and less loss than subsequent G-NRI-TL couplers. The single-ended bridged-T G-NRI-TL offers a metamaterial unit cell with an all-pass magnitude response up to 8 GHz, while still preserving the quad-band phase response of the original circuit. It is shown how the all-pass response leads to wider bandwidths and improved matching in quad-band inverters, power dividers, and hybrid couplers. The dual-band metamaterial leaky-wave antenna presented here was the first to be reported in the literature, and it allows broadside radiation at both 2 GHz and 6 GHz without experiencing the broadside stopband common to conventional periodic antennas. Likewise, the G-NRI-TL resonant antenna is the first reported instance of such a device, achieving quad-band operation between 2.5 GHz and 5.6 GHz, with a minimum radiation efficiency of 80%. Negative-refractive-index transmission line loading is applied to two devices: an NRI-TL meander antenna achieves a measured 52% impedance bandwidth, while a square patch antenna incorporates

  14. Application of magnetically insulated transmission lines for high current, high voltage electron beam accelerators

    International Nuclear Information System (INIS)

    Shope, S.L.; Mazarakis, M.G.; Frost, C.A.; Poukey, J.W.; Turman, B.N.


    Self Magnetically Insulated Transmission Lines (MITL) adders have been used successfully in a number of Sandia accelerators such as HELIA, HERMES III, and SABRE. Most recently the authors used a MITL adder in the RADLAC/SMILE electron beam accelerator to produce high quality, small radius (r b < 2 cm), 11 to 15 MeV, 50 to 100-kA beams with a small transverse velocity v perpendicular/c = β perpendicular ≤ 0.1. In RADLAC/SMILE, a coaxial MITL passed through the eight, 2 MV vacuum envelopes. The MITL summed the voltages of all eight feeds to a single foilless diode. The experimental results are in good agreement with code simulations. The authors' success with the MITL technology led them to investigate the application to higher energy accelerator designs. They have a conceptual design for a cavity-fed MITL that sums the voltages from 100 identical, inductively-isolated cavities. Each cavity is a toroidal structure that is driven simultaneously by four 8-ohm pulse-forming lines, providing a 1-MV voltage pulse to each of the 100 cavities. The point design accelerator is 100 MV, 500 kA, with a 30-50-ns FWHM output pulse

  15. Magnetic insulation regimes in high-current diodes and transmission lines of conical configuration

    International Nuclear Information System (INIS)

    Vasilenko, O.I.; Voronin, V.S.; Lebedev, A.N.


    Steady states of the electron current in a high-voltage diode and of the transmission line of conical configuration at emission current restriction by the space are considered on the basis of the self-consistant kinetic description in connection with the prospects of controlled thermonuclear synthesis. Proceeding from the magnetic self-insulation principle solved are the problems of controling the emission electron current in the double-electron geometry to prevent it from being present on the anode in the line regime and to achieve its maximum focusing in the diode regime. The motion of plasma boundaries as well as the probable contribution of the ion component of the current were not taken into consideration. It is shown that the beam focusing on the system axis takes place at sufficiently strong currents. It is connected with the fact that some part of the full diode current runs on the cathode surface. The results were compared with existing approximate diode models and with the experimetal data on focusien of strong-current beams

  16. A new algorithm for optimum voltage and reactive power control for minimizing transmission lines losses

    International Nuclear Information System (INIS)

    Ghoudjehbaklou, H.; Danai, B.


    Reactive power dispatch for voltage profile modification has been of interest to power utilities. Usually local bus voltages can be altered by changing generator voltages, reactive shunts, ULTC transformers and SVCs. Determination of optimum values for control parameters, however, is not simple for modern power system networks. Heuristic and rather intelligent algorithms have to be sought. In this paper a new algorithm is proposed that is based on a variant of a genetic algorithm combined with simulated annealing updates. In this algorithm a fuzzy multi-objective a approach is used for the fitness function of the genetic algorithm. This fuzzy multi-objective function can efficiently modify the voltage profile in order to minimize transmission lines losses, thus reducing the operating costs. The reason for such a combination is to utilize the best characteristics of each method and overcome their deficiencies. The proposed algorithm is much faster than the classical genetic algorithm and cna be easily integrated into existing power utilities software. The proposed algorithm is tested on an actual system model of 1284 buses, 799 lines, 1175 fixed and ULTC transformers, 86 generators, 181 controllable shunts and 425 loads

  17. Prediction of the dynamic response of complex transmission line systems for unsteady pressure measurements

    International Nuclear Information System (INIS)

    Antonini, C; Persico, G; Rowe, A L


    Among the measurement and control systems of gas turbine engines, a recent new issue is the possibility of performing unsteady pressure measurements to detect flow anomalies in an engine or to evaluate loads on aerodynamic surfaces. A possible answer to this demand could be extending the use of well known and widely used transmission line systems, which have been applied so far to steady monitoring, to unsteady measurements thanks to proper dynamic modeling and compensation. Despite the huge number of models existing in the literature, a novel method has been developed, which is at the same time easy-to-handle, flexible and capable of reproducing the actual physics of the problem. Furthermore, the new model is able to deal with arbitrary complex networks of lines and cavities, and thus its applicability is not limited to series-connected systems. The main objectives of this paper are to show the derivation of the model, its validation against experimental tests and example of its applicability

  18. Application of Magnetically Insulated Transmission Lines for high current, high voltage electron beam accelerators

    International Nuclear Information System (INIS)

    Shope, S.L.; Mazarakis, M.G.; Frost, C.A.; Poukey, J.W.; Turman, B.N.


    Self Magnetically Insulated Transmission Lines (MITL) adders have been used successfully in a number of Sandia accelerators such as HELIA, HERMES III, and SABRE. Most recently we used at MITL adder in the RADLAC/SMILE electron beam accelerator to produce high quality, small radius (r ρ < 2 cm), 11 to 15 MeV, 50 to 100-kA beams with a small transverse velocity v perpendicular/c = β perpendicular ≤ 0.1. In RADLAC/SMILE, a coaxial MITL passed through the eight, 2 MV vacuum envelopes. The MITL summed the voltages of all eight feeds to a single foilless diode. The experimental results are in good agreement with code simulations. Our success with the MITL technology led us to investigate the application to higher energy accelerator designs. We have a conceptual design for a cavity-fed MITL that sums the voltages from 100 identical, inductively-isolated cavities. Each cavity is a toroidal structure that is driven simultaneously by four 8-ohm pulse-forming lines, providing a 1-MV voltage pulse to each of the 100 cavities. The point design accelerator is 100 MV, 500 kA, with a 30--50 ns FWHM output pulse. 10 refs

  19. Application of magnetically insulated transmission lines for high current, high voltage electron beam accelerators (United States)

    Shope, S. L.; Mazarakis, M. G.; Frost, C. A.; Poukey, J. W.; Turman, B. N.

    Self Magnetically Insulated Transmission Lines (MITL) adders were used successfully in a number of Sandia accelerators such as HELIA, HERMES III, and SABRE. Most recently we used at MITL adder in the RADLAC/SMILE electron beam accelerator to produce high quality, small radius (r(sub rho) less than 2 cm), 11 - 15 MeV, 50 - 100-kA beams with a small transverse velocity v(perpendicular)/c = beta(perpendicular) less than or equal to 0.1. In RADLAC/SMILE, a coaxial MITL passed through the eight, 2 MV vacuum envelopes. The MITL summed the voltages of all eight feeds to a single foilless diode. The experimental results are in good agreement with code simulations. Our success with the MITL technology led us to investigate the application to higher energy accelerator designs. We have a conceptual design for a cavity-fed MITL that sums the voltages from 100 identical, inductively-isolated cavities. Each cavity is a toroidal structure that is driven simultaneously by four 8-ohm pulse-forming lines, providing a 1-MV voltage pulse to each of the 100 cavities. The point design accelerator is 100 MV, 500 kA, with a 30 - 50 ns FWHM output pulse.

  20. The Insulation Structure of the 1 Megavolt Transmission Line for the ITER Neutral Beam Injector

    International Nuclear Information System (INIS)

    Lorenzi, A. de; Grando, L.; Gobbo, R; Pesavento, G.; Bettini, P.; Specogna, R.; Trevisan, F.


    The paper describes the studies and the tests for the development of the insulation structure of the 1 MV-50 A Gas Insulated (SF 6 ) Line of the ITER NBI in the SINGAP configuration. Basically, the Transmission Line for the SinGap configuration consists of a coaxial conductor with the inner electrode polarized at the negative value of 1 MV dc. Despite Transmission Line belongs to the Gas Insulated Switchgear (GIS) family, whose technology is nowadays mature, the design of spacers (usually epoxy post and conical type) for High Voltage DC with the same degree of reliability of spacer for High Voltage AC is far away to be attained, due to the substantial difference between AC and DC voltage electric field configuration and insulation behavior at Epoxy-SF 6 interface. Furthermore, the occurrence of very frequent short circuits during the NBI operation introduces further elements of uncertainty in the design of the insulation structure. The first step was then to assess the capability of standard epoxy spacers to withstand DC voltage with frequent short circuits, in order to determine if the choice of the material is suitable for such an application; a test circuit was set up, with the possibility to generate 200 kV DC and to produce a short-circuit every 15'. The system with the spacers was pressurized with SF 6 at 0.3 MPa. For the interpretation of the experimental results, the spacer has been modeled with commercial (ANSYS TM FEM) and research (Cell Method) numerical codes in order to evaluate both the capacitive and resistive electric field distributions. Once assessed the possibility of using epoxy compounds for the spacer construction, the post and cone spacers have been designed taking into consideration various cases, like electrostatic field configuration, resistive distribution for homogeneous and skin conductivity of the spacer, and for high SF 6 conductivity. In these cases the optimization of the triple point screening has been evaluated, leading to

  1. Transmission Lines or Poles, Electric, Electric transmission lines locations provided to us from Kansas City Power and Light and City of Gardner only at this time. AIMS is working on getting other providers in area. Data is limited to CUE (Collaborative Utility Exchange) Participants and subc, Published in 2004, Johnson County Government. (United States)

    NSGIC Local Govt | GIS Inventory — Transmission Lines or Poles, Electric dataset current as of 2004. Electric transmission lines locations provided to us from Kansas City Power and Light and City of...

  2. Propagation of 1-THz bandwidth electrical pulses on high Tc superconducting transmission lines

    International Nuclear Information System (INIS)

    Nuss, M.C.; Mankiewich, P.M.; Howard, R.E.; Harvey, T.E.; Brandle, C.D.; Straugh, B.L.; Smith, P.R.


    The new high temperature superconductors have triggered enormous interest not only because of the unique physics involved but also because of their technical potentials, such as the promise for propagation of extremely short electrical pulses. Superconducting band caps of --20TH z are predicted assuming BCS theory for the superconductor, making lossless propagation of electrical pulses as short as 50 fs possible. Despite microwave measurements at low frequencies of several gigahertz first studies at higher frequencies by Dykaar et al have shown distortion-free propagation of 100-GHz electrical pulses on YBa 2 Cu 3 O 3 (YBCO) lines for --5-mm propagation distance. Results were also reported for aluminum coplanar lines and a YBCO ground plane. The authors report on the propagation of 1-ps electrical pulses (1-THz bandwidth) on YBCO coplanar transmission lines defined on lanthanum gallate (LaGaO 3 ) as a substrate. On LaGaO 3 , YBCO grows highly oriented as on SrTiO 3 . However, unlike SrTiO 3 , LaGaO 3 has a much lower dielectric constant and small losses in the terahertz frequency range. Electrical pulses of --750-fs duration are generated in a radiation-damaged silicon-on-sapphire photoconductive switch integrated into a 20-μm coplanar stripline with 10-μm spacing and excited with 100-fs optical pulses from a CPM laser. An μ1-THz bandwidth electrical contact is made to the YBCO coplanar stripline defined on LaGaO 3 using a flip-chip geometry. They find that electrical pulses broaden only from 750 fs to 1 ps with little loss in amplitude on traveling through their flip-chip input and propagated electrical pulses are probed by electooptic sampling in two small LiTaO 3 crystals separated by 3 mm

  3. Design winds during ice storm as a function of direction for transmission lines

    Energy Technology Data Exchange (ETDEWEB)

    Chouinard, L. [McGill Univ., Montreal, PQ (Canada); Feknous, N. [SNC-Lavalin, Montreal, PQ (Canada); Sabourin, G. [Hydro-Quebec, Montreal, PQ (Canada)


    The effects of wind directionality are important considerations in the design of electric transmission lines. A procedure for the estimation of the probability distribution function of maximum wind speed as a function of direction was proposed. The procedure was applied to the sample of annual maximum wind speeds using the Gumbal distribution method and then used to estimate the maximum wind speed as a function of direction for the sample of maximum annual wind speeds, and maximum annual wind speeds during ice storms at 22 locations throughout Quebec. Wind direction obtained from the meteorological stations was recorded in 10 degrees sectors. The data set was used to obtain maximum wind speed for each year in each of 36 sectors. The joint probability distribution function was obtained by assuming that extreme distribution for non-directional winds was common to all directions during a season or period, as well as by assuming independence between wind speed and wind direction during a storm pattern. Structural effects were obtained by integrating the joint probability distribution with design equations. Results were then presented in the form of a ratio relative to the reference wind speed for each location. The procedure was demonstrated using a meteorological data set as well as glaze ice data from Quebec City, and covered a period of 30 years. Results indicated that a reduction factor of 25 per cent can be achieved on ice accumulations when overhead lines are directed parallel to dominant winds. It was concluded that the method will represent significant savings in the design and up-grading of existing lines. Further research will be conducted to address issues related to regional criteria and local adjustments for topographical features. 7 refs., 4 figs.

  4. Analyzing the Health Risks Resulting from Extending the 400kV High Voltage Transmission Lines on the Human

    Directory of Open Access Journals (Sweden)

    Mohammed Hassan Dervish


    Full Text Available Although it is difficult to imagine life without electricity, there are compiling confirmations show thatexposure to magnetic fields correlated electricity and radio frequencies pose magnificent hazards to human health. The most economist method to transfer electricity from power generation stations to users is by measures of high power transmission lines, buoyed by big transmission towers. The cables laced between the towers radiate magnetic and electric fields. In this research study, the magnetic field at ground level under 400 kV network lines extended in residential places have been conducted in two ways, mathematical calculation and practical measurement then the obtained results analyzed and compared with the international standards reference values. the reason of chose this type of transmission line is frequently using. The results indicate that they fall within the safe limiter commended by the WorldHealth Organization. the strength of radiation increasing with high of sea level and moisture ratiobecause of air ionization.

  5. On the dynamic response of pressure transmission lines in the research of helium-charged free piston Stirling engines (United States)

    Miller, Eric L.; Dudenhoefer, James E.


    The signal distortion inherent to pressure transmission lines in free-piston Stirling engine research is discussed. Based on results from classical analysis, guidelines are formulated to describe the dynamic response properties of a volume-terminated transmission tube for applications involving the helium-charged free-piston Stirling engines. The underdamped flow regime is described, the primary resonance frequency is derived, and the pressure phase and amplitude distortion are discussed. The scope and limitation of the dynamic response analysis are considered.

  6. Review of fire behavior during passage of Sandy Lake Fire 13 (NWT) across a Northwest Territories Power Corporation transmission line

    Energy Technology Data Exchange (ETDEWEB)

    Schroeder, D.; Thomasson, J.


