International Nuclear Information System (INIS)
Smith, M.R.; Lautensleger, A.W.; Laul, J.C.
1988-01-01
An improved method for determining radium and thorium from the 232 Th decay series has been developed which measures the activity of 220 Rn as an assay of its parents. Although some ingrowth corrections and minor separation procedures for Th are required, the results to date show that the dynamic counting of 220 Rn via de-emanation and alpha counting by the alpha-scintillation method is preferable. The method for lower limit detection depends on the emanation rate. (author) 3 refs.; 6 figs
Inhalation exposures at a thorium refinery
International Nuclear Information System (INIS)
Mausner, L.F.
1982-01-01
There is a current interest in the metabolism and health effects of thorium due to its potential use in the 232 Th - 233 U nuclear fuel cycle. The airborne concentrations of thorium, thoron daughters and rare earths in a plant which produced thorium and rare earth chemicals from 1932 to 1973 were calculated from past records of alpha counting and air filter samples. This analysis showed that high airborne concentrations of 232 Th, 220 Rn, 212 Pb, 212 Bi and rare earth elements were sometimes reached during plant operations. Limited measurements on autopsy samples of former employees of the plant showed increased tissue concentrations of thorium and rare earths. (U.K.)
International Nuclear Information System (INIS)
Meyer, H.R.; Till, J.E.
1978-01-01
Recent emphasis on proliferation-resistant fuel cycles utilizing thorium--uranium-233 fuels has necessitated evaluation of the potential radiological impact of mining and milling thorium ore. Therefore, an analysis has been completed of hypothetical mine-mill complexes using population and meteorological data representative of a thorium resource site in the Lemhi Pass area of Idaho/Montana, United States of America. Source terms for the site include thorium-232 decay chain radionuclides suspended as dusts and radon-220 and daughters initially released as gas. Fifty-year dose commitments to maximally exposed individuals of 2.4 mrem to total body, 9.5 mrem to bone, and 35 mrem to lungs are calculated to result from facility operation. Radium-228, thorium-228, thorium-232 and lead-212 (daughter of radon-220) are found to be the principal contributors to dose. General population doses for a 50-mile radius surrounding the facility are estimated to be 0.05 man-rem to total body, 0.1 man-rem to bone, and 0.7 man-rem to lungs. Generally speaking, the results of this study indicate that the radiological aspects of thorium mining and milling should pose no significant problems with regard to implementation of thorium fuel cycles
International Nuclear Information System (INIS)
Lindstrom, F.T.; Cawlfield, D.E.; Donahue, M.E.; Emer, D.F.; Shott, G.J.
1992-07-01
US Department of Energy (DOE) Order 5820.2A (DOE, 1988) requires performance assessment of all new and existing low-level radioactive waste (LLW) disposal sites. An integral part of performance assessment is estimating the fluxes of radioactive gases such as radon-220 and radon-222. Mathematical models, which point out data needs and therefore drive site characterization, provide a logical means of performing the required flux estimations. Thorium-232 Waste, consisting largely of thorium hydroxide and thorium oxides, has been approved for disposal in shallow trenches and pits at the LLW Radioactive Waste Management Site in Area 5 of the Nevada Test Site. A sophisticated gas transport model, CASCADR8 (Lindstrom et al., 1992), was used to simulate the transport and fate of radon-220 from its source of origin nine feet below a closure cap of native soil, through the dry alluvial earth, to its point of release to the atmosphere. CASCADR8 is an M-chain gas-phase radionuclide transport and fate model. It has been tailored to the site-specific needs of the dry desert environment of southern Nevada. It is based on the mass balance principle for each radionuclide and uses gas-phase diffusion as well as barometric pressure-induced advection as its main modes of transport
Environmental thoron (220Rn): a review
International Nuclear Information System (INIS)
Ramachandran, T.V.
2013-01-01
Ever since studies on uranium miners established the presence of a positive risk coefficient for the occurrence of lung cancer in miners exposed to elevated levels of 222 Rn and its progeny, there was a great upsurge of interest in the measurement of 222 Rn in the environment and considerable data is generated on the levels of 222 Rn in the environment across the worlds and is periodically reported by UNSCEAR. In contrast to this, data pertaining to 220 Rn in indoors and workplace environment is scare due to the general perception that its levels are negligible due to its shorter half life, and subsequently its contribution to the total inhalation dose is ignored, in the presence of other significant sources of natural radiation. Many locations have higher levels of natural background radiation due to elevated levels of primordial radio nuclides in the soil and their decay products like radon ( 222 Rn), and thoron ( 220 Rn) in the environment. It is estimated inhalation of 222 Rn, 220 Rn and their short lived progenies contribute more than 54 % of the total natural background radiation dose received by the general population. This component is not adequately estimated for any country so far on a national level. 220 Rn problem will also be a problem in industries which uses thorium nitrate. Including India lamps using thoriated gas mantles are being still used for indoor and outdoor lighting and hawkers in rural as well as urban areas. Considering the fact that large amount of thorium nitrate is being handled by these industries, contribution to the inhalation dose of workers from 220 Rn gas emanated and build up of the progeny in ambient air may also be quite significant. In this article current status of 220 Rn levels in the indoor environment workplaces as well as in other industries where large amount of 232 Th is being handled are being summarized. (author)
Radon in air concentrations arising from storage of articles containing radium or thorium
International Nuclear Information System (INIS)
Slater, M.; Gooding, M.
2006-01-01
A major component of public and occupational radiation exposure worldwide arises from the inhalation of radon and thoron gases, produced during the decay of naturally occurring uranium and thorium respectively. Whilst radon and thoron exposures are normally associated with the natural environment, there may also be a risk associated with sources, manufactured articles and waste produced through refining and concentration of naturally occurring radioactive material. Sources and articles manufactured from refined uranium do not normally give rise to the release of radon as the uranium progeny are largely removed during production and, if removed, will take thousands of years to reach full equilibrium with the uranium parent isotopes. Exposure to radon -222 ( 222 Rn) may, however, arise in areas where the uranium-238 ( 238 U) daughter radium-226 ( 226 Ra) is concentrated, for example in the form of sources, luminous articles or low-specific activity (LSA) scale. Exposure to radon- 220 ( 220 Rn), otherwise known as thoron, may occur in areas where thorium isotopes are concentrated, for example as manufactured laboratory thorium compounds. This paper explores the issues affecting radon and thoron release from manufactured articles containing uranium and thorium and their progeny. A methodology is provided for the calculation of 222 Rn and 220 Rn in air concentrations likely to arise as a result of the storage and use of articles containing radium-226 ( 226 Ra) or thorium-232 ( 232 Th). The methodology provided in the document allows derivation of the equilibrium equivalent radon concentration and the radon exposure rate in circumstances where the ventilation rate and volume of the facility can be reliably estimated and the quantities of 226 Ra or 232 Th held are known. A critical variable in the calculation is the release fraction (i.e. the proportion of radon generated that is release to atmosphere), and this paper considers methods for estimating this parameter
Energy Technology Data Exchange (ETDEWEB)
Coombs, M.A.; Cuddihy, R.G. (Lovelace Biomedical and Environmental Research Inst., Albuquerque, NM (USA). Inhalation Toxicology Research Inst.)
1983-01-01
Emanation of /sup 232/U daughter products by nuclear recoil and inert gas diffusion from spherical, submicrometer particles of uranium oxide and thorium dioxide was studied. Monodisperse samples of particles containing 1% /sup 232/U and having physical diameters between 0.1 and 1 ..mu..m were used for the emanation measurements. Thorium-228 ions recoiling from the particles after alpha-decay of /sup 232/U were collected electrostatically on a recoil cathode. Radon-220 diffusing from the particles was swept by an airstream into a 4 l. chamber where the /sup 220/Rn daughters were collected on a second cathode. Mathematical models of radionuclide emanation from spherical particles were used to calculate the recoil range of /sup 228/Th and the diffusion coefficient of /sup 220/Rn in the particle matrix. A /sup 228/Th recoil range of 0.02 ..mu..m and a /sup 220/Rn diffusion coefficient of 3 x 10/sup -14/ cm/sup 2//sec were obtained in both uranium oxide and thorium dioxide particles.
Ultimate storage of thorium-bearing waste
International Nuclear Information System (INIS)
Ganser, B.
1986-01-01
The goal of this R and D project was to experimentally determine the release of the radioactive noble gas radon from thorium-bearing waste. For the experiments, three 200 litre waste forms have been prepared: One package consisting of inactive cement (for blank value determination), the second of cemented, radioactive sludge precipitate (for reference value determination), and the third of untreated sludge precipitate in a drum. The release rate measured on the reference package at room temperature is 3.1x10 10 Bq/a for Rn-220, and 2.4x10 6 Bq/a for Rn-222. The release rate from a drum under equal conditions is 4.1x10 8 Bq/a for Rn-220, and 2.1x10 6 Bq/a for Rn-222. (orig./RB) [de
International Nuclear Information System (INIS)
Anon
1998-01-01
The development and application of a measuring method is described for thorium incorporation monitoring by way of measuring Rn-220 (thoron) in exhaled breath. The method is intended for application to monitoring the incorporation of thorium by occupationally exposed persons in compliance with the regulatory guide on health physics monitoring for determination of whole-body dose. (orig./CB) [de
Environmental thoron (220Rn): a review
International Nuclear Information System (INIS)
Ramachandran, T.V.
2008-01-01
adequately estimated for any country so far on a national level. 220 Rn problem will also be a problem in industries which uses thorium nitrate. Including India, lamps using thoriated gas mantles are being still used for indoor and outdoor lighting and hawkers in rural as well as urban areas. Considering the fact that large amount of thorium nitrate is being handled by these industries, contribution to the inhalation dose of workers from 220 Rn gas emanated and build up of the progeny in ambient air may also be quite significant. In this paper current status of 220 Rn levels in the indoor environment and workplaces as well as in other industries where large amount of 232 Th is being handled are being summarized. Methods of measurement and reported levels are also summarized. (author)
Thoron (220Rn) in the indoor environment and work places
Ramachandran, T. V.; Sahoo, B. K.
2009-08-01
Ever since studies on uranium miners established the presence of a positive risk coefficient for the occurrence of lung cancer in miners exposed to elevated levels of 222Rn and its progeny, there was a great upsurge of interest in the measurement of 222Rn in the environment. Subsequently, considerable data is being generated on the levels of 222Rn in the environment across the worlds and is being periodically reported by UNSCEAR reports. In contrast to this, data pertaining to 220Rn in indoors and workplace environment is scaree due to the genral perception that its levels are negligible due to its shorter half life, and subsequently its contribution to the total inhalation dose is ignored, in the presence of other significant sources of natural radiation. This may not be true. Globally many locations have higher levels of natural background radiation due to elevated levels of primordial radio nuclides in the soil and their decay products like radon (222Rn), and thoron (220Rn) in the environment. Of late, technologically enhanced naturally occurring radioactive material has also contributed to the burden of background radiation. It is estimated that inhalation of 222Rn, 220Rn and their short lived progenies contribute more than 54% of the total natural background radiation dose received by the general population. 220Rn problem exists in industries which use thorium nitrate. Including India, lamps using thoriated gas mantles are still being used for indoor and outdoor lighting and by hawkers in rural as well as urban areas. Considering the fact that large amount of thorium nitrate is being handled by these industries, contribution to the inhalation dose of workers from 220Rn gas emanated and build up of the progeny in ambient air may also be quite significant. In this paper current status of 220Rn levels in the indoor environment and workplaces as well as in other industries where large amount of 232Th is being handled is being summarized. Methods of measurement and
Thoron (220Rn) in the indoor environment and work places
International Nuclear Information System (INIS)
Ramchandran, T.V.; Sahoo, B.K.
2009-01-01
Ever since studies on uranium miners established the presence of a positive risk coefficient for the occurrence of lung cancer in miners exposed to elevated levels of 222 Rn and its progeny, there was a great upsurge of interest in the measurement of 222 Rn in the environment. Subsequently, considerable data is being generated on the levels of 222 Rn in the environment across the worlds and is being periodically reported by UNSCEAR reports. In contrast to this, data pertaining to 220 Rn in indoors and workplace environment is scaree due to the general perception that its levels are negligible due to its shorter half life, and subsequently its contribution to the total inhalation dose is ignored, in the presence of other significant sources of natural radiation. This may not be true. Globally many locations have higher levels of natural background radiation due to elevated levels of primordial radio nuclides in the soil and their decay products like radon ( 222 Rn), and thoron ( 220 Rn) in the environment. Of late, technologically enhanced naturally occurring radioactive material has also contributed to the burden of background radiation. It is estimated that inhalation of 222 Rn, 220 Rn and their short lived progenies contribute more than 54% of the total natural background radiation dose received by the general population. 220 Rn problem exists in industries which use thorium nitrate. Including India, lamps using thoriated gas mantles are still being used for indoor and outdoor lighting and by hawkers in rural as well as urban areas. Considering the fact that large amount of thorium nitrate is being handled by these industries, contribution to the inhalation dose of workers from 220 Rn gas emanated and build up of the progeny in ambient air may also be quite significant. In this paper current status of 220 Rn levels in the indoor environment and workplaces as well as in other industries where large amount of 232 Th is being handled is being summarized. Methods of
Use of ultra-filtration in organic-rich groundwater for the physical separation of thorium
International Nuclear Information System (INIS)
Singhal, R.K.; Basu, H.; Pimple, M.V.; Manisha, V.; Bassan, M.K.T.; Reddy, A.V.R.
2014-01-01
During this work, size fractionation technique 'ultra filtration' is used in physical speciation of thorium in organic rich groundwater. Laboratory simulated experiments were carried out to study the physical speciation of thorium in aquatic environment having elevated level of dissolved humus material classified as dissolved organic carbon (DOC). Samples were collected from organic rich environment having DOC in the range of 50-60 μg mL -1 . Th(IV) ions are extremely particle reactive having K d value of the order of 105-6, hence to avoid adsorption on suspended particulate matter, spiking of the solution with Th(NO 3 )4 was carried out in ground water samples after filtering through 450 nm pore size using suction filtration. Particles in dissolved state (colloids) ranging between 220 nm were separated using suction filtration assembly having a membrane with a pore diameter of 220 nm. Thereafter, solution was sequentially passed through the ultra-filtration membranes having pore diameters of 14 nm [300 k NMWL (nominal molecular weight limit)], 3.1 nm (50 k NMWL), 2.2 nm (30 k NMWL), 1.6 nm (10 k NMWL) and 1.1 nm (0.5 k NMWL) by using 'Stirred Ultra-filtration Cells', operating in concentration mode. Thorium has only one stable oxidation state i.e. IV, under all redox conditions in natural waters and therefore, its speciation is dominated by its interaction with various fractions of DOC. Experimental results show 50-60 % of the spiked Th is in association with fraction enriched with particles of 10 k NMWL (1.6 nm) followed by fraction enriched with particle of 0.5 k NMWL and <220 nm. (author)
Long term radiological impact of thorium extraction
International Nuclear Information System (INIS)
Menard, S.; Schapira, J.P.
1995-01-01
Thorium extraction produces a certain amount of radioactive wastes. Potential long term radiological impact of these residues has been calculated using the recent ICRP-68 ingestion dose factors in connection with the computing code DECAY, developed at Orsay and described in this work. This code solves the well known Bateman's equations which govern the time dependence of a set of coupled radioactive nuclei. Monazites will be very likely the minerals to be exploited first, in case of an extensive use of thorium as nuclear fuel. Because monazites contain uranium as well, mining residues will contain not only the descendants of 232 Th and a certain proportion of non-extracted thorium (taken here to be 5%), but also this uranium, if left in the wastes for economical reasons. If no uranium would be present at all in the mineral, the potential radiotoxicity would strongly decrease in approximately 60 years, at the pace of the 5.8 years period of 228 Ra, which becomes the longest-lived radionuclide of the 4n radioactive family in the residues. Moreover, there is no risk due to radon exhalation, because of the very short period of 220 Rn. These significant differences between uranium and thorium mining have to be considered in view of some estimated long term real radiological impacts due to uranium residues, which could reach a value of the order of 1 mSv/year, the dose limit recommended for the public by the recent ICRP-60. (authors). 15 refs., 4 figs., 3 tabs., 43 appendices
Measurement of airborne concentrations of radon-220 daughter products by alpha-particle spectrometry
International Nuclear Information System (INIS)
Kerr, G.D.; Ryan, M.T.; Perdue, P.T.
1978-01-01
The decay of naturally occurring uranium-238 and thorium-232 produces radon-222 and radon-220 isotopes which can escape into the atmosphere. If these radon gases become concentrated in air, their daughter products may present an inhalation hazard to man. The airborne concentrations of radon-222 can usually be measured very accurately in the presence of normal airborne concentrations of radon-220 and its daughters. In contrast, the measurements of the airborne concentrations of radon-220 daughters are usually complicated by the presence of radon-222 and its daughters even at normally occurring airborne concentrations. The complications involved in these measurements can be overcome in most situations by using an alpha particle spectrometer to distinguish the activity of radon-222 daughters from that due to radon-220 daughters collected on a filter. A practical spectrometer for field measurements of alpha particle activity on a filter is discussed
Recovering of thorium contained in wastes from Thorium Purification Plant
International Nuclear Information System (INIS)
Brandao Filho, D.; Hespanhol, E.C.B.; Baba, S.; Miranda, L.E.T.; Araujo, J.A. de.
1992-08-01
A study has been developed in order to establish a chemical process for recovering thorium from wastes produced at the Thorium Purification Plant of the Instituto de Pesquisas Energeticas e Nucleares. The recovery of thorium in this process will be made by means of solvent extraction technique. Solutions of TBP/Varsol were employed as extracting agent during the runs. The influence of thorium concentration in the solution, aqueous phase acidity, volume ratio of the phases, percentage of TBP/Varsol and the contact time of the phases on the extraction of thorium and lanthanides was determined. (author)
Studies on the preparation of thorium metal sponge from thorium oxalate
International Nuclear Information System (INIS)
Vijay, P.L.; Sehra, J.C.; Sundaram, C.V.; Gurumurthy, K.R.; Raghavan, R.V.
1978-01-01
The results of investigations carried out on the production of high purity thorium metal sponge, starting with thorium oxalate are presented. The flow sheet includes chlorination of thorium oxalate, purification of raw thorium tetrachloride, magnesium reduction of anhydrous thorium tetrachloride, slag metal separation, vacuum distillation for removal of residual MgCl 2 and excess magnesium, and consolidation of the metal sponge. Studies have been carried out to investigate the optimum chlorination efficiency and chlorine utilization attainable using different chlorinating agents, and to compare the quality of the sponge obtained with single and double distilled chloride. The overall process efficiency under optimum conditions was 81%. The thorium metal button, prepared from the sponge by arc-melting, analysed : O 2 - 847, N 2 - 20, C - 179, Mg - 100, Fe - 49, Ni<50, Al - 11, Cr - 7 (expressed in parts per million parts of thorium). The button could be further purified by electron beam melting to improve its ductility. (author)
Thorium-applications and handling
International Nuclear Information System (INIS)
Reichelt, A.
1993-01-01
The most important aspects concerning the natural occurrence and extraction of thorium are presented the topics covered are: natural isotopes, occurence in minerals, thorium-activity-content of naturally occuring materials, the resulting radiation exposure, extraction of thorium from ores, time-dependent activity after separation. The sources of radiation exposure due to Thorium, caused by human activity, can be divided into two categories, namely, those in which thorium is deliberately added to (consumer) products in order to improve their usefullness, and those in which the thorium is present accidentally and unwanted due to the naturally occuring thorium in the material used in the manufacturing processes. Some examples of such products and substances will be presented and results about their specific thorium activity will be discussed. Experimental data from a currently running research programme, will be presented, and will include results concerning the radiation occupational exposure due to phosphate fertilizers, thorium impregnated gas mantles and the use of thoriated TIG-Electrodes in arc welding. (orig.) [de
International Nuclear Information System (INIS)
Zajac, R.; Darilek, P.; Breza, J.; Necas, V.
2010-01-01
In this presentation author deals with the thorium fuel cycle management. Description of the thorium fuels and thorium fuel cycle benefits and challenges as well as thorium fuel calculations performed by the computer code HELIOS are presented.
Sudeep Kumara, K; Sahoo, B K; Gaware, J J; Sapra, B K; Mayya, Y S; Karunakara, N
2017-06-01
Exposure due to thoron ( 220 Rn) gas and its decay products in a thorium fuel cycle facility handling thorium or 232 U/ 233 U mixture compounds is an important issue of radiological concern requiring control and mitigation. Adsorption in a flow-through charcoal bed offers an excellent method of alleviating the release of 220 Rn into occupational and public domain. In this paper, we present the design, development, and characterization of a Thoron Mitigation System (TMS) for industrial application. Systematic experiments were conducted in the TMS for examining the 220 Rn mitigation characteristics with respect to a host of parameters such as flow rate, pressure drop, charcoal grain size, charcoal mass and bed depth, water content, and heat of the carrier gas. An analysis of the experimental data shows that 220 Rn attenuation in a flow through charcoal bed is not exponential with respect to the residence time, L/U a (L: bed depth; U a : superficial velocity), but follows a power law behaviour, which can be attributed to the occurrence of large voids due to wall channeling in a flow through bed. The study demonstrates the regeneration of charcoal adsorption capacity degraded due to moisture adsorption, by hot air blowing technique. It is found that the mitigation factor (MF), which is the ratio of the inlet 220 Rn concentration (C in ) to the outlet 220 Rn concentration (C out ), of more than 10 4 for the TMS is easily achievable during continuous operation (>1000 h) at a flow rate of 40 L min -1 with negligible (evaluated for its long-term performance and overall effectiveness in mitigating 220 Rn levels in the workplace. Copyright © 2017 Elsevier Ltd. All rights reserved.
Determination of natural thorium in urines; Dosage du thorium dans les urines
Energy Technology Data Exchange (ETDEWEB)
Jeanmaire, L; Jammet, H [Commissariat a l' Energie Atomique, Saclay (France).Centre d' Etudes Nucleaires
1959-07-01
A procedure for the quantitative analysis of thorium in urine is described. After precipitation with ammonium hydroxide, dissolution of the precipitate, extraction at pH 4-4.2 with cupferron in chloroformic solution and mineralization, a colorimetric determination of thorium with thorin is performed. It is thus possible to detect about 2 {gamma} of thorium in the sample. (author) [French] Cet article decrit une technique de dosage du thorium dans l'urine. Apres precipitation par l'ammoniaque, remise en solution, extraction a pH 4-4,2 par le cupferron en solution chloroformique et mineralisation, le thorium est dose par colorimetrie avec le thorin. Cette methode permet de deceler environ 2 {gamma} de thorium dans l'echantillon. (auteur)
Conceptual design of a passively safe thorium breeder Pebble Bed Reactor
International Nuclear Information System (INIS)
Wols, F.J.; Kloosterman, J.L.; Lathouwers, D.; Hagen, T.H.J.J. van der
2015-01-01
Highlights: • This work proposes three possible designs for a thorium Pebble Bed Reactor. • A high-conversion PBR (CR > 0.96), passively safe and within practical constraints. • A thorium breeder PBR (220 cm core) in practical regime, but not passively safe. • A passively safe breeder, requiring higher fuel reprocessing and recycling rates. - Abstract: More sustainable nuclear power generation might be achieved by combining the passive safety and high temperature applications of the Pebble Bed Reactor (PBR) design with the resource availability and favourable waste characteristics of the thorium fuel cycle. It has already been known that breeding can be achieved with the thorium fuel cycle inside a Pebble Bed Reactor if reprocessing is performed. This is also demonstrated in this work for a cylindrical core with a central driver zone, with 3 g heavy metal pebbles for enhanced fission, surrounded by a breeder zone containing 30 g thorium pebbles, for enhanced conversion. The main question of the present work is whether it is also possible to combine passive safety and breeding, within a practical operating regime, inside a thorium Pebble Bed Reactor. Therefore, the influence of several fuel design, core design and operational parameters upon the conversion ratio and passive safety is evaluated. A Depressurized Loss of Forced Cooling (DLOFC) is considered the worst safety scenario that can occur within a PBR. So, the response to a DLOFC with and without scram is evaluated for several breeder PBR designs using a coupled DALTON/THERMIX code scheme. With scram it is purely a heat transfer problem (THERMIX) demonstrating the decay heat removal capability of the design. In case control rods cannot be inserted, the temperature feedback of the core should also be able to counterbalance the reactivity insertion by the decaying xenon without fuel temperatures exceeding 1600 °C. Results show that high conversion ratios (CR > 0.96) and passive safety can be combined in
International Nuclear Information System (INIS)
Shivade, R.K.; Deshpande, S.B.
