Expressions of Matrix Metalloproteinases (MMP-2, MMP-7, and MMP-9 and Their Inhibitors (TIMP-1, TIMP-2 in Inflammatory Bowel Diseases

Directory of Open Access Journals (Sweden)

Katarzyna Jakubowska

2016-01-01

Full Text Available Crohn’s disease (CD and ulcerative colitis (UC belong to a group of inflammatory bowel diseases (IBD. The aim of our study was to evaluate the expression of MMP-2, MMP-7, MMP-9, TIMP-1, and TIMP-2 in ulcerative colitis and Crohn’s disease. The study group comprised 34 patients with UC and 10 patients with CD. Evaluation of MMP-2, MMP-7, MMP-9, TIMP-1, and TIMP-2 expression in tissue samples was performed using immunohistochemistry. The overexpression of MMP-9 and TIMP-1 was dominant in both the glandular epithelium and inflammatory infiltration in UC patients. In contrast, in CD subjects the positive expression of MMP-2 and TIMP-1 was in glandular tubes while mainly MMP-7 and TIMP-2 expression was in inflammatory infiltration. Metalloproteinases’ expression was associated with the presence of erosions, architectural tissue changes, and inflammatory infiltration in the lamina propria of UC patients. The expression of metalloproteinase inhibitors correlated with the presence of eosinophils and neutrophils in UC and granulomas in CD patients. Our studies indicate that the overexpression of metalloproteinases and weaker expression of their inhibitors may determine the development of IBD. It appears that MMP-2, MMP-7, and MMP-9 may be a potential therapeutic target and the use of their inhibitors may significantly reduce UC progression.

Norrie disease gene is distinct from the monoamine oxidase genes

OpenAIRE

Sims, Katherine B.; Ozelius, Laurie; Corey, Timothy; Rinehart, William B.; Liberfarb, Ruth; Haines, Jonathan; Chen, Wei Jane; Norio, Reijo; Sankila, Eeva; de la Chapelle, Albert; Murphy, Dennis L.; Gusella, James; Breakefield, Xandra O.

1989-01-01

The genes for MAO-A and MAO-B appear to be very close to the Norrie disease gene, on the basis of loss and /or disruption of the MAO genes and activities in atypical Norrie disease patients deleted for the DXS7 locus; linkage among the MAO genes, the Norrie disease gene, and the DXS7 locus; and mapping of all these loci to the chromosomal region Xp11. The present study provides evidence that the MAO genes are not disrupted in “classic” Norrie disease patients. Genomic DNA from these “nondelet...

TIMP-1 expression in human colorectal cancer is associated with TGF-B1, LOXL2, INHBA1, TNF-AIP6 and TIMP-2 transcript profiles

DEFF Research Database (Denmark)

Offenberg, Hanne Kjær; Brunner, Nils; Mansilla, Francisco

2008-01-01

colorectal cancer (CRC) and the other TIMPs 2-4, which have also been associated with the progression of colorectal cancer. Genome-wide expression profiling of 172 CRC and normal mucosa samples was used to identify transcript changes for the genes under investigation. We found that TIMP-1 was up...... with the synthesis of extracellullar matrix, genes involved in the TGF-beta signalling pathway, and genes that are likely transcribed by the tumour cells. These insights add to the complex picture emerging about the regulation of TIMPs in colorectal cancer....... that colorectal cancer patients have increased plasma levels of the tissue inhibitor of metalloproteinases-1 (TIMP-1), and that high plasma TIMP-1 levels are associated with short colorectal cancer patient survival. However, although TIMP-1 has been extensively studied in cancer, very little is known about how...

Recombinational event between Norrie disease and DXS7 loci.

Science.gov (United States)

Ngo, J T; Spence, M A; Cortessis, V; Sparkes, R S; Bateman, J B

1988-07-01

We have identified a family affected with X-linked recessive Norrie disease, in which a recombinational event occurred between the disease locus and the DXS7 locus identified by the probe L1.28. The addition of our family brings the total of published informative families to seven, with a maximum lod score of 7.58 at a recombination frequency of 0.038 +/- 0.036. This finding indicates that the L1.28 probe is useful but may not be completely reliable for prenatal diagnosis and that the gene for Norrie disease is not within the DNA sequence identified by the L1.28 probe.

Immunohistochemical analysis of MMP-9, MMP-2 and TIMP-1, TIMP-2 expression in the central nervous system following infection with viral and bacterial meningitis.

Directory of Open Access Journals (Sweden)

Lech Chyczewski

2009-01-01

Full Text Available Matrix metalloproteinases (MMPs are capable of degrading components of the basal lamina of cerebral vessels, thereby disrupting the blood-brain barrier and inducing leukocyte recruitment. This study provides comprehensive information regarding the cell specificity of matrix metalloproteinases (MMP-2, MMP-9 and their binding tissue inhibitors (TIMP-1, TIMP-2 in the central nervous system during viral and bacterial meningitis. Specifically, we evaluated the immunoreactivity of MMPs and TIMPs in various cell types in brain parenchyma and meninges obtained from autopsy tissues. We found that a higher proportion of endothelial cells were positive for MMP-9 during meningitis when compared to controls. In addition, the immunoreactivity of MMP-9 decreased and the immunoreactivity of TIMP-1 increased in astrocytes upon infection. Furthermore, the results of this study revealed that mononuclear cells were highly immunoreactive for TIMP-1, TIMP-2 and MMP-9 during viral meningitis and that the expression of TIMPs in polymorphonuclear cells was even higher during bacterial meningitis. Taken together the results of this study indicated that the central nervous system resident cells and inflammatory infiltrates contribute to MMPs activity and that the expression patterns vary between cell types and in response to viral and bacterial meningitis.

TIMP-1 as a tumor marker in breast cancer - an update

DEFF Research Database (Denmark)

Würtz, Sidse Ørnbjerg; Rasmussen, Anne-Sofie Schrohl; Mouridsen, Henning

2008-01-01

. This review gives an update on the ongoing investigation of the potential role of TIMP-1 as a tumor marker in breast cancer. Furthermore, we link the clinical findings with studies of the molecular actions of the TIMP-1 protein, raising hypotheses that may explain why TIMP-1 could play an important role...... opportunities emerge in the future this need will continue to grow. Thus, the search for molecular markers of prognosis and prediction is ongoing. Tissue Inhibitor of Metalloproteinases-1 (TIMP-1) has been suggested as a marker of both prognosis and response to treatment. Several studies have demonstrated...... the association between TIMP-1 and prognosis in breast cancer and new studies within this area have focused on the possibility of using blood samples or paraffin embedded tissue instead of tumor tissue extracts for measurements of TIMP-1. Interestingly, recent studies have investigated the association between...

The urine biomarker panel [IGFBP7]x[TIMP-2] (NephroCheck® parameter does not correlate with IGFBP7 and TIMP-2 gene expression in urinary sediment.

Directory of Open Access Journals (Sweden)

Daniela Knafl

Full Text Available Acute kidney injury (AKI is frequently observed in serious infections, following nephrotoxic medication, surgery and trauma. Here we tested whether the detection of two recently identified biomarkers for AKI, Tissue Inhibitor of Metalloproteinase-2 (TIMP-2 and Insulin-Like Growth Factor Binding Protein 7 (IGFBP7, depends on the expression of these proteins in cells of the urinary sediment.We collected urine samples of 33 kidney transplant recipients and 14 non-transplanted patients who all had AKI (stages 1-3 according to KDIGO, and measured [IGFBP7]x[TIMP-2] using the NephroCheck® Astute1 40 ™ meter. Concomitantly, we analyzed IGFBP7 and TIMP-2 mRNA expression by quantitative polymerase chain reaction (qPCR from urinary sediment of the same patients, and correlated the results with [IGFBP7]x[TIMP-2] (protein, by linear regression analysis. We also determined the association between [IGFBP7]x[TIMP-2] and estimated glomerular filtration rate (eGFR, and between IGFBP7 and TIMP-2 mRNA expression and markers of inflammation. Light microscopy and confocal immunofluorescence served to illustrate changes in the urinary sediment over the time course of renal function improvement.Of the 47 analyzed AKI patients, 14 presented with ascending urinary tract infection. Serum creatinine (sCr, blood urea nitrogen (BUN and eGFR in all patients were 3.9±2.28 mg/dL, 47.59±23.1 mg/dL and 22.88±16.0 mL/min/1.73m2, respectively, on average ±standard deviation. [IGFBP7]x[TIMP-2] was 2.33±9.95 (ng/ml2/1000, and did not associate with IGFBP7 and TIMP-2 gene expression (r = -0.0220, p = 0.4216; respectively r = 0.0972, p = 0.1909. [IGFBP7]x[TIMP-2] did not associate with eGFR; IGFBP7 and TIMP-2 mRNA expression. Improvement of renal function went along with disappearance of casts, decrease in aquaporin1 positive renal epithelial cells and leukocytes from the urinary sediment.The gene expression pattern of IGFBP7 and TIMP-2 from urinary sediment, which contains

Localization of Tissue Inhibitor of Metalloproteinases 1 (TIMP-1) in Human Colorectal Adenoma and Adenocarcinoma

DEFF Research Database (Denmark)

Holten-Andersen, Mads N.; Hansen, Ulla; Brünner, Nils

2005-01-01

-growth. We have previously demonstrated that TIMP-1 is elevated in blood from colorectal cancer patients and that high TIMP-1 levels predict poor prognosis. To clarify the role of TIMP-1 in colorectal tumorigenesis, the expression pattern of TIMP-1 in benign and malignant colorectal tumors was studied....... In all of 24 cases of colorectal adenocarcinoma TIMP-1 mRNA was detected by in situ hybridization. In all cases TIMP-1 expression was found in fibroblast-like cells located at the invasive front but was seen only sporadically in normal mucosa. No TIMP-1 mRNA was seen in any of the cases in benign...... or malignant epithelial cells, in vascular cells or smooth muscle cells. Comparison of sections processed for TIMP-1 in situ hybridization with sections immunohistochemically stained with antibodies against TIMP-1 showed good correlation between TIMP-1 mRNA and immunoreactivity. Combining TIMP-1 in situ...

Detection of the matrix metalloproteinases MMP-2 and MMP-9 and tissue inhibitors of metalloproteinases TIMP-1 and TIMP-2 in llama (Lama glama) oviduct.

Science.gov (United States)

Zampini, R; Argañaraz, M E; Miceli, D C; Apichela, S A

2014-06-01

Matrix metalloproteinases (MMPs) and their inhibitors (TIMPs) are involved in several reproductive events like oocyte-spermatozoa interaction and semen liquefaction. In order to study their role in the llama oviductal reproductive process, MMP activity in oviductal fluid (OF) was assayed. Considering that llama genome sequences are partially known, a strategy to procure cDNA sequences of MMP-2, MMP-9, TIMP-1 and TIMP-2 was designed. Afterwards, their expression patterns in the different llama oviductal segments were assayed. Gelatine zymograms detected 62 and 94 kDa protease activities that matched MMP-2 and pro-MMP-9, respectively. Expression pattern analysis showed that MMP and TIMP mRNAs were present in ampulla, isthmus, utero-tubal junction (UTJ) and papilla. Altogether, these findings support the argument that MMPs/TIMPs are produced in the oviduct and secreted into the oviductal lumen. Our results encourage further studies to elucidate the role of these proteins in reproductive oviductal events. © 2014 Blackwell Verlag GmbH.

Increased expression of metalloproteinase-2 and -9 (MMP-2, MMP-9), tissue inhibitor of metalloproteinase-1 and -2 (TIMP-1, TIMP-2), and EMMPRIN (CD147) in multiple myeloma.

Science.gov (United States)

Urbaniak-Kujda, Donata; Kapelko-Slowik, Katarzyna; Prajs, Iwona; Dybko, Jarosław; Wolowiec, Dariusz; Biernat, Monika; Slowik, Miroslaw; Kuliczkowski, Kazimierz

2016-01-01

Activity of metalloproteinases (MMP) is controlled both by specific tissue inhibitors (TIMP) and activators (extracellular matrix metalloproteinase inducer, EMMPRIN). There are few data available concerning concentration the bone marrow of MMP-2, MMP-9, TIMP-1, and TIMP-2, or EMMPRIM expression by bone marrow mesenchymal stromal cells (BMSCs) in patients with multiple myeloma (MM). We studied 40 newly diagnosed, untreated patients: 18 males and 22 females with de novo MM and 11 healthy controls. Bone marrow was collected prior to therapy. BMSCs were derived by culturing bone marrow cells on MesenCult. Protein concentrations were determined in bone marrow plasma and culture supernatants by ELISA. EMMPRIN expression by BMSCs was assessed by flow cytometry. The median concentrations of MMP-9, TIMP-1, and TIMP-2 in both marrow plasma and culture supernatants were significantly higher in MM patients than controls. EMMPRIN expression and ratios MMP-9/TIMP-1 and MMP-2/TIMP-2 were higher in MM patients, our results demonstrate that in MM patients MMP-2 and MMP-9 are secreted in higher amounts and are not balanced by inhibitors.

Age-related changes of MAO-A and -B distribution in human and mouse brain.

Science.gov (United States)

Mahy, N; Andrés, N; Andrade, C; Saura, J

2000-01-01

Age-related changes of MAO-A and -B were studied in human and BL/C57 mouse brain areas (substantia nigra, putamen and cerebellum). [3H]Ro41-1049 and [3H]lazabemide were used as selective radioligands to image and quantify MAO-A and MAO-B respectively by enzyme autoradiography. MAO-A binding was higher in mouse, whereas MAO-B binding was higher in human. With aging, mouse MAO-A was significantly reduced between 4 and 8 weeks and remained unchanged until 19 months followed by a slight increase between 19 and 25 months. In contrast, no clear variation was observed in humans between the age of 17-93 years. In most of the structures studied a clear age-related increase in MAO-B was observed beginning in mouse brain at 4 weeks, whereas in human tissue this increase started at the age of 50-60 years. These results show marked differences in the levels and variations of mouse and human MAO-A and -B associated with aging and should be taken into account when extrapolating experimental data from mouse to human.

The interactive effect of the MAOA-VNTR genotype and childhood abuse on aggressive behaviors in Chinese male adolescents.

Science.gov (United States)

Zhang, Yun; Ming, Qingsen; Wang, Xiang; Yao, Shuqiao

2016-06-01

Gene-environment interactions that moderate aggressive behavior have been identified in association with the MAOA (monoamine oxidase A) gene. The present study examined the moderating effect of MAOA-VNTR (variable number of tandem repeats) on aggression behavior relating to child abuse among Chinese adolescents. A sample of 507 healthy Chinese male adolescents completed the Child Trauma Questionnaire-Short Form (CTQ-SF) and Youth Self-report of the Child Behavior Checklist. The participants' buccal cells were sampled and subjected to DNA analysis. The effects of childhood abuse (CTQ-SF scores), MAOA-VNTR [high-activity allele (H) versus low-activity allele (L)], and their interaction in aggressive behaviors were analyzed by linear regression. Child maltreatment was found to be a significant independent factor in the manifestation of aggressive behavior, whereas MAOA activity was not. There was a significant interaction between MAOA-VNTR and childhood maltreatment in the exhibition of aggressive behaviors. In the context of physical or emotional abuse, boys in the MAOA-L group showed a greater tendency toward aggression than those in the MAOA-H group. Aggressive behavior arising from childhood maltreatment is moderated by MAOA-VNTR, which may be differentially sensitive to the subtype of childhood maltreatment experienced, among Chinese adolescents.

Differential expression of IL-6/IL-6R and MAO-A regulates invasion/angiogenesis in breast cancer.

Science.gov (United States)

Bharti, Rashmi; Dey, Goutam; Das, Anjan Kumar; Mandal, Mahitosh

2018-04-26

Monoamine oxidases (MAO) are mitochondrial enzymes functioning in oxidative metabolism of monoamines. The action of MAO-A has been typically described in neuro-pharmacological domains. Here, we have established a co-relation between IL-6/IL-6R and MAO-A and their regulation in hypoxia induced invasion/angiogenesis. We employed various in-vitro and in-vivo techniques and clinical samples. We studied a co-relation among MAO-A and IL-6/IL-6R and tumour angiogenesis/invasion in hypoxic environment in breast cancer model. Activation of IL-6/IL-6R and its downstream was found in hypoxic cancer cells. This elevation of IL-6/IL-6R caused sustained inhibition of MAO-A in hypoxic environment. Inhibition of IL-6R signalling or IL-6R siRNA increased MAO-A activity and inhibited tumour angiogenesis and invasion significantly in different models. Further, elevation of MAO-A with 5-azacytidine (5-Aza) modulated IL-6 mediated angiogenesis and invasive signatures including VEGF, MMPs and EMT in hypoxic breast cancer. High grade invasive ductal carcinoma (IDC) clinical specimen displayed elevated level of IL-6R and depleted MAO-A expression. Expression of VEGF and HIF-1α was unregulated and loss of E-Cadherin was observed in high grade IDC tissue specimen. Suppression of MAO-A by IL-6/IL-6R activation promotes tumour angiogenesis and invasion in hypoxic breast cancer environment.

Immunohistochemical Expression of Tissue Inhibitor of Metalloproteinase-1 (Timp-1 in Invasive Breast Carcinoma

Directory of Open Access Journals (Sweden)

Suada Kuskunović

2009-05-01

Full Text Available Tissue inhibitor of metalloproteinase-1 (TIMP-1 is a natural inhibitor of matrix metalloproteinas-es (MMPs. Aim of this study was to assess the immunohistochemical expression of TIMP-1 in invasive breast carcinomas, and to examine its association with classical clinico-pathological parameters, oestrogen receptor, progesterone receptor and Her-2/neu protein expression. Immuno-histochemistry was used to determine the expression of TIMP-1 on 38 paraffin-embedded breast tissue specimens - 18 with invasive ductal carcinoma, 10 with invasive lobular carcinoma, and 10 specimens from patients with fibrocystic breast disease. TIMP-1 protein was immunodetected in the carcinoma cells, fibroblasts and inflammatory cells of the stroma in 92,9%, 65,8%, and 65,8% of cases, respectively. TIMP-1 protein expression in carcinoma cells showed positive correlation with TIMP-1 protein expression in peritumoural fibroblasts (p=0,010. Positive peritumoural fibroblast TIMP-1 expression was associated with histological tumour type with higher frequency in ductal carcinomas (p=0,023. Negative association was found between TIMP-1 protein expression in carcinoma cells and HER-2/neu nuclear staining (p=0,005. TIMP-1 may be particularly useful as a predictive marker in breast carcinoma when evaluated along with HER-2/neu protein being a promising indicator of favourable prognosis in breast carcinoma.

MAO-A inhibition profiles of some benzophenone glucosides from Gentiana verna subsp. pontica

DEFF Research Database (Denmark)

Kaya, Duygu; Jäger, Anna; Yalçin, Funda N

2014-01-01

Gentiana verna L. subsp. pontica (Soltok.) Hayek, G. pyrenaica L., and G. verna L. subsp. balcanica Pritchard from Turkey were tested for their MAO-A inhibitory effects. A photometric peroxidase linked MAO-A bioassay performed on the H20 extracts prepared from the methanolic extracts of the title...

Association of low-activity MAOA allelic variants with violent crime in incarcerated offenders.

Science.gov (United States)

Stetler, Dean A; Davis, Chad; Leavitt, Kathryn; Schriger, Ilana; Benson, Katie; Bhakta, Samir; Wang, Lam Chee; Oben, Cynthia; Watters, Matthew; Haghnegahdar, Tara; Bortolato, Marco

2014-11-01

The main enzyme for serotonin degradation, monoamine oxidase (MAO) A, has recently emerged as a key biological factor in the predisposition to impulsive aggression. Male carriers of low-activity variants of the main functional polymorphism of the MAOA gene (MAOA-uVNTR) have been shown to exhibit a greater proclivity to engage in violent acts. Thus, we hypothesized that low-activity MAOA-uVNTR alleles may be associated with a higher risk for criminal violence among male offenders. To test this possibility, we analyzed the MAOA-uVNTR variants of violent (n = 49) and non-violent (n = 40) male Caucasian and African-American convicts in a correctional facility. All participants were also tested with the Childhood Trauma Questionnaire (CTQ), Barratt Impulsivity Scale (BIS-11) and Buss-Perry Aggression Questionnaire (BPAQ) to assess their levels of childhood trauma exposure, impulsivity and aggression, respectively. Our results revealed a robust (P crime. This association was replicated in the group of Caucasian violent offenders (P crime charges were not associated with CTQ, BIS-11 and BPAQ scores, carriers of low-activity alleles exhibited a mild, yet significant (P genetic determinant for criminal violence. Further studies are required to confirm these results in larger samples of inmates and evaluate potential interactions between MAOA alleles and environmental vulnerability factors. Copyright © 2014 Elsevier Ltd. All rights reserved.

TIMP-1 and responsiveness to gemcitabine in advanced breast cancer

DEFF Research Database (Denmark)

Jørgensen, Charlotte Levin Tykjær; Bjerre, Christina Annette; Ejlertsen, Bent Laursen

2014-01-01

receiving GD. CONCLUSIONS: TIMP-1 status was an independent prognostic factor for OS but not TTP in patients with advanced breast cancer receiving either D or GD. There was no statistically significant interaction between TIMP-1 status and treatment, but a trend towards an incremental OS from the addition...... and predictive marker in advanced breast cancer patients receiving docetaxel (D) or gemcitabine plus docetaxel (GD). METHODS: Patients with locally advanced or metastatic breast cancer who were assigned to D or GD by participation in a randomized phase III trial were included in the study. Assessment of TIMP-1...

Early trauma and increased risk for physical aggression during adulthood: the moderating role of MAOA genotype.

Directory of Open Access Journals (Sweden)

Giovanni Frazzetto

Full Text Available Previous research has reported that a functional polymorphism in the monoamine oxidase A (MAOA gene promoter can moderate the association between early life adversity and increased risk for violence and antisocial behavior. In this study of a combined population of psychiatric outpatients and healthy volunteers (N = 235, we tested the hypothesis that MAOA genotype moderates the association between early traumatic life events (ETLE experienced during the first 15 years of life and the display of physical aggression during adulthood, as assessed by the Aggression Questionnaire. An ANOVA model including gender, exposure to early trauma, and MAOA genotype as between-subjects factors showed significant MAOAxETLE (F(1,227 = 8.20, P = 0.005 and genderxMAOAxETLE (F(1,227 = 7.04, P = 0.009 interaction effects. Physical aggression scores were higher in men who had experienced early traumatic life events and who carried the low MAOA activity allele (MAOA-L. We repeated the analysis in the subgroup of healthy volunteers (N = 145 to exclude that the observed GxE interactions were due to the inclusion of psychiatric patients in our sample and were not generalizable to the population at large. The results for the subgroup of healthy volunteers were identical to those for the entire sample. The cumulative variance in the physical aggression score explained by the ANOVA effects involving the MAOA polymorphism was 6.6% in the entire sample and 12.1% in the sub-sample of healthy volunteers. Our results support the hypothesis that, when combined with exposure to early traumatic life events, low MAOA activity is a significant risk factor for aggressive behavior during adulthood and suggest that the use of dimensional measures focusing on behavioral aspects of aggression may increase the likelihood of detecting significant gene-by-environment interactions in studies of MAOA-related aggression.

Tissue inhibitor of metalloproteinase-3 (TIMP3) promotes endothelial apoptosis via a caspase-independent mechanism.

Science.gov (United States)

Qi, Jian Hua; Anand-Apte, Bela

2015-04-01

Tissue inhibitor of metalloproteinases-3 (TIMP3) is a tumor suppressor and a potent inhibitor of angiogenesis. TIMP3 exerts its anti-angiogenic effect via a direct interaction with vascular endothelial growth factor (VEGF) receptor-2 (KDR) and inhibition of proliferation, migration and tube formation of endothelial cells (ECs). TIMP3 has also been shown to induce apoptosis in some cancer cells and vascular smooth muscle cells via MMP inhibition and caspase-dependent mechanisms. In this study, we examined the molecular mechanisms of TIMP3-mediated apoptosis in endothelial cells. We have previously demonstrated that mice developed smaller tumors with decreased vascularity when injected with breast carcinoma cells overexpressing TIMP3, than with control breast carcinoma cells. TIMP3 overexpression resulted in increased apoptosis in human breast carcinoma (MDA-MB435) in vivo but not in vitro. However, TIMP3 could induce apoptosis in ECs in vitro. The apoptotic activity of TIMP3 in ECs appears to be independent of MMP inhibitory activity. Furthermore, the equivalent expression of functional TIMP3 promoted apoptosis and caspase activation in ECs expressing KDR (PAE/KDR), but not in ECs expressing PDGF beta-receptor (PAE/β-R). Surprisingly, the apoptotic activity of TIMP3 appears to be independent of caspases. TIMP3 inhibited matrix-induced focal adhesion kinase (FAK) tyrosine phosphorylation and association with paxillin and disrupted the incorporation of β3 integrin, FAK and paxillin into focal adhesion contacts on the matrix, which were not affected by caspase inhibitors. Thus, TIMP3 may induce apoptosis in ECs by triggering a caspase-independent cell death pathway and targeting a FAK-dependent survival pathway.

TIMPs of parasitic helminths - a large-scale analysis of high-throughput sequence datasets.

Science.gov (United States)

Cantacessi, Cinzia; Hofmann, Andreas; Pickering, Darren; Navarro, Severine; Mitreva, Makedonka; Loukas, Alex

2013-05-30

Tissue inhibitors of metalloproteases (TIMPs) are a multifunctional family of proteins that orchestrate extracellular matrix turnover, tissue remodelling and other cellular processes. In parasitic helminths, such as hookworms, TIMPs have been proposed to play key roles in the host-parasite interplay, including invasion of and establishment in the vertebrate animal hosts. Currently, knowledge of helminth TIMPs is limited to a small number of studies on canine hookworms, whereas no information is available on the occurrence of TIMPs in other parasitic helminths causing neglected diseases. In the present study, we conducted a large-scale investigation of TIMP proteins of a range of neglected human parasites including the hookworm Necator americanus, the roundworm Ascaris suum, the liver flukes Clonorchis sinensis and Opisthorchis viverrini, as well as the schistosome blood flukes. This entailed mining available transcriptomic and/or genomic sequence datasets for the presence of homologues of known TIMPs, predicting secondary structures of defined protein sequences, systematic phylogenetic analyses and assessment of differential expression of genes encoding putative TIMPs in the developmental stages of A. suum, N. americanus and Schistosoma haematobium which infect the mammalian hosts. A total of 15 protein sequences with high homology to known eukaryotic TIMPs were predicted from the complement of sequence data available for parasitic helminths and subjected to in-depth bioinformatic analyses. Supported by the availability of gene manipulation technologies such as RNA interference and/or transgenesis, this work provides a basis for future functional explorations of helminth TIMPs and, in particular, of their role/s in fundamental biological pathways linked to long-term establishment in the vertebrate hosts, with a view towards the development of novel approaches for the control of neglected helminthiases.

iTIMP: isotriplet Technicolor Interacting Massive Particle as Dark Matter

DEFF Research Database (Denmark)

T. Frandsen, Mads; Sannino, Francesco

2010-01-01

We suggest that a weak isotriplet composite scalar possessing an unbroken U(1) global symmetry naturally arises in technicolor models leading to an interesting type of dark matter candidate: the iTIMP. We propose explicit models of the iTIMP, study earth based constraints and suggest possible...

Identifying sources and estimating glandular output of salivary TIMP-1

DEFF Research Database (Denmark)

Holten-Andersen, Lars; Jensen, Siri Beier; Jensen, Allan Bardow

2008-01-01

saliva (267.01 ng/min). Conclusion. This study shows that saliva contains authentic TIMP-1, the concentration of which was found to depend on gland type and salivary flow. Stimulated whole saliva is suggested as a reliable and easily accessible source for TIMP-1 determinations in bodily fluids....

MAOA-uVNTR genotype predicts interindividual differences in experimental aggressiveness as a function of the degree of provocation.

Science.gov (United States)

Kuepper, Yvonne; Grant, Phillip; Wielpuetz, Catrin; Hennig, Juergen

2013-06-15

The MAOA-uVNTR has been suggested to play a role regarding aggression, however, results are inconsistent. We aimed at further elucidating potential effects of the MAOA-uVNTR on aggressiveness with respect to potential modulators: sex, experimental vs. trait aggressiveness and type of aggressiveness (proactive vs. reactive aggressiveness). We tested 239 healthy young adults (88 men/151 women). Participants were genotyped for the MAOA-uVNTR and performed a modified version of a competitive reaction time task - a commonly used and well established tool to elicit and measure aggressiveness. Furthermore, they completed a self-report scale measuring trait aggressiveness. We found a main effect of MAOA-uVNTR on a measure of reactive aggressiveness for both men and women, whereby the low-activity alleles of the MAOA-uVNTR were associated with substantially increased aggressive reactions (pimpulsive experimental aggressiveness in healthy men and women. Furthermore the association between the MAOA-uVNTR genotype and aggressive responses increases in a fashion linear to the degree of provocation. This indicates that the low-functional alleles of the MAOA-uVNTR are not associated with increased aggressive behavior per se, but rather with an increased aggressive reactivity to provocation. Copyright © 2013 Elsevier B.V. All rights reserved.

MAO-A promoter polymorphism and idiopathic pulmonary arterial ...

Indian Academy of Sciences (India)

Introduction. Monoamine oxidases (MAO) are mitochondrial enzymes ... liver and later in lungs by the enzyme MAO-A, via ox- ... Diagnosis was based on WHO criteria .... treatment of pulmonary arterial hypertension of the European so-.

Tissue inhibitor of metalloproteinase-2 (TIMP-2) regulates myogenesis and β1 integrin expression in vitro

International Nuclear Information System (INIS)

Lluri, Gentian; Langlois, Garret D.; Soloway, Paul D.; Jaworski, Diane M.

2008-01-01

Myogenesis in vitro involves myoblast cell cycle arrest, migration, and fusion to form multinucleated myotubes. Extracellular matrix (ECM) integrity during these processes is maintained by the opposing actions of matrix metalloproteinase (MMP) proteases and their inhibitors, the tissue inhibitor of metalloproteinases (TIMPs). Here, we report that TIMP-2, MMP-2, and MT1-MMP are differentially expressed during mouse myoblast differentiation in vitro. A specific role for TIMP-2 in myogenesis is demonstrated by altered TIMP-2 -/- myotube formation. When differentiated in horse serum-containing medium, TIMP-2 -/- myotubes are larger than wild-type myotubes. In contrast, when serum-free medium is used, TIMP-2 -/- myotubes are smaller than wild-type myotubes. Regardless of culture condition, myotube size is directly correlated with MMP activity and inversely correlated with β1 integrin expression. Treatment with recombinant TIMP-2 rescues reduced TIMP-2 -/- myotube size and induces increased MMP-9 activation and decreased β1 integrin expression. Treatment with either MMP-2 or MMP-9 similarly rescues reduced myotube size, but has no effect on β1 integrin expression. These data suggest a specific regulatory relationship between TIMP-2 and β1 integrin during myogenesis. Elucidating the role of TIMP-2 in myogenesis in vitro may lead to new therapeutic options for the use of TIMP-2 in myopathies and muscular dystrophies in vivo

[Association between MAOA-u VNTR polymorphism and its interaction with stressful life events and major depressive disorder in adolescents].

Science.gov (United States)

Ma, Jing; Yu, Shun-Ying; Liang, Shan; Ding, Jun; Feng, Zhe; Yang, Fan; Gao, Wei-Jia; Lin, Jia-Ni; Huang, Chun-Xiang; Liu, Xue-Jun; Su, Lin-Yan

2013-07-01

To investigate whether the genetic polymorphism, upstream variable number of tandem repeats (uVNTR), in the monoamine oxidase A (MAOA) gene, is associated with major depressive disorder (MDD) in adolescents and to test whether there is gene-environment interaction between MAOA-uVNTR polymorphism and stressful life events (SLEs). A total of 394 Chinese Han subjects, including 187 adolescent patients with MDD and 207 normal students as a control group, were included in the study. Genotyping was performed by SNaP-shot assay. SLEs in the previous 12 months were evaluated. The groups were compared in terms of the frequency distributions of MAOA-uVNTR genotypes and alleles using statistical software. The binary logistic regression model of gene-environment interaction was established to analyze the association of the gene-environment interaction between MAOA-u VNTR genotypes and SLEs with adolescent MDD. The distribution profiles of MAOA-u VNTR genotypes and alleles were not related to the onset of MDD, severity of depression, comorbid anxiety and suicidal ideation/behavior/attempt in adolescents. The gene-environment interaction between MAOA-u VNTR genotypes and SLEs was not associated with MDD in male or female adolescents. It is not proven that MAOA-u VNTR polymorphism is associated with adolescent MDD. There is also no gene-environment interaction between MAOA-u VNTR polymorphism and SLEs that is associated with adolescent MDD.

Dicty_cDB: SLC426 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available SL (Link to library) SLC426 (Link to dictyBase) - G01922 DDB0233225 Contig-U14991-1 SLC4...26E (Link to Original site) SLC426F 335 SLC426Z 320 SLC426P 655 SLC426E 335 Show SLC426 Library SL (Lin...Contig Contig-U14991-1 Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-B/SLC4...26Q.Seq.d/ Representative seq. ID SLC426E (Link to Original site) Representative DNA sequence >SLC426 (SLC4...26Q) /CSM/SL/SLC4-B/SLC426Q.Seq.d/ AAATAATAAATAGTAAATAATAAATAATAATAAATAATAATAATAATATTTNAAAATGGG

Changes in soluble CEA and TIMP-1 levels during adjuvant chemotherapy for stage III colon cancer

DEFF Research Database (Denmark)

Aldulaymi, Bahir; Christensen, Ib Jarle; Sölétormos, György

2010-01-01

Tissue inhibitor of metalloproteinases-1 (TIMP-1) has been suggested to be a valuable marker in colorectal cancer (CRC), but the effects of chemotherapy on TIMP-1 levels are unknown. The present study evaluated the effect of chemotherapy on TIMP-1 levels in comparison with carcinoembryonic antige...... (CEA) levels in patients with stage III colon cancer.......Tissue inhibitor of metalloproteinases-1 (TIMP-1) has been suggested to be a valuable marker in colorectal cancer (CRC), but the effects of chemotherapy on TIMP-1 levels are unknown. The present study evaluated the effect of chemotherapy on TIMP-1 levels in comparison with carcinoembryonic antigen...

Quantitative Evaluation of MMP-9 and TIMP-1 Promoter Methylation in Chronic Periodontitis.

Science.gov (United States)

Li, Xiting; Lu, Jiaxuan; Teng, Wei; Zhao, Chuanjiang; Ye, Xiaolei

2018-03-01

In this study, we investigated the promoter DNA methylation (DNAm) status of the MMP-9 and TIMP-1 genes in patients with chronic periodontitis to evaluate disease progression. Using pyrosequencing technology, DNAm levels of MMP-9 and TIMP-1 CpG islands were measured in 88 chronic periodontitis patients and 15 healthy controls. We found a positive correlation between methylation levels of MMP-9 CpG islands and the severity of chronic periodontitis. Methylated CpG islands were also closely associated with the duration of chronic periodontitis. Moreover, female patients exhibited lower methylation levels of MMP-9 but higher methylation levels of TIMP-1 compared with male patients, and the methylation levels of TIMP-1 gradually decreased with age. The findings of gender disparity in the DNAm of MMP-9 and TIMP-1 genes provide novel insights into chronic periodontitis.

32 CFR 644.426 - Classification.

Science.gov (United States)

2010-07-01

... 32 National Defense 4 2010-07-01 2010-07-01 true Classification. 644.426 Section 644.426 National... HANDBOOK Disposal Disposal of Fee-Owned Real Property and Easement Interests § 644.426 Classification... required by the special acts, classification will be coordinated with the interested Federal agency. The...

Association of the MAOA promoter uVNTR polymorphism with suicide attempts in patients with major depressive disorder

Directory of Open Access Journals (Sweden)

Tzeng Dong-Sheng

2011-05-01

Full Text Available Abstract Background The MAOA uVNTR polymorphism has been documented to affect the MAOA gene at the transcriptional level and is associated with aggressive impulsive behaviors, depression associated with suicide (depressed suicide, and major depressive disorder (MDD. We hypothesized that the uVNTR polymorphism confers vulnerability to MDD, suicide or both. The aim of this study was to explore the association between the MAOA uVNTR and depressed suicide, using multiple controls. Methods Four different groups were included: 432 community controls, 385 patients with MDD who had not attempted suicide, 96 community subjects without mental disorders who had attempted suicide, and 109 patients with MDD who had attempted suicide. The MAOA uVNTR polymorphism was genotyped by a PCR technique. The symptom profiles and personal characteristics in each group were also compared. Results The MAOA 4R allele was more frequent in males with MDD than in male community controls (χ2 = 4.182, p = 0.041. Logistic regression analysis showed that, among the depressed subjects, those younger in age, more neurotic or who smoked had an increased risk of suicide (β = -0.04, p = 0.002; β = 0.15, p = 0.017; β = 0.79, p = 0.031, respectively. Moreover, among those who had attempted suicide, those younger in age, with more paternal overprotection, and more somatic symptoms were more likely to be in the MDD group than in the community group (β = -0.11, p Conclusion The MAOA 4R allele is associated with enhanced vulnerability to suicide in depressed males, but not in community subjects. The MAOA 4R allele affects vulnerability to suicide through the mediating factor of depressive symptoms. Further large-scale studies are needed to verify the psychopathology of the relationships among MAOA uVNTR polymorphism, symptom profiles, and suicidal behavior.

MMP-7 and TIMP-1, new targets in predicting poor wound healing in apical periodontitis.

Science.gov (United States)

Letra, Ariadne; Ghaneh, Ghazaleh; Zhao, Min; Ray, Herbert; Francisconi, Carolina Favaro; Garlet, Gustavo Pompermaier; Silva, Renato Menezes

2013-09-01

Matrix metalloproteinases (MMPs) and the tissue inhibitors of metalloproteinases (TIMPs) are strongly associated with tissue destruction because of inflammation. In this study, we investigated the expression of MMPs and TIMPs messenger RNA and protein levels in apical periodontitis lesions. Tissue samples from patients presenting clinical signs of chronic apical abscess (CAA) or asymptomatic apical periodontitis (AAP) were collected postoperatively and used for gene expression analysis of MMP-2, -3, -7, -9, -14, -16, and -25; TIMP-1; and TIMP-2 in real-time polymerase chain reaction. Immunohistochemistry was also performed to detect the expression of MMP-7 and TIMP-1 proteins. Lastly, U-937 cells were induced to terminal differentiation into macrophages, infected with purified Escherichia coli lipopolysaccharide, and assessed for the expression of MMP-7 and TIMP-1 using immunocytochemistry and confocal microscopy. Significantly higher messenger RNA levels were found for all genes in AAP and CAA samples when compared with healthy control samples (P < .001). AAP cases exhibited significantly higher TIMP-1 when compared with CAA cases, whereas CAA cases showed higher MMP-2, MMP-7, and MMP-9 messenger RNA levels (P < .05). We also detected positive the expression of MMP-7 and TIMP-1 proteins in the tissue samples. The expression of both MMP-7 and TIMP-1 were increased in lipopolysaccharide-stimulated cells compared with nonstimulated cells and appear to colocalize in the Golgi apparatus. MMPs appear to have an influential role in CAA cases in which ongoing tissue destruction is observed. TIMPs are preferentially associated with AAP, perhaps as a subsequent defense mechanism against excessive destruction. Taken together, our findings implicate MMP and TIMP molecules in the dynamics of inflammatory periapical lesion development. Copyright © 2013 American Association of Endodontists. Published by Elsevier Inc. All rights reserved.

42 CFR 426.532 - Discovery.

Science.gov (United States)

2010-10-01

... 42 Public Health 3 2010-10-01 2010-10-01 false Discovery. 426.532 Section 426.532 Public Health... § 426.532 Discovery. (a) General rule. If the Board orders discovery, the Board must establish a reasonable timeframe for discovery. (b) Protective order—(1) Request for a protective order. Any party...

A novel cell line derived from pleomorphic adenoma expresses MMP2, MMP9, TIMP1, TIMP2, and shows numeric chromosomal anomalies.

Directory of Open Access Journals (Sweden)

Aline Semblano Carreira Falcão

Full Text Available Pleomorphic adenoma is the most common salivary gland neoplasm, and it can be locally invasive, despite its slow growth. This study aimed to establish a novel cell line (AP-1 derived from a human pleomorphic adenoma sample to better understand local invasiveness of this tumor. AP-1 cell line was characterized by cell growth analysis, expression of epithelial and myoepithelial markers by immunofluorescence, electron microscopy, 3D cell culture assays, cytogenetic features and transcriptomic study. Expression of matrix metalloproteinases (MMPs and their tissue inhibitors (TIMPs was also analyzed by immunofluorescence and zymography. Furthermore, epithelial and myoepithelial markers, MMPs and TIMPs were studied in the tumor that originated the cell line. AP-1 cells showed neoplastic epithelial and myoepithelial markers, such as cytokeratins, vimentin, S100 protein and smooth-muscle actin. These molecules were also found in vivo, in the tumor that originated the cell line. MMPs and TIMPs were observed in vivo and in AP-1 cells. Growth curve showed that AP-1 exhibited a doubling time of 3.342 days. AP-1 cells grown inside Matrigel recapitulated tumor architecture. Different numerical and structural chromosomal anomalies were visualized in cytogenetic analysis. Transcriptomic analysis addressed expression of 7 target genes (VIM, TIMP2, MMP2, MMP9, TIMP1, ACTA2 e PLAG1. Results were compared to transcriptomic profile of non-neoplastic salivary gland cells (HSG. Only MMP9 was not expressed in both libraries, and VIM was expressed solely in AP-1 library. The major difference regarding gene expression level between AP-1 and HSG samples occurred for MMP2. This gene was 184 times more expressed in AP-1 cells. Our findings suggest that AP-1 cell line could be a useful model for further studies on pleomorphic adenoma biology.

42 CFR 426.432 - Discovery.

Science.gov (United States)

2010-10-01

... 42 Public Health 3 2010-10-01 2010-10-01 false Discovery. 426.432 Section 426.432 Public Health... § 426.432 Discovery. (a) General rule. If the ALJ orders discovery, the ALJ must establish a reasonable timeframe for discovery. (b) Protective order—(1) Request for a protective order. Any party receiving a...

TIMP3 interplays with apelin to regulate cardiovascular metabolism in hypercholesterolemic mice

Directory of Open Access Journals (Sweden)

Robert Stöhr

2015-10-01

Conclusion: TIMP3 regulates lipid metabolism as well as oxidative stress response via apelin. These findings therefore suggest that TIMP3 maintains metabolic flexibility in the heart, particularly during episodes of increased cardiac stress.

25 CFR 11.426 - Bribery.

Science.gov (United States)

2010-04-01

... 25 Indians 1 2010-04-01 2010-04-01 false Bribery. 11.426 Section 11.426 Indians BUREAU OF INDIAN... Criminal Offenses § 11.426 Bribery. (a) A person is guilty of bribery, a misdemeanor, if he or she offers... a person whom the actor sought to influence was not qualified to act in the desired way, whether...

Interaction between MAOA and FOXP2 in association with autism and verbal communication in a Korean population.

Science.gov (United States)

Park, YoungJoon; Won, SeongSik; Nam, Min; Chung, Joo-Ho; Kwack, KyuBum

2014-12-01

Expression levels of monoamine oxidase A (MAOA), the enzyme that related to monoamine neurotransmitters metabolism such as serotonin, are related to schizophrenia and autism spectrum disorder. Forkhead box protein P2 (FOXP2), a transcription factor, is associated with abnormal language development and is expressed in several areas of the central nervous system in response to serotonin. For this reason, we undertook interaction analysis between MAOA and FOXP2 in autism spectrum disorder, including testing the verbal communication score of the childhood autism rating scale. In interaction analysis, the FOXP2-TCGC (rs12531289-rs1350135-rs10230087-rs2061183) diplotype and MAOA-TCG (rs6323-rs1801291-rs3027407) haplotype were significantly associated with autism spectrum disorder in males. However, when the interaction term was omitted, neither MAOA nor FOXP2 was associated with autism spectrum disorder or verbal communication. These results indicate that language and speech ability is affected by an interaction between FOXP2 and MAOA, but not by either gene separately. © The Author(s) 2013.

Reversible Inhibitors of Monoamine Oxidase-A (RIMAs): Robust, Reversible Inhibition of Human Brain MAO-A by CX157

Science.gov (United States)

Fowler, Joanna S; Logan, Jean; Azzaro, Albert J; Fielding, Robert M; Zhu, Wei; Poshusta, Amy K; Burch, Daniel; Brand, Barry; Free, James; Asgharnejad, Mahnaz; Wang, Gene-Jack; Telang, Frank; Hubbard, Barbara; Jayne, Millard; King, Payton; Carter, Pauline; Carter, Scott; Xu, Youwen; Shea, Colleen; Muench, Lisa; Alexoff, David; Shumay, Elena; Schueller, Michael; Warner, Donald; Apelskog-Torres, Karen

2010-01-01

Reversible inhibitors of monoamine oxidase-A (RIMA) inhibit the breakdown of three major neurotransmitters, serotonin, norepinephrine and dopamine, offering a multi-neurotransmitter strategy for the treatment of depression. CX157 (3-fluoro-7-(2,2,2-trifluoroethoxy)phenoxathiin-10,10-dioxide) is a RIMA, which is currently in development for the treatment of major depressive disorder. We examined the degree and reversibility of the inhibition of brain monoamine oxidase-A (MAO-A) and plasma CX157 levels at different times after oral dosing to establish a dosing paradigm for future clinical efficacy studies, and to determine whether plasma CX157 levels reflect the degree of brain MAO-A inhibition. Brain MAO-A levels were measured with positron emission tomography (PET) imaging and [11C]clorgyline in 15 normal men after oral dosing of CX157 (20–80 mg). PET imaging was conducted after single and repeated doses of CX157 over a 24-h time course. We found that 60 and 80 mg doses of CX157 produced a robust dose-related inhibition (47–72%) of [11C]clorgyline binding to brain MAO-A at 2 h after administration and that brain MAO-A recovered completely by 24 h post drug. Plasma CX157 concentration was highly correlated with the inhibition of brain MAO-A (EC50: 19.3 ng/ml). Thus, CX157 is the first agent in the RIMA class with documented reversible inhibition of human brain MAO-A, supporting its classification as a RIMA, and the first RIMA with observed plasma levels that can serve as a biomarker for the degree of brain MAO-A inhibition. These data were used to establish the dosing regimen for a current clinical efficacy trial with CX157. PMID:19890267

Association of the MAOA promoter uVNTR polymorphism with suicide attempts in patients with major depressive disorder

Science.gov (United States)

2011-01-01

Background The MAOA uVNTR polymorphism has been documented to affect the MAOA gene at the transcriptional level and is associated with aggressive impulsive behaviors, depression associated with suicide (depressed suicide), and major depressive disorder (MDD). We hypothesized that the uVNTR polymorphism confers vulnerability to MDD, suicide or both. The aim of this study was to explore the association between the MAOA uVNTR and depressed suicide, using multiple controls. Methods Four different groups were included: 432 community controls, 385 patients with MDD who had not attempted suicide, 96 community subjects without mental disorders who had attempted suicide, and 109 patients with MDD who had attempted suicide. The MAOA uVNTR polymorphism was genotyped by a PCR technique. The symptom profiles and personal characteristics in each group were also compared. Results The MAOA 4R allele was more frequent in males with MDD than in male community controls (χ2 = 4.182, p = 0.041). Logistic regression analysis showed that, among the depressed subjects, those younger in age, more neurotic or who smoked had an increased risk of suicide (β = -0.04, p = 0.002; β = 0.15, p = 0.017; β = 0.79, p = 0.031, respectively). Moreover, among those who had attempted suicide, those younger in age, with more paternal overprotection, and more somatic symptoms were more likely to be in the MDD group than in the community group (β = -0.11, p depressed suicide were associated with severity of depression, personality traits, age, marital status, and inversely associated with anxiety symptoms. However, depression did not affect suicidal behavior in the community group. Conclusion The MAOA 4R allele is associated with enhanced vulnerability to suicide in depressed males, but not in community subjects. The MAOA 4R allele affects vulnerability to suicide through the mediating factor of depressive symptoms. Further large-scale studies are needed to verify the psychopathology of the

Aggressive Behavior and Altered Amounts of Brain Serotonin and Norepinephrine in Mice Lacking MAOA

Science.gov (United States)

Cases, Olivier; Grimsby, Joseph; Gaspar, Patricia; Chen, Kevin; Pournin, Sandrine; Müller, Ulrike; Aguet, Michel; Babinet, Charles; Shih, Jean Chen; De Maeyer, Edward

2010-01-01

Deficiency in monoamine oxidase A (MAOA), an enzyme that degrades serotonin and norepinephrine, has recently been shown to be associated with aggressive behavior in men of a Dutch family. A line of transgenic mice was isolated in which transgene integration caused a deletion in the gene encoding MAOA, providing an animal model of MAOA deficiency. In pup brains, serotonin concentrations were increased up to ninefold, and serotonin-like immunoreactivity was present in catecholaminergic neurons. In pup and adult brains, norepinephrine concentrations were increased up to twofold, and cytoarchitectural changes were observed in the somatosensory cortex. Pup behavioral alterations, including trembling, difficulty in righting, and fearfulness were reversed by the serotonin synthesis inhibitor parachlorophenylalanine. Adults manifested a distinct behavioral syndrome, including enhanced aggression in males. PMID:7792602

Preclinical profile of befloxatone, a new reversible MAO-A inhibitor.

Science.gov (United States)

Curet, O; Damoiseau-Ovens, G; Sauvage, C; Sontag, N; Avenet, P; Depoortere, H; Caille, D; Bergis, O; Scatton, B

1998-12-01

Befloxatone, a novel oxazolidinone derivative, is a potent, selective and reversible monoamine oxidase A (MAO-A) inhibitor in vitro (K1A = 1.9-3.6 nM) and ex vivo (ED50 MAO-A = 0.02 mg/kg, p.o.). It does not interact with a large number of receptors, monoamine transporters or other amine oxidases. Binding studies with [3H]-befloxatone in rat brain sections show that it labels with high affinity (Kd = 1.3 nM) a single population of sites with the pharmacological characteristics and regional distribution of MAO-A. In the rat brain, befloxatone (0.75 mg/kg, i.p.) increases tissue levels of monoamines and decreases levels of their deaminated metabolites. Acute administration of befloxatone (0.75 mg/kg, i.p.) induces an increase in extracellular striatal dopamine and cortical norepinephrine but not cortical serotonin levels in the rat. Befloxatone (1 mg/kg, i.p.) potently inhibits the firing rate of serotonergic neurons, partially decreases the firing of noradrenergic neurons and has no effect on the firing of dopaminergic neurons (a mirror image of its effects on monoamine release in terminal regions), suggesting that the relative effects of befloxatone on monoamine release may be governed by autoreceptor-mediated control of monoaminergic neurons at the cell body level. Befloxatone (0.03-0.3 mg/kg, p.o.) exhibits potent activity in behavioural models predictive of antidepressant activity. Befloxatone (up to 1.5 mg/kg, p.o.) does not potentiate the pressor effects of orally administered tyramine at centrally active doses and duodenal [3H]-befloxatone binding is displaced by increasing doses of orally administered tyramine (0.1-40 mg/kg, i.p.). These results suggest that befloxatone is a potent reversible MAO-A inhibitor with antidepressant potential and a wide safety margin with regard to the potentiation of the pressor effect of tyramine.

Co-expression of TIMP-1 and its cell surface binding partner CD63 in glioblastomas

DEFF Research Database (Denmark)

Aaberg-Jessen, Charlotte; Sørensen, Mia D.; Matos, Ana L.S.A.

2018-01-01

scoring. CD63 expression in tumor-associated microglia/macrophages was examined by double-immunofluorescence with ionized calcium-binding adapter molecule 1 (Iba1). The association between CD63 and TIMP-1 was investigated using previously obtained TIMP-1 data from our astrocytoma cohort. Cellular co-expression...... of CD63 was widely distributed in astrocytomas with a significantly increased level in glioblastomas. CD63 levels did not significantly correlate with patient survival at a protein level, and CD63 did not augment the prognostic significance of TIMP-1. Up to 38% of the CD63+ cells expressed Iba1; however......, Iba1 did not appear to impact the prognostic value of CD63. A significant correlation was found between TIMP-1 and CD63, and the TIMP-1 and CD63 proteins were co-expressed at the cellular level and located in close molecular proximity, suggesting that TIMP-1 and CD63 could be co...

Changes in plasma TIMP-1 levels after resection for primary colorectal cancer

DEFF Research Database (Denmark)

Frederiksen, C.; Lomholt, A.F.; Davis, G.J.

2009-01-01

BACKGROUND: Increased plasma levels of tissue inhibitor of metalloproteinases (TIMP-1) are associated with poor outcome in colorectal cancer (CRC), however postoperative changes in plasma TIMP-1 levels after resections for CRC have not been thoroughly evaluated. MATERIALS AND METHODS: Plasma samp...

MAOA alters the effects of heavy drinking and childhood physical abuse on risk for severe impulsive acts of violence among alcoholic violent offenders.

Science.gov (United States)

Tikkanen, Roope; Ducci, Francesca; Goldman, David; Holi, Matti; Lindberg, Nina; Tiihonen, Jari; Virkkunen, Matti

2010-05-01

A polymorphism in the promoter region of the monoamine oxidase A gene (MAOA) has been shown to alter the effect of persistent drinking and childhood maltreatment on the risk for violent and antisocial behaviors. These findings indicate that MAOA could contribute to inter-individual differences in stress resiliency. Recidivism in severe violent crimes was assessed after 8 years of nonincarcerated follow-up in a male sample of 174 impulsive Finnish alcoholic violent offenders, the majority of whom exhibited antisocial (ASPD) or borderline personality disorder (BPD) or both. We examined whether MAOA genotype alters the effects of heavy drinking and childhood physical abuse (CPA) on the risk for committing impulsive recidivistic violent crimes. Logistic regression analyses showed that both heavy drinking and CPA were significant independent predictors of recidivism in violent behavior (OR 5.2, p = 0.004 and OR 5.3, p = 0.003) among offenders having the high MAOA activity genotype (MAOA-H), but these predictors showed no effect among offenders carrying the low MAOA activity genotype (MAOA-L). Carriers of the MAOA-H allele have a high risk to commit severe recidivistic impulsive violent crimes after exposure to heavy drinking and CPA.

Selective inhibition of ADAM12 catalytic activity through engineering of tissue inhibitor of metalloproteinase 2 (TIMP-2)

DEFF Research Database (Denmark)

Kveiborg, Marie; Jacobsen, Jonas; Lee, Meng-Huee

2010-01-01

activity may be of great value therapeutically and as an investigative tool to elucidate its mechanisms of action. We have previously reported the inhibitory profile of TIMPs (tissue inhibitor of metalloproteinases) against ADAM12, demonstrating in addition to TIMP-3, a unique ADAM-inhibitory activity...... activity of TIMPs against the transmembrane ADAM12-L (full-length ADAM12), verifying the distinctive inhibitory abilities of N-TIMP-2 and engineered N-TIMP-2 mutants in a cellular environment. Taken together, our findings support the idea that a distinctive ADAM12 inhibitor with future therapeutic...

New pyrrole inhibitors of monoamine oxidase: synthesis, biological evaluation, and structural determinants of MAO-A and MAO-B selectivity.

Science.gov (United States)

La Regina, Giuseppe; Silvestri, Romano; Artico, Marino; Lavecchia, Antonio; Novellino, Ettore; Befani, Olivia; Turini, Paola; Agostinelli, Enzo

2007-03-08

A series of new pyrrole derivatives have been synthesized and evaluated for their monoamine oxidase (MAO) A and B inhibitory activity and selectivity. N-Methyl,N-(benzyl),N-(pyrrol-2-ylmethyl)amine (7) and N-(2-benzyl),N-(1-methylpyrrol-2-ylmethyl)amine (18) were the most selective MAO-B (7, SI = 0.0057) and MAO-A (18, SI = 12500) inhibitors, respectively. Docking and molecular dynamics simulations gave structural insights into the MAO-A and MAO-B selectivity. Compound 18 forms an H-bond with Gln215 through its protonated amino group into the MAO-A binding site. This H-bond is absent in the 7/MAO-A complex. In contrast, compound 7 places its phenyl ring into an aromatic cage of the MAO-B binding pocket, where it forms charge-transfer interactions. The slightly different binding pose of 18 into the MAO-B active site seems to be forced by a bulkier Tyr residue, which replaces a smaller Ile residue present in MAO-A.

Glotaran: A Java-Based Graphical User Interface for the R Package TIMP

NARCIS (Netherlands)

Snellenburg, J.J.; Laptenok, S.; Seger, R.; Mullen, K.M.; van Stokkum, I.H.M.

2012-01-01

In this work the software application called Glotaran is introduced as a Java-based graphical user interface to the R package TIMP, a problem solving environment for fitting superposition models to multi-dimensional data. TIMP uses a command-line user interface for the interaction with data, the

49 CFR 172.426 - OXIDIZER label.

Science.gov (United States)

2010-10-01

... 49 Transportation 2 2010-10-01 2010-10-01 false OXIDIZER label. 172.426 Section 172.426... SECURITY PLANS Labeling § 172.426 OXIDIZER label. (a) Except for size and color, the OXIDIZER label must be... OXIDIZER label must be yellow. [Amdt. 172-123, 56 FR 66257, Dec. 20, 1991] ...

29 CFR 42.6 - Enforcement strategy.

Science.gov (United States)

2010-07-01

... 29 Labor 1 2010-07-01 2010-07-01 true Enforcement strategy. 42.6 Section 42.6 Labor Office of the Secretary of Labor COORDINATED ENFORCEMENT § 42.6 Enforcement strategy. (a) Each Regional Farm Labor... enforcement strategy for each protective statute pursuant to § 42.20(c)(3). The National Committee shall...

42 CFR 426.425 - LCD review.

Science.gov (United States)

2010-10-01

... 42 Public Health 3 2010-10-01 2010-10-01 false LCD review. 426.425 Section 426.425 Public Health... PROGRAM REVIEW OF NATIONAL COVERAGE DETERMINATIONS AND LOCAL COVERAGE DETERMINATIONS Review of an LCD § 426.425 LCD review. (a) Opportunity for the aggrieved party, after his or her review of the LCD record...

42 CFR 426.525 - NCD review.

Science.gov (United States)

2010-10-01

... 42 Public Health 3 2010-10-01 2010-10-01 false NCD review. 426.525 Section 426.525 Public Health... PROGRAM REVIEW OF NATIONAL COVERAGE DETERMINATIONS AND LOCAL COVERAGE DETERMINATIONS Review of an NCD § 426.525 NCD review. (a) Opportunity for the aggrieved party after his or her review of the NCD record...

TIMP-1 stimulates proliferation of human aortic smooth muscle cells and Ras effector pathways

International Nuclear Information System (INIS)

Akahane, Takemi; Akahane, Manabu; Shah, Amy; Thorgeirsson, Unnur P.

2004-01-01

Tissue inhibitor of metalloproteinases-1 (TIMP-1) is a multifunctional protein, which is found in most tissues and body fluids. Here, we demonstrated that recombinant TIMP-1 but not the synthetic matrix metalloproteinase inhibitor, GM6001, stimulated proliferation of human aortic smooth muscle cells (AoSMC) in a dose-dependent manner. The mitogenic effect was associated with activation of Ras, increased phosphorylation of ERK, and stimulation of cyclin D1 expression. The phosphatidylinositol 3-kinase (PI3K) signaling pathway was also involved since the PI3K inhibitor, LY294002, abolished the TIMP-1-mediated growth stimulation. These data suggest that TIMP-1 activates Ras, which then turns on the ERK and PI3K signaling pathways to promote cell cycle progression of the AoSMC

Myocardial overexpression of TIMP3 after myocardial infarction exerts beneficial effects by promoting angiogenesis and suppressing early proteolysis.

Science.gov (United States)

Takawale, Abhijit; Zhang, Pu; Azad, Abul; Wang, Wang; Wang, Xiuhua; Murray, Allan G; Kassiri, Zamaneh

2017-08-01

Myocardial infarction (MI) results in loss of cardiomyocytes, adverse extracellular matrix (ECM) and structural remodeling, and left ventricular (LV) dilation and dysfunction. Tissue inhibitors of metalloproteinase (TIMPs) inhibit matrix metalloproteinases (MMPs), the main regulators of ECM turnover. TIMPs also have MMP-independent functions. TIMP3 levels are reduced in the heart within 24 h of MI in mice. We investigated if overexpression of TIMP3 post-MI limits adverse remodeling and LV dilation and dysfunction. MI was induced by left anterior descending coronary artery ligation in 10- to 12-wk-old male C57BL/6J mice, and adenoviral constructs expressing human (h)TIMP3 (Ad-hTIMP3) or no TIMP (Ad-Null) were injected in the peri-infarct zone (5.4 × 10 7 plaque-forming units/heart, 5 injections/heart). Cardiac function assessed by echocardiography showed improved LV physiology and reduced LV dilation after TIMP3 overexpression compared with the Ad-Null-MI group. Post-MI adverse remodeling was attenuated in the Ad-hTIMP3-MI group, as assessed by greater cardiomyocyte density, less infarct expansion, and ECM disruption. TIMP3 overexpression blunted the early rise in proteolytic activities post-MI. A higher density of coronary arteries and a greater number of proliferating endothelial cells were detected in the infarct and peri-infarct regions in the Ad-hTIMP3-MI group compared with the Ad-Null-MI group. In vitro three-dimensional angiogenesis assay confirmed that recombinant TIMP3 promotes angiogenesis in human endothelial cells, although biphasically and in a dose-dependent manner. Intriguingly, overexpression of Ad-hTIMP3 at 10-fold higher concentration had no beneficial effects, consistent with antiangiogenic effects of TIMP3 at higher doses. In conclusion, optimal overexpression of TIMP3 can be a promising therapeutic approach to limit adverse post-MI remodeling by dually inhibiting early proteolysis and promoting angiogenesis. NEW & NOTEWORTHY Here, we report

Detection of a molecular deletion at the DXS732 locus in a patient with X-linked hypohidrotic ectodermal dysplasia (EDA), with the identification of a unique junctional fragment

Energy Technology Data Exchange (ETDEWEB)

Zonana, J.; Gault, J.; Jones, M.; Browne, D.; Litt, M. (Oregon Health Sciences Univ., Portland (United States)); Davies, K.J.P.; Clarke, A.; Thomas, N.S.T. (Univ. of Wales, Cardiff (United Kingdom)); Brockdorff, N.; Rastan, S. (Medical Research Council Clinical Research Centre, Harrow (United Kingdom))

1993-01-01

X-linked hypohidrotic ectodermal dysplasia (EDA) has been localized to the Xq12-q13.1. A panel of genomic DNA samples from 80 unrelated males with EDA has been screened for deletions at seven genetic loci within the Xq12-13 region. A single individual was identified with a deletion at the DXS732 locus by hybridization with the mouse genomic probe pcos169E/4. This highly conserved DNA probe is from locus DXCrc169, which is tightly linked to the Ta locus, the putative mouse homologue of EDA. The proband had the classical phenotype of EDA, with no other phenotypic abnormalities, and a normal cytogenetic analysis. A human genomic DNA clone, homologous to pcos169E/4, was isolated from a human X-chromosome cosmid library. On hybridization with the cosmid, the proband was found to be only partially deleted at the DXS732 locus, with a unique junctional fragment identified in the proband and in three of his maternal relatives. This is the first determination of carrier status for EDA in females, by direct mutation analysis. Failure to detect deletion of the other loci tested in the proband suggests that the DXS732 locus is the closest known locus to the EDA gene. Since the DXS732 locus contains a highly conserved sequence, it must be considered to be a candidate locus for the EDA gene itself. 18 refs., 3 figs., 1 tab.

Coronary plaque property evaluation by coronary CTA and its correlation with inflammatory molecules and MMPs/TIMPs

Directory of Open Access Journals (Sweden)

Wen-Bing Yang

2017-11-01

Full Text Available Objective: To study the evaluation value of coronary CTA for coronary plaque properties and its correlation with inflammatory molecules and MMPs/TIMPs. Methods: Patients who were diagnosed with acute coronary syndrome in Renmin Hospital of Wuhan University between August 2014 and December 2016 were selected as the ACS group of the research, patients who were diagnosed with stable angina pectoris were selected as the SAP group of the research, and healthy subjects who received physical examination during the same period were selected as the control group of the research. Coronary CTA was done to determine the coronary plaque properties of ACS group, and serum was collected from the three groups of subjects to determine the contents of inflammatory molecules and MMPs/TIMPs collagen metabolites. Results: Serum MIP-1α, MCP-1, sFGL-2, sCD14, CXCL5, I-CTP, III-CTP and EMMPRIN contents of ACS group and SAP group were higher than those of control group while TIMP1, TIMP2 contents were lower than those of control group; serum MIP-1α, MCP-1, sFGL-2, sCD14, CXCL5, I-CTP, III-CTP and EMMPRIN contents of ACS group were higher than those of SAP group while TIMP1 and TIMP2 contents were lower than those of SAP group. Serum MIP-1α, MCP-1, sFGL-2, sCD14, CXCL5, I-CTP, III-CTP and EMMPRIN contents of ACS patients with soft plaque and fibrous plaque were higher than those of ACS patients with calcified plaque while TIMP1 and TIMP2 contents were lower than those of ACS patients with calcified plaque; serum MIP-1α, MCP-1, sFGL-2, sCD14, CXCL5, I-CTP, III-CTP and EMMPRIN contents of ACS patients with soft plaque were higher than those of ACS patients with fibrous plaque while TIMP1, TIMP2 contents were lower than those of ACS patients with fibrous plaque. Conclusion: The coronary plaque property evaluation by coronary CTA is closely related to the changes of inflammatory response and MMPs/TIMPs collagen metabolism.

Overexpression of TIMP-1 and Sensitivity to Topoisomerase Inhibitors in Glioblastoma Cell Lines

DEFF Research Database (Denmark)

Aaberg-Jessen, Charlotte; Fogh, Louise; Sørensen, Mia Dahl

2018-01-01

The multifunctional protein - tissue inhibitor of metalloproteinases-1 (TIMP-1) - has been associated with a poor prognosis in several types of cancers including glioblastomas. In addition, TIMP-1 has been associated with decreased response to chemotherapy, and especially the efficacy of the family...

Monoamine Oxidase Inhibitory Constituents of Propolis: Kinetics and Mechanism of Inhibition of Recombinant Human MAO-A and MAO-B

Directory of Open Access Journals (Sweden)

Narayan D. Chaurasiya

2014-11-01

Full Text Available Propolis is the resinous material that bees gather from leaf buds, flowers and vegetables. Propolis extracts contain constituents with a broad spectra of pharmacological properties and are important ingredients of popular dietary supplements. Propolis extracts were evaluated in vitro for inhibition of recombinant human monoamine oxidase (MAO-A and MAO-B. The dichloromethane extract of propolis showed potent inhibition of human MAO-A and MAO-B. Further fractionation identified the most active fractions as rich in flavonoids. Galangin and apigenin were identified as the principal MAO-inhibitory constituents. Inhibition of MAO-A by galangin was about 36 times more selective than MAO-B, while apigenin selectivity for MAO-A vs. MAO-B was about 1.7 fold. Apigenin inhibited MAO-B significantly more potently than galangin. Galangin and apigenin were further evaluated for kinetic characteristics and the mechanism for the enzymes’ inhibition. Binding of galangin and apigenin with MAO-A and -B was not time-dependent and was reversible, as suggested by enzyme-inhibitor binding and dissociation-dialysis assay. The inhibition kinetics studies suggested that galangin and apigenin inhibited MAO-A and -B by a competitive mechanism. Presence of prominent MAO inhibitory constituents in propolis products suggests their potential for eliciting pharmacological effects that might be useful in depression or other neurological disorders. The results may also have important implications in drug-dietary supplement interactions.

Low expression of tissue inhibitor of metalloproteinases-1 (TIMP-1) in glioblastoma predicts longer patient survival

DEFF Research Database (Denmark)

Aaberg-Jessen, Charlotte; Christensen, Karina; Offenberg, Hanne Kjær

2009-01-01

In colorectal cancer and breast cancer a high TIMP-1 level has been shown to correlate with a shorter overall patient survival and it has been suggested that TIMP-1 is involved in tumour invasion, proliferation and apoptosis in different types of cancers. TIMP-1 is known to be expressed in glioma...

Dynamic, adaptive changes in MAO-A binding after alterations in substrate availability: an in vivo [11C]-harmine positron emission tomography study

Science.gov (United States)

Sacher, Julia; Rabiner, Eugenii A; Clark, Michael; Rusjan, Pablo; Soliman, Alexandra; Boskovic, Rada; Kish, Stephen J; Wilson, Alan A; Houle, Sylvain; Meyer, Jeffrey H

2012-01-01

Monoamine oxidase A (MAO-A) is an important target in the pathophysiology and therapeutics of major depressive disorder, aggression, and neurodegenerative conditions. We measured the effect of changes in MAO-A substrate on MAO-A binding in regions implicated in affective and neurodegenerative disease with [11C]-harmine positron emission tomography in healthy volunteers. Monoamine oxidase A VT, an index of MAO-A density, was decreased (mean: 14%±9%) following tryptophan depletion in prefrontal cortex (PMAO-A in maintaining monoamine neurotransmitter homeostasis by rapidly compensating fluctuating monoamine levels. PMID:22186668

Pancreatic cancer stimulates pancreatic stellate cell proliferation and TIMP-1 production through the MAP kinase pathway

International Nuclear Information System (INIS)

Yoshida, Seiya; Yokota, Tokuyasu; Ujiki, Michael; Ding Xianzhong; Pelham, Carolyn; Adrian, Thomas E.; Talamonti, Mark S.; Bell, Richard H.; Denham, Woody

2004-01-01

Pancreatic adenocarcinoma is characterized by an intense desmoplastic reaction that surrounds the tumor. Pancreatic stellate cells (PSCs) are thought to be responsible for production of this extracellular matrix. When activated, PSCs have a myofibroblast phenotype and produce not only components of the extracellular matrix including collagen, fibronectin, and laminin, but also matrix metalloproteinases and tissue inhibitors of metalloproteinases (TIMPs). Since PSCs are found in the stroma surrounding human pancreatic adenocarcinoma, we postulate that pancreatic cancer could impact PSC proliferation and TIMP-1 production. Rat PSCs were isolated and cultured. Isolated PSCs were exposed to PANC-1 conditioned medium (CM) and proliferation, activation of the mitogen-activated protein (MAP) kinase pathway, and TIMP-1 gene induction were determined. Exposure to PANC-1 CM increased PSC DNA synthesis, cell number, and TIMP-1 mRNA (real-time PCR) as well as activating the extracellular-regulated kinase (ERK) 1/2. Inhibition of ERK 1/2 phosphorylation (U0126) prevented the increases in growth and TIMP-1 expression. PANC-1 CM stimulates PSC proliferation and TIMP-1 through the MAP kinase (ERK 1/2) pathway

Plasma levels of the MMP-9:TIMP-1 complex as prognostic biomarker in breast cancer: a retrospective study

International Nuclear Information System (INIS)

Thorsen, Stine B; Møller, Susanne; Brünner, Nils; Schrohl, Anne-Sofie; Stenvang, Jan; Christensen, Sarah LT; Würtz, Sidse Ø; Lundberg, Martin; Nielsen, Birgitte S; Vinther, Lena; Knowles, Mick; Gee, Nick; Fredriksson, Simon

2013-01-01

Worldwide more than one million women are annually diagnosed with breast cancer. A considerable fraction of these women receive systemic adjuvant therapy; however, some are cured by primary surgery and radiotherapy alone. Prognostic biomarkers guide stratification of patients into different risk groups and hence improve management of breast cancer patients. Plasma levels of Matrix Metalloproteinase-9 (MMP-9) and its natural inhibitor Tissue inhibitor of metalloproteinase-1 (TIMP-1) have previously been associated with poor patient outcome and resistance to certain forms of chemotherapy. To pursue additional prognostic information from MMP-9 and TIMP-1, the level of the MMP-9 and TIMP-1 complex (MMP-9:TIMP-1) was investigated in plasma from breast cancer patients. Detection of protein:protein complexes in plasma was performed using a commercially available ELISA kit and, for the first time, the highly sensitive in-solution proximity ligation assay (PLA). We screened plasma from 465 patients with primary breast cancer for prognostic value of the MMP-9:TIMP-1 complex. Both assays were validated and applied for quantification of MMP-9:TIMP-1 concentration. In this retrospective study, we analyzed the association between the concentration of the MMP-9:TIMP-1 complex and clinicopathological data and disease free survival (DFS) in univariate and multivariate survival analyses. Following successful validation both assays were applied for MMP-9:TIMP-1 measurements. Of the clinicopathological parameters, only menopausal status demonstrated significant association with the MMP-9:TIMP-1 complex; P = 0.03 and P = 0.028 for the ELISA and PLA measurements, respectively. We found no correlation between the MMP-9:TIMP-1 protein complex and DFS neither in univariate nor in multivariate survival analyses. Despite earlier reports linking MMP-9 and TIMP-1 with prognosis in breast cancer patients, we here demonstrate that plasma levels of the MMP-9:TIMP-1 protein complex hold no

Identification of alternatively spliced TIMP-1 mRNA in cancer cell lines and colon cancer tissue

DEFF Research Database (Denmark)

Usher, Pernille Autzen; Sieuwerts, A.M.; Bartels, Annette

2007-01-01

TIMP-1 is a promising new candidate as a prognostic marker in colorectal and breast cancer. We now describe the discovery of two alternatively spliced variants of TIMP-1 mRNA. The two variants lacking exon 2 (del-2) and 5 (del-5), respectively, were identified in human cancer cell lines by RT......-PCR. The del-2 variant was, furthermore, detected in extracts from 12 colorectal cancer tissue samples. By western blotting additional bands of lower molecular mass than full-length TIMP-1 were identified in tumor tissue, but not in plasma samples obtained from cancer patients. The two splice variants of TIMP...

TIMP-1 increases expression and phosphorylation of proteins associated with drug resistance in breast cancer cells

DEFF Research Database (Denmark)

Hekmat, Omid; Munk, Stephanie; Fogh, Louise

2013-01-01

may explain the resistance phenotype to topoisomerase inhibitors that was observed in cells with high TIMP-1 levels. Pathway analysis showed an enrichment of proteins from functional categories such as apoptosis, cell cycle, DNA repair, transcription factors, drug targets and proteins associated......Tissue inhibitor of metalloproteinase 1 (TIMP-1) is a protein with a potential biological role in drug resistance. To elucidate the unknown molecular mechanisms underlying the association between high TIMP-1 levels and increased chemotherapy resistance, we employed SILAC-based quantitative mass...... spectrometry to analyze global proteome and phosphoproteome differences of MCF-7 breast cancer cells expressing high or low levels of TIMP-1. In TIMP-1 high expressing cells, 312 proteins and 452 phosphorylation sites were up-regulated. Among these were the cancer drug targets topoisomerase 1, 2A and 2B, which...

Study of a possible role of the monoamine oxidase A (MAOA) gene in paranoid schizophrenia among a Chinese population.

Science.gov (United States)

Sun, Yuhui; Zhang, Jiexu; Yuan, Yanbo; Yu, Xin; Shen, Yan; Xu, Qi

2012-01-01

Monoamine oxidase A (MAOA) is the enzyme responsible for degradation of several monoamines, such as dopamine and serotonin that are considered as being two of the most important neurotransmitters involved in the pathophysiology of schizophrenia. To study a possible role of the MAOA gene in conferring susceptibility to schizophrenia, the present study genotyped the variable number of tandem repeat (VNTR) polymorphism and 41 SNPs across this gene among 555 unrelated patients with paranoid schizophrenia and 567 unrelated healthy controls. Quantitative real-time PCR analysis was employed to quantify expression of MAOA mRNA in 73 drug-free patients. While none of these genotyped DNA markers showed allelic association with paranoid schizophrenia, haplotypic association was found for the VNTR-rs6323, VNTR-rs1137070, and VNTR-rs6323-rs1137070 haplotypes in female subjects. Nevertheless, no significant change of the expression of MAOA mRNA was detected in either female or male patients with paranoid schizophrenia. Our study suggests that the interaction between genetic variants within the MAOA gene may contribute to an increased risk of paranoid schizophrenia, but the precise mechanism needs further investigation. Copyright © 2011 Wiley Periodicals, Inc.

Desarrollo del hueso timpánico como estimador de edad

OpenAIRE

García Mancuso, Rocío; Sbatella, A.; Desántolo, Bárbara; Plischuk, Marcos; Prat, Guillermo Daniel; Inda, Ana María

2010-01-01

El hueso temporal es un complejo de osificación intramembranosa y endocondral que forma parte del neurocráneo y en edades tempranas se encuentra separado distinguiéndose tres partes: porción escamosa, porción petromastoiea y anillo timpánico. El desarrollo del hueso timpánico fue propuesto como estimador de edad dado que presenta una serie de modificaciones que lo caracterizan. Este proceso fue evaluado por Weaver (1979) definiendo 6 estadios de desarrollo que servirían de estimador de edad d...

Desarrollo del hueso timpánico como estimador de edad

OpenAIRE

García Mancuso, Rocío; Desántolo, Bárbara; Plischuk, Marcos; Prat, Guillermo Daniel; Inda, Ana María

2013-01-01

Este trabajo se propone evaluar el desarrollo del hueso temporal como estimador de edad en el período perinatal. El hueso temporal es un complejo de osificación intramembranosa y endocondral que forma parte del neurocráneo y en edades tempranas se encuentra separado distinguiéndose tres partes: porción escamosa, porción petromastoiea y anillo timpánico. El desarrollo del hueso timpánico fue propuesto como estimador de edad dado que presenta una serie de modificaciones que lo caracterizan....

Impact of elective resection on plasma TIMP-1 levels in patients with colon cancer

DEFF Research Database (Denmark)

Hammer, J. H.; Basse, L.; Svedsen, M. N.

2006-01-01

-1 measurements. PATIENTS AND METHODS: Consecutively, 48 patients with colon cancer (CC) and 12 patients with nonmalignant colonic disease were randomised to undergo elective laparoscopically assisted or open resection followed by fast track recovery. Plasma samples were collected just before and 1......OBJECTIVE: Pre- and post-operative plasma tissue inhibitor of metalloproteinases-1 (TIMP-1) levels have a prognostic impact on patients with colorectal cancer. However, the surgical trauma may play an essential role in regulation of plasma TIMP-1 levels, which in turn may influence subsequent TIMP...

Impact of elective resection on plasma TIMP-1 levels in patients with colon cancer

DEFF Research Database (Denmark)

Hammer, J. H.; Basse, L.; Svedsen, M. N.

2006-01-01

OBJECTIVE: Pre- and post-operative plasma tissue inhibitor of metalloproteinases-1 (TIMP-1) levels have a prognostic impact on patients with colorectal cancer. However, the surgical trauma may play an essential role in regulation of plasma TIMP-1 levels, which in turn may influence subsequent TIMP......-1 measurements. PATIENTS AND METHODS: Consecutively, 48 patients with colon cancer (CC) and 12 patients with nonmalignant colonic disease were randomised to undergo elective laparoscopically assisted or open resection followed by fast track recovery. Plasma samples were collected just before and 1...

Tissue inhibitor of metalloproteinase 1 (TIMP-1) as a biomarker in gastric cancer

DEFF Research Database (Denmark)

Grunnet, Mie; Mau-Sørensen, Morten; Brünner, Nils

2013-01-01

The value of Tissue Inhibitor of MetalloProteinase-1 (TIMP-1) as a biomarker in patients with gastric cancer (GC) is widely debated. The aim of this review is to evaluate available literature describing the association between levels of TIMP-1 in tumor tissue and/or blood and the prognosis...

Development of TIMP1 magnetic nanoformulation for regulation of synaptic plasticity in HIV-1 infection

Directory of Open Access Journals (Sweden)

Atluri VSR

2016-08-01

Full Text Available Venkata Subba Rao Atluri* Rahul Dev Jayant* Sudheesh Pilakka-Kanthikeel, Gabriella Garcia, Thangavel Samikkannu, Adriana Yndart, Ajeet Kaushik, Madhavan Nair Center for Personalized Nanomedicine, Department of Immunology, Herbert Wertheim College of Medicine, Florida International University, Miami, FL, USA *These authors contributed equally to this work Abstract: Although the introduction of antiretroviral therapy has reduced the prevalence of severe forms of neurocognitive disorders, human immunodeficiency virus (HIV-1-associated neurocognitive disorders were observed in 50% of HIV-infected patients globally. The blood–brain barrier is known to be impermeable to most of antiretroviral drugs. Successful delivery of antiretroviral drugs into the brain may induce an inflammatory response, which may further induce neurotoxicity. Therefore, alternate options to antiretroviral drugs for decreasing the HIV infection and neurotoxicity may help in reducing neurocognitive impairments observed in HIV-infected patients. In this study, we explored the role of magnetic nanoparticle (MNP-bound tissue inhibitor of metalloproteinase-1 (TIMP1 protein in reducing HIV infection levels, oxidative stress, and recovering spine density in HIV-infected SK-N-MC neuroblastoma cells. We did not observe any neuronal cytotoxicity with either the free TIMP1 or MNP-bound TIMP1 used in our study. We observed significantly reduced HIV infection in both solution phase and in MNP-bound TIMP1-exposed neuronal cells. Furthermore, we also observed significantly reduced reactive oxygen species production in both the test groups compared to the neuronal cells infected with HIV alone. To observe the effect of both soluble-phase TIMP1 and MNP-bound TIMP1 on spine density in HIV-infected neuronal cells, confocal microscopy was used. We observed significant recovery of spine density in both the test groups when compared to the cells infected with HIV alone, indicting the

42 CFR 426.406 - Ex parte contacts.

Science.gov (United States)

2010-10-01

... 42 Public Health 3 2010-10-01 2010-10-01 false Ex parte contacts. 426.406 Section 426.406 Public Health CENTERS FOR MEDICARE & MEDICAID SERVICES, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED... LCD § 426.406 Ex parte contacts. No party or person (except employees of the ALJ's office...