    The Sandy Lake Fire 13 of July 2008 was an intense forest fire that burned up to and across a power line right-of-way in the Northwest Territories, approximately 160 km northwest of Fort Smith. The terrain in the area is flat and vegetation is characterized by boreal pine and black spruce uplands with black spruce and tamarack in lower areas and adjacent to wetlands. This report documented post fire conditions at locations where the fire crossed the power line. The towers on this line were made from an aluminum alloy and may not have had the same resistance to heat damage as steel towers, more commonly used on major transmission lines. The transmission line was de-energized during the fire. Therefore, the effects of fire on power transmission were not documented. Although the intense wildfire crossed sections of the power line, it did not result in observable damage to the towers or lines. Fire intensity was likely greater than 40,000 kw/m along some sections of the right-of-way. Although the management of the right-of-way may have reduced heat exposure to the transmission towers, it did not stop the fire. Pine mixed with an aspen component greater than 50 per cent had a mitigating effect on fire behaviour. The fire did not result in any immediate damage to the power line infrastructure. It was concluded that the use of power lines for fire operations should consider right-of-way width in order to assess equipment maneuverability, especially around tower guy wires. 5 refs., 1 tab., 12 figs.

  7. Residual life assessment of overhead transmission lines 110 kV and above and determination of their reconstruction terms

    Directory of Open Access Journals (Sweden)

    Uteuliyev Bauyrzhan


    Full Text Available In this article is given a method for assessment the residual life of overhead transmission lines on reinforced concrete supports with centrifuged poles. Reinforced concrete poles of supports, wires and lightning protection cables are adopted as the main elements. The intensity of change in the actual state parameters of these elements is determined by the laws of random variables distribution that allow predicting the residual life and the timing of repairs and reconstruction of overhead transmission lines. The parameters of natural climatic conditions and other external factors are considered by including of coefficients into the formula for changing the actual state parameters.

  8. Long term investigation of thermal behaviour of 110 kV underground transmission lines in the Belgrade area

    Energy Technology Data Exchange (ETDEWEB)

    Sredojevic, M.R.; Naumov, R.M.; Popovic, D.P. [Nikola Tesla Electrical Engineering Inst., Belgrade (Yugoslavia); Simic, M.D. [Electrical Utility Co., Belgrade (Yugoslavia)


    The paper describes the procedure for applying a special cable backfill material, developed and manufactured at the Institute ``Nikola Tesla`` for the thermal stabilisation and reduction of hot spot cable operating temperature, on specific hot spots of 110 kV underground transmission lines in the Belgrade area. The results presented in this paper are an important contribution to the proof of the justification and necessity of defining and introducing in practice new procedures for the thermal stabilisation and reduction of operating temperature of existing, as well as of new, underground transmission cable lines to be built. (author)

  9. Generalized transmission line method to study the far-zone radiation of antennas under a multilayer structure

    CERN Document Server

    Wu, Xuan Hui


    This book gives a step-by-step presentation of a generalized transmission line method to study the far-zone radiation of antennas under a multilayer structure. Normally, a radiation problem requires a full wave analysis which may be time consuming. The beauty of the generalized transmission line method is that it transforms the radiation problem for a specific type of structure, say the multilayer structure excited by an antenna, into a circuit problem that can be efficiently analyzed. Using the Reciprocity Theorem and far-field approximation, the method computes the far-zone radiation due to

  10. A Novel Method of Autonomous Inspection for Transmission Line based on Cable Inspection Robot LiDAR Data

    Directory of Open Access Journals (Sweden)

    Xinyan Qin


    Full Text Available With the growth of the national economy, there is increasing demand for electricity, which forces transmission line corridors to become structurally complicated and extend to complex environments (e.g., mountains, forests. It is a great challenge to inspect transmission line in these regions. To address these difficulties, a novel method of autonomous inspection for transmission line is proposed based on cable inspection robot (CIR LiDAR data, which mainly includes two steps: preliminary inspection and autonomous inspection. In preliminary inspection, the position and orientation system (POS data is used for original point cloud dividing, ground point filtering, and structured partition. A hierarchical classification strategy is established to identify the classes and positions of the abnormal points. In autonomous inspection, CIR can autonomously reach the specified points through inspection planning. These inspection targets are imaged with PTZ (pan, tilt, zoom cameras by coordinate transformation. The feasibility and effectiveness of the proposed method are verified by test site experiments and actual line experiments, respectively. The proposed method greatly reduces manpower and improves inspection accuracy, providing a theoretical basis for intelligent inspection of transmission lines in the future.

  11. Transmission line pulse system for avalanche characterization of high power semiconductor devices (United States)

    Riccio, Michele; Ascione, Giovanni; De Falco, Giuseppe; Maresca, Luca; De Laurentis, Martina; Irace, Andrea; Breglio, Giovanni


    Because of the increasing in power density of electronic devices for medium and high power application, reliabilty of these devices is of great interest. Understanding the avalanche behaviour of a power device has become very important in these last years because it gives an indication of the maximum energy ratings which can be seen as an index of the device ruggedness. A good description of this behaviour is given by the static IV blocking characteristc. In order to avoid self heating, very relevant in high power devices, very short pulses of current have to be used, whose value can change from few milliamps up to tens of amps. The most used method to generate short pulses is the TLP (Transmission Line Pulse) test, which is based on charging the equivalent capacitance of a transmission line to high value of voltage and subsequently discharging it onto a load. This circuit let to obtain very short square pulses but it is mostly used for evaluate the ESD capability of semiconductor and, in this environment, it generates pulses of low amplitude which are not high enough to characterize the avalanche behaviour of high power devices . Advanced TLP circuit able to generate high current are usually very expensive and often suffer of distorption of the output pulse. In this article is proposed a simple, low cost circuit, based on a boosted-TLP configuration, which is capable to produce very square pulses of about one hundreds of nanosecond with amplitude up to some tens of amps. A prototype is implemented which can produce pulses up to 20A of amplitude with 200 ns of duration which can characterize power devices up to 1600V of breakdown voltage. Usage of microcontroller based logic make the circuit very flexible. Results of SPICE simulation are provided, together with experimental results. To prove the effectiveness of the circuit, the I-V blocking characteristics of two commercial devices, namely a 600V PowerMOS and a 1200V Trench-IGBT, are measured at different

  12. Environmental impact of high voltage aerial transmission lines; Impacto ambiental de linhas de transmissao aereas de alta tensao

    Energy Technology Data Exchange (ETDEWEB)

    Silva, R P [CAEEB, Brasilia, DF (Brazil); Mouallen, M C [Eletricidade de Sao Paulo, SP (Brazil); Quintella, S E.A.


    The identification of environmental impacts caused by the aerial transmission lines and the measures for reducing these impacts are discussed, considering the impact over the soil in different areas, biological effects caused by delayed exposure and visual impacts due to the line structures. A methodology for the impact evaluation and the aspects of the Environmental Impact Studies and Environmental Impact Report are also studied. (C.G.C.). 2 refs, 1 fig.

  13. Mechanical Implementation and Simulation of MoboLab, A Mobile Robot for Inspection of Power Transmission Lines

    Directory of Open Access Journals (Sweden)

    Mahmud Saadat Foumani


    Full Text Available This paper describes the first phase in development of a mobile robot that can navigate aerial power transmission lines completely unattended by human operator. Its ultimate purpose is to automate inspection of power transmission lines and their equipments. The authors have developed a scaled functional model of such a mobile robot with a preliminary simple computer based on-off controller. MoboLab (Mobile Laboratory navigates a power transmission line between two strain towers. It can maneuver over obstructions created by line equipments such as insulators, warning spheres, dampers, and spacer dampers. It can also easily negotiate the towers by its three flexible arms. MoboLab has an internal main screw which enables the robot to move itself or its two front and rear arms independently through changing gripped points. When the front arm gets close to an obstacle, the arm detaches from the line and goes down, the robot moves forward, the arm passes the obstacle and grippes the line again. In a same way another arms pass the obstacle.

  14. Transmission line model and fields analysis of metamaterial absorber in the terahertz band. (United States)

    Wen, Qi-Ye; Xie, Yun-Song; Zhang, Huai-Wu; Yang, Qing-Hui; Li, Yuan-Xun; Liu, Ying-Li


    Metamaterial (MM) absorber is a novel device to provide near-unity absorption to electromagnetic wave, which is especially important in the terahertz (THz) band. However, the principal physics of MM absorber is still far from being understood. In this work, a transmission line (TL) model for MM absorber was proposed, and with this model the S-parameters, energy consumption, and the power loss density of the absorber were calculated. By this TL model, the asymmetric phenomenon of THz absorption in MM absorber is unambiguously demonstrated, and it clarifies that strong absorption of this absorber under studied is mainly related to the LC resonance of the split-ring-resonator structure. The distribution of power loss density in the absorber indicates that the electromagnetic wave is firstly concentrated into some specific locations of the absorber and then be strongly consumed. This feature as electromagnetic wave trapper renders MM absorber a potential energy converter. Based on TL model, some design strategies to widen the absorption band were also proposed for the purposes to extend its application areas.

  15. Protection relay of phase-shifting device with thyristor switch for high voltage power transmission lines (United States)

    Lachugin, V. F.; Panfilov, D. I.; Akhmetov, I. M.; Astashev, M. G.; Shevelev, A. V.


    Problems of functioning of differential current protection systems of phase shifting devices (PSD) with mechanically changed coefficient of transformation of shunt transformer are analyzed. Requirements for devices of protection of PSD with thyristor switch are formulated. Based on use of nonlinear models of series-wound and shunt transformers of PSD modes of operation of major protection during PSD, switching to zero load operation and to operation under load and during short circuit operation were studied for testing PSD with failures. Use of the principle of duplicating by devices of differential current protection (with realization of functions of breaking) of failures of separate pares of PSD with thyristor switch was substantiated. To ensure protection sensitivity to the shunt transformer winding short circuit, in particular, to a short circuit that is not implemented in the current differential protection for PSD with mechanical switch, the differential current protection reacting to the amount of primary ampere-turns of high-voltage and low-voltage winding of this transformer was designed. Studies have shown that the use of differential current cutoff instead of overcurrent protection for the shunt transformer wndings allows one to provide the sensitivity during thyristor failure with the formation of a short circuit. The results of simulation mode for the PSD with switch thyristor designed to be installed as switching point of Voskhod-Tatarskaya-Barabinsk 220 kV transmission line point out the efficiency of the developed solutions that ensure reliable functioning of the PSD.

  16. A Ku-band magnetically insulated transmission line oscillator with overmoded slow-wave-structure (United States)

    Jiang, Tao; He, Jun-Tao; Zhang, Jian-De; Li, Zhi-Qiang; Ling, Jun-Pu


    In order to enhance the power capacity, an improved Ku-band magnetically insulated transmission line oscillator (MILO) with overmoded slow-wave-structure (SWS) is proposed and investigated numerically and experimentally. The analysis of the dispersion relationship and the resonant curve of the cold test indicate that the device can operate at the near π mode of the TM01 mode, which is useful for mode selection and control. In the particle simulation, the improved Ku-band MILO generates a microwave with a power of 1.5 GW and a frequency of 12.3 GHz under an input voltage of 480 kV and input current of 42 kA. Finally, experimental investigation of the improved Ku-band MILO is carried out. A high-power microwave (HPM) with an average power of 800 MW, a frequency of 12.35 GHz, and pulse width of 35 ns is generated under a diode voltage of 500 kV and beam current of 43 kA. The consistency between the experimental and simulated far-field radiation pattern confirms that the operating mode of the improved Ku-band MILO is well controlled in π mode of the TM01 mode. Project supported partly by the National Natural Science Foundation of China (Grant No. 61171021).

  17. New Keypoint Matching Method Using Local Convolutional Features for Power Transmission Line Icing Monitoring

    Directory of Open Access Journals (Sweden)

    Qiangliang Guo


    Full Text Available Power transmission line icing (PTLI problems, which cause tremendous damage to the power grids, has drawn much attention. Existing three-dimensional measurement methods based on binocular stereo vision was recently introduced to measure the ice thickness in PTLI, but failed to meet requirements of practical applications due to inefficient keypoint matching in the complex PTLI scene. In this paper, a new keypoint matching method is proposed based on the local multi-layer convolutional neural network (CNN features, termed Local Convolutional Features (LCFs. LCFs are deployed to extract more discriminative features than the conventional CNNs. Particularly in LCFs, a multi-layer features fusion scheme is exploited to boost the matching performance. Together with a location constraint method, the correspondence of neighboring keypoints is further refined. Our approach achieves 1.5%, 5.3%, 13.1%, 27.3% improvement in the average matching precision compared with SIFT, SURF, ORB and MatchNet on the public Middlebury dataset, and the measurement accuracy of ice thickness can reach 90.9% compared with manual measurement on the collected PTLI dataset.

  18. A simplified theory of ELF propagation in the Earth-ionosphere transmission line

    International Nuclear Information System (INIS)

    Booker, H.G.


    An approximate theory of ELF propagation in the Earth-ionosphere transmission line is developed by combining the reflection theory of Booker and Lefeuvre with Greifinger and Greifinger's treatment of the effect of ionization below the level of reflection. The theory allows for the influence of the Earth's magnetic field, for reflection from the gradient on the under side of the D-region (or, at night, of a ledge below the E-region), for reflection from the gradient on the underside of the E-region and for reflection from the gradient on the topside of the E-region. The procedure is to compare local vertical gradient with local wavelength, thereby classifying altitude into intervals where the gradient is high and ones where it is low. Where the gradient is low, the phase-integral treatment is adequate. An interval where the gradient is high may, to a first approximation, be replaced by a discontinuity. The amount of the discontinuity is the difference between the refractive indices at the top and bottom of the interval of high gradient, judged in relation to local wavelength. It is then a matter of combining reflections from the several discontinuities. This requires calculation of the complex phase-changes between the discontinuities. But there are the intervals where the phase-integral treatment is available. To a better approximation, there is a non-zero phase change associated with an interval of high gradient. The method for incorporating this is described. (author)

  19. Autonomous Inspection Robot for Power Transmission Lines Maintenance While Operating on the Overhead Ground Wires

    Directory of Open Access Journals (Sweden)

    Zheng Li


    Full Text Available This paper describes the development of a mobile robot capable of clearing such obstacles as counterweights, anchor clamps, and torsion tower. The mobile robot walks on overhead ground wires in 500KV power tower. Its ultimate purpose is to automate to inspect the defect of power transmission line. The robot with 13 motors is composed of two arms, two wheels, two claws, two wrists, etc. Each arm has 4 degree of freedom. Claws are also mounted on the arms. An embedded computer based on PC/104 is chosen as the core of control system. Visible light and thermal infrared cameras are installed to obtain the video and temperature information, and the communication system is based on wireless LAN TCP/IP protocol. A prototype robot was developed with careful considerations of mobility. The new sensor configuration is used for the claw to grasp the overhead ground wires. The bridge is installed in the torsion tower for the robot easy to cross obstacles. The new posture plan is proposed for obstacles cleaning in the torsion tower. Results of experiments demonstrate that the robot can be applied to execute the navigation and inspection tasks.

  20. Autonomous Inspection Robot for Power Transmission Lines Maintenance While Operating on the Overhead Ground Wires

    Directory of Open Access Journals (Sweden)

    Zheng Li


    Full Text Available This paper describes the development of a mobile robot capable of clearing such obstacles as counterweights, anchor clamps, and torsion tower. The mobile robot walks on overhead ground wires in 500KV power tower. Its ultimate purpose is to automate to inspect the defect of power transmission line. The robot with 13 motors is composed of two arms, two wheels, two claws, two wrists, etc. Each arm has 4 degree of freedom. Claws are also mounted on the arms. An embedded computer based on PC/104 is chosen as the core of control system. Visible light and thermal infrared cameras are installed to obtain the video and temperature information, and the communication system is based on wireless LAN TCP/IP protocol. A prototype robot was developed with careful considerations of mobility. The new sensor configuration is used for the claw to grasp the overhead ground wires. The bridge is installed in the torsion tower for the robot easy to cross obstacles. The new posture plan is proposed for obstacles cleaning in the torsion tower. Results of experiments demonstrate that the robot can be applied to execute the navigation and inspection tasks.