2016-01-01
Natural uranium in oxide form is used as fuel in the Indian PHWR. Natural 238 U fuel contains 232 Th as an impurity to the extent of 50 - 60 ppm. This thorium impurity is converted to 232 U in reactor during irradiation. 232 U is converted to 224 Ra by alpha decays, 224 Ra further decays to 220 Rn by alpha decays. 220 Rn decays to stable 208 Pb by emitting alpha, beta particles and gamma rays. 220 Rn is inert gas but its daughter products are in particulate form. Effective half-life of Tn decay series is 10.6 hrs and four days are required to reduce the air borne activity concentration to negligible level on a filter paper sample. Uranium or thorium is handled remotely in the glove boxes with proper shielding. Glove boxes are under optimum negative pressure. Exhausts from glove boxes are connected to stack with proper filtration. Amber ares of the Lab is also supplied with conditioned air supply for human comfort and to keep the atmospheric thoron daughter concentration under control. Even after using proper engineering safety features, thoron that is in the gaseous form can came out from glove boxes due to holes on the neoprene gloves of micro or nano dimensions. Probability of thoron gas leakage is more during bagging out or bagging in operations. This gives rise to thoron daughter activity in the working atmosphere of Lab constantly and workers should be protected adequately
Thoron (220Rn) in the indoor atmospheric environment
International Nuclear Information System (INIS)
Ramachandran, T.V.
2006-01-01
Naturally occurring background radiation is a topic, which has evoked curiosity and concern between the scientist and layman alike in recent years due to the shift in focus of health effects due to exposure of radiation from acute high level to chronic low level. Many locations around the world have higher levels of natural background radiation due to elevated levels of primordial radio nuclides in the soil and their decay products like radon ( 222 Rn), and thoron ( 220 Rn) in the environment. Of late, technologically enhanced naturally occurring radioactive material has also contributed to the burden of background radiation. It has been estimated that inhalation of 222 Rn, 2 20 Rn and their short lived progenies contribute more than 54% of the total natural background radiation dose received by the general population. In the Indian context, in an earlier national survey, the external gamma radiation dose rates have been more or less well mapped using thermo luminescent dosimeters covering more than 214 locations, which has yielded a national average of 775 mGy/y. Of this, nearly 48.7% contribution of the dose rate is from 40 K and the rest from the uranium (33.6%) and thorium (17.7%) series. A good database pertaining to the country wide levels of uranium, thorium and potassium in geological materials also exists. Thus, there exists a good database on the total external gamma radiation level across the country. Since the contribution from inhalation of 222 Rn, 220 Rn and their short lived progenies contributes more than 54% of the total background radiation dose, it was necessary to supplement the external component with inhalation component. This component is not adequately estimated for the country so far on national level. With this in mind, a national survey has been executed by this center involving a large number of universities and other allied research institutions from different parts of the country for the estimation of inhalation component of the dose
Assessment of thorium and thoron decay products in air - thorium plant
International Nuclear Information System (INIS)
Dhandayutham, R.; Gohel, C.O.; Shetty, P.N.; Savant, P.B.; Rao, D.V.V.
1977-01-01
For the evaluation of radiation dose to the lungs in a thorium plant, it is necessary to estimate the concentration of thorium, thoron and its daughter products in air. Methods employed in estimating thorium and its decay products and 'working level' are presented. (M.G.B.)
International Nuclear Information System (INIS)
Silva, C.M. da; Pires, M.A.F.
1994-01-01
Available as short communication only. A simple analytical method to analyze sulfates in thorium salt, is presented. The method is based on the thorium separation as hydroxide. The gravimetric technique is used to analyze the sulfate in the filtered as barium sulfate. Using this method, the sulfate separation from thorium has been reach 99,9% yield, and 0,1% precision. This method is applied to thorium salts specifically thorium sulfate, carbonate and nitrate. (author). 5 refs, 2 tabs
Transformation of thorium sulfate in thorium nitrate by ion exchange resin
International Nuclear Information System (INIS)
Pereira, W.
1991-01-01
A procedure for transforming thorium sulfate into thorium nitrate by means of a strong cationic ion exchanger is presented. The thorium sulfate solution (approximately 15 g/L Th (SO 4 ) 2 ) is percolate through the resin and the column is washed first with water, with a 0,2 M N H 4 OH solution and then with a 0.2 M N H 4 NO 3 solution in order to eliminate sulfate ion. Thorium is eluted with a 2 M solution of (N H 4 ) 2 CO 3 . This eluate is treated with a solution of nitric acid in order to obtain the complete transformation into Th (NO 3 ) 4 . The proposed procedure leads to good quality thorium nitrate with high uranium decontamination. (author)
Neutron irradiation effects on the mechanical properties of thorium and thorium--carbon alloy
International Nuclear Information System (INIS)
Wang, S.C.P.
1978-04-01
The effects of neutron exposure to 3.0 x 10 18 neutrons/cm 2 on the mechanical properties of thorium and thorium-carbon alloy are described. Tensile measurements were done at six different test temperatures from 4 0 K to 503 0 K and at two strain rates. Thorium and thorium-carbon alloy are shown to display typical radiation hardening like other face-centered cubic metals. The yield drop phenomenon of the thorium-carbon alloy is unchanged after irradiation. The variation of shear stress and effective shear stress with test temperature was fitted to Seeger's and Fleischer's equations for irradiated and unirradiated thorium and thorium-carbon alloy. Neutron irradiation apparently contributes an athermal component to the yield strength. However, some thermal component is detected in the low temperature range. Strain-rate parameter is increased and activation volume is decreased slightly for both kinds of metal after irradiation
Energy Technology Data Exchange (ETDEWEB)
Trauger, D B [Oak Ridge National Lab., TN (USA)
1978-01-01
Some of the factors that provide incentive for the utilization of thorium in specific reactor types are explored and the constraints that stand in the way are pointed out. The properties of thorium and derived fuels are discussed, and test and reactor operating experience is reviewed. In addition, symbiotic systems of breeder and converter reactor are suggested as being particularly attractive systems for energy production. Throughout the discussion, the High-Temperature Gas-Cooled Reactor and Molten Salt Reactor are treated in some detail because they have been developed primarily for use with thorium fuel cycles.
International Nuclear Information System (INIS)
Garg, R.K.; Raghavan, R.V.; Karve, V.M.; Narayandas, G.R.
1977-01-01
Although a number of studies have been conducted in various countries to evolve reactor systems based on thorium fuel cycle, its use, so far, is limited to only a few reactors. However, for countries having large reserves of thorium, its utilization is of great significance for their nuclear power programmes. Reasonably assured world resources of thorium in the lower price range have been estimated at more than 500,000 tons of ThO 2 . While most of these resources are in placer deposits in various parts of the world, some vein deposits and uranium ores are other important sources of thorium. Monazite, the most important mineral of thorium, is found in the beach sand deposits along with other heavy minerals like ilmenite, rutile, zircon, and sillimanite etc. Mining of these deposits is usually carried out by suction dredging and separation of monazite from other minerals is effected by a combination of magnetic, electrostatic and gravity separation techniques. Chemical processing of monazite is carried out either by sulphuric acid or caustic treatment, followed by separation of the rare earths and thorium by partial precipitation or leaching. The thorium concentrate is further processed to obtain mantle grade thorium nitrate by chemical purification steps whereas solvent extraction using TBP is adopted for making nuclear-grade material. The purified thorium nitrate is converted to the oxide usually by precipitation as oxalate followed by calcination. The oxide is reduced directly with calcium or converted to the chloride or fluoride and then reduced by calcium or magnesium to obtain thorium metal. Various fuel designs based on the metal or its alloys, mixed oxides or carbides, and dispersed type fuel elements have been developed and accordingly, different fabrication techniques have been employed. Work on irradiation of thorium containing fuel elements and separation of U 233 is being carried out. This paper reviews the status of thorium technology in the world with
Beaver, R.J.
1961-11-21
A method of cladding thorium with zirconium is described. The quality of the bond achieved between thorium and zirconium by hot-rolling is improved by inserting and melting a thorium-zirconium alloy foil between the two materials prior to rolling. (AEC)
International Nuclear Information System (INIS)
Tennery, V.J.; Bomar, E.S.; Bond, W.D.; Morse, L.E.; Meyer, H.R.; Till, J.E.; Yalcintas, M.G.
1980-01-01
The analysis of thorium mining and milling suggests that the resulting doses should be similar to those from uranium operations. An absolute comparison cannot be made at this time, however, due to differences in some assumptions utilized by the various investigators and the lack in some cases of site-specific meteorology and population data at thorium resource sites in the western United States. A distinct difference resulting from the short half-life of 220 Rn (T/sub 1/2/ = 55.6 s) in the thorium decay chain compared to that for 222 Rn (T/sub 1/2/ = 3.82 d) in uranium decay was noted for emissions following mill shutdown. This effect is to make potential releases following thorium mill shutdown of lesser consequence than in the uranium case. Thorium tailings activity would also decrease relatively rapidly due to the comparatively short half-life (T/sub 1/2 = 5.75 y) of 228 Ra. Doses due to airborne releases from thorium-uranium carbide fuel refabrication are significantly less than that due to fuel reprocessing. Tritium is the principal contributor to reprocessing plant doses while carbon-14, 131 Cs, and 232 U account for most of the remaining dose. A tenfold increase in reprocessing plant CF for tritium reduces both individual and population doses by about 60%. For refabrication operations, a near linear dependence upon dose with 232 U content of the fuel was calculated between concentrations of 10 ppM and 5000 ppM. Comparison of (Th, U)C and (U, Pu)C showed little difference in dose commitment, but the presence of 232 U in the (Th, U) fuel causes a notable increase in the refabrication plant dose over that previously calculated for (U, Pu) type fuels
Future perspective of thorium based nuclear fuels and thorium potential of Turkey
International Nuclear Information System (INIS)
Unak, T.; Yildirim, Y.
2001-01-01
Today's nuclear technology has principally been based on the use of fissile U-235 and Pu-239. he existence of thorium in the nature and its potential use in the nuclear technology were not unfortunately into account with a sufficient importance. The global distributions of thorium and uranium reserves indicate that in general some developed countries such as the USA, Canada, Australia, France have considerable uranium reserves, and contrarily only some developing countries such as Turkey, Brazil, India, Egypt have considerable thorium reserves. The studies carried out on the thorium during the last 50 years have clearly showed that the thorium based nuclear fuels have the potential easily use in most of reactor types actually operated with the classical uranium based nuclear fuels without any considerable modification. In the case of the use of thorium based nuclear fuels in future nuclear energy production systems, the serious problems such as the excess of Pu-239, the proliferation potential of nuclear weapons, and also the anxious of nuclear terrorism will probably be resolved, and sustainable nuclear energy production will be realized in the next new century. (authors)
Future perspective of thorium based nuclear fuels and thorium potential of Turkey
International Nuclear Information System (INIS)
Unak, T.; Yildirim, Y.
2000-01-01
Today's nuclear technology has principally been based on the use of fissile U-235 and Pu-239. The existence of thorium in the nature and its potential use in the nuclear technology were not unfortunately into account with a sufficient importance. The global distributions of thorium and uranium reserves indicate that in general some developed countries such as the USA, Canada, Australia, France have considerable uranium reserves, and contrarily only some developing countries such as Turkey, Brazil, India, Egypt have considerable thorium reserves. The studies carried out on the thorium during the last 50 years have clearly showed that the thorium based nuclear fuels have the potential easily use in most of reactor types actually operated with the classical uranium based nuclear fuels without any considerable modification. In the case of the use of thorium based nuclear fuels in future nuclear energy production systems, the serious problems such as the excess of Pu-239, the proliferation potential of nuclear weapons, and also the anxious of nuclear terrorism will probably be resolved, and sustainable nuclear energy production will be realized in the next new century. (authors)
International Nuclear Information System (INIS)
Coote, G.E.
1977-06-01
Relevant topics in nuclear and reactor physics are outlined. These include: the thorium decay series; generation of fissile from fertile nuclides, in particular U-233 from Th-232; the princiiples underlying thermal breeder reactors; the production of U-232 in thorium fuel and its important influence on nuclear safeguards and the recycling of U-233. Development work is continuing on several types of reactor which could utilise thorium; each of these is briefly described and its possible role is assessed. Other tipics covered include safety aspects of thorium oxide fuel, reprocessing, fabrication of recycle fuel and the possibility of denaturing U-233 by adding natural uranium. It is concluded that previoue arguments for development of the thorium cycle are still valid but those relating to non-proliferation of weapons may become even more compelling. (auth.)
Thorium: Issues and prospects in Malaysia
Energy Technology Data Exchange (ETDEWEB)
AL-Areqi, Wadeeah M.; Majid, Amran Ab.; Sarmani, Sukiman; Bahri, Che Nor Aniza Che Zainul [Nuclear Science Programme, School of Applied Physics, Faculty of Science and Technology, Universiti Kebangsaan Malaysia, 43600 Bangi, Malaysia. walareqi@yahoo.com (Malaysia)
2015-04-29
In Malaysia, thorium exists in minerals and rare earth elements production residue. The average range of thorium content in Malaysian monazite and xenotime minerals was found about 70,000 and 15,000 ppm respectively. About 2,636 tonnes of Malaysian monazite was produced for a period of 5 years (2006-2010) and based on the above data, it can be estimated that Malaysian monazite contains about 184.5 tonnes of thorium. Although thorium can become a major radiological problem to our environment, but with the significant deposit of thorium in Malaysian monazite, it has a prospect as a future alternative fuel in nuclear technology. This paper will discuss the thorium issues in Malaysia especially its long term radiological risks to public health and environment at storage and disposal stages, the prospect of exploring and producing high purity thorium from our rare earth elements minerals for future thorium based reactor. This paper also highlights the holistic approach in thorium recovery from Malaysian rare earth element production residue to reduce its radioactivity and extraction of thorium and rare earth elements from the minerals with minimum radiological impact to health and environment.
Thorium: Issues and prospects in Malaysia
International Nuclear Information System (INIS)
AL-Areqi, Wadeeah M.; Majid, Amran Ab.; Sarmani, Sukiman; Bahri, Che Nor Aniza Che Zainul
2015-01-01
In Malaysia, thorium exists in minerals and rare earth elements production residue. The average range of thorium content in Malaysian monazite and xenotime minerals was found about 70,000 and 15,000 ppm respectively. About 2,636 tonnes of Malaysian monazite was produced for a period of 5 years (2006-2010) and based on the above data, it can be estimated that Malaysian monazite contains about 184.5 tonnes of thorium. Although thorium can become a major radiological problem to our environment, but with the significant deposit of thorium in Malaysian monazite, it has a prospect as a future alternative fuel in nuclear technology. This paper will discuss the thorium issues in Malaysia especially its long term radiological risks to public health and environment at storage and disposal stages, the prospect of exploring and producing high purity thorium from our rare earth elements minerals for future thorium based reactor. This paper also highlights the holistic approach in thorium recovery from Malaysian rare earth element production residue to reduce its radioactivity and extraction of thorium and rare earth elements from the minerals with minimum radiological impact to health and environment
Thorium: Issues and prospects in Malaysia
AL-Areqi, Wadeeah M.; Majid, Amran Ab.; Sarmani, Sukiman; Bahri, Che Nor Aniza Che Zainul
2015-04-01
In Malaysia, thorium exists in minerals and rare earth elements production residue. The average range of thorium content in Malaysian monazite and xenotime minerals was found about 70,000 and 15,000 ppm respectively. About 2,636 tonnes of Malaysian monazite was produced for a period of 5 years (2006-2010) and based on the above data, it can be estimated that Malaysian monazite contains about 184.5 tonnes of thorium. Although thorium can become a major radiological problem to our environment, but with the significant deposit of thorium in Malaysian monazite, it has a prospect as a future alternative fuel in nuclear technology. This paper will discuss the thorium issues in Malaysia especially its long term radiological risks to public health and environment at storage and disposal stages, the prospect of exploring and producing high purity thorium from our rare earth elements minerals for future thorium based reactor. This paper also highlights the holistic approach in thorium recovery from Malaysian rare earth element production residue to reduce its radioactivity and extraction of thorium and rare earth elements from the minerals with minimum radiological impact to health and environment.
Systematic study on Thorium fuel
International Nuclear Information System (INIS)
Shibata, Toshikazu; Kimura, Itsuro; Iwata, Shiro; Furuya, Hirotaka; Suzuki, Susumu.
1988-01-01
Introduced is the activities of the Joint Research Project Team on Thorium Fuel organized by mainly university researchers in Japan and supported by the Ministry of Education, Science and Culture for seven years since 1980. Four major groups were organized; (1) nuclear data, reactor physics and design, (2) nuclear fuel, (3) down stream and (4) biological effects of thorium. The first group covered measurements and analysis on nuclear data of thorium related nuclides, experiment and analysis on nuclear characteristics of thorium containing cores, basic engineering on a thorium molten salt reactor, and designs of several types of reactors. Fabrication and irradiation tests of thorium oxide fuel, and basic studies on new type thorium fuels (e.g. carbide and nitride) were studied by the second group. The third group covered the use of solutions in reprocessing of spent fuel, behavior of fission products, immobilization of high level radioactive waste, and continuous reprocessing for a molten salt reactor. The fourth group performed the trace study for patients who had been intravascularly injected with thorotrast for diagnosis of war injuries during the Second World War. (author)
Energy Technology Data Exchange (ETDEWEB)
2008-02-15
Final Recommendations of the Thorium Report Committee: 1) No technology should be idolized or demonized. All carbon-dioxide (Co2) emission-free energy production technologies should be considered. The potential contribution of nuclear energy to a sustainable energy future should be recognized. 2) An investigation into the resources in the Fen Complex and other sites in Norway should be performed. It is essential to assess whether thorium in Norwegian rocks can be defined as an economical asset for the benefit of future generations. Furthermore, the application of new technologies for the extraction of thorium from the available mineral sources should be studied. 3) Testing of thorium fuel in the Halden Reactor should be encouraged, taking benefit of the well recognized nuclear fuel competence in Halden. 4) Norway should strengthen its participation in international collaborations by joining the EURATOM fission program and the GIF program on Generation IV reactors suitable for the use of thorium. 5) The development of an Accelerator Driven System (ADS) using thorium is not within the capability of Norway working alone. Joining the European effort in this field should be considered. Norwegian research groups should be encouraged to participate in relevant international projects, although these are currently focused on waste management. 6) Norway should bring its competence in waste management up to an international standard and collaboration with Sweden and Finland could be beneficial. 7) Norway should bring its competence with respect to dose assessment related to the thorium cycle up to an international standard. 8) Since the proliferation resistance of uranium-233 depends on the reactor and reprocessing technologies, this aspect will be of key concern should any thorium reactor be built in Norway. 9) Any new nuclear activities in Norway, e.g. thorium fuel cycles, would need strong international pooling of human resources, and in the case of thorium, a strong long
Thorium and health: state of the art; Thorium et sante: etat de l'art
Energy Technology Data Exchange (ETDEWEB)
Leiterer, A.; Berard, Ph.; Menetrier, F.
2010-07-01
This report reviews data available in the literature on the subject: 'thorium and health'. Thorium is a natural radioactive element of the actinide series. It is widely distributed in the earth's crust and 99% is found as isotope thorium-232. Its various uses are explained by its chemical, physical, and nuclear properties. As a potential nuclear fuel, thorium is still in demonstration in pilot scale reactors. But thorium has already multiple and sometimes unknown industrial uses. Some mass market products are concerned like light bulb. This raises the issue of wastes, and of exposures of workers and public. Environmental exposure via food and drink of the general population is low, where as workers can be exposed to significant doses, especially during ore extraction. Data on bio-monitoring of workers and biokinetic of thorium, in particular those provided by ICRP, are gathered here. Studies on health effects and toxicity of thorium are scarce and mostly old, except outcomes of its previous medical use. Studies on other forms of thorium should be undertaken to provide substantial data on its toxicity. Concerning treatment, Ca-DTPA is the recommended drug even if its efficacy is moderate. LiHOPO molecule shows interesting results in animals, and further research on chelating agents is needed. (authors)
Thorium research and development in Turkey
International Nuclear Information System (INIS)
Güngör, Görkem
2015-01-01
Turkey has a great potential regarding thorium resources. Thorium exploration activities have been done in the past mainly by state organizations for determining the thorium resources in Turkey. Thorium occurs as complex mineral together with barite, fluorite and rare earth elements (REE). The increase in global demand for REE creates the opportunity for REE production which will also produce thorium as a by-product. The development of nuclear energy program in Turkey provides the stimulus for research and development activities in nuclear technologies. The final declaration of the workshop emphasizes the importance of thorium reserves in Turkey and the necessity for thorium exploration and development activities in order to determine the feasibility of thorium mining and fuel cycle in Turkey. These activities should be conducted together with the development of technologies for separation of these complex minerals and purification of thorium, REE and other minerals to be utilized as commercial products. There are advanced academic research studies on thorium fuel cycle which should be supported by the industry in order to commercialize the results of these studies. Turkey should be integrated to international R and D activities on ADS which is expected to commercialize on medium term. The legislative framework should be developed in order to provide the industrial baseline for nuclear technologies independent from nuclear regulatory activities
A study of uranium-thorium mixed lattices; Etude de reseaux mixtes uranium - thorium
Energy Technology Data Exchange (ETDEWEB)
Bacher, P; Eckert, R; Mazancourt, R de [Commissariat a l' Energie Atomique, Saclay (France). Centre d' Etudes Nucleaires
1957-07-01
Some subcritical experiments have been carried out during the charging of the pile G1 by introducing thorium bars in a regular lattice into the pile. The spreading out of these experiments over a period of three months has permitted: a) work on a pile gradually increasing in size and b) measurements on comparable charges in so far that they have either the same number of bars of thorium, or the same concentration of thorium. From the measurements at constant charge and at constant concentration, it is possible by extrapolation to determine the critical charges and concentrations. The values obtained have showed that the material Laplacian of the lattice depends linearly on the thorium concentration and must cancel out for a concentration T = 8.8 {+-} 0.3 per cent by volume. These results have been found, to a very good approximation, by a simple calculation. (author) [French] Des experiences sous-critiques ont ete effectuees au cours du chargement de la pile G1 en introduisant des barres de thorium reparties suivant un reseau regulier dans la pile. L'etalement de ces experiences sur trois mois a permis d'operer sur une pile de plus en plus grosse et de faire un grand nombre de mesures sur des chargements comparables par le fait qu'ils avaient soit le meme nombre de barres de thorium, soit la meme concentration en thorium. A partir des mesures a chargement constant et a concentration constante, il a ete possible de determiner par extrapolation les chargements et concentrations critiques. Les valeurs obtenues ont montre que le laplacien matiere moyen du reseau dependait lineairement de la concentration en thorium, et devrait s'annuler pour une concentration T = 8,8 {+-} 0,3% en volume. Ces resultats ont ete retrouves avec une tres bonne approximation par un calcul elementaire. (auteur)
Thorium utilization in power reactors
International Nuclear Information System (INIS)
Saraceno; Marcos.
1978-10-01
In this work the recent (prior to Aug, 1976) literature on thorium utilization is reviewed briefly and the available information is updated. After reviewing the nuclear properties relevant to the thorium fuel cycle we describe briefly the reactor systems that have been proposed using thorium as a fertile material. (author) [es
Energy Technology Data Exchange (ETDEWEB)
Yamaji, K [Central Research Inst. of Electric Power Industry, Tokyo (Japan)
1980-07-01
Systems analysis of the thorium cycle, a nuclear fuel cycle accomplished by using thorium, is reported in this paper. Following a brief review on the history of the thorium cycle development, analysis is made on the three functions of the thorium cycle; (1) auxiliary system of U-Pu cycle to save uranium consumption, (2) thermal breeder system to exert full capacity of the thorium resource, (3) symbiotic system to utilize special features of /sup 233/U and neutron sources. The effects of the thorium loading in LWR (Light Water Reactor), HWR (Heavy Water Reactor) and HTGR (High Temperature Gas-cooled Reactor) are considered for the function of auxiliary system of U-Pu cycle. Analysis is made to find how much uranium is saved by /sup 233/U recycling and how the decrease in Pu production influences the introduction of FBR (Fast Breeder Reactor). Study on thermal breeder system is carried out in the case of MSBR (Molten Salt Breeder Reactor). Under a certain amount of fissile material supply, the potential system expansion rate of MSBR, which is determined by fissile material balance, is superior to that of FBR because of the smaller specific fissile inventory of MSBR. For symbiotic system, three cases are treated; i) nuclear heat supply system using HTGR, ii) denatured fuel supply system for nonproliferation purpose, and iii) hybrid system utilizing neutron sources other than fission reactor.
Radiological significance of thorium processing in manufacturing
International Nuclear Information System (INIS)
Davis, M.W.
