The Battle between the Biometricians and the Mendelians: How Sir Francis Galton's Work Caused His Disciples to Reach Conflicting Conclusions about the Hereditary Mechanism

Science.gov (United States)

Gillham, Nicholas W.

2015-01-01

Francis Galton, Charles Darwin's cousin, had wide and varied interests. They ranged from exploration and travel writing to fingerprinting and the weather. After reading Darwin's "On the Origin of Species," Galton reached the conclusion that it should be possible to improve the human stock through selective breeding, as was the…

Finite-size scaling of survival probability in branching processes.

Science.gov (United States)

Garcia-Millan, Rosalba; Font-Clos, Francesc; Corral, Álvaro

2015-04-01

Branching processes pervade many models in statistical physics. We investigate the survival probability of a Galton-Watson branching process after a finite number of generations. We derive analytically the existence of finite-size scaling for the survival probability as a function of the control parameter and the maximum number of generations, obtaining the critical exponents as well as the exact scaling function, which is G(y)=2ye(y)/(e(y)-1), with y the rescaled distance to the critical point. Our findings are valid for any branching process of the Galton-Watson type, independently of the distribution of the number of offspring, provided its variance is finite. This proves the universal behavior of the finite-size effects in branching processes, including the universality of the metric factors. The direct relation to mean-field percolation is also discussed.

[Under what conditions does G.C Watson-Crick DNA base pair acquire all four configurations characteristic for A.T Watson-Crick DNA base pair?].

Science.gov (United States)

Brovarets', O O

2013-01-01

At the MP2/6-311++G(2df,pd)//B3LYP/6-311++G(d,p) level of theory it was established for the first time, that the Löwdin's G*.C* DNA base pair formed by the mutagenic tautomers can acquire, as the A-T Watson-Crick DNA base pair, four biologically important configurations, namely: Watson-Crick, reverse Watson-Crick, Hoogsteen and reverse Hoogsteen. This fact demonstrates rather unexpected role of the tautomerisation of the one of the Watson-Crick DNA base pairs, in particular, via double proton transfer: exactly the G.C-->G*.C* tautomerisation allows to overcome steric hindrances for the implementation of the above mentioned configurations. Geometric, electron-topological and energetic properties of the H-bonds that stabilise the studied pairs, as well as the energetic characteristics of the latters are presented.

Oncologists partner with Watson on genomics.

Science.gov (United States)

2015-08-01

A new collaboration between IBM Watson Health and more than a dozen cancer centers uses the power of cognitive computing to dramatically reduce the time it takes to analyze data from patients' DNA and identify targeted treatment options. ©2015 American Association for Cancer Research.

Ed Watson - 1940-2006

CERN Multimedia

2006-01-01

Ed Watson passed away suddenly on 1 August in Geneva, he was 66. He leaves his wife and two children. Ed Watson arrived at CERN in March 1973 to work on digital electronics and CAMAC systems under Bob Dobinson, after many years at Rolls Royce in Scotland. He joined the European Muon Collaboration in 1976, where he played a major role in the design, deployment and running of its data acquisition system (DAQ) with David Botterill, Bob Dobinson, and Vicky White. The CAMAC-ROMULUS system was by far the largest and most advanced of its time, and it became a defining standard for DAQ systems for years to come. Ed was deeply involved in the detailed planning of the control rooms and the experiment cabling, as well as sharing the responsibility for the CAMAC readout system. He had a real talent for trouble shooting and played a vital part in supporting the experiment throughout its lifetime. He offered great moral support to the younger members of the collaboration and helped them a great deal with their work. The...

Making IBM's Computer, Watson, Human

Science.gov (United States)

Rachlin, Howard

2012-01-01

This essay uses the recent victory of an IBM computer (Watson) in the TV game, "Jeopardy," to speculate on the abilities Watson would need, in addition to those it has, to be human. The essay's basic premise is that to be human is to behave as humans behave and to function in society as humans function. Alternatives to this premise are considered…

Chuck Watson's ``differential psychoacoustics:'' Individual differences in auditory abilities

Science.gov (United States)

Kidd, Gary R.

2004-05-01

Chuck Watson was among the first in the psychoacoustic community to seriously address the topic of individual differences. At a time when there was little concern with variation among ``normal listeners'' in psychoacoustic research, Watson began a research program to document the range of human auditory abilities. The primary goals were to determine the number of distinct abilities, to specify the nature of each ability, and to document the distribution of these abilities in the general population. Thanks to Watson's talent for organizing and directing large-scale projects and his workmanlike approach to science, a large and valuable body of data on human individual differences has been collected. The research program began about 20 years ago with the study of basic auditory abilities, and it has expanded to include other modalities and cognitive/intellectual abilities in adults and children. A somewhat biased view of the importance of this work will be presented by one of Watson's many colleagues in this endeavor. The talk will provide an overview of this ongoing research program as well as a brief review of some related research by other investigators. New findings from recent extensions of this work will also be discussed.

Modelling the PCR amplification process by a size-dependent branching process and estimation of the efficiency

NARCIS (Netherlands)

Lalam, N.; Jacob, C.; Jagers, P.

2004-01-01

We propose a stochastic modelling of the PCR amplification process by a size-dependent branching process starting as a supercritical Bienaymé-Galton-Watson transient phase and then having a saturation near-critical size-dependent phase. This model allows us to estimate the probability of replication

A Boyer-Moore (or Watson-Watson) type algorithm for regular tree pattern matching

NARCIS (Netherlands)

Watson, B.W.; Aarts, E.H.L.; Eikelder, ten H.M.M.; Hemerik, C.; Rem, M.

1995-01-01

In this chapter, I outline a new algorithm for regular tree pattern matching. The existence of this algorithm was first mentioned in the statements accompanying my dissertation, [2]. In order to avoid repeating the material in my dissertation, it is assumed that the reader is familiar with Chapters

How a low-fidelity DNA polymerase chooses non-Watson-Crick from Watson-Crick incorporation.

Science.gov (United States)

Wu, Wen-Jin; Su, Mei-I; Wu, Jian-Li; Kumar, Sandeep; Lim, Liang-Hin; Wang, Chun-Wei Eric; Nelissen, Frank H T; Chen, Ming-Chuan Chad; Doreleijers, Jurgen F; Wijmenga, Sybren S; Tsai, Ming-Daw

2014-04-02

A dogma for DNA polymerase catalysis is that the enzyme binds DNA first, followed by MgdNTP. This mechanism contributes to the selection of correct dNTP by Watson-Crick base pairing, but it cannot explain how low-fidelity DNA polymerases overcome Watson-Crick base pairing to catalyze non-Watson-Crick dNTP incorporation. DNA polymerase X from the deadly African swine fever virus (Pol X) is a half-sized repair polymerase that catalyzes efficient dG:dGTP incorporation in addition to correct repair. Here we report the use of solution structures of Pol X in the free, binary (Pol X:MgdGTP), and ternary (Pol X:DNA:MgdGTP with dG:dGTP non-Watson-Crick pairing) forms, along with functional analyses, to show that Pol X uses multiple unprecedented strategies to achieve the mutagenic dG:dGTP incorporation. Unlike high fidelity polymerases, Pol X can prebind purine MgdNTP tightly and undergo a specific conformational change in the absence of DNA. The prebound MgdGTP assumes an unusual syn conformation stabilized by partial ring stacking with His115. Upon binding of a gapped DNA, also with a unique mechanism involving primarily helix αE, the prebound syn-dGTP forms a Hoogsteen base pair with the template anti-dG. Interestingly, while Pol X prebinds MgdCTP weakly, the correct dG:dCTP ternary complex is readily formed in the presence of DNA. H115A mutation disrupted MgdGTP binding and dG:dGTP ternary complex formation but not dG:dCTP ternary complex formation. The results demonstrate the first solution structural view of DNA polymerase catalysis, a unique DNA binding mode, and a novel mechanism for non-Watson-Crick incorporation by a low-fidelity DNA polymerase.

78 FR 43198 - Watson Cogeneration Company; Notice of Filing

Science.gov (United States)

2013-07-19

... DEPARTMENT OF ENERGY Federal Energy Regulatory Commission [Docket No. TX13-1-000] Watson... Commission's (Commission) Regulations, 18 CFR 36.1, Watson Cogeneration Company filed an application... physical interconnection to the Watson facility; (2) direct SCE and California Independent System Operator...

The multiple personalities of Watson and Crick strands.

Science.gov (United States)

Cartwright, Reed A; Graur, Dan

2011-02-08

In genetics it is customary to refer to double-stranded DNA as containing a "Watson strand" and a "Crick strand." However, there seems to be no consensus in the literature on the exact meaning of these two terms, and the many usages contradict one another as well as the original definition. Here, we review the history of the terminology and suggest retaining a single sense that is currently the most useful and consistent. The Saccharomyces Genome Database defines the Watson strand as the strand which has its 5'-end at the short-arm telomere and the Crick strand as its complement. The Watson strand is always used as the reference strand in their database. Using this as the basis of our standard, we recommend that Watson and Crick strand terminology only be used in the context of genomics. When possible, the centromere or other genomic feature should be used as a reference point, dividing the chromosome into two arms of unequal lengths. Under our proposal, the Watson strand is standardized as the strand whose 5'-end is on the short arm of the chromosome, and the Crick strand as the one whose 5'-end is on the long arm. Furthermore, the Watson strand should be retained as the reference (plus) strand in a genomic database. This usage not only makes the determination of Watson and Crick unambiguous, but also allows unambiguous selection of reference stands for genomics. This article was reviewed by John M. Logsdon, Igor B. Rogozin (nominated by Andrey Rzhetsky), and William Martin.

The multiple personalities of Watson and Crick strands

Directory of Open Access Journals (Sweden)

Graur Dan

2011-02-01

Full Text Available Abstract Background In genetics it is customary to refer to double-stranded DNA as containing a "Watson strand" and a "Crick strand." However, there seems to be no consensus in the literature on the exact meaning of these two terms, and the many usages contradict one another as well as the original definition. Here, we review the history of the terminology and suggest retaining a single sense that is currently the most useful and consistent. Proposal The Saccharomyces Genome Database defines the Watson strand as the strand which has its 5'-end at the short-arm telomere and the Crick strand as its complement. The Watson strand is always used as the reference strand in their database. Using this as the basis of our standard, we recommend that Watson and Crick strand terminology only be used in the context of genomics. When possible, the centromere or other genomic feature should be used as a reference point, dividing the chromosome into two arms of unequal lengths. Under our proposal, the Watson strand is standardized as the strand whose 5'-end is on the short arm of the chromosome, and the Crick strand as the one whose 5'-end is on the long arm. Furthermore, the Watson strand should be retained as the reference (plus strand in a genomic database. This usage not only makes the determination of Watson and Crick unambiguous, but also allows unambiguous selection of reference stands for genomics. Reviewers This article was reviewed by John M. Logsdon, Igor B. Rogozin (nominated by Andrey Rzhetsky, and William Martin.

Uporaba orodja poslovne inteligence IBM Watson za predvidevanje prodaje

OpenAIRE

Stojić, Igor

2016-01-01

Diplomska naloga obravnava uporabo orodja IBM Watson in njegovo poslovno vrednost, ki jo ima v okviru oblikovanja napovedi prihodnje prodaje produktov. V teoretičnem delu podrobneje opredeljuje napovedovanje in smoter le-tega. V okviru empiričnega dela pa je bila izvedena primerjava uporabe ERP sistemov SAP in IBM Watson, pri čemer je bil dosledno prikazan postopek oblikovanja napovedi, tako s SAP kot tudi z IBM Watson, s slednjim pa tudi identificiran parameter, ki vpliva na prodajo nekateri...

Percolation Model for the Existence of a Mitochondrial Eve

CERN Document Server

Neves, A G M

2005-01-01

We look at the process of inheritance of mitochondrial DNA as a percolation model on trees equivalent to the Galton-Watson process. The model is exactly solvable for its percolation threshold $p_c$ and percolation probability critical exponent. In the approximation of small percolation probability, and assuming limited progeny number, we are also able to find the maximum and minimum percolation probabilities over all probability distributions for the progeny number constrained to a given $p_c$. As a consequence, we can relate existence of a mitochondrial Eve to quantitative knowledge about demographic evolution of early mankind. In particular, we show that a mitochondrial Eve may exist even in an exponentially growing population, provided that the average number of children per individual is constrained to a small range depending on the probability $p$ that a newborn child is a female.

Theoretical study of the Hoogsteen-Watson-Crick junctions in DNA.

Science.gov (United States)

Cubero, Elena; Luque, F Javier; Orozco, Modesto

2006-02-01

A series of d (AT)(n) oligonucleotides containing mixtures of normal B-type Watson-Crick and antiparallel Hoogsteen helices have been studied using molecular dynamics simulation techniques to analyze the structural and thermodynamic impact of the junction between Watson-Crick and antiparallel Hoogsteen structures. Analysis of molecular dynamics simulations strongly suggests that for all oligonucleotides studied the antiparallel Hoogsteen appears as a reasonable conformation, only slightly less stable than the canonical B-type Watson-Crick one. The junctions between the Watson-Crick and Hoogsteen structures introduces a priori a sharp discontinuity in the helix, because the properties of each type of conformation are very well preserved in the corresponding fragments. However, and quite counterintuitively, junctions do not largely distort the duplex in structural, dynamics or energetic terms. Our results strongly support the possibility that small fragments of antiparallel Hoogsteen duplex might be embedded into large fragments of B-type Watson-Crick helices, making possible protein-DNA interactions that are specific of the antiparallel Hoogsteen conformation.

Theoretical Study of the Hoogsteen–Watson-Crick Junctions in DNA

Science.gov (United States)

Cubero, Elena; Luque, F. Javier; Orozco, Modesto

2006-01-01

A series of d (AT)n oligonucleotides containing mixtures of normal B-type Watson-Crick and antiparallel Hoogsteen helices have been studied using molecular dynamics simulation techniques to analyze the structural and thermodynamic impact of the junction between Watson-Crick and antiparallel Hoogsteen structures. Analysis of molecular dynamics simulations strongly suggests that for all oligonucleotides studied the antiparallel Hoogsteen appears as a reasonable conformation, only slightly less stable than the canonical B-type Watson-Crick one. The junctions between the Watson-Crick and Hoogsteen structures introduces a priori a sharp discontinuity in the helix, because the properties of each type of conformation are very well preserved in the corresponding fragments. However, and quite counterintuitively, junctions do not largely distort the duplex in structural, dynamics or energetic terms. Our results strongly support the possibility that small fragments of antiparallel Hoogsteen duplex might be embedded into large fragments of B-type Watson-Crick helices, making possible protein-DNA interactions that are specific of the antiparallel Hoogsteen conformation. PMID:16287814

Replication infidelity via a mismatch with Watson-Crick geometry.

Science.gov (United States)

Bebenek, Katarzyna; Pedersen, Lars C; Kunkel, Thomas A

2011-02-01

In describing the DNA double helix, Watson and Crick suggested that "spontaneous mutation may be due to a base occasionally occurring in one of its less likely tautomeric forms." Indeed, among many mispairing possibilities, either tautomerization or ionization of bases might allow a DNA polymerase to insert a mismatch with correct Watson-Crick geometry. However, despite substantial progress in understanding the structural basis of error prevention during polymerization, no DNA polymerase has yet been shown to form a natural base-base mismatch with Watson-Crick-like geometry. Here we provide such evidence, in the form of a crystal structure of a human DNA polymerase λ variant poised to misinsert dGTP opposite a template T. All atoms needed for catalysis are present at the active site and in positions that overlay with those for a correct base pair. The mismatch has Watson-Crick geometry consistent with a tautomeric or ionized base pair, with the pH dependence of misinsertion consistent with the latter. The results support the original idea that a base substitution can originate from a mismatch having Watson-Crick geometry, and they suggest a common catalytic mechanism for inserting a correct and an incorrect nucleotide. A second structure indicates that after misinsertion, the now primer-terminal G • T mismatch is also poised for catalysis but in the wobble conformation seen in other studies, indicating the dynamic nature of the pathway required to create a mismatch in fully duplex DNA.

A Challenge to Watson

Science.gov (United States)

Detterman, Douglas K.

2011-01-01

Watson's Jeopardy victory raises the question of the similarity of artificial intelligence and human intelligence. Those of us who study human intelligence issue a challenge to the artificial intelligence community. We will construct a unique battery of tests for any computer that would provide an actual IQ score for the computer. This is the same…

Two Trees: Migrating Fault Trees to Decision Trees for Real Time Fault Detection on International Space Station

Science.gov (United States)

Lee, Charles; Alena, Richard L.; Robinson, Peter

2004-01-01

We started from ISS fault trees example to migrate to decision trees, presented a method to convert fault trees to decision trees. The method shows that the visualizations of root cause of fault are easier and the tree manipulating becomes more programmatic via available decision tree programs. The visualization of decision trees for the diagnostic shows a format of straight forward and easy understands. For ISS real time fault diagnostic, the status of the systems could be shown by mining the signals through the trees and see where it stops at. The other advantage to use decision trees is that the trees can learn the fault patterns and predict the future fault from the historic data. The learning is not only on the static data sets but also can be online, through accumulating the real time data sets, the decision trees can gain and store faults patterns in the trees and recognize them when they come.

78 FR 17231 - Importer of Controlled Substances, Notice of Registration, Watson Pharma, Inc.

Science.gov (United States)

2013-03-20

... Registration, Watson Pharma, Inc. By Notice dated November 5, 2012, and published in the Federal Register on November 13, 2012, 77 FR 67675, Watson Pharma, Inc., 2455 Wardlow Road, Corona, California 92880-2882, made.... 823(a) and Sec. 952(a) and determined that the registration of Watson Pharma, Inc., to import the...

"A dedicated missionary". Charles Galton Darwin and the new quantum mechanics in Britain

Science.gov (United States)

Navarro, Jaume

In this paper I discuss the work on quantum physics and wave mechanics by Charles Galton Darwin, a Cambridge wrangler of the last generation, as a case study to better understand the early reception of quantum physics in Britain. I argue that his proposal in the early 1920s to abandon the strict conservation of energy, as well as his enthusiastic embracement of wave mechanics at the end of the decade, can be easily understood by tracing his ontological and epistemological commitments to his early training in the Cambridge Mathematical Tripos. I also suggest that Darwin's work cannot be neglected in a study of quantum physics in Britain, since he was one of very few fellows of the Royal Society able to judge and explain quantum physics and quantum mechanics.

78 FR 64016 - Importer of Controlled Substances; Notice of Registration; Watson Pharma, Inc.

Science.gov (United States)

2013-10-25

... Registration; Watson Pharma, Inc. By Notice dated May 24, 2013, and published in the Federal Register on June 4, 2013, 78 FR 33440, Watson Pharma, Inc., 2455 Wardlow Road, Corona, California 92880-2882, made... in 21 U.S.C. 823(a) and 952(a) and determined that the registration of Watson Pharma, Inc., to import...

Laser-assisted collisions: The Kroll-Watson formula and bremsstrahlung theory

International Nuclear Information System (INIS)

Geltman, S.

1996-01-01

Recent measurements on CO 2 -laser-assisted electron-atom collisions have shown large inconsistencies with the Kroll-Watson formula for small-angle scattering. We have carried out a detailed study to compare the predictions of Kroll-Watson theory (for both single and multimode fields) with those of conventional perturbation theory for stimulated free-free transitions. It is found that for E 0 /2ω 2 <1, where perturbation theory is valid, there are large differences with the Kroll-Watson theory. Comparisons of experimental variations with respect to scattering angle and electron energy show much better agreement with perturbation theory than with Kroll-Watson theory. A study of the angular variations in perturbation theory shows that use of the open-quote open-quote outgoing close-quote close-quote wave final state gives much better agreement with experiment than does the open-quote open-quote ingoing close-quote close-quote wave final state, which is different from the choice made in early bremsstrahlung theory. copyright 1996 The American Physical Society

Sommerfeld-Watson transformation for nuclear fission

International Nuclear Information System (INIS)

Alexandru, G.

1978-01-01

It is proved that the fission matrix element can be written like a Sommerfeld-Watson relation. This leads to a dispersion relation for the fission process in which the substraction term is uniquely determined. (author)

Timing-Driven-Testable Convergent Tree Adders

Directory of Open Access Journals (Sweden)

Johnnie A. Huang

2002-01-01

Full Text Available Carry lookahead adders have been, over the years, implemented in complex arithmetic units due to their regular structure which leads to efficient VLSI implementation for fast adders. In this paper, timing-driven testability synthesis is first performed on a tree adder. It is shown that the structure of the tree adder provides for a high fanout with an imbalanced tree structure, which likely contributes to a racing effect and increases the delay of the circuit. The timing optimization is then realized by reducing the maximum fanout of the adder and by balancing the tree circuit. For a 56-b testable tree adder, the optimization produces a 6.37%increase in speed of the critical path while only contributing a 2.16% area overhead. The full testability of the circuit is achieved in the optimized adder design.

Computing Refined Buneman Trees in Cubic Time

DEFF Research Database (Denmark)

Brodal, G.S.; Fagerberg, R.; Östlin, A.

2003-01-01

Reconstructing the evolutionary tree for a set of n species based on pairwise distances between the species is a fundamental problem in bioinformatics. Neighbor joining is a popular distance based tree reconstruction method. It always proposes fully resolved binary trees despite missing evidence...... in the underlying distance data. Distance based methods based on the theory of Buneman trees and refined Buneman trees avoid this problem by only proposing evolutionary trees whose edges satisfy a number of constraints. These trees might not be fully resolved but there is strong combinatorial evidence for each...... proposed edge. The currently best algorithm for computing the refined Buneman tree from a given distance measure has a running time of O(n 5) and a space consumption of O(n 4). In this paper, we present an algorithm with running time O(n 3) and space consumption O(n 2). The improved complexity of our...

TimeTree2: species divergence times on the iPhone.

Science.gov (United States)

Kumar, Sudhir; Hedges, S Blair

2011-07-15

Scientists, educators and the general public often need to know times of divergence between species. But they rarely can locate that information because it is buried in the scientific literature, usually in a format that is inaccessible to text search engines. We have developed a public knowledgebase that enables data-driven access to the collection of peer-reviewed publications in molecular evolution and phylogenetics that have reported estimates of time of divergence between species. Users can query the TimeTree resource by providing two names of organisms (common or scientific) that can correspond to species or groups of species. The current TimeTree web resource (TimeTree2) contains timetrees reported from molecular clock analyses in 910 published studies and 17 341 species that span the diversity of life. TimeTree2 interprets complex and hierarchical data from these studies for each user query, which can be launched using an iPhone application, in addition to the website. Published time estimates are now readily accessible to the scientific community, K-12 and college educators, and the general public, without requiring knowledge of evolutionary nomenclature. TimeTree2 is accessible from the URL http://www.timetree.org, with an iPhone app available from iTunes (http://itunes.apple.com/us/app/timetree/id372842500?mt=8) and a YouTube tutorial (http://www.youtube.com/watch?v=CxmshZQciwo).

Building Watson: An Overview of the DeepQA Project

OpenAIRE

Ferrucci, David; Brown, Eric; Chu-Carroll, Jennifer; Fan, James; Gondek, David; Kalyanpur, Aditya A.; Lally, Adam; Murdock, J. William; Nyberg, Eric; Prager, John; Schlaefer, Nico; Welty, Chris

2010-01-01

IBM Research undertook a challenge to build a computer system that could compete at the human champion level in real time on the American TV Quiz show, Jeopardy! The extent of the challenge includes fielding a real-time automatic contestant on the show, not merely a laboratory exercise. The Jeopardy! Challenge helped us address requirements that led to the design of the DeepQA architecture and the implementation of Watson. After 3 years of intense research and development by a core team of ab...

Log and tree sawing times for hardwood mills

Science.gov (United States)

Everette D. Rast

1974-01-01

Data on 6,850 logs and 1,181 trees were analyzed to predict sawing times. For both logs and trees, regression equations were derived that express (in minutes) sawing time per log or tree and per Mbf. For trees, merchantable height is expressed in number of logs as well as in feet. One of the major uses for the tables of average sawing times is as a bench mark against...

Finite-size scaling of survival probability in branching processes

OpenAIRE

Garcia-Millan, Rosalba; Font-Clos, Francesc; Corral, Alvaro

2014-01-01

Branching processes pervade many models in statistical physics. We investigate the survival probability of a Galton-Watson branching process after a finite number of generations. We reveal the finite-size scaling law of the survival probability for a given branching process ruled by a probability distribution of the number of offspring per element whose standard deviation is finite, obtaining the exact scaling function as well as the critical exponents. Our findings prove the universal behavi...

Little Albert's alleged neurological impairment: Watson, Rayner, and historical revision.

Science.gov (United States)

Digdon, Nancy; Powell, Russell A; Harris, Ben

2014-11-01

In 2012, Fridlund, Beck, Goldie, and Irons (2012) announced that "Little Albert"-the infant that Watson and Rayner used in their 1920 study of conditioned fear (Watson & Rayner, 1920)-was not the healthy child the researchers described him to be, but was neurologically impaired almost from birth. Fridlund et al. also alleged that Watson had committed serious ethical breaches in regard to this research. Our article reexamines the evidentiary bases for these claims and arrives at an alternative interpretation of Albert as a normal infant. In order to set the stage for our interpretation, we first briefly describe the historical context for the Albert study, as well as how the study has been construed and revised since 1920. We then discuss the evidentiary issues in some detail, focusing on Fridlund et al.'s analysis of the film footage of Albert, and on the context within which Watson and Rayner conducted their study. In closing, we return to historical matters to speculate about why historiographical disputes matter and what the story of neurologically impaired Albert might be telling us about the discipline of psychology today.

Theoretical Study of the Hoogsteen–Watson-Crick Junctions in DNA

OpenAIRE

Cubero, Elena; Luque, F. Javier; Orozco, Modesto

2005-01-01

A series of d (AT)n oligonucleotides containing mixtures of normal B-type Watson-Crick and antiparallel Hoogsteen helices have been studied using molecular dynamics simulation techniques to analyze the structural and thermodynamic impact of the junction between Watson-Crick and antiparallel Hoogsteen structures. Analysis of molecular dynamics simulations strongly suggests that for all oligonucleotides studied the antiparallel Hoogsteen appears as a reasonable conformation, only slightly less ...

Portrait of a discovery. Watson, Crick, and the double helix.

Science.gov (United States)

de Chadarevian, Soraya

2003-03-01

This essay examines an iconic image of twentieth-century science: Antony Barrington Brown's photograph of James Watson, Francis Crick, and the double-helical model of DNA. The detailed reconstruction of the production, reception, and uses of the photograph reveals the central role of the image in making the discovery it portrays. Taken in May 1953, two full months after the scientists built the model, to accompany a report on the structure in Time magazine, the photograph (like the report) was never published. It came into circulation only fifteen years later, as an illustration in Watson's best-selling book The Double Helix. While the image served as a historical document and advertisement for the book, only the book provided the description that made the image as well as the people and the model it represented famous. The history of the image provides insights into the retrospective construction of the discovery, which has since been celebrated as the origin of a new science of life.

How the challenge of explaining learning influenced the origins and development of John B. Watson's behaviorism.

Science.gov (United States)

Rilling, M

2000-01-01

Before he invented behaviorism, John B. Watson considered learning one of the most important topics in psychology. Watson conducted excellent empirical research on animal learning. He developed behaviorism in part to promote research and elevate the status of learning in psychology. Watson was much less successful in the adequacy and originality of the mechanisms he proposed to explain learning. By assimilating the method of classical conditioning and adopting Pavlov's theory of stimulus substitution, Watson linked behaviorism with a new method that could compete with both Titchener's method of introspection and Freud's methods of psychoanalysis. Watson's interest in explaining psychopathology led to the discovery of conditioned emotional responses and a behavioristic explanation for the learning of phobic behavior. Watson established learning as a central topic for basic research and application in American psychology.

Graham Watson: Eesti vajab enam riigi sekkumist majandusse

Index Scriptorium Estoniae

Watson, Graham

2009-01-01

18. aprillil pidasid keskerakondlased Tallinnas Euroopa Parlamendi valimiste konverentsi. Euroopa Parlamendi demokraatide ja liberaalide fraktsiooni juht Graham Watson saatis Keskerakonnale videotervituse

From theory to practice: caring science according to Watson and Brewer.

Science.gov (United States)

Clarke, Pamela N; Watson, Jean; Brewer, Barbara B

2009-10-01

Caring science is presented by Jean Watson and Barbara Brewer through an interview and dialogue format. Jean Watson presents caring science and its philosophy and evolution and the impact of her model on nursing and other disciplines. Barbara Brewer addresses the implementation of the model in a Magnet hospital setting and describes how her leadership facilitated implementation.

Did John B. Watson Really "Found" Behaviorism?

Science.gov (United States)

Malone, John C

2014-05-01

Developments culminating in the nineteenth century, along with the predictable collapse of introspective psychology, meant that the rise of behavioral psychology was inevitable. In 1913, John B. Watson was an established scientist with impeccable credentials who acted as a strong and combative promoter of a natural science approach to psychology when just such an advocate was needed. He never claimed to have founded "behavior psychology" and, despite the acclaim and criticism attending his portrayal as the original behaviorist, he was more an exemplar of a movement than a founder. Many influential writers had already characterized psychology, including so-called mental activity, as behavior, offered many applications, and rejected metaphysical dualism. Among others, William Carpenter, Alexander Bain, and (early) Sigmund Freud held views compatible with twentieth-century behaviorism. Thus, though Watson was the first to argue specifically for psychology as a natural science, behaviorism in both theory and practice had clear roots long before 1913. If behaviorism really needs a "founder," Edward Thorndike might seem more deserving, because of his great influence and promotion of an objective psychology, but he was not a true behaviorist for several important reasons. Watson deserves the fame he has received, since he first made a strong case for a natural science (behaviorist) approach and, importantly, he made people pay attention to it.

John B. Watson's Alleged Sex Research: An Appraisal of the Evidence

Science.gov (United States)

Benjamin, Ludy T. Jr.; Whitaker, Jodi L.; Ramsey, Russell M.; Zeve, Daniel R.

2007-01-01

In 1974, a story was published about clandestine research done by John B. Watson that was judged to be so reprehensible that it was offered as the real reason he was fired from his faculty position at Johns Hopkins University in 1920, at perhaps the peak of his academic career. Watson's dismissal from Johns Hopkins may have been the most important…

When sleep-related hypermotor epilepsy (SHE) met Charles Darwin and Francis Galton.

Science.gov (United States)

Parrino, Liborio; Pavesi, Giovanni

2017-08-01

Sleep-related hypermotor epilepsy (SHE) is characterized by short-lasting seizures patterned by repetitive and stereotyped motor events in the same person. In autosomal dominant SHE, genetic factors play a well-known key role. In The Expression of Emotions in Man and Animals, Charles Darwin quotes a plausible example of SHE illustrated by his cousin Sir Francis Galton: "the gentleman…lay fast asleep on his back in bed, raising his right arm slowly in front of his face, up to his forehead, and then dropping it with a jerk, so that the wrist fell heavily on the bridge of his nose. The trick did not occur every night, but occasionally, and was independent of any ascertained cause. Sometimes it was repeated incessantly for an hour or more." Similar manifestations during sleep occurred also in the patient's son and granddaughter, suggesting an autosomal inheritance without sex relationship. Differential diagnosis with REM behavior disorder and other parasomnias is discussed. To our knowledge, this could be the first description of a stereotyped SHE pattern with genetic transmission. © 2017 American Academy of Neurology.

[From humanism to nihilism: dialectics on Jean Watson's caring theory].

Science.gov (United States)

Krol, Pawel J; Lavoie, Mireille

2015-09-01

nursing today is heir to values that have developed over many years. In addition to the values of human care, present-day nursing embraces values that shape our modern world. This dialectical study first traces the evolution of a number of the traditional values associated with human care that nursing has retained. It goes on to show how some of the values of human care have been cast aside in favour of modern--neoliberal, technocratic and bureaucratic--values which have in turn given rise to disturbing problems of instrumentalization. Watson's theory of caring proposes two ways to remedy such instrumentalization: espousing a transcendental, metaphysical mode of thought and adopting an altruistic humanism. However, many critics have questioned the theoretical consistency and very legitimacy of the theory as a means of dealing with instrumentalization. this study analyses Watson's proposals, using a Nietzschean dialectic approach to test them and to suggest possible solutions. Significant problems in terms of both consistency and relevance are brought to light, tending to refute Watson's notions. the study findings suggest that the application of Watson's theory may paradoxically perpetuate dualism and nihilism and, rather than curb their invasive impact, lead inevitably to a conversion to instrumental values. it's suggested an alternative, ethics-of-life approach based on the synthesis of our dialectics that would foster a return to, and respect for, humanity's essential nature.

77 FR 67675 - Importer of Controlled Substances; Notice of Application; Watson Pharma, Inc.

Science.gov (United States)

2012-11-13

... DEPARTMENT OF JUSTICE Drug Enforcement Administration Importer of Controlled Substances; Notice of Application; Watson Pharma, Inc. Pursuant to Title 21 Code of Federal Regulations 1301.34(a), this is notice that on August 28, 2012, Watson Pharma, Inc., 2455 Wardlow Road, Corona, California 92880-2882, made...

78 FR 33440 - Importer of Controlled Substances, Notice of Application; Watson Pharma, Inc.

Science.gov (United States)

2013-06-04

... DEPARTMENT OF JUSTICE Drug Enforcement Administration Importer of Controlled Substances, Notice of Application; Watson Pharma, Inc. Pursuant to Title 21 Code of Federal Regulations 1301.34 (a), this is notice that on May 3, 2013, Watson Pharma, Inc., 2455 Wardlow Road, Corona, California 92880-2882, made...

A history of the term radical behaviorism: From Watson to Skinner

Science.gov (United States)

Schneider, Susan M.; Morris, Edward K.

1987-01-01

This paper describes the origins and evolution of the term radical behaviorism. John B. Watson's coining of behaviorism in 1913 is presented first, followed by a discussion of the uses of “radical” within psychology during these early years. When the term radical behaviorism first emerged in the early 1920s, its referent was Watson's behaviorism, most specifically his stance on consciousness. In the 1930s, B. F. Skinner described his own position with the term radical behaviorism in an unpublished manuscript, and then in 1945 first referred in print to his views as such. Today, radical behaviorism is generally applied to Skinner's views alone. The paper concludes with a brief discussion of a similarity in Watson's and Skinner's positions on consciousness, which seems a possible historical and philosophical connection between their respective radical behaviorisms. PMID:22477958

Watson's theorem and resonant pion photoproduction amplitude in the delta channel

International Nuclear Information System (INIS)

Wittman, R.; Davidson, R.; Mukhopadhyay, N.C.

1984-01-01

The CGLN and BL theories of the pion photoproduction on nucleons, used in nuclear calculations, are examined regarding their predictions of the resonant M 1 + and E 1 + multipoles. The nonunitary BL approach violates Watson's theorem, and predicts these multipoles porly. In the static limit, the CGLN multipoles satisfy Watson's theorem and are in fine agreement with data. The unitarized BL multipoles agree with those from the Olsson theory and data. (orig.)

Time-dependent methodology for fault tree evaluation

International Nuclear Information System (INIS)

Vesely, W.B.

1976-01-01

Any fault tree may be evaluated applying the method called the kinetic theory of fault trees. The basic feature of this method as presented here is in that any information on primary failure, type failure or peak failure is derived from three characteristics: probability of existence, failure intensity and failure density. The determination of the said three characteristics for a given phenomenon yields the remaining probabilistic information on the individual aspects of the failure and on their totality for the whole observed period. The probabilistic characteristics are determined by applying the analysis of phenomenon probability. The total time dependent information on the peak failure is obtained by using the type failures (critical paths) of the fault tree. By applying the said process the total time dependent information is obtained for every primary failure and type failure of the fault tree. In the application of the method of the kinetic theory of fault trees represented by the PREP and KITT programmes, the type failures are first obtained using the deterministic testing method or using the Monte Carlo simulation (PREP programme). The respective characteristics are then determined using the kinetic theory of fault trees (KITT programmes). (Oy)

Ed Watson 1940-2006

CERN Multimedia

2006-01-01

Ed Watson arrived at CERN in March 1973 to work on digital electronics and CAMAC systems under Bob Dobinson, after many years at Rolls Royce in Scotland. He joined the European Muon Collaboration in 1976, where he played a major role in the design, deployment and running of its data acquisition system (DAQ) with David Botterill, Bob Dobinson, and Vicky White. The CAMAC-ROMULUS system was by far the largest and most advanced of its time, and it became a defining standard for DAQ systems for years to come. Ed was deeply involved in the detailed planning of the control rooms and the experiment cabling, as well as sharing the responsibility for the CAMAC readout system. He had a real talent for trouble shooting and played a vital part in supporting the experiment throughout its lifetime. He offered great moral support to the younger members of the collaboration and helped them a great deal with their work. The EMC had a wonderful social life to which Ed was a major contributor - who can forget its barbecues?  In...

Watson's behaviorism: a comparison of the two editions (1925 and 1930).

Science.gov (United States)

Carpintero, Helio

2004-05-01

J.B. Watson's Behaviorism, a complete presentation of the mature psychological points of view of its author, had 2 editions, in 1925 and 1930, which presented significant differences in their texts. Although Watson maximized such variations, to the point of considering the 2nd edition as nearly a brand-new book, both suppressions and additions reveal his feelings when presenting his ideas to a general audience. Such variations are here presented through an in-depth analysis.

Ultraviolet Absorption Induces Hydrogen-Atom Transfer in G⋅C Watson-Crick DNA Base Pairs in Solution.

Science.gov (United States)

Röttger, Katharina; Marroux, Hugo J B; Grubb, Michael P; Coulter, Philip M; Böhnke, Hendrik; Henderson, Alexander S; Galan, M Carmen; Temps, Friedrich; Orr-Ewing, Andrew J; Roberts, Gareth M

2015-12-01

Ultrafast deactivation pathways bestow photostability on nucleobases and hence preserve the structural integrity of DNA following absorption of ultraviolet (UV) radiation. One controversial recovery mechanism proposed to account for this photostability involves electron-driven proton transfer (EDPT) in Watson-Crick base pairs. The first direct observation is reported of the EDPT process after UV excitation of individual guanine-cytosine (G⋅C) Watson-Crick base pairs by ultrafast time-resolved UV/visible and mid-infrared spectroscopy. The formation of an intermediate biradical species (G[-H]⋅C[+H]) with a lifetime of 2.9 ps was tracked. The majority of these biradicals return to the original G⋅C Watson-Crick pairs, but up to 10% of the initially excited molecules instead form a stable photoproduct G*⋅C* that has undergone double hydrogen-atom transfer. The observation of these sequential EDPT mechanisms across intermolecular hydrogen bonds confirms an important and long debated pathway for the deactivation of photoexcited base pairs, with possible implications for the UV photochemistry of DNA. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

When a clear strong voice was needed: A retrospective review of Watson's (1924/1930) behaviorism.

Science.gov (United States)

Malone, John C; García-Penagos, Andrés

2014-07-25

Despite the attention given John B. Watson during the century since he introduced behaviorism, there remain questions about what he really contributed. He is still appropriately criticized for his arrogant self-promotion and especially for his perceived emphasis on a simple S-R reflexology. However, we argue that the former was necessary at the time and that criticism of Watson on the second count only diverts attention from the genuine contributions that he did make. In support of these contentions we examine several aspects of his contributions that warrant clarification, namely, his promotion of applied comparative psychology, his views on the nature of mind, his originality, criticism from and respect afforded by contemporaries, his relation to recent interest in "the embodiment of mind," his treatment of thinking, and his appreciation of Freud's work. We organize our discussion around specific chapters of the two editions of Behaviorism, but in support of our arguments we include publications of Watson that are less well known. Those works develop some important points that are only briefly treated in both editions of Behaviorism. © Society for the Experimental Analysis of Behavior.

Watson will see you now: a supercomputer to help clinicians make informed treatment decisions.

Science.gov (United States)

Doyle-Lindrud, Susan

2015-02-01

IBM has collaborated with several cancer care providers to develop and train the IBM supercomputer Watson to help clinicians make informed treatment decisions. When a patient is seen in clinic, the oncologist can input all of the clinical information into the computer system. Watson will then review all of the data and recommend treatment options based on the latest evidence and guidelines. Once the oncologist makes the treatment decision, this information can be sent directly to the insurance company for approval. Watson has the ability to standardize care and accelerate the approval process, a benefit to the healthcare provider and the patient.

A conversation with Geoff Watson

OpenAIRE

Beran, R. J.; Fisher, N. I.

1998-01-01

Geoffrey Stuart Watson, Professor Emeritus at Princeton University, celebrated his 75th birthday on December 3, 1996. A native Australian, his early education included Bendigo High School and Scotch College in Melbourne. After graduating with a B.A. (Hons.) from Melbourne University in December 1942, he spent the next few years, during and after World War II, doing research and teaching on applied mathematical topics. His wandering as a scholar began in 1947, when he became ...

Predicting the Mechanism and Kinetics of the Watson-Crick to Hoogsteen Base Pairing Transition

NARCIS (Netherlands)

Vreede, J.; Bolhuis, P.G.; Swenson, D.W.H.

2016-01-01

DNA duplexes predominantly contain Watson-Crick (WC) base pairs. Yet, a non-negligible number of base pairs converts to the Hoogsteen (HG) hydrogen bonding pattern, involving a 180° rotation of the purine base relative to Watson-Crick. These WC to HG conversions alter the conformation of DNA, and

Conformational analysis of a covalently cross-linked Watson-Crick base pair model.

Science.gov (United States)

Jensen, Erik A; Allen, Benjamin D; Kishi, Yoshito; O'Leary, Daniel J

2008-11-15

Low-temperature NMR experiments and molecular modeling have been used to characterize the conformational behavior of a covalently cross-linked DNA base pair model. The data suggest that Watson-Crick or reverse Watson-Crick hydrogen bonding geometries have similar energies and can interconvert at low temperatures. This low-temperature process involves rotation about the crosslink CH(2)C(5') (psi) carbon-carbon bond, which is energetically preferred over the alternate CH(2)N(3) (phi) carbon-nitrogen bond rotation.

Elementary? Question Answering, IBM's Watson, and the Jeopardy ...

Indian Academy of Sciences (India)

IAS Admin

One of the most readable accounts of early AI systems, including. NLP systems, may be .... tions of these questions to annotations of information segments in ..... Watson as a decision-aide rather than as a decision-maker will be a safe step ...

Relativistic generalisation of the Kroll-Watson formula

International Nuclear Information System (INIS)

Kaminski, J.Z.

1985-01-01

The relativistic analogue of the space-translation method is derived. Using this method the generalisation of the Kroll-Watson formula [1973, Phys. Rev. A. 8 804] is obtained for the scattering of an arbitrary charged particle (e.g. mesons, hyperons, quarks, etc). The separation of the background and resonant parts of the scattering amplitude is predicted. (author)

Conformational Analysis of a Covalently Cross-Linked Watson-Crick Base Pair Model

OpenAIRE

Jensen, Erik A.; Allen, Benjamin D.; Kishi, Yoshito; O'Leary, Daniel J.

2008-01-01

Low temperature NMR experiments and molecular modeling have been used to characterize the conformational behavior of a covalently cross-linked DNA base pair model. The data suggest that Watson-Crick or reverse Watson-Crick hydrogen bonding geometries have similar energies and can interconvert at low temperatures. This low-temperature process involves rotation about the crosslink CH2–C(5′) (ψ) carbon-carbon bond, which is energetically preferred over the alternate CH2–N(3) (ϕ) carbon-nitrogen ...

Photoinduced electron transfer in a Watson-Crick base-paired, 2-aminopurine:uracil-C60 hydrogen bonding conjugate.

Science.gov (United States)

D'Souza, Francis; Gadde, Suresh; Islam, D-M Shafiqul; Pang, Siew-Cheng; Schumacher, Amy Lea; Zandler, Melvin E; Horie, Rumiko; Araki, Yasuyaki; Ito, Osamu

2007-02-07

A fluorescent reporter molecule, 2-aminopurine was self-assembled via Watson-Crick base-pairing to a uracil appended fullerene to form a donor-acceptor conjugate; efficient photoinduced charge separation was confirmed by time-resolved emission and transient absorption spectral studies.

A comparative study of the second-order Born and Faddeev-Watson approximations for electron-atom collisions

International Nuclear Information System (INIS)

Fargher, H.E.; Roberts, M.J.

1983-01-01

Simplified versions of the second-order Born and Faddeev-Watson approximations are applied to the excitation of the n=2 levels of atomic hydrogen by the impact of 54.4 eV electrons. The theories are compared with the measurements of differential cross sections and angular correlation parameters. The results indicate that the Born approximation is better at low angles of scattering but that the Faddeev-Watson approximation is better at high angles. The importance of the phases of the two-body T matrices in the Faddeev-Watson approximation is illustrated. (author)

Resummed tree heptagon

Science.gov (United States)

Belitsky, A. V.

2018-04-01

The form factor program for the regularized space-time S-matrix in planar maximally supersymmetric gauge theory, known as the pentagon operator product expansion, is formulated in terms of flux-tube excitations propagating on a dual two-dimensional world-sheet, whose dynamics is known exactly as a function of 't Hooft coupling. Both MHV and non-MHV amplitudes are described in a uniform, systematic fashion within this framework, with the difference between the two encoded in coupling-dependent helicity form factors expressed via Zhukowski variables. The nontrivial SU(4) tensor structure of flux-tube transitions is coupling independent and is known for any number of charged excitations from solutions of a system of Watson and Mirror equations. This description allows one to resum the infinite series of form factors and recover the space-time S-matrix exactly in kinematical variables at a given order of perturbation series. Recently, this was done for the hexagon. Presently, we successfully perform resummation for the seven-leg tree NMHV amplitude. To this end, we construct the flux-tube integrands of the fifteen independent Grassmann component of the heptagon with an infinite number of small fermion-antifermion pairs accounted for in NMHV two-channel conformal blocks.

First a hero of science and now a martyr to science: the James Watson Affair - political correctness crushes free scientific communication.

Science.gov (United States)

Charlton, Bruce G

2008-01-01

In 2007 James D. Watson, perhaps the most famous living scientist, was forced to retire from his position and retreat from public life in the face of international mass media condemnation following remarks concerning genetically-caused racial differences in intelligence. Watson was punished for stating forthright views on topics that elite opinion has determined should be discussed only with elaborate caution, frequent disclaimers, and solemn deference to the currently-prevailing pieties. James Watson has always struck many people as brash; however this blunt, truth-telling quality was intrinsic to his role in one of the greatest scientific discoveries. Much more importantly than 'good manners', Watson has consistently exemplified the cardinal scientific virtue: he speaks what he understands to be the truth without regard for the opinion of others. The most chilling aspect of the Watson Affair was the way in which so many influential members of the scientific research community joined the media condemnation directed against Watson. Perhaps the most egregious betrayal of science was an article by editorialists of the premier UK scientific journal Nature. Instead of defending the freedom of discourse in pursuit of scientific truth, Nature instead blamed Watson for being 'crass' and lacking 'sensitivity' in discussing human genetic differences. But if asked to choose between the 'sensitive' editors of Nature or the 'crass' genius of James D. Watson, all serious scientists must take the side of Watson. Because when a premier researcher such as Watson is hounded from office by a vicious, arbitrary and untruthful mob; all lesser scientists are made vulnerable to analogous treatment at the whim of the media. A zealous and coercive brand of 'political correctness' is now making the biological truth of human genetic differences intolerably difficult to discover and discuss in US and UK. This needs to change. My hope is that truth will prevail over political correctness and

The form of electron-atom excitation amplitudes at high momentum transfers in the Faddeev-Watson approximation

International Nuclear Information System (INIS)

Catalan, G.; Roberts, M.J.

1979-01-01

A form of the off-shell Coulomb T matrix, which has a well defined on-shell limit, is used in the Faddeev-Watson multiple-scattering expansion for a direct three-body collision process. Using the excitation of atomic hydrogen by electron impact as an example, approximations to the second-order terms, which are valid for high momentum transfers of the incident electron, are derived. It is shown how the resulting asymptotic behaviour of the second-order Faddeev-Watson approximation is related to the high momentum transfer limit of the second Born approximation. The results are generalised to the excitation of more complex atoms. The asymptotic forms of the Faddeev-Watson and Born approximations are compared with other theories and with measurements of differential cross sections and angular correlation parameters for the excitation of H(2p) and He(2 1 P). The results indicate that the Faddeev-Watson approximation converges more rapidly at high momentum transfers than does the Born approximation. (author)

Real Time Animation of Trees Based on BBSC in Computer Games

Directory of Open Access Journals (Sweden)

Xuefeng Ao

2009-01-01

Full Text Available That researchers in the field of computer games usually find it is difficult to simulate the motion of actual 3D model trees lies in the fact that the tree model itself has very complicated structure, and many sophisticated factors need to be considered during the simulation. Though there are some works on simulating 3D tree and its motion, few of them are used in computer games due to the high demand for real-time in computer games. In this paper, an approach of animating trees in computer games based on a novel tree model representation—Ball B-Spline Curves (BBSCs are proposed. By taking advantage of the good features of the BBSC-based model, physical simulation of the motion of leafless trees with wind blowing becomes easier and more efficient. The method can generate realistic 3D tree animation in real-time, which meets the high requirement for real time in computer games.

O pensamento em Watson: rompendo com o legado metafísico e buscando uma referência materializante

Directory of Open Access Journals (Sweden)

Cláudio Ivan de Oliveira

Full Text Available O trabalho de Watson sobre o pensamento foi tratado inadequadamente por muitos intérpretes, gerando uma lacuna na interpretação histórica visto que Watson exerceu ampla influência sobre a Psicologia. Nosso objetivo é sanar parte deste problema esclarecendo as principais posições de Watson sobre pensamento. Nossa hipótese é que a teoria watsoniana sobre o pensamento como hábito é uma forma de referencialização materializante influenciada pela desmetafisicização do pensamento Ocidental proveniente do Iluminismo. Admitimos que a teoria de Watson reproduziu premissas do erro de categoria cartesiano. Assumimos também que a prioritária associação entre pensamento e linguagem watsoniana denuncia influências indiretas da tradição filosófica grega clássica.

A comparative study of the second-order Born and Faddeev-Watson approximations: Pt. 3

International Nuclear Information System (INIS)

Roberts, M.J.

1988-01-01

Singularities which arise in the second-order Born and Faddeev-Watson approximations for ionisation processes are examined. A regularisation procedure for the latter is suggested. Comparison with He(e,2e)He + experimental data in symmetric coplanar energy-sharing kinematics shows that the second-order Faddeev-Watson approximation is inferior to the second Born results of Byron et al. (1985. J. Phys. B: At. Mol. Phys. 18, 3203). (author)

Dynamic travel time estimation using regression trees.

Science.gov (United States)

2008-10-01

This report presents a methodology for travel time estimation by using regression trees. The dissemination of travel time information has become crucial for effective traffic management, especially under congested road conditions. In the absence of c...

Life spans of a Bellman-Harris branching process with immigration

International Nuclear Information System (INIS)

Badalbaev, I.S.; Mashrabbaev, A.

1987-01-01

One considers two schemes of the Bellman-Harris process with immigration when a) the lifetime of the particles is an integral-valued random variable and the immigration is defined by a sequence of independent random variables; b) the distribution of the lifetime of the particles is nonlattice and the immigration is a process with continuous time. One investigates the properties of the life spans of such processes. The results obtained here are a generalization to the case of Bellman-Harris processes of the results of A.M. Zubkov, obtained for Markov branching processes. For the proof one makes use in an essential manner of the known inequalities of Goldstein, estimating the generating function of the Bellman-Harris process in terms of the generating functions of the imbedded Galton-Watson process

The Game is aFoot, Watson: DeepQA systems and the future of HCI

OpenAIRE

Keates, Simeon; Varker, Philip

2012-01-01

In February 2011, the IBM Watson DeepQA (deep question and answer) system took part in a special challenge, pitting its question and answer capability against former Jeopardy!TM grand champions in a televised match. Watson emerged victorious from the challenge, demonstrating that current question answering technology has advanced to the point where it can arguably be more dependable than human experts. This new system represents a significant breakthrough in humanity’s decades-long endeavour ...

The Effect of Nonzero Autocorrelation Coefficients on the Distributions of Durbin-Watson Test Estimator: Three Autoregressive Models

Directory of Open Access Journals (Sweden)

Mei-Yu LEE

2014-11-01

Full Text Available This paper investigates the effect of the nonzero autocorrelation coefficients on the sampling distributions of the Durbin-Watson test estimator in three time-series models that have different variance-covariance matrix assumption, separately. We show that the expected values and variances of the Durbin-Watson test estimator are slightly different, but the skewed and kurtosis coefficients are considerably different among three models. The shapes of four coefficients are similar between the Durbin-Watson model and our benchmark model, but are not the same with the autoregressive model cut by one-lagged period. Second, the large sample case shows that the three models have the same expected values, however, the autoregressive model cut by one-lagged period explores different shapes of variance, skewed and kurtosis coefficients from the other two models. This implies that the large samples lead to the same expected values, 2(1 – ρ0, whatever the variance-covariance matrix of the errors is assumed. Finally, comparing with the two sample cases, the shape of each coefficient is almost the same, moreover, the autocorrelation coefficients are negatively related with expected values, are inverted-U related with variances, are cubic related with skewed coefficients, and are U related with kurtosis coefficients.

A comment on Watson, Deary, and Austin and Watson, Roberts, Gow, and Deary : How to investigate whether personality items form a hierarchical scale?

NARCIS (Netherlands)

Meijer, Rob R.

I comment on two recent papers by Watson et al. (2007, 2008) who investigated whether personality items form a hierarchical scale. I discuss that the methods they used are inappropriate and discuss alternative methods presented in the literature. (C) 2009 Elsevier Ltd All rights reserved..

Calibrated birth-death phylogenetic time-tree priors for bayesian inference.

Science.gov (United States)

Heled, Joseph; Drummond, Alexei J

2015-05-01

Here we introduce a general class of multiple calibration birth-death tree priors for use in Bayesian phylogenetic inference. All tree priors in this class separate ancestral node heights into a set of "calibrated nodes" and "uncalibrated nodes" such that the marginal distribution of the calibrated nodes is user-specified whereas the density ratio of the birth-death prior is retained for trees with equal values for the calibrated nodes. We describe two formulations, one in which the calibration information informs the prior on ranked tree topologies, through the (conditional) prior, and the other which factorizes the prior on divergence times and ranked topologies, thus allowing uniform, or any arbitrary prior distribution on ranked topologies. Although the first of these formulations has some attractive properties, the algorithm we present for computing its prior density is computationally intensive. However, the second formulation is always faster and computationally efficient for up to six calibrations. We demonstrate the utility of the new class of multiple-calibration tree priors using both small simulations and a real-world analysis and compare the results to existing schemes. The two new calibrated tree priors described in this article offer greater flexibility and control of prior specification in calibrated time-tree inference and divergence time dating, and will remove the need for indirect approaches to the assessment of the combined effect of calibration densities and tree priors in Bayesian phylogenetic inference. © The Author(s) 2014. Published by Oxford University Press, on behalf of the Society of Systematic Biologists.