  1. Numerical simulation of cathode plasma dynamics in magnetically insulated vacuum transmission lines

    International Nuclear Information System (INIS)

    Thoma, C.; Genoni, T. C.; Welch, D. R.; Rose, D. V.; Clark, R. E.; Miller, C. L.; Stygar, W. A.; Kiefer, M. L.


    A novel algorithm for the simulation of cathode plasmas in particle-in-cell codes is described and applied to investigate cathode plasma evolution in magnetically insulated transmission lines (MITLs). The MITL electron sheath is modeled by a fully kinetic electron species. Electron and ion macroparticles, both modeled as fluid species, form a dense plasma which is initially localized at the cathode surface. Energetic plasma electron particles can be converted to kinetic electrons to resupply the electron flux at the plasma edge (the “effective” cathode). Using this model, we compare results for the time evolution of the cathode plasma and MITL electron flow with a simplified (isothermal) diffusion model. Simulations in 1D show a slow diffusive expansion of the plasma from the cathode surface. But in multiple dimensions, the plasma can expand much more rapidly due to anomalous diffusion caused by an instability due to the strong coupling of a transverse magnetic mode in the electron sheath with the expanding resistive plasma layer

  2. Triangular node for Transmission-Line Modeling (TLM) applied to bio-heat transfer. (United States)

    Milan, Hugo F M; Gebremedhin, Kifle G


    Transmission-Line Modeling (TLM) is a numerical method used to solve complex and time-domain bio-heat transfer problems. In TLM, rectangles are used to discretize two-dimensional problems. The drawback in using rectangular shapes is that instead of refining only the domain of interest, a large additional domain will also be refined in the x and y axes, which results in increased computational time and memory space. In this paper, we developed a triangular node for TLM applied to bio-heat transfer that does not have the drawback associated with the rectangular nodes. The model includes heat source, blood perfusion (advection), boundary conditions and initial conditions. The boundary conditions could be adiabatic, temperature, heat flux, or convection. A matrix equation for TLM, which simplifies the solution of time-domain problems or solves steady-state problems, was also developed. The predicted results were compared against results obtained from the solution of a simplified two-dimensional problem, and they agreed within 1% for a mesh length of triangular faces of 59µm±9µm (mean±standard deviation) and a time step of 1ms. Copyright © 2016 Elsevier Ltd. All rights reserved.

  3. Tetrahedral node for Transmission-Line Modeling (TLM) applied to Bio-heat Transfer. (United States)

    Milan, Hugo F M; Gebremedhin, Kifle G


    Transmission-Line Modeling (TLM) is a numerical method used to solve complex and time-domain bio-heat transfer problems. In TLM, parallelepipeds are used to discretize three-dimensional problems. The drawback in using parallelepiped shapes is that instead of refining only the domain of interest, a large additional domain would also have to be refined, which results in increased computational time and memory space. In this paper, we developed a tetrahedral node for TLM applied to bio-heat transfer that does not have the drawback associated with the parallelepiped node. The model includes heat source, blood perfusion, boundary conditions and initial conditions. The boundary conditions could be adiabatic, temperature, heat flux, or convection. The predicted temperature and heat flux were compared against results from an analytical solution and the results agreed within 2% for a mesh size of 69,941 nodes and a time step of 5ms. The method was further validated against published results of maximum skin-surface temperature difference in a breast with and without tumor and the results agreed within 6%. The published results were obtained from a model that used parallelepiped TLM node. An open source software, TLMBHT, was written using the theory developed herein and is available for download free-of-charge. Copyright © 2016 Elsevier Ltd. All rights reserved.

  4. Effects of Electron Flow Current Density on Flow Impedance of Magnetically Insulated Transmission Lines

    International Nuclear Information System (INIS)

    He Yong; Zou Wen-Kang; Song Sheng-Yi


    In modern pulsed power systems, magnetically insulated transmission lines (MITLs) are used to couple power between the driver and the load. The circuit parameters of MITLs are well understood by employing the concept of flow impedance derived from Maxwell's equations and pressure balance across the flow. However, the electron density in an MITL is always taken as constant in the application of flow impedance. Thus effects of electron flow current density (product of electron density and drift velocity) in an MITL are neglected. We calculate the flow impedances of an MITL and compare them under three classical MITL theories, in which the electron density profile and electron flow current density are different from each other. It is found that the assumption of constant electron density profile in the calculation of the flow impedance is not always valid. The electron density profile and the electron flow current density have significant effects on flow impedance of the MITL. The details of the electron flow current density and its effects on the operation impedance of the MITL should be addressed more explicitly by experiments and theories in the future. (nuclear physics)

  5. Proposal of a novel compact P-band magnetically insulated transmission line oscillator with inclined vanes (United States)

    Zhang, Xiaoping; Dang, Fangchao; Li, Yangmei; Jin, Zhenxing


    In this paper, we present a novel compact P-band magnetically insulated transmission line oscillator (MILO) with specially inclined slow-wave-structure (SWS) vanes to decrease its total dimension and weight. The dispersion characteristics of the inclined SWS are investigated in detail and made comparisons with that of the traditional straight SWS. The results show that the inclined SWS is more advantageous in operating on a steady frequency in a wide voltage range and has a better asymmetric mode segregation and a relatively large band-gap between the TM00 and TM01 modes which are in favor of avoiding the asymmetric and transverse mode competition. Besides, the transverse dimension of the proposed novel inclined SWS with the same operation frequency is decreased by about 50%, and correspondingly the device volume shrinks remarkably to its 0.35 times. In particle-in-cell simulation, the electron bunching spokes are obviously formed in the inclined SWS, and a P-band high-power microwave with a power of 5.8 GW, frequency of 645 MHz, and efficiency of 17.2% is generated by the proposed device, which indicates the feasibility of the compact design with the inclined vanes at the P-band.

  6. Slit shaped microwave induced atmospheric pressure plasma based on a parallel plate transmission line resonator (United States)

    Kang, S. K.; Seo, Y. S.; Lee, H. Wk; Aman-ur-Rehman; Kim, G. C.; Lee, J. K.


    A new type of microwave-excited atmospheric pressure plasma source, based on the principle of parallel plate transmission line resonator, is developed for the treatment of large areas in biomedical applications such as skin treatment and wound healing. A stable plasma of 20 mm width is sustained by a small microwave power source operated at a frequency of 700 MHz and a gas flow rate of 0.9 slm. Plasma impedance and plasma density of this plasma source are estimated by fitting the calculated reflection coefficient to the measured one. The estimated plasma impedance shows a decreasing trend while estimated plasma density shows an increasing trend with the increase in the input power. Plasma uniformity is confirmed by temperature and optical emission distribution measurements. Plasma temperature is sustained at less than 40 °C and abundant amounts of reactive species, which are important agents for bacteria inactivation, are detected over the entire plasma region. Large area treatment ability of this newly developed device is verified through bacteria inactivation experiment using E. coli. Sterilization experiment shows a large bacterial killing mark of 25 mm for a plasma treatment time of 10 s.

  7. Superconducting qubit in a nonstationary transmission line cavity: Parametric excitation, periodic pumping, and energy dissipation

    Energy Technology Data Exchange (ETDEWEB)

    Zhukov, A.A. [N.L. Dukhov All-Russia Research Institute of Automatics, 127055 Moscow (Russian Federation); National Research Nuclear University (MEPhI), 115409 Moscow (Russian Federation); Shapiro, D.S., E-mail: [N.L. Dukhov All-Russia Research Institute of Automatics, 127055 Moscow (Russian Federation); V.A. Kotel' nikov Institute of Radio Engineering and Electronics, Russian Academy of Sciences, 125009 Moscow (Russian Federation); Moscow Institute of Physics and Technology, Dolgoprudny, Moscow Region 141700 (Russian Federation); National University of Science and Technology MISIS, 119049 Moscow (Russian Federation); Remizov, S.V. [N.L. Dukhov All-Russia Research Institute of Automatics, 127055 Moscow (Russian Federation); V.A. Kotel' nikov Institute of Radio Engineering and Electronics, Russian Academy of Sciences, 125009 Moscow (Russian Federation); Pogosov, W.V. [N.L. Dukhov All-Russia Research Institute of Automatics, 127055 Moscow (Russian Federation); Moscow Institute of Physics and Technology, Dolgoprudny, Moscow Region 141700 (Russian Federation); Institute for Theoretical and Applied Electrodynamics, Russian Academy of Sciences, 125412 Moscow (Russian Federation); Lozovik, Yu.E. [N.L. Dukhov All-Russia Research Institute of Automatics, 127055 Moscow (Russian Federation); National Research Nuclear University (MEPhI), 115409 Moscow (Russian Federation); Moscow Institute of Physics and Technology, Dolgoprudny, Moscow Region 141700 (Russian Federation); Institute of Spectroscopy, Russian Academy of Sciences, 142190 Moscow Region, Troitsk (Russian Federation)


    We consider a superconducting qubit coupled to the nonstationary transmission line cavity with modulated frequency taking into account energy dissipation. Previously, it was demonstrated that in the case of a single nonadiabatical modulation of a cavity frequency there are two channels of a two-level system excitation which are due to the absorption of Casimir photons and due to the counterrotating wave processes responsible for the dynamical Lamb effect. We show that the parametric periodical modulation of the resonator frequency can increase dramatically the excitation probability. Remarkably, counterrotating wave processes under such a modulation start to play an important role even in the resonant regime. Our predictions can be used to control qubit-resonator quantum states as well as to study experimentally different channels of a parametric qubit excitation. - Highlights: • Coupled qubit-resonator system under the modulation of a resonator frequency is considered. • Counterrotating terms of the Hamiltonian are of importance even in the resonance. • Qubit excited state population is highest if driving frequency matches dressed-state energy.

  8. Compact Single-Layer Traveling-Wave Antenna DesignUsing Metamaterial Transmission Lines (United States)

    Alibakhshikenari, Mohammad; Virdee, Bal Singh; Limiti, Ernesto


    This paper presents a single-layer traveling-wave antenna (TWA) that is based on composite right/left-handed (CRLH)-metamaterial (MTM) transmission line (TL) structure, which is implemented by using a combination of interdigital capacitors and dual-spiral inductive slots. By embedding dual-spiral inductive slots inside the CRLH MTM-TL results in a compact TWA. Dimensions of the proposed CRLH MTM-TL TWA is 21.5 × 30.0 mm2 or 0.372λ0 × 0.520λ0 at 5.2 GHz (center frequency). The fabricated TWA operates over 1.8-8.6 GHz with a fractional bandwidth greater than 120%, and it exhibits a peak gain and radiation efficiency of 4.2 dBi and 81%, respectively, at 5 GHz. By avoiding the use of lumped components, via-holes or defected ground structures, the proposed TWA design is economic for mass production as well as easy to integrate with wireless communication systems.

  9. Bipole III transmission line Henday-Riel: Alternative corridors status report

    International Nuclear Information System (INIS)


    As part of expansion plans in the Manitoba Hydro system, it is proposed to build a 850-km high voltage dc transmission line from the Henday converter station on the Nelson River to a new converter station near Winnipeg. A review is provided of work done on the first stage of route selection and environmental assessment for this project. Right-of-way requirements are outlined and environmental impact issues are discussed in the areas of employment and business opportunities, effects on wilderness areas and aesthetics, electric and magnetic field effects, and land use. The four zones, east and west of Lake Winnipeg, that were studied in the selection of potential corridors are described along with the corridor siting criteria. Five discrete corridor alternatives are identified and evaluated. A route east of Lake Winnipeg has been selected as the preferred corridor. Feedback from public consultations will assist in preparation of a final corridor selection study which is to be submitted to federal and provincial environmental review. 12 figs

  10. A GaAs planar Schottky varactor diode for left-handed nonlinear transmission line applications

    International Nuclear Information System (INIS)

    Dong Jun-Rong; Yang Hao; Tian Chao; Huang Jie; Zhang Hai-Ying


    The left-handed nonlinear transmission line (LH-NLTL) based on monolithic microwave integrated circuit (MMIC) technology possesses significant advantages such as wide frequency band, high operating frequency, high conversion efficiency, and applications in millimeter and submillimeter wave frequency multiplier. The planar Schottky varactor diode (PSVD) is a major limitation to the performance of the LH-NLTL frequency multiplier as a nonlinear component. The design and the fabrication of the diode for such an application are presented. An accurate large-signal model of the diode is proposed. A 16 GHz-39.6 GHz LH-NLTL frequency doubler using our large-signal model is reported for the first time. The measured maximum output powers of the 2nd harmonic are up to 8 dBm at 26.4 GHz, and above 0 dBm from 16 GHz to 39.6 GHz when the input power is 20 dBm. The application of the LH-NLTL frequency doubler furthermore validates the accuracy of the large-signal model of the PSVD. (condensed matter: electronic structure, electrical, magnetic, and optical properties)

  11. Rogue waves generation in a left-handed nonlinear transmission line with series varactor diodes (United States)

    Onana Essama, B. G.; Atangana, J.; Biya Motto, F.; Mokhtari, B.; Cherkaoui Eddeqaqi, N.; Kofane, Timoleon C.


    We investigate the electromagnetic wave behavior and its characterization using collective variables technique. Second-order dispersion, first- and second-order nonlinearities, which strongly act in a left-handed nonlinear transmission line with series varactor diodes, are taken into account. Four frequency ranges have been found. The first one gives the so-called energetic soliton due to a perfect combination of second-order dispersion and first-order nonlinearity. The second frequency range presents a dispersive soliton leading to the collapse of the electromagnetic wave at the third frequency range. But the fourth one shows physical conditions which are able to provoke the appearance of wave trains generation with some particular waves, the rogue waves. Moreover, we demonstrate that the number of rogue waves increases with frequency. The soliton, thereafter, gains a relative stability when second-order nonlinearity comes into play with some specific values in the fourth frequency range. Furthermore, the stability conditions of the electromagnetic wave at high frequencies have been also discussed.

  12. Development of data acquisition and control system for ICH & CD transmission line components test facility

    Energy Technology Data Exchange (ETDEWEB)

    Patel, Manoj, E-mail: [ITER-India, Institute for Plasma Research, Bhat, Gandhinagar 382428, Gujarat (India); Jha, Akhil [ITER-India, Institute for Plasma Research, Bhat, Gandhinagar 382428, Gujarat (India); Patel, Nidhi [Department of Instrumentation & Control Engineering, Dharmsinh Desai University, Nadiad 387001, Gujarat (India); Krishna, J.V.S. Hari; Rajnish, Kumar; Soni, Dipal; Verma, Sriprakash; Patel, Hriday; Trivedi, Rajesh; Mukherjee, Aparajita [ITER-India, Institute for Plasma Research, Bhat, Gandhinagar 382428, Gujarat (India)


    Highlights: • Traveling Wave Resonator (TWR) gain achieved is 13.58 dB using 10 dB coupler. • Software module for Automatic calibration for power detector is developed and integrated. • Application module is developed using LabVIEW™ for high power RF operation of TWR. - Abstarct: India is developing a very high power test bed (∼MW level) based on concept of Travelling Wave Resonator (TWR) for testing of passive transmission line components [3]. Data acquisition and control system is required for safe and reliable operation of TWR. It includes online monitoring of input power and circulating ring power. Acquired RF signal provides information about forward and reflected RF power. For MW power level testing, system is protected against arc and thermal effect during CW operation. National Instrument make hardware and software have been used to acquire signals from RF detector, Arc detectors, IR camera and thermocouples etc. LabVIEW™ based software has been developed for calculation of RF parameters. Graphical user interface is developed for better visualization. Initial testing of the TWR setup with 10 dB coupler provides a power gain of 13.58 dB (22X). For future 3 MW TWR test bed the required power gain is ∼20 dB (100X) since the available source is ∼40 kW. This paper describes the detail design and integrated test results for data acquisition and control system for TWR test bed.