1985-01-01
The study of thorium processing in manufacturing comprised monitoring programs at a plant where thorium dioxide was in use and another where the use of thorium nitrate had been discontinued. The measurements of the solubility in simulated lung fluid proved that both materials belonged in the Y Class with dissolution half-times greater than 500 days. Bioassay measurements of 20 subjects from both facilities proved that in vitro monitoring methods, urine, feces, hair and nails analysis were not sufficient indicators of thorium uptake. In vivo monitoring by phoswich and large sodium iodide detectors were proven to be good methods of determining thorium lung burdens. The thoron in breath technique was shown to have a lower limit of sensitivity than lung counting, however, due to lack of information regarding the thoron escape rate from the thorium particles in the lungs the method is not as accurate as lung counting. Two subjects at the thorium dioxide facility had lung burdens of 21+- 16 Bq and 29+- 24 Bq Th 232 and one at the thorium nitrate facility had a lung burden of 37+- 13 Bq. Improvements in the procedures and use of a glove box were among the recommendations to reduce the inhalation of thorium by workers at the thorium dioxide facility. Decontamination of several rooms at the thorium nitrate facility and sealing of the walls and floors were recommended in order to reduce the escape of thoron gas into the room air. The risk to non Atomic Radiation Workers was primarily due to thoron daughters in air while gamma radiation and thorium in air were less important. Conversely, at the thorium dioxide facility the inhalation of thorium in air was the most significant exposure pathway
The economics of thorium fuel cycles
International Nuclear Information System (INIS)
James, R.A.
1978-01-01
The individual cost components and the total fuel cycle costs for natural uranium and thorium fuel cycles are discussed. The thorium cycles are initiated by using either enriched uranium or plutonium. Subsequent thorium cycles utilize recycled uranium-233 and, where necessary, either uranium-235 or plutonium as topping. A calculation is performed to establish the economic conditions under which thorium cycles are economically attractive. (auth)
Thorium utilisation in thermal reactors
International Nuclear Information System (INIS)
Balakrishnan, K.
1997-01-01
It is now more or less accepted that the best way to use thorium is in thermal reactors. This is due to the fact that U233 is a good material in the thermal spectrum. Studies of different thorium cycles in various reactor concepts had been carried out in the early days of nuclear power. After three decades of neglect, the world is once again looking at thorium with some interest. We in India have been studying thorium cycles in most of the existing thermal reactor concepts, with greater emphasis on heavy water reactors. In this paper, we report some of the work done in India on different thorium cycles in the Indian pressurized heavy water reactor (PHWR), and also give a description of the design of the advanced heavy water reactor (AHWR). (author). 1 ref., 2 tabs., 5 figs
Thorium resources and energy utilization (14)
International Nuclear Information System (INIS)
Unesaki, Hironobu
2014-01-01
After the accident at the Fukushima Daiichi Nuclear Power Station of Tokyo Electric Power Company, thorium reactor has been attracting attention from the viewpoint of safety. Regarding thorium as the resources for nuclear energy, this paper explains its estimated reserves in the whole world and each country, its features such as the situation of utilization, and the reason why it attracts attention now. The following three items are taken up here as the typical issues among the latest topics on thorium: (1) utilization of thorium as a tension easing measure against environmental effects involved in nuclear energy utilization, (2) thorium-based reactor as the next generation type reactor with improved safety, and (3) thorium utilization as the improvement policy of nuclear proliferation resistance. The outline, validity, and problems of these items are explained. Thorium reactor has been adopted as a research theme since the 1950s up to now mainly in the U.S. However, it is not enough in the aspect of technological development and also insufficient in the verification of reliability based on technological demonstration, compared with uranium-fueled light-water reactor. This paper explains these situations, and discusses the points for thorium utilization and future prospects. (A.O.)
International Nuclear Information System (INIS)
Lainetti, Paulo E.O.; Freitas, Antonio A.; Mindrisz, Ana C.
2013-01-01
The Brazilian's interest in the nuclear utilization of thorium has started in the 50's as a consequence of the abundant occurrence of monazite sands. Since the sixties, IPEN-CNEN/SP has performed some developments related to the thorium fuel cycle. The production and purification of thorium compounds was carried out at IPEN for about 18 years and the main product was the thorium nitrate with high purity, having been produced over 170 metric tons of this material in the period, obtained through solvent extraction. The thorium nitrate was supplied to the domestic industry and used for gas portable lamps (Welsbach mantle). Although the thorium compounds produced have not been employed in the nuclear area, several studies were conducted. Therefore, those activities and the accumulated experience are of strategic importance, on one hand due to huge Brazilian thorium reserves, on the other hand by the resurgence of the interest of thorium for the Generation IV Advanced Reactors. This paper presents a review of the Brazilian research and development activities related to thorium technology. (author)
Investigation of thorium hydroxotrifluoroacetates
International Nuclear Information System (INIS)
Andryushin, V.G.; Samatov, A.V.; Chuklinov, R.N.; Shmidt, V.S.
1984-01-01
The precipitation process of thorium hydroxotrifluoroacetates in the Th(NO 3 ) 4 -HNO 3 -CF 3 COOH-NH 4 OH-H 2 O system in the pH range from 0.1 to 8.6 at a 100 g/l thorium concentration in it has been investigated. The curve of the pH dependence of the main thorium salts solubility in the pH=4.4 range exhibits a local maximum, the position of the latter being in complete accordance with its earlier established relation to the parameter of the ligand anion nucleophility. The composition of isolated hydroxotrifluoroacetate hydrates corresponds to the generic formula Th(OH)sub(x)(CFsub(3)COO)sub(4-x)xnHsub(2)O, where 3.0 >= x >= 1.5, and n=1.0-6.0. The density of the crystals obtained is measured and the thermal stability is studied. It is established, that, for the thorium hydroxotrifluoroacetate hydrates, the same general regularities in the effect of degree of hydrolysis and hydration on the position of decomposition temperature effects and on the density of compounds hold, as has been previously found in studying thorium- and plutonium hydroxosalts
International Nuclear Information System (INIS)
Stankevicius, Alejandro
2012-01-01
We revise the advantages and possible problems on the use of thorium as a nuclear fuel instead of uranium. The following aspects are considered: 1) In the world there are three times more thorium than uranium 2) In spite that thorium in his natural form it is not a fisil, under neutron irradiation, is possible to transform it to uranium 233, a fisil of a high quality. 3) His ceramic oxides properties are superior to uranium or plutonium oxides. 4) During the irradiation the U 233 due to n,2n reaction produce small quantities of U 232 and his decay daughters' bismuth 212 and thallium 208 witch are strong gamma source. In turn thorium 228 and uranium 232 became, in time anti-proliferate due to there radiation intensity. 5) As it is described in here and experiments done in several countries reactors PHWR can be adapted to the use of thorium as a fuel element 6) As a problem we should mentioned that the different steps in the process must be done under strong radiation shielding and using only automatized equipment s (author)
Drying characteristics of thorium fuel corrosion products
Energy Technology Data Exchange (ETDEWEB)
Smith, R.-E. E-mail: rzl@inel.gov
2004-07-01
The open literature and accessible US Department of Energy-sponsored reports were reviewed for the dehydration and rehydration characteristics of potential corrosion products from thorium metal and thorium oxide nuclear fuels. Mixed oxides were not specifically examined unless data were given for performance of mixed thorium-uranium fuels. Thorium metal generally corrodes to thorium oxide. Physisorbed water is readily removed by heating to approximately 200 deg. C. Complete removal of chemisorbed water requires heating above 1000 deg. C. Thorium oxide adsorbs water well in excess of the amount needed to cover the oxide surface by chemisorption. The adsorption of water appears to be a surface phenomenon; it does not lead to bulk conversion of the solid oxide to the hydroxide. Adsorptive capacity depends on both the specific surface area and the porosity of the thorium oxide. Heat treatment by calcination or sintering reduces the adsorption capacity substantially from the thorium oxide produced by metal corrosion.
International Nuclear Information System (INIS)
Teller, E.
1978-01-01
The use of thorium and neutrons to make 233 U would provide energy for many thousands of years. Thorium is more abundant than uranium and 233 U is the best fissile material for thermal neutron reactors. Four approaches to the use of thorium are worth developing: heavy water moderated reactors with conversion ratios greater than 0.9, such as modified CANDU with lower cost of separating D 2 O and 235 U; molten salt breeder reactors, from which fission products and excess fuel may be continuously removed; fusion-fission hybrids that produce adequate tritium and excess neutrons for sustenance and 233 U production in a subcritical thorium 233 U blanket; and by fission-initiated thermo-nuclear explosions in cavities in salt beds one mile below the earth's surface, yielding 233 U from the excess neutrons and thorium and decontaminated steam for power production. (author)
International Nuclear Information System (INIS)
Freitas, Antonio Alves de
2008-01-01
As consequence of the operation of a Thorium purification facility, for pure Thorium Nitrate production, the IPEN (Instituto de Pesquisas Energeticas e Nucleares) has stored away a solid residue called RETOTER (REsiduo de TOrio e TErras Raras). The RETOTER is rich in Rare-Earth Elements and significant amount of Thorium-232 and minor amount of Uranium. Furthermore it contains several radionuclides from the natural decay series. Significant radioactivity contribution is generated by the Thorium descendent, mainly the Radium-228(T 1/2 =5.7y), known as meso thorium and Thorium-228(T 1/2 1.90y). An important thorium daughter is the Lead-208, a stable isotope present with an expressive quantity. After the enclosure of the operation of the Thorium purification facility, many researches have been developed for the establishment of methodologies for recovery of Thorium, Rare-Earth Elements and Lead-208 from the RETOTER. This work presents a method for RETOTER decontamination, separating and bordering upon some radioactive isotopes. The residue was digested with nitric acid and the Radium-228 was separated by the Barium Sulphate co-precipitation procedure. Finally, the Thorium was separated by the peroxide precipitation and the Rare-Earth Elements were also recovered by the Rare-Earth peroxide precipitation in the filtrate solution.(author)
Thorium nuclear fuel cycle technology
International Nuclear Information System (INIS)
Eom, Tae Yoon; Do, Jae Bum; Choi, Yoon Dong; Park, Kyoung Kyum; Choi, In Kyu; Lee, Jae Won; Song, Woong Sup; Kim, Heong Woo
1998-03-01
Since thorium produces relatively small amount of TRU elements after irradiation in the reactor, it is considered one of possible media to mix with the elements to be transmuted. Both solid and molten-salt thorium fuel cycles were investigated. Transmutation concepts being studied involved fast breeder reactor, accelerator-driven subcritical reactor, and energy amplifier with thorium. Long-lived radionuclides, especially TRU elements, could be separated from spent fuel by a pyrochemical process which is evaluated to be proliferation resistance. Pyrochemical processes of IFR, MSRE and ATW were reviewed and evaluated in detail, regarding technological feasibility, compatibility of thorium with TRU, proliferation resistance, their economy and safety. (author). 26 refs., 22 figs
Review of thorium fuel reprocessing experience
International Nuclear Information System (INIS)
Brooksbank, R.E.; McDuffee, W.T.; Rainey, R.H.
1978-01-01
The review reveals that experience in the reprocessing of irradiated thorium materials is limited. Plants that have processed thorium-based fuels were not optimized for the operations. Previous demonstrations of several viable flowsheets provide a sound technological base for the development of optimum reprocessing methods and facilities. In addition to the resource benefit by using thorium, recent nonproliferation thrusts have rejuvenated an interest in thorium reprocessing. Extensive radiation is generated as the result of 232 U-contamination produced in the 233 U, resulting in the remote operation and fabrication operations and increased fuel cycle costs. Development of the denatured thorium flowsheet, which is currently of interest because of nonproliferation concerns, represents a difficult technological challenge
Revol, Jean-Pierre; Bourquin, Maurice; Kadi, Yacine; Lillestol, Egil; De Mestral, Jean-Christophe; Samec, Karel
2016-01-01
The Thorium Energy Conference (ThEC13) gathered some of the world’s leading experts on thorium technologies to review the possibility of destroying nuclear waste in the short term, and replacing the uranium fuel cycle in nuclear systems with the thorium fuel cycle in the long term. The latter would provide abundant, reliable and safe energy with no CO2 production, no air pollution, and minimal waste production. The participants, representatives of 30 countries, included Carlo Rubbia, Nobel Prize Laureate in physics and inventor of the Energy Amplifier; Jack Steinberger, Nobel Prize Laureate in physics; Hans Blix, former Director General of the International Atomic Energy Agency (IAEA); Rolf Heuer, Director General of CERN; Pascal Couchepin, former President of the Swiss Confederation; and Claude Haegi, President of the FEDRE, to name just a few. The ThEC13 proceedings are a source of reference on the use of thorium for energy generation. They offer detailed technical reviews of the status of thorium energy ...
Minerals yearbook, 1991: Thorium. Annual report
International Nuclear Information System (INIS)
Hedrick, J.B.
1992-10-01
Domestic mine production data for thorium-bearing monazite are developed by the U.S. Bureau of Mines from a voluntary survey of U.S. operations entitled, 'Rare Earths, Thorium, and Scandium.' The one mine to which a survey form was sent responded, representing 100% of domestic production. Mine production data for thorium are withheld to avoid disclosing company proprietary data. Statistics on domestic thorium consumption are developed by surveying various processors and end users, evaluating import-export data, and analyzing Government stockpile shipments
International Nuclear Information System (INIS)
Angelelli, Victorio.
1984-01-01
The main occurences of the thorium minerals of the Argentine Republic which have not been exploited, due to their reduced volume, are described. The thoriferous deposits have three genetic types: pegmatitic, hydrothermal and detritic, being the most common minerals: monazite, thorite and thorogummite. The most important thorium accumulations are located in Salta, being of less importance those of Cordoba, Jujuy and San Juan. (M.E.L.) [es
Thorium fuel cycle - Potential benefits and challenges
International Nuclear Information System (INIS)
2005-05-01
There has been significant interest among Member States in developing advanced and innovative technologies for safe, proliferation resistant and economically efficient nuclear fuel cycles, while minimizing waste and environmental impacts. This publication provides an insight into the reasons for renewed interest in the thorium fuel cycle, different implementation scenarios and options for the thorium cycle and an update of the information base on thorium fuels and fuel cycles. The present TECDOC focuses on the upcoming thorium based reactors, current information base, front and back end issues, including manufacturing and reprocessing of thorium fuels and waste management, proliferation-resistance and economic issues. The concluding chapter summarizes future prospects and recommendations pertaining to thorium fuels and fuel cycles
International Nuclear Information System (INIS)
Merz, E.R.
1977-01-01
The utilization of the thorium fuel cycle has long since been considered attractive owing to the excellent neutronic characteristics of 233 U, and the widespread and cheap thorium resources. Rapidly increasing uranium prices, public reluctance for widespread Pu recycling and expected delays for the market penetration of fast breeders have led to a reconsideration of the thorium fuel cycle merits. In addition, problems associated with reprocessing and waste handling, particularly with re-fabrication by remote handling of 233 U, are certainly not appreciably more difficult than for Pu recycling. To divert from uranium as a nuclear energy source it seems worth while intensifying future efforts for closing the Th/ 233 U fuel cycle. HTGRs are particularly promising for economic application. However, further research and development activities should not concentrate on this reactor type alone. Light- and heavy-water-moderated reactors, and even future fast breeders, may just as well take advantage of a demonstrated thorium fuel cycle. (author)
International Nuclear Information System (INIS)
Xia Yuanxian; Qian Hesheng
1986-01-01
In this paper the spectrophotometric method for determination of trace amount of thorium in weak acidic medium by chlorophosphonazo-mA is described. The composition of the complex was estimated to be 1:4 by slope ratio method. The apparent molar absorption of thorium at 675 nm is 9.2 x 10 4 . Beer's law is obeyed for 0-12.0 μg of thorium in 10 ml solution. The coefficient of variation for thorium is 0.88%. The method has been applied to the determination of trace amounts of thorium in the extraction process of thorium
Technology of getting of microspheric thorium dioxide
International Nuclear Information System (INIS)
Balakhonov, V.G.; Matyukha, V.A.; Saltan, N.P.; Filippov, E.A.; Zhiganov, A.N.
1999-01-01
There has been proposed a technique for getting granulated thorium dioxide from its salts solutions according to the cryogenic technology by the method of a solid phase conversion. It includes the following operations: dispersion of the initial solution into liquid nitrogen and getting of cryogranules of the necessary size by putting oscillations of definite frequency on a die device and by charging formed drops in the constant electric field; solid phase conversion of thorium salts into its hydroxide by treating cryogranules with a cooled ammonia solution, drying and calcination of hydroxide granules having got granulated thorium dioxide. At the pilot facility there have been defined and developed optimum regimes for getting granulated thorium dioxide. The mechanism of thorium hydroxide cryogranules conversion into thorium dioxide was investigated by the thermal analysis methods. (author)
Energy Technology Data Exchange (ETDEWEB)
Del Litto, B [Commissariat a l' Energie Atomique, Grenoble (France). Centre d' Etudes Nucleaires
1966-09-01
The hydrolysis of thorium dicarbide leads to the formation of a complex mixture of gaseous and condensed carbon hydrides. The temperature, between 25 and 100 deg. C, has no influence on the nature and composition of the gas phase. The reaction kinetics, however, are strongly temperature dependent. In a hydrochloric medium, an enrichment in hydrogen of the gas mixture is observed. On the other hand a decrease in hydrogen and an increase in acetylene content take place in an oxidizing medium. The general results can be satisfactorily interpreted through a reaction mechanism involving C-C radical groups. In the same way, the hydrolysis of uranium-thorium-carbon ternary alloys leads to the formation of gaseous and condensed carbon hydrides. The variation of the composition of the gas phase versus uranium content in the alloy suggests an hypothesis about the carbon-carbon distance in the alloy crystal lattice. The variation of methane content, on the other hand, has lead us to discuss the nature of the various phases present in uranium-carbon alloys and carbon-rich uranium-thorium-carbon alloys. We have reached the conclusion that these alloys include a proportion of monocarbide which is dependent upon the ratio. Th/(Th + U). We put forward a diagram of the system uranium-carbon with features proper to explain some phenomena which have been observed in the uranium-thorium-carbon ternary diagram. (author) [French] L'hydrolyse du dicarbure de thorium conduit a la formation d'un melange complexe d'hydrures de carbone gazeux et condenses. La temperature entre 25 et 100 deg. C n'a pas d'influence sur la nature ef la composition de la phase gazeuse. Par contre la cinetique en depend fortement. En milieu chlorhydrique, on observe un enrichissement en hydrogene du melange gazeux. Au contraire, en milieu oxydant il se produit une diminution du taux d'hydrogene et une augmentation tres nette du taux d'acetylene. L'ensemble des resultats obtenus peut etre interprete d'une maniere
Hodgkin's disease following thorium dioxide angiography
Energy Technology Data Exchange (ETDEWEB)
Gotlieb, A I; Kirk, M E [McGill Univ., Montreal, Quebec (Canada). Dept. of Pathology; Hutchison, J L [Montreal General Hospital, Quebec (Canada)
1976-09-04
Hodgkin's disease occurred in a 53-year-old man who, 25 years previously, had undergone cerebral angiography, for which thorium dioxide suspension (Thorotrast) was used. Deposits of thorium dioxide were noted in reticuloendothelial cells in various locations. An association between thorium dioxide administration and the subsequent development of malignant tumours and neoplastic hematologic disorders has previously been reported.
Thorium oxalate solubility and morphology
International Nuclear Information System (INIS)
Monson, P.R. Jr.; Hall, R.
1981-10-01
Thorium was used as a stand-in for studying the solubility and precipitation of neptunium and plutonium oxalates. Thorium oxalate solubility was determined over a range of 0.001 to 10.0 in the concentration parameter [H 2 C 2 O 4 ]/[HNO 3 ] 2 . Morphology of thorium oxide made from the oxalate precipitates was characterized by scanning electron microscopy. The different morphologies found for oxalate-lean and oxalate-rich precipitations were in agreement with predictions based on precipitation theory
Magellanic Clouds Cepheids: Thorium Abundances
Directory of Open Access Journals (Sweden)
Yeuncheol Jeong
2018-03-01
Full Text Available The analysis of the high-resolution spectra of 31 Magellanic Clouds Cepheid variables enabled the identification of thorium lines. The abundances of thorium were found with spectrum synthesis method. The calculated thorium abundances exhibit correlations with the abundances of other chemical elements and atmospheric parameters of the program stars. These correlations are similar for both Clouds. The correlations of iron abundances of thorium, europium, neodymium, and yttrium relative to the pulsational periods are different in the Large Magellanic Cloud (LMC and the Small Magellanic Cloud (SMC, namely the correlations are negative for LMC and positive or close to zero for SMC. One of the possible explanations can be the higher activity of nucleosynthesis in SMC with respect to LMC in the recent several hundred million years.
Spectrographic analysis of thorium and its compounds
International Nuclear Information System (INIS)
Grampurohit, S.V.; Saksena, M.D.; Kaimal, V.N.P.; Kapoor, S.K.; Murty, P.S.
1980-01-01
A spectrographic method, which employs the principle of carrier-distillation technique, is described for the analysis of high purity thoria. Two carriers, AgCl and NaF were used in determining 27 trace elements in ThO 2 . The elements were divided into three groups, A, B and C. In group A, 15 elements, viz. Al, B, Be, Cd, Co, Cr, Cu, Fe, Mg, Mn, Ni, Pb, Sb, Si and Sn were included since it was possible to choose sensitive lines of these elements in one spectral region, 220 - 285 nm. Group B covered 8 elements, viz. Ag, Bi, Ca, Ga, Mo, Ti, V and Zn, which could be determined in the spectral region 290 - 352.5 nm. Group C consisted 4 elements, viz. Ba, K, Li and Na which could be determined in the spectral region 440 - 820 nm. 5% AgCl was used as the carrier for the determination of groups A and C elements and 4% NaF was used as the carrier for the estimation of group B elements. One hundred milligrammes of the sample (in the form of ThO 2 ) containing the carrier were taken in a carrier-distillation electrode and excited in a d.c. arc (10 amps for groups A and C; 15 amps for group B). The spectra of sample and synthetic standards were photographed on Hilger's large quartz, JACO 3.4 m Ebert plane grating and Higler's large glass spectrographs respectively for determining group A, B and C elements. The detection limit obtained for B and Cd was 0.1 ppm. Thorium metal and thorium nitrate samples were converted to ThO 2 prior to analysis. (auth.)
Thorium and health: state of the art
International Nuclear Information System (INIS)
Leiterer, A.; Berard, Ph.; Menetrier, F.
2010-01-01
This report reviews data available in the literature on the subject: 'thorium and health'. Thorium is a natural radioactive element of the actinide series. It is widely distributed in the earth's crust and 99% is found as isotope thorium-232. Its various uses are explained by its chemical, physical, and nuclear properties. As a potential nuclear fuel, thorium is still in demonstration in pilot scale reactors. But thorium has already multiple and sometimes unknown industrial uses. Some mass market products are concerned like light bulb. This raises the issue of wastes, and of exposures of workers and public. Environmental exposure via food and drink of the general population is low, where as workers can be exposed to significant doses, especially during ore extraction. Data on bio-monitoring of workers and biokinetic of thorium, in particular those provided by ICRP, are gathered here. Studies on health effects and toxicity of thorium are scarce and mostly old, except outcomes of its previous medical use. Studies on other forms of thorium should be undertaken to provide substantial data on its toxicity. Concerning treatment, Ca-DTPA is the recommended drug even if its efficacy is moderate. LiHOPO molecule shows interesting results in animals, and further research on chelating agents is needed. (authors)
Competitive biosorption of thorium and uranium by actinomycetes
International Nuclear Information System (INIS)
Nakajima, Akira; Tsuruta, Takehiko
2002-01-01
The competitive biosorption of thorium and uranium by actinomycetes was examined. Of the actinomycetes tested, Streptomyces levoris showed the highest ability to sorb both thorium and uranium from aqueous systems. Thorium sorption was not affected by co-existed uranium, while uranium sorption was strongly hindered by co-existed thorium. The amounts of both thorium and uranium sorbed by Streptomyces levoris cells increased with an increase of the solution pH. Although the equilibrium isotherm of uranium biosorption is in similar manner as that of thorium biosorption, uranium was sorbed much faster than thorium. Biosorption isotherm of each metal ion could be well fitted by Langmuir isotherm taking the ionic charge of metal ions into account. The Langmuir isotherm for binary system did not explain completely the competitive biosorption of thorium and uranium by Streptomyces levoris. However, the results suggested that the ion species of both metals in the cells should be Th(OH) 2 2+ and UO 2 2+ , respectively. (author)
Research and development of thorium fuel cycle
International Nuclear Information System (INIS)
Oishi, Jun.
1994-01-01
Nuclear properties of thorium are summarized and present status of research and development of the use of thorium as nuclear fuel is reviewed. Thorium may be used for nuclear fuel in forms of metal, oxide, carbide and nitride independently, alloy with uranium or plutonium or mixture of the compound. Their use in reactors is described. The reprocessing of the spent oxide fuel in thorium fuel cycle is called the thorex process and similar to the purex process. A concept of a molten salt fuel reactor and chemical processing of the molten salt fuel are explained. The required future research on thorium fuel cycle is commented briefly. (T.H.)
Determination of natural thorium in urines
International Nuclear Information System (INIS)
Jeanmaire, L.; Jammet, H.
1959-01-01
A procedure for the quantitative analysis of thorium in urine is described. After precipitation with ammonium hydroxide, dissolution of the precipitate, extraction at pH 4-4.2 with cupferron in chloroformic solution and mineralization, a colorimetric determination of thorium with thorin is performed. It is thus possible to detect about 2 γ of thorium in the sample. (author) [fr
Advanced thorium cycles in LWRs and HWRs
International Nuclear Information System (INIS)
Radkowsky, A.
