WorldWideScience

Sample records for total dna extracted

  1. A CTAB Procedure Of Total Genomic DNA Extraction For Medicinal Mushrooms

    International Nuclear Information System (INIS)

    Azhar Mohamad; Muhammad Hussaini Mohd Mustafa; Muhammad Hanif Azhari Noor; Rosnani Abdul Rashid; Hasan Hamdani Hasan Mutaat; Meswan Meskom; Mat Rasol Awang

    2014-01-01

    Medicinal mushroom is defined as mushrooms used in medicine or medical research. Isolation of intact, high-molecular-mass genomic DNA is essential for many molecular biology applications including Polymerase Chain Reaction (PCR), endonuclease restriction digestion, Southern blot analysis, and genomic library construction. The most important and prerequisite towards reliable molecular biology work is the total genomic DNA of a sample must be in good quality. Five freshly samples of medicinal mushroom were used in this work known as Auriculariapolytricha, Lentinus edode, Pleurotus sayorcaju, Sczhizopyllum commune and Ganodermalucidum. 5 mg of each sample were used to extraction the DNA, prepared in 3 replications and repeated twice. PCR based technique by using ISSR markers were used in checking the amplification ability of the total genomic extraction. A standard Doyle and Doyle protocol for genomic DNA extraction was modified in optimizing the total genomic DNA from the medicinal mushroom.The modification parameters were percentage of CTAB, incubation period and temperature. The results reveal that each sample required a certain combinations of time and period of incubation. Besides, percentage of CTAB in the buffer was found significant in giving a high yielding of extracted total genomic DNA. The extracted total genomic DNA from the medicinal mushroom yielded from 39.7 ng/ μl to 919.1 ng/ μl. The different yield among the samples found to be corresponded to polysaccharide content in the medicinal mushrooms. The objective of this works is to optimize total genomic DNA extraction of medicinal mushrooms towards a high quality intact genomic DNA for molecular activities. (author)

  2. A simple and efficient total genomic DNA extraction method for individual zooplankton.

    Science.gov (United States)

    Fazhan, Hanafiah; Waiho, Khor; Shahreza, Md Sheriff

    2016-01-01

    Molecular approaches are widely applied in species identification and taxonomic studies of minute zooplankton. One of the most focused zooplankton nowadays is from Subclass Copepoda. Accurate species identification of all life stages of the generally small sized copepods through molecular analysis is important, especially in taxonomic and systematic assessment of harpacticoid copepod populations and to understand their dynamics within the marine community. However, total genomic DNA (TGDNA) extraction from individual harpacticoid copepods can be problematic due to their small size and epibenthic behavior. In this research, six TGDNA extraction methods done on individual harpacticoid copepods were compared. The first new simple, feasible, efficient and consistent TGDNA extraction method was designed and compared with the commercial kit and modified available TGDNA extraction methods. The newly described TGDNA extraction method, "Incubation in PCR buffer" method, yielded good and consistent results based on the high success rate of PCR amplification (82%) compared to other methods. Coupled with its relatively consistent and economical method the "Incubation in PCR buffer" method is highly recommended in the TGDNA extraction of other minute zooplankton species.

  3. Evaluation of five methods for total DNA extraction from western corn rootworm beetles.

    Directory of Open Access Journals (Sweden)

    Hong Chen

    Full Text Available BACKGROUND: DNA extraction is a routine step in many insect molecular studies. A variety of methods have been used to isolate DNA molecules from insects, and many commercial kits are available. Extraction methods need to be evaluated for their efficiency, cost, and side effects such as DNA degradation during extraction. METHODOLOGY/PRINCIPAL FINDINGS: From individual western corn rootworm beetles, Diabrotica virgifera virgifera, DNA extractions by the SDS method, CTAB method, DNAzol reagent, Puregene solutions and DNeasy column were compared in terms of DNA quantity and quality, cost of materials, and time consumed. Although all five methods resulted in acceptable DNA concentrations and absorbance ratios, the SDS and CTAB methods resulted in higher DNA yield (ng DNA vs. mg tissue at much lower cost and less degradation as revealed on agarose gels. The DNeasy kit was most time-efficient but was the costliest among the methods tested. The effects of ethanol volume, temperature and incubation time on precipitation of DNA were also investigated. The DNA samples obtained by the five methods were tested in PCR for six microsatellites located in various positions of the beetle's genome, and all samples showed successful amplifications. CONCLUSION/SIGNIFICANCE: These evaluations provide a guide for choosing methods of DNA extraction from western corn rootworm beetles based on expected DNA yield and quality, extraction time, cost, and waste control. The extraction conditions for this mid-size insect were optimized. The DNA extracted by the five methods was suitable for further molecular applications such as PCR and sequencing by synthesis.

  4. High-throughput sequencing of nematode communities from total soil DNA extractions

    DEFF Research Database (Denmark)

    Sapkota, Rumakanta; Nicolaisen, Mogens

    2015-01-01

    nematodes without the need for enrichment was developed. Using this strategy on DNA templates from a set of 22 agricultural soils, we obtained 64.4% sequences of nematode origin in total, whereas the remaining sequences were almost entirely from other metazoans. The nematode sequences were derived from...... in previous sequence-based studies are not nematode specific but also amplify other groups of organisms such as fungi and plantae, and thus require a nematode enrichment step that may introduce biases. Results: In this study an amplification strategy which selectively amplifies a fragment of the SSU from...... a broad taxonomic range and most sequences were from nematode taxa that have previously been found to be abundant in soil such as Tylenchida, Rhabditida, Dorylaimida, Triplonchida and Araeolaimida. Conclusions: Our amplification and sequencing strategy for assessing nematode diversity was able to collect...

  5. Extraction of Total DNA and RNA from Marine Filter Samples and Generation of a cDNA as Universal Template for Marker Gene Studies.

    Science.gov (United States)

    Schneider, Dominik; Wemheuer, Franziska; Pfeiffer, Birgit; Wemheuer, Bernd

    2017-01-01

    Microbial communities play an important role in marine ecosystem processes. Although the number of studies targeting marker genes such as the 16S rRNA gene has been increased in the last few years, the vast majority of marine diversity is rather unexplored. Moreover, most studies focused on the entire bacterial community and thus disregarded active microbial community players. Here, we describe a detailed protocol for the simultaneous extraction of DNA and RNA from marine water samples and for the generation of cDNA from the isolated RNA which can be used as a universal template in various marker gene studies.

  6. Repeated extraction of DNA from FTA cards

    DEFF Research Database (Denmark)

    Stangegaard, Michael; Ferrero, Laura; Børsting, Claus

    2011-01-01

    Extraction of DNA using magnetic bead based techniques on automated DNA extraction instruments provides a fast, reliable and reproducible method for DNA extraction from various matrices. However, the yield of extracted DNA from FTA-cards is typically low. Here, we demonstrate that it is possible...... to repeatedly extract DNA from the processed FTA-disk. The method increases the yield from the nanogram range to the microgram range....

  7. DNA extraction from herbarium specimens.

    Science.gov (United States)

    Drábková, Lenka Záveská

    2014-01-01

    With the expansion of molecular techniques, the historical collections have become widely used. Studying plant DNA using modern molecular techniques such as DNA sequencing plays an important role in understanding evolutionary relationships, identification through DNA barcoding, conservation status, and many other aspects of plant biology. Enormous herbarium collections are an important source of material especially for specimens from areas difficult to access or from taxa that are now extinct. The ability to utilize these specimens greatly enhances the research. However, the process of extracting DNA from herbarium specimens is often fraught with difficulty related to such variables as plant chemistry, drying method of the specimen, and chemical treatment of the specimen. Although many methods have been developed for extraction of DNA from herbarium specimens, the most frequently used are modified CTAB and DNeasy Plant Mini Kit protocols. Nine selected protocols in this chapter have been successfully used for high-quality DNA extraction from different kinds of plant herbarium tissues. These methods differ primarily with respect to their requirements for input material (from algae to vascular plants), type of the plant tissue (leaves with incrustations, sclerenchyma strands, mucilaginous tissues, needles, seeds), and further possible applications (PCR-based methods or microsatellites, AFLP).

  8. DNA Extraction and Primer Selection

    DEFF Research Database (Denmark)

    Karst, Søren Michael; Nielsen, Per Halkjær; Albertsen, Mads

    Talk regarding pitfalls in DNA extraction and 16S amplicon primer choice when performing community analysis of complex microbial communities. The talk was a part of Workshop 2 "Principles, Potential, and Limitations of Novel Molecular Methods in Water Engineering; from Amplicon Sequencing to -omics...

  9. DNA Extraction Techniques for Use in Education

    Science.gov (United States)

    Hearn, R. P.; Arblaster, K. E.

    2010-01-01

    DNA extraction provides a hands-on introduction to DNA and enables students to gain real life experience and practical knowledge of DNA. Students gain a sense of ownership and are more enthusiastic when they use their own DNA. A cost effective, simple protocol for DNA extraction and visualization was devised. Buccal mucosal epithelia provide a…

  10. Automated extraction of DNA from clothing

    DEFF Research Database (Denmark)

    Stangegaard, Michael; Hjort, Benjamin Benn; Nøhr Hansen, Thomas

    2011-01-01

    Presence of PCR inhibitors in extracted DNA may interfere with the subsequent quantification and short tandem repeat (STR) reactions used in forensic genetic DNA typing. We have compared three automated DNA extraction methods based on magnetic beads with a manual method with the aim of reducing...

  11. Extraction of Chromosomal DNA from Schizosaccharomyces pombe.

    Science.gov (United States)

    Murray, Johanne M; Watson, Adam T; Carr, Antony M

    2016-05-02

    Extraction of DNA from Schizosaccharomyces pombe cells is required for various uses, including templating polymerase chain reactions (PCRs), Southern blotting, library construction, and high-throughput sequencing. To purify high-quality DNA, the cell wall is removed by digestion with Zymolyase or Lyticase and the resulting spheroplasts lysed using sodium dodecyl sulfate (SDS). Cell debris, SDS, and SDS-protein complexes are subsequently precipitated by the addition of potassium acetate and removed by centrifugation. Finally, DNA is precipitated using isopropanol. At this stage, purity is usually sufficient for PCR. However, for more sensitive procedures, such as restriction enzyme digestion, additional purification steps, including proteinase K digestion and phenol-chloroform extraction, are recommended. All of these steps are described in detail here. © 2016 Cold Spring Harbor Laboratory Press.

  12. DNA extraction from sea anemone (Cnidaria: Actiniaria tissues for molecular analyses

    Directory of Open Access Journals (Sweden)

    Pinto S.M.

    2000-01-01

    Full Text Available A specific DNA extraction method for sea anemones is described in which extraction of total DNA from eight species of sea anemones and one species of corallimorpharian was achieved by changing the standard extraction protocols. DNA extraction from sea anemone tissue is made more difficult both by the tissue consistency and the presence of symbiotic zooxanthellae. The technique described here is an efficient way to avoid problems of DNA contamination and obtain large amounts of purified and integral DNA which can be used in different kinds of molecular analyses.

  13. Extraction of ultrashort DNA molecules from herbarium specimens.

    Science.gov (United States)

    Gutaker, Rafal M; Reiter, Ella; Furtwängler, Anja; Schuenemann, Verena J; Burbano, Hernán A

    2017-02-01

    DNA extracted from herbarium specimens is highly fragmented; therefore, it is crucial to use extraction protocols that retrieve short DNA molecules. Improvements in extraction and DNA library preparation protocols for animal remains have allowed efficient retrieval of molecules shorter than 50 bp. Here, we applied these improvements to DNA extraction protocols for herbarium specimens and evaluated extraction performance by shotgun sequencing, which allows an accurate estimation of the distribution of DNA fragment lengths. Extraction with N-phenacylthiazolium bromide (PTB) buffer decreased median fragment length by 35% when compared with cetyl-trimethyl ammonium bromide (CTAB); modifying the binding conditions of DNA to silica allowed for an additional decrease of 10%. We did not observe a further decrease in length for single-stranded DNA (ssDNA) versus double-stranded DNA (dsDNA) library preparation methods. Our protocol enables the retrieval of ultrashort molecules from herbarium specimens, which will help to unlock the genetic information stored in herbaria.

  14. Methods for microbial DNA extraction from soil for PCR amplification

    Directory of Open Access Journals (Sweden)

    Yeates C

    1998-01-01

    Full Text Available Amplification of DNA from soil is often inhibited by co-purified contaminants. A rapid, inexpensive, large-scale DNA extraction method involving minimal purification has been developed that is applicable to various soil types (1. DNA is also suitable for PCR amplification using various DNA targets. DNA was extracted from 100g of soil using direct lysis with glass beads and SDS followed by potassium acetate precipitation, polyethylene glycol precipitation, phenol extraction and isopropanol precipitation. This method was compared to other DNA extraction methods with regard to DNA purity and size.

  15. Genomic DNA extraction from sapwood of Pinus roxburghii for ...

    African Journals Online (AJOL)

    A method for extraction of genomic DNA from sapwood tissues of mature tall trees of Pinus roxburghii, where collection of needle tissues is extremely difficult has been standardized. The extracted DNA was comparable to that obtained from the needle tissue in terms of yield and purity. The yield of extracted DNA ranged ...

  16. Microbial food safety: Potential of DNA extraction methods for use in diagnostic metagenomics

    DEFF Research Database (Denmark)

    Josefsen, Mathilde Hasseldam; Andersen, Sandra Christine; Christensen, Julia

    2015-01-01

    ) yielding protocols. The PowerLyzer PowerSoil DNA Isolation Kit performed significantly better than all other protocols tested. Selected protocols were modified, i.e., extended heating and homogenization, resulting in increased yields of total DNA. For QIAamp Fast DNA Stool Mini Kit (Qiagen) a 7-fold...... of the protocols to extract DNA was observed. The highest DNA yield was obtained with the PowerLyzer PowerSoil DNA Isolation Kit, whereas the FastDNA SPIN Kit for Feces (MP Biomedicals) resulted in the highest amount of PCR-amplifiable C. jejuni DNA....

  17. Extraction of genomic DNA from Melipona quadrifasciata (Hymenoptera: Apidae, Meliponinae)

    OpenAIRE

    Waldschmidt, Ana Maria; Salomão, Tânia Maria Fernandes; Barros, Everaldo Gonçalves de; Campos, Lúcio de Antônio Oliveira

    1997-01-01

    The objective of the present study was to test three different procedures for DNA extraction of Melipona quadrifasciata based on existing methods for DNA extraction of Apis, plants and fungi. These methods differ in the concentrations of specific substances in the extraction buffer. The results demonstrate that the method used for Apis is not adequate for DNA extraction from M. quadrifasciata. On the other hand, with minor modifications this method and the methods for plants and fungi were ad...

  18. The study of genomic DNA adsorption and subsequent interactions using total internal reflection ellipsometry.

    Science.gov (United States)

    Nabok, Alexei; Tsargorodskaya, Anna; Davis, Frank; Higson, Séamus P J

    2007-10-31

    The adsorption of genomic DNA and subsequent interactions between adsorbed and solvated DNA was studied using a novel sensitive optical method of total internal reflection ellipsometry (TIRE), which combines spectroscopic ellipsometry with surface plasmon resonance (SPR). Single strands of DNA of two species of fish (herring and salmon) were electrostatically adsorbed on top of polyethylenimine films deposited upon gold coated glass slides. The ellipsometric spectra were recorded and data fitting utilized to extract optical parameters (thickness and refractive index) of adsorbed DNA layers. The further adsorption of single stranded DNA from an identical source, i.e. herring ss-DNA on herring ss-DNA or salmon ss-DNA on salmon ss-DNA, on the surface was observed to give rise to substantial film thickness increases at the surface of about 20-21 nm. Conversely adsorption of DNA from alternate species, i.e. salmon ss-DNA on herring ss-DNA or herring ss-DNA on salmon ss-DNA, yielded much smaller changes in thickness of 3-5 nm. AFM studies of the surface roughness of adsorbed layers were in line with the TIRE data.

  19. Microbial diversity in fecal samples depends on DNA extraction method

    DEFF Research Database (Denmark)

    Mirsepasi, Hengameh; Persson, Søren; Struve, Carsten

    2014-01-01

    was to evaluate two different DNA extraction methods in order to choose the most efficient method for studying intestinal bacterial diversity using Denaturing Gradient Gel Electrophoresis (DGGE). FINDINGS: In this study, a semi-automatic DNA extraction system (easyMag®, BioMérieux, Marcy I'Etoile, France......BACKGROUND: There are challenges, when extracting bacterial DNA from specimens for molecular diagnostics, since fecal samples also contain DNA from human cells and many different substances derived from food, cell residues and medication that can inhibit downstream PCR. The purpose of the study...... by easyMag® from the same fecal samples. Furthermore, DNA extracts obtained using easyMag® seemed to contain inhibitory compounds, since in order to perform a successful PCR-analysis, the sample should be diluted at least 10 times. DGGE performed on PCR from DNA extracted by QIAamp DNA Stool Mini Kit DNA...

  20. Genomic DNA extraction protocols from ovine hair

    Directory of Open Access Journals (Sweden)

    Jennifer Nonato da Silva Prate

    2013-12-01

    Full Text Available Genomic DNA extracted from animal cells can be used for several purposes, for example, to know genetic variability and genetic relationships between individuals, breeds and/or species, paternity tests, to describe the genetic profile for registration of the animal at association of breeders, detect genetic polymorphisms (SNP related to characteristics of commercial interest, disease diagnose, assess resistance or susceptibility to pathogens, etc. For such evaluations, in general, DNA is amplified by PCR (polymerase chain reaction, and then subjected to various techniques as RFLP (restriction fragments length polymorphism, SSCP (single strand conformation polymorphism, and sequencing. The DNA may be obtained from blood, buccal swabs, meat, cartilage or hair bulb. Among all, the last biological material has been preferred by farmers for its ease acquisition. Several methods for extracting DNA from hair bulb were reported without any consensus for its implementation. This study aimed to optimize a protocol for efficient DNA extraction for use in PCR-RFLP analysis of the Prion gene. For this study, were collected hair samples containing hair bulb from 131 Santa Inês sheep belonging to the Institute of Zootechny, Nova Odessa - SP. Two DNA extraction protocols were evaluated. The first, called phenol-chloroform-isoamyl alcohol (PCIA has long been used by Animal Genetic Laboratories, whose procedures are described below: in each microtube (1.5 mL containing 500 µL of TE-Tween solution (Tris-HCl 50 mM, EDTA 1 mM and 0.5% Tween 20 were added to approximately 30 hair bulb per animal which was incubated at 65°C with shaking at 170 rpm for 2 hours. Then was added 15 µL of proteinase K [10 mg mL-1] and incubated at 55°C at 170 rpm for 6-12 hours. At the end of digestion was added 1 volume of solution phenol-chloroform-isoamyl alcohol (25:24:1 followed by vigorous shaking for 10 seconds and centrifuged at 8000 rpm and 4°C for 10 minutes. The upper phase

  1. Food Fish Identification from DNA Extraction through Sequence Analysis

    Science.gov (United States)

    Hallen-Adams, Heather E.

    2015-01-01

    This experiment exposed 3rd and 4th y undergraduates and graduate students taking a course in advanced food analysis to DNA extraction, polymerase chain reaction (PCR), and DNA sequence analysis. Students provided their own fish sample, purchased from local grocery stores, and the class as a whole extracted DNA, which was then subjected to PCR,…

  2. Overcoming DNA extraction problems from carnivorous plants

    Directory of Open Access Journals (Sweden)

    Fleischmann, Andreas

    2009-12-01

    Full Text Available We tested previously published protocols for DNA isolation from plants with high contents of polyphenols and polysaccharides for several taxa of carnivorous plants. However, we did not get satisfying results with fresh or silica dried leaf tissue obtained from field collected or greenhouse grown plants, nor from herbarium specimens. Therefore, we have developed a simple modified protocol of the commercially available Macherey- Nagel NucleoSpin® Plant kit for rapid, effective and reproducible isolation of high quality genomic DNA suitable for PCR reactions. DNA extraction can be conducted from both fresh and dried leaf tissue of various carnivorous plant taxa, irrespective of high contents of polysaccharides, phenolic compounds and other secondary plant metabolites that interfere with DNA isolation and amplification.

    Probamos algunos protocolos publicados previamente para el aislamiento del ADN de plantas con alto contenido de polifenoles y polisacáridos para varios táxones de plantas carnívoras. Sin embargo, no conseguimos muy buenos resultados ni con tejidos de hojas frescas, ni con tejidos de hojas secadas en gel de sílice obtenidas de plantas colectadas en el campo o cultivadas en los invernaderos, ni de especímenes de herbario. Por lo tanto, hemos desarrollado un protocolo sencillo, modificado del Macherey- Nagel NucleoSpin® Plant kit disponible en el mercado para el aislamiento rápido, eficaz y reproducible de ADN genómico de alta calidad conveniente para la reacción en cadena de la polimerasa. La extracción del ADN se puede realizar en tejidos de hojas frescas o secas de varios táxones de plantas carnívoras, sin importar el grado de contenido de polisacáridos, compuestos fenólicos u otros metabolitos secundarios que interfieren con el aislamiento y la amplificación del ADN.

  3. An efficient method for DNA extraction from Cladosporioid fungi.

    Science.gov (United States)

    Moslem, M A; Bahkali, A H; Abd-Elsalam, K A; Wit, P J G M

    2010-11-23

    We developed an efficient method for DNA extraction from Cladosporioid fungi, which are important fungal plant pathogens. The cell wall of Cladosporioid fungi is often melanized, which makes it difficult to extract DNA from their cells. In order to overcome this we grew these fungi for three days on agar plates and extracted DNA from mycelium mats after manual or electric homogenization. High-quality DNA was isolated, with an A(260)/A(280) ratio ranging between 1.6 and 2.0. Isolated genomic DNA was efficiently digested with restriction enzymes and produced distinct banding patterns on agarose gels for the different Cladosporium species. Clear DNA fragments from the isolated DNA were amplified by PCR using small and large subunit rDNA primers, demonstrating that this method provides DNA of sufficiently high quality for molecular analyses.

  4. Response Surface Optimized Extraction of Total Triterpene Acids ...

    African Journals Online (AJOL)

    Purpose: To optimize extraction of total triterpene acids from loquat leaf and evaluate their in vitro antioxidant activities. Methods: The independent variables were ethanol concentration, extraction time, and solvent ratio, while the dependent variable was content of total triterpene acids. Composite design and response ...

  5. An efficient method for DNA extraction from Cladosporioid fungi

    OpenAIRE

    Moslem, M.A.; Bahkali, A.H.; Abd-Elsalam, K.A.; Wit, de, P.J.G.M.

    2010-01-01

    We developed an efficient method for DNA extraction from Cladosporioid fungi, which are important fungal plant pathogens. The cell wall of Cladosporioid fungi is often melanized, which makes it difficult to extract DNA from their cells. In order to overcome this we grew these fungi for three days on agar plates and extracted DNA from mycelium mats after manual or electric homogenization. High-quality DNA was isolated, with an A260/A280 ratio ranging between 1.6 and 2.0. Isolated genomic DNA w...

  6. Comparative analysis of protocols for DNA extraction from soybean caterpillars.

    Science.gov (United States)

    Palma, J; Valmorbida, I; da Costa, I F D; Guedes, J V C

    2016-04-07

    Genomic DNA extraction is crucial for molecular research, including diagnostic and genome characterization of different organisms. The aim of this study was to comparatively analyze protocols of DNA extraction based on cell lysis by sarcosyl, cetyltrimethylammonium bromide, and sodium dodecyl sulfate, and to determine the most efficient method applicable to soybean caterpillars. DNA was extracted from specimens of Chrysodeixis includens and Spodoptera eridania using the aforementioned three methods. DNA quantification was performed using spectrophotometry and high molecular weight DNA ladders. The purity of the extracted DNA was determined by calculating the A260/A280 ratio. Cost and time for each DNA extraction method were estimated and analyzed statistically. The amount of DNA extracted by these three methods was sufficient for PCR amplification. The sarcosyl method yielded DNA of higher purity, because it generated a clearer pellet without viscosity, and yielded high quality amplification products of the COI gene I. The sarcosyl method showed lower cost per extraction and did not differ from the other methods with respect to preparation times. Cell lysis by sarcosyl represents the best method for DNA extraction in terms of yield, quality, and cost effectiveness.

  7. A Rapid and Cost-Effective Method for DNA Extraction from Archival Herbarium Specimens.

    Science.gov (United States)

    Krinitsina, A A; Sizova, T V; Zaika, M A; Speranskaya, A S; Sukhorukov, A P

    2015-11-01

    Here we report a rapid and cost-effective method for the extraction of total DNA from herbarium specimens up to 50-90-year-old. The method takes about 2 h, uses AMPure XP magnetic beads diluted by PEG-8000- containing buffer, and does not require use of traditional volatile components like chloroform, phenol, and liquid nitrogen. It yields up to 4 µg of total nucleic acid with high purity from about 30 mg of dry material. The quality of the extracted DNA was tested by PCR amplification of 5S rRNA and rbcL genes (nuclear and chloroplast DNA markers) and compared against the traditional chloroform/isoamyl alcohol method. Our results demonstrate that the use of the magnetic beads is crucial for extraction of DNA suitable for subsequent PCR from herbarium samples due to the decreasing inhibitor concentrations, reducing short fragments of degraded DNA, and increasing median DNA fragment sizes.

  8. Total lipid profile with aqueous fruit extract of Solanum macrocarpum ...

    African Journals Online (AJOL)

    Abstract. Studies were undertaken to investigate the effects of the aqueous fruit extract of Solanum macrocarpum Linn. on the total lipid profile: total cholesterol, triglycerides, high density lipoprotein-cholesterol (HDL-C) and low density lipoprotein-cholesterol (LDL-C) on hypercholesterolaemic rats. Total serum cholesterol ...

  9. Rapid DNA extraction of bacterial genome using laundry detergents ...

    African Journals Online (AJOL)

    Yomi

    2012-01-03

    Jan 3, 2012 ... Genomic DNA extraction from bacterial cells involves processes normally performed in most biological laboratories. Therefore, various methods have been offered, manually and kit, but these methods may be time consuming and costly. In this paper, genomic DNA extraction of Pseudomonas aeruginosa ...

  10. A quick DNA extraction protocol: Without liquid nitrogen in ambient ...

    African Journals Online (AJOL)

    Marker assisted selection is an effective technique for quality traits selection in breeding program which are impossible by visual observation. Marker assisted selection in early generation requires rapid DNA extraction protocol for large number of samples in a low cost approach. A rapid and inexpensive DNA extraction ...

  11. An optimized DNA extraction protocol for benthic Didymosphenia geminata.

    Science.gov (United States)

    Uyua, Noelia Mariel; Manrique, Julieta Marina; Jones, Leandro Roberto

    2014-09-01

    Didymosphenia geminata mats display few cells in relation to extracellular material and contain polysaccharides and heavy metals that interfere with molecular studies. We describe an optimized DNA extraction protocol that help to overcome these difficulties. Our protocol outperformed five previously described DNA extraction techniques. Copyright © 2014 Elsevier B.V. All rights reserved.

  12. Rapid DNA extraction of bacterial genome using laundry detergents ...

    African Journals Online (AJOL)

    Genomic DNA extraction from bacterial cells involves processes normally performed in most biological laboratories. Therefore, various methods have been offered, manually and kit, but these methods may be time consuming and costly. In this paper, genomic DNA extraction of Pseudomonas aeruginosa was investigated ...

  13. DNA Extraction from Chorionic Villi for Prenatal Diagnosis of Foetal ...

    African Journals Online (AJOL)

    BACKGROUND: Extraction of DNA from the chorionic villi is the first major step in the molecular determination of foetal haemoglobin genotype. There are few reports on DNA extraction from the chorionic villi. A desired method should be simple to conduct, reliable and cost effective. OBJECTIVE: The aim of the study was to ...

  14. Designing easy DNA extraction: Teaching creativity through laboratory practice.

    Science.gov (United States)

    Susantini, Endang; Lisdiana, Lisa; Isnawati; Tanzih Al Haq, Aushia; Trimulyono, Guntur

    2017-05-01

    Subject material concerning Deoxyribose Nucleic Acid (DNA) structure in the format of creativity-driven laboratory practice offers meaningful learning experience to the students. Therefore, a laboratory practice in which utilizes simple procedures and easy-safe-affordable household materials should be promoted to students to develop their creativity. This study aimed to examine whether designing and conducting DNA extraction with household materials could foster students' creative thinking. We also described how this laboratory practice affected students' knowledge and views. A total of 47 students participated in this study. These students were grouped and asked to utilize available household materials and modify procedures using hands-on worksheet. Result showed that this approach encouraged creative thinking as well as improved subject-related knowledge. Students also demonstrated positive views about content knowledge, social skills, and creative thinking skills. This study implies that extracting DNA with household materials is able to develop content knowledge, social skills, and creative thinking of the students. © 2016 by The International Union of Biochemistry and Molecular Biology, 45(3):216-225, 2017. © 2016 The International Union of Biochemistry and Molecular Biology.

  15. extraction of high quality dna from polysaccharides-secreting ...

    African Journals Online (AJOL)

    cistvr

    A DNA extraction method using CTAB was used for the isolation of genomic DNA from ten. Xanthomonas campestris pathovars, ten isolates of Xanthomonas albilineans and one isolate of. Pseudomonas rubrisubalbicans. High quality DNA was obtained that was ideal for molecular analy- ses. Extracellular polysaccharides ...

  16. Genomic DNA extraction method from pearl millet ( Pennisetum ...

    African Journals Online (AJOL)

    DNA extraction is difficult in a variety of plants because of the presence of metabolites that interfere with DNA isolation procedures and downstream applications such as DNA restriction, amplification, and cloning. Here we describe a modified procedure based on the hexadecyltrimethylammonium bromide (CTAB) method to ...

  17. Genomic DNA extraction method from Annona senegalensis Pers ...

    African Journals Online (AJOL)

    Extraction of DNA in many plants is difficult because of the presence of metabolites that interfere with DNA isolation procedures and downstream applications such as DNA restriction, replications, amplification, as well as cloning. Modified procedure based on the hexadecyltrimethyl ammoniumbromide (CTAB) method is ...

  18. Comparative evaluation of total RNA extraction methods in Theobroma cacao using shoot apical meristems.

    Science.gov (United States)

    Silva, D V; Branco, S M J; Holanda, I S A; Royaert, S; Motamayor, J C; Marelli, J P; Corrêa, R X

    2016-03-04

    Theobroma cacao is a species of great economic importance with its beans used for chocolate production. The tree has been a target of various molecular studies. It contains many polyphenols, which complicate the extraction of nucleic acids with the extraction protocols requiring a large amount of plant material. These issues, therefore, necessitate the optimization of the protocols. The aim of the present study was to evaluate different methods for extraction of total RNA from shoot apical meristems of T. cacao 'CCN 51' and to assess the influence of storage conditions for the meristems on the extraction. The study also aimed to identify the most efficient protocol for RNA extraction using a small amount of plant material. Four different protocols were evaluated for RNA extraction using one shoot apical meristem per sample. Among these protocols, one that was more efficient was then tested to extract RNA using four different numbers of shoot apical meristems, subjected to three different storage conditions. The best protocol was tested for cDNA amplification using reverse transcription-polymerase chain reaction; the cDNA quality was determined to be satisfactory for molecular analyses. The study revealed that with the best RNA extraction protocol, one shoot apical meristem was sufficient for extraction of high-quality total RNA. The results obtained might enable advances in genetic analyses and molecular studies using reduced amount of plant material.

  19. Microwave-assisted extraction and antihyperlipidemic effect of total ...

    African Journals Online (AJOL)

    The process of microwave-assisted extraction (MAE) of total flavonoids from corn silk and the hypolipidemia in animal models were studied. Influence of solvent concentration, microwave power, extraction time and dose of solvent were investigated and then, the orthogonal experiments were performed. Animal models of ...

  20. Total Phenol amd Flavonoid contents of Crude Extract and Fractions ...

    African Journals Online (AJOL)

    Phenolic compounds are numerous in plants and are essential part of human diet. Picralima nitida has been extensively used in African folk medicine especially in West Africa. The present study evaluated the total phenolic and flavonoid contents of the extract and fractions of Picralima nitida. The methanol extracts of P.

  1. Extraction of total RNA in the developing chicken forebrain

    Directory of Open Access Journals (Sweden)

    Sayed Rasoul Zaker

    2014-01-01

    Full Text Available Background: Gene expression of Gama-Aminobutyric acid (GABA A receptor subunits may change during development. Procedures in molecular biology are required to understand the gene expression profile GABA A R in chicken. The outcome of the results depends on good-quality high-molecular-weight RNA. Several procedures can be used to isolate RNA from the brain of chicken; however, most of them are time-consuming and require disruption of cells or freeze and thaw in the presence of RNase inhibitors. The aim of this experiment was isolation of RNA from chicken embryonic brain tissues using appropriate RNA extraction kit. Materials and Methods: Fertilized eggs from Ross breed (Gallus gallus were incubated at 38°C and 60% relative humidity in a forced-draft incubator and were turned every 3 h. After 3, 7, 14 and 20 days of incubation, eggs were cooled on ice to induce deep anesthesia. Then whole brains were dissected out. As brains could not be excised in a reproducible way from earlier embryos (embryonic days 4 and 6, whole heads were collected. Chicken embryos between day 7 to 20 and 1 day after birth were decapitated, and their brains removed. Samples were immediately inserted into lysis buffer and stored at −70°C. Total RNA was isolated and a contaminating genomic deoxyribonucleic acid (DNA was digested. RNA quality was checked using gel electrophoresis. Results: We obtained 52 mg/ml to 745 mg/ml with A260/280 1.7-2.2. Only high-quality RNA, with no signs of degradation, was used for further experiments. Conclusion: In conclusion, protocol was found to be suitable for the isolation of total RNA from embryonic chicken cells.

  2. ANTIOXIDANT ACTIVITY, TOTAL PHENOLIC AND FLAVONOID CONTENT OF MORINDA CITRIFOLIA FRUIT EXTRACTS FROM VARIOUS EXTRACTION PROCESSES

    Directory of Open Access Journals (Sweden)

    PRAVEEN K. RAMAMOORTHY

    2007-04-01

    Full Text Available Soxhlet, Ultrasonic extract of Morinda citrifolia L. fruit and four extracts from high pressure extraction at 10 MPa using ethanol, ethyl acetate as solvent and dried by vacuum oven and spray dryer were analyzed for their antioxidant activity by peroxide value method and diphenylpicrylhydrazyl radical scavenging method. The five extracts along with the reference samples, butylated hydroxyl toluene and tannic acid were further analyzed to determine their total phenolic content by Folin-Ciocalteau method and total flavonoid content by Dowd method. The M. citrifolia extract by high pressure extraction with ethyl acetate as solvent and spray dried was found to exhibit highest antioxidant activity and total flavonoid content. High total phenolic content was determined in the high pressure extract using ethyl acetate as solvent and vacuum dried. It was interesting to note that ultrasonic extract exhibited significant antioxidant activity, total phenolic and flavonoid content. High pressure extracted M. citrifolia in ethanol was found to express lesser values comparatively. The significant difference in activity among the high pressure extracts was found to be due to the polarity of the solvents used for extraction as M. citrifolia fruit contains relatively larger quantity of non-polar antioxidant compounds. It was also found that the drying methods had significant impact on the antioxidant activity, total phenolic and flavonoid content of the extracts.

  3. Extraction and determination of total flavonoids in jujube by alcohol extraction

    Science.gov (United States)

    Ji, Y. B.; Ru, X.; Yu, M.; Wang, S. W.; Lu, L.; Qiao, A. N.; Guo, A. Z.

    2017-12-01

    Jujube is a ripe fruit of Rhamnaceae. Its main active component is flavonoids, so the extraction and determination of total flavonoids in jujube will help to develop and utilize the medicinal value of jujube. In this study, the total flavonoids were extracted from jujube by alcohol extraction method. Through single factor investigation and orthogonal test, it was found that the total flavonoids content in jujube was the highest under the condition of 70°C, material ratio of 1:40, and extraction of 30 min by 70% ethanol. The content of total flavonoids in the extract of jujube was 1.57% at the wavelength of 510 nm by UV and rutin as the standard. The method was evaluated by methodological study, and it was determined that this method could be used as the detection of total flavonoids in jujube extraction.

  4. Necessity of purification during bacterial DNA extraction with environmental soils

    Directory of Open Access Journals (Sweden)

    Hyun Jeong Lim

    2017-08-01

    Full Text Available Complexity and heterogeneity of soil samples have often implied the inclusion of purification steps in conventional DNA extraction for polymerase chain reaction (PCR assays. Unfortunately the purification steps are also time and labor intensive. Therefore the necessity of DNA purification was re-visited and investigated for a variety of environmental soil samples that contained various amounts of PCR inhibitors. Bead beating and centrifugation was used as the baseline (without purification method for DNA extraction. Its performance was compared with that of conventional DNA extraction kit (with purification. The necessity criteria for DNA purification were established with environmental soil samples. Using lysis conditions at 3000 rpm for 3 minutes with 0.1 mm glass beads, centrifugation time of 10 minutes and 1:10 dilution ratio, the baseline method outperformed conventional DNA extraction on cell seeded sand samples. Further investigation with PCR inhibitors (i.e., humic acids, clay, and magnesium [Mg] showed that sand samples containing less than 10 μg/g humic acids and 70% clay may not require purifications. Interestingly, the inhibition pattern of Mg ion was different from other inhibitors due to the complexation interaction of Mg ion with DNA fragments. It was concluded that DNA extraction method without purification is suitable for soil samples that have less than 10 μg/g of humic acids, less than 70% clay content and less than 0.01% Mg ion content.

  5. Extraction of DNA from plant and fungus tissues in situ

    Directory of Open Access Journals (Sweden)

    Abu Almakarem Amal S

    2012-06-01

    Full Text Available Abstract Background When samples are collected in the field and transported to the lab, degradation of the nucleic acids contained in the samples is frequently observed. Immediate extraction and precipitation of the nucleic acids reduces degradation to a minimum, thus preserving accurate sequence information. An extraction method to obtain high quality DNA in field studies is described. Findings DNA extracted immediately after sampling was compared to DNA extracted after allowing the sampled tissues to air dry at 21°C for 48 or 72 hours. While DNA extracted from fresh tissues exhibited little degradation, DNA extracted from all tissues exposed to 21°C air for 48 or 72 hours exhibited varying degrees of degradation. Yield was higher for extractions from fresh tissues in most cases. Four microcentrifuges were compared for DNA yield: one standard electric laboratory microcentrifuge (max rcf = 16,000×g, two battery-operated microcentrifuges (max rcf = 5,000 and 3,000 ×g, and one manually-operated microcentrifuge (max rcf = 120×g. Yields for all centrifuges were similar. DNA extracted under simulated field conditions was similar in yield and quality to DNA extracted in the laboratory using the same equipment. Conclusions This CTAB (cetyltrimethylammonium bromide DNA extraction method employs battery-operated and manually-operated equipment to isolate high quality DNA in the field. The method was tested on plant and fungus tissues, and may be adapted for other types of organisms. The method produced high quality DNA in laboratory tests and under simulated field conditions. The field extraction method should prove useful for working in remote sites, where ice, dry ice, and liquid nitrogen are unavailable; where degradation is likely to occur due to the long distances between the sample site and the laboratory; and in instances where other DNA preservation and transportation methods have been unsuccessful. It may be possible to adapt

  6. DNA extraction method for PCR in mycorrhizal fungi.

    Science.gov (United States)

    Manian, S; Sreenivasaprasad, S; Mills, P R

    2001-10-01

    To develop a simple and rapid DNA extraction protocol for PCR in mycorrhizal fungi. The protocol combines the application of rapid freezing and boiling cycles and passage of the extracts through DNA purification columns. PCR amplifiable DNA was obtained from a number of endo- and ecto-mycorrhizal fungi using minute quantities of spores and mycelium, respectively. DNA extracted following the method, was used to successfully amplify regions of interest from high as well as low copy number genes. The amplicons were suitable for further downstream applications such as sequencing and PCR-RFLPs. The protocol described is simple, short and facilitates rapid isolation of PCR amplifiable genomic DNA from a large number of fungal isolates in a single day. The method requires only minute quantities of starting material and is suitable for mycorrhizal fungi as well as a range of other fungi.

  7. Genomic DNA extraction method from Annona senegalensis Pers ...

    African Journals Online (AJOL)

    aghomotsegin

    2014-02-05

    SDS) or cetyl-methyl ammonium bromide (CTAB). The released DNA should be protected from endogenous nuclease. Ethylenediaminetetra acetate. (EDTA) is often included in the extraction buffer to chelate magnesium ions ...

  8. A novel method of genomic DNA extraction for Cactaceae1

    Science.gov (United States)

    Fehlberg, Shannon D.; Allen, Jessica M.; Church, Kathleen

    2013-01-01

    • Premise of the study: Genetic studies of Cactaceae can at times be impeded by difficult sampling logistics and/or high mucilage content in tissues. Simplifying sampling and DNA isolation through the use of cactus spines has not previously been investigated. • Methods and Results: Several protocols for extracting DNA from spines were tested and modified to maximize yield, amplification, and sequencing. Sampling of and extraction from spines resulted in a simplified protocol overall and complete avoidance of mucilage as compared to typical tissue extractions. Sequences from one nuclear and three plastid regions were obtained across eight genera and 20 species of cacti using DNA extracted from spines. • Conclusions: Genomic DNA useful for amplification and sequencing can be obtained from cactus spines. The protocols described here are valuable for any cactus species, but are particularly useful for investigators interested in sampling living collections, extensive field sampling, and/or conservation genetic studies. PMID:25202521

  9. Effect of DNA extraction in the Rosa canina L. identification under different processing temperature

    Directory of Open Access Journals (Sweden)

    Jana Žiarovská

    2017-01-01

    Full Text Available Rosa canina, L. is widely used for medicinal purposes as well as in food industry where it is a valuable source, bioactive compounds and natural colorants. Actually, no specific method is recommended as suitable one for DNA extraction from rose hips. The aim of the study was to compare three commercial and three non-commercial methods to extract total genomic DNA from rose hips hyphanthium. Four methods are based on the precipitation in principle and two methods are based on resin-binding. Extracted DNA was proved for the effectivity in following PCR. In total, six different DNA isolations was performed for differently heat processes rose hips - fresh hyphanthium, 2-weeks frozen hyphanthium, dried hyphanthium (50 °C and boiled hyphanthium (100 °C. The amplification parameters of 500 bp chloroplast gene amplicon were evaluated. Obtained amounts of extracted DNA was very variable not only for every individual method used but for individual treatment of samples, too. In general, non-commercial method provided higher amount of extracted DNA, but the A260/280 ratio was lower. When regarding the processing treatment of the samples, high differences were found among the samples untreated by heat and those that were dried or boiled for three of the used extraction methods. All the samples were positive for amplification, but different amounts of amplified product were obtained. The comparison of data for concentrations of extracted DNA and concentrations of amplified product showed large differences when regarding the achieved purity of DNA in extraction.

  10. An improved method of DNA extraction from plants for pathogen ...

    African Journals Online (AJOL)

    Polymerase chain reaction (PCR)-based applications in plant molecular biology and molecular diagnostics for plant pathogens require good quality DNA for reliable and reproducible results. Leaf tissue is often the choice for DNA extraction, but the use of other sources such as tubers, stems, or seeds, is not uncommon.

  11. Comparison of protocols for genomic DNA extraction from 'velame ...

    African Journals Online (AJOL)

    usuario

    2013-07-24

    Jul 24, 2013 ... involving C. linearifolius, we compared the efficiency of six protocols for genomic DNA extraction previously ... phytic, with diverse aspect and floristics, average rainfall between ..... The variation observed for DNA concentrations estimated with .... performed with protocol 1 (data not shown), or still, bands.

  12. Genomic DNA extraction from sapwood of Pinus roxburghii for ...

    African Journals Online (AJOL)

    Ashish

    2013-02-22

    Feb 22, 2013 ... A method for extraction of genomic DNA from sapwood tissues of mature tall trees of Pinus roxburghii, .... DNA as a template. PCR was performed on a thermal cycler. (Biorad, Mycycler) incorporating 10 ng genomic DNA to a 25 µl reaction mix containing 1X Taq buffer, 3 mM MgCl2, 0.2 mM each of dNTPs ...

  13. Digital PCR for direct quantification of viruses without DNA extraction

    OpenAIRE

    Pav?i?, Jernej; ?el, Jana; Milavec, Mojca

    2015-01-01

    DNA extraction before amplification is considered an essential step for quantification of viral DNA using real-time PCR (qPCR). However, this can directly affect the final measurements due to variable DNA yields and removal of inhibitors, which leads to increased inter-laboratory variability of qPCR measurements and reduced agreement on viral loads. Digital PCR (dPCR) might be an advantageous methodology for the measurement of virus concentrations, as it does not depend on any calibration mat...

  14. Phytochemical screening, total phenolic, total flavonoids contents and antioxidant activity of cinchona ledgeriana leaves ethanol extract

    Science.gov (United States)

    Sundowo, Andini; Artanti, Nina; Hanafi, M.; Minarti, Primahana, Gian

    2017-11-01

    C ledgeriana is a medicinal plant that contains alkaloids, especially on the barks for commercial production of quinine as antimalarial. The main alkaloids in this plant are cinchonine, cinchonidine, quinine and quinidine. Besides for antiamalarial this plant is also commonly used to treat whooping cough, influenza and dysentery. Compare to other medicinal plants, nowadays only very few studies were conducted in Cinchona species. Our current study aims to determine the content of phytochemical, total phenol and total flavonoids from C. ledgeriana leaves 70% ethanol extract. The extraction was performed by maceration method using 70% ethanol solvent and then fractionated into hexane, ethylacetate and butanol. Phytochemical screening was performed to determine the content of alkaloids, flavonoids, terpenoids, tannins and saponins. Total phenol and flavonoid contents of the extract were determined by Folin-Ciocalteu and alumunium chloride colorimetric methods using gallic acid and quercetin as standards. The antioxidant activity was determined by using 2, 2-diphenyl-1-picrylhydrazyl (DPPH) radical scavenging activity. The results of phytochemical screening showed that the 70% ethanol extract of C. ledgeriana leaves contained alkaloids, flavonoids, terpenoids, tannins and saponins. The total phenol and total flavonoids analysis showed that ethyl acetate fraction had the highest total phenol (40.23%) and total flavonoids (65.34%).

  15. rich extract on total polyphenols and antioxidant activity obtained

    African Journals Online (AJOL)

    Z. Ghouila

    USTHB, Organic Functional Analysis Laboratory, 16111 Bab Ezzouar, Algiers, ... Keywords: Ahmeur Bouamer, extraction, grape seeds, total polyphenols, ... These compounds are known as good natural antioxidant agents arising from natural ... surface between solid and liquid phases; this is mainly due to the dispersion of ...

  16. Digital PCR for direct quantification of viruses without DNA extraction.

    Science.gov (United States)

    Pavšič, Jernej; Žel, Jana; Milavec, Mojca

    2016-01-01

    DNA extraction before amplification is considered an essential step for quantification of viral DNA using real-time PCR (qPCR). However, this can directly affect the final measurements due to variable DNA yields and removal of inhibitors, which leads to increased inter-laboratory variability of qPCR measurements and reduced agreement on viral loads. Digital PCR (dPCR) might be an advantageous methodology for the measurement of virus concentrations, as it does not depend on any calibration material and it has higher tolerance to inhibitors. DNA quantification without an extraction step (i.e. direct quantification) was performed here using dPCR and two different human cytomegalovirus whole-virus materials. Two dPCR platforms were used for this direct quantification of the viral DNA, and these were compared with quantification of the extracted viral DNA in terms of yield and variability. Direct quantification of both whole-virus materials present in simple matrices like cell lysate or Tris-HCl buffer provided repeatable measurements of virus concentrations that were probably in closer agreement with the actual viral load than when estimated through quantification of the extracted DNA. Direct dPCR quantification of other viruses, reference materials and clinically relevant matrices is now needed to show the full versatility of this very promising and cost-efficient development in virus quantification.

  17. An Estimate of the Total DNA in the Biosphere.

    Science.gov (United States)

    Landenmark, Hanna K E; Forgan, Duncan H; Cockell, Charles S

    2015-06-01

    Modern whole-organism genome analysis, in combination with biomass estimates, allows us to estimate a lower bound on the total information content in the biosphere: 5.3 × 1031 (±3.6 × 1031) megabases (Mb) of DNA. Given conservative estimates regarding DNA transcription rates, this information content suggests biosphere processing speeds exceeding yottaNOPS values (1024 Nucleotide Operations Per Second). Although prokaryotes evolved at least 3 billion years before plants and animals, we find that the information content of prokaryotes is similar to plants and animals at the present day. This information-based approach offers a new way to quantify anthropogenic and natural processes in the biosphere and its information diversity over time.

  18. Protocol optimization for deoxyribonucleic acid (DNA) extraction ...

    African Journals Online (AJOL)

    Arachis hypogaea L.) is particularly problematic due to the presence of phenolic compounds and polysaccharides. Inconsistencies in extraction results can be attributed to the age and growth stages of the plant material analyzed. Mature leaves ...

  19. Soil DNA extraction procedure influences protist 18S rRNA gene community profiling outcome

    DEFF Research Database (Denmark)

    Santos, Susana S.; Nunes, Ines Marques; Nielsen, Tue K.

    2017-01-01

    Advances in sequencing technologies allow deeper studies of the soil protist diversity and function. However, little attention has been given to the impact of the chosen soil DNA extraction procedure to the overall results. We examined the effect of three acknowledged DNA recovery methods, two...... manual methods (ISOm-11063, GnS-GII) and one commercial kit (MoBio), on soil protist community structures obtained from different sites with different land uses. Results from 18S rRNA gene amplicon sequencing suggest that DNA extraction method significantly affect the replicate homogeneity, the total...... number of operational taxonomic units (OTUs) recovered and the overall taxonomic structure and diversity of soil protist communities. However, DNA extraction effects did not overwhelm the natural variation among samples, as the community data still strongly grouped by geographical location...

  20. Highly efficient DNA extraction method from skeletal remains

    Directory of Open Access Journals (Sweden)

    Irena Zupanič Pajnič

    2011-03-01

    Full Text Available Background: This paper precisely describes the method of DNA extraction developed to acquire high quality DNA from the Second World War skeletal remains. The same method is also used for molecular genetic identification of unknown decomposed bodies in routine forensic casework where only bones and teeth are suitable for DNA typing. We analysed 109 bones and two teeth from WWII mass graves in Slovenia. Methods: We cleaned the bones and teeth, removed surface contaminants and ground the bones into powder, using liquid nitrogen . Prior to isolating the DNA in parallel using the BioRobot EZ1 (Qiagen, the powder was decalcified for three days. The nuclear DNA of the samples were quantified by real-time PCR method. We acquired autosomal genetic profiles and Y-chromosome haplotypes of the bones and teeth with PCR amplification of microsatellites, and mtDNA haplotypes 99. For the purpose of traceability in the event of contamination, we prepared elimination data bases including genetic profiles of the nuclear and mtDNA of all persons who have been in touch with the skeletal remains in any way. Results: We extracted up to 55 ng DNA/g of the teeth, up to 100 ng DNA/g of the femurs, up to 30 ng DNA/g of the tibias and up to 0.5 ng DNA/g of the humerus. The typing of autosomal and YSTR loci was successful in all of the teeth, in 98 % dekalof the femurs, and in 75 % to 81 % of the tibias and humerus. The typing of mtDNA was successful in all of the teeth, and in 96 % to 98 % of the bones. Conclusions: We managed to obtain nuclear DNA for successful STR typing from skeletal remains that were over 60 years old . The method of DNA extraction described here has proved to be highly efficient. We obtained 0.8 to 100 ng DNA/g of teeth or bones and complete genetic profiles of autosomal DNA, Y-STR haplotypes, and mtDNA haplotypes from only 0.5g bone and teeth samples.

  1. Comparison of two commercial DNA extraction kits for the analysis of nasopharyngeal bacterial communities

    Directory of Open Access Journals (Sweden)

    Keith A. Crandall

    2016-04-01

    Full Text Available Characterization of microbial communities via next-generation sequencing (NGS requires an extraction ofmicrobial DNA. Methodological differences in DNA extraction protocols may bias results and complicate inter-study comparisons. Here we compare the effect of two commonly used commercial kits (Norgen and Qiagenfor the extraction of total DNA on estimatingnasopharyngeal microbiome diversity. The nasopharynxis a reservoir for pathogens associated with respiratory illnesses and a key player in understandingairway microbial dynamics. Total DNA from nasal washes corresponding to 30 asthmatic children was extracted using theQiagenQIAamp DNA and NorgenRNA/DNA Purification kits and analyzed via IlluminaMiSeq16S rRNA V4 ampliconsequencing. The Norgen samples included more sequence reads and OTUs per sample than the Qiagen samples, but OTU counts per sample varied proportionallybetween groups (r = 0.732.Microbial profiles varied slightly between sample pairs, but alpha- and beta-diversity indices (PCoAand clustering showed highsimilarity between Norgen and Qiagenmicrobiomes. Moreover, no significant differences in community structure (PERMANOVA and adonis tests and taxa proportions (Kruskal-Wallis test were observed betweenkits. Finally, aProcrustes analysis also showed low dissimilarity (M2 = 0.173; P< 0.001 between the PCoAs of the two DNA extraction kits. Contrary to what has been observed in previous studies comparing DNA extraction methods, our 16S NGS analysis of nasopharyngeal washes did not reveal significant differences in community composition or structure between kits. Our findingssuggest congruence between column-based chromatography kits and supportthe comparison of microbiomeprofilesacross nasopharyngeal metataxonomic studies.

  2. DNA extraction from wings as a suitable approach for queen bees genotyping

    Directory of Open Access Journals (Sweden)

    Elena Facchini

    2018-06-01

    Full Text Available In livestock, genomics has been used since a decade in combination with phenotypic information for the estimation of breeding values. In honey bees (Apis mellifera, the advantage for including genomics in selective breeding programmes is represented by the possibility to reduce the generation interval and increase the accuracies of estimated breeding values resulting in higher genetic gain (Brascamp et al., 2018. The limit for this application is DNA extraction. Extraction methods for small animals such as insects often rely upon destructive approaches. The challenge is to develop tissue sampling methods that permit the survival of the animal while providing adequate quality DNA for genotyping. Along with previous reports of DNA extraction from several matrices, this study aims to contribute in developing suitable methodologies for genotyping honey bees queens using DNA extracted from wing cuttings (Chaline et al., 2004; Gregory and Rinderer, 2004; Gould et al., 2011. The clipping of the queen wings in beekeeping is a common practice and it ensures the survival and normal activities of the animal (Forster, 1971. A total of 57 queens with known pedigree were enrolled for this study. Wings from each queen were cut and stored at -20°C until processed (Fig. 1. Extractions were carried out using a modified protocol provided by Qiagen (DNeasy® Blood & Tissue. The modification consists in an initial incubation of the samples with proteinase K for 20 minutes, further steps are carried out following the manufacturer’s instructions. To test the suitability of the extracted DNA for genotyping, PCR was performed on Esterase FE4 like gene. Although quantification with NanoDrop™ resulted in <20 ng/μL of DNA in solution, the extracted material was sufficient for PCR amplification of candidate genes for sequencing and genotyping. Our results show that it is possible to extract DNA from wings’ cuttings permitting to implement genomic approaches in honey

  3. Nonhomologous DNA End Joining in Cell-Free Extracts

    Directory of Open Access Journals (Sweden)

    Sheetal Sharma

    2010-01-01

    Full Text Available Among various DNA damages, double-strand breaks (DSBs are considered as most deleterious, as they may lead to chromosomal rearrangements and cancer when unrepaired. Nonhomologous DNA end joining (NHEJ is one of the major DSB repair pathways in higher organisms. A large number of studies on NHEJ are based on in vitro systems using cell-free extracts. In this paper, we summarize the studies on NHEJ performed by various groups in different cell-free repair systems.

  4. Evaluation of Four Automated Protocols for Extraction of DNA from FTA Cards

    OpenAIRE

    Stangegaard, Michael; Børsting, Claus; Ferrero-Miliani, Laura; Frank-Hansen, Rune; Poulsen, Lena; Hansen, Anders J; Morling, Niels

    2013-01-01

    Extraction of DNA using magnetic bead-based techniques on automated DNA extraction instruments provides a fast, reliable, and reproducible method for DNA extraction from various matrices. Here, we have compared the yield and quality of DNA extracted from FTA cards using four automated extraction protocols on three different instruments. The extraction processes were repeated up to six times with the same pieces of FTA cards. The sample material on the FTA cards was either blood or buccal cell...

  5. Extraction of DNA from Forensic Biological Samples for Genotyping.

    Science.gov (United States)

    Stray, J E; Liu, J Y; Brevnov, M G; Shewale, J G

    2010-07-01

    Biological forensic samples constitute evidence with probative organic matter. Evidence believed to contain DNA is typically processed for extraction and purification of its nucleic acid content. Forensic DNA samples are composed of two things, a tissue and the substrate it resides on. Compositionally, a sample may contain almost anything and for each, the type, integrity, and content of both tissue and substrate will vary, as will the contaminant levels. This fact makes the success of extraction one of the most unpredictable steps in genotypic analysis. The development of robust genotyping systems and analysis platforms for short tandem repeat (STR) and mitochondrial DNA sequencing and the acceptance of results generated by these methods in the court system, resulted in a high demand for DNA testing. The increasing variety of sample submissions created a need to isolate DNA from forensic samples that may be compromised or contain low levels of biological material. In the past decade, several robust chemistries and isolation methods have been developed to safely and reliably recover DNA from a wide array of sample types in high yield and free of PCR inhibitors. In addition, high-throughput automated workflows have been developed to meet the demand for processing increasing numbers of samples. This review summarizes a number of the most widely adopted methods and the best practices for DNA isolation from forensic biological samples, including manual, semiautomated, and fully automated platforms. Copyright © 2010 Central Police University.

  6. CGH and SNP array using DNA extracted from fixed cytogenetic preparations and long-term refrigerated bone marrow specimens

    Directory of Open Access Journals (Sweden)

    MacKinnon Ruth N

    2012-02-01

    Full Text Available Abstract Background The analysis of nucleic acids is limited by the availability of archival specimens and the quality and amount of the extracted material. Archived cytogenetic preparations are stored in many laboratories and are a potential source of total genomic DNA for array karyotyping and other applications. Array CGH using DNA from fixed cytogenetic preparations has been described, but it is not known whether it can be used for SNP arrays. Diagnostic bone marrow specimens taken during the assessment of hematological malignancies are also a potential source of DNA, but it is generally assumed that DNA must be extracted, or the specimen frozen, within a day or two of collection, to obtain DNA suitable for further analysis. We have assessed DNA extracted from these materials for both SNP array and array CGH. Results We show that both SNP array and array CGH can be performed on genomic DNA extracted from cytogenetic specimens stored in Carnoy's fixative, and from bone marrow which has been stored unfrozen, at 4°C, for at least 36 days. We describe a procedure for extracting a usable concentration of total genomic DNA from cytogenetic suspensions of low cellularity. Conclusions The ability to use these archival specimens for DNA-based analysis increases the potential for retrospective genetic analysis of clinical specimens. Fixed cytogenetic preparations and long-term refrigerated bone marrow both provide DNA suitable for array karyotyping, and may be suitable for a wider range of analytical procedures.

  7. Comparison of different methodologies for DNA extraction from Aegla longirostri

    Directory of Open Access Journals (Sweden)

    João Vitor Trindade Bitencourt

    2007-11-01

    Full Text Available The aim of this study was to compare some DNA extraction methodologies for Aegla longirostri. The protocols were based on the traditional phenol-chloroform DNA extraction methodology and using a commercial kit for DNA extraction. They differed in tissues used, the addition - or not - of beta-mercaptoethanol to the lysis buffer, times and methods for the animal's conservation (frozen, in ethanol or fresh. Individuals stored at -20°C for a long time supplied lower molecular weight DNA than those stored for a short time. The best yield for the specimens preserved in ethanol was obtained for 15 days storage in 95% ethanol. The kit resulted in a low quantity of high molecular weight DNA. The best protocol for DNA extraction from Aeglidae, and probably for other crustaceans should, therefore, utilize fresh specimens, with addition of beta-mercaptoethanol to the lysis buffer.Marcadores moleculares são ferramentas úteis para esclarecer dúvidas a respeito dos Aeglidae, único grupo de crustáceos Anomura de água doce. Essas técnicas dependem da obtenção de DNA de boa qualidade e sem contaminantes. O objetivo deste estudo foi comparar algumas metodologias de extração de DNA de Aegla longirostri. Quatorze protocolos foram analisados, baseados na metodologia tradicional de extração de DNA com fenol-clorofórmio, exceto o protocolo K no qual se utilizou um Kit. Os procedimentos diferiram quanto aos tecidos utilizados e a adição de beta-mercaptoetanol ao tampão de lise. Avaliaram-se também diferentes tempos e maneiras de conservação. Indivíduos congelados apresentaram maior degradação do material obtido conforme o tempo em que ficaram congelados. Para os indivíduos conservados em álcool, aqueles mantidos em etanol 95% forneceram material de melhor qualidade. A utilização do Mini Kit resultou em uma quantidade muito pequena de DNA de alto peso molecular. O melhor protocolo para extração de DNA de Aeglidae utilizou músculos e br

  8. Optimizing factors influencing DNA extraction from fresh whole avian ...

    African Journals Online (AJOL)

    A study was conducted to optimize the efficient combination of lysis buffer, proteinase K, incubation time, phenol-chloroform-isoamyl alcohol (PCI) volume, spinning rate (rpm), and precipitation agent on quantity and quality of DNA extracted from various volumes of avian blood. Blood samples were collected in EDTA and ...

  9. Efficient method for the extraction of genomic DNA from wormwood ...

    African Journals Online (AJOL)

    STORAGESEVER

    2008-09-17

    Sep 17, 2008 ... DNA is extracted from plant material it will also contain. *Corresponding author. ... an important issue in the field of plant molecular biology. Various plants ..... An excellent guide to over 500 of the more well known medicinal ...

  10. The Effect of a Grape Seed Extract on Radiation-Induced DNA Damage in Human Lymphocytes

    Science.gov (United States)

    Dicu, Tiberius; Postescu, Ion D.; Foriş, Vasile; Brie, Ioana; Fischer-Fodor, Eva; Cernea, Valentin; Moldovan, Mircea; Cosma, Constantin

    2009-05-01

    Plant-derived antioxidants due to their phenolic compounds content are reported as potential candidates for reducing the levels of oxidative stress in living organisms. Grape seed extracts are very potent antioxidants and exhibit numerous interesting pharmacologic activities. Hydroethanolic (50/50, v/v) standardized extract was obtained from red grape seed (Vitis vinifera, variety Burgund Mare—BM). The total polyphenols content was evaluated by Folin-Ciocalteu procedure and expressed as μEq Gallic Acid/ml. The aim of this study was to evaluate the potential antioxidant effects of different concentrations of BM extract against 60Co γ-rays induced DNA damage in human lymphocytes. Samples of human lymphocytes were incubated with BM extract (12.5, 25.0 and 37.5 μEq GA/ml, respectively) administered at 30 minutes before in vitro irradiation with γ-rays (2 Gy). The DNA damage and repair in lymphocytes were evaluated using alkaline comet assay. Using the lesion score, the radiation-induced DNA damage was found to be significantly different (pextract (except the lymphocytes treated with 37.5 μEq GA/ml BM extract). DNA repair analyzed by incubating the irradiated cells at 37° C and 5% CO2 atmosphere for 2 h, indicated a significant difference (pextract, immediately and two hours after irradiation. These results suggest radioprotective effects after treatment with BM extract in human lymphocytes.

  11. Antioxidant Activities of Total Pigment Extract from Blackberries

    Directory of Open Access Journals (Sweden)

    Jiechao Liu

    2005-01-01

    Full Text Available Total pigment has been extracted from blackberries and its antioxidant activity against lipid peroxidation and scavenging capacities towards superoxide anion radicals, hydroxyl radicals and nitrite in different in vitro systems have been investigated. The total pigment extract from blackberries (TPEB exhibited strong antioxidant activity against lipid peroxidation in a linoleic acid model system and scavenging capacities towards superoxide anion radicals, generated by a pyrogallol autoxidation system or by an illuminating riboflavin system, hydroxyl radicals generated by Fenton reaction, and nitrite. Furthermore, the antioxidant activities were correlated with the concentrations of the TPEB. In the test concentration range, the maximum inhibition percentage against linoleic acid peroxidation was 98.32 % after one week’s incubation, and the maximum scavenging percentages for the free radicals and nitrite inhibition in the above reactive systems reached 90.48, 96.48, 93.58 and 98.94 %, respectively. The TPEB is a natural, edible colorant with excellent antioxidant activities and health benefits and it seems to be applicable in both healthy food and medicine.

  12. DNA extraction and barcode identification of development stages of forensically important flies in the Czech Republic.

    Science.gov (United States)

    Olekšáková, Tereza; Žurovcová, Martina; Klimešová, Vanda; Barták, Miroslav; Šuláková, Hana

    2018-04-01

    Several methods of DNA extraction, coupled with 'DNA barcoding' species identification, were compared using specimens from early developmental stages of forensically important flies from the Calliphoridae and Sarcophagidae families. DNA was extracted at three immature stages - eggs, the first instar larvae, and empty pupal cases (puparia) - using four different extraction methods, namely, one simple 'homemade' extraction buffer protocol and three commercial kits. The extraction conditions, including the amount of proteinase K and incubation times, were optimized. The simple extraction buffer method was successful for half of the eggs and for the first instar larval samples. The DNA Lego Kit and DEP-25 DNA Extraction Kit were useful for DNA extractions from the first instar larvae samples, and the DNA Lego Kit was also successful regarding the extraction from eggs. The QIAamp DNA mini kit was the most effective; the extraction was successful with regard to all sample types - eggs, larvae, and pupari.

  13. Inaccurate DNA synthesis in cell extracts of yeast producing active human DNA polymerase iota.

    Science.gov (United States)

    Makarova, Alena V; Grabow, Corinn; Gening, Leonid V; Tarantul, Vyacheslav Z; Tahirov, Tahir H; Bessho, Tadayoshi; Pavlov, Youri I

    2011-01-31

    Mammalian Pol ι has an unusual combination of properties: it is stimulated by Mn(2+) ions, can bypass some DNA lesions and misincorporates "G" opposite template "T" more frequently than incorporates the correct "A." We recently proposed a method of detection of Pol ι activity in animal cell extracts, based on primer extension opposite the template T with a high concentration of only two nucleotides, dGTP and dATP (incorporation of "G" versus "A" method of Gening, abbreviated as "misGvA"). We provide unambiguous proof of the "misGvA" approach concept and extend the applicability of the method for the studies of variants of Pol ι in the yeast model system with different cation cofactors. We produced human Pol ι in baker's yeast, which do not have a POLI ortholog. The "misGvA" activity is absent in cell extracts containing an empty vector, or producing catalytically dead Pol ι, or Pol ι lacking exon 2, but is robust in the strain producing wild-type Pol ι or its catalytic core, or protein with the active center L62I mutant. The signature pattern of primer extension products resulting from inaccurate DNA synthesis by extracts of cells producing either Pol ι or human Pol η is different. The DNA sequence of the template is critical for the detection of the infidelity of DNA synthesis attributed to DNA Pol ι. The primer/template and composition of the exogenous DNA precursor pool can be adapted to monitor replication fidelity in cell extracts expressing various error-prone Pols or mutator variants of accurate Pols. Finally, we demonstrate that the mutation rates in yeast strains producing human DNA Pols ι and η are not elevated over the control strain, despite highly inaccurate DNA synthesis by their extracts.

  14. Inaccurate DNA synthesis in cell extracts of yeast producing active human DNA polymerase iota.

    Directory of Open Access Journals (Sweden)

    Alena V Makarova

    2011-01-01

    Full Text Available Mammalian Pol ι has an unusual combination of properties: it is stimulated by Mn(2+ ions, can bypass some DNA lesions and misincorporates "G" opposite template "T" more frequently than incorporates the correct "A." We recently proposed a method of detection of Pol ι activity in animal cell extracts, based on primer extension opposite the template T with a high concentration of only two nucleotides, dGTP and dATP (incorporation of "G" versus "A" method of Gening, abbreviated as "misGvA". We provide unambiguous proof of the "misGvA" approach concept and extend the applicability of the method for the studies of variants of Pol ι in the yeast model system with different cation cofactors. We produced human Pol ι in baker's yeast, which do not have a POLI ortholog. The "misGvA" activity is absent in cell extracts containing an empty vector, or producing catalytically dead Pol ι, or Pol ι lacking exon 2, but is robust in the strain producing wild-type Pol ι or its catalytic core, or protein with the active center L62I mutant. The signature pattern of primer extension products resulting from inaccurate DNA synthesis by extracts of cells producing either Pol ι or human Pol η is different. The DNA sequence of the template is critical for the detection of the infidelity of DNA synthesis attributed to DNA Pol ι. The primer/template and composition of the exogenous DNA precursor pool can be adapted to monitor replication fidelity in cell extracts expressing various error-prone Pols or mutator variants of accurate Pols. Finally, we demonstrate that the mutation rates in yeast strains producing human DNA Pols ι and η are not elevated over the control strain, despite highly inaccurate DNA synthesis by their extracts.

  15. Antioxidant activity, total phenolic, and total flavonoid of extracts from stems of Jasminum nervosum Lour

    Directory of Open Access Journals (Sweden)

    Wei, Xiangyong

    2011-06-01

    Full Text Available Guangxi traditional Chinese Medical University Universidad de Medicina Tradicional China de Guangxi This study evaluated the antioxidant activities of the extracts of Jasminum nervosum Lour. stems along with the effects of different extract solvents on total phenolics (TP, total flavonoids (TF, and antioxidant potential. The antioxidant activity of the extracts was assessed using the following methods: DPPH, ABTS+ both free radicals scavenging assays, and reducing assays. TP and TF were detected by spectrophotometric and HPLC methods. In former methods, the highest amount of TP content was ethy lacetate extract (EAE, expressed as gallic acid equivalents. The greatest TF content was in the n-butanol extract (BE, expressed as lutin equivalents. No significant difference was observed in the TP/TF content between these two extracts. The antioxidant activity and TP/TF content of three extracts seemed to follow the same trend. This implied that there is a good correlation between antioxidant activities and TP/TF content. But in HPLC methods, EAE contained the highest content of lutin and gallic acid, which decreased in the same order of EAE > BE > PE, the rank order of TP/TF content of EAE and BE were different according to antioxidant ability. The overall results showed that the EAE and BE were richer in phenolics and flavonoids than petroleum ether extract (PE, and may represent a good source of antioxidants.Este estudio evaluó las actividades antioxidantes de extractos de tallos de Jasminum nervosum Lour., y el efecto de diferentes disolventes de extracción en los fenoles totales (TP y flavonoides totales (TF, y su potencial antioxidante. La actividad antioxidante de los extractos fue evaluada usando los siguientes métodos: DPPH, ABTS+ y ensayos reductores. TP y TF fueron detectados por métodos espectroscópicos y por HPLC. Con el primer método, el contenido más alto de TP se obtuvo en el extracto con acetato de etilo (EAE, expresado como

  16. Fire severity effects on ash extractable Total Phosphorous

    Science.gov (United States)

    Pereira, Paulo; Úbeda, Xavier; Martin, Deborah

    2010-05-01

    Phosphorous (P) is a crucial element to plant nutrition and limits vegetal production. The amounts of P in soil are lower and great part of this nutrient is absorbed or precipitated. It is well known that fire has important implications on P cycle, that can be lost throughout volatilization, evacuated with the smoke, but also more available to transport after organic matter mineralization imposed by the fire. The release of P depends on ash pH and their chemical and physical characteristics. Fire temperatures impose different severities, according to the specie affected and contact time. Fire severity is often evaluated by ash colour and this is a low-cost and excellent methodology to assess the fire effects on ecosystems. The aim of this work is study the ash properties physical and chemical properties on ash extractable Total Phosphorous (TP), collected in three wildfires, occured in Portugal, (named, (1) Quinta do Conde, (2) Quinta da Areia and (3) Casal do Sapo) composed mainly by Quercus suber and Pinus pinaster trees. The ash colour was assessed using the Munsell color chart. From all three plots we analyzed a total of 102 ash samples and we identified 5 different ash colours, ordered in an increasing order of severity, Very Dark Brown, Black, Dark Grey, Very Dark Grey and Light Grey. In order to observe significant differences between extractable TP and ash colours, we applied an ANOVA One Way test, and considered the differences significant at a p<0.05. The results showed that significant differences in the extractable TP among the different ash colours. Hence, to identify specific differences between each ash colour, we applied a post-hoc Fisher LSD test, significant at a p<0.05. The results obtained showed significant differences between the extractable TP from Very dark Brown and Black ash, produced at lower severities, in relation to Dark Grey, Very Dark Grey and Light Grey ash, generated at higher severities. The means of the first group were higher

  17. Isolation of Microarray-Grade Total RNA, MicroRNA, and DNA from a Single PAXgene Blood RNA Tube

    DEFF Research Database (Denmark)

    Kruhøffer, Mogens; Andersen, Lars Dyrskjøt; Voss, Thorsten

    2007-01-01

    We have developed a procedure for isolation of microRNA and genomic DNA in addition to total RNA from whole blood stabilized in PAXgene Blood RNA tubes. The procedure is based on automatic extraction on a BioRobot MDx and includes isolation of DNA from a fraction of the stabilized blood...... and recovery of small RNA species that are otherwise lost. The procedure presented here is suitable for large-scale experiments and is amenable to further automation. Procured total RNA and DNA was tested using Affymetrix Expression and single-nucleotide polymorphism GeneChips, respectively, and isolated micro......RNA was tested using spotted locked nucleic acid-based microarrays. We conclude that the yield and quality of total RNA, microRNA, and DNA from a single PAXgene blood RNA tube is sufficient for downstream microarray analysis....