  13. Self-consistent nonlinear transmission line model of standing wave effects in a capacitive discharge

    International Nuclear Information System (INIS)

    Chabert, P.; Raimbault, J.L.; Rax, J.M.; Lieberman, M.A.


    It has been shown previously [Lieberman et al., Plasma Sources Sci. Technol. 11, 283 (2002)], using a non-self-consistent model based on solutions of Maxwell's equations, that several electromagnetic effects may compromise capacitive discharge uniformity. Among these, the standing wave effect dominates at low and moderate electron densities when the driving frequency is significantly greater than the usual 13.56 MHz. In the present work, two different global discharge models have been coupled to a transmission line model and used to obtain the self-consistent characteristics of the standing wave effect. An analytical solution for the wavelength λ was derived for the lossless case and compared to the numerical results. For typical plasma etching conditions (pressure 10-100 mTorr), a good approximation of the wavelength is λ/λ 0 ≅40 V 0 1/10 l -1/2 f -2/5 , where λ 0 is the wavelength in vacuum, V 0 is the rf voltage magnitude in volts at the discharge center, l is the electrode spacing in meters, and f the driving frequency in hertz

  14. An ME-PC Enhanced HDMR Method for Efficient Statistical Analysis of Multiconductor Transmission Line Networks

    KAUST Repository

    Yucel, Abdulkadir C.


    An efficient method for statistically characterizing multiconductor transmission line (MTL) networks subject to a large number of manufacturing uncertainties is presented. The proposed method achieves its efficiency by leveraging a high-dimensional model representation (HDMR) technique that approximates observables (quantities of interest in MTL networks, such as voltages/currents on mission-critical circuits) in terms of iteratively constructed component functions of only the most significant random variables (parameters that characterize the uncertainties in MTL networks, such as conductor locations and widths, and lumped element values). The efficiency of the proposed scheme is further increased using a multielement probabilistic collocation (ME-PC) method to compute the component functions of the HDMR. The ME-PC method makes use of generalized polynomial chaos (gPC) expansions to approximate the component functions, where the expansion coefficients are expressed in terms of integrals of the observable over the random domain. These integrals are numerically evaluated and the observable values at the quadrature/collocation points are computed using a fast deterministic simulator. The proposed method is capable of producing accurate statistical information pertinent to an observable that is rapidly varying across a high-dimensional random domain at a computational cost that is significantly lower than that of gPC or Monte Carlo methods. The applicability, efficiency, and accuracy of the method are demonstrated via statistical characterization of frequency-domain voltages in parallel wire, interconnect, and antenna corporate feed networks.

  15. A 32-channel lattice transmission line array for parallel transmit and receive MRI at 7 tesla. (United States)

    Adriany, Gregor; Auerbach, Edward J; Snyder, Carl J; Gözübüyük, Ark; Moeller, Steen; Ritter, Johannes; Van de Moortele, Pierre-François; Vaughan, Tommy; Uğurbil, Kâmil


    Transmit and receive RF coil arrays have proven to be particularly beneficial for ultra-high-field MR. Transmit coil arrays enable such techniques as B(1) (+) shimming to substantially improve transmit B(1) homogeneity compared to conventional volume coil designs, and receive coil arrays offer enhanced parallel imaging performance and SNR. Concentric coil arrangements hold promise for developing transceiver arrays incorporating large numbers of coil elements. At magnetic field strengths of 7 tesla and higher where the Larmor frequencies of interest can exceed 300 MHz, the coil array design must also overcome the problem of the coil conductor length approaching the RF wavelength. In this study, a novel concentric arrangement of resonance elements built from capacitively-shortened half-wavelength transmission lines is presented. This approach was utilized to construct an array with whole-brain coverage using 16 transceiver elements and 16 receive-only elements, resulting in a coil with a total of 16 transmit and 32 receive channels. (c) 2010 Wiley-Liss, Inc.

  16. Two-dimensional electron flow in pulsed power transmission lines and plasma opening switches

    International Nuclear Information System (INIS)

    Church, B.W.; Longcope, D.W.; Ng, C.K.; Sudan, R.N.


    The operation of magnetically insulated transmission lines (MITL) and the interruption of current in a plasma opening switch (POS) are determined by the physics of the electrons emitted by the cathode surface. A mathematical model describes the self-consistent two-dimensional flow of an electron fluid. A finite element code, FERUS, has been developed to solve the two equations which describe Poisson's and Ampere's law in two dimensions. The solutions from this code are obtained for parameters where the electron orbits are considerably modified by the self-magnetic field of the current. Next, the self-insulated electron flow in a MITL with a step change in cross-section is studied using a conventional two-dimensional fully electromagnetic particle-in-cell code, MASK. The equations governing two-dimensional quasi-static electron flow are solved numerically by a third technique which is suitable for predicting current interruption in a POS. The object of the study is to determine the critical load impedance, Z CL , required for current interruption for a given applied voltage, cathode voltage and plasma length. (author). 9 refs, 5 figs

  17. Relative localization in wireless sensor networks for measurement of electric fields under HVDC transmission lines. (United States)

    Cui, Yong; Wang, Qiusheng; Yuan, Haiwen; Song, Xiao; Hu, Xuemin; Zhao, Luxing


    In the wireless sensor networks (WSNs) for electric field measurement system under the High-Voltage Direct Current (HVDC) transmission lines, it is necessary to obtain the electric field distribution with multiple sensors. The location information of each sensor is essential to the correct analysis of measurement results. Compared with the existing approach which gathers the location information by manually labelling sensors during deployment, the automatic localization can reduce the workload and improve the measurement efficiency. A novel and practical range-free localization algorithm for the localization of one-dimensional linear topology wireless networks in the electric field measurement system is presented. The algorithm utilizes unknown nodes' neighbor lists based on the Received Signal Strength Indicator (RSSI) values to determine the relative locations of nodes. The algorithm is able to handle the exceptional situation of the output permutation which can effectively improve the accuracy of localization. The performance of this algorithm under real circumstances has been evaluated through several experiments with different numbers of nodes and different node deployments in the China State Grid HVDC test base. Results show that the proposed algorithm achieves an accuracy of over 96% under different conditions.

  18. Relative Localization in Wireless Sensor Networks for Measurement of Electric Fields under HVDC Transmission Lines

    Directory of Open Access Journals (Sweden)

    Yong Cui


    Full Text Available In the wireless sensor networks (WSNs for electric field measurement system under the High-Voltage Direct Current (HVDC transmission lines, it is necessary to obtain the electric field distribution with multiple sensors. The location information of each sensor is essential to the correct analysis of measurement results. Compared with the existing approach which gathers the location information by manually labelling sensors during deployment, the automatic localization can reduce the workload and improve the measurement efficiency. A novel and practical range-free localization algorithm for the localization of one-dimensional linear topology wireless networks in the electric field measurement system is presented. The algorithm utilizes unknown nodes’ neighbor lists based on the Received Signal Strength Indicator (RSSI values to determine the relative locations of nodes. The algorithm is able to handle the exceptional situation of the output permutation which can effectively improve the accuracy of localization. The performance of this algorithm under real circumstances has been evaluated through several experiments with different numbers of nodes and different node deployments in the China State Grid HVDC test base. Results show that the proposed algorithm achieves an accuracy of over 96% under different conditions.

  19. Study of the effect of loop inductance on the RF transmission line to cavity coupling coefficient

    International Nuclear Information System (INIS)

    Lal, Shankar; Pant, K. K.


    Coupling of RF power is an important aspect in the design and development of RF accelerating structures. RF power coupling employing coupler loops has the advantage of tunability of β, the transmission line to cavity coupling coefficient. Analytical expressions available in literature for determination of size of the coupler loop using Faraday’s law of induction show reasonably good agreement with experimentally measured values of β below critical coupling (β ≤ 1) but show large deviation with experimentally measured values and predictions by simulations for higher values of β. In actual accelerator application, many RF cavities need to be over-coupled with β > 1 for reasons of beam loading compensation, reduction of cavity filling time, etc. This paper discusses a modified analytical formulation by including the effect of loop inductance in the determination of loop size for any desired coupling coefficient. The analytical formulation shows good agreement with 3D simulations and with experimentally measured values. It has been successfully qualified by the design and development of power coupler loops for two 476 MHz pre-buncher RF cavities, which have successfully been conditioned at rated power levels using these coupler loops.

  20. Time-dependent stochastic inversion in acoustic tomography of the atmosphere with reciprocal sound transmission

    International Nuclear Information System (INIS)

    Vecherin, Sergey N; Ostashev, Vladimir E; Wilson, D Keith; Ziemann, A


    Time-dependent stochastic inversion (TDSI) was recently developed for acoustic travel-time tomography of the atmosphere. This type of tomography allows reconstruction of temperature and wind-velocity fields given the location of sound sources and receivers and the travel times between all source–receiver pairs. The quality of reconstruction provided by TDSI depends on the geometry of the transducer array. However, TDSI has not been studied for the geometry with reciprocal sound transmission. This paper is focused on three aspects of TDSI. First, the use of TDSI in reciprocal sound transmission arrays is studied in numerical and physical experiments. Second, efficiency of time-dependent and ordinary stochastic inversion (SI) algorithms is studied in numerical experiments. Third, a new model of noise in the input data for TDSI is developed that accounts for systematic errors in transducer positions. It is shown that (i) a separation of the travel times into temperature and wind-velocity components in tomography with reciprocal transmission does not improve the reconstruction, (ii) TDSI yields a better reconstruction than SI and (iii) the developed model of noise yields an accurate reconstruction of turbulent fields and estimation of errors in the reconstruction

  1. Intensity-dependent resonant transmission of x-rays in solid-density aluminum plasma (United States)

    Cho, M. S.; Chung, H.-K.; Cho, B. I.


    X-ray free-electron lasers (XFELs) provide unique opportunities to generate and investigate dense plasmas. The absorption and transmission properties of x-ray photons in dense plasmas are important in characterizing the state of the plasmas. Experimental evidence shows that the transmission of x-ray photons through dense plasmas depends greatly on the incident XFEL intensity. Here, we present a detailed analysis of intensity-dependent x-ray transmission in solid-density aluminum using collisional-radiative population kinetics calculations. Reverse saturable absorption (RSA), i.e., an increase in x-ray absorption with intensity has been observed for photon energies below the K-absorption edge and in the intensity range of 1016-1017 W/cm2 for XFEL photons with 1487 eV. At higher intensities, a transition from RSA to saturable absorption (SA) is predicted; thus, the x-ray absorption decreases with intensity above a threshold value. For XFEL photon energies of 1501 eV and 1515 eV, the transition from RSA to SA occurs at XFEL intensities between 1017-1018 W/cm2. Electron temperatures are predicted to be in the range of 30-50 eV for the given experimental conditions. Detailed population kinetics of the charge states explains the intensity-dependent absorption of x-ray photons and the fast modulation of XFEL pulses for both RSA and SA.

  2. To Solution of Classical Problem Pertaining to Magnetic Interference of Overhead Power Transmission Line on Extended Conducting Communications

    Directory of Open Access Journals (Sweden)

    V. I. Glushko


    Full Text Available The paper considers a problem pertaining to magnetic interference of overhead power transmission lines and high-voltage bus bars of electrical installations on extended conducting communications and secondary circuits of relay protection and automation. A simplified task solution has been obtained on the basis of the Carson integral approximation.

  3. The mechanisms underlying multiple lobes in SOAE suppression tuning curves in a transmission line model of the cochlea

    DEFF Research Database (Denmark)

    Epp, Bastian; Manley, Geoff; van Dijk, Pim


    ]. In the present study, a nonlinear and active transmission line model of the cochlea is used to investigate this hypothesis. The model is able to produce SOAEs with plausible characteristics and further shows the suggested standing wave pattern. This approach hence makes it possible to disentangle contributions...

  4. Shielding Effectiveness Analysis and Modification of the Coupling Effect Transmission Line Method on Cavities with Multi-Sided Apertures

    Directory of Open Access Journals (Sweden)

    Tao Hu


    Full Text Available Because the traditional transmission line method treats electromagnetic waves as excitation sources and the cavity as a rectangular waveguide whose terminal is shorted, the transmission line method can only calculate shielding effectiveness in the center line of the cavity with apertures on one side. In this paper, the aperture coupling effect of different sides was analyzed based on vector analysis. According to the field intensity distribution of different transport modes in the rectangular waveguide, the calculation model of cavity shielding effectiveness in any position is proposed, which can solve the question of the calculation model of shielding effectiveness in any position in the traditional method of equivalent transmission methods. Further expansion of the equivalent transmission lines model is adopted to study the shielding effectiveness of different aperture cavities, and the coupling effect rule of the incident angle, the number of apertures, and the size of the cavity is obtained, which can provide the technical support for the design of electromagnetic shielding cavities for electronic equipment.

  5. Frequency domain analysis of the lightning current distribution to ground at the transmission line tower with cellular phone base station

    NARCIS (Netherlands)

    Grcev, L.; Deursen, van A.P.J.; Waes, van J.B.M.


    Cellular phone base stations are often placed in the poles of power transmission lines. We consider the case when such base stations are powered from the low-voltage network. Of special concern is the current that might be led through the cable metallic shields to other customers' premises in case

  6. 75 FR 75170 - Minnkota Power Cooperative, Inc.: Bemidji to Grand Rapids 230 kV Transmission Line Project (United States)


    ... availability of Record of Decision. SUMMARY: The Rural Utilities Service, hereinafter referred to as RUS and/or the Agency, has issued a Record of Decision (ROD) for the Environmental Impact Statement (EIS) for the... financing to construct the 230 kilovolt (kV) transmission line between the Wilton Substation near Bemidji...

  7. 75 FR 32940 - Request for Proposals for New or Upgraded Transmission Line Projects Under Section 1222 of the... (United States)


    ... financial condition and has the ability to secure the necessary financing to meet the Project's requirements... for Proposals for New or Upgraded Transmission Line Projects Under Section 1222 of the Energy Policy..., Department of Energy. ACTION: Request for Project Proposals. SUMMARY: The Department of Energy (DOE or...

  8. Development of electric power transmission line anomaly approaching alarm system. Sodensen ijo sekkin keiho sochi no kaihatsu

    Energy Technology Data Exchange (ETDEWEB)

    Kusaba, Masaro; Tabata, Takatoshi; Miyazaki, Shusuke [Kyushu Electric Power Co., Inc., Fukuoka (Japan)


    In order to plan preventive measures from the occurrence of electric power transmission line accident, a power transmission line anomaly approaching alarm system was developed to automatically alarm the operators and surveillants. The surveillance system, composed of camera, surveillance unit proper and alarm receiving portion, generates alarm and indicate hazard to the operators, when animal invades a hazardous area designated on the monitor. Wireless telegraph for the alarm transmission use used frequency around a 322MHz band with the Radio Ray law and preventive measures from noise, taken into consideration. The prototype is characterized by unnecessary ancillary fitting to the surveillance object, rare erroneous operations and high reliability. While the hazardous area can be simply designated, changed and released, as made by volume on the control panel. It is moreover easy to designate, as done by confirming the surveillance object on the display. It is also possible in multidimensional surveillance and easy to use on site. 7 figs.