Vaginal Lactoferrin Modulates PGE2, MMP-9, MMP-2, and TIMP-1 Amniotic Fluid Concentrations

Directory of Open Access Journals (Sweden)

Alessandro Trentini

2016-01-01

Full Text Available Inflammation plays an important role in pregnancy, and cytokine and matrix metalloproteases (MMPs imbalance has been associated with premature rupture of membranes and increased risk of preterm delivery. Previous studies have demonstrated that lactoferrin (LF, an iron-binding protein with anti-inflammatory properties, is able to decrease amniotic fluid (AF levels of IL-6. Therefore, we aimed to evaluate the effect of vaginal LF administration on amniotic fluid PGE2 level and MMP-TIMP system in women undergoing genetic amniocentesis. One hundred and eleven women were randomly divided into controls (n=57 or treated with LF 4 hours before amniocentesis (n=54. Amniotic fluid PGE2, active MMP-9 and MMP-2, and TIMP-1 and TIMP-2 concentrations were determined by commercially available assays and the values were normalized by AF creatinine concentration. PGE2, active MMP-9, and its inhibitor TIMP-1 were lower in LF-treated group than in controls (p<0.01, p<0.005, and p<0.001, resp.. Conversely, active MMP-2 (p<0.0001 and MMP-2/TIMP-2 molar ratio (p<0.001 were increased, whilst TIMP-2 was unchanged. Our data suggest that LF administration is able to modulate the inflammatory response following amniocentesis, which may counteract cytokine and prostanoid imbalance that leads to abortion. This trial is registered with Clinical Trial number NCT02695563.

TIMP1 overexpression mediates resistance of MCF-7 human breast cancer cells to fulvestrant and down-regulates progesterone receptor expression

DEFF Research Database (Denmark)

Bjerre, Christina; Vinther, Lena; Belling, Kirstine C.

2013-01-01

is associated with endocrine sensitivity. We established a panel of 11 MCF-7 subclones with a wide range of TIMP1 mRNA and protein expression levels. Cells with high expression of TIMP1 versus low TIMP1 displayed significantly reduced sensitivity to the antiestrogen fulvestrant (ICI 182,780, Faslodex®), while......, the effects of fulvestrant, 4-hydroxytamoxifen, or estrogen on estrogen receptor expression were not associated with TIMP1 levels. Gene expression analyses revealed associations between expression of TIMP1 and genes involved in metabolic pathways, epidermal growth factor receptor 1/cancer signaling pathways......, and cell cycle. Gene and protein expression analyses showed no general defects in estrogen receptor signaling except from lack of progesterone receptor expression and estrogen inducibility in clones with high TIMP1. The present study suggests a relation between high expression level of TIMP1 and loss...

Conditionally replicating adenovirus expressing TIMP2 increases survival in a mouse model of disseminated ovarian cancer.

Directory of Open Access Journals (Sweden)

Sherry W Yang

Full Text Available Ovarian cancer remains difficult to treat mainly due to presentation of the disease at an advanced stage. Conditionally-replicating adenoviruses (CRAds are promising anti-cancer agents that selectively kill the tumor cells. The present study evaluated the efficacy of a novel CRAd (Ad5/3-CXCR4-TIMP2 containing the CXCR4 promoter for selective viral replication in cancer cells together with TIMP2 as a therapeutic transgene, targeting the matrix metalloproteases (MMPs in a murine orthotopic model of disseminated ovarian cancer. An orthotopic model of ovarian cancer was established in athymic nude mice by intraperitonal injection of the human ovarian cancer cell line, SKOV3-Luc, expressing luciferase. Upon confirmation of peritoneal dissemination of the cells by non-invasive imaging, mice were randomly divided into four treatment groups: PBS, Ad-ΔE1-TIMP2, Ad5/3-CXCR4, and Ad5/3-CXCR4-TIMP2. All mice were imaged weekly to monitor tumor growth and were sacrificed upon reaching any of the predefined endpoints, including high tumor burden and significant weight loss along with clinical evidence of pain and distress. Survival analysis was performed using the Log-rank test. The median survival for the PBS cohort was 33 days; for Ad-ΔE1-TIMP2, 39 days; for Ad5/3-CXCR4, 52.5 days; and for Ad5/3-CXCR4-TIMP2, 63 days. The TIMP2-armed CRAd delayed tumor growth and significantly increased survival when compared to the unarmed CRAd. This therapeutic effect was confirmed to be mediated through inhibition of MMP9. Results of the in vivo study support the translational potential of Ad5/3-CXCR4-TIMP2 for treatment of human patients with advanced ovarian cancer.

Development of a YAC contig covering the minimal region of a CSNB1 locus in Xp11

Energy Technology Data Exchange (ETDEWEB)

Boycott, K.M.; Gratton, K.J.; Moore, B.J. [Univ. of Calgary (Canada)] [and others

1994-09-01

X-linked congenital stationary night blindness (CSNB1) is an eye disorder that includes impairment of night vision, reduced visual acuity and, in some cases, myopia and congenital nystagmus. Electroretinography reveals a marked reduction of the b-wave in affected individuals suggesting that X-linked CSNB is due to a molecular defect in the bipolar layer of the retina. Based on our studies of a large four generation family with X-linked CSNB, a CSNB1 locus was mapped to a 4-5 cM region at Xp11.23-Xp11.22 bounded telomerically by DXS426 and centromerically by DXS988. Using a panel of radiation and conventional somatic cell hybrids, a detailed map of new and published STSs has been generated for the minimal region of CSNB1. PCR primer pairs for STSs has been generated for the minimal region of CSNB1. PCR primer pairs for twenty-five STSs, including eleven end-clones, were used to isolate YAC clones from CEPH, mega-CEPH, and X chromosome-specific YAC libraries. In total, fifty-two YACs were characterized for STS overlaps and assembled to provide a minimum of 3 Mb of physical coverage in the region between DXS426 and DXS988. Five gaps proximal to SYP are still to be closed. Our physical map suggests the following gene order: Xpter-OTAL1-GF1-DXS1011E-MG81-HUMCRAS2P-SYP-Xcen. STS analysis of the YACs revealed three subregions of the physical map which appear to be particularly susceptible to internal deletions and end-clone analysis demonstrated chimerism in six of seventeen YACs. A physical map of Xp11.23-Xp11.22 will provide a resource for the isolation of candidate genes for the X-linked CSNB gene which maps to this region.

Urinary biomarkers TIMP-2 and IGFBP7 early predict acute kidney injury after major surgery.

Directory of Open Access Journals (Sweden)

Ivan Gocze

Full Text Available To assess the ability of the urinary biomarkers IGFBP7 (insulin-like growth factor-binding protein 7 and TIMP-2 (tissue inhibitor of metalloproteinase 2 to early predict acute kidney injury (AKI in high-risk surgical patients.Postoperative AKI is associated with an increase in short and long-term mortality. Using IGFBP7 and TIMP-2 for early detection of cellular kidney injury, thus allowing the early initiation of renal protection measures, may represent a new concept of evaluating renal function.In this prospective study, urinary [TIMP-2]×[IGFBP7] was measured in surgical patients at high risk for AKI. A predefined cut-off value of [TIMP-2]×[IGFBP7] >0.3 was used for assessing diagnostic accuracy. Perioperative characteristics were evaluated, and ROC analyses as well as logistic regression models of risk assessment were calculated with and without a [TIMP-2]×[IGFBP7] test.107 patients were included in the study, of whom 45 (42% developed AKI. The highest median values of biomarker were detected in septic, transplant and patients after hepatic surgery (1.24 vs 0.45 vs 0.47 ng/l²/1000. The area under receiving operating characteristic curve (AUC for the risk of any AKI was 0.85, for early use of RRT 0.83 and for 28-day mortality 0.77. In a multivariable model with established perioperative risk factors, the [TIMP-2]×[IGFBP7] test was the strongest predictor of AKI and significantly improved the risk assessment (p<0.001.Urinary [TIMP-2]×[IGFBP7] test sufficiently detect patients with risk of AKI after major non-cardiac surgery. Due to its rapid responsiveness it extends the time frame for intervention to prevent development of AKI.

Amlodipine and Atorvastatin Improved Hypertensive Cardiac Remodeling through Regulation of MMPs/TIMPs in SHR Rats

Directory of Open Access Journals (Sweden)

Jingchao Lu

2016-06-01

Full Text Available Background: MMPs/TIMPs system is well known to play important roles in pressure overload-induced cardiac remodeling, and Amlodipine and Atorvastatin have been showed to exert favourable protective effects on cardiovascular disease, however, it is not clear whether Amlodipine and Atorvastatin can improve hypertensive cardiac remodeling and whether the MMPs/TIMPs system is involved. The present study aims to answer these questions. Methods: 36 weeks old male spontaneous hypertension (SHR rats were randomly divided into four groups: 1. SHR control group, 2. Amlodipine alone (10 mg/kg/d group, 3. Atorvastatin alone (10 mg/kg/d group, 4.Combination of Amlodipine and Atorvastatin (10 mg/kg/d for each group. Same gender, weight and age of Wistar-Kyoto (WKY rats with normal blood pressure were used as normal control. Drugs were administered by oral gavage over 12 weeks. The blood pressure and left ventricle mass index were measured. Enzyme activity of MMP-2 and MMP-9 was assessed with Gelatin zymography. MMP-2, MMP-9, TIMP-1 and TIMP-2 mRNA and protein expression was studied by RT-PCR and Western blot. Single factor ANOVA and LSD-t test were used in statistical analysis. Results: Treatment with Amlodipine alone or combination with atorvastatin significantly decreased blood pressure, left ventricle mass index in SHR rats (P Conclusion: Amlodipine and Atorvastatin could improve ventricular remodeling in SHR rats through intervention with the imbalance of MMP-2/TIMP-2 and MMP-9/TIMP-1 system.

O papel do polimorfismo funcional VNTR da região promotora do gene MAOA nos transtornos psiquiátricos

Directory of Open Access Journals (Sweden)

Sílvia A. Nishioka

2011-01-01

Full Text Available INTRODUÇÃO: Muitos estudos têm investigado a associação do polimorfismo VNTR (número variável de repetições em série localizado na região promotora do gene da enzima monoamina oxidase A (MAOA com alterações no comportamento humano e em diversos transtornos psiquiátricos. OBJETIVO: O objetivo do presente trabalho foi revisar a literatura sobre a participação desse polimorfismo funcional na modulação do comportamento humano para o desenvolvimento dos transtornos psiquiátricos. MÉTODO: A pesquisa foi realizada na literatura em inglês, de janeiro de 1998 a junho de 2009, disponível no Medline, Embase, Web of Science e na base de dados PsycInfo, utilizando os seguintes termos: "MAOA e comportamento humano" e "MAOA e psiquiatria". RESULTADOS: Foram encontrados 3.873 estudos. Desses, 109 foram selecionados e incluídos na revisão. Encontrou-se associação de alelos de baixa atividade do VNTR com transtorno de personalidade antissocial, transtorno de conduta, transtorno de déficit de atenção e hiperatividade, jogo patológico e dependência de substâncias. Alelos da alta atividade da MAOA foram associados a depressão, ansiedade, neuroticismo e anorexia nervosa. Não se encontrou associação entre polimorfismos da MAOA e esquizofrenia e transtorno bipolar. CONCLUSÃO: Os principais achados dão suporte ao papel do polimorfismo VNTR da região promotora do gene da MAOA em alguns transtornos psiquiátricos, apesar das divergências encontradas devidas às dificuldades metodológicas de estudos em genética. De modo geral, os estudos associam os alelos de baixa atividade da MAOA com comportamentos impulsivos e agressivos ("comportamentos hiperativos", enquanto os alelos de alta atividade do gene são mais associados a "comportamentos hipoativos".

Brain morphometric correlates of MAOA-uVNTR polymorphism in violent behavior

Directory of Open Access Journals (Sweden)

C. Romero-Rebollar

2015-01-01

Discussion: This findings suggests that grey matter integrity in superior temporal pole could be a neurobiological correlate of the allelic association between MAOA-uVNTR polymorphism and violent behavior due to its implication in socio-emotional processing.

MAOA/B deletion syndrome in male siblings with severe developmental delay and sudden loss of muscle tonus.

Science.gov (United States)

Saito, Mari; Yamagata, Takanori; Matsumoto, Ayumi; Shiba, Yusuke; Nagashima, Masako; Taniguchi, Shuhei; Jimbo, Eriko; Momoi, Mariko Y

2014-01-01

Deletion of the monoamine oxidase (MAO)-A and MAO-B was detected in two male siblings and in their mother. The approximately 800-kb deletion, extending from about 43.0MB to 43.8MB, was detected by array comparative genomic hybridization analysis. The MAOA and MAOB genes were included in the deletion, but the adjacent Norrie disease gene, NDP, was not deleted. The boys had short stature, hypotonia, severe developmental delays, episodes of sudden loss of muscle tone, exiting behavior, lip-smacking and autistic features. The serotonin levels in their cerebrospinal fluid were extremely elevated. Another set of siblings with this deletion was reported previously. We propose recognition of MAOA/B deletion syndrome as a distinct disorder. Copyright © 2013 The Japanese Society of Child Neurology. Published by Elsevier B.V. All rights reserved.

Association between tumor tissue TIMP-1 levels and objective response to first-line chemotherapy in metastatic breast cancer

DEFF Research Database (Denmark)

Klintman, Marie; Würtz, Sidse Ørnbjerg; Christensen, Ib Jarle

2010-01-01

.07). This OR is very similar to the result from our previous study. Increasing levels of TIMP-1 were also associated with a shorter disease-free survival and overall survival, however, not statistically significant. The results from the present study support previous data that TIMP-1 is associated with objective......In a previous study from our laboratory, high tumor levels of tissue inhibitor of metalloproteinases-1 (TIMP-1) have been associated with an adverse response to chemotherapy in metastatic breast cancer suggesting that TIMP-1, which is known to inhibit apoptosis, may be a new predictive marker...

Lack of relationship between TIMP-1 tumour cell immunoreactivity, treatment efficacy and prognosis in patients with advanced epithelial ovarian cancer

International Nuclear Information System (INIS)

Steffensen, Karina Dahl; Waldstrøm, Marianne; Christensen, Rikke Kølby; Bartels, Annette; Brünner, Nils; Jakobsen, Anders

2010-01-01

Tissue inhibitor of metalloproteinase 1 (TIMP-1) is a natural inhibitor of the matrix metalloproteinases (MMPs) which are proteolytic enzymes involved in degradation of extracellular matrix thereby favoring tumour cell invasion and metastasis. TIMP-1 activity in tumour tissue may therefore play an essential role in the progression of a malignant tumour. The primary aim of the present study was to evaluate TIMP-1 protein immunoreactivity in tissue from primary ovarian cancer patients and associate these findings with the course of the disease including response to treatment in the individual patient. TIMP-1 was assessed by immunohistochemistry (in tissue micro arrays) in a total of 163 ovarian cancer specimens obtained from primary debulking surgery during 1991-1994 as part of a randomized clinical protocol. Positive TIMP-1 immunoreactivity was found in 12.3% of the tumours. The median survival time for the 143 patients with TIMP-1 negative tumours was 23.7 months [19.0-29.4] 95% CI, while the median survival time for the 20 patients with TIMP-1 positive tumours was 15.9 months [12.3-27.4] 95% CI. Although a difference of 7.8 months in median overall survival in favor of the TIMP-1 tumour negative patients was found, this difference did not reach statistical significance (p = 0.28, Kaplan-Meier, log-rank test). Moreover, TIMP-1 immunoreactivity was not associated with CA125 response (p = 0.53) or response at second look surgery (p = 0.72). TIMP-1 immunoreactivity in tumour tissue from patients with primary epithelial ovarian cancer did not correlate with patient survival or response to combination platinum/cyclophosphamide therapy

17 CFR 256.426.1 - Donations.

Science.gov (United States)

2010-04-01

... 17 Commodity and Securities Exchanges 3 2010-04-01 2010-04-01 false Donations. 256.426.1 Section... COMPANY ACT OF 1935 Income and Expense Accounts § 256.426.1 Donations. This account shall include all payments or donations for charitable, social or community welfare purposes. ...

38 CFR 4.26 - Bilateral factor.

Science.gov (United States)

2010-07-01

... 38 Pensions, Bonuses, and Veterans' Relief 1 2010-07-01 2010-07-01 false Bilateral factor. 4.26... DISABILITIES General Policy in Rating § 4.26 Bilateral factor. When a partial disability results from disease... disability. The bilateral factor will be applied to such bilateral disabilities before other combinations are...

MAO-A inhibitory activity of quercetin from Calluna vulgaris (L.) Hull

DEFF Research Database (Denmark)

Saaby, Lasse; Rasmussen, Hasse Bonde; Jäger, Anna Katharina

2009-01-01

AIM OF THE STUDY: This study investigated MAO-A inhibitory activity of methanol extract of Calluna vulgaris (L.) Hull., which traditionally has been used as a nerve calming remedy. MATERIALS AND METHODS: A methanolic extract of Calluna vulgaris was partitioned against heptane, ethyl acetate...

24 CFR 570.426 - Program income.

Science.gov (United States)

2010-04-01

... 24 Housing and Urban Development 3 2010-04-01 2010-04-01 false Program income. 570.426 Section 570... in Hawaii and Insular Areas Programs § 570.426 Program income. (a) The provisions of § 570.504(b) apply to all program income generated by a specific grant and received prior to grant closeout. (b) If...

Effect of collagen type IV, MMPs and TIMPs on remodeling of radiation pulmonary injury

International Nuclear Information System (INIS)

Diao Ruiying; Song Liangwen; Wang Shaoxia; Yin Jiye

2007-01-01

Objective: To explore the effect of collagen type IV, matrix metalloproteinases (MMPs) and tissue inhibitors of MMPs(TIMPs) on early remodeling after radiation pulmonary injury. Methods: Right lungs of rats were irradiated by 60 Co γ-rays at a dose of 20 Gy to induce radiation pulmonary injury, and the lung specimens were taken at weeks 1, 2, 4 after irradiation. Quantitative analysis was performed on pulmonary collagen type IV, MMP-2, MMP-9, TIMP-2, TIMP-1 at the level of gene expression and protein synthesis using real-time PCR or immunohistochemistry. Results: Gene detection using real-time PCR: gene expression of collagen type IV increased at week 1 and decreased at week 2 after irradiation; MMP-2 reached peak at week 2 in which an opposed alteration trend was displayed; MMP-9 appeared a significant trend of elevation, then decrease and elevation again which was similar to those of collagen type IV; expression of TIMP-1 was lower, and there was no marked difference among all time points; TIMP-2 displayed a trend of slight elevation, then decrease and elevation again, which was opposed to MMP-2. Immunohistochemistry-image analysis: Pulmonary collagen type IV obviously increased at week 1, and began to decrease at week 2; MMP-2 decreased at week 2 and then increased; an opposed alteration trend to that of collagen type IV was displayed; alteration trend of MMP-9 was similar to that of collagen type IV but the extent was higher; gene expression of TIMP-1 slightly increased at 2 week and an opposed trend to of MMP-9 was displayed. Conclusions: Collagen type IV, MMP-2, MMP-9 and their tissue inhibitors were involved in ineffective remodeling in the early radiation pulmonary injury; MMP-2 and MMP-9 play an important role in degradation of collagen type IV; Disturbance of collagen type IV degradation might have relationship with the initiation of pulmonary fibrosis. (authors)

Isolation of a random cosmid clone, cX5, which defines a new polymorphic locus DXS148 near the locus for Duchenne muscular dystrophy

NARCIS (Netherlands)

Hofker, M. H.; Bergen, A. A.; Skraastad, M. I.; Bakker, E.; Francke, U.; Wieringa, B.; Bartley, J.; van Ommen, G. J.; Pearson, P. L.

1986-01-01

We have isolated a random cosmid cX5 (DXS148), which maps into a small Xp21 deletion associated with Duchenne muscular dystrophy (DMD), chronic granulomatous disease (CGD), retinitis pigmentosa (RP) and McLeod syndrome, cX5 maps proximally outside several other deletions associated with DMD,

A dual role for microglia in promoting tissue inhibitor of metalloproteinase (TIMP expression in glial cells in response to neuroinflammatory stimuli

Directory of Open Access Journals (Sweden)

Milner Richard

2011-06-01

Full Text Available Abstract Background By neutralizing the effect of the matrix metalloproteinases (MMPs, the tissue inhibitors of matrix metalloproteinases (TIMPs play a critical role in maintaining tissue proteolysis in balance. As the major reactive glial cell types in the central nervous system (CNS, microglia and astrocytes play fundamental roles in mediating tissue breakdown and repair. As such, it is important to define the TIMP expression profile in these cells, as well as the mechanisms of regulation by neuroinflammatory stimuli. Methods Primary mixed glial cultures (MGC, pure microglia, and pure astrocytes were used in this study. To study astrocytes, we employed a recently described pure astrocyte culture system, which has the major advantage of totally lacking microglia. The three different types of culture were treated with lipopolysaccharide (LPS or individual cytokines, and cell culture supernatants assayed for TIMP-1 or TIMP-2 protein expression by western blot. Results LPS induced TIMP-1 expression in MGC, but not in pure astrocyte or microglial cultures. When pure astrocytes were treated with the cytokines IL-1β, IFN-γ, TNF or TGF-β1, only IL-1β induced TIMP-1 expression. Significantly, astrocyte TIMP-1 expression was restored in LPS-treated astrocyte cultures after the addition of microglia, or conditioned medium taken from LPS-activated microglia (MG-CM. Furthermore, this effect was lost after depletion of IL-1β from MG-CM. By contrast, TIMP-2 was constitutively expressed by astrocytes, whereas microglia expressed TIMP-2 only after exposure to serum. Conclusions Taken together, these results demonstrate an important concept in glial interactions, by showing that microglia play a central role in regulating glial cell expression of TIMPs, and identify microglial IL-1β as playing a key role in mediating microglial-astrocyte communication.

The Association between Infants' Self-Regulatory Behavior and MAOA Gene Polymorphism

Science.gov (United States)

Zhang, Minghao; Chen, Xinyin; Way, Niobe; Yoshikawa, Hirokazu; Deng, Huihua; Ke, Xiaoyan; Yu, Weiwei; Chen, Ping; He, Chuan; Chi, Xia; Lu, Zuhong

2011-01-01

Self-regulatory behavior in early childhood is an important characteristic that has considerable implications for the development of adaptive and maladaptive functioning. The present study investigated the relations between a functional polymorphism in the upstream region of monoamine oxidase A gene (MAOA) and self-regulatory behavior in a sample…

Evaluation of tissue metalloproteinase inhibitor TIMP-1 and Survivin levels during third trimester pregnancy - a preliminary report.

Science.gov (United States)

Karowicz-Bilińska, Agata; Kowalska-Koprek, Urszula; Estemberg, Dorota; Sikora-Szubert, Anita

2017-01-01

A proper implantation of trophoblastic cells and an appropriate metalloproteinases activity is required to cause disintegration of basal membranes of cells. The activity of tissue matrix metaloproteinases can be inhibited by their matrix inhibitors - TIMP-s. Survivin is a member of inhibitor of apoptosis proteins family (IAP), that suppresses caspase activation, influences VEGF expression and promotes proliferative action of endothelial cells. The aim of the study was to assess concentrations of two independent anti-apoptotic factors. TIMP-1 and survivin in serum of women in their third trimester of pregnancy and in umbilical cord blood of neonates - drawn separately from veins and arteries. The study group consisted of 29 pregnant women in physiological pregnancy and with correct fetal development, in gestational age between 37 to 40 weeks of gestation. Blood used in the study was collected from maternal cubital fossa veins and from neonatal umbilical cords (from veins and from arteries separately). The research was conducted using TIMP-1 and Survivin ELISA kits from R & D Systems according to manufacturers' recommendations and protocols. The concentrations of TIMP-1 were similar and independent of the source of blood samples. Arterial values of TIMP-1 in umbilical cord compared to maternal and fetal veins were slightly lower, but no statistical difference was found. The mean concentrations of Survivin were comparable but we found that in some cases the results in cord blood serum in both vessels-vein and arteries were almost negative. Arterial values of Survivin in umbilical cord compared to maternal blood were higher, but no statistical difference was found. In III-rd trimester of pregnancy parameters of Timp-1 and Survivin - anti-apoptotic substances concentration were similar in maternal and cord blood in both artery and vein. We found no increased activity of selected antiapoptotic factors.

Cell surface-bound TIMP3 induces apoptosis in mesenchymal Cal78 cells through ligand-independent activation of death receptor signaling and blockade of survival pathways.

Directory of Open Access Journals (Sweden)

Christina Koers-Wunrau

Full Text Available BACKGROUND: The matrix metalloproteinases (MMPs and their endogenous regulators, the tissue inhibitor of metalloproteinases (TIMPs 1-4 are responsible for the physiological remodeling of the extracellular matrix (ECM. Among all TIMPs, TIMP3 appears to play a unique role since TIMP3 is a secreted protein and, unlike the other TIMP family members, is tightly bound to the ECM. Moreover TIMP3 has been shown to be able to induce apoptotic cell death. As little is known about the underlying mechanisms, we set out to investigate the pro-apoptotic effect of TIMP3 in human mesenchymal cells. METHODOLOGY/PRINCIPAL FINDINGS: Lentiviral overexpression of TIMP3 in mesenchymal cells led to a strong dose-dependent induction of ligand-independent apoptosis as reflected by a five-fold increase in caspase 3 and 7 activity compared to control (pLenti6/V5-GW/lacZ or uninfected cells, whereas exogenous TIMP3 failed to induce apoptosis. Concordantly, increased cleavage of death substrate PARP and the caspases 3 and 7 was observed in TIMP3 overexpressing cultures. Notably, activation of caspase-8 but not caspase-9 was observed in TIMP3-overexpressing cells, indicating a death receptor-dependent mechanism. Moreover, overexpression of TIMP3 led to a further induction of apoptosis after stimulation with TNF-alpha, FasL and TRAIL. Most interestingly, TIMP3-overexpression was associated with a decrease in phosphorylation of cRaf, extracellular signal-regulated protein kinase (Erk1/2, ribosomal S6 kinase (RSK1 and Akt and serum deprivation of TIMP3-overexpressing cells resulted in a distinct enhancement of apoptosis, pointing to an impaired signaling of serum-derived survival factors. Finally, heparinase treatment of heparan sulfate proteoglycans led to the release of TIMP3 from the surface of overexpressing cells and to a significant decrease in apoptosis indicating that the binding of TIMP3 is necessary for apoptosis induction. CONCLUSION: The results demonstrate that

Regulation of MT1-MMP/MMP-2/TIMP-2 axis in human placenta

Directory of Open Access Journals (Sweden)

Vincent ZL

2015-10-01

Full Text Available Zoë L Vincent,1,2 Murray D Mitchell,l,3 Anna P Ponnampalam1,2 1Liggins Institute, 2Gravida: National Centre for Growth and Development, University of Auckland, Auckland, New Zealand; 3University of Queensland Centre for Clinical Research, Brisbane, QLD, Australia Abstract: Matrix metalloproteinases (MMPs and specific endogenous tissue inhibitors of metalloproteinases (TIMPs mediate rupture of the fetal membranes in both physiological and pathological conditions. MMPs and TIMPs are subject to regulation by DNA methylation in human malignancies and pre-eclampsia. To determine if membrane type 1 MMP (MT1-MMP, MMP2, and TIMP2 are regulated by DNA methylation in human placentas, we employed an in vitro model where human placental tissues were collected at term gestation and cultured with methylation inhibiting agent 5-aza-2′deoxycytidine (AZA and lipopolysaccharide. The results suggest that DNA methylation is not directly involved in the regulation of MT1-MMP in placental tissue; however, remodeling of chromatin by a pharmacologic agent such as AZA potentiates an infection-related increase in MT1-MMP. MT1-MMP is a powerful activator of MMP2 and this action, coupled with either no change or a decrease in TIMP2 concentrations, favors a gelatinolytic state leading to extracellular matrix degradation, which could predispose fetal membranes to rupture prematurely during inflammation. Keywords: placenta, epigenetic regulation, DNA methylation, MMPs, labor

MMP3 and TIMP1 variants contribute to chronic periodontitis and may be implicated in disease progression.

Science.gov (United States)

Letra, Ariadne; Silva, Renato M; Rylands, Ryan J; Silveira, Elcia M; de Souza, Ana P; Wendell, Steven K; Garlet, Gustavo P; Vieira, Alexandre R

2012-08-01

Matrix metalloproteinases (MMPs) play a key role in the tissue destruction characteristic of chronic periodontitis. The purpose of this study was to investigate the association of MMP and TIMP polymorphisms with chronic periodontitis in two populations. A total of 34 polymorphisms spanning 12 MMP and 2 TIMP genes were genotyped in 401 individuals from Brazil (99 cases with chronic periodontitis and 302 controls), and 274 individuals from the US (70 cases and 204 controls). Individuals were considered cases if presenting at least three teeth exhibiting sites of clinical attachment loss ≥ 5 mm in two different quadrants. Controls were characterized by absence of clinical attachment loss and no sites with probing depth >3 mm. MMP3 and TIMP1 mRNA expression was evaluated in healthy and diseased periodontal tissues. TIMP1 showed association with chronic periodontitis in the Brazilian population (for rs5906435, p = 0.0004), whereas MMP3 showed association in the US population (for rs679620, p = 0.0003; and rs650108, p = 0.002) and in the Brazilian population (for rs639752, p = 0.005). MMP3 and TIMP1 mRNA expression was significantly higher in diseased tissues when compared to control tissues. Our results further support a role for variations in MMP3 in chronic periodontitis and report a novel association with TIMP1. These genes may be considered additional candidate genes for chronic periodontitis. © 2012 John Wiley & Sons A/S.

Enhanced secretion of TIMP-1 by human hypertrophic scar keratinocytes could contribute to fibrosis.

Science.gov (United States)

Simon, Franck; Bergeron, Daniele; Larochelle, Sébastien; Lopez-Vallé, Carlos A; Genest, Hervé; Armour, Alexis; Moulin, Véronique J

2012-05-01

Hypertrophic scars are a pathological process characterized by an excessive deposition of extracellular matrix components. Using a tissue-engineered reconstructed human skin (RHS) method, we previously reported that pathological keratinocytes induce formation of a fibrotic dermal matrix. We further investigated keratinocyte action using conditioned media. Results showed that conditioned media induce a similar action on dermal thickness similar to when an epidermis is present. Using a two-dimensional electrophoresis technique, we then compared conditioned media from normal or hypertrophic scar keratinocytes and determined that TIMP-1 was increased in conditioned media from hypertrophic scar keratinocytes. This differential profile was confirmed using ELISA, assaying TIMP-1 presence on media from monolayer cultured keratinocytes and from RHS. The dermal matrix of these RHS was recreated using mesenchymal cells from three different origins (skin, wound and hypertrophic scar). The effect of increased TIMP-1 levels on dermal fibrosis was also validated independently from the mesenchymal cell origin. Immunodetection of TIMP-1 showed that this protein was increased in the epidermis of hypertrophic scar biopsies. The findings of this study represent an important advance in understanding the role of keratinocytes as a direct potent modulator for matrix degradation and scar tissue remodeling, possibly through inactivation of MMPs. Copyright © 2011 Elsevier Ltd and ISBI. All rights reserved.

Comparison of circulating MMP-9, TIMP-1 and CA19-9 in the detection of pancreatic cancer

DEFF Research Database (Denmark)

Jørgensen, Maiken Thyregod; Brunner, Nils; Schaffalitzky de Muckadell, Ove B.

2010-01-01

, TIMP-1 and CA19-9 in detecting pancreatic ductal adenocarcinoma were 58.82%, 47.1% and 86%, respectively, with specificities of 34.6%, 69.2% and 73%. The AUCs of MMP-9, TIMP-1 and CA19-9 were 0.50, 0.64 and 0.84, respectively. Combining the three markers did not significantly improve detection......Background/Aim: The performance of the circulating tumor markers carbohydrate antigen 19-9 (CA19-9), matrix metalloproteinase 9 (MMP-9) and tissue inhibitor of metalloproteinase 1 (TIMP-1) were evaluated separately and in combination for their potential value in detecting pancreatic ductal...... adenocarcinoma. PATIENTS AND METHODS: The patients had symptoms of pancreatic cancer. The discriminative strength of MMP-9 and TIMP-1 were compared to that of CA19-9 using receiver operating characteristics curves, area under the curves (AUC), specificity and sensitivity. RESULTS: The sensitivities of MMP-9...

Effect of simvastatin on MMPs and TIMPs in cigarette smoke-induced rat COPD model

Directory of Open Access Journals (Sweden)

Sun J

2017-02-01

Full Text Available Jiawei Sun,1,* Jie Bao,2,* Yanan Shi,3 Bin Zhang,4 Lindong Yuan,5 Junhong Li,1 Lihai Zhang,1 Mo Sun,6 Ling Zhang,2 Wuzhuang Sun1 1Department of Respiratory Medicine, First Hospital of Hebei Medical University, 2Department of Respiratory Medicine, Chest Hospital of Hebei Province, 3Maternal and Child Health Care Center of Hebei Province, 4Department of Emergency, First Hospital of Hebei Medical University, Shijiazhuang, 5Department of Respiratory Medicine, People’s Hospital of Liaocheng, Liaocheng, 6Hebei Medical University, Shijiazhuang, People’s Republic of China *These authors contributed equally to this work Background: Proteases may play an important role in the development of chronic obstructive pulmonary disease and emphysema in response to cigarette smoke exposure (CSE. The current study was designed to investigate the expression of matrix metalloproteinase (MMP-8, MMP-9, MMP-12, tissue inhibitor of MMP (TIMP-1, and TIMP-4 in rat lung tissues in response to CSE, and assessed the effect of simvastatin in regulating expression of MMPs and TIMPs.Methods: Thirty normal Sprague Dawley (SD rats were divided into control (n=10, CSE (n=10, and CSE plus simvastatin (n=10 groups. Animals were whole-body exposed to the cigarette smoke in the box for 1 hour each time, twice a day, 5 days a week for 16 weeks. Animals of CSE + simvastatin group were intra-gastrically administered simvastatin at a dose of 5 mg/kg/day followed by CSE. Bronchoalveolar lavage fluid was harvested for inflammatory cell count and lung tissues were stained for morphologic examination. Expression of mRNA and protein level of MMP-8, MMP-9, MMP-12, TIMP-1, and TIMP-4 was assessed by real-time reverse transcription polymerase chain reaction and immunohistochemistry, respectively.Results: CSE resulted in a significant increase of mean linear intercept (MLI: 34.6±2.0 µm and bronchial wall thickness and diameter (BWT/D, 0.250±0.062 compared to control (MLI: 24.0±1.7 µm, BWT

HER2,TOP2A, and TIMP-1 and responsiveness to adjuvant anthracycline-containing chemotherapy in high-risk breast cancer patients

DEFF Research Database (Denmark)

Ejlertsen, Bent; Jensen, Maj-Britt; Nielsen, Kirsten V.

2010-01-01

analyzed individually. PATIENTS AND METHODS The Danish Breast Cancer Cooperative Group (DBCG) 89D trial randomly assigned 980 high-risk Danish breast cancer patients to CMF or CEF. Archival tumor tissue was analyzed TIMP-1, and HER2-negative and TIMP-1 immunoreactive tumors were classified as HT...... nonresponsive and otherwise HT responsive. Similarly, the 2T panel was constructed by combining TOP2A and TIMP-1; tumors with normal TOP2A status and TIMP-1 immunoreactivity were classified as 2T-nonresponsive and otherwise 2T-responsive. Results In total, 623 tumors were available for analysis, of which 154......(interaction) containing chemotherapy than HER2, TIMP-1, or TOP2A individually, and compared with these, 2T classifies a larger proportion of patients as sensitive to anthracyclines....

X-linked recessive primary retinal dysplasia is linked to the Norrie disease locus.

Science.gov (United States)

Ravia, Y; Braier-Goldstein, O; Bat-Miriam, K M; Erlich, S; Barkai, G; Goldman, B

1993-08-01

X-linked primary retinal dysplasia (PRD) refers to an abnormal proliferation of retinal tissue causing either its neural elements or its glial tissue to form folds, giving rise to gliosis. A Jewish family of oriental origin was previously reported by Godel and Goodman, in which a total of five males suffer from different degrees of blindness. The authors postulated that the described findings are distinguished from Norrie disease, since in this case no clinical findings, other than those associated with the eyes, were noticed in the affected males. In addition, two of the carrier females exhibit minimal eye changes. We have performed linkage analysis of the family using the L1.28, p58-1 and m27 beta probes, and DXS426 and MAOB associated microsatellites. Our results map the gene responsible for the disorder between the MAOB and DXS426, m27 beta and p58-1 loci, on the short arm of the X chromosome at Xp11.3, which suggest the possibility that the same gene is responsible for both primary retinal dysplasia and Norrie disease.

Mesenchymal Stem Cells Regulate Blood Brain Barrier Integrity in Traumatic Brain Injury Through Production of the Soluble Factor TIMP3

Science.gov (United States)

Menge, Tyler; Zhao, Yuhai; Zhao, Jing; Wataha, Kathryn; Geber, Michael; Zhang, Jianhu; Letourneau, Phillip; Redell, John; Shen, Li; Wang, Jing; Peng, Zhalong; Xue, Hasen; Kozar, Rosemary; Cox, Charles S.; Khakoo, Aarif Y.; Holcomb, John B.; Dash, Pramod K.; Pati, Shibani

2013-01-01

Mesenchymal stem cells (MCSs) have been shown to have therapeutic potential in multiple disease states associated with vascular instability including traumatic brain injury (TBI). In the present study, Tissue Inhibitor of Matrix Metalloproteinase-3 (TIMP3) is identified as the soluble factor produced by MSCs that can recapitulate the beneficial effects of MSCs on endothelial function and blood brain barrier (BBB) compromise in TBI. Attenuation of TIMP3 expression in MSCs completely abrogates the effect of MSCs on BBB permeability and stability, while intravenous administration of rTIMP3 alone can inhibit BBB permeability in TBI. Our results demonstrate that MSCs increase circulating levels of soluble TIMP3, which inhibits VEGF-A induced breakdown of endothelial AJs in vitro and in vivo. These findings elucidate a clear molecular mechanism for the effects of MSCs on the BBB in TBI, and directly demonstrate a role for TIMP3 in regulation of BBB integrity. PMID:23175708

Lack of relationship between TIMP-1 tumour cell immunoreactivity, treatment efficacy and prognosis in patients with advanced epithelial ovarian cancer

DEFF Research Database (Denmark)

Steffensen, Karina Dahl; Waldstrøm, Marianne; Christensen, Rikke Kølby

2010-01-01

BACKGROUND: Tissue inhibitor of metalloproteinase 1 (TIMP-1) is a natural inhibitor of the matrix metalloproteinases (MMPs) which are proteolytic enzymes involved in degradation of extracellular matrix thereby favoring tumour cell invasion and metastasis. TIMP-1 activity in tumour tissue may ther...... immunoreactivity in tumour tissue from patients with primary epithelial ovarian cancer did not correlate with patient survival or response to combination platinum/cyclophosphamide therapy.......BACKGROUND: Tissue inhibitor of metalloproteinase 1 (TIMP-1) is a natural inhibitor of the matrix metalloproteinases (MMPs) which are proteolytic enzymes involved in degradation of extracellular matrix thereby favoring tumour cell invasion and metastasis. TIMP-1 activity in tumour tissue may...... therefore play an essential role in the progression of a malignant tumour.The primary aim of the present study was to evaluate TIMP-1 protein immunoreactivity in tissue from primary ovarian cancer patients and associate these findings with the course of the disease including response to treatment...

Effect of MAOA promoter polymorphism and neuropsychological performance on psychopathy traits

Directory of Open Access Journals (Sweden)

C. Romero-Rebollar

2015-01-01

Discussion: These findings were according to the previous studies about abnormal emotional processing and behavioral inhibition failures reported in subjects with genetic risk for violence, as well as with studies about neuropsychological performance in psychopaths. Further the MAOA genotype moderates the relationship between orbitofrontal functioning and antisocial traits of psychopathy which is a risk factor for violence.

Engineering N-terminal domain of tissue inhibitor of metalloproteinase (TIMP)-3 to be a better inhibitor against tumour necrosis factor-alpha-converting enzyme.

Science.gov (United States)

Lee, Meng-Huee; Verma, Vandana; Maskos, Klaus; Nath, Deepa; Knäuper, Vera; Dodds, Philippa; Amour, Augustin; Murphy, Gillian

2002-01-01

We previously reported that full-length tissue inhibitor of metalloproteinase-3 (TIMP-3) and its N-terminal domain form (N-TIMP-3) displayed equal binding affinity for tissue necrosis factor-alpha (TNF-alpha)-converting enzyme (TACE). Based on the computer graphic of TACE docked with a TIMP-3 model, we created a number of N-TIMP-3 mutants that showed significant improvement in TACE inhibition. Our strategy was to select those N-TIMP-3 residues that were believed to be in actual contact with the active-site pockets of TACE and mutate them to amino acids of a better-fitting nature. The activities of these mutants were examined by measuring their binding affinities (K(app)(i)) and association rates (k(on)) against TACE. Nearly all mutants at position Thr-2 exhibited slightly impaired affinity as well as association rate constants. On the other hand, some Ser-4 mutants displayed a remarkable increase in their binding tightness with TACE. In fact, the binding affinities of several mutants were less than 60 pM, beyond the sensitivity limits of fluorimetric assays. Further studies on cell-based processing of pro-TNF-alpha demonstrated that wild-type N-TIMP-3 and one of its tight-binding mutants, Ser-4Met, were capable of inhibiting the proteolytic shedding of TNF-alpha. Furthermore, the Ser-4Met mutant was also significantly more active (P<0.05) than the wild-type N-TIMP-3 in its cellular inhibition. Comparison of N-TIMP-3 and full-length TIMP-3 revealed that, despite their identical TACE-interaction kinetics, the latter was nearly 10 times more efficient in the inhibition of TNF-alpha shedding, with concomitant implications for the importance of the TIMP-3 C-terminal domain in vivo. PMID:11988096

TIMP2 gene polymorphism as a potential tool to infer Brazilian population origin

Directory of Open Access Journals (Sweden)

da Silva RA

2013-12-01

Full Text Available Rodrigo Augusto da Silva,1 André Luis Shinohara,2 Denise Carleto Andia,1 Ariadne Letra,3 Regina Célia Peres,1 Ana Paula de Souza11Department of Morphology, Piracicaba Dental School, State University of Campinas, 2Oral Biology Program, Bauru Dental School, State University of São Paulo, São Paulo, Brazil; 3Department of Endodontics and Center for Craniofacial Research, School of Dentistry, University of Texas Health Science Center, Houston, TX, USAAbstract: Single nucleotide polymorphisms are genome variations that can be used as population-specific markers to infer genetic background and population origin. The Brazilian population is highly admixed due to immigration from several other populations. In particular, the state of São Paulo is recognized for the presence of Japanese individuals who seem likely to have contributed to a substantial proportion of ancestry in the modern Brazilian population. In the present study, we analyzed allele and genotype frequencies and associations of the –418G>C (rs8179090 single nucleotide polymorphism in the TIMP2 gene promoter in Brazilian and Japanese subjects, as well as in Japanese descendants from southeastern Brazil. The allele and genotype frequency analyses among groups demonstrated statistical significance (PC single nucleotide polymorphism of the TIMP2 gene, have a high probability of being Japanese or Japanese descendants. In addition to other genetic polymorphisms, the −418G>C TIMP2 polymorphism could be a population marker to assist in predicting Japanese ancestry, both in Japanese individuals and in admixed populations.Keywords: Brazilian, Japanese, polymorphism, allele, TIMP2

Increased ratio of serum matrix metalloproteinase-9 against TIMP-1 predicts poor wound healing in diabetic foot ulcers.

Science.gov (United States)

Li, Zhihong; Guo, Shuqin; Yao, Fang; Zhang, Yunliang; Li, Tingting

2013-01-01

Little is known about serum concentrations of Matrix Metalloproteinase-9 (MMP-9), MMP-2, TIMP-1 and TIMP-2 in diabetic patients with foot ulcers. This study demonstrates their relationship with wound healing. Ninety-four patients with diabetic foot ulcers were recruited in the study. Serum MMP-9, MMP-2, TIMP-1 and TIMP-2 were measured at the first clinic visit and the end of 4-week treatment and followed up till 12 weeks. According to the decreasing rate of ulcer healing area at the fourth week, we divided those cases into good and poor healers. Through analyses, we explore the possible relationship among those factors and degree of wound healing. The median level of serum MMP-9 in good healers was lower than poor healers at first visit (124.2 μg/L vs 374.6 μg/L, phealing than MMP-9 alone before therapy and after 4 week treatment (r = -0.6475 vs -0.3251, r = -0.7096 vs -0.1231, respectively). Receiver Operator Curve (ROC) showed that the cutoff for MMP-9/TIMP-1 ratio at healing and might provide a novel target for the future therapy in diabetic foot ulcers. Copyright © 2013 Elsevier Inc. All rights reserved.

TIMP-1 resistant matrix metalloproteinase-9 is the predominant serum active isoform associated with MRI activity in patients with multiple sclerosis.

Science.gov (United States)

Trentini, Alessandro; Manfrinato, Maria C; Castellazzi, Massimiliano; Tamborino, Carmine; Roversi, Gloria; Volta, Carlo A; Baldi, Eleonora; Tola, Maria R; Granieri, Enrico; Dallocchio, Franco; Bellini, Tiziana; Fainardi, Enrico

2015-08-01

The activity of matrix metalloproteinase-9 (MMP-9) depends on two isoforms, an 82 kDa active MMP-9 modulated by its specific tissue inhibitor (TIMP-1), and a 65 kDa TIMP-1 resistant active MMP-9. The relevance of these two enzymatic isoforms in multiple sclerosis (MS) is still unknown. To investigate the contribution of the TIMP-1 modulated and resistant active MMP-9 isoforms to MS pathogenesis. We measured the serum levels of the 82 kDa and TIMP-1 resistant active MMP-9 isoforms by activity assay systems in 86 relapsing-remitting MS (RRMS) patients, categorized according to clinical and magnetic resonance imaging (MRI) evidence of disease activity, and in 70 inflammatory (OIND) and 69 non-inflammatory (NIND) controls. Serum levels of TIMP-1 resistant MMP-9 were more elevated in MS patients than in OIND and NIND (p < 0.05, p < 0.02, respectively). Conversely, 82 kDa active MMP-9 was higher in NIND than in the OIND and MS patients (p < 0.01 and p < 0.00001, respectively). MRI-active patients had higher levels of TIMP-1 resistant MMP-9 and 82 kDa active MMP-9, than did those with MRI inactive MS (p < 0.01 and p < 0.05, respectively). Our findings suggested that the TIMP-1 resistant MMP-9 seem to be the predominantly active isoform contributing to MS disease activity. © The Author(s), 2015.

TIMP-1 mediates the inhibitory effect of interleukin-6 on the proliferation of a hepatocarcinoma cell line in a STAT3-dependent manner

Directory of Open Access Journals (Sweden)

S.-Y. Guo

2007-05-01

Full Text Available The tissue inhibitor of metalloproteinases (TIMP-1 is a multifunctional protein which is not only an inhibitor of matrix metalloproteinases (MMPs but also to have a possible "cytokine-like" action. Here, we first compared mRNA expression of TIMP-1 and MMP-9 in BEL-7402 (a hepatocellular carcinoma cell line, L-02 (a normal liver cell line and QSG-7701 (a cell line derived from peripheral tissue of liver carcinoma using real-time quantitative RT-PCR. By evaluating the variation of the MMP-9/TIMP-1 ratio as an index of reciprocal changes of the expression of the two genes, we observed that the MMP-9/TIMP-1 ratio was about 13- and 5-fold higher in BEL-7402 than in L-02 and QSG-7701, respectively. Significantly, overexpression of TIMP-1 decreased the MMP-9/TIMP-1 ratio in BEL-7402 and then inhibited the cell growth to 60% and reduced the migration to about 30%. Meanwhile, our data showed that interleukin-6 (IL-6 (100 ng/mL could also inhibited the cell growth of BEL-7402. Further studies indicated that TIMP-1 mediated the inhibitory effect of IL-6 on BEL-7402 cell proliferation in a STAT3-dependent manner, which could further accelerate the expression of the cyclin-dependent kinase inhibitor p21. A dominant negative STAT3 mutant totally abolished IL-6-induced TIMP-1 expression and its biological functions. The present results demonstrate that TIMP-1 may be one of the mediators that regulate the inhibitory effect of IL-6 on BEL-7402 proliferation in which STAT3 signal transduction and p21 up-regulation also play important roles.

42 CFR 426.415 - CMS' role in the LCD review.

Science.gov (United States)

2010-10-01

... 42 Public Health 3 2010-10-01 2010-10-01 false CMS' role in the LCD review. 426.415 Section 426... Review of an LCD § 426.415 CMS' role in the LCD review. CMS may provide to the ALJ, and all parties to the LCD review, information identifying the person who represents the contractor or CMS, if necessary...

TIMP2 gene polymorphisms are associated with hypertension in ...

Indian Academy of Sciences (India)

2014-08-06

Aug 6, 2014 ... 5Epidemiologic and Health Service Research Unit, Again Area, Centro Médico Nacional Siglo XXI,. Instituto ... TIMPs are proteins of 21 to 30 kDa and belong to a family of spe- ... characterized-clinical cohort of Mexican Mestizo patients. We also ... 200 mg/dL and/or low-density lipoprotein cholesterol ≥.

TIMP-1 Is Significantly Associated with Objective Response and Survival in Metastatic Colorectal Cancer Patients Receiving Combination of Irinotecan, 5-Fluorouracil, and Folinic Acid

DEFF Research Database (Denmark)

Sørensen, Nanna M; Byström, Per; Christensen, Ib Jarle

2007-01-01

that patients with low plasmaTIMP-1had higher probability of obtaining an objective response [odds ratio (OR), 3.5; 95% confidence interval (95% CI), 1.4-8.5,P =0.007].CEAtreatedas a continuous variablewas also a statistically significantpredictorof no response (OR,1.3; 95%CI,1.0-1.7, P = 0.02, areaunder......Purpose: Tissue inhibitor of metalloproteinase-1 (TIMP-1) is known to protect cells against apoptosis.We raisedth e hypothesis that elevatedtu mor tissue levels and thereby plasma levels of TIMP-1wouldp redict resistance to apoptosis-inducing chemotherapy. Experimental Design: Ninety patients...... includingTTP instead of OS showed that only plasmaTIMP-1was retained in the model (HR,1.5). CEA was not significantly associatedw ith TTP or OS when TIMP-1was included in the model. Conclusion: This study shows that plasmaTIMP-1 levels are significantly and independently associatedw ith objective response...

Surgery-induced hippocampal angiotensin II elevation causes blood-brain barrier disruption via MMP/TIMP in aged rats

Directory of Open Access Journals (Sweden)

Zhengqian eLi

2016-04-01

Full Text Available Reversible BBB disruption has been uniformly reported in several animal models of postoperative cognitive dysfunction (POCD. Nevertheless, the precise mechanism underlying this occurrence remains unclear. Using an aged rat model of POCD, we investigated the dynamic changes in expression of molecules involved in BBB disintegration, matrix metalloproteinase-2 (MMP-2 and -9 (MMP-9, as well as three of their endogenous tissue inhibitors (TIMP-1, -2, -3, and tried to establish the correlation between MMP/TIMP balance and surgery-induced hippocampal BBB disruption. We validated the increased hippocampal expression of angiotensin II (Ang II and Ang II receptor type 1 (AT1 after surgery. We also found MMP/TIMP imbalance as early as 6 h after surgery, together with increased BBB permeability and decreased expression of Occludin and zonula occludens-1 (ZO-1, as well as increased basal lamina protein laminin at 24 h postsurgery. The AT1 antagonist candesartan restored MMP/TIMP equilibrium and modulated expression of Occludin and laminin, but not ZO-1, thereby improving BBB permeability. These events were accompanied by suppression of the surgery-induced canonical nuclear factor-κB (NF-κB activation cascade. Nevertheless, AT1 antagonism did not affect nuclear receptor peroxisome proliferator-activated receptor-γ expression. Collectively, these findings suggest that surgery-induced Ang II release impairs BBB integrity by activating NF-κB signaling and disrupting downstream MMP/TIMP balance via AT1 receptor.

Inhibitors of MAO-A and MAO-B in Psychiatry and Neurology

Directory of Open Access Journals (Sweden)

John Paul Maurice Finberg

2016-10-01

Full Text Available Inhibitors of MAO-A and MAO-B are in clinical use for the treatment of psychiatric and neurological disorders respectively. Elucidation of the molecular structure of the active sites of the enzymes has enabled a precise determination of the way in which substrates and inhibitor molecules are metabolized, or inhibit metabolism of substrates, respectively. Despite the knowledge of the strong antidepressant efficacy of irreversible MAO inhibitors, their clinical use has been limited by their side effect of potentiation of the cardiovascular effects of dietary amines (cheese effect. A number of reversible MAO-A inhibitors which are devoid of cheese effect have been described in the literature, but only one, moclobemide, is currently in clinical use. The irreversible inhibitors of MAO-B, selegiline and rasagiline, are used clinically in treatment of Parkinson’s disease, and a recently introduced reversible MAO-B inhibitor, safinamide, has also been found efficacious. Modification of the pharmacokinetic characteristics of selegiline by transdermal administration has led to the development of a new drug form for treatment of depression. The clinical potential of MAO inhibitors together with detailed knowledge of the enzyme’s binding site structure should lead to future developments with these drugs.

Inhibitors of MAO-A and MAO-B in Psychiatry and Neurology.

Science.gov (United States)

Finberg, John P M; Rabey, Jose M

2016-01-01

Inhibitors of MAO-A and MAO-B are in clinical use for the treatment of psychiatric and neurological disorders respectively. Elucidation of the molecular structure of the active sites of the enzymes has enabled a precise determination of the way in which substrates and inhibitor molecules are metabolized, or inhibit metabolism of substrates, respectively. Despite the knowledge of the strong antidepressant efficacy of irreversible MAO inhibitors, their clinical use has been limited by their side effect of potentiation of the cardiovascular effects of dietary amines ("cheese effect"). A number of reversible MAO-A inhibitors which are devoid of cheese effect have been described in the literature, but only one, moclobemide, is currently in clinical use. The irreversible inhibitors of MAO-B, selegiline and rasagiline, are used clinically in treatment of Parkinson's disease, and a recently introduced reversible MAO-B inhibitor, safinamide, has also been found efficacious. Modification of the pharmacokinetic characteristics of selegiline by transdermal administration has led to the development of a new drug form for treatment of depression. The clinical potential of MAO inhibitors together with detailed knowledge of the enzyme's binding site structure should lead to future developments with these drugs.

Development of a monoclonal antibody that specifically detects tissue inhibitor of metalloproteinase-4 (TIMP-4) in formalin-fixed, paraffin-embedded human tissues.

Science.gov (United States)

Donover, P Scott; Wojciechowski, Brian S; Thirumaran, Rajesh; Zemba-Palko, Vlasta; Prendergast, George C; Wallon, U Margaretha

2010-08-01

Overexpression of the extracellular metalloproteinase inhibitor TIMP-4 in estrogen receptor-negative breast cancers was found recently to be associated with a poor prognosis for survival. To pursue exploration of the theranostic applications of TIMP-4, specific antibodies with favorable properties for immunohistochemical use and other clinical assays are needed. Here we report the characterization of a monoclonal antibody (clone 9:4-7) specific for full-length human TIMP-4 with suitable qualities. The antibody was determined to be an IgG(2b) immunoglobulin. In enzyme-linked immunosorbent assay (ELISA) and immunoblotting assays, it did not exhibit any detectable crossreactivity with recombinant forms of the other human TIMPs 1, 2, and 3. In contrast, the antibody displayed high specificity and sensitivity for TIMP-4 including in formalin-fixed and paraffin-embedded specimens of human breast specimens. An analysis of tissue microarrays of human cancer and corresponding normal tissues revealed specific staining patterns with excellent signal-to-noise ratios. This study documents TIMP-4 monoclonal antibody clone 9:4-7 as an effective tool for preclinical and clinical investigations. Published 2010 Wiley-Liss, Inc.

Clinical significance of detection of serum expressions of MMP-2 and TIMP-2 in patients with small cell pulmonary carcinoma

International Nuclear Information System (INIS)

Peng Liang

2008-01-01

Objective: To investigate the clinical significance of changes of serum expressions of matrix metallo-proteinase 2 (MMP-2) and tissue inhibitors of metallo-proteinase 2 (TIMP-2) in patients with small cell lung cancer (SCLC). Methods: Serum MMP-2 and TIMP-2 contents were measured with RIA in 80 patients with small cell lung cancer (SCLC) and 35 controls. Results: The serum contents of MMP-2 and TIMP-2 in patients with SCLC were significantly higher than those in the controls (P<0.01). Among the patients, the serum concentration of the two parameters in patients with wide-spread disease were significantly higher than those in patients with localized disease (P<0.05). Conclusion: Serum concentrations of MMP-2 and TIMP-2 were much increased in patients with SCLC, especially in patients with wide-spread disease. (authors)

Calcifying Cystic Odontogenic Tumour: immunohistochemical expression of matrix metalloproteinases, their inhibitors (TIMPs and RECK) and inducer (EMMPRIN).

Science.gov (United States)

Prosdócimi, Fábio C; Rodini, Camila O; Sogayar, Mari C; Sousa, Suzana C O M; Xavier, Flávia C A; Paiva, Katiúcia B S

2014-08-01

Calcifying cyst odontogenic tumour (CCOT) is a rare benign cystic neoplasm of odontogenic origin. MMPs are responsible for extracellular matrix remodelling and, together their inhibitors and inducer, determinate the level of its turnover in pathological processes, leading to an auspicious microenvironment for tumour development. Thus, our goal was to evaluate matrix metalloproteinases (MMPs-2, -7, -9 and -14), their inhibitors (TIMPs-2, -3, -4 and RECK) and its inductor (EMMPRIN) expression in CCOT. We used 18 cases of CCOT submitted to immunolocalization of the target proteins and analysed in both neoplastic odontogenic epithelial and stromal compartments. All molecules evaluated were expressed in both compartments in CCOT. In epithelial layer, immunostaining for MMPs, TIMPs, RECK and EMMPRIN was found in basal, suprabasal spindle and stellate cells surrounding ghost cells and ghost cells themselves, except for MMP-9 and TIMP-2 which were only expressed by ghost cells. In stromal compartment, extracellular matrix, mesenchymal (MC) and endothelial cells (EC) were positive for MMP-2, -7, TIMP-3 and -4, while MMP-9, TIMP-2 and RECK were positive only in MC and MMP-14 only in EC. Statistical significance difference was found between both compartments for MMP-9 (P EMMPRIN (P EMMPRIN and RECK expression was found (R = 0.661, P = 0.003). We concluded that these proteins/enzymes are differentially expressed in both epithelium and stroma of CCOT, suggesting an imbalance between MMPs and their inducer/inhibitors may contribute on the tumour behaviour. © 2014 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

Association of polymorphisms in 5-HTT (SLC6A4) and MAOA genes with measures of obesity in young adults of Portuguese origin.

Science.gov (United States)

Dias, Helena; Muc, Magdalena; Padez, Cristina; Manco, Licínio

2016-01-01

To investigate the association of polymorphisms in SLC6A4 and MAOA genes with overweight (including obesity). Young adults (n = 535) of Portuguese origin were genotyped for the SLC6A4 polymorphisms 5-HTTLPR and STin2 and a MAOA VNTR. BMI and body fat percentage were measured and a questionnaire was used to assess individual's sport practicing habits. In whole study sample, haplotype-based analysis revealed significant association with overweight/obesity for the individual 5-HTTLPR/Stin2 haplotype L10 (p = 0.04). In men, the MAOA 3R genotype was nominally associated with body fat (p = 0.04). In inactive individuals, overweight/obesity was found significantly associated with 5-HTTLPR L-allele (p = 0.01) and nominally associated with STin2 10-allele (p = 0.03). A significant association was also found testing for all haplotype effects (χ(2 )= 8.7; p = 0.03). We found some evidences for the association of SLC6A4 and MAOA genes with measures of obesity. Our results suggest physical inactivity accentuates the influence of SLC6A4 polymorphisms on obesity risk.

Tumor tissue levels of tissue inhibitor of metalloproteinases-I (TIMP-I) and outcome following adjuvant chemotherapy in premenopausal lymph node-positive breast cancer patients

DEFF Research Database (Denmark)

Schrohl, Anne-Sofie; Look, Maxime P.; Gelder, Marion E. Meijer-van

2009-01-01

BACKGROUND: We have previously demonstrated that high tumor tissue levels of TIMP-1 are associated with no or limited clinical benefit from chemotherapy with CMF and anthracyclines in metastatic breast cancer patients. Here, we extend our investigations to the adjuvant setting studying outcome...... an association between shorter survival after treatment in TIMP-1 high patients compared with TIMP-1 low patients, especially in patients receiving anthracycline-based therapy. This suggests that high tumor tissue levels of TIMP-1 might be associated with reduced benefit from classical adjuvant chemotherapy. Our...... after adjuvant chemotherapy in premenopausal lymph node-positive patients. We hypothesize that TIMP-1 high tumors are less sensitive to chemotherapy and accordingly that high tumor tissue levels are associated with shorter survival. METHODS: From our original retrospectively collected tumor samples we...

Maternal hypoxia increases the activity of MMPs and decreases the expression of TIMPs in the brain of neonatal rats.

Science.gov (United States)

Tong, Wenni; Chen, Wanqiu; Ostrowski, Robert P; Ma, Qingyi; Souvenir, Rhonda; Zhang, Lubo; Zhang, John H; Tang, Jiping

2010-02-15

A recent study has shown that increased activity of matrix metalloproteinases-2 and metalloproteinases-9 (MMP-2 and MMP-9) has detrimental effect on the brain after neonatal hypoxia. The present study determined the effect of maternal hypoxia on neuronal survivability and the activity of MMP-2 and MMP-9, as well as the expression of tissue inhibitors of metalloproteinase 1 and 2 (TIMP-1 and TIMP-2) in the brain of neonatal rats. Pregnant rats were exposed to 10.5% oxygen for 6 days from the gestation day 15 to day 21. Pups were sacrificed at day 0, 4, 7, 14, and 21 after birth. Body weight and brain weight of the pups were measured at each time point. The activity of MMP-2 and MMP-9 and the protein abundance of TIMP-1 and TIMP-2 were determined by zymography and Western blotting, respectively. The tissue distribution of MMPs was examined by immunofluorescence staining. The neuronal death was detected by Nissl staining. Maternal hypoxia caused significant decreases in body and brain size, increased activity of MMP-2 at day 0, and increased MMP-9 at day 0 and 4. The increased activity of the MMPs was accompanied by an overall tendency towards a reduced expression of TIMPs at all ages with the significance observed for TIMPs at day 0, 4, and 7. Immunofluorescence analysis showed an increased expression of MMP-2, MMP-9 in the hippocampus at day 0 and 4. Nissl staining revealed significant cell death in the hippocampus at day 0, 4, and 7. Functional tests showed worse neurobehavioral outcomes in the hypoxic animals.

Purification and characterization of bioactive his₆-tagged recombinant human tissue inhibitor of metalloproteinases-1 (TIMP-1) protein expressed at high yields in mammalian cells

DEFF Research Database (Denmark)

Jensen, Lena Vinther; Lademann, Ulrik Axel; Andersen, Elisabeth Veyhe

2014-01-01

Tissue inhibitor of metalloproteinases-1 (TIMP-1) is an endogenous inhibitor of matrix metalloproteinases (MMPs) with reported tumor promoting, as well as inhibitory, effects. These paradoxical properties are presumably mediated by different biological functions, MMP-dependent as well as -indepen...... TIMP-1, which structurally and functionally is similar to endogenous human TIMP-1, while using an expression system that is adaptable to most biochemical and biomedical laboratories including those that do not perform protein purifications routinely.......Tissue inhibitor of metalloproteinases-1 (TIMP-1) is an endogenous inhibitor of matrix metalloproteinases (MMPs) with reported tumor promoting, as well as inhibitory, effects. These paradoxical properties are presumably mediated by different biological functions, MMP-dependent as well...... as -independent, and probably related to TIMP-1 levels of protein expression, post-translational modifications, and cellular localization. TIMP-1 is an N-glycosylated protein that folds into two functional domains, a C- and an N-terminal domain, with six disulfide bonds. Furthermore, TIMP-1 is processed in the N...

HER2, TOP2A, and TIMP-1 and responsiveness to adjuvant anthracycline-containing chemotherapy in high-risk breast cancer patients

DEFF Research Database (Denmark)

Ejlertsen, Bent; Jensen, Maj-Britt; Nielsen, Kirsten

2010-01-01

(interaction) benefit from anthracycline-containing chemotherapy than HER2, TIMP-1, or TOP2A individually, and compared with these, 2T classifies a larger proportion of patients as sensitive to anthracyclines.......PURPOSE To evaluate whether the combination of HER2 with TIMP-1 (HT) or TOP2A with TIMP-1 (2T) more accurately identifies patients who benefit from cyclophosphamide, epirubicin, and fluorouracil (CEF) compared with cyclophosphamide, methotrexate, and fluorouracil (CMF) than these markers do when...... lacked TIMP-1 immunoreactivity, 188 were HER2 positive, and 139 had a TOP2A aberration. HT status was a statistically significant predictor of benefit from CEF compared with CMF (P(interaction) = .036 for invasive disease-free survival [IDFS] and .047 for overall survival [OS]). The 269 (43%) patients...

Overexpression of TIMP-1 under the MMP-9 promoter interferes with wound healing in transgenic mice

OpenAIRE

Salonurmi, T.; Parikka, M.; Kontusaari, S.; Pirila, E.; Munaut, Carine; Salo, T.; Tryggvason, K.

2004-01-01

We have generated transgenic mice harboring the murine matrix metalloproteinase 9 (MMP-9) promoter cloned in front of human TIMP-1 cDNA. The transgenic mice were viable and fertile and exhibited normal growth and general development. During wound healing the mice were shown to express human TIMP-1 in keratinocytes that normally express MMP-9. However, the healing of skin wounds was significantly retarded with slow migration of keratinocytes over the wound in transgenic mice. In situ zymograph...

Tumor tissue levels of Tissue Inhibitor of Metalloproteinases-1 (TIMP-1) and outcome following adjuvant chemotherapy in premenopausal lymph node-positive breast cancer patients: A retrospective study

International Nuclear Information System (INIS)

Schrohl, Anne-Sofie; Look, Maxime P; Meijer-van Gelder, Marion E; Foekens, John A; Brünner, Nils

2009-01-01

We have previously demonstrated that high tumor tissue levels of TIMP-1 are associated with no or limited clinical benefit from chemotherapy with CMF and anthracyclines in metastatic breast cancer patients. Here, we extend our investigations to the adjuvant setting studying outcome after adjuvant chemotherapy in premenopausal lymph node-positive patients. We hypothesize that TIMP-1 high tumors are less sensitive to chemotherapy and accordingly that high tumor tissue levels are associated with shorter survival. From our original retrospectively collected tumor samples we selected a group of 525 pre-menopausal lymph node-positive patients (adjuvant treatment: CMF, 324 patients; anthracycline-based, 99 patients; no adjuvant chemotherapy, 102 patients). TIMP-1 levels were measured using ELISA in cytosolic extracts of frozen primary tumors. TIMP-1 was analyzed as a continuous variable and as a dichotomized one using the median TIMP-1 concentration as a cut point between high and low TIMP-1 groups. We analyzed the benefit of adjuvant CMF and anthracyclines in univariate and multivariable survival models; endpoints were disease-free (DFS) and overall survival (OS). In this selected cohort of high-risk patients, and in the subgroup of patients receiving no adjuvant therapy, TIMP-1 was not associated with prognosis. In the subgroup of patients treated with anthracyclines, when analyzed as a continuous variable we observed a tendency for increasing TIMP-1 levels to be associated with shorter DFS (multivariable analysis, HR 1.75, 95% CI 1.00-3.07, P = 0.05) and a significant association between increasing TIMP-1 and shorter OS in both univariate (HR 3.52, 95% CI 1.54-8.06, P = 0.003) and multivariable analyses (HR 4.19, 95% CI 1.67-10.51, P = 0.002). No statistically significant association between TIMP-1 and DFS was observed in the CMF-treated patients although high TIMP-1 was associated with shorter OS when analyzed as a dichotomized variable (HR 1.64, 95% CI 1.02-2.65, P

Elevated expression of MMP-13 and TIMP-1 in head and neck squamous cell carcinomas may reflect increased tumor invasiveness

International Nuclear Information System (INIS)

Culhaci, Nil; Metin, Kubilay; Copcu, Eray; Dikicioglu, Emel

2004-01-01

Matrix metalloproteinases [MMPs], which degrade the extracellular matrix, play an important role in the invasion and metastasis of squamous cell carcinomas. One MMP, MMP-13, is thought to play a central role in MMP activation. The purpose of this study was to investigate MMP-13 and TIMP-1 expression in squamous cell carcinomas of the head and neck and to relate these levels of expression to histologic patterns of invasion. This study included T1 lesions obtained via biopsy from the larynx, tongue, and skin/mucosa of 78 patients with head and neck squamous cell carcinomas. The relationship between expression of MMP-13 and TIMP-1 and the mode of tumor invasion [MI] was evaluated immunohistochemically, using breast carcinoma tissue as a positive control. Increased expression was observed in highly invasive tumors, as reflected by the significant correlation between the degree of staining for MMP-13 or TIMP-1 and MI grade [p < 0.05]. There was no significant relationship between the degree of staining for MMP-13 or TIMP-1 and patient age, sex, tumor site, or tumor histologic grade. In addition, levels of staining for MMP-13 did not correlate with levels of staining for TIMP-1. The expression of MMP-13 and TIMP-1 appears to play an important role in determining the invasive capacity of squamous cell carcinomas of the head and neck. Whereas additional studies are needed to confirm these findings, evaluating expression of these MMPs in small biopsy samples may be useful in determining the invasive capacity of these tumors at an earlier stage

MicroRNA-206 regulates the secretion of inflammatory cytokines and MMP9 expression by targeting TIMP3 in Mycobacterium tuberculosis-infected THP-1 human macrophages.

Science.gov (United States)

Fu, Xiangdong; Zeng, Lihong; Liu, Zhi; Ke, Xue; Lei, Lin; Li, Guobao

2016-08-19

Tuberculosis (TB) is a serious disease that is characterized by Mycobacterium tuberculosis (M.tb)-triggered immune system impairment and lung tissue damage shows limited treatment options. MicroRNAs (miRNAs) are regulators of gene expression that play critical roles in many human diseases, and can be up- or downregulated by M.tb infection in macrophage. Recently, tissue inhibitor of matrix metalloproteinase (TIMP) 3 has been found to play roles in regulating macrophage inflammation. Here, we found that TIMP3 expression was regulated by miR-206 in M.tb-infected THP-1 human macrophages. In THP-1 cells infected with M.tb, the miR-206 level was significantly upregulated and the expression of TIMP3 was markedly decreased when the secretion of inflammatory cytokines was increased. Inhibition of miR-206 markedly suppressed inflammatory cytokine secretion and upregulated the expression of TIMP3. In contrast, the upregulation of miR-206 promoted the matrix metalloproteinase (MMP) 9 levels and inhibited TIMP3 levels. Using a dual-luciferase reporter assay, a direct interaction between miR-206 and the 3'-untranslated region (UTR) of TIMP3 was confirmed. SiTIMP3, the small interfering RNA (siRNA) specific for TIMP3, significantly attenuated the suppressive effects of miR-206-inhibitor on inflammatory cytokine secretion and MMP9 expression. Our data suggest that miR-206 may function as an inflammatory regulator and drive the expression of MMP9 in M.tb-infected THP-1 cells by targeting TIMP3, indicating that miR-206 is a potential therapeutic target for patients with TB. Copyright © 2016 Elsevier Inc. All rights reserved.

Bovine lactoferricin induces TIMP-3 via the ERK1/2-Sp1 axis in human articular chondrocytes.

Science.gov (United States)

Yan, Dongyao; Chen, Di; Hawse, John R; van Wijnen, Andre J; Im, Hee-Jeong

2013-03-15

Bovine lactoferricin (LfcinB) is a heparan sulfate-binding peptide with multiple bioactivities. In human articular cartilage, LfcinB antagonizes interleukin-1 β (IL-1β) and fibroblast growth factor 2 (FGF-2) in proteoglycan metabolism, catabolic protease expression, and induction of pro-inflammatory mediators. LfcinB specifically activates ERK1/2, p38 and Akt, but whether these signaling pathways control the expression of LfcinB target genes remained unknown. In this report, we characterized a novel aspect of LfcinB-mediated genetic response in human articular chondrocytes, tissue inhibitor of metalloproteinase 3 (TIMP-3) induction. Inhibition of individual signaling pathways revealed that ERK1/2 functions as the major pathway in TIMP-3 expression, whereas Akt plays a minor role. Further investigation identified Sp1 as a critical transcriptional activator in TIMP-3 regulation, and Sp1 activity is modulated by ERK1/2, not Akt. Comparative quantification indicates that significant downregulation of TIMP-3 occurs in OA chondrocytes, suggesting a beneficial role of LfcinB in OA pathogenesis. Our results collectively provide new insights into the mechanism of action of LfcinB, and support the candidacy of LfcinB as a chondroprotective agent. Copyright © 2013 Elsevier B.V. All rights reserved.

MicroRNA-222 Promotes the Proliferation of Pulmonary Arterial Smooth Muscle Cells by Targeting P27 and TIMP3

Directory of Open Access Journals (Sweden)

Ying Xu

2017-08-01

Full Text Available Background/Aims: Aberrant vascular smooth muscle cell (VSMC proliferation plays an important role in the development of pulmonary artery hypertension (PAH. Dysregulated microRNAs (miRNAs, miRs have been implicated in the progression of PAH. miR-222 has a pro-proliferation effect on VSMCs while it has an anti-proliferation effect on vascular endothelial cells (ECs. As the biological function of a single miRNA could be cell-type specific, the role of miR-222 in pulmonary artery smooth muscle cell (PASMC proliferation is not clear and deserves to be explored. Methods: PASMCs were transfected with miR-222 mimic or inhibitor and PASMC proliferation was determined by Western blot for PCNA, Ki-67 and EdU staining, and cell number counting. The target genes of miR-222 including P27 and TIMP3 were determined by luciferase assay and Western blot. In addition, the functional rescue experiments were performed based on miR-222 inhibitor and siRNAs to target genes. Results: miR-222 mimic promoted PASMC proliferation while miR-222 inhibitor decreased that. TIMP3 was identified to be a direct target gene of miR-222 based on luciferase assay. Meanwhile, P27 and TIMP3 were up-regulated by miR-222 inhibitor and down-regulated by miR-222 mimic. Moreover, P27 siRNA and TIMP3 siRNA could both attenuate the anti-proliferation effect of miR-222 inhibitor in PASMCs, supporting that P27 and TIMP3 are at least partially responsible for the regulatory effect of miR-222 in PASMCs. Conclusion: miR-222 promotes PASMC proliferation at least partially through targeting P27 and TIMP3.

7 CFR 28.426 - Strict Good Ordinary Spotted Color.

Science.gov (United States)

2010-01-01

... 7 Agriculture 2 2010-01-01 2010-01-01 false Strict Good Ordinary Spotted Color. 28.426 Section 28.426 Agriculture Regulations of the Department of Agriculture AGRICULTURAL MARKETING SERVICE (Standards... Spotted Color. Strict Good Ordinary Spotted Color is color which is within the range represented by a set...

Liver Fibrosis in HCV Monoinfected and HIV/HCV Coinfected Patients: Dysregulation of Matrix Metalloproteinases (MMPs and Their Tissue Inhibitors TIMPs and Effect of HCV Protease Inhibitors

Directory of Open Access Journals (Sweden)

Tiziana Latronico

2016-03-01

Full Text Available An imbalance between matrix metalloproteinases (MMPs and tissue inhibitors of metalloproteinases (TIMPs may contribute to liver fibrosis in patients with hepatitis C (HCV infection. We measured the circulating levels of different MMPs and TIMPs in HCV monoinfected and HIV/HCV coinfected patients and evaluated the potential for anti-HCV therapy to modulate MMP and TIMP levels in HCV subjects. We analyzed 83 plasma samples from 16 HCV monoinfected patients undergoing dual or triple anti-HCV therapy, 15 HIV/HCV coinfected patients with undetectable HIV load, and 10 healthy donors (HD. Levels of MMP-1, MMP-2, MMP-3, MMP-8, MMP-9, MMP-10, TIMP-1, and TIMP-2 were measured by a SearchLight Multiplex Immunoassay Kit. MMP-2 and MMP-9 were the highest expressed MMPs among all the analyzed samples and their levels significantly increased in HCV monoinfected and HIV/HCV coinfected subjects compared to HD. TIMP-1 levels were significantly higher in HCV and HIV/HCV subjects compared to HD and were correlated with liver stiffness. These findings raise the possibility of using circulating TIMP-1 as a non-invasive marker of liver fibrosis in HCV infection. A longitudinal study demonstrated that MMP-9 levels significantly decreased (40% reduction from baseline in patients receiving dual as well as triple direct-acting antivirals (DAA anti-HCV therapy, which had no effect on MMP-2, TIMP-1, and TIMP-2. As the dysregulation of MMP-2 and MMP-9 may reflect inflammatory processes in the liver, the decrease of MMP-9 following HCV protease inhibitor treatment suggests a positive effect on the reduction of liver inflammation.

Irradiation Alters MMP-2/TIMP-2 System and Collagen Type IV Degradation in Brain

Energy Technology Data Exchange (ETDEWEB)

Lee, Won Hee [School of Biomedical Engineering and Sciences, Virginia Polytechnic Institute and State University, Blacksburg, Virginia (United States); Warrington, Junie P.; Sonntag, William E. [Reynolds Oklahoma Center on Aging, Department of Geriatric Medicine, University of Oklahoma Health Sciences Center, Oklahoma City, Oklahoma (United States); Lee, Yong Woo, E-mail: ywlee@vt.edu [School of Biomedical Engineering and Sciences, Virginia Polytechnic Institute and State University, Blacksburg, Virginia (United States); Department of Biomedical Sciences and Pathobiology, Virginia Polytechnic Institute and State University, Blacksburg, Virginia (United States)

2012-04-01

Purpose: Blood-brain barrier (BBB) disruption is one of the major consequences of radiation-induced normal tissue injury in the central nervous system. We examined the effects of whole-brain irradiation on matrix metalloproteinases (MMPs)/tissue inhibitors of metalloproteinases (TIMPs) and extracellular matrix (ECM) degradation in the brain. Methods and Materials: Animals received either whole-brain irradiation (a single dose of 10 Gy {gamma}-rays or a fractionated dose of 40 Gy {gamma}-rays, total) or sham-irradiation and were maintained for 4, 8, and 24 h following irradiation. mRNA expression levels of MMPs and TIMPs in the brain were analyzed by real-time reverse transcriptase-polymerase chain reaction (PCR). The functional activity of MMPs was measured by in situ zymography, and degradation of ECM was visualized by collagen type IV immunofluorescent staining. Results: A significant increase in mRNA expression levels of MMP-2, MMP-9, and TIMP-1 was observed in irradiated brains compared to that in sham-irradiated controls. In situ zymography revealed a strong gelatinolytic activity in the brain 24 h postirradiation, and the enhanced gelatinolytic activity mediated by irradiation was significantly attenuated in the presence of anti-MMP-2 antibody. A significant reduction in collagen type IV immunoreactivity was also detected in the brain at 24 h after irradiation. In contrast, the levels of collagen type IV were not significantly changed at 4 and 8 h after irradiation compared with the sham-irradiated controls. Conclusions: The present study demonstrates for the first time that radiation induces an imbalance between MMP-2 and TIMP-2 levels and suggests that degradation of collagen type IV, a major ECM component of BBB basement membrane, may have a role in the pathogenesis of brain injury.