The main aspects of advanced thorium cycles in LWRs and HWRs are reviewed. New concepts include the seed blanket close packed heavy water breeder, the light water seed blanket thorium burner and self-induced thorium cycle in CANDU type reactors. (author)
Homogeneous Thorium Fuel Cycles in Candu Reactors
Energy Technology Data Exchange (ETDEWEB)
Hyland, B.; Dyck, G.R.; Edwards, G.W.R.; Magill, M. [Chalk River Laboratories, Atomic Energy of Canada Limited (Canada)
2009-06-15
The CANDU{sup R} reactor has an unsurpassed degree of fuel-cycle flexibility, as a consequence of its fuel-channel design, excellent neutron economy, on-power refueling, and simple fuel bundle [1]. These features facilitate the introduction and full exploitation of thorium fuel cycles in Candu reactors in an evolutionary fashion. Because thorium itself does not contain a fissile isotope, neutrons must be provided by adding a fissile material, either within or outside of the thorium-based fuel. Those same Candu features that provide fuel-cycle flexibility also make possible many thorium fuel-cycle options. Various thorium fuel cycles can be categorized by the type and geometry of the added fissile material. The simplest of these fuel cycles are based on homogeneous thorium fuel designs, where the fissile material is mixed uniformly with the fertile thorium. These fuel cycles can be competitive in resource utilization with the best uranium-based fuel cycles, while building up a 'mine' of U-233 in the spent fuel, for possible recycle in thermal reactors. When U-233 is recycled from the spent fuel, thorium-based fuel cycles in Candu reactors can provide substantial improvements in the efficiency of energy production from existing fissile resources. The fissile component driving the initial fuel could be enriched uranium, plutonium, or uranium-233. Many different thorium fuel cycle options have been studied at AECL [2,3]. This paper presents the results of recent homogeneous thorium fuel cycle calculations using plutonium and enriched uranium as driver fuels, with and without U-233 recycle. High and low burnup cases have been investigated for both the once-through and U-233 recycle cases. CANDU{sup R} is a registered trademark of Atomic Energy of Canada Limited (AECL). 1. Boczar, P.G. 'Candu Fuel-Cycle Vision', Presented at IAEA Technical Committee Meeting on 'Fuel Cycle Options for LWRs and HWRs', 1998 April 28 - May 01, also Atomic Energy
Utilization of thorium in thermal reactors
International Nuclear Information System (INIS)
Srinivasan, K.R.; Nakra, A.N.
1978-01-01
Large deposits of thorium are found in India. 233 U produced by neutron capture in 232 Th is a more valuable fuel for thermal reactors than the plutonium that results from capture in 238 U. These two facts are the main reasons for the interest in utilizing thorium in power reactors. But natural thorium does not contain any fissile material and its capture cross section is nearly two and a half times that of 238 U. These have made the fuelling cost high. However, in certain conditions and certain types of reactors the costs are comparable with those using uranium fuel. The relative cost effectiveness of different fuels is discussed. Apart from long term interest, the short term interest of using thorium fuel in RAPP type reactors is also briefly described. Finally the reactor physics experiments using thorium fuel and their comparison with calculations are presented. (author)
The hydrolysis of thorium dicarbide and of mixed uranium-thorium dicarbides
International Nuclear Information System (INIS)
Del Litto, B.
1966-09-01
The hydrolysis of thorium dicarbide leads to the formation of a complex mixture of gaseous and condensed carbon hydrides. The temperature, between 25 and 100 deg. C, has no influence on the nature and composition of the gas phase. The reaction kinetics, however, are strongly temperature dependent. In a hydrochloric medium, an enrichment in hydrogen of the gas mixture is observed. On the other hand a decrease in hydrogen and an increase in acetylene content take place in an oxidizing medium. The general results can be satisfactorily interpreted through a reaction mechanism involving C-C radical groups. In the same way, the hydrolysis of uranium-thorium-carbon ternary alloys leads to the formation of gaseous and condensed carbon hydrides. The variation of the composition of the gas phase versus uranium content in the alloy suggests an hypothesis about the carbon-carbon distance in the alloy crystal lattice. The variation of methane content, on the other hand, has lead us to discuss the nature of the various phases present in uranium-carbon alloys and carbon-rich uranium-thorium-carbon alloys. We have reached the conclusion that these alloys include a proportion of monocarbide which is dependent upon the ratio. Th/(Th + U). We put forward a diagram of the system uranium-carbon with features proper to explain some phenomena which have been observed in the uranium-thorium-carbon ternary diagram. (author) [fr
International Nuclear Information System (INIS)
Noey, K.C.; Liedle, S.D.; Hickey, C.R.; Doane, R.W.
1989-01-01
The authors are currently performing radiological surveys on approximately ninety properties in the St. Louis, Missouri area as part of the U.S. Department of Energy's Formerly Utilized Sites Remedial Action Program. The properties involved are the St. Louis Airport Site, Latty Avenue Properties, St. Louis Downtown Site, Coldwater Creek, and the associated roads and vicinity properties. The primary radioactive contaminant on these properties is thorium-230. Since field instrumentation is not available to detect the presence of alpha-emitting contamination in soil, soil samples are being collected and sent to an analytical laboratory for analysis. Thorium-230 analysis is costly and time-consuming, and as a result, soil sample analysis results are not available to help direct the field sampling program. This paper provides discussion of the manner in which the properties became radioactively contaminated, followed by a discussion of the difficulties associated with the detection of thorium-230. Finally, new methodologies for detecting alpha-emitting radionuclides in the field are described
Energy Technology Data Exchange (ETDEWEB)
Pradel, J; Billard, F [Commissariat a l' Energie Atomique, Saclay (France). Centre d' Etudes Nucleaires
1959-07-01
1. Thorium compounds continually give off thoron and its daughters and their radioactivity can constitute a danger for operators who may inhale them. 2. By analogy with radon the maximum admissible content in air of thoron and its daughters has been set at 10{sup -7} {mu}c/cm{sup 3}. However the differences in behaviour between radon and its active deposit on the one hand, and thoron and its daughters on the other, appear great enough to justify more thorough investigation. In fact it seemed probable that, contrary to what takes place with radon, the thoron + thorium A content at a given point may differ appreciable from the thorium B + thorium C + thorium C' + thorium C'' content at the same point, because of the considerable differences in half-life which allow a greater or lesser distribution. 3. To determine the relative concentrations it was necessary to develop a method for estimating thoron in equilibrium with thorium A, the measurement of thorium B and its daughters being carried out in the conventional way by counting the activity collected on a filter. 4. Another object of this study was to estimate the danger presented by thoron in equilibrium with thorium A in the immediate vicinity of thorium sources, in a plant extracting thorium from urano-thorianite. (author) [French] 1. Le thoron et ses descendants se degagent constamment des composes du thorium et leur radioactivite peut presenter un danger pour les personnes qui sont amenees a les respirer. 2. Par analogie avec le radon, la teneur maximum admissible dans l'air de thoron et de ses descendants a ete fixee a 10{sup -7} {mu}c/cm{sup 3}. Mais, les differences de comportement du radon et de son depot actif d'une part, du thoron et de ses descendants d'autre part, ont paru suffisantes pour justifier une etude plus complete. Il semblait en effet probable, contrairement a ce qui se produit pour le radon, qu'en un meme point, la teneur en thoron + thorium A puisse differer notablement de la teneur en
Energy Technology Data Exchange (ETDEWEB)
Pradel, J.; Billard, F. [Commissariat a l' Energie Atomique, Saclay (France). Centre d' Etudes Nucleaires
1959-07-01
1. Thorium compounds continually give off thoron and its daughters and their radioactivity can constitute a danger for operators who may inhale them. 2. By analogy with radon the maximum admissible content in air of thoron and its daughters has been set at 10{sup -7} {mu}c/cm{sup 3}. However the differences in behaviour between radon and its active deposit on the one hand, and thoron and its daughters on the other, appear great enough to justify more thorough investigation. In fact it seemed probable that, contrary to what takes place with radon, the thoron + thorium A content at a given point may differ appreciable from the thorium B + thorium C + thorium C' + thorium C'' content at the same point, because of the considerable differences in half-life which allow a greater or lesser distribution. 3. To determine the relative concentrations it was necessary to develop a method for estimating thoron in equilibrium with thorium A, the measurement of thorium B and its daughters being carried out in the conventional way by counting the activity collected on a filter. 4. Another object of this study was to estimate the danger presented by thoron in equilibrium with thorium A in the immediate vicinity of thorium sources, in a plant extracting thorium from urano-thorianite. (author) [French] 1. Le thoron et ses descendants se degagent constamment des composes du thorium et leur radioactivite peut presenter un danger pour les personnes qui sont amenees a les respirer. 2. Par analogie avec le radon, la teneur maximum admissible dans l'air de thoron et de ses descendants a ete fixee a 10{sup -7} {mu}c/cm{sup 3}. Mais, les differences de comportement du radon et de son depot actif d'une part, du thoron et de ses descendants d'autre part, ont paru suffisantes pour justifier une etude plus complete. Il semblait en effet probable, contrairement a ce qui se produit pour le radon, qu'en un meme point, la teneur en thoron + thorium A puisse
Equipment for the handling of thorium materials
International Nuclear Information System (INIS)
Heisler, S.W. Jr.; Mihalovich, G.S.
1988-01-01
The Feed Materials Production Center (FMPC) is the United States Department of Energy's storage facility for thorium. FMPC thorium handling and overpacking projects ensure the continued safe handling and storage of the thorium inventory until final disposition of the materials is determined and implemented. The handling and overpacking of the thorium materials requires the design of a system that utilizes remote handling and overpacking equipment not currently utilized at the FMPC in the handling of uranium materials. The use of remote equipment significantly reduces radiation exposure to personnel during the handling and overpacking efforts. The design system combines existing technologies from the nuclear industry, the materials processing and handling industry and the mining industry. The designed system consists of a modified fork lift truck for the transport of thorium containers, automated equipment for material identification and inventory control, and remote handling and overpacking equipment for material identification and inventory control, and remote handling and overpacking equipment for repackaging of the thorium materials
Thorium and its future importance for nuclear energy generation
International Nuclear Information System (INIS)
Lainetti, Paulo E.O.
2015-01-01
Thorium was discovered in 1828 by the Swedish chemist Jons J. Berzelius. Despite some advantages over uranium for use in nuclear reactors, its main use, in the almost two centuries since its discovery, the use of thorium was restricted to use for gas mantles, especially in the early twentieth century. In the beginning of the Nuclear Era, many countries had interested on thorium, particularly during the 1950-1970 period. There are about 435 nuclear reactors in the world nowadays. They need more than 65.000 tons of uranium yearly. The future world energy needs will increase and, even if we assumed a conservative contribution of nuclear generation, it will be occur a significant increasing in the uranium prices, taking into account that uranium, as used in the present thermal reactors, is a finite resource. Thorium is nearly three times more abundant than uranium in the Earth's crust. Despite thorium is not a fissile material, 232 Th can be converted to 233 U (fissile) more efficiently than 238 U to 239 Pu. Besides this, since it is possible to convert thorium waste into nonradioactive elements, thorium is an environment-friendly alternative energy source. Thorium fuel cycle is also inherently resistant to proliferation. Some papers evaluate the thorium resources in Brazil over 1.200.000 metric t. Then, the thorium alternative must be seriously considered in Brazil for strategic reasons. In this paper a brief history of thorium is presented, besides a review of the world thorium utilization and a discussion about advantages and restrictions of thorium use. (author)
Safety and Regulatory Issues of the Thorium Fuel Cycle
Energy Technology Data Exchange (ETDEWEB)
Ade, Brian [ORNL; Worrall, Andrew [ORNL; Powers, Jeffrey [ORNL; Bowman, Steve [ORNL; Flanagan, George [ORNL; Gehin, Jess [ORNL
2014-02-01
Thorium has been widely considered an alternative to uranium fuel because of its relatively large natural abundance and its ability to breed fissile fuel (233U) from natural thorium (232Th). Possible scenarios for using thorium in the nuclear fuel cycle include use in different nuclear reactor types (light water, high temperature gas cooled, fast spectrum sodium, molten salt, etc.), advanced accelerator-driven systems, or even fission-fusion hybrid systems. The most likely near-term application of thorium in the United States is in currently operating light water reactors (LWRs). This use is primarily based on concepts that mix thorium with uranium (UO2 + ThO2), add fertile thorium (ThO2) fuel pins to LWR fuel assemblies, or use mixed plutonium and thorium (PuO2 + ThO2) fuel assemblies. The addition of thorium to currently operating LWRs would result in a number of different phenomenological impacts on the nuclear fuel. Thorium and its irradiation products have nuclear characteristics that are different from those of uranium. In addition, ThO2, alone or mixed with UO2 fuel, leads to different chemical and physical properties of the fuel. These aspects are key to reactor safety-related issues. The primary objectives of this report are to summarize historical, current, and proposed uses of thorium in nuclear reactors; provide some important properties of thorium fuel; perform qualitative and quantitative evaluations of both in-reactor and out-of-reactor safety issues and requirements specific to a thorium-based fuel cycle for current LWR reactor designs; and identify key knowledge gaps and technical issues that need to be addressed for the licensing of thorium LWR fuel in the United States.
International Nuclear Information System (INIS)
Busev, A.I.; Tiptsova, V.G.; Ivanov, V.M.
1978-01-01
The basic methods for extracting thorium from monazites and determining it photometrically and complexometrically are described. Monazite is decomposed by fusion with sodium peroxide, then thorium and the totality of lanthanides are precipitated in the form of oxalates. After the oxalates have been broken down, thorium is determined photometrically with the aid of arsenazo 1, quercetin of 1-2(-pyridylazo)-resorcin. It takes 25 to 30 minutes to photometrically determine Th in monazites with the aid of arsenazo 2 (error: 3 to 5%). Arsenazo 2 is recommended for analysis of monazites containing 20 to 30% of lanthanides. Arsenazo 3 permits determining Th in zircon and in Nb-containing materials. In this case, the determination is possible in strongly acidic solutions, the ratio of arsenazo 3 to Th being 7.5:1. Arsenazo 3 can also be used in determining trace amounts of Th (1x10 -5 to 1x10 -4 %) in rocks, as well as in extraction-photometric determination of Th traces. The dyed compound of Th with arsenazo 3 is extracted with isoamyl alcohol in the presence of diphenylguanidinium chloride and monochloroacetic acid. The method permits determining Th at 1:5x10 8 (0.002 g/ml) dilution. Also described is the iodate-complexometric method for determining Th
Prospective thorium fuels for future nuclear energy generation
International Nuclear Information System (INIS)
Lainetti, Paulo E.O.
2017-01-01
In the beginning of the Nuclear Era, many countries were interested on thorium, particularly during the 1950 1970 periods. Nevertheless, since its discovery almost two centuries ago, the use of thorium has been restricted to gas mantles employed in gas lighting. The future world energy needs will increase and, even if we assumed a conservative contribution of nuclear generation, it will be occur a significant increasing in the uranium prices, taking into account that uranium, as used in the present thermal reactors, is a finite resource. Nowadays approximately the worldwide yearly requirement of uranium for about 435 nuclear reactors in operation is 65,000 metric t. Therefore, alternative solutions for future must be developed. Thorium is nearly three times more abundant than uranium in The Earth's crust. Despite thorium is not a fissile material, 232 Th can be converted to 233 U (fissile) more efficiently than 238 U to 239 Pu. Besides this, thorium is an environment alternative energy source and also inherently resistant to proliferation.. Many countries had initiated research on thorium in the past, Nevertheless, the interest evanesced due new uranium resources discoveries and availability of enriched uranium at low prices from obsolete weapons. Some papers evaluate the thorium resources in Brazil over 1.200.000 metric t. Then, the thorium alternative must be seriously considered in Brazil for strategic reasons. A brief history of thorium and its utilization are presented, besides a very short discussion about prospective thorium nuclear fuels for the next generation of nuclear reactors. (author)
Prospective thorium fuels for future nuclear energy generation
Energy Technology Data Exchange (ETDEWEB)
Lainetti, Paulo E.O., E-mail: lainetti@ipen.br [Instituto de Pesquisas Energeticas e Nucleares (IPEN/CNEN-SP), Sao Paulo, SP (Brazil)
2017-07-01
In the beginning of the Nuclear Era, many countries were interested on thorium, particularly during the 1950 1970 periods. Nevertheless, since its discovery almost two centuries ago, the use of thorium has been restricted to gas mantles employed in gas lighting. The future world energy needs will increase and, even if we assumed a conservative contribution of nuclear generation, it will be occur a significant increasing in the uranium prices, taking into account that uranium, as used in the present thermal reactors, is a finite resource. Nowadays approximately the worldwide yearly requirement of uranium for about 435 nuclear reactors in operation is 65,000 metric t. Therefore, alternative solutions for future must be developed. Thorium is nearly three times more abundant than uranium in The Earth's crust. Despite thorium is not a fissile material, {sup 232}Th can be converted to {sup 233}U (fissile) more efficiently than {sup 238}U to {sup 239}Pu. Besides this, thorium is an environment alternative energy source and also inherently resistant to proliferation.. Many countries had initiated research on thorium in the past, Nevertheless, the interest evanesced due new uranium resources discoveries and availability of enriched uranium at low prices from obsolete weapons. Some papers evaluate the thorium resources in Brazil over 1.200.000 metric t. Then, the thorium alternative must be seriously considered in Brazil for strategic reasons. A brief history of thorium and its utilization are presented, besides a very short discussion about prospective thorium nuclear fuels for the next generation of nuclear reactors. (author)
Thorium in occupationally exposed men
International Nuclear Information System (INIS)
Stehney, A. F.
1999-01-01
Higher than environmental levels of 232 Th have been found in autopsy samples of lungs and other organs from four former employees of a thorium refinery. Working periods of the subjects ranged from 3 to 24 years, and times from end of work to death ranged from 6 to 31 years. Examination of the distribution of thorium among the organs revealed poor agreement with the distribution calculated from the dosimetric models in Publication 30 of the International Commission on Radioprotection (ICRP). Concentrations in the lungs relative to pulmonary lymph nodes, bone or liver were much higher than calculated from the model for class Y thorium and the exposure histories of the workers. Much better agreement was found with more recently proposed models in Publications 68 and 69 of the ICRP. Radiation doses estimated from the amounts of thorium in the autopsy samples were compatible with health studies that found no significant difference in mortality from that of the general population of men in the US
Model Matematik Reduksi Thorium dalam Proses Elektrokoagulasi
Directory of Open Access Journals (Sweden)
Prayitno
2017-11-01
Full Text Available Thorium reduction by electrocoagulation has been conducted on radioactive waste with thorium contaminant grade of 5x10-4Kg/l through a batch system using aluminium electrodes. This study aims to determine a mathematical model of thorium reduction through speed reaction, constante reaction rate and reaction order which are affected by electrocoagulation process parameters like voltage, time, electrode distance, and pH. The research results the optimum voltage condition at 12.5 V at 1 cm electrode spacing, pH 7, and 30 minutes of processing time with 99.6 % efficiency. Prediction on thorium decline rate constante is obtained through mathematic integral method calculation. The research results thorium decline rate is following second order constante with its value at 5x10-3KgL-1min-1.
International Nuclear Information System (INIS)
Merz, E.R.
1977-01-01
The utilization of the thorium fuel cycle has long since been considered attractive due to the excellent neutronic characteristics of 233 U, and the widespread and cheap thorium resources. Although the uranium ore as well as the separative work requirements are usually lower for any thorium-based fuel cycle in comparison to present uranium-plutonium fuel cycles of thermal water reactors, interest by nuclear industry has hitherto been marginal. Fast increasing uranium prices, public reluctance against widespread Pu-recycling and expected retardations for the market penetration of fast breeders have led to a reconsideration of the thorium fuel cycle merits. In addition, it could be learned in the meantime that problems associated with reprocessing and waste handling, but particularly with a remote refabrication of 233 U are certainly not appreciably more difficult than for Pu-recycling. This may not only be due to psychological constraints but be based upon technological as well as economical facts, which have been mostly neglected up till now. In order to diversify from uranium as a nuclear energy source it seems to be worthwhile to greatly intensify efforts in the future for closing the Th/ 233 U fuel cycle. HTGR's are particularly promising for economic application. However, further R and D activites should not be solely focussed on this reactor type alone. Light and heavy-water moderated reactors, as well as even fast breeders later on, may just as well take advantage of a demonstrated thorium fuel cycle. A summary is presented of the state-of-the-art of Th/ 233 U-recycling technology and the efforts still necessary to demonstrate this technology all the way through to its industrial application
Status and development of the thorium fuel cycle
International Nuclear Information System (INIS)
Yi Weijing; Wei Renjie
2003-01-01
A perspective view of the thorium fuel cycle is provided in this paper. The advantages and disadvantages of the thorium fuel cycle are given and the development of thorium fuel cycle in several types of reactors is introduced. The main difficulties in developing the thorium fuel cycle lie in the reprocessing and disposal of the waste and its economy, and the ways tried by foreign countries to solve the problems are presented in the paper
U.S. leans toward denatured thorium cycle
International Nuclear Information System (INIS)
Smock, R.
1977-01-01
Denatured thorium appears to be the most promising among the nonproliferating alternatives to the plutonium cycle, which the Carter Administration is trying to cancel. Criteria for a better system include uranium utilization comparable to current light water reactors and minimal separation of fissile material into the waste stream. Comparisons with other systems conclude that thorium is preferable because it can lead to an acceptable fast breeder. The thorium cycle can be placed in energy centers for sensitive facilities and can also be introduced into ongoing light water systems. Reprocessing can be handled in the centers, where thorium can be mixed with plutonium for use in reactors within the center, while light water reactors operate on the outside. Any fuel leaving the center would be unsuitable for weapons. Later adaptation to in-center fast breeders will extend energy supplies, although a thorium breeder will be less efficient than a plutonium fast breeder. Denatured thorium is a technical answer to a complex political problem, but those in the nuclear industry see the U.S. goal of a nonproliferating fuel as futile in the light of world politics and breeder efforts in other countries
Thoron and associated risks in the handling of thorium compounds
International Nuclear Information System (INIS)
Pradel, J.; Billard, F.
1959-01-01
1. Thorium compounds continually give off thoron and its daughters and their radioactivity can constitute a danger for operators who may inhale them. 2. By analogy with radon the maximum admissible content in air of thoron and its daughters has been set at 10 -7 μc/cm 3 . However the differences in behaviour between radon and its active deposit on the one hand, and thoron and its daughters on the other, appear great enough to justify more thorough investigation. In fact it seemed probable that, contrary to what takes place with radon, the thoron + thorium A content at a given point may differ appreciable from the thorium B + thorium C + thorium C' + thorium C'' content at the same point, because of the considerable differences in half-life which allow a greater or lesser distribution. 3. To determine the relative concentrations it was necessary to develop a method for estimating thoron in equilibrium with thorium A, the measurement of thorium B and its daughters being carried out in the conventional way by counting the activity collected on a filter. 4. Another object of this study was to estimate the danger presented by thoron in equilibrium with thorium A in the immediate vicinity of thorium sources, in a plant extracting thorium from urano-thorianite. (author) [fr
Thorium-based nuclear fuel: current status and perspectives
International Nuclear Information System (INIS)
1987-03-01
Until the present time considerable efforts have already been made in the area of fabrication, utilization and reprocessing of Th-based fuels for different types of reactors, namely: by FRG and USA - for HTRs; FRG and Brazil, Italy - for LWRs; India - for HWRs and FBRs. Basic research of thorium fuels and thorium fuel cycles are also being undertaken by Australia, Canada, China, France, FRG, Romania, USSR and other countries. Main emphasis has been given to the utilization of thorium fuels in once-through nuclear fuel cycles, but in some projects closed thorium-uranium or thorium-plutonium fuel cycles are also considered. The purpose of the Technical Committee on the Utilization of Thorium-Based Nuclear Fuel: Current Status and Perspective was to review the world thorium resources, incentives for further exploration, obtained experience in the utilization of Th-based fuels in different types of reactors, basic research, fabrication and reprocessing of Th-based fuels. As a result of the panel discussion the recommendations on future Agency activities and list of major worldwide activities in the area of Th-based fuel were developed. A separate abstract was prepared for each of the 9 papers in this proceedings series
Thorium as an energy source. Opportunities for Norway
International Nuclear Information System (INIS)
2008-01-01
Final Recommendations of the Thorium Report Committee: 1) No technology should be idolized or demonized. All carbon-dioxide (Co2) emission-free energy production technologies should be considered. The potential contribution of nuclear energy to a sustainable energy future should be recognized. 2) An investigation into the resources in the Fen Complex and other sites in Norway should be performed. It is essential to assess whether thorium in Norwegian rocks can be defined as an economical asset for the benefit of future generations. Furthermore, the application of new technologies for the extraction of thorium from the available mineral sources should be studied. 3) Testing of thorium fuel in the Halden Reactor should be encouraged, taking benefit of the well recognized nuclear fuel competence in Halden. 4) Norway should strengthen its participation in international collaborations by joining the EURATOM fission program and the GIF program on Generation IV reactors suitable for the use of thorium. 5) The development of an Accelerator Driven System (ADS) using thorium is not within the capability of Norway working alone. Joining the European effort in this field should be considered. Norwegian research groups should be encouraged to participate in relevant international projects, although these are currently focused on waste management. 6) Norway should bring its competence in waste management up to an international standard and collaboration with Sweden and Finland could be beneficial. 7) Norway should bring its competence with respect to dose assessment related to the thorium cycle up to an international standard. 8) Since the proliferation resistance of uranium-233 depends on the reactor and reprocessing technologies, this aspect will be of key concern should any thorium reactor be built in Norway. 9) Any new nuclear activities in Norway, e.g. thorium fuel cycles, would need strong international pooling of human resources, and in the case of thorium, a strong long
Thorium as an energy source. Opportunities for Norway
Energy Technology Data Exchange (ETDEWEB)
2008-01-15
Final Recommendations of the Thorium Report Committee: 1) No technology should be idolized or demonized. All carbon-dioxide (Co2) emission-free energy production technologies should be considered. The potential contribution of nuclear energy to a sustainable energy future should be recognized. 2) An investigation into the resources in the Fen Complex and other sites in Norway should be performed. It is essential to assess whether thorium in Norwegian rocks can be defined as an economical asset for the benefit of future generations. Furthermore, the application of new technologies for the extraction of thorium from the available mineral sources should be studied. 3) Testing of thorium fuel in the Halden Reactor should be encouraged, taking benefit of the well recognized nuclear fuel competence in Halden. 4) Norway should strengthen its participation in international collaborations by joining the EURATOM fission program and the GIF program on Generation IV reactors suitable for the use of thorium. 5) The development of an Accelerator Driven System (ADS) using thorium is not within the capability of Norway working alone. Joining the European effort in this field should be considered. Norwegian research groups should be encouraged to participate in relevant international projects, although these are currently focused on waste management. 6) Norway should bring its competence in waste management up to an international standard and collaboration with Sweden and Finland could be beneficial. 7) Norway should bring its competence with respect to dose assessment related to the thorium cycle up to an international standard. 8) Since the proliferation resistance of uranium-233 depends on the reactor and reprocessing technologies, this aspect will be of key concern should any thorium reactor be built in Norway. 9) Any new nuclear activities in Norway, e.g. thorium fuel cycles, would need strong international pooling of human resources, and in the case of thorium, a strong long
Geochemical prospecting for thorium and uranium deposits
International Nuclear Information System (INIS)
Boyle, R.W.