Systematic evaluation of fault trees using real-time model checker UPPAAL

International Nuclear Information System (INIS)

Cha, Sungdeok; Son, Hanseong; Yoo, Junbeom; Jee, Eunkyung; Seong, Poong Hyun

2003-01-01

Fault tree analysis, the most widely used safety analysis technique in industry, is often applied manually. Although techniques such as cutset analysis or probabilistic analysis can be applied on the fault tree to derive further insights, they are inadequate in locating flaws when failure modes in fault tree nodes are incorrectly identified or when causal relationships among failure modes are inaccurately specified. In this paper, we demonstrate that model checking technique is a powerful tool that can formally validate the accuracy of fault trees. We used a real-time model checker UPPAAL because the system we used as the case study, nuclear power emergency shutdown software named Wolsong SDS2, has real-time requirements. By translating functional requirements written in SCR-style tabular notation into timed automata, two types of properties were verified: (1) if failure mode described in a fault tree node is consistent with the system's behavioral model; and (2) whether or not a fault tree node has been accurately decomposed. A group of domain engineers with detailed technical knowledge of Wolsong SDS2 and safety analysis techniques developed fault tree used in the case study. However, model checking technique detected subtle ambiguities present in the fault tree

Fit for Practice: Analysis and Evaluation of Watson's Theory of Human Caring.

Science.gov (United States)

Pajnkihar, Majda; McKenna, Hugh P; Štiglic, Gregor; Vrbnjak, Dominika

2017-07-01

The aim of the authors of this paper is to analyze Watson's theory of human caring for its usefulness and worth in education, practice, and research. The reason for undertaking this analysis is to evaluate if Watson's theory would be useful for nursing in those countries where such theories were not an established part of the nursing curriculum. Furthermore, in some European countries, their political past or cultural influences led to an unquestioned adoption of the biomedical model. As their political culture changes, many social structures have had to be revisited, and for nursing, this has meant the introduction of theoretical reasoning, teaching, and practice.

Watson-Crick hydrogen bonding of unlocked nucleic acids

DEFF Research Database (Denmark)

Langkjær, Niels; Wengel, Jesper; Pasternak, Anna

2015-01-01

We herein describe the synthesis of two new unlocked nucleic acid building blocks containing hypoxanthine and 2,6-diaminopurine as nucleobase moieties and their incorporation into oligonucleotides. The modified oligonucleotides were used to examine the thermodynamic properties of UNA against unmo...... unmodified oligonucleotides and the resulting thermodynamic data support that the hydrogen bonding face of UNA is Watson-Crick like....

Watson, Skinner y Algunas Disputas dentro del Conductismo

Directory of Open Access Journals (Sweden)

RICARDO PELLÓN SUÁREZ DE PUGA

2013-01-01

Full Text Available Con motivo del primer centenario de la publicación del manifiesto conductista, se revisa brevemente la concepción de Watson (1913 sobre el aprendizaje y la conducta, y se extiende dicho análisis al conductismo de B. F. Skinner y a las disputas entre enfoques molares y moleculares en el análisis de la conducta.

IBM Watson: How Cognitive Computing Can Be Applied to Big Data Challenges in Life Sciences Research.

Science.gov (United States)

Chen, Ying; Elenee Argentinis, J D; Weber, Griff

2016-04-01

Life sciences researchers are under pressure to innovate faster than ever. Big data offer the promise of unlocking novel insights and accelerating breakthroughs. Ironically, although more data are available than ever, only a fraction is being integrated, understood, and analyzed. The challenge lies in harnessing volumes of data, integrating the data from hundreds of sources, and understanding their various formats. New technologies such as cognitive computing offer promise for addressing this challenge because cognitive solutions are specifically designed to integrate and analyze big datasets. Cognitive solutions can understand different types of data such as lab values in a structured database or the text of a scientific publication. Cognitive solutions are trained to understand technical, industry-specific content and use advanced reasoning, predictive modeling, and machine learning techniques to advance research faster. Watson, a cognitive computing technology, has been configured to support life sciences research. This version of Watson includes medical literature, patents, genomics, and chemical and pharmacological data that researchers would typically use in their work. Watson has also been developed with specific comprehension of scientific terminology so it can make novel connections in millions of pages of text. Watson has been applied to a few pilot studies in the areas of drug target identification and drug repurposing. The pilot results suggest that Watson can accelerate identification of novel drug candidates and novel drug targets by harnessing the potential of big data. Copyright © 2016 The Authors. Published by Elsevier Inc. All rights reserved.

J. B. Watson y la Publicidad, los Inicios de la Psicología del Consumidor

Directory of Open Access Journals (Sweden)

FELIPE PARRADO CORREDOR

2013-01-01

Full Text Available La investigación del comportamiento de las personas frente a los productos y servicios se remonta a los inicios del siglo XX y J. B. Watson es uno de sus principales precursores. Watson ofreció un curso de psicología aplicada titulado Psicología de la Publicidad, introdujo en varias empresas las técnicas experimentales para el mercadeo de sus productos y, tras su retiro de la vida académica, se vinculó a la agencia de publicidad Walter Thompson, donde desarrolló campañas masivas con los mismos principios de las reacciones emocionales condicionadas. En este ensayo se expone la importancia del trabajo de Watson en la psicología de la publicidad, como precursor de los desarrollos científicos de la psicología del consumidor.

Annual Quality Assurance Conference Files by Nicola Watson and Rui Li

Science.gov (United States)

26th Annual Quality Assurance Conference. Abstract: An Innovative Water Management Device for Online and Canister-based Thermal Desorption of Trace-level VVOCs in High Humidity Ambient Air by Nicola Watson and Rui Li

Interview with Mark Watson

Directory of Open Access Journals (Sweden)

Katy Shaw

2016-04-01

Full Text Available Mark Watson is a British comedian and novelist. His five novels to date – 'Bullet Points' (2004, 'A Light-Hearted Look At Murder' (2007, 'Eleven' (2010, 'The Knot' (2012 and 'Hotel Alpha' (2014 – explore human relationships and communities in contemporary society. His latest novel Hotel Alpha tells the story of an extraordinary hotel in London and two mysterious disappearances that raise questions no one seems willing to answer. External to the novel, readers can also discover more about the hotel and its inhabitants in one hundred extra stories that expand the world of the novel and can be found at http://www.hotelalphastories.com. In conversation here with Dr Katy Shaw, Mark offers some reflections on his writing process, the field of contemporary literature, and the vitality of the novel form in the twenty-first century.

Watson: A new link in the IIE iron chain

Science.gov (United States)

Olsen, Edward; Davis, Andrew; Clarke, Roy S., Jr.; Schultz, Ludolf; Weber, Hartwig W.; Clayton, Robert; Mayeda, Toshiko; Jarosewich, Eugene; Sylvester, Paul; Grossman, Lawrence

1994-01-01

Watson, which was found in 1972 in South Australia, contains the largest single silicate rock mass seen in any known iron meteorite. A comprehensive study has been completed on this unusual meteorite: petrography, metallography, analyses of the silicate inclusion (whole rock chemical analysis, INAA, RNAA, noble gases, and oxygen isotope analysis) and mineral compositions (by electron microprobe and ion microprobe). The whole rock has a composition of an H-chondrite minus the normal H-group metal and troilite content. The oxygen isotope composition is that of the silicates in the IIE iron meteorites and lies along an oxygen isotope fractionation line with the H-group chondrites. Trace elements in the metal confirm Watson is a new IIE iron. Whole rock Watson silicate shows an enrichment in K and P (each approximately 2X H-chondrites). The silicate inclusion has a highly equilibrated igneous (peridotite-like) texture with olivine largely poikilitic within low-Ca pyroxene: olivine (Fa20), opx (Fs17Wo3), capx (Fs9Wo14)(with very fine exsolution lamellae), antiperthite feldspar (An1-3Or5) with less than 1 micron exsolution lamellae (An1-3Or greater than 40), shocked feldspar with altered stoichiometry, minor whitlockite (also a poorly characterized interstitial phosphate-rich phase) and chromite, and only traces of metal and troilite. The individual silicate minerals have normal chondritic REE patterns, but whitlockite has a remarkable REE pattern. It is very enriched in light REE (La is 720X C1, and Lu is 90X C1, as opposed to usual chonditic values of approximately 300X and 100-150X, respectively) with a negative Eu anomaly. The enrichment of whole rock K is expressed both in an unusually high mean modal Or content of the feldspar, Or13, and in the presence of antiperthite.

Complexes of DNA bases and Watson-Crick base pairs with small neutral gold clusters.

Science.gov (United States)

Kryachko, E S; Remacle, F

2005-12-08

The nature of the DNA-gold interaction determines and differentiates the affinity of the nucleobases (adenine, thymine, guanine, and cytosine) to gold. Our preliminary computational study [Kryachko, E. S.; Remacle, F. Nano Lett. 2005, 5, 735] demonstrates that two major bonding factors govern this interaction: the anchoring, either of the Au-N or Au-O type, and the nonconventional N-H...Au hydrogen bonding. In this paper, we offer insight into the nature of nucleobase-gold interactions and provide a detailed characterization of their different facets, i.e., geometrical, energetic, and spectroscopic aspects; the gold cluster size and gold coordination effects; proton affinity; and deprotonation energy. We then investigate how the Watson-Crick DNA pairing patterns are modulated by the nucleobase-gold interaction. We do so in terms of the proton affinities and deprotonation energies of those proton acceptors and proton donors which are involved in the interbase hydrogen bondings. A variety of properties of the most stable Watson-Crick [A x T]-Au3 and [G x C]-Au3 hybridized complexes are described and compared with the isolated Watson-Crick A x T and G x C ones. It is shown that enlarging the gold cluster size to Au6 results in a rather short gold-gold bond in the Watson-Crick interbase region of the [G x C]-Au6 complex that bridges the G x C pair and thus leads to a significant strengthening of G x C pairing.

Non-Watson Crick base pairs might stabilize RNA structural motifs in ...

Indian Academy of Sciences (India)

Watson Crick base pairs, internal loops and pseudoknots have been the highlighting feature of recent structural determination of RNAs. The recent crystal structure of group-I introns has demonstrated that these might constitute RNA structural ...

WATSON: Detecting organic material in subsurface ice using deep-UV fluorescence and Raman spectroscopy

Science.gov (United States)

Eshelman, E.; Wanger, G.; Manatt, K.; Malaska, M.; Willis, M.; Abbey, W.; Doloboff, I.; Beegle, L. W.; DeFlores, L. P.; Priscu, J. C.; Lane, A. L.; Carrier, B. L.; Mellerowicz, B.; Kim, D.; Paulsen, G.; Zacny, K.; Bhartia, R.

2017-12-01

Future astrobiological missions to Europa and other ocean worlds may benefit from next-generation instrumentation capable of in situ organic and life detection in subsurface ice environments. WATSON (Wireline Analysis Tool for in Situ Observation of Northern ice sheets) is an instrument under development at NASA's Jet Propulsion Laboratory. WATSON contains high-TRL instrumentation developed for SHERLOC, the Mars 2020 deep-UV fluorescence and Raman spectrometer, including a 248.6 nm NeCu hollow cathode laser as an excitation source. In WATSON, these technologies provide spectroscopic capabilities highly sensitive to many organic compounds, including microbes, in an instrument package approximately 1.2 m long with a 101.6 mm diameter, designed to accommodate a 108 mm ice borehole. Interrogation into the ice wall with a laser allows for a non-destructive in situ measurement that preserves the spatial distribution of material within the ice. We report on a successful deployment of WATSON to Kangerlussuaq, Greenland, where the instrument was lowered to a 4.5 m depth in a hand-cored hole on the Kangerlussuaq sector of the Greenland ice sheet. Motorized stages within the instrument were used to raster a laser across cm-scale regions of the interior surface of the borehole, obtaining fluorescence spectral maps with a 200 µm spatial resolution and a spectral range from 265 nm to 440 nm. This region includes the UV emission bands of many aromatic compounds and microbes, and includes the water and ice Raman O-H stretching modes. We additionally report on experiments designed to inform an early-2018 deployment to Kangerlussuaq where WATSON will be incorporated into a Honeybee Robotics planetary deep drill, with a goal of drilling to a depth of 100 m and investigating the distribution of organic material within the ice sheet. These experiments include laboratory calibrations to determine the sensitivity to organic compounds embedded in ice at various depths, as well as

Watson-Crick base pairing controls excited-state decay in natural DNA.

Science.gov (United States)

Bucher, Dominik B; Schlueter, Alexander; Carell, Thomas; Zinth, Wolfgang

2014-10-13

Excited-state dynamics are essential to understanding the formation of DNA lesions induced by UV light. By using femtosecond IR spectroscopy, it was possible to determine the lifetimes of the excited states of all four bases in the double-stranded environment of natural DNA. After UV excitation of the DNA duplex, we detected a concerted decay of base pairs connected by Watson-Crick hydrogen bonds. A comparison of single- and double-stranded DNA showed that the reactive charge-transfer states formed in the single strands are suppressed by base pairing in the duplex. The strong influence of the Watson-Crick hydrogen bonds indicates that proton transfer opens an efficient decay path in the duplex that prohibits the formation or reduces the lifetime of reactive charge-transfer states. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Visualizing Transient Watson-Crick Like Mispairs in DNA and RNA Duplexes

Science.gov (United States)

Kimsey, Isaac J.; Petzold, Katja; Sathyamoorthy, Bharathwaj; Stein, Zachary W.; Al-Hashimi, Hashim M.

2015-01-01

Rare tautomeric and anionic nucleobases are believed to play fundamental biological roles but their prevalence and functional importance has remained elusive because they exist transiently, in low-abundance, and involve subtle movements of protons that are difficult to visualize. Using NMR relaxation dispersion, we show that wobble dG•dT and rG•rU mispairs in DNA and RNA duplexes exist in dynamic equilibrium with short-lived, low-populated Watson-Crick like mispairs that are stabilized by rare enolic or anionic bases. These mispairs can evade Watson-Crick fidelity checkpoints and form with probabilities (10−3-10−5) that strongly imply a universal role in replication and translation errors. Our results indicate that rare tautomeric and anionic bases are widespread in nucleic acids, expanding their structural and functional complexity beyond that attainable with canonical bases. PMID:25762137

Visualizing transient Watson-Crick-like mispairs in DNA and RNA duplexes.

Science.gov (United States)

Kimsey, Isaac J; Petzold, Katja; Sathyamoorthy, Bharathwaj; Stein, Zachary W; Al-Hashimi, Hashim M

2015-03-19

Rare tautomeric and anionic nucleobases are believed to have fundamental biological roles, but their prevalence and functional importance has remained elusive because they exist transiently, in low abundance, and involve subtle movements of protons that are difficult to visualize. Using NMR relaxation dispersion, we show here that wobble dG•dT and rG•rU mispairs in DNA and RNA duplexes exist in dynamic equilibrium with short-lived, low-populated Watson-Crick-like mispairs that are stabilized by rare enolic or anionic bases. These mispairs can evade Watson-Crick fidelity checkpoints and form with probabilities (10(-3) to 10(-5)) that strongly imply a universal role in replication and translation errors. Our results indicate that rare tautomeric and anionic bases are widespread in nucleic acids, expanding their structural and functional complexity beyond that attainable with canonical bases.

Jokulhlaups and sediment transport in Watson River, Kangerlussuaq, West Greenland

DEFF Research Database (Denmark)

Mikkelsen, A. B.; Hasholt, Bent; Knudsen, N. T.

2013-01-01

For 3 years, during a 4-year observation period (2007-2010), jokulhlaups were observed from a lake at the northern margin of Russells Gletscher. At a gauging station located on a bedrock sill near the outlet of Watson River into Sdr Stromfjord, discharge and sediment transport was monitored during...

Comparable stability of Hoogsteen and Watson-Crick base pairs in ionic liquid choline dihydrogen phosphate.

Science.gov (United States)

Tateishi-Karimata, Hisae; Nakano, Miki; Sugimoto, Naoki

2014-01-08

The instability of Hoogsteen base pairs relative to Watson-Crick base pairs has limited biological applications of triplex-forming oligonucleotides. Hydrated ionic liquids (ILs) provide favourable environments for a wide range of chemical reactions and are known to impact the stabilities of Watson-Crick base pairs. We found that DNA triplex formation was significantly stabilized in hydrated choline dihydrogen phosphate as compared with an aqueous buffer at neutral pH. Interestingly, the stability of Hoogsteen base pairs was found to be comparable with that of Watson-Crick base pairs in the hydrated IL. Molecular dynamics simulations of a DNA triplex in the presence of choline ions revealed that the DNA triplex was stabilized because of the binding of choline ion around the third strand in the grooves. Our finding will facilitate the development of new DNA materials. Our data also indicate that triplex formation may be stabilized inside cells where choline ions and their derivatives are abundant in vivo.

Assessing the Watson-Barker Listening Test (WBLT)-Form C in Measuring Listening Comprehension of Post-Secondary Hispanic-American Students

Science.gov (United States)

Worthington, Debra L.; Keaton, Shaughan; Cook, John; Fitch-Hauser, Margaret; Powers, William G.

2014-01-01

The Watson-Barker Listening Test (WBLT) is one of the most popular measures of listening comprehension. However, participants in studies utilizing this scale have been almost exclusively Anglo-American. At the same time, previous research questions the psychometric properties of the test. This study addressed both of these issues by testing the…

Computing the Quartet Distance Between Evolutionary Trees in Time O(n log n)

DEFF Research Database (Denmark)

Brodal, Gerth Sølfting; Fagerberg, Rolf; Pedersen, Christian Nørgaard Storm

2003-01-01

Evolutionary trees describing the relationship for a set of species are central in evolutionary biology, and quantifying differences between evolutionary trees is therefore an important task. The quartet distance is a distance measure between trees previously proposed by Estabrook, McMorris, and ...... unrooted evolutionary trees of n species, where all internal nodes have degree three, in time O(n log n. The previous best algorithm for the problem uses time O(n 2).......Evolutionary trees describing the relationship for a set of species are central in evolutionary biology, and quantifying differences between evolutionary trees is therefore an important task. The quartet distance is a distance measure between trees previously proposed by Estabrook, Mc......Morris, and Meacham. The quartet distance between two unrooted evolutionary trees is the number of quartet topology differences between the two trees, where a quartet topology is the topological subtree induced by four species. In this paper we present an algorithm for computing the quartet distance between two...

IBM Watson Analytics: Automating Visualization, Descriptive, and Predictive Statistics.

Science.gov (United States)

Hoyt, Robert Eugene; Snider, Dallas; Thompson, Carla; Mantravadi, Sarita

2016-10-11

We live in an era of explosive data generation that will continue to grow and involve all industries. One of the results of this explosion is the need for newer and more efficient data analytics procedures. Traditionally, data analytics required a substantial background in statistics and computer science. In 2015, International Business Machines Corporation (IBM) released the IBM Watson Analytics (IBMWA) software that delivered advanced statistical procedures based on the Statistical Package for the Social Sciences (SPSS). The latest entry of Watson Analytics into the field of analytical software products provides users with enhanced functions that are not available in many existing programs. For example, Watson Analytics automatically analyzes datasets, examines data quality, and determines the optimal statistical approach. Users can request exploratory, predictive, and visual analytics. Using natural language processing (NLP), users are able to submit additional questions for analyses in a quick response format. This analytical package is available free to academic institutions (faculty and students) that plan to use the tools for noncommercial purposes. To report the features of IBMWA and discuss how this software subjectively and objectively compares to other data mining programs. The salient features of the IBMWA program were examined and compared with other common analytical platforms, using validated health datasets. Using a validated dataset, IBMWA delivered similar predictions compared with several commercial and open source data mining software applications. The visual analytics generated by IBMWA were similar to results from programs such as Microsoft Excel and Tableau Software. In addition, assistance with data preprocessing and data exploration was an inherent component of the IBMWA application. Sensitivity and specificity were not included in the IBMWA predictive analytics results, nor were odds ratios, confidence intervals, or a confusion matrix

Computing and visualizing time-varying merge trees for high-dimensional data

Energy Technology Data Exchange (ETDEWEB)

Oesterling, Patrick [Univ. of Leipzig (Germany); Heine, Christian [Univ. of Kaiserslautern (Germany); Weber, Gunther H. [Lawrence Berkeley National Lab. (LBNL), Berkeley, CA (United States); Morozov, Dmitry [Lawrence Berkeley National Lab. (LBNL), Berkeley, CA (United States); Scheuermann, Gerik [Univ. of Leipzig (Germany)

2017-06-03

We introduce a new method that identifies and tracks features in arbitrary dimensions using the merge tree -- a structure for identifying topological features based on thresholding in scalar fields. This method analyzes the evolution of features of the function by tracking changes in the merge tree and relates features by matching subtrees between consecutive time steps. Using the time-varying merge tree, we present a structural visualization of the changing function that illustrates both features and their temporal evolution. We demonstrate the utility of our approach by applying it to temporal cluster analysis of high-dimensional point clouds.

Investigation of Growth and Survival of Transplanted Plane and Pine Trees According to IBA Application, Tree Age, Transplanting Time and Method

Directory of Open Access Journals (Sweden)

N. Etemadi

2015-03-01

Full Text Available The major problems in transplanting the landscape trees are high level of mortality and low establishment rate of transplanted trees, especially in the first year. In order to achieve the best condition for successful transplanting of pine and plane trees in Isfahan landscape, the present study was carried out based on a completely randomized block design with four replicates and three treatments including transplanting method (balled and burlapped and bare root, tree age (immature and mature and IBA application (0 and 150 mg/L. Trees were transplanted during 2009 and 2010 in three times (dormant season, early and late growing season. Survival rate and Relative Growth Rate index based on tree height (RGRH and trunk diameter (RGRD were measured during the first and second years. Trees transplanted early in the growing season showed the most survival percentage during the two years, as compared to other transplanting dates. Survival of Balled and burlapped and immature transplanted trees was significantly greater than bare root or mature trees. The significant effect of age treatment was continued in the second year. IBA treatment had no effect on survival rate of the studied species. Balled and burlapped and immature transplanted pine trees also had higher RGRH and RGRD compared to bare root or mature trees. According to the results of this study, early growing season is the best time for transplanting pine and plane trees. Also, transplanting of immature trees using balled and burlapped method is recommended to increase the survival and establishment rate.

Impact parameter representation from the Watson-Sommerfeld transform

International Nuclear Information System (INIS)

Islam, M.M.

1976-01-01

Using the Watson-Sommerfeld transform the elastic scattering amplitude of two spinless particles is shown to have an exact and unique impact parameter, or Fourier-Bessel (FB) representation. The representation is valid for all physical energies and scattering angles. Wallace's recent work is found to be an asymptotic expansion of the FB amplitude obtained from the partial-wave expansion. The way singularities of the partial-wave amplitude in the l-plane enter in the FB amplitude is also explicitly shown. (Auth.)

Some Econometric Results for the Blanchard-Watson Bubble Model

DEFF Research Database (Denmark)

Johansen, Soren; Lange, Theis

The purpose of the present paper is to analyse a simple bubble model suggested by Blanchard and Watson. The model is defined by y(t) =s(t)¿y(t-1)+e(t), t=1,…,n, where s(t) is an i.i.d. binary variable with p=P(s(t)=1), independent of e(t) i.i.d. with mean zero and finite variance. We take ¿>1 so...

DNA base dimers are stabilized by hydrogen-bonding interactions including non-Watson-Crick pairing near graphite surfaces.

Science.gov (United States)

Shankar, Akshaya; Jagota, Anand; Mittal, Jeetain

2012-10-11

Single- and double-stranded DNA are increasingly being paired with surfaces and nanoparticles for numerous applications, such as sensing, imaging, and drug delivery. Unlike the majority of DNA structures in bulk that are stabilized by canonical Watson-Crick pairing between Ade-Thy and Gua-Cyt, those adsorbed on surfaces are often stabilized by noncanonical base pairing, quartet formation, and base-surface stacking. Not much is known about these kinds of interactions. To build an understanding of the role of non-Watson-Crick pairing on DNA behavior near surfaces, one requires basic information on DNA base pair stacking and hydrogen-bonding interactions. All-atom molecular simulations of DNA bases in two cases--in bulk water and strongly adsorbed on a graphite surface--are conducted to study the relative strengths of stacking and hydrogen bond interactions for each of the 10 possible combinations of base pairs. The key information obtained from these simulations is the free energy as a function of distance between two bases in a pair. We find that stacking interactions exert the dominant influence on the stability of DNA base pairs in bulk water as expected. The strength of stability for these stacking interactions is found to decrease in the order Gua-Gua > Ade-Gua > Ade-Ade > Gua-Thy > Gua-Cyt > Ade-Thy > Ade-Cyt > Thy-Thy > Cyt-Thy > Cyt-Cyt. On the other hand, mutual interactions of surface-adsorbed base pairs are stabilized mostly by hydrogen-bonding interactions in the order Gua-Cyt > Ade-Gua > Ade-Thy > Ade-Ade > Cyt-Thy > Gua-Gua > Cyt-Cyt > Ade-Cyt > Thy-Thy > Gua-Thy. Interestingly, several non-Watson-Crick base pairings, which are commonly ignored, have similar stabilization free energies due to interbase hydrogen bonding as Watson-Crick pairs. This clearly highlights the importance of non-Watson-Crick base pairing in the development of secondary structures of oligonucleotides near surfaces.

Volume Estimates in Chronic Hemodialysis Patients by the Watson Equation and Bioimpedance Spectroscopy and the Impact on the Kt/Vurea calculation.

Science.gov (United States)

Noori, Nazanin; Wald, Ron; Sharma Parpia, Arti; Goldstein, Marc B

2018-01-01

Accurate assessment of total body water (TBW) is essential for the evaluation of dialysis adequacy (Kt/V urea ). The Watson formula, which is recommended for the calculation of TBW, was derived in healthy volunteers thereby leading to potentially inaccurate TBW estimates in maintenance hemodialysis recipients. Bioimpedance spectroscopy (BIS) may be a robust alternative for the measurement of TBW in hemodialysis recipients. The primary objective of this study was to evaluate the accuracy of Watson formula-derived TBW estimates as compared with TBW measured with BIS. Second, we aimed to identify the anthropometric characteristics that are most likely to generate inaccuracy when using the Watson formula to calculate TBW. Finally, we derived novel anthropometric equations for the more accurate estimation of TBW. This was a cross-sectional study of prevalent in-center HD patients at St Michael's Hospital. One hundred eighty-four hemodialysis patients (109 men and 75 women) were evaluated in this study. Anthropometric measurements including weight, height, waist circumference, midarm circumference, and 4-site skinfold (biceps, triceps, subscapular, and suprailiac) thickness were measured; fat mass was measured using the formula by Durnin and Womersley. We measured TBW by BIS using the Body Composition Monitor (Fresenius Medical Care, Bad Homburg, Germany). We used the Bland-Altman method to calculate the difference between the TBW derived from the Watson method and the BIS. To derive new equations for TBW estimation, Pearson's correlation coefficients between BIS-TBW (the reference test) and other variables were examined. We used the least squares regression analysis to develop parsimonious equations to predict TBW. TBW values based on the Watson method had a high correlation with BIS-TBW (correlation coefficients = 0.87 and P Watson formula overestimated TBW by 5.1 (4.5-5.8) liters and 3.8 (3.0-4.5) liters, in men and women, respectively. Higher fat mass and waist

A time-dependent event tree technique for modelling recovery operations

International Nuclear Information System (INIS)

Kohut, P.; Fitzpatrick, R.

1991-01-01

The development of a simplified time dependent event tree methodology is presented. The technique is especially applicable to describe recovery operations in nuclear reactor accident scenarios initiated by support system failures. The event tree logic is constructed using time dependent top events combined with a damage function that contains information about the final state time behavior of the reactor core. Both the failure and the success states may be utilized for the analysis. The method is illustrated by modeling the loss of service water function with special emphasis on the RCP [reactor coolant pump] seal LOCA [loss of coolant accident] scenario. 5 refs., 2 figs., 2 tabs

Immersion in the Field: The Elementary Block Network in the Watson College of Education at the University of North Carolina Wilmington

Science.gov (United States)

Roseboro, Donyell; Lewis, Somer; Buchanan, Lisa; Higgins, Heidi; Schlichting, Katie; Brinkley, Brian

2014-01-01

In 1989, the Watson College of Education at the University of North Carolina Wilmington started the Model Clinical Teaching Project and the Consortium for the Advancement of Public Education's School Reform Initiative (CAPE). Since that time, the partnership system has grown to include 146 schools across twelve traditional school districts and…

de Jean Watson

Directory of Open Access Journals (Sweden)

Thaís Schossler

2008-01-01

Full Text Available Este estudio tuvo como objetivo conocer la percepción del cuidador domiciliario del anciano acerca del cuidado de sí mismo, teniendo como base teórica a Jean Watson en su Teoría del Cuidado Humano. La investigación se caracterizó por un abordaje cualitativo, de tipo exploratorio-descriptivo, el cual fue desarrollado en la Unidad de la Vila Floresta con nueve cuidadores domiciliarios de ancianos, integrantes del Programa de Atención a Domicilio. La recolección de informaciones se realizó en el período de agosto a octubre de 2006, por medio de una entrevista parcialmente estructurada. Se utilizó el análisis de contenido de Bardin y emergieron las categorías: compartir el cuidado al anciano - una posibilidad para cuidar de sí mismo; descansar, pasear, dormir, uno no tiene más ese derecho; presencia de la familia: una necesidad sentida por el cuidador domiciliar; (desequilibrio del cuerpo físico y mental, una resultante percibida en el (descuidado de sí mismo. Se concluye que el cuidador domiciliario es el principal responsable por el cuidado del anciano y que el cuidado de sí mismo se hace presente en su realidad.

Formation of base triplets by non-Watson-Crick bonds mediates homologous recognition in RecA recombination filaments.

OpenAIRE

Rao, B J; Radding, C M

1994-01-01

Whereas complementary strands of DNA recognize one another by forming Watson-Crick base pairs, the way in which RecA protein enables a single strand to recognize homology in duplex DNA has remained unknown. Recent experiments, however, have shown that a single plus strand in the RecA filament can recognize an identical plus strand via bonds that, by definition, are non-Watson-Crick. In experiments reported here, base substitutions had the same qualitative and quantitative effects on the pairi...

Timing analysis of safety properties using fault trees with time dependencies and timed state-charts

International Nuclear Information System (INIS)

Magott, Jan; Skrobanek, Pawel

2012-01-01

Behavior in time domain is often crucial for safety critical systems. Standard fault trees cannot express time-dependent behavior. In the paper, timing analysis of safety properties using fault trees with time dependencies (FTTDs) and timed state-charts is presented. A new version of timed state-charts (TSCs) is also proposed. These state-charts can model the dynamics of technical systems, e.g. controllers, controlled objects, and people. In TSCs, activity and communication times are represented by time intervals. In the proposed approach the structure of FTTD is fixed by a human. Time properties of events and gates of FTTD are expressed by time intervals, and are calculated using TSCs. The minimal and maximal values of these time intervals of FTTD can be calculated by finding paths with minimal and maximal time lengths in TSCs, which is an NP-hard problem. In order to reduce the practical complexity of computing the FTTD time parameters, some reductions of TSCs are defined in the paper, such as sequential, alternative, loop (iteration), and parallel. Some of the reductions are intuitive, in case of others—theorems are required. Computational complexity of each reduction is not greater than linear in the size of reduced TSC. Therefore, the obtained results enable decreasing of the costs of FTTD time parameters calculation when system dynamics is expressed by TSCs. Case study of a railroad crossing with a controller that controls semaphores, gate, light-audio signal close to the gate will be analyzed.

Direct NMR Evidence that Transient Tautomeric and Anionic States in dG·dT Form Watson-Crick-like Base Pairs.

Science.gov (United States)

Szymanski, Eric S; Kimsey, Isaac J; Al-Hashimi, Hashim M

2017-03-29

The replicative and translational machinery utilizes the unique geometry of canonical G·C and A·T/U Watson-Crick base pairs to discriminate against DNA and RNA mismatches in order to ensure high fidelity replication, transcription, and translation. There is growing evidence that spontaneous errors occur when mismatches adopt a Watson-Crick-like geometry through tautomerization and/or ionization of the bases. Studies employing NMR relaxation dispersion recently showed that wobble dG·dT and rG·rU mismatches in DNA and RNA duplexes transiently form tautomeric and anionic species with probabilities (≈0.01-0.40%) that are in concordance with replicative and translational errors. Although computational studies indicate that these exceptionally short-lived and low-abundance species form Watson-Crick-like base pairs, their conformation could not be directly deduced from the experimental data, and alternative pairing geometries could not be ruled out. Here, we report direct NMR evidence that the transient tautomeric and anionic species form hydrogen-bonded Watson-Crick-like base pairs. A guanine-to-inosine substitution, which selectively knocks out a Watson-Crick-type (G)N2H 2 ···O2(T) hydrogen bond, significantly destabilized the transient tautomeric and anionic species, as assessed by lack of any detectable chemical exchange by imino nitrogen rotating frame spin relaxation (R 1ρ ) experiments. An 15 N R 1ρ NMR experiment targeting the amino nitrogen of guanine (dG-N2) provides direct evidence for Watson-Crick (G)N2H 2 ···O2(T) hydrogen bonding in the transient tautomeric state. The strategy presented in this work can be generally applied to examine hydrogen-bonding patterns in nucleic acid transient states including in other tautomeric and anionic species that are postulated to play roles in replication and translational errors.

Probing the Watson-Crick, wobble, and sugar-edge hydrogen bond sites of uracil and thymine.

Science.gov (United States)

Müller, Andreas; Frey, Jann A; Leutwyler, Samuel

2005-06-16

The nucleobases uracil (U) and thymine (T) offer three hydrogen-bonding sites for double H-bond formation via neighboring N-H and C=O groups, giving rise to the Watson-Crick, wobble and sugar-edge hydrogen bond isomers. We probe the hydrogen bond properties of all three sites by forming hydrogen bonded dimers of U, 1-methyluracil (1MU), 3-methyluracil (3MU), and T with 2-pyridone (2PY). The mass- and isomer-specific S1 origins exhibit large spectral blue shifts relative to the 2PY monomer. Ab initio CIS calculations of the spectral shifts of the different hydrogen-bonded dimers show a linear correlation with experiment. This correlation allows us to identify the R2PI spectra of the weakly populated Watson-Crick and wobble isomers of both 2PY.U and 2PY.T. (3) PW91 density functional calculation of the ground-state binding and dissociation energies De and D0 are in agreement with the assignment of the dominant hydrogen bond isomers of 2PY.U, 2PY.3MU and 2PY.T as the sugar-edge form. For 2PY.U, 2PY.T and 2PY.1MU the measured wobble:Watson-Crick:sugar-edge isomer ratios are in good agreement with the calculated ratios, based on the ab initio dissociation energies and gas-phase statistical mechanics. The Watson-Crick and wobble isomers are thereby determined to be several kcal/mol less strongly bound than the sugar-edge isomers. The 36 observed intermolecular frequencies of the nine different H-bonded isomers give detailed insight into the intermolecular force field.

A method for investigating relative timing information on phylogenetic trees.

Science.gov (United States)

Ford, Daniel; Matsen, Frederick A; Stadler, Tanja

2009-04-01

In this paper, we present a new way to describe the timing of branching events in phylogenetic trees. Our description is in terms of the relative timing of diversification events between sister clades; as such it is complementary to existing methods using lineages-through-time plots which consider diversification in aggregate. The method can be applied to look for evidence of diversification happening in lineage-specific "bursts", or the opposite, where diversification between 2 clades happens in an unusually regular fashion. In order to be able to distinguish interesting events from stochasticity, we discuss 2 classes of neutral models on trees with relative timing information and develop a statistical framework for testing these models. These model classes include both the coalescent with ancestral population size variation and global rate speciation-extinction models. We end the paper with 2 example applications: first, we show that the evolution of the hepatitis C virus deviates from the coalescent with arbitrary population size. Second, we analyze a large tree of ants, demonstrating that a period of elevated diversification rates does not appear to have occurred in a bursting manner.

J. B. Watson y la Publicidad, los Inicios de la Psicología del Consumidor

Directory of Open Access Journals (Sweden)

FELIPE PARRADO CORREDOR

2013-12-01

Full Text Available Research regarding the behavior of individuals with respect to products and services dates back to the beginning of the 20th century, and J. B. Watson is one of its main precursors. Watson taught an applied psychology course called Psychology of Advertising, introduced many companies to experimental techniques for the marketing of their products, and, after retiring from academic life, joined the Walter Thompson advertising agency, where he developed massive campaigns using the principles of conditioned emotional responses. The article highlights the importance of Watson’s work in the psychology of advertising, as a forerunner of the scientific developments of consumer psychology.

On the extension of the Fermi-Watson Theorem to high energy diffraction

International Nuclear Information System (INIS)

Malecki, A.; Istituto Nazionale di Fisica Nucleare, Frascati

1995-12-01

The Fermi-Watson theorem, established for low energy reactions and then applied to high energy collision, is revisited. Its use for the processes of inelastic diffraction is discussed. The theorem turns out to be valid in the case inclusive cross-section of diffractive transition

The Thurgood Marshall School of Law Empirical Findings: A Report of the Watson-Glaser for the 2009-2010 Test Takers

Science.gov (United States)

Kadhi, T.; Palasota, A.; Holley, D.; Rudley, D.

2010-01-01

The following report gives the statistical findings of the 2009-2010 Watson-Glaser test. Data is pre-existing and was given to the Evaluator by email from the Director, Center for Legal Pedagogy. Statistical analyses were run using SPSS 17 to address the following questions: 1. What are the statistical descriptors of the Watson-Glaser results of…

Comparison of Taxi Time Prediction Performance Using Different Taxi Speed Decision Trees

Science.gov (United States)

Lee, Hanbong

2017-01-01

In the STBO modeler and tactical surface scheduler for ATD-2 project, taxi speed decision trees are used to calculate the unimpeded taxi times of flights taxiing on the airport surface. The initial taxi speed values in these decision trees did not show good prediction accuracy of taxi times. Using the more recent, reliable surveillance data, new taxi speed values in ramp area and movement area were computed. Before integrating these values into the STBO system, we performed test runs using live data from Charlotte airport, with different taxi speed settings: 1) initial taxi speed values and 2) new ones. Taxi time prediction performance was evaluated by comparing various metrics. The results show that the new taxi speed decision trees can calculate the unimpeded taxi-out times more accurately.

"Elementary, my dear Watson". Per una falsa citazione

Directory of Open Access Journals (Sweden)

Irene Minella

2014-12-01

Full Text Available Nowhere, among Sir Arthur Conan Doyle's pages concerning one of the most celebrated characters of British literature, Sherlock Holmes, is to be found the interjection: "Elementary, my dear Watson!". Exploring the creation of the London investigator as well as Holmes' first appearance in theatre, cinema and literature, this essay will help to understand why he is still so popular and why the 'non-quotation' keeps haunting the collective imagination. Despite its philological inaccuracy, the interjection has become so famous that it has been used even outside its original context.

Wobble↔Watson-Crick tautomeric transitions in the homo-purine DNA mismatches: a key to the intimate mechanisms of the spontaneous transversions.

Science.gov (United States)

Brovarets', Ol'ha O; Hovorun, Dmytro M

2015-01-01

The intrinsic capability of the homo-purine DNA base mispairs to perform wobble↔Watson-Crick/Topal-Fresco tautomeric transitions via the sequential intrapair double proton transfer was discovered for the first time using QM (MP2/DFT) and QTAIM methodologies that are crucial for understanding the microstructural mechanisms of the spontaneous transversions.

Crick's gossip test and Watson's boredom principle: A pseudo-mathematical analysis of effort in scientific research.

Science.gov (United States)

Charlton, Bruce G

2008-01-01

Crick and Watson gave complementary advice to the aspiring scientist based on the insight that to do your best work you need to make your greatest possible effort. Crick made the positive suggestion to work on the subject which most deeply interests you, the thing about which you spontaneously gossip - Crick termed this 'the gossip test'. Watson made the negative suggestion of avoiding topics and activities that bore you - which I have termed 'the boredom principle'. This is good advice because science is tough and the easy things have already been done. Solving the harder problems that remain requires a lot of effort. But in modern biomedical science individual effort does not necessarily correlate with career success as measured by salary, status, job security, etc. This is because Crick and Watson are talking about revolutionary science - using Thomas Kuhn's distinction between paradigm-shifting 'revolutionary' science and incremental 'normal' science. There are two main problems with pursuing a career in revolutionary science. The first is that revolutionary science is intrinsically riskier than normal science, the second that even revolutionary success in a scientific backwater may be less career-enhancing than mundane work in a trendy field. So, if you pick your scientific problem using the gossip test and the boredom principle, you might also be committing career suicide. This may explain why so few people follow Crick and Watson's advice. The best hope for future biomedical science is that it will evolve towards a greater convergence between individual effort and career success.

Modeling time-to-event (survival) data using classification tree analysis.

Science.gov (United States)

Linden, Ariel; Yarnold, Paul R

2017-12-01

Time to the occurrence of an event is often studied in health research. Survival analysis differs from other designs in that follow-up times for individuals who do not experience the event by the end of the study (called censored) are accounted for in the analysis. Cox regression is the standard method for analysing censored data, but the assumptions required of these models are easily violated. In this paper, we introduce classification tree analysis (CTA) as a flexible alternative for modelling censored data. Classification tree analysis is a "decision-tree"-like classification model that provides parsimonious, transparent (ie, easy to visually display and interpret) decision rules that maximize predictive accuracy, derives exact P values via permutation tests, and evaluates model cross-generalizability. Using empirical data, we identify all statistically valid, reproducible, longitudinally consistent, and cross-generalizable CTA survival models and then compare their predictive accuracy to estimates derived via Cox regression and an unadjusted naïve model. Model performance is assessed using integrated Brier scores and a comparison between estimated survival curves. The Cox regression model best predicts average incidence of the outcome over time, whereas CTA survival models best predict either relatively high, or low, incidence of the outcome over time. Classification tree analysis survival models offer many advantages over Cox regression, such as explicit maximization of predictive accuracy, parsimony, statistical robustness, and transparency. Therefore, researchers interested in accurate prognoses and clear decision rules should consider developing models using the CTA-survival framework. © 2017 John Wiley & Sons, Ltd.

Finding Little Albert: A Journey to John B. Watson's Infant Laboratory

Science.gov (United States)

Beck, Hall P.; Levinson, Sharman; Irons, Gary

2009-01-01

In 1920, John Watson and Rosalie Rayner claimed to have conditioned a baby boy, Albert, to fear a laboratory rat. In subsequent tests, they reported that the child's fear generalized to other furry objects. After the last testing session, Albert disappeared, creating one of the greatest mysteries in the history of psychology. This article…

Time Series of Images to Improve Tree Species Classification

Science.gov (United States)

Miyoshi, G. T.; Imai, N. N.; de Moraes, M. V. A.; Tommaselli, A. M. G.; Näsi, R.

2017-10-01

Tree species classification provides valuable information to forest monitoring and management. The high floristic variation of the tree species appears as a challenging issue in the tree species classification because the vegetation characteristics changes according to the season. To help to monitor this complex environment, the imaging spectroscopy has been largely applied since the development of miniaturized sensors attached to Unmanned Aerial Vehicles (UAV). Considering the seasonal changes in forests and the higher spectral and spatial resolution acquired with sensors attached to UAV, we present the use of time series of images to classify four tree species. The study area is an Atlantic Forest area located in the western part of São Paulo State. Images were acquired in August 2015 and August 2016, generating three data sets of images: only with the image spectra of 2015; only with the image spectra of 2016; with the layer stacking of images from 2015 and 2016. Four tree species were classified using Spectral angle mapper (SAM), Spectral information divergence (SID) and Random Forest (RF). The results showed that SAM and SID caused an overfitting of the data whereas RF showed better results and the use of the layer stacking improved the classification achieving a kappa coefficient of 18.26 %.

Tokunaga and Horton self-similarity for level set trees of Markov chains

International Nuclear Information System (INIS)

Zaliapin, Ilia; Kovchegov, Yevgeniy

2012-01-01

Highlights: ► Self-similar properties of the level set trees for Markov chains are studied. ► Tokunaga and Horton self-similarity are established for symmetric Markov chains and regular Brownian motion. ► Strong, distributional self-similarity is established for symmetric Markov chains with exponential jumps. ► It is conjectured that fractional Brownian motions are Tokunaga self-similar. - Abstract: The Horton and Tokunaga branching laws provide a convenient framework for studying self-similarity in random trees. The Horton self-similarity is a weaker property that addresses the principal branching in a tree; it is a counterpart of the power-law size distribution for elements of a branching system. The stronger Tokunaga self-similarity addresses so-called side branching. The Horton and Tokunaga self-similarity have been empirically established in numerous observed and modeled systems, and proven for two paradigmatic models: the critical Galton–Watson branching process with finite progeny and the finite-tree representation of a regular Brownian excursion. This study establishes the Tokunaga and Horton self-similarity for a tree representation of a finite symmetric homogeneous Markov chain. We also extend the concept of Horton and Tokunaga self-similarity to infinite trees and establish self-similarity for an infinite-tree representation of a regular Brownian motion. We conjecture that fractional Brownian motions are also Tokunaga and Horton self-similar, with self-similarity parameters depending on the Hurst exponent.

Does the Watson-Jones or Modified Smith-Petersen Approach Provide Superior Exposure for Femoral Neck Fracture Fixation?

Science.gov (United States)

Lichstein, Paul M; Kleimeyer, John P; Githens, Michael; Vorhies, John S; Gardner, Michael J; Bellino, Michael; Bishop, Julius

2018-04-24

A well-reduced femoral neck fracture is more likely to heal than a poorly reduced one, and increasing the quality of the surgical exposure makes it easier to achieve anatomic fracture reduction. Two open approaches are in common use for femoral neck fractures, the modified Smith-Petersen and Watson-Jones; however, to our knowledge, the quality of exposure of the femoral neck exposure provided by each approach has not been investigated. (1) What is the respective area of exposed femoral neck afforded by the Watson-Jones and modified Smith-Petersen approaches? (2) Is there a difference in the ability to visualize and/or palpate important anatomic landmarks provided by the Watson-Jones and modified Smith-Petersen approaches? Ten fresh-frozen human pelvi underwent both modified Smith-Petersen (utilizing the caudal extent of the standard Smith-Petersen interval distal to the anterosuperior iliac spine and parallel to the palpable interval between the tensor fascia lata and the sartorius) and Watson-Jones approaches. Dissections were performed by three fellowship-trained orthopaedic traumatologists with extensive experience in both approaches. Exposure (in cm) was quantified with calibrated digital photographs and specialized software. Modified Smith-Petersen approaches were analyzed before and after rectus femoris tenotomy. The ability to visualize and palpate seven clinically relevant anatomic structures (the labrum, femoral head, subcapital femoral neck, basicervical femoral neck, greater trochanter, lesser trochanter, and medial femoral neck) was also recorded. The quantified area of the exposed proximal femur was utilized to compare which approach afforded the largest field of view of the femoral neck and articular surface for assessment of femoral neck fracture and associated femoral head injury. The ability to visualize and palpate surrounding structures was assessed so that we could better understand which approach afforded the ability to assess structures that

GOTHIC: Gravitational oct-tree code accelerated by hierarchical time step controlling

Science.gov (United States)

Miki, Yohei; Umemura, Masayuki

2017-04-01

The tree method is a widely implemented algorithm for collisionless N-body simulations in astrophysics well suited for GPU(s). Adopting hierarchical time stepping can accelerate N-body simulations; however, it is infrequently implemented and its potential remains untested in GPU implementations. We have developed a Gravitational Oct-Tree code accelerated by HIerarchical time step Controlling named GOTHIC, which adopts both the tree method and the hierarchical time step. The code adopts some adaptive optimizations by monitoring the execution time of each function on-the-fly and minimizes the time-to-solution by balancing the measured time of multiple functions. Results of performance measurements with realistic particle distribution performed on NVIDIA Tesla M2090, K20X, and GeForce GTX TITAN X, which are representative GPUs of the Fermi, Kepler, and Maxwell generation of GPUs, show that the hierarchical time step achieves a speedup by a factor of around 3-5 times compared to the shared time step. The measured elapsed time per step of GOTHIC is 0.30 s or 0.44 s on GTX TITAN X when the particle distribution represents the Andromeda galaxy or the NFW sphere, respectively, with 224 = 16,777,216 particles. The averaged performance of the code corresponds to 10-30% of the theoretical single precision peak performance of the GPU.

Quantitative Attack Tree Analysis via Priced Timed Automata

NARCIS (Netherlands)

Kumar, Rajesh; Ruijters, Enno Jozef Johannes; Stoelinga, Mariëlle Ida Antoinette; Sankaranarayanan, Sriram; Vicario, Enrico

The success of a security attack crucially depends on the resources available to an attacker: time, budget, skill level, and risk appetite. Insight in these dependencies and the most vulnerable system parts is key to providing effective counter measures. This paper considers attack trees, one of the

A chat with James Watson

CERN Multimedia

2011-01-01

On 6 September, Nobel laureate James Watson paid a visit to CERN. In this interview, he shares his views with CERN's Paola Catapano.      var flash_video_player=get_video_player_path(); insert_player_for_external('Video/Public/Movies/2011/CERN-MOVIE-2011-144/CERN-MOVIE-2011-144-0753-kbps-640x360-25-fps-audio-64-kbps-44-kHz-stereo', 'mms://mediastream.cern.ch/MediaArchive/Video/Public/Movies/2011/CERN-MOVIE-2011-144/CERN-MOVIE-2011-144-0480-kbps-512x288-25-fps-audio-128-kbps-48-kHz-stereo.wmv', 'false', 480, 360, 'https://mediastream.cern.ch/MediaArchive/Video/Public/Movies/2011/CERN-MOVIE-2011-144/CERN-MOVIE-2011-144-posterframe-640x360-at-10-percent.jpg', '1384418', true, 'Video/Public/Movies/2011/CERN-MOVIE-2011-144/CERN-MOVIE-2011-144-0600-kbps-maxH-360-25-fps-audio-128-kbps-48-kHz-stereo.mp4');

Charge transport properties of DNA aperiodic molecule: The role of interbase hopping in Watson-Crick base pair

Science.gov (United States)

Sinurat, E. N.; Yudiarsah, E.

2017-07-01

The charge transport properties of DNA aperiodic molecule has been studied by considering various interbase hopping parameter on Watson-Crick base pair. 32 base pairs long double-stranded DNA aperiodic model with sequence GCTAGTACGTGACGTAGCTAGGATATGCCTGA on one chain and its complement on the other chain is used. Transfer matrix method has been used to calculate transmission probabilities, for determining I-V characteristic using Landauer Büttiker formula. DNA molecule is modeled using tight binding hamiltonian combined with the theory of Slater-Koster. The result show, the increment of Watson-Crick hopping value leads to the transmission probabilities and current of DNA aperiodic molecule increases.

Meltwater chemistry and solute export from a Greenland ice sheet catchment, Watson River, West Greenland

DEFF Research Database (Denmark)

Yde, Jacob C.; Knudsen, N. Tvis; Hasholt, Bent

2014-01-01

–2010 for the Watson River sector of the GrIS that drains into the fjord Kangerlussuaq. The hydrochemistry is dominated by Ca2+ and HCO3− with a relatively high molar K+/Na+ ratio of 0.6 ± 0.1, typical for meltwaters draining a gneissic lithology. Low molar Ca2+/Na+ and Mg2+/Na+ ratios indicate that weathering....... However, when normalized by discharge the denudation rates are comparable to other Arctic sites. When extrapolating the results from the Watson River catchment to the entire Greenland for 2007–2010, the solute export from Greenland meltwater varied between 7.1 × 106 and 7.8 × 106 tons, whilst the major...

The extension of a DNA double helix by an additional Watson-Crick base pair on the same backbone

DEFF Research Database (Denmark)

Kumar, P.; Sharma, P. K.; Madsen, Charlotte S.

2013-01-01

Additional base pair: The DNA duplex can be extended with an additional Watson-Crick base pair on the same backbone by the use of double-headed nucleotides. These also work as compressed dinucleotides and form two base pairs with cognate nucleobases on the opposite strand.......Additional base pair: The DNA duplex can be extended with an additional Watson-Crick base pair on the same backbone by the use of double-headed nucleotides. These also work as compressed dinucleotides and form two base pairs with cognate nucleobases on the opposite strand....

AVE bond index in the H-bond of the Watson-Crick pairs

International Nuclear Information System (INIS)

Giambiagi, M.; Giambiagi, M.S. de; Barroso Filho, W.

1981-01-01

The normal Watson-Crick base pairs are treated as super-molecules. The properties of the electronic distribution along the N-H...Y bonds are studied in an all-valence-electrons calculation, through a bond index formula devised for non-orthogonal basis. Eletronic density diagrams of the adenine-uracil base pair are analysed. (Auhor) [pt

Post-event human decision errors: operator action tree/time reliability correlation

International Nuclear Information System (INIS)

Hall, R.E.; Fragola, J.; Wreathall, J.

1982-11-01

This report documents an interim framework for the quantification of the probability of errors of decision on the part of nuclear power plant operators after the initiation of an accident. The framework can easily be incorporated into an event tree/fault tree analysis. The method presented consists of a structure called the operator action tree and a time reliability correlation which assumes the time available for making a decision to be the dominating factor in situations requiring cognitive human response. This limited approach decreases the magnitude and complexity of the decision modeling task. Specifically, in the past, some human performance models have attempted prediction by trying to emulate sequences of human actions, or by identifying and modeling the information processing approach applicable to the task. The model developed here is directed at describing the statistical performance of a representative group of hypothetical individuals responding to generalized situations

Post-event human decision errors: operator action tree/time reliability correlation

Energy Technology Data Exchange (ETDEWEB)

Hall, R E; Fragola, J; Wreathall, J

1982-11-01

This report documents an interim framework for the quantification of the probability of errors of decision on the part of nuclear power plant operators after the initiation of an accident. The framework can easily be incorporated into an event tree/fault tree analysis. The method presented consists of a structure called the operator action tree and a time reliability correlation which assumes the time available for making a decision to be the dominating factor in situations requiring cognitive human response. This limited approach decreases the magnitude and complexity of the decision modeling task. Specifically, in the past, some human performance models have attempted prediction by trying to emulate sequences of human actions, or by identifying and modeling the information processing approach applicable to the task. The model developed here is directed at describing the statistical performance of a representative group of hypothetical individuals responding to generalized situations.

Artificial intelligence in neurodegenerative disease research: use of IBM Watson to identify additional RNA-binding proteins altered in amyotrophic lateral sclerosis.

Science.gov (United States)

Bakkar, Nadine; Kovalik, Tina; Lorenzini, Ileana; Spangler, Scott; Lacoste, Alix; Sponaugle, Kyle; Ferrante, Philip; Argentinis, Elenee; Sattler, Rita; Bowser, Robert

2018-02-01

Amyotrophic lateral sclerosis (ALS) is a devastating neurodegenerative disease with no effective treatments. Numerous RNA-binding proteins (RBPs) have been shown to be altered in ALS, with mutations in 11 RBPs causing familial forms of the disease, and 6 more RBPs showing abnormal expression/distribution in ALS albeit without any known mutations. RBP dysregulation is widely accepted as a contributing factor in ALS pathobiology. There are at least 1542 RBPs in the human genome; therefore, other unidentified RBPs may also be linked to the pathogenesis of ALS. We used IBM Watson ® to sieve through all RBPs in the genome and identify new RBPs linked to ALS (ALS-RBPs). IBM Watson extracted features from published literature to create semantic similarities and identify new connections between entities of interest. IBM Watson analyzed all published abstracts of previously known ALS-RBPs, and applied that text-based knowledge to all RBPs in the genome, ranking them by semantic similarity to the known set. We then validated the Watson top-ten-ranked RBPs at the protein and RNA levels in tissues from ALS and non-neurological disease controls, as well as in patient-derived induced pluripotent stem cells. 5 RBPs previously unlinked to ALS, hnRNPU, Syncrip, RBMS3, Caprin-1 and NUPL2, showed significant alterations in ALS compared to controls. Overall, we successfully used IBM Watson to help identify additional RBPs altered in ALS, highlighting the use of artificial intelligence tools to accelerate scientific discovery in ALS and possibly other complex neurological disorders.