Irradiation Alters MMP-2/TIMP-2 System and Collagen Type IV Degradation in Brain

International Nuclear Information System (INIS)

Lee, Won Hee; Warrington, Junie P.; Sonntag, William E.; Lee, Yong Woo

2012-01-01

Purpose: Blood-brain barrier (BBB) disruption is one of the major consequences of radiation-induced normal tissue injury in the central nervous system. We examined the effects of whole-brain irradiation on matrix metalloproteinases (MMPs)/tissue inhibitors of metalloproteinases (TIMPs) and extracellular matrix (ECM) degradation in the brain. Methods and Materials: Animals received either whole-brain irradiation (a single dose of 10 Gy γ-rays or a fractionated dose of 40 Gy γ-rays, total) or sham-irradiation and were maintained for 4, 8, and 24 h following irradiation. mRNA expression levels of MMPs and TIMPs in the brain were analyzed by real-time reverse transcriptase-polymerase chain reaction (PCR). The functional activity of MMPs was measured by in situ zymography, and degradation of ECM was visualized by collagen type IV immunofluorescent staining. Results: A significant increase in mRNA expression levels of MMP-2, MMP-9, and TIMP-1 was observed in irradiated brains compared to that in sham-irradiated controls. In situ zymography revealed a strong gelatinolytic activity in the brain 24 h postirradiation, and the enhanced gelatinolytic activity mediated by irradiation was significantly attenuated in the presence of anti-MMP-2 antibody. A significant reduction in collagen type IV immunoreactivity was also detected in the brain at 24 h after irradiation. In contrast, the levels of collagen type IV were not significantly changed at 4 and 8 h after irradiation compared with the sham-irradiated controls. Conclusions: The present study demonstrates for the first time that radiation induces an imbalance between MMP-2 and TIMP-2 levels and suggests that degradation of collagen type IV, a major ECM component of BBB basement membrane, may have a role in the pathogenesis of brain injury.

42 CFR 426.517 - CMS' statement regarding new evidence.

Science.gov (United States)

2010-10-01

... 42 Public Health 3 2010-10-01 2010-10-01 false CMS' statement regarding new evidence. 426.517... DETERMINATIONS Review of an NCD § 426.517 CMS' statement regarding new evidence. (a) CMS may review any new... experts; and (5) Presented during any hearing. (b) CMS may submit a statement regarding whether the new...

42 CFR 426.515 - CMS' role in making the NCD record available.

Science.gov (United States)

2010-10-01

... 42 Public Health 3 2010-10-01 2010-10-01 false CMS' role in making the NCD record available. 426.515 Section 426.515 Public Health CENTERS FOR MEDICARE & MEDICAID SERVICES, DEPARTMENT OF HEALTH AND... COVERAGE DETERMINATIONS Review of an NCD § 426.515 CMS' role in making the NCD record available. CMS will...

40 CFR 426.100 - Applicability; description of the glass tubing (Danner) manufacturing subcategory.

Science.gov (United States)

2010-07-01

... glass tubing (Danner) manufacturing subcategory. 426.100 Section 426.100 Protection of Environment... CATEGORY Glass Tubing (Danner) Manufacturing Subcategory § 426.100 Applicability; description of the glass tubing (Danner) manufacturing subcategory. The provisions of this subpart are applicable to discharges...

Implication of MMP and TIMP in the matrice remodeling: early and delayed radiation effects of the digestive tractus; Implication des MMP et des TIMP dans le remodelage matriciel: effets aigus et tardifs de l'irradiation du tractus digestif

Energy Technology Data Exchange (ETDEWEB)

Strup-Perrot, C

2004-12-15

irradiation induces a marked acute remodeling of the gut wall and may lead to late fibrosis. Combining morphological, biochemical and molecular approach, we studied the expression of MMP and TIMP in the ileum and colon of rats one to seven days after irradiation and in ileum of patients with radiation enteritis. In both studies expression and activity of MMP and TIMP were increased, their balance being in favor of extra-cellular matrix degradation in the acute phase while in favor of matrix accumulation in radiation enteritis. (author)

Plasma levels and diagnostic utility of VEGF, MMP-2 and TIMP-2 in the diagnostics of breast cancer patients.

Science.gov (United States)

Ławicki, Sławomir; Zajkowska, Monika; Głażewska, Edyta Katarzyna; Będkowska, Grażyna Ewa; Szmitkowski, Maciej

2017-03-01

We investigated plasma levels and diagnostic utility of vascular endothelial growth factor VEGF, matrix metalloproteinase-2 (MMP-2) and tissue inhibitors of metalloproteinase-2 (TIMP-2) in comparison to cancer antigen 15-3 (CA 15-3). Plasma levels of tested parameters were determined using enzyme-linked immunosorbent assay (ELISA) while CA 15-3 with chemiluminescent microparticle immunoassay (CMIA). The plasma levels of VEGF, TIMP-2 showed significantly higher than CA 15-3 values of the diagnostic sensitivity, the predictive values of positive and negative test results (PPV, NPV) and the area under the receiver-operating characteristics (ROC) curve (AUC) in early stages of breast cancer (BC). The combined use of the tested parameters with CA 15-3 resulted in the increase in sensitivity, NPV and AUC, especially in the combination with VEGF (83%; 72%; 0.888) and TIMP-2 (83%; 72%; 0.894). The highest values were obtained for combination of all three parameters (93%; 85%; 0.923). These findings suggest the usefulness of the tested parameters in the diagnosis of BC, especially VEGF and TIMP-2 with CA 15-3 in early stages of BC, which could be a new diagnostic panel.

TIMP-2*IGFBP7 (Nephrocheck® Measurements at Intensive Care Unit Admission After Cardiac Surgery are Predictive for Acute Kidney Injury Within 48 Hours

Directory of Open Access Journals (Sweden)

Mehmet Oezkur

2017-07-01

Full Text Available Background/Aims: Acute kidney injury (AKI is a postoperative complication after cardiac surgery with a high impact on mortality and morbidity. Nephrocheck® [TIMP-2*IGFBP7] determines markers of tubular stress, which occurs prior to tubular damage. It is unknown at which time-point [TIMP-2*IGFBP7] measurement should be performed to ideally predict AKI. We investigated the association of [TIMP-2*IGFBP7] at various time-points with the incidence of AKI in patients undergoing elective cardiac surgery including cardio-pulmonary bypass. Methods: In a prospective cohort study, serial blood and urine samples were collected from 150 patients: pre-operative, at ICU-admission, 24h and 48h post-surgery. AKI was defined as Serum-Creatinine rise >0.3 mg/dl within 48hrs. Urinary [TIMP-2*IGFBP7] was measured at pre-operative, ICU-admission and 24h post-surgery; medical staff was kept blinded to these results. Results: A total of 35 patients (23.5% experienced AKI, with a higher incidence in those with high [TIMP-2*IGFBP7] values at ICU admission (57.1% vs. 10.1%, p<0.001. In logistic regression [TIMP-2*IGFBP7] at ICU admission was independently associated with the occurrence of AKI (Odds Ratio 11.83; p<0.001, C-statistic= 0.74 after adjustment for EuroSCORE II and CBP-time. Conclusions: Early detection of elevated [TIMP-2*IGFBP7] at ICU admission was strongly predictive for postoperative AKI and appeared to be more precise as compared to subsequent measurements.

Chemoradiation-induced changes in serum CEA and plasma TIMP-1 in patients with locally advanced rectal cancer

DEFF Research Database (Denmark)

Aldulaymi, Bahir; Christensen, Ib J; Sölétormos, György

2010-01-01

BACKGROUND: Preoperative biomarkers serum CEA and plasma TIMP-1 have been shown to have prognostic and predictive value in patients with colorectal cancer. The aim of the present study was to evaluate the possible impact of chemoradiotherapy (CRT) on preoperative biomarker levels in patients...... with rectal cancer. PATIENTS AND METHODS: Thirty-three patients with rectal cancer were prospectively included. The patients received CRT for 6-8 weeks. Blood samples were collected before CRT (pre-CRT) and preoperatively (post-CRT). RESULTS: Median CEA was 3.5 (range 0.6-36.1) µg/l and 2.4 (range 0.......0-10.2) µg/l (p=0.002) and median plasma TIMP-1 was 132.1 (range 77.8-342.7) µg/l and 140.0 (range 82.6-440.9) µg/l (p=0.04) in the pre- and post-CRT measurements, respectively. CONCLUSION: CRT induced a significant decrease in serum CEA and increase in plasma TIMP-1 levels. Therefore, the preoperative...

49 CFR 173.426 - Excepted packages for articles containing natural uranium or thorium.

Science.gov (United States)

2010-10-01

... outer surface of the uranium or thorium is enclosed in an inactive sheath made of metal or other durable... uranium or thorium. 173.426 Section 173.426 Transportation Other Regulations Relating to Transportation....426 Excepted packages for articles containing natural uranium or thorium. A manufactured article in...

The effect of adjunctive chlorhexidine mouthrinse on GCF MMP-8 and TIMP-1 levels in gingivitis: a randomized placebo-controlled study

Science.gov (United States)

2014-01-01

Background The aim of the present study was to evaluate the effect of adjunctive chlorhexidine (CHX) mouthrinse on gingival crevicular fluid (GCF) MMP-8 and TIMP-1 levels in plaque-associated gingivitis. Methods A total of 50 gingivitis patients were included in the present study. In addition to daily plaque control, CHX group rinsed with CHX, while placebo group rinsed with placebo mouthrinse for 4 weeks. GCF samples were collected, and clinical parameters including plaque index, papillary bleeding index, calculus index and pocket depth were recorded at baseline and 4 weeks. GCF MMP-8 and TIMP-1 levels were determined by immunofluorometric assay (IFMA) and enzyme-linked immunosorbent assay (ELISA), respectively. Results In both groups, GCF MMP-8 levels of anterior and posterior sites at four weeks were not different from baseline (p > 0.05). There were no significant differences in GCF MMP-8 levels between the study groups at four weeks (p > 0.05). GCF TIMP-1 levels of anterior and posterior sites at four weeks were higher compared to baseline in both groups (p  0.05). Conclusions CHX usage had no significant effects on the GCF MMP-8 and TIMP-1 levels in plaque-associate gingivitis. However, daily plaque control resulted in the increase of GCF TIMP-1 levels regardless of CHX usage. PMID:24886536

Implication of MMP and TIMP in the matrice remodeling: early and delayed radiation effects of the digestive tractus; Implication des MMP et des TIMP dans le remodelage matriciel: effets aigus et tardifs de l'irradiation du tractus digestif

Energy Technology Data Exchange (ETDEWEB)

Strup-Perrot, C

2004-12-15

irradiation induces a marked acute remodeling of the gut wall and may lead to late fibrosis. Combining morphological, biochemical and molecular approach, we studied the expression of MMP and TIMP in the ileum and colon of rats one to seven days after irradiation and in ileum of patients with radiation enteritis. In both studies expression and activity of MMP and TIMP were increased, their balance being in favor of extra-cellular matrix degradation in the acute phase while in favor of matrix accumulation in radiation enteritis. (author)

MAOA, early experiences of harsh parenting, irritable oppositionality and bullying-victimization : A moderated indirect-effects analysis

NARCIS (Netherlands)

Whelan, Yvonne M.; Kretschmer, Tina; Barker, Edward D.

Harsh parenting and child characteristics such as opposition and aggression have been found to relate to bullying, victimization, and bullying-victimization, yet not all children display equal vulnerability to harsh parenting. The monoamine oxidase A gene (MAOA; low-activity variant) may be a key

Attention Deficit Hyperactivity Disorder comorbid oppositional defiant disorder and its predominately inattentive type: evidence for an association with COMT but not MAOA in a Chinese sample

Directory of Open Access Journals (Sweden)

Wang Yu-Feng

2009-02-01

Full Text Available Abstract Background There are three childhood disruptive behavior disorders (DBDs, attention deficit hyperactivity disorder (ADHD, oppositional defiant disorder (ODD, and conduct disorder (CD. The most common comorbid disorder in ADHD is ODD. DSM-IV describes three ADHD subtypes: predominantly inattentive type (ADHD-IA, predominantly hyperactive-impulsive type (ADHD-HI, and combined type (ADHD-C. Prior work suggests that specific candidate genes are associated with specific subtypes of ADHD in China. Our previous association studies between ADHD and functional polymorphisms of COMT and MAOA, consistently showed the low transcriptional activity alleles were preferentially transmitted to ADHD-IA boys. Thus, the goal of the present study is to test the hypothesis that COMT Val158Met and MAOA-uVNTR jointly contribute to the ODD phenotype among Chinese ADHD boys. Methods 171 Chinese boys between 6 and 17.5 years old (mean = 10.3, SD = 2.6 with complete COMT val158met and MAOA-uVNTR genotyping information were studied. We used logistic regression with genotypes as independent variables and the binary phenotype as the dependent variable. We used p Results Our results highlight the potential etiologic role of COMT in the ADHD with comorbid ODD and its predominately inattentive type in male Chinese subjects. ADHD with comorbid ODD was associated with homozygosity of the high-activity Val allele, while the predominantly inattentive ADHD subtype was associated with the low-activity Met allele. We found no evidence of association between the MAOA-uVNTR variant and ADHD with comorbid ODD or the ADHD-IA subtype. Conclusion Our study of attention deficit hyperactivity disorder comorbid oppositional defiant disorder and its predominately inattentive type highlights the potential etiologic role of COMT for ADHD children in China. But we failed to observe an interaction between COMT and MAOA, which suggests that epistasis between COMT and MAOA genes does not

27 CFR 40.426 - Closing.

Science.gov (United States)

2010-04-01

... TOBACCO Manufacture of Cigarette Papers and Tubes Operations by Manufacturers § 40.426 Closing. A closing report, covering the period from the first of the month to the date of the closing inventory, shall be made with such inventory. (72 Stat. 1422; 26 U.S.C. 5722) Inventories ...

High Plasma TIMP-1 and Serum CEA Levels during Combination Chemotherapy for Metastatic Colorectal Cancer Are Significantly Associated with Poor Outcome

DEFF Research Database (Denmark)

Aldulaymi, Bahir; Byström, Per; Berglund, Ake

2010-01-01

. The first response evaluation was performed after 8 weeks of chemotherapy. Results: Median plasma TIMP-1 and serum CEA levels did not change significantly during 6 weeks of treatment. High plasma TIMP-1 and high serum CEA levels before treatment and at weeks 2, 4 and 6 were related to poor objective...... associated with poor overall survival; p

  Tumor tissue levels of Tissue Inhibitor of Metalloproteinases-1 (TIMP-1) and survival following adjuvant chemotherapy in pre-menopausal lymph node-positive breast cancer patients (N=525)

DEFF Research Database (Denmark)

Rasmussen, Anne-Sofie Schrohl; Look, Maxime P.; Meijer-van Gelder, Marion E.

tumor tissue TIMP-1 concentrations are associated with decreased benefit from adjuvant chemotherapy. Especially in the group treated with anthracycline-based therapy, there is a strong tendency for TIMP-1 high tumors to be less sensitive to the treatment. The anthracycline-treated group, however...... Predictive markers are needed to guide planning of adjuvant therapy for patients with breast cancer. We have recently shown that high tumor tissue levels of TIMP-1 are associated with decreased response to chemotherapy in metastatic breast cancer patients (Schrohl et al, Clin Cancer Res, 2006......) suggesting that TIMP-1 may be a predictive marker in breast cancer patients. Purpose: This study investigates the association of tumor tissue TIMP-1 levels with response to adjuvant chemotherapy with CMF (cyclophosphamide/methotrexate/5-fluorouracil) or an anthracycline-containing regimen. Patients...

Cryoplasty for Canine Iliac Artery Stenosis and its Impact on Expression of TIMP-2 and MMP-2.

Science.gov (United States)

Wu, Zhengzhong; Zang, Shengbing; Liu, Wenwen; Jiang, Na; Yang, Weizhu

2015-01-01

This study was performed to observe the effects of cryoplasty on canine iliac artery stenosis and the expression of tissue inhibition of matrix metalloproteinase 2 (TIMP-2) and matrix metalloproteinase 2 (MMP-2). We produced a reliable canine model to mimic the atherosclerotic stenosis in the iliac artery by suturing the artery followed by vessel ligation to create an injury to intimal and medial walls. Sixteen mongrel dogs with iliac artery stenosis were randomized to conventional balloon angioplasty (n = 8) or cryoplasty (n = 8). Four weeks posttreatment, the cryoplasty group with less collagen fibers and smooth muscle demonstrated significantly larger luminal diameter of iliac artery compared to the balloon angioplasty group (P < .001). Expression of TIMP-2 significantly increased and expression of MMP-2 significantly reduced in iliac artery of the cryoplasty group compared to conventional balloon angioplasty. Our study suggests cryoplasty might increase the expression of TIMP-2 and decrease the expression of MMP-2, thereby inhibiting vascular hyperplasia and collagen fibers synthesis of the stenotic vessels. © The Author(s) 2015.

Update on the pharmacology of selective inhibitors of MAO-A and MAO-B: focus on modulation of CNS monoamine neurotransmitter release.

Science.gov (United States)

Finberg, John P M

2014-08-01

Inhibitors of monoamine oxidase (MAO) were initially used in medicine following the discovery of their antidepressant action. Subsequently their ability to potentiate the effects of an indirectly-acting sympathomimetic amine such as tyramine was discovered, leading to their limitation in clinical use, except for cases of treatment-resistant depression. More recently, the understanding that: a) potentiation of indirectly-acting sympathomimetic amines is caused by inhibitors of MAO-A but not by inhibitors of MAO-B, and b) that reversible inhibitors of MAO-A cause minimal tyramine potentiation, has led to their re-introduction to clinical use for treatment of depression (reversible MAO-A inhibitors and new dose form MAO-B inhibitor) and treatment of Parkinson's disease (MAO-B inhibitors). The profound neuroprotective properties of propargyl-based inhibitors of MAO-B in preclinical experiments have drawn attention to the possibility of employing these drugs for their neuroprotective effect in neurodegenerative diseases, and have raised the question of the involvement of the MAO-mediated reaction as a source of reactive free radicals. Despite the long-standing history of MAO inhibitors in medicine, the way in which they affect neuronal release of monoamine neurotransmitters is still poorly understood. In recent years, the detailed chemical structure of MAO-B and MAO-A has become available, providing new possibilities for synthesis of mechanism-based inhibitors. This review describes the latest advances in understanding the way in which MAO inhibitors affect the release of the monoamine neurotransmitters dopamine, noradrenaline and serotonin (5-HT) in the CNS, with an accent on the importance of these effects for the clinical actions of the drugs. Copyright © 2014 Elsevier Inc. All rights reserved.

Implication of MMP and TIMP in the matrice remodeling: early and delayed radiation effects of the digestive tractus

International Nuclear Information System (INIS)

Strup-Perrot, C.

2004-12-01

irradiation induces a marked acute remodeling of the gut wall and may lead to late fibrosis. Combining morphological, biochemical and molecular approach, we studied the expression of MMP and TIMP in the ileum and colon of rats one to seven days after irradiation and in ileum of patients with radiation enteritis. In both studies expression and activity of MMP and TIMP were increased, their balance being in favor of extra-cellular matrix degradation in the acute phase while in favor of matrix accumulation in radiation enteritis. (author)

TIMP-1 overexpression does not affect sensitivity to HER2-targeting drugs in the HER2-gene-amplified SK-BR-3 human breast cancer cell line

DEFF Research Database (Denmark)

Deng, Xiaohong; Fogh, Louise; Lademann, Ulrik Axel

2013-01-01

affect sensitivity to the HER2-targeting drugs trastuzumab and lapatinib. SK-BR-3 human breast cancer cells were stably transfected with TIMP-1, characterized with regard to TIMP-1 protein expression, proliferation, and functionality of the secreted TIMP-1, and the sensitivity to trastuzumab...... and lapatinib was studied in five selected single-cell subclones expressing TIMP-1 protein at various levels plus the parental SK-BR-3 cell line. Both trastuzumab and lapatinib reduced cell viability, as determined by MTT assay, but the sensitivity to the drugs was not associated with the expression level...... to trastuzumab and lapatinib....

MAOA, Early Experiences of Harsh Parenting, Irritable Opposition, and Bullying-Victimization: A Moderated Indirect-Effects Analysis

Science.gov (United States)

Whelan, Yvonne M.; Kretschmer, Tina; Barker, Edward D.

2014-01-01

Harsh parenting and child characteristics such as opposition and aggression have been found to relate to bullying, victimization, and bullying-victimization, yet not all children display equal vulnerability to harsh parenting. The monoamine oxidase A gene ("MAOA"; "low-activity" variant) may be a key vulnerability allele as it…

SERUM CONCENTRATIONS OF MATRIX METALLOPROTEINASE-9, -13 AND TIMP-1 IN AN OVARIECTOMIZED WISTAR RAT MODEL OF OSTEOPOROSIS

Directory of Open Access Journals (Sweden)

Armine V. Grigoryan

2017-12-01

Full Text Available Introduction. Osteoporosis is a disease characterized by decreased bone density and destruction of the microarchitectonics of the bone structure. This leads to increased bone fragility and risk of fracture, particularly of the hip, spine, wrist and shoulder. Osteoporosis is known as „The Silent Epidemic of the Century“ because bone loss occurs without symptoms. An altered ovarian function is one of the most common causes of osteoporosis. Indicators for altered bone homeostasis are the changes in serum levels of matrix metalloproteinases (MMPs and their tissue inhibitors (TIMPs. Objective. The aim of current study was to determine the activity of alkaline phosphatase (ALP and serum concentrations of MMP-9, MMP-13 and TIMP-1 in the ovariectomized rats. Materials and Methods. An experiment was performed on 35 female Wistar rats at reproductive age – 2 months divided into 2 groups: group 1 (G1-20 animals were sham-operated (sham and group 2 (G2-15 were ovariectomized (ovx. Results. The concentrations of ALP, MMP-9, MMP-13 and TIMP-1 in G2 were significantly increased compared to G1 (p<0.05. Conclusion. Our study confirmed that the serum activity of ALP, which is a marker of bone formation, was elevated in rats with OVX-induced osteoporosis. Although the level of TIMP-1 is increased, the level of MMP 9 in G2 is also increased, that confirms the thesis that MMP-9 may be a marker for osteoclast activity.

Genotypes do not confer risk for delinquency but rather alter susceptibility to positive and negative environmental factors: gene-environmentinteractions of BDNF Val66Met, 5-HTTLPR, and MAOA-uVNTR [corrected].

Science.gov (United States)

Nilsson, Kent W; Comasco, Erika; Hodgins, Sheilagh; Oreland, Lars; Åslund, Cecilia

2014-12-10

Previous evidence of gene-by-environment interactions associated with emotional and behavioral disorders is contradictory. Differences in findings may result from variation in valence and dose of the environmental factor, and/or failure to take account of gene-by-gene interactions. The present study investigated interactions between the brain-derived neurotrophic factor gene (BDNF Val66Met), the serotonin transporter gene-linked polymorphic region (5-HTTLPR), the monoamine oxidase A (MAOA-uVNTR) polymorphisms, family conflict, sexual abuse, the quality of the child-parent relationship, and teenage delinquency. In 2006, as part of the Survey of Adolescent Life in Västmanland, Sweden, 1 337 high-school students, aged 17-18 years, anonymously completed questionnaires and provided saliva samples for DNA analyses. Teenage delinquency was associated with two-, three-, and four-way interactions of each of the genotypes and the three environmental factors. Significant four-way interactions were found for BDNF Val66Met × 5-HTTLPR×MAOA-uVNTR × family conflicts and for BDNF Val66Met × 5-HTTLPR×MAOA-uVNTR × sexual abuse. Further, the two genotype combinations that differed the most in expression levels (BDNF Val66Met Val, 5-HTTLPR LL, MAOA-uVNTR LL [girls] and L [boys] vs BDNF Val66Met Val/Met, 5-HTTLPR S/LS, MAOA-uVNTR S/SS/LS) in interaction with family conflict and sexual abuse were associated with the highest delinquency scores. The genetic variants previously shown to confer vulnerability for delinquency (BDNF Val66Met Val/Met × 5-HTTLPR S × MAOA-uVNTR S) were associated with the lowest delinquency scores in interaction with a positive child-parent relationship. Functional variants of the MAOA-uVNTR, 5-HTTLPR, and BDNF Val66Met, either alone or in interaction with each other, may be best conceptualized as modifying sensitivity to environmental factors that confer either risk or protection for teenage delinquency. © The Author 2015. Published by Oxford University

Genotypes Do Not Confer Risk For Delinquency ut Rather Alter Susceptibility to Positive and Negative Environmental Factors: Gene-Environment Interactions of BDNF Val66Met, 5-HTTLPR, and MAOA-uVNTR

Science.gov (United States)

Comasco, Erika; Hodgins, Sheilagh; Oreland, Lars; Åslund, Cecilia

2015-01-01

Background: Previous evidence of gene-by-environment interactions associated with emotional and behavioral disorders is contradictory. Differences in findings may result from variation in valence and dose of the environmental factor, and/or failure to take account of gene-by-gene interactions. The present study investigated interactions between the brain-derived neurotrophic factor gene (BDNF Val66Met), the serotonin transporter gene-linked polymorphic region (5-HTTLPR), the monoamine oxidase A (MAOA-uVNTR) polymorphisms, family conflict, sexual abuse, the quality of the child-parent relationship, and teenage delinquency. Methods: In 2006, as part of the Survey of Adolescent Life in Västmanland, Sweden, 1 337 high-school students, aged 17–18 years, anonymously completed questionnaires and provided saliva samples for DNA analyses. Results: Teenage delinquency was associated with two-, three-, and four-way interactions of each of the genotypes and the three environmental factors. Significant four-way interactions were found for BDNF Val66Met × 5-HTTLPR×MAOA-uVNTR × family conflicts and for BDNF Val66Met × 5-HTTLPR×MAOA-uVNTR × sexual abuse. Further, the two genotype combinations that differed the most in expression levels (BDNF Val66Met Val, 5-HTTLPR LL, MAOA-uVNTR LL [girls] and L [boys] vs BDNF Val66Met Val/Met, 5-HTTLPR S/LS, MAOA-uVNTR S/SS/LS) in interaction with family conflict and sexual abuse were associated with the highest delinquency scores. The genetic variants previously shown to confer vulnerability for delinquency (BDNF Val66Met Val/Met × 5-HTTLPR S × MAOA-uVNTR S) were associated with the lowest delinquency scores in interaction with a positive child-parent relationship. Conclusions: Functional variants of the MAOA-uVNTR, 5-HTTLPR, and BDNF Val66Met, either alone or in interaction with each other, may be best conceptualized as modifying sensitivity to environmental factors that confer either risk or protection for teenage delinquency. PMID

Glotaran: A Java-Based Graphical User Interface for the R Package TIMP

Directory of Open Access Journals (Sweden)

Katharine M. Mullen

2012-06-01

Full Text Available In this work the software application called Glotaran is introduced as a Java-based graphical user interface to the R package TIMP, a problem solving environment for fitting superposition models to multi-dimensional data. TIMP uses a command-line user interface for the interaction with data, the specification of models and viewing of analysis results. Instead, Glotaran provides a graphical user interface which features interactive and dynamic data inspection, easier -- assisted by the user interface -- model specification and interactive viewing of results. The interactivity component is especially helpful when working with large, multi-dimensional datasets as often result from time-resolved spectroscopy measurements, allowing the user to easily pre-select and manipulate data before analysis and to quickly zoom in to regions of interest in the analysis results. Glotaran has been developed on top of the NetBeans rich client platform and communicates with R through the Java-to-R interface Rserve. The background and the functionality of the application are described here. In addition, the design, development and implementation process of Glotaran is documented in a generic way.

Plasma TIMP-1 and CEA as markers for detection of primary colorectal cancer

DEFF Research Database (Denmark)

Christensen, Ib Jarle; Brünner, Nils; Dowell, Barry

2015-01-01

endoscopy were prospectively included (N=1965). Baseline data and co-morbidity were recorded. The primary end-point was the detection of CRC. Plasma was obtained before endoscopy and TIMP-1 and CEA levels were determined using an automated analysis platform when all samples were collected. RESULTS: CRC...

A Role for Timp3 in Microbiota-Driven Hepatic Steatosis and Metabolic Dysfunction

Directory of Open Access Journals (Sweden)

Maria Mavilio

2016-07-01

Full Text Available The effect of gut microbiota on obesity and insulin resistance is now recognized, but the underlying host-dependent mechanisms remain poorly undefined. We find that tissue inhibitor of metalloproteinase 3 knockout (Timp3−/− mice fed a high-fat diet exhibit gut microbiota dysbiosis, an increase in branched chain and aromatic (BCAA metabolites, liver steatosis, and an increase in circulating soluble IL-6 receptors (sIL6Rs. sIL6Rs can then activate inflammatory cells, such as CD11c+ cells, which drive metabolic inflammation. Depleting the microbiota through antibiotic treatment significantly improves glucose tolerance, hepatic steatosis, and systemic inflammation, and neutralizing sIL6R signaling reduces inflammation, but only mildly impacts glucose tolerance. Collectively, our results suggest that gut microbiota is the primary driver of the observed metabolic dysfunction, which is mediated, in part, through IL-6 signaling. Our findings also identify an important role for Timp3 in mediating the effect of the microbiota in metabolic diseases.

Does prior traumatization affect the treatment outcome of CBT for panic disorder? The potential role of the MAOA gene and depression symptoms.

Science.gov (United States)

Trautmann, Sebastian; Richter, Jan; Muehlhan, Markus; Höfler, Michael; Wittchen, Hans-Ulrich; Domschke, Katharina; Ströhle, Andreas; Hamm, Alfons O; Weber, Heike; Kircher, Tilo; Arolt, Volker; Gerlach, Alexander L; Alpers, Georg W; Fydrich, Thomas; Lang, Thomas; Reif, Andreas

2017-07-15

Although cognitive behavioral therapy (CBT) is highly effective in the treatment of anxiety disorders, many patients still do not benefit. This study investigates whether a history of traumatic event experience is negatively associated with outcomes of CBT for panic disorder. The moderating role of the monoamine oxidase A (MAOA) gene and depression symptoms as well as the association between trauma history and fear reactivity as a potential mechanism are further analyzed. We conducted a post-hoc analysis of 172 male and 60 female patients with panic disorder treated with CBT in a multi-center study. Treatment outcome was assessed at post-treatment using self-report and clinician rating scales. Fear reactivity before treatment was assessed via heart rate and self-reported anxiety during a behavioral avoidance test. Among females, we did not find any differences in treatment response between traumatized and non-traumatized individuals or any two-way interaction trauma history × MAOA genotype. There was a significant three-way interaction trauma history × MAOA genotype × depression symptoms on all treatment outcomes indicating that in traumatized female patients carrying the low-activity allele, treatment effect sizes decreased with increasing depression symptoms at baseline. No such effects were observed for males. In conclusion, we found no evidence for a differential treatment response in traumatized and non-traumatized individuals. There is preliminary evidence for poorer treatment outcomes in a subgroup of female traumatized individuals carrying the low-active variant of the MAOA gene. These patients also report more symptoms of depression symptomatology and exhibit a dampened fear response before treatment which warrants further investigation.

Há equivalência entre a temperatura da membrana timpânica e a temperatura retal em ovinos Santa Inês normotérmicos?

OpenAIRE

Del Campo,Claudia; Boere,Vanner

2008-01-01

A utilização do termômetro de raios infravermelhos para a aferição da temperatura timpânica em animais tem se tornado uma alternativa prática na clínica veterinária. Em ovinos, a mensuração da temperatura timpânica não foi suficientemente comparada com a aferição da temperatura retal. Este estudo avaliou a equivalência entre a temperatura timpânica e a temperatura retal em 16 ovinos da raça Santa Inês. Durante a coleta de dados, a temperatura e a umidade relativa do ar foram monitoradas e não...

Correlation of Endostatin and Tissue Inhibitor of Metalloproteinases 2 (TIMP2 Serum Levels With Cardiovascular Involvement in Systemic Sclerosis Patients

Directory of Open Access Journals (Sweden)

Bozena Dziankowska-Bartkowiak

2005-01-01

pathogenesis of SSc. Heart fibrosis is one of the most important prognostic factors in SSc patients. So, the aim of our study was to examine cardiovascular dysfunction in SSc patients and its correlation with serum levels of vascular endothelial growth factor (VEGF, endostatin, and tissue inhibitor of metalloproteinase 2 (TIMP2. The study group comprised 34 patients (19 with limited scleroderma (lSSc and 15 with diffuse scleroderma (dSSc. The control group consisted of 20 healthy persons, age and sex matched. Internal organ involvement was assessed on the basis of specialist procedures. Serum VEGF, endostatin, and TIMP2 levels were evaluated by ELISA. We found cardiovascular changes in 15 patients with SSc (8 with lSSc and 7 with dSSc. The observed symptoms were of different characters and also coexisted with each other. Higher endostatin serum levels in all systemic sclerosis patients in comparison to the control group were demonstrated (P<.05. Also higher serum levels of endostatin and TIMP2 were observed in patients with cardiovascular changes in comparison to the patients without such changes (P<.05. The obtained results support the notion that angiogenesis and fibrosis disturbances may play an important role in SSc. Evaluation of endostatin and TIMP2 serum levels seems to be one of the noninvasive, helpful examinations of heart involvement in the course of systemic sclerosis.

Therapy of psoriasis with narrowband ultraviolet-B light influences plasma concentrations of MMP-2 and TIMP-2 in patients

Directory of Open Access Journals (Sweden)

Głażewska EK

2016-10-01

Full Text Available Edyta Katarzyna Głażewska,1 Marek Niczyporuk,1 Sławomir Ławicki,2 Maciej Szmitkowski,2 Monika Zajkowska,2 Grażyna Ewa Będkowska,3 Andrzej Przylipiak1 1Department of Esthetic Medicine, 2Department of Biochemical Diagnostics, 3Department of Haematological Diagnostics, Medical University, Białystok, Poland Background: Matrix metalloproteinases (MMPs, which show a significant ability to cleave the components of extracellular matrix, and tissue inhibitors of metalloproteinases (TIMPs, which slow down the activity of those enzymes, may be implicated in the pathogenesis and spread of psoriatic disease. This study aims to analyze plasma levels of MMP-2 and TIMP-2 in plaque psoriasis patients before and after the course of narrowband ultraviolet-B (NBUVB therapy with respect to disease advancement. Patients and methods: A total of 49 patients suffering from plaque psoriasis and 40 healthy volunteers were enrolled into the study. Plasma levels of MMP-2 and TIMP-2 were determined using enzyme-linked immunosorbent assay, while Psoriasis Area and Severity Index (PASI was used to define the disease advancement. Results: The results showed increased plasma levels of MMP-2 and TIMP-2, but this change was significant only in case of MMP-2 in total psoriatic group compared to healthy subjects. Moreover, there was an increase in the concentrations of chosen factors with an increase in the severity of the disease. The NBUVB therapy causes a decline in the concentration of the analyzed enzyme and its inhibitor, although this change was statistically significant in the total psoriatic group only in case of MMP-2. There was also a positive correlation between MMP-2, TIMP-2, and PASI score value. Conclusion: Our study highlights a possible important role of MMP-2 in the activity of psoriasis and clearance of disease symptoms. Moreover, plasma MMP-2 seems to be a valuable psoriasis biomarker. Keywords: gelatinase A, matrix metalloproteinases, tissue inhibitor of

Identification of Single Nucleotide Polymorphism (SNP in Mono Amine Oxidase A (MAO-A Gene as a genetic marker for aggressiveness in sheep

Directory of Open Access Journals (Sweden)

Eko Handiwirawan

2012-12-01

Full Text Available In the population, there are aggressive sheep in a small number which requires special management those specific animal house and routine management. The purpose of this study was to identify the variation of DNA marker SNP (single nucleotide polymorphism as a genetic marker for the aggressive trait in several of sheep breed. The identification of point mutations in exon 8 of MAO-A gene associated with aggressive behavior in sheep may be further useful to become of DNA markers for the aggressive trait in sheep. Five of sheep breed were used, i.e.: Barbados Black belly Cross sheep (BC, Composite Garut (KG, Local Garut (LG, Composite Sumatra (KS and St. Cross Croix (SC. Duration of ten behavior traits, blood serotonin concentrations and DNA sequence of exon 8 of MAO-A gene from the sheep aggressive and nonaggressive were observed. PROC GLM of SAS Ver. 9.0 program was used to analyze variable behavior and blood serotonin concentrations. DNA polymorphism in exon 8 of MAO-A gene was analyzed using the MEGA software Ver. 4.0. The results show that the percentage of the aggressive rams of each breed was less than 10 percent; except for the KS sheep is higher (23%. Based on the duration of behavior, aggressive sheep group was not significantly different with non aggressive sheep group, except duration of care giving and drinking behavior. It is known that concentration of blood serotonin in aggressive and non aggressive rams was not significantly different. The aggressive trait in sheep has a mechanism or a different cause like that occurs in mice and humans. In this study, aggressive behavior in sheep was not associated with a mutation in exon 8 of MAO-A gene.

Porphyromonas gingivalis decreases osteoblast proliferation through IL-6-RANKL/OPG and MMP-9/TIMPs pathways

Directory of Open Access Journals (Sweden)

Le Xuan

2009-01-01

Full Text Available Background: Porphyromonas gingivalis, an important periodontal pathogen, is closely associated with inflammatory alveolar bone resorption. This bacterium exerts its pathogenic effect indirectly through multiple virulence factors, such as lipopolysaccharides, fimbriae, and proteases. Another possible pathogenic path may be through a direct interaction with the host′s soft and hard tissues (e.g., alveolar bone, which could lead to periodontitis. Aims and Objectives: The aim of the present study was to investigate the direct effect of live and heat-inactivated P gingivalis on bone resorption, using an in vitro osteoblast culture model. Results: Optical microscopy and 3-[4,5-dimethylthiazol-2-yl]-2,5-diphenyl-tetrazolium bromide MTT assay revealed that live P gingivalis induced osteoblast detachment and reduced their proliferation. This effect was specific to live bacteria and was dependent on their concentration. Live P gingivalis increased IL-6 mRNA expression and protein production and downregulated RANKL and OPG mRNA expression. The effect of live P gingivalis on bone resorption was strengthened by an increase in MMP-9 expression and its activity. This increase was accompanied by an increase in TIMP-1 and TIMP-2 mRNA expression and protein production by osteoblasts infected with live P gingivalis. Conclusion: Overall, the results suggest that direct contact of P gingivalis with osteoblasts induces bone resorption through an inflammatory pathway that involves IL-6, RANKL/OPG, and MMP-9/TIMPs.

Comparison of Salivary TIMP-1 Levels in Periodontally Involved and Healthy Controls and the Response to Nonsurgical Periodontal Therapy

Directory of Open Access Journals (Sweden)

Angel Fenol

2014-01-01

Full Text Available Background. Periodontal disease is a chronic inflammatory condition affecting the supporting structures of the dentition. Periodontal destruction is an outcome of the imbalance between matrix metalloproteinases and tissue inhibitors of matrix metalloproteinases (TIMPs. We wanted to prove the hypothesis that salivary TIPM-1 level will vary in different people. A decrease in TIMP-1 level could make them more susceptible to periodontitis whereas a normal level could prevent increased tissue destruction thereby inhibiting the progression from gingivitis to periodontitis. This could probably pave the way for TIPM-1 to be a specific salivary biomarker and serve as a useful diagnostic and therapeutic tool in periodontitis. Methods. Whole unstimulated saliva of 2 ml was collected from twenty-five periodontally healthy and twenty-seven systemically healthy subjects with periodontitis. Clinical parameters recorded at baseline and reevaluated after four weeks in subjects with periodontitis following nonsurgical periodontal therapy were gingival index (GI, oral hygiene index-Simplified (OHI-S, probing pocket depth, and clinical attachment level (CAL. Salivary TIMP-1 levels in both were analyzed using a commercially available ELISA kit.

43 CFR 426.23 - Recovery of operation and maintenance (O&M) costs.

Science.gov (United States)

2010-10-01

... operation and maintenance (O&M) costs. (a) General. All new, amended, and renewed contracts shall provide... 43 Public Lands: Interior 1 2010-10-01 2010-10-01 false Recovery of operation and maintenance (O&M) costs. 426.23 Section 426.23 Public Lands: Interior Regulations Relating to Public Lands BUREAU OF...

Clinical significance of determination the changes of serum CGRP, MMP-9 and TIMP-1 levels both before and after treatment in pediatric patients with bronchial asthma

International Nuclear Information System (INIS)

Chen Guijin

2011-01-01

Objective: To explore the changes of serum CGRP, MMP-9 and TIMP-1 levels after treatment in pediatric patients with bronchial asthma. Methods: Serum CGRP(with RIA), MMP-9, TIMP-1 (with ELISA) levels were measured in 32 patients with bronchial asthma both before and after treatment as well as in 35 controls. Results: Before treatment, the serum CGRP levels was significantly lower in patients than those in controls (P 0.05). Conclusion: Abnormal lower CGRP and high MMP-9, TIMP-1 levels might play an important role in the pathogenesis and development of bronchial asthma in children. (authors)

Linkage and candidate gene analysis of X-linked familial exudative vitreoretinopathy.

Science.gov (United States)

Shastry, B S; Hejtmancik, J F; Plager, D A; Hartzer, M K; Trese, M T

1995-05-20

Familial exudative vitreoretinopathy (FEVR) is a hereditary eye disorder characterized by avascularity of the peripheral retina, retinal exudates, tractional detachment, and retinal folds. The disorder is most commonly transmitted as an autosomal dominant trait, but X-linked transmission also occurs. To initiate the process of identifying the gene responsible for the X-linked disorder, linkage analysis has been performed with three previously unreported three- or four-generation families. Two-point analysis showed linkage to MAOA (Zmax = 2.1, theta max = 0) and DXS228 (Zmax = 0.5, theta max = 0.11), and this was further confirmed by multipoint analysis with these same markers (Zmax = 2.81 at MAOA), which both lie near the gene causing Norrie disease. Molecular genetic analysis further reveals a missense mutation (R121W) in the third exon of the Norrie's disease gene that perfectly cosegregates with the disease through three generations in one family. This mutation was not detected in the unaffected family members and six normal unrelated controls, suggesting that it is likely to be the pathogenic mutation. Additionally, a polymorphic missense mutation (H127R) was detected in a severely affected patient.

MAOA-uVNTR and early physical discipline interact to influence delinquent behavior.

Science.gov (United States)

Edwards, Alexis C; Dodge, Kenneth A; Latendresse, Shawn J; Lansford, Jennifer E; Bates, John E; Pettit, Gregory S; Budde, John P; Goate, Alison M; Dick, Danielle M

2010-06-01

A functional polymorphism in the promoter region of the monoamine oxidizing gene monoamine oxidase A (MAOA) has been associated with behavioral sensitivity to adverse environmental conditions in multiple studies (e.g., Caspi et al. 2002; Kim-Cohen et al., 2006). The present study investigates the effects of genotype and early physical discipline on externalizing behavior. We expand on the current literature in our assessment of externalizing, incorporating information across multiple reporters and over a broad developmental time period, and in our understanding of environmental risk. This study uses data from the Child Development Project, an ongoing longitudinal study following a community sample of children beginning at age 5. Physical discipline before age 6 was quantified using a subset of questions from the Conflict Tactics Scale (Straus, 1979). Externalizing behavior was assessed in the male, European-American sub-sample (N = 250) by parent, teacher, and self-report using Achenbach's Child Behavior Checklist, Teacher Report Form, and Youth Self-Report (Achenbach, 1991), at 17 time points from ages 6 to 22. Regression analyses tested the influence of genotype, physical discipline, and their interaction on externalizing behavior, and its subscales, delinquency and aggression. We found a significant interaction effect between genotype and physical discipline on levels of delinquent behavior. Similar trends were observed for aggression and overall externalizing behavior, although these did not reach statistical significance. Main effects of physical discipline held for all outcome variables, and no main effects held for genotype. The adverse consequences of physical discipline on forms of externalizing behavior are exacerbated by an underlying biological risk conferred by MAOA genotype.

Monoamine Oxidase A (MAOA Gene and Personality Traits from Late Adolescence through Early Adulthood: A Latent Variable Investigation

Directory of Open Access Journals (Sweden)

Man K. Xu

2017-10-01

Full Text Available Very few molecular genetic studies of personality traits have used longitudinal phenotypic data, therefore molecular basis for developmental change and stability of personality remains to be explored. We examined the role of the monoamine oxidase A gene (MAOA on extraversion and neuroticism from adolescence to adulthood, using modern latent variable methods. A sample of 1,160 male and 1,180 female participants with complete genotyping data was drawn from a British national birth cohort, the MRC National Survey of Health and Development (NSHD. The predictor variable was based on a latent variable representing genetic variations of the MAOA gene measured by three SNPs (rs3788862, rs5906957, and rs979606. Latent phenotype variables were constructed using psychometric methods to represent cross-sectional and longitudinal phenotypes of extraversion and neuroticism measured at ages 16 and 26. In males, the MAOA genetic latent variable (AAG was associated with lower extraversion score at age 16 (β = −0.167; CI: −0.289, −0.045; p = 0.007, FDRp = 0.042, as well as greater increase in extraversion score from 16 to 26 years (β = 0.197; CI: 0.067, 0.328; p = 0.003, FDRp = 0.036. No genetic association was found for neuroticism after adjustment for multiple testing. Although, we did not find statistically significant associations after multiple testing correction in females, this result needs to be interpreted with caution due to issues related to x-inactivation in females. The latent variable method is an effective way of modeling phenotype- and genetic-based variances and may therefore improve the methodology of molecular genetic studies of complex psychological traits.

Characterization of a human X-linked gene from the DXS732E locus in the candidate region for the anhidrotic ectodermal dysplasia (EDA) gene (Xq13.1)

Energy Technology Data Exchange (ETDEWEB)

Gault, J.; Zonana, J. [Oregon Health Sciences Univ., Portland, OR (United States); Zeltinger, J. [Univ. of Washington, Seattle, WA (United States)] [and others

1994-09-01

A conserved mouse genomic clone was used to identify a homologous human genomic clone (the DXS732E locus), which was subsequently employed to isolate cDNAs from a human fetal brain library. Nine unique overlapping cDNAs were isolated, and sequences analysis of 3.9 kb identified a putative 1 kb ORF. GRAIL analysis of the sequence supported the hypothesis that the putative ORF was coding sequence, and Prosite analysis of the putative ORF identified potential glycosylation and phosphorylation sites. The 5{prime} end of the gene maps within a CpG island, and comparison of cDNA sequences indicate the gene is alternatively spliced at its 3{prime} end. Northern analysis and RT-PCR indicate that two different sized messages appear to be expressed with the gene expressed in human fetal kidney, intestine, brain, and muscle. The gene is expressed in 77 day human skin, a time when hair follicle formation occurs. Anhidrotic ectodermal dysplasia (EDA) results in the abnormal morphogenesis of hair, teeth and eccrine sweat glands. A positional cloning strategy towards cloning the EDA gene had been used, and deletion and X-autosome translocation patients have been useful in further delimiting the EDA region. The present gene at the DXS732E locus is partially deleted in one EDA patient who does not have other apparent abnormalities. No rearrangements of the gene have been detected in two female X-autosome translocation EDA patients, nor in four additional male patients with submicroscopic molecular deletions.

MMP3 and TIMP2 gene variants as predisposing factors for Achilles tendon pathologies: Attempted replication study in a British case-control cohort.

Science.gov (United States)

El Khoury, Louis; Ribbans, William J; Raleigh, Stuart M

2016-09-01

Variants within the MMP3 (rs679620) and TIMP2 (rs4789932) genes have been associated with the risk of Achilles tendon pathology (ATP) in populations from South Africa and Australia. This study aimed to determine whether these variants were associated with the risk of ATP in British Caucasians. We recruited 118 cases with ATP, including a subset of 25 individuals with Achilles tendon rupture (RUP) and 131 controls. DNA samples were isolated from saliva and genotyped using qPCR. For the TIMP2 rs4789932 variant we found a significant (p = 0.038) difference in the genotype distribution frequency between males with ATP (CC, 39.4%; CT, 43.7%; TT, 16.9%) compared to male controls (CC, 20.7%; CT, 59.8%; TT, 19.5%). We also observed a difference in the TIMP2 rs4789932 genotype distribution between males with rupture compared to male controls (p = 0.038). The MMP3 rs679620 GG genotype was found to be overrepresented in the Achilles tendon rupture (RUP) group (AA, 24.0%; AG, 32.0%; GG, 44.0%) compared to controls (AA, 26.7%; AG, 54.2%; GG, 19.1%). In conclusion, the CT genotype of the TIMP2 rs4789932 variant was associated with lower risk of ATP in males. Furthermore, while we revealed differences for both variants in genotype distribution between the RUP and control groups, the sample size of the RUP group was small and confirmation would be required in additional cohorts. Finally, although both the TIMP2 rs4789932 and MMP3 rs679620 variants tentatively associated with ATP, there were differences in the direction of association compared to earlier work.

Emergence in extinction of enhanced and persistent responding to ambiguous aversive cues is associated with high MAOA activity in the prelimbic cortex

Directory of Open Access Journals (Sweden)

Guillaume L. Poirier

2016-12-01

Full Text Available There is a great deal of individual variability in the emotional outcomes of potentially traumatic events, and the underlying mechanisms are only beginning to be understood. In order to further our understanding of individual trajectories to trauma, its vulnerability and resilience, we adapted a model of fear expression to ambiguous vs perfect cues in adult male rats, and examined long-term fear extinction, 2, 3, and 50 days from acquisition. After the final conditioned fear test, mitochondrial enzyme monoamine oxidase A (MAOA function was examined. In order to identify associations between this function and behavioral expression, an a posteri median segregation approach was adopted, and animals were classified as high or low responding according to level of freezing to the ambiguous cue at remote testing, long after the initial extinction. Those individuals characterized by their higher response showed a freezing pattern that persisted from their previous extinction sessions, in spite of their acquisition levels being equivalent to the low-freezing group. Furthermore, unlike more adaptive individuals, freezing levels of high-freezing animals even increased at initial extinction, to almost double their acquisition session levels. Controlling for perfect cue response at remote extinction, greater ambiguous threat cue response was associated with enhanced prelimbic cortex MAOA functional activity. These findings underscore MAOA as a potential target for the development of interventions to mitigate the impact of traumatic experiences.

Association of MMP-9 Haplotypes and TIMP-1 Polymorphism with Spontaneous Deep Intracerebral Hemorrhage in the Taiwan Population.

Directory of Open Access Journals (Sweden)

Wei-Min Ho

Full Text Available Spontaneous deep intracerebral hemorrhage (SDICH is a devastating stroke subtype. The causes of SDICH are heterogeneous. Matrix metalloproteinase-9 (MMP-9, Gelantinase B has been shown to relate to stroke and the development of aneurysm and may increase risks of intracerebral hemorrhage. MMP activities are modulated by their endogenous inhibitors, tissue inhibitors of metalloproteinases (TIMPs. We analyzed the genetic variants of MMP-9 and TIMP-1 and SDICH susceptibility.Associations were tested by logistic regression or general linear models with adjusting for multiple covariables. Multiplicative terms between genes were applied to detect the interaction effects on SDICH. Permutation testing of 1,000 replicates was performed for empirical estimates.In the group of ≥65 years old (y/o, we found associations of SDICH with rs3787268 (Odds ratio [OR] = 0.48, 95% confidence interval [CI] 0.27 to 0.86, P = 0.01 and haplotype1 (Hap1 (OR = 0.48, 95% CI 0.26 to 0.86, P = 0.014. For TIMP1 gene, rs4898 was associated with SDICH in the elder male group (OR = 0.35, 95% CI 0.15 to 0.81, P = 0.015. In contrast, in the younger male group, there were associations of SDICH with rs2250889 (OR = 0.48, 95% CI 0.27 to 0.84, P = 0.01 and Hap3 (OR = 0.61, 95% CI 0.38 to 0.97, P = 0.04. We found significant genetic interaction between TIMP-1 and MMP-9 in SDICH susceptibility among younger male subjects (P = 0.004. In subjects carrying rs4898 minor allele, carriers with Hap3 had lower SDICH risk than non-carriers (OR = 0.19, 95% CI 0.07 to 0.51, P = 0.001. In addition, this study showed that when young males were exposed to alcohol, Hap3 was a protective factor of SDICH (OR = 0.06, 95% CI 0.01 to 0.27, P = 0.0002. In contrast, when they were exposed to smoke, Hap2 carriers had increased risk of SDICH (OR = 2.45, 95% CI 1.05 to 5.73, P = 0.04.This study showed modest to moderate effects of MMP-9 and TIMP-1 polymorphisms on SDICH risks with significant age differences

17 CFR 256.426.5 - Other deductions.

Science.gov (United States)

2010-04-01

... deductible before determining total income before interest charges. (b) Records shall be so maintained by...) UNIFORM SYSTEM OF ACCOUNTS FOR MUTUAL SERVICE COMPANIES AND SUBSIDIARY SERVICE COMPANIES, PUBLIC UTILITY HOLDING COMPANY ACT OF 1935 Income and Expense Accounts § 256.426.5 Other deductions. (a) This account...

Correlation of Claudins6 (CLDN6 gene expression in meningioma tissue with the expression of matrix metalloproteinases (MMPs/ tissue inhibitors of matrix metalloproteinase (TIMPs and epithelialmesenchymal transition (EMT genes

Directory of Open Access Journals (Sweden)

An-Qiang Yang

2017-09-01

Full Text Available Objective: To study the correlation of Claudins6 (CLDN6 gene expression in meningioma tissue with the expression of matrix metalloproteinases (MMPs/tissue inhibitors of matrix metalloproteinase (TIMPs and epithelial-mesenchymal transition (EMT genes. Methods: Meningioma tissue samples that were surgically removed in Yibin First People’s Hospital between April 2014 and May 2017 were selected, normal arachnoid tissue samples that were collected from decompressive craniectomy in Yibin First People’s Hospital during the same period were selected, and the expression of CLDN6, MMPs/TIMPs and EMT genes in tissues were determined. Results: CLDN6 protein expression in meningioma tissue was significantly lower than that in normal arachnoid tissue; EMMPRIN, MMP2, MMP9, Vimentin and N-cadherin protein expression in meningioma tissue were significantly higher than those in normal arachnoid tissue while TIMP1, TIMP2, E-cadherin and α-catenin protein expression were significantly lower than those in normal arachnoid tissue; EMMPRIN, MMP2, MMP9, Vimentin and N-cadherin protein expression in meningioma tissue with higher CLDN6 expression were significantly lower than those in meningioma tissue with lower CLDN6 expression while TIMP1, TIMP2, E-cadherin and α-catenin protein expression were significantly higher than those in meningioma tissue with lower CLDN6 expression. Conclusion: Lowly expressed CLDN6 gene in meningioma tissue can increase the hydrolysis activity of MMPs, induce epithelial-mesenchymal transition and thus promote the invasive growth of meningioma.

Allele frequencies of AVPR1A and MAOA in the Afrikaner population

Directory of Open Access Journals (Sweden)

J. Christoff Erasmus

2015-07-01

Full Text Available The Afrikaner population was founded mainly by European immigrants that arrived in South Africa from 1652. However, female slaves from Asia and Africa and local KhoeSan women may have contributed as much as 7% to this population’s genes. We quantified variation at two tandem repeats to see if this historical founder effect and/or admixture could be detected. The two loci were chosen because they are in the promoters of genes of neurotransmitters that are known to be correlated with social behaviour. Specifically, arginine vasopressin receptor 1A’s (AVPR1A RS3 locus has been shown to correlate with age of sexual onset and happiness in monogamous relationships while the tandem repeat in the promoter of the monoamine oxidase A (MAOA gene correlates with reactive aggression. The Afrikaner population contained more AVPR1A RS3 alleles than other Caucasoid populations, potentially reflecting a history of admixture. Even though Afrikaners have one of the lowest recorded non-paternity rates in the world, the population did not differ at AVPR1A RS3 locus form other European populations, suggesting a non-genetic explanation, presumably religion, for the low non-paternity rate. By comparing population allele-frequency spectra it was found that different studies have confused AVPR1A RS3 alleles and we make some suggestions to rectify these mistakes in future studies. While MAOA allele frequencies differed between racial groups, the Afrikaner population showed no evidence of admixture. In fact, Afrikaners had more 4-repeat alleles than other populations of European origin, not fewer. The 4-repeat allele may have been selected for during colonisation.

The MAO-A inhibitor clorgyline reduces ethanol-induced locomotion and its volitional intake in mice.

Science.gov (United States)

Ledesma, Juan Carlos; Escrig, Miguel Angel; Pastor, Raúl; Aragon, Carlos M G

2014-01-01

Hydrogen peroxide is the co-substrate used by the enzyme catalase to form Compound I (the catalase-H2O2 system), which is the major pathway for the conversion of ethanol (EtOH) into acetaldehyde in the brain. This acetaldehyde has been involved in many of the effects of EtOH. Previous research demonstrated that treatments that change the levels of cerebral H2O2 available to catalase modulate the locomotor-stimulating effects of EtOH and its volitional intake in rodents. However, the source of H2O2 which is used by catalase to form Compound I and mediates the psychoactive actions of EtOH is unknown. One cause of the generation of H2O2 in the brain comes from the deamination of biogenic amines by the activity of MAO-A. Here we explore the consequences of the administration of the MAO-A inhibitor clorgyline on EtOH-induced locomotion and voluntary EtOH drinking. For the locomotor activity tests, we injected Swiss (RjOrl) mice intraperitoneally (IP) with clorgyline (0-10mg/kg) and later (0.5-8h) with EtOH (0-3.75 g/kg; IP). Following these treatments, mice were placed in locomotor activity chambers to measure their locomotion. For the drinking experiments, mice of the C57BL/6J strain were injected IP with clorgyline prior to offering them an EtOH (20%) solution following a drinking-in-the-dark procedure. Additional experiments were performed to assess the selectivity of this compound in altering EtOH-stimulated locomotion and EtOH intake. Moreover, we indirectly tested the ability of clorgyline to reduce brain H2O2 levels. We showed that this treatment selectively reduced EtOH-induced locomotion and its self-administration. Moreover, this compound decreased central H2O2 levels available to catalase. We suggest that H2O2 derived from the deamination of biogenic amines by the activity of MAO-A could determine the formation of brain EtOH-derived acetaldehyde. This centrally-formed acetaldehyde within the neurons of the aminergic system could play a role in the

PARP-1 depletion in combination with carbon ion exposure significantly reduces MMPs activity and overall increases TIMPs expression in cultured HeLa cells

International Nuclear Information System (INIS)

Ghorai, Atanu; Sarma, Asitikantha; Chowdhury, Priyanka; Ghosh, Utpal

2016-01-01

Hadron therapy is an innovative technique where cancer cells are precisely killed leaving surrounding healthy cells least affected by high linear energy transfer (LET) radiation like carbon ion beam. Anti-metastatic effect of carbon ion exposure attracts investigators into the field of hadron biology, although details remain poor. Poly(ADP-ribose) polymerase-1 (PARP-1) inhibitors are well-known radiosensitizer and several PARP-1 inhibitors are in clinical trial. Our previous studies showed that PARP-1 depletion makes the cells more radiosensitive towards carbon ion than gamma. The purpose of the present study was to investigate combining effects of PARP-1 inhibition with carbon ion exposure to control metastatic properties in HeLa cells. Activities of matrix metalloproteinases-2, 9 (MMP-2, MMP-9) were measured using the gelatin zymography after 85 MeV carbon ion exposure or gamma irradiation (0- 4 Gy) to compare metastatic potential between PARP-1 knock down (HsiI) and control cells (H-vector - HeLa transfected with vector without shRNA construct). Expression of MMP-2, MMP-9, tissue inhibitor of MMPs such as TIMP-1, TIMP-2 and TIMP-3 were checked by immunofluorescence and western blot. Cell death by trypan blue, apoptosis and autophagy induction were studied after carbon ion exposure in each cell-type. The data was analyzed using one way ANOVA and 2-tailed paired-samples T-test. PARP-1 silencing significantly reduced MMP-2 and MMP-9 activities and carbon ion exposure further diminished their activities to less than 3 % of control H-vector. On the contrary, gamma radiation enhanced both MMP-2 and MMP-9 activities in H-vector but not in HsiI cells. The expression of MMP-2 and MMP-9 in H-vector and HsiI showed different pattern after carbon ion exposure. All three TIMPs were increased in HsiI, whereas only TIMP-1 was up-regulated in H-vector after irradiation. Notably, the expressions of all TIMPs were significantly higher in HsiI than H-vector at 4 Gy. Apoptosis was

Activation of PPARs α, β/δ, and γ Impairs TGF-β1-Induced Collagens' Production and Modulates the TIMP-1/MMPs Balance in Three-Dimensional Cultured Chondrocytes

Directory of Open Access Journals (Sweden)

Paul-Emile Poleni

2010-01-01

Full Text Available Background and Purpose. We investigated the potency of Peroxisome Proliferators-Activated Receptors (PPARs α, β/δ, and γ agonists to modulate Transforming Growth Factor-β1 (TGF-β1- induced collagen production or changes in Tissue Inhibitor of Matrix Metalloproteinase- (TIMP- 1/Matrix Metalloproteinase (MMP balance in rat chondrocytes embedded in alginate beads. Experimental Approach. Collagen production was evaluated by quantitative Sirius red staining, while TIMP-1 protein levels and global MMP (-1, -2, -3, -7, and -9 or specific MMP-13 activities were measured by ELISA and fluorigenic assays in culture media, respectively. Levels of mRNA for type II collagen, TIMP-1, and MMP-3 & 13 were quantified by real-time PCR. Key Results. TGF-β1 increased collagen deposition and type II collagen mRNA levels, while inducing TIMP-1 mRNA and protein expression. In contrast, it decreased global MMP or specific MMP-13 activities, while decreasing MMP-3 or MMP-13 mRNA levels. PPAR agonists reduced most of the effects of TGF-β1 on changes in collagen metabolism and TIMP-1/MMP balance in rat in a PPAR-dependent manner, excepted for Wy14643 on MMP activities. Conclusions and Implications. PPAR agonists reduce TGF-β1-modulated ECM turnover and inhibit chondrocyte activities crucial for collagen biosynthesis, and display a different inhibitory profile depending on selectivity for PPAR isotypes.

Are MAO-A deficiency states in the general population and in putative high-risk populations highly uncommon?

Science.gov (United States)

Murphy, D L; Sims, K; Eisenhofer, G; Greenberg, B D; George, T; Berlin, F; Zametkin, A; Ernst, M; Breakefield, X O

1998-01-01

Lack of monoamine oxidase A (MAO-A) due to either Xp chromosomal deletions or alterations in the coding sequence of the gene for this enzyme are associated with marked changes in monoamine metabolism and appear to be associated with variable cognitive deficits and behavioral changes in humans and in transgenic mice. In mice, some of the most marked behavioral changes are ameliorated by pharmacologically-induced reductions in serotonin synthesis during early development, raising the question of possible therapeutic interventions in humans with MAO deficiency states. At the present time, only one multi-generational family and a few other individuals with marked MAO-A deficiency states have been identified and studied in detail. Although MAO deficiency states associated with Xp chromosomal deletions were identified by distinct symptoms (including blindness in infancy) produced by the contiguous Norrie disease gene, the primarily behavioral phenotype of individuals with the MAO mutation is less obvious. This paper reports a sequential research design and preliminary results from screening several hundred volunteers in the general population and from putative high-risk groups for possible MAO deficiency states. These preliminary results suggest that marked MAO deficiency states are very rare.

Increased MMP-9 and TIMP-1 in mouse neonatal brain and plasma and in human neonatal plasma after hypoxia-ischemia: a potential marker of neonatal encephalopathy.

Science.gov (United States)

Bednarek, Nathalie; Svedin, Pernilla; Garnotel, Roselyne; Favrais, Géraldine; Loron, Gauthier; Schwendiman, Leslie; Hagberg, Henrik; Morville, Patrice; Mallard, Carina; Gressens, Pierre

2012-01-01

To implement neuroprotective strategies in newborns, sensitive and specific biomarkers are needed for identifying those who are at risk for brain damage. We evaluated the effectiveness of matrix metalloproteinases (MMPs) and their naturally occurring tissue inhibitors of metalloproteinases (TIMPs) in predicting neonatal encephalopathy (NE) damage in newborns. Plasma MMP-9 and TIMP-1 levels were upregulated as early as 1 h after the HI insult but not did not show such elevations after other types of injury (ibotenate-induced excitotoxicity, hypoxia, lipopolysaccharide-induced inflammation), and brain levels reflected this increase soon thereafter. We confirmed these results by carrying out plasma MMP-9 and TIMP-1 measurements in human newborns with NE. In these infants, protein levels of MMP-9 and TIMP-1 were found to be elevated during a short window up to 6 h after birth. This feature is particularly useful in identifying newborns in need of neuroprotection. A second peak observed 72 h after birth is possibly related to the second phase of energy failure after a HI insult. Our data, although preliminary, support the use of MMP-9 and TIMP-1 as early biomarkers for the presence and extent of perinatal brain injury in human term newborns. We first used a mouse model of neonatal HI injury to explore mechanistic aspects such as the time course of these markers after the hypoxia-ischemia event, and the correlation between the levels of these candidate markers in brain and plasma.

Evaluation of matrix metalloproteinases-2 (MMP-2) and tissue inhibitors of metalloproteinases-2 (TIMP-2) in oral submucous fibrosis and their correlation with disease severity.

Science.gov (United States)

Shrestha, A; Carnelio, S

2013-01-01

Oral submucous fibrosis (OSF), a potentially malignant oral lesion, is a form of pathological fibrosis affecting the oral mucosa. It results from an imbalance in equilibrium of the normal process of synthesis and degradation of extra cellular matrix. Matrix metalloproteinases and its inhibitors play important role in remodeling of the extra cellular matrix which are important in progression and pathogenesis of potentially malignant lesions to malignancy. To evaluate the expression and distribution of Matrix metalloproteinases-2 (MMP- 2) and Tissue inhibitor of metalloproteinases-2 (TIMP-2) in different grades of Oral Submucous Fibrosis(OSF). Immunohistochemical analysis for MMP-2 and its TIMP-2 was performed in 30 histopathologically confirmed, formalin fixed, paraffin embedded specimens of OSF. A semi-quantitative analysis was done to assess the expression, distribution and comparison of these in various stages of this disease. All moderately advanced cases and 64.2% for MMP-2 and 78.5% for TIMP-2 of early stage cases showed positivity. Between two stages of OSF, statistically significant differences were noted in expression of TIMP-2 in lamina propria, deep connective tissue and supra basal layers (p<0.05) and basal and supra basal layers for MMP-2 (p<0.05). The simultaneous increase in expression of MMP-2 and TIMP-2 with advancing stages of OSF can provide a basis for considering the proteases as important mediators in the pathogenesis and progression of OSF which could aid in identifying the aggressiveness of the condition and elucidate its role in its malignant transformation.

Platelet monoamine oxidase type B, MAOB intron 13 and MAOA-uVNTR polymorphism and symptoms of post-traumatic stress disorder.

Science.gov (United States)

Svob Strac, Dubravka; Kovacic Petrovic, Zrnka; Nikolac Perkovic, Matea; Umolac, Danica; Nedic Erjavec, Gordana; Pivac, Nela

2016-07-01

Post-traumatic stress disorder (PTSD), a disorder that develops following exposure to traumatic experience(s), is frequently associated with agitation, aggressive behavior and psychotic symptoms. Monoamine oxidase (MAO) degrades different biogenic amines and regulates mood, emotions and behavior, and has a role in the pathophysiology of various neuropsychiatric disorders. The aim of the study was to investigate the association between different symptoms occurring in PTSD [PTSD symptom severity assessed by the Clinician Administered PTSD Scale (CAPS), agitation and selected psychotic symptoms assessed by the Positive and Negative Syndrome Scale (PANSS)] and platelet MAO-B activity and/or genetic variants of MAOB rs1799836 and MAOA-uVNTR polymorphisms in 249 Croatian male veterans with PTSD. Our study revealed slightly higher platelet MAO-B activity in veterans with PTSD with more severe PTSD symptoms and in veterans with agitation, and significantly higher platelet MAO-B activity in veterans with more pronounced psychotic symptoms compared to veterans with less pronounced psychotic symptoms. Platelet MAO-B activity was associated with smoking but not with age. Genetic variants of MAOB rs1799836 and MAOA-uVNTR were not associated with agitation and selected psychotic symptoms in veterans with PTSD. A marginally significant association was found between MAOB rs1799836 polymorphism and severity of PTSD symptoms, but it was not confirmed since carriers of G or A allele of MAOB rs1799836 did not differ in their total CAPS scores. These findings suggest an association of platelet MAO-B activity, but a lack of association of MAOB rs1799836 and MAOA-uVNTR, with selected psychotic symptoms in ethnically homogenous veterans with PTSD.

HPV-positive oropharyngeal squamous cell carcinoma is associated with TIMP3 and CADM1 promoter hypermethylation

International Nuclear Information System (INIS)

Kempen, Pauline M W van; Bockel, Liselotte van; Braunius, Weibel W; Moelans, Cathy B; Olst, Marina van; Jong, Rick de; Stegeman, Inge; Diest, Paul J van; Grolman, Wilko; Willems, Stefan M

2014-01-01

Oropharyngeal squamous cell carcinoma (OPSCC) is associated with human papillomavirus (HPV) in a proportion of tumors. HPV-positive OPSCC is considered a distinct molecular entity with a prognostic advantage compared to HPV-negative cases. Silencing of cancer-related genes by DNA promoter hypermethylation may play an important role in the development of OPSCC. Hence, we examined promoter methylation status in 24 common tumor suppressor genes in a group of 200 OPSCCs to determine differentially methylated genes in HPV-positive versus HPV-negative primary OPSCC. Methylation status was correlated with HPV status, clinical features, and patient survival using multivariate methods. Additionally, methylation status of 16 cervical squamous cell carcinomas (SCC) was compared with HPV-positive OPSCC. Using methylation-specific probe amplification, HPV-positive OPSCC showed a significantly higher cumulative methylation index (CMI) compared to HPV-negative OPSCC (P=0.008). For the genes CDH13, DAPK1, and RARB, both HPV-positive and HPV-negative OPSCC showed promoter hypermethylation in at least 20% of the tumors. HPV status was found to be an independent predictor of promoter hypermethylation of CADM1 (P < 0.001), CHFR (P = 0.027), and TIMP3 (P < 0.001). CADM1 and CHFR showed similar methylation patterns in OPSCC and cervical SCC, but TIMP3 showed no methylation in cervical SCC in contrast to OPSCC. Methylation status of neither individual gene nor CMI was associated with survival. These results suggest that HPV-positive tumors are to a greater extent driven by promotor hypermethylation in these tumor suppressor genes. Especially CADM1 and TIMP3 are significantly more frequently hypermethylated in HPV-positive OPSCC and CHFR in HPV-negative tumors

A mutation in the Norrie disease gene (NDP) associated with X-linked familial exudative vitreoretinopathy.

Science.gov (United States)

Chen, Z Y; Battinelli, E M; Fielder, A; Bundey, S; Sims, K; Breakefield, X O; Craig, I W

1993-10-01

Familial exudative vitreoretinopathy (FEVR) is a hereditary disorder characterized by an abnormality of the peripheral retina. Both autosomal dominant (adFEVR) and X-linked (XLFEVR) forms have been described, but the biochemical defect(s) underlying the symptoms are unknown. Molecular analysis of the Norrie gene locus (NDP) in a four generation FEVR family (shown previously to exhibit linkage to the X-chromosome markers DXS228 and MAOA (Xp11.4-p11.3)) reveals a missense mutation in the highly conserved region of the NDP gene, which caused a neutral amino acid substitution (Leu124Phe), was detected in all of the affected males, but not in the unaffected family members, nor in normal controls. The observations suggest that phenotypes of both XLFEVR and Norrie disease can result from mutations in the same gene.

ADHD and Disruptive behavior scores – associations with MAO-A and 5-HTT genes and with platelet MAO-B activity in adolescents

Directory of Open Access Journals (Sweden)

Larsson Jan-Olov

2008-04-01

Full Text Available Abstract Background Pharmacological and genetic studies suggest the importance of the dopaminergic, serotonergic, and noradrenergic systems in the pathogenesis of Attention Deficit Hyperactivity Disorder (ADHD and Disruptive Behavior Disorder (DBD. We have, in a population-based sample, studied associations between dimensions of the ADHD/DBD phenotype and Monoamine Oxidase B (MAO-B activity in platelets and polymorphisms in two serotonergic genes: the Monoamine Oxidase A Variable Number of Tandem Repeats (MAO-A VNTR and the 5-Hydroxytryptamine Transporter gene-Linked Polymorphic Region (5-HTT LPR. Methods A population-based sample of twins, with an average age of 16 years, was assessed for ADHD/DBD with a clinical interview; Kiddie Schedule for Affective Disorders and Schizophrenia for School-Age Children-Present and Lifetime Version (K-SADS-PL. Blood was drawn from 247 subjects and analyzed for platelet MAO-B activity and polymorphisms in the MAO-A and 5-HTT genes. Results We found an association in girls between low platelet MAO-B activity and symptoms of Oppositional Defiant Disorder (ODD. In girls, there was also an association between the heterozygote long/short 5-HTT LPR genotype and symptoms of conduct disorder. Furthermore the heterozygote 5-HTT LPR genotype in boys was found to be associated with symptoms of Conduct Disorder (CD. In boys, hemizygosity for the short MAO-A VNTR allele was associated with disruptive behavior. Conclusion Our study suggests that the serotonin system, in addition to the dopamine system, should be further investigated when studying genetic influences on the development of Disruptive Behavior Disorders.

18 CFR 367.4261 - Account 426.1, Donations.

Science.gov (United States)

2010-04-01

... 18 Conservation of Power and Water Resources 1 2010-04-01 2010-04-01 false Account 426.1, Donations. 367.4261 Section 367.4261 Conservation of Power and Water Resources FEDERAL ENERGY REGULATORY..., Donations. This account must include all payments or donations for charitable, social or community welfare...

43 CFR 426.14 - Involuntary acquisition of land.

Science.gov (United States)

2010-10-01

... from excess status, except for: (A) Financial institutions; or (B) Landowners for which § 426.12(g) (1.... (a) Definitions for purposes of this section. Financial institution means a commercial bank or trust company, a private bank, an agency or branch of a foreign bank in the United States, a thrift institution...

Crucial factors of the inflammatory microenvironment (IL-1β/TNF-α/TIMP-1) promote the maintenance of the malignant hemopoietic clone of myelofibrosis: an in vitro study.

Science.gov (United States)

Sollazzo, Daria; Forte, Dorian; Polverelli, Nicola; Romano, Marco; Perricone, Margherita; Rossi, Lara; Ottaviani, Emanuela; Luatti, Simona; Martinelli, Giovanni; Vianelli, Nicola; Cavo, Michele; Palandri, Francesca; Catani, Lucia

2016-07-12

Along with molecular abnormalities (mutations in JAK2, Calreticulin (CALR) and MPL genes), chronic inflammation is the major hallmark of Myelofibrosis (MF). Here, we investigated the in vitro effects of crucial factors of the inflammatory microenvironment (Interleukin (IL)-1β, Tumor Necrosis Factor (TNF)-α, Tissue Inhibitor of Metalloproteinases (TIMP)-1 and ATP) on the functional behaviour of MF-derived circulating CD34+ cells.We found that, regardless mutation status, IL-1β or TNF-α increases the survival of MF-derived CD34+ cells. In addition, along with stimulation of cell cycle progression to the S-phase, IL-1β or TNF-α ± TIMP-1 significantly stimulate(s) the in vitro clonogenic ability of CD34+ cells from JAK2V617 mutated patients. Whereas in the JAK2V617F mutated group, the addition of IL-1β or TNF-α + TIMP-1 decreased the erythroid compartment of the CALR mutated patients. Megakaryocyte progenitors were stimulated by IL-1β (JAK2V617F mutated patients only) and inhibited by TNF-α. IL-1β + TNF-α + C-X-C motif chemokine 12 (CXCL12) ± TIMP-1 highly stimulates the in vitro migration of MF-derived CD34+ cells. Interestingly, after migration toward IL-1β + TNF-α + CXCL12 ± TIMP-1, CD34+ cells from JAK2V617F mutated patients show increased clonogenic ability.Here we demonstrate that the interplay of these inflammatory factors promotes and selects the circulating MF-derived CD34+ cells with higher proliferative activity, clonogenic potential and migration ability. Targeting these micro-environmental interactions may be a clinically relevant approach.

LncRNA-LET inhibits cell viability, migration and EMT while induces apoptosis by up-regulation of TIMP2 in human granulosa-like tumor cell line KGN.

Science.gov (United States)

Han, Qingfang; Zhang, Wenke; Meng, Jinlai; Ma, Li; Li, Aihua

2018-04-01

Polycystic ovary syndrome (PCOS) is a common endocrine disease characterized by hyperandrogenism, irregular menses, and polycystic ovaries. Several long non-coding RNAs (lncRNAs) are aberrantly expressed in PCOS patients; however, little is known about the effects of the lncRNA-low expression in tumor (lncRNA-LET) on PCOS. We aimed to explore the effects of lncRNA-LET on human granulosa-like tumor cell line, KGN. Expression of lncRNA-LET in normal IOSE80 cells and granulosa cells was determined by qRT-PCR. KGN cell viability, apoptosis and migration were measured by trypan blue exclusion method, flow cytometry assay and wound healing assay, respectively. TGF-β1 was used to induce epithelial-mesenchymal transition (EMT) process. LncRNA-LET expression and mRNA expressions of TIMP2 and EMT-related proteins were measured by qRT-PCR. Western blot analysis was used to measure the protein expression of apoptosis-related proteins, EMT-related proteins, TIMP2, and the proteins in the Wnt/β-catenin and Notch signaling pathways. lncRNA-LET was down-regulated in KGN cells, and its overexpression inhibited cell viability and migration, and promoted apoptosis in KGN cells. Overexpression of lncRNA-LET increased the expression of E-cadherin and decreased the expressions of N-cadherin and vimentin in KGN cells. These effects of lncRNA-LET on KGN cells were reversed by TIMP2 suppression. Overexpression of TIMP2 inhibited cell viability, migration and EMT process, and increased apoptosis by activating the Wnt/β-catenin and Notch pathways. Overexpression of lncRNA-LET inhibits cell viability, migration and EMT process, and increases apoptosis in KGN cells by up-regulating the expression of TIMP2 and activating the Wnt/β-catenin and notch signaling pathways. Copyright © 2018 Elsevier Masson SAS. All rights reserved.

47 CFR 42.6 - Retention of telephone toll records.

Science.gov (United States)

2010-10-01

... whether it is billing its own toll service customers for toll calls or billing customers for another... Section 42.6 Telecommunication FEDERAL COMMUNICATIONS COMMISSION (CONTINUED) COMMON CARRIER SERVICES... telephone toll records. Each carrier that offers or bills toll telephone service shall retain for a period...

Storage potential of ‘SCS426 Venice’ apples under different storage technologies

Directory of Open Access Journals (Sweden)

Mariuccia Schlichting de Martin

2018-04-01

Full Text Available Abstract This study aimed to evaluate the storage potential of SCS426 Venice apples under different storage technologies. Fruits were harvested in an experimental orchard located in Fraiburgo, SC and stored for up to eight and ten months in 2013 and 2014, respectively. Apples were treated or not with methylcyclopropene (1-MCP and stored under air atmosphere (AA, 0.5±0.5 °C/RH 85±5% or controlled atmosphere (CA; 1.5 kPa of O2 and 1.5 kPa of CO2 at 0.7±0.5 °C/RH of 93±3%. Fruits were evaluated every two months of storage, after one and seven days of shelf life (23 ± 0.3 °C/RH 93±3%. The storage period of ‘SCS426 Venice’ apples under AA without 1-MCP application should not extend beyond six months. Under this storage condition, fruits had higher incidence of decay, ethylene production and respiratory rates, higher skin degreening, lower flesh firmness, titratable acidity and soluble solids content than fruits stored under CA or AA with 1-MCP. ‘SCS426 Venice’ apples develop flesh browning and superficial scald after long-term storage. ‘SCS426 Venice’ apples under AA treated with 1-MCP or under CA (regardless of 1-MCP application can be stored for more than eight months, keeping flesh firmness above 14 lb and low incidence of physiological disorders even after ten months of storage.

9 CFR 93.426 - Inspection at port of entry.

Science.gov (United States)

2010-01-01

... CERTAIN ANIMALS, BIRDS, FISH, AND POULTRY, AND CERTAIN ANIMAL, BIRD, AND POULTRY PRODUCTS; REQUIREMENTS FOR MEANS OF CONVEYANCE AND SHIPPING CONTAINERS Ruminants Mexico 10 § 93.426 Inspection at port of entry. (a) All ruminants offered for entry from Mexico, including such ruminants intended for movement...

Polymorphisms in the Promoters of the MMP-2 and TIMP-2 Genes Are Associated with Spontaneous Deep Intracerebral Hemorrhage in the Taiwan Population.