  18. DNA Damage Protecting Activity and Antioxidant Potential of Launaea taraxacifolia Leaves Extract.

    Science.gov (United States)

    Adinortey, Michael Buenor; Ansah, Charles; Weremfo, Alexander; Adinortey, Cynthia Ayefoumi; Adukpo, Genevieve Etornam; Ameyaw, Elvis Ofori; Nyarko, Alexander Kwadwo

    2018-01-01

    The leaf extract of Launaea taraxacifolia commonly known as African Lettuce is used locally to treat dyslipidemia and liver diseases, which are associated with oxidative stress. Methanol extract from L. taraxacifolia leaves was tested for its antioxidant activity and its ability to protect DNA from oxidative damage. In vitro antioxidant potential of the leaf extract was evaluated using 1,1-diphenyl-2-picrylhydrazyl (DPPH), nitric oxide (NO), and hydroxyl (OH) radical scavenging assays. Ferric reducing power, total antioxidant capacity (TAC), metal chelating, and anti-lipid peroxidation ability of the extract were also examined using gallic acid, ascorbic acid, citric acid, and ethylenediaminetetraacetic acid as standards. L. taraxacifolia leaves extract showed antioxidant activity with IC 50 values of 16.18 μg/ml (DPPH), 123.3 μg/ml (NO), 128.2 μg/ml (OH radical), 97.94 μg/ml (metal chelating), 80.28 μg/ml (TAC), and 23 μg/ml (anti-lipid peroxidation activity). L. taraxacifolia leaves extract exhibited a strong capability for DNA damage protection at 20 mg/ml concentration. These findings suggest that the methanolic leaf extract of L. taraxacifolia could be used as a natural antioxidant and also as a preventive therapy against diseases such as arteriosclerosis associated with DNA damage.

  19. Comparison of six simple methods for extracting ribosomal and mitochondrial DNA from Toxocara and Toxascaris nematodes.

    Science.gov (United States)

    Mikaeili, F; Kia, E B; Sharbatkhori, M; Sharifdini, M; Jalalizand, N; Heidari, Z; Zarei, Z; Stensvold, C R; Mirhendi, H

    2013-06-01

    Six simple methods for extraction of ribosomal and mitochondrial DNA from Toxocara canis, Toxocara cati and Toxascaris leonina were compared by evaluating the presence, appearance and intensity of PCR products visualized on agarose gels and amplified from DNA extracted by each of the methods. For each species, two isolates were obtained from the intestines of their respective hosts: T. canis and T. leonina from dogs, and T. cati from cats. For all isolates, total DNA was extracted using six different methods, including grinding, boiling, crushing, beating, freeze-thawing and the use of a commercial kit. To evaluate the efficacy of each method, the internal transcribed spacer (ITS) region and the cytochrome c oxidase subunit 1 (cox1) gene were chosen as representative markers for ribosomal and mitochondrial DNA, respectively. Among the six DNA extraction methods, the beating method was the most cost effective for all three species, followed by the commercial kit. Both methods produced high intensity bands on agarose gels and were characterized by no or minimal smear formation, depending on gene target; however, beating was less expensive. We therefore recommend the beating method for studies where costs need to be kept at low levels. Copyright © 2013 Elsevier Inc. All rights reserved.

  20. Human DNA Extraction by Two Extraction Methods for Forensic Typification from Human Feces on FTA Paper

    Directory of Open Access Journals (Sweden)

    Shirleny Monserrat Sandoval-Arias

    2014-11-01

    Full Text Available The identification of suspects in criminal investigations has been facilitated since DNA test are executed on different samples. The application of this technology for forensic typification from human fecal samples still presents complications therefore this research evaluated two DNA extraction protocols with modifications to determine that of major efficiency. Organic extractions and extractions using the commercial kit “IQTM DNA Casework Sample Kit for Maxwell ® 16” on FTA portions of 4cm2 and 1cm2 impregnated with feces from the same individual were done to accomplish the objective. In all the assays the results were useful, however; the best forensic typification (by the electropherogram characteristics was obtained by using the commercial kit in an area of 1 cm2 of FTA paper impregnated in a 1:4 dilution.

  1. DNA Everywhere. A Guide for Simplified Environmental Genomic DNA Extraction Suitable for Use in Remote Areas

    Energy Technology Data Exchange (ETDEWEB)

    Pecora, Gabrielle N. [Lawrence Berkeley National Lab. (LBNL), Berkeley, CA (United States); Reid, Francine C. [Lawrence Berkeley National Lab. (LBNL), Berkeley, CA (United States); Tom, Lauren M. [Lawrence Berkeley National Lab. (LBNL), Berkeley, CA (United States); Piceno, Yvette M. [Lawrence Berkeley National Lab. (LBNL), Berkeley, CA (United States); Andersen, Gary L. [Lawrence Berkeley National Lab. (LBNL), Berkeley, CA (United States)

    2016-05-01

    Collecting field samples from remote or geographically distant areas can be a financially and logistically challenging. With participation of a local organization where the samples are originated from, gDNA samples can be extracted from the field and shipped to a research institution for further processing and analysis. The ability to set up gDNA extraction capabilities in the field can drastically reduce cost and time when running long-term microbial studies with a large sample set. The method outlined here has developed a compact and affordable method for setting up a “laboratory” and extracting and shipping gDNA samples from anywhere in the world. This white paper explains the process of setting up the “laboratory”, choosing and training individuals with no prior scientific experience how to perform gDNA extractions and safe methods for shipping extracts to any research institution. All methods have been validated by the Andersen group at Lawrence Berkeley National Laboratory using the Berkeley Lab PhyloChip.

  2. Arduino-based automation of a DNA extraction system.

    Science.gov (United States)

    Kim, Kyung-Won; Lee, Mi-So; Ryu, Mun-Ho; Kim, Jong-Won

    2015-01-01

    There have been many studies to detect infectious diseases with the molecular genetic method. This study presents an automation process for a DNA extraction system based on microfluidics and magnetic bead, which is part of a portable molecular genetic test system. This DNA extraction system consists of a cartridge with chambers, syringes, four linear stepper actuators, and a rotary stepper actuator. The actuators provide a sequence of steps in the DNA extraction process, such as transporting, mixing, and washing for the gene specimen, magnetic bead, and reagent solutions. The proposed automation system consists of a PC-based host application and an Arduino-based controller. The host application compiles a G code sequence file and interfaces with the controller to execute the compiled sequence. The controller executes stepper motor axis motion, time delay, and input-output manipulation. It drives the stepper motor with an open library, which provides a smooth linear acceleration profile. The controller also provides a homing sequence to establish the motor's reference position, and hard limit checking to prevent any over-travelling. The proposed system was implemented and its functionality was investigated, especially regarding positioning accuracy and velocity profile.

  3. Optimization of DNA extraction for ISSR studies in Tectona grandis Lf

    African Journals Online (AJOL)

    GRACE

    2006-07-03

    Jul 3, 2006 ... genomic DNA, emphasizing screening of inexpensive, rapid and simple DNA extraction methods (Weishing et al., 1995). Yield and quality of DNA often varies among tree tissue types (Henry, 2001). Besides, purification of genomic DNA in trees is difficult due to co-extraction of high quantities of tannins, ...

  4. Bacterial community analysis of activated sludge: an evaluation of four commonly used DNA extraction methods

    NARCIS (Netherlands)

    Vanysacker, L.; Declerck, S.A.J.; Hellemans, B.; De Meester, L.; Vankelecom, I.; Declerck, P.

    2010-01-01

    The effectiveness of three commercially available direct DNA isolation kits (Mobio, Fast, Qiagen) and one published direct DNA extraction protocol (Bead) for extracting bacterial DNA from different types of activated sludge was investigated and mutually compared. The DNA quantity and purity were

  5. High-Quality and -Quantity DNA Extraction from Frozen Archival Blood Clots for Genotyping of Single-Nucleotide Polymorphisms

    DEFF Research Database (Denmark)

    Bank, Steffen; Nexø, Bjørn Andersen; Andersen, Vibeke

    2013-01-01

    the efficiency of commercial purification kits for extracting DNA from long-term frozen clotted blood. Methods: Serum tubes with clotted blood were stored at −20°C for 1 to 2.5 years before DNA extraction. DNA was extracted from 10 blood clot samples using PureGene (Qiagen) with and without glycogen, the QIAamp...... with a median of 0.65 μg (range 0.5–2.6 μg) pr 300 μL total blood. Conclusion: The yield obtained by the different commercial kits varied considerably. Our work demonstrates that high-quality and -quantity DNA can be extracted with the Maxwell 16 Blood purification kit (Promega) from cryopreserved blood clots...

  6. Evaluation of four automated protocols for extraction of DNA from FTA cards.

    Science.gov (United States)

    Stangegaard, Michael; Børsting, Claus; Ferrero-Miliani, Laura; Frank-Hansen, Rune; Poulsen, Lena; Hansen, Anders J; Morling, Niels

    2013-10-01

    Extraction of DNA using magnetic bead-based techniques on automated DNA extraction instruments provides a fast, reliable, and reproducible method for DNA extraction from various matrices. Here, we have compared the yield and quality of DNA extracted from FTA cards using four automated extraction protocols on three different instruments. The extraction processes were repeated up to six times with the same pieces of FTA cards. The sample material on the FTA cards was either blood or buccal cells. With the QIAamp DNA Investigator and QIAsymphony DNA Investigator kits, it was possible to extract DNA from the FTA cards in all six rounds of extractions in sufficient amount and quality to obtain complete short tandem repeat (STR) profiles on a QIAcube and a QIAsymphony SP. With the PrepFiler Express kit, almost all the extractable DNA was extracted in the first two rounds of extractions. Furthermore, we demonstrated that it was possible to successfully extract sufficient DNA for STR profiling from previously processed FTA card pieces that had been stored at 4 °C for up to 1 year. This showed that rare or precious FTA card samples may be saved for future analyses even though some DNA was already extracted from the FTA cards.

  7. Direct human DNA protection by Coriolus versicolor (Yunzhi) extract.

    Science.gov (United States)

    Szeto, Yim Tong; Lau, Po Chun; Kalle, Wouter; Pak, Sok Cheon

    2013-07-01

    Scientific evidence has shown Coriolus versicolor (L. ex Fr.) Quel (also known as Yunzhi) has the role of immunomodulator in therapeutic effect. The aim of this in vitro study was to investigate the antioxidative effect of Yunzhi and to explore the mechanisms behind its DNA protection. Commercial Yunzhi extract was dissolved in water and diluted in five concentrations (10(1)-10(5) μg/L) with appropriate buffers. Lymphocytes harvested from three healthy subjects were incubated with Yunzhi extract for 30 min. Cells were then subjected to 5 min oxidant challenge by 45 μM hydrogen peroxide. The standard alkaline comet (SAC) assay and lysed cell comet (LCC) assay were performed in parallel. DNA damage of each treatment was scored under a fluorescence microscope and compared with the cells without Yunzhi pretreatment. U-shaped dose-response was seen in both versions of the comet assay. Yunzhi at 10(4) μg/L demonstrated a genoprotective effect against oxidative damage in the SAC assay (25% decrease in comet score). In the LCC assay, a trend of protection in lymphocytes was observed but it did not reach statistical significance. A direct antioxidant effect of Yunzhi against oxidant challenge on the DNA of lymphocytes was evidenced. The active component in Yunzhi was likely to be membrane permeable.

  8. Comparative Study of Seven Commercial Kits for Human DNA Extraction from Urine Samples Suitable for DNA Biomarker-Based Public Health Studies

    Science.gov (United States)

    El Bali, Latifa; Diman, Aurélie; Bernard, Alfred; Roosens, Nancy H. C.; De Keersmaecker, Sigrid C. J.

    2014-01-01

    Human genomic DNA extracted from urine could be an interesting tool for large-scale public health studies involving characterization of genetic variations or DNA biomarkers as a result of the simple and noninvasive collection method. These studies, involving many samples, require a rapid, easy, and standardized extraction protocol. Moreover, for practicability, there is a necessity to collect urine at a moment different from the first void and to store it appropriately until analysis. The present study compared seven commercial kits to select the most appropriate urinary human DNA extraction procedure for epidemiological studies. DNA yield has been determined using different quantification methods: two classical, i.e., NanoDrop and PicoGreen, and two species-specific real-time quantitative (q)PCR assays, as DNA extracted from urine contains, besides human, microbial DNA also, which largely contributes to the total DNA yield. In addition, the kits giving a good yield were also tested for the presence of PCR inhibitors. Further comparisons were performed regarding the sampling time and the storage conditions. Finally, as a proof-of-concept, an important gene related to smoking has been genotyped using the developed tools. We could select one well-performing kit for the human DNA extraction from urine suitable for molecular diagnostic real-time qPCR-based assays targeting genetic variations, applicable to large-scale studies. In addition, successful genotyping was possible using DNA extracted from urine stored at −20°C for several months, and an acceptable yield could also be obtained from urine collected at different moments during the day, which is particularly important for public health studies. PMID:25365790

  9. Comparative study of seven commercial kits for human DNA extraction from urine samples suitable for DNA biomarker-based public health studies.

    Science.gov (United States)

    El Bali, Latifa; Diman, Aurélie; Bernard, Alfred; Roosens, Nancy H C; De Keersmaecker, Sigrid C J

    2014-12-01

    Human genomic DNA extracted from urine could be an interesting tool for large-scale public health studies involving characterization of genetic variations or DNA biomarkers as a result of the simple and noninvasive collection method. These studies, involving many samples, require a rapid, easy, and standardized extraction protocol. Moreover, for practicability, there is a necessity to collect urine at a moment different from the first void and to store it appropriately until analysis. The present study compared seven commercial kits to select the most appropriate urinary human DNA extraction procedure for epidemiological studies. DNA yield has been determined using different quantification methods: two classical, i.e., NanoDrop and PicoGreen, and two species-specific real-time quantitative (q)PCR assays, as DNA extracted from urine contains, besides human, microbial DNA also, which largely contributes to the total DNA yield. In addition, the kits giving a good yield were also tested for the presence of PCR inhibitors. Further comparisons were performed regarding the sampling time and the storage conditions. Finally, as a proof-of-concept, an important gene related to smoking has been genotyped using the developed tools. We could select one well-performing kit for the human DNA extraction from urine suitable for molecular diagnostic real-time qPCR-based assays targeting genetic variations, applicable to large-scale studies. In addition, successful genotyping was possible using DNA extracted from urine stored at -20°C for several months, and an acceptable yield could also be obtained from urine collected at different moments during the day, which is particularly important for public health studies.

  10. Evaluation of Sample Stability and Automated DNA Extraction for Fetal Sex Determination Using Cell-Free Fetal DNA in Maternal Plasma

    Directory of Open Access Journals (Sweden)

    Elena Ordoñez

    2013-01-01

    Full Text Available Objective. The detection of paternally inherited sequences in maternal plasma, such as the SRY gene for fetal sexing or RHD for fetal blood group genotyping, is becoming part of daily routine in diagnostic laboratories. Due to the low percentage of fetal DNA, it is crucial to ensure sample stability and the efficiency of DNA extraction. We evaluated blood stability at 4°C for at least 24 hours and automated DNA extraction, for fetal sex determination in maternal plasma. Methods. A total of 158 blood samples were collected, using EDTA-K tubes, from women in their 1st trimester of pregnancy. Samples were kept at 4°C for at least 24 hours before processing. An automated DNA extraction was evaluated, and its efficiency was compared with a standard manual procedure. The SRY marker was used to quantify cfDNA by real-time PCR. Results. Although lower cfDNA amounts were obtained by automated DNA extraction (mean 107,35 GE/mL versus 259,43 GE/mL, the SRY sequence was successfully detected in all 108 samples from pregnancies with male fetuses. Conclusion. We successfully evaluated the suitability of standard blood tubes for the collection of maternal blood and assessed samples to be suitable for analysis at least 24 hours later. This would allow shipping to a central reference laboratory almost from anywhere in Europe.

  11. DNA extraction on bio-chip: history and preeminence over conventional and solid-phase extraction methods.

    Science.gov (United States)

    Ayoib, Adilah; Hashim, Uda; Gopinath, Subash C B; Md Arshad, M K

    2017-11-01

    This review covers a developmental progression on early to modern taxonomy at cellular level following the advent of electron microscopy and the advancement in deoxyribonucleic acid (DNA) extraction for expatiation of biological classification at DNA level. Here, we discuss the fundamental values of conventional chemical methods of DNA extraction using liquid/liquid extraction (LLE) followed by development of solid-phase extraction (SPE) methods, as well as recent advances in microfluidics device-based system for DNA extraction on-chip. We also discuss the importance of DNA extraction as well as the advantages over conventional chemical methods, and how Lab-on-a-Chip (LOC) system plays a crucial role for the future achievements.

  12. High-capacity conductive nanocellulose paper sheets for electrochemically controlled extraction of DNA oligomers.

    Directory of Open Access Journals (Sweden)

    Aamir Razaq

    Full Text Available Highly porous polypyrrole (PPy-nanocellulose paper sheets have been evaluated as inexpensive and disposable electrochemically controlled three-dimensional solid phase extraction materials. The composites, which had a total anion exchange capacity of about 1.1 mol kg(-1, were used for extraction and subsequent release of negatively charged fluorophore tagged DNA oligomers via galvanostatic oxidation and reduction of a 30-50 nm conformal PPy layer on the cellulose substrate. The ion exchange capacity, which was, at least, two orders of magnitude higher than those previously reached in electrochemically controlled extraction, originated from the high surface area (i.e. 80 m(2 g(-1 of the porous composites and the thin PPy layer which ensured excellent access to the ion exchange material. This enabled the extractions to be carried out faster and with better control of the PPy charge than with previously employed approaches. Experiments in equimolar mixtures of (dT(6, (dT(20, and (dT(40 DNA oligomers showed that all oligomers could be extracted, and that the smallest oligomer was preferentially released with an efficiency of up to 40% during the reduction of the PPy layer. These results indicate that the present material is very promising for the development of inexpensive and efficient electrochemically controlled ion-exchange membranes for batch-wise extraction of biomolecules.

  13. Response Surface Optimized Extraction of Total Triterpene Acids ...

    African Journals Online (AJOL)

    Tropical Journal of Pharmaceutical Research May 2014; 13 (5): 787-792 ... surface method were used to optimize the extraction process, while antioxidant activity was evaluated in vitro using α ... Response surface methodology is increasingly.

  14. DNA Extraction Protocols for Whole-Genome Sequencing in Marine Organisms.

    Science.gov (United States)

    Panova, Marina; Aronsson, Henrik; Cameron, R Andrew; Dahl, Peter; Godhe, Anna; Lind, Ulrika; Ortega-Martinez, Olga; Pereyra, Ricardo; Tesson, Sylvie V M; Wrange, Anna-Lisa; Blomberg, Anders; Johannesson, Kerstin

    2016-01-01

    The marine environment harbors a large proportion of the total biodiversity on this planet, including the majority of the earths' different phyla and classes. Studying the genomes of marine organisms can bring interesting insights into genome evolution. Today, almost all marine organismal groups are understudied with respect to their genomes. One potential reason is that extraction of high-quality DNA in sufficient amounts is challenging for many marine species. This is due to high polysaccharide content, polyphenols and other secondary metabolites that will inhibit downstream DNA library preparations. Consequently, protocols developed for vertebrates and plants do not always perform well for invertebrates and algae. In addition, many marine species have large population sizes and, as a consequence, highly variable genomes. Thus, to facilitate the sequence read assembly process during genome sequencing, it is desirable to obtain enough DNA from a single individual, which is a challenge in many species of invertebrates and algae. Here, we present DNA extraction protocols for seven marine species (four invertebrates, two algae, and a marine yeast), optimized to provide sufficient DNA quality and yield for de novo genome sequencing projects.

  15. A simple Chelex protocol for DNA extraction from Anopheles spp.

    Science.gov (United States)

    Musapa, Mulenga; Kumwenda, Taida; Mkulama, Mtawa; Chishimba, Sandra; Norris, Douglas E; Thuma, Philip E; Mharakurwa, Sungano

    2013-01-09

    Endemic countries are increasingly adopting molecular tools for efficient typing, identification and surveillance against malaria parasites and vector mosquitoes, as an integral part of their control programs. For sustainable establishment of these accurate approaches in operations research to strengthen malaria control and elimination efforts, simple and affordable methods, with parsimonious reagent and equipment requirements are essential. Here we present a simple Chelex-based technique for extracting malaria parasite and vector DNA from field collected mosquito specimens. We morphologically identified 72 Anopheles gambiae sl. from 156 mosquitoes captured by pyrethrum spray catches in sleeping rooms of households within a 2,000 km(2) vicinity of the Malaria Institute at Macha. After dissection to separate the head and thorax from the abdomen for all 72 Anopheles gambiae sl. mosquitoes, the two sections were individually placed in 1.5 ml microcentrifuge tubes and submerged in 20 μl of deionized water. Using a sterile pipette tip, each mosquito section was separately homogenized to a uniform suspension in the deionized water. Of the ensuing homogenate from each mosquito section, 10 μl was retained while the other 10 μl was transferred to a separate autoclaved 1.5 ml tube. The separate aliquots were subjected to DNA extraction by either the simplified Chelex or the standard salting out extraction protocol(9,10). The salting out protocol is so-called and widely used because it employs high salt concentrations in lieu of hazardous organic solvents (such as phenol and chloroform) for the protein precipitation step during DNA extraction(9). Extracts were used as templates for PCR amplification using primers targeting arthropod mitochondrial nicotinamide adenine dinucleotide dehydrogenase (NADH) subunit 4 gene (ND4) to check DNA quality, a PCR for identification of Anopheles gambiae sibling species(10) and a nested PCR for typing of Plasmodium falciparum infection

  16. The fruit extract of Berberis crataegina DC: exerts potent antioxidant activity and protects DNA integrity.

    Science.gov (United States)

    Charehsaz, Mohammad; Sipahi, Hande; Celep, Engin; Üstündağ, Aylin; Cemiloğlu Ülker, Özge; Duydu, Yalçın; Aydın, Ahmet; Yesilada, Erdem

    2015-04-17

    Dried fruits of Berberis crataegina (Berberidaceae) have been frequently consumed as food garniture in Turkish cuisine, while its fruit paste has been used to increase stamina and in particular to prevent from cardiovascular dysfunctions in Northeastern Black Sea region of Turkey. This study investigated this folkloric information in order to explain the claimed healing effects as well as to evaluate possible risks. Total phenolic, flavonoid and proanthocyanidin contents and antioxidant capacity of the methanolic fruit extract were evaluated through several in vitro assays. The cytotoxic and genotoxic effects of B. crataegina fruit extract were also assessed in both cervical cancer cell line (HeLa) and human peripheral blood lymphocytes. The extract showed protective effects against ferric-induced oxidative stress and had a relatively good antioxidant activity. It also ameliorated the H2O2 mediated DNA damage in lymphocytes, suggesting the protective effect against oxidative DNA damage. The methanolic extract of B. crataegina fruits may be a potential antioxidant nutrient and also may exert a protective role against lipid peroxidation as well as oxidative DNA damage.

  17. Evaluation of Four Automated Protocols for Extraction of DNA from FTA Cards

    DEFF Research Database (Denmark)

    Stangegaard, Michael; Børsting, Claus; Ferrero-Miliani, Laura

    2013-01-01

    protocols on three different instruments. The extraction processes were repeated up to six times with the same pieces of FTA cards. The sample material on the FTA cards was either blood or buccal cells. With the QIAamp DNA Investigator and QIAsymphony DNA Investigator kits, it was possible to extract DNA...... from the FTA cards in all six rounds of extractions in sufficient amount and quality to obtain complete short tandem repeat (STR) profiles on a QIAcube and a QIAsymphony SP. With the PrepFiler Express kit, almost all the extractable DNA was extracted in the first two rounds of extractions. Furthermore......, we demonstrated that it was possible to successfully extract sufficient DNA for STR profiling from previously processed FTA card pieces that had been stored at 4 °C for up to 1 year. This showed that rare or precious FTA card samples may be saved for future analyses even though some DNA was already...

  18. Comparison of DNA extraction methods for detection of citrus huanglongbing in Colombia

    Directory of Open Access Journals (Sweden)

    Jorge Evelio Ángel

    2014-04-01

    Full Text Available Four DNA citrus plant tissue extraction protocols and three methods of DNA extraction from vector psyllid Diaphorina citri Kuwayama (Hemiptera: Psyllidae were compared as part of the validation process and standardization for detection of huanglongbing (HLB. The comparison was done using several criterias such as integrity, purity and concentration. The best quality parameters presented in terms of extraction of DNA from plant midribs tissue of citrus, were cited by Murray and Thompson (1980 and Rodríguez et al. (2010, while for the DNA extraction from psyllid vectors of HLB, the best extraction method was suggested by Manjunath et al.(2008.

  19. DNA Extraction by Isotachophoresis in a Microfluidic Channel

    Energy Technology Data Exchange (ETDEWEB)

    Stephenson, S J

    2011-08-10

    Biological assays have many applications. For example, forensics personnel and medical professionals use these tests to diagnose diseases and track their progression or identify pathogens and the host response to them. One limitation of these tests, however, is that most of them target only one piece of the sample - such as bacterial DNA - and other components (e.g. host genomic DNA) get in the way, even though they may be useful for different tests. To address this problem, it would be useful to extract several different substances from a complex biological sample - such as blood - in an inexpensive and efficient manner. This summer, I worked with Maxim Shusteff at Lawrence Livermore National Lab on the Rapid Automated Sample Prep project. The goal of the project is to solve the aforementioned problem by creating a system that uses a series of different extraction methods to extract cells, bacteria, and DNA from a complex biological sample. Biological assays can then be run on purified output samples. In this device, an operator could input a complex sample such as blood or saliva, and would receive separate outputs of cells, bacteria, viruses, and DNA. I had the opportunity to work this summer with isotachophoresis (ITP), a technique that can be used to extract nucleic acids from a sample. This technique is intended to be the last stage of the purification device. Isotachophoresis separates particles based on different electrophoretic mobilities. This technique is convenient for out application because free solution DNA mobility is approximately equal for DNA longer than 300 base pairs in length. The sample of interest - in our case DNA - is fed into the chip with streams of leading electrolyte (LE) and trailing electrolyte (TE). When an electric field is applied, the species migrate based on their electrophoretic mobilities. Because the ions in the leading electrolyte have a high electrophoretic mobility, they race ahead of the slower sample and trailing

  20. rich extract on total polyphenols and antioxidant activity obtained by ...

    African Journals Online (AJOL)

    Z. Ghouila

    ABSTRACT: Conventional and non-conventional extraction methods were applied in the first time for the ... The heating of the matrix internally and externally without thermal gradient gives numerous advantages to microwave ... Once in laboratory, the clusters were washed with distilled and de-ionized water, then dried and ...

  1. Comparison of DNA quantification methodology used in the DNA extraction protocol for the UK Biobank cohort.

    Science.gov (United States)

    Welsh, Samantha; Peakman, Tim; Sheard, Simon; Almond, Rachael

    2017-01-05

    UK Biobank is a large prospective cohort study in the UK established by the Medical Research Council (MRC) and the Wellcome Trust to enable approved researchers to investigate the role of genetic factors, environmental exposures and lifestyle in the causes of major diseases of late and middle age. A wide range of phenotypic data has been collected at recruitment and has recently been enhanced by the UK Biobank Genotyping Project. All UK Biobank participants (500,000) have been genotyped on either the UK Biobank Axiom® Array or the Affymetrix UK BiLEVE Axiom® Array and the workflow for preparing samples for genotyping is described. The genetic data is hoped to provide further insight into the genetics of disease. All data, including the genetic data, is available for access to approved researchers. Data for two methods of DNA quantification (ultraviolet-visible spectroscopy [UV/Vis]) measured on the Trinean DropSense™ 96 and PicoGreen®) were compared by two laboratories (UK Biobank and Affymetrix). The sample processing workflow established at UK Biobank, for genotyping on the custom Affymetrix Axiom® array, resulted in high quality DNA (average DNA concentration 38.13 ng/μL, average 260/280 absorbance 1.91). The DNA generated high quality genotype data (average call rate 99.48% and pass rate 99.45%). The DNA concentration measured on the Trinean DropSense™ 96 at UK Biobank correlated well with DNA concentration measured by PicoGreen® at Affymetrix (r = 0.85). The UK Biobank Genotyping Project demonstrated that the high throughput DNA extraction protocol described generates high quality DNA suitable for genotyping on the Affymetrix Axiom array. The correlation between DNA concentration derived from UV/Vis and PicoGreen® quantification methods suggests, in large-scale genetic studies involving two laboratories, it may be possible to remove the DNA quantification step in one laboratory without affecting downstream analyses. This would result in

  2. DNA is a co-factor for its own replication in Xenopus egg extracts

    NARCIS (Netherlands)

    Lebofsky, Ronald; van Oijen, Antoine M.; Walter, Johannes C.

    Soluble Xenopus egg extracts efficiently replicate added plasmids using a physiological mechanism, and thus represent a powerful system to understand vertebrate DNA replication. Surprisingly, DNA replication in this system is highly sensitive to plasmid concentration, being undetectable below

  3. Comparative analysis of environmental DNA extraction and purification methods from different humic acid rich soils

    CSIR Research Space (South Africa)

    Lakay, FM

    2007-01-01

    Full Text Available Three different soil DNA isolation and four purification strategies were compared on different soil samples with variable rates of success. Bead beating extraction gave significantly higher DNA yields than microwave-based and liquid nitrogen...

  4. Alkaline Extraction of DNA from Pathogenic Fungi for PCR-RFLP Analysis

    OpenAIRE

    Matsumoto, Masaru; Mishima, Shinobu; Matsuyama, Nobuaki; 松元, 賢; 松山, 宣明

    1997-01-01

    For the preparation of DNA samples from fungal mycelia alkaline extraction method was applied and assessed its usefulness for PCR-RFLP analysis. Using alkaline treatment protocols, 18S ribosomal DNAs (rDNA) derived from fungal genomic DNA of Pyricularia oryzae, P. zingiberi, Rhizoctonia solani and R. oryzae were PCR-amplified and digested with Hha I, Msp I and Hae ill. RFLP analysis with HhaI showed the divergent polymorphism between genus Pyricularia and Rhizoctonia. The alkaline DNA extract...

  5. Comparison of nine DNA extraction methods for the diagnosis of bovine tuberculosis by real time PCR

    OpenAIRE

    Moura, André; Hodon, Mikael Arrais; Soares Filho, Paulo Martins; Issa, Marina de Azevedo; Oliveira, Ana Paula Ferreira de; Fonseca Júnior, Antônio Augusto

    2016-01-01

    ABSTRACT: Bovine tuberculosis is an infectious disease with a high impact on the cattle industry, particularly in developing countries. PCR is a very sensitive method for detection of infectious agents, but the sensitivity of molecular diagnosis is largely dependent on the efficiency of the DNA extraction methods. The objective of this study was to evaluate DNA extraction methods for direct detection of Mycobacterium bovis in bovine tissue. Nine commercial kits for DNA extraction were evalua...

  6. Comparison of Six DNA Extraction Procedures and the Application of Plastid DNA Enrichment Methods in Selected Non-photosynthetic Plants

    Directory of Open Access Journals (Sweden)

    Shin-Yi Shyu

    2013-12-01

    Full Text Available Genomic DNA was isolated using three DNA extraction commercial kits and three CTAB-based methods for two non-photosynthetic plants, Balanophora japonica and Mitrastemon kanehirai. The quality of the isolated DNA was evaluated and subjected to following restriction enzyme digestions. All six procedures yielded DNA of sufficient quality for PCR, and the method described by Barnwell et al. (1998 performed well in isolating DNA from both species for restriction enzyme digestion. In addition, we succeeded to enrich plastid DNA content by using the methods depending on a high salt buffer to deplete nuclear material. The ‘high salt’ methods based on protocol presented by Milligan (1989 were able to increase plastid DNA effectively and significantly reduce nuclear DNA from M. kanehirai. The plastid DNA enrichment protocols are inexpensive and not time-consuming, and may be applicable to other non-photosynthetic plants.

  7. Rapid and reliable extraction of genomic DNA from various wild-type and transgenic plants

    Directory of Open Access Journals (Sweden)

    Yang Moon-Sik

    2004-09-01

    Full Text Available Abstract Background DNA extraction methods for PCR-quality DNA from calluses and plants are not time efficient, since they require that the tissues be ground in liquid nitrogen, followed by precipitation of the DNA pellet in ethanol, washing and drying the pellet, etc. The need for a rapid and simple procedure is urgent, especially when hundreds of samples need to be analyzed. Here, we describe a simple and efficient method of isolating high-quality genomic DNA for PCR amplification and enzyme digestion from calluses, various wild-type and transgenic plants. Results We developed new rapid and reliable genomic DNA extraction method. With our developed method, plant genomic DNA extraction could be performed within 30 min. The method was as follows. Plant tissue was homogenized with salt DNA extraction buffer using hand-operated homogenizer and extracted by phenol:chloroform:isoamyl alcohol (25:24:1. After centrifugation, the supernatant was directly used for DNA template for PCR, resulting in successful amplification for RAPD from various sources of plants and specific foreign genes from transgenic plants. After precipitating the supernatant, the DNA was completely digested by restriction enzymes. Conclusion This DNA extraction procedure promises simplicity, speed, and efficiency, both in terms of time and the amount of plant sample required. In addition, this method does not require expensive facilities for plant genomic DNA extraction.

  8. Total Phenolics and Total Flavonoids Contents and Hypnotic Effect in Mice of Ziziphus mauritiana Lam. Seed Extract

    Directory of Open Access Journals (Sweden)

    Aye Moh Moh San

    2013-01-01

    Full Text Available The seeds of Ziziphus mauritiana Lam. have been traditionally used for treatment of various complications including insomnia and anxiety. They are popularly used as sedative and hypnotic drugs in China, Korea, Myanmar, Vietnam, and other Asian countries. However, no scientific proof on hypnotic activity of Z. mauritiana seeds (ZMS was reported. In this study, the hypnotic activity of 50% ethanolic extract from ZMS was observed on the loss of righting reflex in mice using pentobarbital-induced sleep mice method. The contents of total phenolics and total flavonoids in the extract were also determined. The results showed that the 50% ethanolic extract from ZMS contained total phenolics  mg gallic acid equivalent (GAE/g extract and total flavonoids  mg quercetin equivalent (QE/g extract. Oral administration of the extract at the dose of 200 mg/kg significantly increased the sleeping time in mice intraperitoneally administered with sodium pentobarbital (50 mg/kg body weight. These results supported the traditional use of ZMS for the treatment of insomnia. The seeds of Z. mauritiana should be further developed as an alternative sedative and/or hypnotic product.

  9. [Study on a collagenase protocol to extract DNA from remnant feathers in edible bird's nest].

    Science.gov (United States)

    Wang, Ling-Li; Chen, Nian; Zhang, Wei-Wei; Wu, Guo-Hong; Lai, Xiao-Ping

    2013-08-01

    To establish a method for extracting genomic DNA from rudimental bird feather from the precious edible bird's nest (EBN) harvested from the swiftlet cave. Observed the EBN using endoscopic and studied the influence of adding collagenase on the extracting yield of DNA. PCR amplification and sequencing for the extraction was also conducted. Collagenase was used in addition to protease K which could substantively increase the DNA yield. The DNA extracted by this method could be used for PCR and other molecular biology analyses. This method can be applied to identify the species types in biological products, especially for animal tissue materials that rich in collagen.

  10. Evaluation of DNA Extraction Methods Suitable for PCR-based Detection and Genotyping of Clostridium botulinum

    DEFF Research Database (Denmark)

    Auricchio, Bruna; Anniballi, Fabrizio; Fiore, Alfonsina

    2013-01-01

    in terms of cost, time, labor, and supplies. Eleven botulinum toxin–producing clostridia strains and 25 samples (10 food, 13 clinical, and 2 environmental samples) naturally contaminated with botulinum toxin–producing clostridia were used to compare 4 DNA extraction procedures: Chelex® 100 matrix, Phenol......Sufficient quality and quantity of extracted DNA is critical to detecting and performing genotyping of Clostridium botulinum by means of PCR-based methods. An ideal extraction method has to optimize DNA yield, minimize DNA degradation, allow multiple samples to be extracted, and be efficient...

  11. Automated extraction of DNA from biological stains on fabric from crime cases. A comparison of a manual and three automated methods.

    Science.gov (United States)

    Stangegaard, Michael; Hjort, Benjamin B; Hansen, Thomas N; Hoflund, Anders; Mogensen, Helle S; Hansen, Anders J; Morling, Niels

    2013-05-01

    The presence of PCR inhibitors in extracted DNA may interfere with the subsequent quantification and short tandem repeat (STR) reactions used in forensic genetic DNA typing. DNA extraction from fabric for forensic genetic purposes may be challenging due to the occasional presence of PCR inhibitors that may be co-extracted with the DNA. Using 120 forensic trace evidence samples consisting of various types of fabric, we compared three automated DNA extraction methods based on magnetic beads (PrepFiler Express Forensic DNA Extraction Kit on an AutoMate Express, QIAsyphony DNA Investigator kit either with the sample pre-treatment recommended by Qiagen or an in-house optimized sample pre-treatment on a QIAsymphony SP) and one manual method (Chelex) with the aim of reducing the amount of PCR inhibitors in the DNA extracts and increasing the proportion of reportable STR-profiles. A total of 480 samples were processed. The highest DNA recovery was obtained with the PrepFiler Express kit on an AutoMate Express while the lowest DNA recovery was obtained using a QIAsymphony SP with the sample pre-treatment recommended by Qiagen. Extraction using a QIAsymphony SP with the sample pre-treatment recommended by Qiagen resulted in the lowest percentage of PCR inhibition (0%) while extraction using manual Chelex resulted in the highest percentage of PCR inhibition (51%). The largest number of reportable STR-profiles was obtained with DNA from samples extracted with the PrepFiler Express kit (75%) while the lowest number was obtained with DNA from samples extracted using a QIAsymphony SP with the sample pre-treatment recommended by Qiagen (41%). Copyright © 2013 Elsevier Ireland Ltd. All rights reserved.

  12. Optimization of Total Flavonoids Extraction from Coreopsis tinctoria Nutt. by Response Surface Methodology

    Directory of Open Access Journals (Sweden)

    Liu, X. F.

    2014-11-01

    Full Text Available Response surface methodology (RSM was applied to predict optimum conditions for extraction of flavonoid from Coreopsis tinctoria Nutt. A central composite design (CCD was used to monitor the effect of extraction temperature, extraction time, and water-to-material ratio on yield of total flavonoids. The optimal extraction conditions were obtained as water-to-material ratio of 55 ml g−1, extraction temperature of 80 °C and extraction time of 70 minutes. Under these conditions, the average total flavonoids yield, according to the mass of raw material, was 9.0 ± 0.6 %, which corresponds to the predicted value of 8.9 %. Thus, the extraction method was applied successfully to extract total flavonoids from C. tinctoria.

  13. Phosphogypsum analysis: total content and extractable element concentrations

    International Nuclear Information System (INIS)

    Gennari, Roseli F.; Medina, Nilberto H.; Garcia, Isabella; Silveira, Marcilei A.G.

    2011-01-01

    Phosphogypsum stand for the chemical origin gypsum generated in fertilizers production, in which phosphate rock is attacked by sulfuric acid resulting in phosphoric acid (H 3 PO 4 ) and phosphate fertilizers. Phosphogypsum is not a commercial product and it is stocked in large open areas or accumulated in lakes inducing to a major environmental problem due to the presence of toxic and radioactive elements. The increasing world agricultural demand is the real responsible for the severity of this environmental problem. Nevertheless, there are some possibilities for the application of this reject material, such as civil construction, waste water treatment, and in cultivated lands, etc. In the agriculture the phosphogypsum is commonly used as a nutrient source due to its large amounts of phosphorus, calcium and sulfur. However, there are still some environmental questions related to the use of this by-product since phosphogypsum is classified as TENORM (Technologically Enhanced Naturally Occurring Radioactive Material), which is a solid waste containing heavy metals and naturally occurring radioactive elements from the rock matrix. In this work, Plasma Mass Spectrometry (ICP-MS) was used to study phosphogypsum samples. Several acid solutions for samples digestion were evaluated in order to be feasible the chemical analysis. BCR sequential extractions were also performed. The results showed analyte concentrations are highly dependent on the acid solution used. The BCR guidelines could not be applied as used for soil, since the phosphogypsum solubility is different. So, it would be necessary to use different mass aliquots in the extractions, to be feasible an environmental evaluation. (author)

  14. Ultrasound-Assisted Extraction of Total Flavonoids from Corn Silk and Their Antioxidant Activity

    Directory of Open Access Journals (Sweden)

    Ling-Li Zheng

    2016-01-01

    Full Text Available Object. Ultrasound-assisted extraction of total flavonoids from corn silk and their antioxidant activities were studied. Methods. Response surface methodology was adopted to optimize the extraction conditions and antioxidant activities of the extracted total flavonoids were detected through ferric reducing antioxidant power (FRAP assay. Results. Through a three-level, three-variable Box-Behnken design of response surface methodology (RSM adopting yield as response, the optimal conditions were determined as follows: ultrasonic power 500 W, extraction time 20 min, material solvent ratio 1 : 20, and ethanol concentration 30%. Under the optimum conditions, the extraction yield of total flavonoids was 1.13%. FRAP value of total flavonoids extracted from corn silk was 467.59 μmol/L. Conclusion. The total flavonoids of corn silk could be developed as food natural antioxidant reagents.

  15. Comparison of DNA extraction protocols for microbial communities from soil treated with biochar

    Directory of Open Access Journals (Sweden)

    D.C.A. Leite

    2014-01-01

    Full Text Available Many studies have evaluated the effects of biochar application on soil structure and plant growth. However, there are very few studies describing the effect of biochar on native soil microbial communities. Microbial analysis of environmental samples requires accurate and reproducible methods for the extraction of DNA from samples. Because of the variety among microbial species and the strong adsorption of the phosphate backbone of the DNA molecule to biochar, extracting and purifying high quality microbial DNA from biochar-amended soil is not a trivial process and can be considerably more difficult than the extraction of DNA from other environmental samples. The aim of this study was to compare the relative efficacies of three commercial DNA extraction kits, the FastDNA® SPIN Kit for Soil (FD kit, the PowerSoil® DNA Isolation Kit (PS kit and the ZR Soil Microbe DNA Kit MiniprepTM (ZR kit, for extracting microbial genomic DNA from sand treated with different types of biochar. The methods were evaluated by comparing the DNA yields and purity and by analysing the bacterial and fungal community profiles generated by PCR-DGGE. Our results showed that the PCR-DGGE profiles for bacterial and fungal communities were highly affected by the purity and yield of the different DNA extracts. Among the tested kits, the PS kit was the most efficient with respect to the amount and purity of recovered DNA and considering the complexity of the generated DGGE microbial fingerprint from the sand-biochar samples.

  16. Comparison of DNA extraction protocols for microbial communities from soil treated with biochar

    Science.gov (United States)

    Leite, D.C.A.; Balieiro, F.C.; Pires, C.A.; Madari, B.E.; Rosado, A.S.; Coutinho, H.L.C.; Peixoto, R.S.

    2014-01-01

    Many studies have evaluated the effects of biochar application on soil structure and plant growth. However, there are very few studies describing the effect of biochar on native soil microbial communities. Microbial analysis of environmental samples requires accurate and reproducible methods for the extraction of DNA from samples. Because of the variety among microbial species and the strong adsorption of the phosphate backbone of the DNA molecule to biochar, extracting and purifying high quality microbial DNA from biochar-amended soil is not a trivial process and can be considerably more difficult than the extraction of DNA from other environmental samples. The aim of this study was to compare the relative efficacies of three commercial DNA extraction kits, the FastDNA® SPIN Kit for Soil (FD kit), the PowerSoil® DNA Isolation Kit (PS kit) and the ZR Soil Microbe DNA Kit Miniprep™ (ZR kit), for extracting microbial genomic DNA from sand treated with different types of biochar. The methods were evaluated by comparing the DNA yields and purity and by analysing the bacterial and fungal community profiles generated by PCR-DGGE. Our results showed that the PCR-DGGE profiles for bacterial and fungal communities were highly affected by the purity and yield of the different DNA extracts. Among the tested kits, the PS kit was the most efficient with respect to the amount and purity of recovered DNA and considering the complexity of the generated DGGE microbial fingerprint from the sand-biochar samples. PMID:24948928

  17. Anti-tumor potential of total alkaloid extract of Prosopis juliflora DC ...

    African Journals Online (AJOL)

    The total alkaloid extract from Prosopis juliflora DC. leaves was obtained using acid/base modified extraction method. The in vitro anti-tumor potential of the extract was evaluated using MTT (3-(4,5- dimethythiazol-2yl)2,5-diphenyl tetrazolium bromide) based cytotoxicity monitoring after 24, 48 and 72 h exposure of the ...

  18. DNA excision repair in cell extracts from human cell lines exhibiting hypersensitivity to DNA-damaging agents

    International Nuclear Information System (INIS)

    Hansson, J.; Keyse, S.M.; Lindahl, T.; Wood, R.D.

    1991-01-01

    Whole cell extracts from human lymphoid cell lines can perform in vitro DNA repair synthesis in plasmids damaged by agents including UV or cis-diamminedichloroplatinum(II) (cis-DDP). Extracts from xeroderma pigmentosum (XP) cells are defective in repair synthesis. We have now studied in vitro DNA repair synthesis using extracts from lymphoblastoid cell lines representing four human hereditary syndromes with increased sensitivity to DNA-damaging agents. Extracts of cell lines from individuals with the sunlight-sensitive disorders dysplastic nevus syndrome or Cockayne's syndrome (complementation groups A and B) showed normal DNA repair synthesis in plasmids with UV photoproducts. This is consistent with in vivo measurements of the overall DNA repair capacity in such cell lines. A number of extracts were prepared from two cell lines representing the variant form of XP (XP-V). Half of the extracts prepared showed normal levels of in vitro DNA repair synthesis in plasmids containing UV lesions, but the remainder of the extracts from the same cell lines showed deficient repair synthesis, suggesting the possibility of an unusually labile excision repair protein in XP-V. Fanconi's anemia (FA) cells show cellular hypersensitivity to cross-linking agents including cis-DDP. Extracts from cell lines belonging to two different complementation groups of FA showed normal DNA repair synthesis in plasmids containing cis-DDP or UV adducts. Thus, there does not appear to be an overall excision repair defect in FA, but the data do not exclude a defect in the repair of interstrand DNA cross-links

  19. COMPARISON OF COMMERCIAL DNA KITS AND TRADITIONAL DNA EXTRACTION PROCEDURE IN PCR DETECTION OF PORK IN DRY/FERMENTED SAUSAGES

    Directory of Open Access Journals (Sweden)

    Ivona Djurkin Kušec

    2015-09-01

    Full Text Available In the present study four commercially available DNA extraction kits (Wizard® Genomic DNA Purification Kit, High Pure PCR Template Kit, DNeasy mericon Food and GeneJET PCR Purification Kit, as well as standard phenol/chloroform isolation technique have been evaluated regarding their concentration, purity and suitability for amplification of porcine DNA in dry/fermented sausages. The isolates were assessed for quantity and quality using spectrophotometer (IMPLEN GmbH, Germany. To verify template usability and quality of isolated DNA, the polymerase chain reaction (PCR targeting at porcine cytochrome b by species specific primers was used. The comparison of extraction methods revealed satisfactory efficiency and purity of all extraction kits, while with standard phenol/chloroform isolation method high concentrations of DNA with low A260/280 were obtained. However, all the investigated techniques proved to be suitable for identification of porcine DNA in dry/fermented sausage. Thus, the standard phenol/chloroform DNA extraction method, as the cost-effective one, can be recommended as a good alternative to more expensive isolation kits when investigating the presence of pork DNA in dry/ fermented meat products.

  20. Evaluation of the ISO standard 11063 DNA extraction procedure for assessing soil microbial abundance and community structure.

    Directory of Open Access Journals (Sweden)

    Pierre Plassart

    Full Text Available Soil DNA extraction has become a critical step in describing microbial biodiversity. Historically, ascertaining overarching microbial ecological theories has been hindered as independent studies have used numerous custom and commercial DNA extraction procedures. For that reason, a standardized soil DNA extraction method (ISO-11063 was previously published. However, although this ISO method is suited for molecular tools such as quantitative PCR and community fingerprinting techniques, it has only been optimized for examining soil bacteria. Therefore, the aim of this study was to assess an appropriate soil DNA extraction procedure for examining bacterial, archaeal and fungal diversity in soils of contrasting land-use and physico-chemical properties. Three different procedures were tested: the ISO-11063 standard; a custom procedure (GnS-GII; and a modified ISO procedure (ISOm which includes a different mechanical lysis step (a FastPrep ®-24 lysis step instead of the recommended bead-beating. The efficacy of each method was first assessed by estimating microbial biomass through total DNA quantification. Then, the abundances and community structure of bacteria, archaea and fungi were determined using real-time PCR and terminal restriction fragment length polymorphism approaches. Results showed that DNA yield was improved with the GnS-GII and ISOm procedures, and fungal community patterns were found to be strongly dependent on the extraction method. The main methodological factor responsible for differences between extraction procedure efficiencies was found to be the soil homogenization step. For integrative studies which aim to examine bacteria, archaea and fungi simultaneously, the ISOm procedure results in higher DNA recovery and better represents microbial communities.

  1. Effect of extraction solvent on total phenol content, total flavonoid content, and antioxidant activity of Limnophila aromatica

    Directory of Open Access Journals (Sweden)

    Quy Diem Do

    2014-09-01

    Full Text Available Limnophila aromatica is commonly used as a spice and a medicinal herb in Southeast Asia. In this study, water and various concentrations (50%, 75%, and 100% of methanol, ethanol, and acetone in water were used as solvent in the extraction of L. aromatica. The antioxidant activity, total phenolic content, and total flavonoid content of the freeze-dried L. aromatica extracts were investigated using various in vitro assays. The extract obtained by 100% ethanol showed the highest total antioxidant activity, reducing power and DPPH (2,2-diphenyl-1-picrylhydrazyl radical scavenging activity. The same extract also exhibited the highest phenolic content (40.5 mg gallic acid equivalent/g of defatted L. aromatica and the highest flavonoid content (31.11 mg quercetin equivalent/g of defatted L. aromatica. The highest extraction yield was obtained by using 50% aqueous acetone. These results indicate that L. aromatica can be used in dietary applications with a potential to reduce oxidative stress.

  2. JUICE EXTRACTION FOR TOTAL SOLUBLE SOLIDS CONTENT DETERMINATION IN MELON

    Directory of Open Access Journals (Sweden)

    Paulo Sérgio Lima e Silva

    2006-01-01

    Full Text Available The total soluble solids content (TSSC shows high positive correlation with sugars content, and therefore is generally accepted as an important quality trait of fruits. In melon, this evaluation is usually done by grinding a slice of the fruit's pulp in a household food processor, straining the ground material and then proceeding the TSSC determination in the resulting juice. This evaluation is labor-intensive and takes a long time to complete. An alternative process was delineated for obtaining the juice: the pulp of the fruit slice would be transversally cut one or more times, and longitudinally pressed by hand to obtain the juice. The objective of this work was to compare processes for obtaining juice to evaluate TSSC in melons. Fifty, 15, and 15 fruits of the Galia, Yellow, and Cantaloupe type melons were evaluated, respectively. Each fruit was considered as a block, and was longitudinally split into six fractions with similar sizes, which corresponded to the plots. The following treatments were evaluated: fraction without cuts, fractions with one, three, five, or seven transversal cuts, and the fraction treated by the conventional process. It was concluded that the procedure by which the melon slices of Galia, Yellow and Cantaloupe types are pressed for obtaining the juice to evaluate TSSC can overestimate this content. This would probably be due to the fact that the most internal section of the mesocarp presents greater TSSC than the portions closer to the epicarp.

  3. Droplet centrifugation, droplet DNA extraction, and rapid droplet thermocycling for simpler and faster PCR assay using wire-guided manipulations.

    Science.gov (United States)

    You, David J; Yoon, Jeong-Yeol

    2012-09-04

    A computer numerical control (CNC) apparatus was used to perform droplet centrifugation, droplet DNA extraction, and rapid droplet thermocycling on a single superhydrophobic surface and a multi-chambered PCB heater. Droplets were manipulated using "wire-guided" method (a pipette tip was used in this study). This methodology can be easily adapted to existing commercial robotic pipetting system, while demonstrated added capabilities such as vibrational mixing, high-speed centrifuging of droplets, simple DNA extraction utilizing the hydrophobicity difference between the tip and the superhydrophobic surface, and rapid thermocycling with a moving droplet, all with wire-guided droplet manipulations on a superhydrophobic surface and a multi-chambered PCB heater (i.e., not on a 96-well plate). Serial dilutions were demonstrated for diluting sample matrix. Centrifuging was demonstrated by rotating a 10 μL droplet at 2300 round per minute, concentrating E. coli by more than 3-fold within 3 min. DNA extraction was demonstrated from E. coli sample utilizing the disposable pipette tip to cleverly attract the extracted DNA from the droplet residing on a superhydrophobic surface, which took less than 10 min. Following extraction, the 1500 bp sequence of Peptidase D from E. coli was amplified using rapid droplet thermocycling, which took 10 min for 30 cycles. The total assay time was 23 min, including droplet centrifugation, droplet DNA extraction and rapid droplet thermocycling. Evaporation from of 10 μL droplets was not significant during these procedures, since the longest time exposure to air and the vibrations was less than 5 min (during DNA extraction). The results of these sequentially executed processes were analyzed using gel electrophoresis. Thus, this work demonstrates the adaptability of the system to replace many common laboratory tasks on a single platform (through re-programmability), in rapid succession (using droplets), and with a high level of

  4. Droplet centrifugation, droplet DNA extraction, and rapid droplet thermocycling for simpler and faster PCR assay using wire-guided manipulations

    Directory of Open Access Journals (Sweden)

    You David J

    2012-09-01

    Full Text Available Abstract A computer numerical control (CNC apparatus was used to perform droplet centrifugation, droplet DNA extraction, and rapid droplet thermocycling on a single superhydrophobic surface and a multi-chambered PCB heater. Droplets were manipulated using “wire-guided” method (a pipette tip was used in this study. This methodology can be easily adapted to existing commercial robotic pipetting system, while demonstrated added capabilities such as vibrational mixing, high-speed centrifuging of droplets, simple DNA extraction utilizing the hydrophobicity difference between the tip and the superhydrophobic surface, and rapid thermocycling with a moving droplet, all with wire-guided droplet manipulations on a superhydrophobic surface and a multi-chambered PCB heater (i.e., not on a 96-well plate. Serial dilutions were demonstrated for diluting sample matrix. Centrifuging was demonstrated by rotating a 10 μL droplet at 2300 round per minute, concentrating E. coli by more than 3-fold within 3 min. DNA extraction was demonstrated from E. coli sample utilizing the disposable pipette tip to cleverly attract the extracted DNA from the droplet residing on a superhydrophobic surface, which took less than 10 min. Following extraction, the 1500 bp sequence of Peptidase D from E. coli was amplified using rapid droplet thermocycling, which took 10 min for 30 cycles. The total assay time was 23 min, including droplet centrifugation, droplet DNA extraction and rapid droplet thermocycling. Evaporation from of 10 μL droplets was not significant during these procedures, since the longest time exposure to air and the vibrations was less than 5 min (during DNA extraction. The results of these sequentially executed processes were analyzed using gel electrophoresis. Thus, this work demonstrates the adaptability of the system to replace many common laboratory tasks on a single platform (through re-programmability, in rapid succession (using droplets

  5. A RAPID DNA EXTRACTION METHOD FOR PCR IDENTIFICATION OF FUNGAL INDOOR AIR CONTAMINANTS

    Science.gov (United States)

    Following air sampling, fungal DNA needs to be extracted and purified to a state suitable for laboratory use. Our laboratory has developed a simple method of extraction and purification of fungal DNA appropriate for enzymatic manipulation and polymerase chain reaction (PCR) appli...

  6. Two mini-preparation protocols to DNA extraction from plants with ...

    African Journals Online (AJOL)

    Were standardized two previously reported standard plant DNA extraction methods, but improved them on mini preparations to use the samples for population genetic analysis. The combination of CTAB lysis procedure-solvent extraction and DNA column purification (DNeasy plant mini kit modification) enables a faster and ...

  7. A rapid and low-cost DNA extraction method for isolating ...

    African Journals Online (AJOL)

    The price of commercial DNA extraction methods makes the routine use of polymerase chain reaction amplification (PCR) based methods rather costly for scientists in developing countries. A guanidium thiocayante-based DNA extraction method was investigated in this study for the isolation of Escherichia coli (E. coli) DNA ...

  8. Effect of Cassia hirsuta (L) extract on DNA profile of some ...

    African Journals Online (AJOL)

    The effect of ethanol extract of leaf of Cassia hirsute (L) on the DNA profile of some selected pathogenic microorganisms were investigated using PCR-RAPD analysis to generate DNA fingerprint. The change in molecular configuration of organisms with and without extract shows a wide disparity between the sensitive and ...

  9. Ultrasound-Assisted Extraction of Total Flavonoids from Corn Silk and Their Antioxidant Activity

    OpenAIRE

    Zheng, Ling-Li; Wen, Guan; Yuan, Min-Yong; Gao, Feng

    2016-01-01

    Object. Ultrasound-assisted extraction of total flavonoids from corn silk and their antioxidant activities were studied. Methods. Response surface methodology was adopted to optimize the extraction conditions and antioxidant activities of the extracted total flavonoids were detected through ferric reducing antioxidant power (FRAP) assay. Results. Through a three-level, three-variable Box-Behnken design of response surface methodology (RSM) adopting yield as response, the optimal conditions we...

  10. DNA damage induced in mouse tissues by organic wood preserving waste extracts as assayed by {sup 32}P-postlabeling

    Energy Technology Data Exchange (ETDEWEB)

    Randerath, E. [Division of Toxicology, Department of Pharmacology, Baylor College of Medicine, Houston, TX (United States); Zhou, G.D. [Division of Toxicology, Department of Pharmacology, Baylor College of Medicine, Houston, TX (United States); Donnelly, K.C. [Department of Veterinary Anatomy and Public Health, Texas A and M University, College Station, TX (United States); Safe, S.H. [Department of Veterinary Physiology/Pharmacology, Texas A and M University, College Station, TX (United States); Randerath, K. [Division of Toxicology, Department of Pharmacology, Baylor College of Medicine, Houston, TX (United States)

    1996-09-01

    In the present study, a mouse bioassay was used in combination with {sup 32}P-postlabeling to determine DNA adduct formation induced by hexane/acetone extracts of two samples from a WPW site. Female ICR mice were treated dermally with extract corresponding to 3 mg residue or vehicle control once per day for 2 days and killed 24 h later. Skin, lung, liver, kidney, and heart DNA preparations were assayed by nuclease P1-enhanced postlabeling. Adduct profiles were tissue-specific and displayed a multitude of non-polar DNA adducts with levels amounting to one adduct in 1.6 x 10{sup 6} DNA nucleotides in skin (both extracts) and one adduct in 3.2 x 10{sup 7} or 1.2 x 10{sup 7} DNA nucleotides in liver (extract 1 or extract 2). Based on their chromatographic properties, these adducts appeared largely derived from polycyclic aromatic hydrocarbons (PAHs) present in the extracts. One of the major adducts was identified as the {sup 32}P-labeled derivative of the reaction product of 7{beta}, 8{alpha}-dihydroxy-9{alpha}, 10{alpha}-epoxy-7, 8, 9, 10-tetrahydrobenzo[a]pyrene (BPDE I) with N{sup 2} of deoxyguanosine. Total non-polar DNA adduct levels were highest in skin and lung, amounting to 17.4 and 24.0% of the skin values for extracts 1 and 2, respectively, in lung while the corresponding levels in liver were 5.0 and 12.6%. These results were in accord with the carcinogenic potencies of PAHs in these organs. Extract 2 induced higher adduct levels in internal organs, although its PAH concentrations were lower than those of extract 1, i.e. lung, liver, kidney, and heart had 1.4, 2.5, 1.9, and 1.7 times higher total adduct levels and 1.6, 3.3, 1.6, and 1.9 times higher benzo[a]pyrene adduct levels. With the exception of total adducts in lung, the differences between the two extracts were all significant, suggestive of compound interactions. (orig.) (orig.). With 5 figs., 6 tabs.

  11. DNA damage induced in mouse tissues by organic wood preserving waste extracts as assayed by 32P-postlabeling

    International Nuclear Information System (INIS)

    Randerath, E.; Zhou, G.D.; Donnelly, K.C.; Safe, S.H.; Randerath, K.

    1996-01-01

    In the present study, a mouse bioassay was used in combination with 32 P-postlabeling to determine DNA adduct formation induced by hexane/acetone extracts of two samples from a WPW site. Female ICR mice were treated dermally with extract corresponding to 3 mg residue or vehicle control once per day for 2 days and killed 24 h later. Skin, lung, liver, kidney, and heart DNA preparations were assayed by nuclease P1-enhanced postlabeling. Adduct profiles were tissue-specific and displayed a multitude of non-polar DNA adducts with levels amounting to one adduct in 1.6 x 10 6 DNA nucleotides in skin (both extracts) and one adduct in 3.2 x 10 7 or 1.2 x 10 7 DNA nucleotides in liver (extract 1 or extract 2). Based on their chromatographic properties, these adducts appeared largely derived from polycyclic aromatic hydrocarbons (PAHs) present in the extracts. One of the major adducts was identified as the 32 P-labeled derivative of the reaction product of 7β, 8α-dihydroxy-9α, 10α-epoxy-7, 8, 9, 10-tetrahydrobenzo[a]pyrene (BPDE I) with N 2 of deoxyguanosine. Total non-polar DNA adduct levels were highest in skin and lung, amounting to 17.4 and 24.0% of the skin values for extracts 1 and 2, respectively, in lung while the corresponding levels in liver were 5.0 and 12.6%. These results were in accord with the carcinogenic potencies of PAHs in these organs. Extract 2 induced higher adduct levels in internal organs, although its PAH concentrations were lower than those of extract 1, i.e. lung, liver, kidney, and heart had 1.4, 2.5, 1.9, and 1.7 times higher total adduct levels and 1.6, 3.3, 1.6, and 1.9 times higher benzo[a]pyrene adduct levels. With the exception of total adducts in lung, the differences between the two extracts were all significant, suggestive of compound interactions. (orig.) (orig.). With 5 figs., 6 tabs

  12. Modifying and adapting a plant-based DNA extraction protocol for ...

    African Journals Online (AJOL)

    ... a 100 apparently healthy individuals residing in Calabar. The modified DNA procedure yielded good quality genomic DNA which was used in carrying out allele specific polymerase chain reaction which also yielded good quality amplicons. This method is simple and suitable for the extraction of DNA from human red cell.

  13. A rapid and low-cost DNA extraction method for isolating ...

    African Journals Online (AJOL)

    user

    2011-02-21

    Feb 21, 2011 ... Available online at http://www.academicjournals.org/AJB ... α-casein, produces PCR ready DNA at a fraction of the cost of commercial DNA extraction kits. Key words: DNA .... This experiment was performed to evaluate the efficiency of the ..... Zoetendal EG, Ben-Amor K, Akkermans AD, Abee T, De Vos WM.

  14. The effects of three different grinding methods in DNA extraction of ...

    African Journals Online (AJOL)

    Rapid DNA extraction is a prerequisite for molecular studies. Generally, plant tissue is ground in liquid nitrogen to isolate DNA; but, liquid nitrogen is dangerous and volatile. Besides, liquid nitrogen is not always available in many developing countries. To investigate if high quality DNA could be obtained for downstream ...

  15. An effective and low-cost method for DNA extraction from herbal ...

    African Journals Online (AJOL)

    Rhubarb is an important traditional Chinese herbal drug with high secondary metabolites that interfere with DNA extraction procedures and downstream applications, such as DNA restriction and amplification. An effective and low-cost protocol for isolating genomic DNA from root of Rheum tanguticum is described in this ...

  16. In vitro antimicrobial activity of total extracts of the leaves of Petiveria alliacea L. (Anamu

    Directory of Open Access Journals (Sweden)

    Ania Ochoa Pacheco

    2013-06-01

    Full Text Available The antimicrobial activity of 13 total extracts was evaluated, 10 soft extracts (B and 3 blended extracts (E prepared from dry and fresh leaves of Petiveria alliacea L. Various solvents were used for their preparation: hydroalcoholic solution at 30%, 80% and isopropyl alcohol. The antimicrobial effect of the extracts was tested by means of the method of Kirby-Bauer, using four bacterial strains from the ATCC collection (Escherichia coli, Staphylococcus aureus, Enterococcus faecalis and Pseudomonas aeruginosa and a leveduriform fungus (Candida albicans. The following quality control parameters were determined for most active extracts: physical, physical-chemical and chemical parameters. The results were: nine extracts showed antibacterial activity, being the most concentrated (B8 and E3, the ones with the highest activity in the presence of the bacteria tested; the effect of blended extracts (E1, E2 and E3 was greater in the presence of P. aeruginosa. Blended extracts are considered more potent and active than soft extracts. No antifungal activity was obtained for both types of extracts. The Minimum Inhibitory Concentration (MIC and Minimum Bactericidal Concentration (MBC were determined for both extracts, with the following results: MIC-soft extracts (>100 mg/mL, blended extracts (>50 mg/mL; MBC-soft extracts (≥400 mg/mL, blended extracts (≥200 mg/mL based on fresh leaves.

  17. Study the Three Extraction Methods for HBV DNA to Use in PCR

    Directory of Open Access Journals (Sweden)

    N. Sheikh

    2004-07-01

    Full Text Available Diagnosis of Hepatitis B is important because of the its high prevalence. Recently PCR method , has found greater interest among different diagnostic methods. Several reports emphasis on some false negative results in those laboratories using PCR. The aim of this study was to compare three different procedures for HBV DNA extraction. A total 30 serum samples received from Shariati hospital. Sera was taken from patients having chronic Hepatitis with HBs antigen positive and HBe antigen negative. The sensitivity of guanidium hydrochloride method for extracting the HBV DNA from serum were evaluated and compared with phenol–chloroform and boiling methods. Diagnostic PCR kit was obtained from Cynagene contained taq polymerase, reaction mixture, dNTP, and buffer for reaction. A 353 bp product were amplified by amplification program provided in used PCR protocol. The comparison of results indicated that procedure was successful for amplification of the designed products from Hepatitis B in sera. Number of positive results were 16,19,23 and number of negative result were 14,11,7 for the boiling, phenol-chloroform and guanidium-hydrochloride extraction methods respectively.PCR method is the fastest diagnosis method and the most accurate procedure to identify Hepatitis B. Guanidium hydrochloride method was the most successful procedure studied in this survey for viruses.

  18. Direct DNA extraction method of an obligate parasitic fungus from infected plant tissue.

    Science.gov (United States)

    Liu, L; Wang, C L; Peng, W Y; Yang, J; Lan, M Q; Zhang, B; Li, J B; Zhu, Y Y; Li, C Y

    2015-12-28

    Powdery mildew and rust fungi are obligate parasites that cannot live without host organisms. They are difficult to culture in synthetic medium in the laboratory. Genomic DNA extraction is one of the basic molecular techniques used to study the genetic structure of populations. In this study, 2 different DNA extraction methods, Chelex-100 and cetyltrimethylammonium bromide (CTAB), were used to extract DNA from euonymus powdery mildew and Puccinia striiformis f. sp Tritici. Polymerase chain reaction was carried out with a race-specific-marker rDNA-internal transcribed spacer sequence. Both DNA extraction methods were compared and analyzed. The results showed that both Chelex-100 and CTAB were effective for extracting genomic DNA from infected plant tissue. However, less DNA was required for the Chelex-100 method than for the CTAB method, and the Chelex-100 method involved fewer steps, was simpler and safer, and did not require organic solvents compared to the CTAB method. DNA quality was evaluated by polymerase chain reaction, and the results showed that genomic DNA extracted using the Chelex-100 method was better than that using CTAB method, and was sufficient for studying the genetic structure of population.

  19. Extraction of DNA from honey and its amplification by PCR for botanical identification

    Directory of Open Access Journals (Sweden)

    Sona Arun Jain

    2013-12-01

    Full Text Available The physiochemical and biological properties of honey are directly associated to its floral origin. Some current commonly used methods for identification of botanical origin of honey involve palynological analysis, chromatographic methods, or direct observation of the bee behavior. However, these methods can be less sensitive and time consuming. DNA-based methods have become popular due to their simplicity, quickness, and reliability. The main objective of this research is to introduce a protocol for the extraction of DNA from honey and demonstrate that the molecular analysis of the extracted DNA can be used for its botanical identification. The original CTAB-based protocol for the extraction of DNA from plants was modified and used in the DNA extraction from honey. DNA extraction was carried out from different honey samples with similar results in each replication. The extracted DNA was amplified by PCR using plant specific primers, confirming that the DNA extracted using the modified protocol is of plant origin and has good quality for analysis of PCR products and that it can be used for botanical identification of honey.

  20. Evaluation of DNA extraction methods for the detection of Cytomegalovirus in dried blood spots

    Science.gov (United States)

    Koontz, D.; Baecher, K.; Amin, M.; Nikolova, S.; Gallagher, M.; Dollard, S.

    2015-01-01

    Background Dried blood spots (DBS) are collected universally from newborns and may be valuable for the diagnosis of congenital Cytomegalovirus (CMV) infection. The reported analytical sensitivity for DBS testing compared to urine or saliva varies greatly across CMV studies. The purpose of this study was to directly compare the performance of various DNA extraction methods for identification of CMV in DBS including those used most often in CMV studies. Study design Whatman® Grade 903 filter paper cards were spotted with blood samples from 25 organ transplant recipients who had confirmed CMV viremia. Six DNA extraction methods were compared for relative yield of viral and cellular DNA: 2 manual solution-based methods (Gentra Puregene, thermal shock), 2 manual silica column-based methods (QIAamp DNA Mini, QIAamp DNA Investigator), and 2 automated methods (M48 MagAttract Mini, QIAcube Investigator). DBS extractions were performed in triplicate followed by real-time quantitative PCR (qPCR). Results For extraction of both viral and cellular DNA, two methods (QIAamp DNA Investigator and thermal shock) consistently gave the highest yields, and two methods (M48 MagAttract Mini and QIAamp DNA Mini) consistently gave the lowest yields. There was an average 3-fold difference in DNA yield between the highest and lowest yield methods. Conclusion The choice of DNA extraction method is a major factor in the ability to detect low levels of CMV in DBS and can largely account for the wide range of DBS sensitivities reported in studies to date. PMID:25866346

  1. DNA in ancient bone - where is it located and how should we extract it?

    DEFF Research Database (Denmark)

    Campos, Paula; Craig, Oliver E.; Turner-Walker, Gordon

    2012-01-01

    Despite the widespread use of bones in ancient DNA (aDNA) studies, relatively little concrete information exists in regard to how the DNA in mineralised collagen degrades, or where it survives in the material's architecture. While, at the macrostructural level, physical exclusion of microbes...... and other external contaminants may be an important feature, and, at the ultrastructural level, the adsorption of DNA to hydroxyapatite and/or binding of DNA to Type I collagen may stabilise the DNA, the relative contribution of each, and what other factors may be relevant, are unclear....... The question arises as to whether this may be due to post-collection preservation or just an artefact of the extraction methods used in these different studies? In an attempt to resolve these questions, we examine the efficacy of DNA extraction methods, and the quality and quantity of DNA recovered from both...