Decision-Tree Models of Categorization Response Times, Choice Proportions, and Typicality Judgments

Science.gov (United States)

Lafond, Daniel; Lacouture, Yves; Cohen, Andrew L.

2009-01-01

The authors present 3 decision-tree models of categorization adapted from T. Trabasso, H. Rollins, and E. Shaughnessy (1971) and use them to provide a quantitative account of categorization response times, choice proportions, and typicality judgments at the individual-participant level. In Experiment 1, the decision-tree models were fit to…

Hazardous Waste Cleanup: IBM Corporation-TJ Watson Research Center in Yorktown Heights, New York

Science.gov (United States)

IBM Corporation -TJ Watson Research Center is located in southern Yorktown near the boundary separating the Town of Yorktown from the Town of New Castle. The site occupies an area of approximately 217 acres and adjoins land uses are predominantly residenti

The circumstances of the missing biographer or why Watson didn't narrate these four Sherlock Holmes stories.

Science.gov (United States)

Caplan, R M

1982-06-01

The author provides arguments to explain why four of Arthur Conan Doyle's sixty stories about Sherlock Holmes were not narrated by Dr. Watson. The arguments relate to logical demands of the plot in the cases of the two stories told by an unidentified narrator. The two told by Holmes seem to demand Watson's absence because the final elucidation requires skill in cutaneous diagnosis; the presence of a medical man would have, or should have, relieved the dramatic tension of the mystery too soon. The Sherlock Holmes stories can provide delightful diversion as well as serve constantly to enhance our appreciation for highly alert and careful physical examination.

Time lags between crown and basal sap flows in tropical lianas and co-occurring trees.

Science.gov (United States)

Chen, Ya-Jun; Bongers, Frans; Tomlinson, Kyle; Fan, Ze-Xin; Lin, Hua; Zhang, Shu-Bin; Zheng, Yu-Long; Li, Yang-Ping; Cao, Kun-Fang; Zhang, Jiao-Lin

2016-06-01

Water storage in the stems of woody plants contributes to their responses to short-term water shortages. To estimate the contribution of water storage to the daily water budget of trees, time lags of sap flow between different positions of trunk are used as a proxy of stem water storage. In lianas, another large group of woody species, it has rarely been studied whether stored water functions in their daily water use, despite their increasing roles in the carbon and water dynamics of tropical forests caused by their increasing abundance. We hypothesized that lianas would exhibit large time lags due to their extremely long stems, wide vessels and large volume of parenchyma in the stem. We examined time lags in sap flow, diel changes of stem volumetric water content (VWC) and biophysical properties of sapwood of 19 lianas and 26 co-occurring trees from 27 species in 4 forests (karst, tropical seasonal, flood plain and savanna) during a wet season. The plants varied in height/length from 60 m. The results showed that lianas had significantly higher saturated water content (SWC) and much lower wood density than trees. Seven of 19 liana individuals had no time lags; in contrast, only 3 of 26 tree individuals had no time lags. In general, lianas had shorter time lags than trees in our data set, but this difference was not significant for our most conservative analyses. Across trees and lianas, time lag duration increased with diurnal maximum changeable VWC but was independent of the body size, path length, wood density and SWC. The results suggest that in most lianas, internal stem water storage contributes little to daily water budget, while trees may rely more on stored water in the stem. © The Author 2015. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

Hydration of Watson-Crick base pairs and dehydration of Hoogsteen base pairs inducing structural polymorphism under molecular crowding conditions.

Science.gov (United States)

Miyoshi, Daisuke; Nakamura, Kaori; Tateishi-Karimata, Hisae; Ohmichi, Tatsuo; Sugimoto, Naoki

2009-03-18

It has been revealed recently that molecular crowding, which is one of the largest differences between in vivo and in vitro conditions, is a critical factor determining the structure, stability, and function of nucleic acids. However, the effects of molecular crowding on Watson-Crick and Hoogsteen base pairs remain unclear. In order to investigate directly and quantitatively the molecular crowding effects on base pair types in nucleic acids, we designed intramolecular parallel- and antiparallel-stranded DNA duplexes consisting of Hoogsteen and Watson-Crick base pairs, respectively, as well as an intramolecular parallel-stranded triplex containing both types of base pairs. Thermodynamic analyses demonstrated that the values of free energy change at 25 degrees C for Hoogsteen base-pair formations decreased from +1.45 +/- 0.15 to +1.09 +/- 0.13 kcal mol(-1), and from -1.89 +/- 0.13 to -2.71 +/- 0.11 kcal mol(-1) in the intramolecular duplex and triplex, respectively, when the concentration of PEG 200 (polyethylene glycol with average molecular weight 200) increased from 0 to 20 wt %. However, corresponding values for Watson-Crick formation in the duplex and triplex increased from -10.2 +/- 0.2 to -8.7 +/- 0.1 kcal mol(-1), and from -10.8 +/- 0.2 to -9.2 +/- 0.2 kcal mol(-1), respectively. Furthermore, it was revealed that the opposing effects of molecular crowding on the Hoogsteen and Watson-Crick base pairs were due to different behaviors of water molecules binding to the DNA strands.

Silver(I)-Mediated Base Pairs in DNA Sequences Containing 7-Deazaguanine/Cytosine: towards DNA with Entirely Metallated Watson-Crick Base Pairs.

Science.gov (United States)

Méndez-Arriaga, José M; Maldonado, Carmen R; Dobado, José A; Galindo, Miguel A

2018-03-26

DNA sequences comprising noncanonical 7-deazaguanine ( 7C G) and canonical cytosine (C) are capable of forming Watson-Crick base pairs via hydrogen bonds as well as silver(I)-mediated base pairs by coordination to central silver(I) ions. Duplexes I and II containing 7C G and C have been synthesized and characterized. The incorporation of silver(I) ions into these duplexes has been studied by means of temperature-dependent UV spectroscopy, circular dichroism, and DFT calculations. The results suggest the formation of DNA molecules comprising contiguous metallated 7C G-Ag I -C Watson-Crick base pairs that preserve the original B-type conformation. Furthermore, additional studies performed on duplex III indicated that, in the presence of Ag I ions, 7C G-C and 7C A-T Watson-Crick base pairs ( 7C A, 7-deazadenine; T, thymine) can be converted to metallated 7C G-Ag I -C and 7C A-Ag I -T base pairs inside the same DNA molecule whilst maintaining its initial double helix conformation. These findings are very important for the development of customized silver-DNA nanostructures based on a Watson-Crick complementarity pattern. © 2018 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

The Watson-Glaser Critical Thinking Appraisal and the Performance of Business Management Students.

Science.gov (United States)

Hicks, R. E.; Southey, G. N.

1990-01-01

The 80-item Watson-Glaser Critical Thinking Appraisal-Form A was administered to 415 business management students in Australia as a step toward adapting the test for Australian use. The results correspond reasonably closely to the U.S. data. Analysis of group results and item statistics provided information about necessary modifications. (SLD)

Quasi-four-particle first-order Faddeev-Watson-Lovelace terms in proton-helium scattering

Science.gov (United States)

Safarzade, Zohre; Akbarabadi, Farideh Shojaei; Fathi, Reza; Brunger, Michael J.; Bolorizadeh, Mohammad A.

2017-06-01

The Faddeev-Watson-Lovelace equations, which are typically used for solving three-particle scattering problems, are based on the assumption of target having one active electron while the other electrons remain passive during the collision process. So, in the case of protons scattering from helium or helium-like targets, in which there are two bound-state electrons, the passive electron has a static role in the collision channel to be studied. In this work, we intend to assign a dynamic role to all the target electrons, as they are physically active in the collision. By including an active role for the second electron in proton-helium-like collisions, a new form of the Faddeev-Watson-Lovelace integral equations is needed, in which there is no disconnected kernel. We consider the operators and the wave functions associated with the electrons to obey the Pauli exclusion principle, as the electrons are indistinguishable. In addition, a quasi-three-particle collision is assumed in the initial channel, where the electronic cloud is represented as a single identity in the collision.

Stability of non-Watson-Crick G-A/A-G base pair in synthetic DNA and RNA oligonucleotides.

Science.gov (United States)

Ito, Yuko; Sone, Yumiko; Mizutani, Takaharu

2004-03-01

A non-Watson-Crick G-A/A-G base pair is found in SECIS (selenocysteine-insertion sequence) element in the 3'-untranslated region of Se-protein mRNAs and in the functional site of the hammerhead ribozyme. We studied the stability of G-A/A-G base pair (bold) in 17mer GT(U)GACGGAAACCGGAAC synthetic DNA and RNA oligonucleotides by thermal melting experiments and gel electrophoresis. The measured Tm value of DNA oligonucleotide having G-A/A-G pair showed an intermediate value (58 degrees C) between that of Watson-Crick G-C/C-G base pair (75 degrees C) and that of G-G/A-A of non-base-pair (40 degrees C). Similar thermal melting patterns were obtained with RNA oligonucleotides. This result indicates that the secondary structure of oligonucleotide having G-A/A-G base pair is looser than that of the G-C type Watson-Crick base pair. In the comparison between RNA and DNA having G-A/A-G base pair, the Tm value of the RNA oligonucleotide was 11 degrees C lower than that of DNA, indicating that DNA has a more rigid structure than RNA. The stained pattern of oligonucleotide on polyacrylamide gel clarified that the mobility of the DNA oligonucleotide G-A/A-G base pair changed according to the urea concentration from the rigid state (near the mobility of G-C/C-G oligonucleotide) in the absence of urea to the random state (near the mobility of G-G/A-A oligonucleotide) in 7 M urea. However, the RNA oligonucleotide with G-A/A-G pair moved at an intermediate mobility between that of oligonucleotide with G-C/C-G and of the oligonucleotide with G-G/A-A, and the mobility pattern did not depend on urea concentration. Thus, DNA and RNA oligonucleotides with the G-A/A-G base pair showed a pattern indicating an intermediate structure between the rigid Watson-Crick base pair and the random structure of non-base pair. RNA with G-A/A-G base pair has the intermediate structure not influenced by urea concentration. Finally, this study indicated that the intermediate rigidity imparted by Non-Watson

The McLean-Watson line strength formula and its implementation

International Nuclear Information System (INIS)

Hey, J D

2009-01-01

We consider the application of the line strength formula recently derived by Watson (2006 J. Phys. B: At. Mol. Opt. Phys. 39 L291) to transitions between states of high principal quantum number in hydrogenic atoms and ions (Rydberg-Rydberg transitions). Apparent difficulties in the implementation of this formula are overcome by the use of recurrence relations derived by the ladder operator technique of Infeld and Hull (1951 Rev. Mod. Phys. 23 21), and set out in an earlier paper by the present author (2006 J. Phys. B: At. Mol. Opt. Phys. 39 2641). The use of the McLean-Watson formula for such cases is illustrated by the determination of the radiative lifetimes for levels with n ∼ 1000 and comparison of present results with approximate formulae. Interest in this work on the radial matrix elements for large n and n' is related both to measurements of radio recombination lines from tenuous space plasmas, e.g. Stepkin et al (2007 Mon. Not. R. Astron. Soc. 374 852) and to the calculation of Stark broadening for such spectra, e.g. Gigosos et al (2007 Astron. Astrophys. 466 1189), Stambulchik et al (2007 Phys. Rev. E 75 016401) and Stambulchik and Maron (2008 J. Phys. B: At. Mol. Opt. Phys. 41 095703). In addition, we discuss the question of inaccuracy caused by the omission of fine structure in such calculations, and the numerical stability of the recurrence relations used to implement the line strength formulae.

[Analysis of Conformational Features of Watson-Crick Duplex Fragments by Molecular Mechanics and Quantum Mechanics Methods].

Science.gov (United States)

Poltev, V I; Anisimov, V M; Sanchez, C; Deriabina, A; Gonzalez, E; Garcia, D; Rivas, F; Polteva, N A

2016-01-01

It is generally accepted that the important characteristic features of the Watson-Crick duplex originate from the molecular structure of its subunits. However, it still remains to elucidate what properties of each subunit are responsible for the significant characteristic features of the DNA structure. The computations of desoxydinucleoside monophosphates complexes with Na-ions using density functional theory revealed a pivotal role of DNA conformational properties of single-chain minimal fragments in the development of unique features of the Watson-Crick duplex. We found that directionality of the sugar-phosphate backbone and the preferable ranges of its torsion angles, combined with the difference between purines and pyrimidines. in ring bases, define the dependence of three-dimensional structure of the Watson-Crick duplex on nucleotide base sequence. In this work, we extended these density functional theory computations to the minimal' fragments of DNA duplex, complementary desoxydinucleoside monophosphates complexes with Na-ions. Using several computational methods and various functionals, we performed a search for energy minima of BI-conformation for complementary desoxydinucleoside monophosphates complexes with different nucleoside sequences. Two sequences are optimized using ab initio method at the MP2/6-31++G** level of theory. The analysis of torsion angles, sugar ring puckering and mutual base positions of optimized structures demonstrates that the conformational characteristic features of complementary desoxydinucleoside monophosphates complexes with Na-ions remain within BI ranges and become closer to the corresponding characteristic features of the Watson-Crick duplex crystals. Qualitatively, the main characteristic features of each studied complementary desoxydinucleoside monophosphates complex remain invariant when different computational methods are used, although the quantitative values of some conformational parameters could vary lying within the

A sub-cubic time algorithm for computing the quartet distance between two general trees

DEFF Research Database (Denmark)

Nielsen, Jesper; Kristensen, Anders Kabell; Mailund, Thomas

2011-01-01

Background When inferring phylogenetic trees different algorithms may give different trees. To study such effects a measure for the distance between two trees is useful. Quartet distance is one such measure, and is the number of quartet topologies that differ between two trees. Results We have...... derived a new algorithm for computing the quartet distance between a pair of general trees, i.e. trees where inner nodes can have any degree ≥ 3. The time and space complexity of our algorithm is sub-cubic in the number of leaves and does not depend on the degree of the inner nodes. This makes...... it the fastest algorithm so far for computing the quartet distance between general trees independent of the degree of the inner nodes. Conclusions We have implemented our algorithm and two of the best competitors. Our new algorithm is significantly faster than the competition and seems to run in close...

Canopy seed banks as time capsules of biodiversity in pasture-remnant tree crowns.

Science.gov (United States)

Nadkarni, Nalini M; Haber, Willam A

2009-10-01

Tropical pastures present multiple barriers to tree regeneration and restoration. Relict trees serve as "regeneration foci" because they ameliorate the soil microclimate and serve as safe spots for dispersers. Here, we describe another mechanism by which remnant trees may facilitate pasture regeneration: the presence of seed banks in the canopy soil that accumulates from decomposing epiphytes within the crowns of mature remnant trees in tropical cloud forest pastures. We compared seed banks of canopy soils (histosols derived from fallen leaves, fruits, flower, and twigs of host trees and epiphytes, dead bryophytes, bark, detritus, dead animals, and microorganisms, and dust that accumulate on trunks and the upper surfaces of large branches) in pastures, canopy soils in primary forest trees, and soil on the forest floor in Monteverde, Costa Rica. There were 5211 epiphytic and terrestrial plant seeds in the three habitats. All habitats were dominated by seeds in a relatively small number of plant families, most of which were primarily woody, animal pollinated, and animal dispersed. The density of seeds on the forest floor was greater than seed density in either pasture-canopy or forest-canopy soils; the latter two did not differ. Eight species in 44 families and 61 genera from all of the habitats were tallied. There were 37 species in the pasture-canopy soil, 33 in the forest-canopy soil, and 57 on the forest floor. Eleven species were common to all habitats. The mean species richness in the pasture canopy was significantly higher than the forest canopy (F =83.38; p banks of pasture trees can function as time capsules by providing propagules that are removed in both space and time from the primary forest. Their presence may enhance the ability of pastures to regenerate more quickly, reinforcing the importance of trees in agricultural settings.

Flouting maxim by sherlock holmes and dr. Watson in tv series Of sherlock season

Directory of Open Access Journals (Sweden)

Lina Affifatusholihah

2017-04-01

In running daily activities, people will always meet and interact with other people, and language is a medium that is used by humans to interact with each other. In a conversation or discussion, everyone should pay attention to the four maxims in order that there are no errors in communication. However, it is not uncommon that the four rules above are breached by the speakers. This is called non-observance of the maxims, and one of a non-observance of the maxims that often occurs in is flouting maxim. The aims of this paper are to describe types of maxims that are flouted by Sherlock Holmes and dr. Watson as well as to describe how the maxims are flouted in Sherlock TV series season 1. This research used qualitative descriptive method. The researcher classifies the utterances to know what kind of maxim which are flouted, categorizes those into the category based on the Grice’s theory of Cooperative Principle, namely: maxim of quantity, quality, relation and manner. The research procedure begin by searching the script in the internet, matching the utterances in the script and in film and sorting the utterances between Sherlock Holmes and dr. Watson as well observing every word or sentence which are flouted by the main characters. The findings find that all kinds of maxims are flouted by Sherlock and dr. Watson. The result of analysis shows that the maxim flouted when the speakers say something irrelevant; something roguishness or lied to hide the truth in the form of rhetorical question; the information becomes more or too informative than what is required; and something obscurity of expression, ambiguity, or unnecessary prolixity.

James Watson's most inconvenient truth: race realism and the moralistic fallacy.

Science.gov (United States)

Rushton, J Philippe; Jensen, Arthur R

2008-11-01

Recent editorials in this journal have defended the right of eminent biologist James Watson to raise the unpopular hypothesis that people of sub-Saharan African descent score lower, on average, than people of European or East Asian descent on tests of general intelligence. As those editorials imply, the scientific evidence is substantial in showing a genetic contribution to these differences. The unjustified ill treatment meted out to Watson therefore requires setting the record straight about the current state of the evidence on intelligence, race, and genetics. In this paper, we summarize our own previous reviews based on 10 categories of evidence: The worldwide distribution of test scores; the g factor of mental ability; heritability differences; brain size differences; trans-racial adoption studies; racial admixture studies; regression-to-the-mean effects; related life-history traits; human origins research; and the poverty of predictions from culture-only explanations. The preponderance of evidence demonstrates that in intelligence, brain size, and other life-history variables, East Asians average a higher IQ and larger brain than Europeans who average a higher IQ and larger brain than Africans. Further, these group differences are 50-80% heritable. These are facts, not opinions and science must be governed by data. There is no place for the "moralistic fallacy" that reality must conform to our social, political, or ethical desires.

A practical O(n log2 n) time algorithm for computing the triplet distance on binary trees

DEFF Research Database (Denmark)

Sand, Andreas; Pedersen, Christian Nørgaard Storm; Mailund, Thomas

2013-01-01

rooted binary trees in time O (n log2 n). The algorithm is related to an algorithm for computing the quartet distance between two unrooted binary trees in time O (n log n). While the quartet distance algorithm has a very severe overhead in the asymptotic time complexity that makes it impractical compared......The triplet distance is a distance measure that compares two rooted trees on the same set of leaves by enumerating all sub-sets of three leaves and counting how often the induced topologies of the tree are equal or different. We present an algorithm that computes the triplet distance between two...

Human DNA primase uses Watson-Crick hydrogen bonds to distinguish between correct and incorrect nucleoside triphosphates.

Science.gov (United States)

Moore, Chad L; Zivkovic, Aleksandra; Engels, Joachim W; Kuchta, Robert D

2004-09-28

Human DNA primase synthesizes short RNA primers that DNA polymerase alpha further elongates. Primase readily misincorporates the natural NTPs and will generate a wide variety of mismatches. In contrast, primase exhibited a remarkable resistance to polymerizing NTPs containing unnatural bases. This included bases whose shape was almost identical to the natural bases (4-aminobenzimidazole and 4,6-difluorobenzimidazole), bases shaped very differently than a natural base [e.g., 5- and 6-(trifluoromethyl)benzimidazole], bases much more hydrophobic than a natural base [e.g., 4- and 7-(trifluoromethyl)benzimidazole], bases of similar hydrophobicity as a natural base but with the Watson-Crick hydrogen-bonding groups in unusual positions (7-beta-D-guanine), and bases capable of forming only one Watson-Crick hydrogen bond with the template base (purine and 4-aminobenzimidazole). Primase only polymerized NTP analogues containing bases capable of forming hydrogen bonds between the equivalent of both N-1 and the exocyclic group at C-6 of a purine NTP (2-fluoroadenine, 2-chloroadenine, 3-deazaadenine, and hypoxanthine) and N-3 and the exocyclic group at C-4 of a pyrimidine. These data indicate that human primase requires the formation of Watson-Crick hydrogen bonds in order to polymerize a NTP, a situation very different than what is observed with some DNA polymerases. The implications of these results with respect to current theories of how polymerases discriminate between right and wrong (d)NTPs are discussed.

Automatic Determination of the Need for Intravenous Contrast in Musculoskeletal MRI Examinations Using IBM Watson's Natural Language Processing Algorithm.

Science.gov (United States)

Trivedi, Hari; Mesterhazy, Joseph; Laguna, Benjamin; Vu, Thienkhai; Sohn, Jae Ho

2018-04-01

Magnetic resonance imaging (MRI) protocoling can be time- and resource-intensive, and protocols can often be suboptimal dependent upon the expertise or preferences of the protocoling radiologist. Providing a best-practice recommendation for an MRI protocol has the potential to improve efficiency and decrease the likelihood of a suboptimal or erroneous study. The goal of this study was to develop and validate a machine learning-based natural language classifier that can automatically assign the use of intravenous contrast for musculoskeletal MRI protocols based upon the free-text clinical indication of the study, thereby improving efficiency of the protocoling radiologist and potentially decreasing errors. We utilized a deep learning-based natural language classification system from IBM Watson, a question-answering supercomputer that gained fame after challenging the best human players on Jeopardy! in 2011. We compared this solution to a series of traditional machine learning-based natural language processing techniques that utilize a term-document frequency matrix. Each classifier was trained with 1240 MRI protocols plus their respective clinical indications and validated with a test set of 280. Ground truth of contrast assignment was obtained from the clinical record. For evaluation of inter-reader agreement, a blinded second reader radiologist analyzed all cases and determined contrast assignment based on only the free-text clinical indication. In the test set, Watson demonstrated overall accuracy of 83.2% when compared to the original protocol. This was similar to the overall accuracy of 80.2% achieved by an ensemble of eight traditional machine learning algorithms based on a term-document matrix. When compared to the second reader's contrast assignment, Watson achieved 88.6% agreement. When evaluating only the subset of cases where the original protocol and second reader were concordant (n = 251), agreement climbed further to 90.0%. The classifier was

Crystal structure of an intermolecular 2:1 complex between adenine and thymine. Evidence for both Hoogsteen and 'quasi-Watson-Crick' interactions.

Science.gov (United States)

Chandrasekhar, Sosale; Naik, Tangali R Ravikumar; Nayak, Susanta K; Row, Tayur N Guru

2010-06-15

The titled complex, obtained by co-crystallization (EtOH/25 degrees C), is apparently the only known complex of the free bases. Its crystal structure, as determined by X-ray diffraction at both 90 K and 313 K, showed that one A-T pair involves a Hoogsteen interaction, and the other a Watson-Crick interaction but only with respect to the adenine unit. The absence of a clear-cut Watson-Crick base pair raises intriguing questions about the basis of the DNA double helix. Copyright 2010 Elsevier Ltd. All rights reserved.

Water-Stressed Loquat Trees Need More Time and Heat to Ripen Their Fruits

Directory of Open Access Journals (Sweden)

Julián Cuevas

2018-06-01

Full Text Available To determine if water-stressed trees need more time and heat to mature their fruits, we compared chronological and thermal time from bloom to harvest among control fully-irrigated ‘Algerie’ loquat trees and trees suffering prior-to-bloom deficit irrigation (DI. Heat requirement calculation was performed using the double sine method with a lower threshold temperature of 3 °C. The results show that the greater the blooming advancement achieved by DI, the longer the period to mature the fruits. Such a pattern indicates that the longer duration for bloom-harvest period under DI is due to a displacement of the reproductive phenology to cooler dates. However, some effects of DI on heat requirements for ripening persist, indicating a slower fruit development in some, but not all, DI treatments. The differences in fruit development rate between fully-irrigated and water-stressed trees were established during the phase of rapid fruit growth. The comparison of water stress effects on sink (flower size and seed number and source (leaf number and size, gas exchange and mineral and carbohydrate nutrition of DI treatments seems to indicate that the amount of stored reserves in the leaves to sustain early fruit development is the most plausible reason behind the increase in thermal time between bloom and harvest in water-stressed loquats.

Substituent effif ects on hydrogen bonding in Watson-Crick base pairs. A theoretical study

NARCIS (Netherlands)

Fonseca Guerra, C.; van der Wijst, T.; Bickelhaupt, F.M.

2005-01-01

We have theoretically analyzed Watson-Crick AT and GC base pairs in which purine C8 and/or pyrimidine C6 positions carry a substituent X = H, F, Cl or Br, using the generalized gradient approximation (GGA) of density functional theory at BP86/TZ2P. The purpose is to study the effects on structure

The Towers Watson Approach to Improving Corporate Wellness.

Science.gov (United States)

Wootton, Adam

2012-06-01

Encouraging employees to take care of their health is in the interests of everyone. Employees benefit from being healthier and happier, employers benefit from having an engaged workforce, lower absenteeism, and lower medical costs, and society as a whole benefits from using less medical resources. Employers have been trying to push healthy messages to employees for a long time and have had some good success. For example, an increased emphasis on the dangers of tobacco use in employer and government communications has helped bring about a significant decrease in smoking. However, overall population health in key risk areas (such as obesity and diabetes) continues to decline. These areas are where employers can really make a difference in health outcomes-and effective communications are critical to success. Towers Watson helps many companies educate employees about health and wellness and encourage more effective use of healthcare. The challenge is to find new and engaging ways to deliver this information so that employees take notice-and take action. After all, the amount of material employees receive on a daily basis from marketers, employers, and each other across the wide range of available media makes it extremely difficult to be heard. This is where gaming comes in-and why we think it's the tool to be incorporating into communication and engagement plans.

Modelling effects of tree population dynamics, tree throw and pit-mound formation/diffusion on microtopography over time in different forest settings

Science.gov (United States)

Martin, Y. E.; Johnson, E. A.; Gallaway, J.; Chaikina, O.

2011-12-01

Herein we conduct a followup investigation to an earlier research project in which we developed a numerical model of tree population dynamics, tree throw, and sediment transport associated with the formation of pit-mound features for Hawk Creek watershed, Canadian Rockies (Gallaway et al., 2009). We extend this earlier work by exploring the most appropriate transport relations to simulate the diffusion over time of newly-formed pit-pound features due to tree throw. We combine our earlier model with a landscape development model that can incorporate these diffusive transport relations. Using these combined models, changes in hillslope microtopography over time associated with the formation of pit-mound features and their decay will be investigated. The following ideas have motivated this particular study: (i) Rates of pit-mound degradation remain a source of almost complete speculation, as there is almost no long-term information on process rates. Therefore, we will attempt to tackle the issue of pit-mound degradation in a methodical way that can guide future field studies; (ii) The degree of visible pit-mound topography at any point in time on the landscape is a joint function of the rate of formation of new pit-mound features due to tree death/topple and their magnitude vs. the rate of decay of pit-mound features. An example of one interesting observation that arises is the following: it appears that pit-mound topography is often more pronounced in some eastern North American forests vs. field sites along the eastern slopes of the Canadian Rockies. Why is this the case? Our investigation begins by considering whether pit-mound decay might occur by linear or nonlinear diffusion. What differences might arise depending on which diffusive approach is adopted? What is the magnitude of transport rates associated with these possible forms of transport relations? We explore linear and nonlinear diffusion at varying rates and for different sizes of pit-mound pairs using a

Trends over time in tree and seedling phylogenetic diversity indicate regional differences in forest biodiversity change

Science.gov (United States)

Kevin M. Potter; Christopher W. Woodall

2012-01-01

Changing climate conditions may impact the short-term ability of forest tree species to regenerate in many locations. In the longer term, tree species may be unable to persist in some locations while they become established in new places. Over both time frames, forest tree biodiversity may change in unexpected ways. Using repeated inventory measurements five years...

A Stochastic Model for Malaria Transmission Dynamics

Directory of Open Access Journals (Sweden)

Rachel Waema Mbogo

2018-01-01

Full Text Available Malaria is one of the three most dangerous infectious diseases worldwide (along with HIV/AIDS and tuberculosis. In this paper we compare the disease dynamics of the deterministic and stochastic models in order to determine the effect of randomness in malaria transmission dynamics. Relationships between the basic reproduction number for malaria transmission dynamics between humans and mosquitoes and the extinction thresholds of corresponding continuous-time Markov chain models are derived under certain assumptions. The stochastic model is formulated using the continuous-time discrete state Galton-Watson branching process (CTDSGWbp. The reproduction number of deterministic models is an essential quantity to predict whether an epidemic will spread or die out. Thresholds for disease extinction from stochastic models contribute crucial knowledge on disease control and elimination and mitigation of infectious diseases. Analytical and numerical results show some significant differences in model predictions between the stochastic and deterministic models. In particular, we find that malaria outbreak is more likely if the disease is introduced by infected mosquitoes as opposed to infected humans. These insights demonstrate the importance of a policy or intervention focusing on controlling the infected mosquito population if the control of malaria is to be realized.

A Tree Based Broadcast Scheme for (m, k)-firm Real-Time Stream in Wireless Sensor Networks.

Science.gov (United States)

Park, HoSung; Kim, Beom-Su; Kim, Kyong Hoon; Shah, Babar; Kim, Ki-Il

2017-11-09

Recently, various unicast routing protocols have been proposed to deliver measured data from the sensor node to the sink node within the predetermined deadline in wireless sensor networks. In parallel with their approaches, some applications demand the specific service, which is based on broadcast to all nodes within the deadline, the feasible real-time traffic model and improvements in energy efficiency. However, current protocols based on either flooding or one-to-one unicast cannot meet the above requirements entirely. Moreover, as far as the authors know, there is no study for the real-time broadcast protocol to support the application-specific traffic model in WSN yet. Based on the above analysis, in this paper, we propose a new ( m , k )-firm-based Real-time Broadcast Protocol (FRBP) by constructing a broadcast tree to satisfy the ( m , k )-firm, which is applicable to the real-time model in resource-constrained WSNs. The broadcast tree in FRBP is constructed by the distance-based priority scheme, whereas energy efficiency is improved by selecting as few as nodes on a tree possible. To overcome the unstable network environment, the recovery scheme invokes rapid partial tree reconstruction in order to designate another node as the parent on a tree according to the measured ( m , k )-firm real-time condition and local states monitoring. Finally, simulation results are given to demonstrate the superiority of FRBP compared to the existing schemes in terms of average deadline missing ratio, average throughput and energy consumption.

What trees tell us about the climate of past times

International Nuclear Information System (INIS)

Graf, W.; Trimborn, P.; Stichler, W.

1999-01-01

The air temperatures in Central Europe have risen by approximately one degree centigrade since the last century. Climate models predict a further warming of the earth's atmosphere. The causes are still disputed. Most scientists attribute the rise in temperature to the increase in greenhouse gases in the earth's atmosphere. Others point out that the observed variations will probably not exceed the extent of the natural climate fluctuations that occurred during the Holocene period - the warm period that began approximately 11,000 years ago. Who is right? Palaeoclimatologists try to assess the natural variability of the climate, and to decide whether the 20th century is really unusual in comparison with the preceding millennia. There are various climate archives available for this. The Institute of Hydrology investigates fossilised trees. Fossilised trees store information about the climate in earlier times in, amongst others, cellulose: specifically in the ratios of the stable isotopes of carbon ( 13 C/ 12 C), hydrogen ( 2 H/ 1 H) and oxygen ( 18 O/ 16 O). As a result of the development of annual rings, the trees represent a climate archive with high temporal resolution. (orig.) [de

Mispairs with Watson-Crick base-pair geometry observed in ternary complexes of an RB69 DNA polymerase variant.

Science.gov (United States)

Xia, Shuangluo; Konigsberg, William H

2014-04-01

Recent structures of DNA polymerase complexes with dGMPCPP/dT and dCTP/dA mispairs at the insertion site have shown that they adopt Watson-Crick geometry in the presence of Mn(2+) indicating that the tautomeric or ionization state of the base has changed. To see whether the tautomeric or ionization state of base-pair could be affected by its microenvironment, we determined 10 structures of an RB69 DNA polymerase quadruple mutant with dG/dT or dT/dG mispairs at position n-1 to n-5 of the Primer/Template duplex. Different shapes of the mispairs, including Watson-Crick geometry, have been observed, strongly suggesting that the local environment of base-pairs plays an important role in their tautomeric or ionization states. © 2014 The Protein Society.

Aplicação da Teoria do Cuidado Transpessoal de Jean Watson: uma década de produção brasileira Aplicación de la Teoría del Cuidado Transpersonal de Jean Watson: una década de producción brasileña Jean Watson's Theory of Human Caring: a decade of Brazilian publications

Directory of Open Access Journals (Sweden)

Luciane Favero

2009-01-01

Full Text Available Esta revisão sistemática objetivou descrever e analisar a aplicação da Teoria do Cuidado Transpessoal de Jean Watson nas pesquisas divulgadas em publicações de Enfermagem brasileiras dos últimos dez anos. O levantamento bibliográfico abrangeu 34 produções científicas selecionadas nas bases de dados eletrônicas MEDLINE (MEDLARS [Medical Literature Analysis and Retrieval System] On-line, LILACS (Literatura Latino Americana e do Caribe em Ciências da Saúde, BDENF (Base de dados de Enfermagem e SciELO (Scientific Electronic Library On-line, que após aplicação dos critérios de inclusão estabelecidos, compuseram a amostra do estudo. Os resultados apontaram que a Região Sul concentra 61,8% das produções referidas ao tema de estudo, que ela pode ser aplicada nos níveis de atenção primária, secundária e terciária e que 64,7% das produções utilizam os fatores de cuidado propostos por Jean Watson em 1979. Emerge a necessidade de aprimoramento das pesquisas acerca da transformação ocorrida na Teoria do Cuidado Transpessoal, com abordagem do Processo Clinical Caritas, porém como são escassos os estudos referentes a esta temática, dificultam sua utilização prática.Esta revisión sistemática tuvo como objetivo describir y analizar la aplicación de la Teoría del Cuidado Transpersonal de Jean Watson en las investigaciones divulgadas en publicaciones de Enfermería brasileñas de los últimos diez años. El levantamiento bibliográfico abarcó 34 producciones seleccionadas en las bases de datos electrónicas MEDLINE (MEDLARS [Medical Literature Analysis and Retrieval System] On-line, LILACS (Literatura Latinoamericana y del Caribe en Ciencias de la Salud, BDENF (Base de datos de Enfermería y SciELO (Scientific Electronic Library On-line, que después de la aplicación de los criterios de inclusión establecidos, compusieron la muestra del estudio. Los resultados señalaron que la región Sur concentra el 61,8% de las

Dropout Rates and Response Times of an Occupation Search Tree in a Web Survey

Directory of Open Access Journals (Sweden)

Tijdens Kea

2014-03-01

Full Text Available Occupation is key in socioeconomic research. As in other survey modes, most web surveys use an open-ended question for occupation, though the absence of interviewers elicits unidentifiable or aggregated responses. Unlike other modes, web surveys can use a search tree with an occupation database. They are hardly ever used, but this may change due to technical advancements. This article evaluates a three-step search tree with 1,700 occupational titles, used in the 2010 multilingual WageIndicator web survey for UK, Belgium and Netherlands (22,990 observations. Dropout rates are high; in Step 1 due to unemployed respondents judging the question not to be adequate, and in Step 3 due to search tree item length. Median response times are substantial due to search tree item length, dropout in the next step and invalid occupations ticked. Overall the validity of the occupation data is rather good, 1.7-7.5% of the respondents completing the search tree have ticked an invalid occupation.

DNA polymerase catalysis in the absence of Watson-Crick hydrogen bonds

Science.gov (United States)

Potapova, Olga; Chan, Chikio; DeLucia, Angela M.; Helquist, Sandra A.; Kool, Eric T.; Grindley, Nigel D. F.; Joyce, Catherine M.

2008-01-01

We report the first pre-steady-state kinetic studies of DNA replication in the absence of hydrogen bonds. We have used nonpolar nucleotide analogues that mimic the shape of a Watson-Crick base pair in order to investigate the kinetic consequences of a lack of hydrogen bonds in the polymerase reaction catalyzed by the Klenow fragment of DNA Polymerase I from Escherichia coli. With a thymine isostere lacking hydrogen bonding ability in the nascent pair, the efficiency (kpol/Kd) of the polymerase reaction is decreased by 30-fold, affecting ground state (Kd) and transition state (kpol) approximately equally. When both thymine and adenine analogues in the nascent pair lack hydrogen bonding ability, the efficiency of the polymerase reaction is decreased by about 1000-fold, with most the decrease attributable to the transition state. Reactions using nonpolar analogues at the primer terminal base pair demonstrated the requirement for a hydrogen bond between the polymerase and the minor groove of the primer-terminal base. The R668A mutation of Klenow fragment abolished this requirement, identifying R668 as the probable hydrogen bond donor. Detailed examination of the kinetic data suggested that Klenow fragment has an extremely low tolerance of even minor deviations of the analogue base pairs from ideal Watson-Crick geometry. Consistent with this idea, some analogue pairings were better tolerated by Klenow fragment mutants having more spacious active sites. By contrast, the Y-family polymerase Dbh was much less sensitive to changes in base pair dimensions, and more dependent on hydrogen bonding between base-paired partners. PMID:16411765

Watson-Crick base pairs with thiocarbonyl groups: How sulfur changes the hydrogen bonds in DNA

NARCIS (Netherlands)

Fonseca Guerra, C.; Baerends, E.J.; Bickelhaupt, F.M.

2008-01-01

We have theoretically analyzed mimics of Watson-Crick AT and GC base pairs in which N-H•••O hydrogen bonds are replaced by N-H•••S, using the generalized gradient approximation (GGA) of density functional theory at BP86/TZ2P level. The general effect of the above substitutions is an elongation and a

Spatial, Hysteretic, and Adaptive Host-Guest Chemistry in a Metal-Organic Framework with Open Watson-Crick Sites.

Science.gov (United States)

Cai, Hong; Li, Mian; Lin, Xiao-Rong; Chen, Wei; Chen, Guang-Hui; Huang, Xiao-Chun; Li, Dan

2015-09-01

Biological and artificial molecules and assemblies capable of supramolecular recognition, especially those with nucleobase pairing, usually rely on autonomous or collective binding to function. Advanced site-specific recognition takes advantage of cooperative spatial effects, as in local folding in protein-DNA binding. Herein, we report a new nucleobase-tagged metal-organic framework (MOF), namely ZnBTCA (BTC=benzene-1,3,5-tricarboxyl, A=adenine), in which the exposed Watson-Crick faces of adenine residues are immobilized periodically on the interior crystalline surface. Systematic control experiments demonstrated the cooperation of the open Watson-Crick sites and spatial effects within the nanopores, and thermodynamic and kinetic studies revealed a hysteretic host-guest interaction attributed to mild chemisorption. We further exploited this behavior for adenine-thymine binding within the constrained pores, and a globally adaptive response of the MOF host was observed. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Automated reasoning with dynamic event trees: a real-time, knowledge-based decision aide

International Nuclear Information System (INIS)

Touchton, R.A.; Gunter, A.D.; Subramanyan, N.

1988-01-01

The models and data contained in a probabilistic risk assessment (PRA) Event Sequence Analysis represent a wealth of information that can be used for dynamic calculation of event sequence likelihood. In this paper we report a new and unique computerization methodology which utilizes these data. This sub-system (referred to as PREDICTOR) has been developed and tested as part of a larger system. PREDICTOR performs a real-time (re)calculation of the estimated likelihood of core-melt as a function of plant status. This methodology uses object-oriented programming techniques from the artificial intelligence discipline that enable one to codify event tree and fault tree logic models and associated probabilities developed in a PRA study. Existence of off-normal conditions is reported to PREDICTOR, which then updates the relevant failure probabilities throughout the event tree and fault tree models by dynamically replacing the off-the-shelf (or prior) probabilities with new probabilities based on the current situation. The new event probabilities are immediately propagated through the models (using 'demons') and an updated core-melt probability is calculated. Along the way, the dominant non-success path of each event tree is determined and highlighted. (author)

Bounds on Average Time Complexity of Decision Trees

KAUST Repository

Chikalov, Igor

2011-01-01

In this chapter, bounds on the average depth and the average weighted depth of decision trees are considered. Similar problems are studied in search theory [1], coding theory [77], design and analysis of algorithms (e.g., sorting) [38]. For any diagnostic problem, the minimum average depth of decision tree is bounded from below by the entropy of probability distribution (with a multiplier 1/log2 k for a problem over a k-valued information system). Among diagnostic problems, the problems with a complete set of attributes have the lowest minimum average depth of decision trees (e.g, the problem of building optimal prefix code [1] and a blood test study in assumption that exactly one patient is ill [23]). For such problems, the minimum average depth of decision tree exceeds the lower bound by at most one. The minimum average depth reaches the maximum on the problems in which each attribute is "indispensable" [44] (e.g., a diagnostic problem with n attributes and kn pairwise different rows in the decision table and the problem of implementing the modulo 2 summation function). These problems have the minimum average depth of decision tree equal to the number of attributes in the problem description. © Springer-Verlag Berlin Heidelberg 2011.

A Tree Based Broadcast Scheme for (m, k-firm Real-Time Stream in Wireless Sensor Networks

Directory of Open Access Journals (Sweden)

HoSung Park

2017-11-01

Full Text Available Recently, various unicast routing protocols have been proposed to deliver measured data from the sensor node to the sink node within the predetermined deadline in wireless sensor networks. In parallel with their approaches, some applications demand the specific service, which is based on broadcast to all nodes within the deadline, the feasible real-time traffic model and improvements in energy efficiency. However, current protocols based on either flooding or one-to-one unicast cannot meet the above requirements entirely. Moreover, as far as the authors know, there is no study for the real-time broadcast protocol to support the application-specific traffic model in WSN yet. Based on the above analysis, in this paper, we propose a new (m, k-firm-based Real-time Broadcast Protocol (FRBP by constructing a broadcast tree to satisfy the (m, k-firm, which is applicable to the real-time model in resource-constrained WSNs. The broadcast tree in FRBP is constructed by the distance-based priority scheme, whereas energy efficiency is improved by selecting as few as nodes on a tree possible. To overcome the unstable network environment, the recovery scheme invokes rapid partial tree reconstruction in order to designate another node as the parent on a tree according to the measured (m, k-firm real-time condition and local states monitoring. Finally, simulation results are given to demonstrate the superiority of FRBP compared to the existing schemes in terms of average deadline missing ratio, average throughput and energy consumption.

Fanconi anaemia and the repair of Watson and Crick DNA crosslinks.

Science.gov (United States)

Kottemann, Molly C; Smogorzewska, Agata

2013-01-17

The function of Fanconi anaemia proteins is to maintain genomic stability. Their main role is in the repair of DNA interstrand crosslinks, which, by covalently binding the Watson and the Crick strands of DNA, impede replication and transcription. Inappropriate repair of interstrand crosslinks causes genomic instability, leading to cancer; conversely, the toxicity of crosslinking agents makes them a powerful chemotherapeutic. Fanconi anaemia proteins can promote stem-cell function, prevent tumorigenesis, stabilize replication forks and inhibit inaccurate repair. Recent advances have identified endogenous aldehydes as possible culprits of DNA damage that may induce the phenotypes seen in patients with Fanconi anaemia.

Drawing non-layered tidy trees in linear time

NARCIS (Netherlands)

A.J. van der Ploeg (Atze)

2013-01-01

htmlabstractThe well-known Reingold–Tilford algorithm produces tidy-layered drawings of trees: drawings where all nodes at the same depth are vertically aligned. However, when nodes have varying heights, layered drawing may use more vertical space than necessary. A non-layered drawing of a tree

Visualizing Individual Tree Differences in Tree-Ring Studies

Directory of Open Access Journals (Sweden)

Mario Trouillier

2018-04-01

Full Text Available Averaging tree-ring measurements from multiple individuals is one of the most common procedures in dendrochronology. It serves to filter out noise from individual differences between trees, such as competition, height, and micro-site effects, which ideally results in a site chronology sensitive to regional scale factors such as climate. However, the climate sensitivity of individual trees can be modulated by factors like competition, height, and nitrogen deposition, calling attention to whether average chronologies adequately assess climatic growth-control. In this study, we demonstrate four simple but effective methods to visually assess differences between individual trees. Using individual tree climate-correlations we: (1 employed jitter plots with superimposed metadata to assess potential causes for these differences; (2 plotted the frequency distributions of climate correlations over time as heat maps; (3 mapped the spatial distribution of climate sensitivity over time to assess spatio-temporal dynamics; and (4 used t-distributed Stochastic Neighborhood Embedding (t-SNE to assess which trees were generally more similar in terms of their tree-ring pattern and their correlation with climate variables. This suite of exploratory methods can indicate if individuals in tree-ring datasets respond differently to climate variability, and therefore, should not solely be explored with climate correlations of the mean population chronology.

Los procesos de ramificación como instrumentos para el estudio de la fecundidad humana

Directory of Open Access Journals (Sweden)

Manuel Ordorica

2002-01-01

Full Text Available El objetivo de este trabajo es presentar un análisis de los cambios de la fecundidad observados en México a través de la Teoría de la Ramificación, desarrollada por Galton y Watson a finales del siglo XIX. Con esta técnica es posible calcular la probabilidad de extinción de una descendencia. Esta metodología estadística basada en el cálculo de probabilidades permite utilizar indicadores de la fecundidad derivados de los censos de población, según el orden de nacimiento, lo cual permite hacer un análisis diferente de esta variable al realizado hasta la fecha en nuestro país. Es posible analizar a qué número de hijas e hijos está tendiendo la población mexicana.

The critical domain size of stochastic population models.

Science.gov (United States)

Reimer, Jody R; Bonsall, Michael B; Maini, Philip K

2017-02-01

Identifying the critical domain size necessary for a population to persist is an important question in ecology. Both demographic and environmental stochasticity impact a population's ability to persist. Here we explore ways of including this variability. We study populations with distinct dispersal and sedentary stages, which have traditionally been modelled using a deterministic integrodifference equation (IDE) framework. Individual-based models (IBMs) are the most intuitive stochastic analogues to IDEs but yield few analytic insights. We explore two alternate approaches; one is a scaling up to the population level using the Central Limit Theorem, and the other a variation on both Galton-Watson branching processes and branching processes in random environments. These branching process models closely approximate the IBM and yield insight into the factors determining the critical domain size for a given population subject to stochasticity.

Branching processes in biology

CERN Document Server

Kimmel, Marek

2015-01-01

This book provides a theoretical background of branching processes and discusses their biological applications. Branching processes are a well-developed and powerful set of tools in the field of applied probability. The range of applications considered includes molecular biology, cellular biology, human evolution and medicine. The branching processes discussed include Galton-Watson, Markov, Bellman-Harris, Multitype, and General Processes. As an aid to understanding specific examples, two introductory chapters, and two glossaries are included that provide background material in mathematics and in biology. The book will be of interest to scientists who work in quantitative modeling of biological systems, particularly probabilists, mathematical biologists, biostatisticians, cell biologists, molecular biologists, and bioinformaticians. The authors are a mathematician and cell biologist who have collaborated for more than a decade in the field of branching processes in biology for this new edition. This second ex...

Assistência em Enfermagem e Jean Watson: Uma reflexão sobre a empatia

Directory of Open Access Journals (Sweden)

Roberta Maria Savieto

2016-03-01

Full Text Available Resumo Objetivo: Relacionar a empatia com a Teoria do Cuidado Humano, de Jean Watson, no contexto atual da Enfermagem. Métodos: Trata-se de um ensaio teórico-reflexivo que propõe uma discussão acerca da empatia e sua relação com a Teoria do Cuidado Humano, de Jean Watson, na prática contemporânea da Enfermagem. Resultado: É apresentado o processo Clinical Caritas e cada elemento de cuidado que o compõe visando propor e discutir as conexões com a empatia na assistência em Enfermagem. Torna-se imperioso aliar aspectos técnicos e humanísticos na oferta do cuidado de Enfermagem, além de resgatar a valorização da abordagem da empatia na formação de profissionais da saúde, bem como na continuidade dos estudos após a graduação. Conclusão: Entende-se que essa reflexão pode contribuir para a reorganização de ideias e conceitos sobre aprimoramentos essenciais que se mostram necessários à prática atual da Enfermagem, além de reforçar seu crescimento enquanto ciência.

Thermodynamic stability of Hoogsteen and Watson-Crick base pairs in the presence of histone H3-mimicking peptide.

Science.gov (United States)

Pramanik, Smritimoy; Nakamura, Kaori; Usui, Kenji; Nakano, Shu-ichi; Saxena, Sarika; Matsui, Jun; Miyoshi, Daisuke; Sugimoto, Naoki

2011-03-14

We found that Hoogsteen base pairs were stabilized by molecular crowding and a histone H3-mimicking peptide, which was not observed for Watson-Crick base pairs. Our findings demonstrate that the type of DNA base pair is critical for the interaction between DNA and histones.

Variation in content of macronutrients of guava tree leaves, in function of type and time of storage

Directory of Open Access Journals (Sweden)

Henrique Antunes de Souza

2010-10-01

Full Text Available Leaf analysis for perennial crops such as the guava tree is an important tool. It was used to evaluate the influence of the type of packaging (with or without refrigerator and storage time after collection on the macronutrient composition of guava tree leaves. The leaf sampling was carried out on a commercial guava tree (cv. Paluma, collecting the third pair of recently matured leaves in full bloom. The experimental design was in randomized blocks, subdivided according to the type of packaging (with or without refrigerator and further subdivided into eight storage times before washing (zero, 6, 12, 24, 48, 72, 96 and 168h after sampling, with four replications. The storage time significantly affected the concentration of leaf nitrogen, calcium and sulfur. Moreover, the type and time of conditioning (with or without refrigerator affected only the magnesium. In general, storage fot up to 12h before washing produced no significant changes in the levels of macronutrients.

Variation in content of macronutrients of guava tree leaves, in function of type and time of storage

Directory of Open Access Journals (Sweden)

Henrique Antunes de Souza

2010-09-01

Full Text Available Leaf analysis for perennial crops such as the guava tree is an important tool. It was used to evaluate the influence of the type of packaging (with or without refrigerator and storage time after collection on the macronutrient composition of guava tree leaves. The leaf sampling was carried out on a commercial guava tree (cv. Paluma, collecting the third pair of recently matured leaves in full bloom. The experimental design was in randomized blocks, subdivided according to the type of packaging (with or without refrigerator and further subdivided into eight storage times before washing (zero, 6, 12, 24, 48, 72, 96 and 168h after sampling, with four replications. The storage time significantly affected the concentration of leaf nitrogen, calcium and sulfur. Moreover, the type and time of conditioning (with or without refrigerator affected only the magnesium. In general, storage fot up to 12h before washing produced no significant changes in the levels of macronutrients.

Non-Watson-Crick structures in oligodeoxynucleotides: Self-association of d(TpCpGpA) stabilized at acidic pH

International Nuclear Information System (INIS)

Topping, R.J.; Stone, M.P.; Brush, C.K.; Harris, T.M.

1988-01-01

The 1 H NMR spectrum of the tetradeoxynucleotide d(TpCpGpA) was examined as a function of temperature, pH, and concentration. At pH 7 and above the solution conformation for this oligodeoxynucleotide appears to be a mixture of random coil and Watson-Crick duplex. At 25 degree C, a pH titration of d(TpCpGaA) shown that distinct conformational changes occur as the pH is lowered below 7.0. These conformational changes are reversible upon readjusting the pH to neutrality, indicating the presence of a pH-dependent set of conformational equilibria. At 25 degree C, the various conformational state in the mixture are in rapid exchange on the NMR time scale. Examination of the titration curve shown the presence of distinct conformational states at pH greater than 7, and between pH 4 and pH 5. When the pH titration is repeated at 5 degree C, the conformational equilibria are in slow exchange on the NMR time scale; distinct signals from each conformational state are observable. The stable conformational state present between pH 4 and pH 5 represents an ordered conformation of d(TpCpGpA) which dissociates to a less ordered structure upon raising the temperature. The ordered conformation differs from the Watson-Crick helix, as is shown from nuclear Overhauser enhancement experiments, as well as chemical shift data. These results indicate that their ordered conformation is similar to the conformation of d(TpCpGpA) observed between pH 4 and pH 5. In the present case it is likely that stabilization of an ordered duplex conformation for d(TpCpGpA) is achieved by protonation of cytosine. A possible model which could explain the data involves formation of Hoogsteen C + :G base pairs

Refining discordant gene trees.

Science.gov (United States)

Górecki, Pawel; Eulenstein, Oliver

2014-01-01

Evolutionary studies are complicated by discordance between gene trees and the species tree in which they evolved. Dealing with discordant trees often relies on comparison costs between gene and species trees, including the well-established Robinson-Foulds, gene duplication, and deep coalescence costs. While these costs have provided credible results for binary rooted gene trees, corresponding cost definitions for non-binary unrooted gene trees, which are frequently occurring in practice, are challenged by biological realism. We propose a natural extension of the well-established costs for comparing unrooted and non-binary gene trees with rooted binary species trees using a binary refinement model. For the duplication cost we describe an efficient algorithm that is based on a linear time reduction and also computes an optimal rooted binary refinement of the given gene tree. Finally, we show that similar reductions lead to solutions for computing the deep coalescence and the Robinson-Foulds costs. Our binary refinement of Robinson-Foulds, gene duplication, and deep coalescence costs for unrooted and non-binary gene trees together with the linear time reductions provided here for computing these costs significantly extends the range of trees that can be incorporated into approaches dealing with discordance.

MeshTree: A Delay optimised Overlay Multicast Tree Building Protocol

OpenAIRE

Tan, Su-Wei; Waters, A. Gill; Crawford, John

2005-01-01

We study decentralised low delay degree-constrained overlay multicast tree construction for single source real-time applications. This optimisation problem is NP-hard even if computed centrally. We identify two problems in traditional distributed solutions, namely the greedy problem and delay-cost trade-off. By offering solutions to these problems, we propose a new self-organising distributed tree building protocol called MeshTree. The main idea is to embed the delivery tree in a degree-bound...