1982-01-01
The basic purpose of this book is to present an analysis of the various geochemical methods applicable in the search for all types of thorium and uranium deposits. The general chemistry and geochemistry of thorium and uranium are briefly described in the opening chapter, and this is followed by a chapter on the deposits of the two elements with emphasis on their indicator (pathfinder) elements and on the primary and secondary dispersion characteristics of thorium and uranium in the vicinity of their deposits. The next seven chapters form the main part of the book and describe geochemical prospecting for thorium and uranium, stressing selection of areas in which to prospect, radiometric surveys, analytical geochemical surveys based on rocks (lithochemical surveys), unconsolidated materials (pedochemical surveys), natural waters and sediments (hydrochemical surveys), biological materials (biogeochemical surveys), gases (atmochemical surveys), and miscellaneous methods. A final brief chapter reviews radiometric and analytical methods for the detection and estimation of thorium and uranium. (Auth.)
Determination of boron spectrophotometry in thorium sulfate
International Nuclear Information System (INIS)
Federgrun, L.; Abrao, A.
1976-01-01
A procedure for the determination of microquantities of boron in nuclear grade thorium sulfate is described. The method is based on the extraction of BF - 4 ion associated to monomethylthionine (MMT) in 1,2 - dichloroethane. The extraction of the colored BF - 4 -MMT complex does not allow the presence of sulfuric and phosphoric acids; other anions interfere seriously. This fact makes the dissolution of the thorium sulfate impracticable, since it is insoluble in both acids. On the other hand, the quantitative separation of thorium is mandatory, to avoid the precipitation of ThF 4 . To overcome this difficulty, the thorium sulfate is dissolved using a strong cationic ion exchanger, Th 4+ being totally retained into the resin. Boron is then analysed in the effluent. The procedure allows the determination of 0.2 to 10.0 microgramas of B, with a maximum error of 10%. Thorium sulfate samples with contents of 0.2 to 2.0μg B/gTh have being analysed [pt
Competitive biosorption of thorium and uranium by Micrococcus luteus
International Nuclear Information System (INIS)
Nakajima, A.; Tsuruta, T.
2004-01-01
Eighteen species of bacteria were screened for abilities to adsorb thorium and uranium. High adsorption capacity was observed for thorium by Arthrobacter nicotianae and Micrococcus luteus, and for uranium by Arthrobacter nicotianae. The adsorption of both thorium and uranium by Micrococcus luteus cells was rapid, was affected by the solution pH, and obeyed the Langmuir adsorption isotherm for binary systems in a competitive manner taking the ionic charge of the metal ion into account. The thorium selectivity in the competitive adsorption is assumed to be caused by the faster adsorption and the slower desorption rates of thorium than those of uranium. (author)
Energy Technology Data Exchange (ETDEWEB)
Brandao Filho, D; Hespanhol, E C.B.; Baba, S; Miranda, L E.T.; Araujo, J.A. de
1992-08-01
A study has been developed in order to establish a chemical process for recovering thorium from wastes produced at the Thorium Purification Plant of the Instituto de Pesquisas Energeticas e Nucleares. The recovery of thorium in this process will be made by means of solvent extraction technique. Solutions of TBP/Varsol were employed as extracting agent during the runs. The influence of thorium concentration in the solution, aqueous phase acidity, volume ratio of the phases, percentage of TBP/Varsol and the contact time of the phases on the extraction of thorium and lanthanides was determined. (author).
Towards proliferation-resistant thorium fuels
International Nuclear Information System (INIS)
Alhaj, M. Yousif; Mohamed, Nader M.A.; Badawi, Alya; Abou-Gabal, Hanaa H.
2017-01-01
Thorium-plutonium mixture is proposed as alternative nuclear reactor fuel to incinerate the increasing stockpile plutonium. However, this fuel will produce an amount of uranium with about 90% 233U at applicable discharge burnups (60GWD/MTU). This research focuses on proposing an optimum non proliferative thorium fuel, by adding a small amount of 238U to reduce the attractiveness of the resultant uranium. Three types of additive which contain 238U were used: 4.98% enriched, natural and depleted uranium. We found that introducing uranium to the fresh thorium-plutonium fuel reduces its performance even if the uranium was enriched up to 5%. While uranium admixtures reduce the quality of the reprocessed uranium, it also increases the quality of the plutonium. However, this increase is very low compared to the reduced quality of uranium. We also found that using uranium as admixture for thorium-plutonium mixed fuel increases the critical mass of the extracted uranium by a factor of two when using only 1% admixture of uranium. The higher the percentage of uranium admixture the higher the critical mass of the reprocessed one.
Polarographic determination of trace amounts of thorium
Energy Technology Data Exchange (ETDEWEB)
Zaofan Zhao; Xiaohua Cai; Peibiao Li; Handong Yang
1986-07-01
A sensitive linear-sweep polarographic method for the determination of thorium is described. It is based on the thorium complex with Xylidyl Blue I (XBI) in a medium containing ethylenediamine, 1, 10-phenanthroline, oxalic acid and ninhydrin, at pH 10.5-11.5. The complex has been proved to be Th(XBI)/sub 2/, with log ..beta..'=9.6. The method can be used to determine trace amounts of thorium over the range 3.5x10/sup -8/-3x10/sup -6/M. The detection limit is 1x10/sup -8/M. A solvent extraction procedure is necessary to eliminate interference from several cations. The method has been applied to determination of traces of thorium in minerals, with good results.
Present state and perspective of research on thorium cycle
International Nuclear Information System (INIS)
Kimura, Itsuro
1994-01-01
For the prosperity of Japan and the welfare of mankind in the world, enormous quantity of energy is required in 21st century, and the general circumstances of energy and nuclear power are described. In addition to the present nuclear power using mostly 235 U and the plutonium produced from 238 U, it is the thorium cycle that 233 U produced from the third nuclear fuel, thorium, is used for electric power generation as an energy source. In this report, the 'General research on thorium cycle as a promising energy source in and after 21st century' is outlined, which has been advanced by accepting the subsidy of scientific research expense of the Ministry of Education. The features of the thorium cycle and the nuclear data and the nuclear characteristics in comparison with uranium-plutonium reactors are described. The trend of the research and development in the world and in Japan is reported. Two general researches were carried out for five years from fiscal year 1988 to 1992 on the thorium cycle. The results of the research on the nuclear data, the design of thorium reactors, the criticality experiment and analysis, thorium hybrid, thorium fuel, molten salt, fuel reprocessing and radiation safety are reported. (K.I.)
Titanium(IV), zirconium, hafnium and thorium
International Nuclear Information System (INIS)
Brown, Paul L.; Ekberg, Christian
2016-01-01
Titanium can exist in solution in a number of oxidation states. The titanium(IV) exists in acidic solutions as the oxo-cation, TiO 2+ , rather than Ti 4+ . Zirconium is used in the ceramics industry and in nuclear industry as a cladding material in reactors where its reactivity towards hydrolysis reactions and precipitation of oxides may result in degradation of the cladding. In nature, hafnium is found together with zirconium and as a consequence of the contraction in ionic radii that occurs due to the 4f -electron shell, the ionic radius of hafnium is almost identical to that of zirconium. All isotopes of thorium are radioactive and, as a consequence of it being fertile, thorium is important in the nuclear fuel cycle. The polymeric hydrolysis species that have been reported for thorium are somewhat different to those identified for zirconium and hafnium, although thorium does form the Th 4 (OH) 8 8+ species.
Thorium exposure in a niobium mine
International Nuclear Information System (INIS)
Fonseca, Adelaide M. Gondin da
1995-01-01
The workers involved in the mineral process to obtain Nb-Fe alloy are exposure to thorium. Internal contamination with radioactive materials is a common problem. This is caused by presence of U and Th and their natural decay series associated with the mine ore. The examples are the workers at the niobium mine located in the state of Goias. Twenty mine workers were evaluated using in vitro bioassay techniques. Samples of urine and feces from occupationally exposed mine workers were analyzed for thorium isotopes. The fecal samples corresponding to one complete excretion and urine sample corresponding to a 24 hours collection were analyzed using alpha spectrometry. The results of thorium excretion (feces) have shown that in all the samples the 228 Th excretions in high than 232 Th. Thorium concentration in all the urine samples were below limit of detection that is approximately 1 mBq/l. (author). 3 refs., 1 fig., 1 tab
Parametric study of a thorium model
International Nuclear Information System (INIS)
Lourenco, M.C.; Lipsztein, J.L.; Szwarcwald, C.L.
2002-01-01
Models for radionuclides distribution in the human body and dosimetry involve assumptions on the biokinetic behavior of the material among compartments representing organs and tissues in the body. One of the most important problem in biokinetic modeling is the assignment of transfer coefficients and biological half-lives to body compartments. In Brazil there are many areas of high natural radioactivity, where the population is chronically exposed to radionuclides of the thorium series. The uncertainties of the thorium biokinetic model are a major cause of uncertainty in the estimates of the committed dose equivalent of the population living in high background areas. The purpose of this study is to discuss the variability in the thorium activities accumulated in the body compartments in relation to the variations in the transfer coefficients and compartments biological half-lives of a thorium-recycling model for continuous exposure. Multiple regression analysis methods were applied to analyze the results. (author)
Extractive spectrophotometric determination of thorium
International Nuclear Information System (INIS)
Venkatesan, M.; Gopalakrishnan, V.; Ramanujam, A.; Nadkarni, M.N.
1981-01-01
An extractive spectrophotometric method has been standardized for the analysis of 0.2 to 1.6 milligrams of thorium present in nitric acid solutions. The method involves the extraction of thorium from nitric acid solutions into 0.5 M thenoyl trifluoro acetone (HTTA) in benzene and its direct estimation from the organic extract by spectrophotometry as Thoron colour complex. In this method, interference due to iron upto 5 milligrams can be suppressed by adding ascorbic acid in the ratio of 1:2 prior to HTTA extraction. Uranium(VI) does not interefere even when present in 2000 times the amount of thorium. Plutonium and cerium do not interfere at one milligram level whereas zirconium interferes in this method. The overall error variation and precision of this method has been determined to be +- 3.5%. (author)
Alpha spectrometry and secondary ion mass spectrometry of thorium
International Nuclear Information System (INIS)
Strisovska, Jana; Kuruc, Jozef; Galanda, Dusan; Matel, Lubomir; Velic, Dusan; Aranyosiova, Monika
2009-01-01
A sample of thorium content on steel discs was prepared by electrodeposition with a view to determining the natural thorium isotope. Thorium was determined by alpha spectrometry and by secondary ion mass spectrometry and the results of the two methods were compared
Thorium: An energy source for the world of tomorrow ?
CERN. Geneva
2014-01-01
To meet the tremendous world energy needs, systematic R&D has to be pursued to replace fossil fuels. The ThEC13 conference organized by iThEC at CERN last October has shown that thorium is seriously considered by developing countries as a key element of their energy strategy. Developed countries are also starting to move in the same direction. How thorium could make nuclear energy (based on thorium) acceptable to society will be discussed. Thorium can be used both to produce energy and to destroy nuclear waste. As thorium is not fissile, one elegant option is to use an accelerator, in so-called “Accelerator Driven Systems (ADS)”, as suggested by Carlo Rubbia. CERN’s important contributions to R&D on thorium related issues will be mentioned as well as the main areas where CERN could contribute to this field in the future.
Thorium oxide dissolution kinetics for hydroxide and carbonate complexation
International Nuclear Information System (INIS)
Jardin, R.; Curran, V.; Czerwinski, K.R.
2002-01-01
The purpose of this project was to determine the kinetics and thermodynamics of thorium oxide dissolution in the environment. Solubility is important because it establishes an upper concentration limit on the concentration of a dissolved radionuclide in solution L1. While understanding the behavior of thorium fuels in the proposed repository at Yucca Mountain is most applicable, a more rigorous study of thorium solubility over a wide pH range was performed so that the data could also be used to model the behavior of thorium fuels in any environmental system. To achieve this, the kinetics and thermodynamics of thorium oxide dissolution under both pure argon and argon with P CO2 of 0. 1 were studied under the full pH range available in each atmosphere. In addition, thorium oxide powder remnants were studied after each experiment to examine structural changes that may affect kinetics
A survey of thorium utilization in thermal power reactors
International Nuclear Information System (INIS)
Oosterkamp, W.J.
1974-01-01
The present status of thorium utilization in thermal reactors HTGR's, HWR's and LWR's has been reviewed. Physics considerations are made to obtain the optimum use of thorium. Existing information on reprocessing and refabrication is given together with the properties of thorium metal and thoria
Evaluation of thorium based nuclear fuel. Extended summary
International Nuclear Information System (INIS)
Franken, W.M.P.; Bultman, J.H.; Konings, R.J.M.; Wichers, V.A.
1995-04-01
Application of thorium based nuclear fuels has been evaluated with emphasis on possible reduction of the actinide waste. As a result three ECN-reports are published, discussing in detail: - The reactor physics aspects, by comparing the operation characteristics of the cores of Pressurized Water Reactors and Heavy Water Reactors with different fuel types, including equilibrium thorium/uranium free, once-through uranium fuel and equilibrium uranium/plutonium fuel, - the chemical aspects of thorium based fuel cycles with emphasis on fuel (re)fabrication and fuel reprocessing, - the possible reduction in actinide waste as analysed for Heavy Water Reactors with various types of thorium based fuels in once-through operation and with reprocessing. These results are summarized in this report together with a short discussion on non-proliferation and uranium resource utilization. It has been concluded that a substantial reduction of actinide radiotoxicity of the disposed waste may be achieved by using thorium based fuels, if very efficient partitioning and multiple recycling of uranium and thorium can be realized. This will, however, require large efforts to develop the technology to the necessary industrial scale of operation. (orig.)
Survey of thorium utilization in power reactor systems
International Nuclear Information System (INIS)
Schwartz, M.H.; Schleifer, P.; Dahlberg, R.C.
1976-01-01
It is clear that thorium-fueled thermal power reactor systems based on current technology can play a vital role in serving present and long-term energy needs. Advanced thorium converters and thermal breeders can provide an expanded resource base from which the world's growing energy demands can be met. Utilization of a symbiotic system of fast breeders and thorium-fueled thermal reactors can be particularly effective in providing low cost power while conserving uranium resources. Breeder reactors are characterized by high capital costs and very low fuel costs since they produce more fuel than they consume. This excess fuel can be used to fuel thermal converter reactors whose capital costs are low. This symbiosis is optimized when 233 U is bred in the fast breeders and then used to fuel high-conversion-ratio thermal converter reactors operating on the thorium-uranium fuel cycle. The thorium-cycle HTGR, after undergoing more than fifteen years of development in both the United States and Europe, provides for the optimum utilization of our limited uranium resources. Other thermal reactor systems, previously operating on the uranium cycle, also show potential in their capability to utilize the thorium cycle effectively
Thorium valency in molten alkali halides in equilibrium with metallic thorium
International Nuclear Information System (INIS)
Smirnov, M.V.; Kudyakov, V.Ya.
1983-01-01
Metallic thorium is shown to corrode in molten alkali halides even in the absence of external oxidizing agents, alkali cations acting as oxidizing agents. Its corrosion rate grows in the series of alkali chlorides from LiCl to CsCl at constant temperature. Substituting halide anions for one another exerts a smaller influence, the rate rising slightly in going from chlorides to bromides and iodides, having the same alkali cations. Thorium valency is determined coulometrically, the metal being dissolved anodically in molten alkali halides and their mixtures. In fluoride melts it is equal to 4 but in chloride, bromide and iodide ones, as a rule, it has non-integral values between 4 and 2 which diminish as the temperature is raised, as the thorium concentration is lowered, as the radii of alkali cations decrease and those of halide anions increase. The emf of cells Th/N ThHlsub(n) + (1-N) MHl/MHl/C, Hlsub(2(g)) where Hl is Cl, Br or I, M is Li, Na, K, Cs or Na + K, and N < 0.05, is measured as a function of concentration at several temperatures. Expressions are obtained for its concentration dependence. The emf grows in the series of alkali chlorides from LiCl to CsCl, other conditions being equal. (author)
Thorium: An energy source for the world of tomorrow
Directory of Open Access Journals (Sweden)
Revol J.-P.
2015-01-01
Full Text Available To meet the tremendous world energy needs, systematic R&D has to be pursued to replace fossil fuels. Nuclear energy, which produces no green house gases and no air pollution, should be a leading candidate. How nuclear energy, based on thorium rather than uranium, could be an acceptable solution is discussed. Thorium can be used both to produce energy and to destroy nuclear waste. The thorium conference, organized by iThEC at CERN in October 2013, has shown that thorium is seriously considered by some major developing countries as a key element of their energy strategy. However, developed countries do not seem to move fast enough in that direction, while global cooperation is highly desirable in this domain. Thorium is not fissile. Various possible ways of using thorium will be reviewed. However, an elegant option is to drive an “Accelerator Driven System (ADS” with a proton accelerator, as suggested by Nobel Prize laureate Carlo Rubbia .
International Nuclear Information System (INIS)
Mai, V. T.; Fujii, T.; Wada, K.; Kitada, T.; Takaki, N.; Yamaguchi, A.; Watanabe, H.; Unesaki, H.
2012-01-01
Considering the importance of thorium data and concerning about the accuracy of Th-232 cross section library, a series of experiments of thorium critical core carried out at KUCA facility of Kyoto Univ. Research Reactor Inst. have been analyzed. The core was composed of pure thorium plates and 93% enriched uranium plates, solid polyethylene moderator with hydro to U-235 ratio of 140 and Th-232 to U-235 ratio of 15.2. Calculations of the effective multiplication factor, control rod worth, reactivity worth of Th plates have been conducted by MVP code using JENDL-4.0 library [1]. At the experiment site, after achieving the critical state with 51 fuel rods inserted inside the reactor, the measurements of the reactivity worth of control rod and thorium sample are carried out. By comparing with the experimental data, the calculation overestimates the effective multiplication factor about 0.90%. Reactivity worth of the control rods evaluation using MVP is acceptable with the maximum discrepancy about the statistical error of the measured data. The calculated results agree to the measurement ones within the difference range of 3.1% for the reactivity worth of one Th plate. From this investigation, further experiments and research on Th-232 cross section library need to be conducted to provide more reliable data for thorium based fuel core design and safety calculation. (authors)
Geochemical prospecting for uranium and thorium deposits
International Nuclear Information System (INIS)
Boyle, R.W.
1980-01-01
A brief review of analytical geochemical prospecting methods for uranium and thorium is given excluding radiometric techniques, except those utilized in the determination of radon. The indicator (pathfinder) elements useful in geochemical surveys are listed for each of the types of known uranium and thorium deposits; this is followed by sections on analytical geochemical surveys based on rocks (lithochemical surveys), unconsolidated materials (pedochemical surveys), natural waters and sediments (hydrochemical surveys), biological materials (biogeochemical surveys) and gases (atmochemical surveys). All of the analytical geochemical methods are applicable in prospecting for thorium and uranium, particularly where radiometric methods fail due to attenuation by overburden, water, deep leaching and so on. Efficiency in the discovery of uranium and/or thorium orebodies is promoted by an integrated methods approach employing geological pattern recognition in the localization of deposits, analytical geochemical surveys, and radiometric surveys. (author)
Practical introduction of thorium fuel cycles
International Nuclear Information System (INIS)
Kasten, P.R.
1982-01-01
The pracitcal introduction of throrium fuel cycles implies that thorium fuel cycles compete economically with uranium fuel cycles in economic nuclear power plants. In this study the reactor types under consideration are light water reactors (LWRs), heavy water reactors (HWRs), high-temperature gas-cooled reactors (HTGRs), and fast breeder reactors (FBRs). On the basis that once-through fuel cycles will be used almost exclusively for the next 20 or 25 years, introduction of economic thorium fuel cycles appears best accomplished by commercial introduction of HTGRs. As the price of natural uranium increases, along with commercialization of fuel recycle, there will be increasing incentive to utilize thorium fuel cycles in heavy water reactors and light water reactors as well as in HTGRs. After FBRs and fuel recycle are commercialized, use of thorium fuel cycles in the blanket of FBRs appears advantageous when fast breeder reactors and thermal reactors operate in a symbiosis mode (i.e., where 233 U bred in the blanket of a fast breeder reactor is utilized as fissile fuel in thermal converter reactors)
Light water reactors with a denatured thorium fuel cycle
International Nuclear Information System (INIS)
1978-05-01
Discussed in this paper is the performance of denatured thorium fuel cycles in PWR plants of conventional design, such as those currently in operation or under construction. Although some improvement in U 3 O 8 utilization is anticipated in PWRs optimized explicitly for the denatured thorium fuel cycle, this paper is limited to a discussion of the performance of denatured thorium fuels in conventional PWRs and consequently the data presented is representative of the use of thorium fuel in existing PWRs or those presently under construction. In subsequent sections of this paper, the design of the PWR, its performance on the denatured thorium fuel cycle, safety, accident and environmental considerations, and technological status and R and D requirements are discussed
Automated methods for thorium determination in liquids, solids and aerosols
International Nuclear Information System (INIS)
Robertson, R.; Stuart, J.E.
1984-01-01
Methodology for determining trace thorium levels in a variety of sample types for compliance purposes was developed. Thorium in filtered water samples is concentrated by ferric hydroxide co-precipitation. Aerosols on glass-fibre, cellulose ester or teflon filters are acid digested and thorium is concentrated by lanthanum fluoride co-precipitation. Chemical separation and measurement are then done on a Technicon AAII-C auto-analyzer via TTA-solvent extraction and colorimetry using the thorium-arsenazo III colour complex. Solid samples are acid digested and thorium is concentrated and separated using lanthanum fluoride co-precipitation followed by anion-exchange chromatography. Measurement is then carried out on the autoanalyzer by direct development of the thorium-arsenazo III colour complex. Chemical yields are determined through the addition of thorium-234 tracer with assay by gamma-ray spectrometry. The sensitivities of the methods for liquids, aerosols and solids are approximately 1μg/L,0.5μg and 0.5 μg/g respectively. At thorium levels about ten times the detection limits, accuracy and reproducibility are typically +-10 percent for liquids and aerosols and +- 15 percent for solid samples
International Nuclear Information System (INIS)
Hirose, Katsumi; Tanque, Eiichiro
1994-01-01
The interaction between thorium and oceanic particulate matter was examined experimentally by using chemical equilibrium techniques. Thorium reacts quantitatively with the organic binding site of Particulate Matter (PM) in 0.1 mol/L HCl solution by complexation, which is equilibrated within 34 h. According to mass balance analysis, thorium forms a 1:1 complex with the organic binding site in PM, whose conditional stability constant is 10 6.6 L/mol. The Th adsorption ability is present even in 6.9 mol/L HCl solution although the amount of Th adsorption decreases with increasing acidity in the solution. Interferences to Th adsorption by Fe(III) suggests that other metals cannot react with PM in more than 0.1 mol/L HCl solutions when concentrations of other metals are the same level of Th. The competitive reaction between Th and Fe(III) occurs in higher Fe concentrations, which means that the organic binding site is nonspecific for Th. A vertical profile of Th complexing capacity of PM in the western North Pacific is characterized; that is, the Th complexing capacity shows a surface maximum and decreases rapidly with depth
Chemistry of titanium, zirconium and thorium picramates
International Nuclear Information System (INIS)
Srivastava, R.S.; Agrawal, S.P.; Bhargava, H.N.