  2. Effect of seven Indian plant extracts on Fenton reaction-mediated damage to DNA constituents.

    Science.gov (United States)

    Kar, Indrani; Chattopadhyaya, Rajagopal

    2017-11-01

    The influences of substoichiometric amounts of seven plant extracts in the Fenton reaction-mediated damage to deoxynucleosides, deoxynucleoside monophosphates, deoxynucleoside triphosphates, and supercoiled plasmid DNA were studied to rationalize anticancer properties reported in some of these extracts. Extracts from Acacia catechu, Emblica officinalis, Spondias dulcis, Terminalia belerica, Terminalia chebula, as well as gallic acid, epicatechin, chebulagic acid and chebulinic acid enhance the extent of damage in Fenton reactions with all monomeric substrates but protect supercoiled plasmid DNA, compared to standard Fenton reactions. The damage to pyrimidine nucleosides/nucleotides is enhanced by these extracts and compounds to a greater extent than for purine ones in a concentration dependent manner. Dolichos biflorus and Hemidesmus indicus extracts generally do not show this enhancement for the monomeric substrates though they protect plasmid DNA. Compared to standard Fenton reactions for deoxynucleosides with ethanol, the presence of these five plant extracts render ethanol scavenging less effective as the radical is generated in the vicinity of the target. Since substoichiometric amounts of these extracts and the four compounds produce this effect, a catalytic mechanism involving the presence of a ternary complex of the nucleoside/nucleotide substrate, a plant compound and the hydroxyl radical is proposed. Such a mechanism cannot operate for plasmid DNA as the planar rings in the extract compounds cannot stack with the duplex DNA bases. These plant extracts, by enhancing Fenton reaction-mediated damage to deoxynucleoside triphosphates, slow down DNA replication in rapidly dividing cancer cells, thus contributing to their anticancer properties.

  3. Whole genome amplification of Chelex-extracted DNA from a single mite: a method for studying genetics of the predatory mite Phytoseiulus persimilis.

    Science.gov (United States)

    Konakandla, Bhanu; Park, Yoonseong; Margolies, David

    2006-01-01

    We developed and optimized a method using Chelex DNA extraction followed by whole genome amplification (WGA) to overcome problems conducting molecular genetic studies due to the limited amount of DNA obtainable from individual small organisms such as predatory mites. The DNA from a single mite, Phytoseiulus persimilis Athias-Henrot (Acari: Phytoseiidae), isolated in Chelex suspension was subjected to WGA. More than 1000-fold amplification of the DNA was achieved using as little as 0.03 ng genomic DNA template. The DNA obtained by the WGA was used for polymerase chain reaction followed by direct sequencing. From WGA DNA, nuclear DNA intergenic spacers ITS1 and ITS2 and a mitochondrial DNA 12S marker were tested in three different geographical populations of the predatory mite: California, the Netherlands, and Sicily. We found a total of four different alleles of the 12S in the Sicilian population, but no polymorphism was identified in the ITS marker. The combination of Chelex DNA extraction and WGA is thus shown to be a simple and robust technique for examining molecular markers for multiple loci by using individual mites. We conclude that the methods, Chelex extraction of DNA followed by WGA, provide a large quantity of DNA template that can be used for multiple PCR reactions useful for genetic studies requiring the genotypes of individual mites.

  4. Complete sequence analysis of 18S rDNA based on genomic DNA extraction from individual Demodex mites (Acari: Demodicidae).

    Science.gov (United States)

    Zhao, Ya-E; Xu, Ji-Ru; Hu, Li; Wu, Li-Ping; Wang, Zheng-Hang

    2012-05-01

    The study for the first time attempted to accomplish 18S ribosomal DNA (rDNA) complete sequence amplification and analysis for three Demodex species (Demodex folliculorum, Demodex brevis and Demodex canis) based on gDNA extraction from individual mites. The mites were treated by DNA Release Additive and Hot Start II DNA Polymerase so as to promote mite disruption and increase PCR specificity. Determination of D. folliculorum gDNA showed that the gDNA yield reached the highest at 1 mite, tending to descend with the increase of mite number. The individual mite gDNA was successfully used for 18S rDNA fragment (about 900 bp) amplification examination. The alignments of 18S rDNA complete sequences of individual mite samples and those of pooled mite samples ( ≥ 1000mites/sample) showed over 97% identities for each species, indicating that the gDNA extracted from a single individual mite was as satisfactory as that from pooled mites for PCR amplification. Further pairwise sequence analyses showed that average divergence, genetic distance, transition/transversion or phylogenetic tree could not effectively identify the three Demodex species, largely due to the differentiation in the D. canis isolates. It can be concluded that the individual Demodex mite gDNA can satisfy the molecular study of Demodex. 18S rDNA complete sequence is suitable for interfamily identification in Cheyletoidea, but whether it is suitable for intrafamily identification cannot be confirmed until the ascertainment of the types of Demodex mites parasitizing in dogs. Copyright © 2012 Elsevier Inc. All rights reserved.

  5. An Optimized DNA Analysis Workflow for the Sampling, Extraction, and Concentration of DNA obtained from Archived Latent Fingerprints.

    Science.gov (United States)

    Solomon, April D; Hytinen, Madison E; McClain, Aryn M; Miller, Marilyn T; Dawson Cruz, Tracey

    2018-01-01

    DNA profiles have been obtained from fingerprints, but there is limited knowledge regarding DNA analysis from archived latent fingerprints-touch DNA "sandwiched" between adhesive and paper. Thus, this study sought to comparatively analyze a variety of collection and analytical methods in an effort to seek an optimized workflow for this specific sample type. Untreated and treated archived latent fingerprints were utilized to compare different biological sampling techniques, swab diluents, DNA extraction systems, DNA concentration practices, and post-amplification purification methods. Archived latent fingerprints disassembled and sampled via direct cutting, followed by DNA extracted using the QIAamp® DNA Investigator Kit, and concentration with Centri-Sep™ columns increased the odds of obtaining an STR profile. Using the recommended DNA workflow, 9 of the 10 samples provided STR profiles, which included 7-100% of the expected STR alleles and two full profiles. Thus, with carefully selected procedures, archived latent fingerprints can be a viable DNA source for criminal investigations including cold/postconviction cases. © 2017 American Academy of Forensic Sciences.

  6. A rapid and inexpensive method for isolation of total DNA from Trichoderma spp (Hypocreaceae).

    Science.gov (United States)

    Vazquez-Angulo, J C; Mendez-Trujillo, V; González-Mendoza, D; Morales-Trejo, A; Grimaldo-Juarez, O; Cervantes-Díaz, L

    2012-05-15

    Extraction of high-quality genomic DNA for PCR amplification from filamentous fungi is difficult because of the complex cell wall and the high concentrations of polysaccharides and other secondary metabolites that bind to or co-precipitate with nucleic acids. We developed a modified sodium dodecyl sulfate/phenol protocol, without maceration in liquid nitrogen and without a final ethanol precipitation step. The A(260/280) absorbance ratios of isolated DNA were approximately 1.7-1.9, demonstrating that the DNA fraction is pure and can be used for analysis. Additionally, the A(260/230) values were higher than 1.6, demonstrating negligible contamination by polysaccharides. The DNA isolated by this protocol is of sufficient quality for molecular applications; this technique could be applied to other organisms that have similar substances that hinder DNA extraction. The main advantages of the method are that the mycelium is directly recovered from culture medium and it does not require the use of expensive and specialized equipment.

  7. How Severely Is DNA Quantification Hampered by RNA Co-extraction?

    Science.gov (United States)

    Sanchez, Ignacio; Remm, Matthieu; Frasquilho, Sonia; Betsou, Fay; Mathieson, William

    2015-10-01

    The optional RNase digest that is part of many DNA extraction protocols is often omitted, either because RNase is not provided in the kit or because users do not want to risk contaminating their laboratory. Consequently, co-eluting RNA can become a "contaminant" of unknown magnitude in a DNA extraction. We extracted DNA from liver, lung, kidney, and heart tissues and established that 28-52% of the "DNA" as assessed by spectrophotometry is actually RNA (depending on tissue type). Including an RNase digest in the extraction protocol reduced 260:280 purity ratios. Co-eluting RNA drives an overestimation of DNA yield when quantification is carried out using OD 260 nm spectrophotometry, or becomes an unquantified contaminant when spectrofluorometry is used for DNA quantification. This situation is potentially incompatible with the best practice guidelines for biobanks issued by organizations such as the International Society for Biological and Environmental Repositories, which state that biospecimens should be accurately characterized in terms of their identity, purity, concentration, and integrity. Consequently, we conclude that an RNase digest must be included in DNA extractions if pure DNA is required. We also discuss the implications of unquantified RNA contamination in DNA samples in the context of laboratory accreditation schemes.

  8. DNA extraction techniques compared for accurate detection of genetically modified organisms (GMOs) in maize food and feed products.

    Science.gov (United States)

    Turkec, Aydin; Kazan, Hande; Karacanli, Burçin; Lucas, Stuart J

    2015-08-01

    In this paper, DNA extraction methods have been evaluated to detect the presence of genetically modified organisms (GMOs) in maize food and feed products commercialised in Turkey. All the extraction methods tested performed well for the majority of maize foods and feed products analysed. However, the highest DNA content was achieved by the Wizard, Genespin or the CTAB method, all of which produced optimal DNA yield and purity for different maize food and feed products. The samples were then screened for the presence of GM elements, along with certified reference materials. Of the food and feed samples, 8 % tested positive for the presence of one GM element (NOS terminator), of which half (4 % of the total) also contained a second element (the Cauliflower Mosaic Virus 35S promoter). The results obtained herein clearly demonstrate the presence of GM maize in the Turkish market, and that the Foodproof GMO Screening Kit provides reliable screening of maize food and feed products.

  9. Quantification of total phosphorothioate in bacterial DNA by a bromoimane-based fluorescent method.

    Science.gov (United States)

    Xiao, Lu; Xiang, Yu

    2016-06-01

    The discovery of phosphorothioate (PT) modifications in bacterial DNA has challenged our understanding of conserved phosphodiester backbone structure of cellular DNA. This exclusive DNA modification in bacteria is not found in animal cells yet, and its biological function in bacteria is still poorly understood. Quantitative information about the bacterial PT modifications is thus important for the investigation of their possible biological functions. In this study, we have developed a simple fluorescence method for selective quantification of total PTs in bacterial DNA, based on fluorescent labeling of PTs and subsequent release of the labeled fluorophores for absolute quantification. The method was highly selective to PTs and not interfered by the presence of reactive small molecules or proteins. The quantification of PTs in an E. coli DNA sample was successfully achieved using our method and gave a result of about 455 PTs per million DNA nucleotides, while almost no detectable PTs were found in a mammalian calf thymus DNA. With this new method, the content of phosphorothioate in bacterial DNA could be successfully quantified, serving as a simple method suitable for routine use in biological phosphorothioate related studies. Copyright © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  10. Simple practical approach for sample loading prior to DNA extraction using a silica monolith in a microfluidic device.

    Science.gov (United States)

    Shaw, Kirsty J; Joyce, Domino A; Docker, Peter T; Dyer, Charlotte E; Greenman, John; Greenway, Gillian M; Haswell, Stephen J

    2009-12-07

    A novel DNA loading methodology is presented for performing DNA extraction on a microfluidic system. DNA in a chaotropic salt solution was manually loaded onto a silica monolith orthogonal to the subsequent flow of wash and elution solutions. DNA was successfully extracted from buccal swabs using electro-osmotic pumping (EOP) coupled with in situ reagents contained within a 1.5% agarose gel matrix. The extracted DNA was of sufficient quantity and purity for polymerase chain reaction (PCR) amplification.

  11. Optimization of HPV DNA detection in urine by improving collection, storage, and extraction.

    Science.gov (United States)

    Vorsters, A; Van den Bergh, J; Micalessi, I; Biesmans, S; Bogers, J; Hens, A; De Coster, I; Ieven, M; Van Damme, P

    2014-11-01

    The benefits of using urine for the detection of human papillomavirus (HPV) DNA have been evaluated in disease surveillance, epidemiological studies, and screening for cervical cancers in specific subgroups. HPV DNA testing in urine is being considered for important purposes, notably the monitoring of HPV vaccination in adolescent girls and young women who do not wish to have a vaginal examination. The need to optimize and standardize sampling, storage, and processing has been reported.In this paper, we examined the impact of a DNA-conservation buffer, the extraction method, and urine sampling on the detection of HPV DNA and human DNA in urine provided by 44 women with a cytologically normal but HPV DNA-positive cervical sample. Ten women provided first-void and midstream urine samples. DNA analysis was performed using real-time PCR to allow quantification of HPV and human DNA.The results showed that an optimized method for HPV DNA detection in urine should (a) prevent DNA degradation during extraction and storage, (b) recover cell-free HPV DNA in addition to cell-associated DNA, (c) process a sufficient volume of urine, and (d) use a first-void sample.In addition, we found that detectable human DNA in urine may not be a good internal control for sample validity. HPV prevalence data that are based on urine samples collected, stored, and/or processed under suboptimal conditions may underestimate infection rates.

  12. Noninvasive genetic sampling of endangered muriqui (Primates, Atelidae: efficiency of fecal DNA extraction

    Directory of Open Access Journals (Sweden)

    Paulo B. Chaves

    2006-01-01

    Full Text Available The muriqui (Brachyteles is one of the most endangered primates in the world, however little is known about the viability of the remaining populations. We evaluated the technique of extracting DNA from wild muriqui feces for PCR applications. In order to determine the effect of the DNA in subsequent amplifications, we analyzed five different extracts. The importance of the recommended BSA and the HotStarTaq DNA polymerase was tested. The minimal conditions to successfully amplify highly degraded fecal DNA were determined, showing that the recommended reagents are not required. We envision that this method may be useful in further conservation management studies.

  13. Ultrasound-Assisted Extraction of Total Phenolic Compounds from Inula helenium

    Directory of Open Access Journals (Sweden)

    Jin Wang

    2013-01-01

    Full Text Available Ultrasound-assisted extraction (UAE of phenolic compounds from Inula helenium was studied. Effects of ethanol concentration, ultrasonic time, solid-liquid ratio, and number of extractions were investigated. An orthogonal array was constructed to optimize UAE process. The optimized extraction conditions were as follows: ethanol concentration, 30%; solid-liquid ratio, 1 : 20; number of extractions, 2 times; extraction time, 30 min. Under the optimal conditions, the yield of total phenolic compounds and chlorogenic acid was 6.13±0.58 and 1.32±0.17 mg/g, respectively. The results showed that high amounts of phenolic compounds can be extracted from I. helenium by ultrasound-assisted extraction technology.

  14. Free radical scavenging and total antioxidant capacity of root extracts of Anchomanes difformis Engl. (Araceae).

    Science.gov (United States)

    Aliyu, Abubakar B; Ibrahim, Mohammed A; Musa, Aliyu M; Musa, Aisha O; Kiplimo, Joyce J; Oyewale, Adebayo O

    2013-01-01

    Antioxidants activities from plants sources have attracted a wide range of interest across the world in recent times. This is due to growing concern for safe and alternative sources of antioxidants. The free radical scavenging activity using 1,1-diphenyl-2-picrylhydrazyl radical (DPPH), reducing power assay, total antioxidant capacity of the phosphomolybdenum method and the total phenolics content using the Folin-Ciocalteu reagent were carried out on the acetone, n-butanol and methanol root extracts of Anchomanes difformis. The results of the total phenolics content expressed in mg/100 g of gallic acid equivalent (GAE) showed that the n-butanol extract has significantly (p extracts. All the extracts displayed strong concentration dependent radical scavenging activity. It was also observed that the n-butanol extract showed higher activity of 70.87% and 78.59% at low concentrations of 31.25 microg/mL and 62.5 microg/mL, respectively, than methanol and acetone extracts. The results also showed that the n-butanol extract has strongest reducing ability which is comparable to that of gallic acid at all the concentrations tested. Phytochemical screening on the extracts revealed the presence of flavonoids, saponins, and tannins. The results suggest that n-butanol extract of the plant is very rich in antioxidant compounds worthy of further investigations.

  15. A study of extraction process and in vitro antioxidant activity of total ...

    African Journals Online (AJOL)

    The study investigated the extraction method of Rhizoma Imperatae and its antioxidant activity, and provided a basis for its rational development. The extraction method of Rhizoma Imperatae was determined using orthogonal design test and by total phenol content, its hydroxyl radical scavenging ability was measured by ...

  16. RAPD analysis of Arabidopsis thaliana transferred with total DNA of cabbage by ion beam

    International Nuclear Information System (INIS)

    Bian Po; Yu Zengliang; Qin Guangyong; Huo Yuping; Wang Yan

    2003-01-01

    Two mutants were found among the Arabidopsis thaliana transferred with total DNA of cabbage. Variation of genome of T6 and its offspring were analyzed by RAPD-PCR with 40 random primers. The result from S168 primer was different from the CK, indicating that variation of genome can be made by total DNA transferring by use of ion beam, and this variation is hereditary. It is found that S 168-1850 is included within the gene of ABC transporter by aligning with genome of Arabidopsis thaliana in TAIT

  17. Comparison of DNA extraction methods for human gut microbial community profiling.

    Science.gov (United States)

    Lim, Mi Young; Song, Eun-Ji; Kim, Sang Ho; Lee, Jangwon; Nam, Young-Do

    2018-03-01

    The human gut harbors a vast range of microbes that have significant impact on health and disease. Therefore, gut microbiome profiling holds promise for use in early diagnosis and precision medicine development. Accurate profiling of the highly complex gut microbiome requires DNA extraction methods that provide sufficient coverage of the original community as well as adequate quality and quantity. We tested nine different DNA extraction methods using three commercial kits (TianLong Stool DNA/RNA Extraction Kit (TS), QIAamp DNA Stool Mini Kit (QS), and QIAamp PowerFecal DNA Kit (QP)) with or without additional bead-beating step using manual or automated methods and compared them in terms of DNA extraction ability from human fecal sample. All methods produced DNA in sufficient concentration and quality for use in sequencing, and the samples were clustered according to the DNA extraction method. Inclusion of bead-beating step especially resulted in higher degrees of microbial diversity and had the greatest effect on gut microbiome composition. Among the samples subjected to bead-beating method, TS kit samples were more similar to QP kit samples than QS kit samples. Our results emphasize the importance of mechanical disruption step for a more comprehensive profiling of the human gut microbiome. Copyright © 2017 The Authors. Published by Elsevier GmbH.. All rights reserved.

  18. DNA extraction methods for detecting genetically modified foods: A comparative study.

    Science.gov (United States)

    Elsanhoty, Rafaat M; Ramadan, Mohamed Fawzy; Jany, Klaus Dieter

    2011-06-15

    The work presented in this manuscript was achieved to compare six different methods for extracting DNA from raw maize and its derived products. The methods that gave higher yield and quality of DNA were chosen to detect the genetic modification in the samples collected from the Egyptian market. The different methods used were evaluated for extracting DNA from maize kernels (without treatment), maize flour (mechanical treatment), canned maize (sweet corn), frozen maize (sweet corn), maize starch, extruded maize, popcorn, corn flacks, maize snacks, and bread made from corn flour (mechanical and thermal treatments). The quality and quantity of the DNA extracted from the standards, containing known percentages of GMO material and from the different food products were evaluated. For qualitative detection of the GMO varieties in foods, the GMOScreen 35S/NOS test kit was used, to screen the genetic modification in the samples. The positive samples for the 35S promoter and/or the NOS terminator were identified by the standard methods adopted by EU. All of the used methods extracted yielded good DNA quality. However, we noted that the purest DNA extract were obtained using the DNA extraction kit (Roche) and this generally was the best method for extracting DNA from most of the maize-derived foods. We have noted that the yield of DNA extracted from maize-derived foods was generally lower in the processed products. The results indicated that 17 samples were positive for the presence of 35S promoter, while 34% from the samples were positive for the genetically modified maize line Bt-176. Copyright © 2010 Elsevier Ltd. All rights reserved.

  19. Evaluation and optimization of DNA extraction and purification procedures for soil and sediment samples.

    Science.gov (United States)

    Miller, D N; Bryant, J E; Madsen, E L; Ghiorse, W C

    1999-11-01

    We compared and statistically evaluated the effectiveness of nine DNA extraction procedures by using frozen and dried samples of two silt loam soils and a silt loam wetland sediment with different organic matter contents. The effects of different chemical extractants (sodium dodecyl sulfate [SDS], chloroform, phenol, Chelex 100, and guanadinium isothiocyanate), different physical disruption methods (bead mill homogenization and freeze-thaw lysis), and lysozyme digestion were evaluated based on the yield and molecular size of the recovered DNA. Pairwise comparisons of the nine extraction procedures revealed that bead mill homogenization with SDS combined with either chloroform or phenol optimized both the amount of DNA extracted and the molecular size of the DNA (maximum size, 16 to 20 kb). Neither lysozyme digestion before SDS treatment nor guanidine isothiocyanate treatment nor addition of Chelex 100 resin improved the DNA yields. Bead mill homogenization in a lysis mixture containing chloroform, SDS, NaCl, and phosphate-Tris buffer (pH 8) was found to be the best physical lysis technique when DNA yield and cell lysis efficiency were used as criteria. The bead mill homogenization conditions were also optimized for speed and duration with two different homogenizers. Recovery of high-molecular-weight DNA was greatest when we used lower speeds and shorter times (30 to 120 s). We evaluated four different DNA purification methods (silica-based DNA binding, agarose gel electrophoresis, ammonium acetate precipitation, and Sephadex G-200 gel filtration) for DNA recovery and removal of PCR inhibitors from crude extracts. Sephadex G-200 spin column purification was found to be the best method for removing PCR-inhibiting substances while minimizing DNA loss during purification. Our results indicate that for these types of samples, optimum DNA recovery requires brief, low-speed bead mill homogenization in the presence of a phosphate-buffered SDS-chloroform mixture, followed

  20. Evaluation and comparison of FTA card and CTAB DNA extraction methods for non-agricultural taxa.

    Science.gov (United States)

    Siegel, Chloe S; Stevenson, Florence O; Zimmer, Elizabeth A

    2017-02-01

    An efficient, effective DNA extraction method is necessary for comprehensive analysis of plant genomes. This study analyzed the quality of DNA obtained using paper FTA cards prepared directly in the field when compared to the more traditional cetyltrimethylammonium bromide (CTAB)-based extraction methods from silica-dried samples. DNA was extracted using FTA cards according to the manufacturer's protocol. In parallel, CTAB-based extractions were done using the automated AutoGen DNA isolation system. DNA quality for both methods was determined for 15 non-agricultural species collected in situ, by gel separation, spectrophotometry, fluorometry, and successful amplification and sequencing of nuclear and chloroplast gene markers. The FTA card extraction method yielded less concentrated, but also less fragmented samples than the CTAB-based technique. The card-extracted samples provided DNA that could be successfully amplified and sequenced. The FTA cards are also useful because the collected samples do not require refrigeration, extensive laboratory expertise, or as many hazardous chemicals as extractions using the CTAB-based technique. The relative success of the FTA card method in our study suggested that this method could be a valuable tool for studies in plant population genetics and conservation biology that may involve screening of hundreds of individual plants. The FTA cards, like the silica gel samples, do not contain plant material capable of propagation, and therefore do not require permits from the U.S. Department of Agriculture (USDA) Animal and Plant Health Inspection Service (APHIS) for transportation.

  1. Identifikasi bite marks dengan ekstraksi DNA metode Chelex (Bite marks identification with Chelex methods in DNA extraction

    Directory of Open Access Journals (Sweden)

    Imelda Kristina Sutrisno

    2013-06-01

    Full Text Available Background: In the case of crime often encountered evidence in bite marks form that was found on the victim’s body. Generally, bitemarks identification use standard techniques that compare the interpretation picture with the tooth model of suspected person. However, sometimes the techniques do not obtain accurate results. Therefore another technique is needed to support the identification process,such as DNA analysis that use the remaining epithelium attached in saliva to identify the DNA of the suspected person. In this processes a limited DNA material could be met, not only less in quantity but also less in quality. Chelex known as one of an effective DNA extraction method in DNA forensic case is needed to overcome this problem. Purpose: The study was aimed to examine the use of Chelex as DNA extraction method on a bitemarks sample models. Methods: The blood and bitemarks of 5 persons with were taken. The DNA of each subject was exctracted with Chelex and quantified the quantity with UV Spechtrophotometer. The DNA results was amplified by PCR at locus vWA and TH01 then vizualised by electrophoresis. Results: The electrophoresis’s results showed band at locus vWA and TH01 for blood sample and bite marks with no significant differences. Conclusion: The study showed that Chelex method could be use to extract DNA from bitemarks.Latar belakang: Dalam kasus kejahatan sering dijumpai bukti dalam bentuk bekas gigitan (bitemarks yang ditemukan pada tubuh korban. Umumnya, untuk mengidentifikasi bite marks menggunakan teknik standar yaitu membandingkan foto interpretasi dengan model gigi dari orang yang dicurigai. Namun demikian teknik ini terkadang tidak mendapatkan hasil yang akurat, sehingga diperlukan teknik lain untuk menunjang keberhasilan proses identifikasi pelaku, yakni melalui analisis DNA bitemarks, yang diperoleh dari saliva yang mengandung sisa epitel tersangka pelaku. Sampel DNA yang berasal dari bitemarks umumnya terbatas, tidak hanya

  2. Back to Basics – The Influence of DNA Extraction and Primer Choice on Phylogenetic Analysis of Activated Sludge Communities

    DEFF Research Database (Denmark)

    Albertsen, Mads; Karst, Søren Michael; Ziegler, Anja Sloth

    2015-01-01

    the impact of a number of parameters on the observed microbial community: bead beating intensity, primer choice, extracellular DNA removal, and various PCR settings. In total, 176 samples were subjected to 16S rRNA amplicon sequencing, and selected samples were investigated throughmetagenomics...... and metatranscriptomics. Quantitative fluorescence in situ hybridization was used as a DNA extraction-independent method for qualitative comparison. In general, an effect on the observed community was found on all parameters tested, although bead beating and primer choice had the largest effect. The effect of bead...

  3. TOTAL PHENOLIC CONTENT, ANTIOXIDANT AND ANTIBACTERIAL ACTIVITIES OF THE EXTRACT OF EPHEDRA PROCERA FISCH. ET MEY.

    Science.gov (United States)

    Dehkordi, Naser Vahed; Kachouie, Mehrdad Ataie; Pirbalouti, Abdollah Ghasemi; Malekpoor, Fatemeh; Rabei, Mohammad

    2015-01-01

    Ephedra prcera belonging to the family Ephedraceae is a poison and medicinal plant. The main aim of present study was to determine total phenolic content and antioxidant and antibacterial activities of ethanolic extract from the aerial parts of E. procera collected from a natural habitat in Chaharmahal va Bakhtiari province, Southwestern Iran. The total phenolic content of the extract by Folin-Ciocalteu method and the antioxidant activity using DPPH assay were determined. The antibacterial activity, minimum inhibitory concentration (MIC), and minimum bactericidal concentration (MBC) of the extract were evaluated against five bacteria, including Proteus vulgaris, Pseudomonas aeruginosa, Enteobacter aeogenes, Bacillus ceirus and Staphylococcus aureus. Total phenolic content in the extract of E. procera was 0.718 mg tannic acid/g dry weight extract. The results indicated that the ethanolic extract of E. piocera exhibited radical scavenging activity. In addition, the results of this study confirmed that the ethanolic extract of E. procera exhibited antibacterial activity. In conclusion, the extract of E. piocera could be an important source of phenolic components with antioxidant capacity and antibacterial activity.

  4. Antioxidant and DNA damage protective properties of anthocyanin-rich extracts from Hibiscus and Ocimum: a comparative study.

    Science.gov (United States)

    Sarkar, Biswatrish; Kumar, Dhananjay; Sasmal, Dinakar; Mukhopadhyay, Kunal

    2014-01-01

    Anthocyanin extracts (AEs) from Ocimum tenuiflorum (leaf), Hibiscus rosa-sinensis (petal) and Hibiscus sabdariffa (calyx) were investigated and compared for in vitro antioxidant activity and DNA damage protective property. Total phenolic content (TPC) and total anthocyanin content (TAC) of the AEs were determined and the major anthocyanins were characterised. In vitro antioxidant activities were assessed by ferric-reducing antioxidant power (FRAP) assay, 2,2-diphenyl-1-picryl hydrazyl (DPPH) radical-scavenging activity, 2-deoxy-D-ribose degradation assay and lipid peroxidation assay. The protective property of the AEs was also examined against oxidative DNA damage by H2O2 and UV using pUC19 plasmid. All the AEs particularly those from O. tenuiflorum demonstrated efficient antioxidant activity and protected DNA from damage. Strong correlation between antioxidant capacity and TPC and TAC was observed. Significant correlation between antioxidant capacity and TPC and TAC ascertained that phenolics and anthocyanins were the major contributors of antioxidant activity.

  5. Rapid and efficient extraction of genomic DNA from different phytopathogenic fungi using DNAzol reagent.

    Science.gov (United States)

    Guo, Jian-Rong; Schnieder, F; Abd-Elsalam, K A; Verreet, J A

    2005-01-01

    A modified procedure using the commercial DNAzol reagent was successfully applied to extract genomic DNA from 25 fungal species. The DNA yield varied from 306 to 1,927 microg g(-1) dry mycelia and the A(260)/A(280) ratio from 1.59 to 1.93. Compared with the method of J.L. Cenis (Nucleic Acids Res. 1992, 20: 2380) this procedure generated a higher DNA yield from 17 species and a higher A(260)/A(280) ratio from 23 species. But for four species, Cenis (1992) method was more suitable. No inhibitor of polymerase chain reaction was evident for the DNA extracted by the modified procedure, whereas some inhibitors remained in DNA of eight species extracted by the previous method.

  6. The use of carrier RNA to enhance DNA extraction from microfluidic-based silica monoliths.

    Science.gov (United States)

    Shaw, Kirsty J; Thain, Lauren; Docker, Peter T; Dyer, Charlotte E; Greenman, John; Greenway, Gillian M; Haswell, Stephen J

    2009-10-12

    DNA extraction was carried out on silica-based monoliths within a microfluidic device. Solid-phase DNA extraction methodology was applied in which the DNA binds to silica in the presence of a chaotropic salt, such as guanidine hydrochloride, and is eluted in a low ionic strength solution, such as water. The addition of poly-A carrier RNA to the chaotropic salt solution resulted in a marked increase in the effective amount of DNA that could be recovered (25ng) compared to the absence of RNA (5ng) using the silica-based monolith. These findings confirm that techniques utilising nucleic acid carrier molecules can enhance DNA extraction methodologies in microfluidic applications.

  7. A rapid mini-prep DNA extraction method in rice (Oryza sativa)

    African Journals Online (AJOL)

    STORAGESEVER

    2009-01-19

    Jan 19, 2009 ... homogenizer with a plastic tip is incomplete, since the leaves of these plants .... mortar and pestle with liquid nitrogen and transferred to a tube. ... rapid DNA extraction protocols for gymnosperms for application in population ...

  8. [DNA Extraction from Old Bones by AutoMate Express™ System].

    Science.gov (United States)

    Li, B; Lü, Z

    2017-08-01

    To establish a method for extracting DNA from old bones by AutoMate Express™ system. Bones were grinded into powder by freeze-mill. After extraction by AutoMate Express™, DNA were amplified and genotyped by Identifiler®Plus and MinFiler™ kits. DNA were extracted from 10 old bone samples, which kept in different environments with the postmortem interval from 10 to 20 years, in 3 hours by AutoMate Express™ system. Complete STR typing results were obtained from 8 samples. AutoMate Express™ system can quickly and efficiently extract DNA from old bones, which can be applied in forensic practice. Copyright© by the Editorial Department of Journal of Forensic Medicine

  9. Comparison of nine DNA extraction methods for the diagnosis of bovine tuberculosis by real time PCR

    Directory of Open Access Journals (Sweden)

    André Moura

    2016-07-01

    Full Text Available ABSTRACT: Bovine tuberculosis is an infectious disease with a high impact on the cattle industry, particularly in developing countries. PCR is a very sensitive method for detection of infectious agents, but the sensitivity of molecular diagnosis is largely dependent on the efficiency of the DNA extraction methods. The objective of this study was to evaluate DNA extraction methods for direct detection of Mycobacterium bovis in bovine tissue. Nine commercial kits for DNA extraction were evaluated when combined with two real time PCRs. The DNeasy Blood & Tissue Kit from QIAGEN showed better performance and sensitivity followed by the DNA Mini Kit RBC and FTA Elute Micro Card. Results suggested that, even when the analytical sensitivity of the qPCR is very high, the extraction method can influence the diagnostic sensitivity.

  10. Integrated and Total HIV-1 DNA Predict Ex Vivo Viral Outgrowth.

    Directory of Open Access Journals (Sweden)

    Maja Kiselinova

    2016-03-01

    Full Text Available The persistence of a reservoir of latently infected CD4 T cells remains one of the major obstacles to cure HIV. Numerous strategies are being explored to eliminate this reservoir. To translate these efforts into clinical trials, there is a strong need for validated biomarkers that can monitor the reservoir over time in vivo. A comprehensive study was designed to evaluate and compare potential HIV-1 reservoir biomarkers. A cohort of 25 patients, treated with suppressive antiretroviral therapy was sampled at three time points, with median of 2.5 years (IQR: 2.4-2.6 between time point 1 and 2; and median of 31 days (IQR: 28-36 between time point 2 and 3. Patients were median of 6 years (IQR: 3-12 on ART, and plasma viral load (<50 copies/ml was suppressed for median of 4 years (IQR: 2-8. Total HIV-1 DNA, unspliced (us and multiply spliced HIV-1 RNA, and 2LTR circles were quantified by digital PCR in peripheral blood, at 3 time points. At the second time point, a viral outgrowth assay (VOA was performed, and integrated HIV-1 DNA and relative mRNA expression levels of HIV-1 restriction factors were quantified. No significant change was found for long- and short-term dynamics of all HIV-1 markers tested in peripheral blood. Integrated HIV-1 DNA was associated with total HIV-1 DNA (p<0.001, R² = 0.85, us HIV-1 RNA (p = 0.029, R² = 0.40, and VOA (p = 0.041, R2 = 0.44. Replication-competent virus was detected in 80% of patients by the VOA and it correlated with total HIV-1 DNA (p = 0.039, R² = 0.54. The mean quantification difference between Alu-PCR and VOA was 2.88 log10, and 2.23 log10 between total HIV-1 DNA and VOA. The levels of usHIV-1 RNA were inversely correlated with mRNA levels of several HIV-1 restriction factors (TRIM5α, SAMHD1, MX2, SLFN11, pSIP1. Our study reveals important correlations between the viral outgrowth and total and integrated HIV-1 DNA measures, suggesting that the total pool of HIV-1 DNA may predict the size of the

  11. A study of extraction process and in vitro antioxidant activity of total phenols from Rhizoma Imperatae.

    Science.gov (United States)

    Zhou, Xian-rong; Wang, Jian-hua; Jiang, Bo; Shang, Jin; Zhao, Chang-qiong

    2013-01-01

    The study investigated the extraction method of Rhizoma Imperatae and its antioxidant activity, and provided a basis for its rational development. The extraction method of Rhizoma Imperatae was determined using orthogonal design test and by total phenol content, its hydroxyl radical scavenging ability was measured by Fenton reaction, and potassium ferricyanide reduction method was used to determine its reducing power. The results showed that the optimum extraction process of Rhizoma Imperatae was a 50-fold volume of water, 30 °C, three times of extraction with 2 h each. Its IC50 for scavenging of hydroxyl radicals was 0.0948 mg/mL, while IC50 of ascorbic acid was 0.1096 mg/mL; in the ferricyanide considerable reduction method, the extract exhibited reducing power comparable to that of the ascorbic acid. The study concluded that Rhizoma Imperatae extract contains relatively large amount of polyphenols, and has a good anti-oxidation ability.

  12. Chemical Composition of the Essential Oil, Total Phenolics, Total Flavonoids and Antioxidant Activity of Methanolic Extracts of Satureja montana L.

    Directory of Open Access Journals (Sweden)

    Avni Hajdari

    2016-05-01

    Full Text Available Aerial parts of Satureja montana L. (Lamiaceae were collected from seven growing wild populations (four populations in Kosovo, two in Albania and one in Montenegro in 2013 with the aim of assessing the natural variation in the chemical composition of the essential oils, total flavonoids, total phenolics and the antioxidant activity of their methanolic extracts. Essential oils were obtained by steam distillation and analysed using GC-FID and GC-MS, whereas total flavonoids, total phenolics and antioxidant activities were determined using spectrophotometric methods. Sixty-one volatile constituents were identified. The main constituents were myrcene, p-cymene, γ-terpinene, linalool, thymol, carvacrol and viridiflorol. Total phenolics ranged from 68.1 to 102.6 mg/g dry mass, the total flavonoid content ranged from 38.3 to 67.0 mg/g dm, and the antioxidant activity according to the DPPH assay ranged from 253.3 to 342.9 mg TE/g dm and according to the FRAP assay ranged from 8.9 to 11.4 mg TE/g dm. Hierarchical cluster analysis and principal component analyses were used to assess the geographical variations in the essential oil composition. Statistical analysis revealed that the analysed populations are grouped into four main clusters that appear to reflect the environmental impact on the chemical composition, which is influenced by differences in habitat composition, altitude and microclimatic conditions.

  13. Optimization of supercritical carbon dioxide extraction of Piper Betel Linn leaves oil and total phenolic content

    Science.gov (United States)

    Aziz, A. H. A.; Yunus, M. A. C.; Arsad, N. H.; Lee, N. Y.; Idham, Z.; Razak, A. Q. A.

    2016-11-01

    Supercritical Carbon Dioxide (SC-CO2) Extraction was applied to extract piper betel linn leaves. The piper betel leaves oil was used antioxidant, anti-diabetic, anticancer and antistroke. The aim of this study was to optimize the conditions of pressure, temperature and flowrate for oil yield and total phenolic content. The operational conditions of SC-CO2 studied were pressure (10, 20, 30 MPa), temperature (40, 60, 80 °C) and flowrate carbon dioxide (4, 6, 8 mL/min). The constant parameters were average particle size and extraction regime, 355pm and 3.5 hours respectively. First order polynomial expression was used to express the extracted oil while second order polynomial expression was used to express the total phenolic content and the both results were satisfactory. The best conditions to maximize the total extraction oil yields and total phenolic content were 30 MPa, 80 °C and 4.42 mL/min leading to 7.32% of oil and 29.72 MPa, 67.53 °C and 7.98 mL/min leading to 845.085 mg GAE/g sample. In terms of optimum condition with high extraction yield and high total phenolic content in the extracts, the best operating conditions were 30 MPa, 78 °C and 8 mL/min with 7.05% yield and 791.709 mg gallic acid equivalent (GAE)/g sample. The most dominant condition for extraction of oil yield and phenolic content were pressure and CO2 flowrate. The results show a good fit to the proposed model and the optimal conditions obtained were within the experimental range with the value of R2 was 96.13% for percentage yield and 98.52% for total phenolic content.

  14. Universal and rapid salt-extraction of high quality genomic DNA for PCR-based techniques.

    OpenAIRE

    Aljanabi, S M; Martinez, I

    1997-01-01

    A very simple, fast, universally applicable and reproducible method to extract high quality megabase genomic DNA from different organisms is described. We applied the same method to extract high quality complex genomic DNA from different tissues (wheat, barley, potato, beans, pear and almond leaves as well as fungi, insects and shrimps' fresh tissue) without any modification. The method does not require expensive and environmentally hazardous reagents and equipment. It can be performed even i...

  15. Strategy for the extraction of yeast DNA from artisan agave must for quantitative PCR analysis.

    Science.gov (United States)

    Kirchmayr, Manuel Reinhart; Segura-Garcia, Luis Eduardo; Flores-Berrios, Ericka Patricia; Gschaedler, Anne

    2011-11-01

    An efficient method for the direct extraction of yeast genomic DNA from agave must was developed. The optimized protocol, which was based on silica-adsorption of DNA on microcolumns, included an enzymatic cell wall degradation step followed by prolonged lysis with hot detergent. The resulting extracts were suitable templates for subsequent qPCR assays that quantified mixed yeast populations in artisan Mexican mezcal fermentations. Copyright © 2011 The Society for Biotechnology, Japan. Published by Elsevier B.V. All rights reserved.

  16. A rapid and efficient DNA extraction protocol from fresh and frozen human blood samples.

    Science.gov (United States)

    Guha, Pokhraj; Das, Avishek; Dutta, Somit; Chaudhuri, Tapas Kumar

    2018-01-01

    Different methods available for extraction of human genomic DNA suffer from one or more drawbacks including low yield, compromised quality, cost, time consumption, use of toxic organic solvents, and many more. Herein, we aimed to develop a method to extract DNA from 500 μL of fresh or frozen human blood. Five hundred microliters of fresh and frozen human blood samples were used for standardization of the extraction procedure. Absorbance at 260 and 280 nm, respectively, (A 260 /A 280 ) were estimated to check the quality and quantity of the extracted DNA sample. Qualitative assessment of the extracted DNA was checked by Polymerase Chain reaction and double digestion of the DNA sample. Our protocol resulted in average yield of 22±2.97 μg and 20.5±3.97 μg from 500 μL of fresh and frozen blood, respectively, which were comparable to many reference protocols and kits. Besides yielding bulk amount of DNA, our protocol is rapid, economical, and avoids toxic organic solvents such as Phenol. Due to unaffected quality, the DNA is suitable for downstream applications. The protocol may also be useful for pursuing basic molecular researches in laboratories having limited funds. © 2017 Wiley Periodicals, Inc.

  17. Determination of total triterpenoid acids in different part and extract of Ganoderma lucidum

    Directory of Open Access Journals (Sweden)

    FENG Huiqin

    2013-04-01

    Full Text Available Aim To develop a method for determination of total triterpenoid acids in different part and extracts of Ganoderma lucidum. Method The samples of Ganoderma lucidum were extracted with ethanol and successively extracted with CHCl3 and 5% NaHCO3,the NaHCO3 layer was acidified to pH 3 with 2 mol/L HCl,the resulting precipitates were dissolved in CHCl3 and evaporated in vacuo then weighed. The total triterpenoid acids were obtained. Result The total triterpenoid acids of Ganoderma lucidum fruitbody,spore and mycelium were (8.58±0.25 mg/g,(3.48±0.03 mg/g and (1.75 ±0.09 mg/g respectively. The total triterpenoid acids of pileus and stipe were (12.62±0.22 mg/g and (7.66±0.08 mg/g. The range of total triterpenoid acid content among 10 batches of Ganoderma lucidum fruitbody purchased from the market was between 4.34 to 16.39 mg/g. The highest content fro/8/8/88/ m Ganoderma lucidum fruiting body with alcohol - water extracting was (208.70±5.54 mg/g and the lowest content with alkaline solution extracting was (123.07±4.99 mg/g. The composition of total triterpenoid acid from fruitbody,spores and extract of fruitbody analyzed by HPLC were almost the same. This method is reliable for determination of total triterpenoid acid in the fruiting body and its extracts,spore and mycelium from Ganoderma lucidum,which provides an indicator for the quality of Ganoderma lucidum product.

  18. Comparison of seven DNA extraction and ampliffication protocols in historical herbarium specimens of Juncaceae

    Czech Academy of Sciences Publication Activity Database

    Drábková, Lenka; Kirschner, Jan; Vlček, Čestmír

    2002-01-01

    Roč. 20, - (2002), s. 161-175 ISSN 0735-9640 R&D Projects: GA MŠk LN00A079; GA ČR GA206/02/0355 Institutional research plan: CEZ:AV0Z6005908 Keywords : cpDNA * DNA extraction * herbarium specimens Subject RIV: EF - Botanics Impact factor: 0.803, year: 2002

  19. Simplified extraction of good quality genomic DNA from a variety of ...

    African Journals Online (AJOL)

    Depending on the nature and complexity of plant material, proper method needs to be employed for extraction of genomic DNA, along with its performance evaluation by different molecular techniques. Here, we optimized and employed a simple genomic DNA isolation protocol suitable for a variety of plant materials ...

  20. Evaluating the efficacy of DNA differential extraction methods for sexual assault evidence.

    Science.gov (United States)

    Klein, Sonja B; Buoncristiani, Martin R

    2017-07-01

    Analysis of sexual assault evidence, often a mixture of spermatozoa and victim epithelial cells, represents a significant portion of a forensic DNA laboratory's case load. Successful genotyping of sperm DNA from these mixed cell samples, particularly with low amounts of sperm, depends on maximizing sperm DNA recovery and minimizing non-sperm DNA carryover. For evaluating the efficacy of the differential extraction, we present a method which uses a Separation Potential Ratio (SPRED) to consider both sperm DNA recovery and non-sperm DNA removal as variables for determining separation efficiency. In addition, we describe how the ratio of male-to-female DNA in the sperm fraction may be estimated by using the SPRED of the differential extraction method in conjunction with the estimated ratio of male-to-female DNA initially present on the mixed swab. This approach may be useful for evaluating or modifying differential extraction methods, as we demonstrate by comparing experimental results obtained from the traditional differential extraction and the Erase Sperm Isolation Kit (PTC © ) procedures. Copyright © 2017 Elsevier B.V. All rights reserved.

  1. [Application of DNA extraction kit, 'GM quicker' for detection of genetically modified soybeans].

    Science.gov (United States)

    Sato, Noriko; Sugiura, Yoshitsugu; Tanaka, Toshitsugu

    2012-01-01

    Several DNA extraction methods have been officially introduced to detect genetically modified soybeans, but the choice of DNA extraction kits depend on the nature of the samples, such as grains or processed foods. To overcome this disadvantage, we examined whether the GM quicker kit is available for both grains and processed foods. We compared GM quicker with four approved DNA extraction kits in respect of DNA purity, copy numbers of lectin gene, and working time. We found that the DNA quality of GM quicker was superior to that of the other kits for grains, and the procedure was faster. However, in the case of processed foods, GM quicker was not superior to the other kits. We therefore investigated an unapproved GM quicker 3 kit, which is available for DNA extraction from processed foods, such as tofu and boiled soybeans. The GM quicker 3 kit provided good DNA quality from both grains and processed foods, so we made a minor modification of the GM quicker-based protocol that was suitable for processed foods, using GM quicker and its reagents. The modified method enhanced the performance of GM quicker with processed foods. We believe that GM quicker with the modified protocol is an excellent tool to obtain high-quality DNA from grains and processed foods for detection of genetically modified soybeans.

  2. Modified DNA extraction for rapid PCR detection of methicillin-resistant staphylococci

    International Nuclear Information System (INIS)

    Japoni, A.; Alborzi, A.; Rasouli, M.; Pourabbas, B.

    2004-01-01

    Nosocomial infection caused by methicillin-resistant staphylococci poses a serious problem in many countries. The aim of this study was to rapidly and reliably detect methicillin-resistant-staphylococci in order to suggest appropriate therapy. The presence or absence of the methicillin-resistance gene in 115 clinical isolates of staphylococcus aureus and 50 isolates of coagulase negative staphylococci was examined by normal PCR. DNA extraction for PCR performance was then modified by omission of achromopeptadiase and proteinase K digestion, phenol/chloroform extraction and ethanol precipitation. All isolates with Mic>8 μ g/ml showed positive PCR. No differences in PCR detection have been observed when normal and modified DNA extractions have been performed. Our modified DNA extraction can quickly detect methicillin-resistant staphylococci by PCR. The advantage of rapid DNA extraction extends to both reduction of time and cost of PCR performance. This modified DNA extraction is suitable for different PCR detection, when staphylococci are the subject of DNA analysis

  3. How to open the treasure chest? Optimising DNA extraction from herbarium specimens.

    Science.gov (United States)

    Särkinen, Tiina; Staats, Martijn; Richardson, James E; Cowan, Robyn S; Bakker, Freek T

    2012-01-01

    Herbarium collections are potentially an enormous resource for DNA studies, but the use of herbarium specimens in molecular studies has thus far been slowed down by difficulty in obtaining amplifiable DNA. Here we compare a set of commercially available DNA extraction protocols and their performance in terms of DNA purity and yield, and PCR amplification success as measured by using three differentially sized markers, the rbcL barcoding marker (cpDNA), the LEAFY exon 3 (nrDNA), and the trnL((UAA)) P6 loop (cpDNA). Results reveal large differences between extraction methods, where DNA purity rather than yield is shown to be strongly correlated with PCR success. Amplicon size shows similarly strong correlation with PCR success, with the shortest fragment showing the highest success rate (78%, P6 loop, 10-143 base pairs (bp)) and the largest fragment the lowest success (10%, rbcL, 670 bp). The effect of specimen preparation method on PCR success was also tested. Results show that drying method strongly affects PCR success, especially the availability of fragments longer than 250 bp, where longer fragments are more available for PCR amplification in air dried material compared to alcohol dried specimens. Results from our study indicate that projects relying on poor-quality starting material such as herbarium or scat samples should focus on extracting pure DNA and aim to amplify short target regions (herbarium samples available into barcoding initiatives and other molecular studies.

  4. Effect of DNA extraction and sample preservation method on rumen bacterial population.

    Science.gov (United States)

    Fliegerova, Katerina; Tapio, Ilma; Bonin, Aurelie; Mrazek, Jakub; Callegari, Maria Luisa; Bani, Paolo; Bayat, Alireza; Vilkki, Johanna; Kopečný, Jan; Shingfield, Kevin J; Boyer, Frederic; Coissac, Eric; Taberlet, Pierre; Wallace, R John

    2014-10-01

    The comparison of the bacterial profile of intracellular (iDNA) and extracellular DNA (eDNA) isolated from cow rumen content stored under different conditions was conducted. The influence of rumen fluid treatment (cheesecloth squeezed, centrifuged, filtered), storage temperature (RT, -80 °C) and cryoprotectants (PBS-glycerol, ethanol) on quality and quantity parameters of extracted DNA was evaluated by bacterial DGGE analysis, real-time PCR quantification and metabarcoding approach using high-throughput sequencing. Samples clustered according to the type of extracted DNA due to considerable differences between iDNA and eDNA bacterial profiles, while storage temperature and cryoprotectants additives had little effect on sample clustering. The numbers of Firmicutes and Bacteroidetes were lower (P rumen fluid subjected to the eDNA isolation procedure considerably changed the ratio of molecular operational taxonomic units (MOTUs) of Bacteroidetes and Firmicutes. Intracellular DNA extraction using bead-beating method from cheesecloth sieved rumen content mixed with PBS-glycerol and stored at -80 °C was found as the optimal method to study ruminal bacterial profile. Copyright © 2013 Elsevier Ltd. All rights reserved.

  5. Optimization of DNA extraction for RAPD and ISSR analysis of Arbutus unedo L. Leaves.

    Science.gov (United States)

    Sá, Olga; Pereira, José Alberto; Baptista, Paula

    2011-01-01

    Genetic analysis of plants relies on high yields of pure DNA. For the strawberry tree (Arbutus unedo) this represents a great challenge since leaves can accumulate large amounts of polysaccharides, polyphenols and secondary metabolites, which co-purify with DNA. For this specie, standard protocols do not produce efficient yields of high-quality amplifiable DNA. Here, we present for the first time an improved leaf-tissue protocol, based on the standard cetyl trimethyl ammonium bromide protocol, which yields large amounts of high-quality amplifiable DNA. Key steps in the optimized protocol are the addition of antioxidant compounds-namely polyvinyl pyrrolidone (PVP), 1,4-dithiothreitol (DTT) and 2-mercaptoethanol, in the extraction buffer; the increasing of CTAB (3%, w/v) and sodium chloride (2M) concentration; and an extraction with organic solvents (phenol and chloroform) with the incubation of samples on ice. Increasing the temperature for cell lyses to 70 °C also improved both DNA quality and yield. The yield of DNA extracted was 200.0 ± 78.0 μg/μL and the purity, evaluated by the ratio A(260)/A(280), was 1.80 ± 0.021, indicative of minimal levels of contaminating metabolites. The quality of the DNA isolated was confirmed by random amplification polymorphism DNA and by inter-simple sequence repeat amplification, proving that the DNA can be amplified via PCR.

  6. Optimization of DNA Extraction for RAPD and ISSR Analysis of Arbutus unedo L. Leaves

    Directory of Open Access Journals (Sweden)

    Paula Baptista

    2011-06-01

    Full Text Available Genetic analysis of plants relies on high yields of pure DNA. For the strawberry tree (Arbutus unedo this represents a great challenge since leaves can accumulate large amounts of polysaccharides, polyphenols and secondary metabolites, which co-purify with DNA. For this specie, standard protocols do not produce efficient yields of high-quality amplifiable DNA. Here, we present for the first time an improved leaf-tissue protocol, based on the standard cetyl trimethyl ammonium bromide protocol, which yields large amounts of high-quality amplifiable DNA. Key steps in the optimized protocol are the addition of antioxidant compounds—namely polyvinyl pyrrolidone (PVP, 1,4-dithiothreitol (DTT and 2-mercaptoethanol, in the extraction buffer; the increasing of CTAB (3%, w/v and sodium chloride (2M concentration; and an extraction with organic solvents (phenol and chloroform with the incubation of samples on ice. Increasing the temperature for cell lyses to 70 °C also improved both DNA quality and yield. The yield of DNA extracted was 200.0 ± 78.0 µg/µL and the purity, evaluated by the ratio A260/A280, was 1.80 ± 0.021, indicative of minimal levels of contaminating metabolites. The quality of the DNA isolated was confirmed by random amplification polymorphism DNA and by inter-simple sequence repeat amplification, proving that the DNA can be amplified via PCR.

  7. The validation of forensic DNA extraction systems to utilize soil contaminated biological evidence.

    Science.gov (United States)

    Kasu, Mohaimin; Shires, Karen

    2015-07-01

    The production of full DNA profiles from biological evidence found in soil has a high failure rate due largely to the inhibitory substance humic acid (HA). Abundant in various natural soils, HA co-extracts with DNA during extraction and inhibits DNA profiling by binding to the molecular components of the genotyping assay. To successfully utilize traces of soil contaminated evidence, such as that found at many murder and rape crime scenes in South Africa, a reliable HA removal extraction system would often be selected based on previous validation studies. However, for many standard forensic DNA extraction systems, peer-reviewed publications detailing the efficacy on soil evidence is either lacking or is incomplete. Consequently, these sample types are often not collected or fail to yield suitable DNA material due to the use of unsuitable methodology. The aim of this study was to validate the common forensic DNA collection and extraction systems used in South Africa, namely DNA IQ, FTA elute and Nucleosave for processing blood and saliva contaminated with HA. A forensic appropriate volume of biological evidence was spiked with HA (0, 0.5, 1.5 and 2.5 mg/ml) and processed through each extraction protocol for the evaluation of HA removal using QPCR and STR-genotyping. The DNA IQ magnetic bead system effectively removed HA from highly contaminated blood and saliva, and generated consistently acceptable STR profiles from both artificially spiked samples and crude soil samples. This system is highly recommended for use on soil-contaminated evidence over the cellulose card-based systems currently being preferentially used for DNA sample collection. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.

  8. Comparison of Three Different DNA Extraction Methods for Linguatula serrata as a Food Born Pathogen

    Directory of Open Access Journals (Sweden)

    Gilda ESLAMI

    2017-06-01

    Full Text Available Background: One of the most important items in molecular characterization of food-borne pathogens is high quality genomic DNA. In this study, we investigated three protocols and compared their simplicity, duration and costs for extracting genomic DNA from Linguatula serrata.Methods: The larvae were collected from the sheep’s visceral organs from the Yazd Slaughterhouse during May 2013. DNA extraction was done in three different methods, including commercial DNA extraction kit, Phenol Chloroform Isoamylalcohol (PCI, and salting out. Extracted DNA in each method was assessed for quantity and quality using spectrophotometery and agarose gel electrophoresis, respectively.Results: The less duration was regarding to commercial DNA extraction kit and then salting out protocol. The cost benefit one was salting out and then PCI method. The best quantity was regarding to PCI with 72.20±29.20 ng/μl, and purity of OD260/OD280 in 1.76±0.947. Agarose gel electrophoresis for assessing the quality found all the same.Conclusion: Salting out is introduced as the best method for DNA extraction from L. seratta as a food-borne pathogen with the least costand appropriate purity. Although, the best purity was regarding to PCI but PCI is not safe as salting out. In addition, the duration of salting out was less than PCI. The least duration was seen in commercial DNA extraction kit, but it is expensive and therefore is not recommended for developing countries where consumption of offal is common.

  9. A Suitable Method for DNA Extraction from Bones for Forensic Applications: A Case Study

    Directory of Open Access Journals (Sweden)

    Aqeela S. Abuidrees

    2016-06-01

    Full Text Available Human identification techniques are constantly developing. Before the discovery of DNA, anthropology accompanied with odontology was the most applicable technique for human identification. With the new era of molecular biology and the revolution of DNA and PCR techniques, DNA profiling has become the core of the human forensic identification process. Different types of samples can be exploited in forensic DNA analysis. In some extreme cases, bone samples are the only accessible samples of DNA due to the bad conditions of putrefaction or degradation of other biological materials and tissues. Therefore, an appropriate method should be determined to yield a full and clean profile. A case study is presented here in order to identify human remains and conclude the most appropriate method of DNA extraction from human remains. In addition, this study looks at the best part of the skeletal remains to be considered in the extraction of DNA for the purposes of identification. A suspect admitted that he buried his aborted son six months ago. The remains were recovered and DNA analysis was performed in order to determine any genetic link of the remains to the suspect and the female who delivered the baby. Two extraction methods were compared, the standard organic (phenol:chloroform:isoamyl alcohol and automated extraction using magnetic beads coated with silica (Qiagen EZ1 Advanced XL. Two bone parts, femur and clavicle, were also compared in terms of DNA yield. The efficiency of the two methods of DNA extraction from bones is illustrated quantitatively and qualitatively. Paternity testing was performed and the suspect was excluded from being the alleged father.

  10. Unscheduled DNA synthesis in spleen cells of mice exposed to low doses of total body irradiation

    International Nuclear Information System (INIS)

    Tuschl, H.; Kovac, R.; Hruby, E.

    1983-07-01

    Unscheduled DNA synthesis was induced by UV irradiation of spleen cells obtained from C 57 Bl mice after repeated total body irradiation of 0.05 Gy 60 Co (0.00125 Gy/mice) and determined autoradiographically. An enhancement in the ability for repair of UV induced DNA lesions was observed in cells of gamma irradiated animals. While the amount of 3 H-thymidine incorporated per cell was increased, the percentage of labeled cells remained unchanged. The present results are compared with previous data on low dose radiation exposure in men. (Author) [de

  11. Permanganate-assisted removal of PCR inhibitors during the DNA Chelex extraction from stained denim samples.

    Science.gov (United States)

    Pîrlea, Sorina; Puiu, Mihaela; Răducan, Adina; Oancea, Dumitru

    2017-03-01

    In this study, it was demonstrated that the DNA Chelex extraction combined with the permanganate assisted-oxidation is highly efficient in removing the PCR inhibitors often found in clothing materials, such as phthalocyanine. The extraction assays were conducted in saliva, blood and epithelial cells samples mixed with three oxidation-resistant dye copper(II) α-phthalocyanine, copper(II) β-phthalocyanine and tetrasulfonated copper(II) β-phthalocyanine. After DNA amplification, all samples were able to provide full DNA profiles. The permanganate/Chelex system was tested further on denim-stained samples and displayed the same ability to remove the PCR inhibitors from the commercial textile materials.

  12. Efficient method for extracting DNA of parasites causing bovine babesiosis from tick vectors

    Science.gov (United States)

    The southern cattle tick, Rhipicephalus (Boophilus) microplus, is an economically important pest costing animal agriculture billions of dollars worldwide. This research focuses on a comparison of three different tick DNA extraction methods: phenol-chloroform extraction (method 1), a modified version...

  13. Surfactant mediated extraction of total phenolic contents (TPC) and antioxidants from fruits juices.

    Science.gov (United States)

    Sharma, Shweta; Kori, Shivpoojan; Parmar, Ankush

    2015-10-15

    The aim of this study was to enhance the extraction of total phenolic contents (TPC) and antioxidants from fruit juices by the application of surfactants formulations instead of conventional solvents (methanol, ethanol and acetone). A variety of fruit infusions: apple red delicious (apple (rd)) (Malus domestica), Mcintosh apple (apple (i)) (Malus pumila), sweet lemon (Citrus limetta) and mango (Magnifera indica) were studied. Effect of water, organic solvents and five different aqueous surfactant formulations viz. SDS, Brij-35, Brij-58, Triton X-100 and Span-40 were explored for the extraction of TPC and determining the antioxidant activity (AA). The TPC and AA (%) were determined using Folin-Ciocalteu (FCA) and DPPH assay, respectively. The effect of surfactant type, concentration and common organic solvents on the extraction of TPC and AA (%) was studied using UV-visible spectrophotometric technique. Among all the extracting systems employed, Brij-58 showed the highest extraction efficiency. Copyright © 2015 Elsevier Ltd. All rights reserved.

  14. Evaluation and comparison of FTA card and CTAB DNA extraction methods for non-agricultural taxa 1

    OpenAIRE

    Siegel, Chloe S.; Stevenson, Florence O.; Zimmer, Elizabeth A.

    2017-01-01

    Premise of the study: An efficient, effective DNA extraction method is necessary for comprehensive analysis of plant genomes. This study analyzed the quality of DNA obtained using paper FTA cards prepared directly in the field when compared to the more traditional cetyltrimethylammonium bromide (CTAB)?based extraction methods from silica-dried samples. Methods: DNA was extracted using FTA cards according to the manufacturer?s protocol. In parallel, CTAB-based extractions were done using the a...

  15. Solid-Liquid Extraction Kinetics of Total Phenolic Compounds (TPC from Red Dates

    Directory of Open Access Journals (Sweden)

    Bee Lin Chua

    2018-01-01

    Full Text Available Red dates are one of the most famous herbal plants in making traditional Chinese medicine. They contain large amount of bioactive compounds. The objectives of this research were to optimise the crude extract yield and total phenolic compounds (TPC yield from red dates using response surface methodology (RSM and model the extraction kinetics of TPC yield from red dates. Date fruits were dried in an oven under temperatures 50°C, 60°C, 70°C and 80°C until a constant weight was obtained. The optimum drying temperature was 60°C as it gave the highest crude extract yield and TPC yield. Besides that, single factor experiments were used to determine the optimum range of four extraction parameters which were: liquid-solid ratio (10-30 ml/g; ultrasonic power (70-90%; extraction temperature (50-70°C; and extraction time (40-60min. The optimum range of the four parameters were further optimised using the Box-Behken Design (BBD of RSM. The extraction conditions that gave the highest crude extract yield and TPC yield were chosen. The optimum value for liquid-solid ratio, ultrasonic power, extraction temperature and extraction time were 30ml/g, 70%, 60°C and 60 min respectively. The two equations generated from RSM were reliable and can be used to predict the crude extract yield and TPC yield. The higher the extraction temperature, liquid-solid ratio, and extraction time and lower ultrasonic power, the higher the crude extract and TPC yield. Finally, the results of TPC yield versus time based on the optimum extraction parameters from RSM optimisation were fitted into three extraction kinetic models (Peleg’s model, Page’s model and Ponomaryov’s model. It was found that the most suitable kinetic model to represent the extraction process of TPC from red dates was Page’s model due to its coefficient of determination (R2 was the closest to unity, 0.9663 while its root mean square error (RMSE was the closest to zero, 0.001534.

  16. Evaluation of methods for the extraction and purification of DNA from the human microbiome.

    Directory of Open Access Journals (Sweden)

    Sanqing Yuan

    Full Text Available DNA extraction is an essential step in all cultivation-independent approaches to characterize microbial diversity, including that associated with the human body. A fundamental challenge in using these approaches has been to isolate DNA that is representative of the microbial community sampled.In this study, we statistically evaluated six commonly used DNA extraction procedures using eleven human-associated bacterial species and a mock community that contained equal numbers of those eleven species. These methods were compared on the basis of DNA yield, DNA shearing, reproducibility, and most importantly representation of microbial diversity. The analysis of 16S rRNA gene sequences from a mock community showed that the observed species abundances were significantly different from the expected species abundances for all six DNA extraction methods used.Protocols that included bead beating and/or mutanolysin produced significantly better bacterial community structure representation than methods without both of them. The reproducibility of all six methods was similar, and results from different experimenters and different times were in good agreement. Based on the evaluations done it appears that DNA extraction procedures for bacterial community analysis of human associated samples should include bead beating and/or mutanolysin to effectively lyse cells.

  17. Microbes on building materials - Evaluation of DNA extraction protocols as common basis for molecular analysis

    Energy Technology Data Exchange (ETDEWEB)

    Ettenauer, Joerg D., E-mail: joerg.ettenauer@boku.ac.at [VIBT-BOKU, University of Natural Resources and Life Sciences, Department of Biotechnology, Muthgasse 11, A-1190 Vienna (Austria); Pinar, Guadalupe, E-mail: Guadalupe.Pinar@boku.ac.at [VIBT-BOKU, University of Natural Resources and Life Sciences, Department of Biotechnology, Muthgasse 11, A-1190 Vienna (Austria); Lopandic, Ksenija, E-mail: Ksenija.Lopandic@boku.ac.at [VIBT-BOKU, University of Natural Resources and Life Sciences, Department of Biotechnology, Muthgasse 11, A-1190 Vienna (Austria); Spangl, Bernhard, E-mail: Bernhard.Spangl@boku.ac.at [University of Natural Resources and Life Sciences, Department of Landscape, Spatial and Infrastructure Science, Institute of Applied Statistics and Computing (IASC), Gregor Mendel-Str. 33, A-1180 Vienna (Austria); Ellersdorfer, Guenther, E-mail: Guenther.Ellersdorfer@boku.ac.at [VIBT-BOKU, University of Natural Resources and Life Sciences, Department of Biotechnology, Muthgasse 11, A-1190 Vienna (Austria); Voitl, Christian, E-mail: Christian.Voitl@boku.ac.at [VIBT-BOKU, University of Natural Resources and Life Sciences, Department of Biotechnology, Muthgasse 11, A-1190 Vienna (Austria); Sterflinger, Katja, E-mail: Katja.Sterflinger@boku.ac.at [VIBT-BOKU, University of Natural Resources and Life Sciences, Department of Biotechnology, Muthgasse 11, A-1190 Vienna (Austria)

    2012-11-15

    The study of microbial life in building materials is an emerging topic concerning biodeterioration of materials as well as health risks in houses and at working places. Biodegradation and potential health implications associated with microbial growth in our residues claim for more precise methods for quantification and identification. To date, cultivation experiments are commonly used to gain insight into the microbial diversity. Nowadays, molecular techniques for the identification of microorganisms provide efficient methods that can be applied in this field. The efficiency of DNA extraction is decisive in order to perform a reliable and reproducible quantification of the microorganisms by qPCR or to characterize the structure of the microbial community. In this study we tested thirteen DNA extraction methods and evaluated their efficiency for identifying (1) the quantity of DNA, (2) the quality and purity of DNA and (3) the ability of the DNA to be amplified in a PCR reaction using three universal primer sets for the ITS region of fungi as well as one primer pair targeting the 16S rRNA of bacteria with three typical building materials - common plaster, red brick and gypsum cardboard. DNA concentration measurements showed strong variations among the tested methods and materials. Measurement of the DNA yield showed up to three orders of magnitude variation from the same samples, whereas A260/A280 ratios often prognosticated biases in the PCR amplifications. Visualization of the crude DNA extracts and the comparison of DGGE fingerprints showed additional drawbacks of some methods. The FastDNA Spin kit for soil showed to be the best DNA extraction method and could provide positive results for all tests with the three building materials. Therefore, we suggest this method as a gold standard for quantification of indoor fungi and bacteria in building materials. -- Highlights: Black-Right-Pointing-Pointer Up to thirteen extraction methods were evaluated with three

  18. Microbes on building materials — Evaluation of DNA extraction protocols as common basis for molecular analysis

    International Nuclear Information System (INIS)

    Ettenauer, Jörg D.; Piñar, Guadalupe; Lopandic, Ksenija; Spangl, Bernhard; Ellersdorfer, Günther; Voitl, Christian; Sterflinger, Katja

    2012-01-01

    The study of microbial life in building materials is an emerging topic concerning biodeterioration of materials as well as health risks in houses and at working places. Biodegradation and potential health implications associated with microbial growth in our residues claim for more precise methods for quantification and identification. To date, cultivation experiments are commonly used to gain insight into the microbial diversity. Nowadays, molecular techniques for the identification of microorganisms provide efficient methods that can be applied in this field. The efficiency of DNA extraction is decisive in order to perform a reliable and reproducible quantification of the microorganisms by qPCR or to characterize the structure of the microbial community. In this study we tested thirteen DNA extraction methods and evaluated their efficiency for identifying (1) the quantity of DNA, (2) the quality and purity of DNA and (3) the ability of the DNA to be amplified in a PCR reaction using three universal primer sets for the ITS region of fungi as well as one primer pair targeting the 16S rRNA of bacteria with three typical building materials — common plaster, red brick and gypsum cardboard. DNA concentration measurements showed strong variations among the tested methods and materials. Measurement of the DNA yield showed up to three orders of magnitude variation from the same samples, whereas A260/A280 ratios often prognosticated biases in the PCR amplifications. Visualization of the crude DNA extracts and the comparison of DGGE fingerprints showed additional drawbacks of some methods. The FastDNA Spin kit for soil showed to be the best DNA extraction method and could provide positive results for all tests with the three building materials. Therefore, we suggest this method as a gold standard for quantification of indoor fungi and bacteria in building materials. -- Highlights: ► Up to thirteen extraction methods were evaluated with three building materials.

  19. A rapid and simple method for DNA extraction from yeasts and fungi isolated from Agave fourcroydes.

    Science.gov (United States)

    Tapia-Tussell, Raul; Lappe, Patricia; Ulloa, Miguel; Quijano-Ramayo, Andrés; Cáceres-Farfán, Mirbella; Larqué-Saavedra, Alfonso; Perez-Brito, Daisy

    2006-05-01

    A simple and easy protocol for extracting high-quality DNA from different yeast and filamentous fungal species is described. This method involves two important steps: first, the disruption of cell walls by mechanical means and freezing; and second, the extraction, isolation, and precipitation of genomic DNA. The absorbance ratios (A(260)/A(280)) obtained ranged from 1.6 to 2.0. The main objective of this procedure is to extract pure DNA from yeast and filamentous fungi, including those with high contents of proteins, polysaccharides, and other complex compounds in their cell walls. The yield and quality of the DNAs obtained were suitable for micro/minisatellite primer-polymerase chain reaction (MSP-PCR) fingerprinting as well as for the sequence of the D1/D2 domain of the 26S rDNA.

  20. [DNA extraction from decomposed tissue by double-digest and magnetic beads methods].

    Science.gov (United States)

    Yang, Dian; Liu, Chao; Liu, Hong

    2011-12-01

    To study the effect of the double-digest and magnetic beads method for DNA extraction from 3 types of decomposed tissues. DNA of cartilages, nails and joint capsule in 91 highly decomposed corpses which had not been extracted by common magnetic beads method, were prepared with the double-digest and magnetic beads methods, and quantified with Quantifiler kit, followed by amplification with Sinofiler kit or Minifiler kit. DNA concentration extracted from the 91 highly decomposed cartilages, nails and joint capsule samples was 0-0.225 ng/microL. Sixty-two samples whose DNA concentration were more than 0.020 ng/microL had obtained 9 or more STR loci successfully. The detection rate was 68.13%. The successful rate of STR genotyping for the 3 types of decomposed tissues can be significantly improved by the double-digest and magnetic beads methods.