Tree Species Classification in Temperate Forests Using Formosat-2 Satellite Image Time Series

Directory of Open Access Journals (Sweden)

David Sheeren

2016-09-01

Full Text Available Mapping forest composition is a major concern for forest management, biodiversity assessment and for understanding the potential impacts of climate change on tree species distribution. In this study, the suitability of a dense high spatial resolution multispectral Formosat-2 satellite image time-series (SITS to discriminate tree species in temperate forests is investigated. Based on a 17-date SITS acquired across one year, thirteen major tree species (8 broadleaves and 5 conifers are classified in a study area of southwest France. The performance of parametric (GMM and nonparametric (k-NN, RF, SVM methods are compared at three class hierarchy levels for different versions of the SITS: (i a smoothed noise-free version based on the Whittaker smoother; (ii a non-smoothed cloudy version including all the dates; (iii a non-smoothed noise-free version including only 14 dates. Noise refers to pixels contaminated by clouds and cloud shadows. The results of the 108 distinct classifications show a very high suitability of the SITS to identify the forest tree species based on phenological differences (average κ = 0 . 93 estimated by cross-validation based on 1235 field-collected plots. SVM is found to be the best classifier with very close results from the other classifiers. No clear benefit of removing noise by smoothing can be observed. Classification accuracy is even improved using the non-smoothed cloudy version of the SITS compared to the 14 cloud-free image time series. However conclusions of the results need to be considered with caution because of possible overfitting. Disagreements also appear between the maps produced by the classifiers for complex mixed forests, suggesting a higher classification uncertainty in these contexts. Our findings suggest that time-series data can be a good alternative to hyperspectral data for mapping forest types. It also demonstrates the potential contribution of the recently launched Sentinel-2 satellite for

Mass of 17O from Penning-trap mass spectrometry and molecular spectroscopy: A precision test of the Dunham-Watson model in carbon monoxide

International Nuclear Information System (INIS)

Mount, Brianna J.; Redshaw, Matthew; Myers, Edmund G.; Mueller, Holger S. P.

2010-01-01

By fitting the Dunham-Watson model to extensive rotational and vibrational spectroscopic data of isotopic variants of CO, and by using existing precise masses of 13 C, 16 O, and 18 O from Penning-trap mass spectrometry, we determine the atomic mass of 17 O to be M[ 17 O]=16.999 131 644(30) u, where the uncertainty is purely statistical. Using Penning-trap mass spectrometry, we have also directly determined the atomic mass of 17 O with the more precise result M[ 17 O]=16.999 131 756 6(9) u. The Dunham-Watson model applied to the molecular spectroscopic data hence predicts the mass of 17 O to better than 1 part in 10 8 .

Two new fern chloroplasts and decelerated evolution linked to the long generation time in tree ferns.

Science.gov (United States)

Zhong, Bojian; Fong, Richard; Collins, Lesley J; McLenachan, Patricia A; Penny, David

2014-04-30

We report the chloroplast genomes of a tree fern (Dicksonia squarrosa) and a "fern ally" (Tmesipteris elongata), and show that the phylogeny of early land plants is basically as expected, and the estimates of divergence time are largely unaffected after removing the fastest evolving sites. The tree fern shows the major reduction in the rate of evolution, and there has been a major slowdown in the rate of mutation in both families of tree ferns. We suggest that this is related to a generation time effect; if there is a long time period between generations, then this is probably incompatible with a high mutation rate because otherwise nearly every propagule would probably have several lethal mutations. This effect will be especially strong in organisms that have large numbers of cell divisions between generations. This shows the necessity of going beyond phylogeny and integrating its study with other properties of organisms. © The Author(s) 2014. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

Detecting Drought-Induced Tree Mortality in Sierra Nevada Forests with Time Series of Satellite Data

Directory of Open Access Journals (Sweden)

Sarah Byer

2017-09-01

Full Text Available A five-year drought in California led to a significant increase in tree mortality in the Sierra Nevada forests from 2012 to 2016. Landscape level monitoring of forest health and tree dieback is critical for vegetation and disaster management strategies. We examined the capability of multispectral imagery from the Moderate Resolution Imaging Spectroradiometer (MODIS in detecting and explaining the impacts of the recent severe drought in Sierra Nevada forests. Remote sensing metrics were developed to represent baseline forest health conditions and drought stress using time series of MODIS vegetation indices (VIs and a water index. We used Random Forest algorithms, trained with forest aerial detection surveys data, to detect tree mortality based on the remote sensing metrics and topographical variables. Map estimates of tree mortality demonstrated that our two-stage Random Forest models were capable of detecting the spatial patterns and severity of tree mortality, with an overall producer’s accuracy of 96.3% for the classification Random Forest (CRF and a RMSE of 7.19 dead trees per acre for the regression Random Forest (RRF. The overall omission errors of the CRF ranged from 19% for the severe mortality class to 27% for the low mortality class. Interpretations of the models revealed that forests with higher productivity preceding the onset of drought were more vulnerable to drought stress and, consequently, more likely to experience tree mortality. This method highlights the importance of incorporating baseline forest health data and measurements of drought stress in understanding forest response to severe drought.

DupTree: a program for large-scale phylogenetic analyses using gene tree parsimony.

Science.gov (United States)

Wehe, André; Bansal, Mukul S; Burleigh, J Gordon; Eulenstein, Oliver

2008-07-01

DupTree is a new software program for inferring rooted species trees from collections of gene trees using the gene tree parsimony approach. The program implements a novel algorithm that significantly improves upon the run time of standard search heuristics for gene tree parsimony, and enables the first truly genome-scale phylogenetic analyses. In addition, DupTree allows users to examine alternate rootings and to weight the reconciliation costs for gene trees. DupTree is an open source project written in C++. DupTree for Mac OS X, Windows, and Linux along with a sample dataset and an on-line manual are available at http://genome.cs.iastate.edu/CBL/DupTree

On Determining if Tree-based Networks Contain Fixed Trees.

Science.gov (United States)

Anaya, Maria; Anipchenko-Ulaj, Olga; Ashfaq, Aisha; Chiu, Joyce; Kaiser, Mahedi; Ohsawa, Max Shoji; Owen, Megan; Pavlechko, Ella; St John, Katherine; Suleria, Shivam; Thompson, Keith; Yap, Corrine

2016-05-01

We address an open question of Francis and Steel about phylogenetic networks and trees. They give a polynomial time algorithm to decide if a phylogenetic network, N, is tree-based and pose the problem: given a fixed tree T and network N, is N based on T? We show that it is [Formula: see text]-hard to decide, by reduction from 3-Dimensional Matching (3DM) and further that the problem is fixed-parameter tractable.

[The Watson-Crick model of the DNA doublehelix. The history of the discovery and the role of the protein paradigm].

Science.gov (United States)

Hagemann, Rudolf

2007-01-01

At the beginning, the two fundamental papers by Watson and Crick published in 1953 are presented. Subsequently, the main phases of protein and nucleic acids research, starting in the middle of the 19th century, are shortly reviewed. It is outlined, how the 'protein-paradigm' was gradually developed and ultimately became widely accepted. It is then described how Caspersson in 1936 newly raised the question what the chemical nature of genes was: proteins or nucleic acids ? In the main part of this report six lines of research are reviewed, the results of which led to the demise of the 'protein paradigm', the creation of the Watson-Crick model of the DNA and the elaboration of the mechanism of DNA replication: (a) mutation experiments with UV and determination of the UV action spectrum, (b) determination of the chemical identity of the transforming agent in bacteria, (c) detailed chemical analysis of the DNA of different organisms, (d) molecular investigation of the infection of bacteria by bacteriophages, (e) X-ray analysis of DNA fibers, (f) model building and theoretical treatment of all data obtained. In this article, the factors promoting and inhibiting scientific progress in this field are described (and, above all, the relations between scientists with fixated concepts). The results from these lines of research led to the recognition of the decisive role of nucleic acids as the carriers of genetic information and, in this way, formally established the 'nucleic acid paradigm'. Finally the question is discussed why Watson and Crick found the right solution for the DNA structure (and not one of their competitors).

Fragmentation of random trees

International Nuclear Information System (INIS)

Kalay, Z; Ben-Naim, E

2015-01-01

We study fragmentation of a random recursive tree into a forest by repeated removal of nodes. The initial tree consists of N nodes and it is generated by sequential addition of nodes with each new node attaching to a randomly-selected existing node. As nodes are removed from the tree, one at a time, the tree dissolves into an ensemble of separate trees, namely, a forest. We study statistical properties of trees and nodes in this heterogeneous forest, and find that the fraction of remaining nodes m characterizes the system in the limit N→∞. We obtain analytically the size density ϕ s of trees of size s. The size density has power-law tail ϕ s ∼s −α with exponent α=1+(1/m). Therefore, the tail becomes steeper as further nodes are removed, and the fragmentation process is unusual in that exponent α increases continuously with time. We also extend our analysis to the case where nodes are added as well as removed, and obtain the asymptotic size density for growing trees. (paper)

Accommodation of an N-(deoxyguanosin-8-yl)-2-acetylaminofluorene adduct in the active site of human DNA polymerase iota: Hoogsteen or Watson-Crick base pairing?

Science.gov (United States)

Donny-Clark, Kerry; Shapiro, Robert; Broyde, Suse

2009-01-13

Bypass across DNA lesions by specialized polymerases is essential for maintenance of genomic stability. Human DNA polymerase iota (poliota) is a bypass polymerase of the Y family. Crystal structures of poliota suggest that Hoogsteen base pairing is employed to bypass minor groove DNA lesions, placing them on the spacious major groove side of the enzyme. Primer extension studies have shown that poliota is also capable of error-free nucleotide incorporation opposite the bulky major groove adduct N-(deoxyguanosin-8-yl)-2-acetylaminofluorene (dG-AAF). We present molecular dynamics simulations and free energy calculations suggesting that Watson-Crick base pairing could be employed in poliota for bypass of dG-AAF. In poliota with Hoogsteen-paired dG-AAF the bulky AAF moiety would reside on the cramped minor groove side of the template. The Hoogsteen-capable conformation distorts the active site, disrupting interactions necessary for error-free incorporation of dC opposite the lesion. Watson-Crick pairing places the AAF rings on the spacious major groove side, similar to the position of minor groove adducts observed with Hoogsteen pairing. Watson-Crick-paired structures show a well-ordered active site, with a near reaction-ready ternary complex. Thus our results suggest that poliota would utilize the same spacious region for lesion bypass of both major and minor groove adducts. Therefore, purine adducts with bulk on the minor groove side would use Hoogsteen pairing, while adducts with the bulky lesion on the major groove side would utilize Watson-Crick base pairing as indicated by our MD simulations for dG-AAF. This suggests the possibility of an expanded role for poliota in lesion bypass.

Winter Birch Trees

Science.gov (United States)

Sweeney, Debra; Rounds, Judy

2011-01-01

Trees are great inspiration for artists. Many art teachers find themselves inspired and maybe somewhat obsessed with the natural beauty and elegance of the lofty tree, and how it changes through the seasons. One such tree that grows in several regions and always looks magnificent, regardless of the time of year, is the birch. In this article, the…

RNAHelix: computational modeling of nucleic acid structures with Watson-Crick and non-canonical base pairs.

Science.gov (United States)

Bhattacharyya, Dhananjay; Halder, Sukanya; Basu, Sankar; Mukherjee, Debasish; Kumar, Prasun; Bansal, Manju

2017-02-01

Comprehensive analyses of structural features of non-canonical base pairs within a nucleic acid double helix are limited by the availability of a small number of three dimensional structures. Therefore, a procedure for model building of double helices containing any given nucleotide sequence and base pairing information, either canonical or non-canonical, is seriously needed. Here we describe a program RNAHelix, which is an updated version of our widely used software, NUCGEN. The program can regenerate duplexes using the dinucleotide step and base pair orientation parameters for a given double helical DNA or RNA sequence with defined Watson-Crick or non-Watson-Crick base pairs. The original structure and the corresponding regenerated structure of double helices were found to be very close, as indicated by the small RMSD values between positions of the corresponding atoms. Structures of several usual and unusual double helices have been regenerated and compared with their original structures in terms of base pair RMSD, torsion angles and electrostatic potentials and very high agreements have been noted. RNAHelix can also be used to generate a structure with a sequence completely different from an experimentally determined one or to introduce single to multiple mutation, but with the same set of parameters and hence can also be an important tool in homology modeling and study of mutation induced structural changes.

Phase synchronization based minimum spanning trees for analysis of financial time series with nonlinear correlations

Science.gov (United States)

Radhakrishnan, Srinivasan; Duvvuru, Arjun; Sultornsanee, Sivarit; Kamarthi, Sagar

2016-02-01

The cross correlation coefficient has been widely applied in financial time series analysis, in specific, for understanding chaotic behaviour in terms of stock price and index movements during crisis periods. To better understand time series correlation dynamics, the cross correlation matrices are represented as networks, in which a node stands for an individual time series and a link indicates cross correlation between a pair of nodes. These networks are converted into simpler trees using different schemes. In this context, Minimum Spanning Trees (MST) are the most favoured tree structures because of their ability to preserve all the nodes and thereby retain essential information imbued in the network. Although cross correlations underlying MSTs capture essential information, they do not faithfully capture dynamic behaviour embedded in the time series data of financial systems because cross correlation is a reliable measure only if the relationship between the time series is linear. To address the issue, this work investigates a new measure called phase synchronization (PS) for establishing correlations among different time series which relate to one another, linearly or nonlinearly. In this approach the strength of a link between a pair of time series (nodes) is determined by the level of phase synchronization between them. We compare the performance of phase synchronization based MST with cross correlation based MST along selected network measures across temporal frame that includes economically good and crisis periods. We observe agreement in the directionality of the results across these two methods. They show similar trends, upward or downward, when comparing selected network measures. Though both the methods give similar trends, the phase synchronization based MST is a more reliable representation of the dynamic behaviour of financial systems than the cross correlation based MST because of the former's ability to quantify nonlinear relationships among time

The extension of a DNA double helix by an additional Watson-Crick base pair on the same backbone.

Science.gov (United States)

Kumar, Pawan; Sharma, Pawan K; Madsen, Charlotte S; Petersen, Michael; Nielsen, Poul

2013-06-17

Additional base pair: The DNA duplex can be extended with an additional Watson-Crick base pair on the same backbone by the use of double-headed nucleotides. These also work as compressed dinucleotides and form two base pairs with cognate nucleobases on the opposite strand. Copyright © 2013 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Trees in the city: valuing street trees in Portland, Oregon

Science.gov (United States)

G.H. Donovan; D.T. Butry

2010-01-01

We use a hedonic price model to simultaneously estimate the effects of street trees on the sales price and the time-on-market (TOM) of houses in Portland. Oregon. On average, street trees add $8,870 to sales price and reduce TOM by 1.7 days. In addition, we found that the benefits of street trees spill over to neighboring houses. Because the provision and maintenance...

Recursive algorithms for phylogenetic tree counting.

Science.gov (United States)

Gavryushkina, Alexandra; Welch, David; Drummond, Alexei J

2013-10-28

In Bayesian phylogenetic inference we are interested in distributions over a space of trees. The number of trees in a tree space is an important characteristic of the space and is useful for specifying prior distributions. When all samples come from the same time point and no prior information available on divergence times, the tree counting problem is easy. However, when fossil evidence is used in the inference to constrain the tree or data are sampled serially, new tree spaces arise and counting the number of trees is more difficult. We describe an algorithm that is polynomial in the number of sampled individuals for counting of resolutions of a constraint tree assuming that the number of constraints is fixed. We generalise this algorithm to counting resolutions of a fully ranked constraint tree. We describe a quadratic algorithm for counting the number of possible fully ranked trees on n sampled individuals. We introduce a new type of tree, called a fully ranked tree with sampled ancestors, and describe a cubic time algorithm for counting the number of such trees on n sampled individuals. These algorithms should be employed for Bayesian Markov chain Monte Carlo inference when fossil data are included or data are serially sampled.

Anthropogenic edges, isolation and the flowering time and fruit set of Anadenanthera peregrina, a cerrado savanna tree.

Science.gov (United States)

Athayde, Eduardo Anversa; Morellato, Leonor Patrícia Cerdeira

2014-05-01

Fragmentation exposes plants to extreme environmental conditions with implications for species phenology and reproduction.We investigated whether isolation and edge effects influence size, flowering time, fruit set, and seedling establishment of Anadenanthera peregrina var. falcata. We compared trees in the interior (n =85), and on the edge (n =74) of a cerrado savanna fragment as well as in a pasture (n =26) with respect to size, flowering phenology, flower and fruit production, fruit and seed set, predispersal seed predation, and seedling establishment. Trees in the pasture were larger and produced a higher number of flowers and fruits than trees on the edge and interior, yet seed set did not differ across environments. The plant size structure explained the flower and fruit production, and the self-compatibility breeding system caused a similar seed set regardless of the environment. First flowering was later and fruit set higher in the interior. We argue that time of first flower influenced the fruit set of Anadenathera. Edge and isolated trees started to flower earlier as a response to microclimatic conditions--mainly temperature--reducing the fruit set. Predispersal seed predation was lower among pasture trees. Conversely, we found seedlings only on the edge and in the interior of cerrado, suggesting that the pasture was of poor quality habitat for Anadenanthera recruitment. Isolation affected the plant size structure and reproduction of Anadenanthera trees. Studies comparing plant phenology under contrasting environmental conditions may offer clues on how global change may affect plant reproduction in the tropics.

Long-Range Vibrational Dynamics Are Directed by Watson-Crick Base Pairing in Duplex DNA.

Science.gov (United States)

Hithell, Gordon; Shaw, Daniel J; Donaldson, Paul M; Greetham, Gregory M; Towrie, Michael; Burley, Glenn A; Parker, Anthony W; Hunt, Neil T

2016-05-05

Ultrafast two-dimensional infrared (2D-IR) spectroscopy of a 15-mer A-T DNA duplex in solution has revealed structure-dependent vibrational coupling and energy transfer processes linking bases with the sugar-phosphate backbone. Duplex melting induces significant changes in the positions of off-diagonal peaks linking carbonyl and ring-stretching vibrational modes of the adenine and thymine bases with vibrations of the phosphate group and phosphodiester linkage. These indicate that Watson-Crick hydrogen bonding and helix formation lead to a unique vibrational coupling arrangement of base vibrational modes with those of the phosphate unit. On the basis of observations from time-resolved 2D-IR data, we conclude that rapid energy transfer processes occur between base and backbone, mediated by additional modes located on the deoxyribose moiety within the same nucleotide. These relaxation dynamics are insensitive to duplex melting, showing that efficient intramolecular energy relaxation to the solvent via the phosphate groups is the key to excess energy dissipation in both single- and double-stranded DNA.

Fast Tree: Computing Large Minimum-Evolution Trees with Profiles instead of a Distance Matrix

Energy Technology Data Exchange (ETDEWEB)

N. Price, Morgan; S. Dehal, Paramvir; P. Arkin, Adam

2009-07-31

Gene families are growing rapidly, but standard methods for inferring phylogenies do not scale to alignments with over 10,000 sequences. We present FastTree, a method for constructing large phylogenies and for estimating their reliability. Instead of storing a distance matrix, FastTree stores sequence profiles of internal nodes in the tree. FastTree uses these profiles to implement neighbor-joining and uses heuristics to quickly identify candidate joins. FastTree then uses nearest-neighbor interchanges to reduce the length of the tree. For an alignment with N sequences, L sites, and a different characters, a distance matrix requires O(N^2) space and O(N^2 L) time, but FastTree requires just O( NLa + N sqrt(N) ) memory and O( N sqrt(N) log(N) L a ) time. To estimate the tree's reliability, FastTree uses local bootstrapping, which gives another 100-fold speedup over a distance matrix. For example, FastTree computed a tree and support values for 158,022 distinct 16S ribosomal RNAs in 17 hours and 2.4 gigabytes of memory. Just computing pairwise Jukes-Cantor distances and storing them, without inferring a tree or bootstrapping, would require 17 hours and 50 gigabytes of memory. In simulations, FastTree was slightly more accurate than neighbor joining, BIONJ, or FastME; on genuine alignments, FastTree's topologies had higher likelihoods. FastTree is available at http://microbesonline.org/fasttree.

Measurement of 14C time scale of the rings of a tree by accelerator mass spectrometry

International Nuclear Information System (INIS)

Oda, Hirotaka; Furukawa, Michiaki; Yonenobu, Hitoshi; Ikeda, Akiko; Nakamura, Toshio.

1996-01-01

14 C time scale is different from a histrical data in order that it is calculated by assuming that the concentration of 14 C in the sample has not been changed by age. The object of this work is to make clear the errors in measurement of 14 C time scale of the ring of a tree known the tree age. The every year ring of a Hinoki in Kiso, 950 years old, was used as a sample. The most external ring is determined as 1923 years old on the basis of the dendrochronology. The rings after 1120 years were used as the samples. α-cellulose, the most stable component in the structural components of cell of tree, was prepared from each ring. About 8 mg of α-cellulose was reduced to graphite to be measured by the tandem thoron analytic meter. The results obtained showed that 14 C time scale was older than that of the histrical data in the twelfth and thirteenth century, but it was more new than that of the histrical data from the late seventeenth to the middle of eighteenth century. The results were agreement with that of Stuiver and Pearson (1933). (S.Y.)

ELB-trees an efficient and lock-free B-tree derivative

DEFF Research Database (Denmark)

Bonnichsen, Lars Frydendal; Karlsson, Sven; Probst, Christian W.

2013-01-01

overhead. All lock-free data structures are based on simple atomic operations that, though supported by modern processors, are expensive in execution time. We present a lock-free data structure, ELB-trees, which under certain assumptions can be used as multimaps as well as priority queues. Specifically...... it cannot store duplicate key-value pairs, and it is not linearizable. Compared to existing data structures, ELB-trees require fewer atomic operations leading to improved performance. We measure the parallel performance of ELB-trees using a set of benchmarks and observe that ELB-trees are up to almost 30......As computer systems scale in the number of processors, scalable data structures with good parallel performance become increasingly important. Lock-free data structures promise such improved parallel performance at the expense of higher algorithmic complexity and higher sequential execution time...

Implementation of Tree and Butterfly Barriers with Optimistic Time Management Algorithms for Discrete Event Simulation

Science.gov (United States)

Rizvi, Syed S.; Shah, Dipali; Riasat, Aasia

The Time Wrap algorithm [3] offers a run time recovery mechanism that deals with the causality errors. These run time recovery mechanisms consists of rollback, anti-message, and Global Virtual Time (GVT) techniques. For rollback, there is a need to compute GVT which is used in discrete-event simulation to reclaim the memory, commit the output, detect the termination, and handle the errors. However, the computation of GVT requires dealing with transient message problem and the simultaneous reporting problem. These problems can be dealt in an efficient manner by the Samadi's algorithm [8] which works fine in the presence of causality errors. However, the performance of both Time Wrap and Samadi's algorithms depends on the latency involve in GVT computation. Both algorithms give poor latency for large simulation systems especially in the presence of causality errors. To improve the latency and reduce the processor ideal time, we implement tree and butterflies barriers with the optimistic algorithm. Our analysis shows that the use of synchronous barriers such as tree and butterfly with the optimistic algorithm not only minimizes the GVT latency but also minimizes the processor idle time.

Tree ring and ice core time scales around the Santorini eruption

Science.gov (United States)

Löfroth, Elin; Muscheler, Raimund; Aldahan, Ala; Possnert, Göran; Berggren, Ann-Marie

2010-05-01

When studying cosmogenic radionuclides in ice core and tree ring archives around the Santorini eruption a ~20 year discrepancy was found between the records (Muscheler 2009). In this study a new 10Be dataset from the NGRIP ice core is presented. It has a resolution of 7 years and spans the period 3752-3244 BP (1803-1295 BC). The NGRIP 10Be record and the previously published 10Be GRIP record were compared to the IntCal datasets to further investigate the discrepancy between the ice core and tree ring chronologies. By modelling the 14C production rate based on atmospheric 14C records a comparison could be made to the 10Be flux which is assumed to represent the 10Be production rate. This showed a time shift of ~23 years between the records. The sensitivity of the results to changes in important model parameters was evaluated. Uncertainties in the carbon cycle model cannot explain a substantial part of the timing differences. Potential influences of climate and atmospheric processes on the 10Be deposition were studied using δ18O from the respective cores and GISP2 ice core ion data. The comparison to δ18O revealed a small but significant correlation between 10Be flux and δ18O when the 14C-derived production signal was removed from the 10Be curves. The ion data, as proxies for atmospheric circulation changes, did not show any correlations to the 10Be record or the 10Be/14C difference. When including possible data uncertainties there is still a minimum discrepancy of ~10 years between the 10Be ice core and the 14C tree ring record. Due to lack of alternative explanations it is concluded that the ice core and/or the tree ring chronologies contains unaccounted errors in this range. This also reconciles the radiocarbon 1627-1600 BC (Friedrich et al., 2006) and ice core 1642±5 BC (Vinther et al., 2006) datings of the Santorini eruption. Friedrich, W.L., Kromer, B., Friedrich, M., Heinemeier, J., Pfeiffer, T., & Talamo, S., 2006: Santorini eruption radiocarbon dated to

FB-Tree: A B+-Tree for Flash-Based SSDs

DEFF Research Database (Denmark)

Jørgensen, Martin V.; Rasmussen, René B.; Saltenis, Simonas

2011-01-01

Due to their many advantages, flash-based SSDs (Solid-State Drives) have become a mainstream alternative to magnetic disks for database servers. Nevertheless, database systems, designed and optimized for magnetic disks, still do not fully exploit all the benefits of the new technology. We propose....... As a consequence, the FB-tree outperforms a regular B+-tree in all scenarios tested. For instance, the throughput of a random workload of 75% updates increases by a factor of three using only two times the space of the B+-tree....

Watson-Crick Base Pairing, Electronic and Photophysical Properties of Triazole Modified Adenine Analogues: A Computational Study

KAUST Repository

Das, Shubhajit

2015-09-17

We employ first-principles Density Functional Theory (DFT) and time-dependent DFT (TDDFT) to elucidate structural, electronic and optical properties of a few recently reported triazole adenine nucleobase analogues. The results are compared against the findings obtained for both natural adenine nucleobase and available experimental data. The optical absorption of these adenine analogues are calculated both in gas-phase and in solvent (methanol) using Polarized Continuum Model (PCM). We find that all the analogues show a red-shifted absorption profile as compared to adenine. Our simulated emission spectra in solvent compare fairly well with experimentally observed results. We investigate base paring ability of these adenine analogues with thymine. The calculations on the intrinsic stability of these base pairs ascertain that all the adenine analogues form the hydrogen bonded Watson-Crick base pair with similar H-bonding energy as obtained for natural adenine-thymine base pair. In our study, we provide a microscopic origin of the low-energy absorption and emission peaks, observed experimentally.

Watson-Crick Base Pairing, Electronic and Photophysical Properties of Triazole Modified Adenine Analogues: A Computational Study

KAUST Repository

Das, Shubhajit; Samanta, Pralok Kumar; Pati, Swapan

2015-01-01

We employ first-principles Density Functional Theory (DFT) and time-dependent DFT (TDDFT) to elucidate structural, electronic and optical properties of a few recently reported triazole adenine nucleobase analogues. The results are compared against the findings obtained for both natural adenine nucleobase and available experimental data. The optical absorption of these adenine analogues are calculated both in gas-phase and in solvent (methanol) using Polarized Continuum Model (PCM). We find that all the analogues show a red-shifted absorption profile as compared to adenine. Our simulated emission spectra in solvent compare fairly well with experimentally observed results. We investigate base paring ability of these adenine analogues with thymine. The calculations on the intrinsic stability of these base pairs ascertain that all the adenine analogues form the hydrogen bonded Watson-Crick base pair with similar H-bonding energy as obtained for natural adenine-thymine base pair. In our study, we provide a microscopic origin of the low-energy absorption and emission peaks, observed experimentally.

A Durable Flash Memory Search Tree

OpenAIRE

Clay III, James; Wortman, Kevin

2012-01-01

We consider the task of optimizing the B-tree data structure, used extensively in operating systems and databases, for sustainable usage on multi-level flash memory. Empirical evidence shows that this new flash memory tree, or FM Tree, extends the operational lifespan of each block of flash memory by a factor of roughly 27 to 70 times, while still supporting logarithmic-time search tree operations.

How does warming affect carbon allocation, respiration and residence time in trees? An isotope tracer approach in a eucalypt

Science.gov (United States)

Pendall, E.; Drake, J. E.; Furze, M.; Barton, C. V.; Carillo, Y.; Richter, A.; Tjoelker, M. G.

2017-12-01

Climate warming has the potential to alter the balance between photosynthetic carbon assimilation and respiratory losses in forest trees, leading to uncertainty in predicting their future physiological functioning. In a previous experiment, warming decreased canopy CO2 assimilation (A) rates of Eucalyptus tereticornis trees, but respiration (R) rates were usually not significantly affected, due to physiological acclimation to temperature. This led to a slight increase in (R/A) and thus decrease in plant carbon use efficiency with climate warming. In contrast to carbon fluxes, the effect of warming on carbon allocation and residence time in trees has received less attention. We conducted a study to test the hypothesis that warming would decrease the allocation of C belowground owing to reduced cost of nutrient uptake. E. parramattensis trees were grown in the field in unique whole-tree chambers operated at ambient and ambient +3 °C temperature treatments (n=3 per treatment). We applied a 13CO2 pulse and followed the label in CO2 respired from leaves, roots, canopy and soil, in plant sugars, and in rhizosphere microbes over a 3-week period in conjunction with measurements of tree growth. The 9-m tall, 57 m3 whole-tree chambers were monitored for CO2 concentrations in independent canopy and below ground (root and soil) compartments; periodic monitoring of δ13C values in air in the compartments allowed us to quantify the amount of 13CO2 assimilated and respired by each tree. Warmed trees grew faster and assimilated more of the label than control trees, but the 13C allocation to canopy, root and soil respiration was not altered. However, warming appeared to reduce the residence time of carbon respired from leaves, and especially from roots and soil, indicating that autotrophic respiration has the potential to feedback to climate change. This experiment provides insights into how warming may affect the fate of assimilated carbon from the leaf to the ecosystem scale.

Dissociation of single-strand DNA: single-walled carbon nanotube hybrids by Watson-Crick base-pairing.

Science.gov (United States)

Jung, Seungwon; Cha, Misun; Park, Jiyong; Jeong, Namjo; Kim, Gunn; Park, Changwon; Ihm, Jisoon; Lee, Junghoon

2010-08-18

It has been known that single-strand DNA wraps around a single-walled carbon nanotube (SWNT) by pi-stacking. In this paper it is demonstrated that such DNA is dissociated from the SWNT by Watson-Crick base-pairing with a complementary sequence. Measurement of field effect transistor characteristics indicates a shift of the electrical properties as a result of this "unwrapping" event. We further confirm the suggested process through Raman spectroscopy and gel electrophoresis. Experimental results are verified in view of atomistic mechanisms with molecular dynamics simulations and binding energy analyses.

Enol tautomers of Watson-Crick base pair models are metastable because of nuclear quantum effects.

Science.gov (United States)

Pérez, Alejandro; Tuckerman, Mark E; Hjalmarson, Harold P; von Lilienfeld, O Anatole

2010-08-25

Intermolecular enol tautomers of Watson-Crick base pairs could emerge spontaneously via interbase double proton transfer. It has been hypothesized that their formation could be facilitated by thermal fluctuations and proton tunneling, and possibly be relevant to DNA damage. Theoretical and computational studies, assuming classical nuclei, have confirmed the dynamic stability of these rare tautomers. However, by accounting for nuclear quantum effects explicitly through Car-Parrinello path integral molecular dynamics calculations, we find the tautomeric enol form to be dynamically metastable, with lifetimes too insignificant to be implicated in DNA damage.

The influence of anharmonic and solvent effects on the theoretical vibrational spectra of the guanine-cytosine base pairs in Watson-Crick and Hoogsteen configurations.

Science.gov (United States)

Bende, Attila; Muntean, Cristina M

2014-03-01

The theoretical IR and Raman spectra of the guanine-cytosine DNA base pairs in Watson-Crick and Hoogsteen configurations were computed using DFT method with M06-2X meta-hybrid GGA exchange-correlation functional, including the anharmonic corrections and solvent effects. The results for harmonic frequencies and their anharmonic corrections were compared with our previously calculated values obtained with the B3PW91 hybrid GGA functional. Significant differences were obtained for the anharmonic corrections calculated with the two different DFT functionals, especially for the stretching modes, while the corresponding harmonic frequencies did not differ considerable. For the Hoogtseen case the H⁺ vibration between the G-C base pair can be characterized as an asymmetric Duffing oscillator and therefore unrealistic anharmonic corrections for normal modes where this proton vibration is involved have been obtained. The spectral modification due to the anharmonic corrections, solvent effects and the influence of sugar-phosphate group for the Watson-Crick and Hoogsteen base pair configurations, respectively, were also discussed. For the Watson-Crick case also the influence of the stacking interaction on the theoretical IR and Raman spectra was analyzed. Including the anharmonic correction in our normal mode analysis is essential if one wants to obtain correct assignments of the theoretical frequency values as compared with the experimental spectra.

Distilling allometric and environmental information from time series of conduit size: the standardization issue and its relationship to tree hydraulic architecture.

Science.gov (United States)

Carrer, Marco; von Arx, Georg; Castagneri, Daniele; Petit, Giai

2015-01-01

Trees are among the best natural archives of past environmental information. Xylem anatomy preserves information related to tree allometry and ecophysiological performance, which is not available from the more customary ring-width or wood-density proxy parameters. Recent technological advances make tree-ring anatomy very attractive because time frames of many centuries can now be covered. This calls for the proper treatment of time series of xylem anatomical attributes. In this article, we synthesize current knowledge on the biophysical and physiological mechanisms influencing the short- to long-term variation in the most widely used wood-anatomical feature, namely conduit size. We also clarify the strong mechanistic link between conduit-lumen size, tree hydraulic architecture and height growth. Among the key consequences of these biophysical constraints is the pervasive, increasing trend of conduit size during ontogeny. Such knowledge is required to process time series of anatomical parameters correctly in order to obtain the information of interest. An appropriate standardization procedure is fundamental when analysing long tree-ring-related chronologies. When dealing with wood-anatomical parameters, this is even more critical. Only an interdisciplinary approach involving ecophysiology, wood anatomy and dendrochronology will help to distill the valuable information about tree height growth and past environmental variability correctly. © The Author 2015. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

Accommodation of an N-(deoxyguanosin-8-yl)-2-acetylaminofluorene adduct in the active site of human DNA polymerase ι: Hoogsteen or Watson-Crick base pairing?†

Science.gov (United States)

Donny-Clark, Kerry; Shapiro, Robert; Broyde, Suse

2009-01-01

Bypass across DNA lesions by specialized polymerases is essential for maintenance of genomic stability. Human DNA polymerase ι (polι) is a bypass polymerase of the Y family. Crystal structures of polι suggest that Hoogsteen base pairing is employed to bypass minor groove DNA lesions, placing them on the spacious major groove side of the enzyme. Primer extension studies have shown that polι is also capable of error-free nucleotide incorporation opposite the bulky major groove adduct N-(deoxyguanosin-8-yl)-2-acetyl-aminofluorene (dG-AAF). We present molecular dynamics simulations and free energy calculations suggesting that Watson-Crick base pairing could be employed in polι for bypass of dG-AAF. In polι with Hoogsteen paired dG-AAF the bulky AAF moiety would reside on the cramped minor groove side of the template. The Hoogsteen-capable conformation distorts the active site, disrupting interactions necessary for error-free incorporation of dC opposite the lesion. Watson-Crick pairing places the AAF rings on the spacious major groove side, similar to the position of minor groove adducts observed with Hoogsteen pairing. Watson-Crick paired structures show a well-ordered active site, with a near reaction-ready ternary complex. Thus our results suggest that polι would utilize the same spacious region for lesion bypass of both major and minor groove adducts. Therefore, purine adducts with bulk on the minor groove side would use Hoogsteen pairing, while adducts with the bulky lesion on the major groove side would utilize Watson-Crick base pairing as indicated by our MD simulations for dG-AAF. This suggests the possibility of an expanded role for polι in lesion bypass. PMID:19072536

The impact of tree age on biomass growth and carbon accumulation capacity: A retrospective analysis using tree ring data of three tropical tree species grown in natural forests of Suriname.

Science.gov (United States)

Köhl, Michael; Neupane, Prem R; Lotfiomran, Neda

2017-01-01

The world's forests play a pivotal role in the mitigation of global climate change. By photosynthesis they remove CO2 from the atmosphere and store carbon in their biomass. While old trees are generally acknowledged for a long carbon residence time, there is no consensus on their contribution to carbon accumulation due to a lack of long-term individual tree data. Tree ring analyses, which use anatomical differences in the annual formation of wood for dating growth zones, are a retrospective approach that provides growth patterns of individual trees over their entire lifetime. We developed time series of diameter growth and related annual carbon accumulation for 61 trees of the species Cedrela odorata L. (Meliacea), Hymenaea courbaril L. (Fabacea) and Goupia glabra Aubl. (Goupiacea). The trees grew in unmanaged tropical wet-forests of Suriname and reached ages from 84 to 255 years. Most of the trees show positive trends of diameter growth and carbon accumulation over time. For some trees we observed fluctuating growth-periods of lower growth alternate with periods of increased growth. In the last quarter of their lifetime trees accumulate on average between 39 percent (C. odorata) and 50 percent (G. glabra) of their final carbon stock. This suggests that old-growth trees in tropical forests do not only contribute to carbon stocks by long carbon resistance times, but maintain high rates of carbon accumulation at later stages of their life time.

Reconciliation with non-binary species trees.

Science.gov (United States)

Vernot, Benjamin; Stolzer, Maureen; Goldman, Aiton; Durand, Dannie

2008-10-01

Reconciliation extracts information from the topological incongruence between gene and species trees to infer duplications and losses in the history of a gene family. The inferred duplication-loss histories provide valuable information for a broad range of biological applications, including ortholog identification, estimating gene duplication times, and rooting and correcting gene trees. While reconciliation for binary trees is a tractable and well studied problem, there are no algorithms for reconciliation with non-binary species trees. Yet a striking proportion of species trees are non-binary. For example, 64% of branch points in the NCBI taxonomy have three or more children. When applied to non-binary species trees, current algorithms overestimate the number of duplications because they cannot distinguish between duplication and incomplete lineage sorting. We present the first algorithms for reconciling binary gene trees with non-binary species trees under a duplication-loss parsimony model. Our algorithms utilize an efficient mapping from gene to species trees to infer the minimum number of duplications in O(|V(G) | x (k(S) + h(S))) time, where |V(G)| is the number of nodes in the gene tree, h(S) is the height of the species tree and k(S) is the size of its largest polytomy. We present a dynamic programming algorithm which also minimizes the total number of losses. Although this algorithm is exponential in the size of the largest polytomy, it performs well in practice for polytomies with outdegree of 12 or less. We also present a heuristic which estimates the minimal number of losses in polynomial time. In empirical tests, this algorithm finds an optimal loss history 99% of the time. Our algorithms have been implemented in NOTUNG, a robust, production quality, tree-fitting program, which provides a graphical user interface for exploratory analysis and also supports automated, high-throughput analysis of large data sets.

Reducing process delays for real-time earthquake parameter estimation - An application of KD tree to large databases for Earthquake Early Warning

Science.gov (United States)

Yin, Lucy; Andrews, Jennifer; Heaton, Thomas

2018-05-01

Earthquake parameter estimations using nearest neighbor searching among a large database of observations can lead to reliable prediction results. However, in the real-time application of Earthquake Early Warning (EEW) systems, the accurate prediction using a large database is penalized by a significant delay in the processing time. We propose to use a multidimensional binary search tree (KD tree) data structure to organize large seismic databases to reduce the processing time in nearest neighbor search for predictions. We evaluated the performance of KD tree on the Gutenberg Algorithm, a database-searching algorithm for EEW. We constructed an offline test to predict peak ground motions using a database with feature sets of waveform filter-bank characteristics, and compare the results with the observed seismic parameters. We concluded that large database provides more accurate predictions of the ground motion information, such as peak ground acceleration, velocity, and displacement (PGA, PGV, PGD), than source parameters, such as hypocenter distance. Application of the KD tree search to organize the database reduced the average searching process by 85% time cost of the exhaustive method, allowing the method to be feasible for real-time implementation. The algorithm is straightforward and the results will reduce the overall time of warning delivery for EEW.

Identification of pests and diseases of Dalbergia hainanensis based on EVI time series and classification of decision tree

Science.gov (United States)

Luo, Qiu; Xin, Wu; Qiming, Xiong

2017-06-01

In the process of vegetation remote sensing information extraction, the problem of phenological features and low performance of remote sensing analysis algorithm is not considered. To solve this problem, the method of remote sensing vegetation information based on EVI time-series and the classification of decision-tree of multi-source branch similarity is promoted. Firstly, to improve the time-series stability of recognition accuracy, the seasonal feature of vegetation is extracted based on the fitting span range of time-series. Secondly, the decision-tree similarity is distinguished by adaptive selection path or probability parameter of component prediction. As an index, it is to evaluate the degree of task association, decide whether to perform migration of multi-source decision tree, and ensure the speed of migration. Finally, the accuracy of classification and recognition of pests and diseases can reach 87%--98% of commercial forest in Dalbergia hainanensis, which is significantly better than that of MODIS coverage accuracy of 80%--96% in this area. Therefore, the validity of the proposed method can be verified.

Decision tree for accurate infection timing in individuals newly diagnosed with HIV-1 infection.

Science.gov (United States)

Verhofstede, Chris; Fransen, Katrien; Van Den Heuvel, Annelies; Van Laethem, Kristel; Ruelle, Jean; Vancutsem, Ellen; Stoffels, Karolien; Van den Wijngaert, Sigi; Delforge, Marie-Luce; Vaira, Dolores; Hebberecht, Laura; Schauvliege, Marlies; Mortier, Virginie; Dauwe, Kenny; Callens, Steven

2017-11-29

There is today no gold standard method to accurately define the time passed since infection at HIV diagnosis. Infection timing and incidence measurement is however essential to better monitor the dynamics of local epidemics and the effect of prevention initiatives. Three methods for infection timing were evaluated using 237 serial samples from documented seroconversions and 566 cross sectional samples from newly diagnosed patients: identification of antibodies against the HIV p31 protein in INNO-LIA, SediaTM BED CEIA and SediaTM LAg-Avidity EIA. A multi-assay decision tree for infection timing was developed. Clear differences in recency window between BED CEIA, LAg-Avidity EIA and p31 antibody presence were observed with a switch from recent to long term infection a median of 169.5, 108.0 and 64.5 days after collection of the pre-seroconversion sample respectively. BED showed high reliability for identification of long term infections while LAg-Avidity is highly accurate for identification of recent infections. Using BED as initial assay to identify the long term infections and LAg-Avidity as a confirmatory assay for those classified as recent infection by BED, explores the strengths of both while reduces the workload. The short recency window of p31 antibodies allows to discriminate very early from early infections based on this marker. BED recent infection results not confirmed by LAg-Avidity are considered to reflect a period more distant from the infection time. False recency predictions in this group can be minimized by elimination of patients with a CD4 count of less than 100 cells/mm3 or without no p31 antibodies. For 566 cross sectional sample the outcome of the decision tree confirmed the infection timing based on the results of all 3 markers but reduced the overall cost from 13.2 USD to 5.2 USD per sample. A step-wise multi assay decision tree allows accurate timing of the HIV infection at diagnosis at affordable effort and cost and can be an important

The national tree-list layer

Science.gov (United States)

Stacy A. Drury; Jason M. Herynk

2011-01-01

The National Tree-List Layer (NTLL) project used LANDFIRE map products to produce the first national tree-list map layer that represents tree populations at stand and regional levels. The NTLL was produced in a short time frame to address the needs of Fire and Aviation Management for a map layer that could be used as input for simulating fire-caused tree mortality...

Measuring Stratigraphic Congruence Across Trees, Higher Taxa, and Time.

Science.gov (United States)

O'Connor, Anne; Wills, Matthew A

2016-09-01

The congruence between the order of cladistic branching and the first appearance dates of fossil lineages can be quantified using a variety of indices. Good matching is a prerequisite for the accurate time calibration of trees, while the distribution of congruence indices across large samples of cladograms has underpinned claims about temporal and taxonomic patterns of completeness in the fossil record. The most widely used stratigraphic congruence indices are the stratigraphic consistency index (SCI), the modified Manhattan stratigraphic measure (MSM*), and the gap excess ratio (GER) (plus its derivatives; the topological GER and the modified GER). Many factors are believed to variously bias these indices, with several empirical and simulation studies addressing some subset of the putative interactions. This study combines both approaches to quantify the effects (on all five indices) of eight variables reasoned to constrain the distribution of possible values (the number of taxa, tree balance, tree resolution, range of first occurrence (FO) dates, center of gravity of FO dates, the variability of FO dates, percentage of extant taxa, and percentage of taxa with no fossil record). Our empirical data set comprised 647 published animal and plant cladograms spanning the entire Phanerozoic, and for these data we also modeled the effects of mean age of FOs (as a proxy for clade age), the taxonomic rank of the clade, and the higher taxonomic group to which it belonged. The center of gravity of FO dates had not been investigated hitherto, and this was found to correlate most strongly with some measures of stratigraphic congruence in our empirical study (top-heavy clades had better congruence). The modified GER was the index least susceptible to bias. We found significant differences across higher taxa for all indices; arthropods had lower congruence and tetrapods higher congruence. Stratigraphic congruence-however measured-also varied throughout the Phanerozoic, reflecting

Real-Time Flood Control by Tree-Based Model Predictive Control Including Forecast Uncertainty: A Case Study Reservoir in Turkey

Directory of Open Access Journals (Sweden)

Gökçen Uysal

2018-03-01

Full Text Available Optimal control of reservoirs is a challenging task due to conflicting objectives, complex system structure, and uncertainties in the system. Real time control decisions suffer from streamflow forecast uncertainty. This study aims to use Probabilistic Streamflow Forecasts (PSFs having a lead-time up to 48 h as input for the recurrent reservoir operation problem. A related technique for decision making is multi-stage stochastic optimization using scenario trees, referred to as Tree-based Model Predictive Control (TB-MPC. Deterministic Streamflow Forecasts (DSFs are provided by applying random perturbations on perfect data. PSFs are synthetically generated from DSFs by a new approach which explicitly presents dynamic uncertainty evolution. We assessed different variables in the generation of stochasticity and compared the results using different scenarios. The developed real-time hourly flood control was applied to a test case which had limited reservoir storage and restricted downstream condition. According to hindcasting closed-loop experiment results, TB-MPC outperforms the deterministic counterpart in terms of decreased downstream flood risk according to different independent forecast scenarios. TB-MPC was also tested considering different number of tree branches, forecast horizons, and different inflow conditions. We conclude that using synthetic PSFs in TB-MPC can provide more robust solutions against forecast uncertainty by resolution of uncertainty in trees.

Non-Watson-Crick basepairing and hydration in RNA motifs: molecular dynamics of 5S rRNA loop E

Czech Academy of Sciences Publication Activity Database

Réblová, K.; Špačková, Naďa; Štefl, R.; Csaszar, K.; Koča, J.; Leontis, N. B.; Šponer, Jiří

2003-01-01

Roč. 84, č. 6 (2003), s. 3564-3582 ISSN 0006-3495 R&D Projects: GA MŠk LN00A016 Grant - others:National Institutes of Health(US) 2R15 GM55898; National Science Foundation(US) CHE-9732563 Institutional research plan: CEZ:AV0Z5004920 Keywords : non-Watson-Crick base pairs * ribosomal RNA * Loop E Subject RIV: BO - Biophysics Impact factor: 4.463, year: 2003

Real-time precision measuring device of tree diameter growth

Science.gov (United States)

Guo, Mingming; Chen, Aijun; Li, Dongsheng; Liu, Nan; Yao, Jingyuan

2016-01-01

DBH(diameter at breast height) is an important factor to reflect of the quality of plant growth, also an important parameter indispensable in forest resources inventory and forest carbon sink, the accurate measurement of DBH or not is directly related to the research of forest resources inventory and forest carbon sink. In this paper, the principle and the mathematical model of DBH measurement device were introduced, the fixture measuring device and the hardware circuit for this tree diameter were designed, the measurement software programs were compiled, and the precision measuring device of tree diameter growth was developed. Some experiments with Australia fir were conducted. Based on experiment data, the correlations among the DBH variation of Australian fir, the environment temperature, air humility and PAR(photosynthetically active radiation) were obtained. The effects of environmental parameters (environment temperature, air humility and PAR) on tree diameter were analyzed. Experimental results show that there is a positive correlation between DBH variation of Australian fir and environment temperature, a negative correlation between DBH variation of Australian fir and air humility , so is PAR.

The first example of a Hoogsteen base-paired DNA duplex in dynamic equilibrium with a Watson-Crick base-paired duplex--a structural (NMR), kinetic and thermodynamic study.

Science.gov (United States)

Isaksson, J; Zamaratski, E; Maltseva, T V; Agback, P; Kumar, A; Chattopadhyaya, J

2001-06-01

A single-point substitution of the O4' oxygen by a CH2 group at the sugar residue of A6 (i.e. 2'-deoxyaristeromycin moiety) in a self-complementary DNA duplex, 5'-d(C1G2C3G4A5A6T7T8C9G10C11G12)2(-3), has been shown to steer the fully Watson-Crick basepaired DNA duplex (1A), akin to the native counterpart, to a doubly A6:T7 Hoogsteen basepaired (1B) B-type DNA duplex, resulting in a dynamic equilibrium of (1A)(1B): Keq = k1/k(-1) = 0.56+/-0.08. The dynamic conversion of the fully Watson-Crick basepaired (1A) to the partly Hoogsteen basepaired (1B) structure is marginally kinetically and thermodynamically disfavoured [k1 (298K) = 3.9 0.8 sec(-1); deltaHdegrees++ = 164+/-14 kJ/mol; -TdeltaS degrees++ (298K) = -92 kJ/mol giving a deltaG degrees++ 298 of 72 kJ/mol. Ea (k1) = 167 14 kJ/mol] compared to the reverse conversion of the Hoogsteen (1B) to the Watson-Crick (1A) structure [k-1 (298K) = 7.0 0.6 sec-1, deltaH degrees++ = 153 13 kJ/mol; -TdeltaSdegrees++ (298K) = -82 kJ/mol giving a deltaGdegrees++(298) of 71 kJ/mol. Ea (k-1) = 155 13 kJ/mol]. Acomparison of deltaGdegrees++(298) of the forward (k1) and backward (k-1) conversions, (1A)(1B), shows that there is ca 1 kJ/mol preference for the Watson-Crick (1A) over the double Hoogsteen basepaired (1B) DNA duplex, thus giving an equilibrium ratio of almost 2:1 in favour of the fully Watson-Crick basepaired duplex. The chemical environments of the two interconverting DNA duplexes are very different as evident from their widely separated sets of chemical shifts connected by temperature-dependent exchange peaks in the NOESY and ROESY spectra. The fully Watson-Crick basepaired structure (1A) is based on a total of 127 intra, 97 inter and 17 cross-strand distance constraints per strand, whereas the double A6:T7 Hoogsteen basepaired (1B) structure is based on 114 intra, 92 inter and 15 cross-strand distance constraints, giving an average of 22 and 20 NOE distance constraints per residue and strand, respectively. In addition

A stochastic approach for automatic generation of urban drainage systems.

Science.gov (United States)

Möderl, M; Butler, D; Rauch, W

2009-01-01

Typically, performance evaluation of new developed methodologies is based on one or more case studies. The investigation of multiple real world case studies is tedious and time consuming. Moreover extrapolating conclusions from individual investigations to a general basis is arguable and sometimes even wrong. In this article a stochastic approach is presented to evaluate new developed methodologies on a broader basis. For the approach the Matlab-tool "Case Study Generator" is developed which generates a variety of different virtual urban drainage systems automatically using boundary conditions e.g. length of urban drainage system, slope of catchment surface, etc. as input. The layout of the sewer system is based on an adapted Galton-Watson branching process. The sub catchments are allocated considering a digital terrain model. Sewer system components are designed according to standard values. In total, 10,000 different virtual case studies of urban drainage system are generated and simulated. Consequently, simulation results are evaluated using a performance indicator for surface flooding. Comparison between results of the virtual and two real world case studies indicates the promise of the method. The novelty of the approach is that it is possible to get more general conclusions in contrast to traditional evaluations with few case studies.

Principles of RNA base pairing: Structures and energies of cis and trans-Watson-Crick/Sugar Edge base pairs revealed by quantum chemical calculations

Czech Academy of Sciences Publication Activity Database

Šponer, Judit E.; Leszczynski, J.; Šponer, Jiří

2005-01-01

Roč. 22, č. 6 (2005), s. 826 ISSN 0739-1102. [Albany 2005. Conversation /14./. 14.06.2005-18.06.2005, Albany] Institutional research plan: CEZ:AV0Z50040507 Keywords : RNA base pairing * DNA * Watson-Crick/Sugar Edge Subject RIV: BO - Biophysics

DFT investigation of the vibrational properties of GC Watson-Crick and Hoogsteen base pairs in the presence of Mg²⁺, Ca²⁺, and Cu²⁺ ions.

Science.gov (United States)

Morari, Cristian; Muntean, Cristina M; Tripon, Carmen; Buimaga-Iarinca, Luiza; Calborean, Adrian

2014-04-01

The binding effects of Mg²⁺, Ca²⁺, and Cu²⁺ ions on the vibrational properties of guanine-cytosine base pairs have been performed using density functional theory investigations. Both Watson-Crick and Hoogsteen configurations of the base pairs were investigated. In Watson-Crick configuration, the metal was coordinated at N7 atom of guanine, while in the case of Hoogsteen configuration, the coordination is at N3 atom of guanine. We have pointed out the geometric properties of the metal-GC base pairs structure, as well as the vibrational bands that can be used to detect the presence of metallic ions in the Watson-Crick and Hoogsteen GC structures. For the geometric models used by us, the vibrational amplitudes of metallic atoms were stronger for wavenumbers lower than 500 cm⁻¹. This suggests that in the experimental studies on DNA the presence of the three metallic atoms (Mg, Ca, and Cu) can be explicitly detected at low frequencies.

Tree Transduction Tools for Cdec

Directory of Open Access Journals (Sweden)

Austin Matthews

2014-09-01

Full Text Available We describe a collection of open source tools for learning tree-to-string and tree-to-tree transducers and the extensions to the cdec decoder that enable translation with these. Our modular, easy-to-extend tools extract rules from trees or forests aligned to strings and trees subject to different structural constraints. A fast, multithreaded implementation of the Cohn and Blunsom (2009 model for extracting compact tree-to-string rules is also included. The implementation of the tree composition algorithm used by cdec is described, and translation quality and decoding time results are presented. Our experimental results add to the body of evidence suggesting that tree transducers are a compelling option for translation, particularly when decoding speed and translation model size are important.