Directory of Open Access Journals (Sweden)

Yi Chun Chen

Full Text Available Spontaneous intracerebral hemorrhage (ICH is a devastating stroke subtype. Matrix metalloproteinases (MMPs function in the degradation of extracellular matrix and the activities of MMPs are modulated by their endogenous inhibitors, tissue inhibitors of metalloproteinases (TIMPs. This study aimed to discuss relationship of MMP-2 and TIMP-2 to spontaneous deep ICH (SDICH susceptibility and hematoma size.Associations were tested by logistic regression and general linear models (GLM where appropriate, adjusting with covariables of age, sex, hypertension, diabetes mellitus, smoking, and alcohol consumption. Association analyses were performed first by stratification of genders and then by the age of 65 years old (y/o. Elder population was defined as subjects who were older than 65 y/o.There were 396 SDICH patients and 376 control subjects in this study. In the elder group, rs7503607 C>A variant in TIMP-2 was associated with SDICH in male and overall patients (OR = 3.49, 95% CI 1.45 to 8.40, P = 0.005 and OR = 2.45, 95% CI 1.37 to 4.38, P = 0.003, respectively in additive genetic model. In recessive genetic model, rs2285053 TT genotype in MMP-2 was correlated to SDICH in male patients and overall elder group (OR = 7.30, 95% CI 1.3 to 40, P = 0.02 and OR = 2.91, 95% CI 1.02 to 8.31, P = 0.046, respectively, and rs7503726 AA genotype in TIMP-2 was associated with SDICH in female patients (OR = 0.29, 95% CI 0.1 to 0.84, P = 0.02. In younger male and overall younger patients, SDICH patients who had supratentorial hemorrhage had significantly lower frequency of AA genotypes in rs7503726 than those with infratentorial hemorrhage (OR = 0.36, 95% CI 0.17 to 0.75, P = 0.006 and OR = 0.43, 95% CI 0.22 to 0.84, P = 0.014, respectively. Hemorrhage size increased by 9.7 (95% CI 2.1 to 43, P = 0.004 cm3 per minor allele (A of the rs7503607 variant in the elder female patients and increased by 4.3 (95% CI 1.4 to 12.9, P = 0.009 cm3 per minor allele (A in all elder

The tumor suppressor PTEN inhibits EGF-induced TSP-1 and TIMP-1 expression in FTC-133 thyroid carcinoma cells

International Nuclear Information System (INIS)

Soula-Rothhut, Mahdhia; Coissard, Cyrille; Sartelet, Herve; Boudot, Cedric; Bellon, Georges; Martiny, Laurent; Rothhut, Bernard

2005-01-01

Thrombospondin-1 (TSP-1) is a multidomain extracellular macromolecule that was first identified as natural modulator of angiogenesis and tumor growth. In the present study, we found that epidermal growth factor (EGF) up-regulated TSP-1 expression in FTC-133 (primary tumor) but not in FTC-238 (lung metastasis) thyroid cancer cells. Both EGF and TSP-1 induced expression of tissue inhibitor of metalloproteinase-1 (TIMP-1) in a mitogen-activated protein kinase/extracellular signal-regulated kinase (MAPK/ERK) and phosphatidylinositol 3-kinase (PI3-kinase)-dependent manner. In FTC-133 cells, EGF induced proliferation in a TSP-1- and TIMP-1-dependent manner. In addition, we determined that re-expression of the tumor suppressor protein PTEN induced cell death, an effect that correlated with a block of Akt kinase phosphorylation. EGF-induced TSP-1 and TIMP-1 promoter activity and protein expression were inhibited in FTC-133 cells stably expressing wtPTEN but not in cells expressing mutant PTEN. Furthermore, we found that wtPTEN inhibited EGF-but not TSP-1-stimulated FTC-133 cell migration and also inhibited invasion induced by EGF and by TSP-1. Finally, an antibody against TSP-1 reversed EGF-stimulated FTC-133 cell invasion as well as the constitutive invasive potential of FTC-238 cells. Overall, our results suggest that PTEN can function as an important modulator of extracellular matrix proteins in thyroid cancer. Therefore, analyzing differential regulation of TSP-1 by growth factors such as EGF can be helpful in understanding thyroid cancer development

TIMP-1 and CEA as biomarkers in third-line treatment with irinotecan and cetuximab for metastatic colorectal cancer

DEFF Research Database (Denmark)

Spindler, Karen-Lise Garm; Christensen, Ib Jarle; Nielsen, Hans Jørgen

2015-01-01

in colorectal cancer (CRC). The aim of the present study was to investigate the clinical value of TIMP-1 in patients with metastatic colorectal cancer (mCRC) treated with cetuximab and irinotecan. Patients with chemotherapy-resistant mCRC referred to third-line treatment with cetuximab (initial 400 mg/m(2...

43 CFR 426.8 - Nonresident aliens and foreign entities.

Science.gov (United States)

2010-10-01

... 43 Public Lands: Interior 1 2010-10-01 2010-10-01 false Nonresident aliens and foreign entities..., DEPARTMENT OF THE INTERIOR ACREAGE LIMITATION RULES AND REGULATIONS § 426.8 Nonresident aliens and foreign... reclamation law or these regulations, a nonresident alien or foreign entity that directly holds land in a...

38 CFR 42.6 - Prerequisites for issuing a complaint.

Science.gov (United States)

2010-07-01

... this section), the amount of money or the value of property or services, or both, demanded or requested... are unrelated or were not submitted simultaneously, regardless of the amount of money, or the value of... AFFAIRS (CONTINUED) STANDARDS IMPLEMENTING THE PROGRAM FRAUD CIVIL REMEDIES ACT § 42.6 Prerequisites for...

THE ROLE OF MATRIX METALLOPROTEINASE MMP-9, ITS INHIBITOR TIMP-1 AND INTERLEUKINE-1β IN PATHOGENESIS OF TRAUMATIC BRAIN INJURY

Directory of Open Access Journals (Sweden)

S. V. Ziablitsev

2016-09-01

  Resume Traumatic brain injury (TBI is accompanied by high rates of morbidity and mortality in both developed and undeveloped countries that makes it one of the most actual medical and social problems. In recent years matrix metalloproteinases are in increasing interest while studying TBI pathogenesis because of their ability to increase permeability of the blood-brain barrier and to cause nervous tissue matrix reorganization. The goal of given study was to investigate the role of matrix metalloproteinase MMP-9, its inhibitor TIMP-1 and interleukin IL-1β in pathogenesis of TBI. Methods: The study was performed on 98 mature white rats. Moderate severity TBI was modeled with one blow on the cranial vault by means of free-fall­ing plummet. Control group included 30 rats. Cytokines (IL-1b, IL-6, IL-8, TNF-a, MMP-9 and TIMP-1 levels were investi­gated in animals blood by means of ELISA on 1st, 3rd, 7th, 14th and 21st days after trauma. Results and discussion: MMP-9 levels increased by only 38,2% on the 1st day, but on the 3rd day there was its marked increase to 538%. It is known that metalloproteinases are released from the cells under the influence of various factors, including cytokines. On the 1st day after trauma it was IL-1β which increased by 705% showing the highest rise among other cytokines and exceeding increase in MMP-9 levels. This might indicate regulatory role of IL-1β.  A marked increase in MMP-9 levels in turn lead to TIMP-1 activation. Significant increase in TIMP-1 levels was determined on the 3rd day after trauma. On the 7th day there was a critical period with the highest levels of IL-1β (2147,2%, MMP-9 (720,3% and TIMR-1 (339,3%. Then all research indicators were decreasing with the most pronounced decrease in IL-1β and MMP-9. Conclusion: MMP-9 levels began to increase on the 1st day after trauma due to influence mainly IL-1β. An abrupt increase in MMP-9 in its turn caused an increase in TIMR-1 levels. Conclusion: Identified changes in

Deletion of MAOA and MAOB in a male patient causes severe developmental delay, intermittent hypotonia and stereotypical hand movements

OpenAIRE

Whibley, Annabel; Urquhart, Jill; Dore, Jonathan; Willatt, Lionel; Parkin, Georgina; Gaunt, Lorraine; Black, Graeme; Donnai, Dian; Raymond, F Lucy

2010-01-01

Monoamine oxidases (MAO-A and MAO-B) have a key role in the degradation of amine neurotransmitters, such as dopamine, norepinephrine and serotonin. We identified an inherited 240 kb deletion on Xp11.3–p11.4, which encompasses both monoamine oxidase genes but, unlike other published reports, does not affect the adjacent Norrie disease gene (NDP). The brothers who inherited the deletion, and thus have no monoamine oxidase function, presented with severe developmental delay, intermittent hypoton...

Hypoxia induces a phenotypic switch of fibroblasts to myofibroblasts through a MMP-2/TIMP mediated pathway: Implications for venous neointimal hyperplasia in hemodialysis access

Science.gov (United States)

Misra, Sanjay; Fu, Alex A.; Misra, Khamal D.; Shergill, Uday M.; Leof, Edward B; Mukhopadhyay, Debabrata

2010-01-01

Purpose Hemodialysis grafts fail because of venous neointimal hyperplasia formation caused by adventitial fibroblasts which have become myofibroblasts (α-smooth muscle actin positive cells) and migrate to the neointima. There is increased expression of hypoxia inducible factor-1 alpha (HIF-1α in venous neointimal hyperplasia formation in experimental animal model and clinical samples. We hypothesized that under hypoxic stimulus (HIF-1α fibroblasts will convert to myofibroblasts through a matrix metalloproteinase-2 (MMP-2) mediated pathway. Materials and methods Murine AKR-2B fibroblasts were made hypoxic or normoxic for 24, 48, and 72 hours. Protein expression for HIF-1α, α-smooth muscle actin, MMP-2, MMP-9, TIMP-1, and TIMP-2 was performed to determine the kinetic changes of these proteins. Immunostaining for α-smooth muscle actin, collagen, and fibronectin was performed. Results At all time points, there was significantly increased expression of HIF-1α in the hypoxic fibroblasts when compared to normoxic fibroblasts (P<0.05). There was significantly increased expression α-smooth muscle actin at all time points which peaked by 48 hours in hypoxic fibroblasts when compared to normoxic fibroblasts (P<0.05). There was a significant increase in the expression of active MMP-2 by 48-72 hours and a significant increase in tissue inhibitor of metalloproteinase-1 (TIMP-1) by 48-72 hours by hypoxic fibroblasts (P<0.05). By 72 hours, there was significant increase in TIMP-2 expression (P<0.05). Immunohistochemical analysis demonstrated increased expression for α-smooth muscle actin, collagen, and fibronectin as the length of hypoxia increased. Conclusions Under hypoxia, fibroblasts will convert to myofibroblasts through a MMP-2 mediated pathway which may provide insight into the mechanism of venous neointimal hyperplasia. PMID:20434368

[The administration of interleukin-1beta during early postnatal develop ment impairs FGF2, but not TIMP1, mRNA expression in brain structures of adult rats].

Science.gov (United States)

Trofimov, A N; Zubareva, O E; Shvarts, A P; Ishchenko, A M; Klimenko, V M

2014-09-01

According to the Neurodevelopmental hypothesis, the long-lasting cognitive deficit in schizophrenia and other types of neuropathology may occur by injurious factors, such as hypoxia, traumas, infections that take place during pre- and postnatal development, at least at early stages. These pathological conditions are often associated with the high production of pro-inflammatory cytokine interleukin-1B (IL-1B) by the cells of immune and nervous systems. We investigated the expression of genes involved in the neuroplastic regulation (Fgf2 and Timp2) in medial prefrontal cortex and dorsal and ventral regions of hippocampus of adult rats that were treated with IL-1beta between P15 and P21. The learning impairment in IL-1beta-treated rats is accompanied by lower FGF-2 mRNA levels in medial prefrontal cortex and ventral (not dorsal) hippocampus, but TIMP-1 was not affected. No differences in TIMP-1 and FGF-2 mRNA expressions were observed in untrained IL-1beta-treated when compared to control rats.

Ang-(1-7) exerts protective role in blood-brain barrier damage by the balance of TIMP-1/MMP-9.

Science.gov (United States)

Wu, Jitao; Zhao, Duo; Wu, Shuang; Wang, Dan

2015-02-05

Cerebrovascular disease (CVD) ranks as the top three health risks, specially cerebral ischemia characterized with the damage of blood-brain barrier (BBB). The angiotensin Ang-(1-7) was proven to have a protective effect on cerebrovascular diseases. However, its role on blood-brain barrier and the underlying molecular mechanism remains unclear. In this study, Ang-(1-7) significantly relieved damage of ischemia reperfusion injury on blood-brain barrier in cerebral ischemia reperfusion injury (IRI) rats. Furthermore, its treatment attenuated BBB permeability and brain edema. Similarly, Ang-(1-7) also decreased the barrier permeability of brain endothelial cell line RBE4. Further analysis showed that Ang-(1-7) could effectively restore tight junction protein (claudin-5 and zonula occludens ZO-1) expression levels both in IRI-rats and hypoxia-induced RBE4 cells. Furthermore, Ang-(1-7) stimulation down-regulated hypoxia-induced matrix metalloproteinase-9 (MMP-9) levels, whose silencing with (matrix metalloproteinase-9 hemopexin domain) MMP9-PEX inhibitor significantly increased the expression of claudin-5 and ZO-1. Further mechanism analysis demonstrated that Ang-(1-7) might junction protein levels by tissue inhibitor of metalloproteinase 1 (TIMP1)-MMP9 pathway, because Ang-(1-7) enhanced TIMP1 expression, whose silencing obviously attenuated the inhibitor effect of Ang-(1-7) on MMP-9 levels and decreased Ang-(1-7)-triggered increase in claudin-5 and ZO-1. Together, this study demonstrated a protective role of Ang-(1-7) in IRI-induced blood-brain barrier damage by TIMP1-MMP9-regulated tight junction protein expression. Accordingly, Ang-(1-7) may become a promising therapeutic agent against IRI and its complications. Copyright © 2014 Elsevier B.V. All rights reserved.

34 CFR 426.5 - What activities does the Secretary fund under the Program for Model Consumer and Homemaking...

Science.gov (United States)

2010-07-01

... the impact of new technology on life and work; (k) Applying consumer and homemaking education skills... 34 Education 3 2010-07-01 2010-07-01 false What activities does the Secretary fund under the Program for Model Consumer and Homemaking Education Projects? 426.5 Section 426.5 Education Regulations of...

Expression of matrix metalloproteinase 9 (MMP-9) and tissue inhibitor of metalloproteinases 1 (TIMP-1) by colorectal cancer cells and adjacent stroma cells - associations with histopathology and patients outcome

DEFF Research Database (Denmark)

Jensen, Søren Astrup; Vainer, Ben; Bartels, Annette

2010-01-01

AIM: To elucidate cellular features accountable for colorectal cancers' (CRC) capability to invade normal tissue and to metastasize, we investigated the level of the collagenase matrix metalloproteinase 9 (MMP-9) and its physiological inhibitor tissue inhibitor of metalloproteinases 1 (TIMP-1) in...... cells is associated with poor prognosis independent of its function as inhibitor of MMP-9. MMP-9 and TIMP-1 are important mediators of the host-cancer cell interaction in the tumour microenvironment with significant influence on the histopathology and on prognosis of CRC....

Expression of MMP-2 and TIMP-1 in cerebrospinal fluid and the correlation with dynamic changes of serum PCT in neonatal purulent meningitis

Science.gov (United States)

Chen, Huilan; Wu, Fei; Fu, Rong; Feng, Xiangchun

2018-01-01

Matrix metalloproteinase 2 (MMP-2) and tissue inhibitor of metalloproteinase-1 (TIMP-1) levels in cerebrospinal fluid of pediatric patients with neonatal purulent meningitis were observed to analyze changes in serum procalcitonin (PCT) and the correlation among the three factors (MMP-2, TIMP-1 and PCT). Sixty pediatric patients with neonatal purulent meningitis from April 2015 to December 2016 were enrolled as the purulent meningitis group and 60 pediatric patients with viral encephalitis treated during the same period were enrolled as the viral encephalitis group. Additionally, 60 healthy newborns who underwent physical examinations in our hospital during the same period were enrolled as the control group. The levels of MMP-2 were 136.73±25.42 ng/ml in the purulent meningitis group, 45.32±6.57 ng/ml in the viral encephalitis group and 1.32±0.51 ng/ml in the control group and the differences between the three groups were statistically significant (F=15.052, pfluid were 374.55±36.04 ng/ml in the purulent meningitis group, 176.61±21.06 ng/ml in the viral encephalitis group and 7.72±2.44 ng/ml in the control group. The serum levels of PCT were 14.56±2.21 ng/ml in the purulent meningitis group, 9.04±1.17 ng/ml in the viral encephalitis group and 0.38±0.14 ng/ml in the control group. The level of MMP-2 in cerebrospinal fluid of pediatric patients in the purulent meningitis group was positively correlated with the level of serum PCT (r=0.582, pfluid of pediatric patients in the viral encephalitis group was positively correlated with the level of serum PCT (r=0.635, p<0.05). In conclusion, MMP-2 and TIMP-1 were positively correlated with the levels of serum PCT, suggesting that MMP-2, TIMP-1 and PCT were involved in the occurrence and development of neonatal purulent meningitis. PMID:29399119

Urinary Biomarkers IGFBP7 and TIMP-2 for the Diagnostic Assessment of Transient and Persistent Acute Kidney Injury in Critically Ill Patients

Science.gov (United States)

Daubin, Delphine; Cristol, Jean Paul; Dupuy, Anne Marie; Kuster, Nils; Besnard, Noémie; Platon, Laura; Buzançais, Aurèle; Brunot, Vincent; Garnier, Fanny; Jonquet, Olivier; Klouche, Kada

2017-01-01

Objective The capability of urinary TIMP-2 (tissue inhibitor of metalloproteinase) and IGFBP7 (insulin-like growth factor binding protein)—NephroCheck Test (NC) = ([TIMP-2] x [IGFBP7]) / 1000)—to predict renal recovery from acute kidney injury (AKI) has been poorly studied. The aim of this study was to assess the performance of measurements of ([TIMP-2] x [IGFBP7]) / 1000) over 24 hours to differentiate transient from persistent AKI. Methods Of 460 consecutive adult patients admitted to the ICU, 101 were prospectively studied: 56 men, 62 (52–71) years old. A fresh urine sample was collected at H0, H4, H12 and H24 to determine ([TIMP-2] x [IGFBP7]) / 1000) levels. Areas under the curves of Delta NC H4-Ho and H12-H4 and serum creatinine (sCr) for detection of AKI recovery were compared. Results Forty-one (40.6%) patient were diagnosed with AKI: 27 transient and 14 persistent AKI. At admission (H0), AKI patients had a significantly higher NC score than patients without AKI (0.43 [0.07–2.06] vs 0.15 [0.07–0.35], p = 0.027). In AKI groups, transient AKI have a higher NC, at H0 and H4, than persistent AKI (0.87 [0.09–2.82] vs 0.13 [0.05–0.66] p = 0.035 and 0.13 [0.07–0.61] vs 0.05 [0.02–0.13] p = 0.013). Thereafter, NC level decreased in both AKI groups with a Delta NC score H4-H0 and H12-H4 significantly more important in transient AKI. Roc curves showed however that delta NC scores did not discriminate between transient and persistent AKI. Conclusion In our population, absolute urinary levels of NC score were higher at early hours after ICU admission (H0 and H4) in transient AKI as compared to persistent AKI patients. NC variations (Delta NC scores) over the first 12 hours may indicate the AKI’s evolving nature with a more significant decrease in case of transient AKI but were not able to differentiate transient from persistent AKI. PMID:28085896

Urinary Biomarkers IGFBP7 and TIMP-2 for the Diagnostic Assessment of Transient and Persistent Acute Kidney Injury in Critically Ill Patients.

Directory of Open Access Journals (Sweden)

Delphine Daubin

Full Text Available The capability of urinary TIMP-2 (tissue inhibitor of metalloproteinase and IGFBP7 (insulin-like growth factor binding protein-NephroCheck Test (NC = ([TIMP-2] x [IGFBP7] / 1000-to predict renal recovery from acute kidney injury (AKI has been poorly studied. The aim of this study was to assess the performance of measurements of ([TIMP-2] x [IGFBP7] / 1000 over 24 hours to differentiate transient from persistent AKI.Of 460 consecutive adult patients admitted to the ICU, 101 were prospectively studied: 56 men, 62 (52-71 years old. A fresh urine sample was collected at H0, H4, H12 and H24 to determine ([TIMP-2] x [IGFBP7] / 1000 levels. Areas under the curves of Delta NC H4-Ho and H12-H4 and serum creatinine (sCr for detection of AKI recovery were compared.Forty-one (40.6% patient were diagnosed with AKI: 27 transient and 14 persistent AKI. At admission (H0, AKI patients had a significantly higher NC score than patients without AKI (0.43 [0.07-2.06] vs 0.15 [0.07-0.35], p = 0.027. In AKI groups, transient AKI have a higher NC, at H0 and H4, than persistent AKI (0.87 [0.09-2.82] vs 0.13 [0.05-0.66] p = 0.035 and 0.13 [0.07-0.61] vs 0.05 [0.02-0.13] p = 0.013. Thereafter, NC level decreased in both AKI groups with a Delta NC score H4-H0 and H12-H4 significantly more important in transient AKI. Roc curves showed however that delta NC scores did not discriminate between transient and persistent AKI.In our population, absolute urinary levels of NC score were higher at early hours after ICU admission (H0 and H4 in transient AKI as compared to persistent AKI patients. NC variations (Delta NC scores over the first 12 hours may indicate the AKI's evolving nature with a more significant decrease in case of transient AKI but were not able to differentiate transient from persistent AKI.

Allele and haplotype diversity of new multiplex of 19 ChrX-STR loci in Han population from Guanzhong region (China).

Science.gov (United States)

Zhang, Yu-Dang; Shen, Chun-Mei; Meng, Hao-Tian; Guo, Yu-Xin; Dong, Qian; Yang, Guang; Yan, Jiang-Wei; Liu, Yao-Shun; Mei, Ting; Huang, Rui-Zhe; Zhu, Bo-Feng

2016-07-01

X-chromosomal short tandem repeats (X-STRs) have been proved to be useful for some deficiency paternity cases in recent years. Here, we studied the genetic polymorphisms of 19 X-STR loci (DXS10148-DXS10135-DXS8378, DXS10159-DXS10162-DXS10164, DXS7132-DXS10079-DXS10074-DXS10075, DXS6809-DXS6789, DXS7424-DXS101, DXS10103-HPRTB-DXS10101 and DXS7423-DXS10134) in 252 male and 222 female individuals from Guanzhong Han population, China. No deviation for all 19 loci was observed from the Hardy-Weinberg equilibrium. The polymorphism information content values of the panel of 19 loci were more than 0.5 with the exception of the locus DXS7423. The combined power of discrimination were 0.9999999999999999999994340 in females and 0.9999999999997662 in males, respectively; and the combined mean exclusion chances were 0.999999993764 in duos and 0.999999999997444 in trios, respectively. The haplotype diversities for all the seven clusters of linked loci were more than 0.9. The results showed that the panel of 19 X-STR loci were powerful for forensic applications in Guanzhong Han population. Locus by locus population comparisons showed significant differences at more than seven loci between Guanzhong Han population and the groups from North America, Europe and Africa. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Lack of TIMP-1 tumour cell immunoreactivity predicts effect of adjuvant anthracycline-based chemotherapy in patients (n=647) with primary breast cancer

DEFF Research Database (Denmark)

Willemoe, Gro L.; Hertel, Pernille Bræmer; Bartels, Annette

2009-01-01

PURPOSE: A number of prospective studies have shown that adjuvant CEF significantly improves disease-free and overall survival as compared to CMF in breast cancer patients. Our aim was to determine whether the benefit of epirubicin versus methotrexate differs according to TIMP-1 tumour cell...

Abnormalities in soluble CD147 / MMPs / TIMPs axis in Ankylosing Spondylitis patients with and without a history of Acute Anterior Uveitis / Anomalii ale axei CD147 solubil / MMPs / TIMPs la pacienții cu spondilită anchilozantă cu sau fără uveită acută anterioară

Directory of Open Access Journals (Sweden)

Mitulescu Traian Costin

2014-12-01

Full Text Available Spondilita Anchilozantă (SA este prototipul formei axiale a spondiloartritelor. În pofida studiilor extinse, sunt încă incomplet înțelese mecansimele complexe legate de procesele celulare și moleculare anormale din SA. Printre mediatorii inflamației, cum ar fi citokinele proinflamatoare, NOS-2, chemokinele, care conduc la inflamație, metaloproteinazele de matrice (MMPs joacă un rol important în procesele inflamatoare care caracterizează SA. De aceea, ne-am propus să evaluăm dacă perturbări ale homeostaziei inductorului extracelular de MMPs (EMMPRIN/CD147, MMPs și inhibitorilor tisulari ai MMPs (TIMPs joacă un rol în evoluția SA în special la pacienții care au în istoricul lor Uveită Acută Anterioară (UAA. În acest scop seruri de la pacienți cu SA și de la donatori sănătoși (DS au fost analizate pentru nivelurile de CD147 solubil (sCD147, MMP-3 și TIMP-1 prin tehnica imunoenzimatica ELISA și pentru activitatea gelatinazelor MMP-2 si MMP-9 folosind gelatin zimografia. Rezultatele experimentale au arătat că nivelurile de sCD147, MMP-3 si TIMP-1 sunt semnificativ crescute la pacienții cu SA comparativ cu DS. sCD147 ca și raportul MMP-2/sCD147 a diferențiat pacienții cu UAA de cei fără UAA în istoricul lor. La pacienții cu SA rapoartele MMP-2/sCD147, MMP-3/sCD147 și MMP-3/TIMP-1 au sugerat dezechilibrul dintre MMPs și reglatorii lor. Aceste rezultate sugerează că rapoartele MMPs/sCD147 pot deveni biomarkeri potențiali pentru întărirea caracterizării pacienților cu SA și pentru a prognoza evoluția bolii. Corelațiile pozitive și negative dintre anumite caracteristici experimentale și/sau clinice ale pacienților cu SA și terapie subliniază de asemenea utilitatea evaluării acestor biomarkeri pentru a identifica o terapie individualizată și eficientă.

Genetic polymorphism study on 12 X STR loci of investigator Argus X STR kit in Bhil tribal population of Madhya Pradesh, India.

Science.gov (United States)

Shrivastava, Pankaj; Jain, Toshi; Gupta, Umang; Trivedi, Veena Ben

2015-05-01

The analysis of 12 X STR loci (DXS10103, DXS8378, DXS7132, DXS10134, DXS10074, DXS10101, DXS10135, DXS7423, DXS10146, DXS10079, HPRTB and DXS10148) belonging to four linkage group was done in 183 (100 males and 83 females) unrelated members of Bhil population. Heterozygosity among the studied 12 X STR loci showed a distribution of from 59.7% to 92.8%. No significant difference was recorded in the allele frequencies of males and females. The loci DXS10135 and DXS10101 were found to be most polymorphic. Haplotype diversity was found to be higher than 0.990 for all the four linkage groups. A total of 86, 69, 71 and 71 haplotypes were observed for linkage group I, II, III and IV, respectively. The results showed departure from Hardy-Weinberg equilibrium with respect to three loci DXS10079, DXS10135 and DXS10101. This is first report on these 12 X STR markers from India. All the loci in the Argus X 12 kit were fairly informative in the Bhil population and the population showed significant genetic variation with all the compared populations from other parts of the world. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.

Genetic analysis of eight population groups living in Taiwan using a 13 X-chromosomal STR loci multiplex system.

Science.gov (United States)

Hwa, Hsiao-Lin; Lee, James Chun-I; Chang, Yih-Yuan; Yin, Hsiang-Yi; Chen, Ya-Hui; Tseng, Li-Hui; Su, Yi-Ning; Ko, Tsang-Ming

2011-01-01

A 13 X-chromosomal short tandem repeat (STR) multiplex system (DXS6807, DXS8378, DSX9902, DXS7132, DXS9898, DXS6809, DXS6789, DXS7424, DXS101, GATA172D05, HPRTB, DXS8377, and DXS7423) was tested on 1,037 DNA samples from eight population groups currently living in Taiwan. Different distributions of the allelic frequencies in different populations were presented. DXS8377 and DXS101 were the two most polymorphic loci in these eight populations, whereas DXS7423 was the least informative marker in most of the populations studied. The genetic distances between the populations and the constructed phylogenetic tree revealed a long genetic distance between Asian and Caucasian populations as well as isolation of the Tao population. The phylogenetic tree grouped populations into clusters compatible with their ethnogeographic relationships. This 13 X-chromosomal short tandem repeat multiplex system offers a considerable number of polymorphic patterns in different populations. This system can be useful in forensic identification casework and ethnogeographic research.

Human mesenchymal stem cells generate a distinct pericellular zone of MMP activities via binding of MMPs and secretion of high levels of TIMPs.

Science.gov (United States)

Lozito, Thomas P; Jackson, Wesley M; Nesti, Leon J; Tuan, Rocky S

2014-02-01

Mesenchymal stem cells (MSCs) are attractive candidates for inclusion in cell-based therapies by virtue of their abilities to home to wound sites. However, in-depth characterization of the specific effects of MSCs on their microenvironments is needed to realize their full therapeutic potentials. Furthermore, since MSCs of varying properties can be isolated from a diverse spectrum of tissues, a strategic and rational approach in MSC sourcing for a particular application has yet to be achieved. For example, MSCs that activate their proteolytic environments may promote tissue remodeling, while those from different tissue sources may inhibit proteases and promote tissue stabilization. This study attempts to address these issues by analyzing MSCs isolated from three adult tissue sources in terms of their effects on their proteolytic microenvironments. Human bone marrow, adipose, and traumatized muscle derived MSCs were compared in their soluble and cellular-associated MMP components and activity. For all types of MSCs, MMP activity associated with the cell surface, but activity levels and MMP profiles differed with tissue source. All MSC types bound exogenous active MMPs at their surfaces. MSCs were also able to activate exogenous proMMP-2 and proMMP-13. This is in marked contrast to the MSC soluble compartment, which strongly inhibited MMPs via endogenous TIMPs. The exact TIMP used to inhibit the exogenous MMP differed with MSC type. Thus, MSCs saturate their environment with both MMPs and TIMPs. Since they bind and activate MMPs at their surfaces, the net result is a very controlled pericellular localization of MMP activities by MSCs. © 2013.

Polysaccharides of Aloe vera induce MMP-3 and TIMP-2 gene expression during the skin wound repair of rat.

Science.gov (United States)

Tabandeh, Mohammad Reza; Oryan, Ahmad; Mohammadalipour, Adel

2014-04-01

Polysaccharides are the main macromolecules of Aloe vera gel but no data about their effect on extracellular matrix (ECM) elements are available. Here, mannose rich Aloe vera polysaccharides (AVP) with molecular weight between 50 and 250 kDa were isolated and characterized. Open cutaneous wounds on the back of 45 rats (control and treated) were daily treated with 25mg (n=15) and 50 mg (n=15) AVP for 30 days. The levels of MMP-3 and TIMP-2 gene expression were analyzed using real time PCR. The levels of n-acetyl glucosamine (NAGA), n-acetyl galactosamine (NAGLA) and collagen contents were also measured using standard biochemical methods. Faster wound closure was observed at day 15 post wounding in AVP treated animals in comparison with untreated group. At day 10 post wounding, AVP inhibited MMP-3 gene expression, while afterwards MMP-3 gene expression was upregulated. AVP enhanced TIMP-2 gene expression, collagen, NAGLA and NAGA synthesis in relation to untreated wounds. Our results suggest that AVP has positive effects on the regulation of ECM factor synthesis, which open up new perspectives for the wound repair activity of Aloe vera polysaccharide at molecular level. Copyright © 2014 Elsevier B.V. All rights reserved.

X-chromosome STR markers data in a Cabo Verde immigrant population of Lisboa.

Science.gov (United States)

Afonso Costa, Heloísa; Morais, Paulo; Vieira da Silva, Cláudia; Matos, Sara; Marques Santos, Rodolfo; Espinheira, Rosa; Costa Santos, Jorge; Amorim, António

2014-01-01

Population genetic data of 12 X chromosomal short tandem repeats markers (DXS10074, DXS10079, DXS10101, DXS10103, DXS10134, DXS10135, DXS10146, DXS10148, DXS7132, DXS7423, DXS8378 and HPRTB) were analysed in 54 females and 95 males of an immigrant population from Cabo Verde living in Lisboa. The obtained results for forensic statistical parameters such as observed heterozigosity, polymorphism information content, power of discrimination and mean exclusion chance, based on single allele frequencies, reveal that this multiplex system is highly informative and can represent an important tool for genetic identification purposes in the immigrant population of Cabo Verde. Since the studied short tandem repeats genetic markers are distributed on four linkage groups, that can provide independent genotype information, we studied those groups as haploytes. The forensic efficiency parameters for the linked groups were all higher than 0.97, with linkage group I being the most polymorphic and linkage group III the less informative.

Refined mapping and YAC contig construction of the X-linked cleft palate and ankyloglossia locus (CPX) including the proximal X-Y homology breakpoint within Xq21.3

Energy Technology Data Exchange (ETDEWEB)

Forbes, S.A.; Brennan, L.; Richardson, M. [Queen Charlotte`s Hospital, London (United Kingdom)] [and others

1996-01-01

The gene for X-linked cleft palate (CPX) has previously been mapped in an Icelandic kindred between the unordered proximal markers DXS1002/DXS349/DXS95 and the distal marker DXYS1X, which maps to the proximal end of the X-Y homology region in Xq21.3. Using six sequence-tagged sites (STSs) within the region, a total of 91 yeast artificial chromosome (YAC) clones were isolated and overlapped in a single contig that spans approximately 3.1 Mb between DXS1002 and DXYS1X. The order of microsatellite and STS markers in this was established as DXS1002-DXS1168-DXS349-DXS95-DXS364-DXS1196-DXS472-DXS1217-DXYS1X. A long-range restriction map of this region was created using eight nonchimeric, overlapping YAC clones. Analysis of newly positioned polymorphic markers in recombinant individuals from the Icelandic family has enabled us to identify DXS1196 and DXS1217 as the flanking markers for CPX. The maximum physical distance containing the CPX gene has been estimated to be 2.0 Mb, which is spanned by a minimum set of five nonchimeric YAC clones. In addition, YAC end clone and STS analyses have pinpointed the location of the proximal boundary of the X-Y homology region within the map. 40 refs., 2 figs., 2 tabs.

Nance-Horan syndrome: linkage analysis in a family from The Netherlands.

Science.gov (United States)

Bergen, A A; ten Brink, J; Schuurman, E J; Bleeker-Wagemakers, E M

1994-05-01

Linkage analysis was carried out in a Dutch family with Nance-Horan (NH) syndrome. Close linkage without recombination between NH and the Xp loci DXS207, DXS43, and DXS365 (zmax = 3.23) was observed. Multipoint linkage analysis and the analysis of recombinations in multiple informative meioses suggest the genetic order Xcen-DMD (exon 49)-DXS451-(NH, DXS207, DXS365, DXS43)-(STS, DXF30)-Xpter. These data refine the localization of the NH locus on the distal Xp.

Use of matrix metalloproteinase-9 (MMP-9 and its tissue inhibitor (TIMP-1 in the pathomorphological diagnosis of carotid pathology: literature review and own observations

Directory of Open Access Journals (Sweden)

Yu. I. Kuzyk

2016-04-01

Full Text Available Matrix metalloproteinases (MMPs are the degradative enzymes of the extracellular matrix. Currently, the role of MMP-2 and MMP-9 in the progression of atherosclerosis (AS is proved. The question of possible involvement of MMP-9 into elastin degradation in fibromuscular dysplasia (FMD and pathological tortuosity (PT remains open and insufficiently explored. The aim of the study – analysis of the current literature on the role of degradative enzymes in the development of carotid pathology and study of the expression of type I, III, IV collagens, MMP-9 and TIPM-1 in the wall of the carotid arteries in FMD, PT and AS. Materials and methods included literature review and own research. Immunohistochemical study of type I, III and IV collagens, TIMP-1 and MMP-9 was carried out on surgical material of patients with main carotid diseases: three observations with AS, two – with FMD, two – with PT. The level of expression was assessed by semiquantitative method. Results. Own observations showed that in FMD types I and III collagen content in the media and in the adventitia remains unchanged. MMP-9 expression level reached the highest level of intensity in atherosclerotic plaques, particularly in macrophages, constituting the main part of the atheromatous mass. Moderate intensity of expression is noted in FMD and PT. In PT expression prevailed in the lower third of the media on the border with adventitia, including the adventitia, in FMD – mainly in the media. The level of TIMP-1 is weakly positive in PT and FMD, negative in AS. Conclusions. These results demonstrate the possibility of using MMP-9 and TIMP-1 as a morphological marker determining pathological processes in carotid pathology. Data of immunohistochemical study of type I, II, IV collagens indicate moderate expression of collagen type I in FMD and PT, severe expression of collagen III in FMD, moderate in PT. Type IV collagen is highly expressed in atherosclerotic plaques. For AS high

Assessment of apoptosis and MMP-1, MMP-3 and TIMP-2 expression in tibial hyaline cartilage after viable medial meniscus transplantation in the rabbit.

Science.gov (United States)

Zwierzchowski, Tomasz J; Stasikowska-Kanicka, Olga; Danilewicz, Marian; Fabiś, Jarosław

2012-12-20

The porpuse of this animal study was to assess chondrocyte apoptosis and MMP-1, MMP-3 and TIMP-2 expression in rabbit tibial cartilage 6 months after viable medial meniscal autografts and allografts. Twenty white male New Zealand rabbits were chosen for the study. The medial meniscus was excised from 14 animals and stored under tissue culture conditions for 2 weeks, following which t of them were implantated as autografts and 7 as allografts. The control group consisted of 6 animals which underwent arthtrotomy. When the animals were eutanized, the tibial cartilage was used for immunohisochemical examination. Apoptosis (TUNEL method) and MMP-1, MMP-3 and TIMP-2 expression were estimated semiquantatively. An increased level of chodrocyte apoptosis in the tibail cartilage was observed after both kinds of transplants (p hyaline cartilage against excessive apoptosis. The results of experimantal studies on humans indicate the need to device a method of apoptosis inhibition in the hyaline cartilage to improve long-term results of meniscal transplantation.

A Retrospective Performance Assessment of the Developmental Neurotoxicity Study in Support of OECD Test Guideline 426

DEFF Research Database (Denmark)

Makris, Susan L.; Raffaele, Kathleen; Allen, Sandra

2009-01-01

OBJECTIVE: We conducted a review of the history and performance of developmental neurotoxicity mic (DNT) testing in support of the finalization and implementation of Organisation of Economic Co-operation and Development (OECD) DNT test guideline 426 (TG 426). INFORMATION SOURCES AND ANALYSIS......: In this review we summarize extensive scientific efforts that form the foundation for this testing paradigm, including basic neurotoxicology research, interlaboratory collaborative studies, expert workshops, and validation studies, and we address the relevance, applicability, and use of the DNT study in risk...... and international acceptance of new or updated test methods for hazard characterization. Multiple independent, expert scientific peer reviews affirm these conclusions....

ON THE PRO-METASTATIC STRESS RESPONSE TO CANCER THERAPIES: EVIDENCE FOR A POSITIVE CO-OPERATION BETWEEN TIMP-1, HIF-1α, AND miR-210

Directory of Open Access Journals (Sweden)

Haissi eCui

2012-07-01

Full Text Available In contrast to expectations in the past that tumor starvation or unselective inhibition of proteolytic activity would cure cancer, there is accumulating evidence that microenvironmental stress, such as hypoxia or broad spectrum inhibition of metalloproteinases can promote metastasis. In fact, malignant tumor cells, due to their genetic and epigenetic instability, are predisposed to react to stress by adaptation and, if the stress persists, by escape and formation of metastasis. Recent recognition of the concepts of dynamic evolution as well as population and systems biology is extremely helpful to understand the disappointments of clinical trials with new drugs and may lead to paradigm-shifts in therapy strategies. This must be complemented by an increased understanding of molecular mechanism involved in stress response. Here, we review new roles of Hypoxia-inducible factor-1 (HIF-1, one transcription factor regulating stress response-related gene expression: HIF-1 is crucial for invasion and metastasis, independent from its pro-survival function. In addition, HIF-1 mediates pro-metastatic microenvironmental changes of the proteolytic balance as triggered by high systemic levels of tissue inhibitor of metalloproteinases-1 (TIMP-1, typical for many aggressive cancers, and regulates the metabolic switch to glycolysis, notably via activation of the microRNA miR-210. There is preliminary evidence that TIMP-1 also induces miR-210. Such positive-regulatory co-operation of HIF-1α, miR-210, and TIMP-1, all described to correlate with bad prognosis of cancer patients, opens new perspectives of gaining insight into molecular mechanisms of metastasis-inducing evasion of tumor cells from stress.

Development of the 16 X-STR loci typing system and genetic analysis in a Shanghai Han population from China.

Science.gov (United States)

Sun, Kuan; Zhao, Shumin; Tian, Huaizhou; Zhang, Suhua; Li, Chengtao

2013-11-01

This study developed a new multiplex PCR system that simultaneously amplifies 16 X-STR loci in the same PCR reaction, and the polymorphism and mutation rates of these 16 X-STR loci were explored in a Shanghai Han population from China. These loci included DXS10134, DXS10159, DXS6789, DXS6795, DXS6800, DXS6803, DXS6807, DXS6810, DXS7132, DXS7424, DXS8378, DXS9902, GATA165B12, GATA172D05, GATA31E08, and HPRTB. Samples from 591 unrelated individuals (293 males and 298 females) and 400 two-generation families were successfully analyzed using this multiplex system. Allele frequencies and mutation rates of the 16 loci were investigated, with the comparison of allele frequency distributions among different populations performed. Polymorphism information contents of these loci were all >0.6440 except the locus DXS6800 (0.4706). Nine cases of mutations were detected in the 16 loci from the investigation of 9232 meioses. Pairwise comparisons of allele frequency distributions showed significant differences for most loci among populations from different countries and ethnic groups but not among the Han population living in other areas of China. These results suggest that the 16 X-STR loci system provides highly informative polymorphic data for paternity testing and forensic identification in the Han population in Shanghai, China, as a complementary tool. © 2013 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

25 CFR 42.6 - When does due process require a formal disciplinary hearing?

Science.gov (United States)

2010-04-01

... 25 Indians 1 2010-04-01 2010-04-01 false When does due process require a formal disciplinary... RIGHTS § 42.6 When does due process require a formal disciplinary hearing? Unless local school policies and procedures provide for less, a formal disciplinary hearing is required before a suspension in...

Toxoplasma gondii infection shifts dendritic cells into an amoeboid rapid migration mode encompassing podosome dissolution, secretion of TIMP-1, and reduced proteolysis of extracellular matrix.

Science.gov (United States)

Ólafsson, Einar B; Varas-Godoy, Manuel; Barragan, Antonio

2018-03-01

Dendritic cells (DCs) infected by Toxoplasma gondii rapidly acquire a hypermigratory phenotype that promotes systemic parasite dissemination by a "Trojan horse" mechanism in mice. Recent paradigms of leukocyte migration have identified the amoeboid migration mode of DCs as particularly suited for rapid locomotion in extracellular matrix and tissues. Here, we have developed a microscopy-based high-throughput approach to assess motility and matrix degradation by Toxoplasma-challenged murine and human DCs. DCs challenged with T. gondii exhibited dependency on metalloproteinase activity for hypermotility and transmigration but, strikingly, also dramatically reduced pericellular proteolysis. Toxoplasma-challenged DCs up-regulated expression and secretion of tissue inhibitor of metalloproteinases-1 (TIMP-1) and their supernatants impaired matrix degradation by naïve DCs and by-stander DCs dose dependently. Gene silencing of TIMP-1 by short hairpin RNA restored matrix degradation activity in Toxoplasma-infected DCs. Additionally, dissolution of podosome structures in parasitised DCs coincided with abrogated matrix degradation. Toxoplasma lysates inhibited pericellular proteolysis in a MyD88-dependent fashion whereas abrogated proteolysis persevered in Toxoplasma-infected MyD88-deficient DCs. This indicated that both TLR/MyD88-dependent and TLR/MyD88-independent signalling pathways mediated podosome dissolution and the abrogated matrix degradation. We report that increased TIMP-1 secretion and cytoskeletal rearrangements encompassing podosome dissolution are features of Toxoplasma-induced hypermigration of DCs with an impact on matrix degradation. Jointly, the data highlight how an obligate intracellular parasite orchestrates key regulatory cellular processes consistent with non-proteolytic amoeboid migration of the vehicle cells that facilitate its dissemination. © 2017 John Wiley & Sons Ltd.

Development and validation of a multiplex reaction analyzing eight miniSTRs of the X chromosome for identity and kinship testing with degraded DNA.

Science.gov (United States)

Castañeda, María; Odriozola, Adrián; Gómez, Javier; Zarrabeitia, María T

2013-07-01

We report the development of an effective system for analyzing X chromosome-linked mini short tandem repeat loci with reduced-size amplicons (less than 220 bp), useful for analyzing highly degraded DNA samples. To generate smaller amplicons, we redesigned primers for eight X-linked microsatellites (DXS7132, DXS10079, DXS10074, DXS10075, DXS6801, DXS6809, DXS6789, and DXS6799) and established efficient conditions for a multiplex PCR system (miniX). The validation tests confirmed that it has good sensitivity, requiring as little as 20 pg of DNA, and performs well with DNA from paraffin-embedded tissues, thus showing potential for improved analysis and identification of highly degraded and/or very limited DNA samples. Consequently, this system may help to solve complex forensic cases, particularly when autosomal markers convey insufficient information.

Increased expression of HIF-1α, VEGF-A and its receptors, MMP-2, TIMP-1, and ADAMTS-1 at the venous stenosis of arteriovenous fistula in a mouse model with renal insufficiency

Science.gov (United States)

Misra, Sanjay; Shergill, Uday; Yang, Binxia; Janardhanan, Rajiv; Misra, Khamal D.

2010-01-01

Purpose A mouse model of renal insufficiency with arteriovenous fistula (AVF) and venous stenosis was created. We tested the hypothesis that there is increased gene expression of hypoxia inducible factor-1 alpha (HIF-1α), vascular endothelial growth factor- A (VEGF-A) and its receptors (VEGFR-1, -2), matrix metalloproteinase-2 (MMP-2), -9 (MMP-9), tissue inhibitor of metalloproteinase-1, -2 (TIMP-1, -2), and a disintegrin and metalloproteinase thrombospondin-1 (ADAMTS-1) at the venous stenosis. Materials and methods Nineteen male C57BL/6 mice underwent a left nephrectomy and a surgical occlusion of the right upper pole to induce renal insufficiency and characterized in eight mice. Twenty eight days later, an AVF (n=11) was created from the right carotid artery to ipsilateral jugular vein and the mice were sacrificed at day 7 (n=4) and day 14 (n=4). The outflow and control veins were removed for gene expression. Three mice were sacrificed at day 28 for histologic analysis. Results The mean serum blood urea nitrogen remained significantly elevated for 8 weeks when compared to baseline (P<0.05). By day 7, there was a significant increase in the expression of HIF-1α, VEGF-A, VEGFR-1, VEGFR-2, MMP-2, TIMP-1, and ADAMTS-1 at the outflow vein with HIF-1α and TIMP-1 being significantly elevated at day 14 (P<0.05). By day 28, the venous stenosis was characterized by a thickened vein wall and neointima. Conclusions A mouse model of renal insufficiency with AVF was developed which had increased expression of HIF-1α, VEGF-A, VEGFR-1, VEGFR-2, MMP-2, TIMP-1, and ADAMTS-1 at the outflow vein with venous stenosis by day 28. PMID:20598569

Increased expression of HIF-1alpha, VEGF-A and its receptors, MMP-2, TIMP-1, and ADAMTS-1 at the venous stenosis of arteriovenous fistula in a mouse model with renal insufficiency.

Science.gov (United States)

Misra, Sanjay; Shergill, Uday; Yang, Binxia; Janardhanan, Rajiv; Misra, Khamal D

2010-08-01

A mouse model of renal insufficiency with arteriovenous fistula (AVF) and venous stenosis was created. The authors tested the hypothesis that there is increased gene expression of hypoxia-inducible factor-1 alpha (HIF-1alpha); vascular endothelial growth factor-A (VEGF-A) and its receptors (VEGFR-1, -2); matrix metalloproteinase-2 (MMP-2), -9 (MMP-9); tissue inhibitor of metalloproteinase-1, -2 (TIMP-1, -2); and a disintegrin and metalloproteinase thrombospondin-1 (ADAMTS-1) at the venous stenosis. Nineteen male C57BL/6 mice underwent a left nephrectomy and a surgical occlusion of the right upper pole to induce renal function characterized in eight animals. Twenty eight days later, an AVF (n = 11) was created from the right carotid artery to ipsilateral jugular vein, and the mice were killed at day 7 (n = 4) and day 14 (n = 4). The outflow and control veins were removed for gene expression. Three mice were killed at day 28 for histologic analysis. The mean serum blood urea nitrogen level remained significantly elevated for 8 weeks when compared with baseline (P < .05). By day seven, there was a significant increase in the expression of HIF-1alpha, VEGF-A, VEGFR-1, VEGFR-2, MMP-2, TIMP-1, and ADAMTS-1 at the outflow vein, with HIF-1alpha and TIMP-1 levels significantly elevated at day 14 (P < .05). By day 28, the venous stenosis was characterized by a thickened vein wall and neointima. A mouse model of renal insufficiency with AVF was developed that had increased expression of HIF-1alpha, VEGF-A, VEGFR-1, VEGFR-2, MMP-2, TIMP-1, and ADAMTS-1 at the outflow vein with venous stenosis by day 28. Copyright (c) 2010 SIR. Published by Elsevier Inc. All rights reserved.

Plasma TIMP-1 and CEA in detection of primary colorectal cancer: a prospective, population based study of 4509 high-risk individuals

DEFF Research Database (Denmark)

Nielsen, Hans J; Brünner, Nils; Jørgensen, Lars Nannestad

2011-01-01

. Individuals (n = 4509) referred for large bowel endoscopy due to symptoms of CRC were prospectively included. Baseline data and concurrent diseases were recorded. The primary endpoint was detection of CRC and findings at examinations were recorded using International Classification of Diseases-10 codes....... This prospective validation study supports the use of the combination of plasma TIMP-1 and CEA protein measurements as a potential aid in early detection of CRC and specifically of CC....

Analysis of the 19 Y-STR and 16 X-STR loci system in the Han population of Shandong province, China.

Science.gov (United States)

Gao, H M; Wang, C; Han, S Y; Sun, S H; Xiao, D J; Wang, Y S; Li, C T; Zhang, M X

2017-03-30

The sex-linked short tandem repeats (STR), Y-STR and X-STR, are important for autosomal STRs in forensic paternity testing. We evaluated the forensic parameters of 19 Y-STRs and 16 X-STRs in the Han population of Shandong province, China. A Goldeneye 20Y kit (DYS391, DYS389I, DYS390, DYS389II, DYS348, DYS456, Y-GATA-H4, DYS447, DYS19, DYS392, DYS393, DYS388, DYS439, DYS635, DYS448, DYS460, DYS458, DYS437, DYS385 a/b) was used to analyze the forensic parameters of 534 unrelated males. A Goldeneye17X system (DXS6795, DXS9902, DXS8378, HPRTB, GATA165B12, DXS7132, DXS7424, DXS6807, DXS6803, GATA172D05, DXS6800, DXS10134, GATA31E08, DXS10159, DXS6789, DXS6810, amelogenin) was used to analyze 97 unrelated males and 214 females. In addition, we used the kits to examine 5 cases with abnormal amelogenin test results, as well as a male child with agenosomia typed by autosomal STR. We found 203 Y-STR haplotypes with allele frequencies ranging from 0.0019 to 0.7959, and GD ranging from 0.3429 to 0.9667. Expect in DXS6803, the allele frequencies of the other 15 X-STR loci showed no differences between females and males. PD F ranged from 0.5504 to 0.9638, while PD M ranged from 0.3176 to 0.8377. With the exception of DXS6803 and DXS6810, the allele frequencies of other X-STR loci were in accordance with Hardy-Weinberg equilibrium in females. One amelogenin negative case was characterized as a deletion of Y-DYS458. This paper provided data regarding the genetic polymorphism of Y-STRs and X-STRs in the Han population, and demonstrated the importance of Y-STR and X-STR in forensic autosomal STR analysis.

Platelet-derived growth factor-D modulates extracellular matrix homeostasis and remodeling through TIMP-1 induction and attenuation of MMP-2 and MMP-9 gelatinase activities

Energy Technology Data Exchange (ETDEWEB)

Borkham-Kamphorst, Erawan, E-mail: ekamphorst@ukaachen.de; Alexi, Pascal; Tihaa, Lidia; Haas, Ute; Weiskirchen, Ralf, E-mail: rweiskirchen@ukaachen.de

2015-02-13

Platelet-derived growth factor-D (PDGF-D) is a more recent recognized growth factor involved in the regulation of several cellular processes, including cell proliferation, transformation, invasion, and angiogenesis by binding to and activating its cognate receptor PDGFR-β. After bile duct ligation or in the carbon tetrachloride-induced hepatic fibrosis model{sub ,} PDGF-D showed upregulation comparable to PDGF-B. Moreover, adenoviral PDGF-D gene transfer induced hepatic stellate cell proliferation and liver fibrosis. We here investigated the molecular mechanism of PDGF-D involvement in liver fibrogenesis. Therefore, the GRX mouse cell line was stimulated with PDGF-D and evaluated for fibrotic markers and PDGF-D signaling pathways in comparison to the other PDGF isoforms. We found that PDGF-D failed to enhance Col I and α-smooth muscle actin (α-SMA) production but has capacity to upregulate expression of the tissue inhibitor of metalloprotease 1 (TIMP-1) resulting in attenuation of MMP-2 and MMP-9 gelatinase activity as indicated by gelatinase zymography. This phenomenon was restored through application of a PDGF-D neutralizing antibody. Unexpectedly, PDGF-D incubation decreased both PDGFR-α and -β in mRNA and protein levels, and PDGF-D phosphorylated typrosines specific for PDGFR-α and -β. We conclude that PDGF-D intensifies fibrogenesis by interfering with the fibrolytic activity of the TIMP-1/MMP system and that PDGF-D signaling is mediated through both PDGF-α and -β receptors. - Highlights: • PDGF-D signals through PDGF receptor type α and β. • PDGF-D modulates extracellular matrix homeostasis and remodeling. • Like PDGF-B, PDGF-D triggers phosphorylation of PLC-γ, Akt/PKB, JNK, ERK1/2, and p38. • PDGF-D induces TIMP-1 expression through ERK and p38 MAPK. • PDGF-D attenuates MMP-2 and MMP-9 gelatinase activities.

Platelet-derived growth factor-D modulates extracellular matrix homeostasis and remodeling through TIMP-1 induction and attenuation of MMP-2 and MMP-9 gelatinase activities

International Nuclear Information System (INIS)

Borkham-Kamphorst, Erawan; Alexi, Pascal; Tihaa, Lidia; Haas, Ute; Weiskirchen, Ralf

2015-01-01

Platelet-derived growth factor-D (PDGF-D) is a more recent recognized growth factor involved in the regulation of several cellular processes, including cell proliferation, transformation, invasion, and angiogenesis by binding to and activating its cognate receptor PDGFR-β. After bile duct ligation or in the carbon tetrachloride-induced hepatic fibrosis model , PDGF-D showed upregulation comparable to PDGF-B. Moreover, adenoviral PDGF-D gene transfer induced hepatic stellate cell proliferation and liver fibrosis. We here investigated the molecular mechanism of PDGF-D involvement in liver fibrogenesis. Therefore, the GRX mouse cell line was stimulated with PDGF-D and evaluated for fibrotic markers and PDGF-D signaling pathways in comparison to the other PDGF isoforms. We found that PDGF-D failed to enhance Col I and α-smooth muscle actin (α-SMA) production but has capacity to upregulate expression of the tissue inhibitor of metalloprotease 1 (TIMP-1) resulting in attenuation of MMP-2 and MMP-9 gelatinase activity as indicated by gelatinase zymography. This phenomenon was restored through application of a PDGF-D neutralizing antibody. Unexpectedly, PDGF-D incubation decreased both PDGFR-α and -β in mRNA and protein levels, and PDGF-D phosphorylated typrosines specific for PDGFR-α and -β. We conclude that PDGF-D intensifies fibrogenesis by interfering with the fibrolytic activity of the TIMP-1/MMP system and that PDGF-D signaling is mediated through both PDGF-α and -β receptors. - Highlights: • PDGF-D signals through PDGF receptor type α and β. • PDGF-D modulates extracellular matrix homeostasis and remodeling. • Like PDGF-B, PDGF-D triggers phosphorylation of PLC-γ, Akt/PKB, JNK, ERK1/2, and p38. • PDGF-D induces TIMP-1 expression through ERK and p38 MAPK. • PDGF-D attenuates MMP-2 and MMP-9 gelatinase activities

76 FR 27078 - Agency Information Collection Activities: Form N-426, Extension of a Currently Approved...

Science.gov (United States)

2011-05-10

... DEPARTMENT OF HOMELAND SECURITY U.S. Citizenship and Immigration Services Agency Information... Military or Naval Service; OMB Control No. 1615-0053. The Department of Homeland Security, U.S. Citizenship... sponsoring the collection: Form N-426, U.S. Citizenship and Immigration Services. (4) Affected public who...

Expression of matrix metalloproteinase 9 (MMP-9) and tissue inhibitor of metalloproteinases 1 (TIMP-1) by colorectal cancer cells and adjacent stroma cells--associations with histopathology and patients outcome

DEFF Research Database (Denmark)

Jensen, Søren Astrup; Vainer, Ben; Bartels, Annette

2010-01-01

To elucidate cellular features accountable for colorectal cancers' (CRC) capability to invade normal tissue and to metastasize, we investigated the level of the collagenase matrix metalloproteinase 9 (MMP-9) and its physiological inhibitor tissue inhibitor of metalloproteinases 1 (TIMP-1) in canc...

Closure Report for Corrective Action Unit 426: Cactus Spring Waste Trenches, Tonopah Test Range, Nevada

Energy Technology Data Exchange (ETDEWEB)

Dave Madsen

1998-08-01

This Closure Report provides the documentation for closure of the Cactus Spring Waste Trenches Corrective Action Unit (CAU) 426. The site is located on the Tonopah Test Range, approximately 225 kilometers northwest of Las Vegas, NV. CAU 426 consists of one corrective action site (CAS) which is comprised of four waste trenches. The trenches were excavated to receive solid waste generated in support of Operation Roller Coaster, primary the Double Tracks Test in 1963, and were subsequently backfilled. The Double Tracks Test involved use of live animals to assess the biological hazards associated with the nonnuclear detonation of plutonium-bearing devices. The Nevada Division of Environmental Protection approved Corrective Action Plan (CAP)which proposed ''capping'' methodology. The closure activities were completed in accordance with the approved CAP and consisted of constructing an engineered cover in the area of the trenches, constructing/planting a vegetative cover, installing a perimeter fence and signs, implementing restrictions on future use, and preparing a Post-Closure Monitoring Plan.

MMP8, MMP9 AND TIMP1 LEVELS IN GCF AND GINGIVAL TISSUE OF PATIENTS WITH GINGIVAL OVERGROWTH DURING ORTHODONTIC TREATMENT

Directory of Open Access Journals (Sweden)

Petra Surlin

2012-03-01

Full Text Available Aim. Periodontal remodellng produced during dental orthodontic treatment represents a series of biologicallyactive substances, part of them playing some role in the initiation and propagation of inflammatory processes. The present study aims at demonstrating the MMP8, MMP9 and TIMP1 levels intervening in tissular periodontal remodeling produced during orthodontic treatments, accompanied by gingival overgrowth, as a reaction of the marginal periodontium to mechanical stress. Materials and Method. Selected for the study were 21 patients – 13 females and 8 males – with ages between 13 and 32 years (17.6±1.3 years affected with dento-maxillary anomalies, who received orthodontic treatment with fixed apparatus. Sampling from the gingival fluid was performed 6 times, namely: 1 hour prior to the application of the orthodontic apparatus, 4 hours after its application, again after 8 and 24 hours and then 1 and, respectively, 2 weeks later. If gingival hypertrophy was installed (HTG, the hypertrophic gingiva was removed, and an immuno-histo-chemical examination was made. The patient was weekly monitorized in the first 6 weeks – during the initial orthodontic treatment, then monthly, samples being taken over from the gingival sulcus on each visit made in the first 6 weeks. Results. MMP-9 immuno-marking was positive both at corione level and in the deep structures of the covering epithelium. The positive cells at MMP-9 evidenced different intensities at the level of each structure forming the gingival mucous membrane. In four of the cases under analysis, disorganization of the normal layering/stratification of the epithelium was evidenced, along with the presence of numerous red cells in the chorione of the mucous membrane. In such cases, immuno-marking to MMP8 showed a normal intensity, even if few positive cells, dispersed among the extravasated red cells could be observed. Immunologically, MMP8 and MMP9 obey the same pattern, registering maximum

40 CFR 426.122 - Effluent limitations guidelines representing the degree of effluent reduction attainable by the...

Science.gov (United States)

2010-07-01

... Incandescent Lamp Envelope Manufacturing Subcategory § 426.122 Effluent limitations guidelines representing the...): (a) Any manufacturing plant which produces incandescent lamp envelopes shall meet the following... any 1 day Average of daily values for 30 consecutive days shall not exceed— Metric units (g/kkg of...

Genetic polymorphisms of nine X-STR loci in four population groups from Inner Mongolia, China.

Science.gov (United States)

Hou, Qiao-Fang; Yu, Bin; Li, Sheng-Bin

2007-02-01

Nine short tandem repeat (STR) markers on the X chromosome (DXS101, DXS6789, DXS6799, DXS6804, DXS7132, DXS7133, DXS7423, DXS8378, and HPRTB) were analyzed in four population groups (Mongol, Ewenki, Oroqen, and Daur) from Inner Mongolia, China, in order to learn about the genetic diversity, forensic suitability, and possible genetic affinities of the populations. Frequency estimates, Hardy-Weinberg equilibrium, and other parameters of forensic interest were computed. The results revealed that the nine markers have a moderate degree of variability in the population groups. Most heterozygosity values for the nine loci range from 0.480 to 0.891, and there are evident differences of genetic variability among the populations. A UPGMA tree constructed on the basis of the generated data shows very low genetic distance between Mongol and Han (Xi'an) populations. Our results based on genetic distance analysis are consistent with the results of earlier studies based on linguistics and the immigration history and origin of these populations. The minisatellite loci on the X chromosome studied here are not only useful in showing significant genetic variation between the populations, but also are suitable for human identity testing among Inner Mongolian populations.

Nance-Horan syndrome: linkage analysis in 4 families refines localization in Xp22.31-p22.13 region.

Science.gov (United States)

Toutain, A; Ronce, N; Dessay, B; Robb, L; Francannet, C; Le Merrer, M; Briard, M L; Kaplan, J; Moraine, C

1997-02-01

Nance-Horan syndrome (NHS) is an X-linked disease characterized by severe congenital cataract with microcornea, distinctive dental findings, evocative facial features and mental impairment in some cases. Previous linkage studies have placed the NHS gene in a large region from DXS143 (Xp22.31) to DXS451 (Xp22.13). To refine this localization further, we have performed linkage analysis in four families. As the maximum expected Lod score is reached in each family for several markers in the Xp22.31-p22.13 region and linkage to the rest of the X chromosome can be excluded, our study shows that NHS is a genetically homogeneous condition. An overall maximum two-point Lod score of 9.36 (theta = 0.00) is obtained with two closely linked markers taken together. DXS207 and DXS1053 in Xp22.2. Recombinant haplotypes indicate that the NHS gene lies between DXS85 and DXS1226. Multipoint analysis yield a maximum Lod score of 9.45 with the support interval spanning a 15-cM region that includes DXS16 and DXS1229/365. The deletion map of the Xp22.3-Xp21.3 region suggests that the phenotypic variability of NHS is not related to gross rearrangement of sequences of varying size but rather to allelic mutations in a single gene, presumably located proximal to DXS16 and distal to DXS1226. Comparison with the map position of the mouse Xcat mutation supports the location of the NHS gene between the GRPR and PDHA1 genes in Xp22.2.

The value of some Corsican sub-populations for genetic association studies

Directory of Open Access Journals (Sweden)

Vona Giuseppe

2008-07-01

Full Text Available Abstract Background Genetic isolates with a history of a small founder population, long-lasting isolation and population bottlenecks represent exceptional resources in the identification of disease genes. In these populations the disease allele reveals Linkage Disequilibrium (LD with markers over significant genetic intervals, therefore facilitating disease locus identification. In a previous study we examined the LD extension on the Xq13 region in three Corsican sub-populations from the inner mountainous region of the island. On the basis of those previous results we have proposed a multistep procedure to carry out studies aimed at the identification of genes involved in complex diseases in Corsica. A prerequisite to carry out the proposed multi-step procedure was the presence of different degrees of LD on the island and a common genetic derivation of the different Corsican sub-populations. In order to evaluate the existence of these conditions in the present paper we extended the analysis to the Corsican coastal populations. Methods Samples were analyzed using seven dinucleotide microsatellite markers on chromosome Xq13-21: DXS983, DXS986, DXS8092, DXS8082, DXS1225, DXS8037 and DXS995 spanning approximately 4.0 cM (13.3 Mb. We have also investigated the distribution of the DXS1225-DXS8082 haplotype which has been recently proposed as a good marker of population genetic history due to its low recombination rate. Results the results obtained indicate a decrease of LD on the island from the central mountainous toward the coastal sub-populations. In addition the analysis of the DXS1225-DXS8082 haplotype revealed: 1 the presence of a particular haplotype with high frequency; 2 the derivation from a common genetic pool of the sub-populations examined in the present study. Conclusion These results indicate the Corsican sub-populations useful for the fine mapping of genes contributing to complex diseases.

Cell Uptake and Validation of Novel PECs for Biomedical Applications.

Science.gov (United States)

Palamà, Ilaria E; Musarò, Mariarosaria; Coluccia, Addolorata M L; D'Amone, Stefania; Gigli, Giuseppe

2011-01-01

This pilot study provides the proof of principle for biomedical application of novel polyelectrolyte complexes (PECs) obtained via electrostatic interactions between dextran sulphate (DXS) and poly(allylamine hydrochloride) (PAH). Scanning electron microscopy (SEM) and atomic force microscopy (AFM) showed that DXS/PAH polyelectrolyte complexes were Monodispersed with regular rounded-shape features and average diameters of 250 nm at 2 : 1 weight ratios of DXS/PAH. Fluorescently labelled DXS and fluorescein-isothiocyanate- (FITC-)conjugate DXS were used to follow cell uptake efficiency of PECs and biodegradability of their enzymatically degradable DXS-layers by using confocal laser scanning microscopy (CLSM). Moreover, quantitative MTT and Trypan Blue assays were employed to validate PECs as feasible and safe nanoscaled carriers at single-cell level without adverse effects on metabolism and viability.

Cell Uptake and Validation of Novel PECs for Biomedical Applications

Directory of Open Access Journals (Sweden)

Ilaria E. Palamà

2011-01-01

Full Text Available This pilot study provides the proof of principle for biomedical application of novel polyelectrolyte complexes (PECs obtained via electrostatic interactions between dextran sulphate (DXS and poly(allylamine hydrochloride (PAH. Scanning electron microscopy (SEM and atomic force microscopy (AFM showed that DXS/PAH polyelectrolyte complexes were Monodispersed with regular rounded-shape features and average diameters of 250 nm at 2 : 1 weight ratios of DXS/PAH. Fluorescently labelled DXS and fluorescein-isothiocyanate- (FITC-conjugate DXS were used to follow cell uptake efficiency of PECs and biodegradability of their enzymatically degradable DXS-layers by using confocal laser scanning microscopy (CLSM. Moreover, quantitative MTT and Trypan Blue assays were employed to validate PECs as feasible and safe nanoscaled carriers at single-cell level without adverse effects on metabolism and viability.

Nance-Horan syndrome: localization within the region Xp21.1-Xp22.3 by linkage analysis.

Science.gov (United States)

Stambolian, D; Lewis, R A; Buetow, K; Bond, A; Nussbaum, R

1990-07-01

Nance-Horan Syndrome (NHS) or X-linked cataract-dental syndrome (MIM 302350) is a disease of unknown pathogenesis characterized by congenital cataracts and dental anomalies. We performed linkage analysis in three kindreds with NHS by using six RFLP markers between Xp11.3 and Xp22.3. Close linkage was found between NHS and polymorphic loci DXS43 (theta = 0 with lod score 2.89), DXS41 (theta = 0 with lod score 3.44), and DXS67 (theta = 0 with lod score 2.74), defined by probes pD2, p99-6, and pB24, respectively. Recombinations were found with the marker loci DXS84 (theta = .04 with lod score 4.13), DXS143 (theta = .06 with lod score 3.11) and DXS7 (theta = .09 with lod score 1.68). Multipoint linkage analysis determined the NHS locus to be linked completely to DXS41 (lod score = 7.07). Our linkage results, combined with analysis of Xp interstitial deletions, suggest that the NHS locus is located within or close to the Xp22.1-Xp22.2 region.

Characterization of a thermophilic cellulase from Geobacillus sp. HTA426, an efficient cellulase-producer on alkali pretreated of lignocellulosic biomass.

Science.gov (United States)

Potprommanee, Laddawan; Wang, Xiao-Qin; Han, Ye-Ju; Nyobe, Didonc; Peng, Yen-Ping; Huang, Qing; Liu, Jing-Yong; Liao, Yu-Ling; Chang, Ken-Lin

2017-01-01

A themophilic cellulase-producing bacterium was isolated from a hot spring district and identified as Geobacillus sp. HTA426. The cellulase enzyme produced by the Geobacillus sp. HTA426 was purified through ammonium sulfate precipitation and ion exchange chromatography, with the recovery yield and fold purification of 10.14% and 5.12, respectively. The purified cellulase has a molecular weight of 40 kDa. The optimum temperature and pH for carboxymethyl cellulase (CMCase) activity of the purified cellulase were 60°C and pH 7.0, respectively. The enzyme was also stable over a wide temperature range of 50°C to 70°C after 5 h of incubation. Moreover, the strain HTA426 was able to grow and produce cellulase on alkali-treated sugarcane bagasse, rice straw and water hyacinth as carbon sources. Enzymatic hydrolysis of sugarcane bagasse, which was regarded as the most effective carbon source for cellulase production (CMCase activity = 103.67 U/mL), followed by rice straw (74.70 U/mL) and water hyacinth (51.10 U/mL). This strain producing an efficient thermostable cellulose is a potential candidate for developing a more efficient and cost-effective process for converting lignocellulosic biomass into biofuel and other industrial process.

Phylogeography of haplotypes of five microsatellites located in a low-recombination region of the X chromosome: studies worldwide and in Brazilian populations.

Science.gov (United States)

Pereira, Rinaldo Wellerson; Pena, Sérgio D J

2006-01-01

We studied five microsatellites (DXS995, DXS8076, DXS8114, DXS1002 and DXS1050) located in a region of very low recombination rate in the long arm of the human X chromosome (Xq13.3-Xq21.3). No recombination was seen in 291 meioses in CEPH families. To test whether haplotypes composed of the five microsatellites could differentiate among distinct human continental populations, we studied an international panel containing 72 males from Africa, Europe, Asia and the America. Haplotypic diversity was very high within these groups and no haplotypes were shared among them. This led to the hope that we might be able to identify continent-specific lineages. However, in a median joining network there was no clear discrimination of the different continental groups. We then tested whether we could identify X chromosomal lineages from different continental origins in Brazilians. We typed 180 white Brazilians from four different geographical regions and examined their proportions of haplotype sharing with Africans, Asians, Europeans and Amerindians. No phylogeographical patterns emerged from the data. Moreover, there were several instances of the same haplotype being shared by many (and in one instance all) groups, suggesting that recombination might be occurring. We thus studied pairwise the level of linkage disequilibrium (LD) between the microsatellites. No detectable linkage disequilibrium between the most external loci DXS995 and DXS1050 was observed. Thus, even though recombination may be absent on short time spans, as seen in the CEPH pedigrees, on a long term basis it occurs often enough to dissipate all linkage disequilibrium. On the other hand, we observed very strong linkage disequilibrium between the pairs DXS995/DXS8076 and DXS1002/DXS8114, raising the possibility of resequencing the segment between them to identify single nucleotide polymorphisms (SNPs) in their intervals. The combination of X-linked microsatellites and SNPs in strong linkage disequilibrium might

MiniX-STR multiplex system population study in Japan and application to degraded DNA analysis.

Science.gov (United States)

Asamura, H; Sakai, H; Kobayashi, K; Ota, M; Fukushima, H

2006-05-01

We sought to evaluate a more effective system for analyzing X-chromosomal short tandem repeats (X-STRs) in highly degraded DNA. To generate smaller amplicon lengths, we designed new polymerase chain reaction (PCR) primers for DXS7423, DXS6789, DXS101, GATA31E08, DXS8378, DXS7133, DXS7424, and GATA165B12 at X-linked short tandem repeat (STR) loci, devising two miniX-multiplex PCR systems. Among 333 Japanese individuals, these X-linked loci were detected in amplification products ranging in length from 76 to 169 bp, and statistical analyses of the eight loci indicated a high usefulness for the Japanese forensic practice. Results of tests on highly degraded DNA indicated the miniX-STR multiplex strategies to be an effective system for analyzing degraded DNA. We conclude that analysis by the current miniX-STR multiplex systems offers high effectiveness for personal identification from degraded DNA samples.

Nance-Horan syndrome: linkage analysis in a family from The Netherlands

NARCIS (Netherlands)

Bergen, A. A.; ten Brink, J.; Schuurman, E. J.; Bleeker-Wagemakers, E. M.

1994-01-01

Linkage analysis was carried out in a Dutch family with Nance-Horan (NH) syndrome. Close linkage without recombination between NH and the Xp loci DXS207, DXS43, and DXS365 (zmax = 3.23) was observed. Multipoint linkage analysis and the analysis of recombinations in multiple informative meioses

Predictive role of HER2/neu, topoisomerase-II-alpha, and tissue inhibitor of metalloproteinases (TIMP-1) for response to adjuvant taxane-based chemotherapy in patients with intermediate-risk breast cancer

DEFF Research Database (Denmark)

Erber, Ramona; Gluz, Oleg; Brünner, Nils

2015-01-01

. In this study, we investigate a large cohort of patients with intermediate-risk BC treated within the WSG EC-DOC Trial for the predictive impact of topoisomerase-II-alpha, HER2/neu, and TIMP-1. Tumor tissue was available in a representative cohort of 772 cases of the WSG EC-DOC Trial collective which compared 4...

New distal marker closely linked to the fragile X locus

NARCIS (Netherlands)

Hulsebos, T. J.; Oostra, B. A.; Broersen, S.; Smits, A.; van Oost, B. A.; Westerveld, A.

1991-01-01

We have isolated II-10, a new X-chromosomal probe that identifies a highly informative two-allele TaqI restriction fragment length polymorphism at locus DXS466. Using somatic cell hybrids containing distinct portions of the long arm of the X chromosome, we could localize DXS466 between DXS296 and

42 CFR 137.426 - May an Indian Tribe get an extension of time to file a notice of appeal?

Science.gov (United States)

2010-10-01

...-GOVERNANCE Appeals Pre-Award Disputes § 137.426 May an Indian Tribe get an extension of time to file a notice... time period. If the Indian Tribe has a valid reason for not filing its notice of appeal on time, it may...

Paragangliomas timpânicos: relato de casos Tympanic paragangliomas: case reports

Directory of Open Access Journals (Sweden)

Maria Eugênia L. R. B de V. Neto

2005-02-01

Full Text Available Os tumores glômicos, também chamados de paragangliomas, são formados por células não cromafins. O tumor é tipicamente vascular formado por vasos capilares e pré-capilares, interposto por células epiteliais. Para a sua abordagem inicial, deve-se ressaltar que os sintomas mais comumentes encontrados são o zumbido pulsátil e hipoacusia. A investigação através de imagem (tomografia computadorizada e ressonância magnética se faz necessária. Apresentaremos neste trabalho 5 pacientes portadores de paragangliomas timpânicos atendidos no Hospital (de 1995 a 2001. O sexo predominante foi o feminino, a idade variou de 48 a 60 anos, com média de 50 anos. A queixa predominante foi o zumbido pulsátil e a hipoacusia. A conduta foi cirúrgica em todos os casos.Glomus tumors, also called paragangliomas, originate from nonchromaffin cells. The tumor is typically vascular and grows from capillary and pre-capillary vessels in-between epithelial cells. It is worth mentioning that the most common symptoms are pulsating tinnitus and hearing loss. Imaging studies (CT and MRI are necessary for diagnosis. This paper shows five patients seen at the Hospital between 1995 and 2001 presenting glomus tympanicum. Women were most commonly affected, and the age ranged from 48 to 60 years (mean age of 50 years. The most common complaints were pulsating tinnitus and hearing loss. All patients were treated surgically.

RELACIÓN DE LA EXPRESIÓN DE mARN DE LAS METALOPROTEINASAS 2 Y 9 Y EL INHIBIDOR TIMP-1 EN MOLA HIDATIDIFORME COMPLETA

Directory of Open Access Journals (Sweden)

Martha Pinzón

2008-04-01

Full Text Available Durante el comienzo de la gestación el factor de crecimiento similar a la insulina tipo II (IGF-II se expresa abundantemente en la placenta y podría regular el comportamiento invasivo de las células trofoblásticas. La habilidad invasiva dependerá también de la capacidad de secretar metaloproteinasas (MMPs, cuya expresión anormal contribuye a varios procesos patológicos. En la Enfermedad Trofoblástica Gestacional (ETG estos factores podrían estar desregulados, así la mola hidatidiforme completa (MHC conduce a la formación del coriocarcinoma, que es un tumor invasivo y metastásico. El objetivo de este estudio fue investigar la relación entre los niveles de mARN de IGF-II, MMP-2, MMP-9 y TIMP-1, por la técnica de RT-PCR, en tejidos de mola hidatidiforme vs. placentas de primer trimestre. La actividad de las MMPs se evaluó usando el ensayo de zimografía, encontrando que en MHC ésta se incrementa, lo cual podría relacionar la malignización del trofoblasto con el incremento en su capacidad invasiva. La expresión elevada de IGF-II en esta patología, también podría estar asociada con el incremento en la actividad de estas MMPs. Una mayor relación entre la expresión de mARNde MMP-9/TIMP-1 en la mola hidatidiforme completa se sugiere como predictor de malignización del tejido trofoblástico.

TIMP-1 in combination with HER2 and TOP2A for prediction of benefit from adjuvant anthracyclines in high-risk breast cancer patients

DEFF Research Database (Denmark)

Hertel, Pernille Bræmer; Tu, Dongsheng; Ejlertsen, Bent Laursen

2012-01-01

HER2 amplification, TOP2A aberrations, and absence of tissue inhibitor of metalloproteinase (TIMP-1) expression in breast carcinomas have been shown to be associated with incremental benefit from anthracycline-containing adjuvant chemotherapy, and this study was undertaken to validate...... treatment interaction was detected for OS (P = 0.01). With this study, we validate a more substantial reduction in mortality by CEF compared to CMF in patients with an HT- or 2T-responsive profile; however, we could not show a similarly significant reduction in RFS events, where a benefit of CEF over CMF...

X-linked mental retardation with neonatal hypotonia in a French family (MRX15): Gene assignment to Xp11.22-Xp21.1

Energy Technology Data Exchange (ETDEWEB)

Raynaud, M.; Dessay, B.; Ayrault, A.D. [INSERM, Marseille (France)] [and others

1996-07-12

Linkage analysis was performed in a family with non-specific X-linked mental retardation (MRX 15). Hypotonia in infancy was the most remarkable physical manifestation. The severity of mental deficiency was variable among the patients, but all of them had poor or absent speech. Significant lod scores at a recombination fraction of zero were detected with the marker loci DXS1126, DXS255, and DXS573 (Zmax = 2.01) and recombination was observed with the two flanking loci DXS164 (Xp21.1) and DXS988 (Xp11.22), identifying a 17 cM interval. This result suggests a new gene localization in the proximal Xp region. In numerous families with non-specific X-linked mental retardation (MRX), the corresponding gene has been localized to the paracentromeric region in which a low recombination rate impairs the precision of mapping. 58 refs., 3 figs., 5 tabs.

The Karimojong from Uganda

DEFF Research Database (Denmark)

Gomes, Iva; Pereira, Vania; Gomes, Verónica

2009-01-01

The Karimojong, an African group from the Karamoja region of Northeast Uganda, were genetically analysed using a decaplex system for X chromosome short tandem repeats (X-STRs). A total of 255 individuals (117 males and 138 females) were genotyped for the following loci: DXS8378, DXS9898, DXS7133......, with gene diversities of 84.79% and 83.94%, respectively. The less discriminating locus observed was DXS7133, with a gene diversity of 39.79%. High overall values of power of discrimination were obtained for female (1 in 1.8 x 10(10)) and male samples (1 in 1.6 x 10(6)), as well as high power of exclusion...

The association of 5-HTR2A-1438A/G, COMTVal158Met, MAOA-LPR, DATVNTR and 5-HTTVNTR gene polymorphisms and antisocial personality disorder in male heroin-dependent Chinese subjects.