  1. Comparative study of the total phenol content and antioxidant activity of some medicinal herbal extracts

    Directory of Open Access Journals (Sweden)

    H. Hajimehdipoor

    2014-08-01

    Full Text Available Herbal medicines can be used as the potential sources of anti-oxidative compounds to help the treatment of diseases associated to oxidative stress. In this paper, the Ferric Reducing Antioxidant Power (FRAP activity of four Lamiaceae herbal extracts, which traditionally applied in oxidative stress related diseases, has been evaluated and total phenolics contents of these extracts determined by using Folin-Ciocalteu reagent. The aqueous methanol extracts were prepared by percolation method and investigated for antioxidant properties and total phenolics content evaluation. All the extracts showed antioxidant effect from 123.6±4.6 mmol of FeSO4.7H2Oequivalent/100 g dried extract in Scutellaria tornefortii to 551.5±16.0 mmol of FeSO4.7H2Oequivalent/100 g dried extract in Satureja sahendica. Interestingly, although Satureja sahendica exhibited the most antioxidant activity, the highest content of polyphenolics belonged to Stachys byzantina. Taking together, antioxidant activity of the mentioned medicinal plants is not necessarily associated with polyphenolic compounds and might be partially due to the presence of other polar constituents like terpenoid-glycosides in aqueous extracts that traditionally used as decoction.

  2. Total phenolic content, antioxidant and antimicrobial activities of Blepharis edulis extracts

    Directory of Open Access Journals (Sweden)

    Mohaddese Mahboubi

    2013-02-01

    Full Text Available Blepharis edulis is traditionally used as an antiseptic, purgative, aphrodisiac and anti-inflammatory agent. The extractsof plant aerial parts were screened for total phenolic content (TPC gallic acid equivalents (GAE, total flavonoid compound(TFC quercetin equivalents (QE, antioxidant capacity and its antimicrobial activity by micro broth dilution assay. The 50%-inhibition values of BHT and 70% (v/v aqueous ethanol, 70% (v/v aqueous methanol, methanol, and water extracts of B.edulis according to the DPPH method were found to be 19.6, 71.2, 73.7, 81.4, and 218.4 g/ml, respectively. TPC ranged from38.9 to 102.7 mg GAE/g dry extracts. The antimicrobial activity showed that yeast and fungi were sensitive and resistantmicroorganisms to the extracts. The 70%-methanol extract showed more drastic antimicrobial activity than the others. Theantimicrobial activity of ethanolic extract is the same as of the methanolic extract; water extract had the weakest antimicrobialactivity.

  3. COMPARISON OF DIFFERENT EXTRACTION METHODS REPRESENTING AVAILABLE AND TOTAL CONCENTRATIONS OF Cd, Cu, Fe, Mn and Zn IN SOIL

    Directory of Open Access Journals (Sweden)

    Vladimir Ivezić

    2013-06-01

    Full Text Available Various extraction methods are used to predict plant uptake of trace metals. Most commonly it is total concentration that is used for risk assessment and evaluation of trace metal availability. However, recent studies showed that total concentration is a poor indicator of availability while concentrations in soil solution show good correlation with plant uptake. Present study was conducted on magricultural soils with low levels of trace metals where 45 soil samples were collected from different soil types. The main objective was to compare four different extraction methods and examine how total and reactive (EDTA trace metal concentrations correlate ,with soil solution concentration (in this study determined by water extraction. The samples were analyzed by four extraction methods: strong acid extraction (ultra-pure HNO3 extraction and aqua regia, weak acid extraction by EDTA and the most available fraction, fraction in soil solution, were represented by water extraction (weakest extractant. Five elements were investigated (Cd, Cu, Fe, Mn and Zn. Water extraction significantly correlated with EDTA extraction for Cu, Fe and Mn, while total extraction (HNO3 extraction and aqua regia correlated significantly with water extraction only for Cu. No correlation between water extraction and total extraction confirmed poor role of total concentration as an indicator of availability. EDTA extraction can be used to represent reactive pool of trace metals in soil but it should be also taken with caution when using it to describe available fraction.

  4. Comparison of two silica-based extraction methods for DNA isolation from bones.

    Science.gov (United States)

    Rothe, Jessica; Nagy, Marion

    2016-09-01

    One of the most demanding DNA extractions is from bones and teeth due to the robustness of the material and the relatively low DNA content. The greatest challenge is due to the manifold nature of the material, which is defined by various factors, including age, storage, environmental conditions, and contamination with inhibitors. However, most published protocols do not distinguish between different types or qualities of bone material, but are described as being generally applicable. Our laboratory works with two different extraction methods based on silica membranes or the use of silica beads. We compared the amplification success of the two methods from bone samples with different qualities and in the presence of inhibitors. We found that the DNA extraction using the silica membrane method results an in higher DNA yield but also in a higher risk of co-extracting impurities, which can act as inhibitors. In contrast the silica beads method shows decreased co-extraction of inhibitors but also less DNA yield. Related to our own experiences it has to be considered that each bone material should be reviewed independently regarding the analysis and extraction method. Therefore, the most ambitious task is determining the quality of the bone material, which requires substantial experience. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.

  5. Dichlorvos exposure impedes extraction and amplification of DNA from insects in museum collections

    Directory of Open Access Journals (Sweden)

    Åkerlund Monika

    2010-01-01

    Full Text Available Abstract Background The insecticides dichlorvos, paradichlorobenzene and naphthalene have been commonly used to eradicate pest insects from natural history collections. However, it is not known how these chemicals affect the DNA of the specimens in the collections. We thus tested the effect of dichlorvos, paradichlorobenzene and naphthalene on DNA of insects (Musca domestica by extracting and amplifying DNA from specimens exposed to insecticides in two different concentrations over increasing time intervals. Results The results clearly show that dichlorvos impedes both extraction and amplification of mitochondrial and nuclear DNA after relatively short time, whereas paradichlorobenzene and naphthalene do not. Conclusion Collections treated with paradichlorobenzene and naphthalene, are better preserved concerning DNA, than those treated with dichlorvos. Non toxic pest control methods should, however, be preferred due to physical damage of specimens and putative health risks by chemicals.

  6. Automated DNA extraction from genetically modified maize using aminosilane-modified bacterial magnetic particles.

    Science.gov (United States)

    Ota, Hiroyuki; Lim, Tae-Kyu; Tanaka, Tsuyoshi; Yoshino, Tomoko; Harada, Manabu; Matsunaga, Tadashi

    2006-09-18

    A novel, automated system, PNE-1080, equipped with eight automated pestle units and a spectrophotometer was developed for genomic DNA extraction from maize using aminosilane-modified bacterial magnetic particles (BMPs). The use of aminosilane-modified BMPs allowed highly accurate DNA recovery. The (A(260)-A(320)):(A(280)-A(320)) ratio of the extracted DNA was 1.9+/-0.1. The DNA quality was sufficiently pure for PCR analysis. The PNE-1080 offered rapid assay completion (30 min) with high accuracy. Furthermore, the results of real-time PCR confirmed that our proposed method permitted the accurate determination of genetically modified DNA composition and correlated well with results obtained by conventional cetyltrimethylammonium bromide (CTAB)-based methods.

  7. DNA extraction from coral reef sediment bacteria for the polymerase chain reaction.

    Science.gov (United States)

    Guthrie, J N; Moriarty, D J; Blackall, L L

    2000-12-15

    A rapid and effective method for the direct extraction of high molecular weight amplifiable DNA from two coral reef sediments was developed. DNA was amplified by the polymerase chain reaction (PCR) using 16S rDNA specific primers. The amplicons were digested with HaeIII, HinP1I and MspI and separated using polyacrylamide gel electrophoresis and silver staining. The resulting amplified ribosomal DNA restriction analysis (ARDRA) patterns were used as a fingerprint to discern differences between the coral reef sediment samples. Results indicated that ARDRA is an effective method for determining differences within the bacterial community amongst different environmental samples.

  8. [Evaluation of the total biological activity and allergenic composition of allergenic extracts].

    Science.gov (United States)

    Lombardero, M; González, R; Duffort, O; Juan, F; Ayuso, R; Ventas, P; Cortés, C; Carreira, J

    1986-01-01

    In the present study, a complete procedure is presented in order to standardize allergenic extracts, the meaning of which is the measurement of the total allergenic activity and the determination of the allergenic composition. The measurement of the biological activity comprises 2 steps: Preparation of Reference Extracts and determination of their "in vivo" activity. Evaluation of the total allergenic activity of extracts for clinical use. Reference extracts were prepared from the main allergens and their "in vivo" biological activity was determined by a quantitative skin prick test in a sample of at least 30 allergic patients. By definition, the protein concentration of Reference Extract that produces, in the allergic population, a geometric mean wheal of 75 mm.2 has an activity of 100 biological units (BUs). The determination of the biological activity of a problem extract is made by RAST inhibition. The sample is compared with the corresponding Reference Extract by this technique and, from this comparison, it is possible to quantify the activity of the problem extract in biologic units (BUs) with clinical significance. Likewise, different techniques have been used to determine the allergenic composition of extracts. These techniques comprise 2 steps: Separation of the components of the extract. Identification of the components that bind specific human IgE. The separation of the components of the extract has been carried out by isoelectric focusing (IEF) and electrophoresis in the presence of sodium dodecyl sulphate (SDS-PAGE). In order to identify the allergenic components, an immunoblotting technique has been employed. The separated components in the IEF gel or SDS-PAGE gel are transferred to a nitrocellulose sheet and later on, this membrane is overlaid with a serum pool from allergic patients and a mouse monoclonal anti-human IgE, labelled with 125I. Finally, the autoradiography of the nitrocellulose membrane is obtained. In this way it is possible to compare

  9. Comparative analysis of three different of extraction protocols of total nucleic acids of squash (Cucurbita moschata) for the diagnosis from geminivirus

    International Nuclear Information System (INIS)

    Hernandez Jimenez, Eduardo

    2008-01-01

    The geminivirus constitute an important group of plant pathogens, characterized by an unusual morphology of the viral particle and its DNA. They have a paired icosahedral cover and a small circular genome of DNA simple band that is replicated, by DNA double band, in the nucleus of the infected cell of the plant. Many researchers have focused on the development and optimization of protocols for obtaining DNA or RNA of interest, because of rapid advances in molecular biology during the second half of the XX century and the beginning of XXI century, and to that the extraction and purification of nucleic acids is the first step mainly of the procedures in this area. The objective is to compare, by means of molecular techniques, the DNA purification in squash from different ways of storage and extraction protocols of total nucleic acids of the plant, in order to improve the quality and amount of genetic matters whereupon the detection and characterization of geminivirus are realised. Three methods were compared: i. Dellaporta and collaborators (1983), ii.- Doyle and Doyle (1990) and iii.- Jose and Usha (2000). The operation of the three methods scaled downward (15 milligrams of leaf tissue) and two ways of storage were evaluated: 1.- tubes with silica gel (SG, a desiccant) and 2.- frozen to -70 degrees Celsius. The method of Jose and Usha (2000) presented technical difficulties that not permitted to scale downward, for which it should work with the purification from a gram of foliar tissue. The integrity of the total DNA was verified superior in the material stored to -70 degrees celsius for all the methods, by means of electrophoresis in gels of agarose, besides that the protocol of Dellaporta et al. (1983) tends to enrich the RNA. The readings were similar for the methods of Dellaporta et al. (1983) and Doyle and Doyle (1993), this was evidenced upon quantifying the total DNA and that is extracted at least a 30% more of DNA from material in the desiccant with respect

  10. Antioxidant, Cytotoxic, and Antiproliferative Activities and Total Polyphenol Contents of the Extracts of Geissospermum reticulatum Bark

    Directory of Open Access Journals (Sweden)

    Joanna J. Sajkowska-Kozielewicz

    2016-01-01

    Full Text Available Geissospermum species are medically important plants due to their health-promoting effects. The objective of this study was to determine the antioxidant ability and antiproliferative and cytotoxic effects of infusions, tinctures, and ethanolic extracts of Geissospermum reticulatum barks in relation to the contents of total phenolics and flavonoids. Seven samples of barks were collected in various regions of Peruvian Amazonia. We found that the amount of total phenolics in the studied products varied from 212.40 ± 0.69 to 1253.92 ± 11.20 mg GAE/kg. In our study there is a correlation (R2=0.7947 between the results of antioxidants assays: FRAP and ORAC for tinctures, infusions, and ethanolic extracts of G. reticulatum barks. We have also observed antiproliferative activities of the ethanolic extracts on normal T-cells. These extracts have caused death on malignant cell lines (THP-1 and HL-60 and this data correlates well with their antioxidant capacity measured by ORAC method. Interestingly, the highest concentration of the ethanolic extract was not toxic in the zebrafish embryo developmental assay. Our results indicate that G. reticulatum is rich in antioxidants and have cytotoxic and antiproliferative properties. The data suggests potential immunosuppressive role of the extracts. This is the first study presenting the results of chemical and biological analysis of multiple preparations from G. reticulatum.

  11. A simple method of genomic DNA extraction suitable for analysis of bulk fungal strains.

    Science.gov (United States)

    Zhang, Y J; Zhang, S; Liu, X Z; Wen, H A; Wang, M

    2010-07-01

    A simple and rapid method (designated thermolysis) for extracting genomic DNA from bulk fungal strains was described. In the thermolysis method, a few mycelia or yeast cells were first rinsed with pure water to remove potential PCR inhibitors and then incubated in a lysis buffer at 85 degrees C to break down cell walls and membranes. This method was used to extract genomic DNA from large numbers of fungal strains (more than 92 species, 35 genera of three phyla) isolated from different sections of natural Ophiocordyceps sinensis specimens. Regions of interest from high as well as single-copy number genes were successfully amplified from the extracted DNA samples. The DNA samples obtained by this method can be stored at -20 degrees C for over 1 year. The method was effective, easy and fast and allowed batch DNA extraction from multiple fungal isolates. Use of the thermolysis method will allow researchers to obtain DNA from fungi quickly for use in molecular assays. This method requires only minute quantities of starting material and is suitable for diverse fungal species.

  12. Extraction of high quality DNA from seized Moroccan cannabis resin (Hashish.

    Directory of Open Access Journals (Sweden)

    Moulay Abdelaziz El Alaoui

    Full Text Available The extraction and purification of nucleic acids is the first step in most molecular biology analysis techniques. The objective of this work is to obtain highly purified nucleic acids derived from Cannabis sativa resin seizure in order to conduct a DNA typing method for the individualization of cannabis resin samples. To obtain highly purified nucleic acids from cannabis resin (Hashish free from contaminants that cause inhibition of PCR reaction, we have tested two protocols: the CTAB protocol of Wagner and a CTAB protocol described by Somma (2004 adapted for difficult matrix. We obtained high quality genomic DNA from 8 cannabis resin seizures using the adapted protocol. DNA extracted by the Wagner CTAB protocol failed to give polymerase chain reaction (PCR amplification of tetrahydrocannabinolic acid (THCA synthase coding gene. However, the extracted DNA by the second protocol permits amplification of THCA synthase coding gene using different sets of primers as assessed by PCR. We describe here for the first time the possibility of DNA extraction from (Hashish resin derived from Cannabis sativa. This allows the use of DNA molecular tests under special forensic circumstances.

  13. Separation/extraction, detection, and interpretation of DNA mixtures in forensic science (review).

    Science.gov (United States)

    Tao, Ruiyang; Wang, Shouyu; Zhang, Jiashuo; Zhang, Jingyi; Yang, Zihao; Sheng, Xiang; Hou, Yiping; Zhang, Suhua; Li, Chengtao

    2018-05-25

    Interpreting mixed DNA samples containing material from multiple contributors has long been considered a major challenge in forensic casework, especially when encountering low-template DNA (LT-DNA) or high-order mixtures that may involve missing alleles (dropout) and unrelated alleles (drop-in), among others. In the last decades, extraordinary progress has been made in the analysis of mixed DNA samples, which has led to increasing attention to this research field. The advent of new methods for the separation and extraction of DNA from mixtures, novel or jointly applied genetic markers for detection and reliable interpretation approaches for estimating the weight of evidence, as well as the powerful massively parallel sequencing (MPS) technology, has greatly extended the range of mixed samples that can be correctly analyzed. Here, we summarized the investigative approaches and progress in the field of forensic DNA mixture analysis, hoping to provide some assistance to forensic practitioners and to promote further development involving this issue.

  14. Extraction and phylogenetic survey of extracellular and intracellular DNA in marine sediments

    DEFF Research Database (Denmark)

    Torti, Andrea

    indeed inflate richness estimates of sediments microbial communities, and point to a role of bioturbation in shaping the prokaryotic diversity of the eDNA pool at the investigated site. Analysis of 18S RNA gene sequences revealed a diverse collection of eukaryotic taxa throughout the sediment column......DNA, and validated for minimal cell lysis during the eDNA extraction process. The optimized method was applied to investigate and compare the bacterial, archaeal, and eukaryotic diversity within iDNA and eDNA pools, in the context of differing geochemical and lithological zones in the Holocene sediment column...... of Aarhus Bay (Demark). Using high-throughput sequencing technologies, I first explored whether, and to what extent, prokaryotic eDNA parallels the phylogenetic composition of the local microbiome. Phylogenetic analyses revealed that, in near-surface sediments influenced by faunal activities, 50% of all...

  15. Extraction of PCR-amplifiable genomic DNA from Bacillus anthracisspores

    Energy Technology Data Exchange (ETDEWEB)

    Torok, Tamas

    2003-05-19

    Bacterial endospore disruption and nucleic acid extractionresulting in DNA of PCR-amplifiable quality and quantity are not trivial.Responding to the needs of the Hazardous Materials Response Unit (HMRU),Laboratory Division, Federal Bureau of Investigation, protocols weredeveloped to close these gaps. Effectiveness and reproducibility of thetechniques were validated with laboratory grown pure spores of Bacillusanthracis and its close phylogenetic neighbors, and with spiked soils anddamaged samples.

  16. DNA extraction from hair shafts of wild Brazilian felids and canids.

    Science.gov (United States)

    Alberts, C C; Ribeiro-Paes, J T; Aranda-Selverio, G; Cursino-Santos, J R; Moreno-Cotulio, V R; Oliveira, A L D; Porchia, B F M M; Santos, W F; Souza, E B

    2010-12-21

    Wild felids and canids are usually the main predators in the food chains where they dwell and are almost invisible to behavior and ecology researchers. Due to their grooming behavior, they tend to swallow shed hair, which shows up in the feces. DNA found in hair shafts can be used in molecular studies that can unravel, for instance, genetic variability, reproductive mode and family structure, and in some species, it is even possible to estimate migration and dispersion rates in given populations. First, however, DNA must be extracted from hair. We extracted successfully and dependably hair shaft DNA from eight wild Brazilian felids, ocelot, margay, oncilla, Geoffroy's cat, pampas cat, jaguarundi, puma, and jaguar, as well as the domestic cat and from three wild Brazilian canids, maned wolf, crab-eating fox, and hoary fox, as well as the domestic dog. Hair samples came mostly from feces collected at the São Paulo Zoo and were also gathered from non-sedated pet or from recently dead wild animals and were also collected from museum specimens. Fractions of hair samples were stained before DNA extraction, while most samples were not. Our extraction protocol is based on a feather DNA extraction technique, based in the phenol:chloroform:isoamyl alcohol general method, with proteinase K as digestive enzyme.

  17. An inexpensive and rapid method for extracting papilionoid genomic DNA from herbarium specimens.

    Science.gov (United States)

    Riahi, M; Zarre, S; Maassoumi, A A; Attar, F; Kazempour Osaloo, S

    2010-07-13

    Three DNA extraction protocols were compared for their ability to yield DNA from the leaves of herbarium specimens of nine species from nine genera of the Papilionoideae. We tested two protocols that use classic procedures for lysis and purification with cetyl trimethylammonium bromide (CTAB); a third protocol used a Nucleospin Plant kit. DNA obtained from all three procedures was quantified and tested by PCR. Test results indicated the superiority of one of the CTAB protocols. We made some modifications, developing a protocol that produced high-quality DNA from all nine species. The modification involved the use of a lower EDTA concentration (20 mM instead of 50 mM) and a higher beta-mercaptoethanol concentration (1% instead of 0.4%) in the extraction buffer. The modified protocol avoids the necessity for a second DNA precipitation step. This new CTAB protocol includes the use of 1.4 M NaCl, 20 mM EDTA and 1% beta-mercaptoethanol in the extraction; DNA precipitation time is reduced. A reduction in contaminating metabolites (such as PCR inhibitors) in the sample mixtures and lower costs for reagents are characteristics of this modified protocol; the cost of analysis per sample was lowered, compared to previous options. The quality of DNA was suitable for PCR amplification. This is a practical alternative to more difficult, time-consuming and expensive protocols.

  18. Ancient DNA in historical parchments - identifying a procedure for extraction and amplification of genetic material.

    Science.gov (United States)

    Lech, T

    2016-05-06

    Historical parchments in the form of documents, manuscripts, books, or letters, make up a large portion of cultural heritage collections. Their priceless historical value is associated with not only their content, but also the information hidden in the DNA deposited on them. Analyses of ancient DNA (aDNA) retrieved from parchments can be used in various investigations, including, but not limited to, studying their authentication, tracing the development of the culture, diplomacy, and technology, as well as obtaining information on the usage and domestication of animals. This article proposes and verifies a procedure for aDNA recovery from historical parchments and its appropriate preparation for further analyses. This study involved experimental selection of an aDNA extraction method with the highest efficiency and quality of extracted genetic material, from among the multi-stage phenol-chloroform extraction methods, and the modern, column-based techniques that use selective DNA-binding membranes. Moreover, current techniques to amplify entire genetic material were questioned, and the possibility of using mitochondrial DNA for species identification was analyzed. The usefulness of the proposed procedure was successfully confirmed in identification tests of historical parchments dating back to the 13-16th century AD.

  19. Multivessel supercritical fluid extraction of food items in Total Diet Study.

    Science.gov (United States)

    Hopper, M L; King, J W; Johnson, J H; Serino, A A; Butler, R J

    1995-01-01

    An off-line, large capacity, multivessel supercritical fluid extractor (SFE) was designed and constructed for extraction of large samples. The extractor can simultaneously process 1-6 samples (15-25 g) by using supercritical carbon dioxide (SC-CO2), which is relatively nontoxic and nonflammable, as the solvent extraction medium. Lipid recoveries for the SFE system were comparable to those obtained by blending or Soxhlet extraction procedures. Extractions at 10,000 psi, 80 degrees C, expanded gaseous CO2 flow rates of 4-5 L/min (35 degrees C), and 1-3 h extraction times gave reproducible lipid recoveries for pork sausage (relative standard deviation [RSD], 1.32%), corn chips (RSD, 0.46%), cheddar cheese (RSD, 1.14%), and peanut butter (RSD, 0.44%). In addition, this SFE system gave reproducible recoveries (> 93%) for butter fortified with cis-chlordane and malathion at the 100 ppm and 0.1 ppm levels. Six portions each of cheddar cheese, saltine crackers, sandwich cookies, and ground hamburger also were simultaneously extracted with SC-CO2 and analyzed for incurred pesticide residues. Results obtained with this SFE system were reproducible and comparable with results from organic-solvent extraction procedures currently used in the Total Diet Study; therefore, use and disposal of large quantities of organic solvents can be eliminated.

  20. High-throughput sequencing of three Lemnoideae (duckweeds chloroplast genomes from total DNA.

    Directory of Open Access Journals (Sweden)

    Wenqin Wang

    Full Text Available BACKGROUND: Chloroplast genomes provide a wealth of information for evolutionary and population genetic studies. Chloroplasts play a particularly important role in the adaption for aquatic plants because they float on water and their major surface is exposed continuously to sunlight. The subfamily of Lemnoideae represents such a collection of aquatic species that because of photosynthesis represents one of the fastest growing plant species on earth. METHODS: We sequenced the chloroplast genomes from three different genera of Lemnoideae, Spirodela polyrhiza, Wolffiella lingulata and Wolffia australiana by high-throughput DNA sequencing of genomic DNA using the SOLiD platform. Unfractionated total DNA contains high copies of plastid DNA so that sequences from the nucleus and mitochondria can easily be filtered computationally. Remaining sequence reads were assembled into contiguous sequences (contigs using SOLiD software tools. Contigs were mapped to a reference genome of Lemna minor and gaps, selected by PCR, were sequenced on the ABI3730xl platform. CONCLUSIONS: This combinatorial approach yielded whole genomic contiguous sequences in a cost-effective manner. Over 1,000-time coverage of chloroplast from total DNA were reached by the SOLiD platform in a single spot on a quadrant slide without purification. Comparative analysis indicated that the chloroplast genome was conserved in gene number and organization with respect to the reference genome of L. minor. However, higher nucleotide substitution, abundant deletions and insertions occurred in non-coding regions of these genomes, indicating a greater genomic dynamics than expected from the comparison of other related species in the Pooideae. Noticeably, there was no transition bias over transversion in Lemnoideae. The data should have immediate applications in evolutionary biology and plant taxonomy with increased resolution and statistical power.

  1. A single-step method for rapid extraction of total lipids from green microalgae.

    Directory of Open Access Journals (Sweden)

    Martin Axelsson

    Full Text Available Microalgae produce a wide range of lipid compounds of potential commercial interest. Total lipid extraction performed by conventional extraction methods, relying on the chloroform-methanol solvent system are too laborious and time consuming for screening large numbers of samples. In this study, three previous extraction methods devised by Folch et al. (1957, Bligh and Dyer (1959 and Selstam and Öquist (1985 were compared and a faster single-step procedure was developed for extraction of total lipids from green microalgae. In the single-step procedure, 8 ml of a 2∶1 chloroform-methanol (v/v mixture was added to fresh or frozen microalgal paste or pulverized dry algal biomass contained in a glass centrifuge tube. The biomass was manually suspended by vigorously shaking the tube for a few seconds and 2 ml of a 0.73% NaCl water solution was added. Phase separation was facilitated by 2 min of centrifugation at 350 g and the lower phase was recovered for analysis. An uncharacterized microalgal polyculture and the green microalgae Scenedesmus dimorphus, Selenastrum minutum, and Chlorella protothecoides were subjected to the different extraction methods and various techniques of biomass homogenization. The less labour intensive single-step procedure presented here allowed simultaneous recovery of total lipid extracts from multiple samples of green microalgae with quantitative yields and fatty acid profiles comparable to those of the previous methods. While the single-step procedure is highly correlated in lipid extractability (r² = 0.985 to the previous method of Folch et al. (1957, it allowed at least five times higher sample throughput.

  2. Anti-tumor potential of total alkaloid extract of Prosopis juliflora DC ...

    African Journals Online (AJOL)

    Jane

    2011-08-15

    Aug 15, 2011 ... Cancer is the second leading cause of death in the world. (Madhusudan and .... formula and from that the percentage of cytotoxicity and IC50 values ... complete media were treated as positive and negative controls, .... Cytotoxic effect of total alkaloid extract of P. juliflora leaves against cancer (black bars).

  3. Total phenol content and antioxidant activity of water solutions of plant extracts

    Directory of Open Access Journals (Sweden)

    Mirela Kopjar

    2009-01-01

    Full Text Available Water solutions of extracts were investigated for total phenol content, flavonoid content and antioxidant activity. Susceptibility to degradation of water solutions of plant extracts, under light and in the dark, during storage at room temperature was investigated in order to determine their stability prior to their application for fortification of food products. Large dispersion of total phenol (TP content in the investigated model solutions of selected extracts (olive leaves, green tea, red grape, red wine, pine bark PE 5:1, pine bark PE 95 %, resveratrol, ranging from 11.10 mg GAE/100 mL to 92.19 mg GAE/100 mL was observed. Consequently, large dispersion of total flavonoids (TF content (8.89 mg to 61.75 mg CTE/100 mL was also observed. Since phenols have been mostly responsible for antioxidant activity of extracts, in most cases, antioxidant activity followed the TP content. That was proven by estimation of correlation coefficient between the total phenol content and antioxidant activity. Correlation coefficients between investigated parameters ranged from 0.5749 to 0.9604. During storage of 5 weeks at room temperature loss of phenols and flavonoids occurred. Antioxidant activity decreased with the decrease of TP and TF content. Degradations of phenols and flavonoids were more pronounced in samples stored at light.

  4. Use of solvent mixtures for total lipid extraction of Chlorella vulgaris and gas chromatography FAME analysis.

    Science.gov (United States)

    Moradi-Kheibari, Narges; Ahmadzadeh, Hossein; Hosseini, Majid

    2017-09-01

    Lipid extraction is the bottleneck step for algae-based biodiesel production. Herein, 12 solvent mixture systems (mixtures of three non-polar and two polar organic solvents) were examined to evaluate their effects on the total lipid yield from Chlorella vulgaris (C. vulgaris). Moreover, the extraction yields of three solvent systems with maximum extraction efficiency of esterifiable lipids were determined by acidic transesterification and GC-FID analysis. Three solvent systems, which resulted in a higher extraction yield, were further subjected to fatty acid methyl ester (FAME) analysis. The total lipid extraction yields (based on dry biomass) were (38.57 ± 1.51), (25.33 ± 0.58), and (25.17 ± 1.14) %, for chloroform-methanol (1:2) (C1M2), hexane-methanol (1:2) (H1M2), and chloroform-methanol (2:1) (C2M1), respectively. The extraction efficiency of C1M2 was approximately 1.5 times higher than H1M2 and C2M1, whereas the FAME profile of extracted lipids by H1M2 and C1M2 were almost identical. Moreover, the esterifiable lipid extraction yields of (18.14 ± 2.60), (16.66 ± 0.35), and (13.22 ± 0.31) % (based on dry biomass) were obtained for C1M2, H1M2, and C2M1 solvent mixture systems, respectively. The biodiesel fuel properties produced from C. vulgaris were empirically predicted and compared to that of the EN 14214 and ASTM 6751 standard specifications.

  5. Optimizing factors influencing DNA extraction from fresh whole avian ...

    African Journals Online (AJOL)

    Administrator

    2007-02-19

    Feb 19, 2007 ... RNA transcription, nucleic acid labeling (random primer labeling) etc. Hence ... form extraction are “tried and true” and nearly always work. Many modified versions of ... Effect (mean ± SE) of starting blood sample (µl) on variables studied. Blood sample ..... PhD Thesis submitted to University of. Agricultural ...

  6. Impact of two different commercial DNA extraction methods on BK virus viral load

    Directory of Open Access Journals (Sweden)

    Massimiliano Bergallo

    2016-03-01

    Full Text Available Background and aim: BK virus, a member of human polyomavirus family, is a worldwide distributed virus characterized by a seroprevalence rate of 70-90% in adult population. Monitoring of viral replication is made by evaluation of BK DNA by quantitative polymerase chain reaction. Many different methods can be applied for extraction of nucleic acid from several specimens. The aim of this study was to assess the impact of two different DNA extraction procedure on BK viral load. Materials and methods: DNA extraction procedure including the Nuclisens easyMAG platform (bioMerieux, Marcy l’Etoile, France and manual QIAGEN extraction (QIAGEN Hilden, Germany. BK DNA quantification was performed by Real Time TaqMan PCR using a commercial kit. Result and discussion: The samples capacity, cost and time spent were compared for both systems. In conclusion our results demonstrate that automated nucleic acid extraction method using Nuclisense easyMAG was superior to manual protocol (QIAGEN Blood Mini kit, for the extraction of BK virus from serum and urine specimens.

  7. Antioxidant, cytotoxic and DNA protective properties of Achillea eriophora DC. and Achillea biebersteinii Afan. extracts: A comparative study

    Directory of Open Access Journals (Sweden)

    Maryam Varasteh-kojourian

    2017-02-01

    Full Text Available Objective: Achillea is a traditional medicinal herb which contains different phenol and flavonoid compounds that are responsible for Achillea pharmacological effects. We aimed to determine phenol and flavonoid contents, besides antioxidant activities of different extracts from Achillea eriophoraa (A. eriophora DC. and Achillea biebersteinii (A. biebersteinii Afan. (endemic species in Iran and to investigate their effects on human cells.Materials and Methods: Achillea extracts, were prepared by maceration and shaking methods, from different parts (aerial parts, stem, leaves and inflorescence of two species using methanol and ethanol as solvents. Total phenol and flavonoid contents were measured by spectrophotometry, and antioxidant activities of the extracts were determined by DPPH radical scavenging, BCB and TBARS assays. Cytotoxicity and antioxidant activities of the extracts were investigated in Human Foreskin Fibroblast (HFF3 cells using MTT, comet and H2O2 assays.Results: Methanol extracts of A. biebersteinii prepared from leaves and inflorescence by maceration method exhibited maximum phenol (1657.58 ± 36.45 mg GAE/100 g DW and flavonoid (264.00 ± 62.16 mg QUE/100 g DW contents. Leaf methanol extract showed significantly higher antioxidant activity (0.0276 ± 0.003, 0.16 ± 0.016 and 13.96 ± 0.26 mg/ml for DPPH, BCB and TBARS IC50s, respectively than those of the other extracts. Leaf extract of A. biebersteinii was not cytotoxic even at the highest examined dose (512 µg/ml and inhibited cell toxicity induced by H2O2 (98% viability for the cells pretreated with plant extract in the presence of H2O2. Comet assay also confirmed high DNA protective activity of leaf extracts.Conclusion: Achillea extracts possess remarkable antioxidant activity, and could be good natural alternatives to synthetic antioxidants in pharmaceutical and food industries.

  8. Comparative analysis of different DNA extraction protocols in fresh and herbarium specimens of the genus Dalbergia.

    Science.gov (United States)

    Ribeiro, R A; Lovato, M B

    2007-03-29

    Five published DNA extraction protocols were compared for their ability to produce good quality DNA from fresh and herbarium leaves of several species of the genus Dalbergia. The leaves of these species contain high amounts of secondary metabolites, which make it difficult to perform a clean DNA extraction and thereby interfering with subsequent PCR amplification. The protocol that produced the best DNA quality in most of the Dalbergia species analyzed, utilizes polyvinylpyrrolidone to bind the phenolic compounds, a high molar concentration of NaCl to inhibit co-precipitation of polysaccharides and DNA, and LiCl for removing RNA by selective precipitation. The DNA quality of herbarium specimens was worse than that for fresh leaves, due to collecting conditions and preservation of samples. We analyzed 54 herbarium specimens, but the recovered DNA allowed successful PCR amplification in only eight. For the genus Dalbergia, the herbarium is an important source of material for phylogenetic and evolutionary studies; due to the occurrence of the different species in various geographical regions in Brazil, it is difficult to obtain fresh material in nature. Our results demonstrated that for Dalbergia species the methods used for the collection and preservation of herbarium specimens have a mayor influence on DNA quality and in the success of phylogenetic studies of the species.

  9. Rapid and efficient method to extract metagenomic DNA from estuarine sediments.

    Science.gov (United States)

    Shamim, Kashif; Sharma, Jaya; Dubey, Santosh Kumar

    2017-07-01

    Metagenomic DNA from sediments of selective estuaries of Goa, India was extracted using a simple, fast, efficient and environment friendly method. The recovery of pure metagenomic DNA from our method was significantly high as compared to other well-known methods since the concentration of recovered metagenomic DNA ranged from 1185.1 to 4579.7 µg/g of sediment. The purity of metagenomic DNA was also considerably high as the ratio of absorbance at 260 and 280 nm ranged from 1.88 to 1.94. Therefore, the recovered metagenomic DNA was directly used to perform various molecular biology experiments viz. restriction digestion, PCR amplification, cloning and metagenomic library construction. This clearly proved that our protocol for metagenomic DNA extraction using silica gel efficiently removed the contaminants and prevented shearing of the metagenomic DNA. Thus, this modified method can be used to recover pure metagenomic DNA from various estuarine sediments in a rapid, efficient and eco-friendly manner.

  10. A high throughput DNA extraction method with high yield and quality

    Directory of Open Access Journals (Sweden)

    Xin Zhanguo

    2012-07-01

    Full Text Available Abstract Background Preparation of large quantity and high quality genomic DNA from a large number of plant samples is a major bottleneck for most genetic and genomic analyses, such as, genetic mapping, TILLING (Targeting Induced Local Lesion IN Genome, and next-generation sequencing directly from sheared genomic DNA. A variety of DNA preparation methods and commercial kits are available. However, they are either low throughput, low yield, or costly. Here, we describe a method for high throughput genomic DNA isolation from sorghum [Sorghum bicolor (L. Moench] leaves and dry seeds with high yield, high quality, and affordable cost. Results We developed a high throughput DNA isolation method by combining a high yield CTAB extraction method with an improved cleanup procedure based on MagAttract kit. The method yielded large quantity and high quality DNA from both lyophilized sorghum leaves and dry seeds. The DNA yield was improved by nearly 30 fold with 4 times less consumption of MagAttract beads. The method can also be used in other plant species, including cotton leaves and pine needles. Conclusion A high throughput system for DNA extraction from sorghum leaves and seeds was developed and validated. The main advantages of the method are low cost, high yield, high quality, and high throughput. One person can process two 96-well plates in a working day at a cost of $0.10 per sample of magnetic beads plus other consumables that other methods will also need.

  11. Does DNA extraction affect the physical and chemical composition of historical cod (Gadus morhua) otoliths?

    DEFF Research Database (Denmark)

    Therkildsen, Nina Overgaard; Eg Nielsen, Einar; Hüssy, Karin

    2010-01-01

    Archived otoliths constitute an important source of historical DNA for use in temporal genetic studies, but such otoliths are also valuable for other research applications, e.g. growth or microchemistry studies, where information about the past is of relevance. Consequently, there are potentially...... conflicting interests regarding how the limited and irreplaceable otolith collections should be used. To resolve this, it is important to find out whether DNA extraction damages otoliths such that they can no longer be used for other research purposes or whether individual otoliths can be used in multiple...... applications. We examined the effects of three different DNA extraction methods on the elemental composition, the morphology, and the clarity of annual growth increments for successful age estimation of Atlantic cod (Gadus morhua) otoliths that had been archived for 0–31 years. The three extraction methods...

  12. Application of FTA technology to extraction of sperm DNA from mixed body fluids containing semen.

    Science.gov (United States)

    Fujita, Yoshihiko; Kubo, Shin-ichi

    2006-01-01

    FTA technology is a novel method designed to simplify the collection, shipment, archiving and purification of nucleic acids from a wide variety of biological sources. In this study, we report a rapid and simple method of extracting DNA from sperm when body fluids mixed with semen were collected using FTA cards. After proteinase K digestion of the sperm and body fluid mixture, the washed pellet suspension as the sperm fraction and the concentrated supernatant as the epithelial cell fraction were respectively applied to FTA cards containing DTT. The FTA cards were dried, then directly added to a polymerase chain reaction (PCR) mix and processed by PCR. The time required from separation of the mixed fluid into sperm and epithelial origin DNA extractions was only about 2.5-3h. Furthermore, the procedure was extremely simple. It is considered that our designed DNA extraction procedure using an FTA card is available for application to routine work.

  13. Two cases of laparoscopic total colectomy with natural orifice specimen extraction and review of the literature.

    Science.gov (United States)

    Gundogan, Ersin; Aktas, Aydin; Kayaalp, Cuneyt; Gonultas, Fatih; Sumer, Fatih

    2017-09-01

    We present two cases of natural orifice specimen extraction (NOSE) after laparoscopic total colectomy and ileorectal anastomosis (TC-IRA), and we also review all of the previously reported cases. Our aim was to focus on patient selection for NOSE after TC-IRA. The PubMed and Google Scholar databases were scanned. Demographic features, surgical indications, and techniques were analyzed. Basic calculations were used for statistical analysis. A total of 13 cases were detected in addition to our 2 cases. All of the specimens were removed through the natural orifices successfully. No case required a diverting ileostomy. No patients were converted to open surgery or to conventional laparoscopy. Complications were reported in three patients. Transanal extractions were performed in 12 cases (10 colonic inertia, 2 polyposis), and transvaginal extractions were performed in 3 cases (2 malignancy, 1 colonic inertia). Both transanal and transvaginal specimen extractions after laparoscopic TC-IRA can be preferred. However, transanal extraction seems to be feasible in cases of TC for benign disease with a limited mesenteric-omental resection. If the indication is a malignancy requiring a mesenteric-omental resection, a transvaginal route should be preferred for a voluminous specimen.

  14. Comparison of three DNA extraction methods for the detection and quantification of GMO in Ecuadorian manufactured food.

    Science.gov (United States)

    Pacheco Coello, Ricardo; Pestana Justo, Jorge; Factos Mendoza, Andrés; Santos Ordoñez, Efrén

    2017-12-20

    In Ecuador, food products need to be labeled if exceeded 0.9% of transgenic content in whole products. For the detection of genetically modified organisms (GMOs), three DNA extraction methods were tested in 35 food products commercialized in Ecuador. Samples with positive amplification of endogenous genes were screened for the presence of the Cauliflower mosaic virus 35S-promoter (P35S) and the nopaline synthase-terminator (Tnos). TaqMan™ probes were used for determination of transgenic content of the GTS 40-3-2 and MON810 events through quantitative PCR (qPCR). Twenty-six processed food samples were positive for the P35S alone and eight samples for the Tnos and P35S. Absolute qPCR results indicated that eleven samples were positive for GTS 40-3-2 specific event and two for MON810 specific event. A total of nine samples for events GTS 40-3-2 and MON810 exceeded the umbral allowed of transgenic content in the whole food product with the specific events. Different food products may require different DNA extraction protocols for GMO detection through PCR. Among the three methods tested, the DNeasy mericon food kit DNA extraction method obtained higher proportion of amplified endogenous genes through PCR. Finally, event-specific GMOs were detected in food products in Ecuador.

  15. Validation of an HPLC method for quantification of total quercetin in Calendula officinalis extracts

    International Nuclear Information System (INIS)

    Muñoz Muñoz, John Alexander; Morgan Machado, Jorge Enrique; Trujillo González, Mary

    2015-01-01

    Introduction: calendula officinalis extracts are used as natural raw material in a wide range of pharmaceutical and cosmetic preparations; however, there are no official methods for quality control of these extracts. Objective: to validate an HPLC-based analytical method for quantification total quercetin in glycolic and hydroalcoholic extracts of Calendula officinalis. Methods: to quantify total quercetin content in the matrices, it was necessary to hydrolyze flavonoid glycosides under optimal conditions. The chromatographic separation was performed on a C-18 SiliaChrom 4.6x150 mm 5 µm column, adapted to a SiliaChrom 5 um C-18 4.6x10 mm precolumn, with UV detection at 370 nm. The gradient elution was performed with a mobile phase consisting of methanol (MeOH) and phosphoric acid (H 3 PO 4 ) (0.08 % w/v). The quantification was performed through the external standard method and comparison with quercetin reference standard. Results: the studied method selectivity against extract components and degradation products under acid/basic hydrolysis, oxidation and light exposure conditions showed no signals that interfere with the quercetin quantification. It was statistically proved that the method is linear from 1.0 to 5.0 mg/mL. Intermediate precision expressed as a variation coefficient was 1.8 and 1.74 % and the recovery percentage was 102.15 and 101.32 %, for glycolic and hydroalcoholic extracts, respectively. Conclusions: the suggested methodology meets the quality parameters required for quantifying total quercetin, which makes it a useful tool for quality control of C. officinalis extracts. (author)

  16. Studies on total polyphenols and reducing power of aqueous extracts from selected lamiaceae species

    Directory of Open Access Journals (Sweden)

    Maria Cioroi

    2010-08-01

    Full Text Available Certain phytochemicals in species are attracting increased attention because of a wide range of biological activities especially the possible cancer preventive properties. Polyphenols, the naturalantioxidants are present in plant extracts and they play a key role in antioxidative defence mechanisms in biological systems and they act as free radicals scavenging agents. Polyphenols might thereforeinhibit development of coronary heart disease and cancers. Basil, oregano and sage are highly fragrant plants whose leaves are used as a seasoning herb for many different types of foods. Aqueous extractswere prepared from basil (Ocimum basilicum L., oregano (Origanum vulgare L. and sage (Salvia officinalis L.. To check the phenols presence, the UV-VIS spectrum was made. The amount of polyphenolic compounds from selected Lamiaceae species was determined by spectrophotometry method using the Folin - Ciocalteau reagent and gallic acid as standard. The range of polyphenols total was between 516,352 mg/100g dried species and 859,617 mg/100g dried species.Reducing power has been established by measuring the redox potential of aqueous extracts. Antioxidant activity was directly correlated with the total amount of polyphenols in the species extracts.The free reducing sugars in aqueous extracts from species were analyzed and correlated to the total content of polyphenols.

  17. Automated extraction of DNA and PCR setup using a Tecan Freedom EVO® liquid handler

    DEFF Research Database (Denmark)

    Frøslev, Tobias Guldberg; Hansen, Anders Johannes; Stangegaard, Michael

    2009-01-01

    We have implemented and validated automated protocols for DNA extraction and PCR setup using a Tecan Freedom EVO® liquid handler mounted with the TeMagS magnetic separation device. The methods were validated for accredited, forensic genetic work according to ISO 17025 using the Qiagen Mag...... genetic DNA typing can be implemented on a simple robot leading to the reduction of manual work as well as increased quality and throughput....

  18. INVESTIGATION OF METHODS OF DNA EXTRACTION FROM PLANT ORIGIN OBJECTS AND FOODS BASED ON THEM

    Directory of Open Access Journals (Sweden)

    L. S. Dyshlyuk

    2014-01-01

    Full Text Available For the last decades modern and highly efficient methods of determining the quality and safety of food products, based on the application of the latest scientific achievements were developed in the world. A special place is given to the methods based on achievements of molecular biology and genetics. At the present stage of development in the field of assessing the quality of raw materials and processed food products much attention is given to highly accurate, sensitive and specific research methods, the method of polymerase chain reaction (PCR occupying a leading place among them. PCR is a sophisticated method that simulates the natural DNA replication and allows to detect a single specific DNA molecule in the presence of millions of other molecules. The key point in the preparation of material for PCR is the extraction of nucleic acids. The low content of DNA in plant material and the high concentration of secondary metabolites complicate the process of extraction. The key solution to this problem is highly effective method of extraction, which allows to obtain the DNA of adequate quality and purity. Comparative analysis of methods for the extraction of nucleic acids from fruit raw materials and products based on them was carried out in the study. General analysis of the experimental data allowed us to determine the most efficient method for DNA extracting. In the comparative analysis it was found out that to extract DNA from plant raw materials and food products prepared on their basis it is the most suitable to use "Sorb-GMO-A" reactants kit (set. The approach described gives us a brilliant opportunity to obtain deoxyribonucleic acid proper quality and purity.

  19. Study of microtip-based extraction and purification of DNA from human samples for portable devices

    Science.gov (United States)

    Fotouhi, Gareth

    DNA sample preparation is essential for genetic analysis. However, rapid and easy-to-use methods are a major challenge to obtaining genetic information. Furthermore, DNA sample preparation technology must follow the growing need for point-of-care (POC) diagnostics. The current use of centrifuges, large robots, and laboratory-intensive protocols has to be minimized to meet the global challenge of limited access healthcare by bringing the lab to patients through POC devices. To address these challenges, a novel extraction method of genomic DNA from human samples is presented by using heat-cured polyethyleneimine-coated microtips generating a high electric field. The microtip extraction method is based on recent work using an electric field and capillary action integrated into an automated device. The main challenges to the method are: (1) to obtain a stable microtip surface for the controlled capture and release of DNA and (2) to improve the recovery of DNA from samples with a high concentration of inhibitors, such as human samples. The present study addresses these challenges by investigating the heat curing of polyethyleneimine (PEI) coated on the surface of the microtip. Heat-cured PEI-coated microtips are shown to control the capture and release of DNA. Protocols are developed for the extraction and purification of DNA from human samples. Heat-cured PEI-coated microtip methods of DNA sample preparation are used to extract genomic DNA from human samples. It is discovered through experiment that heat curing of a PEI layer on a gold-coated surface below 150°C could inhibit the signal of polymerase chain reaction (PCR). Below 150°C, the PEI layer is not completely cured and dissolved off the gold-coated surface. Dissolved PEI binds with DNA to inhibit PCR. Heat curing of a PEI layer above 150°C on a gold-coated surface prevents inhibition to PCR and gel electrophoresis. In comparison to gold-coated microtips, the 225°C-cured PEI-coated microtips improve the

  20. Rapid methods for the extraction and archiving of molecular grade fungal genomic DNA.

    Science.gov (United States)

    Borman, Andrew M; Palmer, Michael; Johnson, Elizabeth M

    2013-01-01

    The rapid and inexpensive extraction of fungal genomic DNA that is of sufficient quality for molecular approaches is central to the molecular identification, epidemiological analysis, taxonomy, and strain typing of pathogenic fungi. Although many commercially available and in-house extraction procedures do eliminate the majority of contaminants that commonly inhibit molecular approaches, the inherent difficulties in breaking fungal cell walls lead to protocols that are labor intensive and that routinely take several hours to complete. Here we describe several methods that we have developed in our laboratory that allow the extremely rapid and inexpensive preparation of fungal genomic DNA.

  1. Minimally destructive DNA extraction from archaeological artefacts made from whale baleen

    DEFF Research Database (Denmark)

    Sinding, Mikkel Holger Strander; Gilbert, Tom; Grønnow, Bjarne

    2012-01-01

    Here we demonstrate the successful extraction and amplification of target species DNA from artefacts made of whale baleen collected from excavations of past palaeo-Eskimo and Inuit cultures in Greenland. DNA was successfully extracted and amplified from a single baleen bristle of 1.5 cm length...... genetic studies. We conclude that genetic investigation of historical baleen collections can contribute to our knowledge of the prehistoric population genetics of baleen whales, for example by quantifying the impact of modern whaling on the genetic diversity of bowhead whales....

  2. Assessing genetic polymorphisms using DNA extracted from cells present in saliva samples

    Directory of Open Access Journals (Sweden)

    Nemoda Zsofia

    2011-12-01

    Full Text Available Abstract Background Technical advances following the Human Genome Project revealed that high-quality and -quantity DNA may be obtained from whole saliva samples. However, usability of previously collected samples and the effects of environmental conditions on the samples during collection have not been assessed in detail. In five studies we document the effects of sample volume, handling and storage conditions, type of collection device, and oral sampling location, on quantity, quality, and genetic assessment of DNA extracted from cells present in saliva. Methods Saliva samples were collected from ten adults in each study. Saliva volumes from .10-1.0 ml, different saliva collection devices, sampling locations in the mouth, room temperature storage, and multiple freeze-thaw cycles were tested. One representative single nucleotide polymorphism (SNP in the catechol-0-methyltransferase gene (COMT rs4680 and one representative variable number of tandem repeats (VNTR in the serotonin transporter gene (5-HTTLPR: serotonin transporter linked polymorphic region were selected for genetic analyses. Results The smallest tested whole saliva volume of .10 ml yielded, on average, 1.43 ± .77 μg DNA and gave accurate genotype calls in both genetic analyses. The usage of collection devices reduced the amount of DNA extracted from the saliva filtrates compared to the whole saliva sample, as 54-92% of the DNA was retained on the device. An "adhered cell" extraction enabled recovery of this DNA and provided good quality and quantity DNA. The DNA from both the saliva filtrates and the adhered cell recovery provided accurate genotype calls. The effects of storage at room temperature (up to 5 days, repeated freeze-thaw cycles (up to 6 cycles, and oral sampling location on DNA extraction and on genetic analysis from saliva were negligible. Conclusions Whole saliva samples with volumes of at least .10 ml were sufficient to extract good quality and quantity DNA. Using

  3. Phytochemicals Screening, Total Phenol Estimation, Antioxidant Activity of Blainvillea Acmella Leaf and Stem Successive Extracts

    International Nuclear Information System (INIS)

    Sharma, P.; Sharma, G.N.; Shrivastava, B.; Jadhav, H.R.

    2014-01-01

    The aim of present work was to investigate antioxidant potential of different extracts of Blainvillea acmella leaf and stem. The successive extraction of individual plant part was carried out using solvents of different polarity viz. n-hexane, ethyl acetate, methanol and water. Preliminary phyto chemical screening of all the extracts was done. The present total phenolic contents were estimated by Folin-Ciocalteu reagent method and expressed as μg/ mg of gallic acid equivalent. The antioxidant potential and reducing power of all the prepared extracts were measured against DPPH, as compared to standard ascorbic acid, and BHA respectively. The result data indicate that the phenolic contents were higher in methanolic extracts of leaf (73.67 ± 0.38 mg/ g) followed by ethyl acetate (29.08 ± 0.38 mg/ g), aqueous (21.50 ± 0.28 mg/ g), and n-Hexane (9.29 ± 0.38 mg/ g); gallic acid equivalent. The similar pattern in stem part was also observed for example methanolic extracts (41.90 ± 0.45 mg/ g), ethyl acetate (21.92 ± 0.28 mg/ g), aqueous (15.13 ± 0.18 mg/ g), and n-Hexane (3.69 ± 0.28 mg/ g). The antioxidant capacity of methanolic extract of both the part for example leaf and stem was found to be maximum, as IC50 values were 226.49 ± 0.16, 402.05 ± 1.10 respectively. The reducing power was also highest in methanol extract of both parts. The result data conclude that the higher antioxidant as well as reducing power may be due to present phenolic contents. (author)

  4. Novel extraction strategy of ribosomal RNA and genomic DNA from cheese for PCR-based investigations.

    Science.gov (United States)

    Bonaïti, Catherine; Parayre, Sandrine; Irlinger, Françoise

    2006-03-15

    Cheese microorganisms, such as bacteria and fungi, constitute a complex ecosystem that plays a central role in cheeses ripening. The molecular study of cheese microbial diversity and activity is essential but the extraction of high quality nucleic acid may be problematic: the cheese samples are characterised by a strong buffering capacity which negatively influenced the yield of the extracted rRNA. The objective of this study is to develop an effective method for the direct and simultaneous isolation of yeast and bacterial ribosomal RNA and genomic DNA from the same cheese samples. DNA isolation was based on a protocol used for nucleic acids isolation from anaerobic digestor, without preliminary washing step with the combined use of the action of chaotropic agent (acid guanidinium thiocyanate), detergents (SDS, N-lauroylsarcosine), chelating agent (EDTA) and a mechanical method (bead beating system). The DNA purification was carried out by two washing steps of phenol-chloroform. RNA was isolated successfully after the second acid extraction step by recovering it from the phenolic phase of the first acid extraction. The novel method yielded pure preparation of undegraded RNA accessible for reverse transcription-PCR. The extraction protocol of genomic DNA and rRNA was applicable to complex ecosystem of different cheese matrices.

  5. Two simple techniques for the safe Sarcoptes collection and individual mite DNA extraction.

    Science.gov (United States)

    Soglia, Dominga; Rambozzi, Luisa; Maione, Sandra; Spalenza, Veronica; Sartore, Stefano; Alasaad, Samer; Sacchi, Paola; Rossi, Luca

    2009-10-01

    Availability of mites is a recognized limiting factor of biological and genetic investigations of the genus Sarcoptes. Current methods of deoxyribonucleic acid (DNA) extraction from individual mites also need substantial improvement in efficiency and operator friendliness. We have first developed a technique for efficient and safe extraction of living mites from scabietic skin samples (crusts or deep skin scrapings). Its core device is a large plastic syringe connected with a 1.5-ml Eppendorf tube. The source material is introduced in the syringe and the device in a shoe box with the tip half of the tube emerging. Mites migrate towards a heat source during a minimum of 36 h. Then, the tube is detached and the mites utilized without risks for the operators. A second technique allows operator-friendly manipulation of individual mites for DNA extraction. Fixed mites are isolated by adhesion to a small strip of polyvinyl chloride (PVC) adhesive tape operated with tweezers. Then, mite and strip are plunged in the lyses buffer and the sample twice submitted to thermal shock for disruption of the chitinous exoskeleton. Data show that the tape does not interfere with successive DNA extraction with a commercial kit. The corresponding protocol, that we briefly name "PVC adhesive tape + thermal shock + kit DNA extraction," compares favorably with the available ones.

  6. Genomic DNA extraction and barcoding of endophytic fungi.

    Science.gov (United States)

    Diaz, Patricia L; Hennell, James R; Sucher, Nikolaus J

    2012-01-01

    Endophytes live inter- and/or intracellularly inside healthy aboveground tissues of plants without causing disease. Endophytic fungi are found in virtually every vascular plant species examined. The origins of this symbiotic relationship between endophytes go back to the emergence of vascular plants. Endophytic fungi receive nutrition and protection from their hosts while the plants benefit from the production of fungal secondary metabolites, which enhance the host plants' resistance to herbivores, pathogens, and various abiotic stresses. Endophytic fungi have attracted increased interest as potential sources of secondary metabolites with agricultural, industrial, and medicinal use. This chapter provides detailed protocols for isolation of genomic DNA from fungal endophytes and its use in polymerase chain reaction-based amplification of the internal transcribed spacer region between the conserved flanking regions of the small and large subunit of ribosomal RNA for barcoding purposes.

  7. Ancient DNA extracted from Danish aurochs (Bos primigenius)

    DEFF Research Database (Denmark)

    Nielsen, Peter Gravlund; Aaris-Sørensen, Kim; Hofreiter, Michael

    2012-01-01

    study of genetic variation of Danish aurochs. In addition, for all specimens we address correlations between the ability to obtain DNA sequences and various parameters such as the age of the sample, the collagen content, the museum storage period, Danish geography and whether the specimens were found...... in an archeological or geological context. We find that aurochs from southern Scandinavia display a star-shaped population genetic structure, that is indicative of a local and relatively recent diversification from a few ancestral haplotypes that may have originated in the ancestral Western European population before...... migration northwards during the retreat of the glaciers. Scenarios suggesting several invasions of genetically distinct aurochs are not supported by these analyses. Rather, our results suggest that a single continuous migration northward occurred. Our findings also suggest, although with only limited...

  8. Rapid extraction of genomic DNA from saliva for HLA typing on microarray based on magnetic nanobeads

    Energy Technology Data Exchange (ETDEWEB)

    Xie Xin; Zhang Xu E-mail: shinezhang@hotmail.com; Yu Bingbin; Gao Huafang; Zhang Huan; Fei Weiyang

    2004-09-01

    A series of simplified protocols are developed for extracting genomic DNA from saliva by using the magnetic nanobeads as absorbents. In these protocols, both the enrichment of the target cells and the adsorption of DNA can be achieved simultaneously by our functionally modified magnetic beads in one step, and the DNA-nanobeads complex can be used as PCR templates. HLA typing based on an oligonucleotide array was conducted by hybridization with the PCR products. The result shows that the protocols are robust and sensitive.

  9. An Improved Method for High Quality Metagenomics DNA Extraction from Human and Environmental Samples

    DEFF Research Database (Denmark)

    Bag, Satyabrata; Saha, Bipasa; Mehta, Ojasvi

    2016-01-01

    and human origin samples. We introduced a combination of physical, chemical and mechanical lysis methods for proper lysis of microbial inhabitants. The community microbial DNA was precipitated by using salt and organic solvent. Both the quality and quantity of isolated DNA was compared with the existing...... methodologies and the supremacy of our method was confirmed. Maximum recovery of genomic DNA in the absence of substantial amount of impurities made the method convenient for nucleic acid extraction. The nucleic acids obtained using this method are suitable for different downstream applications. This improved...

  10. Assessment of DNA extracted from FTA® cards for use on the Illumina iSelect BeadChip

    Science.gov (United States)

    McClure, Matthew C; McKay, Stephanie D; Schnabel, Robert D; Taylor, Jeremy F

    2009-01-01

    Background As FTA® cards provide an ideal medium for the field collection of DNA we sought to assess the quality of genomic DNA extracted from this source for use on the Illumina BovineSNP50 iSelect BeadChip which requires unbound, relatively intact (fragment sizes ≥ 2 kb), and high-quality DNA. Bovine blood and nasal swab samples collected on FTA cards were extracted using the commercially available GenSolve kit with a minor modification. The call rate and concordance of genotypes from each sample were compared to those obtained from whole blood samples extracted by standard PCI extraction. Findings An ANOVA analysis indicated no significant difference (P > 0.72) in BovineSNP50 genotype call rate between DNA extracted from FTA cards by the GenSolve kit or extracted from whole blood by PCI. Two sample t-tests demonstrated that the DNA extracted from the FTA cards produced genotype call and concordance rates that were not different to those produced by assaying DNA samples extracted by PCI from whole blood. Conclusion We conclude that DNA extracted from FTA cards by the GenSolve kit is of sufficiently high quality to produce results comparable to those obtained from DNA extracted from whole blood when assayed by the Illumina iSelect technology. Additionally, we validate the use of nasal swabs as an alternative to venous blood or buccal samples from animal subjects for reliably producing high quality genotypes on this platform. PMID:19531223

  11. Assessment of DNA extracted from FTA cards for use on the Illumina iSelect BeadChip.

    Science.gov (United States)

    McClure, Matthew C; McKay, Stephanie D; Schnabel, Robert D; Taylor, Jeremy F

    2009-06-16

    As FTA cards provide an ideal medium for the field collection of DNA we sought to assess the quality of genomic DNA extracted from this source for use on the Illumina BovineSNP50 iSelect BeadChip which requires unbound, relatively intact (fragment sizes >or= 2 kb), and high-quality DNA. Bovine blood and nasal swab samples collected on FTA cards were extracted using the commercially available GenSolve kit with a minor modification. The call rate and concordance of genotypes from each sample were compared to those obtained from whole blood samples extracted by standard PCI extraction. An ANOVA analysis indicated no significant difference (P > 0.72) in BovineSNP50 genotype call rate between DNA extracted from FTA cards by the GenSolve kit or extracted from whole blood by PCI. Two sample t-tests demonstrated that the DNA extracted from the FTA cards produced genotype call and concordance rates that were not different to those produced by assaying DNA samples extracted by PCI from whole blood. We conclude that DNA extracted from FTA cards by the GenSolve kit is of sufficiently high quality to produce results comparable to those obtained from DNA extracted from whole blood when assayed by the Illumina iSelect technology. Additionally, we validate the use of nasal swabs as an alternative to venous blood or buccal samples from animal subjects for reliably producing high quality genotypes on this platform.

  12. Assessment of DNA extracted from FTA® cards for use on the Illumina iSelect BeadChip

    Directory of Open Access Journals (Sweden)

    Schnabel Robert D

    2009-06-01

    Full Text Available Abstract Background As FTA® cards provide an ideal medium for the field collection of DNA we sought to assess the quality of genomic DNA extracted from this source for use on the Illumina BovineSNP50 iSelect BeadChip which requires unbound, relatively intact (fragment sizes ≥ 2 kb, and high-quality DNA. Bovine blood and nasal swab samples collected on FTA cards were extracted using the commercially available GenSolve kit with a minor modification. The call rate and concordance of genotypes from each sample were compared to those obtained from whole blood samples extracted by standard PCI extraction. Findings An ANOVA analysis indicated no significant difference (P > 0.72 in BovineSNP50 genotype call rate between DNA extracted from FTA cards by the GenSolve kit or extracted from whole blood by PCI. Two sample t-tests demonstrated that the DNA extracted from the FTA cards produced genotype call and concordance rates that were not different to those produced by assaying DNA samples extracted by PCI from whole blood. Conclusion We conclude that DNA extracted from FTA cards by the GenSolve kit is of sufficiently high quality to produce results comparable to those obtained from DNA extracted from whole blood when assayed by the Illumina iSelect technology. Additionally, we validate the use of nasal swabs as an alternative to venous blood or buccal samples from animal subjects for reliably producing high quality genotypes on this platform.

  13. Comparison of three mycobacterial DNA extraction methods from extrapulmonary samples for PCR assay

    Directory of Open Access Journals (Sweden)

    Khandaker Shadia

    2012-01-01

    Full Text Available Sensitivity of the molecular diagnostic tests of extrapulmonary tuberculosis largely depends upon the efficiency of DNA extraction methods. The objective of our study was to compare three methods of extracting DNA of Mycobacterium tuberculosis for testing by polymerase chain reaction. All three methods; heating, heating with sonication and addition of lysis buffer with heating and sonication were implicated on 20 extrapulmonary samples. PCR positivity was 2 (10%, 4 (20% and 7 (35% in the samples extracted by heating, heat+sonication and heat+sonication+lysis buffer method respectively. Of the extraction methods evaluated, maximum PCR positive results were achieved by combined heat, sonication and lysis buffer method which can be applied in routine clinical practice. Ibrahim Med. Coll. J. 2012; 6(1: 9-11

  14. Improving Griffith's protocol for co-extraction of microbial DNA and RNA in adsorptive soils

    DEFF Research Database (Denmark)

    Paulin, Mélanie Marie; Nicolaisen, Mette Haubjerg; Jacobsen, Carsten Suhr

    2013-01-01

    Quantification of microbial gene expression is increasingly being used to study key functions in soil microbial communities, yet major limitations still exist for efficient extraction of nucleic acids, especially RNA for transcript analysis, from this complex matrix. We present an improved......-time PCR on both the RNA (after conversion to cDNA) and the DNA fraction of the extracts. Non-adsorptive soils were characterized by low clay content and/or high phosphate content, whereas adsorptive soils had clay contents above 20% and/or a strong presence of divalent Ca in combination with high p......H. Modifications to the co-extraction protocol improved nucleic acid extraction efficiency from all adsorptive soils and were successfully validated by DGGE analysis of the indigenous community based on 16S rRNA gene and transcripts in soils representing low biomass and/or high clay content. This new approach...

  15. DNA extraction in Echinococcus granulosus and Taenia spp. eggs in dogs stool samples applying thermal shock.

    Science.gov (United States)

    Hidalgo, Alejandro; Melo, Angélica; Romero, Fernando; Hidalgo, Víctor; Villanueva, José; Fonseca-Salamanca, Flery

    2018-03-01

    The extraction of DNA in taeniid eggs shows complications attached to the composition of stool samples and the high resistance of eggs to degradation. The objective of this study was to test a method of DNA extraction in taeniid eggs by applying a thermal shock to facilitate the chemical-enzymatic degradation of these elements. A group of six tubes containing 1 ml of dog stool sample was spiked with eggs of Echinococcus granulosus and another group of six with Taenia pisiformis. Samples were floated with supersaturated sugar solution and centrifuged. The upper portion of each tube (500 μl) was aspirated and deposited in 1.5 ml tubes. Three tubes from each group were incubated at -20 °C and then at 90 °C, the remaining three from each group, incubated at room temperature. Proteinase K and lysis buffer were added to each tube and incubated for 12 h at 58 °C. The lysis effect was evaluated by microscopy at 3, 6 and 12 h and integrity by electrophoresis in 1% agarose gels. With the same experimental scheme, the thermal shock effect was evaluated in extractions of 1, 2, 3 and 4 eggs of each species and the DNA was quantified. Additionally, the protocol was applied in samples of 4 dogs diagnosed with natural infection by Taeniidae worms. Finally, all the extractions were tested by PCR amplification. Both E. granulosus and T. pisiformis eggs showed a similar response in the tests. In samples without treatment, the lysis effect was poor and showed no differences over time, but in those subjected to thermal shock, eggs degradation increased with time. In both treatments, there was no DNA loss integrity. The protocol applied to limited amounts of eggs yielded PCR products in 100% of the samples exposed to thermal shock, allowing PCR amplifications up to 1 egg. In non-exposed samples, the results were not replicable. However, DNA quantification showed low values in both treatments. In turn, DNA extractions with thermal shock in infected dog samples

  16. DNA extraction methods for panbacterial and panfungal PCR detection in intraocular fluids.

    Science.gov (United States)

    Mazoteras, Paloma; Bispo, Paulo José Martins; Höfling-Lima, Ana Luisa; Casaroli-Marano, Ricardo P

    2015-07-01

    Three different methods of DNA extraction from intraocular fluids were compared with subsequent detection for bacterial and fungal DNA by universal PCR amplification. Three DNA extraction methods, from aqueous and vitreous humors, were evaluated to compare their relative efficiency. Bacterial (Gram positive and negative) and fungal strains were used in this study: Escherichia coli, Staphylococcus epidermidis and Candida albicans. The quality, quantification, and detection limit for DNA extraction and PCR amplification were analyzed. Validation procedures for 13 aqueous humor and 14 vitreous samples, from 20 patients with clinically suspected endophthalmitis were carried out. The column-based extraction method was the most time-effective, achieving DNA detection limits ≥10(2) and 10(3 )CFU/100 µL for bacteria and fungi, respectively. PCR amplification detected 100 fg, 1 pg and 10 pg of genomic DNA of E. coli, S. epidermidis and C. albicans respectively. PCR detected 90.0% of the causative agents from 27 intraocular samples collected from 20 patients with clinically suspected endophthalmitis, while standard microbiological techniques could detect only 60.0%. The most frequently found organisms were Streptococcus spp. in 38.9% (n = 7) of patients and Staphylococcus spp. found in 22.2% (n = 4). The column-based extraction method for very small inocula in small volume samples (50-100 µL) of aqueous and/or vitreous humors allowed PCR amplification in all samples with sufficient quality for subsequent sequencing and identification of the microorganism in the majority of them.

  17. Low cost extraction and isothermal amplification of DNA for infectious diarrhea diagnosis.

    Directory of Open Access Journals (Sweden)

    Shichu Huang

    Full Text Available In order to counter the common perception that molecular diagnostics are too complicated to work in low resource settings, we have performed a difficult sample preparation and DNA amplification protocol using instrumentation designed to be operated without wall or battery power. In this work we have combined a nearly electricity-free nucleic acid extraction process with an electricity-free isothermal amplification assay to detect the presence of Clostridium difficile (C. difficile DNA in the stool of infected patients. We used helicase-dependent isothermal amplification (HDA to amplify the DNA in a low-cost, thermoplastic reaction chip heated with a pair of commercially available toe warmers, while using a simple Styrofoam insulator. DNA was extracted from known positive and negative stool samples. The DNA extraction protocol utilized an air pressure driven solid phase extraction device run using a standard bicycle pump. The simple heater setup required no electricity or battery and was capable of maintaining the temperature at 65°C±2°C for 55 min, suitable for repeatable HDA amplification. Experiments were performed to explore the adaptability of the system for use in a range of ambient conditions. When compared to a traditional centrifuge extraction protocol and a laboratory thermocycler, this disposable, no power platform achieved approximately the same lower limit of detection (1.25×10(-2 pg of C. difficile DNA while requiring much less raw material and a fraction of the lab infrastructure and cost. This proof of concept study could greatly impact the accessibility of molecular assays for applications in global health.

  18. Low Cost Extraction and Isothermal Amplification of DNA for Infectious Diarrhea Diagnosis

    Science.gov (United States)

    Huang, Shichu; Do, Jaephil; Mahalanabis, Madhumita; Fan, Andy; Zhao, Lei; Jepeal, Lisa; Singh, Satish K.; Klapperich, Catherine M.

    2013-01-01

    In order to counter the common perception that molecular diagnostics are too complicated to work in low resource settings, we have performed a difficult sample preparation and DNA amplification protocol using instrumentation designed to be operated without wall or battery power. In this work we have combined a nearly electricity-free nucleic acid extraction process with an electricity-free isothermal amplification assay to detect the presence of Clostridium difficile (C. difficile) DNA in the stool of infected patients. We used helicase-dependent isothermal amplification (HDA) to amplify the DNA in a low-cost, thermoplastic reaction chip heated with a pair of commercially available toe warmers, while using a simple Styrofoam insulator. DNA was extracted from known positive and negative stool samples. The DNA extraction protocol utilized an air pressure driven solid phase extraction device run using a standard bicycle pump. The simple heater setup required no electricity or battery and was capable of maintaining the temperature at 65°C±2°C for 55 min, suitable for repeatable HDA amplification. Experiments were performed to explore the adaptability of the system for use in a range of ambient conditions. When compared to a traditional centrifuge extraction protocol and a laboratory thermocycler, this disposable, no power platform achieved approximately the same lower limit of detection (1.25×10−2 pg of C. difficile DNA) while requiring much less raw material and a fraction of the lab infrastructure and cost. This proof of concept study could greatly impact the accessibility of molecular assays for applications in global health. PMID:23555883

  19. Total phenolic and flavonoid contents and biological activities of Cachrys cristata DC. extracts

    Directory of Open Access Journals (Sweden)

    Matejić Jelena S.

    2014-01-01

    Full Text Available The total phenolic/flavonoid contents and antioxidant potential of the methanol, ethyl-acetate, acetone and water extracts obtained from the aerial parts and fruits of Cachrys cristata DC.(Apiaceae were compared. The total phenolic contents of the tested extracts were determined using Folin-Ciocalteu’s reagent. The amounts per g of dry plant extract of gallic acid (GA and quercetin (Qu ranged between 22.60-166.97 mg, and 8.91-46.02 mg, respectively. The antioxidant activity, expressed as IC50, ranged from 1.784-17.621 mg/mL and from 1.01-3.42 mg L(+-ascorbic acid (Vitamin C/g when tested with 2,2-diphenyl-1-picrylhydrazyl (DPPH and ABTS, respectively. The antimicrobial activity of the extracts was investigated by the microwell dilution assay, for the most common human gastrointestinal pathogenic bacterial strains: Escherichia coli ATCC 25922, Pseudomonas aeruginosa ATCC 9027, Salmonella enteritidis ATCC 13076, Bacillus cereus ATCC 10876, Listeria monocytogenes ATCC15313, Staphylococcus aureus ATCC 25923 and yeast Candida albicans ATCC 10231. The results indicate that C. cristata can be regarded as a potential source of antioxidant and antimicrobial agents. [Projekat Ministarstva nauke Republike Srbije, br. 173029

  20. A novel technology coupling extraction and foam fractionation for separating the total saponins from Achyranthes bidentata.