1976-01-01
Picramates of titanium, zirconium and thorium are prepared by treating the aqueous sulphate, chloride and nitrate solutions with sodium picramate. Micro-analysis, colorimetry and spectrophotometry are used to establish the compositions (metal : ligand ratio) of these picramates as 1 : 2 (for titanium and zirconium) and 1 : 4 (for thorium). IR studies indicate H 2 N → Me coordination (where Me denotes the metal). A number of explosive properties of these picramates point to the fact that the zirconium picramate is thermally more stable than the picramates of titanium and thorium. (orig.) [de
Measurement of thorium content in gas mantles produced in India
Energy Technology Data Exchange (ETDEWEB)
Gaur, P K [Bhabha Atomic Research Centre, Mumbai (India). Radiological Physics Div.; Chury, A J; Venkataraman, G [Bhabha Atomic Research Centre, Mumbai (India). Radiation Protection Services Div.
1994-04-01
Incandescent gas mantles, processed with thorium nitrate, were monitored for thorium content, using a 2 inch thick Nal(Tl) detector and detecting medium energy gamma radiations emitted by thorium daughters. Thirty different brands, manufactured in the country have been counted and most of them were found to contain thorium within the permissible limit specified by Atomic Energy Regulatory Board (AERB). (author). 5 refs., 1 fig., 3 tabs.
Moving towards sustainable thorium fuel cycles
International Nuclear Information System (INIS)
Hyland, B.; Hamilton, H.
2011-01-01
The CANDU reactor has an unsurpassed degree of fuel-cycle flexibility as a consequence of its fuel-channel design, excellent neutron economy, on-power refueling, and simple fuel bundle design. These features facilitate the introduction and full exploitation of thorium fuel cycles in CANDU reactors in an evolutionary fashion. Thoria (ThO 2 ) based fuel offers both fuel performance and safety advantages over urania (UO 2 ) based fuel, due its higher thermal conductivity which results in lower fuel-operating temperatures at similar linear element powers. Thoria fuel has demonstrated lower fission gas release than UO 2 under similar operating powers during test irradiations. In addition, thoria has a higher melting point than urania and is far less reactive in hypothetical accident scenarios owing to the fact that it has only one oxidation state. This paper examines one possible strategy for the introduction of thorium fuel cycles into CANDU reactors. In the short term, the initial fissile material would be provided in a heterogeneous bundle of low-enriched uranium and thorium. The medium term scenario uses homogeneous Pu/Th bundles in the CANDU reactor, further increasing the energy derived from the thorium. In the long term, the full energy potential from thorium would be realized through the recycle of the U-233 in the used fuel. With U-233 recycle in CANDU reactors, plutonium would then only be required to top up the fissile content to achieve the desired burnup. (author)
Interaction between thorium and potential clad materials
International Nuclear Information System (INIS)
Kale, G.B.; Gawde, P.S.; Sengupta, Pranesh
2005-01-01
Thorium based fuels are being used for nuclear reactors. The structural stability of fuel-clad assemblies in reactor systems depend upon the nature of interdiffusion reaction between fuel-cladding materials. Interdiffusion reaction thorium and various cladding materials is presented in this paper. (author)
Environmental and radiological aspects of thorium processing in India
International Nuclear Information System (INIS)
Rudran, Kamala; Paul, A.C.; Pillai, P.M.B.; Saha, S.C.; Vidyasagar, D.; Sawant, Pramilla D.
1997-01-01
India has an active programme for using thorium as third stage self- sustaining nuclear fuel. A significant amount of thorium is also used in the gas mantle industry. The presently estimated monazite deposits amounting to five million tonnes are distributed in the beach sands of south western and eastern coasts and some areas in Andhra Pradesh. The sands are processed for recovery of rare earth minerals and thorium. The mineral processing and thorium separation involves hazards to workers from exposure to radiation, radioactive and silica bearing dusts as well as from conventional chemicals used in the processing. Releases of wastes from the plants may necessitate environmental surveillance. The present paper reviews the hazards envisaged, steps taken to mitigate such hazards and achievements in this regard in the thorium industry in India. (author)
Large-scale nuclear energy from the thorium cycle
International Nuclear Information System (INIS)
Lewis, W.B.; Duret, M.F.; Craig, D.S.; Veeder, J.I.; Bain, A.S.
1973-02-01
The thorium fuel cycle in CANDU (Canada Deuterium Uranium) reactors challenges breeders and fusion as the simplest means of meeting the world's large-scale demands for energy for centuries. Thorium oxide fuel allows high power density with excellent neutron economy. The combination of thorium fuel with organic caloporteur promises easy maintenance and high availability of the whole plant. The total fuelling cost including charges on the inventory is estimated to be attractively low. (author) [fr
Extraction of thorium from solution using tribenzylamine
International Nuclear Information System (INIS)
Whitehead, N.E.; Ditchburn, R.G.
1975-01-01
A method is described for isolating thorium from solutions in a state sufficiently pure for alpha spectroscopy. It parallels the method described by Moore and Thern (Radiochemical Radioanalytical Letters 19(2), 117-125, 1974), but uses tribenzylamine instead of Adogen 364. The method involves extracting thorium from a solution in 8M nitric acid, into a 6% w/v solution of tribenzylamine in toluene. The thorium is concentrated in a third, interfacial layer which forms. This layer is isolated, diluted with chloroform, and back extracted with 10M HC1. Overall yields range between 83 and 90% for one extraction. The acidic solution is taken down to near dryness, diluted until the pH is 2 and extracted into 1.2 ml of thenoyltrifluoroacetone in toluene. This solution is evaporated onto a stainless steel disk, flamed, and the disk may be used for alpha spectroscopy of thorium isotopes. (auth.)
The environmental behaviour of uranium and thorium
International Nuclear Information System (INIS)
Sheppard, M. I.
1980-08-01
Uranium and thorium have had many uses in the past, and their present and potential use as nuclear fuels in energy production is very significant. Both elements, and their daughter products, are of environmental interest because they may have effects from the time of mining to the time of ultimate disposal of used nuclear fuel. To assess the impact on the environment of man's use and disposal of uranium and thorium, we must know the physical, chemical and biological behaviour of these elements. This report summarizes the literature, updating and extending earlier reviews pertaining to uranium and thorium. The radiological properties, chemistry, forms of occurrence in nature, soil interactions, as well as distribution coefficients and mode of transport are discussed for both elements. In addition, uranium and thorium concentrations in plants, plant transfer coefficients, concentrations in soil organisms and methods of detection are summarized. (auth)
Environmental control technology for mining, milling, and refining thorium
International Nuclear Information System (INIS)
Weakley, S.A.; Blahnik, D.E.; Young, J.K.; Bloomster, C.H.
1980-02-01
The purpose of this report is to evaluate, in terms of cost and effectiveness, the various environmental control technologies that would be used to control the radioactive wastes generated in the mining, milling, and refining of thorium from domestic resources. The technologies, in order to be considered for study, had to reduce the radioactivity in the waste streams to meet Atomic Energy Commission (10 CFR 20) standards for natural thorium's maximum permissible concentration (MPC) in air and water. Further regulatory standards or licensing requirements, either federal, state, or local, were not examined. The availability and cost of producing thorium from domestic resources is addressed in a companion volume. The objectives of this study were: (1) to identify the major waste streams generated during the mining, milling, and refining of reactor-grade thorium oxide from domestic resources; and (2) to determine the cost and levels of control of existing and advanced environmental control technologies for these waste streams. Six potential domestic deposits of thorium oxide, in addition to stockpiled thorium sludges, are discussed in this report. A summary of the location and characteristics of the potential domestic thorium resources and the mining, milling, and refining processes that will be needed to produce reactor-grade thorium oxide is presented in Section 2. The wastes from existing and potential domestic thorium oxide mines, mills, and refineries are identified in Section 3. Section 3 also presents the state-of-the-art technology and the costs associated with controlling the wastes from the mines, mills, and refineries. In Section 4, the available environmental control technologies for mines, mills, and refineries are assessed. Section 5 presents the cost and effectiveness estimates for the various environmental control technologies applicable to the mine, mill, and refinery for each domestic resource
International Nuclear Information System (INIS)
Seneda, Jose Antonio
2006-01-01
Brazil has a long tradition in thorium technology, from mineral dressing (monazite) to the nuclear grade thorium compounds. The estimate reserves are 1200,000. ton of ThO 2 . As a consequence from the work of thorium purification pilot plant at Instituto de Pesquisas Energeticas e Nucleares-CNEN/IPEN-SP, about 25 ton of a sludge containing thorium and rare earths was accumulated. It comes as a raffinate and washing solutions from thorium solvent extraction. This sludge, a crude hydroxide named RETOTER contains thorium, rare earths and minor impurities including the radiogenic lead-208, with abundance 88.34 %. This work discusses the results of the studies and main parameters for its recovery by anionic ion exchange technique in the hydrochloric system. The isotope abundance of this lead was analyzed by high resolution mass spectrometer (ICPMS) and thermoionic mass spectrometer (TIMS) and the data was used to calculate the thermal neutron capture cross section. The value of σγ 0 = 14.6±0.7 mb was found, quite different from the σγ 0 = 174.2 ± 7.0 mb measure cross section for the natural lead. Preliminary study for the thorium and rare earths separation and recovery was discussed as well. (author)
The possibility of precipitating thorium soap from aqueous solutions
International Nuclear Information System (INIS)
Drathen, H.
1975-01-01
The purpose of the analysis was firstly to determine the precipitation process of thorium with soap and the influence of foreign ions, secondly to explain the conditions for the best method of decontaminating waste waters contaminated by thoriuum. The result was that if thorium is precipitated with soap both thorium soaps and thorium hydroxide are formed. The proportion of each substance depends considerably upon the pH value. All the precipitation compounds exist independently. No adsorption or mixed crystal formation took place. By adding bivalent or multivalent cations the one-step decontamination factor increases to more than 20. Quantitatively, the decontamination of thorium contaminated waste waters can be carried out down to a thorium concentration of 10 -5 mol/1. Technical soaps provide the least expensive solution without displaying any qualitative disadvantages. The only disadvantage is that this method cannot be used continuously. Therefore ion exchangers provide a great advantage, although they are very expensive and have a limited capacity. The best solution, then, is a combination of ion exchangers and precipitation with soap. (orig.) [de
Neutronics assessment of thorium-based fuel assembly in SCWR
International Nuclear Information System (INIS)
Liu, Shichang; Cai, Jiejin
2013-01-01
Highlights: • A novel thorium-based fuel assembly for SCWR has been introduced and investigated. • Neutronic properties of three thorium fuels have been studied, compared with UO 2 fuel. • The thorium-based fuel has advantages on fuel utilization and lower MAs generation. -- Abstract: Aiming to take advantage of neutron spectrum of SCWR, a novel thorium-based fuel assembly for SCWR is introduced in this paper. The neutronic characteristics of the introduced fuel assembly with three different thorium fuel types have been investigated using the “dragon” codes. The parameters in different working conditions, such as infinite multiplication factors, radial power peaking factor, temperature coefficient of reactivity and their relation with the operation period have been assessed by comparing with conventional uranium assembly. Moreover, the moderator-to-fuel ratio (MFR) was changed in order to investigate its influence on the neutronic characteristics of fuel assembly. Results show that the thorium-based fuel has advantages on both efficient fuel utilization and lower minor actinide generation, with some similar neutronic properties to the uranium fuel
Gravimetric determination of uranium(VI) and thorium(IV) with substituted pyrazolones
International Nuclear Information System (INIS)
Arora, H.C.; Rao, G.N.
1981-01-01
4-Acylpyrazolones like 1-phenyl-3-methyl-4-benzoyl-5-pyrazolone (PMBP), 1-phenyl-3-methyl-4-p-nitrobenzoyl-5-pyrazolone (PMNP) and 1-phenyl-3-methyl-4-(3,5 dinitrobenzoyl)-5-pyrazolone (PMDP) have been synthesized and developed as gravimetric reagents for the determination of U(VI) and Th(IV). Uranium(VI) is almost quantitatively precipitated with PMBP, PMNP, and PMDP at pH 2.20, 1.85 and 1.70 respectively. The pH values for the complete precipitation of thorium(IV) with PMBP, PMNP and PMDP are 2.90, 2.75 and 2.50 respectively. PMBP has proved to be an efficient ligand for gravimetric determination of U(VI) by direct weighing method after drying at 100 +- 10 deg C. The percentage relative error varies from 0.4 to 1.6 in the determination of U(VI) by this method. The effect of a number of interfering ions on the precipitation of U(VI) by PMBP has been reported. (author)
Determination of microquantities of zirconium and thorium in uranium dioxide
International Nuclear Information System (INIS)
Weber de D'Alessio, Ana; Zucal, Raquel.
1975-07-01
A method for the determination of 10 to 50 ppm of zirconium and thorium in uranium IV oxide of nuclear purity is established. Zirconium and thorium are retained in a strong cation-exchange resin Dowex 50 WX8 in 1 M HCl. Zirconium is eluted with 0,5% oxalic acid solution and thorium with 4% ammonium oxalate. The colorimetric determination of zirconium with xilenol orange is done in perchloric acid after destructtion of oxalic acid and thorium is determined with arsenazo III in 5 M HCl. 10 μg of each element were determined with a standard deviation of 2,1% for thorium and 3,4% for zirconium. (author) [es
Possible types of breeders with thorium cycle
International Nuclear Information System (INIS)
Ishiguro, Y.; Gouveia, A.S. de
1981-01-01
Neutronics calculations of simplified homogeneous reactor models show the possibility that metal-fueled LMFBRs and coated particle fueled gas cooled reactors achieve doubling times of around 10 years with the thorium cycle. Three concepts of gas-cooled thorium cycle breeders are discussed. (Author) [pt
Possible types of breeders with thorium cycle
International Nuclear Information System (INIS)
Ishiguro, Y.; Gouveia, A.S. de.
1981-02-01
Neutronics calculations of simplified homogeneous reactor models show the possibility that metal-fueled LMFBRs and coated particle fueled gas cooled reactors achieve reactor doubling times of around 10 years with the thorium cycle. Three concepts of gas-cooled thorium cycle breeders are discused. (Author) [pt
International Nuclear Information System (INIS)
Seneda, Jose Antonio
2006-01-01
Brazil has a long tradition in thorium technology, from mineral dressing (monazite) to the nuclear grade thorium compounds. The estimate reserves are 1200,000. ton of ThO 2 . As a consequence from the work of thorium purification pilot plant at Instituto de Pesquisas Energeticas e Nucleares-CNEN/SP, about 25 ton of a sludge containing thorium and rare earths was accumulated. It comes as a raffinate and washing solutions from thorium solvent extraction. This sludge, a crude hydroxide named RETOTER contains thorium, rare earths and minor impurities including the radiogenic lead-208, with abundance 88.34 %. This work discusses the results of the studies and main parameters for its recovery by anionic ion exchange technique in the hydrochloric system. The isotope abundance of this lead was analyzed by high resolution mass spectrometer (ICPMS) and thermoionic mass spectrometer (TIMS) and the data was used to calculate the thermal neutron capture cross section. The value of s ? o = 14.6 +/- 0.7 mb was found, quite different from the s ? o = 174.2 +/- 7.0 mb measure cross section for the natural lead. Preliminary study for the thorium and rare earths separation and recovery was discussed as well. (author)
Thorium contents in soils, vegetables, cereals, and fruits
International Nuclear Information System (INIS)
Frindik, O.
1989-01-01
Thorium contents (α-activities of the naturally occurring isotopes Th-228, Th-230, and Th-232) were detrmined in soils, vegetables, cereals, and fruits. The thorium content of plants depends on the degree of contamination by soil resuspension and thus on the specific surface of the plants. The activity of the isotope Th-230 is almost the same as that of the main isotope Th-232. Th-228, with about the same activity as Th-232 in soil, increases to about 10-fold the activity in vegetables, 29-fold in sweet chestnuts and 740-fold in Brazil nuts. Thorium concentration factors from the soil to these vegetable products are calculated; they include the total concentration, not only the soluble portion of thorium. (orig.) [de
Recovery of lead-208 radiogenic of residues of thorium with rare earth
International Nuclear Information System (INIS)
Ferreira, J.C.; Freitas, A.A. de; Seneda, J.A.F.; Carvalho, M.S. de; Abrao, A.
2008-01-01
In the middle of the years 1970 in IPEN, considerable work for the purification and conversion of uranium and thorium project, the production of thorium nitrate, a pilot scale from different compounds of Thorium was accomplished; This installation of thorium nitrate produced for national marketing, given the industry of incandescent lighting gas mangles.. The method used by this installation was the purification by solvent extraction with pulsed columns. The thorium was in the organic phase, which was reversed as of thorium nitrate with a high degree of purity. The aqueous phase of this chemical process, containing impurities, some not extracted thorium and virtually all rare earths was precipitated in the form of a hydroxide. This was called RETOTER hydroxide (residue of Thorium and Rare Earth). This residue containing thorium, rare earth and some impurities such as lead-208 product of the decay of thorium-232 were stored in the shed of safeguarding IPEN for further recovery of thorium and rare earth. In this work was studied the recovery of lead-208, nuclear material of interest, separating it by the technique of cementation , where it adds zinc metallic to an acid solution of RETOTER, holding up the lead on the surface of the metallic zinc. (author)
An evaluation of once-through homogeneous thorium fuel cycle for light water reactors
International Nuclear Information System (INIS)
Joo, H. K.; Noh, J. M.; Yoo, J. W.
2002-01-01
The other ways enhancing the economic potential of thorium fuel has been assessed ; the utilization of lower enriched uranium in thorium-uranium fuel, duplex thorium fuel concept, thorium utilization in the mixed core with uranium fuel assembly and thorium blanket utilization in the uranium core. The fuel economics of the proposed ways of thorium fuel increased compared to the previous homogeneous thorium fuel cycle. Compared to uranium fuel cycle, however, they do not show any economic incentives. From the view of proliferation resistance potential, thorium fuel option has the advantage to reduce the inventory of plutonium production. Any of proposed thorium options are less economical than uranium fuel option, the thorium fuel option has the potential to be utilized in the future for the sake of the effective consumption of excessive plutonium and the preparation against the using up of uranium resource
Radkowsky Thorium Fuel Project
International Nuclear Information System (INIS)
Todosow, Michael
2006-01-01
In the early/mid 1990's Prof. Alvin Radkowsky, former chief scientist of the U.S. Naval Reactors program, proposed an alternate fuel concept employing thorium-based fuel for use in existing/next generation pressurized water reactors (PWRs). The concept was based on the use of a 'seed-blanket-unit' (SBU) that was a one-for-one replacement for a standard PWR assembly with a uranium-based central 'driver' zone, surrounded by a 'blanket' zone containing uranium and thorium. Therefore, the SBU could be retrofit without significant modifications into existing/next generation PWRs. The objective was to improve the proliferation and waste characteristics of the current once-through fuel cycle. The objective of a series of projects funded by the Initiatives for Proliferation Prevention program of the U.S. Department of Energy (DOE-IPP) - BNL-T2-0074,a,b-RU 'Radkowsky Thorium Fuel (RTF) Concept' - was to explore the characteristics and potential of this concept. The work was performed under several BNL CRADAs (BNL-C-96-02 and BNL-C-98-15) with the Radkowsky Thorium Power Corp./Thorium Power Inc. and utilized the technical and experimental capabilities in the Former Soviet Union (FSU) to explore the potential of this concept for implementation in Russian pressurized water reactors (VVERs), and where possible, also generate data that could be used for design and licensing of the concept for Western PWRs. The Project in Russia was managed by the Russian Research Center-?'Kurchatov Institute' (RRC-KI), and included several institutes (e.g., PJSC 'Electrostal', NPO 'LUCH' (Podolsk), RIINM (Bochvar Institute), GAN RF (Gosatomnadzor), Kalininskaja NPP (VVER-1000)), and consisted of the following phases: Phase-1 ($550K/$275K to Russia): The objective was to perform an initial review of all aspects of the concept (design, performance, safety, implementation issues, cost, etc.) to confirm feasibility/viability and identify any 'show-stoppers'; Phase-2 ($600K/$300K to Russia
Health status and body radioactivity of former thorium workers
International Nuclear Information System (INIS)
Stehney, A.F.; Polednak, A.P.; Rundo, J.; Brues, A.M.; Lucas, H.F. Jr.; Patten, B.C.; Rowland, R.E.
1981-01-01
The objectives of the study are: (1) to assess possible health effects of employment in the thorium milling industry by comparison of mortality and morbidity characteristics of former thorium workers with those of suitable general populations; (2) to examine disease outcomes by estimated exposure levels of thorium and thoron daughter products for possible radiation-related effects; and (3) to determine the body distribution of inhaled thorium (and daughters) and rare earths in humans by radioactivity measurements in vivo and by analysis of autopsy samples. The principal end points for investigation are respiratory disease and cancers of lung, liver, bone, and bone marrow
International Nuclear Information System (INIS)
Miyake, Masanobu; Katsura, Masahiro; Matsuki, Yuichi; Uno, Masayoshi
1983-01-01
Powdered thorium is usually prepared through a combination of hydriding and dehydriding processes of metallic thorium in massive form, in which the hydriding process consists of two steps: the formation of ThH 2 , and the formation of Th 4 H 15 . However, little has yet been known as to on what stage of hydriding process the pulverization takes place. It is found in the present study that the formation of Th 4 H 15 by the reaction of ThH 2 with H 2 is responsible for pulverization. Temperature of 70 deg C adopted in this work for the reaction of formation Th 4 H 15 seems to be much more effective for production of powdered thorium than 200 - 300 deg C in the literature. The pressure-composition-temperature relationships for Th-H system are determined at 200, 300, 350, and 800 deg C. From these results, a tentative equilibrium phase diagram for the Th-H system is proposed, attention being focused on the two-phase region of ThH 2 and Th 4 H 15 . Pulverization process is discussed in terms of the tentative phase diagram. (author)
Determination of Uranium and Thorium in Drinking and Seawater
International Nuclear Information System (INIS)
Rozmaric Macefat, M.; Gojmerac Ivsic, A.; Grahek, Z.; Barisic, D.
2008-01-01
Uranium and thorium are the first members of natural radioactive chain which makes their determination in natural materials interesting from geochemical and radioecological aspect. They are quantitatively determined as elements by spectrophotometric method and/or their radioisotopes by alpha spectrometry and ICP-MS. It is necessary to develop inexpensive, rapid and sensitive methods for the routine researches because of continuous monitoring of the radioactivity level. Development of a new method for the isolation of uranium and thorium from liquid samples and subsequent spectrophotometric determination is described in this paper. It is possible to isolate uranium and thorium from drinking and seawater using extraction chromatography or ion exchange chromatography. Uranium and thorium can be strongly bound on the TRU extraction chromatographic resin from 3 mol dm -3 HNO 3 (chemical recovery is 100 percent) and separated from other interfering elements (sodium, potassium, calcium, strontium etc). Their mutual separation is possible by using anion exchanger Amberlite CG-400 (NO 3 - form). From alcoholic solutions of nitric acid thorium can be strongly bound on the anion exchanger while uranium is much more weakly bound which enables its separation from thorium. After the separation, uranium and thorium are determined by spectrophotometric method with arsenazo III at 652 nm and 662 nm respectively. Developed method enables selection of the optimal mode of isolation for the given purposes.(author)
Thorium fuels for heavy water reactors. Romanian experience
International Nuclear Information System (INIS)
Glodeanu, F.; Mirion, I.; Mehedinteanu, S.; Balan, V.
1984-01-01
The renewed interest in thorium fuel cycle due to the increased demand for fissile materials has resulted in speeding up the related research and development activities. For heavy water reactors the thorium cycles, especially SSET, are very promising and many efforts are made to demonstrate their feasibility. In our country, at INPR, the research and development activity has been initiated in the following areas: the conceptual design of thorium bearing fuel elements; fuel modelling; nuclear grade thorium dioxide powder technology; mixed oxide fuel technology. In the design area, the key factors in performance limitation, especially at extended burnup have been accounted and different remedies proposed. An irradiation programme has been settled and will start this year. The modelling activities are focused on mixed oxide behaviour and material data measurements are in progress. In the nuclear grade thorium powder technology area, a good piece of work has been done to develop an integrated technology for monasite processing (thorium being a by-product in lanthanides extraction). As regards the mixed oxide fuel technology, efforts have been made to obtain (ThU)O 2 pellets with good homogeneity and high density at different compositions. Besides the mixing powders route, other non-conventional technologies for refabrication like: microspheres, pellet impregnation and clay extrusion are studied. Experimental fuel rods for irradiation testing have been manufactured. (author)
On the radiology of thorium-uranium electro breeding
International Nuclear Information System (INIS)
Gai, E.V.; Rabotnov, N.S.; Shubin, Y.N.