Science.gov (United States)

Yang, Mei; Kavi, Vasish; Wang, Wenfu; Wu, Zhimei; Hao, Wei

2012-03-30

To explore the association between the 5-HTR2A-1438A/G, COMTVal158Met, MAOA-LPR, DATVNTR and 5-HTTVNTR polymorphisms with comorbidity of antisocial personality disorder in male heroin-dependent patients. In case control study, we compared the polymorphic distributions of 5-HTR2A-1438A/G, COMTVal158Met, MAOA-LPR, DATVNTR and 5-HTTVNTR in 588 male heroin-dependent patients (including 311 patients with antisocial personality disorder and 277 patients without antisocial personality disorder) and 194 normal males by genotypes, alleles, and interaction between genes. Between male heroin-dependent patients with antisocial personality disorder and normal males, and between male heroin-dependent patients with and without antisocial personality disorder, the distributions of 5-HTTVNTR polymorphic genotypes and alleles were in statistical significance. Individuals carrying 10R allele were in higher risk of the comorbidity of antisocial personality disorder and heroin dependence. By MDR analyses, the interaction between 5-HTTVNTR and DATVNTR was close to statistical significance in predicting the risk of antisocial personality disorder in male heroin dependent patients. In male heroin dependent patients, individuals carrying 5-HTTVNTR 10R allele or/and DATVNTR 9R allele were in higher risks of co-occurring antisocial personality disorder, while individuals with 5-HTTVNTR 12R/12R and DATVNTR 10R/10R genotypes together were in lower risks of antisocial personality disorder. 5-HTTVNTR, and the interaction between 5-HTTVNTR and DATVNTR may be associated with the comorbidity of antisocial personality disorder in male heroin-dependent patients. Copyright © 2011 Elsevier Inc. All rights reserved.

Prerequisite for highly efficient isoprenoid production by cyanobacteria discovered through the over-expression of 1-deoxy-d-xylulose 5-phosphate synthase and carbon allocation analysis.

Science.gov (United States)

Kudoh, Kai; Kawano, Yusuke; Hotta, Shingo; Sekine, Midori; Watanabe, Takafumi; Ihara, Masaki

2014-07-01

Cyanobacteria have recently been receiving considerable attention owing to their potential as photosynthetic producers of biofuels and biomaterials. Here, we focused on the production of isoprenoids by cyanobacteria, and aimed to provide insight into metabolic engineering design. To this end, we examined the over-expression of a key enzyme in 2-C-methyl-d-erythritol 4-phosphate (MEP) pathway, 1-deoxy-d-xylulose 5-phosphate synthase (DXS) in the cyanobacterium Synechocystis sp. PCC6803. In the DXS-over-expression strain (Dxs_ox), the mRNA and protein levels of DXS were 4-times and 1.5-times the levels in the wild-type (WT) strain, respectively. The carotenoid content of the Dxs_ox strain (8.4 mg/g dry cell weight [DCW]) was also up to 1.5-times higher than that in the WT strain (5.6 mg/g DCW), whereas the glycogen content dramatically decreased to an undetectable level. These observations suggested that the carotenoid content in the Dxs_ox strain was increased by consuming glycogen, which is a C-storage compound in cyanobacteria. We also quantified the total sugar (145 and 104 mg/g DCW), total fatty acids (31 and 24 mg/g DCW) and total protein (200 and 240 mg/g DCW) content in the WT and Dxs_ox strains, respectively, which were much higher than the carotenoid content. In particular, approximately 54% of the proteins were phycobiliproteins. This study demonstrated the major destinations of carbon flux in cyanobacteria, and provided important insights into metabolic engineering. Target yield can be improved through optimization of gene expression, the DXS protein stabilization, cell propagation depression and restriction of storage compound synthesis. Copyright © 2013 The Society for Biotechnology, Japan. Published by Elsevier B.V. All rights reserved.

Evaluating TIMP-1, Ki67, and HER2 as markers for non-sentinel node metastases in breast cancer patients with micrometastases to the sentinel node

DEFF Research Database (Denmark)

Tvedskov, Tove Filtenborg; Bartels, Annette; Jensen, Maj-Britt

2011-01-01

The aim was to investigate whether the biochemical prognostic markers TIMP-1, Ki67, and HER2 could predict metastatic spread to non-sentinel nodes (NSN) in breast cancer patients with micrometastases to sentinel node (SN). We included all breast cancer patients with micrometastases to SN operated...... between 2001 and 2007 at the Department of Breast Surgery, Herlev Hospital. The study was designed as a matched case-control study with 25 cases with micrometastases to SN and, in addition, metastatic spread to NSN and 50 matched controls with micrometastases to SN, but without NSN metastases. Patient...

Fraxinus rhynchophylla ethanol extract attenuates carbon tetrachloride-induced liver fibrosis in rats via down-regulating the expressions of uPA, MMP-2, MMP-9 and TIMP-1.

Science.gov (United States)

Peng, Wen-Huang; Tien, Yun-Chen; Huang, Chih-Yang; Huang, Tai-Hung; Liao, Jung-Chun; Kuo, Chao-Lin; Lin, Ying-Chih

2010-02-17

To investigate the effect of Fraxinus rhynchophylla ethanol extract (FR(EtOH)) on liver fibrosis induced by carbon tetrachloride (CCl(4)) in rats. Rat hepatic fibrosis was induced by oral administration of CCl(4). Sixty SD rats were divided randomly into 6 groups: control, CCl(4) group, silymarin group and three FR(EtOH)-treated groups. Except for the rats in control group, all rats were administered orally with CCl(4) (20%, 0.2 mL/100g body weight) twice a week for 8 weeks. Rats in FR(EtOH) groups were treated daily with FR(EtOH) (0.1, 0.5 and 1.0 g/kg, p.o.) throughout the whole experimental period. Liver function parameters (such as activities of serum GOT and GPT levels), activities of liver anti-oxidant enzymes (such as catalase, SOD, GPx) and expressions of uPA, tPA, MMP-2, MMP-9 and TIMP-1, -2, -3, -4 in the liver fibrosis pathway were detected. The results showed that FR(EtOH) (0.1, 0.5 and 1.0 g/kg BW) significantly reduced the elevated activities of sGOT and sGPT caused by CCl(4). FR(EtOH) (0.1 and 0.5 g/kg BW) and significantly increased the activities of GSH-Px. The histopathological study showed that FR(EtOH) (0.1 and 0.5 g/kg BW) reduced the incidence of liver lesions, including hepatic cells cloudy swelling, lymphocytes infiltration, cytoplasm vacuolization hepatic necrosis and fibrous connective tissue proliferated induced by CCl(4) in rats. In our study it was showed that CCl(4)-treated group significantly increased the protein levels of uPA, MMP-2, MMP-9 and TIMP-1. FR(EtOH) (0.1 and 0.5 g/kg BW) could inhibit the protein levels of uPA, MMP-2, MMP-9 and TIMP-1. Finally, the amount of esculetin in the FR(EtOH) was 33.54 mg/g extract. Oral administration of FR(EtOH) significantly reduces CCl(4)-induced hepatic fibrosis in rats, probably by exerting a protective effect against hepatocellular fibrosis by its free radical scavenging ability. FR(EtOH) down-regulated the expressions of uPA, MMP-2 and MMP-9 in CCl(4)-induced liver fibrosis in rats

Prenatal exclusion of Norrie disease with flanking DNA markers.

Science.gov (United States)

Gal, A; Uhlhaas, S; Glaser, D; Grimm, T

1988-10-01

Three polymorphic DNA markers linked to the locus of Norrie disease were used for indirect genotype analysis in a ten-wk-old fetus at risk for the disease. When haplotypes of the family members and the estimated recombination frequency between Norrie gene and each of the DNA marker loci DXS7, DXS84, and DXS146 were taken into account, the risk that the fetus had inherited the mutation was about 1%.

ASSOCIATION STUDY OF 5-HTR2A-1438A/G,COMTVAL158MET,MAOA-LPR,DATVNTR AND 5-HTTVNTR POLYMORPHISMS WITH COOCCURRENCE HEROIN DEPENDENCE AND ANTISOCIAL PERSONALITY DISORDERS IN MALES%5-HTR2A-1438A/G、COMTVal158Met、MAOA-LPR、5-HTTVNTR 、DATVNTR与男性海洛因依赖共患反社会性人格障碍的关联研究*

Institute of Scientific and Technical Information of China (English)

杨梅; 郝伟; 邬志美; 王文甫; 周旭辉; 姜国清; 汤美云; 黄健

2010-01-01

目的:探讨5-HTR2A受体基因(5-hydroxytryptamine receptor 2A gene,5-HTR2A)-1438A/G多态性(5-HTR2A-1438A/G,rs6311)、儿茶酚-O-甲基转移酶基因(catechol-O-methyltransferase gene,COMT)Val158Met多态性(COMTVal158Met,rs4680)、单胺氧化酶A基因(monoamine oxidase A gene,MAOA)启动子区可变数目串联重复序列(variable number of tandem repeats,VNTR) 多态性(称为MAOA多型变异区段,MAOA-linked polymorphic region,MAOA-LPR))、多巴胺转运体基因(dopamine transporter gene,DAT)外显子15靠近3′端的可变数目串联重复序列多态性(DATVNTR)、5-HT转运体基因(5-hydroxytryptamine transporter gene,5-HTT)内含子2内可变数目串联重复序列多态性(5-HTTVNTR)及以上各位点之间的交互作用与男性海洛因依赖共患反社会性人格障碍有无关联.方法:采用病历对照关联分析,应用聚合酶链式反应和连接酶检测反应(polymerase chain reaction-ligase detection reaction,PCR-LDR)技术检测588例男性海洛因依赖者(其中共患反社会性人格障碍者311例,不共患反社会性人格障碍者277例)和194例健康男性5-HTR2A-1438A/G、COMTVal158Met、MAOA-LPR、DATVNTR、5-HTTVNTR多态性的基因型,对各位点的基因型频率、等位基因频率及各位点之间的交互作用进行疾病关联分析.结果:共患反社会性人格障碍的男性海洛因依赖者与健康男性间,共患与不共患反社会性人格障碍的男性海洛因依赖者间在5-HTTVNTR的基因型和等位基因频率上均有统计学差异,携带10次重复序列(10-repeats,10R)等位基因的个体共患海洛因依赖和反社会性人格障碍风险相对较大.经MDR分析,在男性海洛因依赖者中,HTTVNTR与DATVNTR的二因模型子对反社会性人格障碍的预测准确度最大,符号检验有统计学差异,校正后P值为0.067,接近显著性差异.携带5-HTTVNTR等位基因10R和/或携带DATVNTR等位基因9R的个体共患反社会性人格�

Development of novel (1-H benzimidazole bearing pyrimidine-trione based MAO-A inhibitors: Synthesis, docking studies and antidepressant activity

Directory of Open Access Journals (Sweden)

Bijo Mathew

2016-09-01

Full Text Available The synthesis of some novel (1-H benzimidazole bearing pyrimidine-trione based MAO-A inhibitors were achieved by the reaction between 2E-1-(1H-benzimidazol-2-yl-3-phenylprop-2-en-1-ones(4a–f and barbituric acid in the presence of a catalytic amount of acetic acid medium. All the final structures were assigned on the basis of IR, 1HNMR and mass spectra analyses. All the synthesized derivatives showed good antidepressant activity when compared to the standard clomipiramine at a dose level of 20 mg/kg. The compound (5d 5-{(2E-1-(1H-benzimidazol-2-yl-3-[4-(dimethylaminophenyl] prop-2-en-1-ylidene} pyrimidine-2, 4, 6(1H,3H,5H-trione significantly reduced the duration of immobility times at 50 mg/kg−1 dose level when compared to the standard drug. Molecular docking studies revealed the need for an extra hydrophobic interaction in the titled scaffold for acquiring the promising experimental values. It has been concluded that the computational values obtained after the docking calculation are in good agreement with the experimental values.

Close linkage of the locus for X chromosome-linked severe combined immunodeficiency to polymorphic DNA markers in Xq11-q13

International Nuclear Information System (INIS)

de Saint Basile, G.; Arveiler, B.; Oberle, I.

1987-01-01

The gene for X chromosome-linked severe combined immunodeficiency (SCID), a disease characterized by a block in early T-cell differentiation, has been mapped to the region Xq11-q13 by linkage analysis with restriction fragment length polymorphisms. High logarithm of odds (lod) scores were obtained with the marker 19.2 (DXS3) and with the marker cpX73 (DXS159) that showed complete cosegregation with the disease locus in the informative families analyzed. Other significant linkages were obtained with several markers from Xq11 to q22. With the help of a recently developed genetic map of the region, it was possible to perform multipoint linkage analysis, and the most likely genetic order is DXS1-(SCID, DXS159)-DXYS1-DXYS12-DXS3, with a maximum multipoint logarithm of odds score of 11.0. The results demonstrate that the SCID locus (gene symbol IMD4) is not closely linked to the locus of Bruton's agammaglobulinemia (a defect in B-cell maturation). They also provide a way for a better estimation of risk for carrier and antenatal diagnosis

Functional effect of grapevine 1-deoxy-D-xylulose 5-phosphate synthase substitution K284N on Muscat flavour formation

Science.gov (United States)

Battilana, Juri; Emanuelli, Francesco; Gambino, Giorgio; Gribaudo, Ivana; Gasperi, Flavia; Boss, Paul K.; Grando, Maria Stella

2011-01-01

Grape berries of Muscat cultivars (Vitis vinifera L.) contain high levels of monoterpenols and exhibit a distinct aroma related to this composition of volatiles. A structural gene of the plastidial methyl-erythritol-phosphate (MEP) pathway, 1-deoxy-D-xylulose 5-phosphate synthase (VvDXS), was recently suggested as a candidate gene for this trait, having been co-localized with a major quantitative trait locus for linalool, nerol, and geraniol concentrations in berries. In addition, a structured association study discovered a putative causal single nucleotide polymorphism (SNP) responsible for the substitution of a lysine with an asparagine at position 284 of the VvDXS protein, and this SNP was significantly associated with Muscat-flavoured varieties. The significance of this nucleotide difference was investigated by comparing the monoterpene profiles with the expression of VvDXS alleles throughout berry development in Moscato Bianco, a cultivar heterozygous for the SNP mutation. Although correlation was detected between the VvDXS transcript profile and the accumulation of free monoterpenol odorants, the modulation of VvDXS expression during berry development appears to be independent of nucleotide variation in the coding sequence. In order to assess how the non-synonymous mutation may enhance Muscat flavour, an in vitro characterization of enzyme isoforms was performed followed by in vivo overexpression of each VvDXS allele in tobacco. The results showed that the amino acid non-neutral substitution influences the enzyme kinetics by increasing the catalytic efficiency and also dramatically affects monoterpene levels in transgenic lines. These findings confirm a functional effect of the VvDXS gene polymorphism and may pave the way for metabolic engineering of terpenoid contents in grapevine. PMID:21868399

Predictive role of HER2/neu, topoisomerase-II-alpha, and tissue inhibitor of metalloproteinases (TIMP-1) for response to adjuvant taxane-based chemotherapy in patients with intermediate-risk breast cancer: results from the WSG-AGO EC-Doc trial.

Science.gov (United States)

Erber, Ramona; Gluz, Oleg; Brünner, Nils; Kreipe, Hans Heinrich; Pelz, Enrico; Kates, Ronald; Bartels, Annette; Huober, Jens; Mohrmann, Svjetlana; Moustafa, Zehra; Liedtke, Cornelia; Möbus, Volker; Augustin, Doris; Thomssen, Christoph; Jänicke, Fritz; Kiechle, Marion; Kuhn, Walther; Nitz, Ulrike; Harbeck, Nadia; Hartmann, Arndt

2015-04-01

Taxane-anthracycline-based adjuvant chemotherapy is standard of care in patients with node-positive breast cancer (BC) but is also associated with severe side effects and significant costs. It is yet unclear, which biomarkers would predict benefit from taxanes and/or general chemoresistance. In this study, we investigate a large cohort of patients with intermediate-risk BC treated within the WSG EC-DOC Trial for the predictive impact of topoisomerase-II-alpha, HER2/neu, and TIMP-1. Tumor tissue was available in a representative cohort of 772 cases of the WSG EC-DOC Trial collective which compared 4xEC-4xDoc versus 6xCEF/CMF. In addition to hormone receptor status and Ki-67, HER2/neu+ and topoisomerase-II-alpha status using fluorescence in situ hybridisation (FISH) and immunohistochemistry, TIMP-1 using immunohistochemistry, and aneuploidy of chromosome 17 using FISH were evaluated and correlated with outcome and taxane benefit. There was significant superiority of EC-Doc over CEF regarding 5-year DFS (90 vs. 80 %, respectively, p = 0.006) particularly in patient subgroups defined by HR+, HER2/neu+, high proliferation (i.e., Ki-67 ≥ 20 %), patient age >50 years old and normal chromosome 17 status, high TIMP-1 and low topoisomerase-II-alpha protein expression. Significant prognostic factors in multivariate analysis were EC-Doc therapy (HR = 0.61; 95 %CI 0.38-0.986), age Doc vs. CEF) and high topoisomerase-II-alpha protein expression (HR = 0.427; 95 %CI 0.203-0.900) in multivariate interaction analysis. Despite of univariate predictive effect of HER2/neu status among other factors only topoisomerase-II-alpha protein expression was associated with significant benefit from EC-Doc compared to CEF by multivariate interaction analysis.

Analysis of 12 X-STR loci in the population of south Croatia.

Science.gov (United States)

Mršić, Gordan; Ozretić, Petar; Crnjac, Josip; Merkaš, Siniša; Račić, Ivana; Rožić, Sara; Sukser, Viktorija; Popović, Maja; Korolija, Marina

2017-02-01

The aim of the study was to assess forensic pertinence of 12 short tandem repeats (STRs) on X-chromosome in south Croatia population. Investigator ® Argus X-12 kit was used to co-amplify 12 STR loci belonging to four linkage groups (LGs) on X-chromosome in 99 male and 98 female DNA samples of unrelated donors. PCR products were analyzed by capillary electrophoresis. Population genetic and forensic parameters were calculated by the Arlequin and POPTREE2 software, and an on-line tool available at ChrX-STR.org. Hardy-Weinberg equilibrium was confirmed for all X-STR markers in female samples. Biallelic patterns at DXS10079 locus were detected in four male samples. Polymorphism information content for the most (DXS10135) and the least (DXS8378) informative markers was 0.9212 and 0.6347, respectively. In both male and female samples, combined power of discrimination exceeded 0.999999999. As confirmed by linkage disequilibrium test, significant association of marker pair DXS10074-DXS10079 (P = 0.0004) within LG2 and marker pair DXS10101-DXS10103 (P = 0.0003) within LG3 was found only in male samples. Number of observed haplotypes in our sample pool amounted 3.01, 7.53, 5 and 3.25% of the number of possible haplotypes for LG1, LG2, LG3 and LG4, respectively. According to haplotype diversity value of 0.9981, LG1 was the most informative. In comparison of south Croatia with 26 world populations, pair-wise [Formula: see text] values increase in parallel with geographical distance. Overall statistical assessment confirmed suitability of Investigator ® Argus X-12 kit for forensic casework in both identification and familial testing in the population of south Croatia.

TIMP-2 gene transfer by positively charged PEG-lated monosized polycationic carrier to smooth muscle cells

Energy Technology Data Exchange (ETDEWEB)

Lacin, Nelisa, E-mail: melisalacin@yahoo.com [Mersin University, Advanced Technology Education, Research and Application Center (Turkey); Utkan, Gueldem [TUBITAK MAM, Enzyme and Fermentation Technology Laboratory, Genetic Engineering and Biotechnology Institute (Turkey); Kutsal, Tuelin [Hacettepe University, Chemical Engineering Department and Bioengineering Division (Turkey); Dedeoglu, Bala Guer; Yulug, Is Latin-Small-Letter-Dotless-I k G. [Bilkent University, Department of Molecular Biology and Genetics, Faculty of Science (Turkey); Piskin, Erhan [Hacettepe University, Chemical Engineering Department and Bioengineering Division and Center for Bioengineering-Biyomedtek (Turkey)

2012-02-15

Remodeling of the extracellular matrix resulting from increased secretion of metalloproteinase enzymes is implicated in restenosis following balloon angioplasty. Matrix metalloproteinases (MMPs) and the tissue inhibitors of metalloproteinases play an essential role in both normal and pathological extracellular matrix degradation. Tissue inhibitor of matrix metalloproteinase-2 is the most extensively studied tissue inhibitor of metalloproteinases in myocardial tissue in animal models and clinical examples of cardiac disease; therefore it is selected for this study. Gene transfer of tissue inhibitor of matrix metalloproteinase-2 may have a therapeutic potential by inhibition of matrix metalloproteinase activity. We have used PEG-lated nanoparticles poly(St/PEG-EEM/DMAPM) which were synthesized previously in our laboratory. The nanoparticles, with an average size of 77.6 {+-} 2.05 nm with a zeta potential of +64. 4 {+-} 1.14 mV and 201.9 {+-} 1.83 nm with +54.2 {+-} 0.77 mV were used in the transfection studies. Zeta Potential values and size of polyplex were appropriate for an effective transfection. TIMP-2 expression was detected by western blotting. Increased protein level in smooth muscle cells according to non-transfected smooth muscle cells confirms the successful delivery and expression of the tissue inhibitor of matrix metalloproteinase-2 gene with the non-viral vector transfection approach.

TIMP-2 gene transfer by positively charged PEG-lated monosized polycationic carrier to smooth muscle cells

Science.gov (United States)

Laçin, Nelisa; Utkan, Güldem; Kutsal, Tülin; Dedeoğlu, Bala Gür; Yuluğ, Işık G.; Pişkin, Erhan

2012-02-01

Remodeling of the extracellular matrix resulting from increased secretion of metalloproteinase enzymes is implicated in restenosis following balloon angioplasty. Matrix metalloproteinases (MMPs) and the tissue inhibitors of metalloproteinases play an essential role in both normal and pathological extracellular matrix degradation. Tissue inhibitor of matrix metalloproteinase-2 is the most extensively studied tissue inhibitor of metalloproteinases in myocardial tissue in animal models and clinical examples of cardiac disease; therefore it is selected for this study. Gene transfer of tissue inhibitor of matrix metalloproteinase-2 may have a therapeutic potential by inhibition of matrix metalloproteinase activity. We have used PEG-lated nanoparticles poly(St/PEG-EEM/DMAPM) which were synthesized previously in our laboratory. The nanoparticles, with an average size of 77.6 ± 2.05 nm with a zeta potential of +64. 4 ± 1.14 mV and 201.9 ± 1.83 nm with +54.2 ± 0.77 mV were used in the transfection studies. Zeta Potential values and size of polyplex were appropriate for an effective transfection. TIMP-2 expression was detected by western blotting. Increased protein level in smooth muscle cells according to non-transfected smooth muscle cells confirms the successful delivery and expression of the tissue inhibitor of matrix metalloproteinase-2 gene with the non-viral vector transfection approach.

Genetic localisation of MRX27 to Xq24-26 defines another discrete gene for non-specific X-linked mental retardation

Energy Technology Data Exchange (ETDEWEB)

Gedeon, A.K.; Connor, J.M.; Mulley, J.C. [Univ. of Adelaide (Australia); Connor, J.M. [Duncan Guthrie Inst. of Medical Genetics, Yorkhill (United Kingdom); Glass, I.A. [Univ. of California, San Franciso, CA (United States)

1996-07-12

A large family with non-specific X-linked mental retardation (MRX) was first described in 1991, with a suggestion of linkage to Xq26-27. The maximum lod score was 1.60 ({theta} = 0.10) with the F9 locus. The localization of this MRX gene has now been established by linkage to microsatellite markers. Peak pairwise lod scores of 4.02 and 4.01 ({theta} = 0.00) were attained at the DXS1114 and DXS994 loci respectively. This MRX gene is now designated MRX27 and is localized to Xq24-26 by recombination events detected by DXS424 and DXS102. This regional localization spans 26.2 cM on the genetic background map and defines another distinct MRX interval by linkage to a specific region of the X chromosome. 25 refs., 1 fig., 1 tab.

DEM4-26, Least Square Fit for IBM PC by Deming Method

International Nuclear Information System (INIS)

Rinard, P.M.; Bosler, G.E.

1989-01-01

1 - Description of program or function: DEM4-26 is a generalized least square fitting program based on Deming's method. Functions built into the program for fitting include linear, quadratic, cubic, power, Howard's, exponential, and Gaussian; others can easily be added. The program has the following capabilities: (1) entry, editing, and saving of data; (2) fitting of any of the built-in functions or of a user-supplied function; (3) plotting the data and fitted function on the display screen, with error limits if requested, and with the option of copying the plot to the printer; (4) interpolation of x or y values from the fitted curve with error estimates based on error limits selected by the user; and (5) plotting the residuals between the y data values and the fitted curve, with the option copying the plot to the printer. 2 - Method of solution: Deming's method

Profile of MMP and TIMP Expression in Human Pancreatic Stellate Cells: Regulation by IL-1α and TGFβ and Implications for Migration of Pancreatic Cancer Cells

Directory of Open Access Journals (Sweden)

Vegard Tjomsland

2016-07-01

Full Text Available Pancreatic ductal adenocarcinoma is characterized by a prominent fibroinflammatory stroma with both tumor-promoting and tumor-suppressive functions. The pancreatic stellate cell (PSC is the major cellular stromal component and the main producer of extracellular matrix proteins, including collagens, which are degraded by metalloproteinases (MMPs. PSCs interact with cancer cells through various factors, including transforming growth factor (TGFβ and interleukin (IL-1α. The role of TGFβ in the dual nature of tumor stroma, i.e., protumorigenic or tumor suppressive, is not clear. We aimed to investigate the roles of TGFβ and IL-1α in the regulation of MMP profiles in PSCs and the subsequent effects on cancer cell migration. Human PSCs isolated from surgically resected specimens were cultured in the presence of pancreatic cancer cell lines, as well as IL-1α or TGFβ. MMP production and activities in PSCs were quantified by gene array transcripts, mRNA measurements, fluorescence resonance energy transfer–based activity assay, and zymography. PSC-conditioned media and pancreatic cancer cells were included in a collagen matrix cell migration model. We found that production of IL-1α by pancreatic cancer cells induced alterations in MMP and tissue inhibitors of matrix metalloproteinase (TIMP profiles and activities in PSCs, upregulated expression and activation of MMP1 and MMP3, and enhanced migration of pancreatic cancer cells in the collagen matrix model. TGFβ counteracted the effects of IL-1α on PSCs, reestablished PSC MMP and TIMP profiles and activities, and inhibited migration of cancer cells. This suggests that tumor TGFβ has a role as a suppressor of stromal promotion of tumor progression through alterations in PSC MMP profiles with subsequent inhibition of pancreatic cancer cell migration.

Contiguous deletion of the NDP, MAOA, MAOB, and EFHC2 genes in a patient with Norrie disease, severe psychomotor retardation and myoclonic epilepsy.

Science.gov (United States)

Rodriguez-Revenga, L; Madrigal, I; Alkhalidi, L S; Armengol, L; González, E; Badenas, C; Estivill, X; Milà, M

2007-05-01

Norrie disease (ND) is an X-linked disorder, inherited as a recessive trait that, therefore, mostly affects males. The gene responsible for ND, called NDP, maps to the short arm of chromosome X (Xp11.4-p11.3). We report here an atypical case of ND, consisting of a patient harboring a large submicroscopic deletion affecting not only the NDP gene but also the MAOA, MAOB, and EFHC2 genes. Microarray comparative genomic hybridization (CGH) analysis showed that 11 consecutive bacterial artificial chromosome (BAC) clones, mapping around the NDP gene, were deleted. These clones span a region of about 1 Mb on Xp11.3. The deletion was ascertained by fluorescent in situ hybridization (FISH) analysis with different BAC clones located within the region. Clinical features of the proband include bilateral retinal detachment, microcephaly, severe psychomotor retardation without verbal language skills acquired, and epilepsy. The identification and molecular characterization of this case reinforces the idea of a new contiguous gene syndrome that would explain the complex phenotype shared by atypical ND patients.

Monoamine Oxidase A in Antisocial Personality Disorder and Borderline Personality Disorder.

Science.gov (United States)

Kolla, Nathan J; Vinette, Sarah A

2017-01-01

Variation in the monoamine oxidase A (MAO-A) gene and MAO-A enzyme levels have been linked to antisocial behavior and aggression in clinical and non-clinical populations. Here, we provide an overview of the genetic, epigenetic, and neuroimaging research that has examined MAO-A structure and function in antisocial personality disorder (ASPD) and borderline personality disorder (BPD). The low-activity MAO-A variable nucleotide tandem repeat genetic polymorphism has shown a robust association with large samples of violent and seriously violent offenders, many of whom had ASPD. A recent positron emission tomography (PET) study of ASPD similarly revealed low MAO-A density in brain regions thought to contribute to the psychopathology of the condition. By contrast, PET has also demonstrated that brain MAO-A levels are increased in BPD and that they relate to symptoms of low mood and suicidality. Candidate gene studies have produced the most compelling evidence connecting MAO-A genetic variants to both ASPD and BPD. Still, conflicting results abound in the literature, making it highly unlikely that ASPD or BPD is related to a specific MAO-A genetic variant. Future research should strive to examine how MAO-A genotypes interact with broad-spectrum environmental influences to produce brain endophenotypes that may ultimately become tractable targets for novel treatment strategies.

Selective inhibition of monoamine oxidase A by purpurin, an anthraquinone.

Science.gov (United States)

Lee, Hyun Woo; Ryu, Hyung Won; Kang, Myung-Gyun; Park, Daeui; Oh, Sei-Ryang; Kim, Hoon

2017-03-01

Monoamine oxidase (MAO) catalyzes the oxidation of monoamines that act as neurotransmitters. During a target-based screening of natural products using two isoforms of recombinant human MAO-A and MAO-B, purpurin (an anthraquinone derivative) was found to potently and selectively inhibit MAO-A, with an IC 50 value of 2.50μM, and not to inhibit MAO-B. Alizarin (also an anthraquinone) inhibited MAO-A less potently with an IC 50 value of 30.1μM. Furthermore, purpurin was a reversible and competitive inhibitor of MAO-A with a K i value of 0.422μM. A comparison of their chemical structures suggested the 4-hydroxy group of purpurin might play an important role in its inhibition of MAO-A. Molecular docking simulation showed that the binding affinity of purpurin for MAO-A (-40.0kcal/mol) was higher than its affinity for MAO-B (-33.9kcal/mol), and that Ile 207 and Gly 443 of MAO-A were key residues for hydrogen bonding with purpurin. The findings of this study suggest purpurin is a potent, selective, reversible inhibitor of MAO-A, and that it be considered a new potential lead compound for development of novel reversible inhibitors of MAO-A (RIMAs). Copyright © 2017 Elsevier Ltd. All rights reserved.

Search for the Y via e(+)e(-) -> gamma phi J/psi at root s=4.23, 4.26 and 4.36 GeV

NARCIS (Netherlands)

Ablikim, M.; Achasov, M. N.; Ai, X. C.; Albayrak, O.; Albrecht, M.; Ambrose, D. J.; Amoroso, A.; An, F. F.; An, Q.; Bai, J. Z.; Ferroli, R. Baldini; Ban, Y.; Bennett, D. W.; Bennett, J. V.; Bertani, M.; Bettoni, D.; Bian, J. M.; Bianchi, F.; Boger, E.; Bondarenko, O.; Boyko, I.; Briere, R. A.; Cai, H.; Cai, X.; Cakir, O.; Calcaterra, A.; Cao, G. F.; Cetin, S. A.; Chang, J. F.; Chelkov, G.; Chen, G.; Chen, H. S.; Chen, H. Y.; Chen, J. C.; Chen, M. L.; Chen, S. J.; Chen, X.; Chen, X. R.; Chen, Y. B.; Cheng, H. P.; Chu, X. K.; Cibinetto, G.; Cronin-Hennessy, D.; Dai, H. L.; Dai, J. P.; Dbeyssi, A.; Dedovich, D.; Deng, Z. Y.; Denig, A.; Denysenko, I.; Destefanis, M.; De Mori, F.; Ding, Y.; Dong, C.; Dong, J.; Dong, L. Y.; Dong, M. Y.; Du, S. X.; Duan, P. F.; Fan, J. Z.; Fang, J.; Fang, S. S.; Fang, X.; Fang, Y.; Fava, L.; Feldbauer, F.; Felici, G.; Feng, C. Q.; Fioravanti, E.; Fritsch, M.; Fu, C. D.; Gao, Q.; Gao, Y.; Garzia, I.; Goetzen, K.; Gong, W. X.; Gradl, W.; Greco, M.; Gu, M. H.; Gu, Y. T.; Guan, Y. H.; Guo, A. Q.; Guo, L. B.; Guo, T.; Guo, Y.; Guo, Y. P.; Haddadi, Z.; Hafner, A.; Han, S.; Han, Y. L.; Harris, F. A.; He, K. L.; He, Z. Y.; Held, T.; Heng, Y. K.; Hou, Z. L.; Hu, C.; Hu, H. M.; Hu, J. F.; Hu, T.; Hu, Y.; Huang, G. M.; Huang, G. S.; Huang, H. P.; Huang, J. S.; Huang, X. T.; Huang, Y.; Hussain, T.; Ji, Q.; Ji, Q. P.; Ji, X. B.; Ji, X. L.; Jiang, L. L.; Jiang, L. W.; Jiang, X. S.; Jiao, J. B.; Jiao, Z.; Jin, D. P.; Jin, S.; Johansson, T.; Julin, A.; Kalantar-Nayestanaki, N.; Kang, X. L.; Kang, X. S.; Kavatsyuk, M.; Ke, B. C.; Kliemt, R.; Kloss, B.; Kolcu, O. B.; Kopf, B.; Kornicer, M.; Kuehn, W.; Kupsc, A.; Lai, W.; Lange, J. S.; Lara, M.; Larin, P.; Li, C. H.; Li, Cheng; Li, D. M.; Li, F.; Li, G.; Li, H. B.; Li, J. C.; Li, Jin; Li, K.; Li, K.; Li, P. R.; Li, T.; Li, W. D.; Li, W. G.; Li, X. L.; Li, X. M.; Li, X. N.; Li, X. Q.; Li, Z. B.; Liang, H.; Liang, Y. F.; Liang, Y. T.; Liao, G. R.; Lin, D. X.; Liu, B. J.; Liu, C. L.; Liu, C. X.; Liu, F. H.; Liu, Fang; Liu, Feng; Liu, H. B.; Liu, H. H.; Liu, H. H.; Liu, H. M.; Liu, J.; Liu, J. P.; Liu, J. Y.; Liu, K.; Liu, K. Y.; Liu, L. D.; Liu, P. L.; Liu, Q.; Liu, S. B.; Liu, X.; Liu, X. X.; Liu, Y. B.; Liu, Z. A.; Liu, Zhiqiang; Liu, Zhiqing; Loehner, H.; Lou, X. C.; Lu, H. J.; Lu, J. G.; Lu, R. Q.; Lu, Y.; Lu, Y. P.; Luo, C. L.; Luo, M. X.; Luo, T.; Luo, X. L.; Lv, M.; Lyu, X. R.; Ma, F. C.; Ma, H. L.; Ma, L. L.; Ma, Q. M.; Ma, S.; Ma, T.; Ma, X. N.; Ma, X. Y.; Maas, F. E.; Maggiora, M.; Malik, Q. A.; Mao, Y. J.; Mao, Z. P.; Marcello, S.; Messchendorp, J. G.; Min, J.; Min, T. J.; Mitchell, R. E.; Mo, X. H.; Mo, Y. J.; Morales, C. Morales; Moriya, K.; Muchnoi, N. Yu.; Muramatsu, H.; Nefedov, Y.; Nerling, F.; Nikolaev, I. B.; Ning, Z.; Nisar, S.; Niu, S. L.; Niu, X. Y.; Olsen, S. L.; Ouyang, Q.; Pacetti, S.; Patteri, P.; Pelizaeus, M.; Peng, H. P.; Peters, K.; Ping, J. L.; Ping, R. G.; Poling, R.; Pu, Y. N.; Qi, M.; Qian, S.; Qiao, C. F.; Qin, L. Q.; Qin, N.; Qin, X. S.; Qin, Y.; Qin, Z. H.; Qiu, J. F.; Rashid, K. H.; Redmer, C. F.; Ren, H. L.; Ripka, M.; Rong, G.; Ruan, X. D.; Santoro, V.; Sarantsev, A.; Savrie, M.; Schoenning, K.; Schumann, S.; Shan, W.; Shao, M.; Shen, C. P.; Shen, P. X.; Shen, X. Y.; Sheng, H. Y.; Shepherd, M. R.; Song, W. M.; Song, X. Y.; Sosio, S.; Spataro, S.; Spruck, B.; Sun, G. X.; Sun, J. F.; Sun, S. S.; Sun, Y. J.; Sun, Y. Z.; Sun, Z. J.; Sun, Z. T.; Tang, C. J.; Tang, X.; Tapan, I.; Thorndike, E. H.; Tiemens, M.; Toth, D.; Ullrich, M.; Uman, I.; Varner, G. S.; Wang, B.; Wang, B. L.; Wang, D.; Wang, D. Y.; Wang, K.; Wang, L. L.; Wang, L. S.; Wang, M.; Wang, P.; Wang, P. L.; Wang, Q. J.; Wang, S. G.; Wang, W.; Wang, X. F.; Wang, Y. D.; Wang, Y. F.; Wang, Y. Q.; Wang, Z.; Wang, Z. G.; Wang, Z. H.; Wang, Z. Y.; Weber, T.; Wei, D. H.; Wei, J. B.; Weidenkaff, P.; Wen, S. P.; Wiedner, U.; Wolke, M.; Wu, L. H.; Wu, Z.; Xia, L. G.; Xia, Y.; Xiao, D.; Xiao, Z. J.; Xie, Y. G.; Xu, G. F.; Xu, L.; Xu, Q. J.; Xu, Q. N.; Xu, X. P.; Yan, L.; Yan, W. B.; Yan, W. C.; Yan, Y. H.; Yang, H. X.; Yang, L.; Yang, Y.; Yang, Y. X.; Ye, H.; Ye, M.; Ye, M. H.; Yin, J. H.; Yu, B. X.; Yu, C. X.; Yu, H. W.; Yu, J. S.; Yuan, C. Z.; Yuan, W. L.; Yuan, Y.; Yuncu, A.; Zafar, A. A.; Zallo, A.; Zeng, Y.; Zhang, B. X.; Zhang, B. Y.; Zhang, C.; Zhang, C. C.; Zhang, D. H.; Zhang, H. H.; Zhang, H. Y.; Zhang, J. J.; Zhang, J. L.; Zhang, J. Q.; Zhang, J. W.; Zhang, J. Y.; Zhang, J. Z.; Zhang, K.; Zhang, L.; Zhang, S. H.; Zhang, X. J.; Zhang, X. Y.; Zhang, Y.; Zhang, Y. H.; Zhang, Z. H.; Zhang, Z. P.; Zhang, Z. Y.; Zhao, G.; Zhao, J. W.; Zhao, J. Y.; Zhao, J. Z.; Zhao, Lei; Zhao, Ling; Zhao, M. G.; Zhao, Q.; Zhao, Q. W.; Zhao, S. J.; Zhao, T. C.; Zhao, Y. B.; Zhao, Z. G.; Zhemchugov, A.; Zheng, B.; Zheng, J. P.; Zheng, W. J.; Zheng, Y. H.; Zhong, B.; Zhou, L.; Zhou, Li; Zhou, X.; Zhou, X. K.; Zhou, X. R.; Zhou, X. Y.; Zhu, K.; Zhu, K. J.; Zhu, S.; Zhu, X. L.; Zhu, Y. C.; Zhu, Y. S.; Zhu, Z. A.; Zhuang, J.; Zou, B. S.; Zou, J. H.

2015-01-01

Using data samples collected at center-of-mass energies root s = 4.23, 4.26, and 4.36 GeV with the BESIII detector operating at the BEPCII storage ring, we search for the production of the charmoniumlike state Y(4140) through a radiative transition followed by its decay to phi J/psi. No significant

Lower Monoamine Oxidase-A Total Distribution Volume in Impulsive and Violent Male Offenders with Antisocial Personality Disorder and High Psychopathic Traits: An [(11)C] Harmine Positron Emission Tomography Study.

Science.gov (United States)

Kolla, Nathan J; Matthews, Brittany; Wilson, Alan A; Houle, Sylvain; Bagby, R Michael; Links, Paul; Simpson, Alexander I; Hussain, Amina; Meyer, Jeffrey H

2015-10-01

Antisocial personality disorder (ASPD) often presents with highly impulsive, violent behavior, and pathological changes in the orbitofrontal cortex (OFC) and ventral striatum (VS) are implicated. Several compelling reasons support a relationship between low monoamine oxidase-A (MAO-A), an enzyme that regulates neurotransmitters, and ASPD. These include MAO-A knockout models in rodents evidencing impulsive aggression and positron emission tomography (PET) studies of healthy subjects reporting associations between low brain MAO-A levels and greater impulsivity or aggression. However, a fundamental gap in the literature is that it is unknown whether brain MAO-A levels are low in more severe, clinical disorders of impulsivity, such as ASPD. To address this issue, we applied [(11)C] harmine PET to measure MAO-A total distribution volume (MAO-A VT), an index of MAO-A density, in 18 male ASPD participants and 18 age- and sex-matched controls. OFC and VS MAO-A VT were lower in ASPD compared with controls (multivariate analysis of variance (MANOVA): F2,33=6.8, P=0.003; OFC and VS MAO-A VT each lower by 19%). Similar effects were observed in other brain regions: prefrontal cortex, anterior cingulate cortex, dorsal putamen, thalamus, hippocampus, and midbrain (MANOVA: F7,28=2.7, P=0.029). In ASPD, VS MAO-A VT was consistently negatively correlated with self-report and behavioral measures of impulsivity (r=-0.50 to -0.52, all P-valuesdisorder marked by pathological aggression and impulsivity.

Comparison between tympanic and anal temperature with a clinical infrared ray thermometer in dogs Comparação entre a temperatura timpânica e a temperatura anal usando um termômetro clínico de raio infravermelho em cães

Directory of Open Access Journals (Sweden)

G.G.S. Wiedemann

2006-08-01

Full Text Available A clinical thermometer of infrared rays was used twice to record consecutively the temperature of the tympanic membrane in each ear and in the anus of 53 dogs. Temperatures did not differ significantly between organs, and were strongly correlated. The anal temperature measurement with an infrared thermometer in dogs is feasible and trustworthy, as well as the thermal checking of tympanic temperature.Utilizou-se um termômetro clínico de emissão de raios infravermelhos para medir, duas vezes consecutivas, a temperatura da membrana timpânica de cada ouvido e duas vezes a temperatura no ânus de 53 cães. Não houve diferença entre as temperaturas quanto ao órgão estudado e a correlação entre as temperaturas foi alta. Em cães, a medida da temperatura anal com o termômetro clínico de emissão de raios infravermelhos é rápida e confiável tanto quanto a da temperatura timpânica.

The importance of KRAS mutations and EGF61A>G polymorphism to the effect of cetuximab and irinotecan in metastatic colorectal cancer

DEFF Research Database (Denmark)

Spindler, Karen-Lise Garm; Pallisgaard, N; Rasmussen, Anders Aamann

2009-01-01

-line cetuximab-irinotecan. Blood samples were analysed for SNPs. KRAS analysis was carried out by sequencing analysis and quantitative PCR (DxS kit) in primary tumour and distant metastases. RESULTS: There was a clear correlation between KRAS status in primary tumours and metastasis. The DxS kit presented...

Construction of a YAC contig and STS map spanning 2.5 Mbp in Xq25, the critical region for the X-linked lymphoproliferative (XLP) gene

Energy Technology Data Exchange (ETDEWEB)

Lanyi, A.; Li, B.F.; Li, S. [Univ. of Nebraska Medical Center, Omaha, NE (United States)] [and others

1994-09-01

X-linked lymphoproliferative disease (XLP) is characterized by a marked vulnerability in Epstein-Barr virus (EBV) infection. Infection of XLP patients with EBV invariably results in fatal mononucleosis, agammaglobulinemia or B-cell lymphoma. The XLP gene lies within a 10 cM region in Xq25 between DXS42 and DXS10. Initial chromosome studies revealed an interstitial, cytogenetically visible deletion in Xq25 in one XLP family (43-004). We estimated the size of the Xq25 deletion by dual laser flow karyotyping to involve 2% of the X chromosome, or approximately 3 Mbp of DNA sequences. To further delineate the deletion we performed a series of pulsed field gel electrophoresis (PFGE) analyses which showed that DXS6 and DXS100, two Xq25-specific markers, are missing from 45-004 DNA. Five yeast artificial chromosomes (YACs) from a chromosome X specific YAC library containing sequences deleted in patient`s 43-004 DNA were isolated. These five YACs did not overlap, and their end fragments were used to screen the CEPH MegaYAC library. Seven YACs were isolated from the CEPH MegaYAC library. They could be arranged into a contig which spans between DXS6 and DXS100. The contig contains a minimum of 2.5 Mbp of human DNA. A total of 12 YAC end clone, lambda subclones and STS probes have been used to order clones within the contig. These reagents were also used in Southern blot and patients showed interstitial deletions in Xq25. The size of these deletions range between 0.5 and 2.5 Mbp. The shortest deletion probably represents the critical region for the XLP gene.

Monoamine oxidase A gene promoter methylation and transcriptional downregulation in an offender population with antisocial personality disorder.

Science.gov (United States)

Checknita, D; Maussion, G; Labonté, B; Comai, S; Tremblay, R E; Vitaro, F; Turecki, N; Bertazzo, A; Gobbi, G; Côté, G; Turecki, G

2015-03-01

Antisocial personality disorder (ASPD) is characterised by elevated impulsive aggression and increased risk for criminal behaviour and incarceration. Deficient activity of the monoamine oxidase A (MAOA) gene is suggested to contribute to serotonergic system dysregulation strongly associated with impulsive aggression and antisocial criminality. To elucidate the role of epigenetic processes in altered MAOA expression and serotonin regulation in a population of incarcerated offenders with ASPD compared with a healthy non-incarcerated control population. Participants were 86 incarcerated participants with ASPD and 73 healthy controls. MAOA promoter methylation was compared between case and control groups. We explored the functional impact of MAOA promoter methylation on gene expression in vitro and blood 5-HT levels in a subset of the case group. Results suggest that MAOA promoter hypermethylation is associated with ASPD and may contribute to downregulation of MAOA gene expression, as indicated by functional assays in vitro, and regression analysis with whole-blood serotonin levels in offenders with ASPD. These results are consistent with prior literature suggesting MAOA and serotonergic dysregulation in antisocial populations. Our results offer the first evidence suggesting epigenetic mechanisms may contribute to MAOA dysregulation in antisocial offenders. Royal College of Psychiatrists.

Comments from the Developmental Neurotoxicology Committee of the Japanese Teratology Society on the OECD Guideline for the Testing of Chemicals, Proposal for a New Guideline 426, Developmental Neurotoxicity Study, Draft Document (October 2006 version), and on the Draft Document of the Retrospective Performance Assessment of the Draft Test Guideline 426 on Developmental Neurotoxicity.

Science.gov (United States)

Ema, Makoto; Fukui, Yoshihiro; Aoyama, Hiroaki; Fujiwara, Michio; Fuji, Junichiro; Inouye, Minoru; Iwase, Takayuki; Kihara, Takahide; Oi, Akihide; Otani, Hiroki; Shinomiya, Mitsuhiro; Sugioka, Kozo; Yamano, Tsunekazu; Yamashita, Keisuke H; Tanimura, Takashi

2007-06-01

In October 2006, a new revision of the draft guideline (OECD Guideline for the Testing of Chemicals, Proposal for a New Guideline 426. Developmental Neurotoxicity Study) and Draft Document of the Retrospective Performance Assessment (RPA) of the Draft Test Guideline 426 on Developmental Neurotoxicity were distributed following incorporation of the results of the Expert Consultation Meeting in Tokyo on May 24-26, 2005. The draft guideline consists of 50 paragraphs and an appendix with 102 references; and the draft RPA consists of 37 paragraphs with 109 references. National coordinators were requested to arrange for national expert reviews of these draft documents in their member countries. Members of the Developmental Neurotoxicology (DNT) Committee of the Japanese Teratology Society (JTS) reviewed, discussed, and commented on the draft Test Guideline Proposal. The DNT Committee of the JTS also commented on the draft document of the RPA. These comments were sent to the OECD Secretariat. The DNT Committee of the JTS expects the comments to be useful for the finalization of these draft documents.

Elevated Monoamine Oxidase-A Distribution Volume in Borderline Personality Disorder Is Associated With Severity Across Mood Symptoms, Suicidality, and Cognition

Science.gov (United States)

Kolla, Nathan J.; Chiuccariello, Lina; Wilson, Alan A.; Houle, Sylvain; Links, Paul; Bagby, R. Michael; McMain, Shelley; Kellow, Charis; Patel, Jalpa; Rekkas, Paraskevi V.; Pasricha, Suvercha; Meyer, Jeffrey H.

2016-01-01

BACKGROUND Monoamine oxidase-A (MAO-A) is a treatment target in neurodegenerative illness and mood disorders that increases oxidative stress and predisposition toward apoptosis. Increased MAO-A levels in prefrontal cortex (PFC) and anterior cingulate cortex (ACC) occur in rodent models of depressive behavior and human studies of depressed moods. Extreme dysphoria is common in borderline personality disorder (BPD), especially when severe, and the molecular underpinnings of severe BPD are largely unknown. We hypothesized that MAO-A levels in PFC and ACC would be highest in severe BPD and would correlate with symptom magnitude. METHODS [11C] Harmine positron emission tomography measured MAO-A total distribution volume (MAO-A VT), an index of MAO-A density, in severe BPD subjects (n = 14), moderate BPD subjects (n = 14), subjects with a major depressive episode (MDE) only (n = 14), and healthy control subjects (n = 14). All subjects were female. RESULTS Severe BPD was associated with greater PFC and ACC MAO-A VT compared with moderate BPD, MDE, and healthy control subjects (multivariate analysis of variance group effect: F6,102 = 5.6, p MAO-A VT were positively correlated with mood symptoms (PFC: r = .52, p = .005; ACC: r = .53, p = .004) and suicidality (PFC: r = .40, p = .037; ACC: r = .38, p = .046), while hippocampus MAO-A VT was negatively correlated with verbal memory (r = −.44, p = .023). CONCLUSIONS These results suggest that elevated MAO-A VT is associated with multiple indicators of BPD severity, including BPD symptomatology, mood symptoms, suicidality, and neurocognitive impairment. PMID:25698585

Monoamine oxidase A gene polymorphisms and enzyme activity associated with risk of gout in Taiwan aborigines.

Science.gov (United States)

Tu, Hung-Pin; Ko, Albert Min-Shan; Wang, Shu-Jung; Lee, Chien-Hung; Lea, Rod A; Chiang, Shang-Lun; Chiang, Hung-Che; Wang, Tsu-Nai; Huang, Meng-Chuan; Ou, Tsan-Teng; Lin, Gau-Tyan; Ko, Ying-Chin

2010-02-01

Taiwanese aborigines have a high prevalence of hyperuricemia and gout. Uric acid levels and urate excretion have correlated with dopamine-induced glomerular filtration response. MAOs represent one of the major renal dopamine metabolic pathways. We aimed to identify the monoamine oxidase A (MAOA, Xp11.3) gene variants and MAO-A enzyme activity associated with gout risk. This study was to investigate the association between gout and the MAOA single-nucleotide polymorphisms (SNPs) rs5953210, rs2283725, and rs1137070 as well as between gout and the COMT SNPs rs4680 Val158Met for 374 gout cases and 604 controls. MAO-A activity was also measured. All three MAOA SNPs were significantly associated with gout. A synonymous MAOA SNP, rs1137070 Asp470Asp, located in exon 14, was associated with the risk of having gout (P = 4.0 x 10(-5), adjusted odds ratio 1.46, 95% confidence intervals [CI]: 1.11-1.91). We also showed that, when compared to individuals with the MAOA GAT haplotype, carriers of the AGC haplotype had a 1.67-fold (95% CI: 1.28-2.17) higher risk of gout. Moreover, we found that MAOA enzyme activity correlated positively with hyperuricemia and gout (P for trend = 2.00 x 10(-3) vs. normal control). We also found that MAOA enzyme activity by rs1137070 allele was associated with hyperuricemia and gout (P for trend = 1.53 x 10(-6) vs. wild-type allele). Thus, our results show that some MAOA alleles, which have a higher enzyme activity, predispose to the development of gout.

Sensitive and Selective Ratiometric Fluorescence Probes for Detection of Intracellular Endogenous Monoamine Oxidase A.

Science.gov (United States)

Wu, Xiaofeng; Li, Lihong; Shi, Wen; Gong, Qiuyu; Li, Xiaohua; Ma, Huimin

2016-01-19

Monoamine oxidase A (MAO-A) is known to widely exist in most cell lines in the body, and its dysfunction (unusually high or low levels of MAO-A) is thought to be responsible for several psychiatric and neurological disorders. Thus, a sensitive and selective method for evaluating the relative MAO-A levels in different live cells is urgently needed to better understand the function of MAO-A, but to our knowledge such a method is still lacking. Herein, we rationally design two new ratiometric fluorescence probes (1 and 2) that can sensitively and selectively detect MAO-A. The probes are constructed by incorporating a recognition group of propylamine into the fluorescent skeleton of 1,8-naphthalimide, and the detection mechanism is based on amine oxidation and β-elimination to release the fluorophore (4-hydroxy-N-butyl-1,8-naphthalimide), which is verified by HPLC analysis. Reaction of the probes with MAO-A produces a remarkable fluorescence change from blue to green, and the ratio of fluorescence intensity at 550 and 454 nm is directly proportional to the concentration of MAO-A in the ranges of 0.5-1.5 and 0.5-2.5 μg/mL with detection limits of 1.1 and 10 ng/mL (k = 3) for probes 1 and 2, respectively. Surprisingly, these probes show strong fluorescence responses to MAO-A but almost none to MAO-B (one of two isoforms of MAO), indicating superior ability to distinguish MAO-A from MAO-B. The high specificity of the probes for MAO-A over MAO-B is further supported by different inhibitor experiments. Moreover, probe 1 displays higher sensitivity than probe 2 and is thus investigated to image the relative MAO-A levels in different live cells, such as HeLa and NIH-3T3 cells. It is found that the concentration of endogenous MAO-A in HeLa cells is approximately 1.8 times higher than that in NIH-3T3 cells, which is validated by the result from an ELISA kit. Additionally, the proposed probes may find more uses in the specific detection of MAO-A between the two isoforms of MAO

A recombination outside the BB deletion refines the location of the X-linked retinitis pigmentosa locus RP3

Energy Technology Data Exchange (ETDEWEB)

Fujita, R.; Bingham, E.; Forsythe, P.; McHenry, C. [Univ. of Michigan, Ann Arbor, MI (United States)] [and others

1996-07-01

Genetic loci for X-linked retinitis pigmentosa (XLRP) have been mapped between Xp11.22 and Xp22.13 (RP2, RP3, RP6, and RP15). The RP3 gene, which is responsible for the predominant form of XLRP in most Caucasian populations, has been localized to Xp21.1 by linkage analysis and the map positions of chromosomal deletions associated with the disease. Previous linkage studies have suggested that RP3 is flanked by the markers DXS1110 (distal) and OTC (proximal). Patient BB was though to have RP because of a lesion at the RP3 locus, in addition to chronic granulomatous disease, Duchenne muscular dystrophy (DMD), mild mental retardation, and the McLeod phenotype. This patient carried a deletion extending {approximately}3 Mb from DMD in Xp21.3 to Xp21.1, with the proximal breakpoint located {approximately}40 kb centromeric to DXS1110. The RP3 gene, therefore, is believed to reside between DXS1110 and the proximal breakpoint of the BB deletion. In order to refine the location of RP3 and to ascertain patients with RP3, we have been analyzing several XLRP families for linkage to Xp markers. Linkage analysis in an American family of 27 individuals demonstrates segregation of XLRP with markers in Xp21.1, consistent with the RP3 subtype. One affected male shows a recombination event proximal to DXS1110. Additional markers within the DXS1110-OTC interval show that the crossover is between two novel polymorphic markers, DXS8349 and M6, both of which are present in BB DNA and lie centromeric to the proximal breakpoint. This recombination places the XLRP mutation in this family outside the BB deletion and redefines the location of RP3. 22 refs., 3 figs., 2 tabs.

Multipoint linkage analysis in X-linked ocular albinism of the Nettleship-Falls type

NARCIS (Netherlands)

Bergen, A. A.; Samanns, C.; Schuurman, E. J.; van Osch, L.; van Dorp, D. B.; Pinckers, A. J.; Bakker, E.; Gal, A.; van Ommen, G. J.; Bleeker-Wagemakers, E. M.

1991-01-01

An extensive linkage analysis was performed by studying ten Xp22 loci in ten families segregating for X-linked ocular albinism of the Nettleship-Falls type (XOA). Linkage was confirmed between the XOA locus (OA1) and both DXS16 (theta max = 0.10, zeta max = 4.09) and DXS237 (theta max = 0.12, zeta

Elevated Monoamine Oxidase-A Distribution Volume in Borderline Personality Disorder Is Associated With Severity Across Mood Symptoms, Suicidality, and Cognition.

Science.gov (United States)

Kolla, Nathan J; Chiuccariello, Lina; Wilson, Alan A; Houle, Sylvain; Links, Paul; Bagby, R Michael; McMain, Shelley; Kellow, Charis; Patel, Jalpa; Rekkas, Paraskevi V; Pasricha, Suvercha; Meyer, Jeffrey H

2016-01-15

Monoamine oxidase-A (MAO-A) is a treatment target in neurodegenerative illness and mood disorders that increases oxidative stress and predisposition toward apoptosis. Increased MAO-A levels in prefrontal cortex (PFC) and anterior cingulate cortex (ACC) occur in rodent models of depressive behavior and human studies of depressed moods. Extreme dysphoria is common in borderline personality disorder (BPD), especially when severe, and the molecular underpinnings of severe BPD are largely unknown. We hypothesized that MAO-A levels in PFC and ACC would be highest in severe BPD and would correlate with symptom magnitude. [(11)C] Harmine positron emission tomography measured MAO-A total distribution volume (MAO-A VT), an index of MAO-A density, in severe BPD subjects (n = 14), moderate BPD subjects (n = 14), subjects with a major depressive episode (MDE) only (n = 14), and healthy control subjects (n = 14). All subjects were female. Severe BPD was associated with greater PFC and ACC MAO-A VT compared with moderate BPD, MDE, and healthy control subjects (multivariate analysis of variance group effect: F6,102 = 5.6, p mood symptoms (PFC: r = .52, p = .005; ACC: r = .53, p = .004) and suicidality (PFC: r = .40, p = .037; ACC: r = .38, p = .046), while hippocampus MAO-A VT was negatively correlated with verbal memory (r = -.44, p = .023). These results suggest that elevated MAO-A VT is associated with multiple indicators of BPD severity, including BPD symptomatology, mood symptoms, suicidality, and neurocognitive impairment. Copyright © 2016 Society of Biological Psychiatry. Published by Elsevier Inc. All rights reserved.

Maintenance of the Extracellular Matrix in Rat Anterior Pituitary Gland: Identification of Cells Expressing Tissue Inhibitors of Metalloproteinases.

Science.gov (United States)

Azuma, Morio; Tofrizal, Alimuddin; Maliza, Rita; Batchuluun, Khongorzul; Ramadhani, Dini; Syaidah, Rahimi; Tsukada, Takehiro; Fujiwara, Ken; Kikuchi, Motoshi; Horiguchi, Kotaro; Yashiro, Takashi

2015-12-25

The extracellular matrix (ECM) is important in creating cellular environments in tissues. Recent studies have demonstrated that ECM components are localized in anterior pituitary cells and affect cell activity. Thus, clarifying the mechanism responsible for ECM maintenance would improve understanding of gland function. Tissue inhibitors of metalloproteinases (TIMPs) are endogenous inhibitors of matrix metalloproteinases and participate in ECM degradation. In this study, we investigated whether cells expressing TIMPs are present in rat anterior pituitary gland. Reverse transcription polymerase chain reaction was used to analyze expression of the TIMP family (TIMP1-4), and cells producing TIMPs in the gland were identified by using in situ hybridization. Expression of TIMP1, TIMP2, and TIMP3 mRNAs was detected, and the TIMP-expressing cells were located in the gland. The TIMP-expressing cells were also investigated by means of double-staining with in situ hybridization and immunohistochemical techniques. Double-staining revealed that TIMP1 mRNA was expressed in folliculostellate cells. TIMP2 mRNA was detected in folliculostellate cells, prolactin cells, and thyroid-stimulating hormone cells. TIMP3 mRNA was identified in endothelial cells, pericytes, novel desmin-immunopositive perivascular cells, and folliculostellate cells. These findings indicate that TIMP1-, TIMP2-, and TIMP3-expressing cells are present in rat anterior pituitary gland and that they are involved in maintaining ECM components.

Maintenance of the Extracellular Matrix in Rat Anterior Pituitary Gland: Identification of Cells Expressing Tissue Inhibitors of Metalloproteinases

International Nuclear Information System (INIS)

Azuma, Morio; Tofrizal, Alimuddin; Maliza, Rita; Batchuluun, Khongorzul; Ramadhani, Dini; Syaidah, Rahimi; Tsukada, Takehiro; Fujiwara, Ken; Kikuchi, Motoshi; Horiguchi, Kotaro; Yashiro, Takashi

2015-01-01

The extracellular matrix (ECM) is important in creating cellular environments in tissues. Recent studies have demonstrated that ECM components are localized in anterior pituitary cells and affect cell activity. Thus, clarifying the mechanism responsible for ECM maintenance would improve understanding of gland function. Tissue inhibitors of metalloproteinases (TIMPs) are endogenous inhibitors of matrix metalloproteinases and participate in ECM degradation. In this study, we investigated whether cells expressing TIMPs are present in rat anterior pituitary gland. Reverse transcription polymerase chain reaction was used to analyze expression of the TIMP family (TIMP1-4), and cells producing TIMPs in the gland were identified by using in situ hybridization. Expression of TIMP1, TIMP2, and TIMP3 mRNAs was detected, and the TIMP-expressing cells were located in the gland. The TIMP-expressing cells were also investigated by means of double-staining with in situ hybridization and immunohistochemical techniques. Double-staining revealed that TIMP1 mRNA was expressed in folliculostellate cells. TIMP2 mRNA was detected in folliculostellate cells, prolactin cells, and thyroid-stimulating hormone cells. TIMP3 mRNA was identified in endothelial cells, pericytes, novel desmin-immunopositive perivascular cells, and folliculostellate cells. These findings indicate that TIMP1-, TIMP2-, and TIMP3-expressing cells are present in rat anterior pituitary gland and that they are involved in maintaining ECM components

Fiabilidad en la medición de la temperatura corporal con un termómetro timpánico en pacientes geriátricos

Directory of Open Access Journals (Sweden)

Ester Villanueva Álvarez

Full Text Available Resumen: Introducción: La determinación de la temperatura corporal ha de ser precisa, válida y confiable. Objetivos: Evaluar la fiabilidad de la medición de la temperatura corporal con un termómetro timpánico en pacientes geriátricos ingresados. Analizar la concordancia interobservador en la determinación de la temperatura, en aplicación de la técnica correcta y en práctica habitual. Identificar las variables del paciente que podrían influir en la medición de la temperatura. Metodología: Estudio observacional de pruebas diagnósticas en pacientes geriátricos ingresados por patología aguda. Se realizaron tres mediciones consecutivas de la temperatura corporal (condiciones de práctica clínica vs. condiciones ideales con dos investigadoras adiestradas. Resultados: El coeficiente de correlación intraclase (CCI entre investigadoras para el mismo oído fue 0,97 con un intervalo de confianza (0,95-0,98 para el oído derecho y (0,96-0,98 para el oído izquierdo. El CCI entre oídos para el mismo investigador tuvo una concordancia de 0,89 (IC 0,84-0,93 investigador uno y 0,92 (IC 0,87-0,94 investigador dos. Al comparar las mediciones de planta con las de las investigadoras, la concordancia fue 0,76 (IC 0,64-0,84. Hubo variación en todos los CCI al excluir “decúbito lateral sobre oído valorado” con concordancia entre oídos de 0,92 (IC 0,88-0,95 investigador uno y de 0,95 (IC 0,91-0,96 investigador dos; así como concordancia 0,72 (IC 0,56-0,82 entre el promedio de las investigadoras y las mediciones de planta. Conclusiones: El dispositivo timpánico es fiable y reproducible, especialmente si la medición se realiza según una técnica basada en evidencia científica. Existen variables del paciente susceptibles de influir en la medición, como el decúbito lateral sobre oído valorado, por lo que es necesario tener en cuenta ciertos factores y establecer criterios en la medición.

Synergistic effect of 5-HT2A receptor gene and MAOA gene on the negative emotion of patients with depression.

Science.gov (United States)

Guo, Huirong; Ren, Yuming; Zhao, Ning; Wang, Yali; Li, Shuying; Cui, He; Zhang, Sijia; Zhang, Jianhua

2014-07-01

To analyse the synergistic effect of polymorphism of the tandem repeat sequence u-VNTR of 5-hydroxytryptamine 2A (5-HT2A) receptor gene and monoamine oxidase A (MAOA) gene on the negative emotion in frontal lobe of patients with depression through functional magnetic resonance imaging (fMRI) technique. Functional magnetic resonance imaging scanning was performed for 72 patients with depression and 70 gender, age-matched healthy people with physical examination under negative emotion recognition task. Polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) method was adopted to analyse genotype. The superior, middle and inferior gyrus of bilateral frontal lobe was regarded as the brain region of interest, and then the difference of activation intensity in frontal lobe subregion between control groups and patient groups with different genotypes, and the interaction between the two kinds of polymorphism were compared. The activation intensity in right frontal middle gyrus of patients with CC genotype increased obviously compared with TT and TC genotype patient groups and TT genotype control group (Peffect of the two genotypes on the activation abnormality of negative emotion recognition in right frontal middle gyrus (F = 6·18, P = 0·029). The negative activation in right frontal middle gyrus of patients with CC+H genotypes increased most obviously (Peffect on the activity abnormality when recognizing negative emotion in right frontal middle gyrus of patients with depression. © 2013 Scandinavian Society of Clinical Physiology and Nuclear Medicine. Published by John Wiley & Sons Ltd.

Corrrective action decision document for the Cactus Spring Waste Trenches (Corrective Action Unit No. 426). Revision No. 1

Energy Technology Data Exchange (ETDEWEB)

NONE

1997-06-01

The Corrective Action Decision Document (CADD) for the Cactus Spring Waste Trenches (Corrective Action Unit [CAU] No. 426) has been prepared for the US Department of Energy`s (DOE) Nevada Environmental Restoration Project. This CADD has been developed to meet the requirements of the Federal Facility Agreement and Consent Order (FFACO) of 1996, stated in Appendix VI, {open_quotes}Corrective Action Strategy{close_quotes} (FFACO, 1996). The Cactus Spring Waste Trenches Corrective Action Site (CAS) No. RG-08-001-RG-CS is included in CAU No. 426 (also referred to as the {open_quotes}trenches{close_quotes}); it has been identified as one of three potential locations for buried, radioactively contaminated materials from the Double Tracks Test. The trenches are located on the east flank of the Cactus Range in the eastern portion of the Cactus Spring Ranch at the Tonopah Test Range (TTR) in Nye County, Nevada, on the northern portion of Nellis Air Force Range. The TTR is approximately 225 kilometers (km) (140 miles [mi]) northwest of Las Vegas, Nevada, by air and approximately 56 km (35 mi) southeast of Tonopah, Nevada, by road. The trenches were dug for the purpose of receiving waste generated during Operation Roller Coaster, primarily the Double Tracks Test. This test, conducted in 1963, involved the use of live animals to assess the biological hazards associated with non-nuclear detonation of plutonium-bearing devices (i.e., inhalation uptake of plutonium aerosol). The CAS consists of four trenches that received solid waste and had an overall impacted area of approximately 36 meters (m) (120 feet [ft]) long x 24 m (80 ft) wide x 3 to 4.5 m (10 to 15 ft) deep. The average depressions at the trenches are approximately 0.3 m (1 ft) below land surface.

Norrie disease resulting from a gene deletion: clinical features and DNA studies.

OpenAIRE

Donnai, D; Mountford, R C; Read, A P

1988-01-01

We describe a family in which two boys with Norrie disease have a deletion of the DXS7 locus. The deletion does not extend as far distally as the OTC or DXS84 loci. A full clinical description of the patients is given to help establish the range of manifestations of Norrie disease. There is no evidence of any other X linked disease in our patients.

Norrie disease resulting from a gene deletion: clinical features and DNA studies.

Science.gov (United States)

Donnai, D; Mountford, R C; Read, A P

1988-02-01

We describe a family in which two boys with Norrie disease have a deletion of the DXS7 locus. The deletion does not extend as far distally as the OTC or DXS84 loci. A full clinical description of the patients is given to help establish the range of manifestations of Norrie disease. There is no evidence of any other X linked disease in our patients.

MicroRNA-181b Controls Atherosclerosis and Aneurysms Through Regulation of TIMP-3 and Elastin.

Science.gov (United States)

Di Gregoli, Karina; Mohamad Anuar, Nur Najmi; Bianco, Rosaria; White, Stephen J; Newby, Andrew C; George, Sarah J; Johnson, Jason L

2017-01-06

Atherosclerosis and aneurysms are leading causes of mortality worldwide. MicroRNAs (miRs) are key determinants of gene and protein expression, and atypical miR expression has been associated with many cardiovascular diseases; although their contributory role to atherosclerotic plaque and abdominal aortic aneurysm stability are poorly understood. To investigate whether miR-181b regulates tissue inhibitor of metalloproteinase-3 expression and affects atherosclerosis and aneurysms. Here, we demonstrate that miR-181b was overexpressed in symptomatic human atherosclerotic plaques and abdominal aortic aneurysms and correlated with decreased expression of predicted miR-181b targets, tissue inhibitor of metalloproteinase-3, and elastin. Using the well-characterized mouse atherosclerosis models of Apoe - /- and Ldlr -/- , we observed that in vivo administration of locked nucleic acid anti-miR-181b retarded both the development and the progression of atherosclerotic plaques. Systemic delivery of anti-miR-181b in angiotensin II-infused Apoe -/- and Ldlr -/- mice attenuated aneurysm formation and progression within the ascending, thoracic, and abdominal aorta. Moreover, miR-181b inhibition greatly increased elastin and collagen expression, promoting a fibrotic response and subsequent stabilization of existing plaques and aneurysms. We determined that miR-181b negatively regulates macrophage tissue inhibitor of metalloproteinase-3 expression and vascular smooth muscle cell elastin production, both important factors in maintaining atherosclerotic plaque and aneurysm stability. Validation studies in Timp3 -/- mice confirmed that the beneficial effects afforded by miR-181b inhibition are largely tissue inhibitor of metalloproteinase-3 dependent, while also revealing an additional protective effect through elevating elastin synthesis. Our findings suggest that the management of miR-181b and its target genes provides therapeutic potential for limiting the progression of

[Effect of Kaixinsan on monoamine oxidase activity].

Science.gov (United States)

Wang, Shi; Dong, Xian-Zhe; Tan, Xiao; Wang, Yu-Ning; Liu, Ping

2016-05-01

To observe the effect of antidepressant medicine prescription, Kaixinsan (KXS) on monoamine oxidase (MAO) activity, and explore the mechanism of KXS in elevating the levels of monoamine neurotransmitter from the perspective of metabolism, in vitro enzyme reaction system and C6 neuroglial cells, the effect of KXS at different concentrations on MAO-A and MAO-B activity was observed. In animal studies, the effect of KXS at different concentrations on MAO-A and MAO-B activities of brain mitochondrialin normal rats and solitary chronic unpredictable moderate stress (CMS) model rats after intragastric administration for 1, 2, 3 weeks. Results showed that 10 g•L⁻¹ KXS could significantly reduce the activity of MAO-A and MAO-B in enzyme reaction system; and in C6 cells, KXS within 0.625-10 g•L⁻¹ concentration range had no significant effect on the activity of MAO-A, but had obvious inhibitory effect on the activity of MAO-B in a dose dependent manner. KXS had no significant effect on the activity of MAO-A and MAO-B in brains of normal rats after action for 1, 2, 3 weeks. After 2 and 3 weeks treatment with 338 mg•kg⁻¹ dose KXS, MAO-A activity in the brain of CMS rats was decreased as compared with the model group (PMAO-B activity after 1, 2, 3 weeks of treatment. The results indicated that KXS had certain effect on in vitro MAO-A and MAO-B activity, had no effect on brain MAO-A and MAO-B activity in vivo in normal rats, and had certain inhibitory effect on MAO-A activity in brains of CMS rats. Copyright© by the Chinese Pharmaceutical Association.

Mapping the x-linked lymphoproliferative syndrome

International Nuclear Information System (INIS)

Skare, J.C.; Milunsky, A.; Byron, K.S.; Sullivan, J.L.

1987-01-01

The X-linked lymphoproliferative syndrome is triggered by Epstein-Barr virus infection and results in fatal mononucleosis, immunodeficiency, and lymphoproliferative disorders. This study shows that the mutation responsible for X-linked lymphoproliferative syndrome is genetically linked to a restriction fragment length polymorphism detected with the DXS42 probe (from Xq24-q27). The most likely recombination frequency between the loci is 4%, and the associated logarithm of the odds is 5.26. Haplotype analysis using flanking restriction fragment length polymorphism markers indicates that the locus for X-linked lymphoproliferative syndrome is distal to probe DXS42 but proximal to probe DXS99 (from Xq26-q27). It is now possible to predict which members of a family with X-linked lymphoproliferative syndrome are carrier females and to diagnose the syndrome prenatally

X-linked recessive panhypopituitarism associated with a regional duplication in Xq25-q26.

Science.gov (United States)

Lagerström-Fermér, M; Sundvall, M; Johnsen, E; Warne, G L; Forrest, S M; Zajac, J D; Rickards, A; Ravine, D; Landegren, U; Pettersson, U

1997-01-01

We present a linkage analysis and a clinical update on a previously reported family with X-linked recessive panhypopituitarism, now in its fourth generation. Affected members exhibit variable degrees of hypopituitarism and mental retardation. The markers DXS737 and DXS1187 in the q25-q26 region of the X chromosome showed evidence for linkage with a peak LOD score (Zmax) of 4.12 at zero recombination fraction (theta(max) = 0). An apparent extra copy of the marker DXS102, observed in the region of the disease gene in affected males and heterozygous carrier females, suggests that a segment including this marker is duplicated. The gene causing this disorder appears to code for a dosage-sensitive protein central to development of the pituitary. Images Figure 2 PMID:9106538

Mapping the x-linked lymphoproliferative syndrome

Energy Technology Data Exchange (ETDEWEB)

Skare, J.C.; Milunsky, A.; Byron, K.S.; Sullivan, J.L.

1987-04-01

The X-linked lymphoproliferative syndrome is triggered by Epstein-Barr virus infection and results in fatal mononucleosis, immunodeficiency, and lymphoproliferative disorders. This study shows that the mutation responsible for X-linked lymphoproliferative syndrome is genetically linked to a restriction fragment length polymorphism detected with the DXS42 probe (from Xq24-q27). The most likely recombination frequency between the loci is 4%, and the associated logarithm of the odds is 5.26. Haplotype analysis using flanking restriction fragment length polymorphism markers indicates that the locus for X-linked lymphoproliferative syndrome is distal to probe DXS42 but proximal to probe DXS99 (from Xq26-q27). It is now possible to predict which members of a family with X-linked lymphoproliferative syndrome are carrier females and to diagnose the syndrome prenatally.

Monoamine oxidase deficiency in males with an X chromosome deletion.

Science.gov (United States)

Sims, K B; de la Chapelle, A; Norio, R; Sankila, E M; Hsu, Y P; Rinehart, W B; Corey, T J; Ozelius, L; Powell, J F; Bruns, G

1989-01-01

Mapping of the human MAOA gene to chromosomal region Xp21-p11 prompted our study of two affected males in a family previously reported to have Norrie disease resulting from a submicroscopic deletion in this chromosomal region. In this investigation we demonstrate in these cousins deletion of the MAOA gene, undetectable levels of MAO-A and MAO-B activities in their fibroblasts and platelets, respectively, loss of mRNA for MAO-A in fibroblasts, and substantial alterations in urinary catecholamine metabolites. The present study documents that a marked deficiency of MAO activity is compatible with life and that genes for MAO-A and MAO-B are near each other in this Xp chromosomal region. Some of the clinical features of these MAO deletion patients may help to identify X-linked MAO deficiency diseases in humans.

Tissue inhibitor of matrix metalloproteinase-1 suppresses apoptosis of mouse bone marrow stromal cell line MBA-1.

Science.gov (United States)

Guo, L-J; Luo, X-H; Xie, H; Zhou, H-D; Yuan, L-Q; Wang, M; Liao, E-Y

2006-05-01

We investigated the action of tissue inhibitor of metalloproteinase-1 (TIMP-1) on apoptosis and differentiation of mouse bone marrow stromal cell line MBA-1. TIMP-1 did not affect alkaline phosphatase (ALP) activity, suggesting that it is not involved in osteoblastic differentiation in MBA-1 cells. However, TIMP-1 inhibited MBA-1 apoptosis induced by serum deprivation in a dose-dependent manner. Our study also showed increased Bcl-2 protein expression and decreased Bax protein expression with TIMP-1 treatment. TIMP-1 decreased cytochrome c release and caspase-3 activation in MBA-1 cells. TIMP-1 activated phosphatidylinositol 3-kinase (PI3-kinase) and c-Jun N-terminal kinase (JNK), and the PI3-kinase inhibitor LY294002 or the JNK inhibitor SP600125 abolished its antiapoptotic activity. To investigate whether antiapoptotic action of TIMP-1 was mediated through its inhibition on MMP activities, we constructed mutant TIMP-1 by side-directed mutagenesis, which abolished the inhibitory activity of MMPs by deletion of Cys1 to Ala4. Wild-type TIMP-1 and mutant TIMP-1 expression plasmids were transfected in MBA-1 cells, and results showed that mutant TIMP-1 still protected the induced MBA-1 cell against apoptosis. These data suggest that TIMP-1 antiapoptotic actions are mediated via the PI3-kinase and JNK signaling pathways and independent of TIMP-1 inhibition of MMP activities.

Establishment of a 10-Plex Quantitative Fluorescent-PCR Assay for rapid diagnosis of sex chromosome aneuploidies.

Directory of Open Access Journals (Sweden)

Xingmei Xie

Full Text Available Sex chromosome aneuploidies occur commonly in the general population, with an incidence of 1 in 400 newborns. However, no tests specifically targeting sex chromosomes have been carried out in prenatal diagnosis or newborn screening, resulting in late recognition of these diseases. In this study, a rapid diagnostic method for sex chromosome aneuploidies was established using Quantitative Fluorescent-PCR (QF-PCR. Ten markers were included in one multiplex QF-PCR assay, including two sex determination genes (AMXY and SRY, five X-linked short tandem repeats (STRs; DXS1053, DXS981, DXS6809, DXS1187, and DXS8377, one X/Y-common STR (X22, and two autosomal STRs (D13S305 and D21S11. Retrospective tests of 70 cases with known cytogenetic results indicated that the 10-plex QF-PCR assay could well determine sex chromosome copy numbers by both allelic peak numbers and a sex chromosome dosage calculation with the autosomal STRs as internal controls. Prospective comparison with cytogenetic karyotyping on 534 cases confirmed that the 10-plex QF-PCR assay could be well employed for sex chromosome aneuploidy diagnosis in at least the Chinese Han population. This is the first QF-PCR test for the diagnosis of sex chromosome aneuploidies in the Chinese population. This test is superior to previous designs by including up to 8 sex-linked markers covering different parts of sex chromosomes as well as employing internal controls for copy number dosage calculation in a single PCR reaction. Due to simple technique and data analysis, as well as easy implementation within routine clinical services, this method is of great clinical application value and could be widely applied.

[Norrie syndrome: identification of carriers by segregation analysis with flanking DNA markers].

Science.gov (United States)

Körner, J; Uhlhaas, S; Neugebauer, M; Gal, A

1989-01-01

Norrie disease is an X-linked recessive disorder. Affected males present with congenital blindness. Additionally, hearing loss and psychotic behavior may occur at any time. Since carriers are clinically healthy, they can only be identified by genetic means. Daughters of carriers or sisters of affected males have an à priori 50% risk of being carriers themselves. Close linkage has been found between the Norrie disease locus (NDP) and the DNA locus DXS7 mapped to Xp11.3. For genetic counselling, this linkage relationship allows carriers of the disease to be identified in informative families. We describe a large pedigree with Norrie disease. Segregation analysis was carried out with DXS7 and a second flanking marker, DXS255, both linked to NDP. In this way, three females at risk were identified who had a high probability of being carriers for Norrie disease.

Towards Reducing the Data Exfiltration Surface for the Insider Threat

Energy Technology Data Exchange (ETDEWEB)

Schlicher, Bob G [ORNL; MacIntyre, Lawrence Paul [ORNL; Abercrombie, Robert K [ORNL

2016-01-01

Unauthorized data exfiltrations from both insiders and outsiders are costly and damaging. Network communication resources can be used for transporting data illicitly out of the enterprise or cloud. Combined with built-in malware copying utilities, we define this as comprising the Data Exfiltration Surface (DXS). For securing valuable data, it is desirable to reduce the DXS and maintain controls on the egress points. Our approach is to host the data in a protected enclave that includes novel software Data Diode (SDD) installed on a secured, border gateway. The SDD allows copying data into the enclave systems but denies data from being copied out. Simultaneously, it permits remote access with remote desktop and console applications. Our tests demonstrate that we are able to effectively reduce the DXS and we are able to protect data from being exfiltrated through the use of the SDD.

Association of ventral striatum monoamine oxidase-A binding and functional connectivity in antisocial personality disorder with high impulsivity: A positron emission tomography and functional magnetic resonance imaging study.