    Science.gov (United States)

    Ding, Linlin; Wang, Yanji; Wu, Zhaoliang; Liu, Wei; Li, Rui; Wang, Yanyan

    2016-10-02

    A novel technology coupling extraction and foam fractionation was developed for separating the total saponins from Achyranthes bidentata. In the developed technology, the powder of A. bidentata was loaded in a nylon filter cloth pocket with bore diameter of 180 µm. The pocket was fixed in the bulk liquid phase for continuously releasing saponins. Under the optimal conditions, the concentration and the extraction rate of the total saponins in the foamate by the developed technology were 73.5% and 416.2% higher than those by the traditional technology, respectively. The foamates obtained by the traditional technology and the developed technology were analyzed by ultraperformance liquid chromatography-mass spectrometry to determine their ingredients, and the results appeared that the developed technology exhibited a better performance for separating saponins than the traditional technology. The study is expected to develop a novel technology for cost effectively separating plant-derived materials with surface activity.

  1. Robust microwave-assisted extraction protocol for determination of total mercury and methylmercury in fish tissues

    Energy Technology Data Exchange (ETDEWEB)

    Reyes, L. Hinojosa; Rahman, G.M. Mizanur [Department of Chemistry and Biochemistry, Duquesne University, Pittsburgh, PA 15282 (United States); Kingston, H.M. Skip [Department of Chemistry and Biochemistry, Duquesne University, Pittsburgh, PA 15282 (United States)], E-mail: kingston@duq.edu

    2009-01-12

    A rapid and efficient closed vessel microwave-assisted extraction (MAE) method based on acidic leaching was developed and optimized for the extraction of total mercury (Hg), inorganic mercury (Hg{sup 2+}) and methylmercury (CH{sub 3}Hg{sup +}) from fish tissues. The quantitative extraction of total Hg and mercury species from biological samples was achieved by using 5 mol L{sup -1} HCl and 0.25 mol L{sup -1} NaCl during 10 min at 60 deg. C. Total Hg content was determined using inductively coupled plasma mass spectrometry (ICP-MS). Mercury species were measured by liquid chromatography hyphenated with inductively coupled plasma mass spectrometry (LC-ICP-MS). The method was validated using biological certified reference materials ERM-CE464, DOLT-3, and NIST SRM-1946. The analytical results were in good agreement with the certified reference values of total Hg and CH{sub 3}Hg{sup +} at a 95% confidence level. Further, accuracy validation using speciated isotope-dilution mass spectrometry (SIDMS, as described in the EPA Method 6800) was carried out. SIDMS was also applied to study and correct for unwanted species transformation reactions during and/or after sample preparation steps. For the studied reference materials, no statistically significant transformation between mercury species was observed during the extraction and determination procedures. The proposed method was successfully applied to fish tissues with good agreement between SIDMS results and external calibration (EC) results. Interspecies transformations in fish tissues were slightly higher than certified reference materials due to differences in matrix composition. Depending on the type of fish tissue, up to 10.24% of Hg{sup 2+} was methylated and up to 1.75% of CH{sub 3}Hg{sup +} was demethylated to Hg{sup 2+}.

  2. Evaluation by latent class analysis of a magnetic capture based DNA extraction followed by real-time qPCR as a new diagnostic method for detection of Echinococcus multilocularis in definitive hosts.

    Science.gov (United States)

    Maas, Miriam; van Roon, Annika; Dam-Deisz, Cecile; Opsteegh, Marieke; Massolo, Alessandro; Deksne, Gunita; Teunis, Peter; van der Giessen, Joke

    2016-10-30

    A new method, based on a magnetic capture based DNA extraction followed by qPCR, was developed for the detection of the zoonotic parasite Echinococcus multilocularis in definitive hosts. Latent class analysis was used to compare this new method with the currently used phenol-chloroform DNA extraction followed by single tube nested PCR. In total, 60 red foxes and coyotes from three different locations were tested with both molecular methods and the sedimentation and counting technique (SCT) or intestinal scraping technique (IST). Though based on a limited number of samples, it could be established that the magnetic capture based DNA extraction followed by qPCR showed similar sensitivity and specificity as the currently used phenol-chloroform DNA extraction followed by single tube nested PCR. All methods have a high specificity as shown by Bayesian latent class analysis. Both molecular assays have higher sensitivities than the combined SCT and IST, though the uncertainties in sensitivity estimates were wide for all assays tested. The magnetic capture based DNA extraction followed by qPCR has the advantage of not requiring hazardous chemicals like the phenol-chloroform DNA extraction followed by single tube nested PCR. This supports the replacement of the phenol-chloroform DNA extraction followed by single tube nested PCR by the magnetic capture based DNA extraction followed by qPCR for molecular detection of E. multilocularis in definitive hosts. Copyright © 2016 Elsevier B.V. All rights reserved.

  3. Extraction and quantitation of total cholesterol, dolichol and dolichyl phosphate from mammalian liver

    International Nuclear Information System (INIS)

    Crick, D.C.; Carroll, K.K.

    1987-01-01

    A procedure is described for the determination of total cholesterol, dolichol and dolichyl phosphate (Dol-P) in mammalian liver. It is based on extraction of these compounds into diethyl ether after alkaline saponification of the tissue. Extractability is affected by the length of saponification and concentration of potassium hydroxide (KOH) in the saponification mixture. After extraction, total cholesterol and dolichol are quantitated directly by reverse-phase high pressure liquid chromatography (HPLC) on C18. Dol-P requires further purification before quantitation by HPLC, this is accomplished by chromatography on silicic acid. These methods gave recoveries of over 90% for cholesterol and dolichol and about 60% for Dol-P, using [4- 14 C]cholesterol, a polyprenol containing 15 isoprene units, and [1- 14 C]Dol-P as recovery standards. Concentrations of total cholesterol, dolichol and Dol-P in livers from one month-old-CBA mice were found to be 5.7 +/- 0.7 mg/g, 66.3 +/- 1.2 micrograms/g and 3.7 +/- 0.3 micrograms/g, respectively

  4. Optimization of extraction conditions of total phenolics, antioxidant activities, and anthocyanin of oregano, thyme, terebinth, and pomegranate.

    Science.gov (United States)

    Rababah, Taha M; Banat, Fawzi; Rababah, Anfal; Ereifej, Khalil; Yang, Wade

    2010-09-01

    The purpose of this study was to evaluate the total phenolic extracts and antioxidant activity and anthocyanins of varieties of the investigated plants. These plants include oregano, thyme, terebinth, and pomegranate. The optimum extraction conditions including temperature and solvent of the extraction process itself were investigated. Total phenolic and anthocyanin extracts were examined according to Folin-Ciocalteu assay and Rabino and Mancinelli method, respectively. The effect of different extracting solvents and temperatures on extracts of phenolic compounds and anthocyanins were studied. Plant samples were evaluated for their antioxidant chemical activity by 2, 2-diphenyl-1-picrylhydrazl assay, to determine their potential as a source of natural antioxidant. Results showed that all tested plants exhibited appreciable amounts of phenolic compounds. The methanolic extract (60 °C) of sour pomegranate peel contained the highest phenolic extract (4952.4 mg/100 g of dry weight). Terebinth green seed had the lowest phenolic extract (599.4 mg/100 g of dry weight). Anthocyanins ranged between 3.5 (terebinth red seed) and 0.2 mg/100 g of dry material (thyme). Significant effect of different extracting solvents and temperatures on total phenolics and anthocyanin extracts were found. The methanol and 60 °C of extraction conditions found to be the best for extracting phenolic compounds. The distilled water and 60 °C extraction conditions found to be the best for extracting anthocyanin.

  5. Simple DNA extraction of urine samples: Effects of storage temperature and storage time.

    Science.gov (United States)

    Ng, Huey Hian; Ang, Hwee Chen; Hoe, See Ying; Lim, Mae-Lynn; Tai, Hua Eng; Soh, Richard Choon Hock; Syn, Christopher Kiu-Choong

    2018-06-01

    Urine samples are commonly analysed in cases with suspected illicit drug consumption. In events of alleged sample mishandling, urine sample source identification may be necessary. A simple DNA extraction procedure suitable for STR typing of urine samples was established on the Promega Maxwell ® 16 paramagnetic silica bead platform. A small sample volume of 1.7mL was used. Samples were stored at room temperature, 4°C and -20°C for 100days to investigate the influence of storage temperature and time on extracted DNA quantity and success rate of STR typing. Samples stored at room temperature exhibited a faster decline in DNA yield with time and lower typing success rates as compared to those at 4°C and -20°C. This trend can likely be attributed to DNA degradation. In conclusion, this study presents a quick and effective DNA extraction protocol from a small urine volume stored for up to 100days at 4°C and -20°C. Copyright © 2018 Elsevier B.V. All rights reserved.

  6. Filtration Isolation of Nucleic Acids: A Simple and Rapid DNA Extraction Method.

    Science.gov (United States)

    McFall, Sally M; Neto, Mário F; Reed, Jennifer L; Wagner, Robin L

    2016-08-06

    FINA, filtration isolation of nucleic acids, is a novel extraction method which utilizes vertical filtration via a separation membrane and absorbent pad to extract cellular DNA from whole blood in less than 2 min. The blood specimen is treated with detergent, mixed briefly and applied by pipet to the separation membrane. The lysate wicks into the blotting pad due to capillary action, capturing the genomic DNA on the surface of the separation membrane. The extracted DNA is retained on the membrane during a simple wash step wherein PCR inhibitors are wicked into the absorbent blotting pad. The membrane containing the entrapped DNA is then added to the PCR reaction without further purification. This simple method does not require laboratory equipment and can be easily implemented with inexpensive laboratory supplies. Here we describe a protocol for highly sensitive detection and quantitation of HIV-1 proviral DNA from 100 µl whole blood as a model for early infant diagnosis of HIV that could readily be adapted to other genetic targets.

  7. Automated DNA extraction platforms offer solutions to challenges of assessing microbial biofouling in oil production facilities.

    Science.gov (United States)

    Oldham, Athenia L; Drilling, Heather S; Stamps, Blake W; Stevenson, Bradley S; Duncan, Kathleen E

    2012-11-20

    The analysis of microbial assemblages in industrial, marine, and medical systems can inform decisions regarding quality control or mitigation. Modern molecular approaches to detect, characterize, and quantify microorganisms provide rapid and thorough measures unbiased by the need for cultivation. The requirement of timely extraction of high quality nucleic acids for molecular analysis is faced with specific challenges when used to study the influence of microorganisms on oil production. Production facilities are often ill equipped for nucleic acid extraction techniques, making the preservation and transportation of samples off-site a priority. As a potential solution, the possibility of extracting nucleic acids on-site using automated platforms was tested. The performance of two such platforms, the Fujifilm QuickGene-Mini80™ and Promega Maxwell®16 was compared to a widely used manual extraction kit, MOBIO PowerBiofilm™ DNA Isolation Kit, in terms of ease of operation, DNA quality, and microbial community composition. Three pipeline biofilm samples were chosen for these comparisons; two contained crude oil and corrosion products and the third transported seawater. Overall, the two more automated extraction platforms produced higher DNA yields than the manual approach. DNA quality was evaluated for amplification by quantitative PCR (qPCR) and end-point PCR to generate 454 pyrosequencing libraries for 16S rRNA microbial community analysis. Microbial community structure, as assessed by DGGE analysis and pyrosequencing, was comparable among the three extraction methods. Therefore, the use of automated extraction platforms should enhance the feasibility of rapidly evaluating microbial biofouling at remote locations or those with limited resources.

  8. Using a commercially available DNA extraction kit to obtain high quality human genomic DNA suitable for PCR and genotyping from 11-year-old saliva saturated cotton spit wads

    Directory of Open Access Journals (Sweden)

    Hudziak James J

    2008-12-01

    Full Text Available Abstract Background We sought to describe the integrity of human genomic DNA extracted from saliva saturated cotton spit wads stored at -20°C for approximately 11 years. 783 spit wad samples were collected from an ADHD sample population (Vermont Family Study during 1996–2000. Human genomic DNA was extracted from the spit wads using a commercially available kit; QIAamp DNA Blood Midi Kit (Qiagen, Inc., Valencia, CA. with a few modifications. Results The resulting DNA yield was more than adequate for genetic analysis and ranged from approximately 1 μg to a total of 80 μg (mean 17.3 μgs ± 11.9 μgs. A260/A280 ratios for the human genomic DNA extracted from the spit wads was consistently within the generally acceptable values of 1.7–2.0, with the lowest purity being 1.70, and a mean value of 1.937 ± 0.226 for the 783 samples. The DNA also was suitable for PCR reactions as evidenced by the amplification of the serotonin-transporter-linked polymorphic region, 5HTTLPR. 5HTTLPR is a functional polymorphism in the promoter region of the serotonin transporter gene (HTT, SLC6A4, or SERT, consisting of two intensively studied alleles. 770 of the 783 samples (98.3% produced fragments after PCR of the expected size with primers specific for 5HTTLPR. Conclusion High quality and abundant genomic DNA can be successfully retrieved from saliva saturated cotton spit wads using the commercially available kit, QIAamp DNA Blood Midi Kit from Qiagen, Inc. Furthermore, the DNA can be extracted in less than 3 hours and multiple samples can be processed simultaneously thus reducing processing time.

  9. A new method to extract dental pulp DNA: application to universal detection of bacteria.

    Directory of Open Access Journals (Sweden)

    Lam Tran-Hung

    Full Text Available BACKGROUND: Dental pulp is used for PCR-based detection of DNA derived from host and bacteremic microorganims. Current protocols require odontology expertise for proper recovery of the dental pulp. Dental pulp specimen exposed to laboratory environment yields contaminants detected using universal 16S rDNA-based detection of bacteria. METHODOLOGY/PRINCIPAL FINDINGS: We developed a new protocol by encasing decontaminated tooth into sterile resin, extracting DNA into the dental pulp chamber itself and decontaminating PCR reagents by filtration and double restriction enzyme digestion. Application to 16S rDNA-based detection of bacteria in 144 teeth collected in 86 healthy people yielded a unique sequence in only 14 teeth (9.7% from 12 individuals (14%. Each individual yielded a unique 16S rDNA sequence in 1-2 teeth per individual. Negative controls remained negative. Bacterial identifications were all confirmed by amplification and sequencing of specific rpoB sequence. CONCLUSIONS/SIGNIFICANCE: The new protocol prevented laboratory contamination of the dental pulp. It allowed the detection of bacteria responsible for dental pulp colonization from blood and periodontal tissue. Only 10% such samples contained 16S rDNA. It provides a new tool for the retrospective diagnostic of bacteremia by allowing the universal detection of bacterial DNA in animal and human, contemporary or ancient tooth. It could be further applied to identification of host DNA in forensic medicine and anthropology.

  10. The effects of three different grinding methods in DNA extraction of ...

    African Journals Online (AJOL)

    uwerhiavwe

    2013-04-17

    Apr 17, 2013 ... The effects of three different grinding methods in DNA extraction of cowpea .... 100 mg of the leaf tissues were weighed in an electronic balance. CTAB method .... The primers were synthesized by Life Technologies (AB & Invitrogen). .... This work was supported by 'Shuang-Zhi Plan' of Sichuan. Agricultural ...

  11. Efficient recovery of environmental DNA for expression cloning by indirect extraction methods

    NARCIS (Netherlands)

    Gabor, Esther; de Vries, Erik; Janssen, DB

    2003-01-01

    Using direct and cell extraction-based (indirect) isolation methods, DNA was obtained from environmental samples with largely differing characteristics (loam soil, sand soil, sediment, activated sludge, and compost) and evaluated with respect to the comprised bacterial diversity and its suitability

  12. A simple method of DNA extraction from coffee seeds suitable for ...

    African Journals Online (AJOL)

    SERVER

    2008-02-19

    Feb 19, 2008 ... This makes coffee seed as one of the important material for molecular marker ... homogenised in 10 ml of freshly prepared extraction buffer (200. mM Tris-HCl pH 8.0, .... DNA material for particular molecular analysis. This method will be ... Pharmawati M, Yan G, Sedgley R, Finnegan PM (2004). Chloroplast.

  13. Hippophae leaf extract (SBL-1) countered radiation induced dysbiosis in jejunum of total body 60Cobalt gamma - irradiated mice

    International Nuclear Information System (INIS)

    Beniwal, C.S.; Madhu Bala

    2014-01-01

    Single dose of SBL-1 administered at the rate 30 mg/kg body weight (b.w.) 30 min prior to whole body 60 Co-gamma-irradiation at lethal dose (10 Gy), rendered >90% survival in comparison to zero survival in the non-SBL-1 treated 60 Co-gamma-irradiated (10 Gy) mice population (J Herbs Spices Med Plants, 2009; 15(2): 203-215). Present study investigated the effect of SBL-1 on jejunal microbiota in lethally irradiated mice. Study was performed with inbred Swiss albino Strain 'A' male mice (age 9 weeks) weighing 28±2 g. The animals were maintained under controlled environment at 26±2℃; 12 h light/dark cycle and offered standard animal food (Golden feed, Delhi) as well as tap water ad libitum. Metagenomic DNA was extracted, purified and quantified from jejunum of the mice. Universal primers (27f and 1492r) were used to amplify the 16S rRNA DNA from the metagenomic DNA. Amplicons were sequenced, vector contamination and chimeras were removed. The sequences (GenBank Accession No: KF681283 to KF681351) were taxonomically classified by using Sequence Match program, Ribosomal Database Project as well as by nucleotide-BLAST (E-value: 10, database: 16S rRNA gene sequences, Bacteria and Archea). Phylogenetic Tree was prepared using MEGA 5.2 package, using maximum likelihood algorithm after sequence alignment by MUSCLE. Thermus aquaticus was used as out-group to construct rooted tree. Branch stability was assessed by bootstrap analysis. Untreated animals and the animals treated with SBL-1 had 100% Lactobacillus; 60 Co gamma-irradiated animals had 55% Cohaesibacter (Alphaproteobacteria); 27% Mycoplasma (Tenericutes) and only 18% Lactobacillus; animals treated with SBL-1 prior to irradiation had 89% Lactobacillus and 11% Clostridium. This study demonstrated that treatment with SBL-1 at radioprotective doses before total body irradiation with lethal dose (10 Gy) countered the jejunal dysbiosis. (author)

  14. Evaluation of dna extraction methods of the Salmonella sp. bacterium in artificially infected chickens eggs

    Directory of Open Access Journals (Sweden)

    Ana Cristina dos Reis Ferreira

    2015-06-01

    Full Text Available ABSTRACT. Ferreira A.C.dosR. & dos Santos B.M. [Evaluation of dna extraction methods of the Salmonella sp. bacterium in artificially infected chickens eggs.] Avaliação de três métodos de extração de DNA de Salmonella sp. em ovos de galinhas contaminados artificialmente. Revista Brasileira de Medicina Veterinária, 37(2:115-119, 2015. Departamento de Veterinária, Universidade Federal de Viçosa, Campus Universitário, Av. Peter Henry Rolfs, s/n, Viçosa, MG 36571-000, Brasil. E-mail: bmsantos@ufv.br The present study evaluated the efficiency of different protocols for the genomic DNA extraction of Salmonella bacteria in chicken eggs free of specific pathogens – SPF. Seventy-five eggs were used and divided into five groups with fifteen eggs each. Three of the five groups of eggs were inoculated with enteric Salmonella cultures. One of the five groups was inoculated with Escherichia coli bacterium culture. And another group of eggs was the negative control that received saline solution 0.85% infertile. The eggs were incubated on a temperature that varied from 20 to 25°C during 24, 48 and 72 hours. Five yolks of each group were collected every 24 hours. These yolks were homogenized and centrifuged during 10 minutes. The supernatant was rejected. After the discard, PBS ph 7.2 was added and centrifuged again. The sediment obtained of each group was used for the extraction of bacterial genomic DNA. Silica particles and a commercial kit were utilized as the extraction methods. The extracted DNA was kept on a temperature of 20°C until the evaluation through PCR. The primers utilized were related with the invA gene and they were the following: 5’ GTA AAA TTA TCG CCA CGT TCG GGC AA 3’ and 5’ TCA TCG CAC CGT CAA AGG AAC C 3’. The amplification products were visualized in transilluminator with ultraviolet light. The obtained results through the bacterial DNA extractions demonstrated that the extraction method utilizing silica particles was

  15. An Improved DNA Extraction Method for Efficient and Quantitative Recovery of Phytoplankton Diversity in Natural Assemblages.

    Directory of Open Access Journals (Sweden)

    Jian Yuan

    Full Text Available Marine phytoplankton are highly diverse with different species possessing different cell coverings, posing challenges for thoroughly breaking the cells in DNA extraction yet preserving DNA integrity. While quantitative molecular techniques have been increasingly used in phytoplankton research, an effective and simple method broadly applicable to different lineages and natural assemblages is still lacking. In this study, we developed a bead-beating protocol based on our previous experience and tested it against 9 species of phytoplankton representing different lineages and different cell covering rigidities. We found the bead-beating method enhanced the final yield of DNA (highest as 2 folds in comparison with the non-bead-beating method, while also preserving the DNA integrity. When our method was applied to a field sample collected at a subtropical bay located in Xiamen, China, the resultant ITS clone library revealed a highly diverse assemblage of phytoplankton and other micro-eukaryotes, including Archaea, Amoebozoa, Chlorophyta, Ciliphora, Bacillariophyta, Dinophyta, Fungi, Metazoa, etc. The appearance of thecate dinoflagellates, thin-walled phytoplankton and "naked" unicellular organisms indicates that our method could obtain the intact DNA of organisms with different cell coverings. All the results demonstrate that our method is useful for DNA extraction of phytoplankton and environmental surveys of their diversity and abundance.

  16. Evaluation of DNA extraction methods for PCR-based detection of Listeria monocytogenes from vegetables.

    Science.gov (United States)

    Vojkovska, H; Kubikova, I; Kralik, P

    2015-03-01

    Epidemiological data indicate that raw vegetables are associated with outbreaks of Listeria monocytogenes. Therefore, there is a demand for the availability of rapid and sensitive methods, such as PCR assays, for the detection and accurate discrimination of L. monocytogenes. However, the efficiency of PCR methods can be negatively affected by inhibitory compounds commonly found in vegetable matrices that may cause false-negative results. Therefore, the sample processing and DNA isolation steps must be carefully evaluated prior to the introduction of such methods into routine practice. In this study, we compared the ability of three column-based and four magnetic bead-based commercial DNA isolation kits to extract DNA of the model micro-organism L. monocytogenes from raw vegetables. The DNA isolation efficiency of all isolation kits was determined using a triplex real-time qPCR assay designed to specifically detect L. monocytogenes. The kit with best performance, the PowerSoil(™) Microbial DNA Isolation Kit, is suitable for the extraction of amplifiable DNA from L. monocytogenes cells in vegetable with efficiencies ranging between 29.6 and 70.3%. Coupled with the triplex real-time qPCR assay, this DNA isolation kit is applicable to the samples with bacterial loads of 10(3) bacterial cells per gram of L. monocytogenes. Several recent outbreaks of Listeria monocytogenes have been associated with the consumption of fruits and vegetables. Real-time PCR assays allow fast detection and accurate quantification of microbes. However, the success of real-time PCR is dependent on the success with which template DNA can be extracted. The results of this study suggest that the PowerSoil(™) Microbial DNA Isolation Kit can be used for the extraction of amplifiable DNA from L. monocytogenes cells in vegetable with efficiencies ranging between 29.6 and 70.3%. This method is applicable to samples with bacterial loads of 10(3) bacterial cells per gram of L. monocytogenes. © 2014

  17. Nucleotide-excision repair of DNA in cell-free extracts of the yeast Saccharomyces cerevisiae

    International Nuclear Information System (INIS)

    Wang, Z.; Wu, X.; Friedberg, E.C.

    1993-01-01

    A wide spectrum of DNA lesions are repaired by the nucleotide-excision repair (NER) pathway in both eukaryotic and prokaryotic cells. We have developed a cell-free system in Saccharomyces cerevisiae that supports NER. NER was monitored by measuring repair synthesis in DNA treated with cisplatin or with UV radiation. Repair synthesis in vitro was defective in extracts of rad1, rad2, and rad10 mutant cells, all of which have mutations in genes whose products are known to be required for NER in vivo. Additionally, repair synthesis was complemented by mixing different mutant extracts, or by adding purified Rad1 or Rad10 protein to rad1 or rad10 mutant extracts, respectively. The latter observation demonstrates that the Rad1 and Rad10 proteins directly participate in the biochemical pathway of NER. NER supported by nuclear extracts requires ATP and Mg 2+ and is stimulated by polyethylene glycol and by small amounts of whole cell extract containing overexpressed Rad2 protein. The nuclear extracts also contain base-excision repair activity that is present at wild-type levels in rad mutant extracts. This cell-free system is expected to facilitate studies on the biochemical pathway of NER in S. cerevisiae

  18. Grape (Vitis vinifera) extracts protect against radiation-induced oxidative stress and DNA damage

    International Nuclear Information System (INIS)

    Singha, Indrani; Das, Subir Kumar; Saxena, S.; Gautam, S.

    2016-01-01

    Ionizing radiation (IR) causes oxidative stress through the overwhelming generation of reactive oxygen species (ROS) in the living cells leading further to the oxidative damage to biomolecules. Grapes (Vitis vinifera) contain several bioactive phytochemicals and are the richest source of antioxidant. In this study, we investigated and compared in vitro antioxidant activity and DNA damage protective property of the grape extracts of four different cultivars, including the Thompson seedless, Flame seedless, Kishmish chorni and Red globe. The activities of ascorbic acid oxidase and catalase significantly (p<0.01) differed among extracts within the same cultivar, while that of peroxidase and polyphenol oxidase did not differ significantly among extracts of any cultivar. In vitro antioxidant activities were assessed by ferric-reducing antioxidant power (FRAP) assay and ABTS. The superoxide radical-scavenging activity was higher in the seed as compared to the skin or pulp of the same cultivar. DNA damage was evaluated in acellular system using pBR322 plasmid relaxation. Grape extract was able to effectively scavenge free radicals in vitro. It could significantly prevent radiation-induced DNA damage. Furthermore, the protective action of grape depends on the source of extract and type of the cultivars. (author)

  19. Enhanced extraction and purification of plasmid DNA from escherichia coli by applying a hybrid magnetic nanocomposite

    Energy Technology Data Exchange (ETDEWEB)

    Silva, R.J. da; Chavez-Guajardo, A.E.; Medina-llamas, J.C.; Alcaraz-Espinoza, J.J.; Melo, C.P. de [Universidade Federal de Pernambuco (UFPE), PE (Brazil)

    2016-07-01

    Full text: Plasmid DNA (pDNA), a special kind of nucleic acid usually found in bacteria, is a small molecule physically distinct from chromosomal DNA that can replicate independently. This genetic material has been used in a wide set of biotechnological methodologies, such as genetic engineering, production of recombinant drugs and gene therapy, among others. In all these applications, the extraction and purification of pDNA appears as a crucial step. In this work, we describe the synthesis of a polyaniline and maghemite (PANI/?-Fe2O3) magnetic nanocomposite (MNC) and its use in a new Escherichia coli (E. coli) pDNA extraction and purification protocol. We have used transmission electron microscopy (TEM), UV-Vis spectroscopy, infrared spectroscopy (FTIR), X-ray diffraction (XRD), dynamic light scattering (DLS) and magnetic measurements to characterize the MNC, which was synthesized through an emulsion polymerization method. The yield, purity and quality of the pDNA extracted by using our proposed MNC protocol were evaluated through UV-Vis, agarose gel electrophoreses and PCR techniques, respectively. After comparing our results to those obtained by use of a commercial kit (Promega Wizard Plus SV Minipreps), we suggest that the novel protocol here proposed appears as a competitive alternative methodology. Not only the purification step can be completed within only 10 min, but the high adsorption capacity of the MNC results in pDNA yields that are almost twice the best values obtained by using the commercial kit. Hence, this new MNC methodology can be of general interest and find widespread use in different types of biomedical applications. (author)

  20. Comparison of eight methods for the extraction of Bacillus atrophaeus spore DNA from eleven common interferents and a common swab.

    Directory of Open Access Journals (Sweden)

    Helen L Rose

    Full Text Available Eight DNA extraction products or methods (Applied Biosystems PrepFiler Forensic DNA Extraction Kit; Bio-Rad Instagene Only, Bio-Rad Instagene & Spin Column Purification; EpiCentre MasterPure DNA & RNA Kit; FujiFilm QuickGene Mini80; Idaho Technologies 1-2-3 Q-Flow Kit; MoBio UltraClean Microbial DNA Isolation Kit; Sigma Extract-N-Amp Plant and Seed Kit were adapted to facilitate extraction of DNA under BSL3 containment conditions. DNA was extracted from 12 common interferents or sample types, spiked with spores of Bacillus atropheaus. Resulting extracts were tested by real-time PCR. No one method was the best, in terms of DNA extraction, across all sample types. Statistical analysis indicated that the PrepFiler method was the best method from six dry powders (baking, biological washing, milk, plain flour, filler and talcum and one solid (Underarm deodorant, the UltraClean method was the best from four liquids (aftershave, cola, nutrient broth, vinegar, and the MasterPure method was the best from the swab sample type. The best overall method, in terms of DNA extraction, across all sample types evaluated was the UltraClean method.

  1. Freezing fecal samples prior to DNA extraction affects the Firmicutes to Bacteroidetes ratio determined by downstream quantitative PCR analysis

    DEFF Research Database (Denmark)

    Bahl, Martin Iain; Bergström, Anders; Licht, Tine Rask

    2012-01-01

    Freezing stool samples prior to DNA extraction and downstream analysis is widely used in metagenomic studies of the human microbiota but may affect the inferred community composition. In this study, DNA was extracted either directly or following freeze storage of three homogenized human fecal...

  2. Freezing fecal samples prior to DNA extraction affects the Firmicutes to Bacteroidetes ratio determined by downstream quantitative PCR analysis

    DEFF Research Database (Denmark)

    Bahl, Martin Iain; Bergström, Anders; Licht, Tine Rask

    Freezing stool samples prior to DNA extraction and downstream analysis is widely used in metagenomic studies of the human microbiota but may affect the inferred community composition. In this study DNA was extracted either directly or following freeze storage of three homogenized human fecal...

  3. The Effect of Storage and Extraction Methods on Amplification of Plasmodium falciparum DNA from Dried Blood Spots

    NARCIS (Netherlands)

    Schwartz, A.; Baidjoe, A.Y.; Rosenthal, P.J.; Dorsey, G.; Bousema, T.; Greenhouse, B.

    2015-01-01

    Extraction and amplification of DNA from dried blood spots (DBS) collected in field studies is commonly used for detection of Plasmodium falciparum. However, there have been few systematic efforts to determine the effects of storage and extraction methods on the sensitivity of DNA amplification. We

  4. Direct DNA Extraction from Mycobacterium tuberculosis Frozen Stocks as a Reculture-Independent Approach to Whole-Genome Sequencing

    DEFF Research Database (Denmark)

    Bjorn-Mortensen, K; Zallet, J; Lillebaek, T

    2015-01-01

    Culturing before DNA extraction represents a major time-consuming step in whole-genome sequencing of slow-growing bacteria, such as Mycobacterium tuberculosis. We report a workflow to extract DNA from frozen isolates without reculturing. Prepared libraries and sequence data were comparable...... with results from recultured aliquots of the same stocks....

  5. Effect of DNA extraction methods and sampling techniques on the apparent structure of cow and sheep rumen microbial communities.

    Directory of Open Access Journals (Sweden)

    Gemma Henderson

    Full Text Available Molecular microbial ecology techniques are widely used to study the composition of the rumen microbiota and to increase understanding of the roles they play. Therefore, sampling and DNA extraction methods that result in adequate yields of microbial DNA that also accurately represents the microbial community are crucial. Fifteen different methods were used to extract DNA from cow and sheep rumen samples. The DNA yield and quality, and its suitability for downstream PCR amplifications varied considerably, depending on the DNA extraction method used. DNA extracts from nine extraction methods that passed these first quality criteria were evaluated further by quantitative PCR enumeration of microbial marker loci. Absolute microbial numbers, determined on the same rumen samples, differed by more than 100-fold, depending on the DNA extraction method used. The apparent compositions of the archaeal, bacterial, ciliate protozoal, and fungal communities in identical rumen samples were assessed using 454 Titanium pyrosequencing. Significant differences in microbial community composition were observed between extraction methods, for example in the relative abundances of members of the phyla Bacteroidetes and Firmicutes. Microbial communities in parallel samples collected from cows by oral stomach-tubing or through a rumen fistula, and in liquid and solid rumen digesta fractions, were compared using one of the DNA extraction methods. Community representations were generally similar, regardless of the rumen sampling technique used, but significant differences in the abundances of some microbial taxa such as the Clostridiales and the Methanobrevibacter ruminantium clade were observed. The apparent microbial community composition differed between rumen sample fractions, and Prevotellaceae were most abundant in the liquid fraction. DNA extraction methods that involved phenol-chloroform extraction and mechanical lysis steps tended to be more comparable. However

  6. Effect of Allium flavum L. and Allium melanantherum Panč. Extracts on Oxidative DNA Damage and Antioxidative Enzymes Superoxide Dismutase and Catalase.

    Science.gov (United States)

    Mitić-Ćulafić, Dragana; Nikolić, Biljana; Simin, Nataša; Jasnić, Nebojša; Četojević-Simin, Dragana; Krstić, Maja; Knežević-Vukčević, Jelena

    2016-03-01

    Allium flavum L. and Allium melanantherum Panč. are wild growing plants used in traditional diet in Balkan region. While chemical composition and some biological activities of A. flavum have been reported, A. melanantherum, as an endemic in the Balkan Peninsula, has never been comprehensively examined. After chemical characterization of A. melanantherum, we examined the protective effect of methanol extracts of both species against t-butyl hydro-peroxide (t-BOOH)-induced DNA damage and mutagenesis. The bacterial reverse mutation assay was performed on Escherichia coli WP2 oxyR strain. DNA damage was monitored in human fetal lung fibroblasts (MRC-5) with alkaline comet assay. Obtained results indicated that extracts reduced t-BOOH-induced DNA damage up to 70 and 72% for A. flavum and A. melanantherum extract, respectively, and showed no effect on t-BOOH-induced mutagenesis. Since the results indicated modulatory effect on cell-mediated antioxidative defense, the effect of extracts on total protein content, and superoxide dismutase (SOD) and catalase (CAT) amounts and activities were monitored. Both extracts increased total protein content, while the increase of enzyme amount and activity was obtained only with A. melanantherum extract and restricted to CAT. The activity of CuZnSOD family was not affected, while SOD1 and SOD2 amounts were significantly decreased, indicating potential involvement of extracellular CuZnSOD. Obtained results strongly support the traditional use of A. flavum and A. melanantherum in nutrition and recommend them for further study.

  7. Evaluation of Antioxidant Activity, Total Flavonoids, Tannins and Phenolic Compounds in Psychotria Leaf Extracts

    Directory of Open Access Journals (Sweden)

    Anelise Samara Nazari Formagio

    2014-11-01

    Full Text Available The antioxidant activity of Psychotria carthagenensis, P. leiocarpa, P. capillacea and P. deflexa (Rubiaceae extracts were investigated, and the concentrations of total phenolics, flavonoids, condensed tannins and flavonols were determined. The chemical compositions of the extracts were investigated using the high performance liquid chromatography (HPLC/PAD method. We used 1,1-diphenyl-1-picrylhydrazyl free radical (DPPH, β-Carotene bleaching and 2,2-azinobis (3-ethylbenzothiazoline-6-sulfonic acid (ABTS radical cations to determine antioxidant activity. The ability to scavenge radical was measured in these experiments by the discoloration of the solution. Concentrations of constituents were measured spectrophotometrically. P. carthagenensis and P. capillacea exhibited the highest antioxidant activity, in the DPPH test, β-carotene bleaching and ABTS system. The highest phenolic, flavonoid, condensed tannin and flavonol concentration was found in P. carthagenensis and P. capillacea extracts. HPLC-PDA analysis of P. carthagenensis and P. capillacea revealed hydroxycinnamic acid (p-coumaric acid. This is the first report on the antioxidant properties and constituent analysis of these Psychotria extracts.

  8. Evaluation of Antibacterial Activity and Total Phenol Compounds of Punica granatum Hydro-Alcoholic Extract

    Directory of Open Access Journals (Sweden)

    Elahe Ahmadi

    2016-12-01

    Full Text Available Background & Objectives: Punica granatum is a non-productive form of a plant and is used for the treatment of diseases in traditional medicine. In this study, we evaluate the antibacterial activity and the total phenol compounds of Punica granatum. Materials & Methods: Disk and well diffusion methods and MIC were used to evaluate the antibacterial activity of hydro-alcoholic extract on S. aureus and E. coli compared to standard commercial antibiotic disks. Measurement of phenol compounds were performed by Seevers and Daly colorimetric methods (Folin-ciocalteu indicator. Results: 35 and 29 mm inhibition zones in S. aureus and 22 and 17 mm inhibition zones in E. coli were shown by disk and well diffusion method, respectively. Also, 7.8 mg/ml concentration of extract showed the MIC points for two bacteria. Phenol compound of extract was 233.15±5.1 mg/g of extraction. Conclusion: Antibacterial effect of Punica granatum compared to antibiotics indicates the strong activity against examined bacteria. Extensive antibacterial study of Punica granatum is suggested.

  9. Total flavonoids content in the raw material and aqueous extractives from Bauhinia monandra Kurz (Caesalpiniaceae).

    Science.gov (United States)

    Fernandes, Ana Josane Dantas; Ferreira, Magda Rhayanny Assunção; Randau, Karina Perrelli; de Souza, Tatiane Pereira; Soares, Luiz Alberto Lira

    2012-01-01

    The aim of this work was to evaluate the spectrophotometric methodology for determining the total flavonoid content (TFC) in herbal drug and derived products from Bauhinia monandra Kurz. Several analytical parameters from this method grounded on the complex formed between flavonoids and AlCl₃ were evaluated such as herbal amount (0.25 to 1.25 g); solvent composition (ethanol 40 to 80%, v/v); as well as the reaction time and AlCl₃ concentration (2 to 9%, w/v). The method was adjusted to aqueous extractives and its performance studied through precision, linearity and preliminary robustness. The results showed an important dependence of the method response from reaction time, AlCl₃ concentration, sample amount, and solvent mixture. After choosing the optimized condition, the method was applied for the matrixes (herbal material and extractives), showing precision lower than 5% (for both parameters repeatability and intermediate precision), coefficient of determination higher than 0.99, and no important influence could be observed for slight variations from wavelength or AlCl₃ concentration. Thus, it could be concluded that the evaluated analytical procedure was suitable to quantify the total flavonoid content in raw material and aqueous extractives from leaves of B. monandra.

  10. Anti-pseudomonas activity of essential oil, total extract, and proanthocyanidins of Pinus eldarica Medw. bark.

    Science.gov (United States)

    Sadeghi, Masoud; Zolfaghari, Behzad; Jahanian-Najafabadi, Ali; Abtahi, Seyed Reza

    2016-01-01

    Pinus eldarica Medw. (Iranian pine) is native to Transcaucasian region and has been vastly planted in Iran, Afghanistan, and Pakistan. Various parts of this plant have been widely used in traditional medicine for the treatment of various diseases including infectious conditions (e.g. infectious wounds). In this study we aimed to investigate the antibacterial activity of P. eldarica bark extract, essential oil and proanthocyanidins on three important bacteria, Staphylococcus aureus, Escherichia coli and Pseudomonas aeruginosa. Antibacterial analysis was performed using standard disk diffusion method with different concentrations of essential oil, bark total hydroalcoholic extract, and bark proanthocyanidins (0.5, 1, 2 and 3 mg/ml). After incubation at 37°C for 24 h, the antibacterial activity was assessed by measuring the zone of growth inhibition surrounding the disks. The results indicated that the essential oil, total hydroalcoholic extract, and proanthocyanidins of the bark of the P. eldarica were effective against the gram negative bacteria, P. aeruginosa, and significantly inhibited its growth in disk diffusion method (Pessential oil had the most potent inhibitory effect. However, none of the bark preparations could significantly inhibit the growth of S. aureus or E. coli. Our findings showed that P. eldarica bark components have significant anti-pseudomonas activity having potentials for new sources of antibacterial agents or antibacterial herbal preparations.

  11. Screening of immunomodulatory activity of total and protein extracts of some Moroccan medicinal plants.

    Science.gov (United States)

    Daoudi, Abdeljlil; Aarab, Lotfi; Abdel-Sattar, Essam

    2013-04-01

    Herbal and traditional medicines are being widely used in practice in many countries for their benefits of treating different ailments. A large number of plants in Morocco were used in folk medicine to treat immune-related disorders. The objective of this study is to evaluate the immunomodulatory activity of protein extracts (PEs) of 14 Moroccan medicinal plants. This activity was tested on the proliferation of immune cells. The prepared total and PEs of the plant samples were tested using MTT (3-(4,5-dimethylthiazol-2yl)-2,5-diphenyltetrazolium bromide) assay on the splenocytes with or without stimulation by concanavalin-A (Con-A), a mitogenic agent used as positive control. The results of this study indicated different activity spectra. Three groups of activities were observed. The first group represented by Citrullus colocynthis, Urtica dioica, Elettaria cardamomum, Capparis spinosa and Piper cubeba showed a significant immunosuppressive activity. The second group that showed a significant immunostimulatory activity was represented by Aristolochia longa, Datura stramonium, Marrubium vulgare, Sinapis nigra, Delphynium staphysagria, Lepidium sativum, Ammi visnaga and Tetraclinis articulata. The rest of the plant extracts did not alter the proliferation induced by Con-A. This result was more important for the PE than for the total extract. In conclusion, this study revealed an interesting immunomodulating action of certain PEs, which could explain their traditional use. The results of this study may also have implications in therapeutic treatment of infections, such as prophylactic and adjuvant with cancer chemotherapy.

  12. Total Flavonoids Content in the Raw Material and Aqueous Extractives from Bauhinia monandra Kurz (Caesalpiniaceae

    Directory of Open Access Journals (Sweden)

    Ana Josane Dantas Fernandes

    2012-01-01

    Full Text Available The aim of this work was to evaluate the spectrophotometric methodology for determining the total flavonoid content (TFC in herbal drug and derived products from Bauhinia monandra Kurz. Several analytical parameters from this method grounded on the complex formed between flavonoids and AlCl3 were evaluated such as herbal amount (0.25 to 1.25 g; solvent composition (ethanol 40 to 80%, v/v; as well as the reaction time and AlCl3 concentration (2 to 9%, w/v. The method was adjusted to aqueous extractives and its performance studied through precision, linearity and preliminary robustness. The results showed an important dependence of the method response from reaction time, AlCl3 concentration, sample amount, and solvent mixture. After choosing the optimized condition, the method was applied for the matrixes (herbal material and extractives, showing precision lower than 5% (for both parameters repeatability and intermediate precision, coefficient of determination higher than 0.99, and no important influence could be observed for slight variations from wavelength or AlCl3 concentration. Thus, it could be concluded that the evaluated analytical procedure was suitable to quantify the total flavonoid content in raw material and aqueous extractives from leaves of B. monandra.

  13. Ancient microbes from halite fluid inclusions: optimized surface sterilization and DNA extraction.

    Science.gov (United States)

    Sankaranarayanan, Krithivasan; Timofeeff, Michael N; Spathis, Rita; Lowenstein, Tim K; Lum, J Koji

    2011-01-01

    Fluid inclusions in evaporite minerals (halite, gypsum, etc.) potentially preserve genetic records of microbial diversity and changing environmental conditions of Earth's hydrosphere for nearly one billion years. Here we describe a robust protocol for surface sterilization and retrieval of DNA from fluid inclusions in halite that, unlike previously published methods, guarantees removal of potentially contaminating surface-bound DNA. The protocol involves microscopic visualization of cell structures, deliberate surface contamination followed by surface sterilization with acid and bleach washes, and DNA extraction using Amicon centrifugal filters. Methods were verified on halite crystals of four different ages from Saline Valley, California (modern, 36 ka, 64 ka, and 150 ka), with retrieval of algal and archaeal DNA, and characterization of the algal community using ITS1 sequences. The protocol we developed opens up new avenues for study of ancient microbial ecosystems in fluid inclusions, understanding microbial evolution across geological time, and investigating the antiquity of life on earth and other parts of the solar system.

  14. An improved protocol and a new grinding device for extraction of genomic DNA from microorganisms by a two-step extraction procedure.

    Science.gov (United States)

    Zhang, S S; Chen, D; Lu, Q

    2012-05-21

    Current protocols to extract genomic DNA from microorganisms are still laborious, tedious and costly, especially for the species with thick cell walls. In order to improve the effectiveness of extracting DNA from microbial samples, a novel protocol, defined as two-step extraction method, along with an improved tissue-grinding device, was developed. The protocol included two steps, disruption of microbial cells or spores by grinding the sample together with silica sand in a new device and extraction of DNA with an effective buffer containing cell lysis chemicals. The device was prepared by using a commercial electric mini-grinder, adapted with a grinding stone, and a sample cup processed by lathing from a polytetrafluoroethylene rod. We tested the method with vegetative cells of four microbial species and two microbial spores that have thick cell walls and are therefore hard to process; these included Escherichia coli JM109, Bacillus subtilis WB600, Sacchromyces cerevisiae INVSc1, Trichoderma viride AS3.3711, and the spores of S. cerevisiae and T. viride, respectively, representing Gram-positive bacteria, Gram-negative bacteria, yeast, filamentous fungi. We found that this new method and device extracted usable quantities of genomic DNA from the samples. The DNA fragments that were extracted exceeded 23 kb. The target sequences up to about 5 kb were successfully and exclusively amplified by PCR using extracted DNA as the template. In addition, the DNA extraction was finalized within 1.5 h. Thus, we conclude that this two-step extraction method is an effective and improved protocol for extraction of genomic DNA from microbial samples.

  15. Phytochemical screening, total phenolic content and phytotoxic activity of corn (Zea mays) extracts against some indicator species.

    Science.gov (United States)

    Ahmed, Hiwa M

    2018-03-01

    Allelopathic effects of corn (Zea mays) extracts was studied, against seed germination and seedling growth of Phalaris minor, Helianthus annuus, Triticumaestivum, Sorghum halepense, Z. mays. Bioassay results showed that aqueous extracts of corn root and shoot, markedly affected seed germination, and other parameters compared with related controls. Preliminary phytochemical screening revealed the presence of various phytochemicals such as tannins, phlobatannins, flavonoids, terpenoids and alkaloids in both roots and shoot aqueous extracts. However, saponins were only present in the shoot aqueous extract, while in shoot ethanol extracts, only terpenoids and alkaloids were detected. Additionally, total polyphenolic (TPC) content in aqueous extracts of corn root and shoot, plus ethanol extracts of corn shoot were determined using an Ultraviolet-visible spectroscopy. Results revealed TPC content of the corn shoot aqueous extract showed the highest yield, compared to other extracts. These findings suggest that phytochemicals present in Z. mays extracts may contribute to allelopathy effect.

  16. Evaluation of a manual DNA extraction protocol and an isothermal amplification assay for detecting HIV-1 DNA from dried blood spots for use in resource-limited settings.

    Science.gov (United States)

    Jordan, Jeanne A; Ibe, Christine O; Moore, Miranda S; Host, Christel; Simon, Gary L

    2012-05-01

    In resource-limited settings (RLS) dried blood spots (DBS) are collected on infants and transported through provincial laboratories to a central facility where HIV-1 DNA PCR testing is performed using specialized equipment. Implementing a simpler approach not requiring such equipment or skilled personnel could allow the more numerous provincial laboratories to offer testing, improving turn-around-time to identify and treat infected infants sooner. Assess performances of a manual DNA extraction method and helicase-dependent amplification (HDA) assay for detecting HIV-1 DNA from DBS. 60 HIV-1 infected adults were enrolled, blood samples taken and DBS made. DBS extracts were assessed for DNA concentration and beta globin amplification using PCR and melt-curve analysis. These same extracts were then tested for HIV-1 DNA using HDA and compared to results generated by PCR and pyrosequencing. Finally, HDA limit of detection (LOD) studies were performed using DBS extracts prepared with known numbers of 8E5 cells. The manual extraction protocol consistently yielded high concentrations of amplifiable DNA from DBS. LOD assessment demonstrated HDA detected ∼470 copies/ml of HIV-1 DNA extracts in 4/4 replicates. No statistical difference was found using the McNemar's test when comparing HDA to PCR for detecting HIV-1 DNA from DBS. Using just a magnet, heat block and pipettes, the manual extraction protocol and HDA assay detected HIV-1 DNA from DBS at levels that would be useful for early infant diagnosis. Next steps will include assessing HDA for non-B HIV-1 subtypes recognition and comparison to Roche HIV-1 DNA v1.5 PCR assay. Copyright © 2012 Elsevier B.V. All rights reserved.

  17. Rapid extraction of genomic DNA from medically important yeasts and filamentous fungi by high-speed cell disruption.

    Science.gov (United States)

    Müller, F M; Werner, K E; Kasai, M; Francesconi, A; Chanock, S J; Walsh, T J

    1998-06-01

    Current methods of DNA extraction from different fungal pathogens are often time-consuming and require the use of toxic chemicals. DNA isolation from some fungal organisms is difficult due to cell walls or capsules that are not readily susceptible to lysis. We therefore investigated a new and rapid DNA isolation method using high-speed cell disruption (HSCD) incorporating chaotropic reagents and lysing matrices in comparison to standard phenol-chloroform (PC) extraction protocols for isolation of DNA from three medically important yeasts (Candida albicans, Cryptococcus neoformans, and Trichosporon beigelii) and two filamentous fungi (Aspergillus fumigatus and Fusarium solani). Additional extractions by HSCD were performed on Saccharomyces cerevisiae, Pseudallescheria boydii, and Rhizopus arrhizus. Two different inocula (10(8) and 10(7) CFU) were compared for optimization of obtained yields. The entire extraction procedure was performed on as many as 12 samples within 1 h compared to 6 h for PC extraction. In comparison to the PC procedure, HSCD DNA extraction demonstrated significantly greater yields for 10(8) CFU of C. albicans, T. beigelii, A. fumigatus, and F. solani (P extraction and PC extraction. For 10(7) CFU of T. beigelii, PC extraction resulted in a greater yield than did HSCD (P fungi than for yeasts by the HSCD extraction procedure (P extraction procedure, differences were not significant. For all eight organisms, the rapid extraction procedure resulted in good yield, integrity, and quality of DNA as demonstrated by restriction fragment length polymorphism, PCR, and random amplified polymorphic DNA. We conclude that mechanical disruption of fungal cells by HSCD is a safe, rapid, and efficient procedure for extracting genomic DNA from medically important yeasts and especially from filamentous fungi.

  18. Rapid Extraction of Genomic DNA from Medically Important Yeasts and Filamentous Fungi by High-Speed Cell Disruption

    OpenAIRE

    Müller, Frank-Michael C.; Werner, Katherine E.; Kasai, Miki; Francesconi, Andrea; Chanock, Stephen J.; Walsh, Thomas J.

    1998-01-01

    Current methods of DNA extraction from different fungal pathogens are often time-consuming and require the use of toxic chemicals. DNA isolation from some fungal organisms is difficult due to cell walls or capsules that are not readily susceptible to lysis. We therefore investigated a new and rapid DNA isolation method using high-speed cell disruption (HSCD) incorporating chaotropic reagents and lysing matrices in comparison to standard phenol-chloroform (PC) extraction protocols for isolatio...

  19. Establishing a novel automated magnetic bead-based method for the extraction of DNA from a variety of forensic samples.

    Science.gov (United States)

    Witt, Sebastian; Neumann, Jan; Zierdt, Holger; Gébel, Gabriella; Röscheisen, Christiane

    2012-09-01

    Automated systems have been increasingly utilized for DNA extraction by many forensic laboratories to handle growing numbers of forensic casework samples while minimizing the risk of human errors and assuring high reproducibility. The step towards automation however is not easy: The automated extraction method has to be very versatile to reliably prepare high yields of pure genomic DNA from a broad variety of sample types on different carrier materials. To prevent possible cross-contamination of samples or the loss of DNA, the components of the kit have to be designed in a way that allows for the automated handling of the samples with no manual intervention necessary. DNA extraction using paramagnetic particles coated with a DNA-binding surface is predestined for an automated approach. For this study, we tested different DNA extraction kits using DNA-binding paramagnetic particles with regard to DNA yield and handling by a Freedom EVO(®)150 extraction robot (Tecan) equipped with a Te-MagS magnetic separator. Among others, the extraction kits tested were the ChargeSwitch(®)Forensic DNA Purification Kit (Invitrogen), the PrepFiler™Automated Forensic DNA Extraction Kit (Applied Biosystems) and NucleoMag™96 Trace (Macherey-Nagel). After an extensive test phase, we established a novel magnetic bead extraction method based upon the NucleoMag™ extraction kit (Macherey-Nagel). The new method is readily automatable and produces high yields of DNA from different sample types (blood, saliva, sperm, contact stains) on various substrates (filter paper, swabs, cigarette butts) with no evidence of a loss of magnetic beads or sample cross-contamination. Copyright © 2012 Elsevier Ireland Ltd. All rights reserved.

  20. Antioxidant Activity of Lawsonia inermis Extracts Inhibits Chromium(VI-Induced Cellular and DNA Toxicity

    Directory of Open Access Journals (Sweden)

    Gunjan Guha

    2011-01-01

    Full Text Available Hexavalent chromium Cr(VI is a very strong oxidant which consequently causes high cytotoxicity through oxidative stress. Prevention of Cr(VI-induced cellular damage has been sought in this study in aqueous and methanolic extracts of Lawsonia inermis Linn. (Lythraceae, commonly known as Henna. The extracts showed significant (P < .05 potential in scavenging free radicals (DPPH• and ABTS•+ and Fe3+, and in inhibiting lipid peroxidation. DNA damage caused by exposure of pBR322 to Cr(VI-UV is markedly inhibited by both extracts in varying degrees. A distinct decline in Cr(VI-induced cytotoxicity was noticed in MDA-MB-435S (human breast carcinoma cells with an increase in dosage of both extracts individually. Furthermore, both extracts proved to contain a high content of phenolic compounds which were found to have a strong and significant (P < .05 positive correlation to the radical scavenging potential, lipid peroxidation inhibition capacity and cyto-protective efficiency against Cr(VI-induced oxidative cellular damage. HPLC analysis identified some of the major phenolic compounds in both extracts, which might be responsible for the antioxidant potential and the properties of DNA and cyto-protection. This study contributes to the search for natural resources that might yield potent therapeutic drugs against Cr(VI-induced oxidative cell damage.

  1. To beat or not to beat a tick: comparison of DNA extraction methods for ticks (Ixodes scapularis

    Directory of Open Access Journals (Sweden)

    Alyssa D. Ammazzalorso

    2015-08-01

    Full Text Available Background. Blacklegged ticks (Ixodes scapularis are important disease vectors in the United States, known to transmit a variety of pathogens to humans, including bacteria, protozoa, and viruses. Their importance as a disease vector necessitates reliable and comparable methods for extracting microbial DNA from ticks. Furthermore, to explore the population genetics or genomics of this tick, appropriate DNA extraction techniques are needed for both the vector and its microbes. Although a few studies have investigated different methods of DNA isolation from ticks, they are limited in the number and types of DNA extraction and lack species-specific quantification of DNA yield.Methods. Here we determined the most efficient and consistent method of DNA extraction from two different developmental stages of I. scapularis—nymph and adult—that are the most important for disease transmission. We used various methods of physical disruption of the hard, chitinous exoskeleton, as well as commercial and non-commercial DNA isolation kits. To gauge the effectiveness of these methods, we quantified the DNA yield and confirmed the DNA quality via PCR of both tick and microbial genetic material.Results. DNA extraction using the Thermo GeneJET Genomic DNA Purification Kit resulted in the highest DNA yields and the most consistent PCR amplification when combined with either cutting or bead beating with select matrices across life stages. DNA isolation methods using ammonium hydroxide as well as the MoBio PowerSoil kit also produced strong and successful PCR amplification, but only for females.Discussion. We contrasted a variety of readily available methods of DNA extraction from single individual blacklegged ticks and presented the results through a quantitative and qualitative assessment.

  2. Effect of temperature, time, and milling process on yield, flavonoid, and total phenolic content of Zingiber officinale water extract

    Science.gov (United States)

    Andriyani, R.; Kosasih, W.; Ningrum, D. R.; Pudjiraharti, S.

    2017-03-01

    Several parameters such as temperature, time of extraction, and size of simplicia play significant role in medicinal herb extraction. This study aimed to investigate the effect of those parameters on yield extract, flavonoid, and total phenolic content in water extract of Zingiber officinale. The temperatures used were 50, 70 and 90°C and the extraction times were 30, 60 and 90 min. Z. officinale in the form of powder and chips were used to study the effect of milling treatment. The correlation among those variables was analysed using ANOVA two-way factors without replication. The result showed that time and temperature did not influence the yield of extract of Powder simplicia. However, time of extraction influenced the extract of simplicia treated without milling process. On the other hand, flavonoid and total phenolic content were not influenced by temperature, time, and milling treatment.

  3. Rapid DNA extraction from dried blood spots on filter paper: potential applications in biobanking.

    Science.gov (United States)

    Choi, Eun-Hye; Lee, Sang Kwang; Ihm, Chunhwa; Sohn, Young-Hak

    2014-12-01

    Dried blood spot (DBS) technology is a microsampling alternative to traditional plasma or serum sampling for pharmaco- or toxicokinetic evaluation. DBS technology has been applied to diagnostic screening in drug discovery, nonclinical, and clinical settings. We have developed an improved elution protocol involving boiling of blood spots dried on Whatman filter paper. The purpose of this study was to compare the quality, purity, and quantity of DNA isolated from frozen blood samples and DBSs. We optimized a method for extraction and estimation of DNA from blood spots dried on filter paper (3-mm FTA card). A single DBS containing 40 μL blood was used. DNA was efficiently extracted in phosphate-buffered saline (PBS) or Tris-EDTA (TE) buffer by incubation at 37°C overnight. DNA was stable in DBSs that were stored at room temperature or frozen. The housekeeping genes GAPDH and beta-actin were used as positive standards for polymerase chain reaction (PCR) validation of general diagnostic screening. Our simple and convenient DBS storage and extraction methods are suitable for diagnostic screening by using very small volumes of blood collected on filter paper, and can be used in biobanks for blood sample storage.

  4. UV light induced DNA damages and the radiation protection effects of Lingzi mushroom extract

    International Nuclear Information System (INIS)

    Vo Thi Thuong Lan; Dinh Ba Tuan; Ta Bich Thuan; Tran Bang Diep; Tran Minh Quynh

    2016-01-01

    UV light has strongly influenced on the growth of E. coli as well as caused DNA damages. Configurations of both genomic DNA and pUC 19 plasmids extracted from E. coli were significantly changed by the exposure to UV light of 254 nm and DLT, an extract of Ganoderma lucidum Lingzi mushroom. The results also revealed the radio-protective effects of DLT to UV radiation. By adding 2% DLT to its culturing suspension, the growth of E. coli was significantly decreased, whereas a low DLT amount of about 0.5% slightly improved its growth, indicated that the DLT extract can be used as a promising protective substance against UV radiation. At the molecular level, the radio-protective effects of DLT were observed for both UV treated DNA and protein. Thus, DLT can protect DNA in vivo, but not in vitro. This effect was also observed for Taq polymerase, suggested that the radioprotection effect of DLT may due to it accelerated the degradation of radicals or species that produced in the suspensions during UV exposure. (author)

  5. Microwave-assisted extraction and a new determination method for total steroid saponins from Dioscorea zingiberensis C.H. Wright.

    Science.gov (United States)

    Ren, Yao; Chen, Yu; Hu, Bohan; Wu, Hui; Lai, Furao; Li, Xiaofeng

    2015-12-01

    An efficient microwave-assisted extraction (MAE) technique was applied to isolate total steroid saponins from Dioscorea zingiberensis C.H. Wright (DZW). The optimal extracting conditions were established as 75% ethanol as solvent, ratio of solid/liquid 1:20 (g/ml), temperature 75 °C, irradiation power 600 W and three extraction cycles of 6 min each. Scanning electron microscopy (SEM) images of DZW processed by four different extractions provided visual evidence of the disruption effect on DZW. Diosgenin was quantified by HPLC and examined further by LC-ESI/MS after acid hydrolysis. Total steroid saponins were calculated using diosgenin from total steroid saponins. The MAE procedure was optimized, validated and compared with other conventional extraction processes. This report provides a convenient technology for the extraction and quantification of total saponins of DZW combining MAE with HPLC and LC-ESI/MS for the first time. Copyright © 2015 Elsevier Inc. All rights reserved.

  6. Validation of a DNA IQ-based extraction method for TECAN robotic liquid handling workstations for processing casework.

    Science.gov (United States)

    Frégeau, Chantal J; Lett, C Marc; Fourney, Ron M

    2010-10-01

    A semi-automated DNA extraction process for casework samples based on the Promega DNA IQ™ system was optimized and validated on TECAN Genesis 150/8 and Freedom EVO robotic liquid handling stations configured with fixed tips and a TECAN TE-Shake™ unit. The use of an orbital shaker during the extraction process promoted efficiency with respect to DNA capture, magnetic bead/DNA complex washes and DNA elution. Validation studies determined the reliability and limitations of this shaker-based process. Reproducibility with regards to DNA yields for the tested robotic workstations proved to be excellent and not significantly different than that offered by the manual phenol/chloroform extraction. DNA extraction of animal:human blood mixtures contaminated with soil demonstrated that a human profile was detectable even in the presence of abundant animal blood. For exhibits containing small amounts of biological material, concordance studies confirmed that DNA yields for this shaker-based extraction process are equivalent or greater to those observed with phenol/chloroform extraction as well as our original validated automated magnetic bead percolation-based extraction process. Our data further supports the increasing use of robotics for the processing of casework samples. Crown Copyright © 2009. Published by Elsevier Ireland Ltd. All rights reserved.

  7. Pomegranate extract protects against cerebral ischemia/reperfusion injury and preserves brain DNA integrity in rats.

    Science.gov (United States)

    Ahmed, Maha A E; El Morsy, Engy M; Ahmed, Amany A E

    2014-08-21

    Interruption to blood flow causes ischemia and infarction of brain tissues with consequent neuronal damage and brain dysfunction. Pomegranate extract is well tolerated, and safely consumed all over the world. Interestingly, pomegranate extract has shown remarkable antioxidant and anti-inflammatory effects in experimental models. Many investigators consider natural extracts as novel therapies for neurodegenerative disorders. Therefore, this study was carried out to investigate the protective effects of standardized pomegranate extract against cerebral ischemia/reperfusion-induced brain injury in rats. Adult male albino rats were randomly divided into sham-operated control group, ischemia/reperfusion (I/R) group, and two other groups that received standardized pomegranate extract at two dose levels (250, 500 mg/kg) for 15 days prior to ischemia/reperfusion (PMG250+I/R, and PMG500+I/R groups). After I/R or sham operation, all rats were sacrificed and brains were harvested for subsequent biochemical analysis. Results showed reduction in brain contents of MDA (malondialdehyde), and NO (nitric oxide), in addition to enhancement of SOD (superoxide dismutase), GPX (glutathione peroxidase), and GRD (glutathione reductase) activities in rats treated with pomegranate extract prior to cerebral I/R. Moreover, pomegranate extract decreased brain levels of NF-κB p65 (nuclear factor kappa B p65), TNF-α (tumor necrosis factor-alpha), caspase-3 and increased brain levels of IL-10 (interleukin-10), and cerebral ATP (adenosine triphosphate) production. Comet assay showed less brain DNA (deoxyribonucleic acid) damage in rats protected with pomegranate extract. The present study showed, for the first time, that pre-administration of pomegranate extract to rats, can offer a significant dose-dependent neuroprotective activity against cerebral I/R brain injury and DNA damage via antioxidant, anti-inflammatory, anti-apoptotic and ATP-replenishing effects. Copyright © 2014 Elsevier Inc

  8. Robust and effective methodologies for cryopreservation and DNA extraction from anaerobic gut fungi.

    Science.gov (United States)

    Solomon, Kevin V; Henske, John K; Theodorou, Michael K; O'Malley, Michelle A

    2016-04-01

    Cell storage and DNA isolation are essential to developing an expanded suite of microorganisms for biotechnology. However, many features of non-model microbes, such as an anaerobic lifestyle and rigid cell wall, present formidable challenges to creating strain repositories and extracting high quality genomic DNA. Here, we establish accessible, high efficiency, and robust techniques to store lignocellulolytic anaerobic gut fungi long term without specialized equipment. Using glycerol as a cryoprotectant, gut fungal isolates were preserved for a minimum of 23 months at -80 °C. Unlike previously reported approaches, this improved protocol is non-toxic and rapid, with samples surviving twice as long with negligible growth impact. Genomic DNA extraction for these isolates was optimized to yield samples compatible with next generation sequencing platforms (e.g. Illumina, PacBio). Popular DNA isolation kits and precipitation protocols yielded preps that were unsuitable for sequencing due to carbohydrate contaminants from the chitin-rich cell wall and extensive energy reserves of gut fungi. To address this, we identified a proprietary method optimized for hardy plant samples that rapidly yielded DNA fragments in excess of 10 kb with minimal RNA, protein or carbohydrate contamination. Collectively, these techniques serve as fundamental tools to manipulate powerful biomass-degrading gut fungi and improve their accessibility among researchers. Copyright © 2015 Elsevier Ltd. All rights reserved.

  9. Usefulness of FTA® cards as a Pneumocystis-DNA extraction method in bronchoalveolar lavage samples.

    Science.gov (United States)

    Rodiño, Jenniffer M; Aguilar, Yudy A; Rueda, Zulma Vanessa; Vélez, Lázaro A

    2016-01-01

    FTA® cards (Fast Technology for Analysis of Nucleic Acids) are an alternative DNA extraction method in bronchoalveolar lavage (BAL) samples for Pneumocystis jirovecii molecular analyses. The goal was to evaluate the usefulness of FTA® cards to detect P. jirovecii-DNA by PCR in BAL samples compared to silica adsorption chromatography (SAC). This study used 134 BAL samples from immunocompromised patients previously studied to establish microbiological aetiology of pneumonia, among them 15 cases of Pneumocystis pneumonia (PCP) documented by staining and 119 with other alternative diagnoses. The FTA® system and SAC were used for DNA extraction and then amplified by nested PCR to detect P. jirovecii. Performance and concordance of the two DNA extraction methods compared to P. jirovecii microscopy were calculated. The influence of the macroscopic characteristics, transportation of samples and the duration of the FTA® card storage (1, 7, 10 or 12 months) were also evaluated. Among 134 BAL samples, 56% were positive for P. jirovecii-DNA by SAC and 27% by FTA®. All 15 diagnosed by microscopy were detected by FTA® and SAC. Specificity of the FTA® system and SAC were 82.4% and 49.6%, respectively. Compared to SAC, positivity by FTA® decreased with the presence of blood in BAL (62% vs 13.5%). The agreement between samples at 7, 10 and 12 months was 92.5% for FTA®. Positive cases by FTA® remained the same after shipment by mail. Results suggest that FTA® is a practical, safe and economical method to preserve P. jirovecii-DNA in BAL samples for molecular studies.

  10. Human DNA Extraction by Two Extraction Methods for Forensic Typification from Human Feces on FTA Paper

    OpenAIRE

    Sandoval-Arias, Shirleny Monserrat

    2014-01-01

    La identificación de sospechosos en casos criminales se ha facilitado desde la aplicación de pruebas de ADN a diferentes muestras. El uso de esta técnica para la tipificación forense a partir de muestras fecales humanas aún presenta complicaciones, por lo que en esta investigación se evaluaron dos protocolos de extracción de ADN con ciertas modificaciones para determinar el de mayor efectividad. Se realizaron extracciones orgánicas y mediante el kit comercial “DNA IQTM Casework Sample Kit par...

  11. Use of real-time PCR to evaluate two DNA extraction methods from food

    Directory of Open Access Journals (Sweden)

    Maria Regina Branquinho

    2012-03-01

    Full Text Available The DNA extraction is a critical step in Genetically Modified Organisms analysis based on real-time PCR. In this study, the CTAB and DNeasy methods provided good quality and quantity of DNA from the texturized soy protein, infant formula, and soy milk samples. Concerning the Certified Reference Material consisting of 5% Roundup Ready® soybean, neither method yielded DNA of good quality. However, the dilution test applied in the CTAB extracts showed no interference of inhibitory substances. The PCR efficiencies of lectin target amplification were not statistically different, and the coefficients of correlation (R² demonstrated high degree of correlation between the copy numbers and the threshold cycle (Ct values. ANOVA showed suitable adjustment of the regression and absence of significant linear deviations. The efficiencies of the p35S amplification were not statistically different, and all R² values using DNeasy extracts were above 0.98 with no significant linear deviations. Two out of three R² values using CTAB extracts were lower than 0.98, corresponding to lower degree of correlation, and the lack-of-fit test showed significant linear deviation in one run. The comparative analysis of the Ct values for the p35S and lectin targets demonstrated no statistical significant differences between the analytical curves of each target.

  12. Comparison of methods of DNA extraction for real-time PCR in a model of pleural tuberculosis.

    Science.gov (United States)

    Santos, Ana; Cremades, Rosa; Rodríguez, Juan Carlos; García-Pachón, Eduardo; Ruiz, Montserrat; Royo, Gloria

    2010-01-01

    Molecular methods have been reported to have different sensitivities in the diagnosis of pleural tuberculosis and this may in part be caused by the use of different methods of DNA extraction. Our study compares nine DNA extraction systems in an experimental model of pleural tuberculosis. An inoculum of Mycobacterium tuberculosis was added to 23 pleural liquid samples with different characteristics. DNA was subsequently extracted using nine different methods (seven manual and two automatic) for analysis with real-time PCR. Only two methods were able to detect the presence of M. tuberculosis DNA in all the samples: extraction using columns (Qiagen) and automated extraction with the TNAI system (Roche). The automatic method is more expensive, but requires less time. Almost all the false negatives were because of the difficulty involved in extracting M. tuberculosis DNA, as in general, all the methods studied are capable of eliminating inhibitory substances that block the amplification reaction. The method of M. tuberculosis DNA extraction used affects the results of the diagnosis of pleural tuberculosis by molecular methods. DNA extraction systems that have been shown to be effective in pleural liquid should be used.

  13. AFSC/RACE/SAP/Shavey: DNA extraction from archived Giemsa-stained blood smears using polymerase chain reaction to detect host and parasitic DNA

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — These are the data from a laboratory experiment in which DNA content was removed from blood smears and extracted. The blood smears were either stained with...

  14. DNA extraction from dry museum beetles without conferring external morphological damage

    DEFF Research Database (Denmark)

    Gilbert, M Thomas P; Moore, Wendy; Melchior, Linea

    2007-01-01

    undesirable when dealing with rare species or otherwise important specimens, such as type specimens. METHODOLOGY: We describe a method for the extraction of PCR-amplifiable mitochondrial and nuclear DNA from dry insects without causing external morphological damage. Using PCR to amplify approximately 220 bp...... of the mitochondrial gene cytochrome c oxidase I, and 250-345 bp fragments of the multi-copy, nuclear 28s ribosomal DNA gene, we demonstrate the efficacy of this method on beetles collected up to 50 years ago. CONCLUSIONS: This method offers a means of obtaining useful genetic information from rare insects without...... conferring external morphological damage. Udgivelsesdato: 2007-null...

  15. The Protective Effect of Whole Honey and Phenolic Extract on Oxidative DNA Damage in Mice Lymphocytes Using Comet Assay.