  9. Study of a phase-to-ground fault on a 400 kV overhead transmission line (United States)

    Iagăr, A.; Popa, G. N.; Diniş, C. M.


    Power utilities need to supply their consumers at high power quality level. Because the faults that occur on High-Voltage and Extra-High-Voltage transmission lines can cause serious damages in underlying transmission and distribution systems, it is important to examine each fault in detail. In this work we studied a phase-to-ground fault (on phase 1) of 400 kV overhead transmission line Mintia-Arad. Indactic® 650 fault analyzing system was used to record the history of the fault. Signals (analog and digital) recorded by Indactic® 650 were visualized and analyzed by Focus program. Summary of fault report allowed evaluation of behavior of control and protection equipment and determination of cause and location of the fault.


    Directory of Open Access Journals (Sweden)

    B. I. Kuznetsov


    Full Text Available Purpose. Development and field experimental research of layout of the single-circuit active screening system of the magnetic field generated by group of high voltage transmission lines in residential area is given. Methodology. Mathematical model of magnetic field, generated by group of high voltage transmission lines in residential area, based of the experimental values of magnetic field flux density in given points on the basis of optimization problem solving is improved. The objective of the synthesis of the single circuit active screening system is to determine their number, configuration, spatial arrangement, wiring diagrams and compensation cables currents, setting algorithm of the control systems as well as the resulting value of the magnetic flux density at the points of the protected space. Synthesis of the full-scale model of active screening system is reduced to the problem of multiobjective nonlinear programming with constraints in which calculation of the objective functions and constraints are carried out on the basis of the Maxwell equations solutions in the quasi-stationary approximation. The problem is solved by a stochastic multiswarm multi-agent particles optimization. Results. The single-circuit active screening system synthesis results for reduction of a magnetic field generated by group of high voltage transmission lines in residential area is given. Field experimental researches of the single-circuit active screening system of the magnetic field generated by group of high voltage transmission lines in residential area with various control algorithms is given. Originality. For the first time out the development and field experimental studies of the single-circuit active screening system of the magnetic field generated by group of high voltage transmission lines in residential area are carried out. Practical value. Practical recommendations on reasonable choice of the spatial arrangement of compensating cables of single

  11. Genotype-Dependent Interaction of Lentil Lines with Ascochyta lentis

    Directory of Open Access Journals (Sweden)

    Ehsan Sari


    Full Text Available Ascochyta blight of lentil is a prevalent disease in many lentil producing regions and can cause major yield and grain quality losses. The most environmentally acceptable and economically profitable method of control is to develop varieties with high levels of durable resistance. Genetic studies to date suggest that ascochyta blight resistance genes (R-gene in lentil lines CDC Robin, ILL 7537, 964a-46, and ILL 1704 are non-allelic. To understand how different R-genes manifest resistance in these genotypes and an accession of Lens ervoides, L-01-827A, with high level of resistance to ascochyta blight, cellular and molecular defense responses were compared after inoculation with the causal pathogen Ascochyta lentis. Pathogenicity testing of the resistant lines to A. lentis inoculation revealed significantly lower disease severity on CDC Robin and ILL 7537 compared to ILL 1704 and 964a-46, and no symptoms of disease were observed on L-01-827A. Histological examinations indicated that cell death triggered by the pathogen might be disrupted as a mechanism of resistance in CDC Robin. In contrast, limiting colonization of epidermal cells by A. lentis is a suggested mechanism of resistance in 964a-46. A time-series comparison of the expressions of hallmark genes in salicylic acid (SA and jasmonic acid (JA signal transduction pathways between CDC Robin and 964a-46 was conducted. These partially resistant genotypes differed in the timing and the magnitude of SA and JA signaling pathway activation. The SA signaling pathway was only triggered in 964a-46, whereas the JA pathway was triggered in both partially resistant genotypes CDC Robin and 964a-46. The expression of JA-associated genes was lower in 964a-46 than CDC Robin. These observations corroborate the existence of diverse ascochyta blight resistance mechanisms in lentil genotypes carrying different R-genes.

  12. Comparing Effects of TCR and TSC on MHO Distance Protection Setting in 400 kV Algerian Transmission Line

    Directory of Open Access Journals (Sweden)

    Mohamed ZELLAGUI


    Full Text Available This paper presents a study on the performances of distance relays setting in 400 kV in Eastern Algerian transmission networks at Sonelgaz Group (Algerian company of Electrical and Gas compensated by shunt Flexible AC Transmission System (FACTS. The facts are used for controlling transmission voltage, power flow, reactive power, and damping of power system oscillations in high power transfer levels. The effects of SVC devices i.e. Thyristor Controlled Reactor (TCR and the Thyristor Switched Capacitors (TSC insertion, on the total impedance of a transmission line protected by MHO distance relay are investigated. The modified setting zones protections for three forward zones (Z1, Z2 and Z3 have been calculated in order to improve the performances of distance relay protection and prevent circuit breaker nuisance tripping.

  13. Analysis of lightning fault detection, location and protection on short and long transmission lines using Real Time Digital Simulation

    Energy Technology Data Exchange (ETDEWEB)

    Oliveira, Andre Luiz Pereira de [Siemens Ltda., Sao Paulo, SP (Brazil)], E-mail:


    The purpose of this paper is to present an analysis of lightning fault detection, location and protection using numeric distance relays applied in high voltage transmission lines, more specifically in the 500 kV transmission lines of CEMIG (Brazilian Energy Utility) between the Vespasiano 2 - Neves 1 (short line - 23.9 km) and Vespasiano 2 - Mesquita (long line - 148.6 km) substations. The analysis was based on the simulations results of numeric distance protective relays on power transmission lines, realized in September 02 to 06, 2002, at Siemens AG's facilities (Erlangen - Germany), using Real Time Digital Simulator (RTDS{sup TM}). Several lightning faults simulations were accomplished, in several conditions of the electrical power system where the protective relays would be installed. The results are presented not only with the times of lightning faults elimination, but also all the functionality of a protection system, including the correct detection, location and other advantages that these modern protection devices make possible to the power system. (author)

  14. A compact very wideband amplifying filter based on RTD loaded composite right/left-handed transmission lines. (United States)

    Abu-Marasa, Mahmoud O Mahmoud; El-Khozondar, Hala Jarallah


    The composite right/left-handed (CRLH) transmission line (TL) is presented as a general TL possessing both left-handed (LH) and right-handed (RH) natures. RH materials have both positive permittivity and positive permeability, and LH materials have both negative permittivity and negative permeability. This paper aims to design and analyze nonlinear CRLH-TL transmission line loaded with resonant tunneling diode (RTD). The main application of this design is a very wideband and compact filter that amplifies the travelling signal. We used OrCAD and ADS software to analyze the proposed circuit. CRLH-TL consists of a microstrip line which is loaded with complementary split-rings resonators (CSRRs), series gaps, and shunt inductor connected parallel to the RTD. The designed structure possess a wide band that ranges from 5 to 10.5 GHz and amplifies signal up to 50 %. The proposed design is of interest to microwave compact component designers.

  15. Seasonal Patterns of Melatonin, Cortisol, and Progesterone Secretion in Female Lambs Raised Beneath a 500-KV Transmission Line (United States)

    Lee, Jack Monroe, Jr.

    There is ongoing controversy about the possibility of adverse biological effects from environmental exposures to electric and magnetic fields. These fields are produced by all electrical equipment and appliances including electrical transmission lines. The objective of this environmental science study was to investigate the possible effects of a high voltage transmission line on domestic sheep (Ovis aries L.), a species that can often be found near such lines. The study was primarily designed to determine whether a specific effect of electric and magnetic fields found in laboratory animals also occurs in livestock under natural environmental conditions. The effect is the ability of fields, at levels found in the environment, to significantly depress the normally high nocturnal concentrations of the pineal hormone-melatonin. Ten female Suffolk lambs were penned for 10 months directly beneath a 500-kV transmission line near Estacada, Oregon. Ten other lambs of the same type were penned in a control area away from the transmission line where electric and magnetic fields were at ambient levels. Serum melatonin was analyzed by radioimmunoassay (RIA) from 6618 blood samples collected at 0.5 to 3-hour intervals over eight 48-hour periods. Serum progesterone was analyzed by RIA from blood samples collected twice weekly. Serum cortisol was also assayed by RIA from the blood samples collected during the 48-hour samples. Results showed that lambs in both the control and line groups had the typical pattern of melatonin secretion consisting of low daytime and high nighttime serum concentrations. There were no statistically significant differences between groups in melatonin levels, or in the phase or duration of the nighttime melatonin elevation. Age at puberty and number of reproductive cycles also did not differ between groups. Serum cortisol showed a circadian rhythm with highest concentrations during the day. There were, however, no differences in cortisol concentrations

  16. Experience-Dependent Equilibration of AMPAR-Mediated Synaptic Transmission during the Critical Period

    Directory of Open Access Journals (Sweden)

    Kyung-Seok Han


    Full Text Available Experience-dependent synapse refinement is essential for functional optimization of neural circuits. However, how sensory experience sculpts excitatory synaptic transmission is poorly understood. Here, we show that despite substantial remodeling of synaptic connectivity, AMPAR-mediated synaptic transmission remains at equilibrium during the critical period in the mouse primary visual cortex. The maintenance of this equilibrium requires neurogranin (Ng, a postsynaptic calmodulin-binding protein important for synaptic plasticity. With normal visual experience, loss of Ng decreased AMPAR-positive synapse numbers, prevented AMPAR-silent synapse maturation, and increased spine elimination. Importantly, visual deprivation halted synapse loss caused by loss of Ng, revealing that Ng coordinates experience-dependent AMPAR-silent synapse conversion to AMPAR-active synapses and synapse elimination. Loss of Ng also led to sensitized long-term synaptic depression (LTD and impaired visually guided behavior. Our synaptic interrogation reveals that experience-dependent coordination of AMPAR-silent synapse conversion and synapse elimination hinges upon Ng-dependent mechanisms for constructive synaptic refinement during the critical period.

  17. Determination of High-Frequency Current Distribution Using EMTP-Based Transmission Line Models with Resulting Radiated Electromagnetic Fields

    Energy Technology Data Exchange (ETDEWEB)

    Mork, B; Nelson, R; Kirkendall, B; Stenvig, N


    Application of BPL technologies to existing overhead high-voltage power lines would benefit greatly from improved simulation tools capable of predicting performance - such as the electromagnetic fields radiated from such lines. Existing EMTP-based frequency-dependent line models are attractive since their parameters are derived from physical design dimensions which are easily obtained. However, to calculate the radiated electromagnetic fields, detailed current distributions need to be determined. This paper presents a method of using EMTP line models to determine the current distribution on the lines, as well as a technique for using these current distributions to determine the radiated electromagnetic fields.

  18. A long-pulse repetitive operation magnetically insulated transmission line oscillator

    International Nuclear Information System (INIS)

    Fan, Yu-Wei; Zhong, Hui-Huang; Zhang, Jian-De; Shu, Ting; Liu, Jin Liang


    The improved magnetically insulated transmission line oscillator (MILO) is a gigawatt-class L-band high power microwave tube. It has allowed us to generate 3.1 GW pulse of 40 ns duration in the single-pulse operation and 500 MW pulse of 25 ns duration in the repetition rate operation. However, because of the severe impedance mismatch, the power conversion efficiency is only about 4% in the repetition rate operation. In order to eliminate the impedance mismatch and obtain repetitive long-pulse high-power microwave (HPM), a series of experiments are carried out and the recent progress is presented in this paper. In the single-pulse operation, when the diode voltage is 466 kV and current is 41.6 kA, the radiated microwave power is above 2.2 GW, the pulse duration is above 102 ns, the microwave frequency is about 1.74 GHz, and the power conversion efficiency is about 11.5%. In the repetition rate operation, under the condition of the diode voltage about 400 kV, beam current about 38 kA, the radiated microwave power is about 1.0 GW, the pulse duration is about 85 ns. Moreover, the radiated microwave power and the pulse duration decline little by little when the shot numbers increase gradually. The experimental results show that the impedance matching is a vital factor for HPM systems and one of the major technical challenges is to improve the cathode for the repetition rate operation MILO

  19. A long-pulse repetitive operation magnetically insulated transmission line oscillator

    Energy Technology Data Exchange (ETDEWEB)

    Fan, Yu-Wei; Zhong, Hui-Huang; Zhang, Jian-De; Shu, Ting; Liu, Jin Liang [College of Optoelectric Science and Engineering, National University of Defense Technology, Changsha 410073 (China)


    The improved magnetically insulated transmission line oscillator (MILO) is a gigawatt-class L-band high power microwave tube. It has allowed us to generate 3.1 GW pulse of 40 ns duration in the single-pulse operation and 500 MW pulse of 25 ns duration in the repetition rate operation. However, because of the severe impedance mismatch, the power conversion efficiency is only about 4% in the repetition rate operation. In order to eliminate the impedance mismatch and obtain repetitive long-pulse high-power microwave (HPM), a series of experiments are carried out and the recent progress is presented in this paper. In the single-pulse operation, when the diode voltage is 466 kV and current is 41.6 kA, the radiated microwave power is above 2.2 GW, the pulse duration is above 102 ns, the microwave frequency is about 1.74 GHz, and the power conversion efficiency is about 11.5%. In the repetition rate operation, under the condition of the diode voltage about 400 kV, beam current about 38 kA, the radiated microwave power is about 1.0 GW, the pulse duration is about 85 ns. Moreover, the radiated microwave power and the pulse duration decline little by little when the shot numbers increase gradually. The experimental results show that the impedance matching is a vital factor for HPM systems and one of the major technical challenges is to improve the cathode for the repetition rate operation MILO.

  20. A long-pulse repetitive operation magnetically insulated transmission line oscillator. (United States)

    Fan, Yu-Wei; Zhong, Hui-Huang; Zhang, Jian-De; Shu, Ting; Liu, Jin Liang


    The improved magnetically insulated transmission line oscillator (MILO) is a gigawatt-class L-band high power microwave tube. It has allowed us to generate 3.1 GW pulse of 40 ns duration in the single-pulse operation and 500 MW pulse of 25 ns duration in the repetition rate operation. However, because of the severe impedance mismatch, the power conversion efficiency is only about 4% in the repetition rate operation. In order to eliminate the impedance mismatch and obtain repetitive long-pulse high-power microwave (HPM), a series of experiments are carried out and the recent progress is presented in this paper. In the single-pulse operation, when the diode voltage is 466 kV and current is 41.6 kA, the radiated microwave power is above 2.2 GW, the pulse duration is above 102 ns, the microwave frequency is about 1.74 GHz, and the power conversion efficiency is about 11.5%. In the repetition rate operation, under the condition of the diode voltage about 400 kV, beam current about 38 kA, the radiated microwave power is about 1.0 GW, the pulse duration is about 85 ns. Moreover, the radiated microwave power and the pulse duration decline little by little when the shot numbers increase gradually. The experimental results show that the impedance matching is a vital factor for HPM systems and one of the major technical challenges is to improve the cathode for the repetition rate operation MILO.