1995-01-01
Radiological problems arising in thorium-uranium electro-breeding with thorium accelerator target are discussed. Following radiological problems are discussed and evaluated in simplified model calculations: U-232 formation, accumulation of light Th isotopes in (n, xn) reactions on thorium target: accumulation of the same nuclides in final repository after alpha-decay of uranium isotopes. The qualitative comparison of U-Pu and U-Th fuel cycles is performed. The problems seem to be serious enough to justify detailed quantitative investigation. (authors)
International Nuclear Information System (INIS)
Tsuruta, T.
2006-01-01
The effects of proton, thorium and uranium on the bioaccumulation of thorium and uranium from the solution (pH 3.5) containing uranium and thorium using Streptomyces levoris cells were examined. The amount of thorium accumulated using the cells decreased by the pre-contact between the cells and the solution (pH 3.5) containing no metals, whereas that of uranium was almost unaffected by the treatment. The amount of thorium was almost unaffected by the existence of uranium. On the other hand, the amount of uranium accumulated was strongly affected by the thorium, especially thorium addition after uranium accumulation. The decrease of uranium accumulated by the addition of thorium after the accumulation of uranium was higher than that from the solution containing both elements. Therefore, the contribution of uranium-thorium exchange reaction was higher than that of competition reaction. Accordingly, proton-uranium-thorium exchange reaction was occurred in the accumulation of thorium from the solution containing thorium and uranium. The gram-positive bacteria, such as Micrococcus luteus, Arthrobacter nicotianae, Bacillus subtilis and B. megaterium, has a much higher separation factor as thorium/uranium than that of actinomycetes. These gram-positive bacterial strains can be used for the accumulation of thorium from the solution containing uranium and thorium
Vil løyse global energikrise med thorium
Aure, Gyri
2007-01-01
A professor from Bergen claims thorium can contribute to save the world from a global energy crisis. He wants Norway to construct the first accelerator driven reactor in the world powered by thorium. (5 pages)
Immobilization of thorium over fibroin by polyacrylonitrile (PAN)
International Nuclear Information System (INIS)
Aslani, M.A.A.; Akyil, S.; Eral, M.
1997-01-01
This report describes a process for immobilization of thorium over fibroin, which was used as a bio-adsorbant, by polyacrylonitrile. The amounts of thorium in aqueous solutions which may be leached in various aqueous ambients were detected by a spectrophotometer. The results show that polyacrylonitrile processes are feasible to immobilize spent fibroins. The leachability of the materials immobilized with polyacrylonitrile can meet the requirements of storage and final disposal. The leachability of thorium ions from immobilized spent fibroin was rather low for 8 months
Growth scenarios with thorium fuel cycles in pressurised heavy water reactors
International Nuclear Information System (INIS)
Balakrishnan, M.R.
1991-01-01
Since India has generous deposits of thorium, the availability of thorium will not be a limiting factor in any growth scenario. It is fairly well accepted that the best system for utilisation of thorium is the heavy water reactor. The growth scenarios possible using thorium in HWRs are considered. The base has been taken as 50,000 tons of natural uranium and practically unlimited thorium. The reference reactor has been assumed to be the PHWR, and all other growth scenarios are compared with the growth scenario provided by the once-through natural cycle in the PHWR. Two reactor types have been considered: the heavy water moderated, heavy water cooled, pressure tube reactor, known as the PHWR; and the heavy water moderated and cooled pressure vessel kind, similar to the ATUCHA reactor in Argentina. For each reactor, a number of different fuel cycles have been studied. All these cycles have been based on thorium. These are: the self-sustaining equilibrium thorium cycle (SSET); the high conversion ratio high burnup cycle; and the once through thorium cycle (OTT). The cycle have been initiated in two ways: one is by starting the cycle with natural uranium, reprocessing the spent fuel to obtain plutonium, and use that plutonium to initiate the thorium cycle; the other is to enrich the uranium to about 2-3% U-235 (the so-called Low Enriched Uranium or LEU), and use the LEU to initiate the thorium cycle. Both cases have been studied, and growth scenarios have been projected for every one of the possible combinations. (author). 1 tab
Production of thorium nitrate from uranothorianite ores
International Nuclear Information System (INIS)
Brodsky, M.; Sartorius, R.; Sousseuer, Y.
1959-01-01
The separation of thorium and uranium from uranothorianite ores, either by precipitation or solvent-extraction methods, are discussed, and an industrial process for the manufacture of thorium nitrate is described. Reprint of a paper published in 'Progress in Nuclear Energy' Series III, Vol. 2 - Process Chemistry, 1959, p. 68-76 [fr
Road-map design for thorium-uranium breeding recycle in PWR - 031
International Nuclear Information System (INIS)
Shengyi, Si
2010-01-01
The paper was focused on designing a road-map to finally approach sustainable Thorium-Uranium ( 232 Th- 233 U) Breeding Recycle in current PWR, without any other change to the fuel lattice and the core internals, but substituting the UOX pellet with Thorium-based pellet. At first, the paper presented some insights to the inherence of Thorium-Uranium fuel conversion or breeding in PWR based on the neutronics theory and revealed the prerequisites for Thorium-Uranium fuel in PWR to achieve sustainable Breeding Recycle; And then, various Thorium-based fuels were designed and examined, and the calculation results further validated the above theoretical deductions; Based on the above theoretical analysis and calculation results, a road-map for sustainable Thorium-Uranium breeding recycle in PWR was outlined finally. (authors)
A proposal for rational thorium utilization: thorims-nes
International Nuclear Information System (INIS)
Kurukawa, K.; Erbay, L. B.
1997-01-01
In this study, a globally applicable system depending on a new philosophy has been introduced for solving the problems connected with nuclear safety, ratio-waste, anti-nuclear proliferation and terrorism and public/institutional acceptance and economy. This rational thorium breeding fuel-cycle system named as THORIMS-NES (Thorium Molten- Salt Nuclear Energy Synergetics ) appears to be particularly promising and can be the way of nuclear power development. THORIMS-NES depends on three principles: I. Thorium utilization, II. Application of molten-fluoride fuel technology and III. Separation of fissile producing breeders and power producing reactors. Thorium fuel cycle has benefit on the reduction of trans-U elements and for recycling fuels produced by all kinds of military, research and industrial reactors. A system for the realization of THORIMS-NES has been introduced by the explanation of connections/relations between facilities. In this study, the status of countries/groups working on Th and Th fuel cycle has been summarized. Additionally, the resultant announcement of the International Conference on Thorium Molten Salt Reactor Development (8-11 April, 1997, Santa Monica) has been mentioned to present the cooperation of scientists and engineers for the realization of THORIMS-NES
The influence of different hydroponic conditions on thorium uptake by Brassica juncea var. foliosa.
Wang, Dingna; Zhou, Sai; Liu, Li; Du, Liang; Wang, Jianmei; Huang, Zhenling; Ma, Lijian; Ding, Songdong; Zhang, Dong; Wang, Ruibing; Jin, Yongdong; Xia, Chuanqin
2015-05-01
The effects of different hydroponic conditions (such as concentration of thorium (Th), pH, carbonate, phosphate, organic acids, and cations) on thorium uptake by Brassica juncea var. foliosa were evaluated. The results showed that acidic cultivation solutions enhanced thorium accumulation in the plants. Phosphate and carbonate inhibited thorium accumulation in plants, possibly due to the formation of Th(HPO4)(2+), Th(HPO4)2, or Th(OH)3CO3 (-) with Th(4+), which was disadvantageous for thorium uptake in the plants. Organic aids (citric acid, oxalic acid, lactic acid) inhibited thorium accumulation in roots and increased thorium content in the shoots, which suggested that the thorium-organic complexes did not remain in the roots and were beneficial for thorium transfer from the roots to the shoots. Among three cations (such as calcium ion (Ca(2+)), ferrous ion (Fe(2+)), and zinc ion (Zn(2+))) in hydroponic media, Zn(2+) had no significant influence on thorium accumulation in the roots, Fe(2+) inhibited thorium accumulation in the roots, and Ca(2+) was found to facilitate thorium accumulation in the roots to a certain extent. This research will help to further understand the mechanism of thorium uptake in plants.
A review on the status of development in thorium-based nuclear fuels
International Nuclear Information System (INIS)
Lee, Young Woo; Na, S. H.; Lee, Y. W.; Kim, H. S.; Kim, S. H.; Joung, C.Y.
2000-02-01
Thorium as an alternative nuclear energy source had been widely investigated in the 1950s-1960s because it is more abundant than uranium, but the studies of thorium nuclear fuel cycle were discontinued by political and economic reasons in the 1970s. Recently, however, renewed interest was vested in thorium-based nuclear fuel cycle because it may generate less long-lived minor actinides and has a lower radiotoxicity of high level wastes after reprocessing compared with the thorium fuel cycle. In this state-of the art report, thorium-based nuclear cycle. In this state-of the art report, thorium-based nuclear fuel cycle and fuel fabrication processes developed so far with different reactor types are reviewed and analyzed to establish basic technologies of thorium fuel fabrication which could meet our situation. (author)
An assessment of once-through homogeneous thorium fuel economics for light water reactors
International Nuclear Information System (INIS)
Joo, Hyung Kook; Noh, Jae Man; Yoo, Jae Woon
2001-01-01
The fuel economics of an once-through homogeneous thorium fuel concept for PWR was assessed by doing a detailed core analysis. In addition to this, the fuel economics assessment was also performed for two other ways enhancing the economic potential of thorium fuel; thorium utilization in the mixed core with uranium fuel assembly and Duplex thorium fuel concepts. As a results of fuel economics assessment, the thorium fuel cycle does not show any economic incentives in preference to uranium fuel cycle under the 18-months fuel cycle for PWR. However, the utilization of thorium is the mixed core with uranium fuel assembly and Duplex thorium fuel cycle and show superior fuel economics to uranium fuel under the longer fuel cycle scheme. The economic potential of once-through thorium fuel cycle is expected to be increased further by utilizing the Duplex thorium fuel in the mixed core with uranium fuel assembly
International Nuclear Information System (INIS)
Fakhi, S.
1988-01-01
This work concerns essentially the potential applications of 100 kW nuclear reactor of Strasbourg Nuclear Research Centre to neutron activation analysis of Uranium and Thorium. The Uranium dosing has been made using: 239-U, 239-Np, fission products or delayed neutrons. Thorium has been showed up by means of 233-Th or 233-Pa. The 239-U and 233-Th detection leads to a rapid and non-destructive analysis of Uranium and Thorium. The maximum sensitivity is of 78 ng for Uranium and of 160 ng for Thorium. The Uranium and Thorium dosing based on 239-Np and 233-Pa detection needs chemical selective separations for each of these radionuclides. The liquid-liquid extraction has permitted to elaborate rapid and quantitative separation methods. The sensitivities of the analysis after extraction reach 30 ng for Uranium and 50 ng for Thorium. The fission products separation study has allowed to elaborate the La, Ce and Nd extractions and its application to the Uranium dosing gives satisfying results. A rapid dosing method with a sensitivity of 0.35 microgramme has been elaborated with the help of delayed neutrons measurement. These different methods have been applied to the Uranium and Thorium dosing in samples coming from Oklo mine in Gabon. The analyses of these samples by atomic absorption spectroscopy and by the proton induced X-ray emission (PIXE) method confirm that the neutron activation analysis methods are reliable. 37 figs., 14 tabs., 50 refs
The thorium fuel cycle in water-moderated reactor systems
International Nuclear Information System (INIS)
Critoph, E.
1977-01-01
Current interest in the thorium cycle, as an alternative to the uranium cycle, for water-moderated reactors is based on two attractive aspects of its use - the extension of uranium resources, and the related lower sensitivity of energy costs to uranium price. While most of the scientific basis required is already available, some engineering demonstrations are needed to provide better economic data for rational decisions. Thorium and uranium cycles are compared with regard to reactor characteristics and technology, fuel-cycle technology, economic parameters, fuel-cycle costs, and system characteristics. There appear to be no major feasibility problems associated with the use of thorium, although development is required in the areas of fuel testing and fuel management. The use of thorium cycles implies recycling the fuel, and the major uncertainties are in the associated costs. Experience in the design and operation of fuel reprocessing and active-fabrication facilities is required to estimate costs to the accuracy needed for adequately defining the range of conditions economically favourable to thorium cycles. In heavy-water reactors (HWRs) thorium cycles having uranium requirements at equilibrium ranging from zero to a quarter of those for the natural-uranium once-through cycle appear feasible. An ''inventory'' of uranium of between 1 and 2Mg/MW(e) is required for the transition to equilibrium. The cycles with the lowest uranium requirements compete with the others only at high uranium prices. Using thorium in light-water reactors, uranium requirements can be reduced by a factor of between two and three from the once-through uranium cycle. The light-water breeder reactor, promising zero uranium requirements at equilibrium, is being developed. Larger uranium inventories are required than for the HWRs. The lead time, from a decision to use thorium to significant impact on uranium utilization (compared to uranium cycle, recycling plutonium), is some two decades
Heavy water reactors on the denatured thorium cycles
International Nuclear Information System (INIS)
1978-05-01
This paper presents preliminary technical and economic data to INFCE on the denatured U-233/Thorium fuel cycle for use in early comparisons of alternate nuclear systems. The once-through uranium fuel cycle is discussed in a companion paper. In presenting this preliminary information at this time, it is recognized that there are several other denatured thorium fuel cycles of potential interest, such as the U-235/thorium cycle which could be implemented at an earlier date. Information on these alternate cycles is currently being developed, and will be provided to INFCE when available
Preparation of microcuries of 234-thorium
International Nuclear Information System (INIS)
Suner, A.; La Gamma de Batistoni, A.M.; Botbol, J.
1974-11-01
A procedure for the preparation of microcuries of 234 Th from hydrochloric acid solutions of uranium (VI) is described. A solution of uranyl chloride in radioactive equilibrium with 234 Th (older than 6 months) and having 232 Th as carrier, is percoled through a Dowex 50 Wx8 (H + ) resin bed, wherein is absorbed 85% of Th and some uranium, which is then desorbed with 10 N HCl. The thorium remains in the column and is extracted later with a 0,025 M SO 4 H 2 plus 1 M SO 4 (NH 4 ) 2 solution. The thorium solution is freed from sulfate by precipitation with ammonia, dissolving the precipitate with 10 N HCl, whose solution is treated with Dowex 2x8 resin. The ion exchanger absorbs the anionic impurities and the thorium obtained is of high chemical and radiochemical purity. (author)
Remeasurement of thorium-230 in the pore water of Lacnor tailings
International Nuclear Information System (INIS)
Snodgrass, W.J.; Hart, D.R.
1990-02-01
A resampling of the Lacnor tailings management area was undertaken under a comprehensive quality assurance programme to establish levels of thorium 230 in pore water. A quality assurance programme was established for field sampling, sample handling and transport, and laboratory procedures and reporting. The external audit was used to evaluate analytical bias (on synthetic and field samples) and precision (by comparison of duplicate-duplicate results). Accuracy was assessed using synthetic samples. The external audit indicates that thorium 230 measurements by the main laboratory are not significantly different from the interlaboratory average within standard statistical limits. The results of the audit are based on measurement of environmental samples and known synthetic samples. This shows that present and previous measurements of thorium 230 varying from 0,1 to 150 Bq/L are valid data. A qualitative interpretation of the controls on thorium 230 geochemistry is provided in terms of control by thorium 232 and thorium dioxide(c) solid phase. Generic dose estimates for consumption of water containing thorium 230 are made but require refinement ot account for the actual pH of the drinking water and the degree of dilution of the pore water. The results of this project indicate that the performance of the laboratory that will conduct future thorium 230 measurements can be assessed satisfactorily with a smaller scale external laboratory assurance programme. The programme should include replicate samples sent to each laboratory and interlaboratory comparison on samples having high and low values of thorium 230
Thorium prospect of placer deposits in Koba area and its surroundings
International Nuclear Information System (INIS)
Ngadenin; Fd Dian Indrastomo; Widodo
2012-01-01
The objective of the present study of the thorium in placer of Koba, Central Bangka District. Bangka Belitung Province and its surrounding is to find out thorium prospect in alluvial deposits. The study method are geological and radiometrical mapping, grain counting and thorium grade analysis of pan concentrated. Result of the research reveals that lithology of the investigation area compose of meta sandstone unit with radiometric value of 35 c/s - 200 c/s, granite intrusion with radiometric value of 140-550 c/s and alluvial with radiometric value of 40-300 c/s SPP2NF. Content of monazite in the pan concentrated is approximately 7.54 %, content of thorium in pan concentrated of 1410 ppm, covered alluvial deposits of about 400 kilometers square with average thickness 3.77 meters. According to the study thorium prospect in Koba area is feasible to be Based on the type of deposit (placer) which are relatively easy to be mined at low cost, high content of monazite and thorium so that the prospect thorium Koba feasible to develop. (author)
The thorium alloys in aeronautics: from material analysis to regulation application
International Nuclear Information System (INIS)
Laroche, P.; Cazoulat, A.; Gerasimo, P.
1999-01-01
The thorium handled in aeronautics is a mixing in variable proportion of different thorium isotopes and its daughter products, but the regulation considers only two alpha emitters (Th-232 and Th-228): the thorium being considered as a natural radioactive substance, the legislation and the activities authorised are less restrictive than for artificial elements, it is a paradoxical situation because the thorium has the annual limit of intake the lowest of the regulation. (N.C.)
Study on Thorium Hidroxide and Ammonium Diuranate precipitation
International Nuclear Information System (INIS)
Damunir; Sukarsono, R; Busron-Masduki; Indra-Suryawan
1996-01-01
Thorium hydroxide and ammonium diuranate precipitation studied by the reaction of mixed thorium nitrate and uranyl nitrate using ammonium hydroxide. The purposes of this research was study of pH condition. U/Th ratio and NH 4 OH concentration on the precipitation. Mixed of thorium nitrate and uranyl nitrate 50 ml was reacted by excess ammonium hydroxide 2 - 10 M, pH 4-8, 40-80 o C of temperature and 5 - 100 % ratio of U/Th. The best of precipitation depend on thorium and uranium content on the precipitation. The experiment result for the best condition of precipitation was 25 % of ratio U/Th, pH 6 - 8, 60-80 o C of temperature, and 6 - 10 M concentration of ammonium hydroxide, was produced precipitate by 3,938 - 5,455 weight percent of mean concentration of U and 22,365-31,873 weight percent of mean concentration of Th
Thorium (IV) toxicity of green microalgae from Scenedesmus and Monoraphidium genera
International Nuclear Information System (INIS)
Queiroz, Juliana Cristina de
2009-01-01
The toxicity of thorium by two green microalgae species, Monoraphidium sp. and Scenedesmus sp was studied. During the toxicity tests, the microalgae cultures were inoculated in ASM-I culture medium in the presence and absence of thorium (cultures at pH 8.0 and 6.0 in the absence of thorium, - control - and at pH 6.0 for thorium concentrations ranging from 0.5 to 100.0 mg/L Th). Its effect was monitored by direct counting on Fuchs-Rosenthal chamber and with the help of software developed by the group during the experiments. The difference in pH value in the culture medium did not affect the growth of the microalgae, and pH 6.0 was chosen as a reference in order not to compromise solubility and speciation of thorium in solution. The toxicity of the metal over the species was observed just for thorium concentrations over 50.0 mg/L. A Monoraphidium sp. culture containing 6.25x10 5 microorganisms/mL reached a final concentration of 5.52x10 7 microorganisms/mL in the presence of thorium in the concentration of 10.0 mg/L. If we consider the 100.0 ppm thorium solution reached a final concentration of 8.57x10 6 microorganisms/mL. Control tests indicated a final concentration of 2.51x10 7 microorganisms/mL at the end of the growth. Scenedesmus sp. cells proved to be more resistant to the presence of thorium in solution. Low concentrations of the radionuclide favored the growth of these microalgae. A culture containing 7.65x10 5 microorganisms/mL reached a final concentration of 2.25x10 6 microorganisms/mL, in the absence of thorium in the medium. Toxicological tests indicated a final culture concentration of 5.87x10 6 microorganisms/mL in the presence of 0.5 mg/L thorium. The software used for comparison of direct count method proved to be very useful for the improvement of accuracy of the results obtained and a decrease in the uncertainty in counting. Beyond these advantages it also allowed recording of the data. From the present results one can conclude, that the presence
Simulation an Accelerator driven Subcritical Reactor core with thorium fuel
International Nuclear Information System (INIS)
Shirmohammadi, L.; Pazirandeh, A.
2011-01-01
The main purpose of this work is simulation An Accelerator driven Subcritical core with Thorium as a new generation nuclear fuel. In this design core , A subcritical core coupled to an accelerator with proton beam (E p =1 GeV) is simulated by MCNPX code .Although the main purpose of ADS systems are transmutation and use MA (Minor Actinides) as a nuclear fuel but another use of these systems are use thorium fuel. This simulated core has two fuel assembly type : (Th-U) and (U-Pu) . Consequence , Neutronic parameters related to ADS core are calculated. It has shown that Thorium fuel is use able in this core and less nuclear waste ,Although Iran has not Thorium reserves but study on Thorium fuel cycle can open a new horizontal in use nuclear energy as a clean energy and without nuclear waste
Thorium Nitrate Stockpile--From Here to Eternity
International Nuclear Information System (INIS)
Hermes, W. H.; Hylton, T. D.; Mattus, C.H.; Storch, S. N.; Singley, P.S.; Terry, J. W.; Pecullan, M.; Reilly, F. K.
2003-01-01
The Defense National Stockpile Center (DNSC), a field level activity of the Defense Logistics Agency (DLA) has stewardship of a stockpile of thorium nitrate that has been in storage for decades. The stockpile is made up of approximately 3.2 million kg (7 million lb) of thorium nitrate crystals (hydrate form) stored at two depot locations in the United States. DNSC sought technical assistance from Oak Ridge National Laboratory (ORNL) to define and quantify the management options for the thorium nitrate stockpile. This paper describes methodologies and results comprising the work in Phase 1 and Phase 2. The results allow the DNSC to structure and schedule needed tasks to ensure continued safe long-term storage and/or phased disposal of the stockpile
Inhalation radiotoxicity of irradiated thorium as a heavy water reactor fuel
International Nuclear Information System (INIS)
Edwards, G.W.R.; Priest, N.D.; Richardson, R.B.
2013-01-01
The online refueling capability of Heavy Water Reactors (HWRs), and their good neutron economy, allows a relatively high amount of neutron absorption in breeding materials to occur during normal fuel irradiation. This characteristic makes HWRs uniquely suited to the extraction of energy from thorium. In Canada, the toxicity and radiological protection methods dealing with personnel exposure to natural uranium (NU) spent fuel (SF) are well-established, but the corresponding methods for irradiated thorium fuel are not well known. This study uses software to compare the activity and toxicity of irradiated thorium fuel ('thorium SF') against those of NU. Thorium elements, contained in the inner eight elements of a heterogeneous high-burnup bundle having LEU (Low-enriched uranium) in the outer 35 elements, achieve a similar burnup to NU SF during its residence in a reactor, and the radiotoxicity due to fission products was found to be similar. However, due to the creation of such inhalation hazards as U-232 and Th-228, the radiotoxicity of thorium SF was almost double that of NU SF after sufficient time has passed for the decay of shorter-lived fission products. Current radio-protection methods for NU SF exposure are likely inadequate to estimate the internal dose to personnel to thorium SF, and an analysis of thorium in fecal samples is recommended to assess the internal dose from exposure to this fuel. (authors)
Inhalation radiotoxicity of irradiated thorium as a heavy water reactor fuel
Energy Technology Data Exchange (ETDEWEB)
Edwards, G.W.R.; Priest, N.D.; Richardson, R.B. [Atomic Energy of Canada Ltd., Chalk River, Ontario, K0J 1J0 (Canada)
2013-07-01
The online refueling capability of Heavy Water Reactors (HWRs), and their good neutron economy, allows a relatively high amount of neutron absorption in breeding materials to occur during normal fuel irradiation. This characteristic makes HWRs uniquely suited to the extraction of energy from thorium. In Canada, the toxicity and radiological protection methods dealing with personnel exposure to natural uranium (NU) spent fuel (SF) are well-established, but the corresponding methods for irradiated thorium fuel are not well known. This study uses software to compare the activity and toxicity of irradiated thorium fuel ('thorium SF') against those of NU. Thorium elements, contained in the inner eight elements of a heterogeneous high-burnup bundle having LEU (Low-enriched uranium) in the outer 35 elements, achieve a similar burnup to NU SF during its residence in a reactor, and the radiotoxicity due to fission products was found to be similar. However, due to the creation of such inhalation hazards as U-232 and Th-228, the radiotoxicity of thorium SF was almost double that of NU SF after sufficient time has passed for the decay of shorter-lived fission products. Current radio-protection methods for NU SF exposure are likely inadequate to estimate the internal dose to personnel to thorium SF, and an analysis of thorium in fecal samples is recommended to assess the internal dose from exposure to this fuel. (authors)
International Nuclear Information System (INIS)
Duport, P.; Horvath, F.