    Science.gov (United States)

    Cheng, Ni; Wang, Yuan; Cao, Wei

    2017-12-01

    In this study, the antioxidant activity and the protective effect against hydrogen peroxide-induced DNA damage were assessed for five honeys of different botanical origin. Seven phenolic acids were detected in the honey samples. Ferulic acid was the most abundant phenolic acid detected in longan honey, jujube honey and buckwheat honey. Ellagic acid, p-hydroxybenzoic acid and protocatechuic acid were the main phenolic acids detected in vitex honey. Of all honey samples tested, the highest total phenolic content and antioxidant activity were found in buckwheat honey, whereas the lowest total phenolic content and antioxidant activity were found in locust honey. Treatment with hydrogen peroxide induced a 62% increase in tail DNA in mice lymphocytes, and all studied honeys significantly inhibited this effect (P Phenolic extracts of honey displayed greater protective effects than whole honey in comet assay. The hydrogen peroxide-generated increase in 8-hydroxy-2-deoxyguanosine (8-OHdG) was effectively inhibited by the honeys studied (P phenolic acids of honey can penetrate into lymphocytes and protect DNA from oxidative damage by scavenging hydrogen peroxide and/or chelating ferrous ions.

  16. An Improved Methodology to Overcome Key Issues in Human Fecal Metagenomic DNA Extraction

    Directory of Open Access Journals (Sweden)

    Jitendra Kumar

    2016-12-01

    Full Text Available Microbes are ubiquitously distributed in nature, and recent culture-independent studies have highlighted the significance of gut microbiota in human health and disease. Fecal DNA is the primary source for the majority of human gut microbiome studies. However, further improvement is needed to obtain fecal metagenomic DNA with sufficient amount and good quality but low host genomic DNA contamination. In the current study, we demonstrate a quick, robust, unbiased, and cost-effective method for the isolation of high molecular weight (>23 kb metagenomic DNA (260/280 ratio >1.8 with a good yield (55.8 ± 3.8 ng/mg of feces. We also confirm that there is very low human genomic DNA contamination (eubacterial: human genomic DNA marker genes = 227.9:1 in the human feces. The newly-developed method robustly performs for fresh as well as stored fecal samples as demonstrated by 16S rRNA gene sequencing using 454 FLX+. Moreover, 16S rRNA gene analysis indicated that compared to other DNA extraction methods tested, the fecal metagenomic DNA isolated with current methodology retains species richness and does not show microbial diversity biases, which is further confirmed by qPCR with a known quantity of spike-in genomes. Overall, our data highlight a protocol with a balance between quality, amount, user-friendliness, and cost effectiveness for its suitability toward usage for culture-independent analysis of the human gut microbiome, which provides a robust solution to overcome key issues associated with fecal metagenomic DNA isolation in human gut microbiome studies.

  17. Back to basics: an evaluation of NaOH and alternative rapid DNA extraction protocols for DNA barcoding, genotyping, and disease diagnostics from fungal and oomycete samples.

    Science.gov (United States)

    Osmundson, Todd W; Eyre, Catherine A; Hayden, Katherine M; Dhillon, Jaskirn; Garbelotto, Matteo M

    2013-01-01

    The ubiquity, high diversity and often-cryptic manifestations of fungi and oomycetes frequently necessitate molecular tools for detecting and identifying them in the environment. In applications including DNA barcoding, pathogen detection from plant samples, and genotyping for population genetics and epidemiology, rapid and dependable DNA extraction methods scalable from one to hundreds of samples are desirable. We evaluated several rapid extraction methods (NaOH, Rapid one-step extraction (ROSE), Chelex 100, proteinase K) for their ability to obtain DNA of quantity and quality suitable for the following applications: PCR amplification of the multicopy barcoding locus ITS1/5.8S/ITS2 from various fungal cultures and sporocarps; single-copy microsatellite amplification from cultures of the phytopathogenic oomycete Phytophthora ramorum; probe-based P. ramorum detection from leaves. Several methods were effective for most of the applications, with NaOH extraction favored in terms of success rate, cost, speed and simplicity. Frozen dilutions of ROSE and NaOH extracts maintained PCR viability for over 32 months. DNA from rapid extractions performed poorly compared to CTAB/phenol-chloroform extracts for TaqMan diagnostics from tanoak leaves, suggesting that incomplete removal of PCR inhibitors is an issue for sensitive diagnostic procedures, especially from plants with recalcitrant leaf chemistry. NaOH extracts exhibited lower yield and size than CTAB/phenol-chloroform extracts; however, NaOH extraction facilitated obtaining clean sequence data from sporocarps contaminated by other fungi, perhaps due to dilution resulting from low DNA yield. We conclude that conventional extractions are often unnecessary for routine DNA sequencing or genotyping of fungi and oomycetes, and recommend simpler strategies where source materials and intended applications warrant such use. © 2012 Blackwell Publishing Ltd.

  18. DNA analysis of soil extracts can be used to investigate fine root depth distribution of trees

    Science.gov (United States)

    Bithell, Sean L.; Tran-Nguyen, Lucy T. T.; Hearnden, Mark N.; Hartley, Diana M.

    2015-01-01

    Understanding the root distribution of trees by soil coring is time-consuming as it requires the separation of roots from soil and classification of roots into particular size classes. This labour-intensive process can limit sample throughput and therefore sampling intensity. We investigated the use of quantitative polymerase chain reaction (qPCR) on soil DNA extractions to determine live fine root DNA density (RDD, mg DNA m−2) for mango (Mangifera indica) trees. The specificity of the qPCR was tested against DNA extracted from 10 mango cultivars and 14 weed species. All mango cultivars and no weeds were detected. Mango DNA was successfully quantified from control soil spiked with mango roots and weed species. The DNA yield of mango root sections stored in moist soil at 23–28 °C declined after 15 days to low concentrations as roots decayed, indicating that dead root materials in moist soil would not cause false-positive results. To separate large roots from samples, a root separation method for field samples was used to target the root fragments remaining in sieved (minimum 2 mm aperture) soil for RDD comparisons. Using this method we compared the seasonal RDD values of fine roots for five mango rootstock cultivars in a field trial. The mean cultivar DNA yields by depth from root fragments in the sieved soil samples had the strongest relationship (adjusted multiple R2 = 0.9307, P < 0.001) with the dry matter (g m−2) of fine (diameter <0.64 mm) roots removed from the soil by sieving. This method provides a species-specific and rapid means of comparing the distribution and concentration of live fine roots of trees in orchards using soil samples up to 500 g. PMID:25552675

  19. Sensitive radioimmunoassay of total thyroxine (T4) in horses using a simple extraction method.

    Science.gov (United States)

    Tangyuenyong, Siriwan; Nambo, Yasuo; Nagaoka, Kentaro; Tanaka, Tomomi; Watanabe, Gen

    2017-07-28

    Most thyroid hormone determinations in animals are based on immunoassays adapted from those used to test human samples, which may not reflect the actual values of thyroid hormone in horses because of the presence of binding proteins. The aims of the present study were i) to establish a novel radioimmunoassay (RIA) using a more simple and convenient method to separate binding proteins for the measurement of total thyroxine (T4) in horses and ii) to validate the assay by comparing total T4 concentrations in yearling horses raised in different climates. Blood samples were collected from trained yearlings in Hokkaido (temperate climate) and Miyazaki (subtropical climate) in Japan and from adult horses in estrus and diestrus. T4 was extracted from both serum and plasma using modified acid ethanol cryo-precipitation and sodium acetate ethanol methods. Circulating total T4 concentrations were determined by RIA. T4 concentration by sodium acetate ethanol was appropriately detectable rather than sodium salicylate method and was the same as for acid ethanol method. Furthermore, this sodium acetate ethanol method required fewer extraction steps than the other methods. Circulating T4 concentrations in yearlings were 225.98 ± 20.89 ng/ml, which was higher than the previous reference values. With respect to climate, T4 levels in Hokkaido yearlings tended to be higher than those in Miyazaki yearlings throughout the study period. These results indicated that this RIA protocol using a modified sodium acetate ethanol separation technique might be an appropriate tool for specific measurement of total T4 in horses.

  20. Development of an efficient fungal DNA extraction method to be used in random amplified polymorphic DNA-PCR analysis to differentiate cyclopiazonic acid mold producers.

    Science.gov (United States)

    Sánchez, Beatriz; Rodríguez, Mar; Casado, Eva M; Martín, Alberto; Córdoba, Juan J

    2008-12-01

    A variety of previously established mechanical and chemical treatments to achieve fungal cell lysis combined with a semiautomatic system operated by a vacuum pump were tested to obtain DNA extract to be directly used in randomly amplified polymorphic DNA (RAPD)-PCR to differentiate cyclopiazonic acid-producing and -nonproducing mold strains. A DNA extraction method that includes digestion with proteinase K and lyticase prior to using a mortar and pestle grinding and a semiautomatic vacuum system yielded DNA of high quality in all the fungal strains and species tested, at concentrations ranging from 17 to 89 ng/microl in 150 microl of the final DNA extract. Two microliters of DNA extracted with this method was directly used for RAPD-PCR using primer (GACA)4. Reproducible RAPD fingerprints showing high differences between producer and nonproducer strains were observed. These differences in the RAPD patterns did not differentiate all the strains tested in clusters by cyclopiazonic acid production but may be very useful to distinguish cyclopiazonic acid producer strains from nonproducer strains by a simple RAPD analysis. Thus, the DNA extracts obtained could be used directly without previous purification and quantification for RAPD analysis to differentiate cyclopiazonic acid producer from nonproducer mold strains. This combined analysis could be adaptable to other toxigenic fungal species to enable differentiation of toxigenic and non-toxigenic molds, a procedure of great interest in food safety.

  1. Total phenols and antioxidant activities of leaf and stem extracts from coriander, mint and parsley grown in Saudi Arabia

    International Nuclear Information System (INIS)

    Al-Juhaimi, F.; Ghafoorr, K.

    2011-01-01

    Leaves and stems of three different herbs from two different families were used to extract phenolic compounds and the bioactivity of the extracts was evaluated by using 1, 1-diphenyl-2-picrylhydrazyl or DPPH scavenging ability or their antioxidant activities. Extract from leaves of mint, which belongs to Lamiaceae family contained 1.24 mgGAE/100 mL of total phenolic compounds and 34.21% antioxidant activity which were significantly higher than those in extracts from coriander and parsley, both of which belong to Apiaceae family. Extracts of leaves from these herbs showed more quantity of total phenols and higher antioxidant activities than extracts from stem parts, however both leaves and stems of these three herbs grown in Saudi Arabia contained good quantities of total phenols (>1.02 mgGAE/100 mL) and showed more than 18.3% free radical scavenging activity. (author)

  2. [Studies on preparative technology and quantitative determination for extracts of total saponin in roof of Panax japonicus].

    Science.gov (United States)

    He, Yu-min; Lu, Ke-ming; Yuan, Ding; Zhang, Chang-cheng

    2008-11-01

    To explore the optimum extraction and purification condition of the total saponins in the root of Panax japonicus (RPJ), and establish its quality control methods. Designed L16 (4(5)) orthogonal test with the extraction rate of total saponins as index, to determine the rational extraction process, and the techniques of water-saturated n-butanol extraction and acetone precipitation were applied to purify the alcohol extract of RPJ. Total saponins were detected by spectrophotometry and its triterpenoidal sapogenin oleanolic acid detected by HPLC. The optimum conditions of total saponins from RPJ was as follows: the material was pulverized, dipped in 60% ethanol aqueous solution as extract solvent at 10 times of volume, and refluxed 3 times for 3 h each time. Extractant of water-saturated n-butanol with extraction times of 3 and precipitant of acetone with precipitation amount of 4-5 times were included in the purification process, which would obtain the quality products. The content of total saponins could reach to 83.48%, and oleanolic acid to 38.30%. The optimized preparative technology is stable, convenient and practical. The extract rate of RPJ was high and steady with this technology, which provided new evidence for industrializing production of the plant and developing new drug.

  3. DNA purification using dynamic solid-phase extraction on a rotationally-driven polyethylene-terephthalate microdevice

    Energy Technology Data Exchange (ETDEWEB)

    Jackson, K.R. [Department of Chemistry, University of Virginia, Charlottesville, VA 22904 (United States); Borba, J.C. [Instituto de Química de São Carlos, Universidade de São Paulo, São Carlos-SP (Brazil); Meija, M. [Department of Mechanical and Aerospace Engineering, University of Virginia, Charlottesville, VA 22904 (United States); Mills, D.L. [TeGrex Technologies, Sperryville, VA 22740 (United States); Haverstick, D.M. [Department of Pathology, University of Virginia, Charlottesville, VA 22904 (United States); Olson, K.E.; Aranda, R. [Office of the Chief Scientist, Defense Forensic Science Center, N 31st Street, Atlanta, GA 30297 (United States); Garner, G.T. [Department of Mechanical and Aerospace Engineering, University of Virginia, Charlottesville, VA 22904 (United States); Carrilho, E. [Instituto de Química de São Carlos, Universidade de São Paulo, São Carlos-SP (Brazil); Landers, J.P., E-mail: landers@virginia.edu [Department of Chemistry, University of Virginia, Charlottesville, VA 22904 (United States); Department of Mechanical and Aerospace Engineering, University of Virginia, Charlottesville, VA 22904 (United States); Department of Pathology, University of Virginia, Charlottesville, VA 22904 (United States)

    2016-09-21

    We report the development of a disposable polyester toner centrifugal device for semi-automated, dynamic solid phase DNA extraction (dSPE) from whole blood samples. The integration of a novel adhesive and hydrophobic valving with a simple and low cost microfabrication method allowed for sequential addition of reagents without the need for external equipment for fluid flow control. The spin-dSPE method yielded an average extraction efficiency of ∼45% from 0.6 μL of whole blood. The device performed single sample extractions or accommodate up to four samples for simultaneous DNA extraction, with PCR-readiness DNA confirmed by effective amplification of a β-globin gene. The purity of the DNA was challenged by a multiplex amplification with 16 targeted amplification sites. Successful multiplexed amplification could routinely be obtained using the purified DNA collected post an on-chip extraction, with the results comparable to those obtained with commercial DNA extraction methods. This proof-of-principle work represents a significant step towards a fully-automated low cost DNA extraction device. - Highlights: • dSPE design on centrifugal PeT device with a unique mixing strategy was proposed. • Increased fluidic control with novel adhesive tape valves on a PeT device. • Multiplexed spin-dSPE device to run up to 4 samples simultaneously. • Demonstrated strong singleplexed and multiplexed amplification following chip dSPE.

  4. Total Lactic Acid Bacteria (LAB), Antioxidant Activity, and Acceptance of Synbiotic Yoghurt with Binahong Leaf Extract (Anredera cordifolia (Ten.) Steenis)

    Science.gov (United States)

    Lestari, R. P.; Nissa, C.; Afifah, D. N.; Anjani, G.; Rustanti, N.

    2018-02-01

    Alternative treatment for metabolic syndrome can be done by providing a diet consist of functional foods or beverages. Synbiotic yoghurt containing binahong leaf extract which high in antioxidant, total LAB and fiber can be selected to reduce the risk of metabolic syndrome. The effect of binahong leaf extract in synbiotic yoghurt against total LAB, antioxidant activity, and acceptance were analyzed. The experiment was done with complete randomized design with addition of binahong leaf extract 0% (control); 0.12%; 0.25%; 0.5% in synbiotic yoghurt. Analysis of total LAB using Total Plate Count test, antioxidant activity using DPPH, and acceptance were analyzed by hedonic test. The addition of binahong leaf extract in various doses in synbiotic yoghurt decreased total LAB without significant effect (p=0,145). There was no effect of addition binahong leaf extract on antioxidant activity (p=0,297). The addition of binahong leaf extract had an effect on color, but not on aroma, texture and taste. The best result was yoghurt synbiotic with addition of 0,12% binahong leaf extract. Conclusion of the research was the addition of binahong leaf extract to synbiotic yogurt did not significantly affect total LAB, antioxidant activity, aroma, texture and taste; but had a significant effect on color.

  5. A Simple Thermoplastic Substrate Containing Hierarchical Silica Lamellae for High-Molecular-Weight DNA Extraction.

    Science.gov (United States)

    Zhang, Ye; Zhang, Yi; Burke, Jeffrey M; Gleitsman, Kristin; Friedrich, Sarah M; Liu, Kelvin J; Wang, Tza-Huei

    2016-12-01

    An inexpensive, magnetic thermoplastic nanomaterial is developed utilizing a hierarchical layering of micro- and nanoscale silica lamellae to create a high-surface-area and low-shear substrate capable of capturing vast amounts of ultrahigh-molecular-weight DNA. Extraction is performed via a simple 45 min process and is capable of achieving binding capacities up to 1 000 000 times greater than silica microparticles. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  6. Evaluation of simplified dna extraction methods for EMM typing of group a streptococci

    Directory of Open Access Journals (Sweden)

    Jose JJM

    2006-01-01

    Full Text Available Simplified methods of DNA extraction for amplification and sequencing for emm typing of group A streptococci (GAS can save valuable time and cost in resource crunch situations. To evaluate this, we compared two methods of DNA extraction directly from colonies with the standard CDC cell lysate method for emm typing of 50 GAS strains isolated from children with pharyngitis and impetigo. For this, GAS colonies were transferred into two sets of PCR tubes. One set was preheated at 94oC for two minutes in the thermal cycler and cooled while the other set was frozen overnight at -20oC and then thawed before adding the PCR mix. For the cell lysate method, cells were treated with mutanolysin and hyaluronidase before heating at 100oC for 10 minutes and cooling immediately as recommended in the CDC method. All 50 strains could be typed by sequencing the hyper variable region of the emm gene after amplification. The quality of sequences and the emm types identified were also identical. Our study shows that the two simplified DNA extraction methods directly from colonies can conveniently be used for typing a large number of GAS strains easily in relatively short time.

  7. Aqueous extract of Pinus caribaea inhibits the damage induced by ultraviolet radiations, in plasmid DNA

    Directory of Open Access Journals (Sweden)

    Marioly Vernhes Tamayo

    2017-08-01

    Full Text Available Context: The incidence of solar ultraviolet radiation (UV on Earth has increased due to diminish of the ozone layer. This enviromental agent is highly genotoxic causing numerous damage in DNA molecule. Nowadays there is a growing interest in the search of compounds capable to minimize these effects. In particular, phytocompounds have been tested as excelent candidates for their antigenotoxic properties. Aims: To evaluate the protective effect of the aqueous extract of Pinus caribaea (EPC against the damage induced by the UVB and UVC radiation. Methods: The cell-free plasmid DNA assay was employed. The forms of plasmid were separated electrophoretically in agarose gel. For genotoxic and photoprotective evaluation of P. caribaea, different concentrations of the extract (0.1 – 2.0 mg/mL and exposure times were evaluated. The CPD lesions were detected enzymatically. Additionally, the transmittance of the aqueous extract against 254 nm and 312 nm was measured. Results: None of the concentrations were genotoxic in 30 min of treatment, for superior times a clastogenic effect was observed. The EPC despite inhibiting the activity of the enzyme T4 endo V, impedes photolesions formation in DNA at concentrations ≥ 0.1 mg/mL. Conclusions: The EPC has photoprotective properties, this effect could be related with its antioxidants and absorptives capacities.

  8. PROTOCOL FOR EXTRACTION OF BACTERIAL METAGENOME DNA TO PRAWN Macrobrachium carcinus L

    Directory of Open Access Journals (Sweden)

    J U González de la Cruz

    2011-07-01

    Full Text Available In this work we adapted a protocol for the extraction of metagenomic DNA (ADNmg bacteria in the digestive system (intestines, stomach and hepatopancreas of Macrobrachium carcinus L., with reference to the method of extracting bacterial DNA from soils and sediments (Rojas-Herrera et al., 2008. This methodology consisted of enzymatic, physics, mechanics and chemistry after a series of tests was abolished enzymatic lysis. However, the success ADNmg extraction was influenced mainly by the preparation of the samples, in particular the hepatopancreas, where it was necessary to remove the fat by thermal shock temperature and phase separation by centrifugation with the sample frozen.The effectiveness of isolated DNA fragmentation was verified by gel electrophoresis in denaturing gradient (DGGE after amplification with universal primers. In general, it had a low diversity (19 phylotypes between the different organs analyzed of 13.5 ± 1 (intestines to 11.7 ± 0.96 (stomach. The Shannon-Weaver index (2.45, Simpsons (10.88 and equity (0972 obtained from the digitization of the image of the gel, suggested that the phylotypes that form the gut microflora M. carcinus, is distributed unevenly between the different organs analyzed.

  9. A modular method for the extraction of DNA and RNA, and the separation of DNA pools from diverse environmental sample types

    DEFF Research Database (Denmark)

    Lever, Mark; Torti, Andrea; Eickenbusch, Philip

    2015-01-01

    tests, in which permutations of all nucleic acid extraction steps were compared. The final modular protocol is suitable for extractions from igneous rock, air, water, and sediments. Sediments range from high-biomass, organic rich coastal samples to samples from the most oligotrophic region of the world...... DNA pools without cell lysis from intracellular and particle-complexed DNA pools may enable new insights into the cycling and preservation of DNA in environmental samples in the future. A general protocol is outlined, along with recommendations for optimizing this general protocol for specific sample...

  10. Study of total phenol, flavonoids contents and phytochemical screening of various leaves crude extracts of locally grown Thymus vulgaris.

    Science.gov (United States)

    Hossain, Mohammad Amzad; AL-Raqmi, Khulood Ahmed Salim; AL-Mijizy, Zawan Hamood; Weli, Afaf Mohammed; Al-Riyami, Qasim

    2013-09-01

    To prepare various crude extracts using different polarities of solvent and to quantitatively evaluate their total phenol, flavonoids contents and phytochemical screening of Thymus vulgaris collected from Al Jabal Al Akhdar, Nizwa, Sultanate of Oman. The leave sample was extracted with methanol and evaporated. Then it was defatted with water and extracted with different polarities organic solvents with increasing polarities. The prepare hexane, chloroform, ethyl acetate, butanol and methanol crude extracts were used for their evaluation of total phenol, flavonoids contents and phytochemical screening study. The established conventional methods were used for quantitative determination of total phenol, flavonoids contents and phytochemical screening. Phytochemical screening for various crude extracts were tested and shown positive result for flavonoids, saponins and steroids compounds. The result for total phenol content was the highest in butanol and the lowest in methanol crude extract whereas the total flavonoids contents was the highest in methanol and the lowest hexane crude extract. The crude extracts from locally grown Thymus vulgaris showed high concentration of flavonoids and it could be used as antibiotics for different curable and uncurable diseases.

  11. Toxic reagents and expensive equipment: are they really necessary for the extraction of good quality fungal DNA?

    Science.gov (United States)

    Rodrigues, P; Venâncio, A; Lima, N

    2018-01-01

    The aim of this work was to evaluate a fungal DNA extraction procedure with the lowest inputs in terms of time as well as of expensive and toxic chemicals, but able to consistently produce genomic DNA of good quality for PCR purposes. Two types of fungal biological material were tested - mycelium and conidia - combined with two protocols for DNA extraction using Sodium Dodecyl Sulphate (SDS) and Cetyl Trimethyl Ammonium Bromide as extraction buffers and glass beads for mechanical disruption of cell walls. Our results showed that conidia and SDS buffer was the combination that lead to the best DNA quality and yield, with the lowest variation between samples. This study clearly demonstrates that it is possible to obtain high yield and pure DNA from pigmented conidia without the use of strong cell disrupting procedures and of toxic reagents. There are numerous methods for DNA extraction from fungi. Some rely on expensive commercial kits and/or equipments, unavailable for many laboratories, or make use of toxic chemicals such as chloroform, phenol and mercaptoethanol. This study clearly demonstrates that it is possible to obtain high yields of pure DNA from pigmented conidia without the use of strong and expensive cell disrupting procedures and of toxic reagents. The method herein described is simultaneously inexpensive and adequate to DNA extraction from several different types of fungi. © 2017 The Society for Applied Microbiology.

  12. Evaluation of two methods DNA extraction from formalin-fixed, paraffin-embedded tissues on non-optimal conditions

    International Nuclear Information System (INIS)

    Bustamante, Javier Andres; Astudillo, Miryam; Pazos, Alvaro Jairo; Bravo, Luis Eduardo

    2011-01-01

    Paraffin wax embedded tissues are an invaluable material for retrospective studies requiring the application of molecular analysis. Multiple methods are available to extract DNA from these kinds of samples. However, the most common methods are slow and the reagents often contribute to the fragmentation of genetic material. In order to optimize the procedure, two methods for DNA extraction from paraffin embedded tissue non-optimal conditions were used. 47 blocks containing paraffin-embedded biopsies of pleura, lung and pericardium from 24 patients (66.6% males) older than 18 years, with biopsy proven chronic granulomatous inflammation referred to the department of pathology at University Hospital of Valle between 2002 and 2007 were selected. Each sample was subjected to 10 cuts and was to two methods of DNA extraction: 1. conventional and 2. QIAamp - DNA mini kit. The efficiency of the extracted DNA was assessed by spectrophotometry and PCR amplification of a fragment of the housekeeping gene GAPDH. The concentration of DNA samples extracted by the conventional method was of 65.52 ng/Mu l ± 11.47 (mean ± SE) and the 260/280 absorbance ratio ranged between 0.52 and 2.30 the average concentration of DNA of the samples extracted by the commercial method was 60.89 ng/Mu l ± 6.02 (mean ± SE), with an absorbance that fluctuated between 0 and 2.64. The DNA obtained was amplified by PCR, of 47 samples extracted by methods, 25 and 23 respectively the GAPDH gene amplified successfully. The methods used to obtain DNA showed similar performance, highlighting the potential utility of both extraction methods for the retrospective studies from paraffin embedded tissues in unsuitable conditions.

  13. Endonuclease activities in extracts of Micrococcus luteus that act on. gamma. -irradiated DNA

    Energy Technology Data Exchange (ETDEWEB)

    Schoen-Bopp, A; Schaefer, G; Hagen, U [Kernforschungszentrum Karlsruhe (Germany, F.R.). Inst. fuer Strahlenbiologie

    1977-03-01

    Several protein fractions containing endonuclease activity against ..gamma..-irradiated DNA (..gamma..-endonuclease) were isolated from M.luteus. The crude extract was eluted on a phosphocellulose column and chromatographed on TEAE cellulose and subsequently on hydroxypatite. Five peaks of ..gamma..-endonuclease were obtained from each preparation. Repeated experiments showed comparable chromatographic behaviour of the fractions. There was no detectable activity of uv-endonuclease in the fractions with ..gamma..-endonuclease but a small contamination of endonuclease against unirradiated DNA and against DNA with apurinic sites. The ..gamma..-endonuclease was stimulated by, but was not dependent on, magnesium. Several tests for endonuclease activity have been used: the analysis of strand breaks in calf-thymus DNA or in PM2 DNA, and the determination of end-groups formed by endonuclease, either 3'OH end-groups or phosphomonoester end groups. From the results obtained it can be assumed that the strand breaks induced by the ..gamma..-endonuclease carry 3'OH and 5' phosphate end groups.

  14. On-chip concentration of bacteria using a 3D dielectrophoretic chip and subsequent laser-based DNA extraction in the same chip

    International Nuclear Information System (INIS)

    Cho, Yoon-Kyoung; Kim, Tae-hyeong; Lee, Jeong-Gun

    2010-01-01

    We report the on-chip concentration of bacteria using a dielectrophoretic (DEP) chip with 3D electrodes and subsequent laser-based DNA extraction in the same chip. The DEP chip has a set of interdigitated Au post electrodes with 50 µm height to generate a network of non-uniform electric fields for the efficient trapping by DEP. The metal post array was fabricated by photolithography and subsequent Ni and Au electroplating. Three model bacteria samples (Escherichia coli, Staphylococcus epidermidis, Streptococcus mutans) were tested and over 80-fold concentrations were achieved within 2 min. Subsequently, on-chip DNA extraction from the concentrated bacteria in the 3D DEP chip was performed by laser irradiation using the laser-irradiated magnetic bead system (LIMBS) in the same chip. The extracted DNA was analyzed with silicon chip-based real-time polymerase chain reaction (PCR). The total process of on-chip bacteria concentration and the subsequent DNA extraction can be completed within 10 min including the manual operation time.

  15. Effect of gamma-irradiation on rice seed DNA. Pt. 1. Yield and molecular size of DNA extracted from irradiated rice seeds

    International Nuclear Information System (INIS)

    Kawamura, Yoko; Konishi, Akihiro; Yamada, Takashi; Saito, Yukio

    1995-01-01

    The effect of gamma-irradiation on the DNA of hulled rice seeds was investigated. The cetyltrimethylammonium bromide (CTAB) method was preferred for the extraction of DNA from rice seeds because of its high quality and good yield. The yield of DNA that was determined by gel electrophoresis, decreased as the irradiation dose increased from 1 kGy. DNA extracted from rice seeds irradiated with a 30 kGy dose showed a molecular size of less than 20 kb, while that from unirradiated rice showed more than 100 kb in electrophoretic profiles. It can be assumed that the decrease in yield was mainly induced by the crosslinking between protein and DNA, and the reduction in molecular size was induced by double-strand breaks. (J.P.N.)

  16. Camptosorus sibiricus rupr aqueous extract prevents lung tumorigenesis via dual effects against ROS and DNA damage.

    Science.gov (United States)

    He, Shugui; Ou, Rilan; Wang, Wensheng; Ji, Liyan; Gao, Hui; Zhu, Yuanfeng; Liu, Xiaomin; Zheng, Hongming; Liu, Zhongqiu; Wu, Peng; Lu, Linlin

    2018-06-28

    Camptosorus sibiricus Rupr (CSR) is a widely used herbal medicine with antivasculitis, antitrauma, and antitumor effects. However, the effect of CSR aqueous extract on B[a]P-initiated tumorigenesis and the underlying mechanism remain unclear. Moreover, the compounds in CSR aqueous extract need to be identified and structurally characterized. We aim to investigate the chemopreventive effect of CSR and the underlying molecular mechanism. A B[a]P-stimulated normal cell model (BEAS.2B) and lung adenocarcinoma animal model were established on A/J mice. In B[a]P-treated BEAS.2B cells, the protective effects of CSR aqueous extract on B[a]P-induced DNA damage and ROS production were evaluated through flow cytometry, Western blot, real-time quantitative PCR, single-cell gel electrophoresis, and immunofluorescence. Moreover, a model of B[a]P-initiated lung adenocarcinoma was established on A/J mice to determine the chemopreventive effect of CSR in vivo. The underlying mechanism was analyzed via immunohistochemistry and microscopy. Furthermore, the new compounds in CSR aqueous extract were isolated and structurally characterized using IR, HR-ESI-MS, and 1D and 2D NMR spectroscopy. CSR effectively suppressed ROS production by re-activating Nrf2-mediated reductases HO-1 and NQO-1. Simultaneously, CSR attenuated the DNA damage of BEAS.2B cells in the presence of B[a]P. Moreover, CSR at 1.5 and 3 g/kg significantly suppressed tumorigenesis with tumor inhibition ratios of 36.65% and 65.80%, respectively. The tumor volume, tumor size, and multiplicity of B[a]P-induced lung adenocarcinoma were effectively decreased by CSR in vivo. After extracting and identifying the compounds in CSR aqueous extract, three new triterpene saponins were isolated and characterized structurally. CSR aqueous extract prevents lung tumorigenesis by exerting dual effects against ROS and DNA damage, suggesting that CSR is a novel and effective agent for B[a]P-induced carcinogenesis. Moreover, by isolating

  17. Recent Developments in Solid-Phase Extraction for Near and Attenuated Total Reflection Infrared Spectroscopic Analysis

    Directory of Open Access Journals (Sweden)

    Christian W. Huck

    2016-05-01

    Full Text Available A review with more than 100 references on the principles and recent developments in the solid-phase extraction (SPE prior and for in situ near and attenuated total reflection (ATR infrared spectroscopic analysis is presented. New materials, chromatographic modalities, experimental setups and configurations are described. Their advantages for fast sample preparation for distinct classes of compounds containing different functional groups in order to enhance selectivity and sensitivity are discussed and compared. This is the first review highlighting both the fundamentals of SPE, near and ATR spectroscopy with a view to real sample applicability and routine analysis. Most of real sample analyses examples are found in environmental research, followed by food- and bioanalysis. In this contribution a comprehensive overview of the most potent SPE-NIR and SPE-ATR approaches is summarized and provided.

  18. Sources of pre-analytical variations in yield of DNA extracted from blood samples: analysis of 50,000 DNA samples in EPIC.

    Directory of Open Access Journals (Sweden)

    Elodie Caboux

    Full Text Available The European Prospective Investigation into Cancer and nutrition (EPIC is a long-term, multi-centric prospective study in Europe investigating the relationships between cancer and nutrition. This study has served as a basis for a number of Genome-Wide Association Studies (GWAS and other types of genetic analyses. Over a period of 5 years, 52,256 EPIC DNA samples have been extracted using an automated DNA extraction platform. Here we have evaluated the pre-analytical factors affecting DNA yield, including anthropometric, epidemiological and technical factors such as center of subject recruitment, age, gender, body-mass index, disease case or control status, tobacco consumption, number of aliquots of buffy coat used for DNA extraction, extraction machine or procedure, DNA quantification method, degree of haemolysis and variations in the timing of sample processing. We show that the largest significant variations in DNA yield were observed with degree of haemolysis and with center of subject recruitment. Age, gender, body-mass index, cancer case or control status and tobacco consumption also significantly impacted DNA yield. Feedback from laboratories which have analyzed DNA with different SNP genotyping technologies demonstrate that the vast majority of samples (approximately 88% performed adequately in different types of assays. To our knowledge this study is the largest to date to evaluate the sources of pre-analytical variations in DNA extracted from peripheral leucocytes. The results provide a strong evidence-based rationale for standardized recommendations on blood collection and processing protocols for large-scale genetic studies.

  19. KRAS detection in colonic tumors by DNA extraction from FTA paper: the molecular touch-prep.

    Science.gov (United States)

    Petras, Melissa L; Lefferts, Joel A; Ward, Brian P; Suriawinata, Arief A; Tsongalis, Gregory J

    2011-12-01

    DNA isolated from formalin-fixed paraffin-embedded (FFPE) tissue is usually more degraded and contains more polymerase chain reaction (PCR) inhibitors than DNA isolated from nonfixed tissue. In addition, the tumor size and cellular heterogeneity found in tissue sections can often impact testing for molecular biomarkers. As a potential remedy to this situation, we evaluated the use of Whatman FTA paper cards for collection of colorectal tumor samples before tissue fixation and for isolation of DNA for use in a real-time PCR-based KRAS mutation assay. Eleven colon tumor samples were collected by making a cut into the fresh tumor and applying the Whatman FTA paper to the cut surface. Matched FFPE tissue blocks from these tumors were also collected for comparison. KRAS mutation analysis was carried out using the Applied Biosystems 7500 Fast Real-time PCR System using 7 independent custom TaqMan PCR assays. Of the 11 colon tumors sampled, 6 were positive for KRAS mutations in both the Whatman FTA paper preparations and corresponding FFPE samples. Whatman FTA paper cards for collection of colorectal tumor samples before tissue fixation and for isolation of DNA have many advantages including ease of use, intrinsic antimicrobial properties, long storage potential (stability of DNA over time), and a faster turnaround time for results. Extracted DNA should be suitable for most molecular diagnostic assays that use PCR techniques. This novel means of DNA preservation from surgical specimens would benefit from additional study and validation as a dependable and practical technique to preserve specimens for molecular testing.

  20. Changes in total phenol, flavonoid contents and anti-Lactobacillus activity of Callisia fragrans due to extraction solvent

    Science.gov (United States)

    Le, Thom; Cao, Diem Kieu; Pham, Thanh Vy; Huynh, Tan Dat; Ta, Nhat Thuy Anh; Nguyen, Ngoc Thao Linh; Nguyen, Huu Thanh; Le, Hue Huong; Bui, Anh Vo; Truong, Dieu-Hien

    2018-04-01

    Callisia fragrans is a wonder herb with many medicinal properties such as burn, dental diseases, cancer diseases and arthritis in folk medicine. It is noted that the phytochemical constituents and antimicrobial activity of traditional plants depend on not only the extracting method but also the solvent used for extraction. In this study, the effect of five extraction solvents (i.e., distilled water, 80% methanol, 80% ethanol, 80% ethyl acetate, and 80% chloroform) on yield, total phenolic content (TPC) and total flavonoid content (TFC) of Callisia leaves was determined. Besides, changes in anti-Lactobacillus fermentum activity of C. fragrans freeze-dried extract was also evaluated using disk-diffusion method. The recovery percentage of extractable yield of fresh leaves are ranged from 11.93% w/w for distilled water extract to 16.60% w/w for aqueous ethanol extracts. The yield of 80% aqueous methanol extract (16.27% w/w) is only slightly less than that of the ethanol extract. Significant differences were observed among TPC and TFC obtaining by 80% methanol (0.0522% and 0.0335% w/w, respectively) compared to other solvents (p < 0.05). TPC and TFC of C. fragrans extracts increase in the following order: distilled water < 80% chloroform < 80% ethyl acetate < 80% ethanol < 80% methanol. The results revealed that 80% aqueous methanol Calissia extracts has moderate inhibition (9.0 mm of inhibition zone for 1.5 mg/mL of extracts) of L. fermentum compared to standard antibacterial agent. Based on the study results, it can be concluded that the yield, TPC and TFC of C. frgrans extract varied with the extracting solvent. It also showed that Callisia extracts can prevent dental caries by inhibiting the growth of L. fermentum, towards new insights for treatment of dental caries.

  1. Selection of the most suitable method for the extraction of DNA from foods and feeds for species identification

    Directory of Open Access Journals (Sweden)

    Michaela Nesvadbová

    2010-01-01

    Full Text Available High quality and purity of DNA isolated from food and feed is essential for species identification and has unpredictable influences an effect of analysis. In this study, the efficiency of eight different methods for DNA isolation was investigated. For DNA extraction, the raw chicken meet, ham, sausages, tinned lunch meat, pate, tinned feeds for dogs, complete granulated feeds for dogs and chicken flour were used. Kits of several different producers, i.e.: NucleoSpin Food (Marchery-Nagel, Wizard Genomic DNA Purification Kit (Promega, Invisorb Spin Food Kit I (Invitek, Wizard SV Genomic DNA Purification System (Promega, JetQuick Tissue DNA Spin Kit (Genomed, RNA Blue (Top-Bio, JetQuick Blood & Cell Culture Kit (Genomed, QIAamp DNA Mini Kit and QIAamp DNA Blood Mini Kit (Qiagen were employed in the study. Gel agarose electrophoresis for primary verification of DNA quality was performed. The isolates were subsequently assessed for quantity and quality using by spectrophotometer Nanodrop 2000 (Thermo Scientific. To verify of template usability and quality of isolated DNA, the polymerase chain reaction (PCR was used.Differences between isolated DNA from tinned products and meat, ham, sausage, granulated dog feed and chicken flour were found. In tinned food and feed, the DNA was more degraded, DNA content and DNA purity was lower and also PCR amplification was the most difficult. Overall DNA yield and quality have important influence on PCR products amplification. The best results were obtained with NucleoSpin Food and JetQuick Tissue DNA Spin Kit. DNA extracted by these methods proved highest yields, purity and template quality in all foods and feeds and the results of PCR analysis are excellent reproducible. Analyses showed that results depended on different food or feed using and dif­fe­rent isolation system.The results of this work will be utilized to choose the suitable isolating kit for educational course, which is designed for students and

  2. Comparison of DNA extraction protocols to detect Mycobacterium bovis in bovine tissue by PCR

    Directory of Open Access Journals (Sweden)

    Cássia Yumi Ikuta

    2016-11-01

    Full Text Available The current scenario of international beef trading has increased the pressure for better and faster diagnosis of bovine tuberculosis. Although traditional culture remains the gold standard method to confirm Mycobacterium bovis infection, it is exceedingly time consuming, and demands viable mycobacteria. Molecular methods overcome the flaws of the bacteriological methods with faster detection and identification. However, mycobacterial features like a complex cell wall and pathogen–host interaction make the molecular detection a challenge. Three protocols for DNA extraction (A, B and C from bovine tissues were tested to verify the most suitable technique for routine diagnostic assessment of their specificity and sensitivity. Thirty culture-positive and thirty culture-negative granulomatous lesions were included in the trial. From each sample, three tissue suspensions at different dilutions (10-1, 10-2 and 10-3 were prepared and submitted to DNA extraction. PCR procedures targeting IS6110 were performed, employing two volumes of DNA: 5 µL of all three dilutions, and 2.5 µL of the 10-1 dilution. Protocol A was able to detect members of the M. tuberculosis complex in most samples. The sensitivity of the test decreased with increase in tissue-suspension dilution. Although Protocol A presented the highest sensitivity followed by C and B, it showed the lowest specificity, which can be due to a failure in primary isolation caused by the lack of viable organisms or incubation time. Regardless classical bacteriological methods are still recommended by OIE, after evaluating the sensitivity of DNA extraction protocols and PCR procedures, we conclude that the best strategy for M. bovis detection is to follow Protocol A on concentrated tissue suspensions.

  3. Effects of an extract from the sea squirt Ecteinascidia turbinata on DNA synthesis and excision repair in human fibroblasts

    Energy Technology Data Exchange (ETDEWEB)

    Dunn, W.C.; Carrier, W.L.; Regan, J.D.

    1982-01-01

    An aqueous ethanol extract from the marine tunicate species Ecteinascidia turbinata was studied to determine its effect on semiconservative DNA synthesis in human skin fibroblast cultures as measured by (/sup 3/H) thymidine uptake in acid-insoluble cell fractions. In addition, the effect of this extract on DNA excision repair in ultraviolet light (254 nm) irradiated fibroblasts was measured by the bromodeoxyuridine photolysis assay, thymine dimer chromatography, and DNA single-strand break analysis on alkaline sucrose gradients. Repair inhibition was accompanied by an accumulation of single-strand DNA breaks which was enhanced by the addtion of 2 mM hydroxyurea. These results are discussed with respect to a mechanism of action of the marine tunicate extract at the level of DNA polymerases and are contrasted with previously studied inhibitory mechanisms of arabinofuranosyl nucleosides.

  4. Protection of radiation induced DNA and membrane damages by total triterpenes isolated from Ganoderma lucidum (Fr.) P. Karst.

    Science.gov (United States)

    Smina, T P; Maurya, D K; Devasagayam, T P A; Janardhanan, K K

    2015-05-25

    The total triterpenes isolated from the fruiting bodies of Ganoderma lucidum was examined for its potential to prevent γ-radiation induced membrane damage in rat liver mitochondria and microsomes. The effects of total triterpenes on γ-radiation-induced DNA strand breaks in pBR 322 plasmid DNA in vitro and human peripheral blood lymphocytes ex vivo were evaluated. The protective effect of total triterpenes against γ-radiation-induced micronuclei formations in mice bone marrow cells in vivo were also evaluated. The results indicated the significant effectiveness of Ganoderma triterpenes in protecting the DNA and membrane damages consequent to the hazardous effects of radiation. The findings suggest the potential use of Ganoderma triterpenes in radio therapy. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.

  5. Chemopreventive activity of compounds extracted from Casearia sylvestris (Salicaceae) Sw against DNA damage induced by particulate matter emitted by sugarcane burning near Araraquara, Brazil

    Energy Technology Data Exchange (ETDEWEB)

    Prieto, A.M. [UNESP — Univ. Estadual Paulista, College of Pharmaceutical Sciences, Department of Clinical Analysis, Rua Expedicionários do Brasil, 1621, Araraquara (Brazil); Santos, A.G. [UNESP — Univ. Estadual Paulista, College of Pharmaceutical Sciences, Department of Natural Principles and Toxicology, Rodovia Araraquara-Jau, km 01, Araraquara (Brazil); Csipak, A.R.; Caliri, C.M.; Silva, I.C. [UNESP — Univ. Estadual Paulista, College of Pharmaceutical Sciences, Department of Clinical Analysis, Rua Expedicionários do Brasil, 1621, Araraquara (Brazil); Arbex, M.A. [UNIFESP — Federal University of São Paulo, Paulista College of Medicine, Department of Internal Medicine, Rua Pedro de Toledo, 720, São Paulo (Brazil); Silva, F.S.; Marchi, M.R.R. [UNESP — Univ. Estadual Paulista, Chemistry Institute, Department of Analytical Chemistry, Rua Francisco Degni, S/N, Araraquara (Brazil); Cavalheiro, A.J.; Silva, D.H.S.; Bolzani, V.S. [UNESP — Univ. Estadual Paulista, Chemistry Institute, Department of Organic Chemistry, Rua Francisco Degni, S/N, Araraquara (Brazil); Soares, C.P., E-mail: soarescp@hotmail.com [UNESP — Univ. Estadual Paulista, College of Pharmaceutical Sciences, Department of Clinical Analysis, Rua Expedicionários do Brasil, 1621, Araraquara (Brazil)

    2012-12-15

    Ethanolic extract of Casearia sylvestris is thought to be antimutagenic. In this study, we attempted to determine whether this extract and casearin X (a clerodane diterpene from C. sylvestris) are protective against the harmful effects of airborne pollutants from sugarcane burning. To that end, we used the Tradescantia micronucleus test in meiotic pollen cells of Tradescantia pallida, the micronucleus test in mouse bone marrow cells, and the comet assay in mouse blood cells. The mutagenic compound was total suspended particulate (TSP) from air. For the Tradescantia micronucleus test, T. pallida cuttings were treated with the extract at 0.13, 0.25, or 0.50 mg/ml. Subsequently, TSP was added at 0.3 mg/ml, and tetrads from the inflorescences were examined for micronuclei. For the micronucleus test in mouse bone marrow cells and the comet assay in mouse blood cells, Balb/c mice were treated for 15 days with the extract—3.9, 7.5, or 15.0 mg/kg body weight (BW)—or with casearin X—0.3, 0.25, or 1.2 mg/kg BW—after which they received TSP (3.75 mg/kg BW). In T. pallida and mouse bone marrow cells, the extract was antimutagenic at all concentrations tested. In mouse blood cells, the extract was antigenotoxic at all concentrations, whereas casearin X was not antimutagenic but was antigenotoxic at all concentrations. We conclude that C. sylvestris ethanolic extract and casearin X protect DNA from damage induced by airborne pollutants from sugarcane burning. -- Highlights: ► We assessed DNA protection of C. sylvestris ethanolic extract. ► We assessed DNA protection of casearin X. ► We used Tradescantia pallida micronucleus test as screening. ► We used comet assay and micronucleus test in mice. ► The compounds protected DNA against sugar cane burning pollutants.

  6. Determination of polyphenolic content, HPLC analyses and DNA cleavage activity of Malaysian Averrhoa carambola L. fruit extracts

    Directory of Open Access Journals (Sweden)

    Zakia Khanam

    2015-10-01

    Full Text Available In developing countries, the increasing gap between population growth and food supply has created renewed interest in finding reliable and cheap natural resources of nutraceutical value and health promoting properties. Therefore, the present study deals with the phytochemical analyses and DNA cleavage activity of Averrhoa carambola L. fruit (starfruit extracts. The phytochemical studies involve colour tests and quantification of phenolics and flavonoids of the prepared ethanolic and aqueous extracts. Identification of phenolic acids and flavonoids present in the extracts were conducted by high performance liquid chromatography (HPLC equipped with diode array detector (DAD. DNA cleavage activity of the extracts was evaluated through gel electrophoresis against plasmid Escherichia coli DNA at different concentrations (0.125–0.60 μg/μl. The results of the study exhibited that the starfruit is a rich source of polyphenols and all the extracts exhibited a dose dependent DNA cleavage activity, whereas ethanolic extract induced more cleavage as compared to the aqueous extract. In conclusion, the present study provides preliminary evidence with regard to nutraceutical value of the fruit. So, further extensive study is a prerequisite to exploit DNA cleaving properties of the fruit extracts for therapeutic application.

  7. Improved Methods of Carnivore Faecal Sample Preservation, DNA Extraction and Quantification for Accurate Genotyping of Wild Tigers

    Science.gov (United States)

    Harika, Katakam; Mahla, Ranjeet Singh; Shivaji, Sisinthy

    2012-01-01

    Background Non-invasively collected samples allow a variety of genetic studies on endangered and elusive species. However due to low amplification success and high genotyping error rates fewer samples can be identified up to the individual level. Number of PCRs needed to obtain reliable genotypes also noticeably increase. Methods We developed a quantitative PCR assay to measure and grade amplifiable nuclear DNA in feline faecal extracts. We determined DNA degradation in experimentally aged faecal samples and tested a suite of pre-PCR protocols to considerably improve DNA retrieval. Results Average DNA concentrations of Grade I, II and III extracts were 982pg/µl, 9.5pg/µl and 0.4pg/µl respectively. Nearly 10% of extracts had no amplifiable DNA. Microsatellite PCR success and allelic dropout rates were 92% and 1.5% in Grade I, 79% and 5% in Grade II, and 54% and 16% in Grade III respectively. Our results on experimentally aged faecal samples showed that ageing has a significant effect on quantity and quality of amplifiable DNA (pDNA degradation occurs within 3 days of exposure to direct sunlight. DNA concentrations of Day 1 samples stored by ethanol and silica methods for a month varied significantly from fresh Day 1 extracts (p0.05). DNA concentrations of fresh tiger and leopard faecal extracts without addition of carrier RNA were 816.5pg/µl (±115.5) and 690.1pg/µl (±207.1), while concentrations with addition of carrier RNA were 49414.5pg/µl (±9370.6) and 20982.7pg/µl (±6835.8) respectively. Conclusions Our results indicate that carnivore faecal samples should be collected as freshly as possible, are better preserved by two-step method and should be extracted with addition of carrier RNA. We recommend quantification of template DNA as this facilitates several downstream protocols. PMID:23071624

  8. Norgal: extraction and de novo assembly of mitochondrial DNA from whole-genome sequencing data.

    Science.gov (United States)

    Al-Nakeeb, Kosai; Petersen, Thomas Nordahl; Sicheritz-Pontén, Thomas

    2017-11-21

    Whole-genome sequencing (WGS) projects provide short read nucleotide sequences from nuclear and possibly organelle DNA depending on the source of origin. Mitochondrial DNA is present in animals and fungi, while plants contain DNA from both mitochondria and chloroplasts. Current techniques for separating organelle reads from nuclear reads in WGS data require full reference or partial seed sequences for assembling. Norgal (de Novo ORGAneLle extractor) avoids this requirement by identifying a high frequency subset of k-mers that are predominantly of mitochondrial origin and performing a de novo assembly on a subset of reads that contains these k-mers. The method was applied to WGS data from a panda, brown algae seaweed, butterfly and filamentous fungus. We were able to extract full circular mitochondrial genomes and obtained sequence identities to the reference sequences in the range from 98.5 to 99.5%. We also assembled the chloroplasts of grape vines and cucumbers using Norgal together with seed-based de novo assemblers. Norgal is a pipeline that can extract and assemble full or partial mitochondrial and chloroplast genomes from WGS short reads without prior knowledge. The program is available at: https://bitbucket.org/kosaidtu/norgal .

  9. Optimization of conditions to extract high quality DNA for PCR analysis from whole blood using SDS-proteinase K method

    Directory of Open Access Journals (Sweden)

    Wajhul Qamar

    2017-11-01

    Full Text Available In case of studies associated with human genetics, genomics, and pharmacogenetics the genomic DNA is extracted from the buccal cells, whole blood etc. Several methods are exploited by the researchers to extract DNA from the whole blood. One of these methods, which utilizes cell lysis and proteolytic properties of sodium dodecyl sulfate (SDS and proteinase K respectively, might also be called SDS-PK method. It does not include any hazardous chemicals such as phenol or chloroform and is inexpensive. However, several researchers report the same method with different formulas and conditions. During our experiments with whole blood DNA extraction we experienced problems such as protein contamination, DNA purity and yield when followed some SDS-PK protocols reported elsewhere. A260/A280 and A260/A230 ratios along with PCR amplification give a clear idea about the procedure that was followed to extract the DNA. In an effort to increase the DNA purity from human whole blood, we pointed out some steps of the protocol that play a crucial role in determining the extraction of high quality DNA.

  10. The Extraction and Partial Purification of Bacterial DNA as a Practical Exercise for GCE Advanced Level Students.

    Science.gov (United States)

    Falconer, A. C.; Hayes, L. J.

    1986-01-01

    Describes a relatively simple method of extraction and purification of bacterial DNA. This technique permits advanced secondary-level science students to obtain adequate amounts of DNA from very small pellets of bacteria and to observe some of its polymer properties. (ML)

  11. The effect of DNA extraction methods on observed microbial communities from fibrous and liquid rumen fractions of dairy cows

    NARCIS (Netherlands)

    Vaidya, Jueeli D.; Bogert, van den Bartholomeus; Boekhorst, Jos; Saccenti, Edoardo; Plugge, Caroline M.; Smidt, Hauke

    2018-01-01

    DNA based methods have been widely used to study the complexity of the rumen microbiota, and it is well known that the method of DNA extraction is a critical step in enabling accurate assessment of this complexity. Rumen fluid (RF) and fibrous content (FC) fractions differ substantially in terms of

  12. Evaluation of methods to improve the extraction and recovery of DNA from cotton swabs for forensic analysis.

    Science.gov (United States)

    Adamowicz, Michael S; Stasulli, Dominique M; Sobestanovich, Emily M; Bille, Todd W

    2014-01-01

    Samples for forensic DNA analysis are often collected from a wide variety of objects using cotton or nylon tipped swabs. Testing has shown that significant quantities of DNA are retained on the swab, however, and subsequently lost. When processing evidentiary samples, the recovery of the maximum amount of available DNA is critical, potentially dictating whether a usable profile can be derived from a piece of evidence or not. The QIAamp DNA Investigator extraction kit was used with its recommended protocol for swabs (one hour incubation at 56°C) as a baseline. Results indicate that over 50% of the recoverable DNA may be retained on the cotton swab tip, or otherwise lost, for both blood and buccal cell samples when using this protocol. The protocol's incubation time and temperature were altered, as was incubating while shaking or stationary to test for increases in recovery efficiency. An additional step was then tested that included periodic re-suspension of the swab tip in the extraction buffer during incubation. Aliquots of liquid blood or a buccal cell suspension were deposited and dried on cotton swabs and compared with swab-less controls. The concentration of DNA in each extract was quantified and STR analysis was performed to assess the quality of the extracted DNA. Stationary incubations and those performed at 65°C did not result in significant gains in DNA yield. Samples incubated for 24 hours yielded less DNA. Increased yields were observed with three and 18 hour incubation periods. Increases in DNA yields were also observed using a swab re-suspension method for both cell types. The swab re-suspension method yielded an average two-fold increase in recovered DNA yield with buccal cells and an average three-fold increase with blood cells. These findings demonstrate that more of the DNA collected on swabs can be recovered with specific protocol alterations.

  13. Evaluation of methods to improve the extraction and recovery of DNA from cotton swabs for forensic analysis.

    Directory of Open Access Journals (Sweden)

    Michael S Adamowicz

    Full Text Available Samples for forensic DNA analysis are often collected from a wide variety of objects using cotton or nylon tipped swabs. Testing has shown that significant quantities of DNA are retained on the swab, however, and subsequently lost. When processing evidentiary samples, the recovery of the maximum amount of available DNA is critical, potentially dictating whether a usable profile can be derived from a piece of evidence or not. The QIAamp DNA Investigator extraction kit was used with its recommended protocol for swabs (one hour incubation at 56°C as a baseline. Results indicate that over 50% of the recoverable DNA may be retained on the cotton swab tip, or otherwise lost, for both blood and buccal cell samples when using this protocol. The protocol's incubation time and temperature were altered, as was incubating while shaking or stationary to test for increases in recovery efficiency. An additional step was then tested that included periodic re-suspension of the swab tip in the extraction buffer during incubation. Aliquots of liquid blood or a buccal cell suspension were deposited and dried on cotton swabs and compared with swab-less controls. The concentration of DNA in each extract was quantified and STR analysis was performed to assess the quality of the extracted DNA. Stationary incubations and those performed at 65°C did not result in significant gains in DNA yield. Samples incubated for 24 hours yielded less DNA. Increased yields were observed with three and 18 hour incubation periods. Increases in DNA yields were also observed using a swab re-suspension method for both cell types. The swab re-suspension method yielded an average two-fold increase in recovered DNA yield with buccal cells and an average three-fold increase with blood cells. These findings demonstrate that more of the DNA collected on swabs can be recovered with specific protocol alterations.

  14. Direct-acting DNA alkylating agents present in aqueous extracts of areca nut and its products.

    Science.gov (United States)

    Hu, Chiung-Wen; Chao, Mu-Rong

    2012-11-19

    Areca nut is a carcinogen to humans and has been strongly associated with oral premalignant and malignant diseases. Previous studies speculated the presence of unknown direct-acting mutagens present in aqueous extracts of areca nut. We hypothesized whether any direct-acting alkylating agents are present in areca nut and its commercial products. In this study, calf thymus DNA was treated with four different aqueous extracts obtained from unripe and ripe areca nuts or their commercial products, namely, pan masala (without tobacco) and gutkha (with tobacco). Three N-alkylated purines including N7-methylguanine (N7-MeG), N3-methyladenine (N3-MeA), and N7-ethylguanine (N7-EtG) were detected using sensitive and specific isotope-dilution liquid chromatography-tandem-mass spectrometry (LC-MS/MS) methods. The results showed that four types of aqueous extracts significantly induced the formation of N7-MeG and N3-MeA in a linear dose-response manner. Extracts from unripe areca nut exhibited higher methylating potency than those of ripe areca nut, while gutkha had higher methylating potency than pan masala. Meanwhile, gutkha made with areca nut and tobacco, was the only extract found to induce the formation of N7-EtG. Overall, this study first demonstrated that the presence of direct-acting alkylating agents in areca nut and its commercial products exist at a level that is able to cause significant DNA damage. Our findings may provide another mechanistic rationale for areca nut-mediated oral carcinogenesis and also highlight the importance and necessity of the identification of these direct-acting alkylating agents.

  15. DNA agarose gel electrophoresis for antioxidant analysis: Development of a quantitative approach for phenolic extracts.

    Science.gov (United States)

    Silva, Sara; Costa, Eduardo M; Vicente, Sandra; Veiga, Mariana; Calhau, Conceição; Morais, Rui M; Pintado, Manuela E

    2017-10-15

    Most of the fast in vitro assays proposed to determine the antioxidant capacity of a compound/extract lack either biological context or employ complex protocols. Therefore, the present work proposes the improvement of an agarose gel DNA electrophoresis in order to allow for a quantitative estimation of the antioxidant capacity of pure phenolic compounds as well as of a phenolic rich extract, while also considering their possible pro-oxidant effects. The result obtained demonstrated that the proposed method allowed for the evaluation of the protection of DNA oxidation [in the presence of hydrogen peroxide (H 2 O 2 ) and an H 2 O 2 /iron (III) chloride (FeCl 3 ) systems] as well as for the observation of pro-oxidant activities, with the measurements registering interclass correlation coefficients above 0.9. Moreover, this method allowed for the characterization of the antioxidant capacity of a blueberry extract while demonstrating that it had no perceived pro-oxidant effect. Copyright © 2017 Elsevier Ltd. All rights reserved.

  16. Extraction of High Molecular Weight DNA from Fungal Rust Spores for Long Read Sequencing.

    Science.gov (United States)

    Schwessinger, Benjamin; Rathjen, John P

    2017-01-01

    Wheat rust fungi are complex organisms with a complete life cycle that involves two different host plants and five different spore types. During the asexual infection cycle on wheat, rusts produce massive amounts of dikaryotic urediniospores. These spores are dikaryotic (two nuclei) with each nucleus containing one haploid genome. This dikaryotic state is likely to contribute to their evolutionary success, making them some of the major wheat pathogens globally. Despite this, most published wheat rust genomes are highly fragmented and contain very little haplotype-specific sequence information. Current long-read sequencing technologies hold great promise to provide more contiguous and haplotype-phased genome assemblies. Long reads are able to span repetitive regions and phase structural differences between the haplomes. This increased genome resolution enables the identification of complex loci and the study of genome evolution beyond simple nucleotide polymorphisms. Long-read technologies require pure high molecular weight DNA as an input for sequencing. Here, we describe a DNA extraction protocol for rust spores that yields pure double-stranded DNA molecules with molecular weight of >50 kilo-base pairs (kbp). The isolated DNA is of sufficient purity for PacBio long-read sequencing, but may require additional purification for other sequencing technologies such as Nanopore and 10× Genomics.

  17. Ancient microbes from halite fluid inclusions: optimized surface sterilization and DNA extraction.

    Directory of Open Access Journals (Sweden)

    Krithivasan Sankaranarayanan

    Full Text Available Fluid inclusions in evaporite minerals (halite, gypsum, etc. potentially preserve genetic records of microbial diversity and changing environmental conditions of Earth's hydrosphere for nearly one billion years. Here we describe a robust protocol for surface sterilization and retrieval of DNA from fluid inclusions in halite that, unlike previously published methods, guarantees removal of potentially contaminating surface-bound DNA. The protocol involves microscopic visualization of cell structures, deliberate surface contamination followed by surface sterilization with acid and bleach washes, and DNA extraction using Amicon centrifugal filters. Methods were verified on halite crystals of four different ages from Saline Valley, California (modern, 36 ka, 64 ka, and 150 ka, with retrieval of algal and archaeal DNA, and characterization of the algal community using ITS1 sequences. The protocol we developed opens up new avenues for study of ancient microbial ecosystems in fluid inclusions, understanding microbial evolution across geological time, and investigating the antiquity of life on earth and other parts of the solar system.

  18. Evaluation of five protocols for DNA extraction from leaves of Malus sieversii, Vitis vinifera, and Armeniaca vulgaris.

    Science.gov (United States)

    Aubakirova, K; Omasheva, M; Ryabushkina, N; Tazhibaev, T; Kampitova, G; Galiakparov, N

    2014-02-27

    Leaves of Malus sieversii, Vitis vinifera, and Armeniaca vulgaris contain substantial amounts of secondary metabolites, which limit the high-quality DNA extraction performance. In this study, five extraction protocols were compared for their ability to produce good quality DNA from fresh and dried (with silica gel) leaves of these species. The modified protocol of Dellaporta et al., using polyvinylpyrrolidone to bind the phenolic compounds and a high molar concentration of potassium acetate to inhibit co-precipitation of polysaccharides with DNA, produced the best DNA quality for all species tested. DNA extracted by this method had a 1.77-1.96 A260/280 nm ratio and successful amplification of the 18S ribosomal DNA gene. DNA concentrations of dried leaves were lower than those obtained from fresh leaves, which was likely due to aspects of the drying procedure. All five methods for grapevine produced DNA of obvious better quality from green canes compared to leaves, due to the relatively low content of secondary metabolites in the former. For grapevine and apricot, three methods can be equally used to obtain DNA of good quality: the Doyle and Doyle modified method using CTAB and high concentration of NaCl, the Jobes et al. modified method, and the sodium dodecyl sulfate mini preparation method of Edwards et al. The protocol of Jobes et al. using LiCl for RNA removal showed the best results for most of the M. sieversii samples examined.

  19. Genotoxic effect of Peganum harmala extracts on the growth of Vicia faba L. and DNA using nuclear microsatellites

    International Nuclear Information System (INIS)

    Mekki, L.; Mansour, H.

    2015-01-01

    Assessment of genotoxins-induced DNA damage and mutations at molecular level is important in ecogenotoxicology. Treatment with Peganum harmala crude extract can result in cytotoxic, carcinogenic and mutagenic effects. Mutagenesis is indicative of genetic instability and can be assayed using microsatellites or simple sequence repeats (SSRs). The application of SSR marker analysis using capillary electrophoresis (CE) apparatus showed differences in SSR profiles within the extract as well as between the two extracts. All the 12 SSR primer pairs used produced amplification products which showed 100% polymorphism. The total number of scoreable loci obtained with the 12 used primers were 112 alleles. Of the 112 alleles detected 12 alleles (10.7 %) were considered as zero alleles. Three alleles produced by various primers were detected at locus VfG 2 2 to 15 at locus VfG 6 93 and VfG 8 73, with an average of 9.3 bands/SSR. The discrimination power of each SSR locus was estimated by the PIC, which ranged from 0.47 for locus VfG 2 2 to 0.88 for locus VfG 6 93 with a mean of 0.70. About 83.3% of the 18 alleles observed in untreated samples using the 12 primers disappeared from almost all the treatments with water and ethanol extracts. Statistical analysis of morphometric traits showed significant differences between the two extracts in all studied traits except the percentage of germination and root dry weight which were non significant. However, on the other hand significant differences were observed between treatments and the control for all the traits studied. (author)

  20. [Optimization of ultrasonic-assisted extraction of total flavonoids from leaves of the Artocarpus heterophyllus by response surface methodology].

    Science.gov (United States)

    Wang, Hong-wu; Liu, Yan-qing; Wang, Yuan-hong

    2011-07-01

    To investigate the ultrasonic-assisted extract on of total flavonoids from leaves of the Artocarpus heterophyllus. Investigated the effects of ethanol concentration, extraction time, and liquid-solid ratio on flavonoids yield. A 17-run response surface design involving three factors at three levels was generated by the Design-Expert software and experimental data obtained were subjected to quadratic regression analysis to create a mathematical model describing flavonoids extraction. The optimum ultrasonic assisted extraction conditions were: ethanol volume fraction 69.4% and liquid-solid ratio of 22.6:1 for 32 min. Under these optimized conditions, the yield of flavonoids was 7.55 mg/g. The Box-Behnken design and response surface analysis can well optimize the ultrasonic-assisted extraction of total flavonoids from Artocarpus heterophyllus.

  1. A novel reliable method of DNA extraction from olive oil suitable for molecular traceability.

    Science.gov (United States)

    Raieta, Katia; Muccillo, Livio; Colantuoni, Vittorio

    2015-04-01

    Extra virgin olive oil production has a worldwide economic impact. The use of this brand, however, is of great concern to Institutions and private industries because of the increasing number of fraud and adulteration attempts to the market products. Here, we present a novel, reliable and not expensive method for extracting the DNA from commercial virgin and extra virgin olive oils. The DNA is stable overtime and amenable for molecular analyses; in fact, by carrying out simple sequence repeats (SSRs) markers analysis, we characterise the genetic profile of monovarietal olive oils. By comparing the oil-derived pattern with that of the corresponding tree, we can unambiguously identify four cultivars from Samnium, a region of Southern Italy, and distinguish them from reference and more widely used varieties. Through a parentage statistical analysis, we also identify the putative pollinators, establishing an unprecedented and powerful tool for olive oil traceability. Copyright © 2014 Elsevier Ltd. All rights reserved.

  2. The ability of Abelmoschus manihot L. leaf extract in scavenging of free radical DPPH and total flavonoid determination

    Science.gov (United States)

    Sudewi, S.; Lolo, W. A.; Warongan, M.; Rifai, Y.; Rante, H.

    2017-11-01

    Abelmoschus manihot L. has reported to have flavonoids content. This study aims were to determine the ability of A. manihot extract in counteracting free radical DPPH and determine the content of total flavonoids. A. manihot leaf was taken from 2 regions in North Sulawesi, namely Tomohon and Kotamobagu. The maceration was carried out to extract the active compound in a 96% ethanol solvent. Free radical scavenging analysis was carried out by DPPH and determination of its total flavonoid in the extract was measured using spectrophotometri method. The results showed that A. manihot extract from Tomohon and Kotamobagu could counteract free radical of DPPH with value of free radical activity of 88.151 and 88.801 %, respectively. A. manihot leaf from Kotamobagu has higher total flavonoids content 61.763 mg/g compare to Tomohon 46.679 mg/g which presented as quercetin. A. manihot has antioxidant activity.

  3. In vitro antioxidant evaluation and total phenolics of methanolic leaf extracts of Nyctanthes arbor-tristis L.

    Science.gov (United States)

    Michael, J Savarimuthu; Kalirajan, A; Padmalatha, C; Singh, A J A Ranjit

    2013-09-01

    To investigate the in vitro antioxidant activity and total phenolic content of the methanolic leaf extract of Nyctanthes arbor-tristis L. (NA). The sample was tested using five in vitro antioxidant methods (1, 1-diphenyl-2-picryl hydrazine radical scavenging activity (DPPH), hydroxyl radical-scavenging activity (-OH), nitric oxide scavenging activity (NO), superoxide radical-scavenging activity, and total antioxidant activity) to evaluate the in vitro antioxidant potential of NA and the total phenolic content (Folin-Ciocalteu method). The extract showed good free radical scavenging property which was calculated as an IC50 value. IC50 (Half maximal inhibitory concentration) of the methanolic extract was found to be 57.93 μg·mL(-1) for DPPH, 98.61 μg·mL(-1) for -OH, 91.74 μg·mL(-1) for NO, and 196.07 μg·mL(-1) for superoxide radical scavenging activity. Total antioxidant capacity of the extract was found to be (1198 ± 24.05) mg ascorbic acid for the methanolic extract. Free radical scavenging activity observed in the extracts of NA showed a concentration-dependent reaction. The in vitro scavenging tested for free radicals was reported to be due to high phenolic content in the leaf extract. The leaf extract of NA showed the highest total phenolic content with a value of 78.48 ± 4.2 equivalent mg TAE/g (tannic acid equivalent). N. arbor-tristis leaf extract exhibited potent free radical scavenging activity. The finding suggests that N. arbor-tristis leaves could be a potential source of natural antioxidant. Copyright © 2013 China Pharmaceutical University. Published by Elsevier B.V. All rights reserved.

  4. Evaluation of three methods of DNA extraction from paraffin-embedded material for the amplification of genomic DNA by means of the PCR technique

    Directory of Open Access Journals (Sweden)

    MESQUITA Ricardo Alves

    2001-01-01

    Full Text Available There are several protocols reported in the literature for the extraction of genomic DNA from formalin-fixed paraffin-embedded samples. Genomic DNA is utilized in molecular analyses, including PCR. This study compares three different methods for the extraction of genomic DNA from formalin-fixed paraffin-embedded (inflammatory fibrous hyperplasia and non-formalin-fixed (normal oral mucosa samples: phenol with enzymatic digestion, and silica with and without enzymatic digestion. The amplification of DNA by means of the PCR technique was carried out with primers for the exon 7 of human keratin type 14. Amplicons were analyzed by means of electrophoresis in an 8% polyacrylamide gel with 5% glycerol, followed by silver-staining visualization. The phenol/enzymatic digestion and the silica/enzymatic digestion methods provided amplicons from both tissue samples. The method described is a potential aid in the establishment of the histopathologic diagnosis and in retrospective studies with archival paraffin-embedded samples.

  5. Hepatitis B virus DNA quantification with the three-in-one (3io) method allows accurate single-step differentiation of total HBV DNA and cccDNA in biopsy-size liver samples.

    Science.gov (United States)

    Taranta, Andrzej; Tien Sy, Bui; Zacher, Behrend Johan; Rogalska-Taranta, Magdalena; Manns, Michael Peter; Bock, Claus Thomas; Wursthorn, Karsten

    2014-08-01

    Hepatitis B virus (HBV) replicates via reverse transcription converting its partially double stranded genome into the covalently closed circular DNA (cccDNA). The long-lasting cccDNA serves as a replication intermediate in the nuclei of hepatocytes. It is an excellent, though evasive, parameter for monitoring the course of liver disease and treatment efficiency. To develop and test a new approach for HBV DNA quantification in serum and small-size liver samples. The p3io plasmid contains an HBV fragment and human β-actin gene (hACTB) as a standard. Respective TaqMan probes were labeled with different fluorescent dyes. A triplex real-time PCR for simultaneous quantification of total HBV DNA, cccDNA and hACTB could be established. Three-in-one method allows simultaneous analysis of 3 targets with a lower limit of quantification of 48 copies per 20 μl PCR reaction and a wide range of linearity (R(2)>0.99, pDNA samples from HBV infected patients. Total HBV DNA and cccDNA could be quantified in 32 and 22 of 33 FFPE preserved liver specimens, respectively. Total HBV DNA concentrations quantified by the 3io method remained comparable with Cobas TaqMan HBV Test v2.0. The three-in-one protocol allows the single step quantification of viral DNA in samples from different sources. Therefore lower sample input, faster data acquisition, a lowered error and significantly lower costs are the advantages of the method. Copyright © 2014 Elsevier B.V. All rights reserved.

  6. Back to basics – the influence of DNA extraction and primer choice on phylogenetic analysis in activated sludge communities

    DEFF Research Database (Denmark)

    Albertsen, Mads; Karst, Søren Michael; Ziegler, Anja Sloth

    intensity and primer choice on the observed community using 16S rDNA amplicon sequencing. Quantitative fluorescence in situ hybridization (qFISH) was used as a DNA extraction independent method to evaluate the results. The bead beating intensity correlated with cell-wall strength and showed...... that the manufacture recommended settings were insufficient to retrieve a large part of the community. In addition, the in silico “best” primer set was found to greatly underestimate a number of important phyla when compared to qFISH results. The findings underline the need for sample specific and DNA extraction...