Measurement of {sup 14}C time scale of the rings of a tree by accelerator mass spectrometry

Energy Technology Data Exchange (ETDEWEB)

Oda, Hirotaka; Furukawa, Michiaki [Nagoya Univ. (Japan). School of Science; Yonenobu, Hitoshi; Ikeda, Akiko; Nakamura, Toshio

1996-12-01

{sup 14}C time scale is different from a histrical data in order that it is calculated by assuming that the concentration of {sup 14}C in the sample has not been changed by age. The object of this work is to make clear the errors in measurement of {sup 14}C time scale of the ring of a tree known the tree age. The every year ring of a Hinoki in Kiso, 950 years old, was used as a sample. The most external ring is determined as 1923 years old on the basis of the dendrochronology. The rings after 1120 years were used as the samples. {alpha}-cellulose, the most stable component in the structural components of cell of tree, was prepared from each ring. About 8 mg of {alpha}-cellulose was reduced to graphite to be measured by the tandem thoron analytic meter. The results obtained showed that {sup 14}C time scale was older than that of the histrical data in the twelfth and thirteenth century, but it was more new than that of the histrical data from the late seventeenth to the middle of eighteenth century. The results were agreement with that of Stuiver and Pearson (1933). (S.Y.)

Reconciliation of Gene and Species Trees

Directory of Open Access Journals (Sweden)

L. Y. Rusin

2014-01-01

Full Text Available The first part of the paper briefly overviews the problem of gene and species trees reconciliation with the focus on defining and algorithmic construction of the evolutionary scenario. Basic ideas are discussed for the aspects of mapping definitions, costs of the mapping and evolutionary scenario, imposing time scales on a scenario, incorporating horizontal gene transfers, binarization and reconciliation of polytomous trees, and construction of species trees and scenarios. The review does not intend to cover the vast diversity of literature published on these subjects. Instead, the authors strived to overview the problem of the evolutionary scenario as a central concept in many areas of evolutionary research. The second part provides detailed mathematical proofs for the solutions of two problems: (i inferring a gene evolution along a species tree accounting for various types of evolutionary events and (ii trees reconciliation into a single species tree when only gene duplications and losses are allowed. All proposed algorithms have a cubic time complexity and are mathematically proved to find exact solutions. Solving algorithms for problem (ii can be naturally extended to incorporate horizontal transfers, other evolutionary events, and time scales on the species tree.

Bounds on Average Time Complexity of Decision Trees

KAUST Repository

Chikalov, Igor

2011-01-01

In this chapter, bounds on the average depth and the average weighted depth of decision trees are considered. Similar problems are studied in search theory [1], coding theory [77], design and analysis of algorithms (e.g., sorting) [38]. For any

Evidence for Watson-Crick and not Hoogsteen or wobble base pairing in the selection of nucleotides for insertion opposite pyrimidines and a thymine dimer by yeast DNA pol eta.

Science.gov (United States)

Hwang, Hanshin; Taylor, John-Stephen

2005-03-29

We have recently reported that pyrene nucleotide is preferentially inserted opposite an abasic site, the 3'-T of a thymine dimer, and most undamaged bases by yeast DNA polymerase eta (pol eta). Because pyrene is a nonpolar molecule with no H-bonding ability, the unusually high efficiencies of dPMP insertion are ascribed to its superior base stacking ability, and underscore the importance of base stacking in the selection of nucleotides by pol eta. To investigate the role of H-bonding and base pair geometry in the selection of nucleotides by pol eta, we determined the insertion efficiencies of the base-modified nucleotides 2,6-diaminopurine, 2-aminopurine, 6-chloropurine, and inosine which would make a different number of H-bonds with the template base depending on base pair geometry. Watson-Crick base pairing appears to play an important role in the selection of nucleotide analogues for insertion opposite C and T as evidenced by the decrease in the relative insertion efficiencies with a decrease in the number of Watson-Crick H-bonds and an increase in the number of donor-donor and acceptor-acceptor interactions. The selectivity of nucleotide insertion is greater opposite the 5'-T than the 3'-T of the thymine dimer, in accord with previous work suggesting that the 5'-T is held more rigidly than the 3'-T. Furthermore, insertion of A opposite both Ts of the dimer appears to be mediated by Watson-Crick base pairing and not by Hoogsteen base pairing based on the almost identical insertion efficiencies of A and 7-deaza-A, the latter of which lacks H-bonding capability at N7. The relative efficiencies for insertion of nucleotides that can form Watson-Crick base pairs parallel those for the Klenow fragment, whereas the Klenow fragment more strongly discriminates against mismatches, in accord with its greater shape selectivity. These results underscore the importance of H-bonding and Watson-Crick base pair geometry in the selection of nucleotides by both pol eta and the

Minimum variance rooting of phylogenetic trees and implications for species tree reconstruction.

Science.gov (United States)

Mai, Uyen; Sayyari, Erfan; Mirarab, Siavash

2017-01-01

Phylogenetic trees inferred using commonly-used models of sequence evolution are unrooted, but the root position matters both for interpretation and downstream applications. This issue has been long recognized; however, whether the potential for discordance between the species tree and gene trees impacts methods of rooting a phylogenetic tree has not been extensively studied. In this paper, we introduce a new method of rooting a tree based on its branch length distribution; our method, which minimizes the variance of root to tip distances, is inspired by the traditional midpoint rerooting and is justified when deviations from the strict molecular clock are random. Like midpoint rerooting, the method can be implemented in a linear time algorithm. In extensive simulations that consider discordance between gene trees and the species tree, we show that the new method is more accurate than midpoint rerooting, but its relative accuracy compared to using outgroups to root gene trees depends on the size of the dataset and levels of deviations from the strict clock. We show high levels of error for all methods of rooting estimated gene trees due to factors that include effects of gene tree discordance, deviations from the clock, and gene tree estimation error. Our simulations, however, did not reveal significant differences between two equivalent methods for species tree estimation that use rooted and unrooted input, namely, STAR and NJst. Nevertheless, our results point to limitations of existing scalable rooting methods.

Environmental fate of emamectin benzoate after tree micro injection of horse chestnut trees.

Science.gov (United States)

Burkhard, Rene; Binz, Heinz; Roux, Christian A; Brunner, Matthias; Ruesch, Othmar; Wyss, Peter

2015-02-01

Emamectin benzoate, an insecticide derived from the avermectin family of natural products, has a unique translocation behavior in trees when applied by tree micro injection (TMI), which can result in protection from insect pests (foliar and borers) for several years. Active ingredient imported into leaves was measured at the end of season in the fallen leaves of treated horse chestnut (Aesculus hippocastanum) trees. The dissipation of emamectin benzoate in these leaves seems to be biphasic and depends on the decomposition of the leaf. In compost piles, where decomposition of leaves was fastest, a cumulative emamectin benzoate degradation half-life time of 20 d was measured. In leaves immersed in water, where decomposition was much slower, the degradation half-life time was 94 d, and in leaves left on the ground in contact with soil, where decomposition was slowest, the degradation half-life time was 212 d. The biphasic decline and the correlation with leaf decomposition might be attributed to an extensive sorption of emamectin benzoate residues to leaf macromolecules. This may also explain why earthworms ingesting leaves from injected trees take up very little emamectin benzoate and excrete it with the feces. Furthermore, no emamectin benzoate was found in water containing decomposing leaves from injected trees. It is concluded, that emamectin benzoate present in abscised leaves from horse chestnut trees injected with the insecticide is not available to nontarget organisms present in soil or water bodies. Published 2014 SETAC.

TreeMAC: Localized TDMA MAC protocol for real-time high-data-rate sensor networks

Science.gov (United States)

Song, W.-Z.; Huang, R.; Shirazi, B.; Husent, R.L.

2009-01-01

Earlier sensor network MAC protocols focus on energy conservation in low-duty cycle applications, while some recent applications involve real-time high-data-rate signals. This motivates us to design an innovative localized TDMA MAC protocol to achieve high throughput and low congestion in data collection sensor networks, besides energy conservation. TreeMAC divides a time cycle into frames and frame into slots. Parent determines children's frame assigmnent based on their relative bandwidth demand, and each node calculates its own slot assignment based on its hop-count to the sink. This innovative 2-dimensional frame-slot assignment algorithm has the following nice theory properties. Firstly, given any node, at any time slot, there is at most one active sender in its neighborhood (includ ing itself). Secondly, the packet scheduling with TreelMAC is bufferless, which therefore minimizes the probability of network congestion. Thirdly, the data throughput to gateway is at least 1/3 of the optimum assuming reliable links. Our experiments on a 24 node test bed demonstrate that TreeMAC protocol significantly improves network throughput and energy efficiency, by comparing to the TinyOS's default CSMA MAC protocol and a recent TDMA MAC protocol Funneling-MAC[8]. ?? 2009 IEEE.

The Efficacy of Consensus Tree Methods for Summarizing Phylogenetic Relationships from a Posterior Sample of Trees Estimated from Morphological Data.

Science.gov (United States)

O'Reilly, Joseph E; Donoghue, Philip C J

2018-03-01

Consensus trees are required to summarize trees obtained through MCMC sampling of a posterior distribution, providing an overview of the distribution of estimated parameters such as topology, branch lengths, and divergence times. Numerous consensus tree construction methods are available, each presenting a different interpretation of the tree sample. The rise of morphological clock and sampled-ancestor methods of divergence time estimation, in which times and topology are coestimated, has increased the popularity of the maximum clade credibility (MCC) consensus tree method. The MCC method assumes that the sampled, fully resolved topology with the highest clade credibility is an adequate summary of the most probable clades, with parameter estimates from compatible sampled trees used to obtain the marginal distributions of parameters such as clade ages and branch lengths. Using both simulated and empirical data, we demonstrate that MCC trees, and trees constructed using the similar maximum a posteriori (MAP) method, often include poorly supported and incorrect clades when summarizing diffuse posterior samples of trees. We demonstrate that the paucity of information in morphological data sets contributes to the inability of MCC and MAP trees to accurately summarise of the posterior distribution. Conversely, majority-rule consensus (MRC) trees represent a lower proportion of incorrect nodes when summarizing the same posterior samples of trees. Thus, we advocate the use of MRC trees, in place of MCC or MAP trees, in attempts to summarize the results of Bayesian phylogenetic analyses of morphological data.

Impact of the timing and duration of weed control on the establishment of a rubber tree plantation.

Science.gov (United States)

Guzzo, Caio D; Carvalho, Leonardo B de; Giancotti, Paulo R F; Alves, Pedro L C A; Gonçalves, Elaine C P; Martins, José V F

2014-03-01

Rubber tree production is reduced by weeds that compete for environmental resources; therefore, the timing and duration of weed control influences weed interference. The objectives of this study were to evaluate the growth of rubber tree (Hevea brasiliensis) plants, to determine the critical period for weed control, and to evaluate the growth recovery of rubber trees that coexisted with weeds for different periods of time after planting. Two groups of treatments were established under field conditions in the first year of the investigation: one group contained crescent periods of weed infestation, while the other contained crescent periods of weed control, also including a weed-free check and a total weedy check. In the second year of the investigation, the weeds were totally controlled. Urochloa decumbens was the dominant weed (over 90% groundcover). Crop growth was greatly reduced due to the weed interference. Plant height decreased more rapidly than did any other characteristic. Plant height, leaf dry mass, and leaf area decreased by 99%, 97% and 96%, respectively, and were the most reduced characteristics. Plant height also recovered more rapidly than did any characteristic when the period of weed control was lengthened. However, stem dry mass increased by 750%, making it the most recovered characteristic. The critical period for weed control was between 4 and 9½ months after planting in the first year; however, the rubber trees showed an expressive growth recovery when the weeds were controlled throughout the second year.

Skewed Binary Search Trees

DEFF Research Database (Denmark)

Brodal, Gerth Stølting; Moruz, Gabriel

2006-01-01

It is well-known that to minimize the number of comparisons a binary search tree should be perfectly balanced. Previous work has shown that a dominating factor over the running time for a search is the number of cache faults performed, and that an appropriate memory layout of a binary search tree...... can reduce the number of cache faults by several hundred percent. Motivated by the fact that during a search branching to the left or right at a node does not necessarily have the same cost, e.g. because of branch prediction schemes, we in this paper study the class of skewed binary search trees....... For all nodes in a skewed binary search tree the ratio between the size of the left subtree and the size of the tree is a fixed constant (a ratio of 1/2 gives perfect balanced trees). In this paper we present an experimental study of various memory layouts of static skewed binary search trees, where each...

El relato de la experiencia depresiva: Aplicando los factores cuidativos de Jean Watson The expression of the depressive experience: the application of Jean Watson caring factors

Directory of Open Access Journals (Sweden)

Carme Ferré-Grau

2008-03-01

Full Text Available La elevada frecuencia de personas con trastornos depresivos en todos los niveles de atención y la complejidad de los cuidados, conlleva la necesidad, para la enfermera, de desarrollar nuevas habilidades y competencias en el abordaje integral de los pacientes y su familia. Para la comprensión de una persona con depresión es útil una mirada etnográfica que nos permita conocer la expresión subjetiva de la vivencia de la enfermedad. Un marco adecuado de referencia para ayudar en el cuidado de estos procesos es la teoría de Jean Watson sobre la Filosofía y Ciencia de los Cuidados Humanos, que a través de sus diez factores cuidativos enmarca el rol de la enfermera en "cómo tener cuidado de...". Este artículo trata de analizar, a través de los factores cuidativos de Watson, las vivencias subjetivas relacionadas con la transformación del cuerpo y la mente de las personas con depresión: el sufrimiento y el dolor, la autoimagen y el reconocimiento, la falta de energía, la pérdida de la esperanza. Se concluye que no es posible controlar el cuerpo sin controlar la mente y para ello nos puede ayudar el análisis subjetivo de la experiencia y la aplicación de los factores cuidativos.The high frequency of people with depressive disorders in Primary Health Care as well as in Hospital and the complexity of care, carry for nurses the need to develop new skills and competences to deal with complete care of patiens and families. To understand a person suffering depressive disorders may be useful an ethnographic look that let us know the subjective expression of the experience of being ill. An appropriate framework to help care is Jean Watson’s Philosophy and Science of Human Caring, trough 10 caring factors that frame the nursing role "to take care of…". This paper tries to analyze the subjective experience related to body and mind changes: suffering and pain, self-image and acceptance, lack of energy, loss of hope… in patients with

Moose?tree interactions: rebrowsing is common across tree species

OpenAIRE

Mathisen, Karen Marie; Milner, Jos M.; Skarpe, Christina

2017-01-01

Background Plant strategies to resist herbivory include tolerance and avoidance. Tolerance strategies, such as rapid regrowth which increases the palatability of new shoots, can lead to positive feedback loops between plants and herbivores. An example of such a positive feedback occurs when moose (Alces alces) browse trees in boreal forests. We described the degree of change in tree morphology that accumulated over time in response to repeated browsing by moose, using an index of accumulated ...

Case study: IBM Watson Analytics cloud platform as Analytics-as-a-Service system for heart failure early detection

OpenAIRE

Guidi, Gabriele; Miniati, Roberto; Mazzola, Matteo; Iadanza, Ernesto

2016-01-01

In the recent years the progress in technology and the increasing availability of fast connections have produced a migration of functionalities in Information Technologies services, from static servers to distributed technologies. This article describes the main tools available on the market to perform Analytics as a Service (AaaS) using a cloud platform. It is also described a use case of IBM Watson Analytics, a cloud system for data analytics, applied to the following research scope: detect...

Relating phylogenetic trees to transmission trees of infectious disease outbreaks.

Science.gov (United States)

Ypma, Rolf J F; van Ballegooijen, W Marijn; Wallinga, Jacco

2013-11-01

Transmission events are the fundamental building blocks of the dynamics of any infectious disease. Much about the epidemiology of a disease can be learned when these individual transmission events are known or can be estimated. Such estimations are difficult and generally feasible only when detailed epidemiological data are available. The genealogy estimated from genetic sequences of sampled pathogens is another rich source of information on transmission history. Optimal inference of transmission events calls for the combination of genetic data and epidemiological data into one joint analysis. A key difficulty is that the transmission tree, which describes the transmission events between infected hosts, differs from the phylogenetic tree, which describes the ancestral relationships between pathogens sampled from these hosts. The trees differ both in timing of the internal nodes and in topology. These differences become more pronounced when a higher fraction of infected hosts is sampled. We show how the phylogenetic tree of sampled pathogens is related to the transmission tree of an outbreak of an infectious disease, by the within-host dynamics of pathogens. We provide a statistical framework to infer key epidemiological and mutational parameters by simultaneously estimating the phylogenetic tree and the transmission tree. We test the approach using simulations and illustrate its use on an outbreak of foot-and-mouth disease. The approach unifies existing methods in the emerging field of phylodynamics with transmission tree reconstruction methods that are used in infectious disease epidemiology.

MixtureTree annotator: a program for automatic colorization and visual annotation of MixtureTree.

Directory of Open Access Journals (Sweden)

Shu-Chuan Chen

Full Text Available The MixtureTree Annotator, written in JAVA, allows the user to automatically color any phylogenetic tree in Newick format generated from any phylogeny reconstruction program and output the Nexus file. By providing the ability to automatically color the tree by sequence name, the MixtureTree Annotator provides a unique advantage over any other programs which perform a similar function. In addition, the MixtureTree Annotator is the only package that can efficiently annotate the output produced by MixtureTree with mutation information and coalescent time information. In order to visualize the resulting output file, a modified version of FigTree is used. Certain popular methods, which lack good built-in visualization tools, for example, MEGA, Mesquite, PHY-FI, TreeView, treeGraph and Geneious, may give results with human errors due to either manually adding colors to each node or with other limitations, for example only using color based on a number, such as branch length, or by taxonomy. In addition to allowing the user to automatically color any given Newick tree by sequence name, the MixtureTree Annotator is the only method that allows the user to automatically annotate the resulting tree created by the MixtureTree program. The MixtureTree Annotator is fast and easy-to-use, while still allowing the user full control over the coloring and annotating process.

Human action analysis with randomized trees

CERN Document Server

Yu, Gang; Liu, Zicheng

2014-01-01

This book will provide a comprehensive overview on human action analysis with randomized trees. It will cover both the supervised random trees and the unsupervised random trees. When there are sufficient amount of labeled data available, supervised random trees provides a fast method for space-time interest point matching. When labeled data is minimal as in the case of example-based action search, unsupervised random trees is used to leverage the unlabelled data. We describe how the randomized trees can be used for action classification, action detection, action search, and action prediction.

Can tautomerization of the A·T Watson-Crick base pair via double proton transfer provoke point mutations during DNA replication? A comprehensive QM and QTAIM analysis.

Science.gov (United States)

Brovarets, Ol'ha O; Hovorun, Dmytro M

2014-01-01

Trying to answer the question posed in the title, we have carried out a detailed theoretical investigation of the biologically important mechanism of the tautomerization of the A·T Watson-Crick DNA base pair, information that is hard to establish experimentally. By combining theoretical investigations at the MP2 and density functional theory levels of QM theory with quantum theory of atoms in molecules analysis, the tautomerization of the A·T Watson-Crick base pair by the double proton transfer (DPT) was comprehensively studied in vacuo and in the continuum with a low dielectric constant (ϵ = 4) corresponding to a hydrophobic interfaces of protein-nucleic acid interactions. Based on the sweeps of the electron-topological, geometric, and energetic parameters, which describe the course of the tautomerization along its intrinsic reaction coordinate (IRC), it was proved that the A·T → A(∗)·T(∗) tautomerization through the DPT is a concerted (i.e. the pathway without an intermediate) and asynchronous (i.e. protons move with a time gap) process. The limiting stage of this phenomenon is the final PT along the N6H⋯O4 hydrogen bond (H-bond). The continuum with ϵ = 4 does not affect qualitatively the course of the tautomerization reaction: similar to that observed in vacuo, it proceeds via a concerted asynchronous process with the same structure of the transition state (TS). For the first time, the nine key points along the IRC of the A·T base pair tautomerization, which could be considered as electron-topological "fingerprints" of a concerted asynchronous process of the tautomerization via the DPT, have been identified and fully characterized. These nine key points have been used to define the reactant, TS, and product regions of the DPT in the A·T base pair. Considering the energy dependence of each of the three H-bonds, which stabilize the Watson-Crick and Löwdin's base pairs, along the IRC of the tautomerization, it was found that all these H

Representing Boolean Functions by Decision Trees

KAUST Repository

Chikalov, Igor

2011-01-01

A Boolean or discrete function can be represented by a decision tree. A compact form of decision tree named binary decision diagram or branching program is widely known in logic design [2, 40]. This representation is equivalent to other forms, and in some cases it is more compact than values table or even the formula [44]. Representing a function in the form of decision tree allows applying graph algorithms for various transformations [10]. Decision trees and branching programs are used for effective hardware [15] and software [5] implementation of functions. For the implementation to be effective, the function representation should have minimal time and space complexity. The average depth of decision tree characterizes the expected computing time, and the number of nodes in branching program characterizes the number of functional elements required for implementation. Often these two criteria are incompatible, i.e. there is no solution that is optimal on both time and space complexity. © Springer-Verlag Berlin Heidelberg 2011.

Modeling the effects of tree species and incubation temperature on soil's extracellular enzyme activity in 78-year-old tree plantations

Science.gov (United States)

Zhou, Xiaoqi; Wang, Shen S. J.; Chen, Chengrong

2017-12-01

Forest plantations have been widely used as an effective measure for increasing soil carbon (C), and nitrogen (N) stocks and soil enzyme activities play a key role in soil C and N losses during decomposition of soil organic matter. However, few studies have been carried out to elucidate the mechanisms behind the differences in soil C and N cycling by different tree species in response to climate warming. Here, we measured the responses of soil's extracellular enzyme activity (EEA) to a gradient of temperatures using incubation methods in 78-year-old forest plantations with different tree species. Based on a soil enzyme kinetics model, we established a new statistical model to investigate the effects of temperature and tree species on soil EEA. In addition, we established a tree species-enzyme-C/N model to investigate how temperature and tree species influence soil C/N contents over time without considering plant C inputs. These extracellular enzymes included C acquisition enzymes (β-glucosidase, BG), N acquisition enzymes (N-acetylglucosaminidase, NAG; leucine aminopeptidase, LAP) and phosphorus acquisition enzymes (acid phosphatases). The results showed that incubation temperature and tree species significantly influenced all soil EEA and Eucalyptus had 1.01-2.86 times higher soil EEA than coniferous tree species. Modeling showed that Eucalyptus had larger soil C losses but had 0.99-2.38 times longer soil C residence time than the coniferous tree species over time. The differences in the residual soil C and N contents between Eucalyptus and coniferous tree species, as well as between slash pine (Pinus elliottii Engelm. var. elliottii) and hoop pine (Araucaria cunninghamii Ait.), increase with time. On the other hand, the modeling results help explain why exotic slash pine can grow faster, as it has 1.22-1.38 times longer residual soil N residence time for LAP, which mediate soil N cycling in the long term, than native coniferous tree species like hoop pine and

Modeling the effects of tree species and incubation temperature on soil's extracellular enzyme activity in 78-year-old tree plantations

Directory of Open Access Journals (Sweden)

X. Zhou

2017-12-01

Full Text Available Forest plantations have been widely used as an effective measure for increasing soil carbon (C, and nitrogen (N stocks and soil enzyme activities play a key role in soil C and N losses during decomposition of soil organic matter. However, few studies have been carried out to elucidate the mechanisms behind the differences in soil C and N cycling by different tree species in response to climate warming. Here, we measured the responses of soil's extracellular enzyme activity (EEA to a gradient of temperatures using incubation methods in 78-year-old forest plantations with different tree species. Based on a soil enzyme kinetics model, we established a new statistical model to investigate the effects of temperature and tree species on soil EEA. In addition, we established a tree species–enzyme–C∕N model to investigate how temperature and tree species influence soil C∕N contents over time without considering plant C inputs. These extracellular enzymes included C acquisition enzymes (β-glucosidase, BG, N acquisition enzymes (N-acetylglucosaminidase, NAG; leucine aminopeptidase, LAP and phosphorus acquisition enzymes (acid phosphatases. The results showed that incubation temperature and tree species significantly influenced all soil EEA and Eucalyptus had 1.01–2.86 times higher soil EEA than coniferous tree species. Modeling showed that Eucalyptus had larger soil C losses but had 0.99–2.38 times longer soil C residence time than the coniferous tree species over time. The differences in the residual soil C and N contents between Eucalyptus and coniferous tree species, as well as between slash pine (Pinus elliottii Engelm. var. elliottii and hoop pine (Araucaria cunninghamii Ait., increase with time. On the other hand, the modeling results help explain why exotic slash pine can grow faster, as it has 1.22–1.38 times longer residual soil N residence time for LAP, which mediate soil N cycling in the long term, than native

Tree-inception in PMMA with a barrier

International Nuclear Information System (INIS)

Gefle, O S; Lebedev, S M; Pokholkov, Y P; Gockenbach, E; Borsi, H

2004-01-01

The experimental results of a study of the tree-inception phenomenon for three-layer dielectrics in a divergent field are presented in this paper. It is shown that the tree-inception time depends on both the position of the high-permittivity barrier in the insulating gap and the ratio of the permittivities of the barrier material and main dielectric, and that it has a maximum at the optimal barrier position. It is found that the tree-inception length has a minimum value at this barrier position. Good agreement between the coefficient of the local field non-uniformity and the tree-inception time or the initial tree length was found

Teoria do cuidado transpessoal de jean watson no cuidado domiciliar de enfermagem a crianca: uma reflexao

Directory of Open Access Journals (Sweden)

Ingrid Meireles Gomes

2013-09-01

Full Text Available Trata-se de um ensaio reflexivo sobre o potencial de utilização da Teoria do Cuidado Transpessoal de Jean Watson, na realização do cuidado domiciliar de enfermagem direcionado à criança, desenvolvido à luz dos 10 elementos do Processo Clinical Caritas. Este referencial teórico permite desenvolver a transpessoalidade no cuidado domiciliar da criança, momento em que o enfermeiro precisa desenvolver autoconhecimento, ter suporte teórico-filosófico e valer-se deste conhecimento, a fim de ultrapassar o paradigma da objetividade e do biologicismo.

Rediscovering the art of healing connection by creating the Tree of Life poster.

Science.gov (United States)

Pipe, Teri Britt; Mishark, Kenneth; Hansen, Reverend Patrick; Hentz, Joseph G; Hartsell, Zachary

2010-06-01

The goal of this project was to provide a way for hospital staff to form meaningful therapeutic relationships with patients in the fast-paced hospital environment. Watson's Theory of Human Caring was the framework guiding the project. The Lifestory intervention was a Tree of Life poster depicting sources of encouragement and enjoyment, special memories, life lessons, family, and roots. Preintervention and postintervention measures included quality of life (QOL) and spirituality scales with established psychometrics. A one-sample t test was used to analyze data. Mean age of participants (n = 15) was 73.8. Ten (67%) patients reported the intervention positively affected their QOL. Improvements were noted in overall QOL (p = 0.05), as well as emotional (p = 0.005), physical (p = 0.02,) and spiritual well-being, as measured by the Expanded Version of the Functional Assessment of Chronic Illness Therapy-Spiritual Well-Being Scale (p = 0.02). This simple Lifestory intervention was feasible and associated with improvement in several QOL dimensions in hospitalized older adults. Copyright 2010, SLACK Incorporated.

Identifying the rooted species tree from the distribution of unrooted gene trees under the coalescent.

Science.gov (United States)

Allman, Elizabeth S; Degnan, James H; Rhodes, John A

2011-06-01

Gene trees are evolutionary trees representing the ancestry of genes sampled from multiple populations. Species trees represent populations of individuals-each with many genes-splitting into new populations or species. The coalescent process, which models ancestry of gene copies within populations, is often used to model the probability distribution of gene trees given a fixed species tree. This multispecies coalescent model provides a framework for phylogeneticists to infer species trees from gene trees using maximum likelihood or Bayesian approaches. Because the coalescent models a branching process over time, all trees are typically assumed to be rooted in this setting. Often, however, gene trees inferred by traditional phylogenetic methods are unrooted. We investigate probabilities of unrooted gene trees under the multispecies coalescent model. We show that when there are four species with one gene sampled per species, the distribution of unrooted gene tree topologies identifies the unrooted species tree topology and some, but not all, information in the species tree edges (branch lengths). The location of the root on the species tree is not identifiable in this situation. However, for 5 or more species with one gene sampled per species, we show that the distribution of unrooted gene tree topologies identifies the rooted species tree topology and all its internal branch lengths. The length of any pendant branch leading to a leaf of the species tree is also identifiable for any species from which more than one gene is sampled.

Robonaut 2 and Watson: Cognitive Dexterity for Future Exploration

Science.gov (United States)

Badger, Julia M.; Strawser, Philip; Farrell, Logan; Goza, S. Michael; Claunch, Charles A.; Chancey, Raphael; Potapinski, Russell

2018-01-01

Future exploration missions will dictate a level of autonomy never before experienced in human spaceflight. Mission plans involving the uncrewed phases of complex human spacecraft in deep space will require a coordinated autonomous capability to be able to maintain the spacecraft when ground control is not available. One promising direction involves embedding intelligence into the system design both through the employment of state-of-the-art system engineering principles as well as through the creation of a cognitive network between a smart spacecraft or habitat and embodiments of cognitive agents. The work described here details efforts to integrate IBM's Watson and other cognitive computing services into NASA Johnson Space Center (JSC)'s Robonaut 2 (R2) anthropomorphic robot. This paper also discusses future directions this work will take. A cognitive spacecraft management system that is able to seamlessly collect data from subsystems, determine corrective actions, and provide commands to enable those actions is the end goal. These commands could be to embedded spacecraft systems or to a set of robotic assets that are tied into the cognitive system. An exciting collaboration with Woodside provides a promising Earth-bound testing analog, as controlling and maintaining not normally manned off-shore platforms have similar constraints to the space missions described.

Categorizing ideas about trees: a tree of trees.

Science.gov (United States)

Fisler, Marie; Lecointre, Guillaume

2013-01-01

The aim of this study is to explore whether matrices and MP trees used to produce systematic categories of organisms could be useful to produce categories of ideas in history of science. We study the history of the use of trees in systematics to represent the diversity of life from 1766 to 1991. We apply to those ideas a method inspired from coding homologous parts of organisms. We discretize conceptual parts of ideas, writings and drawings about trees contained in 41 main writings; we detect shared parts among authors and code them into a 91-characters matrix and use a tree representation to show who shares what with whom. In other words, we propose a hierarchical representation of the shared ideas about trees among authors: this produces a "tree of trees." Then, we categorize schools of tree-representations. Classical schools like "cladists" and "pheneticists" are recovered but others are not: "gradists" are separated into two blocks, one of them being called here "grade theoreticians." We propose new interesting categories like the "buffonian school," the "metaphoricians," and those using "strictly genealogical classifications." We consider that networks are not useful to represent shared ideas at the present step of the study. A cladogram is made for showing who is sharing what with whom, but also heterobathmy and homoplasy of characters. The present cladogram is not modelling processes of transmission of ideas about trees, and here it is mostly used to test for proximity of ideas of the same age and for categorization.

Drying of firewood - the effect of harvesting time, tree species and shelter of stacked wood

International Nuclear Information System (INIS)

Nord-Larsen, Thomas; Bergstedt, Andreas; Farver, Ole; Heding, Niels

2011-01-01

Firewood represents a renewable source of energy and is the main source of energy for about half the World's population. When burning firewood in domestic stoves, combustion and thus energy efficiency is dependent on the moisture content of the wood. In Denmark, it is generally recommended that moisture content should be no more than 180 g kg -1 total weight. This study aims to assess the effect of species, harvesting time and shelter on the drying of stacked firewood. After felling, the moisture content declined to a relative stable level for all species. The rate of drying depended on the felling time, tree species, and the presence of shelter. The lower asymptotic moisture content depended mainly on the presence of shelter and averaged 188 g kg -1 total weight for frames left in the open and 154 g kg -1 total weight for frames covered by a shelter. It is concluded that Norway spruce felled during the early summer may obtain an acceptable moisture content at the onset of the heating season. Deciduous trees should be felled during the winter or early spring and stored under shelter to be suitable for burning before the heating season. Shelter was found to be of great importance to maintain an acceptable moisture content of firewood in storage during winter. -- Highlights: → Firewood is the main source of energy for about half the World's population. → The moisture content of firewood should be no more than 18% of total weight. → Drying rate depended on the felling time, tree species, and the presence of shelter. → Lower asymptotic moisture content depended mainly on the presence of a shelter. → Sheltered storage is very important to maintain an acceptable moisture content of the firewood.

Extraction of Phrase-Structure Fragments with a Linear Average Time Tree-Kernel

NARCIS (Netherlands)

van Cranenburgh, Andreas

2014-01-01

We present an algorithm and implementation for extracting recurring fragments from treebanks. Using a tree-kernel method the largest common fragments are extracted from each pair of trees. The algorithm presented achieves a thirty-fold speedup over the previously available method on the Wall Street

Application of Goal Tree-Success Tree model as the knowledge-base of operator advisory systems

International Nuclear Information System (INIS)

Kim, I.S.; Modarres, M.

1987-01-01

The most important portion of an expert system development is the articulation of knowledge by the expert and its satisfactory formulation in a suitable knowledge representation scheme for mechanization by a computer. A 'deep knowledge' approach called Goal Tree-Success Tree model is devised to represent complex dynamic domain knowledge. This approach can hierarchically model the underlying principles of a given process domain (for example nuclear power plant operations domain). The Goal Tree-Success Tree can then be used to represent the knowledge-base and provide means of selecting an efficient search routine in the inference engine of an expert system. A prototype expert system has been developed to demonstrate the method. This expert system models the operation of a typical system used in the pressurized water reactors. The expert system is modeled for real-time operations if an interface between plant parameters and the expert system is established. The real-time operation provides an ability to quickly remedy minor disturbances that can quickly lead to a system malfunction or trip. A description of both the Goal Tree-Success Tree model and the prototype expert system is presented. (orig.)

Tautomeric transition between wobble A·C DNA base mispair and Watson-Crick-like A·C* mismatch: microstructural mechanism and biological significance.

Science.gov (United States)

Brovarets', Ol'ha O; Hovorun, Dmytro M

2015-06-21

Here, we use MP2/DFT quantum-chemical methods combined with Quantum Theory of Atoms in Molecules to study the tautomeric transition between wobble A·C(w) mismatch and Watson-Crick-like A·C*(WC) base mispair, proceeding non-dissociatively via sequential proton transfer between bases through the planar, highly stable and zwitterionic TS(A∙C-)(A∙C(W)A∙C&(WC)) transition state joined by the participation of (A)N6(+)H∙∙∙N4(-)(C), (A)N1(+)H∙∙∙N4(-)(C) and (A)C2(+)H∙∙∙N3(-)(C) H-bonds. Notably, the A·C(w) ↔ A·C*(WC) tautomerization reaction is accompanied by 10 unique patterns of the specific intermolecular interactions that consistently replace each other. Our data suggest that biologically significant A·C(w) → A·C*(WC) tautomerization is a kinetically controlled pathway for formation of the enzymatically competent Watson-Crick-like A·C*(WC) DNA base mispair in the essentially hydrophobic recognition pocket of the high-fidelity DNA-polymerase, responsible for the occurrence of spontaneous point AC/CA incorporation errors during DNA biosynthesis.

Phylogenetic search through partial tree mixing

Science.gov (United States)

2012-01-01

Background Recent advances in sequencing technology have created large data sets upon which phylogenetic inference can be performed. Current research is limited by the prohibitive time necessary to perform tree search on a reasonable number of individuals. This research develops new phylogenetic algorithms that can operate on tens of thousands of species in a reasonable amount of time through several innovative search techniques. Results When compared to popular phylogenetic search algorithms, better trees are found much more quickly for large data sets. These algorithms are incorporated in the PSODA application available at http://dna.cs.byu.edu/psoda Conclusions The use of Partial Tree Mixing in a partition based tree space allows the algorithm to quickly converge on near optimal tree regions. These regions can then be searched in a methodical way to determine the overall optimal phylogenetic solution. PMID:23320449

Differences in xylogenesis between dominant and suppressed trees.

Science.gov (United States)

Liu, Shushan; Li, Xiaoxia; Rossi, Sergio; Wang, Lily; Li, Wei; Liang, Eryuan; Leavitt, Steven W

2018-05-01

Most dendroecological studies focus on dominant trees, but little is known about the growing season of trees belonging to different size classes and their sensitivity to biotic factors. The objective of this study was to compare the dynamics of xylem formation between dominant and suppressed trees of Abies fabri of similar age growing in the Gongga Mountains, southeastern Tibetan Plateau, and to identify the association between xylem growth and climate. The timing and duration of xylogenesis in histological sections were investigated weekly during the 2013-2015 growing seasons. Our investigation found that timing and duration of xylogenesis varied with canopy position and its associated tree size. Xylogenesis started 6-14 days earlier, and ended 5-11 days later in dominant trees than in suppressed trees, resulting in a significantly longer growing season. Dominant trees also exhibited higher temperature sensitivity of tracheid production rate than suppressed trees. The observed differences in xylogenesis among trees suggested that competition affects tree growth by reducing the growing period in suppressed trees. Representative climate-growth relationships should involve trees of all size classes when evaluating the effects of the environment on forest dynamics. © 2018 Botanical Society of America.

Structural variability and the nature of intermolecular interactions in Watson-Crick B-DNA base pairs.

Science.gov (United States)

Czyznikowska, Z; Góra, R W; Zaleśny, R; Lipkowski, P; Jarzembska, K N; Dominiak, P M; Leszczynski, J

2010-07-29

A set of nearly 100 crystallographic structures was analyzed using ab initio methods in order to verify the effect of the conformational variability of Watson-Crick guanine-cytosine and adenine-thymine base pairs on the intermolecular interaction energy and its components. Furthermore, for the representative structures, a potential energy scan of the structural parameters describing mutual orientation of the base pairs was carried out. The results were obtained using the hybrid variational-perturbational interaction energy decomposition scheme. The electron correlation effects were estimated by means of the second-order Møller-Plesset perturbation theory and coupled clusters with singles and doubles method adopting AUG-cc-pVDZ basis set. Moreover, the characteristics of hydrogen bonds in complexes, mimicking those appearing in B-DNA, were evaluated using topological analysis of the electron density. Although the first-order electrostatic energy is usually the largest stabilizing component, it is canceled out by the associated exchange repulsion in majority of the studied crystallographic structures. Therefore, the analyzed complexes of the nucleic acid bases appeared to be stabilized mainly by the delocalization component of the intermolecular interaction energy which, in terms of symmetry adapted perturbation theory, encompasses the second- and higher-order induction and exchange-induction terms. Furthermore, it was found that the dispersion contribution, albeit much smaller in terms of magnitude, is also a vital stabilizing factor. It was also revealed that the intermolecular interaction energy and its components are strongly influenced by four (out of six) structural parameters describing mutual orientation of bases in Watson-Crick pairs, namely shear, stagger, stretch, and opening. Finally, as a part of a model study, much of the effort was devoted to an extensive testing of the UBDB databank. It was shown that the databank quite successfully reproduces the

Decision-Tree Formulation With Order-1 Lateral Execution

Science.gov (United States)

James, Mark

2007-01-01

A compact symbolic formulation enables mapping of an arbitrarily complex decision tree of a certain type into a highly computationally efficient multidimensional software object. The type of decision trees to which this formulation applies is that known in the art as the Boolean class of balanced decision trees. Parallel lateral slices of an object created by means of this formulation can be executed in constant time considerably less time than would otherwise be required. Decision trees of various forms are incorporated into almost all large software systems. A decision tree is a way of hierarchically solving a problem, proceeding through a set of true/false responses to a conclusion. By definition, a decision tree has a tree-like structure, wherein each internal node denotes a test on an attribute, each branch from an internal node represents an outcome of a test, and leaf nodes represent classes or class distributions that, in turn represent possible conclusions. The drawback of decision trees is that execution of them can be computationally expensive (and, hence, time-consuming) because each non-leaf node must be examined to determine whether to progress deeper into a tree structure or to examine an alternative. The present formulation was conceived as an efficient means of representing a decision tree and executing it in as little time as possible. The formulation involves the use of a set of symbolic algorithms to transform a decision tree into a multi-dimensional object, the rank of which equals the number of lateral non-leaf nodes. The tree can then be executed in constant time by means of an order-one table lookup. The sequence of operations performed by the algorithms is summarized as follows: 1. Determination of whether the tree under consideration can be encoded by means of this formulation. 2. Extraction of decision variables. 3. Symbolic optimization of the decision tree to minimize its form. 4. Expansion and transformation of all nested conjunctive

On Tree-Constrained Matchings and Generalizations

NARCIS (Netherlands)

S. Canzar (Stefan); K. Elbassioni; G.W. Klau (Gunnar); J. Mestre

2011-01-01

htmlabstractWe consider the following \\textsc{Tree-Constrained Bipartite Matching} problem: Given two rooted trees $T_1=(V_1,E_1)$, $T_2=(V_2,E_2)$ and a weight function $w: V_1\\times V_2 \\mapsto \\mathbb{R}_+$, find a maximum weight matching $\\mathcal{M}$ between nodes of the two trees, such that

Nonbinary Tree-Based Phylogenetic Networks.

Science.gov (United States)

Jetten, Laura; van Iersel, Leo

2018-01-01

Rooted phylogenetic networks are used to describe evolutionary histories that contain non-treelike evolutionary events such as hybridization and horizontal gene transfer. In some cases, such histories can be described by a phylogenetic base-tree with additional linking arcs, which can, for example, represent gene transfer events. Such phylogenetic networks are called tree-based. Here, we consider two possible generalizations of this concept to nonbinary networks, which we call tree-based and strictly-tree-based nonbinary phylogenetic networks. We give simple graph-theoretic characterizations of tree-based and strictly-tree-based nonbinary phylogenetic networks. Moreover, we show for each of these two classes that it can be decided in polynomial time whether a given network is contained in the class. Our approach also provides a new view on tree-based binary phylogenetic networks. Finally, we discuss two examples of nonbinary phylogenetic networks in biology and show how our results can be applied to them.

Algorithms for optimal dyadic decision trees

Energy Technology Data Exchange (ETDEWEB)

Hush, Don [Los Alamos National Laboratory; Porter, Reid [Los Alamos National Laboratory

2009-01-01

A new algorithm for constructing optimal dyadic decision trees was recently introduced, analyzed, and shown to be very effective for low dimensional data sets. This paper enhances and extends this algorithm by: introducing an adaptive grid search for the regularization parameter that guarantees optimal solutions for all relevant trees sizes, revising the core tree-building algorithm so that its run time is substantially smaller for most regularization parameter values on the grid, and incorporating new data structures and data pre-processing steps that provide significant run time enhancement in practice.

14C concentrations in tree stems, 1

International Nuclear Information System (INIS)

Kikata, Yoji; Yonenobu, Hitoshi; Morishita, Fumio; Hattori, Yoshiaki; Marsoen, S.N.

1993-01-01

The 14 C concentrations in trees sampled at various latitudes were measured with a Tandetron Accelerator Mass Spectrometer at Nagoya University. The growing periods of the parts for 14 C measurements were estimated by the relationship between meteorological conditions and the appearance of anatomical features of annual rings such as false rings, latewood formation, and so on. The following results were obtained: 1. The latitude dependence of the 14 C variation is found in tree stems as well as in the atmosphere. 2. The 14 C concentrations in tree stems are almost equal to those in the atmosphere at the latitude where the tree had grown and at the time when the sampled section is formed. Therefore the 14 C concentrations in the atmosphere are estimated by those of the tree stems. 3. The time when the 14 C concentration in the tree showed its maximum value has difference of 1 - 2 years with that of the latitude where the tree had grown. 4. This phenomena seemed to be related closely with the mechanism of global mixing of 14 CO 2 produced by atmospheric nuclear weapon tests. This mechanism causes a time lag of 14 C variation between northern and southern hemisphere. (author)

Trends over time in tree and seedling phylogenetic diversity indicate regional differences in forest biodiversity change.

Science.gov (United States)

Potter, Kevin M; Woodall, Christopher W

2012-03-01

Changing climate conditions may impact the short-term ability of forest tree species to regenerate in many locations. In the longer term, tree species may be unable to persist in some locations while they become established in new places. Over both time frames, forest tree biodiversity may change in unexpected ways. Using repeated inventory measurements five years apart from more than 7000 forested plots in the eastern United States, we tested three hypotheses: phylogenetic diversity is substantially different from species richness as a measure of biodiversity; forest communities have undergone recent changes in phylogenetic diversity that differ by size class, region, and seed dispersal strategy; and these patterns are consistent with expected early effects of climate change. Specifically, the magnitude of diversity change across broad regions should be greater among seedlings than in trees, should be associated with latitude and elevation, and should be greater among species with high dispersal capacity. Our analyses demonstrated that phylogenetic diversity and species richness are decoupled at small and medium scales and are imperfectly associated at large scales. This suggests that it is appropriate to apply indicators of biodiversity change based on phylogenetic diversity, which account for evolutionary relationships among species and may better represent community functional diversity. Our results also detected broadscale patterns of forest biodiversity change that are consistent with expected early effects of climate change. First, the statistically significant increase over time in seedling diversity in the South suggests that conditions there have become more favorable for the reproduction and dispersal of a wider variety of species, whereas the significant decrease in northern seedling diversity indicates that northern conditions have become less favorable. Second, we found weak correlations between seedling diversity change and latitude in both zones

Design of data structures for mergeable trees

DEFF Research Database (Denmark)

Georgiadis, Loukas; Tarjan, Robert Endre; Werneck, Renato Fonseca F.

2006-01-01

merge operation can change many arcs. In spite of this, we develop a data structure that supports merges and all other standard tree operations in O(log2 n) amortized time on an n-node forest. For the special case that occurs in the motivating application, in which arbitrary arc deletions...... are not allowed, we give a data structure with an O(log n) amortized time bound per operation, which is asymptotically optimal. The analysis of both algorithms is not straightforward and requires ideas not previously used in the study of dynamic trees. We explore the design space of algorithms for the problem......Motivated by an application in computational topology, we consider a novel variant of the problem of efficiently maintaining dynamic rooted trees. This variant allows an operation that merges two tree paths. In contrast to the standard problem, in which only one tree arc at a time changes, a single...

William Watson Cheyne (1852-1932): a life in medicine and his innovative surgical treatment of congenital hydrocephalus.

Science.gov (United States)

Watson, Caroline C; Griessenauer, Christoph J; Loukas, Marios; Blount, Jeffrey P; Tubbs, R Shane

2013-11-01

William Watson Cheyne lived and trained during a period of great advances in medical knowledge and surgical techniques. Despite his various contributions to the fields of bacteriology and surgery, little is known about his career or his life apart from his affiliations with Joseph Lister. This article aims to identify Cheyne as a pioneer in the treatment of congenital hydrocephalus and sheds light on the man who existed in Lister's shadow for most of his life. Cheyne's technique for surgical intervention of hydrocephalus was a great turning point and contributes to the current treatment strategy utilized today for hydrocephalus.

Effects of nurse trees, spacing, and tree species on biomass production in mixed forest plantations

DEFF Research Database (Denmark)

Nord-Larsen, Thomas; Meilby, Henrik

2016-01-01

Growing concern about increasing concentrations of greenhouse gases in the atmosphere, and resulting global climate change, has spurred a growing demand for renewable energy. In this study, we hypothesized that a nurse tree crop may provide additional early yields of biomass for fuel, while...... was in most cases reduced due to competition. However, provided timely thinning of nurse trees, the qualitative development of the trees will allow for long-term timber production....

Topological and categorical properties of binary trees

Directory of Open Access Journals (Sweden)

H. Pajoohesh

2008-04-01

Full Text Available Binary trees are very useful tools in computer science for estimating the running time of so-called comparison based algorithms, algorithms in which every action is ultimately based on a prior comparison between two elements. For two given algorithms A and B where the decision tree of A is more balanced than that of B, it is known that the average and worst case times of A will be better than those of B, i.e., ₸A(n ≤₸B(n and TWA (n≤TWB (n. Thus the most balanced and the most imbalanced binary trees play a main role. Here we consider them as semilattices and characterize the most balanced and the most imbalanced binary trees by topological and categorical properties. Also we define the composition of binary trees as a commutative binary operation, *, such that for binary trees A and B, A * B is the binary tree obtained by attaching a copy of B to any leaf of A. We show that (T,* is a commutative po-monoid and investigate its properties.

The ghosts of trees past: savanna trees create enduring legacies in plant species composition.

Science.gov (United States)

Stahlheber, Karen A; Crispin, Kimberly L; Anton, Cassidy; D'Antonio, Carla M

2015-09-01

Isolated trees in savannas worldwide are known to modify their local environment and interact directly with neighboring plants. Less is known about how related tree species differ in their impacts on surrounding communities, how the effects of trees vary between years, and how composition might change following loss of the tree. To address these knowledge gaps, we explored the following questions: How do savanna trees influence the surrounding composition of herbaceous plants? Is the influence of trees consistent across different species and years? How does this change following the death of the tree? We surveyed herbaceous species composition and environmental attributes surrounding living and dead evergreen and deciduous Quercus trees in California (USA) savannas across several years that differed in their total precipitation. Oak trees of all species created distinct, homogenous understory communities dominated by exotic grasses across several sites. The composition of the low-diversity understory communities showed less interannual variation than open grassland, despite a two-fold difference in precipitation between the driest and wettest year. Vegetation composition was correlated with variation in soil properties, which were strongly affected by trees. Oaks also influenced the communities beyond the edge of the crown, but this depended on site and oak species. Low-diversity understory communities persisted up to 43 years following the death of the tree. A gradual decline in the effect of trees on the physical, environment following death did not result in vegetation becoming more similar to open grassland over time. The presence of long-lasting legacies of past tree crowns highlights the difficulty of assigning control of the current distribution of herbaceous species in grassland to their contemporary environment.

Human reliability analysis using event trees

International Nuclear Information System (INIS)

Heslinga, G.

1983-01-01

The shut-down procedure of a technologically complex installation as a nuclear power plant consists of a lot of human actions, some of which have to be performed several times. The procedure is regarded as a chain of modules of specific actions, some of which are analyzed separately. The analysis is carried out by making a Human Reliability Analysis event tree (HRA event tree) of each action, breaking down each action into small elementary steps. The application of event trees in human reliability analysis implies more difficulties than in the case of technical systems where event trees were mainly used until now. The most important reason is that the operator is able to recover a wrong performance; memory influences play a significant role. In this study these difficulties are dealt with theoretically. The following conclusions can be drawn: (1) in principle event trees may be used in human reliability analysis; (2) although in practice the operator will recover his fault partly, theoretically this can be described as starting the whole event tree again; (3) compact formulas have been derived, by which the probability of reaching a specific failure consequence on passing through the HRA event tree after several times of recovery is to be calculated. (orig.)

Various extraction methods influence the adhesive properties of DDGS .... pennycress (Thlaspi arvense L.) and lesquerella (Lesquerella fendleri A. Gary (S. Watson) in the fabrication of lignocellulosic composites

Science.gov (United States)

Lignocellulosic composite (LC) panels were fabricated using an adhesive matrix prepared from three different agricultural by-products: dried distillers grains with solubles (DDGS), pennycress (Thlaspi arvense L.) press cake (PPC) or lesquerella (Lesquerella fendleri A. Gary (S. Watson) press cake (L...

Improved Anonymity for Key-trees

NARCIS (Netherlands)

Veugen, P.J.M.; Beye, M.

2013-01-01

Randomized hash-lock protocols for Radio Frequency IDentification (RFID) tags offer forward untraceability, but incur heavy search on the server. Key trees have been proposed as a way to reduce search times, but because partial keys in such trees are shared, key compromise affects several tags.

Steiner trees for fixed orientation metrics

DEFF Research Database (Denmark)

Brazil, Marcus; Zachariasen, Martin

2009-01-01

We consider the problem of constructing Steiner minimum trees for a metric defined by a polygonal unit circle (corresponding to s = 2 weighted legal orientations in the plane). A linear-time algorithm to enumerate all angle configurations for degree three Steiner points is given. We provide...... a simple proof that the angle configuration for a Steiner point extends to all Steiner points in a full Steiner minimum tree, such that at most six orientations suffice for edges in a full Steiner minimum tree. We show that the concept of canonical forms originally introduced for the uniform orientation...... metric generalises to the fixed orientation metric. Finally, we give an O(s n) time algorithm to compute a Steiner minimum tree for a given full Steiner topology with n terminal leaves....

The relative roles of local climate adaptation and phylogeny in determining leaf-out timing of temperate tree species

Directory of Open Access Journals (Sweden)

Elsa Desnoues

2017-12-01

Full Text Available Background Leaf out times of temperate forest trees are a prominent determinant of global carbon dynamics throughout the year. Abiotic cues of leaf emergence are well studied but investigation of the relative roles of shared evolutionary history (phylogeny and local adaptation to climate in determining the species-level responses to these cues is needed to better apprehend the effect of global change on leaf emergence. We explored the relative importance of phylogeny and climate in determining the innate leaf out phenology across the temperate biome. Methods We used an extensive dataset of leaf-out dates of 1126 temperate woody species grown in eight Northern Hemisphere common gardens. For these species, information on the native climate and phylogenetic position was collected. Using linear regression analyses, we examine the relative effect of climate variables and phylogeny on leaf out variation among species. Results Climate variables explained twice as much variation in leaf out timing as phylogenetic information, a process that was driven primarily by the complex interactive effects of multiple climate variables. Although the primary climate factors explaining species-level variation in leaf-out timing varied drastically across different families, our analyses reveal that local adaptation plays a stronger role than common evolutionary history in determining tree phenology across the temperate biome. Conclusions In the long-term, the direct effects of physiological adaptation to abiotic effects of climate change on forest phenology are likely to outweigh the indirect effects mediated through changes in tree species composition.

The space of ultrametric phylogenetic trees.

Science.gov (United States)

Gavryushkin, Alex; Drummond, Alexei J

2016-08-21

The reliability of a phylogenetic inference method from genomic sequence data is ensured by its statistical consistency. Bayesian inference methods produce a sample of phylogenetic trees from the posterior distribution given sequence data. Hence the question of statistical consistency of such methods is equivalent to the consistency of the summary of the sample. More generally, statistical consistency is ensured by the tree space used to analyse the sample. In this paper, we consider two standard parameterisations of phylogenetic time-trees used in evolutionary models: inter-coalescent interval lengths and absolute times of divergence events. For each of these parameterisations we introduce a natural metric space on ultrametric phylogenetic trees. We compare the introduced spaces with existing models of tree space and formulate several formal requirements that a metric space on phylogenetic trees must possess in order to be a satisfactory space for statistical analysis, and justify them. We show that only a few known constructions of the space of phylogenetic trees satisfy these requirements. However, our results suggest that these basic requirements are not enough to distinguish between the two metric spaces we introduce and that the choice between metric spaces requires additional properties to be considered. Particularly, that the summary tree minimising the square distance to the trees from the sample might be different for different parameterisations. This suggests that further fundamental insight is needed into the problem of statistical consistency of phylogenetic inference methods. Copyright © 2016 The Authors. Published by Elsevier Ltd.. All rights reserved.

Tree compression with top trees

DEFF Research Database (Denmark)

Bille, Philip; Gørtz, Inge Li; Landau, Gad M.

2013-01-01

We introduce a new compression scheme for labeled trees based on top trees [3]. Our compression scheme is the first to simultaneously take advantage of internal repeats in the tree (as opposed to the classical DAG compression that only exploits rooted subtree repeats) while also supporting fast...

Tree compression with top trees

DEFF Research Database (Denmark)

Bille, Philip; Gørtz, Inge Li; Landau, Gad M.