  1. An FFT-accelerated time-domain multiconductor transmission line simulator

    KAUST Repository

    Bagci, Hakan


    A fast time-domain multiconductor transmission line (MTL) simulator for analyzing general MTL networks is presented. The simulator models the networks as homogeneous MTLs that are excited by external fields and driven/terminated/ connected by potentially nonlinear lumped circuitry. It hybridizes an MTL solver derived from time-domain integral equations (TDIEs) in unknown wave coefficients for each MTL with a circuit solver rooted in modified nodal analysis equations in unknown node voltages and voltage-source currents for each circuit. These two solvers are rigorously interfaced at MTL and circuit terminals, and the resulting coupled system of equations is solved simultaneously for all MTL and circuit unknowns at each time step. The proposed simulator is amenable to hybridization, is fast Fourier transform (FFT)-accelerated, and is highly accurate: 1) It can easily be hybridized with TDIE-based field solvers (in a fully rigorous mathematical framework) for performing electromagnetic interference and compatibility analysis on electrically large and complex structures loaded with MTL networks. 2) It is accelerated by an FFT algorithm that calculates temporal convolutions of time-domain MTL Green functions in only O(Ntlog2 N t) rather than O(Ntt2) operations, where N t is the number of time steps of simulation. Moreover, the algorithm, which operates on temporal samples of MTL Green functions, is indifferent to the method used to obtain them. 3) It approximates MTL voltages, currents, and wave coefficients, using high-order temporal basis functions. Various numerical examples, including the crosstalk analysis of a (twisted) unshielded twisted-pair (UTP)-CAT5 cable and the analysis of field coupling into UTP-CAT5 and RG-58 cables located on an airplane, are presented to demonstrate the accuracy, efficiency, and versatility of the proposed simulator. © 2010 IEEE.

  2. Pipe type poles in transmission power lines; Postes tipo tubo en lineas de transmision

    Energy Technology Data Exchange (ETDEWEB)

    Cervantes E, Mario; Becerril A, Armando [Luz y Fuerza del Centro, Mexico, D. F. (Mexico)


    The first supports for transmission power lines were relatively small structures, of simple configuration, to save reduced clearances to resist load in accordance with its need; with the technical development, gradually appeared higher and higher electric tensions and greater obstacles to overcome, consequently the design of the supports had to be adapted to the new conditions. This gave rise to the development of a specific technique that would adequate and incorporate the continuous engineering advances. In this document the initial considerations on the design poles pipe type are examined; within these considerations mention is made of: the design, the manufacture, the prototype tests, installation, quality control and foundations. The type tube pole is portrayed, as well as the steel reinforcement, finally the types of precast foundations are shown [Espanol] Los primeros soportes para lineas de transmision fueron estructuras relativamente pequenas, de configuracion simple, para salvar claros reducidos y resistir cargas proporcionales a sus necesidades, con el desarrollo de la tecnica, fueron apareciendo tensiones electricas cada vez mas elevadas y obstaculos mayores que vencer, por lo que el diseno de los soportes tuvo que adaptarse a las nuevas condiciones. Esto dio origen al desenvolvimiento de una tecnica especifica que fuese adecuando e incorporando los continuos avances de la ingenieria. En este documento se tratan las consideraciones iniciales del diseno de los postes tipo tubo; dentro de estas consideraciones se citan: el diseno, la fabricacion, las pruebas de prototipo, montajes, control de calidad y cimentaciones. Se ilustra el poste tipo tubo, al igual que el armado del poste, por ultimo se muestra los tipos de cimentaciones precoladas

  3. In-Containment Signal Acquisition and Data Transmission via Power Lines within High Dose Areas of Nuclear Power Plants

    International Nuclear Information System (INIS)

    Mueller Steffen; Wibbing Sascha; Weigel Robert; Koelpin Alexander; Dennerlein, Juergen; Janke, Iryna; Weber, Johannes


    Signal acquisition and data transmission for innovative sensor systems and networks inside the containment of nuclear power plants (NPPs) is still a challenge with respect to safety, performance, reliability, availability, and costs. This especially applies to equipment upgrades for existing plants, special measurements, but also for new builds. This paper presents a novel method for efficient and cost-effective sensor signal acquisition and data transmission via power lines, in order to cope with the disadvantages of common system architectures that often suffer from poor signal integrity due to raw data transmissions via long cables, huge efforts and costs for installation, and low flexibility with respect to maintenance and upgrades. A transmitter-receiver architecture is proposed that allows multiplexing of multiple sensor inputs for unidirectional point-to-point transmission by superimposing information signals on existing AC or DC supply lines, but also on active and inactive sensor wires, or spare cables, using power line communication (PLC) technology. Based on commercial off-the-shelf (COTS) electronic parts, a radiation hard transmitter hardware is designed to operate in harsh environment within the containment during full plant operation. The system's modular approach allows application specific trade-offs between redundancy and throughput regarding data transmission, as well as various sensor input front-ends which are compatible with state of the art systems. PLC technology eliminates the need for costly installation of additional cables and wall penetrations, while providing a complementary and diverse communication technology for upgrades of existing systems. At the receiver side in low dose areas, signals are extracted from the power line, demodulated, and de-multiplexed, in order to regain the original sensor signal information and provide it either in analog or digital output format. Successful laboratory qualification tests, field trails

  4. In-Containment Signal Acquisition and Data Transmission via Power Lines within High Dose Areas of Nuclear Power Plants

    Energy Technology Data Exchange (ETDEWEB)

    Mueller Steffen; Wibbing Sascha; Weigel Robert; Koelpin Alexander [Institute for Electronics Engineering, University of Erlangen-Nuremberg (Germany); Dennerlein, Juergen; Janke, Iryna; Weber, Johannes [AREVA GmbH, Paul-Gossen-Str. 100, 91052 Erlangen (Germany)


    Signal acquisition and data transmission for innovative sensor systems and networks inside the containment of nuclear power plants (NPPs) is still a challenge with respect to safety, performance, reliability, availability, and costs. This especially applies to equipment upgrades for existing plants, special measurements, but also for new builds. This paper presents a novel method for efficient and cost-effective sensor signal acquisition and data transmission via power lines, in order to cope with the disadvantages of common system architectures that often suffer from poor signal integrity due to raw data transmissions via long cables, huge efforts and costs for installation, and low flexibility with respect to maintenance and upgrades. A transmitter-receiver architecture is proposed that allows multiplexing of multiple sensor inputs for unidirectional point-to-point transmission by superimposing information signals on existing AC or DC supply lines, but also on active and inactive sensor wires, or spare cables, using power line communication (PLC) technology. Based on commercial off-the-shelf (COTS) electronic parts, a radiation hard transmitter hardware is designed to operate in harsh environment within the containment during full plant operation. The system's modular approach allows application specific trade-offs between redundancy and throughput regarding data transmission, as well as various sensor input front-ends which are compatible with state of the art systems. PLC technology eliminates the need for costly installation of additional cables and wall penetrations, while providing a complementary and diverse communication technology for upgrades of existing systems. At the receiver side in low dose areas, signals are extracted from the power line, demodulated, and de-multiplexed, in order to regain the original sensor signal information and provide it either in analog or digital output format. Successful laboratory qualification tests, field trails

  5. Sound Transmission in a Duct with Sudden Area Expansion, Extended Inlet, and Lined Walls in Overlapping Region

    Directory of Open Access Journals (Sweden)

    Ahmet Demir


    Full Text Available The transmission of sound in a duct with sudden area expansion and extended inlet is investigated in the case where the walls of the duct lie in the finite overlapping region lined with acoustically absorbent materials. By using the series expansion in the overlap region and using the Fourier transform technique elsewhere we obtain a Wiener-Hopf equation whose solution involves a set of infinitely many unknown expansion coefficients satisfying a system of linear algebraic equations. Numerical solution of this system is obtained for various values of the problem parameters, whereby the effects of these parameters on the sound transmission are studied.

  6. Environmental Assessment and Finding of No Significant Impact: Curecanti-Lost Canyon 230-kV Transmission Line Reroute Project, Montrose County, Colorado

    Energy Technology Data Exchange (ETDEWEB)



    The Department of Energy (DOE), Western Area Power Administration (Western) is proposing to reroute a section of the Curecanti-Lost Canyon 230-kilovolt (kV) transmission line, in Montrose County, Colorado. A portion of the transmission line, situated 11 miles southeast of Montrose, Colorado, crosses Waterdog Peak, an area of significant geologic surface activity, which is causing the transmission line's lattice steel towers to shift. This increases stress to structure hardware and conductors, and poses a threat to the integrity of the transmission system. Western proposes to relocate the lattice steel towers and line to a more geologically stable area. The existing section of transmission line and the proposed relocation route cross Bureau of Land Management and private land holdings.

  7. Development of a Laboratory Synchrophasor Network and an Application to Estimate Transmission Line Parameters in Real Time (United States)

    Almiron Bonnin, Rubens Eduardo

    The development of an experimental synchrophasors network and application of synchrophasors for real-time transmission line parameter monitoring are presented in this thesis. In the laboratory setup, a power system is simulated in a RTDS real-time digital simulator, and the simulated voltages and currents are input to hardware phasor measurement units (PMUs) through the analog outputs of the simulator. Time synchronizing signals for the PMU devices are supplied from a common GPS clock. The real time data collected from PMUs are sent to a phasor data concentrator (PDC) through Ethernet using the TCP/IP protocol. A real-time transmission line parameter monitoring application program that uses the synchrophasor data provided by the PDC is implemented and validated. The experimental synchrophasor network developed in this thesis is expected to be used in research on synchrophasor applications as well as in graduate and undergraduate teaching.

  8. Theoretical Analysis of Moving Reference Planes Associated with Unit Cells of Nonreciprocal Lossy Periodic Transmission-Line Structures

    Directory of Open Access Journals (Sweden)

    S. Lamultree


    Full Text Available This paper presents a theoretical analysis of moving reference planes associated with unit cells of nonreciprocal lossy periodic transmission-line structures (NRLSPTLSs by the equivalent bi-characteristic-impedance transmission line (BCITL model. Applying the BCITL theory, only the equivalent BCITL parameters (characteristic impedances for waves propagating in forward and reverse directions and associated complex propagation constants are of interest. An infinite NRLSPTLS is considered first by shifting a reference position of unit cells along TLs of interest. Then, a semi-infinite terminated NRLSPTLS is investigated in terms of associated load reflection coefficients. It is found that the equivalent BCITL characteristic impedances of the original and shifted unit cells are mathematically related by the bilinear transformation. In addition, the associated load reflection coefficients of both unit cells are mathematically related by the bilinear transformation. However, the equivalent BCITL complex propagation constants remain unchanged. Numerical results are provided to show the validity of the proposed theoretical analysis.

  9. Kosovo’s Ground Flash Density and Protection of Transmission Lines of the Kosovo Power System from Atmospheric Discharges

    Directory of Open Access Journals (Sweden)

    Bahri Prebreza


    Full Text Available In this paper is presented the protection of transmission power lines of the Kosovo Power System from atmospheric discharges, with the use of surge arresters. Atmospheric discharges represent one of the main causes of interruptions for the Kosovo Power System. In addition, the ground flash density for Kosovo is given. The transmission lines with the worst performance regarding atmospheric discharges are discussed in more detail and are presented recommendations about the surge arresters used to protect the system from these overvoltages. The data provided by the localized lightning system in Kosovo enable us to provide a detailed correlation of the reported outages of the Kosovo Power System and corresponding atmospheric discharges. Recommendations for protection in terms of surge arresters are given followed by subsequent dynamic simulations using MATLAB software.

  10. Scheme for realizing quantum computation and quantum information transfer with superconducting qubits coupling to a 1D transmission line resonator

    International Nuclear Information System (INIS)

    Zhen-Gang, Shi; Xiong-Wen, Chen; Xi-Xiang, Zhu; Ke-Hui, Song


    This paper proposes a simple scheme for realizing one-qubit and two-qubit quantum gates as well as multiqubit entanglement based on dc-SQUID charge qubits through the control of their coupling to a 1D transmission line resonator (TLR). The TLR behaves effectively as a quantum data-bus mode of a harmonic oscillator, which has several practical advantages including strong coupling strength, reproducibility, immunity to 1/f noise, and suppressed spontaneous emission. In this protocol, the data-bus does not need to stay adiabatically in its ground state, which results in not only fast quantum operation, but also high-fidelity quantum information processing. Also, it elaborates the transfer process with the 1D transmission line. (general)

  11. Evaluation of lightning performance of transmission lines protected by metal oxide surge arresters using artificial intelligence techniques

    Energy Technology Data Exchange (ETDEWEB)

    Christodoulou, C.A.; Perantzakis, G. [Technological Educational Institute (TEI) of Lamia, Department of Electrical Engineering, Lamia (Greece); Spanakis, G.E. [School of Electrical and Computer Engineering, National Technical University of Athens, Athens (Greece); Karampelas, P. [Hellenic American University, Manchester, NH (United States)


    Lightning and switching overvoltages are the main causes for faults in electrical networks. In the last decades, several different conventional methodologies have been used for the adjustment of the lightning performance of high voltage transmission lines, which are protected against lightning using overhead ground wires and surge arresters. The current paper proposes a new developed Artificial Neural Network (ANN), based on the Q-learning algorithm, in order to estimate the lightning failure rate of lines of the Hellenic system. The results obtained by the ANN model exhibit a satisfactory correlation in comparison with the real recorded data or the simulations results taken from a conventional method. (orig.)

  12. Design and performance of the Z magnetically-insulated transmission lines

    International Nuclear Information System (INIS)

    Stygar, W.A.; Spielman, R.B.; Allshouse, G.O.


    The 36-module Z accelerator was designed to drive z-pinch loads for weapon-physics and inertial-confinement-fusion experiments, and to serve as a testing facility for pulsed-power research required to develop higher-current drivers. The authors have designed and tested a 10-nH 1.5-m-radius vacuum section for the Z accelerator. The vacuum section consists of four vacuum flares, four conical 1.3-m-radius magnetically-insulated transmission lines, a 7.6-cm-radius 12-post double-post-hole convolute which connects the four outer MITLs in parallel, and a 5-cm-long inner MITL which connects the output of the convolute to a z-pinch load. IVORY and ELECTRO calculations were performed to minimize the inductance of the vacuum flares with the constraint that there be no significant electron emission from the insulator-stack grading rings. Iterative TLCODE calculations were performed to minimize the inductance of the outer MITLs with the constraint that the MITL electron-flow-current fraction be ≤ 7% at peak current. The TLCODE simulations assume a 2.5 cm/micros MITL-cathode-plasma expansion velocity. The design limits the electron dose to the outer-MITL anodes to 50 J/g to prevent the formation of an anode plasma. The TLCODE results were confirmed by SCREAMER, TRIFL, TWOQUICK, IVORY, and LASNEX simulations. For the TLCODE, SCREAMER, and TRIFL calculations, the authors assume that after magnetic insulation is established, the electron-flow current launched in the outer MITLs is lost at the convolute. This assumption has been validated by 3-D QUICKSILVER simulations for load impedances ≤ 0.36 ohms. LASNEX calculations suggest that ohmic resistance of the pinch and conduction-current-induced energy loss to the MITL electrodes can be neglected in Z power-flow modeling that is accurate to first order. To date, the Z vacuum section has been tested on 100 shots. They have demonstrated they can deliver a 100-ns rise-time 20-MA current pulse to the baseline z-pinch load

  13. Sound transmission through lined, composite panel structures: Transversely isotropic poro-elastic model (United States)

    Kim, Jeong-Woo

    A joint experimental and analytical investigation of the sound transmission loss (STL) and two-dimensional free wave propagation in composite sandwich panels is presented here. An existing panel, a Nomex honeycomb sandwich panel, was studied in detail. For the purpose of understanding the typical behavior of sandwich panels, a composite structure comprising two aluminum sheets with a relatively soft, poro-elastic foam core was also constructed and studied. The cores of both panels were modeled using an anisotropic (transversely isotropic) poro-elastic material theory. Several estimation methods were used to obtain the material properties of the honeycomb core and the skin plates to be used in the numerical calculations. Appropriate values selected from among the estimates were used in the STL and free wave propagation models. The prediction model was then verified in two ways: first, the calculated wave speeds and STL of a single poro-elastic layer were numerically verified by comparison with the predictions of a previously developed isotropic model. Secondly, to physically validate the transversely isotropic model, the measured STL and the phase speeds of the sandwich panels were compared with their predicted values. To analyze the actual treatment of a fuselage structure, multi-layered configurations, including a honeycomb panel and several layers such as air gaps, acoustic blankets and membrane partitions, were formulated. Then, to find the optimal solution for improving the sound barrier performance of an actual fuselage system, air layer depth and glass fiber lining effects were investigated by using these multi-layer models. By using the free wave propagation model, the first anti-symmetric and symmetric modes of the sandwich panels were characterized to allow the identification of the coincidence frequencies of the sandwich panel. The behavior of the STL could then be clearly explained by comparison with the free wave propagation solutions. By performing a

  14. Frequency-Dependent Disease Transmission and the Dynamics of the Silene-Ustilago Host-Pathogen System

    NARCIS (Netherlands)

    Thrall, P.H.; Biere, A.; Uyenoyama, M.K.