  7. Sequential Combination of Microwave- and Ultrasound-Assisted Extraction of Total Flavonoids from Osmanthus fragrans Lour. Flowers

    Directory of Open Access Journals (Sweden)

    Jianfeng Yu

    2017-12-01

    Full Text Available Microwave-assisted and ultrasound-assisted extraction assays were used to isolate total flavonoids (TF from Osmanthus fragrans flowers. The effects of the solid-liquid ratio, ethanol concentration, microwave power, microwave extraction time, ultrasonic power and ultrasonic extraction time on the yield of TF were studied. A sequential combination of microwave- and ultrasound-assisted extraction (SC-MUAE methods was developed, which was subsequently optimized by Box-Behnken design-response surface methodology (BBD-RSM. The interaction effects of the ethanol concentration (40–60%, microwave extraction time (5–7 min, ultrasonic extraction time (8–12 min and ultrasonic power (210–430 W on the yield of TF were investigated. The optimum operating parameters for the extraction of TF were determined to be as follows: ethanol concentration (48.15%, microwave extraction time (6.43 min, ultrasonic extraction time (10.09 min and ultrasonic power (370.9 W. Under these conditions, the extraction yield of TF was 7.86 mg/g.

  8. Antinociceptive and Anti-Inflammatory Effects of Total Alkaloid Extract from Fumaria capreolata

    Directory of Open Access Journals (Sweden)

    Noureddine Bribi

    2015-01-01

    Full Text Available Fumaria capreolata is used in traditional medicine in North Africa for its gastrointestinal and anti-inflammatory activities. The present study investigates the effects of total alkaloids extracted from the aerial parts of Fumaria capreolata (AFC on LPS-induced production of proinflammatory mediators (IL-6, IL-1β, iNOS, TNF-α, COX-2, and MIP-2 in RAW264.7 cells. AFC significantly reduced the inflammatory response inhibiting the production of nitric oxide (NO and IL-6 in a dose-dependent manner, without affecting the viability of cells, and downregulated mRNA expression of proinflammatory key players: IL-6, IL-1β, iNOS, TNF-α, and COX-2. AFC antinociceptive and anti-inflammatory properties were also evaluated on the acetic acid- and formalin-induced pain models in mice. AFC oral administration significantly inhibited acetic acid-induced writhes and reduced formalin-induced paw licking time. Therefore, AFC may be a potential candidate for the treatment of inflammatory diseases, such as colitis and arthritis.

  9. Total flavonoid extract from Coreopsis tinctoria Nutt. protects rats against myocardial ischemia/reperfusion injury.

    Science.gov (United States)

    Zhang, Ya; Yuan, Changsheng; Fang, He; Li, Jia; Su, Shanshan; Chen, Wen

    2016-09-01

    This study aimed to evaluate the protective effects of total flavonoid extract from Coreopsis tinctoria Nutt. (CTF) against myocardial ischemia/reperfusion injury (MIRI) using an isolated Langendorff rat heart model. Left ventricular developed pressure (LVDP) and the maximum rate of rise and fall of LV pressure (±dp/dtmax) were recorded. Cardiac injury was assessed by analyzing lactate dehydrogenase (LDH) and creatine kinase (CK) released in the coronary effluent. Superoxide dismutase (SOD), glutathione peroxidase (GSH-Px), and malondialdehyde (MDA) levels were determined. Myocardial inflammation was assessed by monitoring tumor necrosis factor-alpha (TNF-α), C-reactive protein (CRP), interleukin-8 (IL-8), and interleukin-6 (IL-6) levels. Myocardial infarct size was estimated. Cell morphology was assessed by 2,3,5-triphenyltetrazolium chloride and hematoxylin and eosin (HE) staining. Cardiomyocyte apoptosis was determined by terminal deoxynucleotidyl transferase dUTP nick-end labeling (TUNEL) staining. Pretreatment with CTF significantly increased the heart rate and increased LVDP, as well as SOD and GSH-Px levels. In addition, CTF pretreatment decreased the TUNEL-positive cell ratio, infarct size, and levels of CK, LDH, MDA, TNF-α, CRP, IL-6, and IL-8. These results suggest that CTF exerts cardio-protective effects against MIRI via anti-oxidant, anti-inflammatory, and anti-apoptotic activities.

  10. Comparison of DNA extraction kits for detection of Burkholderia pseudomallei in spiked human whole blood using real-time PCR.

    Directory of Open Access Journals (Sweden)

    Nicole L Podnecky

    Full Text Available Burkholderia pseudomallei, the etiologic agent of melioidosis, is endemic in northern Australia and Southeast Asia and can cause severe septicemia that may lead to death in 20% to 50% of cases. Rapid detection of B. pseudomallei infection is crucial for timely treatment of septic patients. This study evaluated seven commercially available DNA extraction kits to determine the relative recovery of B. pseudomallei DNA from spiked EDTA-containing human whole blood. The evaluation included three manual kits: the QIAamp DNA Mini kit, the QIAamp DNA Blood Mini kit, and the High Pure PCR Template Preparation kit; and four automated systems: the MagNAPure LC using the DNA Isolation Kit I, the MagNAPure Compact using the Nucleic Acid Isolation Kit I, and the QIAcube using the QIAamp DNA Mini kit and the QIAamp DNA Blood Mini kit. Detection of B. pseudomallei DNA extracted by each kit was performed using the B. pseudomallei specific type III secretion real-time PCR (TTS1 assay. Crossing threshold (C T values were used to compare the limit of detection and reproducibility of each kit. This study also compared the DNA concentrations and DNA purity yielded for each kit. The following kits consistently yielded DNA that produced a detectable signal from blood spiked with 5.5×10(4 colony forming units per mL: the High Pure PCR Template Preparation, QIAamp DNA Mini, MagNA Pure Compact, and the QIAcube running the QIAamp DNA Mini and QIAamp DNA Blood Mini kits. The High Pure PCR Template Preparation kit yielded the lowest limit of detection with spiked blood, but when this kit was used with blood from patients with confirmed cases of melioidosis, the bacteria was not reliably detected indicating blood may not be an optimal specimen.

  11. The extraction of total lipids from parsley: Petroselinum crispum (mill. Nym. Ex. A.W. Hill seeds

    Directory of Open Access Journals (Sweden)

    Stanković Mihajlo Z.

    2004-01-01

    Full Text Available The kinetics of extraction of total lipids from ground parsley (Petroselinum crispum (Mill. Nym. ex. A.W. Hill seeds with a mixture of ethanol or methanol with non-polar organic solvents, chloroform, carbon tetrachloride, trichloroethylene and petroleum ether, at various temperatures were studied. The maceration technique with reflux was used. The kinetic parameters were determined in extraction kinetic equations, as well as the optimal operation conditions for total lipids extraction. The maximum total lipids yield under optimal conditions was 33.7 g per 100 g of dry parsley seeds. Nine lipid fractions of the total lipids were separated by thin layer chromatography among which were phospholipids, sterol, mono-, di- and triacylglycerol, free fatty acids and carbohydrates.

  12. Evaluation of raw nepodin extraction from Rumex japonicus and R. obtusifolius and their DNA polymorphisms.

    Science.gov (United States)

    Minami, Motoyasu; Mori, Takako; Yonezawa, Takayuki; Saito, Yukiko; Teruya, Toshiaki; Woo, Je-Tae

    2018-01-01

    Nepodin, found in the roots of Rumex japonicus Houtt. (Polygonaceae), inhibits osteoclast differentiation and has an antidiabetic effect. We propose nepodin as an ingredient of new functional foods or as a drug candidate for reducing the risk of reduced locomotion resulting from diseases such as osteoporosis. Although there are no previous reports of R. obtusifolius L., which is found throughout Japan, having roots containing nepodin, we found nepodin in the roots of this species. Therefore, R. obtusifolius as well as R. japonicus was considered a candidate raw material for nepodin extraction. We also discuss the suitability of R. japonicus and R. obtusifolius as sources of raw nepodin for cultivation on the Ryukyu Islands. In this study, all specimens on the Ryukyu Islands were identified as R. japonicus. Conversely, all specimens on mainland Japan were R. obtusifolius. The DNA sequence of the chloroplast trnL-trnF intergenic spacer region and partial nuclear internal transcribed spacer was consistent with the identification of R. japonicus and R. obtusifolius by morphological characteristics of the perianth segments. Therefore, to avoid erroneous identification and misuse of the plant species used for extraction of raw materials, it is preferable to develop DNA markers for these two regions. The content of nepodin varied from undetectable to 0.34% of the fresh weight (%FW) in R. japonicus and from undetectable to 0.21%FW in R. obtusifolius. From a pharmacological perspective, as plants that might be suitable as raw materials for nepodin extraction, it became clear that both R. japonicus and R. obtusifolius can be used with the same expected extraction efficiency. Based on our findings, R. obtusifolius could not be confirmed as inhabiting the Ryukyu Islands. For this reason, to conserve the endemic genetic characteristics of the Ryukyu Islands and to prevent genetic pollution by R. obtusifolius, only R. japonicus should be cultivated on the Ryukyu Islands.

  13. Rapid and reliable high-throughput methods of DNA extraction for use in barcoding and molecular systematics of mushrooms.

    Science.gov (United States)

    Dentinger, Bryn T M; Margaritescu, Simona; Moncalvo, Jean-Marc

    2010-07-01

    We present two methods for DNA extraction from fresh and dried mushrooms that are adaptable to high-throughput sequencing initiatives, such as DNA barcoding. Our results show that these protocols yield ∼85% sequencing success from recently collected materials. Tests with both recent (100 years) specimens reveal that older collections have low success rates and may be an inefficient resource for populating a barcode database. However, our method of extracting DNA from herbarium samples using small amount of tissue is reliable and could be used for important historical specimens. The application of these protocols greatly reduces time, and therefore cost, of generating DNA sequences from mushrooms and other fungi vs. traditional extraction methods. The efficiency of these methods illustrates that standardization and streamlining of sample processing should be shifted from the laboratory to the field. © 2009 Blackwell Publishing Ltd.

  14. Total flavonoid content and antioxidant activity in leaves and stems extract of cultivated and wild tabat barito (Ficus deltoidea Jack)

    Science.gov (United States)

    Manurung, Hetty; Kustiawan, Wawan; Kusuma, Irawan W.; Marjenah

    2017-02-01

    Tabat barito (Ficus deltoidea Jack) is a name given by Dayak Tribe who lived in Borneo-Kalimantan and it is belongs to the moraceae. Almost all of the parts of F. deltoidea plant is widely used as a medicinal property. The total flavonoid content (TFC) and antioxidant activity from cultivated and wild F. deltoidea leaves and stems extract were assessed. Total flavonoid content was estimated by using Aluminium chloride colorimetric method and expressed as catechin equivalents (mg CE g-1 extract) and the antioxidant activity by the DPPH (2,2-diphenyl-1-picryl hydrazyl) method. The content of total flavonoid of leaves and stems (430.77 and 371.80 µg CE mg-1 extract) of cultivated F. deltoidea were higher than in the wild leaves and stems (114.82 and 66.67 µg CE mg-1 extract). The IC50 of leaves extract of cultivated and wild F. deltoidea, based on the DPPH assay, has a strong antioxidant activity (34.19 and 39.31 µg mL-1 extract) as compared to stems extract. These results showed that the cultivated F. deltoidea are suitable source for medicinal properties and the leaves could be exploited as source of natural antioxidants.

  15. Reconstitution of the cellular response to DNA damage in vitro using damage-activated extracts from mammalian cells

    International Nuclear Information System (INIS)

    Roper, Katherine; Coverley, Dawn

    2012-01-01

    In proliferating mammalian cells, DNA damage is detected by sensors that elicit a cellular response which arrests the cell cycle and repairs the damage. As part of the DNA damage response, DNA replication is inhibited and, within seconds, histone H2AX is phosphorylated. Here we describe a cell-free system that reconstitutes the cellular response to DNA double strand breaks using damage-activated cell extracts and naïve nuclei. Using this system the effect of damage signalling on nuclei that do not contain DNA lesions can be studied, thereby uncoupling signalling and repair. Soluble extracts from G1/S phase cells that were treated with etoposide before isolation, or pre-incubated with nuclei from etoposide-treated cells during an in vitro activation reaction, restrain both initiation and elongation of DNA replication in naïve nuclei. At the same time, H2AX is phosphorylated in naïve nuclei in a manner that is dependent upon the phosphatidylinositol 3-kinase-like protein kinases. Notably, phosphorylated H2AX is not focal in naïve nuclei, but is evident throughout the nucleus suggesting that in the absence of DNA lesions the signal is not amplified such that discrete foci can be detected. This system offers a novel screening approach for inhibitors of DNA damage response kinases, which we demonstrate using the inhibitors wortmannin and LY294002. -- Highlights: ► A cell free system that reconstitutes the response to DNA damage in the absence of DNA lesions. ► Damage-activated extracts impose the cellular response to DNA damage on naïve nuclei. ► PIKK-dependent response impacts positively and negatively on two separate fluorescent outputs. ► Can be used to screen for inhibitors that impact on the response to damage but not on DNA repair. ► LY294002 and wortmannin demonstrate the system's potential as a pathway focused screening approach.

  16. Evaluation and In-House Validation of Five DNA Extraction Methods for PCR-based STR Analysis of Bloodstained Denims

    Directory of Open Access Journals (Sweden)

    Henry Perdigon

    2004-06-01

    Full Text Available One type of crime scene evidence commonly submitted for analysis is bloodstain on denim. However, chemicals (e.g., indigo used to produce denim materials may co-purify with DNA and hence, affect subsequent DNA analysis. The present study compared five methods (e.g., standard organic, organic with hydrogen peroxide (H2O2, modified FTA™, organic/Chelex®-Centricon®, and QIAamp® DNA Mini Kit-based procedures for the isolation of blood DNA from denim. A Short Tandem Repeat (STR-based analysis across two to nine STR markers, namely, HUMvWA, HUMTH01, D8S306, HUMFES/FPS, HUMDHFRP2, HUMF13A01, HUMFGA, HUMTPOX, and HUMCSF1PO, was used to evaluate successful amplification of blood DNA extracted from light indigo, dark indigo, indigo-sulfur, pure indigo, sulfur-top, and sulfur-bottom denim materials. The results of the present study support the utility of organic/Chelex®-Centricon® and QIAamp® Kit procedures in extracting PCR-amplifiable DNA from five different types of denim materials for STR analysis. Furthermore, a solid-based method using FTA™ classic cards was modified to provide a simple, rapid, safe, and cost-effective procedure for extracting blood DNA from light, dark indigo and pure indigo denim materials. However, DNA eluted from bloodstained sulfur-dyed denims (e.g., sulfur-top and sulfur-bottom using FTA™ procedure was not readily amplifiable.

  17. A simple and rapid infrared-assisted self enzymolysis extraction method for total flavonoid aglycones extraction from Scutellariae Radix and mechanism exploration.

    Science.gov (United States)

    Wang, Liping; Duan, Haotian; Jiang, Jiebing; Long, Jiakun; Yu, Yingjia; Chen, Guiliang; Duan, Gengli

    2017-09-01

    A new, simple, and fast infrared-assisted self enzymolysis extraction (IRASEE) approach for the extraction of total flavonoid aglycones (TFA) mainly including baicalein, wogonin, and oroxylin A from Scutellariae Radix is presented to enhance extraction yield. Extraction enzymolysis temperature, enzymolysis liquid-to-solid ratio, enzymolysis pH, enzymolysis time and infrared power, the factors affecting IRASEE procedure, were investigated in a newly designed, temperature-controlled infrared-assisted extraction (TC-IRAE) system to acquire the optimum analysis conditions. The results illustrated that IRASEE possessed great advantages in terms of efficiency and time compared with other conventional extraction techniques. Furthermore, the mechanism of IRASEE was preliminarily explored by observing the microscopic change of the samples surface structures, studying the main chemical compositions change of the samples before and after extraction and investigating the kinetics and thermodynamics at three temperature levels during the IRASEE process. These findings revealed that IRASEE can destroy the surface microstructures to accelerate the mass transfer and reduce the activation energy to intensify the chemical process. This integrative study presents a simple, rapid, efficient, and environmental IRASEE method for TFA extraction which has promising prospects for other similar herbal medicines. Graphical Abstract ᅟ.

  18. The Effect of DNA Extraction Methods on Observed Microbial Communities from Fibrous and Liquid Rumen Fractions of Dairy Cows.

    Science.gov (United States)

    Vaidya, Jueeli D; van den Bogert, Bartholomeus; Edwards, Joan E; Boekhorst, Jos; van Gastelen, Sanne; Saccenti, Edoardo; Plugge, Caroline M; Smidt, Hauke

    2018-01-01

    DNA based methods have been widely used to study the complexity of the rumen microbiota, and it is well known that the method of DNA extraction is a critical step in enabling accurate assessment of this complexity. Rumen fluid (RF) and fibrous content (FC) fractions differ substantially in terms of their physical nature and associated microorganisms. The aim of this study was therefore to assess the effect of four DNA extraction methods (RBB, PBB, FDSS, PQIAmini) differing in cell lysis and/or DNA recovery methods on the observed microbial diversity in RF and FC fractions using samples from four rumen cannulated dairy cows fed 100% grass silage (GS100), 67% GS and 33% maize silage (GS67MS33), 33% GS and 67% MS (GS33MS67), or 100% MS (MS100). An ANOVA statistical test was applied on DNA quality and yield measurements, and it was found that the DNA yield was significantly affected by extraction method ( p anaerobic fungal communities using quantitative PCR and pyrosequencing of relevant taxonomic markers. Redundancy analysis (RDA) of bacterial 16S rRNA gene sequence data at the family level showed that there was a significant effect of rumen fraction ( p = 0.012), and that PBB ( p = 0.012) and FDSS ( p = 0.024) also significantly contributed to explaining the observed variation in bacterial community composition. Whilst the DNA extraction method affected the apparent bacterial community composition, no single extraction method could be concluded to be ineffective. No obvious effect of DNA extraction method on the anaerobic fungi or archaea was observed, although fraction effects were evident for both. In summary, the comprehensive assessment of observed communities of bacteria, archaea and anaerobic fungi described here provides insight into a rational basis for selecting an optimal methodology to obtain a representative picture of the rumen microbiota.

  19. Comparison of QIAsymphony Automated and QIAamp Manual DNA Extraction Systems for Measuring Epstein-Barr Virus DNA Load in Whole Blood Using Real-Time PCR

    OpenAIRE

    Laus, Stella; Kingsley, Lawrence A.; Green, Michael; Wadowsky, Robert M.

    2011-01-01

    Automated and manual extraction systems have been used with real-time PCR for quantification of Epstein-Barr virus [human herpesvirus 4 (HHV-4)] DNA in whole blood, but few studies have evaluated relative performances. In the present study, the automated QIAsymphony and manual QIAamp extraction systems (Qiagen, Valencia, CA) were assessed using paired aliquots derived from clinical whole-blood specimens and an in-house, real-time PCR assay. The detection limits using the QIAsymphony and QIAam...

  20. Automated extraction of DNA from biological stains on fabric from crime cases. A comparison of a manual and three automated methods

    DEFF Research Database (Denmark)

    Stangegaard, Michael; Hjort, Benjamin B; Hansen, Thomas N

    2013-01-01

    The presence of PCR inhibitors in extracted DNA may interfere with the subsequent quantification and short tandem repeat (STR) reactions used in forensic genetic DNA typing. DNA extraction from fabric for forensic genetic purposes may be challenging due to the occasional presence of PCR inhibitors...

  1. In-house PCR with DNA extracted directly from positive slides to confirm or exclude the diagnosis of tuberculosis: focus on biosafety.

    Science.gov (United States)

    de Almeida, Isabela Neves; Aleixo, Agdemir Valéria; Carvalho, Wânia da Silva; de Miranda, Silvana Spindola

    2015-01-01

    The possibility to obtain DNA from smears is a valuable alternative to remedy the lack of samples when they are totally used for bacilloscopy; this technique solves the biosafety problem related to a possible accident with the transportation of flasks containing potentially transmissible clinical samples. Hence, the purpose of this study was to utilize the insertion sequence IS6110 for amplification of DNA from a smear-positive sample for tuberculosis (TB) diagnosis. Among the 52 positive bacilloscopies, sensitivity, specificity, positive predictive value and negative predictive value were 52.3%, 100%, 100% and 89.7%, respectively whereas accuracy was 90.7%. The IS6110-based PCR for TB diagnosis developed in DNA extracted from a positive smear is a fast, simple, specific, and safe method. Copyright © 2014 Asociación Argentina de Microbiología. Publicado por Elsevier España, S.L.U. All rights reserved.

  2. Evaluation of Lysis Methods for the Extraction of Bacterial DNA for Analysis of the Vaginal Microbiota.

    Directory of Open Access Journals (Sweden)

    Christina Gill

    Full Text Available Recent studies on the vaginal microbiota have employed molecular techniques such as 16S rRNA gene sequencing to describe the bacterial community as a whole. These techniques require the lysis of bacterial cells to release DNA before purification and PCR amplification of the 16S rRNA gene. Currently, methods for the lysis of bacterial cells are not standardised and there is potential for introducing bias into the results if some bacterial species are lysed less efficiently than others. This study aimed to compare the results of vaginal microbiota profiling using four different pretreatment methods for the lysis of bacterial samples (30 min of lysis with lysozyme, 16 hours of lysis with lysozyme, 60 min of lysis with a mixture of lysozyme, mutanolysin and lysostaphin and 30 min of lysis with lysozyme followed by bead beating prior to chemical and enzyme-based DNA extraction with a commercial kit.After extraction, DNA yield did not significantly differ between methods with the exception of lysis with lysozyme combined with bead beating which produced significantly lower yields when compared to lysis with the enzyme cocktail or 30 min lysis with lysozyme only. However, this did not result in a statistically significant difference in the observed alpha diversity of samples. The beta diversity (Bray-Curtis dissimilarity between different lysis methods was statistically significantly different, but this difference was small compared to differences between samples, and did not affect the grouping of samples with similar vaginal bacterial community structure by hierarchical clustering.An understanding of how laboratory methods affect the results of microbiota studies is vital in order to accurately interpret the results and make valid comparisons between studies. Our results indicate that the choice of lysis method does not prevent the detection of effects relating to the type of vaginal bacterial community one of the main outcome measures of

  3. Evaluation of Lysis Methods for the Extraction of Bacterial DNA for Analysis of the Vaginal Microbiota.

    Science.gov (United States)

    Gill, Christina; van de Wijgert, Janneke H H M; Blow, Frances; Darby, Alistair C

    2016-01-01

    Recent studies on the vaginal microbiota have employed molecular techniques such as 16S rRNA gene sequencing to describe the bacterial community as a whole. These techniques require the lysis of bacterial cells to release DNA before purification and PCR amplification of the 16S rRNA gene. Currently, methods for the lysis of bacterial cells are not standardised and there is potential for introducing bias into the results if some bacterial species are lysed less efficiently than others. This study aimed to compare the results of vaginal microbiota profiling using four different pretreatment methods for the lysis of bacterial samples (30 min of lysis with lysozyme, 16 hours of lysis with lysozyme, 60 min of lysis with a mixture of lysozyme, mutanolysin and lysostaphin and 30 min of lysis with lysozyme followed by bead beating) prior to chemical and enzyme-based DNA extraction with a commercial kit. After extraction, DNA yield did not significantly differ between methods with the exception of lysis with lysozyme combined with bead beating which produced significantly lower yields when compared to lysis with the enzyme cocktail or 30 min lysis with lysozyme only. However, this did not result in a statistically significant difference in the observed alpha diversity of samples. The beta diversity (Bray-Curtis dissimilarity) between different lysis methods was statistically significantly different, but this difference was small compared to differences between samples, and did not affect the grouping of samples with similar vaginal bacterial community structure by hierarchical clustering. An understanding of how laboratory methods affect the results of microbiota studies is vital in order to accurately interpret the results and make valid comparisons between studies. Our results indicate that the choice of lysis method does not prevent the detection of effects relating to the type of vaginal bacterial community one of the main outcome measures of epidemiological studies

  4. Technical reproducibility of single-nucleotide and size-based DNA biomarker assessment using DNA extracted from formalin-fixed, paraffin-embedded tissues.

    Science.gov (United States)

    Zhang, Shenli; Tan, Iain B; Sapari, Nur S; Grabsch, Heike I; Okines, Alicia; Smyth, Elizabeth C; Aoyama, Toru; Hewitt, Lindsay C; Inam, Imran; Bottomley, Dan; Nankivell, Matthew; Stenning, Sally P; Cunningham, David; Wotherspoon, Andrew; Tsuburaya, Akira; Yoshikawa, Takaki; Soong, Richie; Tan, Patrick

    2015-05-01

    DNA extracted from formalin-fixed, paraffin-embedded (FFPE) tissues has been used in the past to analyze genetic polymorphisms. We evaluated the technical reproducibility of different types of assays for gene polymorphisms using DNA extracted from FFPE material. By using the MassARRAY iPLEX system, we investigated polymorphisms in DPYD (rs1801159 and rs3918290), UMPS (rs1801019), ERCC1 (rs11615), ERCC1 (rs3212986), and ERCC2 (rs13181) in 56 FFPE DNA samples. By using PCR, followed by size-based gel electrophoresis, we also examined TYMS 5' untranslated region 2R/3R repeats and GSTT1 deletions in 50 FFPE DNA samples and 34 DNAs extracted from fresh-frozen tissues and cell lines. Each polymorphism was analyzed by two independent runs. We found that iPLEX biomarker assays measuring single-nucleotide polymorphisms provided consistent concordant results. However, by using FFPE DNA, size-based PCR biomarkers (GSTT1 and TYMS 5' untranslated region) were discrepant in 32.7% (16/49, with exact 95% CI, 19.9%-47.5%; exact binomial confidence limit test) and 4.2% (2/48, with exact 95% CI, 0.5%-14.3%) of cases, respectively, whereas no discrepancies were observed using intact genomic DNA. Our findings suggest that DNA from FFPE material can be used to reliably test single-nucleotide polymorphisms. However, results based on size-based PCR biomarkers, and particularly GSTT1 deletions, using FFPE DNA need to be interpreted with caution. Independent repeated assays should be performed on all cases to assess potential discrepancies. Copyright © 2015 American Society for Investigative Pathology and the Association for Molecular Pathology. Published by Elsevier Inc. All rights reserved.

  5. Establishment of the total RNA extraction system for lily bulbs with ...

    African Journals Online (AJOL)

    USER

    2011-12-07

    Dec 7, 2011 ... The brightness of. CTAB was higher than that of SDS, which indicated that only improved CTAB method can extract biologically active. RNA from lily bulbs. DISCUSSION. The presence of RNase, which can be classified into endogenous and exogenous, is the major cause for the failure of RNA extraction.

  6. Rapid determination of carbohydrates, ash, and extractives contents of straw using attenuated total reflectance fourier transform mid-infrared spectroscopy.

    Science.gov (United States)

    Tamaki, Yukihiro; Mazza, Giuseppe

    2011-06-22

    Analysis of the chemical components of lignocellulosic biomass is essential to understanding its potential for utilization. Mid-infrared spectroscopy and partial least-squares regression were used for rapid measurement of the carbohydrate (total glycans; glucan; xylan; galactan; arabinan; mannan), ash, and extractives content of triticale and wheat straws. Calibration models for total glycans, glucan, and extractives showed good and excellent predictive performance on the basis of slope, r², RPD, and R/SEP criteria. The xylan model showed good and acceptable predictive performance. However, the ash model was evaluated as providing only approximate quantification and screening. The models for galactan, arabinan, and mannan indicated poor and insufficient prediction for application. Most models could predict both triticale and wheat straw samples with the same degree of accuracy. Mid-infrared spectroscopic techniques coupled with partial least-squares regression can be used for rapid prediction of total glycans, glucan, xylan, and extractives in triticale and wheat straw samples.

  7. The Effect of DNA Extraction Methods on Observed Microbial Communities from Fibrous and Liquid Rumen Fractions of Dairy Cows

    Directory of Open Access Journals (Sweden)

    Jueeli D. Vaidya

    2018-01-01

    Full Text Available DNA based methods have been widely used to study the complexity of the rumen microbiota, and it is well known that the method of DNA extraction is a critical step in enabling accurate assessment of this complexity. Rumen fluid (RF and fibrous content (FC fractions differ substantially in terms of their physical nature and associated microorganisms. The aim of this study was therefore to assess the effect of four DNA extraction methods (RBB, PBB, FDSS, PQIAmini differing in cell lysis and/or DNA recovery methods on the observed microbial diversity in RF and FC fractions using samples from four rumen cannulated dairy cows fed 100% grass silage (GS100, 67% GS and 33% maize silage (GS67MS33, 33% GS and 67% MS (GS33MS67, or 100% MS (MS100. An ANOVA statistical test was applied on DNA quality and yield measurements, and it was found that the DNA yield was significantly affected by extraction method (p < 0.001 and fraction (p < 0.001. The 260/280 ratio was not affected by extraction (p = 0.08 but was affected by fraction (p = 0.03. On the other hand, the 260/230 ratio was affected by extraction method (p < 0.001 but not affected by fraction (p = 0.8. However, all four extraction procedures yielded DNA suitable for further analysis of bacterial, archaeal and anaerobic fungal communities using quantitative PCR and pyrosequencing of relevant taxonomic markers. Redundancy analysis (RDA of bacterial 16S rRNA gene sequence data at the family level showed that there was a significant effect of rumen fraction (p = 0.012, and that PBB (p = 0.012 and FDSS (p = 0.024 also significantly contributed to explaining the observed variation in bacterial community composition. Whilst the DNA extraction method affected the apparent bacterial community composition, no single extraction method could be concluded to be ineffective. No obvious effect of DNA extraction method on the anaerobic fungi or archaea was observed, although fraction effects were evident for both. In

  8. Chitinase genes revealed and compared in bacterial isolates, DNA extracts and a metagenomic library from a phytopathogen suppressive soil

    Energy Technology Data Exchange (ETDEWEB)

    Hjort, K.; Bergstrom, M.; Adesina, M.F.; Jansson, J.K.; Smalla, K.; Sjoling, S.

    2009-09-01

    Soil that is suppressive to disease caused by fungal pathogens is an interesting source to target for novel chitinases that might be contributing towards disease suppression. In this study we screened for chitinase genes, in a phytopathogen-suppressive soil in three ways: (1) from a metagenomic library constructed from microbial cells extracted from soil, (2) from directly extracted DNA and (3) from bacterial isolates with antifungal and chitinase activities. Terminal-restriction fragment length polymorphism (T-RFLP) of chitinase genes revealed differences in amplified chitinase genes from the metagenomic library and the directly extracted DNA, but approximately 40% of the identified chitinase terminal-restriction fragments (TRFs) were found in both sources. All of the chitinase TRFs from the isolates were matched to TRFs in the directly extracted DNA and the metagenomic library. The most abundant chitinase TRF in the soil DNA and the metagenomic library corresponded to the TRF{sup 103} of the isolate, Streptomyces mutomycini and/or Streptomyces clavifer. There were good matches between T-RFLP profiles of chitinase gene fragments obtained from different sources of DNA. However, there were also differences in both the chitinase and the 16S rRNA gene T-RFLP patterns depending on the source of DNA, emphasizing the lack of complete coverage of the gene diversity by any of the approaches used.

  9. Development of a real-world direct interface for integrated DNA extraction and amplification in a microfluidic device.

    Science.gov (United States)

    Shaw, Kirsty J; Joyce, Domino A; Docker, Peter T; Dyer, Charlotte E; Greenway, Gillian M; Greenman, John; Haswell, Stephen J

    2011-02-07

    Integrated DNA extraction and amplification have been carried out in a microfluidic device using electro-osmotic pumping (EOP) for fluidic control. All the necessary reagents for performing both DNA extraction and polymerase chain reaction (PCR) amplification were pre-loaded into the microfluidic device following encapsulation in agarose gel. Buccal cells were collected using OmniSwabs [Whatman™, UK] and manually added to a chaotropic binding/lysis solution pre-loaded into the microfluidic device. The released DNA was then adsorbed onto a silica monolith contained within the DNA extraction chamber and the microfluidic device sealed using polymer electrodes. The washing and elution steps for DNA extraction were carried out using EOP, resulting in transfer of the eluted DNA into the PCR chamber. Thermal cycling, achieved using a Peltier element, resulted in amplification of the Amelogenin locus as confirmed using conventional capillary gel electrophoresis. It was demonstrated that the PCR reagents could be stored in the microfluidic device for at least 8 weeks at 4 °C with no significant loss of activity. Such methodology lends itself to the production of 'ready-to-use' microfluidic devices containing all the necessary reagents for sample processing, with many obvious applications in forensics and clinical medicine.

  10. Total DNA of Glycyrrhiza uralensis transformed into Hansenula anomala by ion implantation:Preparing Glycyrrhizic acid in recombined yeasts

    International Nuclear Information System (INIS)

    Jin Xiang; Mao Peihong; Lu Jie; Ma Yuan

    2010-01-01

    Glycyrrhizic acid (GA) in Glycyrrhiza uralensis (G. uralensis) is physiologically active. In this study, the total DNA of wild G. uralensis was randomly transformed into Hansenula anomaly by implantation of low-energy Ar + and N + , to produce five recombinant yeast strains relating to biological synthesis of the GA or Glycyrrhetinic acid (GAs). After culturing in liquid medium for 96 h, the resultant GA, 18α-GAs and 18β-Gas were determined by reversed-phase high performance liquid chromatography (RP-HPLC), and the corresponding concentrations were 114.49, 0.56, and 0.81 mg·L -1 . After one hundred primers were analyzed with random amplified polymorphic DNA (RAPD), the seven different DNA fragments were produced by the N7059 strain of recombined yeasts, and, the polymerase chain reaction (PCR) verified that one of them came from the genome of G. uralensis, indicating a successful transfer of genetic information by ion implantation. (authors)

  11. Comparison of Boiling and Robotics Automation Method in DNA Extraction for Metagenomic Sequencing of Human Oral Microbes.

    Science.gov (United States)

    Yamagishi, Junya; Sato, Yukuto; Shinozaki, Natsuko; Ye, Bin; Tsuboi, Akito; Nagasaki, Masao; Yamashita, Riu

    2016-01-01

    The rapid improvement of next-generation sequencing performance now enables us to analyze huge sample sets with more than ten thousand specimens. However, DNA extraction can still be a limiting step in such metagenomic approaches. In this study, we analyzed human oral microbes to compare the performance of three DNA extraction methods: PowerSoil (a method widely used in this field), QIAsymphony (a robotics method), and a simple boiling method. Dental plaque was initially collected from three volunteers in the pilot study and then expanded to 12 volunteers in the follow-up study. Bacterial flora was estimated by sequencing the V4 region of 16S rRNA following species-level profiling. Our results indicate that the efficiency of PowerSoil and QIAsymphony was comparable to the boiling method. Therefore, the boiling method may be a promising alternative because of its simplicity, cost effectiveness, and short handling time. Moreover, this method was reliable for estimating bacterial species and could be used in the future to examine the correlation between oral flora and health status. Despite this, differences in the efficiency of DNA extraction for various bacterial species were observed among the three methods. Based on these findings, there is no "gold standard" for DNA extraction. In future, we suggest that the DNA extraction method should be selected on a case-by-case basis considering the aims and specimens of the study.

  12. Comparison of Boiling and Robotics Automation Method in DNA Extraction for Metagenomic Sequencing of Human Oral Microbes.

    Directory of Open Access Journals (Sweden)

    Junya Yamagishi

    Full Text Available The rapid improvement of next-generation sequencing performance now enables us to analyze huge sample sets with more than ten thousand specimens. However, DNA extraction can still be a limiting step in such metagenomic approaches. In this study, we analyzed human oral microbes to compare the performance of three DNA extraction methods: PowerSoil (a method widely used in this field, QIAsymphony (a robotics method, and a simple boiling method. Dental plaque was initially collected from three volunteers in the pilot study and then expanded to 12 volunteers in the follow-up study. Bacterial flora was estimated by sequencing the V4 region of 16S rRNA following species-level profiling. Our results indicate that the efficiency of PowerSoil and QIAsymphony was comparable to the boiling method. Therefore, the boiling method may be a promising alternative because of its simplicity, cost effectiveness, and short handling time. Moreover, this method was reliable for estimating bacterial species and could be used in the future to examine the correlation between oral flora and health status. Despite this, differences in the efficiency of DNA extraction for various bacterial species were observed among the three methods. Based on these findings, there is no "gold standard" for DNA extraction. In future, we suggest that the DNA extraction method should be selected on a case-by-case basis considering the aims and specimens of the study.

  13. Evaluating variation in human gut microbiota profiles due to DNA extraction method and inter-subject differences.

    Science.gov (United States)

    Wagner Mackenzie, Brett; Waite, David W; Taylor, Michael W

    2015-01-01

    The human gut contains dense and diverse microbial communities which have profound influences on human health. Gaining meaningful insights into these communities requires provision of high quality microbial nucleic acids from human fecal samples, as well as an understanding of the sources of variation and their impacts on the experimental model. We present here a systematic analysis of commonly used microbial DNA extraction methods, and identify significant sources of variation. Five extraction methods (Human Microbiome Project protocol, MoBio PowerSoil DNA Isolation Kit, QIAamp DNA Stool Mini Kit, ZR Fecal DNA MiniPrep, phenol:chloroform-based DNA isolation) were evaluated based on the following criteria: DNA yield, quality and integrity, and microbial community structure based on Illumina amplicon sequencing of the V4 region of bacterial and archaeal 16S rRNA genes. Our results indicate that the largest portion of variation within the model was attributed to differences between subjects (biological variation), with a smaller proportion of variation associated with DNA extraction method (technical variation) and intra-subject variation. A comprehensive understanding of the potential impact of technical variation on the human gut microbiota will help limit preventable bias, enabling more accurate diversity estimates.

  14. Evaluating variation in human gut microbiota profiles due to DNA extraction method and inter-subject differences

    Directory of Open Access Journals (Sweden)

    Brett eWagner Mackenzie

    2015-02-01

    Full Text Available The human gut contains dense and diverse microbial communities which have profound influences on human health. Gaining meaningful insights into these communities requires provision of high quality microbial nucleic acids from human fecal samples, as well as an understanding of the sources of variation and their impacts on the experimental model. We present here a systematic analysis of commonly used microbial DNA extraction methods, and identify significant sources of variation. Five extraction methods (Human Microbiome Project protocol, MoBio PowerSoil DNA Isolation Kit, QIAamp DNA Stool Mini Kit, ZR Fecal DNA MiniPrep, phenol:chloroform-based DNA isolation were evaluated based on the following criteria: DNA yield, quality and integrity, and microbial community structure based on Illumina amplicon sequencing of the V4 region of bacterial and archaeal 16S rRNA genes. Our results indicate that the largest portion of variation within the model was attributed to differences between subjects (biological variation, with a smaller proportion of variation associated with DNA extraction method (technical variation and intra-subject variation. A comprehensive understanding of the potential impact of technical variation on the human gut microbiota will help limit preventable bias, enabling more accurate diversity estimates.

  15. Comparison of DNA Extraction Methods in Terms of Yield, Purity, Long-Term Storage, and Downstream Manipulation with Brewer's Yeast Chromosomal DNA

    Czech Academy of Sciences Publication Activity Database

    Kopecká, J.; Matoulková, D.; Němec, M.; Jelínková, Markéta; Felsberg, Jürgen

    2014-01-01

    Roč. 72, č. 1 (2014), s. 1-5 ISSN 0361-0470 Institutional support: RVO:61388971 Keywords : Brewer's yeast * Isolation of DNA * Phenol/chloroform extraction Subject RIV: EE - Microbiology, Virology Impact factor: 0.886, year: 2014

  16. Evaluation and comparison of FTA card and CTAB DNA extraction methods for non-agricultural taxa1

    Science.gov (United States)

    Siegel, Chloe S.; Stevenson, Florence O.; Zimmer, Elizabeth A.

    2017-01-01

    Premise of the study: An efficient, effective DNA extraction method is necessary for comprehensive analysis of plant genomes. This study analyzed the quality of DNA obtained using paper FTA cards prepared directly in the field when compared to the more traditional cetyltrimethylammonium bromide (CTAB)–based extraction methods from silica-dried samples. Methods: DNA was extracted using FTA cards according to the manufacturer’s protocol. In parallel, CTAB-based extractions were done using the automated AutoGen DNA isolation system. DNA quality for both methods was determined for 15 non-agricultural species collected in situ, by gel separation, spectrophotometry, fluorometry, and successful amplification and sequencing of nuclear and chloroplast gene markers. Results: The FTA card extraction method yielded less concentrated, but also less fragmented samples than the CTAB-based technique. The card-extracted samples provided DNA that could be successfully amplified and sequenced. The FTA cards are also useful because the collected samples do not require refrigeration, extensive laboratory expertise, or as many hazardous chemicals as extractions using the CTAB-based technique. Discussion: The relative success of the FTA card method in our study suggested that this method could be a valuable tool for studies in plant population genetics and conservation biology that may involve screening of hundreds of individual plants. The FTA cards, like the silica gel samples, do not contain plant material capable of propagation, and therefore do not require permits from the U.S. Department of Agriculture (USDA) Animal and Plant Health Inspection Service (APHIS) for transportation. PMID:28224056

  17. Determination of in vitro total phenolic, flavonoid contents and antioxidant capacity of the methanolic extract of Echium amoenum L.

    Directory of Open Access Journals (Sweden)

    Fathi H

    2016-06-01

    Full Text Available Introduction: In traditional and modern medicine, active ingredients of medicinal plants have many applications in food, pharmaceutical, medical and industry. Antioxidants are compounds that prevent the oxidation process in the cell. Echium amoenum L. is a plant which grows in the mountainous regions of Mazandaran. This plant has different biological effects such as sedation, anti-inflammation, antidepressant and cancer preventive properties in traditional medicine. The aim of this study was to determine the total phenolic, flavonoid contents and antioxidant capacity of the methanolic extract of E.amoenum plant. Methods:In this experimental laboratory study the content of total phenolic Using the folin-siokalatio reactive at 760 nm wavelength and flavonoid With the use of aluminum chloride reagent at 420nm of E.amoenum extract were measured and antioxidant capacities of different concentrations of the extract were evaluated. Results: The results showed that total phenolic content of the extract was 429±2μg gallic acid equivalent/ml and flavonoid content was 148.56±1.52μg quercetin equivalent/ml, respectively. The radical scavenging activity by 2, 2-diphenyl-1-picryl-hydrazyl hydrate (DPPH,inhibitory concentration of 50%(IC50,was determined 178.11 μg/ml. Assessment of the reducing ability of extract showed that the extract had more activity than vitamin C. The percent nitric oxide trap inhibition of the extract was 57.89% and power iron chelating properties was 51.74%,that showed statistically significant difference in comparison with vitamin C and Quercetin (P=0.0473 and (P=0.0096 respectively. Conclusion: According to the results, E.amoenum extract had remarkable antioxidant capacity and can be proposed as an antioxidant compound used in the manufacture of food and pharmaceutical products.

  18. Phytochemical screening, total phenolics and antioxidant activities of bark and leaf extracts of Goniothalamus velutinus (Airy Shaw from Brunei Darussalam

    Directory of Open Access Journals (Sweden)

    Erum Iqbal

    2015-07-01

    Full Text Available Goniothalamus velutinus Airy Shaw belongs to the family Annonaceae which is known to have anticancer, antitumor and many other bioactivities. Natives of Sabah and Sarawak use root decoction of G. velutinus for the treatment of headache and food poisoning while the bark was used as a mosquito repellent. Bark and leaf extracts of this plant, obtained from Brunei Darussalam, were tested for phytochemical and antioxidant activities. Phytochemical screening of plant extracts revealed the presence of alkaloids, steroids, terpenoids and cardiac glycosides. Quantitative determination of total phenolics, total flavonoids, and various in vitro antioxidant activities (DPPH, ABTS and FRAP of methanolic extract was carried out using colorimetric methods. The total phenolic content, expressed as mg of gallic acid equivalent (GAE per gram of extract, was found to be 68 mg GAE/g and 78 mg GAE/g for bark and leaves respectively. The radical scavenging activity measurement, expressed in terms of EC50 (effective concentration of extract in μg/mL that reduces DPPH absorbance to 50% as compared to negative control, for leaf and bark extracts was found to be 155 μg/mL and 204 μg/mL respectively. Standards trolox and ascorbic acid show EC50 value of 5 μg/mL and 4 μg/mL respectively. Trolox equivalent antioxidant capacity (TEAC was measured using the ABTS and FRAP method. Result for bark and leaf extracts was 79 mg and 106 mg trolox equivalent (TE/g respectively for the ABTS method. For FRAP assay, results for bark and leaf extracts were 80 and 89 mg TE/g respectively.

  19. Direct extraction of genomic DNA from maize with aqueous ionic liquid buffer systems for applications in genetically modified organisms analysis.

    Science.gov (United States)

    Gonzalez García, Eric; Ressmann, Anna K; Gaertner, Peter; Zirbs, Ronald; Mach, Robert L; Krska, Rudolf; Bica, Katharina; Brunner, Kurt

    2014-12-01

    To date, the extraction of genomic DNA is considered a bottleneck in the process of genetically modified organisms (GMOs) detection. Conventional DNA isolation methods are associated with long extraction times and multiple pipetting and centrifugation steps, which makes the entire procedure not only tedious and complicated but also prone to sample cross-contamination. In recent times, ionic liquids have emerged as innovative solvents for biomass processing, due to their outstanding properties for dissolution of biomass and biopolymers. In this study, a novel, easily applicable, and time-efficient method for the direct extraction of genomic DNA from biomass based on aqueous-ionic liquid solutions was developed. The straightforward protocol relies on extraction of maize in a 10 % solution of ionic liquids in aqueous phosphate buffer for 5 min at room temperature, followed by a denaturation step at 95 °C for 10 min and a simple filtration to remove residual biopolymers. A set of 22 ionic liquids was tested in a buffer system and 1-ethyl-3-methylimidazolium dimethylphosphate, as well as the environmentally benign choline formate, were identified as ideal candidates. With this strategy, the quality of the genomic DNA extracted was significantly improved and the extraction protocol was notably simplified compared with a well-established method.

  20. Effect of ultrasonic treatment on total phenolic extraction from Lavandula pubescens and its application in palm olein oil industry.

    Science.gov (United States)

    Rashed, Marwan M A; Tong, Qunyi; Abdelhai, Mandour H; Gasmalla, Mohammed A A; Ndayishimiye, Jean B; Chen, Long; Ren, Fei

    2016-03-01

    The aims of the current study were to evaluate the best technique for total phenolic extraction from Lavandula pubescens (Lp) and its application in vegetable oil industries as alternatives of synthetic food additives (TBHQ and BHT). To achieve these aims, three techniques of extraction were used: ultrasonic-microwave (40 kHz, 50 W, microwave power 480 W, 5 min), ultrasonic-homogenizer (20 kHz, 150 W, 5 min) and conventional maceration as a control. By using the Folin-Ciocalteu method, the total phenolic contents (TPC) (mg gallic acid equivalent/g dry matter) were found to be 253.87, 216.96 and 203.41 for ultrasonic-microwave extract, ultrasonic-homogenizer extract and maceration extract, respectively. The ultrasonic-microwave extract achieved the higher scavenger effect of DPPH (90.53%) with EC50 (19.54 μg/mL), and higher inhibition of β-carotene/linoleate emulsion deterioration (94.44%) with IC50 (30.62 μg/mL). The activity of the ultrasonic-microwave treatment could prolong the induction period (18.82 h) and oxidative stability index (1.67) of fresh refined, bleached and deodorized palm olein oil (RBDPOo) according to Rancimat assay. There was an important synergist effect between citric acid and Lp extracts in improving the oxidative stability of fresh RBDPOo. The results of this work also showed that the ultrasonic-microwave assisted extract was the most effective against Gram-positive and Gram-negative strains that were assessed in this study. The uses of ultrasonic-microwave could induce the acoustic cavitation and rupture of plant cells, and this facilitates the flow of solvent into the plant cells and enhances the desorption from the matrix of solid samples, and thus would enhance the efficiency of extraction based on cavitation phenomenon. Copyright © 2015 Elsevier B.V. All rights reserved.

  1. Mutant analysis of Cdt1's function in suppressing nascent strand elongation during DNA replication in Xenopus egg extracts.

    Science.gov (United States)

    Nakazaki, Yuta; Tsuyama, Takashi; Azuma, Yutaro; Takahashi, Mikiko; Tada, Shusuke

    2017-09-02

    The initiation of DNA replication is strictly regulated by multiple mechanisms to ensure precise duplication of chromosomes. In higher eukaryotes, activity of the Cdt1 protein is temporally regulated during the cell cycle, and deregulation of Cdt1 induces DNA re-replication. In previous studies, we showed that excess Cdt1 inhibits DNA replication by suppressing progression of replication forks in Xenopus egg extracts. Here, we investigated the functional regions of Cdt1 that are required for the inhibition of DNA replication. We constructed a series of N-terminally or C-terminally deleted mutants of Cdt1 and examined their inhibitory effects on DNA replication in Xenopus egg extracts. Our results showed that the region spanning amino acids (a. a.) 255-620 is required for efficient inhibition of DNA replication, and that, within this region, a. a. 255-289 have a critical role in inhibition. Moreover, one of the Cdt1 mutants, Cdt1 R285A, was compromised with respect to the licensing activity but still inhibited DNA replication. This result suggests that Cdt1 has an unforeseen function in the negative regulation of DNA replication, and that this function is located within a molecular region that is distinct from those required for the licensing activity. Copyright © 2017 Elsevier Inc. All rights reserved.

  2. Determination of total lipids and characterization of marigold flower extracts (Calendula officinalis

    Directory of Open Access Journals (Sweden)

    Novković Vesna M.

    2005-01-01

    Full Text Available Bioactive extracts from marigold flower are important ingredients for parapharmaceutical and cosmetic preparations. Their antiflogistic holeretic.antimicrobic, antidermatic and anticancer effects are due to the presence of flavonoids, carotenoids, etheric oils, and terpenoids. This study presents the results of spectrophotometric investigation for the overall carotene content calculated as (3-caroten (442 nm, visual and physico-chemical characteristics according to Ph.Jug. V in oil extracts of marigold flower obtained by maceration (room temperature and 70°C and percolation (room temperature with olive oil and sunflower oil by original procedures.The largest content of (3-carotene (57.5 mg/kg of oil extracts is in the oil extract obtained by maceration for 72 hours with olive oil (solvomodulus 1:5 m/m at room temperature.

  3. Evaluation of five DNA extraction methods for purification of DNA from atherosclerotic tissue and estimation of prevalence of Chlamydia pneumoniae in tissue from a Danish population undergoing vascular repair

    Directory of Open Access Journals (Sweden)

    Lindholt Jes S

    2003-09-01

    Full Text Available Abstract Background To date PCR detection of Chlamydia pneumoniae DNA in atherosclerotic lesions from Danish patients has been unsuccessful. To establish whether non-detection was caused by a suboptimal DNA extraction method, we tested five different DNA extraction methods for purification of DNA from atherosclerotic tissue. Results The five different DNA extraction methods were tested on homogenate of atherosclerotic tissue spiked with C. pneumoniae DNA or EB, on pure C. pneumoniae DNA samples and on whole C. pneumoniae EB. Recovery of DNA was measured with a C. pneumoniae-specific quantitative real-time PCR. A DNA extraction method based on DNA-binding to spin columns with a silica-gel membrane (DNeasy Tissue kit showed the highest recovery rate for the tissue samples and pure DNA samples. However, an automated extraction method based on magnetic glass particles (MagNA Pure performed best on intact EB and atherosclerotic tissue spiked with EB. The DNeasy Tissue kit and MagNA Pure methods and the highly sensitive real-time PCR were subsequently used on 78 atherosclerotic tissue samples from Danish patients undergoing vascular repair. None of the samples were positive for C. pneumoniae DNA. The atherosclerotic samples were tested for inhibition by spiking with two different, known amounts of C. pneumoniae DNA and no samples showed inhibition. Conclusion As a highly sensitive PCR method and an optimised DNA extraction method were used, non-detection in atherosclerotic tissue from the Danish population was probably not caused by use of inappropriate methods. However, more samples may need to be analysed per patient to be completely certain on this. Possible methodological and epidemiological reasons for non-detection of C. pneumoniae DNA in atherosclerotic tissue from the Danish population are discussed. Further testing of DNA extraction methods is needed as this study has shown considerable intra- and inter-method variation in DNA recovery.

  4. A simple method for extracting DNA from rhododendron plants infected with Phytophthora spp. for use in PCR

    Directory of Open Access Journals (Sweden)

    Trzewik Aleksandra

    2016-01-01

    Full Text Available Among the numerous protocols that describe the extraction of DNA, those relating to the isolation of DNA from infected plants, are rare. This study describes a rapid and reliable method of extracting a high quality and quantity of DNA from rhododendron leaves artificially infected with Phytophthora cactorum, P. cambivora, P. cinnamomi, P. citrophthora, and P. plurivora. The use of the modified Doyle and Doyle protocol (1987 allowed us to obtain high quantity and quality DNA (18.26 μg from 100 mg of the fresh weight of infected leaves at the ratios of A260/280 and A260/230 - 1.83 and 1.72, respectively, suitable for conventional polymerase chain reaction (PCR and real-time PCR amplifications.

  5. In situ genomic DNA extraction for PCR analysis of regions of interest in four plant species and one filamentous fungi

    Directory of Open Access Journals (Sweden)

    Luis E. Rojas

    2014-07-01

    Full Text Available The extraction methods of genomic DNA are usually laborious and hazardous to human health and the environment by the use of organic solvents (chloroform and phenol. In this work a protocol for in situ extraction of genomic DNA by alkaline lysis is validated. It was used in order to amplify regions of DNA in four species of plants and fungi by polymerase chain reaction (PCR. From plant material of Saccharum officinarum L., Carica papaya L. and Digitalis purpurea L. it was possible to extend different regions of the genome through PCR. Furthermore, it was possible to amplify a fragment of avr-4 gene DNA purified from lyophilized mycelium of Mycosphaerella fijiensis. Additionally, it was possible to amplify the region ap24 transgene inserted into the genome of banana cv. `Grande naine' (Musa AAA. Key words: alkaline lysis, Carica papaya L., Digitalis purpurea L., Musa, Saccharum officinarum L.

  6. Influence of different extracts addition on total phenols, anthocyanin content and antioxidant activity of blackberry juice during storage

    Directory of Open Access Journals (Sweden)

    Blanka Bilić

    2011-01-01

    Full Text Available The aim of this study was investigation of influence of different extracts addition on total phenols, anthocyanin content, antioxidant activity and percent of polymeric colour of blackberry juice during storage of 52 days at 4 °C. Anthocyanin content of control sample (blackberry juice without extracts addition was 149.91 mg/L. Samples with addition of extracts (olive leaf, pine bark PE 5:1, pine bark PE 95 %, green tea, red wine PE 30 %, red wine PE 4:1 and bioflavonoids had higher anthocyanin content (from 152.42 to 161.19 mg/L in comparison to control sample. Sample with addition of bioflavonoids had the highest anthocyanin content. Samples with addition of extracts had much higher total phenol content and antioxidant activity than control sample, what was expected since extracts are rich in phenols. During storage decrease of phenols, anthocyanins and antioxidant activity occurred in higher or lesser extent, depending on extract type addition. Anthocyanin content in control sample was 119.85 mg/L. Samples with addition of bioflavonoids, olive leaf, pine bark PE 5:1 and red wine PE 4:1 had lower (from 103.44 to 118.84 mg/L, while other samples had higher (from 131.99 to 135.57 mg/L anthocyanin content than control sample. After storage, decrease of anthocyanins was followed with increase of percent of polymeric colour, with exception of samples with addition of green tea.

  7. Epigenomics of Total Acute Sleep Deprivation in Relation to Genome-Wide DNA Methylation Profiles and RNA Expression

    OpenAIRE

    Nilsson, Emil K.; Bostr?m, Adrian E.; Mwinyi, Jessica; Schi?th, Helgi B.

    2016-01-01

    Abstract Despite an established link between sleep deprivation and epigenetic processes in humans, it remains unclear to what extent sleep deprivation modulates DNA methylation. We performed a within-subject randomized blinded study with 16 healthy subjects to examine the effect of one night of total sleep deprivation (TSD) on the genome-wide methylation profile in blood compared with that in normal sleep. Genome-wide differences in methylation between both conditions were assessed by applyin...

  8. Evaluating the impact of extraction and cleanup parameters on the yield of total petroleum hydrocarbons in soil

    Energy Technology Data Exchange (ETDEWEB)

    Saari, Eija; Peraemaeki, Paavo; Jalonen, Jorma [University of Oulu, Department of Chemistry (Finland)

    2008-11-15

    Interlaboratory comparisons for the analysis of mineral oil in polluted soil using the GC-FID method indicate that extraction and cleanup conditions have significant effects on the analytical results. In this investigation a ruggedness test was performed on the extraction and cleanup method for the determination of total petroleum hydrocarbons in soil. A two-level Plackett-Burman design was utilized to study the effect of 11 different method parameters on the extraction recovery of total petroleum hydrocarbons (TPH) in soil. Both qualitative and quantitative factors were investigated. The results indicate that total petroleum hydrocarbons can be relatively reliably monitored through strict implementation of the ISO and CEN draft standards. However, variation in certain method parameters readily affects the validity of the results. The most critical factors affecting TPH recovery were the solvent and co-solvent used for extraction, the extraction time, adsorbent and its weight and sample TPH concentration. Because adaptation of the draft standards especially with respect to these factors easily leads to TPH recoveries higher than 200% or lower than 70%, the validity of the adapted method should always be verified. A proper estimate of the expanded uncertainty should also be appended to TPH results, because only then can the reliability of the results be guaranteed and further justification is gained to support the end-use of the data. This also supports the credibility of the analytical services and prevents the data end-users from drawing misleading conclusions concerning the environmental risks and potential remediation requirements. (orig.)

  9. A rapid genotyping method for an obligate fungal pathogen, Puccinia striiformis f.sp. tritici, based on DNA extraction from infected leaf and Multiplex PCR genotyping

    Directory of Open Access Journals (Sweden)

    Enjalbert Jérôme

    2011-07-01

    Full Text Available Abstract Background Puccinia striiformis f.sp. tritici (PST, an obligate fungal pathogen causing wheat yellow/stripe rust, a serious disease, has been used to understand the evolution of crop pathogen using molecular markers. However, numerous questions regarding its evolutionary history and recent migration routes still remains to be addressed, which need the genotyping of a large number of isolates, a process that is limited by both DNA extraction and genotyping methods. To address the two issues, we developed here a method for direct DNA extraction from infected leaves combined with optimized SSR multiplexing. Findings We report here an efficient protocol for direct fungal DNA extraction from infected leaves, avoiding the costly and time consuming step of spore multiplication. The genotyping strategy we propose, amplified a total of 20 SSRs in three Multiplex PCR reactions, which were highly polymorphic and were able to differentiate different PST populations with high efficiency and accuracy. Conclusion These two developments enabled a genotyping strategy that could contribute to the development of molecular epidemiology of yellow rust disease, both at a regional or worldwide scale.

  10. Epigenomics of Total Acute Sleep Deprivation in Relation to Genome-Wide DNA Methylation Profiles and RNA Expression.

    Science.gov (United States)

    Nilsson, Emil K; Boström, Adrian E; Mwinyi, Jessica; Schiöth, Helgi B

    2016-06-01

    Despite an established link between sleep deprivation and epigenetic processes in humans, it remains unclear to what extent sleep deprivation modulates DNA methylation. We performed a within-subject randomized blinded study with 16 healthy subjects to examine the effect of one night of total sleep deprivation (TSD) on the genome-wide methylation profile in blood compared with that in normal sleep. Genome-wide differences in methylation between both conditions were assessed by applying a paired regression model that corrected for monocyte subpopulations. In addition, the correlations between the methylation of genes detected to be modulated by TSD and gene expression were examined in a separate, publicly available cohort of 10 healthy male donors (E-GEOD-49065). Sleep deprivation significantly affected the DNA methylation profile both independently and in dependency of shifts in monocyte composition. Our study detected differential methylation of 269 probes. Notably, one CpG site was located 69 bp upstream of ING5, which has been shown to be differentially expressed after sleep deprivation. Gene set enrichment analysis detected the Notch and Wnt signaling pathways to be enriched among the differentially methylated genes. These results provide evidence that total acute sleep deprivation alters the methylation profile in healthy human subjects. This is, to our knowledge, the first study that systematically investigated the impact of total acute sleep deprivation on genome-wide DNA methylation profiles in blood and related the epigenomic findings to the expression data.

  11. Determination of total and extractable hydrogen peroxide in organic and aqueous solutions of uranyl nitrate

    International Nuclear Information System (INIS)

    Goodall, Ph.

    1999-01-01

    The development of a spectrophotometric method for the determination of hydrogen peroxide in uranyl nitrate solutions is reported. The method involves the measurement of the absorbance at 520 mm of a vanadyl peroxide species. This species was formed by the addition of a reagent consisting of vanadium (V) (50 mmol x dm -3 ) in dilute sulphuric acid (2 mol x dm -3 H 2 SO 4 ). This reagent, after dilution, was also used as an extractant for organic phase samples. The method is simple and robust and tolerant of nitric acid and U(VI). Specificity and accuracy were improved by the application of solid phase extraction techniques to remove entrained organic solvents and Pu(VI). Reverse phase solid phase extraction was used to clean-up aqueous samples or extracts which were contaminated with entrained solvent. A solid phase extraction system based upon an extraction chromatography system was used to remove Pu(IV). Detection limits of 26 μmol x dm -3 (0.88 μg x cm -3 ) or 7 μmol x dm -3 (0.24 μg x cm -3 ) for, respectively, a 1 and 4 cm path length cell were obtained. Precisions of RSD = 1.4% and 19.5% were obtained at the extremes of the calibration curve (5 mmol x dm -3 and 50 μmol x dm -3 H 2 O 2 , 1 cm cell). The introduction of the extraction and clean-up stages had a negligible effect upon the precision of the determination. The stability of an organic phase sample was tested and no loss of analyte could be discerned over a period of at least 5 days. (author)

  12. Quantitative Analysis of Total Petroleum Hydrocarbons in Soils: Comparison between Reflectance Spectroscopy and Solvent Extraction by 3 Certified Laboratories

    Directory of Open Access Journals (Sweden)

    Guy Schwartz

    2012-01-01

    Full Text Available The commonly used analytic method for assessing total petroleum hydrocarbons (TPH in soil, EPA method 418.1, is usually based on extraction with 1,1,2-trichlorotrifluoroethane (Freon 113 and FTIR spectroscopy of the extracted solvent. This method is widely used for initial site investigation, due to the relative low price per sample. It is known that the extraction efficiency varies depending on the extracting solvent and other sample properties. This study’s main goal was to evaluate reflectance spectroscopy as a tool for TPH assessment, as compared with three commercial certified laboratories using traditional methods. Large variations were found between the results of the three commercial laboratories, both internally (average deviation up to 20%, and between laboratories (average deviation up to 103%. Reflectance spectroscopy method was found be as good as the commercial laboratories in terms of accuracy and could be a viable field-screening tool that is rapid, environmental friendly, and cost effective.

  13. Critical points of DNA quantification by real-time PCR – effects of DNA extraction method and sample matrix on quantification of genetically modified organisms

    Directory of Open Access Journals (Sweden)

    Žel Jana

    2006-08-01

    Full Text Available Abstract Background Real-time PCR is the technique of choice for nucleic acid quantification. In the field of detection of genetically modified organisms (GMOs quantification of biotech products may be required to fulfil legislative requirements. However, successful quantification depends crucially on the quality of the sample DNA analyzed. Methods for GMO detection are generally validated on certified reference materials that are in the form of powdered grain material, while detection in routine laboratories must be performed on a wide variety of sample matrixes. Due to food processing, the DNA in sample matrixes can be present in low amounts and also degraded. In addition, molecules of plant origin or from other sources that affect PCR amplification of samples will influence the reliability of the quantification. Further, the wide variety of sample matrixes presents a challenge for detection laboratories. The extraction method must ensure high yield and quality of the DNA obtained and must be carefully selected, since even components of DNA extraction solutions can influence PCR reactions. GMO quantification is based on a standard curve, therefore similarity of PCR efficiency for the sample and standard reference material is a prerequisite for exact quantification. Little information on the performance of real-time PCR on samples of different matrixes is available. Results Five commonly used DNA extraction techniques were compared and their suitability for quantitative analysis was assessed. The effect of sample matrix on nucleic acid quantification was assessed by comparing 4 maize and 4 soybean matrixes. In addition 205 maize and soybean samples from routine analysis were analyzed for PCR efficiency to assess variability of PCR performance within each sample matrix. Together with the amount of DNA needed for reliable quantification, PCR efficiency is the crucial parameter determining the reliability of quantitative results, therefore it was

  14. Critical points of DNA quantification by real-time PCR--effects of DNA extraction method and sample matrix on quantification of genetically modified organisms.

    Science.gov (United States)

    Cankar, Katarina; Stebih, Dejan; Dreo, Tanja; Zel, Jana; Gruden, Kristina

    2006-08-14

    Real-time PCR is the technique of choice for nucleic acid quantification. In the field of detection of genetically modified organisms (GMOs) quantification of biotech products may be required to fulfil legislative requirements. However, successful quantification depends crucially on the quality of the sample DNA analyzed. Methods for GMO detection are generally validated on certified reference materials that are in the form of powdered grain material, while detection in routine laboratories must be performed on a wide variety of sample matrixes. Due to food processing, the DNA in sample matrixes can be present in low amounts and also degraded. In addition, molecules of plant origin or from other sources that affect PCR amplification of samples will influence the reliability of the quantification. Further, the wide variety of sample matrixes presents a challenge for detection laboratories. The extraction method must ensure high yield and quality of the DNA obtained and must be carefully selected, since even components of DNA extraction solutions can influence PCR reactions. GMO quantification is based on a standard curve, therefore similarity of PCR efficiency for the sample and standard reference material is a prerequisite for exact quantification. Little information on the performance of real-time PCR on samples of different matrixes is available. Five commonly used DNA extraction techniques were compared and their suitability for quantitative analysis was assessed. The effect of sample matrix on nucleic acid quantification was assessed by comparing 4 maize and 4 soybean matrixes. In addition 205 maize and soybean samples from routine analysis were analyzed for PCR efficiency to assess variability of PCR performance within each sample matrix. Together with the amount of DNA needed for reliable quantification, PCR efficiency is the crucial parameter determining the reliability of quantitative results, therefore it was chosen as the primary criterion by which to

  15. Critical points of DNA quantification by real-time PCR – effects of DNA extraction method and sample matrix on quantification of genetically modified organisms

    Science.gov (United States)

    Cankar, Katarina; Štebih, Dejan; Dreo, Tanja; Žel, Jana; Gruden, Kristina

    2006-01-01

    Background Real-time PCR is the technique of choice for nucleic acid quantification. In the field of detection of genetically modified organisms (GMOs) quantification of biotech products may be required to fulfil legislative requirements. However, successful quantification depends crucially on the quality of the sample DNA analyzed. Methods for GMO detection are generally validated on certified reference materials that are in the form of powdered grain material, while detection in routine laboratories must be performed on a wide variety of sample matrixes. Due to food processing, the DNA in sample matrixes can be present in low amounts and also degraded. In addition, molecules of plant origin or from other sources that affect PCR amplification of samples will influence the reliability of the quantification. Further, the wide variety of sample matrixes presents a challenge for detection laboratories. The extraction method must ensure high yield and quality of the DNA obtained and must be carefully selected, since even components of DNA extraction solutions can influence PCR reactions. GMO quantification is based on a standard curve, therefore similarity of PCR efficiency for the sample and standard reference material is a prerequisite for exact quantification. Little information on the performance of real-time PCR on samples of different matrixes is available. Results Five commonly used DNA extraction techniques were compared and their suitability for quantitative analysis was assessed. The effect of sample matrix on nucleic acid quantification was assessed by comparing 4 maize and 4 soybean matrixes. In addition 205 maize and soybean samples from routine analysis were analyzed for PCR efficiency to assess variability of PCR performance within each sample matrix. Together with the amount of DNA needed for reliable quantification, PCR efficiency is the crucial parameter determining the reliability of quantitative results, therefore it was chosen as the primary

  16. The extraction of φ-N total cross section from d(γ,pK+K-)n

    International Nuclear Information System (INIS)

    Qian, X.; Chen, W.; Gao, H.; Hicks, K.; Kramer, K.; Laget, J.M.; Mibe, T.; Stepanyan, S.; Tedeschi, D.J.; Xu, W.; Adhikari, K.P.; Amaryan, M.; Anghinolfi, M.; Baghdasaryan, H.; Ball, J.; Battaglieri, M.; Batourine, V.; Bedlinskiy, I.; Bellis, M.; Biselli, A.S.

    2009-01-01

    We report on the first measurement of the differential cross section of φ-meson photoproduction for the d(γ,pK + K - )n exclusive reaction channel. The experiment was performed using a tagged-photon beam and the CEBAF Large Acceptance Spectrometer (CLAS) at Jefferson Lab. A combined analysis using data from the d(γ,pK + K - )n channel and those from a previous publication on coherent φ production on the deuteron has been carried out to extract the φ-N total cross section, σ φN . The extracted φ-N total cross section favors a value above 20 mb. This value is larger than the value extracted using vector-meson dominance models for φ photoproduction on the proton.

  17. Statistical mixture design selective extraction of compounds with antioxidant activity and total polyphenol content from Trichilia catigua.

    Science.gov (United States)

    Lonni, Audrey Alesandra Stinghen Garcia; Longhini, Renata; Lopes, Gisely Cristiny; de Mello, João Carlos Palazzo; Scarminio, Ieda Spacino

    2012-03-16

    Statistical design mixtures of water, methanol, acetone and ethanol were used to extract material from Trichilia catigua (Meliaceae) barks to study the effects of different solvents and their mixtures on its yield, total polyphenol content and antioxidant activity. The experimental results and their response surface models showed that quaternary mixtures with approximately equal proportions of all four solvents provided the highest yields, total polyphenol contents and antioxidant activities of the crude extracts followed by ternary design mixtures. Principal component and hierarchical clustering analysis of the HPLC-DAD spectra of the chromatographic peaks of 1:1:1:1 water-methanol-acetone-ethanol mixture extracts indicate the presence of cinchonains, gallic acid derivatives, natural polyphenols, flavanoids, catechins, and epicatechins. Copyright © 2011 Elsevier B.V. All rights reserved.

  18. COMPARISON OF TWO TOTAL RNA EXTRACTION PROTOCOLS FROM CHO-K1 CELLS FOR RT-PCR: CUT-OFF COST FOR RESEARCHERS

    Directory of Open Access Journals (Sweden)

    Vasila Packeer Mohamed

    2014-05-01

    Full Text Available ABSTRACT: Various methods have been described to extract RNA from adherent mammalian cells. RNA isolation in conjunction with reverse transcription polymerase chain reaction (RT-PCR is a valuable tool used to study gene expression profiling. This approach is now being used in mammalian cell bioprocessing to help understand and improve the system. The objective of this study was to compare and determine the most suitable RNA extraction method for CHO-K1 cells in a setting where a relatively large amount of samples was involved. Total RNA was extracted using Total RNA purification kit (without DNase treatment; Norgen, Canada and RNeasy mini kit (with DNase treatment; Qiagen, USA respectively. The extracted RNA was then reverse transcribed, and the cDNA was subjected to PCR-amplifying 18S. Yield from RNeasy kit was significantly higher (0.316 ± 0.033 µg/µl; p=0.004 than Total RNA purification kit (0.177 ± 0.0243 µg/µl. However, RNA purity for both methods was close to 2.0 and there was no significant difference between the methods. Total RNA purification kit is less expensive than RNeasy kit. Since there is no DNase treatment step in the former, extraction time for RNA is shorter. When the extracted RNA was subjected to RT-PCR, both methods were able to show detection of 18S at 219 bp.   Therefore, this study demonstrates that both protocols are suitable for RNA extraction for CHO-K1 cells. RNeasy mini kit (Qiagen is recommended if higher yields is the primary concern and Total RNA Purification kit (Norgen is recommended if time and cost are concerned. ABSTRAK: Pelbagai kaedah telah digunakan untuk mengekstrak RNA daripada sel mamalia lekat.  Pemencilan RNA dengan menggunakan reaksi rantai polimerase transkripsi berbalik (RT-PCR merupakan kaedah penting yang digunakan dalam mengkaji pernyataan gen berprofil.  Pendekatan ini kini digunakan dalam pemprosesan bio sel mamalia untuk memahami dan menambah baik sistem.  Tujuan kajian dijalankan

  19. Evaluation of Antioxidant Activity of Total Extract of Onopordon leptolepis L. in Vitro

    Directory of Open Access Journals (Sweden)

    Einollah Valizadeh

    2015-08-01

    Full Text Available Background and objectives : Medicinal plants are valuable natural resources that have been considered nowadays in developed countries as raw materials for converting into safe drugs for human. Antioxidants are compounds that effectively prevent oxygen free radical reactions and reduce damage or cell death, cardiovascular diseases and cancer. Material and Methods : After extraction of floral and vegetative parts of Onopordon leptolepis plant, antioxidant potential was determined by two testes: 1. 1diphenyl-2-picrylhydrazyl (DPPH free radical-scavenging and ferric-reducing antioxidant power (FRAP. Results : The hydro-alcohol extract (methanol 70% of floral and vegetative parts of O. leptolepis plant was found as the most active in scavenging DPPH radicals and in FRAP. The antioxidant potential of hydro-alcohol (H.A70% extracts of the floral part of O.leptolepis showed weak effect than the extract of vegetative of O.leptolepis plant. Conclusion : Results showed that the hydro-alcohol extract (methanol 70% of vegetative part can be considered for medicinal and food industries due to the high antioxidant properties.