Science.gov (United States)

Kolla, Nathan J; Dunlop, Katharine; Downar, Jonathan; Links, Paul; Bagby, R Michael; Wilson, Alan A; Houle, Sylvain; Rasquinha, Fawn; Simpson, Alexander I; Meyer, Jeffrey H

2016-04-01

Impulsivity is a core feature of antisocial personality disorder (ASPD) associated with abnormal brain function and neurochemical alterations. The ventral striatum (VS) is a key region of the neural circuitry mediating impulsive behavior, and low monoamine oxidase-A (MAO-A) level in the VS has shown a specific relationship to the impulsivity of ASPD. Because it is currently unknown whether phenotypic MAO-A markers can influence brain function in ASPD, we investigated VS MAO-A level and the functional connectivity (FC) of two seed regions, superior and inferior VS (VSs, VSi). Nineteen impulsive ASPD males underwent [(11)C] harmine positron emission tomography scanning to measure VS MAO-A VT, an index of MAO-A density, and resting-state functional magnetic resonance imaging that assessed the FC of bilateral seed regions in the VSi and VSs. Subjects also completed self-report impulsivity measures. Results revealed functional coupling of the VSs with bilateral dorsomedial prefrontal cortex (DMPFC) that was correlated with VS MAO-A VT (r=0.47, p=0.04), and functional coupling of the VSi with right hippocampus that was anti-correlated with VS MAO-A VT (r=-0.55, p=0.01). Additionally, VSs-DMPFC FC was negatively correlated with NEO Personality Inventory-Revised impulsivity (r=-0.49, p=0.03), as was VSi-hippocampus FC with Barratt Impulsiveness Scale-11 motor impulsiveness (r=-0.50, p=0.03). These preliminary results highlight an association of VS MAO-A level with the FC of striatal regions linked to impulsive behavior in ASPD and suggest that phenotype-based brain markers of ASPD have relevance to understanding brain function. Copyright © 2016 Elsevier B.V. and ECNP. All rights reserved.

{sup 11}C-Choline PET/CT for restaging prostate cancer. Results from 4,426 scans in a single-centre patient series

Energy Technology Data Exchange (ETDEWEB)

Graziani, Tiziano; Ceci, Francesco; Polverari, Giulia; Lima, Giacomo Maria; Lodi, Filippo; Fanti, Stefano [S. Orsola-Malpighi Hospital, University of Bologna, Service of Nuclear Medicine, Bologna (Italy); Castellucci, Paolo [S. Orsola-Malpighi Hospital, University of Bologna, Service of Nuclear Medicine, Bologna (Italy); Azienda Ospedaliero-Universitaria di Bologna, Policlinico S. Orsola-Malpighi, UO Medicina Nucleare, Bologna (Italy); Morganti, Alessio Giuseppe [S. Orsola-Malpighi Hospital, University of Bologna, Department of Radiotherapy, Bologna (Italy); Ardizzoni, Andrea [S. Orsola-Malpighi Hospital, University of Bologna, Department of Oncology, Bologna (Italy); Schiavina, Riccardo [S. Orsola-Malpighi Hospital, University of Bologna, Department of Urology, Bologna (Italy)

2016-10-15

To evaluate {sup 11}C-choline PET/CT as a diagnostic tool for restaging prostate cancer (PCa), in a large, homogeneous and clinically relevant population of patients with biochemical recurrence (BCR) of PCa after primary therapy. The secondary aim was to assess the best timing for performing {sup 11}C-choline PET/CT during BCR. We retrospectively analysed 9,632 {sup 11}C-choline PET/CT scans performed in our institution for restaging PCa from January 2007 to June 2015. The inclusion criteria were: (1) proven PCa radically treated with radical prostatectomy (RP) or with primary external beam radiotherapy (EBRT); (2) PSA serum values available; (3) proven BCR (PSA >0.2 ng/mL after RP or PSA >2 ng/mL above the nadir after primary EBRT with rising PSA levels). Finally, 3,203 patients with recurrent PCa matching all the inclusion criteria were retrospectively enrolled and 4,426 scans were analysed. Overall, 52.8 % of the {sup 11}C-choline PET/CT scans (2,337/4,426) and 54.8 % of the patients (1,755/3,203) were positive. In 29.4 % of the scans, at least one distant finding was observed. The mean and median PSA values were, respectively, 4.9 and 2.1 ng/mL at the time of the scan (range 0.2 - 50 ng/mL). In our series, 995 scans were performed in patients with PSA levels between 1 and 2 ng/mL. In this subpopulation the positivity rate in the 995 scans was 44.7 %, with an incidence of distant findings of 19.2 % and an incidence of oligometastatic disease (one to three lesions) of 37.7 %. The absolute PSA value at the time of the scan and ongoing androgen deprivation therapy were associated with an increased probability of a positive {sup 11}C-choline PET/CT scan (p < 0.0001). In the ROC analysis, a PSA value of 1.16 ng/mL was the optimal cut-off value. In patients with a PSA value <1.16 ng/mL, 26.8 % of 1,426 {sup 11}C-choline PET/CT scans were positive, with oligometastatic disease in 84.7 % of positive scans. In a large cohort of patients, the feasibility of {sup 11}C

Use of a protein engineering strategy to overcome limitations in the production of "Difficult to Express" recombinant proteins.

Science.gov (United States)

Hussain, Hirra; Fisher, David I; Abbott, W Mark; Roth, Robert G; Dickson, Alan J

2017-10-01

Certain recombinant proteins are deemed "difficult to express" in mammalian expression systems requiring significant cell and/or process engineering to abrogate expression bottlenecks. With increasing demand for the production of recombinant proteins in mammalian cells, low protein yields can have significant consequences for industrial processes. To investigate the molecular mechanisms that restrict expression of recombinant proteins, naturally secreted model proteins were analyzed from the tissue inhibitors of metalloproteinase (TIMP) protein family. In particular, TIMP-2 and TIMP-3 were subjected to detailed study. TIMP proteins share significant sequence homology (∼50% identity and ∼70% similarity in amino acid sequence). However, they show marked differences in secretion in mammalian expression systems despite this extensive sequence homology. Using these two proteins as models, this study characterized the molecular mechanisms responsible for poor recombinant protein production. Our results reveal that both TIMP-2 and TIMP-3 are detectable at mRNA and protein level within the cell but only TIMP-2 is secreted effectively into the extracellular medium. Analysis of protein localization and the nature of intracellular protein suggest TIMP-3 is severely limited in its post-translational processing. To overcome this challenge, modification of the TIMP-3 sequence to include a furin protease-cleavable pro-sequence resulted in secretion of the modified TIMP-3 protein, however, incomplete processing was observed. Based on the TIMP-3 data, the protein engineering approach was optimized and successfully applied in combination with cell engineering, the overexpression of furin, to another member of the TIMP protein family (the poorly expressed TIMP-4). Use of the described protein engineering strategy resulted in successful secretion of poorly (TIMP-4) and non-secreted (TIMP-3) targets, and presents a novel strategy to enhance the production of "difficult" recombinant

Calcium-sensitive regulation of monoamine oxidase-A contributes to the production of peroxyradicals in hippocampal cultures: implications for Alzheimer disease-related pathology

Directory of Open Access Journals (Sweden)

Li XinMin

2007-09-01

Full Text Available Abstract Background Calcium (Ca2+ has recently been shown to selectively increase the activity of monoamine oxidase-A (MAO-A, a mitochondria-bound enzyme that generates peroxyradicals as a natural by-product of the deamination of neurotransmitters such as serotonin. It has also been suggested that increased intracellular free Ca2+ levels as well as MAO-A may be contributing to the oxidative stress associated with Alzheimer disease (AD. Results Incubation with Ca2+ selectively increases MAO-A enzymatic activity in protein extracts from mouse hippocampal HT-22 cell cultures. Treatment of HT-22 cultures with the Ca2+ ionophore A23187 also increases MAO-A activity, whereas overexpression of calbindin-D28K (CB-28K, a Ca2+-binding protein in brain that is greatly reduced in AD, decreases MAO-A activity. The effects of A23187 and CB-28K are both independent of any change in MAO-A protein or gene expression. The toxicity (via production of peroxyradicals and/or chromatin condensation associated with either A23187 or the AD-related β-amyloid peptide, which also increases free intracellular Ca2+, is attenuated by MAO-A inhibition in HT-22 cells as well as in primary hippocampal cultures. Conclusion These data suggest that increases in intracellular Ca2+ availability could contribute to a MAO-A-mediated mechanism with a role in AD-related oxidative stress.

Levels of tissue inhibitor of metalloproteinases 1 in plasma and urine frompatients with bladder cancer

DEFF Research Database (Denmark)

Holten Andersen, MN; Brunner, N; Nielsen, HJ

2006-01-01

Aim: To assess the potential use of plasma and urine levels of tissue inhibitor of metalloproteinases 1 (TIMP-1) in urothelial cancer. Methods: TIMP-1 levels were determined in urine and plasma from healthy donors (n=26), patients with bacterial bladder infection (n=24), urothelial bladder adenoma...... (n=3) or adenocarcinoma (n=7). Results: Free and total TIMP-1 in plasma were weakly but significantly correlated with age; urinary TIMP-1 was not. A strong correlation between free and total TIMP-1 in plasma was observed, with an average ratio of 0.85. No correlation between total TIMP-1 in urine...... and plasma was found (p=0.55). No significant differences in free or total TIMP-1 in plasma were found between healthy individuals, patients with cystitis or bladder cancer (p=0.4). Urinary TIMP-1 levels were significantly increased in patients with cystitis (p=0.001). No apparent differences in TIMP-1...

Human aqueous humor levels of transforming growth factor-β2: Association with matrix metalloproteinases/tissue inhibitors of matrix metalloproteinases

OpenAIRE

Jia, Yan; Yue, Yu; Hu, Dan-Ning; Chen, Ji-Li; Zhou, Ji-Bo

2017-01-01

The present study aims to investigate the association of transforming growth factor-β2 (TGF-β2) and matrix metalloproteinases (MMPs), MMP-2 and MMP-3, and tissue inhibitors of matrix metalloproteinases (TIMPs), TIMP-1, TIMP-2 and TIMP-3 in the aqueous humor of patients with high myopia or cataracts. The levels of TGF-β2 and MMPs/TIMPs were measured with the Luminex xMAP Technology using commercially available Milliplex xMAP kits. The association between TGF-β2 and MMPs/TIMPs levels was analyz...

High-resolution mapping of the x-linked hypohidrotic ectodermal dysplasia (EDA) locus

Energy Technology Data Exchange (ETDEWEB)

Zonana, J.; Jones, M.; Litt, M.; Kramer, P.; Browne, D.; Becker, H.W. (Oregon Health Sciences Univ., Portland, OR (United States)); Brockdorff, N.; Rastan, S. (Medical Council Clinical Research Centre, Harrow (United Kingdom)); Davies, K.P.; Clarke, A. (Univ. of Wales College of Medicine, Cardiff (United Kingdom)) (and others)

1992-11-01

The X-linked hypohidrotic ectodermal dysplasia (EDA) locus has been previously localized to the subchromosomal region Xq11-q21.1. The authors have extended previous linkage studies and analyzed linkage between the EDA locus and 10 marker loci, including five new loci, in 41 families. Four of the marker loci showed no recombination with the EDA locus, and six other loci were also linked to the EDA locus with recombination fractions of .009-.075. Multipoint analysis gave support to the placement of the PGK1P1 locus proximal to the EDA locus and the DXS453 and PGK1 loci distal to EDA. Further ordering of the loci could be inferred from a human-rodent somatic cell hybrid derived from an affected female with EDA and an X;9 translocation and from studies of an affected male with EDA and a submicroscopic deletion. Three of the proximal marker loci, which showed no recombination with the EDA locus, when used in combination, were informative in 92% of females. The closely linked flanking polymorphic loci DXS339 and DXS453 had heterozygosites of 72% and 76%, respectively, and when used jointly, they were doubly informative in 52% of females. The human DXS732 locus was defined by a conserved mouse probe pcos169E/4 (DXCrc169 locus) that consegregates with the mouse tabby (Ta) locus, a potential homologue to the EDA locus. The absence of recombination between EDA and the DXSA732 locus lends support to the hypothesis that the DXCrc169 locus in the mouse and the DXS732 locus in humans may contain candidate sequences for the Ta and EDA genes, respectively. 36 refs., 1 fig., 5 tabs.

Tissue inhibitor of metalloproteinase-3 knockout mice exhibit enhanced energy expenditure through thermogenesis.

Directory of Open Access Journals (Sweden)

Yohsuke Hanaoka

Full Text Available Tissue inhibitors of metalloproteinases (TIMPs regulate matrix metalloproteinase activity and maintain extracellular matrix homeostasis. Although TIMP-3 has multiple functions (e.g., apoptosis, inhibition of VEGF binding to VEGF receptor, and inhibition of TNFα converting enzyme, its roles in thermogenesis and metabolism, which influence energy expenditure and can lead to the development of metabolic disorders when dysregulated, are poorly understood. This study aimed to determine whether TIMP-3 is implicated in metabolism by analyzing TIMP-3 knockout (KO mice. TIMP-3 KO mice had higher body temperature, oxygen consumption, and carbon dioxide production than wild-type (WT mice, although there were no differences in food intake and locomotor activity. These results suggest that metabolism is enhanced in TIMP-3 KO mice. Real-time PCR analysis showed that the expression of PPAR-δ, UCP-2, NRF-1 and NRF-2 in soleus muscle, and PGC-1α and UCP-2 in gastrocnemius muscle, was higher in TIMP-3 KO mice than in WT mice, suggesting that TIMP-3 deficiency may increase mitochondrial activity. When exposed to cold for 8 hours to induce thermogenesis, TIMP-3 KO mice had a higher body temperature than WT mice. In the treadmill test, oxygen consumption and carbon dioxide production were higher in TIMP-3 KO mice both before and after starting exercise, and the difference was more pronounced after starting exercise. Our findings suggest that TIMP-3 KO mice exhibit enhanced metabolism, as reflected by a higher body temperature than WT mice, possibly due to increased mitochondrial activity. Given that TIMP-3 deficiency increases energy expenditure, TIMP-3 may present a novel therapeutic target for preventing metabolic disorders.

Prevalencia de apéndice preauricular en 129,426 nacimientos consecutivos ocurridos en el hospital Civil de Guadalajara (México) Dr. Juan I. Menchaca

OpenAIRE

J. Jesús Pérez M.; Noé Alfaro A.; Eusebio Angulo C.; Mireya Robledo A.

2005-01-01

Esta publicación muestra la prevalencia de apéndice preauricular y la frecuencia de algunas variables relevantes. Se estudió la de prevalencia en 254 neonatos con apéndice preauricular diagnosticada en el momento del nacimiento, en 129,426 nacimientos consecutivos ocurridos en el Hospital Civil de Guadalajara (México) Dr. Juan I Menchaca durante el período de 1990 a 2003. Con una entrevista directa a las madres se obtuvo información de las variables relevantes. Se midió la prevalenci...

Carnosine: effect on aging-induced increase in brain regional monoamine oxidase-A activity.

Science.gov (United States)

Banerjee, Soumyabrata; Poddar, Mrinal K

2015-03-01

Aging is a natural biological process associated with several neurological disorders along with the biochemical changes in brain. Aim of the present investigation is to study the effect of carnosine (0.5-2.5μg/kg/day, i.t. for 21 consecutive days) on aging-induced changes in brain regional (cerebral cortex, hippocampus, hypothalamus and pons-medulla) mitochondrial monoamine oxidase-A (MAO-A) activity with its kinetic parameters. The results of the present study are: (1) The brain regional mitochondrial MAO-A activity and their kinetic parameters (except in Km of pons-medulla) were significantly increased with the increase of age (4-24 months), (2) Aging-induced increase of brain regional MAO-A activity including its Vmax were attenuated with higher dosages of carnosine (1.0-2.5μg/kg/day) and restored toward the activity that observed in young, though its lower dosage (0.5μg/kg/day) were ineffective in these brain regional MAO-A activity, (3) Carnosine at higher dosage in young rats, unlike aged rats significantly inhibited all the brain regional MAO-A activity by reducing their only Vmax excepting cerebral cortex, where Km was also significantly enhanced. These results suggest that carnosine attenuated the aging-induced increase of brain regional MAO-A activity by attenuating its kinetic parameters and restored toward the results of MAO-A activity that observed in corresponding brain regions of young rats. Copyright © 2014 Elsevier Ireland Ltd and the Japan Neuroscience Society. All rights reserved.

Plasma tissue inhibitor of metalloproteinases-1 as a biological marker? Pre-analytical considerations

DEFF Research Database (Denmark)

Lomholt, Anne Fog; Frederiksen, Camilla; Christensen, Ib Jarle

2007-01-01

Tissue Inhibitor of Metalloproteinases-1 (TIMP-1) may be a valuable biological marker in Colorectal Cancer (CRC). However, prospective validation of TIMP-1 as a biological marker should include a series of pre-analytical considerations. TIMP-1 is stored in platelets, which may degranulate during ...... collection and storage. The aim of this study was to evaluate the influence of platelet TIMP-1 contamination on plasma TIMP-1 levels in healthy volunteers....

Chitosan-shelled oxygen-loaded nanodroplets abrogate hypoxia dysregulation of human keratinocyte gelatinases and inhibitors: New insights for chronic wound healing

Energy Technology Data Exchange (ETDEWEB)

Khadjavi, Amina [Dipartimento di Neuroscienze, Università di Torino, Torino (Italy); Magnetto, Chiara [Istituto Nazionale di Ricerca Metrologica (INRIM), Torino (Italy); Panariti, Alice [Dipartimento di Scienze della Salute, Università di Milano Bicocca, Monza (Italy); Argenziano, Monica [Dipartimento di Scienza e Tecnologia del Farmaco, Università di Torino, Torino (Italy); Gulino, Giulia Rossana [Dipartimento di Oncologia, Università di Torino, Torino (Italy); Rivolta, Ilaria [Dipartimento di Scienze della Salute, Università di Milano Bicocca, Monza (Italy); Cavalli, Roberta [Dipartimento di Scienza e Tecnologia del Farmaco, Università di Torino, Torino (Italy); Giribaldi, Giuliana [Dipartimento di Oncologia, Università di Torino, Torino (Italy); Guiot, Caterina [Dipartimento di Neuroscienze, Università di Torino, Torino (Italy); Prato, Mauro, E-mail: mauro.prato@unito.it [Dipartimento di Neuroscienze, Università di Torino, Torino (Italy); Dipartimento di Scienze della Sanità Pubblica e Pediatriche, Università di Torino, Torino (Italy)

2015-08-01

Background: : In chronic wounds, efficient epithelial tissue repair is hampered by hypoxia, and balances between the molecules involved in matrix turn-over such as matrix metalloproteinases (MMPs) and tissue inhibitors of metalloproteinases (TIMPs) are seriously impaired. Intriguingly, new oxygenating nanocarriers such as 2H,3H-decafluoropentane-based oxygen-loaded nanodroplets (OLNs) might effectively target chronic wounds. Objective: : To investigate hypoxia and chitosan-shelled OLN effects on MMP/TIMP production by human keratinocytes. Methods: : HaCaT cells were treated for 24 h with 10% v/v OLNs both in normoxia or hypoxia. Cytotoxicity and cell viability were measured through biochemical assays; cellular uptake by confocal microscopy; and MMP and TIMP production by enzyme-linked immunosorbent assay or gelatin zymography. Results: : Normoxic HaCaT cells constitutively released MMP-2, MMP-9, TIMP-1 and TIMP-2. Hypoxia strongly impaired MMP/TIMP balances by reducing MMP-2, MMP-9, and TIMP-2, without affecting TIMP-1 release. After cellular uptake by keratinocytes, nontoxic OLNs abrogated all hypoxia effects on MMP/TIMP secretion, restoring physiological balances. OLN abilities were specifically dependent on time-sustained oxygen diffusion from OLN core. Conclusion: : Chitosan-shelled OLNs effectively counteract hypoxia-dependent dysregulation of MMP/TIMP balances in human keratinocytes. Therefore, topical administration of exogenous oxygen, properly encapsulated in nanodroplet formulations, might be a promising adjuvant approach to promote healing processes in hypoxic wounds. - Highlights: • Hypoxia impairs MMP9/TIMP1 and MMP2/TIMP2 balances in HaCaT human keratinocytes. • Chitosan-shelled oxygen-loaded nanodroplets (OLNs) are internalised by HaCaT cells. • OLNs are not toxic to HaCaT cells. • OLNs effectively counteract hypoxia effects on MMP/TIMP balances in HaCaT cells. • OLNs appear as promising and cost-effective therapeutic tools for hypoxic

Chitosan-shelled oxygen-loaded nanodroplets abrogate hypoxia dysregulation of human keratinocyte gelatinases and inhibitors: New insights for chronic wound healing

International Nuclear Information System (INIS)

Khadjavi, Amina; Magnetto, Chiara; Panariti, Alice; Argenziano, Monica; Gulino, Giulia Rossana; Rivolta, Ilaria; Cavalli, Roberta; Giribaldi, Giuliana; Guiot, Caterina; Prato, Mauro

2015-01-01

Background: : In chronic wounds, efficient epithelial tissue repair is hampered by hypoxia, and balances between the molecules involved in matrix turn-over such as matrix metalloproteinases (MMPs) and tissue inhibitors of metalloproteinases (TIMPs) are seriously impaired. Intriguingly, new oxygenating nanocarriers such as 2H,3H-decafluoropentane-based oxygen-loaded nanodroplets (OLNs) might effectively target chronic wounds. Objective: : To investigate hypoxia and chitosan-shelled OLN effects on MMP/TIMP production by human keratinocytes. Methods: : HaCaT cells were treated for 24 h with 10% v/v OLNs both in normoxia or hypoxia. Cytotoxicity and cell viability were measured through biochemical assays; cellular uptake by confocal microscopy; and MMP and TIMP production by enzyme-linked immunosorbent assay or gelatin zymography. Results: : Normoxic HaCaT cells constitutively released MMP-2, MMP-9, TIMP-1 and TIMP-2. Hypoxia strongly impaired MMP/TIMP balances by reducing MMP-2, MMP-9, and TIMP-2, without affecting TIMP-1 release. After cellular uptake by keratinocytes, nontoxic OLNs abrogated all hypoxia effects on MMP/TIMP secretion, restoring physiological balances. OLN abilities were specifically dependent on time-sustained oxygen diffusion from OLN core. Conclusion: : Chitosan-shelled OLNs effectively counteract hypoxia-dependent dysregulation of MMP/TIMP balances in human keratinocytes. Therefore, topical administration of exogenous oxygen, properly encapsulated in nanodroplet formulations, might be a promising adjuvant approach to promote healing processes in hypoxic wounds. - Highlights: • Hypoxia impairs MMP9/TIMP1 and MMP2/TIMP2 balances in HaCaT human keratinocytes. • Chitosan-shelled oxygen-loaded nanodroplets (OLNs) are internalised by HaCaT cells. • OLNs are not toxic to HaCaT cells. • OLNs effectively counteract hypoxia effects on MMP/TIMP balances in HaCaT cells. • OLNs appear as promising and cost-effective therapeutic tools for hypoxic

A locus for isolated cataract on human Xp.

Science.gov (United States)

Francis, P J; Berry, V; Hardcastle, A J; Maher, E R; Moore, A T; Bhattacharya, S S

2002-02-01

To genetically map the gene causing isolated X linked cataract in a large European pedigree. Using the patient registers at Birmingham Women's Hospital, UK, we identified and examined 23 members of a four generation family with nuclear cataract. Four of six affected males also had complex congenital heart disease. Pedigree data were collated and leucocyte DNA extracted from venous blood. Linkage analysis by PCR based microsatellite marker genotyping was used to identify the disease locus and mutations within candidate genes screened by direct sequencing. The disease locus was genetically refined to chromosome Xp22, within a 3 cM linkage interval flanked by markers DXS9902 and DXS999 (Zmax=3.64 at theta=0 for marker DXS8036). This is the first report of a locus for isolated inherited cataract on the X chromosome. The disease interval lies within the Nance-Horan locus suggesting allelic heterogeneity. The apparent association with congenital cardiac anomalies suggests a possible new oculocardiac syndrome.

A comparative study of tissue inhibitor of metalloproteinases-1 levels in plasma and tumour tissue from patients with primary breast cancer and in plasma from patients with metastatic breast cancer

DEFF Research Database (Denmark)

Rasmussen, Anne-Sofie Schrohl; Mueller, Volkmar; Christensen, Ib Jarle

2008-01-01

OBJECTIVE: Tissue inhibitor of metalloproteinases-1 (TIMP-1) has been investigated as a potential tumour marker in breast cancer. Here we investigated the correlation between TIMP-1 in tumour tissue and plasma to evaluate whether TIMP-1 in plasma is actually a surrogate marker for TIMP-1 in prima...

Rapid, Automated, and Specific Immunoassay to Directly Measure Matrix Metalloproteinase-9–Tissue Inhibitor of Metalloproteinase-1 Interactions in Human Plasma Using AlphaLISA Technology: A New Alternative to Classical ELISA

Directory of Open Access Journals (Sweden)

Helena Pulido-Olmo

2017-07-01

Full Text Available The protocol describes a novel, rapid, and no-wash one-step immunoassay for highly sensitive and direct detection of the complexes between matrix metalloproteinases (MMPs and their tissue inhibitor of metalloproteinases (TIMPs based on AlphaLISA® technology. We describe two procedures: (i one approach is used to analyze MMP-9–TIMP-1 interactions using recombinant human MMP-9 with its corresponding recombinant human TIMP-1 inhibitor and (ii the second approach is used to analyze native or endogenous MMP-9–TIMP-1 protein interactions in samples of human plasma. Evaluating native MMP-9–TIMP-1 complexes using this approach avoids the use of indirect calculations of the MMP-9/TIMP-1 ratio for which independent MMP-9 and TIMP-1 quantifications by two conventional ELISAs are needed. The MMP-9–TIMP-1 AlphaLISA® assay is quick, highly simplified, and cost-effective and can be completed in less than 3 h. Moreover, the assay has great potential for use in basic and preclinical research as it allows direct determination of native MMP-9–TIMP-1 complexes in circulating blood as biofluid.

Successive Release of Tissue Inhibitors of Metalloproteinase-1 Through Graphene Oxide-Based Delivery System Can Promote Skin Regeneration

Science.gov (United States)

Zhong, Cheng; Shi, Dike; Zheng, Yixiong; Nelson, Peter J.; Bao, Qi

2017-09-01

The purpose of this study was to testify the hypothesis that graphene oxide (GO) could act as an appropriate vehicle for the release of tissue inhibitors of metalloproteinase-1 (TIMP-1) protein in the context of skin repair. GO characteristics were observed by scanning electron microscopy, atomic force microscopy, and thermal gravimetric analysis. After TIMP-1 absorbing GO, the release profiles of various concentrations of TIMP-1 from GO were compared. GO biocompatibility with fibroblast viability was assessed by measuring cell cycle and apoptosis. In vivo wound healing assays were used to determine the effect of TIMP-1-GO on skin regeneration. The greatest intensity of GO was 1140 nm, and the most intensity volume was 10,674.1 nm (nanometer). TIMP-1 was shown to be continuously released for at least 40 days from GO. The proliferation and viability of rat fibroblasts cultured with TIMP-1-GO were not significantly different as compared with the cells grown in GO or TIMP-1 alone ( p > 0.05). Skin defect of rats treated with TIMP-1 and TIMP-1-GO showed significant differences in histological and immunohistochemical scores ( p tissue regeneration in skin defect.

Effects of high glucose and thiamine on the balance between matrix metalloproteinases and their tissue inhibitors in vascular cells.

Science.gov (United States)

Tarallo, Sonia; Beltramo, Elena; Berrone, Elena; Dentelli, Patrizia; Porta, Massimo

2010-06-01

Pericyte survival in diabetic retinopathy depends also on interactions with extracellular matrix (ECM) proteins, which are degraded by matrix metalloproteinases (MMP). Elevated glucose influences ECM turnover, through expression of MMP and their tissue inhibitors, TIMP. We reported on reduced pericyte adhesion to high glucose-conditioned ECM and correction by thiamine. We aimed at verifying the effects of thiamine and benfotiamine on MMP-2, MMP-9 and TIMP expression and activity in human vascular cells with high glucose. In HRP, MMP-2 activity, though not expression, increased with high glucose and decreased with thiamine and benfotiamine; TIMP-1 expression increased with high glucose plus thiamine and benfotiamine; MMP-9 was not expressed. In EC, MMP-9 and MMP-2 expression and activity increased with high glucose, but thiamine and benfotiamine had no effects; TIMP-1 expression was unchanged. Neither glucose nor thiamine modified TIMP-2 and TIMP-3 expression. TIMP-1 concentrations did not change in either HRP or EC. High glucose imbalances MMP/TIMP regulation, leading to increased ECM turnover. Thiamine and benfotiamine correct the increase in MMP-2 activity due to high glucose in HRP, while increasing TIMP-1.

Monoamine Oxidase-A Inhibition and Associated Antioxidant Activity in Plant Extracts with Potential Antidepressant Actions

Directory of Open Access Journals (Sweden)

Tomás Herraiz

2018-01-01

Full Text Available Monoamine oxidase (MAO catalyzes the oxidative deamination of amines and neurotransmitters and is involved in mood disorders, depression, oxidative stress, and adverse pharmacological reactions. This work studies the inhibition of human MAO-A by Hypericum perforatum, Peganum harmala, and Lepidium meyenii, which are reported to improve and affect mood and mental conditions. Subsequently, the antioxidant activity associated with the inhibition of MAO is determined in plant extracts for the first time. H. perforatum inhibited human MAO-A, and extracts from flowers gave the highest inhibition (IC50 of 63.6 μg/mL. Plant extracts were analyzed by HPLC-DAD-MS and contained pseudohypericin, hypericin, hyperforin, adhyperforin, hyperfirin, and flavonoids. Hyperforin did not inhibit human MAO-A and hypericin was a poor inhibitor of this isoenzyme. Quercetin and flavonoids significantly contributed to MAO-A inhibition. P. harmala seed extracts highly inhibited MAO-A (IC50 of 49.9 μg/L, being a thousand times more potent than H. perforatum extracts owing to its content of β-carboline alkaloids (harmaline and harmine. L. meyenii root (maca extracts did not inhibit MAO-A. These plants may exert protective actions related to antioxidant effects. Results in this work show that P. harmala and H. perforatum extracts exhibit antioxidant activity associated with the inhibition of MAO (i.e., lower production of H2O2.

Genetic variants near TIMP3 and high-density lipoprotein–associated loci influence susceptibility to age-related macular degeneration

Science.gov (United States)

Chen, Wei; Stambolian, Dwight; Edwards, Albert O.; Branham, Kari E.; Othman, Mohammad; Jakobsdottir, Johanna; Tosakulwong, Nirubol; Pericak-Vance, Margaret A.; Campochiaro, Peter A.; Klein, Michael L.; Tan, Perciliz L.; Conley, Yvette P.; Kanda, Atsuhiro; Kopplin, Laura; Li, Yanming; Augustaitis, Katherine J.; Karoukis, Athanasios J.; Scott, William K.; Agarwal, Anita; Kovach, Jaclyn L.; Schwartz, Stephen G.; Postel, Eric A.; Brooks, Matthew; Baratz, Keith H.; Brown, William L.; Brucker, Alexander J.; Orlin, Anton; Brown, Gary; Ho, Allen; Regillo, Carl; Donoso, Larry; Tian, Lifeng; Kaderli, Brian; Hadley, Dexter; Hagstrom, Stephanie A.; Peachey, Neal S.; Klein, Ronald; Klein, Barbara E. K.; Gotoh, Norimoto; Yamashiro, Kenji; Ferris, Frederick; Fagerness, Jesen A.; Reynolds, Robyn; Farrer, Lindsay A.; Kim, Ivana K.; Miller, Joan W.; Cortón, Marta; Carracedo, Angel; Sanchez-Salorio, Manuel; Pugh, Elizabeth W.; Doheny, Kimberly F.; Brion, Maria; DeAngelis, Margaret M.; Weeks, Daniel E.; Zack, Donald J.; Chew, Emily Y.; Heckenlively, John R.; Yoshimura, Nagahisa; Iyengar, Sudha K.; Francis, Peter J.; Katsanis, Nicholas; Seddon, Johanna M.; Haines, Jonathan L.; Gorin, Michael B.; Abecasis, Gonçalo R.; Swaroop, Anand; Johnson, Robert N.; Ai, Everett; McDonald, H. Richard; Stolarczuk, Margaret; Pavan, Peter Reed; Billiris, Karina K.; Iyer, Mohan; Menosky, Matthew M.; Pautler, Scott E.; Millard, Sharon M.; Hubbard, Baker; Aaberg, Thomas; DuBois, Lindy; Lyon, Alice; Anderson-Nelson, Susan; Jampol, Lee M.; Weinberg, David V.; Muñana, Annie; Rozenbajgier, Zuzanna; Orth, David; Cohen, Jack; MacCumber, Matthew; MacCumber, Matthew; Figliulo, Celeste; Porcz, Liz; Folk, James; Boldt, H. Culver; Russell, Stephen R.; Ivins, Rachel; Hinz, Connie J.; Barr, Charles C.; Bloom, Steve; Jaegers, Ken; Kritchman, Brian; Whittington, Greg; Heier, Jeffrey; Frederick, Albert R.; Morley, Michael G.; Topping, Trexler; Davis, Heather L.; Bressler, Susan B.; Bressler, Neil M.; Doll, Warren; Trese, Michael; Capone, Antonio; Garretson, Bruce R.; Hassan, Tarek S.; Ruby, Alan J.; Osentoski, Tammy; McCannel, Colin A.; Ruszczyk, Margaret J.; Grand, Gilbert; Blinder, Kevin; Holekamp, Nancy M.; Joseph, Daniel P.; Shah, Gaurav; Nobel, Ginny S.; Antoszyk, Andrew N.; Browning, David J.; Stallings, Alison H; Singerman, Lawrence J.; Miller, David; Novak, Michael; Pendergast, Scott; Zegarra, Hernando; Schura, Stephanie A.; Smith-Brewer, Sheila; Davidorf, Frederick H.; Chambers, Robert; Chorich, Louis; Salerno, Jill; Dreyer, Richard F.; Ma, Colin; Kopfer, Marcia R.; Klein, Michael L.; Wilson, David J.; Nolte, Susan K.; Grunwald, Juan E.; Brucker, Alexander J.; Dunaief, Josh; Fine, Stuart L.; Maguire, Albert M.; Stoltz, Robert A.; McRay, Monique N.; Fish, Gary Edd; Anand, Rajiv; Spencer, Rand; Arnwine, Jean; Chandra, Suresh R.; Altaweel, Michael; Blodi, Barbara; Gottlieb, Justin; Ip, Michael; Nork, T. Michael; Perry-Raymond, Jennie; Fine, Stuart L.; Maguire, Maureen G.; Brightwell-Arnold, Mary; Harkins, Sandra; Peskin, Ellen; Ying, Gui-Shuang; Kurinij, Natalie

2010-01-01

We executed a genome-wide association scan for age-related macular degeneration (AMD) in 2,157 cases and 1,150 controls. Our results validate AMD susceptibility loci near CFH (P < 10−75), ARMS2 (P < 10−59), C2/CFB (P < 10−20), C3 (P < 10−9), and CFI (P < 10−6). We compared our top findings with the Tufts/Massachusetts General Hospital genome-wide association study of advanced AMD (821 cases, 1,709 controls) and genotyped 30 promising markers in additional individuals (up to 7,749 cases and 4,625 controls). With these data, we identified a susceptibility locus near TIMP3 (overall P = 1.1 × 10−11), a metalloproteinase involved in degradation of the extracellular matrix and previously implicated in early-onset maculopathy. In addition, our data revealed strong association signals with alleles at two loci (LIPC, P = 1.3 × 10−7; CETP, P = 7.4 × 10−7) that were previously associated with high-density lipoprotein cholesterol (HDL-c) levels in blood. Consistent with the hypothesis that HDL metabolism is associated with AMD pathogenesis, we also observed association with AMD of HDL-c—associated alleles near LPL (P = 3.0 × 10−3) and ABCA1 (P = 5.6 × 10−4). Multilocus analysis including all susceptibility loci showed that 329 of 331 individuals (99%) with the highest-risk genotypes were cases, and 85% of these had advanced AMD. Our studies extend the catalog of AMD associated loci, help identify individuals at high risk of disease, and provide clues about underlying cellular pathways that should eventually lead to new therapies. PMID:20385819

Microdeletion in the X-chromosome and prenatal diagnosis in a family with Norrie disease.

Science.gov (United States)

Zhu, D P; Antonarakis, S E; Schmeckpeper, B J; Diergaarde, P J; Greb, A E; Maumenee, I H

1989-08-01

We have studied a three-generation family in which Norrie disease is segregating and have performed prenatal diagnosis on the fetus of an obligatory carrier. Deletions at loci DXS7 and DXS77 defined by probes L1.28, L1.28-p59, and pX59 were detected in the affected male. DNA studies of chorionic villus biopsy material indicated that the male fetus had inherited the normal allele from the carrier mother. This prediction was confirmed on eye examination at age 5 months.

Peer social interaction is facilitated in juvenile rhesus monkeys treated with fluoxetine.

Science.gov (United States)

Golub, Mari S; Hogrefe, Casey E; Bulleri, Alicia M

2016-06-01

Fluoxetine improves social interactions in children with autism, social anxiety and social phobia. It is not known whether this effect is mediated directly or indirectly by correcting the underlying pathology. Genetics may also influence the drug effect. Polymorphisms of the MAOA (monoamine oxidase A) gene interact with fluoxetine to influence metabolic profiles in juvenile monkeys. Juvenile nonhuman primates provide an appropriate model for studying fluoxetine effects and drug*gene interactions in children. Male rhesus monkeys 1-3 years of age living in permanent social pairs were treated daily with a therapeutic dose of fluoxetine or vehicle (n = 16/group). Both members of each social pair were assigned to the same treatment group. They were observed for social interactions with their familiar cagemate over a 2-year dosing period. Subjects were genotyped for MAOA variable number of tandem repeats (VNTR) polymorphisms categorized for high or low transcription rates (hi-MAOA, low-MAOA). Fluoxetine-treated animals spent 30% more time in social interaction than vehicle controls. Fluoxetine significantly increased the duration of quiet interactions, the most common type of interaction, and also of immature sexual behavior typical of rhesus in this age group. Specific behaviors affected depended on MAOA genotype of the animal and its social partner. When given fluoxetine, hi-MOAO monkeys had more social invitation and initiation behaviors and low-MAOA subjects with low-MAOA partners had more grooming and an increased frequency of some facial and vocal expressive behaviors. Fluoxetine may facilitate social interaction in children independent of remediation of psychopathology. Common genetic variants may modify this effect. Copyright © 2016 Elsevier Ltd. All rights reserved.

Azure B, a metabolite of methylene blue, is a high-potency, reversible inhibitor of monoamine oxidase

Energy Technology Data Exchange (ETDEWEB)

Petzer, Anél, E-mail: 12264954@nwu.ac.za [Unit for Drug Research and Development, School of Pharmacy, North-West University, Private Bag X6001, Potchefstroom, 2520 (South Africa); Harvey, Brian H. [Division of Pharmacology, School of Pharmacy, North-West University, Private Bag X6001, Potchefstroom, 2520 (South Africa); Wegener, Gregers [Centre for Psychiatric Research, Aarhus University Hospital-Risskov, Skovagervej 2, 8240 Risskov (Denmark); Petzer, Jacobus P. [Division of Pharmaceutical Chemistry, School of Pharmacy, North-West University, Private Bag X6001, Potchefstroom, 2520 (South Africa)

2012-02-01

Methylene blue (MB) has been shown to act at multiple cellular and molecular targets and as a result possesses diverse medical applications. Among these is a high potency reversible inhibition of monoamine oxidase A (MAO-A) that may, at least in part, underlie its adverse effects but also its psycho- and neuromodulatory actions. MB is metabolized to yield N-demethylated products of which azure B, the monodemethyl species, is the major metabolite. Similar to MB, azure B also displays a variety of biological activities and may therefore contribute to the pharmacological profile of MB. Based on these observations, the present study examines the interactions of azure B with recombinant human MAO-A and -B. The results show that azure B is a potent MAO-A inhibitor (IC{sub 50} = 11 nM), approximately 6-fold more potent than is MB (IC{sub 50} = 70 nM) under identical conditions. Measurements of the time-dependency of inhibition suggest that the interaction of azure B with MAO-A is reversible. Azure B also reversibly inhibits the MAO-B isozyme with an IC{sub 50} value of 968 nM. These results suggest that azure B may be a hitherto under recognized contributor to the pharmacology and toxicology of MB by blocking central and peripheral MAO-A activity and as such needs to be considered during its use in humans and animals. Highlights: ► Methylene blue (MB) is a known potent MAO-A inhibitor. ► Azure B, the major metabolite of MB, is more potent as a MAO-A inhibitor. ► Azure B may be a contributor to the CNS pharmacology and toxicology of MB.

Three-Dimensional Analysis of the Curvature of the Femoral Canal in 426 Chinese Femurs

Directory of Open Access Journals (Sweden)

Xiu-Yun Su

2015-01-01

Full Text Available Purpose. The human femur has long been considered to have an anatomical anterior curvature in the sagittal plane. We established a new method to evaluate the femoral curvature in three-dimensional (3D space and reveal its influencing factors in Chinese population. Methods. 3D models of 426 femurs and the medullary canal were constructed using Mimics software. We standardized the positions of all femurs using 3ds Max software. After measuring the anatomical parameters, including the radius of femoral curvature (RFC and banking angle, of the femurs using the established femur-specific coordinate system, we analyzed and determined the relationships between the anatomical parameters of the femur and the general characteristics of the population. Results. Pearson’s correlation analyses showed that there were positive correlations between the RFC and height (r=0.339, p<0.001 and the femoral length and RFC (r=0.369, p<0.001 and a negative correlation between the femoral length and banking angle (r=-0.223, p<0.001. Stepwise linear regression analyses showed that the most relevant factors for the RFC and banking angle were the femoral length and gender, respectively. Conclusions. This study concluded that the banking angle of the femur was significantly larger in female than in male.

Unbalanced Metalloproteinase-9 and Tissue inhibitors of Metalloproteinases Ratio Predicts Hemorrhagic Transformation of Lesion in Ischemic Stroke Patients Treated with Thrombolysis: Results from the MAGIC Study

Directory of Open Access Journals (Sweden)

Benedetta ePiccardi

2015-05-01

Full Text Available Background Experimentally, metalloproteinases (MMPs play a detrimental role related to severity of ischemic brain lesions. Both MMPs activity and function in tissues reflect the balance between MMPs and tissue inhibitors of metalloproteinases (TIMPs. We aimed to evaluate the role of MMPs/TIMPs balance in the setting of rtPA treated stroke patients Methods Blood was taken before and 24-hours after rtPA from 327 patients (mean age 68 years, median NIHSS 11 with acute ischemic stroke. Delta median values of each MMP/TIMP ratio [(post rtPA MMP/TIMP-baseline MMP/TIMP/(baseline MMP/TIMP] were analyzed related to symptomatic intracranial hemorrhage (sICH according to NINDS criteria, relevant hemorrhagic transformation (HT defined as hemorrhagic infarction type 2 or any parenchimal hemorrhage, stroke subtypes (according to Oxfordshire Community Stroke Project and 3-month death. The net effect of each MMP/TIMP ratio was estimated by a logistic regression model including major clinical determinants of outcomes Results Adjusting for major clinical determinants, only increase in MMP9/TIMP1 and MMP9/TIMP2 ratios remained significantly associated with sICH (odds ratio [95% confidence interval], 1.67 [1.17 – 2.38], p = 0.005; 1.74 [1.21 – 2.49], p=0.003 respectively. Only relative increase in MMP9/TIMP1 ratio proved significantly associated with relevant HT (odds ratio [95% confidence interval], 1.74 [1.17 – 2.57], p=0.006 with a trend towards significance for MMP9/TIMP2 ratio (p=0.007.Discussion Our data add substantial clinical evidence about the role of MMPs/TIMPs balance in rtPA treated stroke patients. These results may serve to generate hypotheses on MMPs inhibitors to be administered together with rtPA in order to counteract its deleterious effect.

X chromosome and suicide.

Science.gov (United States)

Fiori, L M; Zouk, H; Himmelman, C; Turecki, G

2011-02-01

Suicide completion rates are significantly higher in males than females in most societies. Although gender differences in suicide rates have been partially explained by environmental and behavioral factors, it is possible that genetic factors, through differential expression between genders, may also help explain gender moderation of suicide risk. This study investigated X-linked genes in suicide completers using a two-step strategy. We first took advantage of the genetic structure of the French-Canadian population and genotyped 722 unrelated French-Canadian male subjects, of whom 333 were suicide completers and 389 were non-suicide controls, using a panel of 37 microsatellite markers spanning the entire X chromosome. Nine haplotype windows and several individual markers were associated with suicide. Significant results aggregated primarily in two regions, one in the long arm and another in the short arm of chromosome X, limited by markers DXS8051 and DXS8102, and DXS1001 and DXS8106, respectively. The second stage of the study investigated differential brain expression of genes mapping to associated regions in Brodmann areas 8/9, 11, 44 and 46, in an independent sample of suicide completers and controls. Six genes within these regions, Rho GTPase-activating protein 6, adaptor-related protein complex 1 sigma 2 subunit, glycoprotein M6B, ribosomal protein S6 kinase 90  kDa polypeptide 3, spermidine/spermine N(1)-acetyltransferase 1 and THO complex 2, were found to be differentially expressed in suicide completers.

Human tissue inhibitor of metalloproteinases-1 improved wound healing in diabetes through its anti-apoptotic effect.

Science.gov (United States)

Lao, Guojuan; Ren, Meng; Wang, Xiaoyi; Zhang, Jinglu; Huang, Yanrui; Liu, Dan; Luo, Hengcong; Yang, Chuan; Yan, Li

2017-09-08

Impaired wound healing accompanies severe cell apoptosis in diabetic patients. Tissue inhibitor of metalloproteinases-1 (TIMP-1) was known to have effects on promoting growth and anti-apoptosis for cells. We aimed to determine the actual levels of TIMP-1 and cell apoptosis in: (i) the biopsies of diabetic and non-diabetic foot tissue and (ii) the human fibroblasts with or without treatments of advanced glycation end-products (AGEs). Next, we aimed to determine the improved levels of cell apoptosis and wound healing after the treatments of either active protein of TIMP-1 or in vivo expression of gene therapy vector-mediated TIMP-1 in both the human fibroblasts and the animal model of diabetic rats. The levels of TIMP-1 were significantly reduced in diabetic skin tissues and in AGEs-treated fibroblasts. Both AGEs-treated cells were effectively protected from apoptosis by active protein of TIMP-1 at appropriate dose level. So did the induced in vivo TIMP-1 expression after gene delivery. Similar effects were also found on the significant improvement of impaired wound healing in diabetic rats. We concluded that TIMP-1 improved wound healing through its anti-apoptotic effect. Treatments with either active protein TIMP-1 or TIMP-1 gene therapy delivered in local wound sites may be used as a strategy for accelerating diabetic wound healing. © 2017 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

X linked neonatal centronuclear/myotubular myopathy: evidence for linkage to Xq28 DNA marker loci.

OpenAIRE

Thomas, N S; Williams, H; Cole, G; Roberts, K; Clarke, A; Liechti-Gallati, S; Braga, S; Gerber, A; Meier, C; Moser, H

1990-01-01

We have studied the inheritance of several polymorphic Xq27/28 DNA marker loci in two three generation families with the X linked neonatal lethal form of centronuclear/myotubular myopathy (XL MTM). We found complete linkage of XLMTM to all four informative Xq28 markers analysed, with GCP/RCP (Z = 3.876, theta = 0.00), with DXS15 (Z = 3.737, theta = 0.00), with DXS52 (Z = 2.709, theta = 0.00), and with F8C (Z = 1.020, theta = 0.00). In the absence of any observable recombination, we are unable...

Tissue inhibitor of metalloproteinases-1 in the postoperative monitoring of colorectal cancer

DEFF Research Database (Denmark)

Holten-Andersen, Mads Nikolaj; Nielsen, Hans Jørgen; Sørensen, Steen

2006-01-01

antigen (CEA) in corresponding serum samples were measured and correlated with patient outcome (death, local recurrence (LR) and distant metastases (DM)). The results showed that the course of plasma TIMP-1 from pre- to postoperative levels correlated with patient outcome (P=0.005). However, postoperative...... plasma TIMP-1 alone was strongly associated with patient outcome, high TIMP-1 predicting short survival (P=0.002). Combining postoperative TIMP-1 and CEA demonstrated that high TIMP-1 and CEA levels predicted poor outcome (Panalysis identifying both parameters as strong prognostic...

Monoamine oxidase-A and B activities in the cerebellum and frontal cortex of children and young adults with autism.

Science.gov (United States)

Gu, Feng; Chauhan, Ved; Chauhan, Abha

2017-10-01

Monoamine oxidases (MAOs) catalyze the metabolism of monoamine neurotransmitters, such as serotonin, dopamine, and norepinephrine, and are key regulators for brain function. In this study, we analyzed the activities of MAO-A and MAO-B in the cerebellum and frontal cortex from subjects with autism and age-matched control subjects. In the cerebellum, MAO-A activity in subjects with autism (aged 4-38 years) was significantly lower by 20.6% than in controls. When the subjects were divided into children (aged 4-12 years) and young adults (aged 13-38 years) subgroups, a significant decrease by 27.8% in the MAO-A activity was observed only in children with autism compared with controls. When the 95% confidence interval of the control group was taken as a reference range, reduced activity of MAO-A was observed in 70% of children with autism. In the frontal cortex, MAO-A activity in children with autism was also lower by 30% than in the control group, and impaired activity of MAO-A was observed in 55.6% of children with autism, although the difference between the autism and control groups was not significant when all subjects were considered. On the contrary, there was no significant difference in MAO-B activity in both the cerebellum and frontal cortex between children with autism and the control group as well as in adults. These results suggest impaired MAO-A activity in the brain of subjects with autism, especially in children with autism. Decreased activity of MAOs may lead to increased levels of monoaminergic neurotransmitters, such as serotonin, which have been suggested to have a critical role in autism. © 2017 Wiley Periodicals, Inc. © 2017 Wiley Periodicals, Inc.

Radiosynthesis and in vivo evaluation of [11C]-labelled pyrrole-2-carboxamide derivates as novel radioligands for PET imaging of monoamine oxidase A

International Nuclear Information System (INIS)

De Bruyne, Sylvie; La Regina, Giuseppe; Staelens, Steven; Wyffels, Leonie; Deleye, Steven; Silvestri, Romano; De Vos, Filip

2010-01-01

Introduction: Since MAO-A is an enzyme involved in the metabolism of neurotransmitters, fluctuations in MAO-A functionality are associated with psychiatric and neurological disorders as well as with tobacco addiction and behaviour. This study reports the radiolabelling of two [ 11 C]-labelled pyrrole-2-carboxamide derivates, RS 2315 and RS 2360, along with the characterization of their in vivo properties. Methods: The radiolabelling of [ 11 C]-RS 2315 and [ 11 C]-RS 2360 was accomplished by alkylation of their amide precursors with [ 11 C]CH 3 I. Biodistribution, blocking and metabolite studies of both tracers were performed in NMRI mice. Finally, a PET study in Sprague-Dawley rats was performed for [ 11 C]-RS 2360. Results: Both tracers were obtained in a radiochemical yield of approximately 30% with radiochemical purity of >98%. Biodistribution studies showed high brain uptake followed by rapid brain clearance for both radiotracers. In the brain, [ 11 C]-RS 2360 was more stable than [ 11 C]-RS 2315. Blocking studies in mice could not demonstrate specificity of [ 11 C]-RS 2315 towards MAO-A or MAO-B. The blocking and imaging study with [ 11 C]-RS 2360 on the other hand indicated specific binding in MAO-A at the earliest time points. Conclusions: [ 11 C]-RS 2315 displayed a high nonspecific binding and is therefore not suitable for visualization of MAO-A in vivo. [ 11 C]-RS 2360 on the other hand has potential for mapping MAO-A since specific binding is demonstrated.

Mutations of CDKL5 Cause a Severe Neurodevelopmental Disorder with Infantile Spasms and Mental Retardation

Science.gov (United States)

Weaving, Linda S.; Christodoulou, John; Williamson, Sarah L.; Friend, Kathie L.; McKenzie, Olivia L. D.; Archer, Hayley; Evans, Julie; Clarke, Angus; Pelka, Gregory J.; Tam, Patrick P. L.; Watson, Catherine; Lahooti, Hooshang; Ellaway, Carolyn J.; Bennetts, Bruce; Leonard, Helen; Gécz, Jozef

2004-01-01

Rett syndrome (RTT) is a severe neurodevelopmental disorder caused, in most classic cases, by mutations in the X-linked methyl-CpG-binding protein 2 gene (MECP2). A large degree of phenotypic variation has been observed in patients with RTT, both those with and without MECP2 mutations. We describe a family consisting of a proband with a phenotype that showed considerable overlap with that of RTT, her identical twin sister with autistic disorder and mild-to-moderate intellectual disability, and a brother with profound intellectual disability and seizures. No pathogenic MECP2 mutations were found in this family, and the Xq28 region that contains the MECP2 gene was not shared by the affected siblings. Three other candidate regions were identified by microsatellite mapping, including 10.3 Mb at Xp22.31-pter between Xpter and DXS1135, 19.7 Mb at Xp22.12-p22.11 between DXS1135 and DXS1214, and 16.4 Mb at Xq21.33 between DXS1196 and DXS1191. The ARX and CDKL5 genes, both of which are located within the Xp22 region, were sequenced in the affected family members, and a deletion of nucleotide 183 of the coding sequence (c.183delT) was identified in CDKL5 in the affected family members. In a screen of 44 RTT cases, a single splice-site mutation, IVS13-1G→A, was identified in a girl with a severe phenotype overlapping RTT. In the mouse brain, Cdkl5 expression overlaps—but is not identical to—that of Mecp2, and its expression is unaffected by the loss of Mecp2. These findings confirm CDKL5 as another locus associated with epilepsy and X-linked mental retardation. These results also suggest that mutations in CDKL5 can lead to a clinical phenotype that overlaps RTT. However, it remains to be determined whether CDKL5 mutations are more prevalent in specific clinical subgroups of RTT or in other clinical presentations. PMID:15492925

No Association of BDNF, COMT, MAOA, SLC6A3, and SLC6A4 Genes and Depressive Symptoms in a Sample of Healthy Colombian Subjects.

Science.gov (United States)

González-Giraldo, Yeimy; Camargo, Andrés; López-León, Sandra; Forero, Diego A

2015-01-01

Background. Major depressive disorder (MDD) is the second cause of years lived with disability around the world. A large number of studies have been carried out to identify genetic risk factors for MDD and related endophenotypes, mainly in populations of European and Asian descent, with conflicting results. The main aim of the current study was to analyze the possible association of five candidate genes and depressive symptoms in a Colombian sample of healthy subjects. Methods and Materials. The Spanish adaptation of the Hospital Anxiety and Depression Scale (HADS) was applied to one hundred eighty-eight healthy Colombian subjects. Five functional polymorphisms were genotyped using PCR-based assays: BDNF-Val66Met (rs6265), COMT-Val158Met (rs4680), SLC6A4-HTTLPR (rs4795541), MAOA-uVNTR, and SLC6A3-VNTR (rs28363170). Result. We did not find significant associations with scores of depressive symptoms, derived from the HADS, for any of the five candidate genes (nominal p values >0.05). In addition, we did not find evidence of significant gene-gene interactions. Conclusion. This work is one of the first studies of candidate genes for depressive symptoms in a Latin American sample. Study of additional genetic and epigenetic variants, taking into account other pathophysiological theories, will help to identify novel candidates for MDD in populations around the world.

Tissue Inhibitor of Matrix Metalloproteinase-1 Promotes Myocardial Fibrosis by Mediating CD63-Integrin β1 Interaction.

Science.gov (United States)

Takawale, Abhijit; Zhang, Pu; Patel, Vaibhav B; Wang, Xiuhua; Oudit, Gavin; Kassiri, Zamaneh

2017-06-01

Myocardial fibrosis is excess accumulation of the extracellular matrix fibrillar collagens. Fibrosis is a key feature of various cardiomyopathies and compromises cardiac systolic and diastolic performance. TIMP1 (tissue inhibitor of metalloproteinase-1) is consistently upregulated in myocardial fibrosis and is used as a marker of fibrosis. However, it remains to be determined whether TIMP1 promotes tissue fibrosis by inhibiting extracellular matrix degradation by matrix metalloproteinases or via an matrix metalloproteinase-independent pathway. We examined the function of TIMP1 in myocardial fibrosis using Timp1 -deficient mice and 2 in vivo models of myocardial fibrosis (angiotensin II infusion and cardiac pressure overload), in vitro analysis of adult cardiac fibroblasts, and fibrotic myocardium from patients with dilated cardiomyopathy (DCM). Timp1 deficiency significantly reduced myocardial fibrosis in both in vivo models of cardiomyopathy. We identified a novel mechanism for TIMP1 action whereby, independent from its matrix metalloproteinase-inhibitory function, it mediates an association between CD63 (cell surface receptor for TIMP1) and integrin β1 on cardiac fibroblasts, initiates activation and nuclear translocation of Smad2/3 and β-catenin, leading to de novo collagen synthesis. This mechanism was consistently observed in vivo, in cultured cardiac fibroblasts, and in human fibrotic myocardium. In addition, after long-term pressure overload, Timp1 deficiency persistently reduced myocardial fibrosis and ameliorated diastolic dysfunction. This study defines a novel matrix metalloproteinase-independent function of TIMP1 in promoting myocardial fibrosis. As such targeting TIMP1 could prove to be a valuable approach in developing antifibrosis therapies. © 2017 American Heart Association, Inc.

Refinement of the NHS locus on chromosome Xp22.13 and analysis of five candidate genes.

Science.gov (United States)

Toutain, Annick; Dessay, Benoît; Ronce, Nathalie; Ferrante, Maria-Immacolata; Tranchemontagne, Julie; Newbury-Ecob, Ruth; Wallgren-Pettersson, Carina; Burn, John; Kaplan, Josseline; Rossi, Annick; Russo, Silvia; Walpole, Ian; Hartsfield, James K; Oyen, Nina; Nemeth, Andrea; Bitoun, Pierre; Trump, Dorothy; Moraine, Claude; Franco, Brunella

2002-09-01

Nance-Horan syndrome (NHS) is an X-linked condition characterised by congenital cataracts, dental abnormalities, dysmorphic features, and mental retardation in some cases. Previous studies have mapped the disease gene to a 2 cM interval on Xp22.2 between DXS43 and DXS999. We report additional linkage data resulting from the analysis of eleven independent NHS families. A maximum lod score of 9.94 (theta=0.00) was obtained at the RS1 locus and a recombination with locus DXS1195 on the telomeric side was observed in two families, thus refining the location of the gene to an interval of around 1 Mb on Xp22.13. Direct sequencing or SSCP analysis of the coding exons of five genes (SCML1, SCML2, STK9, RS1 and PPEF1), considered as candidate genes on the basis of their location in the critical interval, failed to detect any mutation in 12 unrelated NHS patients, thus making it highly unlikely that these genes are implicated in NHS.

Influence of Expression Plasmid of Connective Tissue Growth Factor and Tissue Inhibitor of Metalloproteinase-1 shRNA on Hepatic Precancerous Fibrosis in Rats.

Science.gov (United States)

Zhang, Qun; Shu, Fu-Li; Jiang, Yu-Feng; Huang, Xin-En

2015-01-01

In this study, influence caused by expression plasmids of connective tissue growth factor (CTGF) and tissue inhibitor of metalloproteinase-1 (TIMP-1) short hairpin RNA (shRNA) on mRNA expression of CTGF,TIMP-1,procol-α1 and PCIII in hepatic tissue with hepatic fibrosis, a precancerous condition, in rats is analyzed. To screen and construct shRNA expression plasimid which effectively interferes RNA targets of CTGF and TIMP-1 in rats. 50 cleaning Wistar male rats are allocated randomly at 5 different groups after precancerous fibrosis models and then injection of shRNA expression plasimids. Plasmid psiRNA-GFP-Com (CTGF and TIMP-1 included), psiRNA-GFP-CTGF, psiRNA-GFP-TIMP-1 and psiRNA- DUO-GFPzeo of blank plasmid are injected at group A, B, C and D, respectively, and as model control group that none plasimid is injected at group E. In 2 weeks after last injection, to hepatic tissue at different groups, protein expression of CTGF, TIMP-1, procol-α1and PC III is tested by immunohistochemical method and,mRNA expression of CTGF,TIMP-1,procol-α1 and PCIII is measured by real-time PCR. One-way ANOVA is used to comparison between-groups. Compared with model group, there is no obvious difference of mRNA expression among CTGF,TIMP-1,procol-α1,PC III and of protein expression among CTGF, TIMP-1, procol-α1, PC III in hepatic tissue at group injected with blank plasmid. Expression quantity of mRNA of CTGF, TIMP-1, procol-α1 and PCIII at group A, B and C decreases, protein expression of CTGF, TIMP-1, procol-α1, PC III in hepatic tissue is lower, where the inhibition of combination RNA interference group (group A) on procol-α1 mRNA transcription and procol-α1 protein expression is superior to that of single interference group (group B and C) (P<0.01 or P<0.05). RNA interference on CTGF and/or TIMP-1 is obviously a inhibiting factor for mRNA and protein expression of CTGF, TIMP-1, procol-α1 and PCIII. Combination RNA interference on genes of CTGF and TIMP-1 is superior

Verbal episodic memory in 426 multiple sclerosis patients: impairment in encoding, retrieval or both?

Science.gov (United States)

Brissart, H; Morele, E; Baumann, C; Debouverie, M

2012-10-01

Episodic memory is frequently impaired in multiple sclerosis (MS) patients but the exact nature of the disorder is controversial. It was initially thought to be due to a retrieval deficit but some studies have demonstrated an encoding deficit, which could be linked to a slowing of information processing speed or to a deficit in elaboration of strategies. The main objective of this study is to assess the prevalence and the nature of verbal episodic memory (VEM) impairment in MS patients. We retrieved memory performances of 426 patients [314 F-112 M; mean age: 46.1 years; median Expanded Disability Status Scale (EDSS) score: 3.1] from a neuropsychological data base. VEM was assessed using the 16 words RL-RI 16 test. 66% MS patients present at least one recall impaired in VEM (37.2% from 2 to 5 recall). 14.2% MS patients present an impairment in encoding phase. We observed that 5% of patients presented recognition difficulties. Correlations were observed between VEM performances and EDSS, and disease duration but no group effect (ANOVA) is observed between form of MS and VEM performances. These results confirm the high prevalence of VEM impairment in MS patients. Deficits affect mainly information retrieval in early stage MS patients and are then linked to encoding as disability increases. Storage disorders are infrequent, so cognitive rehabilitation with mental imaging could be effective in MS patients.

Dgroup: DG01277 [KEGG MEDICUS

Lifescience Database Archive (English)

Full Text Available DG01277 Chemical ... DGroup Pirlindole ... D08392 ... Pirlindole (INN) D08393 ... Pirlindole hydrochloride Neuropsychi...atric agent ... DG01568 ... MAO inhibitor ... DG01558 ... Monoamine oxidase A inhibitor ... Reversible monoamine oxidase A (MAO-A) inhibitor MAOA [HSA:4128] [KO:K00274] ...

Active site loop conformation regulates promiscuous activity in a lactonase from Geobacillus kaustophilus HTA426.

Directory of Open Access Journals (Sweden)

Yu Zhang

Full Text Available Enzyme promiscuity is a prerequisite for fast divergent evolution of biocatalysts. A phosphotriesterase-like lactonase (PLL from Geobacillus kaustophilus HTA426 (GkaP exhibits main lactonase and promiscuous phosphotriesterase activities. To understand its catalytic and evolutionary mechanisms, we investigated a "hot spot" in the active site by saturation mutagenesis as well as X-ray crystallographic analyses. We found that position 99 in the active site was involved in substrate discrimination. One mutant, Y99L, exhibited 11-fold improvement over wild-type in reactivity (kcat/Km toward the phosphotriesterase substrate ethyl-paraoxon, but showed 15-fold decrease toward the lactonase substrate δ-decanolactone, resulting in a 157-fold inversion of the substrate specificity. Structural analysis of Y99L revealed that the mutation causes a ∼6.6 Å outward shift of adjacent loop 7, which may cause increased flexibility of the active site and facilitate accommodation and/or catalysis of organophosphate substrate. This study provides for the PLL family an example of how the evolutionary route from promiscuity to specificity can derive from very few mutations, which promotes alteration in the conformational adjustment of the active site loops, in turn draws the capacity of substrate binding and activity.

Extracellular Matrix Regulations of Membrane Type 1 - Matrix Metalloproteinasis (MT1-MMP) and Matrix Metalloproteinase-2 (MMP-2) in Human Breast Fibroblasts

National Research Council Canada - National Science Library

Harnandez-Barrantes, Sonia

2001-01-01

.... Thus, under certain conditions, TIMP-2 is a positive regulator of MMP activity. TIMP-4, a close homologue of TIMP-2 also binds to pro-MMP- 2 and can potentially participate in pro-MMP-2 activation...

A new nonsyndromic X-linked sensorineural hearing impairment linked to Xp21.2

Energy Technology Data Exchange (ETDEWEB)

Lalwani, A.K.; Brister, J.R.; Fex, J.; Grundfast, K.M.; Pikus, A.T.; Ploplis, B.; San Agustin, T.; Skarka, H.; Wilcox, E.R. [National Institutes of Health, Bethesda, MD (United States)

1994-10-01

X-linked deafness is a rare cause of hereditary hearing impairment. We have identified a family with X-linked dominant sensorineural hearing impairment, characterized by incomplete penetrance and variable expressivity in carrier females, that is linked to the Xp21.2, which contains the Duchenne muscular dystrophy (DMD) locus. The auditory impairment in affected males was congenital, bilateral, profound, sensorineural, affecting all frequencies, and without evidence of radiographic abnormality of the temporal bone. Adult carrier females manifested bilateral, mild-to-moderate high-frequency sensorineural hearing impairment of delayed onset during adulthood. Eighteen commercially available polymorphic markers from the X chromosome, generating a 10-15-cM map, were initially used for identification of a candidate region. DXS997, located within the DMD gene, generated a two-point LOD score of 2.91 at {theta} = 0, with every carrier mother heterozygous at this locus. Recombination events at DXS992 (located within the DMD locus, 3{prime} to exon 50 of the dystrophin gene) and at DXS1068 (5{prime} to the brain promoter of the dystrophin gene) were observed. No recombination events were noted with the following markers within the DMD locus: 5{prime}DYS II, intron 44, DXS997, and intron 50. There was no clinical evidence of Duchenne or Becker muscular dystrophy in any family member. It is likely that this family represents a new locus on the X chromosome, which when mutated results in nonsyndromic sensorineural hearing loss and is distinct from the heterogeneous group of X-linked hearing losses that have been previously described. 57 refs., 6 figs., 1 tab.

Radiosynthesis and in vivo evaluation of [{sup 11}C]-labelled pyrrole-2-carboxamide derivates as novel radioligands for PET imaging of monoamine oxidase A

Energy Technology Data Exchange (ETDEWEB)

De Bruyne, Sylvie [Laboratory for Radiopharmacy, Ghent University, 9000 Ghent (Belgium); La Regina, Giuseppe [Istituto Pasteur, Fondazione Cenci Bolognetti, Dipartimento di Chimica e Tecnologie del Farmaco, Sapienza Universita di Roma, I-00185 Rome (Italy); Staelens, Steven [IBITECH-Medisip, Ghent University-IBBT, 9000 Ghent (Belgium); Wyffels, Leonie [Laboratory for Radiopharmacy, Ghent University, 9000 Ghent (Belgium); Deleye, Steven [IBITECH-Medisip, Ghent University-IBBT, 9000 Ghent (Belgium); Silvestri, Romano [Istituto Pasteur, Fondazione Cenci Bolognetti, Dipartimento di Chimica e Tecnologie del Farmaco, Sapienza Universita di Roma, I-00185 Rome (Italy); De Vos, Filip [Laboratory for Radiopharmacy, Ghent University, 9000 Ghent (Belgium)], E-mail: filipx.devos@ugent.be

2010-05-15

Introduction: Since MAO-A is an enzyme involved in the metabolism of neurotransmitters, fluctuations in MAO-A functionality are associated with psychiatric and neurological disorders as well as with tobacco addiction and behaviour. This study reports the radiolabelling of two [{sup 11}C]-labelled pyrrole-2-carboxamide derivates, RS 2315 and RS 2360, along with the characterization of their in vivo properties. Methods: The radiolabelling of [{sup 11}C]-RS 2315 and [{sup 11}C]-RS 2360 was accomplished by alkylation of their amide precursors with [{sup 11}C]CH{sub 3}I. Biodistribution, blocking and metabolite studies of both tracers were performed in NMRI mice. Finally, a PET study in Sprague-Dawley rats was performed for [{sup 11}C]-RS 2360. Results: Both tracers were obtained in a radiochemical yield of approximately 30% with radiochemical purity of >98%. Biodistribution studies showed high brain uptake followed by rapid brain clearance for both radiotracers. In the brain, [{sup 11}C]-RS 2360 was more stable than [{sup 11}C]-RS 2315. Blocking studies in mice could not demonstrate specificity of [{sup 11}C]-RS 2315 towards MAO-A or MAO-B. The blocking and imaging study with [{sup 11}C]-RS 2360 on the other hand indicated specific binding in MAO-A at the earliest time points. Conclusions: [{sup 11}C]-RS 2315 displayed a high nonspecific binding and is therefore not suitable for visualization of MAO-A in vivo. [{sup 11}C]-RS 2360 on the other hand has potential for mapping MAO-A since specific binding is demonstrated.

[Matrix metalloproteinases and their inhibitors in lung cancer with malignant pleural effusion].

Science.gov (United States)

Moche, M; Hui, D S C; Huse, K; Chan, K S; Choy, D K L; Scholz, G H; Gosse, H; Winkler, J; Schauer, J; Sack, U; Hoheisel, G

2005-08-01

Matrix metalloproteinases (MMP) and tissue inhibitors of metalloproteinases (TIMP) play a crucial role in physiological and pathological matrix turnover. This study aimed to determine the occurrence of MMP and TIMP in lung cancer patients with malignant pleural effusions (CA). MMP-1, MMP-2, MMP-3, MMP-8, MMP-9, TIMP-1, and IMP-2 oncentrations were determined by ELISA and zymography in pleural effusions and plasma of 31 CA and 14 congestive heart failure (CHF) patients and in plasma of 18 healthy controls (CON). MMP-2, TIMP-1, and TIMP-2 ELISA-concentrations were increased in CA pleural fluid vs. CA plasma (p < 0.005, p < 0.005, p < 0.05), in contrast to MMP-9 being higher in plasma (p < 0.005). Pleural fluid MMP-1 and MMP-8 were increased in CA vs. CHF (p < 0.05, p < 0.005). MMP and TIMP plasma concentrations were not different in CA vs. CHF, but MMP-9, TIMP-1, and TIMP-2 were increased vs. CON (p < 0.005, each). Gelatine zymography MMP-9/MMP-2 ratios were increased in CA plasma vs. effusion fluid (p < 0.005), in CA vs. CHF plasma, CA vs. CHF effusions (p < 0.005 each), and in CA vs. CON plasma (p < 0.05). MMP-2, TIMP-1, and TIMP-2 accumulate in the pleural compartment in CA and CHF, probably reflecting an unspecific pleural reaction. MMP-1 and MMP-8 are increased in cellular rich CA pleural effusions only. The determination of MMP-9/MMP-2 ratios in pleural fluid may contribute to differentiate CHF from CA effusions.

Regulation of matrix metalloproteinase-9 (MMP-9), tissue inhibitor of MMP, and progesterone secretion in luteinized granulosa cells from normally ovulating women with polycystic ovary disease.

Science.gov (United States)

Ben-Shlomo, Izhar; Goldman, Shlomit; Shalev, Eliezer

2003-03-01

To investigate the regulation of MMP-9, TIMP-1, and progesterone via three signal transduction pathways in luteinized granulosa cells from normal ovulatory and PCOD women. In vitro study. Laboratory for Research in Reproductive Sciences, Department of Obstetrics and Gynecology, Ha'Emek Hospital, Afula, Israel. Ten normal ovulatory and 10 women with polycystic ovary disease (PCOD) treated in an assisted reproduction program. Cultured cells were exposed to phorbol 12-myristate 13-acetate (TPA), acting via protein kinase C (PKC), to epidermal growth factor (EGF), acting via protein tyrosine kinase (PTK), and to forskolin, acting via protein kinase A (PKA). Secretion of MMP-9, TIMP-1, and progesterone. Phorbol 12-myristate 13-acetate elicited an increase in MMP-9 and TIMP-1 secretion in both groups and apparently did not affect progesterone secretion. Epidermal growth factor did not change significantly neither MMP-9 nor TIMP-1 secretion but dose dependently decreased MMP-9-TIMP-1 ratio and increased progesterone secretion in the PCOD group. Forskolin inhibited MMP-9 activity and increased TIMP-1 and progesterone secretion in both groups. Progesterone production was inversely related to the ratio of MMP-9-TIMP-1 regardless of cell origin. In this preliminary study, similar and divergent patterns have emerged in the regulation of MMP-9 and TIMP-1 in human luteinized granulosa cells. Repressing MMP-9-TIMP-1 ratio may have an important modulatory effect on progesterone secretion.

Tissue inhibitor of metalloproteinases-1 in breast cancer

DEFF Research Database (Denmark)

Würtz, Sidse Ørnbjerg; Rasmussen, Anne-Sofie Schrohl; Sørensen, Nanna Møller

2005-01-01

Whether patients diagnosed with primary breast cancer are offered adjuvant systemic therapy following surgical removal of the tumor is based on prognosis. Prognosis is estimated in every patient using established prognostic variables. Unfortunately, when using the currently available prognostic...... parameters a significant proportion of patients are over-treated. Thus, in order to improve stratification of breast cancer patients, additional prognostic factors need to be identified. Tissue inhibitor of metalloproteinases-1 (TIMP-1) is one of the promising candidates for new prognostic markers in breast...... cancer, as a number of studies have demonstrated an association between high tumor-tissue levels of TIMP-1 mRNA as well as TIMP-1 protein and a poor prognosis of breast cancer patients. TIMP-1 is a member of the TIMP family, currently comprising four members (TIMP-1-4), and its main function...

Correlation of serum and urinary matrix metalloproteases/tissue inhibitors of metalloproteases with subclinical allograft fibrosis in renal transplantation.

Science.gov (United States)

Hirt-Minkowski, Patricia; Marti, Hans-Peter; Hönger, Gideon; Grandgirard, Denis; Leib, Stephen L; Amico, Patrizia; Schaub, Stefan

2014-01-01

Progressive interstitial fibrosis and tubular atrophy (IF/TA) is a leading cause of chronic allograft dysfunction. Increased extracellular matrix remodeling regulated by matrix metalloproteases (MMPs) and their inhibitors (TIMPs) has been implicated in the development of IF/TA. The aim of this study was to investigate whether urinary/serum MMPs/TIMPs correlate with subclinical IF/TA detected in surveillance biopsies within the first 6months post-transplant. We measured eight different MMPs/TIMPs simultaneously in urine and serum samples from patients classified as normal histology (n=15), IF/TA 1 (n=15) and IF/TA 2-3 (n=10). There was no difference in urinary MMPs/TIMPs among the three groups, and only 1/8 serum MMPs/TIMPs (i.e. MMP-1) was significantly elevated in biopsies with IF/TA 2-3 (p=0.01). In addition, urinary/serum MMPs/TIMPs were not different between surveillance biopsies demonstrating an early development of IF/TA (i.e. delta IF/TA≥1 compared to a previous biopsy obtained three months before; n=11) and stable grade of IF/TA (i.e. delta IF/TA=0; n=20). Next, we investigated whether urinary/serum MMP/TIMP levels are elevated during acute subclinical tubulitis in surveillance biopsies obtained within the first 6months post-transplant (n=25). Compared to biopsies with normal histology, serum MMPs/TIMPs were not different; however, all urinary MMP/TIMP levels were numerically higher during subclinical tubulitis (MMP-1, MMP-7, TIMP-1 with p≤0.04). We conclude that urinary/serum MMPs/TIMPs do hardly correlate with existing or early developing IF/TA in surveillance biopsies obtained within the first 6months post-transplant. This could be explained by the dynamic process of extracellular matrix remodeling, which seems to be active during acute tubulo-interstitial injury/inflammation, but not in quiescent IF/TA. Copyright © 2013 Elsevier B.V. All rights reserved.

Dextran-shelled oxygen-loaded nanodroplets reestablish a normoxia-like pro-angiogenic phenotype and behavior in hypoxic human dermal microvascular endothelium

International Nuclear Information System (INIS)

Basilico, Nicoletta; Magnetto, Chiara; D'Alessandro, Sarah; Panariti, Alice; Rivolta, Ilaria; Genova, Tullio; Khadjavi, Amina; Gulino, Giulia Rossana; Argenziano, Monica; Soster, Marco

2015-01-01

In chronic wounds, hypoxia seriously undermines tissue repair processes by altering the balances between pro-angiogenic proteolytic enzymes (matrix metalloproteinases, MMPs) and their inhibitors (tissue inhibitors of metalloproteinases, TIMPs) released from surrounding cells. Recently, we have shown that in human monocytes hypoxia reduces MMP-9 and increases TIMP-1 without affecting TIMP-2 secretion, whereas in human keratinocytes it reduces MMP-2, MMP-9, and TIMP-2, without affecting TIMP-1 release. Provided that the phenotype of the cellular environment is better understood, chronic wounds might be targeted by new oxygenating compounds such as chitosan- or dextran-shelled and 2H,3H-decafluoropentane-cored oxygen-loaded nanodroplets (OLNs). Here, we investigated the effects of hypoxia and dextran-shelled OLNs on the pro-angiogenic phenotype and behavior of human dermal microvascular endothelium (HMEC-1 cell line), another cell population playing key roles during wound healing. Normoxic HMEC-1 constitutively released MMP-2, TIMP-1 and TIMP-2 proteins, but not MMP-9. Hypoxia enhanced MMP-2 and reduced TIMP-1 secretion, without affecting TIMP-2 levels, and compromised cell ability to migrate and invade the extracellular matrix. When taken up by HMEC-1, nontoxic OLNs abrogated the effects of hypoxia, restoring normoxic MMP/TIMP levels and promoting cell migration, matrix invasion, and formation of microvessels. These effects were specifically dependent on time-sustained oxygen diffusion from OLN core, since they were not achieved by oxygen-free nanodroplets or oxygen-saturated solution. Collectively, these data provide new information on the effects of hypoxia on dermal endothelium and support the hypothesis that OLNs might be used as effective adjuvant tools to promote chronic wound healing processes. - Highlights: • Hypoxia enhances MMP-2 and reduces TIMP-1 secretion by dermal HMEC-1 cell line. • Hypoxia compromises migration and matrix invasion abilities of

Dextran-shelled oxygen-loaded nanodroplets reestablish a normoxia-like pro-angiogenic phenotype and behavior in hypoxic human dermal microvascular endothelium

Energy Technology Data Exchange (ETDEWEB)

Basilico, Nicoletta, E-mail: nicoletta.basilico@unimi.it [Dipartimento di Scienze Biomediche, Chirurgiche e Odontoiatriche, Università di Milano, via Pascal 36, 20133 Milano (Italy); Magnetto, Chiara, E-mail: c.magnetto@inrim.it [Istituto Nazionale di Ricerca Metrologica (INRIM), Strada delle Cacce, 91, 10135 Torino (Italy); D' Alessandro, Sarah, E-mail: sarah.dalessandro@unimi.it [Dipartimento di Scienze Farmacologiche e Biomolecolari, Università di Milano, via Pascal 36, 20133 Milano (Italy); Panariti, Alice, E-mail: alice.panariti@mail.mcgill.ca [Dipartimento di Scienze della Salute, Università di Milano Bicocca, Via Cadore 48, 20900 Monza (Italy); Rivolta, Ilaria, E-mail: ilaria.rivolta@unimib.it [Dipartimento di Scienze della Salute, Università di Milano Bicocca, Via Cadore 48, 20900 Monza (Italy); Genova, Tullio, E-mail: tullio.genova@unito.it [Dipartimento di Scienze della Vita e Biologia dei Sistemi, Via Accademia Albertina 13, 10123 Torino (Italy); Khadjavi, Amina, E-mail: amina.khadjavi@unito.it [Dipartimento di Neuroscienze, Università di Torino, Corso Raffaello 30, 10125 Torino (Italy); Gulino, Giulia Rossana, E-mail: giuliarossana.gulino@unito.it [Dipartimento di Oncologia, Università di Torino, Via Santena 5 bis, 10126 Torino (Italy); Argenziano, Monica, E-mail: monica.argenziano@unito.it [Dipartimento di Scienza e Tecnologia del Farmaco, Università di Torino, Via Giuria, 9, 10125 Torino (Italy); Soster, Marco, E-mail: marco.soster@unito.it [Dipartimento di Scienza e Tecnologia del Farmaco, Università di Torino, Via Giuria, 9, 10125 Torino (Italy); and others

2015-11-01

In chronic wounds, hypoxia seriously undermines tissue repair processes by altering the balances between pro-angiogenic proteolytic enzymes (matrix metalloproteinases, MMPs) and their inhibitors (tissue inhibitors of metalloproteinases, TIMPs) released from surrounding cells. Recently, we have shown that in human monocytes hypoxia reduces MMP-9 and increases TIMP-1 without affecting TIMP-2 secretion, whereas in human keratinocytes it reduces MMP-2, MMP-9, and TIMP-2, without affecting TIMP-1 release. Provided that the phenotype of the cellular environment is better understood, chronic wounds might be targeted by new oxygenating compounds such as chitosan- or dextran-shelled and 2H,3H-decafluoropentane-cored oxygen-loaded nanodroplets (OLNs). Here, we investigated the effects of hypoxia and dextran-shelled OLNs on the pro-angiogenic phenotype and behavior of human dermal microvascular endothelium (HMEC-1 cell line), another cell population playing key roles during wound healing. Normoxic HMEC-1 constitutively released MMP-2, TIMP-1 and TIMP-2 proteins, but not MMP-9. Hypoxia enhanced MMP-2 and reduced TIMP-1 secretion, without affecting TIMP-2 levels, and compromised cell ability to migrate and invade the extracellular matrix. When taken up by HMEC-1, nontoxic OLNs abrogated the effects of hypoxia, restoring normoxic MMP/TIMP levels and promoting cell migration, matrix invasion, and formation of microvessels. These effects were specifically dependent on time-sustained oxygen diffusion from OLN core, since they were not achieved by oxygen-free nanodroplets or oxygen-saturated solution. Collectively, these data provide new information on the effects of hypoxia on dermal endothelium and support the hypothesis that OLNs might be used as effective adjuvant tools to promote chronic wound healing processes. - Highlights: • Hypoxia enhances MMP-2 and reduces TIMP-1 secretion by dermal HMEC-1 cell line. • Hypoxia compromises migration and matrix invasion abilities of

Clinical, biochemical, and neuropsychiatric evaluation of a patient with a contiguous gene syndrome due to a microdeletion Xp11.3 including the Norrie disease locus and monoamine oxidase (MAOA and MAOB) genes.