    Models incorporating density-dependent disease transmission functions generally provide a good fit for airborne and directly transmitted bacterial or viral diseases. However, the transmission dynamics of sexually transmitted and vector-borne diseases are likely to be frequency- rather than density-

  15. Conducting to non-conducting transition in dual transmission lines using a ternary model with long-range correlated disorder

    International Nuclear Information System (INIS)

    Lazo, E.; Diez, E.


    In this work we study the behavior of the allowed and forbidden frequencies in disordered classical dual transmission lines when the values of capacitances {C j } are distributed according to a ternary model with long-range correlated disorder. We introduce the disorder from a random sequence with a power spectrum S(k)∝k -(2α-1) , where α≥0.5 is the correlation exponent. From this sequence we generate an asymmetric ternary map using two map parameters b 1 and b 2 , which adjust the occupancy probability of each possible value of the capacitances C j ={C A, C B, C C, }. If the sequence of capacitance values is totally at random α=0.5 (white noise), the electrical transmission line is in the non-conducting state for every frequency ω. When we introduce long-range correlations in the distribution of capacitances, the electrical transmission lines can change their conducting properties and we can find a transition from the non-conducting to conducting state for a fixed system size. This implies the existence of critical values of the map parameters for each correlation exponent α. By performing finite-size scaling we obtain the asymptotic value of the map parameters in the thermodynamic limit for any α. With these data we obtain a phase diagram for the symmetric ternary model, which separates the non-conducting state from the conducting one. This is the fundamental result of this Letter. In addition, introducing one or more impurities in random places of the long-range correlated distribution of capacitances, we observe a dramatic change in the conducting properties of the electrical transmission lines, in such a way that the system jumps from conducting to non-conducting states. We think that this behavior can be considered as a possible mechanism to secure communication.

  16. Reconfigurable Transmission Line for a Series-Fed Ku-Band Phased Array Using a Single Feed (United States)

    Host, Nicholas K.; Chen, Chi-Chih; Volakis, John L.; Miranda. Felix, A.


    The paper presents a novel approach to realize a lowcost phased array using a simple feeding mechanism. Specifically, a single coplanar stripline (CPS) transmission line is used to feed the antenna array elements. By controlling the CPS's dielectric properties using a movable dielectric plunger, scanning is achieved. Due to its simplicity, single feed, and no phase shifters, this approach leads to a dramatic reduction in cost which does not scale for larger arrays.

  17. Sierra Pacific Power Company Alturas Transmission Line Project, Final Environmental Impact Report/Environmental Impact Statement. Volume 3: Appendices

    International Nuclear Information System (INIS)


    Sierra Pacific Power Company has proposed the construction and operation of a 345,000 volt overhead electric power transmission line from Alturas, California to Reno, Nevada. This Environmental Impact Report/Environmental Impact Statement will assess the potential environmental impacts of the proposed project and alternatives. This report contains Appendices A--I which contain the following: glossary/abbreviations; scoping report; structure coordinate summary; air quality; biological resources; geology; noise; visual contrast rating forms; and cultural resources

  18. The perfect host: a mouse host embryo facilitating more efficient germ line transmission of genetically modified embryonic stem cells.

    Directory of Open Access Journals (Sweden)

    Robert A Taft

    Full Text Available There is a continual need to improve efficiency in creating precise genetic modifications in mice using embryonic stem cells (ESCs. We describe a novel approach resulting in 100% germline transmission from competent injected ESCs. We developed an F1 mouse host embryo (Perfect Host, PH that selectively ablates its own germ cells via tissue-specific induction of diphtheria toxin. This approach allows competent microinjected ESCs to fully dominate the germline, eliminating competition for this critical niche in the developing and adult animal. This is in contrast to conventional methods, where competition from host germ cells results in offspring derived from host cells and ESCs, necessitating extensive breeding of chimeras and genotyping to identify germline. The germline transmission process is also complicated by variability in the actual number of ESCs that colonize the germline niche and the proportion that are germline competent. To validate the PH approach we used ESC lines derived from 129 F1, BALB/cByJ, and BTBR backgrounds as well as an iPS line. Resulting chimeric males produced 194 offspring, all paternally derived from the introduced stem cells, with no offspring being derived from the host genome. We further tested this approach using eleven genetically modified C57BL/6N ESC lines (International Knockout Mouse Consortium. ESC germline transmission was observed in 9/11 (82% lines using PH blastocysts, compared to 6/11 (55% when conventional host blastocysts were used. Furthermore, less than 35% (83/240 of mice born in the first litters from conventional chimeras were confirmed to be of ESC-origin. By comparison, 100% (137/137 of the first litter offspring of PH chimeras were confirmed as ESC-derived. Together, these data demonstrate that the PH approach increases the probability of germline transmission and speeds the generation of ESC derived animals from chimeras. Collectively, this approach reduces the time and costs inherent in the

  19. Gyromagnetic nonlinear transmission line generator of high voltage pulses modulated at 4 GHz frequency with 1000 Hz pulse repetition rate

    International Nuclear Information System (INIS)

    Ulmasculov, M R; Sharypov, K A; Shunailov, S A; Shpak, V G; Yalandin, M I; Pedos, M S; Rukin, S N


    Results of testing of a generator based on a solid-state drive and the parallel gyromagnetic nonlinear transmission lines with external bias are presented. Stable rf-modulated high-voltage nanosecond pulses were shaped in each of the four channels in 1 s packets with 1000 Hz repetition frequencies. Pulse amplitude reaches -175 kV, at a modulation depth of rf-oscillations to 50 % and the effective frequency ∼4 GHz. (paper)

  20. MPTP-meditated hippocampal dopamine deprivation modulates synaptic transmission and activity-dependent synaptic plasticity

    International Nuclear Information System (INIS)

    Zhu Guoqi; Chen Ying; Huang Yuying; Li Qinglin; Behnisch, Thomas


    Parkinson's disease (PD)-like symptoms including learning deficits are inducible by 1-methyl-4-phenyl-1,2,3,6-tetrahydropyridine (MPTP). Therefore, it is possible that MPTP may disturb hippocampal memory processing by modulation of dopamine (DA)- and activity-dependent synaptic plasticity. We demonstrate here that intraperitoneal (i.p.) MPTP injection reduces the number of tyrosine hydroxylase (TH)-positive neurons in the substantia nigra (SN) within 7 days. Subsequently, the TH expression level in SN and hippocampus and the amount of DA and its metabolite DOPAC in striatum and hippocampus decrease. DA depletion does not alter basal synaptic transmission and changes pair-pulse facilitation (PPF) of field excitatory postsynaptic potentials (fEPSPs) only at the 30 ms inter-pulse interval. In addition, the induction of long-term potentiation (LTP) is impaired whereas the duration of long-term depression (LTD) becomes prolonged. Since both LTP and LTD depend critically on activation of NMDA and DA receptors, we also tested the effect of DA depletion on NMDA receptor-mediated synaptic transmission. Seven days after MPTP injection, the NMDA receptor-mediated fEPSPs are decreased by about 23%. Blocking the NMDA receptor-mediated fEPSP does not mimic the MPTP-LTP. Only co-application of D1/D5 and NMDA receptor antagonists during tetanization resembled the time course of fEPSP potentiation as observed 7 days after i.p. MPTP injection. Together, our data demonstrate that MPTP-induced degeneration of DA neurons and the subsequent hippocampal DA depletion alter NMDA receptor-mediated synaptic transmission and activity-dependent synaptic plasticity. - Highlights: → I.p. MPTP-injection mediates death of dopaminergic neurons. → I.p. MPTP-injection depletes DA and DOPAC in striatum and hippocampus. → I.p. MPTP-injection does not alter basal synaptic transmission. → Reduction of LTP and enhancement of LTD after i.p. MPTP-injection. → Attenuation of NMDA-receptors mediated

  1. Technical and economic data for overhead lines in high-voltage a. c. and d. c. transmission

    Energy Technology Data Exchange (ETDEWEB)


    For the study of 'High-power electricity transmission and distribution in densely populated areas' technical and economic data were compiled for high-voltage alternating current and direct current transmission. A modification of the overhead lines for transmitting higher powers is possible as required by means of higher rated transmission voltages, larger conductor cross-sections and a larger number of circuits installed on each mast. For the use of larger partial conductor cross-sections and of bundle conductors with more than 4 partial conductors, and also to use voltages higher than 380 kV, development work is requisite from the points of view of construction, installation, insulators and fittings. Further possible developments result from the use of new materials such as plastic insulators which make possible the use of more versatile shapes for application in heavy pollution, particulary for direct current overhead lines. By using insulating crossarms the width of path can be considerably reduced. Economic efficiency investigations show even today higher cost for such techniques compared with lines of earlier construction.

  2. High-voltage isolation transformer for sub-nanosecond rise time pulses constructed with annular parallel-strip transmission lines. (United States)

    Homma, Akira


    A novel annular parallel-strip transmission line was devised to construct high-voltage high-speed pulse isolation transformers. The transmission lines can easily realize stable high-voltage operation and good impedance matching between primary and secondary circuits. The time constant for the step response of the transformer was calculated by introducing a simple low-frequency equivalent circuit model. Results show that the relation between the time constant and low-cut-off frequency of the transformer conforms to the theory of the general first-order linear time-invariant system. Results also show that the test transformer composed of the new transmission lines can transmit about 600 ps rise time pulses across the dc potential difference of more than 150 kV with insertion loss of -2.5 dB. The measured effective time constant of 12 ns agreed exactly with the theoretically predicted value. For practical applications involving the delivery of synchronized trigger signals to a dc high-voltage electron gun station, the transformer described in this paper exhibited advantages over methods using fiber optic cables for the signal transfer system. This transformer has no jitter or breakdown problems that invariably occur in active circuit components.

  3. Seasonal Patterns of Melatonin, Cortisol, and Progesterone Secretion in Female Lambs Raised Beneath a 500-kV Transmission Line.

    Energy Technology Data Exchange (ETDEWEB)

    Lee, Jack M.


    Although several kinds of biological effects of electric and magnetic fields have been reported from laboratory studies, few have been independently replicated. When this study was being planned, the suppression of nighttime melatonin in rodents was thought to represent one of the strongest known effects of these fields. The effect had been replicated by a single laboratory for 60-Hz electric fields, and by multiple laboratories for d-c magnetic fields. The primary objective of this study was to determine whether the effect of electric and magnetic fields on melatonin would also occur in sheep exposed to a high voltage transmission line. The specific hypothesis tested by this experiment was as follows: The electrical environment produced by a 60-Hz, 500-kV transmission line causes a depression in nocturnal melatonin in chronically exposed female lambs. This may mimic effects of pinealectomy or constant long-day photoperiods, thus delaying the onset of reproductive cycles. Results of the study do not provide evidence to support the hypothesis. Melatonin concentrations in the sheep exposed to the transmission line showed the normal pattern of low daytime and high nighttime serum levels. As compared to the control group, there were no statistically significant group differences in the mean amplitude, phase, or duration of the nighttime melatonin elevation.

  4. Learning-Dependent Plasticity of the Barrel Cortex Is Impaired by Restricting GABA-Ergic Transmission. (United States)

    Posluszny, Anna; Liguz-Lecznar, Monika; Turzynska, Danuta; Zakrzewska, Renata; Bielecki, Maksymilian; Kossut, Malgorzata


    Experience-induced plastic changes in the cerebral cortex are accompanied by alterations in excitatory and inhibitory transmission. Increased excitatory drive, necessary for plasticity, precedes the occurrence of plastic change, while decreased inhibitory signaling often facilitates plasticity. However, an increase of inhibitory interactions was noted in some instances of experience-dependent changes. We previously reported an increase in the number of inhibitory markers in the barrel cortex of mice after fear conditioning engaging vibrissae, observed concurrently with enlargement of the cortical representational area of the row of vibrissae receiving conditioned stimulus (CS). We also observed that an increase of GABA level accompanied the conditioning. Here, to find whether unaltered GABAergic signaling is necessary for learning-dependent rewiring in the murine barrel cortex, we locally decreased GABA production in the barrel cortex or reduced transmission through GABAA receptors (GABAARs) at the time of the conditioning. Injections of 3-mercaptopropionic acid (3-MPA), an inhibitor of glutamic acid decarboxylase (GAD), into the barrel cortex prevented learning-induced enlargement of the conditioned vibrissae representation. A similar effect was observed after injection of gabazine, an antagonist of GABAARs. At the behavioral level, consistent conditioned response (cessation of head movements in response to CS) was impaired. These results show that appropriate functioning of the GABAergic system is required for both manifestation of functional cortical representation plasticity and for the development of a conditioned response.

  5. A theoretical model of rain–wind–induced in-plane galloping on overhead transmission tower-lines system

    Directory of Open Access Journals (Sweden)

    Chao Zhou


    Full Text Available Rain–wind–induced galloping phenomenon often occurs on overhead transmission tower-lines system, just as icing galloping and vortex-excited vibration; this kind of instability oscillation can cause power-line breakage or tower failure. However, the existing theoretical models of rain–wind–induced galloping are mainly based on the hypothesis of the overhead power-lines with fixed ends, which is inconsistent with the actual operation situation. Therefore, this article thus presents a preliminary theoretical study and proposes a new theoretical model taking into account the effect of tower excitations on the in-plane galloping of the overhead power-line and on the motion of the upper rain-line. The theoretical model is solved by Galerkin method and verified by the comparison with the test data obtained in the available literature involved with the overhead power-lines with fixed towers or moving towers. It turns out that the tower excitations may intensify the in-plane galloping amplitude of the overhead power-line within a certain range of frequency ratio and enable better comprehension of rain–wind–induced galloping mechanism.