  20. In vitro activity of total aqueous ethanol leaf extracts of Ricinus communis on Leishmania major promastigotes

    International Nuclear Information System (INIS)

    Okech, B.G.A.; Irungu, L.W.; Anjili, C.O.; Munyua, J.K.; Njagi, E.N.M.; Rukungu, G.

    2006-01-01

    The activity of aqueous and ethanol extracts of Ricinus communis was tested on Leishmania promastigotes in cell-free culture media. Serial dilutions of the extracts ranging from 500μg/ml, 250 μg/ml and 62.5μg/ml were prepared in triplicate using Schneiders Drosophila medium supplemented with 20% fetal bovine serum in the absence of antibiotics and the growth of approximately 1x 10 (power 6) parasites monitored every two days for a period of 8 days. Parasite density was estimated every two days using the Neuabeur counting chamber. At the end of the 8-day period cell morphology was observed and photographed. Significant growth inihibitory effect was observed on the promastigotes by the aqueous and ethanol extracts especially at high concentrations. However, there was an enhanced growth effect initially thereafter leading to to a rapid decline in promastigote cell population. Flagellar motility was also greatly affected at high concentration and it appeared that there was a linear relationship between flagellar motilities and the level of concentrations. Parasite morphology was affected severely. Most of the cultures observed appeared to have abnormal round morphology. Rosseting was also evident in the extract treated cultures. The aqueous leaf extract interfered with parasite morphology but this was dose dependent. The importance of R. communis plant as a potential source for chemotypes with antileishmanial activity is discussed. (author)

  1. Ion-channel genosensor for the detection of specific DNA sequences derived from Plum Pox Virus in plant extracts.

    Science.gov (United States)

    Malecka, Kamila; Michalczuk, Lech; Radecka, Hanna; Radecki, Jerzy

    2014-10-09

    A DNA biosensor for detection of specific oligonucleotides sequences of Plum Pox Virus (PPV) in plant extracts and buffer is proposed. The working principles of a genosensor are based on the ion-channel mechanism. The NH2-ssDNA probe was deposited onto a glassy carbon electrode surface to form an amide bond between the carboxyl group of oxidized electrode surface and amino group from ssDNA probe. The analytical signals generated as a result of hybridization were registered in Osteryoung square wave voltammetry in the presence of [Fe(CN)6]3-/4- as a redox marker. The 22-mer and 42-mer complementary ssDNA sequences derived from PPV and DNA samples from plants infected with PPV were used as targets. Similar detection limits of 2.4 pM (31.0 pg/mL) and 2.3 pM (29.5 pg/mL) in the concentration range 1-8 pM were observed in the presence of the 22-mer ssDNA and 42-mer complementary ssDNA sequences of PPV, respectively. The genosensor was capable of discriminating between samples consisting of extracts from healthy plants and leaf extracts from infected plants in the concentration range 10-50 pg/mL. The detection limit was 12.8 pg/mL. The genosensor displayed good selectivity and sensitivity. The 20-mer partially complementary DNA sequences with four complementary bases and DNA samples from healthy plants used as negative controls generated low signal.

  2. Replication of UV-irradiated DNA in human cell extracts: Evidence for mutagenic bypass of pyrimidine dimers

    International Nuclear Information System (INIS)

    Thomas, D.C.; Kunkel, T.A.

    1993-01-01

    The authors have examined the efficiency and fidelity of simian virus 40-origin-dependent replication of UV-irradiated double-stranded DNA in extracts of human cells. Using as a mutational target the α-complementation domain of the Escherichia coli lacZ gene in bacteriophage M13mp2DNA, replication of undamaged DNA in HeLa cell extracts was highly accurate, whereas replication of DNA irradiated with UV light (280-320 nm) was both less efficient and less accurate. Replication was inhibited by irradiation in a dose-dependent manner. Nonetheless, covalently closed, monomer-length circular products were generated that were resistant to digestion by Dpn I, showing that they resulted from semiconservative replication. These products were incised by T4 endonuclease V, whereas the undamaged replication products were not, suggesting that pyrimidine dimers were bypassed during replication. When replicated, UV-irradiated DNA was used to transfect an E. coli α-complementation host strain to score mutant M13mp2 plaques, the mutant plaque frequency was substantially higher than that obtained with either unirradiated, replicated DNA, or unreplicated, UV-irradiated DNA. Both the increased mutagenicity and the inhibition of replication associated with UV irradiation were reversed by treatment of the irradiated DNA with photolyase before replication. Sequence analysis of mutants resulting from replication of UV-irradiated DNA demonstrated that most mutants contained C → T transition errors at dipyrimidine sites. A few mutants contained 1-nt frameshift errors or tandem double CC → TT substitutions. The data are consistent with the interpretation that pyrimidine dimers are bypassed during replication by the multiprotein replication apparatus in human cell extracts and that this bypass is mutagenic primarily via misincorporation of dAMP opposite a cytosine (or uracil) in the dimer. 56 refs., 2 figs., 3 tabs

  3. Hot water extract of Chlorella vulgaris induced DNA damage and apoptosis

    Science.gov (United States)

    Yusof, Yasmin Anum Mohd; Md. Saad, Suhana; Makpol, Suzana; Shamaan, Nor Aripin; Ngah, Wan Zurinah Wan

    2010-01-01

    OBJECTIVES: The aim of this study was to determine the antiproliferative and apoptotic effects of hot water extracts of Chlorella vulgaris on hepatoma cell line HepG2. INTRODUCTION: The search for food and spices that can induce apoptosis in cancer cells has been a major study interest in the last decade. Chlorella vulgaris, a unicellular green algae, has been reported to have antioxidant and anti‐cancer properties. However, its chemopreventive effects in inhibiting the growth of cancer cells have not been studied in great detail. METHODS: HepG2 liver cancer cells and WRL68 normal liver cells were treated with various concentrations (0‐4 mg/ml) of hot water extract of C. vulgaris after 24 hours incubation. Apoptosis rate was evaluated by TUNEL assay while DNA damage was assessed by Comet assay. Apoptosis proteins were evaluated by Western blot analysis. RESULTS: Chlorella vulgaris decreased the number of viable HepG2 cells in a dose dependent manner (p Chlorella vulgaris tested. Evaluation of apoptosis by TUNEL assay showed that Chlorella vulgaris induced a higher apoptotic rate (70%) in HepG2 cells compared to normal liver cells, WRL68 (15%). Western blot analysis showed increased expression of pro‐ apoptotic proteins P53, Bax and caspase‐3 in the HepG2 cells compared to normal liver cells WRL68, and decreased expression of the anti‐apoptotic protein Bcl‐2. CONCLUSIONS: Chlorella vulgaris may have anti‐cancer effects by inducing apoptosis signaling cascades via an increased expression of P53, Bax and caspase‐3 proteins and through a reduction of Bcl‐2 protein, which subsequently lead to increased DNA damage and apoptosis. PMID:21340229

  4. RAPID DNA EXTRACTION AND PCR VALIDATION FOR DIRECT DETECTION OF Listeria monocytogenes IN RAW MILK

    Directory of Open Access Journals (Sweden)

    Edith Burbano

    2006-05-01

    Full Text Available Objective. The aim of this study was to validate a method for detecting L. monocytogenes in raw milk.Materials and methods. The extraction procedure carried out using a chaotropic agent like NaI, toreduce fat in the sample to 0.2% w/v, which is the lowest limit for detection in the Gerber method, toavoid the polymerization. The raw milk samples were analyzed by using the traditional gold standardmethod for L. monocytogenes. Detection PCR was done on the specificity of primers that recognize theListeria genus by amplifying a specific fragment of about 938bp of the 16S rDNA. Several primer setswere use: L1 (CTCCATAAAGGTGACCCT, U1 (CAGCMGCCGCGGTAATWC, LF (CAAACGTTAACAACGCAGTAand LR (TCCAGAGTGATCGATGTTAA that recognize the hlyA gene of L. monocytogenes, amplifying a 750bpfragment. Results. The DNA of 39 strains evidenced high specificity of the technique since all the strainsof L. monocytogenes amplified the fragments 938bp and 750bp, specifically for genus and species,respectively. The detection limit of the PCR was 101 CFU/ml. T he PCR reproducibility showed a Kappa of0.85; the specificity and sensitivity of 100% were found, predictive positive and negative values were of100% respectively. Conclusions. These results demonstrate that is possible to detect of Listeria spp. byusing any of the three methods since they share the same sensitivity and specificity. One hundred percentof the predictive value for PCR (alternative method provides high reliability, and allows the detection ofthe positive samples. The extraction procedure combined with a PCR method can reduce in 15 days thetime of identification of L. monocytogenes in raw milk. This PCR technique could be adapted and validatedto be use for other types of food such as poultry, meat products and cheeses

  5. Quantification of total and water extractable essential elements in medicinal plants used for stomach problems

    International Nuclear Information System (INIS)

    Sahito, S.R.; Kazi, T.G.; Shar, G.Q.; Mangrio, A.M; Shaikh, M.S.

    2004-01-01

    The role of elements particularly trace elements in health and disease is well known. Present study has been undertaken in our laboratories to quantify the commonly occurring elements in three medicinal plans. Peganum harmala Linn, Phyllanthus emblica Linn, Tamarix dioca used for stomach problems using atomic absorption spectrophotometer. Wet digestion method has been used to extract the acid extractable metals. Samples were boiled in water to obtain water extractable metals. The validation of the method was checked with the NBS-1570 (Spinach) as Standard Reference Material. Levels of essential elements were found high as compared to concentration of toxic elements. The considerable amounts of essential such as calcium, magnesium, potassium, zinc and iron were found in all these plant samples. (author)

  6. Optimisation of pressurised liquid extraction (PLE) for rapid and efficient extraction of superficial and total mineral oil contamination from dry foods.

    Science.gov (United States)

    Moret, Sabrina; Scolaro, Marianna; Barp, Laura; Purcaro, Giorgia; Sander, Maren; Conte, Lanfranco S

    2014-08-15

    Pressurised liquid extraction (PLE) represents a powerful technique which can be conveniently used for rapid extraction of mineral oil saturated (MOSH) and aromatic hydrocarbons (MOAH) from dry foods with a low fat content, such as semolina pasta, rice, and other cereals. Two different PLE methods, one for rapid determination of superficial contamination mainly from the packaging, the other for efficient extraction of total contamination from different sources, have been developed and optimised. The two methods presented good performance characteristics in terms of repeatability (relative standard deviation lower than 5%) and recoveries (higher than 95%). To show their potentiality, the two methods have been applied in combination on semolina pasta and rice packaged in direct contact with recycled cardboard. In the case of semolina pasta it was possible to discriminate between superficial contamination coming from the packaging, and pre-existing contamination (firmly enclosed into the matrix). Copyright © 2014 Elsevier Ltd. All rights reserved.

  7. Aqueous extract of Crataegus azarolus protects against DNA damage in human lymphoblast Cell K562 and enhances antioxidant activity.

    Science.gov (United States)

    Mustapha, Nadia; Bouhlel, Inès; Chaabane, Fadwa; Bzéouich, Imèn Mokdad; Ghedira, Kamel; Hennebelle, Thierry; Chekir-Ghedira, Leila

    2014-02-01

    The present study was carried out to characterize the cellular antioxidant effect of the aqueous extract of Crataegus azarolus and its antigenotoxic potential using human myelogenous cells, K562. The antioxidant capacity of this extract was evaluated by determining its cellular antioxidant activity (CAA) in K562 cells. Also, preceding antigenotoxicity assessment, its eventual genotoxicity property was investigated by evaluating its capacity to induce the DNA degradation of treated cell nuclei. As no genotoxicity was detected at different exposure times, its ability to protect cell DNA against H2O2 oxidative effect was investigated, using the "comet assay." It appears that 800 μg/mL of extract inhibited the genotoxicity induced by H2O2 with a rate of 41.30 %, after 4 h of incubation. In addition, this extract revealed a significant cellular antioxidant capacity against the reactive oxygen species in K562 cells.

  8. Radioprotective effect of methanolic root extract of Loeseneriella arnottiana on radiation induced DNA damage in human lymphocytes in vitro

    International Nuclear Information System (INIS)

    Prajna, P.S.

    2012-01-01

    Intense exposure to ionization radiation by accidental, occupational or therapeutical purpose causes cellular damage mainly by formation of excessive reactive oxygen species (ROS) or by free radicals. Humans are intentionally exposed to ionising radiation for diagnostic or therapeutic purposes. The use of ionising radiation in cancer therapy may lead to transient and/or permanent injury to normal tissues within the treatment field. To increase the therapeutic index of radiation therapy, various modes of radioprotection have been developed that selectively reduce cytotoxic effects to normal tissues. Because radiation-induced cellular damage is attributed primarily to the harmful effects of free radicals, molecules with radical scavenging properties are particularly promising as radioprotectors. Loeseneriella arnottiana, a member of family Hippocrateaceae, is a climbing shrub used by traditional medicine practitioners. To study the antioxidant activity and radioprotective effect of methanolic root extract of Loeseneriella arnottiana against electron beam radiation induced DNA damage in human lymphocytes. Loeseneriella arnottiana roots were dried and extracted using methanol by solvent extraction method. Antioxidant activity was measured by DPPH method. DNA damage was assessed by comet assay parameters. The lymphocytes were incubated for one hour with two different concentrations 10 μg and 50 μg of root extract before exposure to 2 Gy electron beam radiation. 30 μg of methanolic root extract of Loeseneriella arnottiana exhibited 96% radical scavenging activity comparable to 15 μg of ascorbic acid. In reducing power assay it showed dose dependent increase in absorbance indicating that extract is capable of donating hydrogen atoms. Pretreatment of lymphocytes with 10 μg and 50 μg of root extract before irradiation resulted in reduction in the Comet length, Olive tail moment, percentage of DNA in tail when compared to the radiation control group. Results of this

  9. Short Communication An efficient method for simultaneous extraction of high-quality RNA and DNA from various plant tissues.

    Science.gov (United States)

    Oliveira, R R; Viana, A J C; Reátegui, A C E; Vincentz, M G A

    2015-12-29

    Determination of gene expression is an important tool to study biological processes and relies on the quality of the extracted RNA. Changes in gene expression profiles may be directly related to mutations in regulatory DNA sequences or alterations in DNA cytosine methylation, which is an epigenetic mark. Correlation of gene expression with DNA sequence or epigenetic mark polymorphism is often desirable; for this, a robust protocol to isolate high-quality RNA and DNA simultaneously from the same sample is required. Although commercial kits and protocols are available, they are mainly optimized for animal tissues and, in general, restricted to RNA or DNA extraction, not both. In the present study, we describe an efficient and accessible method to extract both RNA and DNA simultaneously from the same sample of various plant tissues, using small amounts of starting material. The protocol was efficient in the extraction of high-quality nucleic acids from several Arabidopsis thaliana tissues (e.g., leaf, inflorescence stem, flower, fruit, cotyledon, seedlings, root, and embryo) and from other tissues of non-model plants, such as Avicennia schaueriana (Acanthaceae), Theobroma cacao (Malvaceae), Paspalum notatum (Poaceae), and Sorghum bicolor (Poaceae). The obtained nucleic acids were used as templates for downstream analyses, such as mRNA sequencing, quantitative real time-polymerase chain reaction, bisulfite treatment, and others; the results were comparable to those obtained with commercial kits. We believe that this protocol could be applied to a broad range of plant species, help avoid technical and sampling biases, and facilitate several RNA- and DNA-dependent analyses.

  10. Efficiency of boiling and four other methods for genomic DNA extraction of deteriorating spore-forming bacteria from milk

    Directory of Open Access Journals (Sweden)

    Jose Carlos Ribeiro Junior

    2016-10-01

    Full Text Available The spore-forming microbiota is mainly responsible for the deterioration of pasteurized milk with long shelf life in the United States. The identification of these microorganisms, using molecular tools, is of particular importance for the maintenance of the quality of milk. However, these molecular techniques are not only costly but also labor-intensive and time-consuming. The aim of this study was to compare the efficiency of boiling in conjunction with four other methods for the genomic DNA extraction of sporulated bacteria with proteolytic and lipolytic potential isolated from raw milk in the states of Paraná and Maranhão, Brazil. Protocols based on cellular lysis by enzymatic digestion, phenolic extraction, microwave-heating, as well as the use of guanidine isothiocyanate were used. This study proposes a method involving simple boiling for the extraction of genomic DNA from these microorganisms. Variations in the quality and yield of the extracted DNA among these methods were observed. However, both the cell lysis protocol by enzymatic digestion (commercial kit and the simple boiling method proposed in this study yielded sufficient DNA for successfully carrying out the Polymerase Chain Reaction (PCR of the rpoB and 16S rRNA genes for all 11 strains of microorganisms tested. Other protocols failed to yield sufficient quantity and quality of DNA from all microorganisms tested, since only a few strains have showed positive results by PCR, thereby hindering the search for new microorganisms. Thus, the simple boiling method for DNA extraction from sporulated bacteria in spoiled milk showed the same efficacy as that of the commercial kit. Moreover, the method is inexpensive, easy to perform, and much less time-consuming.

  11. Investigation of Total Phenolic and Flavonoid Contents, and Evaluation of Antimicrobial and Antioxidant Activities from Baeckea frutescens Extracts

    Science.gov (United States)

    Nisa, K.; Nurhayati, S.; Apriyana, W.; Indrianingsih, A. W.

    2017-12-01

    Baeckea frutescens L. is a medicinal plant endemic to the tropical area and it has been used by locals for topical and oral ailments. This study investigated total phenolic and flavonoid contents and also evaluated in vitro antimicrobial and antioxidant activities of of Baeckea frutescens crude extracts. These extracts were assessed for their antibacterial activities against strains of Escherichia coli, Staphylococcus aureus, Salmonella thypii, and Pseudomonas aureginosa by the broth micro-dilution methods using a modified tetrazolium-based colorimetric assay (3-(4, 5-dimethylthiazol)-2, 5-diphenyl tetrazolium bromide (MTT) assay). Baeckea frutescens crude extracts were also tested against the stable DPPH (2,2-diphenyl-1-picryl-hydrazyl-hydrate) free-radical. The results indicated that Baeckea frutescens water and ethanol extracts possesed remarkable antibacterial activity with the minimum inhibitory concentration less than 100 μg/ml against Escherichia coli and Salmonella thypi. On the evaluation of the antioxidant activity via DPPH assay, Baeckea frutescens ethanol extracts exhibited a good antioxidant activity with IC50 less than 50 μg/ml and Baeckea frutescens water extracts showed a moderate antioxidant activity with IC50 less than 100 μg/ml.

  12. A comparison of DNA extraction protocols from blood spotted on FTA cards for the detection of tick-borne pathogens by Reverse Line Blot hybridization.

    Science.gov (United States)

    Hailemariam, Zerihun; Ahmed, Jabbar Sabir; Clausen, Peter-Henning; Nijhof, Ard Menzo

    2017-01-01

    An essential step in the molecular detection of tick-borne pathogens (TBPs) in blood is the extraction of DNA. When cooled storage of blood under field conditions prior to DNA extraction in a dedicated laboratory is not possible, the storage of blood on filter paper forms a promising alternative. We evaluated six DNA extraction methods from blood spotted on FTA Classic ® cards (FTA cards), to determine the optimal protocol for the subsequent molecular detection of TBPs by PCR and the Reverse Line Blot hybridization assay (RLB). Ten-fold serial dilutions of bovine blood infected with Babesia bovis, Theileria mutans, Anaplasma marginale or Ehrlichia ruminantium were made by dilution with uninfected blood and spotted on FTA cards. Subsequently, DNA was extracted from FTA cards using six different DNA extraction protocols. DNA was also isolated from whole blood dilutions using a commercial kit. PCR/RLB results showed that washing of 3mm discs punched from FTA cards with FTA purification reagent followed by DNA extraction using Chelex ® resin was the most sensitive procedure. The detection limit could be improved when more discs were used as starting material for the DNA extraction, whereby the use of sixteen 3mm discs proved to be most practical. The presented best practice method for the extraction of DNA from blood spotted on FTA cards will facilitate epidemiological studies on TBPs. It may be particularly useful for field studies where a cold chain is absent. Copyright © 2016 Elsevier GmbH. All rights reserved.

  13. Comparison of four DNA extraction methods for the detection of Mycobacterium leprae from Ziehl-Neelsen-stained microscopic slides.

    Science.gov (United States)

    Ruiz-Fuentes, Jenny Laura; Díaz, Alexis; Entenza, Anayma Elena; Frión, Yahima; Suárez, Odelaisy; Torres, Pedro; de Armas, Yaxsier; Acosta, Lucrecia

    2015-12-01

    The diagnosis of leprosy has been a challenge due to the low sensibility of the conventional methods and the impossibility of culturing the causative organism. In this study, four methods for Mycobacterium leprae nucleic-acid extraction from Ziehl-Neelsen-stained slides (ZNS slides) were compared: Phenol/chloroform, Chelex 100 resin, and two commercial kits (Wizard Genomic DNA Purification Kit and QIAamp DNA Mini Kit). DNA was extracted from four groups of slides: a high-codification-slide group (bacteriological index [BI]⩾4), a low-codification-slide group (BI=1), a negative-slide group (BI=0), and a negative-control-slide group (BI=0). Quality DNA was evidenced by the amplification of specific repetitive element present in M. leprae genomic DNA (RLEP) using a nested polymerase chain reaction. This is the first report comparing four different extraction methods for obtaining M. leprae DNA from ZNS slides in Cuban patients, and applied in molecular diagnosis. Good-quality DNA and positive amplification were detected in the high-codification-slide group with the four methods, while from the low-codification-slide group only the QIAGEN and phenol-chloroform methods obtained amplification of M. leprae. In the negative-slide group, only the QIAGEN method was able to obtain DNA with sufficient quality for positive amplification of the RLEP region. No amplification was observed in the negative-control-slide group by any method. Patients with ZNS negative slides can still transmit the infection, and molecular methods can help identify and treat them, interrupting the chain of transmission and preventing the onset of disabilities. The ZNS slides can be sent easily to reference laboratories for later molecular analysis that can be useful not only to improve the diagnosis, but also for the application of other molecular techniques. Copyright © 2015 Asian-African Society for Mycobacteriology. Published by Elsevier Ltd. All rights reserved.

  14. Effects of extracted soy isoflavones alone on blood total and LDL cholesterol: Meta-analysis of randomized controlled trials

    Directory of Open Access Journals (Sweden)

    Kyoko Taku

    2008-07-01

    Full Text Available Kyoko Taku1, Keizo Umegaki1, Yoshiko Ishimi2, Shaw Watanabe31Information Center, National Institute of Health and Nutrition, Tokyo, Japan; 2Nutritional Epidemiology Program, National Institute of Health and Nutrition, Tokyo, Japan; 3Nutritional Education Program, National Institute of Health and Nutrition, Tokyo, JapanAbstract: When provided concurrently with soy protein for 1–3 months, soy isoflavones exert synergistic or additive cholesterol-lowering effects. This meta-analysis was performed to evaluate the effects of extracted soy isoflavones alone (not ingested concurrently with soy protein on total and low density lipoprotein (LDL cholesterol. MEDLINE (1966–2007, EMBASE (1966–2007, CENTRAL (1966–2007, ICHUSHI (1983–2008, and CNKI (1979–2007 were searched for randomized placebo-controlled trials published in English, Japanese, and Chinese, describing the changes in lipid profiles in adult humans resulting from ingestion of extracted soy isoflavones for 1–3 months. Reference lists of relevant systematic reviews and meta-analyses were hand-searched. Meta-analysis of 10 and 9 trials with usable information using REVMAN found that an average of 70 mg soy isoflavones/day (27–132 mg, as the aglycone form alone had a nonsignificant effect on total (0.01 mmol/L [95% CI: –0.12, 0.14]; P = 0.86 and LDL (0.03 mmol/L [95% CI: –0.11, 0.16]; P = 0.71 cholesterol in menopausal women, respectively. It is concluded that ingestion of about 70 mg extracted soy isoflavones/day alone for 1–3 months does not improve total and LDL cholesterol levels in normocholesterolemic menopausal women; further studies are needed to verify the effects of extracted soy isoflavones.Keywords: extracted soy isoflavones, lipid, total cholesterol, LDL cholesterol

  15. A simple method for normalization of DNA extraction to improve the quantitative detection of soil-borne plant pathogenic oomycetes by real-time PCR.

    Science.gov (United States)

    Li, M; Ishiguro, Y; Kageyama, K; Zhu, Z

    2015-08-01

    Most of the current research into the quantification of soil-borne pathogenic oomycetes lacks determination of DNA extraction efficiency, probably leading to an incorrect estimation of DNA quantity. In this study, we developed a convenient method by using a 100 bp artificially synthesized DNA sequence derived from the mitochondrion NADH dehydrogenase subunit 2 gene of Thunnus thynnus as a control to determine the DNA extraction efficiency. The control DNA was added to soils and then co-extracted along with soil genomic DNA. DNA extraction efficiency was determined by the control DNA. Two different DNA extraction methods were compared and evaluated using different types of soils, and the commercial kit was proved to give more consistent results. We used the control DNA combined with real-time PCR to quantify the oomycete DNAs from 12 naturally infested soils. Detectable target DNA concentrations were three to five times higher after normalization. Our tests also showed that the extraction efficiencies varied on a sample-to-sample basis and were simple and useful for the accurate quantification of soil-borne pathogenic oomycetes. Oomycetes include many important plant pathogens. Accurate quantification of these pathogens is essential in the management of diseases. This study reports an easy method utilizing an external DNA control for the normalization of DNA extraction by real-time PCR. By combining two different efficient soil DNA extraction methods, the developed quantification method dramatically improved the results. This study also proves that the developed normalization method is necessary and useful for the accurate quantification of soil-borne plant pathogenic oomycetes. © 2015 The Society for Applied Microbiology.

  16. The impact of different DNA extraction kits and laboratories upon the assessment of human gut microbiota composition by 16S rRNA gene sequencing.

    Science.gov (United States)

    Kennedy, Nicholas A; Walker, Alan W; Berry, Susan H; Duncan, Sylvia H; Farquarson, Freda M; Louis, Petra; Thomson, John M; Satsangi, Jack; Flint, Harry J; Parkhill, Julian; Lees, Charlie W; Hold, Georgina L

    2014-01-01

    Determining bacterial community structure in fecal samples through DNA sequencing is an important facet of intestinal health research. The impact of different commercially available DNA extraction kits upon bacterial community structures has received relatively little attention. The aim of this study was to analyze bacterial communities in volunteer and inflammatory bowel disease (IBD) patient fecal samples extracted using widely used DNA extraction kits in established gastrointestinal research laboratories. Fecal samples from two healthy volunteers (H3 and H4) and two relapsing IBD patients (I1 and I2) were investigated. DNA extraction was undertaken using MoBio Powersoil and MP Biomedicals FastDNA SPIN Kit for Soil DNA extraction kits. PCR amplification for pyrosequencing of bacterial 16S rRNA genes was performed in both laboratories on all samples. Hierarchical clustering of sequencing data was done using the Yue and Clayton similarity coefficient. DNA extracted using the FastDNA kit and the MoBio kit gave median DNA concentrations of 475 (interquartile range 228-561) and 22 (IQR 9-36) ng/µL respectively (p<0.0001). Hierarchical clustering of sequence data by Yue and Clayton coefficient revealed four clusters. Samples from individuals H3 and I2 clustered by patient; however, samples from patient I1 extracted with the MoBio kit clustered with samples from patient H4 rather than the other I1 samples. Linear modelling on relative abundance of common bacterial families revealed significant differences between kits; samples extracted with MoBio Powersoil showed significantly increased Bacteroidaceae, Ruminococcaceae and Porphyromonadaceae, and lower Enterobacteriaceae, Lachnospiraceae, Clostridiaceae, and Erysipelotrichaceae (p<0.05). This study demonstrates significant differences in DNA yield and bacterial DNA composition when comparing DNA extracted from the same fecal sample with different extraction kits. This highlights the importance of ensuring that samples

  17. Statistically extracted fundamental watershed variables for estimating the loads of total nitrogen in small streams

    Science.gov (United States)

    Kronholm, Scott C.; Capel, Paul D.; Terziotti, Silvia

    2016-01-01

    Accurate estimation of total nitrogen loads is essential for evaluating conditions in the aquatic environment. Extrapolation of estimates beyond measured streams will greatly expand our understanding of total nitrogen loading to streams. Recursive partitioning and random forest regression were used to assess 85 geospatial, environmental, and watershed variables across 636 small (monitoring may be beneficial.

  18. Determination of Total Phenolics, Flavonoids and Antioxidant Capacity of Methanolic Extracts of Some Brassica Seeds

    Directory of Open Access Journals (Sweden)

    Maria Doiniţa Borş

    2014-11-01

    Full Text Available Cruciferous vegetables are rich in nutrients and bioactive compounds. Seeds are highly nutritious and they are becoming more and more popular in nowadays diets. In the present study various types of radish and mustard seeds were evaluated on the basis of the total phenolic content (TPC, total flavonoid content (TFC and the antioxidant potential, using simple spectrophotometric methods.

  19. Total lactic acid bacteria, antioxidant activity, and acceptance of synbiotic yoghurt with red ginger extract (Zingiberofficinale var. rubrum)

    Science.gov (United States)

    Larasati, B. A.; Panunggal, B.; Afifah, D. N.; Anjani, G.; Rustanti, N.

    2018-02-01

    Antioxidant related to oxidative stress can caused the metabolic disorders. A functional food that high in antioxidant can be use as the alternative prevention. The addition of red ginger extract in yoghurt could form a functional food, that high in antioxidant, synbiotic and fiber. The influence of red ginger extract on yoghurt synbiotic against lactic acid bacteria, antioxidant activity and acceptance were analyzed. This was an experimental research with one factor complete randomized design, specifically the addition of red ginger extract 0%; 0,1%; 0,3% and 0,5% into synbiotic yoghurt. Total plate count method used to analyze the lactic acid bacteria, 1-1-diphenyl-2-picrylhydrazyl (DPPH) method for antioxidant activity, and acceptance analyzed with hedonic test. The higher the dose of extract added to synbiotic yoghurt, the antioxidant activity got significantly increased (ρ=0,0001), while the lactic acid bacteria got insignificantly decreased (ρ=0,085). The addition of 0,5% red ginger extract obtained the antioxidant activity of 71% and 4,86 × 1013 CFU/ml on lactic acid bacteria, which the requirement for probiotic on National Standard of Indonesia is >107 CFU/ml. The addition of extract had a significant effect on acceptance (ρ=0,0001) in flavor, color, and texture, but not aroma (ρ=0,266). The optimal product in this research was the yoghurt synbiotic with addition of 0,1% red ginger extract. To summarize, the addition of red ginger extract in synbiotic yoghurt had significant effect on antioxidant activity, flavor, color, and texture, but no significant effect on lactic acid bacteria and aroma.

  20. The Effects of Vitex agnus castus Total Extract on Spermatogenesis of Balb/C Mice

    Directory of Open Access Journals (Sweden)

    M Ramezani

    2008-12-01

    Full Text Available ABSTRACT Introduction & Objective: Vitex agnus castus (Verbenaceae is a phytoestrogeic herb native to the Middle East and southern Europe. It has clinical usage in so many countries. In this research, the effects of Vitex agnus castus extract was investigated on spermatogenesis of male Balb/C mice. Materials & Methods: This is an experimental study in which adult male mice were chosen and divided into 3 groups: control, vehicle, and experimental. Animals were daily injected (i.p. with 65, 165 265, 365, and 465 mg/kg of seed extract for ten consecutive days. Then the animals were weighed and eventually killed by cervical dislocation 2 weeks after the last injection. The caudal part of the right epididymis was used for sperm counting. After macroscopic investigation (weight, diameter and volume of testes tissues were fixed in Buin's fixative. Tissues were cut at 5 µm, stained with Hematoxylin and Eosin (H& E.Ccollected data was analyzed by the SPSS software by using one-way ANOVA. Results: No significant differences in body weight, volume, weight and diameter of testes was seen. Light microscopic studies showed a significant reduction in germinal epithelium in doses of 265 and 365 mg/kg and increased of interstitial tissue area in doses of 265, 365, and 465 mg/kg of extract. There was no significant difference in epithelium thickness and of the diameter of the epididymis. Germinal cells contained pyknotic nuclei and several holes that were found scattered in the tubules. Testis also showed a general disarrangement in various germinal elements of seminiferous tubules. Result of sperms count indicated a significant decreasing of spermatozoa in animals which received 265 and 365 mg/kg of extract. Conclusion: Vitex agnus castus contains essential oils, iridoid glycosides, flavonoids diterpenes, and essential fatty acids. The results suggest that its contraceptive effects is related to its flavonoids and essential fatty acids but further studies is

  1. Studies on total polyphenols and reducing power of aqueous extracts from selected lamiaceae species

    OpenAIRE

    Maria Cioroi; Daniela Dumitriu

    2010-01-01

    Certain phytochemicals in species are attracting increased attention because of a wide range of biological activities especially the possible cancer preventive properties. Polyphenols, the naturalantioxidants are present in plant extracts and they play a key role in antioxidative defence mechanisms in biological systems and they act as free radicals scavenging agents. Polyphenols might thereforeinhibit development of coronary heart disease and cancers. Basil, oregano and sage are highly fragr...

  2. Facile and rapid DNA extraction and purification from food matrices using IFAST (immiscible filtration assisted by surface tension).

    Science.gov (United States)

    Strotman, Lindsay N; Lin, Guangyun; Berry, Scott M; Johnson, Eric A; Beebe, David J

    2012-09-07

    Extraction and purification of DNA is a prerequisite to detection and analytical techniques. While DNA sample preparation methods have improved over the last few decades, current methods are still time consuming and labor intensive. Here we demonstrate a technology termed IFAST (Immiscible Filtration Assisted by Surface Tension), that relies on immiscible phase filtration to reduce the time and effort required to purify DNA. IFAST replaces the multiple wash and centrifugation steps required by traditional DNA sample preparation methods with a single step. To operate, DNA from lysed cells is bound to paramagnetic particles (PMPs) and drawn through an immiscible fluid phase barrier (i.e. oil) by an external handheld magnet. Purified DNA is then eluted from the PMPs. Here, detection of Clostridium botulinum type A (BoNT/A) in food matrices (milk, orange juice), a bioterrorism concern, was used as a model system to establish IFAST's utility in detection assays. Data validated that the DNA purified by IFAST was functional as a qPCR template to amplify the bont/A gene. The sensitivity limit of IFAST was comparable to the commercially available Invitrogen ChargeSwitch® method. Notably, pathogen detection via IFAST required only 8.5 μL of sample and was accomplished in five-fold less time. The simplicity, rapidity and portability of IFAST offer significant advantages when compared to existing DNA sample preparation methods.

  3. Assessment of age and greenness of herbarium specimens as predictors for successful extraction and amplification of DNA

    NARCIS (Netherlands)

    Erkens, R.H.J.; Cross, H.; Maas, J.W.; Hoenselaar, K.; Chatrou, L.W.

    2008-01-01

    Age and the greenness of leaves have been frequently used as indicators for selecting herbarium specimens for molecular studies. Although plant DNA extraction and amplification have been common lab procedures for the past 20 years, no studies specifically investigated the success of these

  4. Evaluation of Antioxidant and DNA Damage Protection Activity of the Hydroalcoholic Extract of Desmostachya bipinnata L. Stapf

    Directory of Open Access Journals (Sweden)

    Upendarrao Golla

    2014-01-01

    Full Text Available Desmostachya bipinnata Stapf (Poaceae/Gramineae is an official drug of ayurvedic pharmacopoeia. Various parts of this plant were used extensively in traditional and folklore medicine to cure various human ailments. The present study was aimed to evaluate the antioxidant and DNA damage protection activity of hydroalcoholic extract of Desmostachya bipinnata both in vitro and in vivo, to provide scientific basis for traditional usage of this plant. The extract showed significant antioxidant activity in a dose-dependent manner with an IC50 value of 264.18±3.47 μg/mL in H2O2 scavenging assay and prevented the oxidative damage to DNA in presence of DNA damaging agent (Fenton’s reagent at a concentration of 50 μg/mL. Also, the presence of extract protected yeast cells in a dose-dependent manner against DNA damaging agent (Hydroxyurea in spot assay. Moreover, the presence of extract exhibited significant antioxidant activity in vivo by protecting yeast cells against oxidative stressing agent (H2O2. Altogether, the results of current study revealed that Desmostachya bipinnata is a potential source of antioxidants and lends pharmacological credence to the ethnomedical use of this plant in traditional system of medicine, justifying its therapeutic application for free-radical-induced diseases.

  5. Protective effects of Opuntia ficus-indica extract on ram sperm quality, lipid peroxidation and DNA fragmentation during liquid storage.

    Science.gov (United States)

    Allai, Larbi; Druart, Xavier; Öztürk, Mehmet; BenMoula, Anass; Nasser, Boubker; El Amiri, Bouchra

    2016-12-01

    The present study aimed to assess the phenolic composition of the acetone extract from Opuntia ficus indica cladodes (ACTEX) and its effects on ram semen variables, lipid peroxidation and DNA fragmentation during liquid storage at 5°C for up to 72h in skim milk and Tris egg yolk extenders. Semen samples from five rams were pooled extended with Tris-egg yolk (TEY) or skim milk (SM) extenders containing ACTEX (0%, 1%, 2%, 4% and 8%) at a final concentration of 0.8×10 9 sperm/ml and stored for up to 72h at 5°C. The sperm variables were evaluated at different time periods (8, 24, 48 and 72h). Sperm total motility and viability were superior in TEY than in SM whereas the progressive motility, membrane integrity, abnormality and spontaneous lipid peroxidation were greater in SM compared to TEY (P<0.05). The results also indicated that the inclusion of 1% ACTEX in the SM or TEY extender increased the sperm motility, viability, membrane integrity, and decreased the abnormality, lipids peroxidation up to 72h in storage compared to control group. Similarly, even at 72h of storage, 1% ACTEX can efficiently decrease the negative effects of liquid storage on sperm DNA fragmentation (P<0.05). In conclusion, SM and TEY supplemented with 1% of ACTEX can improve the quality of ram semen. Further studies are required to identify the active components in ACTEX involved in its effect on ram sperm preservation. Copyright © 2016 Elsevier B.V. All rights reserved.

  6. Co-isolation of in vivo 32P-labeled specific transcripts and DNA without phenol extraction of nuclease digestion

    International Nuclear Information System (INIS)

    Hayes, S.; Hayes, C.; Brand, L.

    1981-01-01

    A method is described for isolation and quantitation of specific intact transcripts, for which a hybridization probe is available, from 32 P-labeled bacterial cells. The RNA is extracted in the absence of R Nase activity by incorporating an inert, physically removable R Nase inhibitor throughout the spheroplasting, cell lysis, and pronase digestion steps. [/sup 32/P]RNA is separated from [ 32 P]DNA, without recourse to phenol extraction of DNase treatment, on a Cs 2 SO/sub 4-/HCONH 2 step gradient in which the precipitated RNA forms a sharp band. Specific transcripts are purified from [ 32 P]RNA by physical separation of the transcript and hybridization probe using gel-exclusion chromatography. The gentleness of this technique enables the co-isolation of DNA and can facilitate the analysis of covalently joined RNA-DNA replication intermediates

  7. A device for extraction, manipulation and stretching of DNA from single human chromosomes

    DEFF Research Database (Denmark)

    Rasmussen, Kristian Hagsted; Marie, Rodolphe; Moresco, Jacob Lange

    2011-01-01

    by time-lapse imaging; pressure-driven flow was then used to shunt the chromosomal DNA package into a nanoslit. A long linear DNA strand (>1.3 Mbp) was seen to stretch out from the DNA package and along the length of the nanoslit. Delivery of DNA in its native metaphase chromosome package as well...

  8. A new protocol for extraction of C 0 t-1 DNA from rice | Yan | African ...

    African Journals Online (AJOL)

    C0t-1 DNA, enriched for repetitive DNA sequences, has been proved to be valuable in the studies of plant species differentiation and genome evolution. A new protocol to steadily obtain the aimed range of DNA fragments has been developed by shearing the genomic DNA with the digest system containing DNase ...

  9. Comparison of total and cold-extractable uranium in stream sediments of the southwestern Karoo supergroup, South Africa

    International Nuclear Information System (INIS)

    Jakob, W.R.O.; Smit, M.C.B.; Murphy, G.C.

    1979-01-01

    In order to evaluate the usefullness of cold-extractable uranium as a tool of uranium prospecting in stream sediments of the southwestern Karoo, South Africa, ten orientation studies were conducted near known mineralisation jointly by the Atomic Energy Board and the Geological Survey of South Africa. These indicate that the topography determines the nature of the dispersion. In areas of moderate to high relief the total uranium content of the stream sediment gives dispersion trains up to about 500 m from the mineralisation, and peak-to-background ratios of about 3. The use of cold-extractable uranium doubles the length of the dispersion, and peak-to-background ratios are greater than 10 and may be as high as 35. In areas of low relief, the total uranium content of the sediment gives low anomalies, with short dispersion downstream. Cold-extractable uranium gives anomalies 500-1 000 m from the mineralisation. This is interpreted to be due to the longer residence time of the clay minerals in the stream. In order to test the applicability of cold-extractable uranium on a regional scale, 720 samples were collected at a density of one sample per square kilometre. Statistical treatment of the data shows the U content of the stream sediments, to be log-normally distributed. For cold-extractable uranium, polymodal distributions, apparently representing background and anomalous samples, can be separated with a high rate of success, and meaningful threshold values can be assigned. This is not the case for the total uranium content of the stream sediments [af

  10. Use of Moringa oleifera Flower Pod Extract as Natural Preservative and Development of SCAR Marker for Its DNA Based Identification.

    Science.gov (United States)

    Gull, Iram; Javed, Attia; Aslam, Muhammad Shahbaz; Mushtaq, Roohi; Athar, Muhammad Amin

    2016-01-01

    The use of Moringa oleifera as natural food preservative has been evaluated in the present study. In addition, for quality assurance, the study has also been focused on the shelf life of product to authenticate the identification of plant by development of DNA based marker. Among the different extracts prepared from flower pods of Moringa oleifera, methanol and aqueous extract exhibited high antibacterial and antioxidant activity, respectively. The high phenolic contents (53.5 ± 0.169 mg GAE/g) and flavonoid contents (10.9 ± 0.094 mg QE/g) were also recorded in methanol and aqueous extract, respectively. Due to instability of bioactive compounds in aqueous extract, methanol extract is considered as potent natural preservative. The shelf life of methanol extract was observed for two months at 4°C under dark conditions. The developed SCAR primers (MOF217/317/MOR317) specifically amplified a fragment of 317 bp from DNA of Moringa oleifera samples collected from different regions of Punjab province of Pakistan. The methanol extract of Moringa oleifera flower pods has great potential to be used as natural preservative and nutraceutical in food industry.

  11. TOTAL AND HOT-WATER EXTRACTABLE CARBON RELATIONSHIP IN CHERNOZEM SOIL UNDER DIFFERENT CROPPING SYSTEMS AND LAND USE

    Directory of Open Access Journals (Sweden)

    Srdjan Šeremešić

    2013-12-01

    Full Text Available A study was conducted to determine the hot water extractable organic carbon (HWOC in 9 arable and 3 non arable soil samples on Haplic Chernozem. The hot water extractable carbon represents assimilative component of the total organic matter (OM that could contain readily available nutrients for plant growth. The obtained fraction of organic carbon (C makes up only a small percentage of the soil OM and directly reflects the changes in the rhizosphere. This labile fraction of the organic matter was separated by hot water extraction at 80°C. In our study the HWOC content in different samples ranged from 125 mg g-1 to 226 mg g-1. On the plots that are under native vegetation, higher values were determined (316 mg g-1 to 388 mg g-1. Whereas samples from arable soils were lower in HWOC. It was found that this extraction method can be successfully used to explain the dynamics of the soil OM. Soil samples with lower content of the total OM had lower HWOC content, indicating that the preservation of the OM depends on the renewal of its labile fractions.

  12. Total Phenolic, Flavonoid, Tomatine, and Tomatidine Contents and Antioxidant and Antimicrobial Activities of Extracts of Tomato Plant

    Science.gov (United States)

    Silva-Beltrán, Norma Patricia; Ruiz-Cruz, Saul; Cira-Chávez, Luis Alberto; Estrada-Alvarado, María Isabel; Ornelas-Paz, José de Jesús; López-Mata, Marco Antonio; Del-Toro-Sánchez, Carmen Lizette; Ayala-Zavala, J. Fernando; Márquez-Ríos, Enrique

    2015-01-01

    The purpose of this study was to evaluate the antioxidant and antimicrobial properties of extracts of different fractions of two tomato plant cultivars. The stems, roots, leaves, and whole-plant fractions were evaluated. Tomatine and tomatidine were identified by HPLC-DAD. The leaf extracts from the two varieties showed the highest flavonoids, chlorophyll, carotenoids, and total phenolics contents and the highest antioxidant activity determined by DPPH, ABTS, and ORAC. A positive correlation was observed between the antioxidant capacities of the extracts and the total phenolic, flavonoid, and chlorophyll contents. The Pitenza variety extracts inhibited the growth of pathogens such as E. coli O157:H7, Salmonella Typhimurium, Staphylococcus aureus, and Listeria ivanovii, yielding inhibition halos of 8.0 to 12.9 mm in diameter and MIC values of 12.5 to 3.125 mg/mL. These results suggest that tomato plant shows well potential as sources of various bioactive compounds, antioxidants, and antimicrobials. PMID:26609308

  13. Genotoxic Evaluation of Mikania laevigata Extract on DNA Damage Caused by Acute Coal Dust Exposure

    Energy Technology Data Exchange (ETDEWEB)

    Freitas, T.P.; Heuser, V.D.; Tavares, P.; Leffa, D.D.; da Silva, G.A.; Citadini-Zanette, V.; Romao, P.R.T.; Pinho, R.A.; Streck, E.L.; Andrade,V.M. [University of Extremo Catarinense, Criciuma, SC (Brazil)

    2009-06-15

    We report data on the possible antigenotoxic activity of Mikania laevigata extract (MLE) after acute intratracheal instillation of coal dust using the comet assay in peripheral blood, bone marrow, and liver cells and the micronucleus test in peripheral blood of Wistar rats. The animals were pretreated for 2 weeks with saline solution (groups 1 and 2) or MLE (100 mg/kg) (groups 3 and 4). On day 15, the animals were anesthetized with ketamine (80 mg/kg) and xylazine (20 mg/kg), and gross mineral coal dust (3 mg/0.3 mL saline) (groups 2 and 4) or saline solution (0.3 mL) (groups 1 and 3) was administered directly in the lung by intratracheal administration. Fifteen days after coal dust or saline instillation, the animals were sacrificed, and the femur, liver, and peripheral blood were removed. The results showed a general increase in the DNA damage values at 8 hours for all treatment groups, probably related to surgical procedures that had stressed the animals. Also, liver cells from rats treated with coal dust, pretreated or not with MLE, showed statistically higher comet assay values compared to the control group at 14 days after exposure. These results could be expected because the liver metabolizes a variety of organic compounds to more polar by-products. On the other hand, the micronucleus assay results did not show significant differences among groups. Therefore, our data do not support the antimutagenic activity of M. laevigata as a modulator of DNA damage after acute coal dust instillation.

  14. Effects of certain polyphenols and extracts on furans and acrylamide formation in model system, and total furans during storage.

    Science.gov (United States)

    Oral, Rasim Alper; Dogan, Mahmut; Sarioglu, Kemal

    2014-01-01

    Using a glucose-glycine and asparagine-fructose system as a Maillard reaction model, the effects of seven polyphenols and solid phase extracts of three plants on the formation of furans and acrylamide were investigated. The polyphenols and extracts were used in biscuit formulation and acrylamide formation was observed. They were used for the storage of the glycine-glucose model system at three different temperatures. The addition of some of the extracts and polyphenols significantly decreased furan formation to different extents. All phenolic compounds and plant extracts decreased in the range of 30.8-85% in the model system except for oleuropein, and all of them decreased in the range of 10.3-19.2% in biscuit. Total furan formation was inhibited by caffeic acid, punicalagin, epicatechin, ECE and PPE during storage. This study evaluated and found the inhibitory effect on the formation of furans and acrylamide in Maillard reactions by the use of some plant extracts and polyphenols. Copyright © 2013 Elsevier Ltd. All rights reserved.

  15. Application of thiopropyl sepharose 6B for removal of PCR inhibitors from DNA extracts of a thigh bone recovered from the sea

    DEFF Research Database (Denmark)

    Sørensen, Erik; Hansen, Steen Holger; Eriksen, Birthe

    2003-01-01

    for the removal of PCR inhibitors in DNA extracts originating from stains on clothing. Here we show that TS is efficient also for the removal of inhibitors from PCR extracts from a highly decomposed human thigh bone. TS treatment, however, leads to a substantial loss of DNA making the technique best suited when...

  16. Comparison of Methods of Extracting Salmonella enterica Serovar Enteritidis DNA from Environmental Substrates and Quantification of Organisms by Using a General Internal Procedural Control

    NARCIS (Netherlands)

    Klerks, M.M.; Bruggen, van A.H.C.; Zijlstra, C.; Donnikov, M.; Vos, de R.

    2006-01-01

    This paper compares five commercially available DNA extraction methods with respect to DNA extraction efficiency of Salmonella enterica serovar Enteritidis from soil, manure, and compost and uses an Escherichia coli strain harboring a plasmid expressing green fluorescent protein as a general

  17. 16S rRNA Gene Sequence Analysis of Drinking Water Using RNA and DNA Extracts as Targets for Clone Library Development

    Science.gov (United States)

    The bacterial composition of chlorinated drinking water was analyzed using 16S rRNA gene clone libraries derived from DNA extracts of 12 samples and compared to clone libraries previously generated using RNA extracts from the same samples. Phylogenetic analysis of 761 DNA-based ...

  18. The currently used commercial DNA-extraction methods give different results of clostridial and actinobacterial populations derived from human fecal samples.

    Science.gov (United States)

    Maukonen, Johanna; Simões, Catarina; Saarela, Maria

    2012-03-01

    Recently several human health-related microbiota studies have had partly contradictory results. As some differences may be explained by methodologies applied, we evaluated how different storage conditions and commonly used DNA-extraction kits affect bacterial composition, diversity, and numbers of human fecal microbiota. According to our results, the DNA-extraction did not affect the diversity, composition, or quantity of Bacteroides spp., whereas after a week's storage at -20 °C, the numbers of Bacteroides spp. were 1.6-2.5 log units lower (P Eubacterium rectale (Erec)-group, Clostridium leptum group, bifidobacteria, and Atopobium group were 0.5-4 log units higher (P < 0.05) after mechanical DNA-extraction as detected with qPCR, regardless of storage. Furthermore, the bacterial composition of Erec-group differed significantly after different DNA-extractions; after enzymatic DNA-extraction, the most prevalent genera detected were Roseburia (39% of clones) and Coprococcus (10%), whereas after mechanical DNA-extraction, the most prevalent genera were Blautia (30%), Coprococcus (13%), and Dorea (10%). According to our results, rigorous mechanical lysis enables detection of higher bacterial numbers and diversity from human fecal samples. As it was shown that the results of clostridial and actinobacterial populations are highly dependent on the DNA-extraction methods applied, the use of different DNA-extraction protocols may explain the contradictory results previously obtained. © 2011 Federation of European Microbiological Societies. Published by Blackwell Publishing Ltd. All rights reserved.

  19. Structural Features and Potent Antidepressant Effects of Total Sterols and β-sitosterol Extracted from Sargassum horneri

    Directory of Open Access Journals (Sweden)

    Donghai Zhao

    2016-06-01

    Full Text Available The purified total sterols and β-sitosterol extracted from Sargassum horneri were evaluated for their antidepressant-like activity using the forced swim test (FST and tail suspension test (TST in mice. Total sterols and β-sitosterol significantly reduced the immobility time in the FST and TST. Total sterols were administered orally for 7 days at doses of 50, 100, and 200 mg/kg, and β-sitosterol was administered intraperitoneally at doses of 10, 20, and 30 mg/kg. β-sitosterol had no effect on locomotor activity in the open field test. In addition, total sterols and β-sitosterol significantly increased NE, 5-HT, and the metabolite 5-HIAA in the mouse brain, suggesting that the antidepressant-like activity may be mediated through these neurotransmitters.

  20. Determination of total phenolic content and antioxidant activitity of methanol extract of Maranta arundinacea L fresh leaf and tuber

    Science.gov (United States)

    Kusbandari, A.; Susanti, H.

    2017-11-01

    Maranta arundinacea L is one of herbaceous plants in Indonesia which have flavonoid content. Flavonoids has antioxidants activity by inhibition of free radical oxidation reactions. The study aims were to determination total phenolic content and antioxidant activity of methanol extract of fresh leaf and tuber of M. arundinacea L by UV-Vis spectrophotometer. The methanol extracts were obtained with maceration and remaseration method of fresh leaves and tubers. The total phenolic content was assayed with visible spectrophotometric using Folin Ciocalteau reagent. The antioxidant activity was assayed with 1,1-diphenyl-2-picrilhidrazil (DPPH) compared to gallic acid. The results showed that methanol extract of tuber and fresh leaf of M. arundinacea L contained phenolic compound with total phenolic content (TPC) in fresh tuber of 3.881±0.064 (% GAE) and fresh leaf is 6.518±0.163 (% b/b GAE). IC50 value from fresh tuber is 1.780±0.0005 μg/mL and IC50 fresh leaf values of 0.274±0.0004 μg/mL while the standard gallic acid is IC50 of 0.640±0.0002 μg/mL.

  1. Distribution of Plasmodium species on the island of Grande Comore on the basis of DNA extracted from rapid diagnostic tests

    Directory of Open Access Journals (Sweden)

    Papa Mze Nasserdine

    2016-01-01

    Full Text Available In the Union of Comoros, interventions for combating malaria have contributed to a spectacular decrease in the prevalence of the disease. We studied the current distribution of Plasmodium species on the island of Grande Comore using nested PCR. The rapid diagnostic tests (RDTs currently used in the Comoros are able to identify Plasmodium falciparum but no other Plasmodium species. In this study, we tested 211 RDTs (158 positive and 53 negative. Among the 158 positive RDTs, 22 were positive for HRP2, 3 were positive only for pLDH, and 133 were positive for HRP2 and pLDH. DNA was extracted from a proximal part of the nitrocellulose membrane of RDTs. A total of 159 samples were positive by nested PCR. Of those, 156 (98.11% were positive for P. falciparum, 2 (1.25% were positive for P. vivaxI, and 1 (0.62% was positive for P. malariae. None of the samples were positive for P. ovale. Our results show that P. falciparum is still the most dominant species on the island of Grande Comore, but P. vivax and P. malariae are present at a low prevalence.

  2. New optimized DNA extraction protocol for fingerprints deposited on a special self-adhesive security seal and other latent samples used for human identification.

    Science.gov (United States)

    Kopka, Julieta; Leder, Monika; Jaureguiberry, Stella M; Brem, Gottfried; Boselli, Gabriel O

    2011-09-01

    Obtaining complete short tandem repeat (STR) profiles from fingerprints containing minimal amounts of DNA, using standard extraction techniques, can be difficult. The aim of this study was to evaluate a new kit, Fingerprint DNA Finder (FDF Kit), recently launched for the extraction of DNA and STR profiling from fingerprints placed on a special device known as Self-Adhesive Security Seal Sticker(®) and other latent fingerprints on forensic evidentiary material like metallic guns. The DNA extraction system is based on a reversal of the silica principle, and all the potential inhibiting substances are retained on the surface of a special adsorbent, while nucleic acids are not bound and remain in solution dramatically improving DNA recovery. DNA yield was quite variable among the samples tested, rendering in most of the cases (>90%) complete STR profiles, free of PCR inhibitors, and devoid of artifacts. Even samples with DNA amount below 100 pg could be successfully analyzed. © 2011 American Academy of Forensic Sciences.

  3. Aloe vera extract reduces 8-oxo-2'-deoxyguanosine levels and improves total antioxidants in streptozotocin-induced diabetic rats

    Directory of Open Access Journals (Sweden)

    Wulan Christijanti

    2017-04-01

    Full Text Available Background Diabetes mellitus is a chronic disease caused by lack of insulin production in the pancreas or by insulin resistance, the disease being characterized by elevated blood glucose levels. Hyperglycemia in diabetes could lead to oxidative stress due to the rise in 8-oxo-2'-deoxyguanosine (8-oxo-dG levels and the decrease in levels of total antioxidant status (TAS. The purpose of this study was to assess the effect Aloe vera extract on 8-oxo-dG level and total antioxidant status in diabetic rat testis.   Methods This was an experimental laboratory study with 20 rat samples which were divided into 4 groups (1 control group and 3 treatment groups. Diabetes was induced in the rats by streptozotocin (STZ at 65 mg/kgBW. The diabetic rats were then treated for 28 days with Aloe vera extract at 0 mg (P0, 200 mg rind (P1, 200 mg pulp (P2, respectively. The level of 8 -oxo-dG was measured by ELISA and total antioxidant status with 2,2' -azino-bis (3-ethylbenzothiazoline-6-sulfonic acid (ABTS. Data were analyzed with ANOVA and Least Significant Difference Advanced Test at P<0.05.   Results 8-Oxo-dG levels were significantly different between the control group and both P0 and P2, but not between the control group and P1. Among the treatment groups the 8-oxo-dG levels were significantly different. Mean total antioxidant status was significantly different between control and treatment groups, and also between treatment groups (p<0.05.   Conclusions Aloe vera extract reduced free radicals (level of 8-oxo-dG and increased the total antioxidant status in diabetic rat testis.

  4. A simple and cost-effective method of DNA extraction from small formalin-fixed paraffin-embedded tissue for molecular oncologic testing.

    Science.gov (United States)

    Snow, Anthony N; Stence, Aaron A; Pruessner, Jonathan A; Bossler, Aaron D; Ma, Deqin

    2014-01-01

    Extraction of DNA from formalin-fixed, paraffin-embedded (FFPE) tissue is a critical step in molecular oncologic testing. As molecular oncology testing becomes more important for prognostic and therapeutic decision making and tissue specimens become smaller due to earlier detection of suspicious lesions and the use of fine needle aspiration methods for tissue collection, it becomes more challenging for the typical molecular pathology laboratory to obtain reliable test results. We developed a DNA extraction method to obtain sufficient quantity and high quality genomic DNA from limited FFPE tissue for molecular oncology testing using a combination of H&E stained slides, a matrix capture method and the Qiagen DNA column. THREE DNA EXTRACTION METHODS WERE COMPARED: our standard procedure of manually scraping tissue from unstained slides followed by DNA extraction using the QIAamp FFPE column (Qiagen, Valencia, CA), a glue capture method (Pinpoint Solution, Zymo Research Corp, Inc) on H&E stained slides followed by DNA extraction using either the QIAamp column or the column included with the Pinpoint kit (Zymo Research). The DNA extraction protocol was optimized. Statistical analysis was performed using the paired two-sample student's t-test. The combination of the matrix capture method with the QIAamp column gave an equivalent amount of DNA as our standard extraction method using the unstained slides and a 4.6-fold higher DNA yield than using the Zymo column included in the Pinpoint Slide Solution kit. Several molecular tests were performed and DNA purified using the new method gave the same results as for the previous methods. Using H&E stained slides allows visual confirmation of tumor cells during microdissection. The Pinpoint solution made removal of specific tissue from the slides easier and reduced the risk of contamination and tissue loss. This DNA extraction method is simple, cost-effective, and blends with our current workflow requiring no additional equipment.

  5. Determination of As concentration in earthworm coelomic fluid extracts by total-reflection X-ray fluorescence spectrometry

    Science.gov (United States)

    Allegretta, Ignazio; Porfido, Carlo; Panzarino, Onofrio; Fontanella, Maria Chiara; Beone, Gian Maria; Spagnuolo, Matteo; Terzano, Roberto

    2017-04-01

    Earthworms are often used as sentinel organisms to study As bioavailability in polluted soils. Arsenic in earthworms is mainly sequestrated in the coelomic fluids whose As content can therefore be used to asses As bioavalability. In this work, a method for determining As concentration in coelomic fluid extracts using total-reflection X-ray fluorescence spectrometry (TXRF) is presented. For this purpose coelomic fluid extracts from earthworms living in three polluted soils and one non-polluted (control) soil have been collected and analysed. A very simple sample preparation was implemented, consisting of a dilution of the extracts with polyvinyl alcohol (PVA) using a 1:8 ratio and dropwise deposition of the sample on the reflector. A detection limit of 0.2 μg/l and quantification limit of 0.6 μg/l was obtained in the diluted samples, corresponding to 2 μg/l and 6 μg/l in the coelomic fluid extracts, respectively. This allowed to quantify As concentration in coelomic fluids extracted from earthworms living in soils polluted with As at concentrations higher than 20 mg/kg (considered as a pollution threshold for agricultural soils). The TXRF method has been validated by comparison with As concentrations in standards and by analysing the same samples by ICP-MS, after acid digestion of the sample. The low limit of detection, the proven reliability of the method and the little sample preparation make TXRF a suitable, cost-efficient and "green" technique for the analysis of As in earthworm coelomic fluid extracts for bioavailability studies.

  6. Evaluation of total phenols, total flavonoids and antioxidant activity of the leaves crude extracts of locally grown pigeon pea traditionally used in Sultanate of Oman for the treatment of jaundice and diabetes

    Directory of Open Access Journals (Sweden)

    Asma Hamood Al-Saeedi

    2015-04-01

    Full Text Available Objective: To determine the total phenols, total flavonoids and evaluate the antioxidant activity of crude extracts from the leaves of pigeon pea native to Sultanate of Oman by a popular method. Methods: The powdered leaves samples from pigeon pea were used for extraction by maceration method with methanol solvent. The methanol free crude extract by maceration method was suspended in water and successively extracted with different polarities of solvents. The obtained crude extracts with different polarities were used for the determination of total phenols and flavonoids contents by using Folin-Ciocalteu reagent and aluminum chloride methods. The antioxidant activity of six crude extracts from pigeon pea was determined by α, α-diphenyl-β-picrylhydrazyl method. Results: The different polarities leaves crude extracts showed a significant amount of total phenols content ranging from 97.80 to 256.00 mg of GAE/g of crude extract. The same leaves crude extracts also showed good amount of total flavonoids content ranging from 1.38 to 8.51 mg QE/g plant material. The six crude extracts from the leaves displayed significant α, α- diphenyl-β-picrylhydrazyl free radical scavenging activity with highest value in chloroform extract followed by methanol, butanol, ethyl acetate, hexane and water crude extracts (98.13%, 89.26%, 88.82%, 86.41%, 79.95% and 69.44%, respectively. Conclusions: Leaves crude extracts from pigeon pea have high contents of total phenols and flavonoids. In this regards, it could be used as a medicine for the treatment of different diseases.

  7. Comparison of inductively coupled plasma mass spectrometry and colorimetric determination of total and extractable phosphorus in soils

    International Nuclear Information System (INIS)

    Ivanov, Krasimir; Zaprjanova, Penka; Petkova, Milena; Stefanova, Violeta; Kmetov, Veselin; Georgieva, Deyana; Angelova, Violina

    2012-01-01

    The most widely used method for determination of total phosphorus in soils is perchloric acid digestion, followed by a colorimetric assay to measure the concentration of P in solution. The first part of this study compares an alternative digestion method, using aqua regia (ISO 11466 and EPA Method 3052), with perchloric acid digestion procedure, and also compares inductively coupled plasma mass spectroscopy (ICP-MS) with colorimetry for the measurement of P on the basis of five internationally certified standard soils and 20 real-life soils with widely different extractability of phosphorus. The phosphorus concentration was determined by means of the reduced phosphomolybdenum blue and ICP-MS. The relationship between methods has been examined statistically. Good agreement of the results from colorimetry and ICP-MS was established for all certified soils. The microwave-assisted digestion with aqua regia was comparable, both in precision and accuracy, with the hot plate aqua regia method. The phosphorus concentration found with the HF + HClO 4 digestion method was in good agreement with the certified mean values, while the superiority in extracting phosphorus, when compared to other methods, was obvious. Soil testing for plant-available phosphorus in Bulgaria and many European countries is most commonly conducted using acid Ca-lactate extraction (Egner–Riehm test) and alkaline sodium bicarbonate extraction (BDS ISO 11263:2002), based on Olsen test, followed by a colorimetric assay to measure the concentration of P in solution. The second part of this study reports the differences between Egner–Riehm test and BDS ISO 11263:2002 measured colorimetrically and by ICP-MS. Fifty soils were selected from South Bulgaria to represent a wide range of soil properties. It was established that ICP-MS consistently yielded significantly higher P concentrations than the colorimetric method in both extraction tests, and the relative differences were greatest in soils with lower P

  8. Comparison of inductively coupled plasma mass spectrometry and colorimetric determination of total and extractable phosphorus in soils

    Energy Technology Data Exchange (ETDEWEB)

    Ivanov, Krasimir, E-mail: kivanov1@abv.bg [Department of Chemistry, University of Agriculture, Plovdiv (Bulgaria); Zaprjanova, Penka [Tobacco and Tobacco Products Institute, Plovdiv (Bulgaria); Petkova, Milena [Department of Chemistry, University of Agriculture, Plovdiv (Bulgaria); Stefanova, Violeta; Kmetov, Veselin; Georgieva, Deyana [Department of Analytical Chemistry, Plovdiv University ' Paisii Hilendarski,' Plovdiv (Bulgaria); Angelova, Violina [Department of Chemistry, University of Agriculture, Plovdiv (Bulgaria)

    2012-05-15

    The most widely used method for determination of total phosphorus in soils is perchloric acid digestion, followed by a colorimetric assay to measure the concentration of P in solution. The first part of this study compares an alternative digestion method, using aqua regia (ISO 11466 and EPA Method 3052), with perchloric acid digestion procedure, and also compares inductively coupled plasma mass spectroscopy (ICP-MS) with colorimetry for the measurement of P on the basis of five internationally certified standard soils and 20 real-life soils with widely different extractability of phosphorus. The phosphorus concentration was determined by means of the reduced phosphomolybdenum blue and ICP-MS. The relationship between methods has been examined statistically. Good agreement of the results from colorimetry and ICP-MS was established for all certified soils. The microwave-assisted digestion with aqua regia was comparable, both in precision and accuracy, with the hot plate aqua regia method. The phosphorus concentration found with the HF + HClO{sub 4} digestion method was in good agreement with the certified mean values, while the superiority in extracting phosphorus, when compared to other methods, was obvious. Soil testing for plant-available phosphorus in Bulgaria and many European countries is most commonly conducted using acid Ca-lactate extraction (Egner-Riehm test) and alkaline sodium bicarbonate extraction (BDS ISO 11263:2002), based on Olsen test, followed by a colorimetric assay to measure the concentration of P in solution. The second part of this study reports the differences between Egner-Riehm test and BDS ISO 11263:2002 measured colorimetrically and by ICP-MS. Fifty soils were selected from South Bulgaria to represent a wide range of soil properties. It was established that ICP-MS consistently yielded significantly higher P concentrations than the colorimetric method in both extraction tests, and the relative differences were greatest in soils with lower

  9. Transcriptional effect of an Aframomum angustifolium seed extract on human cutaneous cells using low-density DNA chips.

    Science.gov (United States)

    Bonnet-Duquennoy, Mathilde; Dumas, Marc; Debacker, Adeline; Lazou, Kristell; Talbourdet, Sylvie; Franchi, Jocelyne; Heusèle, Catherine; André, Patrice; Schnebert, Sylvianne; Bonté, Frédéric; Kurfürst, Robin

    2007-06-01

    Studying photoexposed and photoprotected skin biopsies from young and aged women, it has been found that a specific zone, composed of the basal layers of the epidermis, the dermal epidermal junction, and the superficial dermis, is major target of aging and reactive oxygen species. We showed that this zone is characterized by significant variations at a transcriptional and/or protein levels. Using low-density DNA chip technology, we evaluated the effect of a natural mixture of Aframomum angustifolium seed extract containing labdane diterpenoids on these aging markers. Expression profiles of normal human fibroblasts (NHF) were studied using a customized cDNA macroarray system containing genes covering dermal structure, inflammatory responses, and oxidative stress defense mechanisms. For normal human keratinocyte (NHK) investigations, we chose OLISA technique, a sensitive and quantitative method developed by BioMérieux specifically designed to investigate cell death, proliferation, epidermal structure, differentiation, and oxidative stress defense response. We observed that this extract strongly modified gene expression profiles of treated NHK, but weakly for NHF. This extract regulated antioxidant defenses, dermal-epidermal junction components, and epidermal renewal-related genes. Using low-density DNA chip technology, we identified new potential actions of A. angustifolium seed extract on skin aging.

  10. Protective effects of aqueous and ethanolic extracts of Portulaca oleracea L. aerial parts on H2O2-induced DNA damage in lymphocytes by comet assay.

    Science.gov (United States)

    Behravan, Javad; Mosafa, Fatemeh; Soudmand, Negar; Taghiabadi, Elahe; Razavi, Bibi Marjan; Karimi, Gholamreza

    2011-09-01

    The comet assay is a standard method for measuring DNA damage. In this study, the protective effects of ethanolic and aqueous extracts of Portulaca oleracea L. (P. oleracea) on human lymphocyte DNA lesions were evaluated with the comet assay. Lymphocytes were isolated from blood samples taken from healthy volunteers. Human lymphocytes were incubated in H(2)O(2) (50,100, and 200 μM), aqueous extract (0.05, 0.1, 0.5, 1, and 2.5mg/ml), and ethanolic extracts (0.05, 0.1, 0.5, 1, and 2.5mg/ml) of P. oleraceae aerial parts alone with a combination of H(2)O(2) (100 μM) with either 1 or 2.5mg/ml of both extracts at 4°C for 30 minutes. The extent of DNA migration was measured using the alkaline single cell gel electrophoresis approach assay, and DNA damage was expressed as percentage tail DNA. We found that the aqueous extract of P. oleracea significantly inhibited DNA damage, while there was no effect of the ethanolic extract. These data suggest that the aqueous extract of P. oleracea can prevent oxidative DNA damage to human lymphocytes, which is likely due to antioxidant constituents in the extract. Copyright © 2011. Published by Elsevier B.V.

  11. Radioprotection against DNA damage by an extract of Indian green mussel, Perna viridis (L.)

    Digital Repository Service at National Institute of Oceanography (India)

    Kumaran, S.P.; Kutty, B.C.; Chatterji, A.; Parameswaran, P.S.; Mishra, K.P.

    -irradiation Prevention of DNA damage both in plasmid and lymphocytes and cell death in lymphocytes appears correlated with reduction of oxidatively generated free radicals It is concluded that protection against radiation-induced cell death and DNA damage by MH...

  12. Myricitrin and bioactive extract of Albizia amara leaves: DNA protection and modulation of fertility and antioxidant-related genes expression.

    Science.gov (United States)

    Kassem, Mona El Said; Ibrahim, Lamya Fawzy; Hussein, Sameh Reda; El-Sharawy, Reha