Science.gov (United States)

Collins, F A; Murphy, D L; Reiss, A L; Sims, K B; Lewis, J G; Freund, L; Karoum, F; Zhu, D; Maumenee, I H; Antonarakis, S E

1992-01-01

Norrie disease is a rare X-linked recessive disorder characterized by blindness from infancy. The gene for Norrie disease has been localized to Xp11.3. More recently, the genes for monoamine oxidase (MAOA, MAOB) have been mapped to the same region. This study evaluates the clinical, biochemical, and neuropsychiatric data in an affected male and 2 obligate heterozygote females from a single family with a submicroscopic deletion involving Norrie disease and MAO genes. The propositus was a profoundly retarded, blind male; he also had neurologic abnormalities including myoclonus and stereotopy-habit disorder. Both obligate carrier females had a normal IQ. The propositus' mother met diagnostic criteria for "chronic hypomania and schizotypal features." The propositus' MAO activity was undetectable and the female heterozygotes had reduced levels comparable to patients receiving MAO inhibiting antidepressants. MAO substrate and metabolite abnormalities were found in the propositus' plasma and CSF. This study indicates that subtle biochemical and possibly neuropsychiatric abnormalities may be detected in some heterozygotes with the microdeletion in Xp11.3 due to loss of the gene product for the MAO genes; this deletion can also explain some of the complex phenotype of this contiguous gene syndrome in the propositus.

Metalloproteinases and their inhibitors are influenced by inhalative glucocorticoid therapy in combination with environmental dust reduction in equine recurrent airway obstruction.

Science.gov (United States)

Barton, Ann Kristin; Shety, Tarek; Bondzio, Angelika; Einspanier, Ralf; Gehlen, Heidrun

2016-12-09

Overexpression of matrix-metalloproteinases (MMPs) has been shown to lead to tissue damage in equine recurrent airway obstruction (RAO), as a misbalance with their natural inhibitors, the tissue inhibitors of metalloproteinases (TIMPs), occurs. This favors irreversible pulmonary fibrosis formation. Increased levels of MMPs, TIMPs or altered ratios between them can be used as biomarkers of respiratory disease. We hypothesized that levels of MMPs, TIMPs and their ratios correlate with improvement in clinical findings and bronchoalveolar lavage fluid (BALF) cytology after 10 days of inhalative glucocorticoid therapy and environmental dust reduction (EDR) and may be used to monitor treatment success. Ten horses with a history of RAO participated in a prospective clinical study. Clinical and cytological scoring was performed before and after inhalative therapy using budesonide (1500 μg BID over 10 days) and EDR (bedding of wood shavings and wet hay as roughage). Gelatin zymography was performed for qualitative and semi-quantitative evaluation of MMP-2 and MMP-9 in BALF supernatant, while fluorimetry was used to evaluate MMP-8 activity. Additionally, specific equine ELISA assays were used for quantitative assessment of MMP-2, MMP-9, TIMP-1 and TIMP-2. A significant reduction in the total and several single parameters of the clinical score were found after 10 days of inhalative therapy and EDR. The concentrations of MMP-2, MMP-9, TIMP-1 and TIMP-2 (ELISA) as well as their activities (MMP-2 and MMP-9 zymography and MMP-8 fluorimetry) were significantly decreased after therapy. Significant improvements in MMP-8/TIMP-1 and MMP-8/TIMP-2 ratios were also found, differences between other ratios before and after therapy were insignificant. Metalloproteinases and their inhibitors, in particular MMP-9 and TIMP-2, are valuable markers for clinical improvement in RAO.

18 CFR 367.106 - Accounts 426.1, 426.2, 426.3, 426.4, and 426.5, Miscellaneous expense accounts.

Science.gov (United States)

2010-04-01

... PUBLIC UTILITY HOLDING COMPANY ACT OF 2005, FEDERAL POWER ACT AND NATURAL GAS ACT UNIFORM SYSTEM OF ACCOUNTS FOR CENTRALIZED SERVICE COMPANIES SUBJECT TO THE PROVISIONS OF THE PUBLIC UTILITY HOLDING COMPANY... miscellaneous expense items which are nonoperating in nature but which are properly deductible before...

Smad signaling pathway is a pivotal component of tissue inhibitor of metalloproteinases-3 regulation by transforming growth factor beta in human chondrocytes.

Science.gov (United States)

Qureshi, Hamid Yaqoob; Ricci, Gemma; Zafarullah, Muhammad

2008-09-01

Transforming growth factor beta (TGF-beta1) promotes cartilage matrix synthesis and induces tissue inhibitor of metalloproteinases-3 (TIMP-3), which inhibits matrix metalloproteinases, aggrecanases and TNF-alpha-converting enzyme implicated in articular cartilage degradation and joint inflammation. TGF-beta1 activates Akt, ERK and Smad2 pathways in chondrocytes. Here we investigated previously unexplored roles of specific Smads in TGF-beta1 induction of TIMP-3 gene by pharmacological and genetic knockdown approaches. TGF-beta1-induced Smad2 phosphorylation and TIMP-3 protein expression could be inhibited by the Smad2/3 phosphorylation inhibitors, PD169316 and SB203580 and by Smad2-specific siRNA. Specific inhibitor of Smad3 (SIS3) and Smad3 siRNA abolished TGF-beta induction of TIMP-3. Smad2/3 siRNAs also down regulated TIMP-3 promoter-driven luciferase activities, suggesting transcriptional regulation. SiRNA-driven co-Smad4 knockdown abrogated TIMP-3 augmentation by TGF-beta. TIMP-3 promoter deletion analysis revealed that -828 deletion retains the original promoter activity while -333 and -167 deletions display somewhat reduced activity suggesting that most of the TGF-beta-responsive, cis-acting elements are found in the -333 fragment. Chromatin Immunoprecipitation (ChIP) analysis confirmed binding of Smad2 and Smad4 with the -940 and -333 promoter sequences. These results suggest that receptor-activated Smad2 and Smad3 and co-Smad4 critically mediate TGF-beta-stimulated TIMP-3 expression in human chondrocytes and TIMP-3 gene is a target of Smad signaling pathway.

Plasma tissue inhibitor of metalloproteinases-1 as a biological marker?

DEFF Research Database (Denmark)

Lomholt, Anne F.; Frederiksen, Camilla B.; Christensen, Ib J.

2007-01-01

Tissue Inhibitor of Metalloproteinases-1 (TIMP-1) may be a valuable biological marker in Colorectal Cancer (CRC). However, prospective validation of TIMP-1 as a biological marker should include a series of pre-analytical considerations. TIMP-1 is stored in platelets, which may degranulate during...

Specific genetic deficiencies of the A and B isoenzymes of monoamine oxidase are characterized by distinct neurochemical and clinical phenotypes

NARCIS (Netherlands)

Lenders, J. W.; Eisenhofer, G.; Abeling, N. G.; Berger, W.; Murphy, D. L.; Konings, C. H.; Wagemakers, L. M.; Kopin, I. J.; Karoum, F.; van Gennip, A. H.; Brunner, H. G.

1996-01-01

Monoamine oxidase (MAO) exists as two isoenzymes and plays a central role in the metabolism of monoamine neurotransmitters. In this study we compared the neurochemical phenotypes of previously described subjects with genetically determined selective lack of MAO-A or a lack of both MAO-A and MAO-B

Monoamine oxidase A polymorphism moderates stability of attention problems and susceptibility to life stress during adolescence.

Science.gov (United States)

Zohsel, K; Bianchi, V; Mascheretti, S; Hohm, E; Schmidt, M H; Esser, G; Brandeis, D; Banaschewski, T; Nobile, M; Laucht, M

2015-11-01

Attention problems affect a substantial number of children and adolescents and are predictive of academic underachievement and lower global adaptive functioning. Considerable variability has been observed with regard to the individual development of attention problems over time. In particular, the period of adolescence is characterized by substantial maturation of executive functioning including attentional processing, with the influence of genetic and environmental factors on individual trajectories not yet well understood. In the present investigation, we evaluated whether the monoamine oxidase A functional promoter polymorphism, MAOA-LPR, plays a role in determining continuity of parent-rated attention problems during adolescence. At the same time, a potential effect of severe life events (SLEs) was taken into account. A multi-group path analysis was used in a sample of 234 adolescents (149 males, 85 females) who took part in an epidemiological cohort study at the ages of 11 and 15 years. Attention problems during early adolescence were found to be a strong predictor of attention problems in middle adolescence. However, in carriers of the MAOA-LPR low-activity variant (MAOA-L), stability was found to be significantly higher than in carriers of the high-activity variant (MAOA-H). Additionally, only in MAOA-L carriers did SLEs during adolescence significantly impact on attention problems at the age of 15 years, implying a possible gene × environment interaction. To conclude, we found evidence that attention problems during adolescence in carriers of the MAOA-L allele are particularly stable and malleable to life stressors. The present results underline the usefulness of applying a more dynamic GxE perspective. © 2015 John Wiley & Sons Ltd and International Behavioural and Neural Genetics Society.

Do Matrix Metalloproteases and Tissue Inhibitors of Metalloproteases in Tenocytes of the Rotator Cuff Differ with Varying Donor Characteristics?

Directory of Open Access Journals (Sweden)

Franka Klatte-Schulz

2015-06-01

Full Text Available An imbalance between matrix metalloproteases (MMPs and the tissue inhibitors of metalloproteases (TIMPs may have a negative impact on the healing of rotator cuff tears. The aim of the project was to assess a possible relationship between clinical and radiographic characteristics of patients such as the age, sex, as well as the degenerative status of the tendon and the MMPs and TIMPs in their tenocyte-like cells (TLCs. TLCs were isolated from ruptured supraspinatus tendons and quantitative Real-Time PCR and ELISA was performed to analyze the expression and secretion of MMPs and TIMPs. In the present study, MMPs, mostly gelatinases and collagenases such as MMP-2, -9 and -13 showed an increased expression and protein secretion in TLCs of donors with higher age or degenerative status of the tendon. Furthermore, the expression and secretion of TIMP-1, -2 and -3 was enhanced with age, muscle fatty infiltration and tear size. The interaction between MMPs and TIMPs is a complex process, since TIMPs are not only inhibitors, but also activators of MMPs. This study shows that MMPs and TIMPs might play an important role in degenerative tendon pathologies.

[11C]befloxatone distribution is well correlated to monoamine oxidase A protein levels in the human brain.

Science.gov (United States)

Zanotti-Fregonara, Paolo; Bottlaender, Michel

2014-12-01

[(11)C]befloxatone is a positron emission tomography radioligand to image monoamine oxidase A (MAO-A) in the brain, which has been used in preclinical studies and in clinical protocols. However, a recent study found that [(11)C]befloxatone binding potential (k(3)/k(4)) has a poor correlation with MAO-A protein levels measured in the human brain. We here show that this poor correlation only depends on the choice of the parameter when performing kinetic modeling. In particular, the total volume of distribution of [(11)C]befloxatone shows a tight correlation with both protein and mRNA levels of MAO-A in the human brain.

Quantification of tissue inhibitor of metalloproteinases 2 in plasma from healthy donors and cancer patients

DEFF Research Database (Denmark)

Larsen, M. B.; Stephens, R. W.; Brünner, Nils

2005-01-01

Tissue inhibitor of metalloproteinases (TIMP)-2 is a highly conserved molecule, which binds both active and latent matrix metalloproteinase (MMP)-2. TIMP-2 is also involved in the activation of MMP-2 on the cell surface. A quantitative enzyme-linked immunosorbent assay (ELISA) was established...... and optimized for measurement of TIMP-2 in plasma. The capturing antibody in the ELISA was a monoclonal, while the detecting antibody was a chicken polyclonal antibody recognizing the native form of human TIMP-2. The levels of TIMP-2 were measured in ethylenediaminetetraacetic acid (EDTA) and citrate plasma...... from healthy donors. The median values were determined as 163 ng/ml (n = 186) with a range of 109-253 ng/ml for EDTA plasma and 139 ng/ml (n = 77) with a range of 95-223 ng/ml for citrate plasma. The TIMP-2 concentration in citrate plasma from 15 patients with advanced, stage IV breast cancer had...

Flowery odor formation revealed by differential expression of monoterpene biosynthetic genes and monoterpene accumulation in rose (Rosa rugosa Thunb.).

Science.gov (United States)

Feng, Liguo; Chen, Chen; Li, Tinglin; Wang, Meng; Tao, Jun; Zhao, Daqiu; Sheng, Lixia

2014-02-01

Rosa rugosa is an important ornamental and economical plant. In this paper, four genes encoding 1-deoxy-D-xylulose-5-phosphate synthase (DXS), 1-deoxy-d-xylulose-5-phosphate reductoisomerase (DXR), alcohol acyltransferase (AAT) and linalool synthase (LIS) involved in the monoterpene biosynthesis pathways were isolated from R. rugosa 'Tangzi', and the expression patterns of these genes in different flower development stages and different parts of floral organs were determined by real-time quantitative fluorescence PCR. Furthermore, a comprehensive analysis was carried out into the relationship between expression of four monoterpene synthesis genes and accumulation of main volatile monoterpenes and their acetic acid ester derivatives. The results showed that the genes RrDXS, RrDXR and RrLIS showed consistent expressions during the development process for R. rugosa flower from budding to withering stage, the overall expression levels of gene RrDXS and RrLIS were obviously lower as compared with those of gene RrDXR and RrAAT. Although the gene RrDXS, RrDXR, RrAAT and RrLIS were expressed in all parts of R. rugosa floral organs, the expression levels varied significantly. The variations in the constituent and content of volatile monoterpenes including citronellol, geraniol, nerol, linalool, citronellyl acetate, geranyl acetate and neryl acetate at different development stages and parts of floral organs were significantly different. On this basis, we concluded that the gene RrDXR and RrAAT might play a key role in the biosynthesis of volatile monoterpenes in R. rugosa flowers, and the two genes are important candidate genes for the regulation of secondary metabolism for rose aromatic components. Copyright © 2013 Elsevier Masson SAS. All rights reserved.

Mapping X-linked ophthalmic diseases. IV. Provisional assignment of the locus for X-linked congenital cataracts and microcornea (the Nance-Horan syndrome) to Xp22.2-p22.3.

Science.gov (United States)

Lewis, R A; Nussbaum, R L; Stambolian, D

1990-01-01

The Nance-Horan syndrome (NHS) is an infrequent X-linked disorder typified by dense congenital central cataracts, microcornea, anteverted and simplex pinnae, brachymetacarpalia, and numerous dental anomalies. The regional location of the genetic mutation causing NHS is unknown. The authors applied the modern molecular techniques of analysis of restriction fragment length polymorphisms to five multigenerational kindreds in which NHS segregated. Provisional linkage is established to two DNA markers--DXS143 at Xp22.3-p22.2 and DXS43 at Xp22.2. Regional localization of NHS will provide potential antenatal diagnosis in families at risk for the disease and will enhance understanding of the multifaceted genetic defects.

Downregulation of reversion-inducing cysteine-rich protein with Kazal motifs in malignant melanoma: inverse correlation with membrane-type 1-matrix metalloproteinase and tissue inhibitor of metalloproteinase 2.

Science.gov (United States)

Jacomasso, Thiago; Trombetta-Lima, Marina; Sogayar, Mari C; Winnischofer, Sheila M B

2014-02-01

The invasive phenotype of many tumors is associated with an imbalance between the matrix metalloproteinases (MMPs) and their inhibitors, tissue inhibitors of metalloproteinases (TIMPs), and the membrane-anchored reversion-inducing cysteine-rich protein with Kazal motifs (RECK). RECK inhibits MMP-2, MMP-9, and MT1-MMP, and has been linked to patient survival and better prognosis in several types of tumors. However, despite the wide implication of these MMPs in melanoma establishment and progression, the role of RECK in this type of tumor is still unknown. Here, we analyzed the expression of RECK, TIMP1, TIMP2, TIMP3, MT1MMP, MMP2, and MMP9 in two publicly available melanoma microarray datasets and in a panel of human melanoma cell lines. We found that RECK is downregulated in malignant melanoma, accompanied by upregulation of MT1MMP and TIMP2. In both datasets, we observed that the group of samples displaying higher RECK levels show lower median expression levels of MT1MMP and TIMP2 and higher levels of TIMP3. When tested in a sample-wise manner, these correlations were statistically significant. Inverse correlations between RECK, MT1MMP, and TIMP2 were verified in a panel of human melanoma cell lines and in a further reduced model that includes a pair of matched primary tumor-derived and metastasis-derived cell lines. Taken together, our data indicate a consistent correlation between RECK, MT1MMP, and TIMP2 across different models of clinical samples and cell lines and suggest evidence of the potential use of this subset of genes as a gene signature for diagnosing melanoma.

Modulation of Matrix Metalloproteinase 14, Tissue Inhibitor of Metalloproteinase 3, Tissue Inhibitor of Metalloproteinase 4, and Inducible Nitric Oxide Synthase in the Development of Periapical Lesions.

Science.gov (United States)

Cassanta, Lorena Teodoro de Castro; Rodrigues, Virmondes; Violatti-Filho, Jose Roberto; Teixeira Neto, Benedito Alves; Tavares, Vinícius Marques; Bernal, Eduarda Castelo Branco Araujo; Souza, Danila Malheiros; Araujo, Marcelo Sivieri; de Lima Pereira, Sanivia Aparecida; Rodrigues, Denise Bertulucci Rocha

2017-07-01

Periapical cysts and granulomas are chronic lesions caused by an inflammatory immune response against microbial challenge in the root canal. Different cell types, cytokines, and molecules have been associated with periapical lesion formation and expansion. Therefore, because of the chronic inflammatory state of these lesions, the aim of this study was to evaluate the in situ expression of matrix metalloproteinase (MMP)-14 and -19, tissue inhibitor of metalloproteinase (TIMP)-3 and -4, CD68, and inducible nitric oxide synthase (iNOS) in periapical cysts and granulomas. Sixteen cases of periapical cysts and 15 cases of periapical granulomas were analyzed. Ten normal dental pulps were used as the negative control. Immunohistochemistry was performed with anti-MMP-19, anti-MMP-14, anti-TIMP-3, anti-TIMP-4, anti-iNOS, and anti-CD68 antibodies. The expression of TIMP-3, TIMP-4, iNOS, and CD68 was significantly higher in both the cyst and granuloma groups than in the control group. TIMP-4 was also significantly higher in cases of chronic apical abscess. There was also a significant difference in the expression of MMP-14 between the cyst and control groups. However, there were no differences in the expression of MMP-19 between the 3 groups. Our data suggest that the expression of MMP-14, TIMP-3, and TIMP-4 is associated with the development of periapical lesions. Copyright © 2017 American Association of Endodontists. Published by Elsevier Inc. All rights reserved.

Extracellular matrix metalloproteinase inducer (EMMPRIN) remodels the extracellular matrix through enhancing matrix metalloproteinases (MMPs) and inhibiting tissue inhibitors of MMPs expression in HPV-positive cervical cancer cells.

Science.gov (United States)

Xu, Q; Cao, X; Pan, J; Ye, Y; Xie, Y; Ohara, N; Ji, H

2015-01-01

PUPOSE OF INVESTIGATION: To study the expression of extracellular matrix metalloproteinase inducer (EMMPRIN), matrix metalloproteinases (MMPs), and tissue inhibitors of MMP (TIMPs) in uterine cervical cancer cell lines in vitro. EMMPRIN, MMPs, and TIMPs expression were assessed by Western blot and real-time RT-PCR from cervical carcinoma SiHa, HeLa, and C33-A cells. EMMPRIN recombinant significantly increased MMP-2, MMP-9 protein and mRNA expression in SiHa and Hela cells, but not in C33-A cells by Western blot analysis and real-time RT-PCR. EMMPRIN recombinant significantly inhibited TIMP-1 protein and mRNA levels in SiHa and Hela cells, but not in C33-A cells. There was no difference on the TIMP-2 expression in those cells with the treatment of EMMPRIN recombinant. EMMPRIN RNAi decreased MMP-2 and MMP-9 and increased TIMP-1 expression in SiHa and HeLa cells, but not in C33-A cells. There was no change on the expression of TIMP-2 mRNA levels in SiHa, HeLa and C33-A cells transfected with siEMMPRIN. EMMPRIN may induce MMP-2 and MMP-9, and downregulate TIMP-1 in HPV-positive cervical cancer cells in vitro.

Suramin Inhibits Osteoarthritic Cartilage Degradation by Increasing Extracellular Levels of Chondroprotective Tissue Inhibitor of Metalloproteinases 3.

Science.gov (United States)

Chanalaris, Anastasios; Doherty, Christine; Marsden, Brian D; Bambridge, Gabriel; Wren, Stephen P; Nagase, Hideaki; Troeberg, Linda

2017-10-01

Osteoarthritis is a common degenerative joint disease for which no disease-modifying drugs are currently available. Attempts to treat the disease with small molecule inhibitors of the metalloproteinases that degrade the cartilage matrix have been hampered by a lack of specificity. We aimed to inhibit cartilage degradation by augmenting levels of the endogenous metalloproteinase inhibitor, tissue inhibitor of metalloproteinases (TIMP)-3, through blocking its interaction with the endocytic scavenger receptor, low-density lipoprotein receptor-related protein 1 (LRP1). We discovered that suramin (C 51 H 40 N 6 O 23 S 6 ) bound to TIMP-3 with a K D value of 1.9 ± 0.2 nM and inhibited its endocytosis via LRP1, thus increasing extracellular levels of TIMP-3 and inhibiting cartilage degradation by the TIMP-3 target enzyme, adamalysin-like metalloproteinase with thrombospondin motifs 5. NF279 (8,8'-[carbonyl bis (imino-4,1-phenylenecarbonylimino-4,1-phenylenecarbonylimino)] bis -1,3,5-naphthalenetrisulfonic acid hexasodium salt), a structural analog of suramin, has an increased affinity for TIMP-3 and increased ability to inhibit TIMP-3 endocytosis and protect cartilage. Suramin is thus a promising scaffold for the development of novel therapeutics to increase TIMP-3 levels and inhibit cartilage degradation in osteoarthritis. Copyright © 2017 by The Author(s).

Immunohistochemical Correlation of Matrix Metalloproteinase-2 and Tissue Inhibitors of Metalloproteinase-2 in Tobacco Associated Epithelial Dysplasia

Directory of Open Access Journals (Sweden)

Dipshikha Bajracharya

2014-01-01

Full Text Available Aim. To study the immunohistochemical expression of matrix metalloproteinase and tissue inhibitors of matrix metalloproteinase-2 in different histological grades of tobacco associated epithelial dysplasia and correlate the association between these proteases. Potentially malignant oral disorders (PMODs progressing to oral cancer are related to the severity of epithelial dysplasia. Methods. A retrospective immunohistochemical study was carried out on 30 clinically and histologically proven cases of leukoplakia with dysplasia and 10 cases of normal buccal mucosa using anti-MMP-2 and anti-TIMP-2 monoclonal antibodies. Results. Mann Whitney U test, for comparing the expression of both MMP-2 and TIMP-2 in normal mucosa with dysplasia, was highly significant (P<0.001. Kruskal-Wallis test to compare the median score of MMP-2 and TIMP-2 in different grades of dysplasia showed statistical significance (P<0.001, and a Spearman’s correlation between MMP-2 and TIMP-2 through different grades of dysplasia and cells observed showed positive correlation. Conclusion. Concomitant increase in the expression of both MMP-2 and TIMP-2 suggested that the activation of MMP-2 is dependent on TIMP-2 acting as a cofactor. Changes in TIMP-2 levels are considered important because they directly affect the level of MMP-2 activity.

The monoamine oxidase inhibition properties of selected structural analogues of methylene blue

International Nuclear Information System (INIS)

Delport, Anzelle; Harvey, Brian H.; Petzer, Anél; Petzer, Jacobus P.

2017-01-01

The thionine dye, methylene blue (MB), is a potent inhibitor of monoamine oxidase (MAO) A, a property that may, at least in part, mediate its antidepressant effects in humans and animals. The central inhibition of MAO-A by MB has also been linked to serotonin toxicity (ST) which may arise when MB is used in combination with serotonergic drugs. Structural analogues and the principal metabolite of MB, azure B, have also been reported to inhibit the MAO enzymes, with all compounds exhibiting specificity for the MAO-A isoform. To expand on the structure-activity relationships (SARs) of MAO inhibition by MB analogues, the present study investigates the human MAO inhibition properties of five MB analogues: neutral red, Nile blue, new methylene blue, cresyl violet and 1,9-dimethyl methylene blue. Similar to MB, these analogues also are specific MAO-A inhibitors with cresyl violet (IC 50 = 0.0037 μM), Nile blue (IC 50 = 0.0077 μM) and 1,9-dimethyl methylene blue (IC 50 = 0.018 μM) exhibiting higher potency inhibition compared to MB (IC 50 = 0.07 μM). Nile blue also represents a potent MAO-B inhibitor with an IC 50 value of 0.012 μM. From the results it may be concluded that non-thionine MB analogues (e.g. cresyl violet and Nile blue) also may exhibit potent MAO inhibition, a property which should be considered when using these compounds in pharmacological studies. Benzophenoxazines such as cresyl violet and Nile blue are, similar to phenothiazines (e.g. MB), representative of high potency MAO-A inhibitors with a potential risk of ST. - Highlights: • MB analogues, cresyl violet and Nile blue, are high potency MAO-A inhibitors. • Nile blue also represents a potent MAO-B inhibitor. • Potent MAO-A inhibition should alert to potential serotonin toxicity.

The monoamine oxidase inhibition properties of selected structural analogues of methylene blue

Energy Technology Data Exchange (ETDEWEB)

Delport, Anzelle [Pharmaceutical Chemistry, School of Pharmacy, North-West University, Private Bag X6001, Potchefstroom 2520 (South Africa); Centre of Excellence for Pharmaceutical Sciences, North-West University, Private Bag X6001, Potchefstroom 2520 (South Africa); Harvey, Brian H. [Centre of Excellence for Pharmaceutical Sciences, North-West University, Private Bag X6001, Potchefstroom 2520 (South Africa); Pharmacology, School of Pharmacy, North-West University, Private Bag X6001, Potchefstroom 2520 (South Africa); Petzer, Anél [Pharmaceutical Chemistry, School of Pharmacy, North-West University, Private Bag X6001, Potchefstroom 2520 (South Africa); Centre of Excellence for Pharmaceutical Sciences, North-West University, Private Bag X6001, Potchefstroom 2520 (South Africa); Petzer, Jacobus P., E-mail: jacques.petzer@nwu.ac.za [Pharmaceutical Chemistry, School of Pharmacy, North-West University, Private Bag X6001, Potchefstroom 2520 (South Africa); Centre of Excellence for Pharmaceutical Sciences, North-West University, Private Bag X6001, Potchefstroom 2520 (South Africa)

2017-06-15

The thionine dye, methylene blue (MB), is a potent inhibitor of monoamine oxidase (MAO) A, a property that may, at least in part, mediate its antidepressant effects in humans and animals. The central inhibition of MAO-A by MB has also been linked to serotonin toxicity (ST) which may arise when MB is used in combination with serotonergic drugs. Structural analogues and the principal metabolite of MB, azure B, have also been reported to inhibit the MAO enzymes, with all compounds exhibiting specificity for the MAO-A isoform. To expand on the structure-activity relationships (SARs) of MAO inhibition by MB analogues, the present study investigates the human MAO inhibition properties of five MB analogues: neutral red, Nile blue, new methylene blue, cresyl violet and 1,9-dimethyl methylene blue. Similar to MB, these analogues also are specific MAO-A inhibitors with cresyl violet (IC{sub 50} = 0.0037 μM), Nile blue (IC{sub 50} = 0.0077 μM) and 1,9-dimethyl methylene blue (IC{sub 50} = 0.018 μM) exhibiting higher potency inhibition compared to MB (IC{sub 50} = 0.07 μM). Nile blue also represents a potent MAO-B inhibitor with an IC{sub 50} value of 0.012 μM. From the results it may be concluded that non-thionine MB analogues (e.g. cresyl violet and Nile blue) also may exhibit potent MAO inhibition, a property which should be considered when using these compounds in pharmacological studies. Benzophenoxazines such as cresyl violet and Nile blue are, similar to phenothiazines (e.g. MB), representative of high potency MAO-A inhibitors with a potential risk of ST. - Highlights: • MB analogues, cresyl violet and Nile blue, are high potency MAO-A inhibitors. • Nile blue also represents a potent MAO-B inhibitor. • Potent MAO-A inhibition should alert to potential serotonin toxicity.

Neutrophil gelatinase-associated lipocalin (NGAL) and matrix metalloproteinases as novel stress markers in children and young adults on chronic dialysis.

Science.gov (United States)

Musiał, Kinga; Zwolińska, Danuta

2011-03-01

Phenomena related to chronic kidney disease, such as atherosclerosis, aggravate with the introduction of dialysis. Matrix metalloproteinases (MMP) and factors modifying their activity, such as their tissue inhibitors (TIMP) or neutrophil gelatinase-associated lipocalin (NGAL), take part in the matrix turnover and the endothelial damage characteristic for atherogenesis. However, there are no data on the associations between these parameters and other known pro-atherogenic factors, or on the impact of various dialysis modalities on them. The aim of our study was to assess the serum concentrations of NGAL, MMP-7, MMP-9, and TIMP-1, as well as their correlations with human heat shock proteins (Hsp90α, anti-Hsp60), endothelial dysfunction (sE-selectin), and inflammation (hsCRP) in pediatric patients chronically dialyzed. Twenty-two children on automated peritoneal dialysis (APD), 17 patients on hemodialysis (HD) and 24 controls were examined. The serum concentrations of NGAL, MMP-7, MMP-9, TIMP-1, Hsp90α, anti-Hsp60, and sE-selectin were assessed by enzyme-linked immunosorbent assay (ELISA). The median values of NGAL, MMP-7, MMP-9, TIMP-1, and MMP-9/NGAL ratio were significantly elevated in all dialyzed children vs. controls and were higher in HD than in APD. The values of MMP-9/TIMP-1 and MMP-7/TIMP-1 ratios in the HD subjects were lower than those in the APD children. Hsp90α and anti-Hsp60 predicted the values of NGAL, MMPs, and TIMP-1. Additionally, sE-selectin was a predictor of NGAL levels, whereas NGAL predicted the MMP and TIMP-1 concentrations. The increased concentrations of examined parameters indicate the dysfunction of MMP/TIMP/NGAL system in the dialyzed children, more pronounced on hemodialysis. The discrepancies between dialysis modalities and correlations with heat shock proteins (HSPs) suggest that NGAL may be considered a novel stress protein, whereas MMP-7, MMP-9, and TIMP-1 may be regarded as indicators of stress response in the pediatric

Cloning and regulation of rat tissue inhibitor of metalloproteinases-2 in osteoblastic cells

Science.gov (United States)

Cook, T. F.; Burke, J. S.; Bergman, K. D.; Quinn, C. O.; Jeffrey, J. J.; Partridge, N. C.

1994-01-01

Rat tissue inhibitor of metalloproteinases-2 (TIMP-2) was cloned from a UMR 106-01 rat osteoblastic osteosarcoma cDNA library. The 969-bp full-length clone demonstrates 98 and 86% sequence identity to human TIMP-2 at the amino acid and nucleic acid levels, respectively. Parathyroid hormone (PTH), at 10(-8) M, stimulates an approximately twofold increase in both the 4.2- and 1.0-kb transcripts over basal levels in UMR cells after 24 h of exposure. The PTH stimulation of TIMP-2 transcripts was not affected by the inhibitor of protein synthesis, cycloheximide (10(-5) M), suggesting a primary effect of the hormone. This is in contradistinction to regulation of interstitial collagenase (matrix metalloproteinase-1) by PTH in these same cells. Nuclear run-on assays demonstrate that PTH causes an increase in TIMP-2 transcription that parallels the increase in message levels. Parathyroid hormone, in its stimulation of TIMP-2 mRNA, appears to act through a signal transduction pathway involving protein kinase A (PKA) since the increase in TIMP-2 mRNA is reproduced by treatment with the cAMP analogue, 8-bromo-cAMP (5 x 10(-3) M). The protein kinase C and calcium pathways do not appear to be involved due to the lack of effect of phorbol 12-myristate 13-acetate (2.6 x 10(-6) M) and the calcium ionophore, ionomycin (10(-7) M), on TIMP-2 transcript abundance. In this respect, regulation of TIMP-2 and collagenase in osteoblastic cells by PTH are similar. However, we conclude that since stimulation of TIMP-2 transcription is a primary event, the PKA pathway must be responsible for a direct increase in transcription of this gene.

Effects of Hormones on the Expression of Matrix Metalloproteinases and Their Inhibitors in Bovine Spermatozoa

Directory of Open Access Journals (Sweden)

Sang-Hwan Kim

2013-03-01

Full Text Available Proteases and protease inhibitors play key roles in most physiological processes, including cell migration, cell signaling, and cell surface and tissue remodeling. Among these, the matrix metalloproteinase (MMPs pathway is one of the most efficient biosynthetic pathways for controlling the activation of enzymes responsible for protein degradation. This also indicates the association of MMPs with the maturation of spermatozoa. In an attempt to investigate the effect of MMP activation and inhibitors in cultures with various hormones during sperm capacitation, we examined and monitored the localization and expression of MMPs (MMP-2 and MMP-9, tissue inhibitors of metalloproteinases (TIMP-2 and TIMP-3, as well as their expression profiles. Matured spermatozoa were collected from cultures with follicle-stimulating hormone (FSH, luteinizing hormone (LH, and Lutalyse at 1 h, 6 h, 18 h, and 24 h. ELISA detected the expression of MMP-2, MMP-9, TIMP-2, and TIMP-3 in all culture media, regardless of medium type (FSH-supplemented fertilization Brackett-Oliphant medium (FFBO, LH-supplemented FBO (LFBO, or Lutalyse-supplemented FBO (LuFBO. TIMP-2 and TIMP-3 expression patterns decreased in LFBO and LuFBO. MMP-2 and MMP-9 activity in FBO and FFBO progressively increased from 1 h to 24 h but was not detected in LFBO and LuFBO. The localization and expression of TIMP-2 and TIMP-3 in sperm heads was also measured by immunofluorescence analysis. However, MMPs were not detected in the sperm heads. MMP and TIMP expression patterns differed according to the effect of various hormones. These findings suggest that MMPs have a role in sperm viability during capacitation. In conjunction with hormones, MMPs play a role in maintaining capacitation and fertilization by controlling extracellular matrix inhibitors of sperm.

Immunohistochemical correlation of matrix metalloproteinase-2 and tissue inhibitors of metalloproteinase-2 in tobacco associated epithelial dysplasia.

Science.gov (United States)

Bajracharya, Dipshikha; Shrestha, Bijayatha; Kamath, Asha; Menon, Aparna; Radhakrishnan, Raghu

2014-01-01

To study the immunohistochemical expression of matrix metalloproteinase and tissue inhibitors of matrix metalloproteinase-2 in different histological grades of tobacco associated epithelial dysplasia and correlate the association between these proteases. Potentially malignant oral disorders (PMODs) progressing to oral cancer are related to the severity of epithelial dysplasia. A retrospective immunohistochemical study was carried out on 30 clinically and histologically proven cases of leukoplakia with dysplasia and 10 cases of normal buccal mucosa using anti-MMP-2 and anti-TIMP-2 monoclonal antibodies. Mann Whitney U test, for comparing the expression of both MMP-2 and TIMP-2 in normal mucosa with dysplasia, was highly significant (P correlation between MMP-2 and TIMP-2 through different grades of dysplasia and cells observed showed positive correlation. Concomitant increase in the expression of both MMP-2 and TIMP-2 suggested that the activation of MMP-2 is dependent on TIMP-2 acting as a cofactor. Changes in TIMP-2 levels are considered important because they directly affect the level of MMP-2 activity.

A study of monoamine oxidase activity in fetal membranes.

Science.gov (United States)

Sekizawa, A; Ishikawa, H; Morimoto, T; Hirose, K; Suzuki, A; Saito, H; Yanaihara, T; Arai, Y; Oguchi, K

1996-05-01

To study the role of decidual monoamine oxidase (MAO)-A and -B activities before delivery, the relationship between MAO activity in fetal membranes and catecholamine (CA) concentration in amniotic fluid (AF) was determined. Fetal membranes and AF were obtained at the time of elective Cesarean section (CS group, n = 11) and Cesarean section due to fetal distress without labor pains (FD group, n = 5). MAO-A and -B activities were radiometrically measured using 14C-5-hydroxytriptamine for MAO-A substrate and 14C-benzylamine for MAO-B substrate. CA concentrations in AF were measured by high performance liquid chromatograph with an electro-chemical detector. Both MAO-A and -B activities in decidua obtained from CS were significantly lower than those obtained from FD. Both norepinephrine (NE) and epinephrine (EP) concentrations were significantly lower in the CS group than the FD group. A significant positive correlation between decidual MAO-A activity and NE concentration in AF was observed. No significant correlation was observed between MAO-B activity and the concentration of NE in AF. There was no correlation between EP concentrations and MAO activities. These results suggest that CA concentration in AF may be related to the activity of MAO in fetal membranes, determined by certain physiological processes during pregnancy. It has been suggested that metabolism of monoamines in fetal membranes also plays an important role in reducing monoamine influx into maternal myometrium from the AF.

Salivary tissue inhibitor of metalloproteinases-1 localization and glycosylation profile analysis

DEFF Research Database (Denmark)

Holten-Andersen, Lars; Thaysen-Andersen, Morten; Jensen, Siri Beier

2011-01-01

tissue samples (four parotid gland and four submandibular gland biopsies) were analysed for the presence of TIMP-1 mRNA and protein expression. To assess TIMP-1 glycosylation profiles in blood and saliva, the protein was isolated from plasma and unstimulated and stimulated whole saliva as well...... as stimulated parotid and submandibular saliva and analysed by MALDI-TOF mass spectrometry. TIMP-1 protein was demonstrated in mucous acinar cells of the submandibular gland and in ductal cells of both the parotid and submandibular gland. However, no TIMP-1 mRNA was detected in any of these cells...

Associations between advanced glycation endproducts and matrix metalloproteinases and its inhibitor in individuals with type 1 diabetes

DEFF Research Database (Denmark)

Peeters, S A; Engelen, L; Buijs, J

2018-01-01

the production of MMPs and/or TIMP-1. Therefore, we investigated associations between specific AGEs and MMP-1, -2, -3, -9, and -10, and TIMP-1 in individuals with type 1 diabetes. METHODS: In 670 type 1 diabetic individuals we determined serum levels of protein-bound AGEs Nε-(carboxymethyl)lysine (CML), Nε-(carboxyethyl)lysine......AIMS: Advanced glycation endproducts (AGEs) and altered extracellular matrix remodeling by matrix metalloproteinases (MMPs) and tissue inhibitor of metalloproteinase (TIMP) are associated with vascular complications in type 1 diabetes. Experimental studies have shown that AGEs regulate...... (CEL), 5-hydro-5-methylimidazolone (MG-H1) and pentosidine, and MMP-1, -2, -3, -9, and -10, and TIMP-1. We performed linear regression analyses to investigate associations between AGEs and markers of the MMP-TIMP system. Analyses were adjusted for age, sex, HbA1c and duration of diabetes...

Transgenic cells with increased plastoquinone levels and methods of use

Energy Technology Data Exchange (ETDEWEB)

Sayre, Richard T.; Subramanian, Sowmya; Cahoon, Edgar

2016-12-27

Disclosed herein are transgenic cells expressing a heterologous nucleic acid encoding a prephenate dehydrogenase (PDH) protein, a heterologous nucleic acid encoding a homogentisate solanesyl transferase (HST) protein, a heterologous nucleic acid encoding a deoxyxylulose phosphate synthase (DXS) protein, or a combination of two or more thereof. In particular examples, the disclosed transgenic cells have increased plastoquinone levels. Also disclosed are methods of increasing cell growth rates or production of biomass by cultivating transgenic cells expressing a heterologous nucleic acid encoding a PDH protein, a heterologous nucleic acid encoding an HST protein, a heterologous nucleic acid encoding a DXS protein, or a combination of two or more thereof under conditions sufficient to produce cell growth or biomass.

Protease Expression Levels in Prostate Cancer Tissue Can Explain Prostate Cancer-Associated Seminal Biomarkers—An Explorative Concept Study

Directory of Open Access Journals (Sweden)

Jochen Neuhaus

2017-05-01

Full Text Available Previously, we described prostate cancer (PCa detection (83% sensitivity; 67% specificity in seminal plasma by CE-MS/MS. Moreover, advanced disease was distinguished from organ-confined tumors with 80% sensitivity and 82% specificity. The discovered biomarkers were naturally occurring fragments of larger seminal proteins, predominantly semenogelin 1 and 2, representing endpoints of the ejaculate liquefaction. Here we identified proteases putatively involved in PCa specific protein cleavage, and examined gene expression and tissue protein levels, jointly with cell localization in normal prostate (nP, benign prostate hyperplasia (BPH, seminal vesicles and PCa using qPCR, Western blotting and confocal laser scanning microscopy. We found differential gene expression of chymase (CMA1, matrix metalloproteinases (MMP3, MMP7, and upregulation of MMP14 and tissue inhibitors (TIMP1 and TIMP2 in BPH. In contrast tissue protein levels of MMP14 were downregulated in PCa. MMP3/TIMP1 and MMP7/TIMP1 ratios were decreased in BPH. In seminal vesicles, we found low-level expression of most proteases and, interestingly, we also detected TIMP1 and low levels of TIMP2. We conclude that MMP3 and MMP7 activity is different in PCa compared to BPH due to fine regulation by their inhibitor TIMP1. Our findings support the concept of seminal plasma biomarkers as non-invasive tool for PCa detection and risk stratification.

Protease Expression Levels in Prostate Cancer Tissue Can Explain Prostate Cancer-Associated Seminal Biomarkers-An Explorative Concept Study.

Science.gov (United States)

Neuhaus, Jochen; Schiffer, Eric; Mannello, Ferdinando; Horn, Lars-Christian; Ganzer, Roman; Stolzenburg, Jens-Uwe

2017-05-04

Previously, we described prostate cancer (PCa) detection (83% sensitivity; 67% specificity) in seminal plasma by CE-MS/MS. Moreover, advanced disease was distinguished from organ-confined tumors with 80% sensitivity and 82% specificity. The discovered biomarkers were naturally occurring fragments of larger seminal proteins, predominantly semenogelin 1 and 2, representing endpoints of the ejaculate liquefaction. Here we identified proteases putatively involved in PCa specific protein cleavage, and examined gene expression and tissue protein levels, jointly with cell localization in normal prostate (nP), benign prostate hyperplasia (BPH), seminal vesicles and PCa using qPCR, Western blotting and confocal laser scanning microscopy. We found differential gene expression of chymase (CMA1), matrix metalloproteinases (MMP3, MMP7), and upregulation of MMP14 and tissue inhibitors (TIMP1 and TIMP2) in BPH. In contrast tissue protein levels of MMP14 were downregulated in PCa. MMP3/TIMP1 and MMP7/TIMP1 ratios were decreased in BPH. In seminal vesicles, we found low-level expression of most proteases and, interestingly, we also detected TIMP1 and low levels of TIMP2. We conclude that MMP3 and MMP7 activity is different in PCa compared to BPH due to fine regulation by their inhibitor TIMP1. Our findings support the concept of seminal plasma biomarkers as non-invasive tool for PCa detection and risk stratification.

Cerebral monoamine oxidase A inhibition in tobacco smokers confirmed with PET and [{sup 11}C]Befloxatone

Energy Technology Data Exchange (ETDEWEB)

Leroy, C.; Bragulat, V.; Penttila, J.; Artiges, E.; Martinot, J.L.; Trichard, Ch. [INSERM U797, Research Unit ' Neuroimaging and Psychiatry' , Orsay (France); Leroy, C.; Bragulat, V.; Penttila, J.; Artiges, E.; Martinot, J.L.; Trichard, Ch. [CEA, ' Neuroimaging and Psychiatry, U797 Unit, Hospital Department Frederic Joliot and Neurospin (France); Leroy, C.; Bragulat, V.; Penttila, J.; Artiges, E.; Martinot, J.L.; Trichard, Ch. [Paris sud University - Paris Descartes University, UMR U797 (France); Berlin, I. [Service de Pharmacologie, Hopital Pitie-Salpetriere - Universite Paris6 - INSERM U677, Paris (France); Gregoire, M.C.; Bottlaender, M.; Roumenov, D.; Dolle, F.; Bourgeois, S. [CEA, DSV, I2BM, Service Hospitalier Frederic Joliot, Orsay (France); Artiges, E.; Trichard, Ch. [Psychiatry Department, Orsay Hospital, Orsay (France)

2009-07-01

The inhibition of cerebral monoamine oxidases (MAOs) by cigarette smoke components could participate to the tobacco addiction. However, the actual extent of this inhibition in vivo in smokers is still poorly known. We investigated cerebral MAO-A availability in 7 tobacco-dependent subjects and 6 healthy nonsmokers, using positron emission tomography (PET) and the MAO-A selective radioligand [{sup 11}C]befloxatone. In comparison to nonsmokers, smokers showed a significant overall reduction of [{sup 11}C]befloxatone binding potential (BP) in cortical areas (average reduction, -60%) and a similar trend in caudate and thalamus (-40%). Our findings confirm a widespread inhibition of cerebral MAO-A in smokers. This mechanism may contribute to tobacco addiction and for a possible mood-modulating effect of tobacco. (authors)

Cerebral monoamine oxidase A inhibition in tobacco smokers confirmed with PET and [11C]Befloxatone

International Nuclear Information System (INIS)

Leroy, C.; Bragulat, V.; Penttila, J.; Artiges, E.; Martinot, J.L.; Trichard, Ch.; Leroy, C.; Bragulat, V.; Penttila, J.; Artiges, E.; Martinot, J.L.; Trichard, Ch.; Leroy, C.; Bragulat, V.; Penttila, J.; Artiges, E.; Martinot, J.L.; Trichard, Ch.; Berlin, I.; Gregoire, M.C.; Bottlaender, M.; Roumenov, D.; Dolle, F.; Bourgeois, S.; Artiges, E.; Trichard, Ch.

2009-01-01

The inhibition of cerebral monoamine oxidases (MAOs) by cigarette smoke components could participate to the tobacco addiction. However, the actual extent of this inhibition in vivo in smokers is still poorly known. We investigated cerebral MAO-A availability in 7 tobacco-dependent subjects and 6 healthy nonsmokers, using positron emission tomography (PET) and the MAO-A selective radioligand [ 11 C]befloxatone. In comparison to nonsmokers, smokers showed a significant overall reduction of [ 11 C]befloxatone binding potential (BP) in cortical areas (average reduction, -60%) and a similar trend in caudate and thalamus (-40%). Our findings confirm a widespread inhibition of cerebral MAO-A in smokers. This mechanism may contribute to tobacco addiction and for a possible mood-modulating effect of tobacco. (authors)

Serum Matrix Metalloproteinase-9 and Tissue Inhibitor of Metalloproteinase-1 Expression in Patients with Non-alcoholic Fatty Liver Disease

Directory of Open Access Journals (Sweden)

Taner Akyol

2015-06-01

Full Text Available Non-alcoholic fatty liver disease (NAFLD is the most common chronic liver disease in developed countries. NAFLD may progress to non-alcoholic steatohepatitis (NASH and cirrhosis. Emerging evidence suggests that NAFLD is the hepatic manifestation of metabolic syndrome (MetS. NAFLD is closely linked to MetS, with a significant increase in cardiovascular risk. Several matrix metalloproteinases (MMPs and tissue inhibitors of MMPs (TIMPs play important roles in the pathophysiology of atherosclerosis and liver fibrosis. In this study we investigated the usefulness of serum metalloproteinases as noninvasive markers of NAFLD. Forty-six patients with NAFLD and twenty-six healthy controls were enrolled into the study, in Gulhane Military Medical Academy, Haydarpasa Training Hospital. Liver biopsies were performed on all patients with NAFLD and histopathological evaluations were made by an experienced pathologist. All NAFLD patients were divided into 2 subgroups according to MetS status using ATP III criteria. MMP-9 and TIMP-1 were studied in serum samples of all groups. Results were compared between both groups and subgroups. In this study, the NAFLD and control groups did not differ significantly on MMP-9, TIMP-1 and TIMP-1/MMP-9 ratio (p > 0.05. However, we found a significant relationship between the HOMA and TIMP-1 (p<0.05. Moreover, MMP-9 and TIMP-1/MMP-9 levels were significantly correlated with waist circumference (p<0.05. Our findings are not sufficient to suggest that MMP-9, TIMP-1 and TIMP-1/MMP-9 ratio might be used as noninvasive biochemical diagnostic tests among NAFLD patients. [Dis Mol Med 2015; 3(2.000: 11-17

Total levels of tissue inhibitor of metalloproteinases 1 in plasma yield high diagnostic sensitivity and specificity in patients with colon cancer

DEFF Research Database (Denmark)

Holten-Andersen, Mads N; Christensen, Ib Jarle; Nielsen, Hans Jørgen

2002-01-01

: Total TIMP-1 plasma levels were measured by ELISA in blood samples from two different blood donor populations from IBD patients, and preoperative samples from patients with primary colon cancer (CC), rectal cancer (RC), or breast cancer. RESULTS: There were no significant differences in plasma TIMP-1......PURPOSE: The purpose of this study was to measure total levels of tissue inhibitor of metalloproteinases (TIMP-1) by ELISA in plasma from blood donors, patients with inflammatory bowel disease (IBD), and patients with cancer and to correlate the results to patient diagnosis. EXPERIMENTAL DESIGN...... levels between healthy donors and IBD or breast cancer patients, whereas patients with CC or RC had significantly elevated TIMP-1 levels. Total TIMP-1 levels identified patients with CC with a sensitivity of 63% at 98% specificity, patients with early CC (Dukes' A+B) with a sensitivity of 56% at 98...

Interactions of Desmethoxyyangonin, a Secondary Metabolite from Renealmia alpinia, with Human Monoamine Oxidase-A and Oxidase-B

Directory of Open Access Journals (Sweden)

Narayan D. Chaurasiya

2017-01-01

Full Text Available Renealmia alpinia (Zingiberaceae, a medicinal plant of tropical rainforests, is used to treat snakebites and other injuries and also as a febrifuge, analgesic, antiemetic, antiulcer, and anticonvulsant. The dichloromethane extract of R. alpinia leaves showed potent inhibition of human monoamine oxidases- (MAOs- A and B. Phytochemical studies yielded six known compounds, including pinostrobin 1, 4′-methyl ether sakuranetin 2, sakuranetin 3, pinostrobin chalcone 4, yashabushidiol A 5, and desmethoxyyangonin 6. Compound 6 displayed about 30-fold higher affinity for MAO-B than MAO-A, with Ki values of 31 and 922 nM, respectively. Kinetic analysis of inhibition and equilibrium-dialysis dissociation assay of the enzyme-inhibitor complex showed reversible binding of desmethoxyyangonin 6 with MAO-A and MAO-B. The binding interactions of compound 6 in the active site of the MAO-A and MAO-B isoenzymes, investigated through molecular modeling algorithms, confirmed preferential binding of desmethoxyyangonin 6 with MAO-B compared to MAO-A. Selective reversible inhibitors of MAO-B, like desmethoxyyangonin 6, may have important therapeutic significance for the treatment of neurodegenerative disorders, such as Parkinson’s disease and Alzheimer’s disease.

Matrix metalloproteinase 2 and tissue inhibitor of matrix metalloproteinases 2 in the diagnosis of colorectal adenoma and cancer patients

Directory of Open Access Journals (Sweden)

Magdalena Groblewska

2010-04-01

Full Text Available The aim of the study was to assess the importance of the measurement of matrix metalloproteinase 2 (MMP-2and tissue inhibitor of matrix metalloproteinases 2 (TIMP-2 in patients with colorectal cancer (CRC in relation to clinicopathologicalfeatures of tumor and patients' survival. Additionally, we determined serum MMP-2 and TIMP-2 in colorectaladenoma (CA patients and healthy controls and compared them with tumor markers, CEA and CA 19-9. The serum levelsof MMP-2 and TIMP-2 in 91 CRC patients, 28 CA subjects and 91 healthy controls were determined by ELISA method, butconcentrations of CEA and CA 19-9 using MEIA method. Nonparametric statistical analyses were used. Serum levels ofMMP-2 and TIMP-2 were significantly lower in CRC patients than in healthy subjects and decreased with tumor stage.Additionally, MMP-2 concentrations were significantly lower in patients with CRC than in CA group. Diagnostic sensitivityof TIMP-2 (59% was the highest among biomarkers tested and increased in combined use with CEA (79%. Moreover,the area under ROC curve (AUC of TIMP-2 was larger than AUC of MMP-2 in differentiation between CRC and healthysubjects, but lower than AUC of matrix metalloproteinase 2 in differentiation between colorectal cancer and adenoma. Ourfindings suggest clinical usefulness of TIMP-2 as a biomarker in the diagnosis of CRC, especially in combination with CEA.However, further investigation is necessary.

Matrix metalloproteinase 2 and tissue inhibitor of matrix metalloproteinases 2 in the diagnosis of colorectal adenoma and cancer patients.

Directory of Open Access Journals (Sweden)

Barbara Mroczko

2011-04-01

Full Text Available The aim of the study was to assess the importance of the measurement of matrix metalloproteinase 2 (MMP-2 and tissue inhibitor of matrix metalloproteinases 2 (TIMP-2 in patients with colorectal cancer (CRC in relation to clinicopathological features of tumor and patients' survival. Additionally, we determined serum MMP-2 and TIMP-2 in colorectal adenoma (CA patients and healthy controls and compared them with tumor markers, CEA and CA 19-9. The serum levels of MMP-2 and TIMP-2 in 91 CRC patients, 28 CA subjects and 91 healthy controls were determined by ELISA method, but concentrations of CEA and CA 19-9 using MEIA method. Nonparametric statistical analyses were used. Serum levels of MMP-2 and TIMP-2 were significantly lower in CRC patients than in healthy subjects and decreased with tumor stage. Additionally, MMP-2 concentrations were significantly lower in patients with CRC than in CA group. Diagnostic sensitivity of TIMP-2 (59% was the highest among biomarkers tested and increased in combined use with CEA (79%. Moreover, the area under ROC curve (AUC of TIMP-2 was larger than AUC of MMP-2 in differentiation between CRC and healthy subjects, but lower than AUC of matrix metalloproteinase 2 in differentiation between colorectal cancer and adenoma. Our findings suggest clinical usefulness of TIMP-2 as a biomarker in the diagnosis of CRC, especially in combination with CEA. However, further investigation is necessary.

The Test of Infant Motor Performance at 3 months predicts language, cognitive, and motor outcomes in infants born preterm at 2 years of age.

Science.gov (United States)

Peyton, Colleen; Schreiber, Michael D; Msall, Michael E

2018-03-13

To determine the relationship between the Test of Infant Motor Performance (TIMP) at 3 months and cognitive, language, and motor outcomes on the Bayley Scales of Infant and Toddler Development, Third Edition (Bayley-III) at 2 years of age in high-risk infants born preterm. One hundred and six infants (47 females, 59 males) born at earlier than 31 weeks gestational age were prospectively tested with the TIMP at 10 to 15 weeks after term age and were assessed again with the Bayley-III at 2 years corrected age. Sensitivity and specificity were calculated for various cut points of the TIMP z-score and Bayley-III composite scores of no more than 85. The TIMP z-scores at 10 to 15 weeks of age were significantly associated with all three subscales on the Bayley-III at 2 years of age (pcognitive (87%), language (88%), and motor (89%) outcomes, but sensitivity was low (cognitive 41%, language 49%, motor 57%). This study demonstrates that the TIMP is related to cognitive, language, and motor outcomes on the Bayley-III at 2 years of age in high-risk infants born preterm. The Test of Infant Motor Performance (TIMP) predicts Bayley Scales of Infant and Toddler Development, Third Edition outcomes at 2 years of age. The TIMP is relatively good at discriminating between children who will and will not have typical development. © 2018 Mac Keith Press.

Plasma amine oxidase activities in Norrie disease patients with an X-chromosomal deletion affecting monoamine oxidase.

Science.gov (United States)

Murphy, D L; Sims, K B; Karoum, F; Garrick, N A; de la Chapelle, A; Sankila, E M; Norio, R; Breakefield, X O

1991-01-01

Two individuals with an X-chromosomal deletion were recently found to lack the genes encoding monoamine oxidase type A (MAO-A) and MAO-B. This abnormality was associated with almost total (90%) reductions in the oxidatively deaminated urinary metabolites of the MAO-A substrate, norepinephrine, and with marked (100-fold) increases in an MAO-B substrate, phenylethylamine, confirming systemic functional consequences of the genetic enzyme deficiency. However, urinary concentrations of the deaminated metabolites of dopamine and serotonin (5-HT) were essentially normal. To investigate other deaminating systems besides MAO-A and MAO-B that might produce these metabolites of dopamine and 5-HT, we examined plasma amine oxidase (AO) activity in these two patients and two additional patients with the same X-chromosomal deletion. Normal plasma AO activity was found in all four Norrie disease-deletion patients, in four patients with classic Norrie disease without a chromosomal deletion, and in family members of patients from both groups. Marked plasma amine metabolite abnormalities and essentially absent platelet MAO-B activity were found in all four Norrie disease-deletion patients, but in none of the other subjects in the two comparison groups. These results indicate that plasma AO is encoded by gene(s) independent of those for MAO-A and MAO-B, and raise the possibility that plasma AO, and perhaps the closely related tissue AO, benzylamine oxidase, as well as other atypical AOs or MAOs encoded independently from MAO-A and MAO-B may contribute to the oxidative deamination of dopamine and 5-HT in humans.

Neuropsychotoxicity of abused drugs: involvement of matrix metalloproteinase-2 and -9 and tissue inhibitor of matrix metalloproteinase-2 in methamphetamine-induced behavioral sensitization and reward in rodents.

Science.gov (United States)

Mizoguchi, Hiroyuki; Yamada, Kiyofumi; Nabeshima, Toshitaka

2008-01-01

Matrix metalloproteinases (MMPs) and their inhibitors (TIMPs) function to remodel the pericellular environment. We have investigated the role of the MMP/TIMP system in methamphetamine (METH) dependence in rodents, in which the remodeling of neural circuits may be crucial. Repeated METH treatment induced behavioral sensitization, which was accompanied by an increase in MMP-2/-9/TIMP-2 activity in the brain. An antisense TIMP-2 oligonucleotide enhanced the sensitization, which was associated with a potentiation of the METH-induced release of dopamine in the nucleus accumbens (NAc). MMP-2/-9 inhibitors blocked the METH-induced behavioral sensitization and conditioned place preference (CPP), a measure of the rewarding effect of a drug, and reduced the METH-increased dopamine release in the NAc. In MMP-2- and MMP-9-deficient mice, METH-induced behavioral sensitization and CPP as well as dopamine release were attenuated. The MMP/TIMP system may be involved in METH-induced sensitization and reward by regulating extracellular dopamine levels.

Levels of matrix metalloproteinase-1 and tissue inhibitors of metalloproteinase-1 in gastric cancer

Science.gov (United States)

Kemik, Ozgur; Kemik, Ahu Sarbay; Sümer, Aziz; Dulger, Ahmet Cumhur; Adas, Mine; Begenik, Huseyin; Hasirci, Ismail; Yilmaz, Ozkan; Purisa, Sevim; Kisli, Erol; Tuzun, Sefa; Kotan, Cetin

2011-01-01

AIM: To evaluate the levels of preoperative serum matrix metalloproteinase-1 (MMP-1) and tissue inhibitor of metalloproteinase-1 (TIMP-1) in gastric cancer. METHODS: One hundred gastric cancer patients who underwent gastrectomy were enrolled in this study. The serum concentrations of MMP-1 and TIMP-1 in these patients and in fifty healthy controls were determined using an enzyme-linked immunosorbent assay. RESULTS: Higher serum MMP-1 and TIMP-1 levels were observed in patients than in controls (P < 0.001). Serum MMP-1 and TIMP-1 levels were positively associated with morphological appearance, tumor size, depth of wall invasion, lymph node metastasis, liver metastasis, perineural invasion, and pathological stage. They were not significantly associated with age, gender, tumor location, or histological type. CONCLUSION: Increased MMP-1 and TIMP-1 were associated with gastric cancer. Although these markers are not good markers for diagnosis, these markers show in advanced gastric cancer. PMID:21547130

Matrix metalloproteinases and soluble Fas/FasL system as novel regulators of apoptosis in children and young adults on chronic dialysis.

Science.gov (United States)

Musiał, Kinga; Zwolińska, Danuta

2011-07-01

The system of membrane receptor Fas and its ligand FasL compose one of the main pathways triggering apoptosis. However, the role of their soluble forms has not been clarified yet. Although sFasL can be converted from the membrane-bound form by matrix metalloproteinases (MMPs), there are no data on relations between sFas/sFasL, MMPs and their tissue inhibitors (TIMPs) in patients on chronic dialysis--neither children nor adults. The aim of our study was to evaluate serum concentrations of sFas, sFasL, and their potential regulators (MMP-2, MMP-7, MMP-9, TIMP-1, TIMP-2), in children and young adults chronically dialyzed. Twenty-two children on automated peritoneal dialysis (APD), 19 patients on hemodialysis (HD) and 30 controls were examined. Serum concentrations of sFas, sFasL, MMPs and TIMPs were assessed by ELISA. Median values of sFas, sFasL, sFas/sFasL ratio, MMP-2, MMP-7, MMP-9, TIMP-1 and TIMP-2 were significantly elevated in all dialyzed patients vs. controls, the highest values being observed in subjects on HD. A single HD session caused the decrease in values of all parameters to the levels below those seen in children on APD. Regression analysis revealed that MMP-7 and TIMP-1 were the best predictors of sFas and sFasL concentrations. Children and young adults on chronic dialysis are prone to sFas/sFasL system dysfunction, more pronounced in patients on hemodialysis. The correlations between sFas/sFasL and examined enzymes suggest that MMPs and TIMPs take part in the regulation of cell death in the pediatric population on chronic dialysis, triggering both anti- (sFas) and pro-apoptotic (sFasL) mechanisms.

Exclusion of RAI2 as the causative gene for Nance-Horan syndrome.

Science.gov (United States)

Walpole, S M; Ronce, N; Grayson, C; Dessay, B; Yates, J R; Trump, D; Toutain, A

1999-05-01

Nance-Horan syndrome (NHS) is an X-linked condition characterised by congenital cataracts, microphthalmia and/or microcornea, unusual dental morphology, dysmorphic facial features, and developmental delay in some cases. Recent linkage studies have mapped the NHS disease gene to a 3.5-cM interval on Xp22.2 between DXS1053 and DXS443. We previously identified a human homologue of a mouse retinoic-acid-induced gene (RAI2) within the NHS critical flanking interval and have tested the gene as a candidate for Nance-Horan syndrome in nine NHS-affected families. Direct sequencing of the RAI2 gene and predicted promoter region has revealed no mutations in the families screened; RAI2 is therefore unlikely to be associated with NHS.

X linked neonatal centronuclear/myotubular myopathy: evidence for linkage to Xq28 DNA marker loci.

Science.gov (United States)

Thomas, N S; Williams, H; Cole, G; Roberts, K; Clarke, A; Liechti-Gallati, S; Braga, S; Gerber, A; Meier, C; Moser, H

1990-05-01

We have studied the inheritance of several polymorphic Xq27/28 DNA marker loci in two three generation families with the X linked neonatal lethal form of centronuclear/myotubular myopathy (XL MTM). We found complete linkage of XLMTM to all four informative Xq28 markers analysed, with GCP/RCP (Z = 3.876, theta = 0.00), with DXS15 (Z = 3.737, theta = 0.00), with DXS52 (Z = 2.709, theta = 0.00), and with F8C (Z = 1.020, theta = 0.00). In the absence of any observable recombination, we are unable to sublocalise the XLMTM locus further within the Xq28 region. This evidence for an Xq28 localisation may allow us to carry out useful genetic counselling within such families.

Matrix metalloproteinase-2 is elevated in midtrimester amniotic fluid prior to the development of preeclampsia

Directory of Open Access Journals (Sweden)

Daniel-Spiegel Etty

2009-08-01

Full Text Available Abstract Objective To evaluate levels of matrix metalloproteinases (MMP and their inhibitors (TIMP in second trimester amniotic fluid of women with hypertensive disorders compared to normotensive women. Study Design Amniotic fluid was obtained from 133 women undergoing genetic second trimester amniocentesis. Zymography was performed for MMP characterization and an MMP-2 ELISA kit was used to determine MMP-2 levels. TIMP-2 expression was evaluated using western blot. Results Mean amniotic fluid MMP-2 and TIMP-2 levels were significantly higher in women who developed a hypertensive disorder compared to normotensive women (P Conclusion Higher amniotic fluid MMP-2 and TIMP-2 levels are found in women who eventually develop preeclampsia.

Increased expressions of MMP-2 and MMP-9 in lung following 12 Gy local irradiation

International Nuclear Information System (INIS)

Yang Kunyu; Liu Li; Zhang Tao; Wu Gang; Hu Yu; Ruebe, C.; Ruebe, C.

2006-01-01

Objective: To measure expressions of metalloproteinases and tissue inhibitors of metalloproteinases in the lung following thoracic irradiation of 12 Gy, and explore its possible role in the development of radiation-induced lung damage. Methods: C57BL/6J mice at age of 8 weeks were thoracically irradiated with 12 Gy X-rays (10 MV, 2.4 Gy/min, single exposure), and the control mice were sham-irradiated. The mice were sacrificed at 4 or 8 weeks after thoracic irradiation by decapitation. Lung tissues samples were collected. Expressions of MMP-2, MMP-9, MMP-3, MMP-13, TIMP-1, TIMP-2, and TIMP-3 in lung samples were measured. Results: There was no significant difference in expressions of MMP-3, MMP-13, TIMP-1 TIMP-2, and TIMP-3 in the lung between the two groups at 4 and 8 weeks after thoracic irradiation (or sham-irradiation). However, the expressions of MMP-2 were enhanced by 1.7 and 1.9 folds, and MMP-9 by 2.7 and 2.6 folds at 4 and 8 weeks after thoracic irradiation, respectively. Conclusion: Enhanced expressions of MMP-2 and MMP-9 in the lung were involved in the development of acute lung injury after thoracic irradiation, leading to a disruption of the structure and fibrosis. (authors)

Linkage analysis of Norrie disease with an X-chromosomal ornithine aminotransferase locus.

Science.gov (United States)

Bateman, J B; Kojis, T L; Cantor, R M; Heinzmann, C; Ngo, J T; Spence, M A; Inana, G; Kivlin, J D; Curtis, D; Sparkes, R S

1993-01-01

Norrie disease is a rare disease of newborn males caused by prenatal or perinatal retinal detachment, which may be associated with mental retardation, psychosis, and/or hearing loss. DXS7 (L1.28) and MAO A and B loci have been linked to the ND locus on the short arm of the X chromosome. Sequences homologous to OAT also have been mapped to the short arm of the X chromosome. We performed linkage analyses between the ND locus and one of the OAT-like clusters of sequences on the X chromosome (OATL1), using a ScaI RFLP in a ND family, and increased the previously calculated lod score (z) to over 3 (3.38; theta = 0.05). Similarly, we calculated a lod score of 4.06 (theta = 0.01) between the OATL1 and DXS7 loci. Alone, the OATL1 ScaI RFLP system is expected to be informative in 48% of females. If this system were used in combination with the DXS7 TaqI polymorphism, 71% of females would be informative for at least one of the markers and 21% would be informative for both. Because the OATL1 ScaI RFLP is a relatively common polymorphism, this system should be useful for the identification of ND carriers and affected male fetuses and newborns.

Yeast artificial chromosome cloning in the glycerol kinase and adrenal hypoplasia congenita region of Xp21

Energy Technology Data Exchange (ETDEWEB)

Worley, K.C.; Ellison, K.A.; Zhang, Y.H.; Wang, D.F.; Mason, J.; Roth, E.J.; Adams, V.; Fogt, D.D.; Zhu, X.M.; Towbin, J.A. [Baylor College of Medicine, Houston, TX (United States)] [and others

1993-05-01

The adrenal hypoplasia congenita (AHC) and glycerol kinase (GK) loci are telomeric to the Duchenne muscular dystrophy locus in Xp21. The authors developed a pair of yeast artificial chromosome (YAC) contigs spanning at least 1.2 Mb and encompassing the region from the telomeric end of the Duchenne muscular dystrophy (DMD) locus to beyond YHX39 (DXS727), including the genes for AHC and GK. The centromeric contig consists of 13 YACs reaching more than 600 kb from DMD through GK. The telomeric contig group consists of 8 YACs containing more than 600 kb including the markers YHX39 (DXS727) and QST-59 (DXS319). Patient deletion breakpoints in the region of the two YAC contigs define at least eight intervals, and seven deletion breakpoints are contained within these contigs. In addition to the probes developed from YAC ends, they have mapped eight Alu-PCR probes amplified from a radiation-reduced somatic cell hybrid, two anonymous DNA probes, and one Alu-PCR product amplified from a cosmid end, for a total of 26 new markers within this region of 2 Mb or less. One YAC in the centromeric contig contains an insert encompassing the minimum interval for GK deficiency defined by patient deletion breakpoints, and this clone includes all or part of the GK gene. 33 refs., 3 figs., 5 tabs.

Norrie disease and MAO genes: nearest neighbors.

Science.gov (United States)

Chen, Z Y; Denney, R M; Breakefield, X O

1995-01-01

The Norrie disease and MAO genes are tandemly arranged in the p11.4-p11.3 region of the human X chromosome in the order tel-MAOA-MAOB-NDP-cent. This relationship is conserved in the mouse in the order tel-MAOB-MAOA-NDP-cent. The MAO genes appear to have arisen by tandem duplication of an ancestral MAO gene, but their positional relationship to NDP appears to be random. Distinctive X-linked syndromes have been described for mutations in the MAOA and NDP genes, and in addition, individuals have been identified with contiguous gene syndromes due to chromosomal deletions which encompass two or three of these genes. Loss of function of the NDP gene causes a syndrome of congenital blindness and progressive hearing loss, sometimes accompanied by signs of CNS dysfunction, including variable mental retardation and psychiatric symptoms. Other mutations in the NDP gene have been found to underlie another X-linked eye disease, exudative vitreo-retinopathy. An MAOA deficiency state has been described in one family to date, with features of altered amine and amine metabolite levels, low normal intelligence, apparent difficulty in impulse control and cardiovascular difficulty in affected males. A contiguous gene syndrome in which all three genes are lacking, as well as other as yet unidentified flanking genes, results in severe mental retardation, small stature, seizures and congenital blindness, as well as altered amine and amine metabolites. Issues that remain to be resolved are the function of the NDP gene product, the frequency and phenotype of the MAOA deficiency state, and the possible occurrence and phenotype of an MAOB deficiency state.

5-(2-Aminopropyl)indole (5-IT): a psychoactive substance used for recreational purposes is an inhibitor of human monoamine oxidase (MAO).

Science.gov (United States)

Herraiz, Tomás; Brandt, Simon D

2014-01-01

5-(2-Aminopropyl)indole (5-IT) is a psychoactive compound that has recently been associated with several fatal and non-fatal intoxications in a number of European countries. There are indications that acute effects may include symptoms of monoaminergic (e.g. serotonin) toxicity and one mechanism involved in the increase of serotonin levels includes the inhibition of monoamine oxidase. This study investigated the effect of 5-IT on human MAO-A and -B isozymes using kynuramine as the substrate. Substrate conversion to 4-hydroxyquinoline was monitored by high-performance liquid chromatography coupled to diode array detection. This method was employed to determine the extent of MAO inhibition (IC50 and Ki ) and it was found that 5-IT was a selective, competitive and reversible inhibitor of MAO-A. 5-IT revealed a relatively potent ability to inhibit MAO-A (IC50  =1.6 μM and Ki  =0.25 μM) while MAO-B inhibition was not observed (0-500 μM 5-IT). Under identical experimental conditions, other established inhibitors of MAO-A and antidepressants provided the following IC50 values: clorgyline 16 nM, harmaline 20 nM, toloxatone 6.7 μM and moclobemide >500 μM. These data indicated that 5-IT was less potent than clorgyline and harmaline but more potent than toloxatone and moclobemide under the in-vitro conditions studied. The inhibition of MAO-A suggests that 5-IT by itself or in combination with other substances may be able to potentiate serotonergic/monoaminergic effects and further studies are needed to clarify its relevance to the adverse effects reported for 5-IT. Copyright © 2013 John Wiley & Sons, Ltd.

Cortical enlargement in autism is associated with a functional VNTR in the monoamine oxidase A gene.

Science.gov (United States)

Davis, Lea K; Hazlett, Heather C; Librant, Amy L; Nopoulos, Peggy; Sheffield, Val C; Piven, Joesph; Wassink, Thomas H

2008-10-05

Monoamine oxidase A (MAOA) is an enzyme expressed in the brain that metabolizes dopamine, norepinephrine, epinephrine, and serotonin. Abnormalities of serotonin neurotransmission have long been implicated in the psychopathology of autism. A polymorphism exists within the promoter region of the MAOA gene that influences MAOA expression levels so that "low activity" alleles are associated with increased neurotransmitter levels in the brain. Individuals with autism often exhibit elevated serotonin levels. Additional studies indicate that the "low activity" allele may be associated with lower IQ and more severe autistic symptoms. In this study we genotyped the MAOA promoter polymorphism in a group of 29 males (age 2-3 years) with autism and a group of 39 healthy pediatric controls for whom brain MRI data was available. We found a consistent association between the "low activity" allele and larger brain volumes for regions of the cortex in children with autism but not in controls. We did not find evidence for over-transmission of the "low activity" allele in a separate sample of 114 affected sib pair families. Nor did we find any unknown SNPs in yet another sample of 96 probands. Future studies will determine if there is a more severe clinical phenotype associated with both the "low activity" genotype and the larger brain volumes in our sample.

Association study of monoamine oxidase A/B genes and schizophrenia in Han Chinese

Directory of Open Access Journals (Sweden)

Li Sheng-Bin

2011-10-01

Full Text Available Abstract Background Monoamine oxidases (MAOs catalyze the metabolism of dopaminergic neurotransmitters. Polymorphisms of isoforms MAOA and MAOB have been implicated in the etiology of mental disorders such as schizophrenia. Association studies detected these polymorphisms in several populations, however the data have not been conclusive to date. Here, we investigated the association of MAOA and MAOB polymorphisms with schizophrenia in a Han Chinese population. Methods Two functional single nucleotide polymorphisms (SNPs, rs6323 of MAOA and rs1799836 of MAOB, were selected for association analysis in 537 unrelated schizophrenia patients and 536 healthy controls. Single-locus and Haplotype associations were calculated. Results No differences were found in the allelic distribution of rs6323. The G allele of rs1799836 was identified as a risk factor in the development of schizophrenia (P = 0.00001. The risk haplotype rs6323T-rs1799836G was associated with schizophrenia in female patients (P = 0.0002, but the frequency difference was not significant among male groups. Conclusions Our results suggest that MAOB is a susceptibility gene for schizophrenia. In contrast, no significant associations were observed for the MAOA functional polymorphism with schizophrenia in Han Chinese. These data support further investigation of the role of MAO genes in schizophrenia.

Neutrophil Collagenase, Gelatinase and Myeloperoxidase in Tears of Stevens-Johnson Syndrome and Ocular Cicatricial Pemphigoid Patients

Science.gov (United States)

Arafat, Samer N.; Suelves, Ana M.; Spurr-Michaud, Sandra; Chodosh, James; Foster, C. Stephen; Dohlman, Claes H.; Gipson, Ilene K.

2013-01-01

Objective To investigate the levels of matrix metalloproteinases (MMPs), myeloperoxidase (MPO) and tissue inhibitor of metalloproteinase-1 (TIMP-1) in tears of patients with Stevens-Johnson syndrome (SJS) and ocular cicatricial pemphigoid (OCP). Design Prospective non-interventional cohort study. Participants Four SJS patients (7 eyes), 19 OCP patients (37 eyes) and 20 post-phacoemulsification healthy controls (40 eyes). Methods Tear washes were collected from all patients and were analyzed for levels of MMP-2, -3, -7, -8, -9, -12, MPO and TIMP-1 using multi-analyte bead-based enzyme-linked immunosorbent assays (ELISA). Total MMP activity was determined using a fluorimetric assay. Correlation studies were performed between the various analytes within study groups. Main Outcome Measures Levels of MMP-2, -3, -7, -8, -9, -12, MPO and TIMP-1 (in ng/µg protein), total MMP activity (in relative fluorescent units/min/µg protein) in tears, MMP-8/TIMP-1, MMP-9/TIMP-1 ratios and the correlations between MMP-8 and MMP-9 and each MMP and MPO. Results MMP-8, MMP-9 and MPO levels were significantly elevated in SJS and OCP tears (SJS > OCP) when compared to controls. MMP activity was highest in SJS while OCP and controls showed lower and similar activities. TIMP-1 levels were decreased in SJS and OCP when compared to controls with OCP levels reaching significance. MMP-8/TIMP-1 and MMP-9/TIMP-1 ratios were markedly elevated in SJS and OCP tears (SJS > OCP) when compared to controls. Across all study groups, MMP-9 levels correlated strongly with MMP-8 and MPO levels and MMP-8 correlated with MPO but did not reach significance in SJS. There was no relationship between MMP-7 and MPO. Conclusions Since MMP-8 and MPO are produced by inflammatory cells, particularly neutrophils, the correlation data indicate that they may be the common source of elevated enzymes including MMP-9 in SJS and OCP tears. Elevated MMP/TIMP ratios and MMP activity suggest an imbalance in tear MMP regulation

Elevated ratio of MMP2/MMP9 activity is associated with poor response to chemotherapy in osteosarcoma

International Nuclear Information System (INIS)

Kunz, Pierre; Sähr, Heiner; Lehner, Burkhard; Fischer, Christian; Seebach, Elisabeth; Fellenberg, Jörg

2016-01-01

Matrix metalloproteinases (MMPs) are crucially involved in the regulation of multiple stages of cancer progression. Elevated MMP levels have been associated with the development of metastases and poor prognosis in several types of cancer. However, the role of MMPs in osteosarcoma and their prognostic value is still unclear. Available data are conflicting, most likely due to different technical approaches. We hypothesized that in contrast to total mRNA or protein levels frequently analyzed in previous studies the enzymatic activities of MMPs and their inhibitors the tissue inhibitors of matrix metalloproteinases (TIMPs) are closer related to their biological functions. We therefore aimed to evaluate the reliability of different zymography techniques for the quantification of MMP and TIMP activities in osteosarcoma biopsies in order to investigate their distribution, possible regulation and prognostic value. All analyses were done using cryo-conserved osteosarcoma pretreatment biopsies (n = 18). Gene and protein expression of MMPs and TIMPs were analyzed by RT-qPCR and western blot analysis, respectively. Overall MMP activity was analyzed by in situ zymography, individual MMP activities were analyzed by gelatin zymography. Reverse zymography was used to detect and quantify TIMP activities. Strong overall MMP activities could be detected in osteosarcoma pretreatment biopsies with MMP2 and MMP9 as predominant active MMPs. In contrast to total RNA or protein expression MMP2 and MMP9 activities showed significant quantitative differences between good and poor responders. While MMP9 activity was high in the good responder group and significantly decreased in the poor responder group, MMP2 activity showed a reverse distribution. Likewise, significant differences were detected concerning the activity of TIMPs resulting in a negative correlation of TIMP1 activity with MMP2 activity (p = 0.044) and negative correlations of TIMP2 and TIMP3 with MMP9 activity (p = 0.007 and p

Expression of matrix metalloproteinase-2 and tissue inhibitor of metalloproteinase-2 in radiation exposed small intestinal mucosa of the rat

International Nuclear Information System (INIS)

Kwag, Hyon Joo; Lee, Kyoung Ja; Rhee, Chung Sik

2003-01-01

The matrix metalloproteinases (MMPs) are a family of enzymes whose main function is the degradation of the extracellular matrix. Several studies have revealed that MMPs and TIMPs are related to the wound healing process and in photoaging caused by ultraviolet irradiation. However, the expressions of MMP and TIMP after irradiation have not, to the best of our knowledge, been studied. This study investigates the expressions of MMP-2 and TIMP-2 in rat intestinal mucosa following irradiation. The entire abdomen of Sprague-Dawley rats was irradiated using a single dose method. The rats were sacrificed on day 1, 2, 3, 5, 7 and 14 following irradiation. Histopathological observations were made using hematoxilin and eosin staining. The expressions of MMP-2 and TIMP-2 were examined using immunohistochemistry, immunoblotting and ELISA. Radiation induced damage, associated with atrophic villi, and infiltration of inflammatory cells was observed from the first postirradiation day, and severe tissue damage was observed on the second and the third postirradiation days. An increase in mitosis and the number of regenerating crypts, as evidence of regeneration, were most noticeable on the fifth postirradiation day. From the immunohistochemistry, the MMP-2 expression was observed from the first postirradiation day, but was most conspicuous on the third and the fifth postirradiation days. The TIMP-2 expression was most conspicuous on the fifth postirradiation day. From the immunoblotting, the MMP-2 expression was strongly positive on the third postirradiation day, and that of TIMP-2 showed a strong positive response on the fifth postirradiation day. In ELISA, tests, the expressions of MMP-2 and TIMP-2. were increased in the postirradiation groups compared to those of the normal controls, and showed a maximum increase on the fifth postirradiation day. These results were statistically significant. The expressions of MMP-2 and TIMP-2 were increased in the intestinal mucosa of the rats

Matrix metalloproteinase-3 promoter polymorphisms but not dupA-H. pylori correlate to duodenal ulcers in H. pylori-infected females.