  6. Avian mortalities due to transmission line collisions: a review of current estimates and field methods with an emphasis on applications to the Canadian electric network

    Directory of Open Access Journals (Sweden)

    Sébastien Rioux


    Full Text Available Birds are vulnerable to collisions with human-made fixed structures. Despite ongoing development and increases in infrastructure, we have few estimates of the magnitude of collision mortality. We reviewed the existing literature on avian mortality associated with transmission lines and derived an initial estimate for Canada. Estimating mortality from collisions with power lines is challenging due to the lack of studies, especially from sites within Canada, and due to uncertainty about the magnitude of detection biases. Detection of bird collisions with transmission lines varies due to habitat type, species size, and scavenging rates. In addition, birds can be crippled by the impact and subsequently die, although crippling rates are poorly known and rarely incorporated into estimates. We used existing data to derive a range of estimates of avian mortality associated with collisions with transmission lines in Canada by incorporating detection, scavenging, and crippling biases. There are 231,966 km of transmission lines across Canada, mostly in the boreal forest. Mortality estimates ranged from 1 million to 229.5 million birds per year, depending on the bias corrections applied. We consider our most realistic estimate, taking into account variation in risk across Canada, to range from 2.5 million to 25.6 million birds killed per year. Data from multiple studies across Canada and the northern U.S. indicate that the most vulnerable bird groups are (1 waterfowl, (2 grebes, (3 shorebirds, and (4 cranes, which is consistent with other studies. Populations of several groups that are vulnerable to collisions are increasing across Canada (e.g., waterfowl, raptors, which suggests that collision mortality, at current levels, is not limiting population growth. However, there may be impacts on other declining species, such as shorebirds and some species at risk, including Alberta's Trumpeter Swans (Cygnus buccinator and western Canada's endangered Whooping

  7. A new and accurate fault location algorithm for combined transmission lines using Adaptive Network-Based Fuzzy Inference System

    Energy Technology Data Exchange (ETDEWEB)

    Sadeh, Javad; Afradi, Hamid [Electrical Engineering Department, Faculty of Engineering, Ferdowsi University of Mashhad, P.O. Box: 91775-1111, Mashhad (Iran)


    This paper presents a new and accurate algorithm for locating faults in a combined overhead transmission line with underground power cable using Adaptive Network-Based Fuzzy Inference System (ANFIS). The proposed method uses 10 ANFIS networks and consists of 3 stages, including fault type classification, faulty section detection and exact fault location. In the first part, an ANFIS is used to determine the fault type, applying four inputs, i.e., fundamental component of three phase currents and zero sequence current. Another ANFIS network is used to detect the faulty section, whether the fault is on the overhead line or on the underground cable. Other eight ANFIS networks are utilized to pinpoint the faults (two for each fault type). Four inputs, i.e., the dc component of the current, fundamental frequency of the voltage and current and the angle between them, are used to train the neuro-fuzzy inference systems in order to accurately locate the faults on each part of the combined line. The proposed method is evaluated under different fault conditions such as different fault locations, different fault inception angles and different fault resistances. Simulation results confirm that the proposed method can be used as an efficient means for accurate fault location on the combined transmission lines. (author)

  8. Study of HV Dielectrics for High Frequency Operation in Linear and Nonlinear Transmission Lines (NLTLs) and Simulation and Development of Hybrid Nonlinear Lines for RF Generation (United States)


    Microwave & Optolectronics Conf. (IMOC), Rio de Janeiro , RJ, 2013, pp. 1-5. 7) L.P. Silva Neto, J.O. Rossi, J.J. Barroso, A.R. Silva. “Characterization of...Proc. of the SBMO/IEEE MTT-S International Microwave and Optoelectronics Conference, Rio de Janeiro , Brazil, Aug. 2013, pp. 1-5. 11) L.P. Silva Neto...transmission lines,” Proc. of the SBMO/IEEE MTT-S International Microwave and Optoelectronics Conference, Rio de Janeiro , Brazil, Aug. 2013, pp. 1-5

  9. An angle-dependent estimation of CT x-ray spectrum from rotational transmission measurements

    International Nuclear Information System (INIS)

    Lin, Yuan; Samei, Ehsan; Ramirez-Giraldo, Juan Carlos; Gauthier, Daniel J.; Stierstorfer, Karl


    Purpose: Computed tomography (CT) performance as well as dose and image quality is directly affected by the x-ray spectrum. However, the current assessment approaches of the CT x-ray spectrum require costly measurement equipment and complicated operational procedures, and are often limited to the spectrum corresponding to the center of rotation. In order to address these limitations, the authors propose an angle-dependent estimation technique, where the incident spectra across a wide range of angular trajectories can be estimated accurately with only a single phantom and a single axial scan in the absence of the knowledge of the bowtie filter. Methods: The proposed technique uses a uniform cylindrical phantom, made of ultra-high-molecular-weight polyethylene and positioned in an off-centered geometry. The projection data acquired with an axial scan have a twofold purpose. First, they serve as a reflection of the transmission measurements across different angular trajectories. Second, they are used to reconstruct the cross sectional image of the phantom, which is then utilized to compute the intersection length of each transmission measurement. With each CT detector element recording a range of transmission measurements for a single angular trajectory, the spectrum is estimated for that trajectory. A data conditioning procedure is used to combine information from hundreds of collected transmission measurements to accelerate the estimation speed, to reduce noise, and to improve estimation stability. The proposed spectral estimation technique was validated experimentally using a clinical scanner (Somatom Definition Flash, Siemens Healthcare, Germany) with spectra provided by the manufacturer serving as the comparison standard. Results obtained with the proposed technique were compared against those obtained from a second conventional transmission measurement technique with two materials (i.e., Cu and Al). After validation, the proposed technique was applied to measure

  10. Sound transmission through stiffened double-panel structures lined with elastic porous materials (United States)

    Mathur, Gopal P.; Tran, Boi N.; Bolton, J. S.; Shiau, Nae-Ming

    This paper presents transmission loss prediction models for a periodically stiffened panel and stiffened double-panel structures using the periodic structure theory. The inter-panel cavity in the double-panels structures can be modeled as being separated by an airspace or filled with an elastic porous layer in various configurations. The acoustic behavior of elastic porous layer is described by a theory capable of accounting fully for multi-dimensional wave propagation in such materials. The predicted transmission loss of a single stiffened panel is compared with the measured data.

  11. Full-wave analysis using a tangential vector finite-element formulation of arbitrary cross-section transmission lines for millimeter and microwave applications (United States)

    Helal, M.; Legier, J. F.; Pribetich, P.; Kennis, P.


    A tangential vector finite-element formulation is implemented to deal with arbitrary cross section and metallic strip shape. Classical planar transmission lines as well as nonconventional cross-section waveguides such as the new microshield line are treated. Effects on propagation characteristics for these lines are studied when the metallization shape is approximated by a lossy trapezoid area.

  12. N-Terminal Prodomain of Pfs230 Synthesized Using a Cell-Free System Is Sufficient To Induce Complement-Dependent Malaria Transmission-Blocking Activity▿ (United States)

    Tachibana, Mayumi; Wu, Yimin; Iriko, Hideyuki; Muratova, Olga; MacDonald, Nicholas J.; Sattabongkot, Jetsumon; Takeo, Satoru; Otsuki, Hitoshi; Torii, Motomi; Tsuboi, Takafumi


    The aim of a malaria transmission-blocking vaccine is to block the development of malaria parasites in the mosquito and thus prevent subsequent infection of the human host. Previous studies have demonstrated that the gametocyte/gamete surface protein Pfs230 can induce transmission-blocking immunity and have evaluated Escherichia coli-produced Pfs230 as a transmission-blocking vaccine candidate. In this study, we used the wheat germ cell-free expression system to produce N-terminal fragments of Pfs230 and evaluated the transmission-blocking activity of antisera raised against the recombinant Pfs230 protein. The rabbit antisera reacted to the surface of cultured gametocytes and gametes of the Plasmodium falciparum NF54 line, recognized the 360-kDa form of parasite-produced Pfs230 by Western blot assay, and reduced the infectivity of NF54 parasites to Anopheles stefensi mosquitoes in the presence of complement in a standard membrane feeding assay. Thus, our data demonstrate that the N-terminal pro domain of Pfs230 is sufficient to induce complement-dependent transmission-blocking activity against P. falciparum. PMID:21715579

  13. N-terminal prodomain of Pfs230 synthesized using a cell-free system is sufficient to induce complement-dependent malaria transmission-blocking activity. (United States)

    Tachibana, Mayumi; Wu, Yimin; Iriko, Hideyuki; Muratova, Olga; MacDonald, Nicholas J; Sattabongkot, Jetsumon; Takeo, Satoru; Otsuki, Hitoshi; Torii, Motomi; Tsuboi, Takafumi


    The aim of a malaria transmission-blocking vaccine is to block the development of malaria parasites in the mosquito and thus prevent subsequent infection of the human host. Previous studies have demonstrated that the gametocyte/gamete surface protein Pfs230 can induce transmission-blocking immunity and have evaluated Escherichia coli-produced Pfs230 as a transmission-blocking vaccine candidate. In this study, we used the wheat germ cell-free expression system to produce N-terminal fragments of Pfs230 and evaluated the transmission-blocking activity of antisera raised against the recombinant Pfs230 protein. The rabbit antisera reacted to the surface of cultured gametocytes and gametes of the Plasmodium falciparum NF54 line, recognized the 360-kDa form of parasite-produced Pfs230 by Western blot assay, and reduced the infectivity of NF54 parasites to Anopheles stefensi mosquitoes in the presence of complement in a standard membrane feeding assay. Thus, our data demonstrate that the N-terminal pro domain of Pfs230 is sufficient to induce complement-dependent transmission-blocking activity against P. falciparum.

  14. Decision support for mitigating the risk of tree induced transmission line failure in utility rights-of-way. (United States)

    Poulos, H M; Camp, A E


    Vegetation management is a critical component of rights-of-way (ROW) maintenance for preventing electrical outages and safety hazards resulting from tree contact with conductors during storms. Northeast Utility's (NU) transmission lines are a critical element of the nation's power grid; NU is therefore under scrutiny from federal agencies charged with protecting the electrical transmission infrastructure of the United States. We developed a decision support system to focus right-of-way maintenance and minimize the potential for a tree fall episode that disables transmission capacity across the state of Connecticut. We used field data on tree characteristics to develop a system for identifying hazard trees (HTs) in the field using limited equipment to manage Connecticut power line ROW. Results from this study indicated that the tree height-to-diameter ratio, total tree height, and live crown ratio were the key characteristics that differentiated potential risk trees (danger trees) from trees with a high probability of tree fall (HTs). Products from this research can be transferred to adaptive right-of-way management, and the methods we used have great potential for future application to other regions of the United States and elsewhere where tree failure can disrupt electrical power.

  15. Design of protective inductors for HVDC transmission line within DC grid offshore wind farms

    DEFF Research Database (Denmark)

    Deng, Fujin; Chen, Zhe


    in the HVDC link between the offshore station and the onshore station. The transient characteristics of the transmission system are analyzed in detail. The criteria of selecting protective inductors are proposed to effectively limit the short-circuit current and avoid the damage to the converters. A dc grid...

  16. 78 FR 60273 - Granby Pumping Plant Switchyard-Windy Gap Substation Transmission Line Rebuild, Grand County... (United States)


    ... marketing administration in the U.S. Department of Energy (DOE), owns and operates the 69-kilovolt (kV...-State) to improve reliability for their local customer, Mountain Parks Electric, Inc., and to minimize... still need to expand their transmission system to improve service reliability to their customers by...

  17. Scenario calculations for the 2012 grid development plan. Overdimensioned HVDC transmission lines; Szenarienrechnungen zum Netzentwicklungsplan (NEP) 2012. HGUe-Leitungen ueberdimensioniert

    Energy Technology Data Exchange (ETDEWEB)

    Oei, Pao-Yu; Sander, Aram; Hankel, Lisa; Laurisch, Lilian; Lorenz, Casimir [Technische Univ. Berlin (Germany); Schroeder, Andreas [Deutsches Institut fuer Wirtschaftsforschung, Berlin (Germany)


    The grid development plan presented in June 2012 by the German Federal Network Agency envisages a large number of new AC and DC transmission lines for Germany. The purpose of these transmission lines is to facilitate the point-to-point transport of electricity produced from renewable resources to load centres. The authors present a model-assisted analysis of the impact of these transmission lines on the structure of electricity production. They also investigate to what extent an increase in storage capacity and the steering of demand can serve as alternatives to grid expansion.

  18. The effect of external mean flow on sound transmission through double-walled cylindrical shells lined with poroelastic material (United States)

    Zhou, Jie; Bhaskar, Atul; Zhang, Xin


    Sound transmission through a system of double shells, lined with poroelastic material in the presence of external mean flow, is studied. The porous material is modeled as an equivalent fluid because shear wave contributions are known to be insignificant. This is achieved by accounting for the energetically most dominant wave types in the calculations. The transmission characteristics of the sandwich construction are presented for different incidence angles and Mach numbers over a wide frequency range. It is noted that the transmission loss exhibits three dips on the frequency axis as opposed to flat panels where there are only two such frequencies—results are discussed in the light of these observations. Flow is shown to decrease the transmission loss below the ring frequency, but increase this above the ring frequency due to the negative stiffness and the damping effect added by the flow. In the absence of external mean flow, porous material provides superior insulation for most part of the frequency band of interest. However, in the presence of external flow, this is true only below the ring frequency—above this frequency, the presence of air gap in sandwich constructions is the dominant factor that determines the acoustic performance. In the absence of external flow, an air gap always improves sound insulation.

  19. A Cognitive Radio-Based Energy-Efficient System for Power Transmission Line Monitoring in Smart Grids

    Directory of Open Access Journals (Sweden)

    Saeed Ahmed


    Full Text Available The research in industry and academia on smart grids is predominantly focused on the regulation of generated power and management of its consumption. Because transmission of bulk-generated power to the consumer is immensely reliant on secure and efficient transmission grids, comprising huge electrical and mechanical assets spanning a vast geographic area, there is an impending need to focus on the transmission grids as well. Despite the challenges in wireless technologies for SGs, cognitive radio networks are considered promising for provisioning of communications services to SGs. In this paper, first, we present an IEEE 802.22 wireless regional area network cognitive radio-based network model for smart monitoring of transmission lines. Then, for a prolonged lifetime of battery finite monitoring network, we formulate the spectrum resource allocation problem as an energy efficiency maximization problem, which is a nonlinear integer programming problem. To solve this problem in an easier way, we propose an energy-efficient resource-assignment scheme based on the Hungarian method. Performance analysis shows that, compared to a pure opportunistic assignment scheme with a throughput maximization objective and compared to a random scheme, the proposed scheme results in an enhanced lifetime while consuming less battery energy without compromising throughput performance.

  20. Sound transmission through a double-panel construction lined with poroelastic material in the presence of mean flow (United States)

    Zhou, Jie; Bhaskar, Atul; Zhang, Xin


    This paper investigates the sound transmission characteristics through a system of double-panel lined with poroelastic material in the core. The panels are surrounded by external and internal fluid media where a uniform external mean flow exists on one side. Biot's theory is used to model the porous material. Three types of constructions—bonded-bonded, bonded-unbonded and unbonded-unbonded—are considered. The effect of Mach number of the external flow on the sound transmission over a wide frequency range in a diffuse sound field is examined. External mean flow is shown to give a modest increase in transmission loss at low frequency, but a significant increase at high frequency. It is brought out that calculations based on static air on the incidence side provide a conservative estimate of sound transmission through the sandwich structure. The acoustic performance of the sandwich panel for different configurations is presented. The effect of curvature of the panel is also brought out by using shallow shell theory.