2015-01-01

We introduce a new compression scheme for labeled trees based on top trees. Our compression scheme is the first to simultaneously take advantage of internal repeats in the tree (as opposed to the classical DAG compression that only exploits rooted subtree repeats) while also supporting fast...

Application of time-lapse ERT to characterize soil-water-disease interactions of young citrus trees

Science.gov (United States)

Peddinti, S. R.; Kbvn, D. P.; Ranjan, S.; R M, P. G.

2016-12-01

Vidarbha region in Maharashtra, India is witnessing a continuous decrease in orange crop due to the propagation of `Phytopthora root rot', a water mold disease. Under favorable conditions, the disease causing bacteria can attack the plant root system and propagates to the surface (where first visual impression is made), making difficult to regain the plant health. This research aims at co-relating eco-hydrological fluxes with disease sensing parameters of orange trees. Two experimental plots around a healthy-young and declined-young orange trees were selected for our analysis. A 3-dimentional electrical resistivity tomography (ERT) (Figure) was carried at each plot to quantify the soil moisture distribution at a vadose zone. Pedo-electric relations were obtained considering modified Archie's law parameters. ERT derived moisture data was validated with time domain reflectometry (TDR) point observations. Soil moisture profiles derived from ERT were observed to be differ marginally between the two plots. Disease quantification was done by estimating the density of Phytopthora spp. inoculum in soils sampled along the root zone. Identification of Phytopthora spp. was done in the laboratory using taxonomic and morphologic criteria of the colonies. Spatio-temporal profiles of soil moisture and inoculum density were then co-related to comment on the eco-hydrological fluxes contributing to the health propagation of root rot in orange tree for implementing effective water management practices.

Generalising tree traversals and tree transformations to DAGs

DEFF Research Database (Denmark)

Bahr, Patrick; Axelsson, Emil

2017-01-01

We present a recursion scheme based on attribute grammars that can be transparently applied to trees and acyclic graphs. Our recursion scheme allows the programmer to implement a tree traversal or a tree transformation and then apply it to compact graph representations of trees instead. The resul......We present a recursion scheme based on attribute grammars that can be transparently applied to trees and acyclic graphs. Our recursion scheme allows the programmer to implement a tree traversal or a tree transformation and then apply it to compact graph representations of trees instead...... as the complementing theory with a number of examples....

Productivity of the supply system based on whole-tree bundling

Energy Technology Data Exchange (ETDEWEB)

Laitila, J. (Finnish Forest Research Inst., Joensuu (Finland)), Email: juha.laitila@metla.fi; Jylhae, P. (Finnish Forest Research Inst., Kannus (Finland)), Email: paula.jylha@metla.fi; Kaerhae, K. (Metsaeteho Oy, Helsinki (Finland)), Email: kalle.karha@metsateho.fi

2009-07-01

In the present study, time consumption models for bundle harvesting and forwarding were created by applying regression analyses. The time studies related to on-road transportation were created by applying regression analyses. The time studies related to on-road transportation were focused on comparing the terminal times spent on handling of whole-tree bundles and conventional 5-m pulpwood. The number of whole-tree bundles per truck load and the weights of the payloads were also recorded. The forwarding productivity of whole-tree bundles was about double compared to conventional pulpwood and whole-trees. In on-road transportation, the mean loading and unloading time of whole-tree bundles per truck load was 46 % higher compared to that of conventional 5-m pulpwood. The second prototype of the bundle harvester is under construction, and the time studies are to be continued after accomplishing the machine in the autumn 2009. (orig.)

Critique of the Watson-Glaser Critical Thinking Appraisal Test: The More You Know, the Lower Your Score

Directory of Open Access Journals (Sweden)

Kevin Possin

2014-12-01

Full Text Available The Watson-Glaser Critical Thinking Appraisal Test is one of the oldest, most frequently used, multiple-choice critical-thinking tests on the market in business, government, and legal settings for purposes of hiring and promotion. I demonstrate, however, that the test has serious construct-validity issues, stemming primarily from its ambiguous, unclear, misleading, and sometimes mysterious instructions, which have remained unaltered for decades. Erroneously scored items further diminish the test’s validity. As a result, having enhanced knowledge of formal and informal logic could well result in test subjects receiving lower scores on the test. That’s not how things should work for a CT assessment test.

Coalescent methods for estimating phylogenetic trees.

Science.gov (United States)

Liu, Liang; Yu, Lili; Kubatko, Laura; Pearl, Dennis K; Edwards, Scott V

2009-10-01

We review recent models to estimate phylogenetic trees under the multispecies coalescent. Although the distinction between gene trees and species trees has come to the fore of phylogenetics, only recently have methods been developed that explicitly estimate species trees. Of the several factors that can cause gene tree heterogeneity and discordance with the species tree, deep coalescence due to random genetic drift in branches of the species tree has been modeled most thoroughly. Bayesian approaches to estimating species trees utilizes two likelihood functions, one of which has been widely used in traditional phylogenetics and involves the model of nucleotide substitution, and the second of which is less familiar to phylogeneticists and involves the probability distribution of gene trees given a species tree. Other recent parametric and nonparametric methods for estimating species trees involve parsimony criteria, summary statistics, supertree and consensus methods. Species tree approaches are an appropriate goal for systematics, appear to work well in some cases where concatenation can be misleading, and suggest that sampling many independent loci will be paramount. Such methods can also be challenging to implement because of the complexity of the models and computational time. In addition, further elaboration of the simplest of coalescent models will be required to incorporate commonly known issues such as deviation from the molecular clock, gene flow and other genetic forces.

Surface tree languages and parallel derivation trees

NARCIS (Netherlands)

Engelfriet, Joost

1976-01-01

The surface tree languages obtained by top-down finite state transformation of monadic trees are exactly the frontier-preserving homomorphic images of sets of derivation trees of ETOL systems. The corresponding class of tree transformation languages is therefore equal to the class of ETOL languages.

A whole-tree chamber system for examining tree-level physiological responses of field-grown trees to environmental variation and climate change.

Science.gov (United States)

Medhurst, Jane; Parsby, Jan; Linder, Sune; Wallin, Göran; Ceschia, Eric; Slaney, Michelle

2006-09-01

A whole-tree chamber (WTC) system was installed at Flakaliden in northern Sweden to examine the long-term physiological responses of field-grown 40-year-old Norway spruce trees [Picea abies (L.) Karst.] to climate change. The WTCs were designed as large cuvettes to allow the net tree-level CO(2) and water fluxes to be measured on a continuous basis. A total of 12 WTCs were used to impose combinations of atmospheric carbon dioxide concentration, [CO(2)], and air temperature treatments. The air inside the ambient and elevated [CO(2)] WTCs was maintained at 365 and 700 micromol mol(-1), respectively. The air temperature inside the ambient temperature WTCs tracked air temperature outside the WTCs. Elevated temperatures were altered on a monthly time-step and ranged between +2.8 and +5.6 degrees C above ambient temperature. The system allowed continuous, long-term measurement of whole-tree photosynthesis, night-time respiration and transpiration. The performance of the WTCs was assessed using winter and spring data sets. The ability of the WTC system to measure tree-level physiological responses is demonstrated. All WTCs displayed a high level of control over tracking of air temperatures. The set target of 365 micromol mol(-1) in the ambient [CO(2)] chambers was too low to be maintained during winter because of tree dormancy and the high natural increase in [CO(2)] over winter at high latitudes such as the Flakaliden site. Accurate control over [CO(2)] in the ambient [CO(2)] chambers was restored during the spring and the system maintained the elevated [CO(2)] target of 700 micromol mol(-1) for both measurement periods. Air water vapour deficit (VPD) was accurately tracked in ambient temperature WTCs. However, as water vapour pressure in all 12 WTCs was maintained at the level of non-chambered (reference) air, VPD of elevated temperature WTCs was increased.

Modular representation and analysis of fault trees

Energy Technology Data Exchange (ETDEWEB)

Olmos, J; Wolf, L [Massachusetts Inst. of Tech., Cambridge (USA). Dept. of Nuclear Engineering

1978-08-01

An analytical method to describe fault tree diagrams in terms of their modular compositions is developed. Fault tree structures are characterized by recursively relating the top tree event to all its basic component inputs through a set of equations defining each of the modulus for the fault tree. It is shown that such a modular description is an extremely valuable tool for making a quantitative analysis of fault trees. The modularization methodology has been implemented into the PL-MOD computer code, written in PL/1 language, which is capable of modularizing fault trees containing replicated components and replicated modular gates. PL-MOD in addition can handle mutually exclusive inputs and explicit higher order symmetric (k-out-of-n) gates. The step-by-step modularization of fault trees performed by PL-MOD is demonstrated and it is shown how this procedure is only made possible through an extensive use of the list processing tools available in PL/1. A number of nuclear reactor safety system fault trees were analyzed. PL-MOD performed the modularization and evaluation of the modular occurrence probabilities and Vesely-Fussell importance measures for these systems very efficiently. In particular its execution time for the modularization of a PWR High Pressure Injection System reduced fault tree was 25 times faster than that necessary to generate its equivalent minimal cut-set description using MOCUS, a code considered to be fast by present standards.

TreePics: visualizing trees with pictures

Directory of Open Access Journals (Sweden)

Nicolas Puillandre

2017-09-01

Full Text Available While many programs are available to edit phylogenetic trees, associating pictures with branch tips in an efficient and automatic way is not an available option. Here, we present TreePics, a standalone software that uses a web browser to visualize phylogenetic trees in Newick format and that associates pictures (typically, pictures of the voucher specimens to the tip of each branch. Pictures are visualized as thumbnails and can be enlarged by a mouse rollover. Further, several pictures can be selected and displayed in a separate window for visual comparison. TreePics works either online or in a full standalone version, where it can display trees with several thousands of pictures (depending on the memory available. We argue that TreePics can be particularly useful in a preliminary stage of research, such as to quickly detect conflicts between a DNA-based phylogenetic tree and morphological variation, that may be due to contamination that needs to be removed prior to final analyses, or the presence of species complexes.

Totally optimal decision trees for Boolean functions

KAUST Repository

Chikalov, Igor

2016-07-28

We study decision trees which are totally optimal relative to different sets of complexity parameters for Boolean functions. A totally optimal tree is an optimal tree relative to each parameter from the set simultaneously. We consider the parameters characterizing both time (in the worst- and average-case) and space complexity of decision trees, i.e., depth, total path length (average depth), and number of nodes. We have created tools based on extensions of dynamic programming to study totally optimal trees. These tools are applicable to both exact and approximate decision trees, and allow us to make multi-stage optimization of decision trees relative to different parameters and to count the number of optimal trees. Based on the experimental results we have formulated the following hypotheses (and subsequently proved): for almost all Boolean functions there exist totally optimal decision trees (i) relative to the depth and number of nodes, and (ii) relative to the depth and average depth.

DLRS: gene tree evolution in light of a species tree.

Science.gov (United States)

Sjöstrand, Joel; Sennblad, Bengt; Arvestad, Lars; Lagergren, Jens

2012-11-15

PrIME-DLRS (or colloquially: 'Delirious') is a phylogenetic software tool to simultaneously infer and reconcile a gene tree given a species tree. It accounts for duplication and loss events, a relaxed molecular clock and is intended for the study of homologous gene families, for example in a comparative genomics setting involving multiple species. PrIME-DLRS uses a Bayesian MCMC framework, where the input is a known species tree with divergence times and a multiple sequence alignment, and the output is a posterior distribution over gene trees and model parameters. PrIME-DLRS is available for Java SE 6+ under the New BSD License, and JAR files and source code can be downloaded from http://code.google.com/p/jprime/. There is also a slightly older C++ version available as a binary package for Ubuntu, with download instructions at http://prime.sbc.su.se. The C++ source code is available upon request. joel.sjostrand@scilifelab.se or jens.lagergren@scilifelab.se. PrIME-DLRS is based on a sound probabilistic model (Åkerborg et al., 2009) and has been thoroughly validated on synthetic and biological datasets (Supplementary Material online).

Fingerprints of Both Watson-Crick and Hoogsteen Isomers of the Isolated (Cytosine-Guanine)H+ Pair.

Science.gov (United States)

Cruz-Ortiz, Andrés F; Rossa, Maximiliano; Berthias, Francis; Berdakin, Matías; Maitre, Philippe; Pino, Gustavo A

2017-11-16

 Gas phase protonated guanine-cytosine (CGH + ) pair was generated using an electrospray ionization source from solutions at two different pH (5.8 and 3.2). Consistent evidence from MS/MS fragmentation patterns and differential ion mobility spectra (DIMS) point toward the presence of two isomers of the CGH + pair, whose relative populations depend strongly on the pH of the solution. Gas phase infrared multiphoton dissociation (IRMPD) spectroscopy in the 900-1900 cm -1 spectral range further confirms that the Watson-Crick isomer is preferentially produced (91%) at pH = 5.8, while the Hoogsteen isomer predominates (66%) at pH = 3.2). These fingerprint signatures are expected to be useful for the development of new analytical methodologies and to trigger isomer selective photochemical studies of protonated DNA base pairs.

Univariate decision tree induction using maximum margin classification

OpenAIRE

Yıldız, Olcay Taner

2012-01-01

In many pattern recognition applications, first decision trees are used due to their simplicity and easily interpretable nature. In this paper, we propose a new decision tree learning algorithm called univariate margin tree where, for each continuous attribute, the best split is found using convex optimization. Our simulation results on 47 data sets show that the novel margin tree classifier performs at least as good as C4.5 and linear discriminant tree (LDT) with a similar time complexity. F...

Application of the Faddeev-Watson expansion to thermal collisions of Rydberg atoms with neutral particles

International Nuclear Information System (INIS)

de Prunele, E.

1983-01-01

The Faddeev-Watson expansion (FWE) for the T operator is applied to the study of thermal collisions between Rydberg atom and neutral atom. These collisions are considered as a three-body problem (the perturber, the Rydberg electron, and its parent core) and it is assumed, as already done in most theoretical works dealing with Rydberg-atom--atom collisions, that the core-perturber interaction can be neglected. Then the evaluation of the FWE first- and second-order terms is made tractable by using an appropriate separable potential for the Rydberg-electron--perturber interaction. The evaluation of the second-order term allows us to estimate the importance of taking into account explicitly the Rydberg-electron--core interaction in the expression of the (three-body) T operator for the thermal collisions considered. Detailed calculations for the process Rb(n, l = 0)+He →Rb(n',l')+He are presented and discussed. The FWE second-order term has been evaluated for the first time by taking the (two-body) t operator associated with the Rydberg atom (valence electron plus parent core) as the Coulomb potential. The contribution of the FWE second-order term to the scattering amplitude decreases as n increases and is found especially significant when both the momentum transfers involved in the collision are large and the values of l and l' are small

Use of fault and decision tree analyses to protect against industrial sabotage

International Nuclear Information System (INIS)

Fullwood, R.R.; Erdmann, R.C.

1975-01-01

Fault tree and decision tree analyses provide systematic bases for evaluation of safety systems and procedures. Heuristically, this paper shows applications of these methods for industrial sabotage analysis at a reprocessing plant. Fault trees constructed by ''leak path'' analysis for completeness through path inventory. The escape fault tree is readily developed by this method and using the reciprocal character of the trees, the attack fault tree is constructed. After construction, the events on the fault tree are corrected for their nonreciprocal character. The fault trees are algebraically solved and the protection that is afforded is ranked by the number of barriers that must be penetrated. No attempt is made to assess the barrier penetration probabilities or penetration time duration. Event trees are useful for dynamic plant protection analysis through their time-sequencing character. To illustrate their usefulness, a simple attack scenario is devised and event-tree analyzed. Two saboteur success paths and 21 failure paths are found. This example clearly shows the event tree usefulness for concisely presenting the time sequencing of key decision points. However, event trees have the disadvantage of being scenario dependent, therefore requiring a separate event tree for each scenario

Using fragmentation trees and mass spectral trees for identifying unknown compounds in metabolomics.

Science.gov (United States)

Vaniya, Arpana; Fiehn, Oliver

2015-06-01

Identification of unknown metabolites is the bottleneck in advancing metabolomics, leaving interpretation of metabolomics results ambiguous. The chemical diversity of metabolism is vast, making structure identification arduous and time consuming. Currently, comprehensive analysis of mass spectra in metabolomics is limited to library matching, but tandem mass spectral libraries are small compared to the large number of compounds found in the biosphere, including xenobiotics. Resolving this bottleneck requires richer data acquisition and better computational tools. Multi-stage mass spectrometry (MSn) trees show promise to aid in this regard. Fragmentation trees explore the fragmentation process, generate fragmentation rules and aid in sub-structure identification, while mass spectral trees delineate the dependencies in multi-stage MS of collision-induced dissociations. This review covers advancements over the past 10 years as a tool for metabolite identification, including algorithms, software and databases used to build and to implement fragmentation trees and mass spectral annotations.

Using decision tree induction systems for modeling space-time behavior

NARCIS (Netherlands)

Arentze, T.A.; Hofman, F.; Mourik, van H.; Timmermans, H.J.P.; Wets, G.

2000-01-01

Discrete choice models are commonly used to predict individuals' activity and travel choices either separately or simultaneously in activity scheduling models. This paper investigates the possibilities of decision tree induction systems as an alternative approach. The ability of decision frees to

ColorTree: a batch customization tool for phylogenic trees.

Science.gov (United States)

Chen, Wei-Hua; Lercher, Martin J

2009-07-31

Genome sequencing projects and comparative genomics studies typically aim to trace the evolutionary history of large gene sets, often requiring human inspection of hundreds of phylogenetic trees. If trees are checked for compatibility with an explicit null hypothesis (e.g., the monophyly of certain groups), this daunting task is greatly facilitated by an appropriate coloring scheme. In this note, we introduce ColorTree, a simple yet powerful batch customization tool for phylogenic trees. Based on pattern matching rules, ColorTree applies a set of customizations to an input tree file, e.g., coloring labels or branches. The customized trees are saved to an output file, which can then be viewed and further edited by Dendroscope (a freely available tree viewer). ColorTree runs on any Perl installation as a stand-alone command line tool, and its application can thus be easily automated. This way, hundreds of phylogenic trees can be customized for easy visual inspection in a matter of minutes. ColorTree allows efficient and flexible visual customization of large tree sets through the application of a user-supplied configuration file to multiple tree files.

How many tautomerization pathways connect Watson-Crick-like G*·T DNA base mispair and wobble mismatches?

Science.gov (United States)

Brovarets', Ol'ha O; Hovorun, Dmytro M

2015-01-01

In this study, we have theoretically demonstrated the intrinsic ability of the wobble G·T(w)/G*·T*(w)/G·T(w1)/G·T(w2) and Watson-Crick-like G*·T(WC) DNA base mispairs to interconvert into each other via the DPT tautomerization. We have established that among all these transitions, only one single G·T(w) ↔ G*·T(WC) pathway is eligible from a biological perspective. It involves short-lived intermediate - the G·T*(WC) base mispair - and is governed by the planar, highly stable, and zwitterionic [Formula: see text] transition state stabilized by the participation of the unique pattern of the five intermolecular O6(+)H⋯O4(-), O6(+)H⋯N3(-), N1(+)H⋯N3(-), N1(+)H⋯O2(-), and N2(+)H⋯O2(-) H-bonds. This non-dissociative G·T(w) ↔ G*·T(WC) tautomerization occurs without opening of the pair: Bases within mispair remain connected by 14 different patterns of the specific intermolecular interactions that successively change each other along the IRC. Novel kinetically controlled mechanism of the thermodynamically non-equilibrium spontaneous point GT/TG incorporation errors has been suggested. The mutagenic effect of the analogues of the nucleotide bases, in particular 5-bromouracil, can be attributed to the decreasing of the barrier of the acquisition by the wobble pair containing these compounds of the enzymatically competent Watson-Crick's geometry via the intrapair mutagenic tautomerization directly in the essentially hydrophobic recognition pocket of the replication DNA-polymerase machinery. Proposed approaches are able to explain experimental data, namely growth of the rate of the spontaneous point incorporation errors during DNA biosynthesis with increasing temperature.

ANALISIS KESALAHAN SISWA KELAS X MIA 3 SMA NEGERI 1 TANJUNGPINANG TAHUN PELAJARAN 2015/2016 DALAM MENYELESAIKAN PERMASALAHAN PELUANG DENGAN MENGGUNAKAN KATEGORI KESALAHAN WATSON

Directory of Open Access Journals (Sweden)

Susilawati Susilawati

2016-06-01

Full Text Available Studi ini bertujuan untuk menganalisa dan mengklasifikasi kesalahan siswa dalam menyelesaikan permasalahan peluang. Subjek studi ini adalah 38 siswa dari kelas X MIA 3 di SMA Negeri 1 Tanjungpinang. Instrumen yang digunakan adalah tes tertulis yang memuat 5 butir soal uraian yang disusun dan divalidasi bersama oleh peneliti dan guru matematika kelas X MIA 3. Kesalahan yang dianalisis dikategorikan dengan menggunakan kategori kesalahan Watson diantaranya data tidak tepat (inappropriate data/id, prosedur tidak tepat (inappropriate procedure/ip, data hilang (ommited data/od, kesimpulan hilang (ommited conclusion/oc, konflik level respon (response level conflict/rlc, manipulasi tidak langsung (undirected manipulation/um, masalah hierarki keterampilan (skills hierarchy problem/shp, dan jenis kesalahan lain dalam kategori terakhir. Hasil analisis kesalahan menunjukkan persentase data tidak tepat sebesar 14,43 %, prosedur tidak tepat sebesar 12,08 %, data hilang sebesar 19,13%, kesimpulan hilang sebesar 21,14%, konflik level respon sebesar 1,34 %, manipulasi tidak langsung sebesar 12,75 %, serta persentase masalah hirarki keterampilan sebesar 19,13 %. Kata Kunci: Peluang, Kesalahan Siswa, Kategori Kesalahan Menurut Watson DOI: http://dx.doi.org/10.22342/jpm.10.2.3630.39-52

The hydrological vulnerability of western North American boreal tree species based on ground-based observations of tree mortality

Science.gov (United States)

Hember, R. A.; Kurz, W. A.; Coops, N. C.

2017-12-01

Several studies indicate that climate change has increased rates of tree mortality, adversely affecting timber supply and carbon storage in western North American boreal forests. Statistical models of tree mortality can play a complimentary role in detecting and diagnosing forest change. Yet, such models struggle to address real-world complexity, including expectations that hydrological vulnerability arises from both drought stress and excess-water stress, and that these effects vary by species, tree size, and competitive status. Here, we describe models that predict annual probability of tree mortality (Pm) of common boreal tree species based on tree height (H), biomass of larger trees (BLT), soil water content (W), reference evapotranspiration (E), and two-way interactions. We show that interactions among H and hydrological variables are consistently significant. Vulnerability to extreme droughts consistently increases as H approaches maximum observed values of each species, while some species additionally show increasing vulnerability at low H. Some species additionally show increasing vulnerability to low W under high BLT, or increasing drought vulnerability under low BLT. These results suggest that vulnerability of trees to increasingly severe droughts depends on the hydraulic efficiency, competitive status, and microclimate of individual trees. Static simulations of Pm across a 1-km grid (i.e., with time-independent inputs of H, BLT, and species composition) indicate complex spatial patterns in the time trends during 1965-2014 and a mean change in Pm of 42 %. Lastly, we discuss how the size-dependence of hydrological vulnerability, in concert with increasingly severe drought events, may shape future responses of stand-level biomass production to continued warming and increasing carbon dioxide concentration in the region.

Linking and Cutting Spanning Trees

Directory of Open Access Journals (Sweden)

Luís M. S. Russo

2018-04-01

Full Text Available We consider the problem of uniformly generating a spanning tree for an undirected connected graph. This process is useful for computing statistics, namely for phylogenetic trees. We describe a Markov chain for producing these trees. For cycle graphs, we prove that this approach significantly outperforms existing algorithms. For general graphs, experimental results show that the chain converges quickly. This yields an efficient algorithm due to the use of proper fast data structures. To obtain the mixing time of the chain we describe a coupling, which we analyze for cycle graphs and simulate for other graphs.

Atmospheric carbon reduction by urban trees

International Nuclear Information System (INIS)

Nowak, D.J.

1993-01-01

Trees, because they sequester atmospheric carbon through their growth process and conserve energy in urban areas, have been suggested as one means to combat increasing levels of atmospheric carbon. Analysis of the urban forest in Oakland, California (21% tree cover), reveals a tree carbon storage level of 11·0 metric tons/hectare. Trees in the area of the 1991 fire in Oakland stored approximately 14,500 metric tons of carbon, 10% of the total amount stored by Oakland's urban forest. National urban forest carbon storage in the United States (28% tree cover) is estimated at between 350 and 750 million metric tons. Establishment of 10 million urban trees annually over the next 10 years is estimated to sequester and offset the production of 363 million metric tons of carbon over the next 50 years-less than 1% of the estimated carbon emissions in the United States over the same time period. Advantages and limitations of managing urban trees to reduce atmospheric carbon are discussed. 36 refs., 2 figs., 3 tabs

Consequences of Common Topological Rearrangements for Partition Trees in Phylogenomic Inference.

Science.gov (United States)

Chernomor, Olga; Minh, Bui Quang; von Haeseler, Arndt

2015-12-01

In phylogenomic analysis the collection of trees with identical score (maximum likelihood or parsimony score) may hamper tree search algorithms. Such collections are coined phylogenetic terraces. For sparse supermatrices with a lot of missing data, the number of terraces and the number of trees on the terraces can be very large. If terraces are not taken into account, a lot of computation time might be unnecessarily spent to evaluate many trees that in fact have identical score. To save computation time during the tree search, it is worthwhile to quickly identify such cases. The score of a species tree is the sum of scores for all the so-called induced partition trees. Therefore, if the topological rearrangement applied to a species tree does not change the induced partition trees, the score of these partition trees is unchanged. Here, we provide the conditions under which the three most widely used topological rearrangements (nearest neighbor interchange, subtree pruning and regrafting, and tree bisection and reconnection) change the topologies of induced partition trees. During the tree search, these conditions allow us to quickly identify whether we can save computation time on the evaluation of newly encountered trees. We also introduce the concept of partial terraces and demonstrate that they occur more frequently than the original "full" terrace. Hence, partial terrace is the more important factor of timesaving compared to full terrace. Therefore, taking into account the above conditions and the partial terrace concept will help to speed up the tree search in phylogenomic inference.

Are there tides within trees?

Science.gov (United States)

Fisahn, Joachim

2018-01-24

Tree stem diameters and electrical stem potentials exhibit rhythmic variations with periodicities of 24-25 h. Under free-running conditions of constant light or darkness these rhythms were suggested to be mediated by the lunisolar gravitational force. To further unravel the regulation of tree stem diameter dilatations, many of the published time courses of diameter variations were re-evaluated in conjunction with the contemporaneous time courses of the lunisolar tidal acceleration. This was accomplished by application of the Etide program, which estimates, with high temporal resolution, local gravitational changes as a consequence of the diurnal variations of the lunisolar gravitational force due to the orbits and relative positions of Earth, Moon and Sun. In all instances investigated, it was evident that a synchronism exists between the times of the turning points of both the lunisolar tide and stem diameter variations when the direction of extension changes. This finding of synchrony documents that the lunisolar tide is a regulator of the tree stem diameter dilatations. Under the described experimental conditions, rhythms in tree stem diameter dilations and electrical stem potentials are controlled by the lunisolar gravitational acceleration. © The Author(s) 2018. Published by Oxford University Press on behalf of the Annals of Botany Company. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

Acoustic evaluation of standing trees : recent research development

Science.gov (United States)

Xiping Wang; Robert J. Ross; Peter Carter

2005-01-01

This paper presents some research results from recent trial studies on measuring acoustic velocities on standing trees of five softwood species. The relationships between tree velocities measured by time of flight method and log velocities measured by resonance method were evaluated. Theoretical and empirical models were developed for adjusting observed tree velocity...

Speeding Up Neighbour-Joining Tree Construction

DEFF Research Database (Denmark)

Brodal, Gerth Stølting; Fagerberg, Rolf; Mailund, Thomas

A widely used method for constructing phylogenetic trees is the neighbour-joining method of Saitou and Nei. We develope heuristics for speeding up the neighbour-joining method which generate the same phylogenetic trees as the original method. All heuristics are based on using a quad-tree to guide...... the search for the next pair of nodes to join, but di#er in the information stored in quad-tree nodes, the way the search is performed, and in the way the quad-tree is updated after a join. We empirically evaluate the performance of the heuristics on distance matrices obtained from the Pfam collection...... of alignments, and compare the running time with that of the QuickTree tool, a well-known and widely used implementation of the standard neighbour-joining method. The results show that the presented heuristics can give a significant speed-up over the standard neighbour-joining method, already for medium sized...

Tree Colors: Color Schemes for Tree-Structured Data.

Science.gov (United States)

Tennekes, Martijn; de Jonge, Edwin

2014-12-01

We present a method to map tree structures to colors from the Hue-Chroma-Luminance color model, which is known for its well balanced perceptual properties. The Tree Colors method can be tuned with several parameters, whose effect on the resulting color schemes is discussed in detail. We provide a free and open source implementation with sensible parameter defaults. Categorical data are very common in statistical graphics, and often these categories form a classification tree. We evaluate applying Tree Colors to tree structured data with a survey on a large group of users from a national statistical institute. Our user study suggests that Tree Colors are useful, not only for improving node-link diagrams, but also for unveiling tree structure in non-hierarchical visualizations.

Tree growth and its climate signal along latitudinal and altitudinal gradients: comparison of tree rings between Finland and the Tibetan Plateau

Directory of Open Access Journals (Sweden)

L. Lyu

2017-06-01

Full Text Available Latitudinal and altitudinal gradients can be utilized to forecast the impact of climate change on forests. To improve the understanding of how these gradients impact forest dynamics, we tested two hypotheses: (1 the change of the tree growth–climate relationship is similar along both latitudinal and altitudinal gradients, and (2 the time periods during which climate affects growth the most occur later towards higher latitudes and altitudes. To address this, we utilized tree-ring data from a latitudinal gradient in Finland and from two altitudinal gradients on the Tibetan Plateau. We analysed the latitudinal and altitudinal growth patterns in tree rings and investigated the growth–climate relationship of trees by correlating ring-width index chronologies with climate variables, calculating with flexible time windows, and using daily-resolution climate data. High latitude and altitude plots showed higher correlations between tree-ring chronologies and growing season temperature. However, the effects of winter temperature showed contrasting patterns for the gradients. The timing of the highest correlation with temperatures during the growing season at southern sites was approximately 1 month ahead of that at northern sites in the latitudinal gradient. In one out of two altitudinal gradients, the timing for the strongest negative correlation with temperature at low-altitude sites was ahead of treeline sites during the growing season, possibly due to differences in moisture limitation. Mean values and the standard deviation of tree-ring width increased with increasing mean July temperatures on both types of gradients. Our results showed similarities of tree growth responses to increasing seasonal temperature between latitudinal and altitudinal gradients. However, differences in climate–growth relationships were also found between gradients due to differences in other factors such as moisture conditions. Changes in the timing of the most

TreePOD: Sensitivity-Aware Selection of Pareto-Optimal Decision Trees.

Science.gov (United States)

Muhlbacher, Thomas; Linhardt, Lorenz; Moller, Torsten; Piringer, Harald

2018-01-01

Balancing accuracy gains with other objectives such as interpretability is a key challenge when building decision trees. However, this process is difficult to automate because it involves know-how about the domain as well as the purpose of the model. This paper presents TreePOD, a new approach for sensitivity-aware model selection along trade-offs. TreePOD is based on exploring a large set of candidate trees generated by sampling the parameters of tree construction algorithms. Based on this set, visualizations of quantitative and qualitative tree aspects provide a comprehensive overview of possible tree characteristics. Along trade-offs between two objectives, TreePOD provides efficient selection guidance by focusing on Pareto-optimal tree candidates. TreePOD also conveys the sensitivities of tree characteristics on variations of selected parameters by extending the tree generation process with a full-factorial sampling. We demonstrate how TreePOD supports a variety of tasks involved in decision tree selection and describe its integration in a holistic workflow for building and selecting decision trees. For evaluation, we illustrate a case study for predicting critical power grid states, and we report qualitative feedback from domain experts in the energy sector. This feedback suggests that TreePOD enables users with and without statistical background a confident and efficient identification of suitable decision trees.

(Almost) practical tree codes

KAUST Repository

Khina, Anatoly

2016-08-15

We consider the problem of stabilizing an unstable plant driven by bounded noise over a digital noisy communication link, a scenario at the heart of networked control. To stabilize such a plant, one needs real-time encoding and decoding with an error probability profile that decays exponentially with the decoding delay. The works of Schulman and Sahai over the past two decades have developed the notions of tree codes and anytime capacity, and provided the theoretical framework for studying such problems. Nonetheless, there has been little practical progress in this area due to the absence of explicit constructions of tree codes with efficient encoding and decoding algorithms. Recently, linear time-invariant tree codes were proposed to achieve the desired result under maximum-likelihood decoding. In this work, we take one more step towards practicality, by showing that these codes can be efficiently decoded using sequential decoding algorithms, up to some loss in performance (and with some practical complexity caveats). We supplement our theoretical results with numerical simulations that demonstrate the effectiveness of the decoder in a control system setting.

An unusual mode of DNA duplex association: Watson-Crick interaction of all-purine deoxyribonucleic acids.

Science.gov (United States)

Battersby, Thomas R; Albalos, Maria; Friesenhahn, Michel J

2007-05-01

Nucleic acid duplexes associating through purine-purine base pairing have been constructed and characterized in a remarkable demonstration of nucleic acids with mixed sequence and a natural backbone in an alternative duplex structure. The antiparallel deoxyribose all-purine duplexes associate specifically through Watson-Crick pairing, violating the nucleobase size-complementarity pairing convention found in Nature. Sequence-specific recognition displayed by these structures makes the duplexes suitable, in principle, for information storage and replication fundamental to molecular evolution in all living organisms. All-purine duplexes can be formed through association of purines found in natural ribonucleosides. Key to the formation of these duplexes is the N(3)-H tautomer of isoguanine, preferred in the duplex, but not in aqueous solution. The duplexes have relevance to evolution of the modern genetic code and can be used for molecular recognition of natural nucleic acids.

End of the Line? Paul Watson and the Future of the Sea Shepherd Conservation Society

Directory of Open Access Journals (Sweden)

Gerry Joseph Nagtzaam

2014-03-01

Full Text Available This paper critically examines the Sea Shepherd Conservation Society (‘SSCS’ and the legal challenges they are currently facing to continue its self-appointed role to protect oceanic life through direct action.  In Part One, the article examines the history of this radical environmental group and; the role performed by its charismatic leader Paul Watson; it’s organisational structure and its strategies and tactics; its governing philosophy and its attitudes to violence.  Part Two provides a history of the various direct actions carried out by the group; it further examines the organisation’s ongoing confrontations with the Japanese whaling fleet; documents the current legal travails the group and its leader are experiencing; and lastly asks what impact these issues will have on the group’s viability as a direct action group going forward.

pplacer: linear time maximum-likelihood and Bayesian phylogenetic placement of sequences onto a fixed reference tree

Directory of Open Access Journals (Sweden)

Kodner Robin B

2010-10-01

Full Text Available Abstract Background Likelihood-based phylogenetic inference is generally considered to be the most reliable classification method for unknown sequences. However, traditional likelihood-based phylogenetic methods cannot be applied to large volumes of short reads from next-generation sequencing due to computational complexity issues and lack of phylogenetic signal. "Phylogenetic placement," where a reference tree is fixed and the unknown query sequences are placed onto the tree via a reference alignment, is a way to bring the inferential power offered by likelihood-based approaches to large data sets. Results This paper introduces pplacer, a software package for phylogenetic placement and subsequent visualization. The algorithm can place twenty thousand short reads on a reference tree of one thousand taxa per hour per processor, has essentially linear time and memory complexity in the number of reference taxa, and is easy to run in parallel. Pplacer features calculation of the posterior probability of a placement on an edge, which is a statistically rigorous way of quantifying uncertainty on an edge-by-edge basis. It also can inform the user of the positional uncertainty for query sequences by calculating expected distance between placement locations, which is crucial in the estimation of uncertainty with a well-sampled reference tree. The software provides visualizations using branch thickness and color to represent number of placements and their uncertainty. A simulation study using reads generated from 631 COG alignments shows a high level of accuracy for phylogenetic placement over a wide range of alignment diversity, and the power of edge uncertainty estimates to measure placement confidence. Conclusions Pplacer enables efficient phylogenetic placement and subsequent visualization, making likelihood-based phylogenetics methodology practical for large collections of reads; it is freely available as source code, binaries, and a web service.

Efficient reduction and modularization for large fault trees stored by pages

International Nuclear Information System (INIS)

Chen, Shanqi; Wang, Jin; Wang, Jiaqun; Wang, Fang; Hu, Liqin

2016-01-01

Highlights: • New fault tree pre-processing methods used in RiskA are presented. • Including the fault tree paging storage, simplification and modularization. • For getting MCS for fault trees containing more than 10,000 gates and events. • Reduce computer resources needs (RAM) and improve computation speed. - Abstract: Fault Tree Analysis (FTA), an indispensable tool used in Probabilistic Risk Assessment (PRA), has been used throughout the commercial nuclear power industry for safety and reliability analyses. However, large fault tree analysis, such as those used in nuclear power plant requires significant computer resources, which makes the analysis of PRA model inefficient and time consuming. This paper describes a fault tree pre-processing method used in the reliability and probabilistic safety assessment program RiskA that is capable of generating minimal cutsets for fault trees containing more than 10,000 gates and basic events. The novel feature of this method is not only that Boolean reduction rules are used but also that a new objective of simplification is proposed. Moreover, since the method aims to find more fault tree modules by the linear-time algorithm, it can optimize fault tree modularization, which further reduces the computational time of large fault tree analysis.

STBase: one million species trees for comparative biology.

Science.gov (United States)

McMahon, Michelle M; Deepak, Akshay; Fernández-Baca, David; Boss, Darren; Sanderson, Michael J

2015-01-01

Comprehensively sampled phylogenetic trees provide the most compelling foundations for strong inferences in comparative evolutionary biology. Mismatches are common, however, between the taxa for which comparative data are available and the taxa sampled by published phylogenetic analyses. Moreover, many published phylogenies are gene trees, which cannot always be adapted immediately for species level comparisons because of discordance, gene duplication, and other confounding biological processes. A new database, STBase, lets comparative biologists quickly retrieve species level phylogenetic hypotheses in response to a query list of species names. The database consists of 1 million single- and multi-locus data sets, each with a confidence set of 1000 putative species trees, computed from GenBank sequence data for 413,000 eukaryotic taxa. Two bodies of theoretical work are leveraged to aid in the assembly of multi-locus concatenated data sets for species tree construction. First, multiply labeled gene trees are pruned to conflict-free singly-labeled species-level trees that can be combined between loci. Second, impacts of missing data in multi-locus data sets are ameliorated by assembling only decisive data sets. Data sets overlapping with the user's query are ranked using a scheme that depends on user-provided weights for tree quality and for taxonomic overlap of the tree with the query. Retrieval times are independent of the size of the database, typically a few seconds. Tree quality is assessed by a real-time evaluation of bootstrap support on just the overlapping subtree. Associated sequence alignments, tree files and metadata can be downloaded for subsequent analysis. STBase provides a tool for comparative biologists interested in exploiting the most relevant sequence data available for the taxa of interest. It may also serve as a prototype for future species tree oriented databases and as a resource for assembly of larger species phylogenies from precomputed

STBase: one million species trees for comparative biology.

Directory of Open Access Journals (Sweden)

Michelle M McMahon

Full Text Available Comprehensively sampled phylogenetic trees provide the most compelling foundations for strong inferences in comparative evolutionary biology. Mismatches are common, however, between the taxa for which comparative data are available and the taxa sampled by published phylogenetic analyses. Moreover, many published phylogenies are gene trees, which cannot always be adapted immediately for species level comparisons because of discordance, gene duplication, and other confounding biological processes. A new database, STBase, lets comparative biologists quickly retrieve species level phylogenetic hypotheses in response to a query list of species names. The database consists of 1 million single- and multi-locus data sets, each with a confidence set of 1000 putative species trees, computed from GenBank sequence data for 413,000 eukaryotic taxa. Two bodies of theoretical work are leveraged to aid in the assembly of multi-locus concatenated data sets for species tree construction. First, multiply labeled gene trees are pruned to conflict-free singly-labeled species-level trees that can be combined between loci. Second, impacts of missing data in multi-locus data sets are ameliorated by assembling only decisive data sets. Data sets overlapping with the user's query are ranked using a scheme that depends on user-provided weights for tree quality and for taxonomic overlap of the tree with the query. Retrieval times are independent of the size of the database, typically a few seconds. Tree quality is assessed by a real-time evaluation of bootstrap support on just the overlapping subtree. Associated sequence alignments, tree files and metadata can be downloaded for subsequent analysis. STBase provides a tool for comparative biologists interested in exploiting the most relevant sequence data available for the taxa of interest. It may also serve as a prototype for future species tree oriented databases and as a resource for assembly of larger species phylogenies

Succession, climate, and neighborhood dynamics influence tree growth over time: an 87-year record of change in a Pinus resinosa (Aiton)-dominated forest, Minnesota, USA

Science.gov (United States)

Miranda T. Curzon; Anthony W. D' Amato; Shawn Fraver; Emily S. Huff; Brian J. Palik

2016-01-01

Resource availability and its influence on tree-to-tree interactions are expected to change over the course of forest stand development, but the rarity of long-term datasets has limited examinations of neighborhood crowding over extended time periods. How do a history of neighborhood interactions and population-level dynamics, including demographic transition, impact...

Tritium concentrations in tree ring cellulose

International Nuclear Information System (INIS)

Kaji, Toshio; Momoshima, Noriyuki; Takashima, Yoshimasa.

1989-01-01

Measurements of tritium (tissue bound tritium; TBT) concentration in tree rings are presented and discussed. Such measurement is expected to provide a useful means of estimating the tritium level in the environment in the past. The concentration of tritium bound in the tissue (TBT) in a tree ring considered to reflect the environmental tritium level in the area at the time of the formation of the ring, while the concentration of tritium in the free water in the tissue represents the current environmental tritium level. First, tritium concentration in tree ring cellulose sampled from a cedar tree grown in a typical environment in Fukuoka Prefecture is compared with the tritium concentration in precipitation in Tokyo. Results show that the year-to-year variations in the tritium concentration in the tree rings agree well with those in precipitation. The maximum concentration, which occurred in 1963, is attibuted to atmospheric nuclear testing which was performed frequently during the 1961 - 1963 period. Measurement is also made of the tritium concentration in tree ring cellulose sampled from a pine tree grown near the Isotope Center of Kyushu University (Fukuoka). Results indicate that the background level is higher probably due to the release of tritium from the facilities around the pine tree. Thus, measurement of tritium in tree ring cellulose clearly shows the year-to-year variation in the tritium concentration in the atmosphere. (N.K.)

An optimal algorithm for computing all subtree repeats in trees.

Science.gov (United States)

Flouri, T; Kobert, K; Pissis, S P; Stamatakis, A

2014-05-28

Given a labelled tree T, our goal is to group repeating subtrees of T into equivalence classes with respect to their topologies and the node labels. We present an explicit, simple and time-optimal algorithm for solving this problem for unrooted unordered labelled trees and show that the running time of our method is linear with respect to the size of T. By unordered, we mean that the order of the adjacent nodes (children/neighbours) of any node of T is irrelevant. An unrooted tree T does not have a node that is designated as root and can also be referred to as an undirected tree. We show how the presented algorithm can easily be modified to operate on trees that do not satisfy some or any of the aforementioned assumptions on the tree structure; for instance, how it can be applied to rooted, ordered or unlabelled trees.

Dormancy release and flowering time in Ziziphus jujuba Mill., a "direct flowering" fruit tree, has a facultative requirement for chilling.

Science.gov (United States)

Meir, Michal; Ransbotyn, Vanessa; Raveh, Eran; Barak, Simon; Tel-Zur, Noemi; Zaccai, Michele

2016-03-15

In deciduous fruit trees, the effect of chilling on flowering has mostly been investigated in the "indirect flowering" group, characterized by a period of rest between flower bud formation and blooming. In the present study, we explored the effects of chilling and chilling deprivation on the flowering of Ziziphus jujuba, a temperate deciduous fruit tree belonging to the "direct flowering" group, in which flower bud differentiation, blooming and fruit development occur after dormancy release, during a single growing season. Dormancy release, vegetative growth and flowering time in Z. jujuba cv. Ben-Li were assessed following several treatments of chilling. Chilling treatments quantitatively decreased the timing of vegetative bud dormancy release, thereby accelerating flowering, but had no effect on the time from dormancy release to flowering. Trees grown at a constant temperature of 25°C, without chilling, broke dormancy and flowered, indicating the facultative character of chilling in this species. We measured the expression of Z. jujuba LFY and AP1 homologues (ZjLFY and ZjAP1). Chilling decreased ZjLFY expression in dormant vegetative buds but had no effect on ZjAP1expression, which reached peak expression before dormancy release and at anthesis. In conclusion, chilling is not obligatory for dormancy release of Z. jujuba cv. Ben-Li vegetative buds. However, the exposure to chilling during dormancy does accelerate vegetative bud dormancy release and flowering. Copyright © 2016 Elsevier GmbH. All rights reserved.

Benefits of tree mixes in carbon plantings

Science.gov (United States)

Hulvey, Kristin B.; Hobbs, Richard J.; Standish, Rachel J.; Lindenmayer, David B.; Lach, Lori; Perring, Michael P.

2013-10-01

Increasingly governments and the private sector are using planted forests to offset carbon emissions. Few studies, however, examine how tree diversity -- defined here as species richness and/or stand composition -- affects carbon storage in these plantings. Using aboveground tree biomass as a proxy for carbon storage, we used meta-analysis to compare carbon storage in tree mixtures with monoculture plantings. Tree mixes stored at least as much carbon as monocultures consisting of the mixture's most productive species and at times outperformed monoculture plantings. In mixed-species stands, individual species, and in particular nitrogen-fixing trees, increased stand biomass. Further motivations for incorporating tree richness into planted forests include the contribution of diversity to total forest carbon-pool development, carbon-pool stability and the provision of extra ecosystem services. Our findings suggest a two-pronged strategy for designing carbon plantings including: (1) increased tree species richness; and (2) the addition of species that contribute to carbon storage and other target functions.

Modèles aléatoires en écologie et évolution

CERN Document Server

Méléard, Sylvie

2016-01-01

Le but du livre est de définir et développer une grande gamme d'outils probabilistes pour la modélisation en biologie des populations, afin de décrire des dynamiques temporelles de quantités biologiques telles que la taille d'une ou plusieurs populations, la proportion d'un allèle dans une population ou la position d'un individu. En partant de modèles markoviens discrets (marches aléatoires, processus de Galton-Watson), nous abordons progressivement le calcul stochastique et les équations différentielles stochastiques, puis les processus markoviens de saut, tels les processus de branchement à temps continu et les processus de naissance et mort. Nous étudions également les processus discret et continu pour l'évolution génétique et les généalogies: processus de Wright-Fisher et coalescent. Le livre détaille systématiquement les calculs de quantités d'intérêt pour les biologistes. De nombreux exercices d'application sont proposés. Le dernier chapitre montre l'apport de ces outils pour des...

LEOPARD syndrome is not linked to the Marfan syndrome and the Watson syndrome loci

Energy Technology Data Exchange (ETDEWEB)

Rass-Rothchild, A.: Abeliovitch, D.; Kornstein, A. [Tel Aviv Univ. (Israel)]|[Hebrew Univ., Jerusalem (Israel)

1994-09-01

The acronym LEOPARD stands for a syndromic association of Lentigines, Eletrocardiographic changes, Ocular hypertelorism, Pulmonic stenosis, Abnormal genitalia, Retardation of growth and sensorineural Deafness. Inheritance is autosomal dominant with high penetrance and variable expressivity. In 1990 Torok et al. reported on the association of LEOPARD and Marfan syndrome. In addition a clinical similarity (cardiac and cutaneous involvement) exists with the Watson syndrome (neurofibromatosis and pulmonic stenosis) which is linked to the marker D17S33 on chromosome 17. We studied possible linkage of LEOPARD syndrome to the Marfan syndrome locus on chromosome 15 (D15S1, MF13, and (TAAAA)n repeats) and to the NF-1 locus on chromosome 17 in a family with 9 cases of LEOPARD syndrome. Close linkage between LEOPARD syndrome and both the Marfan locus on chromosome 15 and the NF-1 locus on chromosome 17 was excluded (lod score <-2.0 through {theta} = 0.1).

Proton tunneling in the A∙T Watson-Crick DNA base pair: myth or reality?

Science.gov (United States)

Brovarets', Ol'ha O; Hovorun, Dmytro M

2015-01-01

The results and conclusions reached by Godbeer et al. in their recent work, that proton tunneling in the A∙T(WC) Watson-Crick (WC) DNA base pair occurs according to the Löwdin's (L) model, but with a small (~10(-9)) probability were critically analyzed. Here, it was shown that this finding overestimates the possibility of the proton tunneling at the A∙T(WC)↔A*∙T*(L) tautomerization, because this process cannot be implemented as a chemical reaction. Furthermore, it was outlined those biologically important nucleobase mispairs (A∙A*↔A*∙A, G∙G*↔G*∙G, T∙T*↔T*∙T, C∙C*↔C*∙C, H∙H*↔H*∙H (H - hypoxanthine)) - the players in the field of the spontaneous point mutagenesis - where the tunneling of protons is expected and for which the application of the model proposed by Godbeer et al. can be productive.

Watson-Crick Base Pair Radical Cation as a Model for Oxidative Damage in DNA.

Science.gov (United States)

Feketeová, Linda; Chan, Bun; Khairallah, George N; Steinmetz, Vincent; Maitre, Philippe; Radom, Leo; O'Hair, Richard A J

2017-07-06

The deleterious cellular effects of ionizing radiation are well-known, but the mechanisms causing DNA damage are poorly understood. The accepted molecular events involve initial oxidation and deprotonation at guanine sites, triggering hydrogen atom abstraction reactions from the sugar moieties, causing DNA strand breaks. Probing the chemistry of the initially formed radical cation has been challenging. Here, we generate, spectroscopically characterize, and examine the reactivity of the Watson-Crick nucleobase pair radical cation in the gas phase. We observe rich chemistry, including proton transfer between the bases and propagation of the radical site in deoxyguanosine from the base to the sugar, thus rupturing the sugar. This first example of a gas-phase model system providing molecular-level details on the chemistry of an ionized DNA base pair paves the way toward a more complete understanding of molecular processes induced by radiation. It also highlights the role of radical propagation in chemistry, biology, and nanotechnology.

Using tree diversity to compare phylogenetic heuristics.

Science.gov (United States)

Sul, Seung-Jin; Matthews, Suzanne; Williams, Tiffani L

2009-04-29

Evolutionary trees are family trees that represent the relationships between a group of organisms. Phylogenetic heuristics are used to search stochastically for the best-scoring trees in tree space. Given that better tree scores are believed to be better approximations of the true phylogeny, traditional evaluation techniques have used tree scores to determine the heuristics that find the best scores in the fastest time. We develop new techniques to evaluate phylogenetic heuristics based on both tree scores and topologies to compare Pauprat and Rec-I-DCM3, two popular Maximum Parsimony search algorithms. Our results show that although Pauprat and Rec-I-DCM3 find the trees with the same best scores, topologically these trees are quite different. Furthermore, the Rec-I-DCM3 trees cluster distinctly from the Pauprat trees. In addition to our heatmap visualizations of using parsimony scores and the Robinson-Foulds distance to compare best-scoring trees found by the two heuristics, we also develop entropy-based methods to show the diversity of the trees found. Overall, Pauprat identifies more diverse trees than Rec-I-DCM3. Overall, our work shows that there is value to comparing heuristics beyond the parsimony scores that they find. Pauprat is a slower heuristic than Rec-I-DCM3. However, our work shows that there is tremendous value in using Pauprat to reconstruct trees-especially since it finds identical scoring but topologically distinct trees. Hence, instead of discounting Pauprat, effort should go in improving its implementation. Ultimately, improved performance measures lead to better phylogenetic heuristics and will result in better approximations of the true evolutionary history of the organisms of interest.

Predicting human height by Victorian and genomic methods

NARCIS (Netherlands)

Y.S. Aulchenko (Yurii); M.V. Struchalin (Maksim); N.M. Belonogova (Nadezhda); T.I. Axenovich (Tatiana); M.N. Weedon (Michael); A. Hofman (Albert); A.G. Uitterlinden (André); M.H. Kayser (Manfred); B.A. Oostra (Ben); P. Tikka-Kleemola (Päivi); A.C.J.W. Janssens (Cécile); P.M. Borodin (Pavel)

2009-01-01

textabstractIn the Victorian era, Sir Francis Galton showed that 'when dealing with the transmission of stature from parents to children, the average height of the two parents, ... is all we need care to know about them' (1886). One hundred and twenty-two years after Galton's work was published, 54

Analyzing Phylogenetic Trees with Timed and Probabilistic Model Checking: The Lactose Persistence Case Study.

Science.gov (United States)

Requeno, José Ignacio; Colom, José Manuel

2014-12-01

Model checking is a generic verification technique that allows the phylogeneticist to focus on models and specifications instead of on implementation issues. Phylogenetic trees are considered as transition systems over which we interrogate phylogenetic questions written as formulas of temporal logic. Nonetheless, standard logics become insufficient for certain practices of phylogenetic analysis since they do not allow the inclusion of explicit time and probabilities. The aim of this paper is to extend the application of model checking techniques beyond qualitative phylogenetic properties and adapt the existing logical extensions and tools to the field of phylogeny. The introduction of time and probabilities in phylogenetic specifications is motivated by the study of a real example: the analysis of the ratio of lactose intolerance in some populations and the date of appearance of this phenotype.

Phylogenetic tree reconstruction accuracy and model fit when proportions of variable sites change across the tree.

Science.gov (United States)

Shavit Grievink, Liat; Penny, David; Hendy, Michael D; Holland, Barbara R

2010-05-01

Commonly used phylogenetic models assume a homogeneous process through time in all parts of the tree. However, it is known that these models can be too simplistic as they do not account for nonhomogeneous lineage-specific properties. In particular, it is now widely recognized that as constraints on sequences evolve, the proportion and positions of variable sites can vary between lineages causing heterotachy. The extent to which this model misspecification affects tree reconstruction is still unknown. Here, we evaluate the effect of changes in the proportions and positions of variable sites on model fit and tree estimation. We consider 5 current models of nucleotide sequence evolution in a Bayesian Markov chain Monte Carlo framework as well as maximum parsimony (MP). We show that for a tree with 4 lineages where 2 nonsister taxa undergo a change in the proportion of variable sites tree reconstruction under the best-fitting model, which is chosen using a relative test, often results in the wrong tree. In this case, we found that an absolute test of model fit is a better predictor of tree estimation accuracy. We also found further evidence that MP is not immune to heterotachy. In addition, we show that increased sampling of taxa that have undergone a change in proportion and positions of variable sites is critical for accurate tree reconstruction.