Science.gov (United States)

Yeh, Yi-Chun; Cheng, Hsiu-Chi; Chang, Wei-Lun; Yang, Hsiao-Bai; Sheu, Bor-Shyang

2010-08-13

This study investigated if the H. pylori dupA genotype and certain host single nucleotide polymorphisms (SNPs) of matrix metalloproteinases (MMPs) and their inhibitors (TIMPs), including MMP-3, MMP-7, MMP-9, TIMP-1 and TIMP-2, might correlate with ulcer risk of H. pylori-infected Taiwanese patients. Of the 549 H. pylori-infected patients enrolled, 470 patients (265 with gastritis, 118 with duodenal ulcer, and 87 with gastric ulcer) received SNPs analysis of MMP-3-1612 6A > 5A, MMP-7-181 A > G, MMP-9exon 6 A > G, TIMP-1372 T > C and TIMP-2-418 G > C by PCR-RFLP. The 181 collected H. pylori isolates were detected for the dupA genotype by PCR. The rates of dupA-positive H. pylori infection were similar among patients with duodenal ulcer (22.8%), gastric ulcer (20.0%), and gastritis (25.5%) (p > 0.05). Males had higher rates of duodenal ulcer and gastric ulcer than females (p dupA-status, may correlate with susceptibility to duodenal ulcer after H. pylori infection in Taiwanese females.

Synthesis and Preliminary Biological Evaluation of 1,3,5-Triazine Amino Acid Derivatives to Study Their MAO Inhibitors

Directory of Open Access Journals (Sweden)

Sherine N. Khattab

2015-09-01

Full Text Available Three series of 4,6-dimethoxy-, 4,6-dipiperidino- and 4,6-dimorpholino-1,3,5-triazin-2-yl amino acid derivatives were synthesized and characterized. A preliminary study for their monoamine oxidase inhibitory activity showed that compounds 7, 18, and 25 had MAO-A inhibition activity comparable to that of the standard clorgyline, with apparently more selective inhibitory activity toward MAO-A than MAO-B and no significant acute toxicity.

Serum Gelatinases Levels in Multiple Sclerosis Patients during 21 Months of Natalizumab Therapy

Directory of Open Access Journals (Sweden)

Massimiliano Castellazzi

2016-01-01

Full Text Available Background. Natalizumab is a highly effective treatment approved for multiple sclerosis (MS. The opening of the blood-brain barrier mediated by matrix metalloproteinases (MMPs is considered a crucial step in MS pathogenesis. Our goal was to verify the utility of serum levels of active MMP-2 and MMP-9 as biomarkers in twenty MS patients treated with Natalizumab. Methods. Serum levels of active MMP-2 and MMP-9 and of specific tissue inhibitors TIMP-1 and TIMP-2 were determined before treatment and for 21 months of therapy. Results. Serum levels of active MMP-2 and MMP-9 and of TIMP-1 and TIMP-2 did not differ during the treatment. The ratio between MMP-9 and MMP-2 was increased at the 15th month compared with the 3rd, 6th, and 9th months, greater at the 18th month than at the 3rd and 6th months, and higher at the 21st than at the 3rd and 6th months. Discussion. Our data indicate that an imbalance between active MMP-9 and active MMP-2 can occur in MS patients after 15 months of Natalizumab therapy; however, they do not support the use of serum active MMP-2 and active MMP-9 and TIMP-1 and TIMP-2 levels as biomarkers for monitoring therapeutic response to Natalizumab.

Serum Gelatinases Levels in Multiple Sclerosis Patients during 21 Months of Natalizumab Therapy

Science.gov (United States)

Bellini, Tiziana; Trentini, Alessandro; Delbue, Serena; Elia, Francesca; Gastaldi, Matteo; Franciotta, Diego; Bergamaschi, Roberto; Manfrinato, Maria Cristina; Volta, Carlo Alberto; Granieri, Enrico; Fainardi, Enrico

2016-01-01

Background. Natalizumab is a highly effective treatment approved for multiple sclerosis (MS). The opening of the blood-brain barrier mediated by matrix metalloproteinases (MMPs) is considered a crucial step in MS pathogenesis. Our goal was to verify the utility of serum levels of active MMP-2 and MMP-9 as biomarkers in twenty MS patients treated with Natalizumab. Methods. Serum levels of active MMP-2 and MMP-9 and of specific tissue inhibitors TIMP-1 and TIMP-2 were determined before treatment and for 21 months of therapy. Results. Serum levels of active MMP-2 and MMP-9 and of TIMP-1 and TIMP-2 did not differ during the treatment. The ratio between MMP-9 and MMP-2 was increased at the 15th month compared with the 3rd, 6th, and 9th months, greater at the 18th month than at the 3rd and 6th months, and higher at the 21st than at the 3rd and 6th months. Discussion. Our data indicate that an imbalance between active MMP-9 and active MMP-2 can occur in MS patients after 15 months of Natalizumab therapy; however, they do not support the use of serum active MMP-2 and active MMP-9 and TIMP-1 and TIMP-2 levels as biomarkers for monitoring therapeutic response to Natalizumab. PMID:27340316

Fragile X founder effect and distribution of CGG repeats among the mentally retarded population of Andalusia, South Spain

Directory of Open Access Journals (Sweden)

Yolanda de Diego

2002-01-01

Full Text Available Fragile X syndrome is the most common inherited form of mental retardation. We investigated the prevalence of the Fragile X syndrome in the population with mental retardation of unknown etiology in Andalusia, South Spain. We analyzed 322 unrelated patients (280 males and 42 females, and found a fragile X syndrome frequency of 6.5%. Among the non-fragile X chromosomes, the 29 CGG repeat was the most common allele. At the linked microsatellite DXS548 locus, we found a new allele which we called "allele 10" (17 CA. Similar to other south European populations, allele 2 (25 CA at the DXS548 locus and the fragile X allele were in linkage disequilibrium supporting the idea of a common founder chromosome predisposing to the CGG expansion.

Impaired CD23 and CD62L expression and tissue inhibitors of metalloproteinases secretion by eosinophils in adults with atopic dermatitis.

Science.gov (United States)

de Oliveira Titz, T; Orfali, R L; de Lollo, C; Dos Santos, V G; da Silva Duarte, A J; Sato, M N; Aoki, V

2016-12-01

Eosinophils are multifunctional, polymorphonuclear leucocytes that secrete proteins within cytoplasmic granules, such as cytokines, chemokines, metalloproteinases (MMPs) and metalloproteinases tissue inhibitors (TIMPs). Although eosinophilia is a hallmark of atopic dermatitis (AD), several functional aspects of eosinophils remain unknown. We aimed to evaluate the phenotype and functional response of eosinophils under staphylococcal enterotoxin B (SEB) and Toll-like receptor (TLR)-2/6 (FSL-1) stimulation in the secretion of CCL5, MMPs and TIMPs in adults with AD. Forty-one adult patients with AD and 45 healthy controls enrolled for the study. Phenotype of eosinophils from granulocytes of peripheral blood was analysed by flow cytometry. We performed evaluation of CCL5 (cytometric bead array), MMP and TIMP (ELISA) secretion, in culture supernatants of purified eosinophils stimulated with SEB or TLR2/6 agonist (FSL-1). We found a higher frequency of LIN1 - CCR3 + eosinophils, and decreased expression of CD23 and CD62L receptors in eosinophils of AD patients. There was no difference in MMP and TIMP serum levels between the evaluated groups. However, we detected decreased basal levels of TIMP-1, TIMP-2 and CCL5 in culture supernatants from purified, unstimulated eosinophils from AD patients. In adults with AD, phenotypical features of eosinophils reveal decreased expression of early activation and L-selectin receptors. Regarding the functional profile of purified eosinophils related to tissue remodelling in atopic dermatitis, innate immune stimulation (TLR2/6 agonist and SEB) did not affect the ratio of MMP/TIMPs secretion in AD. Our findings reinforce the potential breakdown in tissue remodelling process mediated by eosinophils in AD. © 2016 European Academy of Dermatology and Venereology.

Transforming growth factor β1, matrix metalloproteinase-2 and its tissue inhibitor in patients with pseudoexfoliation glaucoma/syndrome

Directory of Open Access Journals (Sweden)

Đorđević-Jocić Jasmina

2012-01-01

Full Text Available Background/Aim. Transforming growth factor-b1 (TGF-b1, oxidative stress and imbalance between matrix metalloproteinases (MMPs and their tissue inhibitors (TIMPs may play an important role in pathogenesis of pseudoexfoliation syndrome/glaucoma (PEX Sy/Gl. The aim of the study was to measure concentrations of TGF- b1, MMP-2, TIMP-2 in the aqueous humor in the examined group, as well as to compare the biochemical findings with the following clinical parameters: degree of chamber angle pigmantation, presence of pseudoexfoliation and the value of intraocular pressure (IOP. Methods. Aqueous samples from 30 patients with cataract, 30 patients with PEX Sy, 36 patients with PEX Gl, and 42 patients with primary open-angle glaucoma (POAG were collected during phacoemulsification cataract surgery. TGF b1, MMP-2, TIMP-2 Fluotokine Multi Analyze Profiling kits and Luminex technology were used to simultaneously measure TGF b1, MMP-2 and TIMP-2. Results. TGF- β1, MMP-2, TIMP-2 were detected in human aqueous from all the groups with the highest level in the group with PEX Gl. Statistically, a significant correlation between the levels of TGF b1, MMP-2, TIMP-2 in the aqueous humor of the patients with PEX Gl and the IOP value was confirmed (p < 0.05. In this group, the positive correlations between the TGF b1 concentration in the aqueous humor and the presence of pseudoexfoliation (p < 0.01, on the one hand, and between the TIMP-2 level and the presence of pseudoexfoliation (p < 0.05, on the other, were reported. A statistically significant positive correlation of TGF-b1 and MMP-2, and the degree of chamber angle pigmentation in the PEX Gl group was confirmed (p < 0.05. In the POAG group, TIMP-2 values were in a negative correlation with the degree of pigmentation (p < 0.05, and the IOP value (p < 0.05. Conclusion. TGF b1 and MMP-2 affect the degree of chamber angle pigmentation and the degree of pseudoexfoliation in patients with pseudoexfoliative glaucoma.

In contrast to matrix metalloproteinases, serum adiponectin concentrations increase after radioiodine treatment of thyrotoxicosis

Directory of Open Access Journals (Sweden)

Lewiński A

2012-10-01

Full Text Available Abstract Background Matrix metalloproteinases (MMPs, together with their tissue inhibitors (TIMPs, remodel extracellular matrix under physiological and pathological conditions and are implicated in pathogenesis of cardiovascular diseases, cancer and in chronic inflammation. We have endeavoured to assess whether concentrations of MMPs, TIMPs, and anti-inflammatory adiponectin are altered by pharmacological treatment of acute thyrotoxicosis or by radioiodine therapy (RIT. Material and methods We measured serum concentrations of MMP-2, MMP-9, TIMP-1, TIMP-2, and adiponectin, TSH, free T4 (FT4 and free T3 (FT3 in 15 patients (4 males, age (years 51.8±15.3 (mean±SD with hyperthyroidism treated with thiamazole (Group 1 and in 20 subjects (2 males, treated for thyrotoxicosis with radioiodine, age 52.3±12.4 (Group 2, where blood samples were taken before RIT, visit 1 (V1, seven days post RIT, visit 2 (V2, and two to three months post RIT, visit 3 (V3. Results In Group 1 there was no significant change in concentrations of MMP-2, MMP-9, TIMP-1, TIMP-2 or adiponectin, despite a fall in FT4 and FT3 (8.74±4.79 pg/ml vs 3.54±2.40 pg/ml, for FT3, and 4.48 ±2.21 ng/ml vs 1.02±1.07 ng/ml, for FT4, p4 and FT3 from 24.4±15.4 pmol/l (V1 to 14.7±10.6 pmol/l (V3, and from 10.0±5.65 (V1 to 6.1±4.8 pmol/l (V2, p4 and FT3, respectively. Conclusions Radioiodine therapy of thyrotoxicosis does not alter serum MMP-2, MMP-9 or TIMP-1 concentrations either acutely or after about three months of observation. An increase in serum adiponectin might reflect favourable effects of radioiodine administration on cardiovascular risk factors, while an increase in TIMP-2 (principal MMP-2 inhibitor might lead to a decrease in free MMP-2 concentrations.

Primary tumor levels of tissue inhibitor of metalloproteinases-1 are predictive of resistance to chemotherapy in patients with metastatic breast cancer

DEFF Research Database (Denmark)

Rasmussen, Anne-Sofie Schrohl; Meijer-van Gelder, Marion E.; Holten-Andersen, Mads N.

2006-01-01

/methotrexate/5-fluorouracil and anthracycline-based chemotherapy (P = 0.01; odds ratio, 2.0; 95% confidence interval, 1.1-3.3). In a multivariate model, including lymph node status, steroid hormone receptor status, menopausal status, dominant metastases site, type of chemotherapy, and disease-free interval, TIMP......PURPOSE: Only about 50% of metastatic breast cancer patients benefit from cytotoxic chemotherapy. Today, no validated markers exist for prediction of chemotherapy sensitivity/resistance in this patient group. Tissue inhibitor of metalloproteinases-1 (TIMP-1) has been shown to protect against...... tumor expression levels of TIMP-1 protein and objective response to first-line chemotherapy in 173 patients with metastatic breast cancer. RESULTS: When analyzed as a continuous log-transformed variable, increasing TIMP-1 levels were significantly associated with lack of response to cyclophosphamide...

Evaluation of the Expression of Amine Oxidase Proteins in Breast Cancer

Directory of Open Access Journals (Sweden)

Woo Young Sun

2017-12-01

Full Text Available We aimed to evaluate the expression of amine oxidase proteins in breast cancer and their clinical implications. We performed immunohistochemical staining of amine oxidase proteins (LOX, lysyl oxidase, AOC3, amine oxidase, MAOA, monoamine oxidase A, MAOB, monoamine oxidase B. Based on their hormone receptors, such as estrogen receptor (ER and progesterone receptor (PR, human epidermal growth factor receptor 2 (HER-2, and Ki-67 immunohistochemical staining, breast cancer was divided into four molecular subtypes: luminal A, luminal B, HER-2 type, and triple-negative breast cancer (TNBC. Luminal A was observed in 380 cases (49.4%, luminal B in 224 (29.1%, HER-2 type in 68 (8.8%, and TNBC in 98 (12.7%. Stromal AOC3, MAO-A, and MAO-B expression varied according to molecular subtypes. Stromal AOC3 expression was high in luminal B and HER-2 type and MAO-A expression was high in luminal A and luminal B (p < 0.001. MAO-B expression was higher in TNBC than in other subtypes (p = 0.020. LOX positivity was associated with high histological grade (p < 0.001 and high Ki-67 labeling index (LI (p = 0.009, and stromal AOC3 positivity was associated with high histological grade (p = 0.001, high Ki-67 LI (p < 0.001, and HER-2 positivity (p = 0.002. MAO-A positivity was related to low histological grade (p < 0.001, ER positivity, PR positivity (p < 0.001, and low Ki-67 LI (p < 0.001. In univariate analysis, MAO-A positivity was related to short disease-free survival in HER-2 type (p = 0.013, AOC3 negativity was related to short disease-free survival and overall survival in ER-positive breast cancer, PR-positive breast cancer, HER-2-negative breast cancer, and lymph node metastasis. In conclusion, the expression of amine oxidase proteins varies depending on the molecular subtype of breast cancer. Stromal AOC3 expression was high in luminal B and HER-2 type, and MAO-A expression was high in luminal A and luminal B.

Ovarian steroid regulation of monoamine oxidase-A and -B mRNAs in the macaque dorsal raphe and hypothalamic nuclei.

Science.gov (United States)

Gundlah, Chrisana; Lu, Nick Z; Bethea, Cynthia L

2002-03-01

The serotonin neural system plays a pivotal role in mood, affective regulation and integrative cognition, as well as numerous autonomic functions. We have shown that ovarian steroids alter the expression of several genes in the dorsal raphe of macaques, which may increase serotonin synthesis and decrease serotonin autoinhibition. Another control point in aminergic neurotransmission involves degradation by MAO. This enzyme occurs in two isoforms, A and B, which have different substrate preferences. We questioned the effect of ovarian steroid hormones on MAO-A and MAO-B mRNA expression in the dorsal raphe nucleus and hypothalamus using in situ hybridization in non-human primates. Rhesus monkeys ( Macaca mulatta; n=5/group) were spayed and either placebo treated (controls), estrogen (E) treated (28 days), progesterone (P) treated (14 days placebo+14 days P), or E+P treated (14 days E+14 days E+P). Perfusion-fixed sections (25 microm) were hybridized with a 233 bp MAO-A, or a 373 bp MAO-B, radiolabeled-antisense monkey specific probes. Autoradiographic films were analyzed by densitometry, which was performed with NIH Image Software. MAO-A and -B mRNAs were detected in the dorsal raphe nucleus (DRN) and in the hypothalamic suprachiasmatic nucleus (SCN), preoptic area (POA), paraventricular nucleus (PVN), supraoptic nucleus (SON), lateral hypothalamus (LH) and ventromedial nucleus (VMN). MAO-A mRNA optical density was significantly decreased by E, P, and E+P in the DRN and in the hypothalamic PVN, LH and VMN. Ovarian hormones had no effect on MAO-B mRNA expression in the DRN. However, there was a significant decrease in MAO-B optical density in the hypothalamic POA, LH and VMN with E, P or E+P treatment. Pixel area generally reflected optical density. Ovarian steroids decreased MAO-A, but not B, in the raphe nucleus. However, both MAO-A and B were decreased in discrete hypothalamic nuclei by hormone replacement. These data suggest that the transcriptional regulation of

Human monoamine oxidase is inhibited by tobacco smoke: β-carboline alkaloids act as potent and reversible inhibitors

International Nuclear Information System (INIS)

Herraiz, Tomas; Chaparro, Carolina

2005-01-01

Monoamine oxidase (MAO) is a mitochondrial outer-membrane flavoenzyme involved in brain and peripheral oxidative catabolism of neurotransmitters and xenobiotic amines, including neurotoxic amines, and a well-known target for antidepressant and neuroprotective drugs. Recently, positron emission tomography imaging has shown that smokers have a much lower activity of peripheral and brain MAO-A (30%) and -B (40%) isozymes compared to non-smokers. This MAO inhibition results from a pharmacological effect of smoke, but little is known about its mechanism. Working with mainstream smoke collected from commercial cigarettes we confirmed that cigarette smoke is a potent inhibitor of human MAO-A and -B isozymes. MAO inhibition was partly reversible, competitive for MAO-A, and a mixed-type inhibition for MAO-B. Two β-carboline alkaloids, norharman (β-carboline) and harman (1-methyl-β-carboline), were identified by GC-MS, quantified, and isolated from the mainstream smoke by solid phase extraction and HPLC. Kinetics analysis revealed that β-carbolines from cigarette smoke were competitive, reversible, and potent inhibitors of MAO enzymes. Norharman was an inhibitor of MAO-A (K i = 1.2 ± 0.18 μM) and MAO-B (K i = 1.12 ± 0.19 μM), and harman of MAO-A (K i = 55.54 ± 5.3 nM). β-Carboline alkaloids are psychopharmacologically active compounds that may occur endogenously in human tissues, including the brain. These results suggest that β-carboline alkaloids from cigarette smoke acting as potent reversible inhibitors of MAO enzymes may contribute to the MAO-reduced activity produced by tobacco smoke in smokers. The presence of MAO inhibitors in smoke like β-carbolines and others may help us to understand some of the purported neuropharmacological effects associated with smoking

Gene x Disease Interaction on Orbitofrontal Gray Matter in Cocaine Addiction

International Nuclear Information System (INIS)

Alia-Klein, N.; Parvaz, M.A.; Woicik, P.A.; Konova, A.B.; Maloney, T.; Shumay, E.; Wang, R.; Telang, F.; Biegon, A.; Wang, G.-J.; Fowler, J.S.; Tomasi, D.; Volkow, N.D.; Goldstein, R.Z.

2011-01-01

Long-term cocaine use has been associated with structural deficits in brain regions having dopamine-receptive neurons. However, the concomitant use of other drugs and common genetic variability in monoamine regulation present additional structural variability. The objective is to examine variations in gray matter volume (GMV) as a function of lifetime drug use and the genotype of the monoamine oxidase A gene, MAOA, in men with cocaine use disorders (CUD) and healthy male controls. Forty individuals with CUD and 42 controls who underwent magnetic resonance imaging to assess GMV and were genotyped for the MAOA polymorphism (categorized as high- and low-repeat alleles). The impact of cocaine addiction on GMV, tested by (1) comparing the CUD group with controls, (2) testing diagnosis x MAOA interactions, and (3) correlating GMV with lifetime cocaine, alcohol, and cigarette smoking, and testing their unique contribution to GMV beyond other factors. The results are: (1) Individuals with CUD had reductions in GMV in the orbitofrontal, dorsolateral prefrontal, and temporal cortex and the hippocampus compared with controls; (2) The orbitofrontal cortex reductions were uniquely driven by CUD with low- MAOA genotype and by lifetime cocaine use; and (3) The GMV in the dorsolateral prefrontal cortex and hippocampus was driven by lifetime alcohol use beyond the genotype and other pertinent variables. Long-term cocaine users with the low-repeat MAOA allele have enhanced sensitivity to gray matter loss, specifically in the orbitofrontal cortex, indicating that this genotype may exacerbate the deleterious effects of cocaine in the brain. In addition, long-term alcohol use is a major contributor to gray matter loss in the dorsolateral prefrontal cortex and hippocampus, and is likely to further impair executive function and learning in cocaine addiction.

Gene x Disease Interaction on Orbitofrontal Gray Matter in Cocaine Addiction

Energy Technology Data Exchange (ETDEWEB)

Alia-Klein, N.; Alia-Klein, N.; Parvaz, M.A.; Woicik, P.A.; Konova, A.B.; Maloney, T.; Shumay, E.; Wang, R.; Telang, F.; Biegon, A.; Wang, G.-J.; Fowler, J.S.; Tomasi, D.; Volkow, N.D.; Goldstein, R.Z.

2011-03-07

Long-term cocaine use has been associated with structural deficits in brain regions having dopamine-receptive neurons. However, the concomitant use of other drugs and common genetic variability in monoamine regulation present additional structural variability. The objective is to examine variations in gray matter volume (GMV) as a function of lifetime drug use and the genotype of the monoamine oxidase A gene, MAOA, in men with cocaine use disorders (CUD) and healthy male controls. Forty individuals with CUD and 42 controls who underwent magnetic resonance imaging to assess GMV and were genotyped for the MAOA polymorphism (categorized as high- and low-repeat alleles). The impact of cocaine addiction on GMV, tested by (1) comparing the CUD group with controls, (2) testing diagnosis x MAOA interactions, and (3) correlating GMV with lifetime cocaine, alcohol, and cigarette smoking, and testing their unique contribution to GMV beyond other factors. The results are: (1) Individuals with CUD had reductions in GMV in the orbitofrontal, dorsolateral prefrontal, and temporal cortex and the hippocampus compared with controls; (2) The orbitofrontal cortex reductions were uniquely driven by CUD with low- MAOA genotype and by lifetime cocaine use; and (3) The GMV in the dorsolateral prefrontal cortex and hippocampus was driven by lifetime alcohol use beyond the genotype and other pertinent variables. Long-term cocaine users with the low-repeat MAOA allele have enhanced sensitivity to gray matter loss, specifically in the orbitofrontal cortex, indicating that this genotype may exacerbate the deleterious effects of cocaine in the brain. In addition, long-term alcohol use is a major contributor to gray matter loss in the dorsolateral prefrontal cortex and hippocampus, and is likely to further impair executive function and learning in cocaine addiction.

Neutrophil collagenase, gelatinase, and myeloperoxidase in tears of patients with stevens-johnson syndrome and ocular cicatricial pemphigoid.

Science.gov (United States)

Arafat, Samer N; Suelves, Ana M; Spurr-Michaud, Sandra; Chodosh, James; Foster, C Stephen; Dohlman, Claes H; Gipson, Ilene K

2014-01-01

To investigate the levels of matrix metalloproteinases (MMPs), myeloperoxidase (MPO), and tissue inhibitor of metalloproteinase-1 (TIMP-1) in tears of patients with Stevens-Johnson syndrome (SJS) and ocular cicatricial pemphigoid (OCP). Prospective, noninterventional cohort study. Four SJS patients (7 eyes), 19 OCP patients (37 eyes), and 20 healthy controls who underwent phacoemulsification (40 eyes). Tear washes were collected from all patients and were analyzed for levels of MMP-2, MMP-3, MMP-7, MMP-8, MMP-9, MMP-12, MPO, and TIMP-1 using multianalyte bead-based enzyme-linked immunosorbent assays. Total MMP activity was determined using a fluorometric assay. Correlation studies were performed between the various analytes within study groups. Levels of MMP-2, MMP-3, MMP-7, MMP-8, MMP-9, MMP-12, MPO, and TIMP-1 (in nanograms per microgram of protein) and total MMP activity (in relative fluorescent units per minute per microgram of protein) in tears; MMP-8-to-TIMP-1 ratio; MMP-9-to-TIMP-1 ratio; and the correlations between MMP-8 and MMP-9 and both MMP and MPO. MMP-8, MMP-9, and MPO levels were elevated significantly in SJS and OCP tears (SJS>OCP) when compared with controls. The MMP activity was highest in SJS patients, whereas OCP patients and controls showed lower and similar activities. The TIMP-1 levels were decreased in SJS and OCP patients when compared with those in controls, with levels in OCP patients reaching significance. The MMP-8-to-TIMP-1 and MMP-9-to-TIMP-1 ratios were markedly elevated in SJS and OCP tears (SJS>OCP) when compared with those of controls. Across all study groups, MMP-9 levels correlated strongly with MMP-8 and MPO levels, and MMP-8 correlated with MPO, but it did not reach significance in SJS patients. There was no relationship between MMP-7 and MPO. Because MMP-8 and MPO are produced by inflammatory cells, particularly neutrophils, the correlation data indicate that they may be the common source of elevated enzymes, including MMP-9

Monoamine Oxidase-A Genetic Variants and Childhood Abuse Predict Impulsiveness in Borderline Personality Disorder.

Science.gov (United States)

Kolla, Nathan J; Meyer, Jeffrey; Sanches, Marcos; Charbonneau, James

2017-11-30

Impulsivity is a core feature of borderline personality disorder (BPD) and antisocial personality disorder (ASPD) that likely arises from combined genetic and environmental influences. The interaction of the low activity variant of the monoamine oxidase-A (MAOA-L) gene and early childhood adversity has been shown to predict aggression in clinical and non-clinical populations. Although impulsivity is a risk factor for aggression in BPD and ASPD, little research has investigated potential gene-environment (G×E) influences impacting its expression in these conditions. Moreover, G×E interactions may differ by diagnosis. Full factorial analysis of variance was employed to investigate the influence of monoamine oxidase-A (MAO-A) genotype, childhood abuse, and diagnosis on Barratt Impulsiveness Scale-11 (BIS-11) scores in 61 individuals: 20 subjects with BPD, 18 subjects with ASPD, and 23 healthy controls. A group×genotype×abuse interaction was present (F(2,49)=4.4, p =0.018), such that the interaction of MAOA-L and childhood abuse predicted greater BIS-11 motor impulsiveness in BPD. Additionally, BPD subjects reported higher BIS-11 attentional impulsiveness versus ASPD participants (t(1,36)=2.3, p =0.025). These preliminary results suggest that MAOA-L may modulate the impact of childhood abuse on impulsivity in BPD. Results additionally indicate that impulsiveness may be expressed differently in BPD and ASPD.

[Correlation between the mRNA expression of tissue inhibitor of metalloproteinase-1 and apparent diffusion coefficient on diffusion-weighted imaging in rats' liver fibrosis].

Science.gov (United States)

Zhan, Yuefu; Liang, Xianwen; Han, Xiangjun; Chen, Jianqiang; Zhang, Shufang; Tan, Shun; Li, Qun; Wang, Xiong; Liu, Fan

2017-02-28

To explore the correlation between the apparent diffusion coefficient (ADC) and mRNA expression of tissue inhibitor of metalloproteinase-1 (TIMP-1) in different stages of liver fibrosis in rats.
 Methods: A model of liver fibrosis in rats was established by intraperitoneal injection of high-fat diet combined with porcine serum. After drug administration for 4 weeks, 48 rats served as a model group and 12 rats served as a control group, then they underwent diffusion weighted imaging (DWI) scanning. The value of ADC was calculated at b value=800 s/mm2. The rats were sacrificed and carried out pathologic examination after DWI scanning immediately. The mRNA expression of TIMP-1 was detected by real time-polymerase chain reaction (RT-PCR). The rats of hepatic fibrosis were also divided into a S0 group (n=4), a S1 group (n=11), a S2 group (n=12), a S3 group (n=10), and a S4 group (n=9) according to their pathological stage. The value of ADC and the expression of TIMP-1 mRNA among the different stage groups of liver fibrosis were compared, and the correlation between ADC and the TIMP-1 mRNA were analyzed.
 Results: The ADC value and the TIMP-1 mRNA expression were significantly different between the control group and the liver fibrosis group (F=46.54 and 53.87, P0.05). For the comparison of TIMP-1 mRNA, there was no significant difference between the S1 group and the S2 group, the S3 group and the S4 group (both P>0.05). There were significant differences among the rest of the groups (all Pcorrelation analysis showed that there was a negative correlation between the ADC value and the TIMP-1 mRNA expression (r=-0.76, Pcorrelation between them.

Postnatal changes of gene expression for tissue inhibitors of metalloproteinase-1 and -2 and cystatins S and C, in rat submandibular gland demonstrated by quantitative reverse transcription-polymerase chain reaction.

Science.gov (United States)

Nishiura, T; Abe, K

1999-01-01

The rat submandibular gland is not fully developed at birth and definitive differentiation takes place postnatally. The steady-state mRNA expression for the four proteinase inhibitor molecules, tissue inhibitors of metalloproteinase (TIMP)-1 and -2, and cystatins S and C, and for a housekeeping gene, glyceraldehyde-3-phosphate dehydrogenase (G3PDH), in rat submandibular glands was measured by quantitative competitive reverse transcription-polymerase chain reaction (RT-PCR) at different stages of postnatal development. The gene-expression patterns of TIMP-1 and -2 relative to G3PDH were similar to each other. The TIMP-2 and cystatin C genes were more highly expressed than those of TIMP-1 and cystatin S at all stages. Moreover, the gene expressions of TIMP-1 and -2, and of cystatins S and C, were predominant between 1 and 7, and 7 and 12 weeks of age, respectively, and coincided developmentally with the regression of terminal tubule cells and the differentiation of granular convoluted tubule cells, respectively. Quantitative competitive RT-PCR allowed accurate measurement of small changes in the steady-state concentrations of these proteinase-inhibitor mRNA molecules.

Xp21 contiguous gene syndromes: Deletion quantitation with bivariate flow karyotyping allows mapping of patient breakpoints

Energy Technology Data Exchange (ETDEWEB)

McCabe, E.R.B.; Towbin, J.A. (Baylor College of Medicine, Houston, TX (United States)); Engh, G. van den; Trask, B.J. (Lawrence Livermore National Lab., CA (United States))

1992-12-01

Bivariate flow karyotyping was used to estimate the deletion sizes for a series of patients with Xp21 contiguous gene syndromes. The deletion estimates were used to develop an approximate scale for the genomic map in Xp21. The bivariate flow karyotype results were compared with clinical and molecular genetic information on the extent of the patients' deletions, and these various types of data were consistent. The resulting map spans >15 Mb, from the telomeric interval between DXS41 (99-6) and DXS68 (1-4) to a position centromeric to the ornithine transcarbamylase locus. The deletion sizing was considered to be accurate to [plus minus]1 Mb. The map provides information on the relative localization of genes and markers within this region. For example, the map suggests that the adrenal hypoplasia congenita and glycerol kinase genes are physically close to each other, are within 1-2 Mb of the telomeric end of the Duchenne muscular dystrophy (DMD) gene, and are nearer to the DMD locus than to the more distal marker DXS28 (C7). Information of this type is useful in developing genomic strategies for positional cloning in Xp21. These investigations demonstrate that the DNA from patients with Xp21 contiguous gene syndromes can be valuable reagents, not only for ordering loci and markers but also for providing an approximate scale to the map of the Xp21 region surrounding DMD. 44 refs., 3 figs.

Assessment of the biological variation of plasma tissue inhibitor of metalloproteinases-1

DEFF Research Database (Denmark)

Frederiksen, C.B.; Lomholt, Anne Fog; Lottenburger, Tine

2008-01-01

BACKGROUND: Tissue inhibitor of metalloproteinases-1 (TIMP-1) measurements in plasma may be useful for the early detection and prognosis of colorectal cancer (CRC). Data on analytical performance and normal intra- and interindividual biological variation are required in order to interpret...... the utility of TIMP-1 in CRC. The aim of this study was to establish the biological and analytical variation of plasma TIMP-1 in volunteers. MATERIAL AND METHODS: Three separate studies were undertaken. 1: Plasma was collected from 23 volunteers 6 times within a 3-week period, first in September 2004 (round...

Serum Levels of Tissue Inhibitors of Metalloproteinase 2 in Patients With Systemic Sclerosis With Duration More Than 2 Years: Correlation With Cardiac and Pulmonary Abnormalities

Directory of Open Access Journals (Sweden)

Amira Shahin

2006-01-01

with elevated TIMP-2 levels was significantly higher than dSSc patients with normal levels (P=.013. Four patients out of five with elevated TIMP-2 levels showed diastolic dysfunction (80%, compared to 2 out of 15 lSSc patients with normal levels (13.3%, with P=.014. Our research, though involving a small group of patients, points to the probable role of TIMP-2 in the development of pulmonary lesions in dSSc patients and cardiac lesions in lSSc patients with duration equal to or more than 2 years.

No evidence for allelic association between bipolar disorder and monoamine oxidase A gene polymorphisms

Energy Technology Data Exchange (ETDEWEB)

Craddock, N.; Daniels, J.; Roberts, E. [Univ. of Wales, College of Medicine, Cardiff (United Kingdom)] [and others

1995-08-14

We have tested the hypothesis that DNA markers in the MAOA gene show allelic association with bipolar affective disorder. Eighty-four unrelated Caucasian patients with DSM III-R bipolar disorder and 84 Caucasian controls were typed for three markers in MAOA: a dinucleotide repeat in intron 2, a VNTR in intron 1, and an Fnu4HI RFLP in exon 8. No evidence for allelic association was observed between any of the markers and bipolar disorder. 9 refs., 1 tab.

Refined localization of the Prieto-syndrome locus

Energy Technology Data Exchange (ETDEWEB)

Martinez, F.; Prieto, F. [Unidad de Genetica, Valencia (Spain); Gal, A. [Universitaets-Krankenhaus Eppendorf, Hamburg (Germany)

1996-07-12

PRS designates the locus for a syndromal form of X-linked mental retardation (Prieto syndrome) characterized by minor facial anomalies, ear malformation, abnormal growth of teeth, clinodactyly, sacral dimple, patellar luxation, malformation of lower limbs, abnormalities of the fundus of the eye, and subcortical cerebral atrophy. Linkage analysis localized the disease locus between DXS84 (Xp21.1) and DXS255. Here we present additional linkage data that provide further support and refinement of this localization. Individual III-18 gave birth to a male, currently aged 2 7/12 years, who clearly shows delayed psychomotor development. He began to walk at 23 months and his speech is delayed. In addition, he shows the characteristic facial anomalies, {open_quotes}dysplastic{close_quotes} ears, sacral dimple, and clinodactyly, as do all other affected males in this family. 7 refs., 1 tab.

Norrie disease as part of a complex syndrome explained by a submicroscopic deletion of the X chromosome.

Science.gov (United States)

Bleeker-Wagemakers, E M; Zweije-Hofman, I; Gal, A

1988-11-01

A 15-year-old male patient with the typical ocular symptoms of Norrie disease is described. Additionally, he presents severe mental retardation, growth disturbances, hypogonadism, and increased susceptibility to infections. This complex syndrome is apparently segregating through three generations: four other male relatives of the patient were blind from birth and died from recurrent infections between the ages of three to 15 months. The DNA sequence of the DXS7 locus (L1.28 probe), known to be closely linked to the Norrie gene, was not found in the patient's DNA. This result suggests that the more complex clinical picture seen is the result of a deletion of the X chromosome spanning DXS7, the Norrie gene, and several neighbouring loci. A detailed clinical description of the patient is given and compared to that of similar cases.

PPM-X: A new X-linked mental retardation syndrome with psychosis, pyramidal signs, and macroorchidism maps to Xq28

Energy Technology Data Exchange (ETDEWEB)

Lindsay, S.; Splitt, M.; Edney, S. [Univ. of Newcastle upon Tyne (United Kingdom)] [and others

1996-06-01

We report a three-generation family manifesting a previously undescribed X-linked mental retardation syndrome. Four of the six moderately retarded males have had episodes of manic-depressive psychosis. The phenotype also includes pyramidal signs, Parkinsonian features, and macroorchidism, but there are no characteristic dysmorphic facial features. Affected males do not show fragile sites at distal Xq on cytogenetic analysis, nor do they have expansions of the CGG repeats at the FRAXA, FRAXE, or FRAXF loci. Linkage analyses were undertaken, and a maximal LOD score of 3.311 at {theta} = .0 was observed with the microsatellite marker DXS1123 in Xq28. A recombination was detected in one of the affected males with DXS1691 (Xq28), which gives the proximal boundary of the localization. No distal recombination has been detected at any of the loci tested. 31 refs., 2 figs., 2 tabs.

Altered Cerebellar Organization and Function in Monoamine Oxidase A Hypomorphic Mice

Science.gov (United States)

Alzghoul, Loai; Bortolato, Marco; Delis, Foteini; Thanos, Panayotis K.; Darling, Ryan D.; Godar, Sean C; Zhang, Junlin; Grant, Samuel; Wang, Gene-Jack; Simpson, Kimberly L.; Chen, Kevin; Volkow, Nora D.; Lin, Rick C.S.; Shih, Jean C.

2012-01-01

Monoamine oxidase A (MAO-A) is the key enzyme for the degradation of brain serotonin (5-hydroxytryptamine, 5-HT), norepinephrine (NE) and dopamine (DA). We recently generated and characterized a novel line of MAO-A hypormorphic mice (MAO-ANeo), featuring elevated monoamine levels, social deficits and perseverative behaviors as well as morphological changes in the basolateral amygdala and orbitofrontal cortex. Here we showed that MAO-ANeo mice displayed deficits in motor control, manifested as subtle disturbances in gait, motor coordination, and balance. Furthermore, magnetic resonance imaging of the cerebellum revealed morphological changes and a moderate reduction in the cerebellar size of MAO- ANeo mice compared to wild type (WT) mice. Histological and immunohistochemical analyses using calbindin-D-28k (CB) expression of Purkinje cells revealed abnormal cerebellar foliation with vermal hypoplasia and decreased in Purkinje cell count and their dendritic density in MAO- ANeo mice compared to WT. Our current findings suggest that congenitally low MAO-A activity leads to abnormal development of the cerebellum. PMID:22971542

[The role of disequilibrium of expression of matrix metalloproteinase-2/9 and their tissue inhibitors in pathogenesis of hyperoxia-induced acute lung injury in mice].

Science.gov (United States)

Zhang, Xiang-feng; Zhu, Guang-fa; Liu, Shuang; Foda, Hussein D

2008-10-01

To investigate the role of matrix metalloproteinase-2/9 (MMP-2/9) and their tissue inhibitors (TIMP-1/2) in pathogenesis of acute lung injury (ALI) induced by hyperoxia. Seventy-two C57BL/6 mice were randomly divided into normal control group, hyperoxia for 24 hours group, hyperoxia for 48 hours group, and hyperoxia for 72 hours group, with 18 mice in each group. The mice in hyperoxia groups were exposed to >98% oxygen in sealed cages, and the normal control group were placed outside of the cage to breathe room air. At the end of the exposure time the animals were euthanized, the right lung was removed and phosphate buffer solution (PBS) was used to lavage the lung through the endotracheal catheter. The wet/dry weight ratio, broncho-alveolar lavage fluid (BALF) protein content and the volume of pleural fluid were measured, the severity of lung injury was assessed; the expression of MMP-2/9 and TIMP-1/2 mRNA in lung tissue at 24, 48 and 72 hours of hyperoxia were assessed by reverse transcript-polymerase chain reaction (RT-PCR); the amount of MMP-2/9 and TIMP-1/2 protein in lung tissue were measured by enzyme-linked immunosorbent assay (ELISA). Hyperoxia caused ALI as evidenced by the increase in lung wet/dry weight ratio, BALF protein content and the volume of pleural fluid as compared with the normal control group (P<0.05 or P<0.01). RT-PCR study showed increased expression of MMP-2/9 and TIMP-1 mRNA in lung tissues (P<0.05 or P<0.01), and ELISA assay also demonstrated upregulation of MMP-2/9 and an increase in TIMP-1 amount in BALF compared with their normal control group (P<0.05 or P<0.01). The ratios of both MMP-2 mRNA/TIMP-2 mRNA and MMP-2 protein/TIMP-2 protein were all increased in hyperoxia groups as compared with their normal control group (all P<0.01). Hyperoxia causes ALI in mice, and disturbance of MMP-2/TIMP-2 balance plays an important role in the development of hyperoxia-induced ALI in mice.

The correlation between the levels of tissue inhibitor of metalloproteinases 1 in plasma and tumour response and survival after preoperative radiochemotherapy in patients with rectal cancer

International Nuclear Information System (INIS)

Oblak, Irena; Velenik, Vaneja; Anderluh, Franc; Mozina, Barbara; Ocvirk, Janja

2013-01-01

The aim of this study was to analyse whether the level of tissue inhibitor of metalloproteinases (TIMP) 1 is associated with the tumour response and survival to preoperative radiochemotherapy in rectal cancer patients. Ninety-two patients with histologically confirmed non-metastatic rectal cancer of clinical stage I– III were treated with preoperative radiochemotherapy, surgery and postoperative chemotherapy. Plasma TIMP-1 concentrations were measured prior to the start of the treatment with an enzyme-linked immunosorbent assay (ELISA). Median follow-up time was 68 months (range: 3–93 months) while in survivors it was 80 months (range: 68–93 months). The 5-year locoregional control (LRC), disease-free survival (DFS), disease-specific survival (DSS) and overall survival (OS) rates for all patients were 80.2%, 56.4%, 63.7% and 52.2%, respectively. The median TIMP-1 level was 185 ng/mL (range: 22–523 ng/mL) and the mean level (±standard deviation) was 192 (±87) ng/mL. Serum TIMP-1 levels were found to be significantly increased in patients with preoperative CRP>12 mg/L and in those who died from rectal cancer or had cT4 tumours. No correlation was established for age, gender, carcinoembriogenic antigene (CEA) level, platelets count, histopathological grade, response to preoperative therapy, resectability and disease reappearance. On univariate analysis, various parameters favourably influenced one or more survival endpoints: TIMP-1 <170 ng/mL, CRP <12 mg/L, platelets count <290 10E9/L, CEA <3.4mg/L, age <69 years, male gender, early stage disease (cN0 and/or cT2–3), radical surgery (R0) and response to preoperative radiochemotherapy. In multivariate model, LRC was favourably influenced by N-downstage, DFS by lower CRP and N-downstage, DSS by lower CRP and N-downstage and OS by lower TIMP-1 level, lower CRP and N-downstage. Although we did not find any association between pretreatment serum TIMP-1 levels and primary tumour response to preoperative

System of matrix metalloproteinases and cytokine secretion in type 2 diabetes mellitus and impaired carbohydrate tolerance associated with arterial hypertension.

Science.gov (United States)

Kologrivova, I V; Suslova, T E; Koshel'skaya, O A; Vinnitskaya, I V; Trubacheva, O A

2014-03-01

The study included patients with type 2 diabetes mellitus and impaired carbohydrate tolerance associated with arterial hypertension, patients with arterial hypertension, and healthy volunteers. We evaluated the levels of matrix metalloproteinases 2 and 9 (MMP-2, MMP-9), tissue inhibitor of metalloproteinase type 1 (TIMP-1), glucose, insulin, C-peptide, glycated hemoglobin, and spontaneous and mitogen-activated cytokine secretion (IL-2, IL4, IL-6, IL-10, IL-17, TNF-α, and IFN-γ). Patients with type 2 diabetes mellitus in combination with arterial hypertension exhibited maximum TIMP-1 levels and TIMP-1/MMP-2, TIMP-1/ MMP-9 ratios as well as enhanced secretion of TNF-α, IL-6, IL-17 and reduced secretion of IL-10 in comparison with healthy individuals. The observed shifts are probably determined the development of systemic hyperinsulinemia in patients suffering from type 2 diabetes mellitus coupled with arterial hypertension.

Catalytic properties of ADAM12 and its domain deletion mutants

DEFF Research Database (Denmark)

Jacobsen, Jonas; Visse, Robert; Sørensen, Hans Peter

2008-01-01

of pro, catalytic, disintegrin, cysteine-rich, and EGF domains. Here we present a novel activity of recombinant ADAM12-S and its domain deletion mutants on S-carboxymethylated transferrin (Cm-Tf). Cleavage of Cm-Tf occurred at multiple sites, and N-terminal sequencing showed that the enzyme exhibits...... restricted specificity but a consensus sequence could not be defined as its subsite requirements are promiscuous. Kinetic analysis revealed that the noncatalytic C-terminal domains are important regulators of Cm-Tf activity and that ADAM12-PC consisting of the pro domain and catalytic domain is the most...... active on this substrate. It was also observed that NaCl inhibits ADAM12. Among the tissue inhibitors of metalloproteinases (TIMP) examined, the N-terminal domain of TIMP-3 (N-TIMP-3) inhibits ADAM12-S and ADAM12-PC with low nanomolar Ki(app) values while TIMP-2 inhibits them with a slightly lower...

Characterization of [(3)H]harmane binding to rat whole brain membranes.

Science.gov (United States)

Anderson, N J; Robinson, E S J; Husbands, S M; Delagrange, P; Nutt, D J; Hudson, A L

2003-12-01

This study investigates the binding of [(3)H]harmane to rat whole brain homogenates. Saturation studies revealed [(3)H]harmane labels a single, saturable, high-capacity population with high affinity. All the test compounds displaced [(3)H]harmane completely and in an apparently monophasic manner. The displacement profile of the test ligands indicated labeling of MAO-A. Given the high level of MAO-A binding, it is unlikely that a low-capacity I(2) site would be distinguishable from the total [(3)H]harmane population.

Effect of dental restoration with epoxy and bioceramic paste on periodontal tissue damage

Directory of Open Access Journals (Sweden)

Nan-Lin Meng

2017-05-01

Full Text Available Objective: To study the effect of dental restoration with epoxy and bioceramic paste on periodontal tissue damage. Methods: Patients with pulpal and periapical diseases who received root canal therapy in our hospital between May 2013 and October 2016 were retrospectively analyzed, and according to the different root canal filling materials they used, they were divided into epoxy group and bioceramic group who used epoxy paste and bioceramic paste as root canal filling materials respectively. Before and after treatment, gingival crevicular fluid was collected respectively to determine the levels of inflammatory factors, oxidative stress products, cell apoptosis molecules and protease-related molecules. Results: 2 weeks after treatment, IL-1β, IL-6, CRP, ROS, MDA, AOPP, Bcl-2, Bax, Cyt-C, caspase-3, Smac, EMMPRIN, MMP-1, MMP-2, TIMP-1 and TIMP-2 levels in gingival crevicular fluid of epoxy group were not significantly different from those before treatment; IL-1β, IL-6, CRP, ROS, MDA, AOPP, Bax, Cyt-C, caspase-3, Smac, EMMPRIN, MMP-1 and MMP-2 levels in gingival crevicular fluid of bioceramic group were significantly higher than those before treatment while Bcl-2, TIMP-1 and TIMP-2 levels were significantly lower than those before treatment; IL-1β, IL-6, CRP, ROS, MDA, AOPP, Bcl-2, Bax, Cyt-C, caspase-3, Smac, EMMPRIN, MMP-1, MMP-2, TIMP-1 and TIMP-2 levels in gingival crevicular fluid were significantly different between two groups of patients after treatment. Conclusion: Epoxy paste for dental restoration causes less damage to periodontal tissue than bioceramic paste.

Effect of dental restoration with epoxy and bioceramic paste on periodontal tissue damage

Institute of Scientific and Technical Information of China (English)

Nan-Lin Meng

2017-01-01

Objective:To study the effect of dental restoration with epoxy and bioceramic paste on periodontal tissue damage.Methods: Patients with pulpal and periapical diseases who received root canal therapy in our hospital between May 2013 and October 2016 were retrospectively analyzed, and according to the different root canal filling materials they used, they were divided into epoxy group and bioceramic group who used epoxy paste and bioceramic paste as root canal filling materials respectively. Before and after treatment, gingival crevicular fluid was collected respectively to determine the levels of inflammatory factors, oxidative stress products, cell apoptosis molecules and protease-related molecules.Results: 2 weeks after treatment, IL-1β, IL-6, CRP, ROS, MDA, AOPP, Bcl-2, Bax, Cyt-C, caspase-3, Smac, EMMPRIN, MMP-1, MMP-2, TIMP-1 and TIMP-2 levels in gingival crevicular fluid of epoxy group were not significantly different from those before treatment; IL-1β, IL-6, CRP, ROS, MDA, AOPP, Bax, Cyt-C, caspase-3, Smac, EMMPRIN, MMP-1 and MMP-2 levels in gingival crevicular fluid of bioceramic group were significantly higher than those before treatment while Bcl-2, TIMP-1 and TIMP-2 levels were significantly lower than those before treatment; IL-1β, IL-6, CRP, ROS, MDA, AOPP, Bcl-2, Bax, Cyt-C, caspase-3, Smac, EMMPRIN, MMP-1, MMP-2, TIMP-1 and TIMP-2 levels in gingival crevicular fluid were significantly different between two groups of patients after treatment.Conclusion:Epoxy paste for dental restoration causes less damage to periodontal tissue than bioceramic paste.

Tissue inhibitor of matrix metalloproteinase-1 mediates erythropoietin-induced neuroprotection in hypoxia ischemia.

Science.gov (United States)

Souvenir, Rhonda; Fathali, Nancy; Ostrowski, Robert P; Lekic, Tim; Zhang, John H; Tang, Jiping

2011-10-01

Previous studies have shown that erythropoietin (EPO) is neuroprotective in both in vivo and in vitro models of hypoxia ischemia. However these studies hold limited clinical translations because the underlying mechanism remains unclear and the key molecules involved in EPO-induced neuroprotection are still to be determined. This study investigated if tissue inhibitor of matrix metalloproteinase-1 (TIMP-1) and its upstream regulator signaling molecule Janus kinase-2 (JAK-2) are critical in EPO-induced neuroprotection. Hypoxia ischemia (HI) was modeled in-vitro by oxygen and glucose deprivation (OGD) and in-vivo by a modified version of Rice-Vannucci model of HI in 10-day-old rat pups. EPO treated cells were exposed to AG490, an inhibitor of JAK-2 or TIMP-1 neutralizing antibody for 2h with OGD. Cell death, phosphorylation of JAK-2 and signal transducers and activators of transcription protein-3 (STAT-3), TIMP-1 expression, and matrix metalloproteinase-9 (MMP-9) activity were measured and compared with normoxic group. Hypoxic ischemic animals were treated one hour following HI and evaluated 48 h after. Our data showed that EPO significantly increased cell survival, associated with increased TIMP-1 activity, phosphorylation of JAK-2 and STAT-3, and decreased MMP-9 activity in vivo and in vitro. EPO's protective effects were reversed by inhibition of JAK-2 or TIMP-1 in both models. We concluded that JAK-2, STAT-3 and TIMP-1 are key mediators of EPO-induced neuroprotection during hypoxia ischemia injury. Copyright © 2011 Elsevier Inc. All rights reserved.

Gene-expression analysis of matrix metalloproteinases 1 and 2 and their tissue inhibitors in chronic periapical inflammatory lesions.

Science.gov (United States)

Hadziabdic, Naida; Kurtovic-Kozaric, Amina; Pojskic, Naris; Sulejmanagic, Nedim; Todorovic, Ljubomir

2016-03-01

Periapical inflammatory lesions have been investigated previously, but understanding of pathogenesis of these lesions (granulomas and radicular cysts) at the molecular level is still questionable. Matrix metalloproteinases (MMPs) are enzymes involved in the development of periapical pathology, specifically inflammation and tissue destruction. To elucidate pathogenesis of periapical granulomas and radicular cysts, we undertook a detailed analysis of gene expression of MMP-1, MMP-2 and their tissue inhibitors, TIMP-1 and TIMP-2. A total of 149 samples were analyzed using real-time PCR (59 radicular cysts, 50 periapical granulomas and 40 healthy gingiva samples as controls) for expression of MMP-1, MMP-2, TIMP-1 and TIMP-2 genes. The determination of best reference gene for expression analysis of periapical lesions was done using a panel of 12 genes. We have shown that β-actin and GAPDH are not the most stable reference controls for gene expression analysis of inflammatory periapical tissues and healthy gingiva. The most suitable reference gene was determined to be SDHA (a succinate dehydrogenase complex, subunit A, flavoprotein [Fp]). We found that granulomas (n = 50) and radicular cysts (n = 59) exhibited significantly higher expression of all four examined genes, MMP-1, MMP-2, TIMP-1, and TIMP-2, when compared to healthy gingiva (n = 40; P periapical inflammatory lesions. Since the abovementioned markers were not differentially expressed in periapical granulomas and radicular cysts, the challenge of finding the genetic differences between the two lesions still remains. © 2015 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

Diabetes may affect the expression of matrix metalloproteinases and their inhibitors more than smoking in chronic periodontitis.

Science.gov (United States)

Bastos, M F; Tucci, M A; de Siqueira, A; de Faveri, M; Figueiredo, L C; Vallim, P C; Duarte, P M

2017-04-01

No previous study has directly compared the levels of matrix metalloproteinases (MMPs) and tissue inhibitor of metalloproteinases (TIMPs) between smokers and individuals with diabetes mellitus (DM) with periodontitis. Therefore, the aim of this study was to evaluate the gene expression of MMP-1, MMP-2, MMP-8, MMP-9, TIMP-1 and TIMP-2 in tissues with chronic periodontitis (ChP) of smokers and individuals with type 2 DM. Gingival biopsies were harvested from: non-smokers and non-diabetic individuals with ChP (n = 18) (ChP group); non-diabetic smokers (≥ 10 cigarettes per day for at least the past 5 years) with ChP (n = 18) (SChP group); non-smoking individuals with type 2 diabetes (glycated hemoglobin levels ≥ 7.5%) and ChP (n = 18) (DMChP group). The tissue levels of mRNA of MMP-1, MMP-2, MMP-8, MMP-9, TIMP-1 and TIMP-2 were evaluated by quantitative real-time polymerase chain reaction. The MMP-8 expression was the lowest in the ChP group (p smoking, which may contribute to a greater extracellular matrix degradation and periodontal breakdown in DM-related periodontitis. © 2016 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

Elevation of Matrix Metalloproteinases in Different Areas of Ascending Aortic Aneurysms in Patients with Bicuspid and Tricuspid Aortic Valves

Directory of Open Access Journals (Sweden)

Salah A. Mohamed

2012-01-01

Full Text Available Our aim is to investigate the elevation of matrix proteins in tissues obtained from distal, above the sinotubular junction (proximal, concave, and convex sites of aneurysms in the ascending aorta using a simultaneous multiplex protein detection system. Tissues were collected from 41 patients with ascending aortic aneurysms. A total of 31 patients had a bicuspid aortic valve (BAV, whereas 10 had a tricuspid aortic valve (TAV. Concave and convex aortic site samples were collected from all patients, whereas proximal and distal convexity samples were obtained from 19 patients with BAV and 7 patients with TAV. Simultaneous detection of matrix metalloproteinases (MMPs and their inhibitors (TIMPs was performed at each of the four aortic sites. MMP-2 levels were higher in the concave aortic sites than in the convex aortic sites. In contrast, MMP-8 levels were higher in the convex sites than in the concave sites, as were MMP-9 levels. In both BAV and TAV patients, TIMP-3 levels were higher in the concave sites than in the convex sites. However, TIMP-2 and TIMP-4 levels were significantly elevated in the sinotubular proximal aorta of BAV patients. Simultaneous detection of MMPs and TIMPs revealed different levels at different aortic sites in the same patient.

[Analysis of correlation between pulmonary function and expression levels of matrix metalloproteinases-9 and tissue inhibitor of metalloproteinase-1 among toluene diisocyanate exposed workers].

Science.gov (United States)

Miao, P P; Meng, T; Jia, Q; Niu, Y; Ye, M; Ji, Y Q; Ju, R; Chen, X L; Shao, H; Zheng, Y X; Dai, Y F

2016-05-01

To investigate the effect of occupational toluene diisocyanate(TDI) exposure on matrix metalloproteinases-9 (MMP-9) and tissue inhibitor of metalloproteinase-1(TIMP-1), and analysis of the correlation of MMP-9,TIMP-1,MMP-9/TIMP-1 and lung function. In October 2014, based on cluster sampling, we conducted a cross-sectional study in a TDI production factory located in China's western region. 61 exposed workers were recruited from workers engaged in packing, operating and checking. Based on different levels of the external exposure, the packers were classified as high exposed group, while operators and checkers as low exposed group. 58 factory managers, matching age and agent, were selected as controls, having same work intense and not contacting the TDI or other allergens. The questionnaire surveys were used to obtain the agent, age, work age, smoking and drinking, personal and family allergic history, occupational history, and the recent health conditions. The levels of MMP-9 and TIMP-1 in serum of subjects were determind by ELISA. The time weighted average concentrations (8h-TWA) were used to describe the levels of TDI air exposure in working environment. Spearman correlation assay was used to investigate the correlation of MMP-9, TIMP-1, MMP-9/TIMP-1 and lung function, exposure time. 8-hour TWA means of TDI air levels in exposed group, packers, operators and checkers were 0.39, 0.76, 0.25 mg/m(3), respectively . According to the external exposure concentration, the packers were classified as high exposed group, and the operators and checkers were classified as low exposed group. In controls, low exposed group and high exposed group, the levels of MMP-9, respectively, were (807.21±347.70),(586.91±317.50),(388.94±312.01) ng/ml (χ(2)=16.69, Pcorrelation analysis showed that levels of MMP-9 were positively associated with FEV1.0, and FEV1.0/FVC (r values were 0.27, 0.25, respectively, all Pcorrelated with exposure time(r=-0.26, P=0.040). The positive correlations

In vitro and ex vivo distribution of [3H]harmane, an endogenous beta-carboline, in rat brain.

Science.gov (United States)

Anderson, Neil J; Tyacke, Robin J; Husbands, Stephen M; Nutt, David J; Hudson, Alan L; Robinson, Emma S J

2006-03-01

The endogenous beta-carboline, harmane, has been shown to bind to monoamine oxidase A (MAO-A) and a separate, high affinity, non-MAO site. Research in our laboratory has shown that harmane is an active component of clonidine-displacing substance (CDS), the proposed endogenous ligand for imidazoline binding sites (IBS). In the present study we have investigated the distribution of [3H]harmane in rat brain, and related the binding profile to the distribution of the MAO-A selective ligand [3H]Ro41-1049 and the I2BS ligand [3H]2-BFI. The in vivo distribution of [3H]harmane following intravenous administration was also investigated. Receptor autoradiography revealed a highly significant correlation for the distribution of [3H]harmane and [3H]Ro41-1049, and a significant correlation for [3H]harmane and the I2BS ligand [3H]2-BFI. The in vivo distribution of [3H]harmane suggests that the ligand accumulates in the adrenal gland and throughout the brain with the primary route of excretion occurring via the duodenum. In conclusion, these studies have shown that [3H]harmane labels a population of binding sites that reflect the distribution of MAO-A. Further evidence for a non-MAO, IBS [3H]harmane population has not been shown but the high level of expression of the MAO-A site is likely to have masked the much smaller population of I2BS.

Some aspects on the variations in depositional flux of excess Thorium-230 in the central Indian basin during Late Quaternary

Digital Repository Service at National Institute of Oceanography (India)

Sukumaran, N.P.

Examined in this paper is the tentative history of the depositional flux of @u230@@Th@dxs@@ (the unsupported fraction of @u230@@Th scavenged from the overlying water column), for the Late Quaternary period from a sediment core of the Central Indian...

Influence of phase I periodontal therapy on levels of matrix metalloproteinase 1 and tissue inhibitor of metalloproteinase 1

Directory of Open Access Journals (Sweden)

Pallavi S. Ghodpage

2014-10-01

Conclusions: We observed that as the extent of periodontal destruction increases, MMP-1 concentration increases and TIMP-1 concentration decreases in GCF. When chronic periodontitis patients were treated by scaling and root planing (SRP, the average MMP-1 concentrations decreased and TIMP-1 concentrations increased in GCF.

Urinary matrix metalloproteinases reflect renal damage in anti-neutrophil cytoplasm autoantibody-associated vasculitis

NARCIS (Netherlands)

Sanders, J.S.F.; Huitema, M.G.; Hanemaaijer, R.; Goor, H. van; Kallenberg, C.G.M.; Stegeman, C.A.

2007-01-01

Renal expression of MMP-2, -9, and tissue inhibitor of MMP-1 (TIMP-1) correlates with histological disease activity in anti-neutrophil cytoplasm autoantibody (ANCA)-associated vasculitis (AAV). We studied whether urinary and plasma levels of MMP-2, -9, and TIMP-1 reflect renal expression of these

Evaluation of an improved tissue inhibitor of metalloproteinase 1 dual monoclonal sandwich immunoassay

DEFF Research Database (Denmark)

Sørensen, Nanna Møller; Blincko, Stuart; Dinsmore, Emma

2006-01-01

BACKGROUND: It has previously been shown that increased levels of plasma tissue inhibitor of metalloproteinase 1 (TIMP-1) is associated with shorter survival for patients with colorectal cancer (CRC). Furthermore, plasma TIMP-1 levels have been found to be elevated in patients with early-stage CR...

Association between monoamine oxidase A gene promoter 30 bp repeat polymorphism and tardive dyskinesia in Chinese schizophrenics

Institute of Scientific and Technical Information of China (English)

Changhe Fan; Lihua Li; Yan Fu; Hehuang Deng; Xiangjiao Liao; Youcai Zhou

2006-01-01

BACKGROUND: The pathophysiology of tardive dyskinesia (TD) is not yet fully understood. With the hypothesis of altered dopaminergic neurotransmission, altered activities of dopamine degrading enzymes such as monoamine oxidase A (MAOA) and their coding genes are supposed to be related to the pathophysiology of TD.OBJECTIVE: To investigate possible association between 30 bp variable number tandem repeat (VNTR) polymorphism in the promoter of MAOA gene and susceptibility, severity of neuroleptic induced TD in Chinese Han people in Guandong Province.DESIGN: Non-randomization-synchronization controlled study. SETTING: Guangdong Mental Health Institute, Guangdong Provincial People's Hospital; Guangzhou Psychiatric Hospital; Affiliated Psychiatric Hospital of Guangzhou Municipal Bureau of Civil Administration. PARTICIPANTS: A total of 179 subjects were enrolled in the study. All subjects were sporadic and genetically unrelated Chinese schizophrenic patients who were hospitalizing in Guangzhou Psychiatric Hospital or Affiliated Psychiatric Hospital of Guangzhou Municipal Bureau of Civil Administration during January to April 2005. The diagnosis of schizophrenia was made according to the criteria of Diagnostic and Statistic Manual of Mental Disorder-the third edition-revised (DSM-Ⅲ-R). Among all patients, 88 were diagnosed as with TD and 91 without TD according to the research diagnostic criteria described by Schooler-Kane. Informed consent was obtained from all subjects or their relatives.METHODS: ① TD severity was assessed with the AIMS which was a 5-degree rating scale from 0 to 4 (corresponding to none, minimal, mild, moderate and severe, respectively). The study was approved by the Ethics Committees of the two hospitals and informed consent was obtained from all subjects or their relatives. ② The polymerase chain reaction (PCR) and polyacrylamide gel electrophoresis (PAGE) techniques were used to detect MAOA gene 30 bp VNTR polymorphism in schizophrenic patients

Biomarkers in Trypanosoma cruzi-infected and uninfected individuals with varying severity of cardiomyopathy in Santa Cruz, Bolivia.

Science.gov (United States)

Okamoto, Emi E; Sherbuk, Jacqueline E; Clark, Eva H; Marks, Morgan A; Gandarilla, Omar; Galdos-Cardenas, Gerson; Vasquez-Villar, Angel; Choi, Jeong; Crawford, Thomas C; Do, Rose Q; Q, Rose; Fernandez, Antonio B; Colanzi, Rony; Flores-Franco, Jorge Luis; Gilman, Robert H; Bern, Caryn

2014-10-01

Twenty to thirty percent of persons with Trypanosoma cruzi infection eventually develop cardiomyopathy. If an early indicator were to be identified and validated in longitudinal studies, this could enable treatment to be prioritized for those at highest risk. We evaluated cardiac and extracellular matrix remodeling markers across cardiac stages in T. cruzi infected (Tc+) and uninfected (Tc-) individuals. Participants were recruited in a public hospital in Santa Cruz, Bolivia and assigned cardiac severity stages by electrocardiogram and echocardiogram. BNP, NTproBNP, CKMB, troponin I, MMP-2, MMP-9, TIMP-1, TIMP-2, TGFb1, and TGFb2 were measured in specimens from 265 individuals using multiplex bead systems. Biomarker levels were compared between Tc+ and Tc- groups, and across cardiac stages. Receivers operating characteristic (ROC) curves were created; for markers with area under curve>0.60, logistic regression was performed. Analyses stratified by cardiac stage showed no significant differences in biomarker levels by Tc infection status. Among Tc+ individuals, those with cardiac insufficiency had higher levels of BNP, NTproBNP, troponin I, MMP-2, TIMP-1, and TIMP-2 than those with normal ejection fraction and left ventricular diameter. No individual marker distinguished between the two earliest Tc+ stages, but in ROC-based analyses, MMP-2/MMP-9 ratio was significantly higher in those with than those without ECG abnormalities. BNP, NTproBNP, troponin I, MMP-2, TIMP-1, and TIMP-2 levels rose with increasing severity stage but did not distinguish between Chagas cardiomyopathy and other cardiomyopathies. Among Tc+ individuals without cardiac insufficiency, only the MMP-2/MMP-9 ratio differed between those with and without ECG changes.

Genes, Parenting, Self-Control, and Criminal Behavior.

Science.gov (United States)

Watts, Stephen J; McNulty, Thomas L

2016-03-01

Self-control has been found to predict a wide variety of criminal behaviors. In addition, studies have consistently shown that parenting is an important influence on both self-control and offending. However, few studies have examined the role that biological factors may play in moderating the relationship between parenting, self-control, and offending. Using a sample of adolescent males drawn from the National Longitudinal Study of Adolescent Health (N = 3,610), we explore whether variants of the monoamine oxidase A gene (MAOA) and the dopamine transporter (DAT1) gene interact with parenting to affect self-control and offending. Results reveal that parenting interacts with these genes to influence self-control and offending, and that the parenting-by-gene interaction effect on offending is mediated by self-control. The effects of parenting on self-control and offending are most pronounced for those who carry plasticity alleles for both MAOA and DAT1. Thus, MAOA and DAT1 may be implicated in offending because they increase the negative effects of parenting on self-control. Implications for theory are discussed. © The Author(s) 2014.

In-vivo studies by positron emission tomography of the pharmacokinetics of L-6-F-18-fluorodopa

International Nuclear Information System (INIS)

Pate, B.D.; Calne, D.B.; Hewitt, K.A.; Ruth, T.J.; Adam, M.J.

1989-01-01

Positron emission tomography has been used to study the pharmacokinetics of fluorine-18-labelled L-6-fluorodopa in the brains of cynomolgus monkey subjects. The protocol for each experiment consisted of two series of twelve 10-minutes scans, conducted one after the other with the monkey in the same position, with an inhibitor acting at a specific stage of the kinetics, administered before the second series. Subtractions of the two scan series (following correction for activity residue in the second scans) then gave a quantitative measure of the effects produced by the inhibitor. The inhibitors studied include NSD 1015 (decarboxylase inhibitor), chlorgyline (MAO-A inhibitor), deprenyl (MAO-B inhibitor), pargyline (inhibitor of both MAO-A and MAO-B), U-0521 (COMT inhibitor), and reserpine (vesicular storage inhibitor). The results show that L-6-fluorodopa is a substrate for dopa decarboxylase, while fluorodopamine is a substrate for both MAO-A and MAO-B, and for COMT. Vesicular storage (inhibited by reserpine) was shown also to be essential for concentration of the activity into striatal images

Genetic background of extreme violent behavior.

Science.gov (United States)

Tiihonen, J; Rautiainen, M-R; Ollila, H M; Repo-Tiihonen, E; Virkkunen, M; Palotie, A; Pietiläinen, O; Kristiansson, K; Joukamaa, M; Lauerma, H; Saarela, J; Tyni, S; Vartiainen, H; Paananen, J; Goldman, D; Paunio, T

2015-06-01

In developed countries, the majority of all violent crime is committed by a small group of antisocial recidivistic offenders, but no genes have been shown to contribute to recidivistic violent offending or severe violent behavior, such as homicide. Our results, from two independent cohorts of Finnish prisoners, revealed that a monoamine oxidase A (MAOA) low-activity genotype (contributing to low dopamine turnover rate) as well as the CDH13 gene (coding for neuronal membrane adhesion protein) are associated with extremely violent behavior (at least 10 committed homicides, attempted homicides or batteries). No substantial signal was observed for either MAOA or CDH13 among non-violent offenders, indicating that findings were specific for violent offending, and not largely attributable to substance abuse or antisocial personality disorder. These results indicate both low monoamine metabolism and neuronal membrane dysfunction as plausible factors in the etiology of extreme criminal violent behavior, and imply that at least about 5-10% of all severe violent crime in Finland is attributable to the aforementioned MAOA and CDH13 genotypes.

Matrix metalloproteinase-3 promoter polymorphisms but not dupA-H. pylori correlate to duodenal ulcers in H. pylori-infected females

Directory of Open Access Journals (Sweden)

Yeh Yi-Chun

2010-08-01

Full Text Available Abstract Background This study investigated if the H. pylori dupA genotype and certain host single nucleotide polymorphisms (SNPs of matrix metalloproteinases (MMPs and their inhibitors (TIMPs, including MMP-3, MMP-7, MMP-9, TIMP-1 and TIMP-2, might correlate with ulcer risk of H. pylori-infected Taiwanese patients. Results Of the 549 H. pylori-infected patients enrolled, 470 patients (265 with gastritis, 118 with duodenal ulcer, and 87 with gastric ulcer received SNPs analysis of MMP-3-1612 6A > 5A, MMP-7-181 A > G, MMP-9exon 6 A > G, TIMP-1372 T > C and TIMP-2-418 G > C by PCR-RFLP. The 181 collected H. pylori isolates were detected for the dupA genotype by PCR. The rates of dupA-positive H. pylori infection were similar among patients with duodenal ulcer (22.8%, gastric ulcer (20.0%, and gastritis (25.5% (p > 0.05. Males had higher rates of duodenal ulcer and gastric ulcer than females (p H. pylori-infected patients, the MMP-3 6A6A genotype were more common in patients with duodenal ulcers than in those with gastritis (87.7% vs. 74.9%, p p H. pylori-infected females. Conclusions The MMP-3 promoter polymorphism, but not the dupA-status, may correlate with susceptibility to duodenal ulcer after H. pylori infection in Taiwanese females.

Induced sputum MMP-1, -3 & -8 concentrations during treatment of tuberculosis.

Directory of Open Access Journals (Sweden)

Cesar A Ugarte-Gil

Full Text Available Tuberculosis (TB destroys lung tissues and this immunopathology is mediated in part by Matrix Metalloproteinases (MMPs. There are no data on the relationship between local tissue MMPs concentrations, anti-tuberculosis therapy and sputum conversion.Induced sputum was collected from 68 TB patients and 69 controls in a cross-sectional study. MMPs concentrations were measured by Luminex array, TIMP concentrations by ELISA and were correlated with a disease severity score (TBscore. 46 TB patients were then studied longitudinally at the 2nd, 8th week and end of treatment.Sputum MMP-1,-2,-3,-8,-9 and TIMP-1 and -2 concentrations are increased in TB. Elevated MMP-1 and -3 concentrations are independently associated with higher TB severity scores (p<0.05. MMP-1, -3 and -8 concentrations decreased rapidly during treatment (p<0.05 whilst there was a transient increase in TIMP-1/2 concentrations at week 2. MMP-2, -8 and -9 and TIMP-2 concentrations were higher at TB diagnosis in patients who remain sputum culture positive at 2 weeks and MMP-3, -8 and TIMP-1 concentrations were higher in these patients at 2nd week of TB treatment.MMPs are elevated in TB patients and associate with disease severity. This matrix-degrading phenotype resolves rapidly with treatment. The MMP profile at presentation correlates with a delayed treatment response.

Loss of Endothelial Barrier in Marfan Mice (mgR/mgR Results in Severe Inflammation after Adenoviral Gene Therapy.

Directory of Open Access Journals (Sweden)

Philipp Christian Seppelt

Full Text Available Marfan syndrome is an autosomal dominant inherited disorder of connective tissue. The vascular complications of Marfan syndrome have the biggest impact on life expectancy. The aorta of Marfan patients reveals degradation of elastin layers caused by increased proteolytic activity of matrix metalloproteinases (MMPs. In this study we performed adenoviral gene transfer of human tissue inhibitor of matrix metalloproteinases-1 (hTIMP-1 in aortic grafts of fibrillin-1 deficient Marfan mice (mgR/mgR in order to reduce elastolysis.We performed heterotopic infrarenal transplantation of the thoracic aorta in female mice (n = 7 per group. Before implantation, mgR/mgR and wild-type aortas (WT, C57BL/6 were transduced ex vivo with an adenoviral vector coding for human TIMP-1 (Ad.hTIMP-1 or β-galactosidase (Ad.β-Gal. As control mgR/mgR and wild-type aortas received no gene therapy. Thirty days after surgery, overexpression of the transgene was assessed by immunohistochemistry (IHC and collagen in situ zymography. Histologic staining was performed to investigate inflammation, the neointimal index (NI, and elastin breaks. Endothelial barrier function of native not virus-exposed aortas was evaluated by perfusion of fluorescent albumin and examinations of virus-exposed tissue were performed by transmission electron microscopy (TEM.IHC and ISZ revealed sufficient expression of the transgene. Severe cellular inflammation and intima hyperplasia were seen only in adenovirus treated mgR/mgR aortas (Ad.β-Gal, Ad.hTIMP-1 NI: 0.23; 0.43, but not in native and Ad.hTIMP-1 treated WT (NI: 0.01; 0.00. Compared to native mgR/mgR and Ad.hTIMP-1 treated WT aorta, the NI is highly significant greater in Ad.hTIMP-1 transduced mgR/mgR aorta (p = 0.001; p = 0.001. As expected, untreated Marfan grafts showed significant more elastolysis compared to WT (p = 0.001. However, elastolysis in Marfan aortas was not reduced by adenoviral overexpression of hTIMP-1 (compared to untreated

Association of Protein Distribution and Gene Expression Revealed by PET and Post-Mortem Quantification in the Serotonergic System of the Human Brain.

Science.gov (United States)

Komorowski, A; James, G M; Philippe, C; Gryglewski, G; Bauer, A; Hienert, M; Spies, M; Kautzky, A; Vanicek, T; Hahn, A; Traub-Weidinger, T; Winkler, D; Wadsak, W; Mitterhauser, M; Hacker, M; Kasper, S; Lanzenberger, R

2017-01-01

Regional differences in posttranscriptional mechanisms may influence in vivo protein densities. The association of positron emission tomography (PET) imaging data from 112 healthy controls and gene expression values from the Allen Human Brain Atlas, based on post-mortem brains, was investigated for key serotonergic proteins. PET binding values and gene expression intensities were correlated for the main inhibitory (5-HT1A) and excitatory (5-HT2A) serotonin receptor, the serotonin transporter (SERT) as well as monoamine oxidase-A (MAO-A), using Spearman's correlation coefficients (rs) in a voxel-wise and region-wise analysis. Correlations indicated a strong linear relationship between gene and protein expression for both the 5-HT1A (voxel-wise rs = 0.71; region-wise rs = 0.93) and the 5-HT2A receptor (rs = 0.66; 0.75), but only a weak association for MAO-A (rs = 0.26; 0.66) and no clear correlation for SERT (rs = 0.17; 0.29). Additionally, region-wise correlations were performed using mRNA expression from the HBT, yielding comparable results (5-HT1Ars = 0.82; 5-HT2Ars = 0.88; MAO-A rs = 0.50; SERT rs = -0.01). The SERT and MAO-A appear to be regulated in a region-specific manner across the whole brain. In contrast, the serotonin-1A and -2A receptors are presumably targeted by common posttranscriptional processes similar in all brain areas suggesting the applicability of mRNA expression as surrogate parameter for density of these proteins. © The Author 2016. Published by Oxford University Press.

Optical bio-sniffer for methyl mercaptan in halitosis.

Science.gov (United States)

Mitsubayashi, Kohji; Minamide, Takeshi; Otsuka, Kimio; Kudo, Hiroyuki; Saito, Hirokazu

2006-07-28

An optical bio-sniffer for methyl mercaptan (MM) one of major odorous chemicals in halitosis (bad breath) was constructed by immobilizing monoamine oxidase type A (MAO-A) onto a tip of a fiber optic oxygen sensor (od: 1.59 mm) with an oxygen sensitive ruthenium organic complex (excitation: 470 nm, fluorescent: 600 nm). A flow cell for circulating buffer solution was applied to rinse and clean the tip of the device like nasal mucosa. In order to amplify the bio-sniffer output, a substrate regeneration cycle caused by coupling MAO-A with l-ascorbic acid (AsA) as reducing reaction with reagent system was applied to the sensor system. After evaluating the sensor characteristics using a gas flow measurement system with a gas generator, the optical bio-sniffer was applied to expired gases from healthy male volunteers for halitosis analysis as a physiological application. The optical bio-sniffer was applied to detect the oxygen consumption induced by MAO-A enzymatic reaction (and AsA chemical reduction) with gaseous MM application. The bio-sniffer was calibrated against MM vapor from 8.7 to 11500 ppb with correlation coefficient of 0.977, including a MM threshold (200 ppb) of pathologic halitosis and the human sense of smell level 3.5 (10.0 ppb), with good gas-selectivity based on the MAO-A substrate specificity. As the result of the physiological application, the optical bio-sniffer could successfully monitor the MM level change in breath samples during daytime, which is consistent with the previously reported results.