Tree Nut Allergies

Science.gov (United States)

... Blog Vision Awards Common Allergens Tree Nut Allergy Tree Nut Allergy Learn about tree nut allergy, how ... a Tree Nut Label card . Allergic Reactions to Tree Nuts Tree nuts can cause a severe and ...

Highly Accurate Classification of Watson-Crick Basepairs on Termini of Single DNA Molecules

Science.gov (United States)

Winters-Hilt, Stephen; Vercoutere, Wenonah; DeGuzman, Veronica S.; Deamer, David; Akeson, Mark; Haussler, David

2003-01-01

We introduce a computational method for classification of individual DNA molecules measured by an α-hemolysin channel detector. We show classification with better than 99% accuracy for DNA hairpin molecules that differ only in their terminal Watson-Crick basepairs. Signal classification was done in silico to establish performance metrics (i.e., where train and test data were of known type, via single-species data files). It was then performed in solution to assay real mixtures of DNA hairpins. Hidden Markov Models (HMMs) were used with Expectation/Maximization for denoising and for associating a feature vector with the ionic current blockade of the DNA molecule. Support Vector Machines (SVMs) were used as discriminators, and were the focus of off-line training. A multiclass SVM architecture was designed to place less discriminatory load on weaker discriminators, and novel SVM kernels were used to boost discrimination strength. The tuning on HMMs and SVMs enabled biophysical analysis of the captured molecule states and state transitions; structure revealed in the biophysical analysis was used for better feature selection. PMID:12547778

Big trees, old trees, and growth factor tables

Science.gov (United States)

Kevin T. Smith

2018-01-01

The potential for a tree to reach a great size and to live a long life frequently captures the public's imagination. Sometimes the desire to know the age of an impressively large tree is simple curiosity. For others, the date-of-tree establishment can make a big diff erence for management, particularly for trees at historic sites or those mentioned in property...

A Suffix Tree Or Not a Suffix Tree?

DEFF Research Database (Denmark)

Starikovskaya, Tatiana; Vildhøj, Hjalte Wedel

2015-01-01

In this paper we study the structure of suffix trees. Given an unlabeled tree r on n nodes and suffix links of its internal nodes, we ask the question “Is r a suffix tree?”, i.e., is there a string S whose suffix tree has the same topological structure as r? We place no restrictions on S, in part...

Longest common extensions in trees

DEFF Research Database (Denmark)

Bille, Philip; Gawrychowski, Pawel; Gørtz, Inge Li

2016-01-01

to trees and suggest a few applications of LCE in trees to tries and XML databases. Given a labeled and rooted tree T of size n, the goal is to preprocess T into a compact data structure that support the following LCE queries between subpaths and subtrees in T. Let v1, v2, w1, and w2 be nodes of T...... such that w1 and w2 are descendants of v1 and v2 respectively. - LCEPP(v1, w1, v2, w2): (path-path LCE) return the longest common prefix of the paths v1 ~→ w1 and v2 ~→ w2. - LCEPT(v1, w1, v2): (path-tree LCE) return maximal path-path LCE of the path v1 ~→ w1 and any path from v2 to a descendant leaf. - LCETT......(v1, v2): (tree-tree LCE) return a maximal path-path LCE of any pair of paths from v1 and v2 to descendant leaves. We present the first non-trivial bounds for supporting these queries. For LCEPP queries, we present a linear-space solution with O(log* n) query time. For LCEPT queries, we present...

Longest Common Extensions in Trees

DEFF Research Database (Denmark)

Bille, Philip; Gawrychowski, Pawel; Gørtz, Inge Li

2015-01-01

to trees and suggest a few applications of LCE in trees to tries and XML databases. Given a labeled and rooted tree T of size n, the goal is to preprocess T into a compact data structure that support the following LCE queries between subpaths and subtrees in T. Let v1, v2, w1, and w2 be nodes of T...... such that w1 and w2 are descendants of v1 and v2 respectively. - LCEPP(v1, w1, v2, w2): (path-path LCE) return the longest common prefix of the paths v1 ~→ w1 and v2 ~→ w2. - LCEPT(v1, w1, v2): (path-tree LCE) return maximal path-path LCE of the path v1 ~→ w1 and any path from v2 to a descendant leaf. - LCETT......(v1, v2): (tree-tree LCE) return a maximal path-path LCE of any pair of paths from v1 and v2 to descendant leaves. We present the first non-trivial bounds for supporting these queries. For LCEPP queries, we present a linear-space solution with O(log* n) query time. For LCEPT queries, we present...

Sensitivity Analysis for Assessing Effects of Tree Population Dynamics on Soil Bioturbation

Science.gov (United States)

Martin, Y. E.; Johnson, E. A.

2012-12-01

Bioturbation due to tree root throw is thought to be an important process in soil production and soil mixing. Despite progress in our understanding of root throw processes, the tree population dynamics affecting the occurrence and timing of root throw events remain much less well explained. Unfortunately, research about forest dynamics is not always undertaken from the perspective of those interested in tree death, tree topple and associated root throw. As a result, the necessary field data about tree population dynamics is often unavailable for many locations. The acquisition of such data would allow for improved interpretation of root throw observations and for incorporation within numerical models of tree root throw occurrence. The present study uses our earlier tree population dynamics model calibrated for subalpine forests in the Canadian Rockies to test the sensitivity of forest parameters within the model that determine tree death, tree topple, root throw and soil bioturbation. Crown wildfire disturbance is the primary driver of tree population dynamics, with wind throw being mainly of local importance. The recruitment and mortality of trees during multiple generations of forest determine the number of live trees on the landscape at any given time. Tree death may occur due to competition/thinning of trees between wildfire events or as a result of the wildfire itself. Unless trees die due to sudden wind throw events (as mentioned above, this is only of local significance in our study area), they remain standing for some time period after tree death and before tree topple; these trees are referred to as standing dead trees. The duration of this time window and several other factors influence if a tree breaks at its base or upheaves a relatively intact root plate with attached sediment. Our field research has also suggested that a minimum dbh is required before a root plate is large enough to upheave notable amounts of sediment. Modelling results in this study

Estimation of Tree Lists from Airborne Laser Scanning Using Tree Model Clustering and k-MSN Imputation

Directory of Open Access Journals (Sweden)

Jörgen Wallerman

2013-04-01

Full Text Available Individual tree crowns may be delineated from airborne laser scanning (ALS data by segmentation of surface models or by 3D analysis. Segmentation of surface models benefits from using a priori knowledge about the proportions of tree crowns, which has not yet been utilized for 3D analysis to any great extent. In this study, an existing surface segmentation method was used as a basis for a new tree model 3D clustering method applied to ALS returns in 104 circular field plots with 12 m radius in pine-dominated boreal forest (64°14'N, 19°50'E. For each cluster below the tallest canopy layer, a parabolic surface was fitted to model a tree crown. The tree model clustering identified more trees than segmentation of the surface model, especially smaller trees below the tallest canopy layer. Stem attributes were estimated with k-Most Similar Neighbours (k-MSN imputation of the clusters based on field-measured trees. The accuracy at plot level from the k-MSN imputation (stem density root mean square error or RMSE 32.7%; stem volume RMSE 28.3% was similar to the corresponding results from the surface model (stem density RMSE 33.6%; stem volume RMSE 26.1% with leave-one-out cross-validation for one field plot at a time. Three-dimensional analysis of ALS data should also be evaluated in multi-layered forests since it identified a larger number of small trees below the tallest canopy layer.

Tree-growth analyses to estimate tree species' drought tolerance

NARCIS (Netherlands)

Eilmann, B.; Rigling, A.

2012-01-01

Climate change is challenging forestry management and practices. Among other things, tree species with the ability to cope with more extreme climate conditions have to be identified. However, while environmental factors may severely limit tree growth or even cause tree death, assessing a tree

Directional phytoscreening: contaminant gradients in trees for plume delineation.

Science.gov (United States)

Limmer, Matt A; Shetty, Mikhil K; Markus, Samantha; Kroeker, Ryan; Parker, Beth L; Martinez, Camilo; Burken, Joel G

2013-08-20

Tree sampling methods have been used in phytoscreening applications to delineate contaminated soil and groundwater, augmenting traditional investigative methods that are time-consuming, resource-intensive, invasive, and costly. In the past decade, contaminant concentrations in tree tissues have been shown to reflect the extent and intensity of subsurface contamination. This paper investigates a new phytoscreening tool: directional tree coring, a concept originating from field data that indicated azimuthal concentrations in tree trunks reflected the concentration gradients in the groundwater around the tree. To experimentally test this hypothesis, large diameter trees were subjected to subsurface contaminant concentration gradients in a greenhouse study. These trees were then analyzed for azimuthal concentration gradients in aboveground tree tissues, revealing contaminant centroids located on the side of the tree nearest the most contaminated groundwater. Tree coring at three field sites revealed sufficiently steep contaminant gradients in trees reflected nearby groundwater contaminant gradients. In practice, trees possessing steep contaminant gradients are indicators of steep subsurface contaminant gradients, providing compass-like information about the contaminant gradient, pointing investigators toward higher concentration regions of the plume.

TreeNetViz: revealing patterns of networks over tree structures.

Science.gov (United States)

Gou, Liang; Zhang, Xiaolong Luke

2011-12-01

Network data often contain important attributes from various dimensions such as social affiliations and areas of expertise in a social network. If such attributes exhibit a tree structure, visualizing a compound graph consisting of tree and network structures becomes complicated. How to visually reveal patterns of a network over a tree has not been fully studied. In this paper, we propose a compound graph model, TreeNet, to support visualization and analysis of a network at multiple levels of aggregation over a tree. We also present a visualization design, TreeNetViz, to offer the multiscale and cross-scale exploration and interaction of a TreeNet graph. TreeNetViz uses a Radial, Space-Filling (RSF) visualization to represent the tree structure, a circle layout with novel optimization to show aggregated networks derived from TreeNet, and an edge bundling technique to reduce visual complexity. Our circular layout algorithm reduces both total edge-crossings and edge length and also considers hierarchical structure constraints and edge weight in a TreeNet graph. These experiments illustrate that the algorithm can reduce visual cluttering in TreeNet graphs. Our case study also shows that TreeNetViz has the potential to support the analysis of a compound graph by revealing multiscale and cross-scale network patterns. © 2011 IEEE

Anchoring quartet-based phylogenetic distances and applications to species tree reconstruction.

Science.gov (United States)

Sayyari, Erfan; Mirarab, Siavash

2016-11-11

Inferring species trees from gene trees using the coalescent-based summary methods has been the subject of much attention, yet new scalable and accurate methods are needed. We introduce DISTIQUE, a new statistically consistent summary method for inferring species trees from gene trees under the coalescent model. We generalize our results to arbitrary phylogenetic inference problems; we show that two arbitrarily chosen leaves, called anchors, can be used to estimate relative distances between all other pairs of leaves by inferring relevant quartet trees. This results in a family of distance-based tree inference methods, with running times ranging between quadratic to quartic in the number of leaves. We show in simulated studies that DISTIQUE has comparable accuracy to leading coalescent-based summary methods and reduced running times.

Establishment of trees on minesoils during drought and wet years

International Nuclear Information System (INIS)

Larson, M.M.; Kost, D.A.; Vimmerstedt, J.P.

1995-01-01

In two studies, green ash (Fraxinus pennsylvania) and white pine (Pinus strobus) were planted on three minesoils (graded topsoil, ripped topsoil, and gray cast overburden). Mixtures of grasses and/or legumes were seeded at different times in relation to tree planting. In the first study, tree planting was followed by several week of drought; in the second, precipitation was above average for the first two growing seasons following planting. In the drought year, survival of green ash was influenced by minesoil type, herbaceous mixture, and herbaceous seeding time in relation to tree planting. Among minesoils, mean survival was highest (87%) on cast overburden. Seeding grasses the fall before planting resulted in poor ash survival (40% to 47%) compared with seeding at time of planting (82% to 85%). Ash survived well (81% to 94%) on legume-seeded plots. When tree planting was followed by two wet seasons, survival at 4 and 5 yr ranged from very good to excellent in all treatments. Total height of ash trees on cast overburden averaged 31% less than that of trees on topsoil, and 29% greater on legume-seeded subplots than trees on grass subplots, although herbaceous biomass was greater on legume subplots. The three minesoils proved unsuitable for white pine. 17 refs., 7 tabs

TREE SELECTING AND TREE RING MEASURING IN DENDROCHRONOLOGICAL INVESTIGATIONS

Directory of Open Access Journals (Sweden)

Sefa Akbulut

2004-04-01

Full Text Available Dendrochronology is a method of dating which makes use of the annual nature of tree growth. Dendrochronology may be divided into a number of subfields, each of which covers one or more aspects of the use of tree ring data: dendroclimatology, dendrogeomorphology, dendrohydrology, dendroecology, dendroarchaelogy, and dendrogylaciology. Basic of all form the analysis of the tree rings. The wood or tree rings can aid to dating past events about climatology, ecology, geology, hydrology. Dendrochronological studies are conducted either on increment cores or on discs. It may be seen abnormalities on tree rings during the measurement like that false rings, missing rings, reaction wood. Like that situation, increment cores must be extracted from four different sides of each tree and be studied as more as on tree.

Fault tree handbook

International Nuclear Information System (INIS)

Haasl, D.F.; Roberts, N.H.; Vesely, W.E.; Goldberg, F.F.

1981-01-01

This handbook describes a methodology for reliability analysis of complex systems such as those which comprise the engineered safety features of nuclear power generating stations. After an initial overview of the available system analysis approaches, the handbook focuses on a description of the deductive method known as fault tree analysis. The following aspects of fault tree analysis are covered: basic concepts for fault tree analysis; basic elements of a fault tree; fault tree construction; probability, statistics, and Boolean algebra for the fault tree analyst; qualitative and quantitative fault tree evaluation techniques; and computer codes for fault tree evaluation. Also discussed are several example problems illustrating the basic concepts of fault tree construction and evaluation

GumTree-An integrated scientific experiment environment

International Nuclear Information System (INIS)

Lam, Tony; Hauser, Nick; Goetz, Andy; Hathaway, Paul; Franceschini, Fredi; Rayner, Hugh; Zhang, Lidia

2006-01-01

GumTree is an open source and multi-platform graphical user interface for performing neutron scattering and X-ray experiments. It handles the complete experiment life cycle from instrument calibration, data acquisition, and real time data analysis to results publication. The aim of the GumTree Project is to create a highly Integrated Scientific Experiment Environment (ISEE), allowing interconnectivity and data sharing between different distributed components such as motors, detectors, user proposal database and data analysis server. GumTree is being adapted to several instrument control server systems such as TANGO, EPICS and SICS, providing an easy-to-use front-end for users and simple-to-extend model for software developers. The design of GumTree is aimed to be reusable and configurable for any scientific instrument. GumTree will be adapted to six neutron beam instruments for the OPAL reactor at ANSTO. Other European institutes including ESRF, ILL and PSI have shown interest in using GumTree as their workbench for instrument control and data analysis

Water, gravity and trees: Relationship of tree-ring widths and total water storage dynamics

Science.gov (United States)

Creutzfeldt, B.; Heinrich, I.; Merz, B.; Blume, T.; Güntner, A.

2012-04-01

Water stored in the subsurface as groundwater or soil moisture is the main fresh water source not only for drinking water and food production but also for the natural vegetation. In a changing environment water availability becomes a critical issue in many different regions. Long-term observations of the past are needed to improve the understanding of the hydrological system and the prediction of future developments. Tree ring data have repeatedly proved to be valuable sources for reconstructing long-term climate dynamics, e.g. temperature, precipitation and different hydrological variables. In water-limited environments, tree growth is primarily influenced by total water stored in the subsurface and hence, tree-ring records usually contain information about subsurface water storage. The challenge is to retrieve the information on total water storage from tree rings, because a training dataset of water stored in the sub-surface is required for calibration against the tree-ring series. However, measuring water stored in the subsurface is notoriously difficult. We here present high-precision temporal gravimeter measurements which allow for the depth-integrated quantification of total water storage dynamics at the field scale. In this study, we evaluate the relationship of total water storage change and tree ring growth also in the context of the complex interactions of other meteorological forcing factors. A tree-ring chronology was derived from a Norway spruce stand in the Bavarian Forest, Germany. Total water storage dynamics were measured directly by the superconducting gravimeter of the Geodetic Observatory Wettzell for a 9-years period. Time series were extended to 63-years period by a hydrological model using gravity data as the only calibration constrain. Finally, water storage changes were reconstructed based on the relationship between the hydrological model and the tree-ring chronology. Measurement results indicate that tree-ring growth is primarily

Capturing student mathematical engagement through differently enacted classroom practices: applying a modification of Watson's analytical tool

Science.gov (United States)

Patahuddin, Sitti Maesuri; Puteri, Indira; Lowrie, Tom; Logan, Tracy; Rika, Baiq

2018-04-01

This study examined student mathematical engagement through the intended and enacted lessons taught by two teachers in two different middle schools in Indonesia. The intended lesson was developed using the ELPSA learning design to promote mathematical engagement. Based on the premise that students will react to the mathematical tasks in the forms of words and actions, the analysis focused on identifying the types of mathematical engagement promoted through the intended lesson and performed by students during the lesson. Using modified Watson's analytical tool (2007), students' engagement was captured from what the participants' did or said mathematically. We found that teachers' enacted practices had an influence on student mathematical engagement. The teacher who demonstrated content in explicit ways tended to limit the richness of the engagement; whereas the teacher who presented activities in an open-ended manner fostered engagement.

Privacy for Key-Trees with Adaptive Adversaries

NARCIS (Netherlands)

Beye, M.; Veugen, P.J.M.

2011-01-01

Hash-lock authentication protocols for Radio Frequency IDentification (RFID) tags incur heavy search on the server. Key-trees have been proposed as a way to reduce search times, but because partial keys in such trees are shared, key compromise affects several tags. Butty´an [3] and Beye and Veugen

Physiology and Genetics of Tree-Phytophage Interactions

Science.gov (United States)

Frances Lieutier; William J. Mattson; Michael R. Wagner

1999-01-01

Interactions between trees and phytophagous organisms represent an important fundamental process in the evolution of forest ecosystems. Through evolutionary time, the special traits of trees have lead the herbivore populations to differentiate and evolve in order to cope with the variability in natural resistance mechanisms of their hosts. Conversely, damage by...

Anonymity for key-trees with adaptive adversaries

NARCIS (Netherlands)

Beye, M.; Veugen, P.J.M.

2012-01-01

Hash-lock authentication protocols for Radio Frequency IDentification (RFID) tags incur heavy search on the server. Key-trees have been proposed as a way to reduce search times, but because partial keys in such trees are shared, key compromise affects several tags. Buttyán [4] and Beye and Veugen

Genomics-assisted breeding in fruit trees.

Science.gov (United States)

Iwata, Hiroyoshi; Minamikawa, Mai F; Kajiya-Kanegae, Hiromi; Ishimori, Motoyuki; Hayashi, Takeshi

2016-01-01

Recent advancements in genomic analysis technologies have opened up new avenues to promote the efficiency of plant breeding. Novel genomics-based approaches for plant breeding and genetics research, such as genome-wide association studies (GWAS) and genomic selection (GS), are useful, especially in fruit tree breeding. The breeding of fruit trees is hindered by their long generation time, large plant size, long juvenile phase, and the necessity to wait for the physiological maturity of the plant to assess the marketable product (fruit). In this article, we describe the potential of genomics-assisted breeding, which uses these novel genomics-based approaches, to break through these barriers in conventional fruit tree breeding. We first introduce the molecular marker systems and whole-genome sequence data that are available for fruit tree breeding. Next we introduce the statistical methods for biparental linkage and quantitative trait locus (QTL) mapping as well as GWAS and GS. We then review QTL mapping, GWAS, and GS studies conducted on fruit trees. We also review novel technologies for rapid generation advancement. Finally, we note the future prospects of genomics-assisted fruit tree breeding and problems that need to be overcome in the breeding.

Spatial aspects of tree mortality strongly differ between young and old-growth forests.

Science.gov (United States)

Larson, Andrew J; Lutz, James A; Donato, Daniel C; Freund, James A; Swanson, Mark E; HilleRisLambers, Janneke; Sprugel, Douglas G; Franklin, Jerry F

2015-11-01

Rates and spatial patterns of tree mortality are predicted to change during forest structural development. In young forests, mortality should be primarily density dependent due to competition for light, leading to an increasingly spatially uniform pattern of surviving trees. In contrast, mortality in old-growth forests should be primarily caused by contagious and spatially autocorrelated agents (e.g., insects, wind), causing spatial aggregation of surviving trees to increase through time. We tested these predictions by contrasting a three-decade record of tree mortality from replicated mapped permanent plots located in young (old) and old-growth (> 300-year-old) Abies amabilis forests. Trees in young forests died at a rate of 4.42% per year, whereas trees in old-growth forests died at 0.60% per year. Tree mortality in young forests was significantly aggregated, strongly density dependent, and caused live tree patterns to become more uniform through time. Mortality in old-growth forests was spatially aggregated, but was density independent and did not change the spatial pattern of surviving trees. These results extend current theory by demonstrating that density-dependent competitive mortality leading to increasingly uniform tree spacing in young forests ultimately transitions late in succession to a more diverse tree mortality regime that maintains spatial heterogeneity through time.

Conservation and restoration of forest trees impacted by non-native pathogens: the role of genetics and tree improvement

Science.gov (United States)

R.A. Sniezko; L.A. Winn

2017-01-01

North American native tree species in forest ecosystems, as well as managed forests and urban plantings, are being severely impacted by pathogens and insects. The impacts of these pathogens and insects often increase over time, and they are particularly acute for those species affected by non-native pathogens and insects. For restoration of affected tree species or for...

Modular tree automata

DEFF Research Database (Denmark)

Bahr, Patrick

2012-01-01

Tree automata are traditionally used to study properties of tree languages and tree transformations. In this paper, we consider tree automata as the basis for modular and extensible recursion schemes. We show, using well-known techniques, how to derive from standard tree automata highly modular...

Rate of tree carbon accumulation increases continuously with tree size.

Science.gov (United States)

Stephenson, N L; Das, A J; Condit, R; Russo, S E; Baker, P J; Beckman, N G; Coomes, D A; Lines, E R; Morris, W K; Rüger, N; Alvarez, E; Blundo, C; Bunyavejchewin, S; Chuyong, G; Davies, S J; Duque, A; Ewango, C N; Flores, O; Franklin, J F; Grau, H R; Hao, Z; Harmon, M E; Hubbell, S P; Kenfack, D; Lin, Y; Makana, J-R; Malizia, A; Malizia, L R; Pabst, R J; Pongpattananurak, N; Su, S-H; Sun, I-F; Tan, S; Thomas, D; van Mantgem, P J; Wang, X; Wiser, S K; Zavala, M A

2014-03-06

Forests are major components of the global carbon cycle, providing substantial feedback to atmospheric greenhouse gas concentrations. Our ability to understand and predict changes in the forest carbon cycle--particularly net primary productivity and carbon storage--increasingly relies on models that represent biological processes across several scales of biological organization, from tree leaves to forest stands. Yet, despite advances in our understanding of productivity at the scales of leaves and stands, no consensus exists about the nature of productivity at the scale of the individual tree, in part because we lack a broad empirical assessment of whether rates of absolute tree mass growth (and thus carbon accumulation) decrease, remain constant, or increase as trees increase in size and age. Here we present a global analysis of 403 tropical and temperate tree species, showing that for most species mass growth rate increases continuously with tree size. Thus, large, old trees do not act simply as senescent carbon reservoirs but actively fix large amounts of carbon compared to smaller trees; at the extreme, a single big tree can add the same amount of carbon to the forest within a year as is contained in an entire mid-sized tree. The apparent paradoxes of individual tree growth increasing with tree size despite declining leaf-level and stand-level productivity can be explained, respectively, by increases in a tree's total leaf area that outpace declines in productivity per unit of leaf area and, among other factors, age-related reductions in population density. Our results resolve conflicting assumptions about the nature of tree growth, inform efforts to undertand and model forest carbon dynamics, and have additional implications for theories of resource allocation and plant senescence.

TreeBASIS Feature Descriptor and Its Hardware Implementation

Directory of Open Access Journals (Sweden)

Spencer Fowers

2014-01-01

Full Text Available This paper presents a novel feature descriptor called TreeBASIS that provides improvements in descriptor size, computation time, matching speed, and accuracy. This new descriptor uses a binary vocabulary tree that is computed using basis dictionary images and a test set of feature region images. To facilitate real-time implementation, a feature region image is binary quantized and the resulting quantized vector is passed into the BASIS vocabulary tree. A Hamming distance is then computed between the feature region image and the effectively descriptive basis dictionary image at a node to determine the branch taken and the path the feature region image takes is saved as a descriptor. The TreeBASIS feature descriptor is an excellent candidate for hardware implementation because of its reduced descriptor size and the fact that descriptors can be created and features matched without the use of floating point operations. The TreeBASIS descriptor is more computationally and space efficient than other descriptors such as BASIS, SIFT, and SURF. Moreover, it can be computed entirely in hardware without the support of a CPU for additional software-based computations. Experimental results and a hardware implementation show that the TreeBASIS descriptor compares well with other descriptors for frame-to-frame homography computation while requiring fewer hardware resources.

Performance characterization of Watson Ahumada motion detector using random dot rotary motion stimuli.

Directory of Open Access Journals (Sweden)

Siddharth Jain

Full Text Available The performance of Watson & Ahumada's model of human visual motion sensing is compared against human psychophysical performance. The stimulus consists of random dots undergoing rotary motion, displayed in a circular annulus. The model matches psychophysical observer performance with respect to most parameters. It is able to replicate some key psychophysical findings such as invariance of observer performance to dot density in the display, and decrease of observer performance with frame duration of the display.Associated with the concept of rotary motion is the notion of a center about which rotation occurs. One might think that for accurate estimation of rotary motion in the display, this center must be accurately known. A simple vector analysis reveals that this need not be the case. Numerical simulations confirm this result, and may explain the position invariance of MST(d cells. Position invariance is the experimental finding that rotary motion sensitive cells are insensitive to where in their receptive field rotation occurs.When all the dots in the display are randomly drawn from a uniform distribution, illusory rotary motion is perceived. This case was investigated by Rose & Blake previously, who termed the illusory rotary motion the omega effect. Two important experimental findings are reported concerning this effect. First, although the display of random dots evokes perception of rotary motion, the direction of motion perceived does not depend on what dot pattern is shown. Second, the time interval between spontaneous flips in perceived direction is lognormally distributed (mode approximately 2 s. These findings suggest the omega effect fits in the category of a typical bistable illusion, and therefore the processes that give rise to this illusion may be the same processes that underlie much of other bistable phenomenon.

Lodgepole pine provenances differ in chemical defense capacities against foliage and stem diseases

Science.gov (United States)

Maximization of lodgepole pine (Pinus contorta Douglas ex Louden var. latifolia Engelm. ex S. Watson) growth in the face of climate change and new pest outbreaks requires an understanding of the natural variability of quantitative resistance to disease. We assessed trees for the severity of foliar d...

Silver (I) as DNA glue: Ag+-mediated guanine pairing revealed by removing Watson-Crick constraints

Science.gov (United States)

Swasey, Steven M.; Leal, Leonardo Espinosa; Lopez-Acevedo, Olga; Pavlovich, James; Gwinn, Elisabeth G.

2015-01-01

Metal ion interactions with DNA have far-reaching implications in biochemistry and DNA nanotechnology. Ag+ is uniquely interesting because it binds exclusively to the bases rather than the backbone of DNA, without the toxicity of Hg2+. In contrast to prior studies of Ag+ incorporation into double-stranded DNA, we remove the constraints of Watson-Crick pairing by focusing on homo-base DNA oligomers of the canonical bases. High resolution electro-spray ionization mass spectrometry reveals an unanticipated Ag+-mediated pairing of guanine homo-base strands, with higher stability than canonical guanine-cytosine pairing. By exploring unrestricted binding geometries, quantum chemical calculations find that Ag+ bridges between non-canonical sites on guanine bases. Circular dichroism spectroscopy shows that the Ag+-mediated structuring of guanine homobase strands persists to at least 90 °C under conditions for which canonical guanine-cytosine duplexes melt below 20 °C. These findings are promising for DNA nanotechnology and metal-ion based biomedical science. PMID:25973536

Silver (I) as DNA glue: Ag(+)-mediated guanine pairing revealed by removing Watson-Crick constraints.

Science.gov (United States)

Swasey, Steven M; Leal, Leonardo Espinosa; Lopez-Acevedo, Olga; Pavlovich, James; Gwinn, Elisabeth G

2015-05-14

Metal ion interactions with DNA have far-reaching implications in biochemistry and DNA nanotechnology. Ag(+) is uniquely interesting because it binds exclusively to the bases rather than the backbone of DNA, without the toxicity of Hg(2+). In contrast to prior studies of Ag(+) incorporation into double-stranded DNA, we remove the constraints of Watson-Crick pairing by focusing on homo-base DNA oligomers of the canonical bases. High resolution electro-spray ionization mass spectrometry reveals an unanticipated Ag(+)-mediated pairing of guanine homo-base strands, with higher stability than canonical guanine-cytosine pairing. By exploring unrestricted binding geometries, quantum chemical calculations find that Ag(+) bridges between non-canonical sites on guanine bases. Circular dichroism spectroscopy shows that the Ag(+)-mediated structuring of guanine homobase strands persists to at least 90 °C under conditions for which canonical guanine-cytosine duplexes melt below 20 °C. These findings are promising for DNA nanotechnology and metal-ion based biomedical science.

Energy Landscape and Pathways for Transitions between Watson-Crick and Hoogsteen Base Pairing in DNA.

Science.gov (United States)

Chakraborty, Debayan; Wales, David J

2018-01-04

The recent discovery that Hoogsteen (HG) base pairs are widespread in DNA across diverse sequences and positional contexts could have important implications for understanding DNA replication and DNA-protein recognition. While evidence is emerging that the Hoogsteen conformation could be a thermodynamically accessible conformation of the DNA duplex and provide a means to expand its functionality, relatively little is known about the molecular mechanism underlying the Watson-Crick (WC) to HG transition. In this Perspective, we describe pathways and kinetics for this transition at an atomic level of detail, using the energy landscape perspective. We show that competition between the duplex conformations results in a double funnel landscape, which explains some recent experimental observations. The interconversion pathways feature a number of intermediates, with a variable number of WC and HG base pairs. The relatively slow kinetics, with possible deviations from two-state behavior, suggest that this conformational switch is likely to be a challenging target for both simulation and experiment.

Single-stranded γPNAs for in vivo site-specific genome editing via Watson-Crick recognition.

Science.gov (United States)

Bahal, Raman; Quijano, Elias; McNeer, Nicole A; Liu, Yanfeng; Bhunia, Dinesh C; Lopez-Giraldez, Francesco; Fields, Rachel J; Saltzman, William M; Ly, Danith H; Glazer, Peter M

2014-01-01

Triplex-forming peptide nucleic acids (PNAs) facilitate gene editing by stimulating recombination of donor DNAs within genomic DNA via site-specific formation of altered helical structures that further stimulate DNA repair. However, PNAs designed for triplex formation are sequence restricted to homopurine sites. Herein we describe a novel strategy where next generation single-stranded gamma PNAs (γPNAs) containing miniPEG substitutions at the gamma position can target genomic DNA in mouse bone marrow at mixed-sequence sites to induce targeted gene editing. In addition to enhanced binding, γPNAs confer increased solubility and improved formulation into poly(lactic-co-glycolic acid) (PLGA) nanoparticles for efficient intracellular delivery. Single-stranded γPNAs induce targeted gene editing at frequencies of 0.8% in mouse bone marrow cells treated ex vivo and 0.1% in vivo via IV injection, without detectable toxicity. These results suggest that γPNAs may provide a new tool for induced gene editing based on Watson-Crick recognition without sequence restriction.

Benchmark studies on the building blocks of DNA. 3. Watson-Crick and stacked base pairs.

Science.gov (United States)

Szalay, Péter G; Watson, Thomas; Perera, Ajith; Lotrich, Victor; Bartlett, Rodney J

2013-04-18

Excited states of stacked adenine-thymine and guanine-cytosine pairs as well as the Watson-Crick pair of guanine-thymine have been investigated using the equation of motion coupled-cluster (EOM-CC) method with single and double as well as approximate triple excitations. Transitions have been assigned, and the form of the excitations has been analyzed. The majority of the excitations could be classified as localized on the nucleobases, but for all three studied systems, charge-transfer (CT) transitions could also be identified. The main aim of this study was to compare the performance of lower-level methods (ADC(2) and TDDFT) to the high-level EOM-CC ones. It was shown that both ADC(2) and TDDFT with long-range correction have nonsystematic error in excitation energies, causing alternation of the energetic ordering of the excitations. Considering the high costs of the EOM-CC calculations, there is a need for reliable new approximate methods.

Silver (I) as DNA glue: Ag+-mediated guanine pairing revealed by removing Watson-Crick constraints

Science.gov (United States)

Swasey, Steven M.; Leal, Leonardo Espinosa; Lopez-Acevedo, Olga; Pavlovich, James; Gwinn, Elisabeth G.

2015-05-01

Metal ion interactions with DNA have far-reaching implications in biochemistry and DNA nanotechnology. Ag+ is uniquely interesting because it binds exclusively to the bases rather than the backbone of DNA, without the toxicity of Hg2+. In contrast to prior studies of Ag+ incorporation into double-stranded DNA, we remove the constraints of Watson-Crick pairing by focusing on homo-base DNA oligomers of the canonical bases. High resolution electro-spray ionization mass spectrometry reveals an unanticipated Ag+-mediated pairing of guanine homo-base strands, with higher stability than canonical guanine-cytosine pairing. By exploring unrestricted binding geometries, quantum chemical calculations find that Ag+ bridges between non-canonical sites on guanine bases. Circular dichroism spectroscopy shows that the Ag+-mediated structuring of guanine homobase strands persists to at least 90 °C under conditions for which canonical guanine-cytosine duplexes melt below 20 °C. These findings are promising for DNA nanotechnology and metal-ion based biomedical science.

Can an Excess Electron Localise on a Purine Moiety in the Adenine-thymine Watson-Crick Base Pair? A Computational Study

International Nuclear Information System (INIS)

Mazurkiewicz, Kamil; Haranczyk, Maciej; Gutowski, Maciej S.; Rak, Janusz

2007-01-01

The electron affinity and the propensity to electron-induced proton transfer (PT) of hydrogen-bonded complexes between the Watson-Crick adenine-thymine pair (AT) and simple organic acid (HX), attached to adenine in the Hoogsteen-type configuration, were studied at the B3LYP/6-31+G** level. Although the carboxyl group is deprotonated at physiological pH, its neutral form, COOH, resembles the peptide bond or the amide fragment in the side chain of asparagine (Asn) or glutamine (Gln). Thus, these complexes mimic the interaction between the DNA environment (e.g., proteins) and nucleobase pairs incorporated in the biopolymer. Electron attachment is thermodynamically feasible and adiabatic electron affinities range from 0.41 to 1.28 eV, while the vertical detachment energies of the resulting anions span the range of 0.39-2.88 eV. Low-energy activation barriers separate the anionic minima: aHX(AT) from the more stable single-PT anionic geometry, aHX(AT)-SPT, and aHX(AT)-SPT from the double-PT anionic geometry, aHX(AT)-DPT. Interaction between the adenine of the Watson-Crick AT base pair with an acidic proton donor probably counterbalances the larger EA of isolated thymine, as SOMO is almost evenly delocalized over both types of nucleic bases in the aHX(AT) anions. Moreover, as a result of PT the excess electron localizes entirely on adenine. Thus, in DNA interacting with its physiological environment, damage induced by low-energy electrons could begin, contrary to the current view, with the formation of purine anions, which are not formed in isolated DNA because of the greater stability of anionic pyrimidines.

Tree rings and time: recent historical studies in England

Directory of Open Access Journals (Sweden)

Martin Bridge

2000-11-01

Full Text Available By studying the annual growth rings of long-lived trees, and those preserved in ancient timbers that have survived in waterlogged or very dry conditions, it is possible to date past events in calendar years and to investigate climatic and other environmental changes. Dendrochronology has many applications, including the dating of buildings and ships and the calibration of the radiocarbon timescale that is so widely used in archaeology. Here the technique is outlined and some recent applications of it in England are described.

A bijection between phylogenetic trees and plane oriented recursive trees

OpenAIRE

Prodinger, Helmut

2017-01-01

Phylogenetic trees are binary nonplanar trees with labelled leaves, and plane oriented recursive trees are planar trees with an increasing labelling. Both families are enumerated by double factorials. A bijection is constructed, using the respective representations a 2-partitions and trapezoidal words.

Use of dominant tree heights in determining site index for Douglas-fir.

Science.gov (United States)

George R. Staebler

1948-01-01

Measuring heights of Douglas-fir trees for the determination of site index is a time-consuming job, especially in dense stands. Both dominant and codominant trees must be measured since site index curves represent the average height of dominants and codominants. It has been suggested that considerable time might be saved if only dominant trees were measured, since...

Bi-level image compression with tree coding

DEFF Research Database (Denmark)

Martins, Bo; Forchhammer, Søren

1996-01-01

Presently, tree coders are the best bi-level image coders. The current ISO standard, JBIG, is a good example. By organising code length calculations properly a vast number of possible models (trees) can be investigated within reasonable time prior to generating code. Three general-purpose coders...... are constructed by this principle. A multi-pass free tree coding scheme produces superior compression results for all test images. A multi-pass fast free template coding scheme produces much better results than JBIG for difficult images, such as halftonings. Rissanen's algorithm `Context' is presented in a new...

How to select the best tree planting locations to enhance air pollution removal in the MillionTreesNYC initiative

International Nuclear Information System (INIS)

Morani, Arianna; Nowak, David J.; Hirabayashi, Satoshi; Calfapietra, Carlo

2011-01-01

Highest priority zones for tree planting within New York City were selected by using a planting priority index developed combining three main indicators: pollution concentration, population density and low canopy cover. This new tree population was projected through time to estimate potential air quality and carbon benefits. Those trees will likely remove more than 10 000 tons of air pollutants and a maximum of 1500 tons of carbon over the next 100 years given a 4% annual mortality rate. Cumulative carbon storage will be reduced through time as carbon loss through tree mortality outweighs carbon accumulation through tree growth. Model projections are strongly affected by mortality rate whose uncertainties limit estimations accuracy. Increasing mortality rate from 4 to 8% per year produce a significant decrease in the total pollution removal over a 100 year period from 11 000 tons to 3000 tons. - Highlights: → The manuscript is part of the IUFRO Special section 'Adaptation of Forest Ecosystems to Air Pollution and Climate Change' (Elena Paoletti and Yusuf Serengil Eds.) approved by William J. Manning. → It has been already peer-reviewed and accepted outside EES. → The reference number of this manuscript is IUFRO49. - Carbon and air pollutant uptake by urban forests are highly influenced by mortality rates.

How to select the best tree planting locations to enhance air pollution removal in the MillionTreesNYC initiative

Energy Technology Data Exchange (ETDEWEB)

Morani, Arianna [Institute of Agro-Environmental and Forest Biology (IBAF), National Research Council (CNR) Via Salaria km 29300, 00015 Monterotondo Scalo, Roma (Italy); Nowak, David J.; Hirabayashi, Satoshi [USDA Forest Service, Northern Research Station, 5 Moon Library, SUNY-ESF, Syracuse, NY 13210 (United States); Calfapietra, Carlo, E-mail: carlo.calfapietra@ibaf.cnr.it [Institute of Agro-Environmental and Forest Biology (IBAF), National Research Council (CNR) Via Salaria km 29300, 00015 Monterotondo Scalo, Roma (Italy)

2011-05-15

Highest priority zones for tree planting within New York City were selected by using a planting priority index developed combining three main indicators: pollution concentration, population density and low canopy cover. This new tree population was projected through time to estimate potential air quality and carbon benefits. Those trees will likely remove more than 10 000 tons of air pollutants and a maximum of 1500 tons of carbon over the next 100 years given a 4% annual mortality rate. Cumulative carbon storage will be reduced through time as carbon loss through tree mortality outweighs carbon accumulation through tree growth. Model projections are strongly affected by mortality rate whose uncertainties limit estimations accuracy. Increasing mortality rate from 4 to 8% per year produce a significant decrease in the total pollution removal over a 100 year period from 11 000 tons to 3000 tons. - Highlights: > The manuscript is part of the IUFRO Special section 'Adaptation of Forest Ecosystems to Air Pollution and Climate Change' (Elena Paoletti and Yusuf Serengil Eds.) approved by William J. Manning. > It has been already peer-reviewed and accepted outside EES. > The reference number of this manuscript is IUFRO49. - Carbon and air pollutant uptake by urban forests are highly influenced by mortality rates.

The Accounting Standardization System in Portugal and Its First-Time Adoption Effects in the Olive and Cork Tree Cultures

Directory of Open Access Journals (Sweden)

Jonas da Silva Oliveira

2015-06-01

Full Text Available This study examines the quantitative impact of the first-time adoption of the Portuguese Accounting Standardization System on individual annual reports of Portuguese unlisted companies in the cork and olive tree culture sector. Findings indicate that the items which showed significant changes in the transition from the previous accounting frame of reference to the Portuguese Accounting Standardization System are mainly those regarding to biological assets, inventories, liabilities, current ratio, and return on assets. The adoption of the Portuguese Accounting Standardization System has led generally to less conservative accounting practices, indicating that characteristics of code-law countries such as cultural aspects and country enforcement regimes did not influence the adoption of IAS/IFRS-based accounting standards by Portuguese unlisted companies in the cork and olive tree culture sectors.

pH-Modulated Watson-Crick duplex-quadruplex equilibria of guanine-rich and cytosine-rich DNA sequences 140 base pairs upstream of the c-kit transcription initiation site.

Science.gov (United States)

Bucek, Pavel; Jaumot, Joaquim; Aviñó, Anna; Eritja, Ramon; Gargallo, Raimundo

2009-11-23

Guanine-rich regions of DNA are sequences capable of forming G-quadruplex structures. The formation of a G-quadruplex structure in a region 140 base pairs (bp) upstream of the c-kit transcription initiation site was recently proposed (Fernando et al., Biochemistry, 2006, 45, 7854). In the present study, the acid-base equilibria and the thermally induced unfolding of the structures formed by a guanine-rich region and by its complementary cytosine-rich strand in c-kit were studied by means of circular dichroism and molecular absorption spectroscopies. In addition, competition between the Watson-Crick duplex and the isolated structures was studied as a function of pH value and temperature. Multivariate data analysis methods based on both hard and soft modeling were used to allow accurate quantification of the various acid-base species present in the mixtures. Results showed that the G-quadruplex and i-motif coexist with the Watson-Crick duplex over the pH range from 3.0 to 6.5, approximately, under the experimental conditions tested in this study. At pH 7.0, the duplex is practically the only species present.

[Quantum-chemical investigation of tautomerization ways of Watson-Crick DNA base pair guanine-cytosine].

Science.gov (United States)

Brovarets', O O; Hovorun, D M

2010-01-01

A novel physico-chemical mechanism of the Watson-Crick DNA base pair Gua.Cyt tautomerization Gua.Cyt*Gua.CytGua*.Cyt (mutagenic tautomers of bases are marked by asterisks) have been revealed and realized in a pathway of single proton transfer through two mutual isoenergetic transition states with Gibbs free energy of activation 30.4 and 30.6 kcal/mol and they are ion pairs stabilized by three (N2H...N3, N1H...N4- and O6+H...N4-) and five (N2H...O2, N1H...O2, N1H...N3, O6+H...N4- and 06+H...N4-) H-bonds accordingly. Stable base pairs Gua-Cyt* and Gua*.Cyt which dissociate comparably easy into monomers have acceptable relative Gibbs energies--12.9 and 14.3 kcal/mol--for the explanation of the nature of the spontaneous transitions of DNA replication. Results are obtained at the MP2/6-311++G(2df,pd)//B3LYP/6-31 1++G(d,p) level of theory in vacuum approach.

Determining the Walker exponent and developing a modified Smith-Watson-Topper parameter model

Energy Technology Data Exchange (ETDEWEB)

Lv, Zhiqiang; Huang, Hong Zhong; Wang, Hai Kun; Gao, Huiying; Zuo, Fang Jun [University of Electronic Science and Technology of China, Chengdu (China)

2016-03-15

Mean stress effects significantly influence the fatigue life of components. In general, tensile mean stresses are known to reduce the fatigue life of components, whereas compressive mean stresses are known to increase it. To date, various methods that account for mean stress effects have been studied. In this research, considering the high accuracy of mean stress correction and the difficulty in obtaining the material parameter of the Walker method, a practical method is proposed to describe the material parameter of this method. The test data of various materials are then used to verify the proposed practical method. Furthermore, by applying the Walker material parameter and the Smith-Watson-Topper (SWT) parameter, a modified strain-life model is developed to consider sensitivity to mean stress of materials. In addition, three sets of experimental fatigue data from super alloy GH4133, aluminum alloy 7075-T651, and carbon steel are used to estimate the accuracy of the proposed model. A comparison is also made between the SWT parameter method and the proposed strainlife model. The proposed strain-life model provides more accurate life prediction results than the SWT parameter method.

The case of the missing fingerprints or Dr Watson's cosmology

International Nuclear Information System (INIS)

Longair, M.S.

1987-01-01

The cosmological problem has four main areas of uncertainty -the origin of isotropy of the universe, the origin of the fluctuations from which galaxies form, the explanation of why we live in a matter universe rather than one composed of equal amounts of matter and antimatter and why the Universe seems to be within a factor of 10 of the critical, flat universe. These cannot be explained satisfactorily within the Hot Big Bang theory after a millisecond or so. The solutions are presumed, therefore, to lie in the very early universe when it was less than about a millisecond old. The clues which lead to this conclusion are set out in terms of a detective story with Sherlock Holmes explaining the facts about the universe to Dr Watson. Holmes first explains the size of the universe in terms of distances and sizes of stars, galaxies and galaxy clusters. Evidence from pictures of the universe at different temperatures, (X-ray pictures, gamma-ray pictures, far infra-red pictures and pictures at radio and millimetre wavelengths) is presented. Holmes then starts to build up a realistic model of the universe using two of the facts collected (the isotropy of the universe and the expansion of the universe), one assumption (the cosmological principle) and one theory of gravity (General Relativity). However the universe which emerges does not solve the four problems mentioned. Quasars, which provide information (illustrated) from earlier epochs of the universe may, therefore, help to solve the problems. (U.K.)

Rate of tree carbon accumulation increases continuously with tree size

Science.gov (United States)

Stephenson, N.L.; Das, A.J.; Condit, R.; Russo, S.E.; Baker, P.J.; Beckman, N.G.; Coomes, D.A.; Lines, E.R.; Morris, W.K.; Rüger, N.; Álvarez, E.; Blundo, C.; Bunyavejchewin, S.; Chuyong, G.; Davies, S.J.; Duque, Á.; Ewango, C.N.; Flores, O.; Franklin, J.F.; Grau, H.R.; Hao, Z.; Harmon, M.E.; Hubbell, S.P.; Kenfack, D.; Lin, Y.; Makana, J.-R.; Malizia, A.; Malizia, L.R.; Pabst, R.J.; Pongpattananurak, N.; Su, S.-H.; Sun, I-F.; Tan, S.; Thomas, D.; van Mantgem, P.J.; Wang, X.; Wiser, S.K.; Zavala, M.A.

2014-01-01

Forests are major components of the global carbon cycle, providing substantial feedback to atmospheric greenhouse gas concentrations. Our ability to understand and predict changes in the forest carbon cycle—particularly net primary productivity and carbon storage - increasingly relies on models that represent biological processes across several scales of biological organization, from tree leaves to forest stands. Yet, despite advances in our understanding of productivity at the scales of leaves and stands, no consensus exists about the nature of productivity at the scale of the individual tree, in part because we lack a broad empirical assessment of whether rates of absolute tree mass growth (and thus carbon accumulation) decrease, remain constant, or increase as trees increase in size and age. Here we present a global analysis of 403 tropical and temperate tree species, showing that for most species mass growth rate increases continuously with tree size. Thus, large, old trees do not act simply as senescent carbon reservoirs but actively fix large amounts of carbon compared to smaller trees; at the extreme, a single big tree can add the same amount of carbon to the forest within a year as is contained in an entire mid-sized tree. The apparent paradoxes of individual tree growth increasing with tree size despite declining leaf-level and stand-level productivity can be explained, respectively, by increases in a tree’s total leaf area that outpace declines in productivity per unit of leaf area and, among other factors, age-related reductions in population density. Our results resolve conflicting assumptions about the nature of tree growth, inform efforts to understand and model forest carbon dynamics, and have additional implications for theories of resource allocation and plant senescence.

Tree-based indexing for real-time ConvNet landmark-based visual place recognition

Directory of Open Access Journals (Sweden)

Yi Hou

2017-01-01

Full Text Available Recent impressive studies on using ConvNet landmarks for visual place recognition take an approach that involves three steps: (a detection of landmarks, (b description of the landmarks by ConvNet features using a convolutional neural network, and (c matching of the landmarks in the current view with those in the database views. Such an approach has been shown to achieve the state-of-the-art accuracy even under significant viewpoint and environmental changes. However, the computational burden in step (c significantly prevents this approach from being applied in practice, due to the complexity of linear search in high-dimensional space of the ConvNet features. In this article, we propose two simple and efficient search methods to tackle this issue. Both methods are built upon tree-based indexing. Given a set of ConvNet features of a query image, the first method directly searches the features’ approximate nearest neighbors in a tree structure that is constructed from ConvNet features of database images. The database images are voted on by features in the query image, according to a lookup table which maps each ConvNet feature to its corresponding database image. The database image with the highest vote is considered the solution. Our second method uses a coarse-to-fine procedure: the coarse step uses the first method to coarsely find the top-N database images, and the fine step performs a linear search in Hamming space of the hash codes of the ConvNet features to determine the best match. Experimental results demonstrate that our methods achieve real-time search performance on five data sets with different sizes and various conditions. Most notably, by achieving an average search time of 0.035 seconds/query, our second method improves the matching efficiency by the three orders of magnitude over a linear search baseline on a database with 20,688 images, with negligible loss in place recognition accuracy.

Safety validation of decision trees for hepatocellular carcinoma.

Science.gov (United States)

Wang, Xian-Qiang; Liu, Zhe; Lv, Wen-Ping; Luo, Ying; Yang, Guang-Yun; Li, Chong-Hui; Meng, Xiang-Fei; Liu, Yang; Xu, Ke-Sen; Dong, Jia-Hong

2015-08-21

To evaluate a different decision tree for safe liver resection and verify its efficiency. A total of 2457 patients underwent hepatic resection between January 2004 and December 2010 at the Chinese PLA General Hospital, and 634 hepatocellular carcinoma (HCC) patients were eligible for the final analyses. Post-hepatectomy liver failure (PHLF) was identified by the association of prothrombin time 50 μmol/L (the "50-50" criteria), which were assessed at day 5 postoperatively or later. The Swiss-Clavien decision tree, Tokyo University-Makuuchi decision tree, and Chinese consensus decision tree were adopted to divide patients into two groups based on those decision trees in sequence, and the PHLF rates were recorded. The overall mortality and PHLF rate were 0.16% and 3.0%. A total of 19 patients experienced PHLF. The numbers of patients to whom the Swiss-Clavien, Tokyo University-Makuuchi, and Chinese consensus decision trees were applied were 581, 573, and 622, and the PHLF rates were 2.75%, 2.62%, and 2.73%, respectively. Significantly more cases satisfied the Chinese consensus decision tree than the Swiss-Clavien decision tree and Tokyo University-Makuuchi decision tree (P decision trees. The Chinese consensus decision tree expands the indications for hepatic resection for HCC patients and does not increase the PHLF rate compared to the Swiss-Clavien and Tokyo University-Makuuchi decision trees. It would be a safe and effective algorithm for hepatectomy in patients with hepatocellular carcinoma.

PL-MOD: a computer code for modular fault tree analysis and evaluation

International Nuclear Information System (INIS)

Olmos, J.; Wolf, L.

1978-01-01

The computer code PL-MOD has been developed to implement the modular methodology to fault tree analysis. In the modular approach, fault tree structures are characterized by recursively relating the top tree event to all basic event inputs through a set of equations, each defining an independent modular event for the tree. The advantages of tree modularization lie in that it is a more compact representation than the minimal cut-set description and in that it is well suited for fault tree quantification because of its recursive form. In its present version, PL-MOD modularizes fault trees and evaluates top and intermediate event failure probabilities, as well as basic component and modular event importance measures, in a very efficient way. Thus, its execution time for the modularization and quantification of a PWR High Pressure Injection System reduced fault tree was 25 times faster than that necessary to generate its equivalent minimal cut-set description using the computer code MOCUS

Exploring connections between trees and human health

Science.gov (United States)

Geoffrey Donovan; Marie. Oliver

2014-01-01

Humans have intuitively understood the value of trees to their physical and mental health since the beginning of recorded time. A scientist with the Pacific Northwest Research Station wondered if such a link could be scientifically validated. His research team took advantage of an infestation of emerald ash borer, an invasive pest that kills ash trees, to conduct a...

Effects of Nursing Care Based on Watson's Theory of Human Caring on Anxiety, Distress, And Coping, When Infertility Treatment Fails: A Randomized Controlled Trial.

Science.gov (United States)

Durgun Ozan, Yeter; Okumuş, Hülya

2017-06-01

Introduction: The failure of infertility treatment leads to individual, familial, and social problems. The objective of this study was to evaluate the effectiveness of the nursing care program based on Watson's "Theory of Human Caring" on anxiety and distress caused by coping when the treatment fails. Methods: This study randomized controlled trial study was conducted from April to November 2012, with 86 Turkish women with infertility (intervention group: 45, control group: 41). Follow-up of 32 infertile women, who failed infertility treatment from intervention group, and 35 infertile women, who failed infertility treatment from control group, continued for another four weeks. Data were collected through Spiel Berger's State/Trait Anxiety Inventory, Distress Scale, and Ways of Coping Questionnaire. The analyses of data were conducted using SPSS ver 13. Results: The intervention and control groups significantly differed in terms of anxiety, distress, and coping levels. The intervention group's mean anxiety score decreased by thirteen points and distress by fourteen points (in a positive direction). The intervention group's mean positive coping style score increased. Whereas a negative increase was observed in the control group's values depending on the failure of the treatment. Conclusion: Watson's theory of human caring is recommended as a guide to nursing patients with infertility treatment to decrease levels of anxiety and distress, and to increase the positive coping style among infertile women.

GumTree - An Integrated Scientific Experiment Environment

International Nuclear Information System (INIS)

Lam, Tony; Hauser, Nick; Hathaway, Paul; Franceschini, Fredi; Rayner, Hugh; Zhang, Lidia; Goetz, Andy

2005-01-01

Full text: GumTree is an open source and multi-platform graphical user interface for performing neutron scattering and X-ray experiments. It handles the complete experiment life cycle from instrument calibration, data acquisition, and real time data analysis to results publication. The aim of the GumTree Project is to create a highly Integrated Scientific Experiment Environment (ISEE), allowing interconnectivity and data sharing between different distributed components such as motors, detectors, user proposal database and data analysis server. GumTree is being adapted to several instrument control server systems such as TANGO, EPICS and SICS, providing an easy-to-use front-end for users and simple-to-extend model for software developers. The design of GumTree is aimed to be reusable and configurable for any scientific instrument. GumTree will be adapted to six neutron beam instruments for the OPAL reactor at ANSTO. Other European institutes including ESRF, ILL and PSI have shown interest in using GumTree as their workbench for instrument control and data analysis. (authors)

Fibre-tree network for water-surface ranging using an optical time-domain reflectometry technique

Directory of Open Access Journals (Sweden)

Yoshiaki Yamabayashi

2014-10-01

Full Text Available To monitor water level at long distance, a fibre-based time-domain reflectometry network is proposed. A collimator at each fibre end of a tree-type network retrieves 1.55 μm wavelength pulses that are reflected back from remote surfaces. Since this enables a power-supply-free sensor network with non-metal media, this system is expected to be less susceptible to lightning strikes and power cuts than conventional systems that use electrically powered sensors and metal cables. In the present Letter, a successful simultaneous monitoring experiment of two water levels in the laboratory, as well as a trial for detecting a disturbed surface by beam-expanding is reported.

Isoprene emission from Indian trees

Science.gov (United States)

Varshney, C. K.; Singh, Abhai Pratap

2003-12-01

Isoprene is the most dominant non-methane volatile organic compound (NMVOC) emitted by plants. NMVOCs play an important role in regulating the composition of atmospheric trace gases including global concentration of tropospheric ozone. Our present knowledge about NMVOCs emission is mainly from studies on temperate tree species. So far information on biogenic NMVOCs emission from tropical tree species is limited. In this study, isoprene emission rates from 40 tropical Indian tree species belonging to 33 genera and 17 families were measured for the first time using a dynamic flow through enclosure chamber technique. The isoprene emission rate from plants (30°C and PAR 1000 μmolm-2s-1) ranged from undetectable to 81.5 μg g-1 h-1 and values were found to be comparable with other studies on tropical tree species. Tree species screened for isoprene emission in the present study may be grouped into the four categories, proposed by [2001], namely, 18 species were negligible or BDL isoprene emitting (Morus alba Linn., which were earlier reported as BDL or non isoprene emitters in US [, 1998; , 2001] were found to be appreciably high isoprene emitters (0.61-21.60 μg g-1 h-1) in the present study.

Scenario tree airline fleet planning for demand uncertainty

NARCIS (Netherlands)

Repko, M.G.J.; Lopes dos Santos, Bruno F.

2017-01-01

This paper proposes an innovative multi-period modeling approach to solve the airline fleet planning problem under demand uncertainty. The problem is modeled using a scenario tree approach. The tree is composed of nodes, which represent points of decision in multiple time stages of the planning

IcyTree: rapid browser-based visualization for phylogenetic trees and networks.

Science.gov (United States)

Vaughan, Timothy G

2017-08-01

IcyTree is an easy-to-use application which can be used to visualize a wide variety of phylogenetic trees and networks. While numerous phylogenetic tree viewers exist already, IcyTree distinguishes itself by being a purely online tool, having a responsive user interface, supporting phylogenetic networks (ancestral recombination graphs in particular), and efficiently drawing trees that include information such as ancestral locations or trait values. IcyTree also provides intuitive panning and zooming utilities that make exploring large phylogenetic trees of many thousands of taxa feasible. IcyTree is a web application and can be accessed directly at http://tgvaughan.github.com/icytree . Currently supported web browsers include Mozilla Firefox and Google Chrome. IcyTree is written entirely in client-side JavaScript (no plugin required) and, once loaded, does not require network access to run. IcyTree is free software, and the source code is made available at http://github.com/tgvaughan/icytree under version 3 of the GNU General Public License. tgvaughan@gmail.com. © The Author(s) 2017. Published by Oxford University Press.

Comparación entre bioimpedancia espectroscópica y fórmula de Watson para medición de volumen corporal en pacientes en diálisis peritoneal

Directory of Open Access Journals (Sweden)

Gonzalo Martínez Fernández

2016-01-01

Conclusiones: Existen diferencias en el V de los pacientes de una unidad de DP según sea calculado por fórmula de Watson o por BIS. La presencia de hipertensión, diabetes, hipoalbuminemia, obesidad, malnutrición, inflamación, E/I ratio ≥1 y la ausencia de diuresis residual se asocia con la aparición de estas diferencias.

Reconstruction of certain phylogenetic networks from their tree-average distances.

Science.gov (United States)

Willson, Stephen J

2013-10-01

Trees are commonly utilized to describe the evolutionary history of a collection of biological species, in which case the trees are called phylogenetic trees. Often these are reconstructed from data by making use of distances between extant species corresponding to the leaves of the tree. Because of increased recognition of the possibility of hybridization events, more attention is being given to the use of phylogenetic networks that are not necessarily trees. This paper describes the reconstruction of certain such networks from the tree-average distances between the leaves. For a certain class of phylogenetic networks, a polynomial-time method is presented to reconstruct the network from the tree-average distances. The method is proved to work if there is a single reticulation cycle.

Water-Tree Modelling and Detection for Underground Cables

Science.gov (United States)

Chen, Qi

In recent years, aging infrastructure has become a major concern for the power industry. Since its inception in early 20th century, the electrical system has been the cornerstone of an industrial society. Stable and uninterrupted delivery of electrical power is now a base necessity for the modern world. As the times march-on, however, the electrical infrastructure ages and there is the inevitable need to renew and replace the existing system. Unfortunately, due to time and financial constraints, many electrical systems today are forced to operate beyond their original design and power utilities must find ways to prolong the lifespan of older equipment. Thus, the concept of preventative maintenance arises. Preventative maintenance allows old equipment to operate longer and at better efficiency, but in order to implement preventative maintenance, the operators must know minute details of the electrical system, especially some of the harder to assess issues such water-tree. Water-tree induced insulation degradation is a problem typically associated with older cable systems. It is a very high impedance phenomenon and it is difficult to detect using traditional methods such as Tan-Delta or Partial Discharge. The proposed dissertation studies water-tree development in underground cables, potential methods to detect water-tree location and water-tree severity estimation. The dissertation begins by developing mathematical models of water-tree using finite element analysis. The method focuses on surface-originated vented tree, the most prominent type of water-tree fault in the field. Using the standard operation parameters of North American electrical systems, the water-tree boundary conditions are defined. By applying finite element analysis technique, the complex water-tree structure is broken down to homogeneous components. The result is a generalized representation of water-tree capacitance at different stages of development. The result from the finite element analysis

Selective Tree-ring Models: A Novel Method for Reconstructing Streamflow Using Tree Rings

Science.gov (United States)

Foard, M. B.; Nelson, A. S.; Harley, G. L.

2017-12-01

Surface water is among the most instrumental and vulnerable resources in the Northwest United States (NW). Recent observations show that overall water quantity is declining in streams across the region, while extreme flooding events occur more frequently. Historical streamflow models inform probabilities of extreme flow events (flood or drought) by describing frequency and duration of past events. There are numerous examples of tree-rings being utilized to reconstruct streamflow in the NW. These models confirm that tree-rings are highly accurate at predicting streamflow, however there are many nuances that limit their applicability through time and space. For example, most models predict streamflow from hydrologically altered rivers (e.g. dammed, channelized) which may hinder our ability to predict natural prehistoric flow. They also have a tendency to over/under-predict extreme flow events. Moreover, they often neglect to capture the changing relationships between tree-growth and streamflow over time and space. To address these limitations, we utilized national tree-ring and streamflow archives to investigate the relationships between the growth of multiple coniferous species and free-flowing streams across the NW using novel species-and site-specific streamflow models - a term we coined"selective tree-ring models." Correlation function analysis and regression modeling were used to evaluate the strengths and directions of the flow-growth relationships. Species with significant relationships in the same direction were identified as strong candidates for selective models. Temporal and spatial patterns of these relationships were examined using running correlations and inverse distance weighting interpolation, respectively. Our early results indicate that (1) species adapted to extreme climates (e.g. hot-dry, cold-wet) exhibit the most consistent relationships across space, (2) these relationships weaken in locations with mild climatic variability, and (3) some

TreeScaper: Visualizing and Extracting Phylogenetic Signal from Sets of Trees.

Science.gov (United States)

Huang, Wen; Zhou, Guifang; Marchand, Melissa; Ash, Jeremy R; Morris, David; Van Dooren, Paul; Brown, Jeremy M; Gallivan, Kyle A; Wilgenbusch, Jim C

2016-12-01

Modern phylogenomic analyses often result in large collections of phylogenetic trees representing uncertainty in individual gene trees, variation across genes, or both. Extracting phylogenetic signal from these tree sets can be challenging, as they are difficult to visualize, explore, and quantify. To overcome some of these challenges, we have developed TreeScaper, an application for tree set visualization as well as the identification of distinct phylogenetic signals. GUI and command-line versions of TreeScaper and a manual with tutorials can be downloaded from https://github.com/whuang08/TreeScaper/releases TreeScaper is distributed under the GNU General Public License. © The Author 2016. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

Mathematical analysis and modeling of epidemics of rubber tree root diseases: Probability of infection of an individual tree

Energy Technology Data Exchange (ETDEWEB)

Chadoeuf, J.; Joannes, H.; Nandris, D.; Pierrat, J.C.

1988-12-01

The spread of root diseases in rubber tree (Hevea brasiliensis) due to Rigidoporus lignosus and Phellinus noxius was investigated epidemiologically using data collected every 6 month during a 6-year survey in a plantation. The aim of the present study is to see what factors could predict whether a given tree would be infested at the following inspection. Using a qualitative regression method we expressed the probability of pathogenic attack on a tree in terms of three factors: the state of health of the surrounding trees, the method used to clear the forest prior to planting, and evolution with time. The effects of each factor were ranked, and the roles of the various classes of neighbors were established and quantified. Variability between successive inspections was small, and the method of forest clearing was important only while primary inocula in the soil were still infectious. The state of health of the immediate neighbors was most significant; more distant neighbors in the same row had some effect; interrow spread was extremely rare. This investigation dealt only with trees as individuals, and further study of the interrelationships of groups of trees is needed.

Flowering Trees

Indian Academy of Sciences (India)

IAS Admin

Flowering Trees. Ailanthus excelsa Roxb. (INDIAN TREE OF. HEAVEN) of Simaroubaceae is a lofty tree with large pinnately compound alternate leaves, which are ... inflorescences, unisexual and greenish-yellow. Fruits are winged, wings many-nerved. Wood is used in making match sticks. 1. Male flower; 2. Female flower.

Random tree growth by vertex splitting

International Nuclear Information System (INIS)

David, F; Dukes, W M B; Jonsson, T; Stefánsson, S Ö

2009-01-01

We study a model of growing planar tree graphs where in each time step we separate the tree into two components by splitting a vertex and then connect the two pieces by inserting a new link between the daughter vertices. This model generalizes the preferential attachment model and Ford's α-model for phylogenetic trees. We develop a mean field theory for the vertex degree distribution, prove that the mean field theory is exact in some special cases and check that it agrees with numerical simulations in general. We calculate various correlation functions and show that the intrinsic Hausdorff dimension can vary from 1 to ∞, depending on the parameters of the model

From Google Maps to a fine-grained catalog of street trees

Science.gov (United States)

Branson, Steve; Wegner, Jan Dirk; Hall, David; Lang, Nico; Schindler, Konrad; Perona, Pietro

2018-01-01

Up-to-date catalogs of the urban tree population are of importance for municipalities to monitor and improve quality of life in cities. Despite much research on automation of tree mapping, mainly relying on dedicated airborne LiDAR or hyperspectral campaigns, tree detection and species recognition is still mostly done manually in practice. We present a fully automated tree detection and species recognition pipeline that can process thousands of trees within a few hours using publicly available aerial and street view images of Google MapsTM. These data provide rich information from different viewpoints and at different scales from global tree shapes to bark textures. Our work-flow is built around a supervised classification that automatically learns the most discriminative features from thousands of trees and corresponding, publicly available tree inventory data. In addition, we introduce a change tracker that recognizes changes of individual trees at city-scale, which is essential to keep an urban tree inventory up-to-date. The system takes street-level images of the same tree location at two different times and classifies the type of change (e.g., tree has been removed). Drawing on recent advances in computer vision and machine learning, we apply convolutional neural networks (CNN) for all classification tasks. We propose the following pipeline: download all available panoramas and overhead images of an area of interest, detect trees per image and combine multi-view detections in a probabilistic framework, adding prior knowledge; recognize fine-grained species of detected trees. In a later, separate module, track trees over time, detect significant changes and classify the type of change. We believe this is the first work to exploit publicly available image data for city-scale street tree detection, species recognition and change tracking, exhaustively over several square kilometers, respectively many thousands of trees. Experiments in the city of Pasadena

Lesser prairie-chicken avoidance of trees in a grassland landscape

Science.gov (United States)

Lautenbach, Joseph M.; Plumb, Reid T.; Robinson, Samantha G.; Hagen, Christian A.; Haukos, David A.; Pitman, James C.

2016-01-01

Grasslands are among the most imperiled ecosystems in North America. Reasons that grasslands are threatened include conversion to row-crop agriculture, fragmentation, and changes in fire regimes. The reduction of fire processes in remaining prairies has resulted in tree encroachment and establishment in grasslands, further reducing grassland quantity and quality. Grassland birds have been experiencing precipitous population declines in recent decades, commensurate with landscape changes to grasslands. The lesser prairie-chicken (Tympanuchus pallidicinctus Ridgway) is a declining species of prairie grouse of conservation concern. We used second- and third-order habitat selection metrics to test if female lesser prairie-chickens avoid grasslands where trees were present. Our results indicated that female lesser prairie-chickens selected habitats avoiding the nearest trees by 283 m on average, nearly twice as far as would be expected at random. Lesser prairie-chickens were 40 times more likely to use habitats with tree densities of 0 trees ∙ ha− 1 than habitats with 5 trees ∙ ha− 1. Probability of use indicated that lesser prairie-chickens were 19 times more likely to use habitats 1000 m from the nearest tree when compared with using habitats 0 m from the nearest tree. Nest survival was not affected at densities 2 trees ∙ ha− 1. Avoidance of trees could be due to perceived increased predation risk, reduced habitat quality, or a combination of these potentially confounding factors. Preventing further establishment and expansion of trees in landscapes occupied by lesser prairie-chickens could contribute to the continued persistence of the species. Additionally, restoring grasslands through tree removal may facilitate conservation efforts for grassland species such as the lesser prairie-chicken by improving habitat quality and promoting expansion of occupied range.

Comprehensive decision tree models in bioinformatics.

Directory of Open Access Journals (Sweden)

Gregor Stiglic

Full Text Available PURPOSE: Classification is an important and widely used machine learning technique in bioinformatics. Researchers and other end-users of machine learning software often prefer to work with comprehensible models where knowledge extraction and explanation of reasoning behind the classification model are possible. METHODS: This paper presents an extension to an existing machine learning environment and a study on visual tuning of decision tree classifiers. The motivation for this research comes from the need to build effective and easily interpretable decision tree models by so called one-button data mining approach where no parameter tuning is needed. To avoid bias in classification, no classification performance measure is used during the tuning of the model that is constrained exclusively by the dimensions of the produced decision tree. RESULTS: The proposed visual tuning of decision trees was evaluated on 40 datasets containing classical machine learning problems and 31 datasets from the field of bioinformatics. Although we did not expected significant differences in classification performance, the results demonstrate a significant increase of accuracy in less complex visually tuned decision trees. In contrast to classical machine learning benchmarking datasets, we observe higher accuracy gains in bioinformatics datasets. Additionally, a user study was carried out to confirm the assumption that the tree tuning times are significantly lower for the proposed method in comparison to manual tuning of the decision tree. CONCLUSIONS: The empirical results demonstrate that by building simple models constrained by predefined visual boundaries, one not only achieves good comprehensibility, but also very good classification performance that does not differ from usually more complex models built using default settings of the classical decision tree algorithm. In addition, our study demonstrates the suitability of visually tuned decision trees for datasets

Comprehensive decision tree models in bioinformatics.

Science.gov (United States)

Stiglic, Gregor; Kocbek, Simon; Pernek, Igor; Kokol, Peter

2012-01-01

Classification is an important and widely used machine learning technique in bioinformatics. Researchers and other end-users of machine learning software often prefer to work with comprehensible models where knowledge extraction and explanation of reasoning behind the classification model are possible. This paper presents an extension to an existing machine learning environment and a study on visual tuning of decision tree classifiers. The motivation for this research comes from the need to build effective and easily interpretable decision tree models by so called one-button data mining approach where no parameter tuning is needed. To avoid bias in classification, no classification performance measure is used during the tuning of the model that is constrained exclusively by the dimensions of the produced decision tree. The proposed visual tuning of decision trees was evaluated on 40 datasets containing classical machine learning problems and 31 datasets from the field of bioinformatics. Although we did not expected significant differences in classification performance, the results demonstrate a significant increase of accuracy in less complex visually tuned decision trees. In contrast to classical machine learning benchmarking datasets, we observe higher accuracy gains in bioinformatics datasets. Additionally, a user study was carried out to confirm the assumption that the tree tuning times are significantly lower for the proposed method in comparison to manual tuning of the decision tree. The empirical results demonstrate that by building simple models constrained by predefined visual boundaries, one not only achieves good comprehensibility, but also very good classification performance that does not differ from usually more complex models built using default settings of the classical decision tree algorithm. In addition, our study demonstrates the suitability of visually tuned decision trees for datasets with binary class attributes and a high number of possibly

Why do trees die? Characterizing the drivers of background tree mortality

Science.gov (United States)

Das, Adrian J.; Stephenson, Nathan L.; Davis, Kristin P.

2016-01-01

The drivers of background tree mortality rates—the typical low rates of tree mortality found in forests in the absence of acute stresses like drought—are central to our understanding of forest dynamics, the effects of ongoing environmental changes on forests, and the causes and consequences of geographical gradients in the nature and strength of biotic interactions. To shed light on factors contributing to background tree mortality, we analyzed detailed pathological data from 200,668 tree-years of observation and 3,729 individual tree deaths, recorded over a 13-yr period in a network of old-growth forest plots in California's Sierra Nevada mountain range. We found that: (1) Biotic mortality factors (mostly insects and pathogens) dominated (58%), particularly in larger trees (86%). Bark beetles were the most prevalent (40%), even though there were no outbreaks during the study period; in contrast, the contribution of defoliators was negligible. (2) Relative occurrences of broad classes of mortality factors (biotic, 58%; suppression, 51%; and mechanical, 25%) are similar among tree taxa, but may vary with tree size and growth rate. (3) We found little evidence of distinct groups of mortality factors that predictably occur together on trees. Our results have at least three sets of implications. First, rather than being driven by abiotic factors such as lightning or windstorms, the “ambient” or “random” background mortality that many forest models presume to be independent of tree growth rate is instead dominated by biotic agents of tree mortality, with potentially critical implications for forecasting future mortality. Mechanistic models of background mortality, even for healthy, rapidly growing trees, must therefore include the insects and pathogens that kill trees. Second, the biotic agents of tree mortality, instead of occurring in a few predictable combinations, may generally act opportunistically and with a relatively large degree of independence from

Flowering Trees

Indian Academy of Sciences (India)

Flowering Trees. Gyrocarpus americanus Jacq. (Helicopter Tree) of Hernandiaceae is a moderate size deciduous tree that grows to about 12 m in height with a smooth, shining, greenish-white bark. The leaves are ovate, rarely irregularly ... flowers which are unpleasant smelling. Fruit is a woody nut with two long thin wings.

Effect of Watson-Crick and Hoogsteen base pairing on the conformational stability of C8-phenoxyl-2'-deoxyguanosine adducts.

Science.gov (United States)

Millen, Andrea L; Churchill, Cassandra D M; Manderville, Richard A; Wetmore, Stacey D

2010-10-14

Bulky DNA addition products (adducts) formed through attack at the C8 site of guanine can adopt the syn orientation about the glycosidic bond due to changes in conformational stability or hydrogen-bonding preferences directly arising from the bulky group. Indeed, the bulky substituent may improve the stability of (non-native) Hoogsteen pairs. Therefore, such adducts often result in mutations upon DNA replication. This work examines the hydrogen-bonded pairs between the Watson-Crick and Hoogsteen faces of the ortho or para C8-phenoxyl-2'-deoxyguanosine adduct and each natural (undamaged) nucleobase with the goal to clarify the conformational preference of this type of damage, as well as provide insight into the likelihood of subsequent mutation events. B3LYP/6-311+G(2df,p)//B3LYP/6-31G(d) hydrogen-bond strengths were determined using both nucleobase and nucleoside models for adduct pairs, as well as the corresponding complexes involving natural 2'-deoxyguanosine. In addition to the magnitude of the binding strengths, the R(C1'···C1') distances and ∠(N9C1'C1') angles, as well as the degree of propeller-twist and buckle distortions, were carefully compared to the values observed in natural DNA strands. Due to structural changes in the adduct monomer upon inclusion of the sugar moiety, the monomer deformation energy significantly affects the relative hydrogen-bond strengths calculated with the nucleobase and nucleoside models. Therefore, we recommend the use of at least a nucleoside model to accurately evaluate hydrogen-bond strengths of base pairs involving flexible, bulky nucleobase adducts. Our results also emphasize the importance of considering both the magnitude of the hydrogen-bond strength and the structure of the base pair when predicting the preferential binding patterns of nucleobases. Using our best models, we conclude that the Watson-Crick face of the ortho phenoxyl adduct forms significantly more stable complexes than the Hoogsteen face, which

MrEnt: an editor for publication-quality phylogenetic tree illustrations.

Science.gov (United States)

Zuccon, Alessandro; Zuccon, Dario

2014-09-01

We developed MrEnt, a Windows-based, user-friendly software that allows the production of complex, high-resolution, publication-quality phylogenetic trees in few steps, directly from the analysis output. The program recognizes the standard Nexus tree format and the annotated tree files produced by BEAST and MrBayes. MrEnt combines in a single software a large suite of tree manipulation functions (e.g. handling of multiple trees, tree rotation, character mapping, node collapsing, compression of large clades, handling of time scale and error bars for chronograms) with drawing tools typical of standard graphic editors, including handling of graphic elements and images. The tree illustration can be printed or exported in several standard formats suitable for journal publication, PowerPoint presentation or Web publication. © 2014 John Wiley & Sons Ltd.

Cache-Oblivious Search Trees via Binary Trees of Small Height

DEFF Research Database (Denmark)

Brodal, G.S.; Fagerberg, R.; Jacob, R.

2002-01-01

We propose a version of cache oblivious search trees which is simpler than the previous proposal of Bender, Demaine and Farach-Colton and has the same complexity bounds. In particular, our data structure avoids the use of weight balanced B-trees, and can be implemented as just a single array......, and range queries in worst case O(logB n + k/B) memory transfers, where k is the size of the output.The basic idea of our data structure is to maintain a dynamic binary tree of height log n+O(1) using existing methods, embed this tree in a static binary tree, which in turn is embedded in an array in a cache...... oblivious fashion, using the van Emde Boas layout of Prokop.We also investigate the practicality of cache obliviousness in the area of search trees, by providing an empirical comparison of different methods for laying out a search tree in memory....

Flowering Trees

Indian Academy of Sciences (India)

Flowering Trees. Boswellia serrata Roxb. ex Colebr. (Indian Frankincense tree) of Burseraceae is a large-sized deciduous tree that is native to India. Bark is thin, greenish-ash-coloured that exfoliates into smooth papery flakes. Stem exudes pinkish resin ... Fruit is a three-valved capsule. A green gum-resin exudes from the ...

Modeling shade tree use by beef cattle as a function of black globe temperature and time of day

Science.gov (United States)

Foust, Amanda M.; Headlee, William L.

2017-12-01

Increasing temperatures associated with global climate change threaten to disrupt agricultural systems such as beef production, yet relatively little is known about the use of natural tree shade to mitigate the negative effects of heat stress on beef cattle. In this study, we evaluated how temperature and time of day influenced the utilization of tree shade in relation to coloration, orientation, and behavior of beef cattle in a pasture system. Temperatures in shade and direct sunlight were measured using black globe temperature (BGT) data loggers. Time-lapse images from game cameras were used to obtain counts of shade usage, coloration, orientation, and behavior of cattle throughout the daytime hours. In general, we found that shade utilization and most of the predominating orientations and behaviors differed significantly ( P effects (Hour × BGTsun) were often nonsignificant. The mean percentage of the herd using shade was highest in mid-morning (87-96%) and early afternoon (97%), but also increased with BGTsun regardless of the time of day; these trends were similar for both dark- and light-colored cattle. Lying down was the dominant behavior exhibited in the shade, while foraging was the most prevalent behavior in the sun. When herd shade usage was lowest in mid- to late-afternoon (<1%) we also observed an increase in the use of heat-mitigating orientations in the sun (37-47%). We discuss some practical implications of these results, including the potential use of temperature thresholds to interpret cattle behaviors and shade usage.

Systolic trees and systolic language recognition by tree automata

Energy Technology Data Exchange (ETDEWEB)

Steinby, M

1983-01-01

K. Culik II, J. Gruska, A. Salomaa and D. Wood have studied the language recognition capabilities of certain types of systolically operating networks of processors (see research reports Cs-81-32, Cs-81-36 and Cs-82-01, Univ. of Waterloo, Ontario, Canada). In this paper, their model for systolic VLSI trees is formalised in terms of standard tree automaton theory, and the way in which some known facts about recognisable forests and tree transductions can be applied in VLSI tree theory is demonstrated. 13 references.

Improvement of testing and maintenance based on fault tree analysis

International Nuclear Information System (INIS)

Cepin, M.

2000-01-01

Testing and maintenance of safety equipment is an important issue, which significantly contributes to safe and efficient operation of a nuclear power plant. In this paper a method, which extends the classical fault tree with time, is presented. Its mathematical model is represented by a set of equations, which include time requirements defined in the house event matrix. House events matrix is a representation of house events switched on and off through the discrete points of time. It includes house events, which timely switch on and off parts of the fault tree in accordance with the status of the plant configuration. Time dependent top event probability is calculated by the fault tree evaluations. Arrangement of components outages is determined on base of minimization of mean system unavailability. The results show that application of the method may improve the time placement of testing and maintenance activities of safety equipment. (author)

Genomics-assisted breeding in fruit trees

OpenAIRE

Iwata, Hiroyoshi; Minamikawa, Mai F.; Kajiya-Kanegae, Hiromi; Ishimori, Motoyuki; Hayashi, Takeshi

2016-01-01

Recent advancements in genomic analysis technologies have opened up new avenues to promote the efficiency of plant breeding. Novel genomics-based approaches for plant breeding and genetics research, such as genome-wide association studies (GWAS) and genomic selection (GS), are useful, especially in fruit tree breeding. The breeding of fruit trees is hindered by their long generation time, large plant size, long juvenile phase, and the necessity to wait for the physiological maturity of the pl...

Flowering Trees

Indian Academy of Sciences (India)

More Details Fulltext PDF. Volume 8 Issue 8 August 2003 pp 112-112 Flowering Trees. Zizyphus jujuba Lam. of Rhamnaceae · More Details Fulltext PDF. Volume 8 Issue 9 September 2003 pp 97-97 Flowering Trees. Moringa oleifera · More Details Fulltext PDF. Volume 8 Issue 10 October 2003 pp 100-100 Flowering Trees.

Embedding complete ternary tree in hypercubes using AVL trees

NARCIS (Netherlands)

S.A. Choudum; I. Raman (Indhumathi)

2008-01-01

htmlabstractA complete ternary tree is a tree in which every non-leaf vertex has exactly three children. We prove that a complete ternary tree of height h, TTh, is embeddable in a hypercube of dimension . This result coincides with the result of [2]. However, in this paper, the embedding utilizes

Ghost-tree: creating hybrid-gene phylogenetic trees for diversity analyses.

Science.gov (United States)

Fouquier, Jennifer; Rideout, Jai Ram; Bolyen, Evan; Chase, John; Shiffer, Arron; McDonald, Daniel; Knight, Rob; Caporaso, J Gregory; Kelley, Scott T

2016-02-24

Fungi play critical roles in many ecosystems, cause serious diseases in plants and animals, and pose significant threats to human health and structural integrity problems in built environments. While most fungal diversity remains unknown, the development of PCR primers for the internal transcribed spacer (ITS) combined with next-generation sequencing has substantially improved our ability to profile fungal microbial diversity. Although the high sequence variability in the ITS region facilitates more accurate species identification, it also makes multiple sequence alignment and phylogenetic analysis unreliable across evolutionarily distant fungi because the sequences are hard to align accurately. To address this issue, we created ghost-tree, a bioinformatics tool that integrates sequence data from two genetic markers into a single phylogenetic tree that can be used for diversity analyses. Our approach starts with a "foundation" phylogeny based on one genetic marker whose sequences can be aligned across organisms spanning divergent taxonomic groups (e.g., fungal families). Then, "extension" phylogenies are built for more closely related organisms (e.g., fungal species or strains) using a second more rapidly evolving genetic marker. These smaller phylogenies are then grafted onto the foundation tree by mapping taxonomic names such that each corresponding foundation-tree tip would branch into its new "extension tree" child. We applied ghost-tree to graft fungal extension phylogenies derived from ITS sequences onto a foundation phylogeny derived from fungal 18S sequences. Our analysis of simulated and real fungal ITS data sets found that phylogenetic distances between fungal communities computed using ghost-tree phylogenies explained significantly more variance than non-phylogenetic distances. The phylogenetic metrics also improved our ability to distinguish small differences (effect sizes) between microbial communities, though results were similar to non

Trees are good, but…

Science.gov (United States)

E.G. McPherson; F. Ferrini

2010-01-01

We know that “trees are good,” and most people believe this to be true. But if this is so, why are so many trees neglected, and so many tree wells empty? An individual’s attitude toward trees may result from their firsthand encounters with specific trees. Understanding how attitudes about trees are shaped, particularly aversion to trees, is critical to the business of...

A Middle-School Classroom Inquiry: Estimating the Height of a Tree

Science.gov (United States)

Watson, Jane; Brown, Natalie; Wright, Suzie; Skalicky, Jane

2011-01-01

There is an old saying that "there is more than one way to skin a cat." Such is the case with finding the height of tall objects, a task that people have been approximating for centuries. Following an article in the "Australian Primary Mathematics Classroom" (APMC) with methods appropriate for primary students (Brown, Watson,…

Multiple-purpose trees for pastoral farming in New Zealand: with emphasis on tree legumes. [Lucerne Tree: Medick Tree

Energy Technology Data Exchange (ETDEWEB)

Davies, D J.G.; Macfarlane, R P

1979-01-01

The potential for soil conservation and agroforestry of several native and exotic legumes is discussed. Flowering period, chemical composition of leaves/pods, hardiness to frost and drought, timber value, forage potential for livestock and bees, ornamental value and other products are tabulated with information on up to 38 species. Two low-growing species that have proved useful for slope stabilization as well as forage are tree lucerne (Cytisus palmensis) and tree medick (Medicago arborea), the latter being shrubby and more suitable for cold districts. Gleditsia triacanthos is recommended as a shade and fodder tree for farm pasture.

Effect of electronic coupling of Watson-Crick hopping in DNA poly(dA)-poly(dT)

Science.gov (United States)

Risqi, A. M.; Yudiarsah, E.

2017-07-01

Charge transport properties of poly(dA)-poly(dT) DNA has been studied by using thigh binding Hamiltonian approach. Molecule DNA that we use consist of 32 base pair of adenine (A) and thymine (T) and backbone is consist of phosphate and sugar. The molecule DNA is contacted electrode at both ends. Charge transport in molecule DNA depend on the environment, we studied the effect of electronic coupling of Watson-Crick hopping in poly(dA)-poly(dT) DNA to transmission probability and characteristic I-V. The electronic coupling constant influence charge transport between adenine-thymine base pairs at the same site. Transmission probability is studied by using transfer matrix and scattering matrix method, and the result of transmission probability is used to calculate the characteristic I-V by using formula Landauer Buttiker. The result shows that when the electronic coupling increase then transmission probability and characteristic I-V increase slightly.

Phytoforensics—Using trees to find contamination

Science.gov (United States)

Wilson, Jordan L.

2017-09-28

The water we drink, air we breathe, and soil we come into contact with have the potential to adversely affect our health because of contaminants in the environment. Environmental samples can characterize the extent of potential contamination, but traditional methods for collecting water, air, and soil samples below the ground (for example, well drilling or direct-push soil sampling) are expensive and time consuming. Trees are closely connected to the subsurface and sampling tree trunks can indicate subsurface pollutants, a process called phytoforensics. Scientists at the Missouri Water Science Center were among the first to use phytoforensics to screen sites for contamination before using traditional sampling methods, to guide additional sampling, and to show the large cost savings associated with tree sampling compared to traditional methods. 

Pulotu: Database of Austronesian Supernatural Beliefs and Practices.

Science.gov (United States)

Watts, Joseph; Sheehan, Oliver; Greenhill, Simon J; Gomes-Ng, Stephanie; Atkinson, Quentin D; Bulbulia, Joseph; Gray, Russell D

2015-01-01

Scholars have debated naturalistic theories of religion for thousands of years, but only recently have scientists begun to test predictions empirically. Existing databases contain few variables on religion, and are subject to Galton's Problem because they do not sufficiently account for the non-independence of cultures or systematically differentiate the traditional states of cultures from their contemporary states. Here we present Pulotu: the first quantitative cross-cultural database purpose-built to test evolutionary hypotheses of supernatural beliefs and practices. The Pulotu database documents the remarkable diversity of the Austronesian family of cultures, which originated in Taiwan, spread west to Madagascar and east to Easter Island-a region covering over half the world's longitude. The focus of Austronesian beliefs range from localised ancestral spirits to powerful creator gods. A wide range of practices also exist, such as headhunting, elaborate tattooing, and the construction of impressive monuments. Pulotu is freely available, currently contains 116 cultures, and has 80 variables describing supernatural beliefs and practices, as well as social and physical environments. One major advantage of Pulotu is that it has separate sections on the traditional states of cultures, the post-contact history of cultures, and the contemporary states of cultures. A second major advantage is that cultures are linked to a language-based family tree, enabling the use phylogenetic methods, which can be used to address Galton's Problem by accounting for common ancestry, to infer deep prehistory, and to model patterns of trait evolution over time. We illustrate the power of phylogenetic methods by performing an ancestral state reconstruction on the Pulotu variable "headhunting", finding evidence that headhunting was practiced in proto-Austronesian culture. Quantitative cross-cultural databases explicitly linking cultures to a phylogeny have the potential to revolutionise the

Pulotu: Database of Austronesian Supernatural Beliefs and Practices.

Directory of Open Access Journals (Sweden)

Joseph Watts

Full Text Available Scholars have debated naturalistic theories of religion for thousands of years, but only recently have scientists begun to test predictions empirically. Existing databases contain few variables on religion, and are subject to Galton's Problem because they do not sufficiently account for the non-independence of cultures or systematically differentiate the traditional states of cultures from their contemporary states. Here we present Pulotu: the first quantitative cross-cultural database purpose-built to test evolutionary hypotheses of supernatural beliefs and practices. The Pulotu database documents the remarkable diversity of the Austronesian family of cultures, which originated in Taiwan, spread west to Madagascar and east to Easter Island-a region covering over half the world's longitude. The focus of Austronesian beliefs range from localised ancestral spirits to powerful creator gods. A wide range of practices also exist, such as headhunting, elaborate tattooing, and the construction of impressive monuments. Pulotu is freely available, currently contains 116 cultures, and has 80 variables describing supernatural beliefs and practices, as well as social and physical environments. One major advantage of Pulotu is that it has separate sections on the traditional states of cultures, the post-contact history of cultures, and the contemporary states of cultures. A second major advantage is that cultures are linked to a language-based family tree, enabling the use phylogenetic methods, which can be used to address Galton's Problem by accounting for common ancestry, to infer deep prehistory, and to model patterns of trait evolution over time. We illustrate the power of phylogenetic methods by performing an ancestral state reconstruction on the Pulotu variable "headhunting", finding evidence that headhunting was practiced in proto-Austronesian culture. Quantitative cross-cultural databases explicitly linking cultures to a phylogeny have the potential

Fungal diseases of tree stands under urbanized conditions of Moscow

Directory of Open Access Journals (Sweden)

Smirnova Oksana G.

2013-01-01

Full Text Available Phytosanitary and ecological estimation of tree-stands has been con­ducted at the Forest Experimental Station of Moscow Agricultural Academy and parks of Northeast of Moscow in 2007-2011. Fomes fomentarius was proved to be a very serious pathogen of trees under conditions of Moscow, Piptoporus betulinus, Phellinus igniarius, and Fomitopsis pinicola also occurred and caused damage to trees. This rather bad phytosanitary situation depends on alarming ecological situation in Moscow. At the Forest Experimental Station of Moscow Agricultural Academy a number and cover of lichens decreased. In general, all trees in Moscow are in dynamic equilibrium with the urbanized environment. In connection with this, the following classification of tree-stands was proposed for the urbanized environment: 1 - healthy trees, 2 - affected trees which can be managed, 3 - dry woods, 3a - very diseased. Many tree-stands in investigated regions of Moscow are found to belong to the groups 2 and 3c. All tree-stands must be carefully monitored and managed in order to provide a well-timed decision on the support system for preservation of trees as ‘lungs of city’ and avoid unpredictable tree falling which put people and traffic at risk.

Comparing nonparametric Bayesian tree priors for clonal reconstruction of tumors.

Science.gov (United States)

Deshwar, Amit G; Vembu, Shankar; Morris, Quaid

2015-01-01

Statistical machine learning methods, especially nonparametric Bayesian methods, have become increasingly popular to infer clonal population structure of tumors. Here we describe the treeCRP, an extension of the Chinese restaurant process (CRP), a popular construction used in nonparametric mixture models, to infer the phylogeny and genotype of major subclonal lineages represented in the population of cancer cells. We also propose new split-merge updates tailored to the subclonal reconstruction problem that improve the mixing time of Markov chains. In comparisons with the tree-structured stick breaking prior used in PhyloSub, we demonstrate superior mixing and running time using the treeCRP with our new split-merge procedures. We also show that given the same number of samples, TSSB and treeCRP have similar ability to recover the subclonal structure of a tumor…

Shedding light on tree growth : ring analysis of juvenile tropical trees

NARCIS (Netherlands)

Soliz Gamboa, C.C.

2010-01-01

In the understory of tropical forests light is believed to be the main limiting growth factor for the newly established trees. Trees growing in shade of the understory may experience periods of slow radial growth. It is expected that gaps created by tree or branch fall will provoke tree growth

Microwave sensing of tree trunks

Science.gov (United States)

Jezova, Jana; Mertens, Laurence; Lambot, Sebastien

2015-04-01

The main subject of this research is the observation of the inner part of living tree trunks using ground-penetrating radar (GPR). Trees are everyday part of human life and therefore it is important to pay attention to the tree conditions. The most obvious consequence of the poor tree condition is dead or injury caused by falling tree. The trunk internal structure is divided into three main parts: heartwood, sapwood and bark, which make this medium highly anisotropic and heterogeneous. Furthermore, the properties of the wood are not only specie-dependent but also depend on genetic and on environmental conditions. In urban areas the main problem for the stability of the trees relies in the apparition of decays provoked by fungi, insect or birds. This results in cavities or decreasing of the support capacity of the tree. GPR has proved itself to be a very powerful electromagnetic tool for non-destructive detection of buried objects. Since the beginning of the 20th century it has been used in several different areas (archaeology, landmine detection, civil engineering, ...). GPR uses the principle of the scattering of the electromagnetic waves that are radiated from a transmitting antenna. Then the waves propagate through the medium and are reflected from the object and then they are received by a receiving antenna. The velocity of the scattered signal is determined primarily by the permittivity of the material. The optimal functionality of the GPR was investigated using the numerical simulation tool gprMax2D. This tool is based on a Finite-Difference Time-Domain (FDTD) numerical model. Subsequently, the GPR functionality was tested using the laboratory model of a decayed tree trunk. Afterwards, the results and lessons learnt in the simplified tests will be used in the processing of the real data and will help to achieve deeper understanding of them. The laboratory model of the tree trunk was made by plastic or carton pipes and filled by sand. Space inside the model

Efficient Delaunay Tessellation through K-D Tree Decomposition

Energy Technology Data Exchange (ETDEWEB)

Morozov, Dmitriy; Peterka, Tom

2017-08-21

Delaunay tessellations are fundamental data structures in computational geometry. They are important in data analysis, where they can represent the geometry of a point set or approximate its density. The algorithms for computing these tessellations at scale perform poorly when the input data is unbalanced. We investigate the use of k-d trees to evenly distribute points among processes and compare two strategies for picking split points between domain regions. Because resulting point distributions no longer satisfy the assumptions of existing parallel Delaunay algorithms, we develop a new parallel algorithm that adapts to its input and prove its correctness. We evaluate the new algorithm using two late-stage cosmology datasets. The new running times are up to 50 times faster using k-d tree compared with regular grid decomposition. Moreover, in the unbalanced data sets, decomposing the domain into a k-d tree is up to five times faster than decomposing it into a regular grid.

New approaches to evaluating fault trees

International Nuclear Information System (INIS)

Sinnamon, R.M.; Andrews, J.D.

1997-01-01

Fault Tree Analysis is now a widely accepted technique to assess the probability and frequency of system failure in many industries. For complex systems an analysis may produce hundreds of thousands of combinations of events which can cause system failure (minimal cut sets). The determination of these cut sets can be a very time consuming process even on modern high speed digital computers. Computerised methods, such as bottom-up or top-down approaches, to conduct this analysis are now so well developed that further refinement is unlikely to result in vast reductions in computer time. It is felt that substantial improvement in computer utilisation will only result from a completely new approach. This paper describes the use of a Binary Decision Diagram for Fault Tree Analysis and some ways in which it can be efficiently implemented on a computer. In particular, attention is given to the production of a minimum form of the Binary Decision Diagram by considering the ordering that has to be given to the basic events of the fault tree

Advanced features of the fault tree solver FTREX

International Nuclear Information System (INIS)

Jung, Woo Sik; Han, Sang Hoon; Ha, Jae Joo

2005-01-01

This paper presents advanced features of a fault tree solver FTREX (Fault Tree Reliability Evaluation eXpert). Fault tree analysis is one of the most commonly used methods for the safety analysis of industrial systems especially for the probabilistic safety analysis (PSA) of nuclear power plants. Fault trees are solved by the classical Boolean algebra, conventional Binary Decision Diagram (BDD) algorithm, coherent BDD algorithm, and Bayesian networks. FTREX could optionally solve fault trees by the conventional BDD algorithm or the coherent BDD algorithm and could convert the fault trees into the form of the Bayesian networks. The algorithm based on the classical Boolean algebra solves a fault tree and generates MCSs. The conventional BDD algorithm generates a BDD structure of the top event and calculates the exact top event probability. The BDD structure is a factorized form of the prime implicants. The MCSs of the top event could be extracted by reducing the prime implicants in the BDD structure. The coherent BDD algorithm is developed to overcome the shortcomings of the conventional BDD algorithm such as the huge memory requirements and a long run time

Inferring species trees from incongruent multi-copy gene trees using the Robinson-Foulds distance

Science.gov (United States)

2013-01-01

Background Constructing species trees from multi-copy gene trees remains a challenging problem in phylogenetics. One difficulty is that the underlying genes can be incongruent due to evolutionary processes such as gene duplication and loss, deep coalescence, or lateral gene transfer. Gene tree estimation errors may further exacerbate the difficulties of species tree estimation. Results We present a new approach for inferring species trees from incongruent multi-copy gene trees that is based on a generalization of the Robinson-Foulds (RF) distance measure to multi-labeled trees (mul-trees). We prove that it is NP-hard to compute the RF distance between two mul-trees; however, it is easy to calculate this distance between a mul-tree and a singly-labeled species tree. Motivated by this, we formulate the RF problem for mul-trees (MulRF) as follows: Given a collection of multi-copy gene trees, find a singly-labeled species tree that minimizes the total RF distance from the input mul-trees. We develop and implement a fast SPR-based heuristic algorithm for the NP-hard MulRF problem. We compare the performance of the MulRF method (available at http://genome.cs.iastate.edu/CBL/MulRF/) with several gene tree parsimony approaches using gene tree simulations that incorporate gene tree error, gene duplications and losses, and/or lateral transfer. The MulRF method produces more accurate species trees than gene tree parsimony approaches. We also demonstrate that the MulRF method infers in minutes a credible plant species tree from a collection of nearly 2,000 gene trees. Conclusions Our new phylogenetic inference method, based on a generalized RF distance, makes it possible to quickly estimate species trees from large genomic data sets. Since the MulRF method, unlike gene tree parsimony, is based on a generic tree distance measure, it is appealing for analyses of genomic data sets, in which many processes such as deep coalescence, recombination, gene duplication and losses as

Slow growth rates of Amazonian trees: Consequences for carbon cycling

Science.gov (United States)

Vieira, Simone; Trumbore, Susan; Camargo, Plinio B.; Selhorst, Diogo; Chambers, Jeffrey Q.; Higuchi, Niro; Martinelli, Luiz Antonio

2005-01-01

Quantifying age structure and tree growth rate of Amazonian forests is essential for understanding their role in the carbon cycle. Here, we use radiocarbon dating and direct measurement of diameter increment to document unexpectedly slow growth rates for trees from three locations spanning the Brazilian Amazon basin. Central Amazon trees, averaging only ≈1mm/year diameter increment, grow half as fast as those from areas with more seasonal rainfall to the east and west. Slow growth rates mean that trees can attain great ages; across our sites we estimate 17-50% of trees with diameter >10 cm have ages exceeding 300 years. Whereas a few emergent trees that make up a large portion of the biomass grow faster, small trees that are more abundant grow slowly and attain ages of hundreds of years. The mean age of carbon in living trees (60-110 years) is within the range of or slightly longer than the mean residence time calculated from C inventory divided by annual C allocation to wood growth (40-100 years). Faster C turnover is observed in stands with overall higher rates of diameter increment and a larger fraction of the biomass in large, fast-growing trees. As a consequence, forests can recover biomass relatively quickly after disturbance, whereas recovering species composition may take many centuries. Carbon cycle models that apply a single turnover time for carbon in forest biomass do not account for variations in life strategy and therefore may overestimate the carbon sequestration potential of Amazon forests. PMID:16339903

The Complexity of Constructing Evolutionary Trees Using Experiments

DEFF Research Database (Denmark)

Brodal, Gerth Stølting; Fagerberg, Rolf; Pedersen, Christian Nørgaard Storm

2001-01-01

We present tight upper and lower bounds for the problem of constructing evolutionary trees in the experiment model. We describe an algorithm which constructs an evolutionary tree of n species in time O(nd logd n) using at most n⌈d/2⌉(log2⌈d/2⌉-1 n+O(1)) experiments for d > 2, and at most n(log n......+O(1)) experiments for d = 2, where d is the degree of the tree. This improves the previous best upper bound by a factor θ(log d). For d = 2 the previously best algorithm with running time O(n log n) had a bound of 4n log n on the number of experiments. By an explicit adversary argument, we show an Ω......(nd logd n) lower bound, matching our upper bounds and improving the previous best lower bound by a factor θ(logd n). Central to our algorithm is the construction and maintenance of separator trees of small height, which may be of independent interest....

Trees

Science.gov (United States)

Al-Khaja, Nawal

2007-01-01

This is a thematic lesson plan for young learners about palm trees and the importance of taking care of them. The two part lesson teaches listening, reading and speaking skills. The lesson includes parts of a tree; the modal auxiliary, can; dialogues and a role play activity.

Pyrrolo-dC Metal-Mediated Base Pairs in the Reverse Watson-Crick Double Helix: Enhanced Stability of Parallel DNA and Impact of 6-Pyridinyl Residues on Fluorescence and Silver-Ion Binding.

Science.gov (United States)

Yang, Haozhe; Mei, Hui; Seela, Frank

2015-07-06

Reverse Watson-Crick DNA with parallel-strand orientation (ps DNA) has been constructed. Pyrrolo-dC (PyrdC) nucleosides with phenyl and pyridinyl residues linked to the 6 position of the pyrrolo[2,3-d]pyrimidine base have been incorporated in 12- and 25-mer oligonucleotide duplexes and utilized as silver-ion binding sites. Thermal-stability studies on the parallel DNA strands demonstrated extremely strong silver-ion binding and strongly enhanced duplex stability. Stoichiometric UV and fluorescence titration experiments verified that a single (2py) PyrdC-(2py) PyrdC pair captures two silver ions in ps DNA. A structure for the PyrdC silver-ion base pair that aligns 7-deazapurine bases head-to-tail instead of head-to-head, as suggested for canonical DNA, is proposed. The silver DNA double helix represents the first example of a ps DNA structure built up of bidentate and tridentate reverse Watson-Crick base pairs stabilized by a dinuclear silver-mediated PyrdC pair. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Biogeomorphic and pedogenic impact of trees in three soil regions

Science.gov (United States)

Pawlik, Łukasz; Šamonil, Pavel

2017-04-01

Vegetation is an important factor of soil formation which together with topography, geology, climate and time modulates chemical and physical soil characteristics. Tree/soils/regolith interaction was recognized in recently uprooted trees and relict treethrow mounds and pits. In our present study we focus on effects of individual standing trees in pedogenesis and biogeomorphic processes. Constant pressure of tree root systems, changing hydric and temperature regime, together with rhizospheric microbes and root mycorrhizal associations may cause multiscale alterations to regolith and soils. We hypothesize different soil chemical properties under old tree stumps compared to unaffected control pedon resulted from affected pedogenetical pathways at the analyzed microsites. The present project highlights changes in soil properties under tree stumps in three different soil regions: Haplic Cambisols (Turbacz Reserve, Gorce Mts., Poland, hereafter HC), Entic Podzols (Zofin Reserve, Novohradske Mts., the Czech Republic, hereafter EP), Albic Podzols (Upper Peninsula, Michigan, USA, hereafter AP). These three regions represent different degrees of soil weathering and leaching. Pedons under fir, beech and hemlock stumps, as well as unaffected control pedons were sampled and laboratory analyzed for several chemical properties; active and exchangeable soil reaction, oxidized carbon, total nitrogen, and various forms of Fe, Al, Mn and Si. At the same time we studied age of the sampled tree stumps, as well as age of their death using radiocarbon technique and dendrochronology. While no effects of the soil-trees interactions can be visible on hillslope surface, we found important evidence of biomechanical activities of tree roots (e.g. root channels) and biochemical changes which add to the discussion about biogeomorphic and pedogenic significance of trees and tree roots as drivers of biomechanical weathering and soil processes in the decadal and centennial time scales. Preliminary

Decision and Inhibitory Trees for Decision Tables with Many-Valued Decisions

KAUST Repository

Azad, Mohammad

2018-06-06

Decision trees are one of the most commonly used tools in decision analysis, knowledge representation, machine learning, etc., for its simplicity and interpretability. We consider an extension of dynamic programming approach to process the whole set of decision trees for the given decision table which was previously only attainable by brute-force algorithms. We study decision tables with many-valued decisions (each row may contain multiple decisions) because they are more reasonable models of data in many cases. To address this problem in a broad sense, we consider not only decision trees but also inhibitory trees where terminal nodes are labeled with “̸= decision”. Inhibitory trees can sometimes describe more knowledge from datasets than decision trees. As for cost functions, we consider depth or average depth to minimize time complexity of trees, and the number of nodes or the number of the terminal, or nonterminal nodes to minimize the space complexity of trees. We investigate the multi-stage optimization of trees relative to some cost functions, and also the possibility to describe the whole set of strictly optimal trees. Furthermore, we study the bi-criteria optimization cost vs. cost and cost vs. uncertainty for decision trees, and cost vs. cost and cost vs. completeness for inhibitory trees. The most interesting application of the developed technique is the creation of multi-pruning and restricted multi-pruning approaches which are useful for knowledge representation and prediction. The experimental results show that decision trees constructed by these approaches can often outperform the decision trees constructed by the CART algorithm. Another application includes the comparison of 12 greedy heuristics for single- and bi-criteria optimization (cost vs. cost) of trees. We also study the three approaches (decision tables with many-valued decisions, decision tables with most common decisions, and decision tables with generalized decisions) to handle

Responses of Tree Growths to Tree Size, Competition, and Topographic Conditions in Sierra Nevada Forests Using Bi-temporal Airborne LiDAR Data

Science.gov (United States)

Ma, Q.; Su, Y.; Tao, S.; Guo, Q.

2016-12-01

Trees in the Sierra Nevada (SN) forests are experiencing rapid changes due to human disturbances and climatic changes. An improved monitoring of tree growth and understanding of how tree growth responses to different impact factors, such as tree competition, forest density, topographic and hydrologic conditions, are urgently needed in tree growth modeling. Traditional tree growth modeling mainly relied on field survey, which was highly time-consuming and labor-intensive. Airborne Light detection and ranging System (ALS) is increasingly used in forest survey, due to its high efficiency and accuracy in three-dimensional tree structure delineation and terrain characterization. This study successfully detected individual tree growth in height (ΔH), crown area (ΔA), and crown volume (ΔV) over a five-year period (2007-2012) using bi-temporal ALS data in two conifer forest areas in SN. We further analyzed their responses to original tree size, competition indices, forest structure indices, and topographic environmental parameters at individual tree and forest stand scales. Our results indicated ΔH was strongly sensitive to topographic wetness index; whereas ΔA and ΔV were highly responsive to forest density and original tree sizes. These ALS based findings in ΔH were consistent with field measurements. Our study demonstrated the promising potential of using bi-temporal ALS data in forest growth measurements and analysis. A more comprehensive study over a longer temporal period and a wider range of forest stands would give better insights into tree growth in the SN, and provide useful guides for forest growth monitoring, modeling, and management.

Spectra of chemical trees

International Nuclear Information System (INIS)

Balasubramanian, K.

1982-01-01

A method is developed for obtaining the spectra of trees of NMR and chemical interests. The characteristic polynomials of branched trees can be obtained in terms of the characteristic polynomials of unbranched trees and branches by pruning the tree at the joints. The unbranched trees can also be broken down further until a tree containing just two vertices is obtained. The effectively reduces the order of the secular determinant of the tree used at the beginning to determinants of orders atmost equal to the number of vertices in the branch containing the largest number of vertices. An illustrative example of a NMR graph is given for which the 22 x 22 secular determinant is reduced to determinants of orders atmost 4 x 4 in just the second step of the algorithm. The tree pruning algorithm can be applied even to trees with no symmetry elements and such a factoring can be achieved. Methods developed here can be elegantly used to find if two trees are cospectral and to construct cospectral trees

Tritium cycling in a tree spiked with tritiated water

International Nuclear Information System (INIS)

Murphy, C.E. Jr.; Luvall, J.C.

1979-01-01

Transfer and turnover rates in forests are important to compute the residence time of tritiated water in an area following an accidental release. In this study tritium was injected in the base of 7 year old, loblolly pine (Pinus taeda, L) trees to determine the rate of transfer through the trees and the turnover in the trees independent of the soil. The results indicate the flow rates depend on the rate of water movement through the tree, which is influenced by the microclimate, and exchange of tritium with hydrogen exchange sites in the tree. The initial pulse of tritium appears to move through the tree in about four days. The descending portion of the curve can be described as a two compartment model with half-lives of 1.41 and 21.7 days. There is some evidence that a longer turnover compartment is associated with metabolically fixed tritium

Age-related changes in tree growth and physiology