1989-01-01
Based on the recommendations of ICRP Publication 26, the dosimetric and metabolic data of ICRP Publication 30, and using available information on the physical and solubility characteristics of uranium and uranium/thorium ore, the ALI values for airborne ore dust were calculated. Four hypothetical types of ore were considered: uranium ore with no radon emanation, uranium ore with 50% radon emanation, uranium/thorium ore with neither 222 Rn nor thoron emanation, and uranium/thorium ore with 50% 22 Rn and 220 Rn emanation. Furthermore, the ALI values were calculated assuming the radionuclides present in the ore were all: (a) solubility class Y: (b) solubility class W; and (c) equal parts of classes Y and W. The ALI values were also calculated for Activity Median Aerodynamic Diameters (AMAD) ranging from 1 to 10 μm. The results of the calculations show that the solubility class of the radionuclides is the single most important factor that governs ALI values. The ALI value for uranium and uranium-thorium ore dust is proportional to (AMAD) 0.5 for class Y materials, (AMAD) 0.2 for a mixture of equal parts of class Y and class W materials, and is independent of the AMAD for class W materials. A series of graphs is given from which it is possible to evaluate the ALI for airborne ore dust when the AMAD of the dust and the solubility characteristics are known approximately. (author)
Thorium determination by x-ray fluorescence spectrometry in simulated thorex process solutions
International Nuclear Information System (INIS)
Yamaura, M.; Matsuda, H.T.
1991-11-01
The X-ray fluorescence method for thorium determination in aqueous and organic (TBP/n-dodecane) solutions is described. The thin film technique for sample preparation and a suitable internal standard had been used. The best conditions for Thorium determination had been established studying some parameters as analytical line, internal standard, filter paper, paper geometry, sample volume and measurement conditions. With the established conditions, thorium was concentration range of to 200 g Th/L and in organic solutions (2-63g Th/L) with 1,5% of precision. The accuracy of the proposed method was 3% in aqueous and organic phases. The detection limit was 1,2μg thorium for aqueous solutions and 1,4μg for organic solutions. Uranium, fission products, corrosion products and Thorex reagent components were studied as interfering elements in the thorium analysis. The matrix effect was also studied using the Thorex process simulated solutions. Finally, the method was applied to thorium determination in irradiated thorium solutions with satisfactory results. (author)
International Nuclear Information System (INIS)
Oliveira, E.F. de.
1984-09-01
A bibliographic research has been carried out for reprocessing techniques of irradiated thorium fuel from nuclear reactors. The Thorex/Hoechst process has been specially considered to establish a method for reprocessing thorium-uranium fuel from PWR. After a series of cold tests performed in laboratory it was possible to set the behavior of several parameters affecting the Thorex/Hoechst process. Some comments and suggestions are presented for modifications in the process flosheet conditions. A discussion is carried out for operational conditions such as the aqueous to organic flow ratio the acidity of strip and scrub solutions in the process steps for thorium and uranium recovery. The operation diagrams have been constructed using equilibrium experimental data which correspond to conditions observed in laboratory. (Author) [pt
Spectral shift controlled reactors, denatured U-233/thorium cycle
International Nuclear Information System (INIS)
1978-05-01
This paper presents technical and economic data on the SSCR which may be of use in the International Fuel Cycle Evaluation Program to intercompare alternative nuclear systems. Included in this paper are data on the denatured U-233/thorium cycle. This cycle shows a proliferation advantage over more classical thorium fuel cycle (e.g., highly-enriched U-235/thorium or plutonium/thorium) due to the elimination of chemically-separable, concentrated fissile material from unirradiated nuclear fuel. The U-233 is denatured by mixing with depleted uranium to a concentration no greater than 12 w/o. An exogenous source of U-233 is assumed in this paper, since U-233 does not occur in nature and only a limited supply has been produced to date for research and development work
Experiences in running solvent extraction plant for thorium compounds [Paper No. : V-5
International Nuclear Information System (INIS)
Gopalkrishnan, C.R.; Bhatt, J.P.; Kelkar, G.K.
1979-01-01
Indian Rare Earths Ltd. operates a Plant using thorium concentrates as raw material, employing hydrocarbonate route, for the manufacture of thorium compounds. A small demonstration solvent extraction plant designed by the Chemical Engineering Division, B.A.R.C. is also being operated for the same purpose using a partly purified thorium hydrocarbonate as raw material. In the solvent extraction process, separation of pure thorium is done in mixer settlers using 40% mixture of tri-butyl phosphate in kerosene. Though a comparatively purer raw material of hydrocarbonate than thorium concentrate is used, heavy muck formation is encountered in the extraction stage. Production of nuclear grade thorium oxide has been successful so far as quality is concerned. The quality of thorium nitrate suffers in the yellow colouration and high phosphate content, the former being only partly controlled through the use of pretreated kerosene. When a larger solvent extraction plant is to be designed to use thorium concentrates as raw material, some of the problems encountered will be considered. (author)
International Nuclear Information System (INIS)
Pszonicki, L.; Hanna, A.N.; Suschny, O.
1983-06-01
Twenty-nine laboratories from 18 countries took part in this intercomparison, organized by the IAEA's Analytical Quality Control Service, to help laboratories engaged in this task to check the reliability of their results. An additional aim was to establish the concentrations of thorium and uranium in three large batches of thorium ores and certifying them as reference materials. The evaluation was based on 438 individual results (108 laboratory means) for thorium, and on 412 individual results (106 laboratory means) for uranium. The number of laboratory means per element and per sample varied from 34 to 38. The methods most frequently used in the determination of both elements were neutron activation analysis and radiometry. They were followed by spectrophotometry and X-ray fluorescence analysis for thorium and by fluorimetry, X-ray fluorescence analysis and spectrophotometry for uranium determination, respectively. The relative uncertainty of all computed overall medians which were used as the best estimations of true values, does not exceed +-10% and +-5% for the concentration values below and above 0.1%, respectively
Grimaldi, F.S.
1957-01-01
This paper presents a selective iodate separation of thorium from nitric acid medium containing d-tartaric acid and hydrogen peroxide. The catalytic decomposition of hydrogen peroxide is prevented by the use of 8quinolinol. A few micrograms of thorium are separated sufficiently clean from 30 mg. of such oxides as cerium, zirconium, titanium, niobium, tantalum, scandium, or iron with one iodate precipitation to allow an accurate determination of thorium with the thoronmesotartaric acid spectrophotometric method. The method is successful for the determination of 0.001% or more of thorium dioxide in silicate rocks and for 0.01% or more in black sand, monazite, thorite, thorianite, eschynite, euxenite, and zircon.
Interpretation of thorium bioassay data
International Nuclear Information System (INIS)
Juliao, L.M.Q.C.; Azeredo, A.M.G.F.; Santos, M.S.; Melo, D.R.; Dantas, B.M.; Lipsztein, J.L.
1994-01-01
A comparison have been made between bioassay data of thorium-exposed workers from two different facilities. The first of these facilities is a monazite sand extraction plant. Isotopic equilibrium between 232 Th and 238 Th was not observed in excreta samples of these workers. The second facility is a gas mantle factory. An isotopic equilibrium between 232 Th and 228 Th was observed in extra samples. Whole body counter measurements have indicated a very low intake of thorium through inhalation. As the concentration of thorium in feces was very high it was concluded that the main pathway of entrance of the nuclide was ingestion, mainly via contamination through dirty hands. The comparison between the bioassay results of workers from the two facilities shows that the lack of Th isotopic equilibrium observed in the excretion from the workers at the monazite sand plant possibly occurred due to an additional Th intake by ingestion of contaminated fresh food. This is presumably because 228 Ra is more efficiently taken up from the soil by plants, in comparison to 228 Th or 232 Th, and subsequently, 228 Th grows in from its immediate parent, 228 Ra. (author) 5 refs.; 3 tabs
Role of thorium in ensuring long term energy security to India
International Nuclear Information System (INIS)
Malhotra, S.K.
2013-01-01
Role of nuclear power in ensuring energy security to the world is inevitable due to a) dwindling fossil fuel resources and b) need for minimising green house gas emission that poses the risk of global climate change. India, keeping in mind its limited uranium and vast thorium resources, is pursuing a three stage nuclear power programme. The first stage is based on reactors that use uranium as fuel. It comprises of the indigenous Pressurised Heavy Water Reactors using natural uranium as fuel and light water reactors that employ enriched uranium as fuel and are to be set up in technical collaboration with other countries. The second stage is based on fast breeder reactors that employ plutonium derived from reprocessing of spent fuel from the first stage reactors. The third stage envisages reactors which will employ thorium based fuel after its irradiation in the second stage reactors. This programme is sequential in nature and has an ultimate objective of securing long term energy security to India through judicial use of its thorium resources. Thorium based reactors offer advantages in terms of better neutronic characteristics of thorium, it being better fertile host for plutonium disposition and better thermo-mechanical properties and slower fuel deterioration of thorium oxide. It is planned to introduce thorium in the Indian Nuclear Power Programme after sufficient (about 200 GWe) capacity build-up in the second stage. DAE is a global leader in the development of the entire thorium fuel cycle. It has a mature technology for extraction of thorium and preparation of thoria pellets. It has long back carried out irradiation of thoria pellets in its research reactors and also in PHWRs, post irradiation examination and reprocessing of irradiated thoria, fabrication of 233 U based fuel. It has KAMINI - the world's only operating reactor employing 233 U as fuel. An Advanced Heavy Water Reactor (AHWR) has been designed as a technology demonstrator for large scale
Recovery and purification of rare earth elements and thorium
International Nuclear Information System (INIS)
Sungur, A.; Saygi, Z.; Yildiz, H.
1985-01-01
Rare earth elements and thorium found in the low-grade Eskisehir-Beylikahir ore have been recovered by HCl leaching, Lanthanides and thorium were separated and purified from the leach solutions through the precipitation sequence as double sulphate, hydroxide and oxalate. The Ln 2 O 3 and Th(OH) 4 products, finally obtained contained 36% Ce and 65% Th. The analysis of rare earth elements, thorium and other present ingredients were carried out by instrumental neutron activation analysis, atomic absorption spectroscopy, vis-spectroscopy and gravimetry. (author)
Computer simulations for thorium doped tungsten crystals
International Nuclear Information System (INIS)
Eberhard, Bernd
2009-01-01
Tungsten has the highest melting point among all metals in the periodic table of elements. Furthermore, its equilibrium vapor pressure is by far the lowest at the temperature given. Thoria, ThO 2 , as a particle dopant, results in a high temperature creep resistant material. Moreover, thorium covered tungsten surfaces show a drastically reduced electronic work function. This results in a tremendous reduction of tip temperatures of cathodes in discharge lamps, and, therefore, in dramatically reduced tungsten vapor pressures. Thorium sublimates at temperatures below those of a typical operating cathode. For proper operation, a diffusional flow of thorium atoms towards the surface has to be maintained. This atomic flux responds very sensitively on the local microstructure, as grain boundaries as well as dislocation cores offer ''short circuit paths'' for thorium atoms. In this work, we address some open issues of thoriated tungsten. A molecular dynamics scheme (MD) is used to derive static as well as dynamic material properties which have their common origin in the atomistic behavior of tungsten and thorium atoms. The interatomic interactions between thorium and tungsten atoms are described within the embedded atom model (EAM). So far, in literature no W-Th interaction potentials on this basis are described. As there is no alloying system known between thorium and tungsten, we have determined material data for the fitting of these potentials using ab-initio methods. This is accomplished using the full potential augmented plane wave method (FLAPW), to get hypothetical, i.e. not occurring in nature, ''alloy'' data of W-Th. In order to circumvent the limitations of classical (NVE) MD schemes, we eventually couple our model systems to external heat baths or volume reservoirs (NVT, NPT). For the NPT ensemble, we implemented a generalization of the variable cell method in combination with the Langevin piston, which results in a set of Langevin equations, i.e. stochastic
Depth-Resolved Cathodoluminescence of Thorium Dioxide
2013-03-01
plutonium-239 (239Pu)-based nuclear weapons. Thorium also results in less highly radioactive waste in comparison to the uranium fuels. Thorium is four...diameters (1/4 – 3/8”) (Mann & Thompson, 2010). The 99.99% ThO2 powder was placed into the ampoule with a basic mineralizer such as cesium fluoride...conversion ranging from 1 pA/V to 1 mA/V. The electrical noise is further reduced by cooling the PMT housing unit with liquid nitrogen as seen in
Thorium-Based Fuel Cycles in the Modular High Temperature Reactor
Institute of Scientific and Technical Information of China (English)
CHANG Hong; YANG Yongwei; JING Xingqing; XU Yunlin
2006-01-01
Large stockpiles of civil-grade as well as weapons-grade plutonium have been accumulated in the world from nuclear power or other programs of different countries. One alternative for the management of the plutonium is to incinerate it in the high temperature reactor (HTR). The thorium-based fuel cycle was studied in the modular HTR to reduce weapons-grade plutonium stockpiles, while producing no additional plutonium or other transuranic elements. Three thorium-uranium fuel cycles were also investigated. The thorium absorption cross sections of the resolved and unresolved resonances were generated using the ZUT-DGL code based on existing resonance data. The equilibrium core of the modular HTR was calculated and analyzed by means of the code VSOP'94. The results show that the modular HTR can incinerate most of the initially loaded plutonium amounting to about 95.3% net 239Pu for weapons-grade plutonium and can effectively utilize the uranium and thorium in the thorium-uranium fuel cycles.
The comparative distribution of thorium and plutonium in human tissues
International Nuclear Information System (INIS)
Singh, Narayani P.; Shawki Amin Ibrahim; Cohen, Norman; Wrenn, McDonald E.
1978-01-01
Thorium is the most chemically and biologically similar natural element to the manmade element plutonium. Both are actinides, and for both the most stable valency state is +4, and solubility in natural body fluids is low. They are classified together in ICRP Lung Model. The present paper deals with the question of whether or not the analogy between the two actinides in terms of deposition and retention in human tissues is a good one. Preliminary results on the thorium contents ( 228,230 Th and 232 Th) of three sets of human tissues from a western U.S. town containing a uranium tailings pile are compared with the reported values of plutonium content of human tissues from the general populations who are exposed to environmental plutonium from fallout of nuclear detonations. Samples were taken at autopsy where sudden death had occurred. For the three isotopes of thorium, the ratio of the content of each (pCi/organ, normalized by organ weight to ICRP Reference Man) in lung to lymph nodes varies from 2-25 for individuals with a mean of 8; this is similar to that we infer from the literature for 239 , 240 Pu which suggests a ratio of lung to lymph nodes with a mean of approximately 7. However, the relative thorium contents of lung and liver are dissimilar, lung/liver for thorium being 3.5 and for plutonium 0.2 to 0.1. Similarly, the ratios of thorium and plutonium content of liver and bone vary significantly; the ratio for thorium is 0.1 and for plutonium 0.8 to 0.5. The most significant observation at this stage is that the relative accumulation of thorium in human liver is much less than that of plutonium. Some of the plausible reasons will be discussed. (author)
The indispensable role of thorium for creating a sustainable society
International Nuclear Information System (INIS)
Kamei, T.
2012-01-01
Several approaches are required in parallel for constructing a sustainable society. One of them is to fight against global warming. The other one is to make this world nuclear weapon free. Nuclear power has been used for peaceful purpose because nuclear power produces electricity without emitting CO 2 . Nearly 15% of world electricity is produced by nuclear power. Through nuclear power plant has a possibility of severe accident such as Fukushima Daiichi, its advantage is still valuable for the world. President Obama's speech in Prague in 2009 brought a impact to the world to move toward the world without nuclear weapon. The remaining subject is how to treat dismantled fissionable materials. Existing nuclear power plants utilize uranium because only uranium contains natural occurring fissionable material, uranium-235. The spent uranium fuel contains fissionable plutonium-239. Thus, uranium fuel cycle always accompanies possibility of nuclear proliferation. Thorium plays an important role for both solving global warming and nuclear weapon. Fertile thorium can be used as nuclear fuel by support of fissionable plutonium-239 from spent uranium fuel or weapon head. Preliminary calculation indicates that the USA's and Russia's dismantle nuclear weapon enable to start more than 10 GWe of thorium nuclear power plants. In addition, plutonium-239 obtained from uranium fuel is available of 392 GWe of thorium nuclear power. Uranium-233 coming from thorium is also a fissionable but it is hard to be used for weapon because of its accompanied gamma-ray. Thorium itself is now obtained as by-product of rare-earth mining, which is used for high-tech products including photovoltaic cell, wind-mill, and hybrid-vehicle. However, thorium is not taken care adequately and becomes environmental hazard. Both to take care of environment, to support implementation of high-tech product and to make the world without nuclear weapon, a comprehensive role of thorium will be presented
Economics and utilization of thorium in nuclear reactors
International Nuclear Information System (INIS)
1978-05-01
Information on thorium utilization in power reactors is presented concerning the potential demand for nuclear power, the potential supply for nuclear power, economic performance of thorium under different recycle policies, ease of commercialization of the economically preferred cases, policy options to overcome institutional barriers, and policy options to overcome technological and regulatory barriers
Technical soaps - a possibility of decontaminating thorium-contaminated waste waters
International Nuclear Information System (INIS)
Drathen, H.; Erichsen, L. v.
1977-01-01
Thorium-contaminated waste waters showing a concentration of thorium higher than 10sup(-5) mol/l can be quantitatively decontaminated by adding soaps. Concentrations of impurity ions of both tap and sea waters have been taken into consideration. As there is no difference between soaps and soap mixtures concerning the quantity of precipitation rates, technical soaps are from the economic point of view best suited for decontaminating thorium-contaminated waste waters. Having a soap concentration of 200% of the stoichiometric amount of thorium and a concentration of impurity ions of 10sup(-2) mol/l, it is assumed that decontamination factors of more than 20 can be reached in one step. (orig.) [de
Transformation using peroxide of a crude thorium hydroxide in nitrate for mantle grade
International Nuclear Information System (INIS)
Freitas, Antonio Alves de; Carvalho, Fatima Maria Sequeira de; Ferreira, Joao Coutinho; Abrao, Alcidio
2002-01-01
An alternative process for the recovery and purification of thorium starting from a crude thorium hydroxide as the precursor is outlined in this paper. Its composition is 60.1% thorium oxide (ThO 2 ), 18.6% rare earth oxides (TR 2 O 3 ), and common impurities like silicium, iron, titanium, lead and sodium. This material was produced industrially from the monazite processing in Brazil and has been stocked since several years. The crude thorium hydroxide is treated with hot nitric acid and after the digestion and addition of floculant it is filtered for the separation of the insoluble fraction. Using this nitrate solution, the thorium peroxide is precipitated after adjustment of pH and controlled addition of hydrogen peroxide. The final thorium peroxide is dissolved with nitric acid and the resulting thorium nitrate is mantle grade quality. Rare earth elements are recovered from the thorium peroxide filtrate. The main process parameters for the peroxide precipitation, like pH and temperature and main the results are presented and discussed. (author)
1983-01-01
The DEC (Digital Equipment Corporation) VT220 is a text terminal which uses an redesigned keyboard(LK201). The VT220 improved on the earlier VT100 series of terminals with much smaller physical packaging and and a much faster microprocessor.
Establishing bounding internal dose estimates for thorium activities at Rocky Flats.
Ulsh, Brant A; Rich, Bryce L; Chew, Melton H; Morris, Robert L; Sharfi, Mutty; Rolfes, Mark R
2008-07-01
As part of an evaluation of a Special Exposure Cohort petition filed on behalf of workers at the Rocky Flats Plant, the National Institute for Occupational Safety and Health (NIOSH) was required to demonstrate that bounding values could be established for radiation doses due to the potential intake of all radionuclides present at the facility. The main radioactive elements of interest at Rocky Flats were plutonium and uranium, but much smaller quantities of several other elements, including thorium, were occasionally handled at the site. Bounding potential doses from thorium has proven challenging at other sites due to the early historical difficulty in detecting this element through urinalysis methods and the relatively high internal dose delivered per unit intake. This paper reports the results of NIOSH's investigation of the uses of thorium at Rocky Flats and provides bounding dose reconstructions for these operations. During this investigation, NIOSH reviewed unclassified reports, unclassified extracts of classified materials, material balance and inventory ledgers, monthly progress reports from various groups, and health physics field logbooks, and conducted interviews with former Rocky Flats workers. Thorium operations included: (1) an experimental metal forming project with 240 kg of thorium in 1960; (2) the use of pre-formed parts in weapons mockups; (3) the removal of Th from U; (4) numerous analytical procedures involving trace quantities of thorium; and (5) the possible experimental use of thorium as a mold coating compound. The thorium handling operations at Rocky Flats were limited in scope, well-monitored and documented, and potential doses can be bounded.
The Thorium-Cycle: safe, abundant power for the new millennium
Don, May; George, Kim; Peter, Mcintyre; Charles, Meitzler; Robert, Rogers; Akhdior, Sattarov; Mustafa, Yavuz
2001-10-01
A design has been developed for using accelerator-driven thorium fission to produce electric power. A thorium-cycle reactor works by electro-breeding. A pattern of thorium fuel rods is supported in a vessel containing molten lead. A beam of high-energy (1 GeV) protons is targeted in the center of the vessel, and produces a copious flux of energetic neutrons by spallation. The neutrons transmute the thorium nuclei two steps up the periodic table to U233, which fissions rapidly to produce thermal energy. The lead serves as the spallation target, the moderator, and the heat exchange medium to transfer heat from the core to steam exchangers above the core. The thorium cycle has several important advantages over current uranium-cycle fission technology: it is intrinsically stable it cannot melt down; it eats its own waste; it cannot produce bomb-grade isotopes; and there are sufficient thorium reserves to supply the entire Earth’s energy economy for the next millennium. The concept of a thorium-cycle power reactor was first proposed by Rubbia in 1995. Key problems in the original concept were the proton injector (15 MW beam power), reliability of accelerator systems, and parasitic absorption of neutrons by fission products during the life of the core. We have addressed all three problems in a design for a flux-coupled stack of isochronous cyclotrons, delivering a pattern of 7 independent beams to the core. An interdisciplinary collaboration is being formed to develop the concept to a serious design.
Energy Technology Data Exchange (ETDEWEB)
Komura, K; Yanagisawa, M; Sakurai, J; Sakanoue, M
1985-10-01
Uranium, thorium and potassium contents and radioactive equilibrium states of the uranium and thorium series nuclides have been studied for 2 phosphate rocks and 7 phosphate fertilizers. Uranium contents were found to be rather high (39-117 ppm) except for phosphate rock from Kola. The uranium series nuclides were found to be in various equilibration states, which can be grouped into following three categories. Almost in the equilibrium state, 238U approximately 230Th greater than 210Pb greater than 226Ra and 238U greater than 230Th greater than 210Pb greater than 226Ra. Thorium contents were found to be, in general, low and appreciable disequilibrium of the thorium series nuclides was not observed except one sample. Potassium contents were also very low (less than 0.3% K2O) except for complex fertilizers. Based on the present data, discussions were made for the radiation exposure due to phosphate fertilizers.
Candu reactors with thorium fuel cycles
International Nuclear Information System (INIS)
Hopwood, J.M.; Fehrenbach, P.; Duffey, R.; Kuran, S.; Ivanco, M.; Dyck, G.R.; Chan, P.S.W.; Tyagi, A.K.; Mancuso, C.
2006-01-01
Over the last decade and a half AECL has established a strong record of delivering CANDU 6 nuclear power plants on time and at budget. Inherently flexible features of the CANDU type reactors, such as on-power fuelling, high neutron economy, fuel channel based heat transport system, simple fuel bundle configuration, two independent shut down systems, a cool moderator and a defence-in-depth based safety philosophy provides an evolutionary path to further improvements in design. The immediate milestone on this path is the Advanced CANDU ReactorTM** (ACRTM**), in the form of the ACR-1000TM**. This effort is being followed by the Super Critical Water Reactor (SCWR) design that will allow water-cooled reactors to attain high efficiencies by increasing the coolant temperature above 550 0 C. Adaptability of the CANDU design to different fuel cycles is another technology advantage that offers an additional avenue for design evolution. Thorium is one of the potential fuels for future reactors due to relative abundance, neutronics advantage as a fertile material in thermal reactors and proliferation resistance. The Thorium fuel cycle is also of interest to China, India, and Turkey due to local abundance that can ensure sustainable energy independence over the long term. AECL has performed an assessment of both CANDU 6 and ACR-1000 designs to identify systems, components, safety features and operational processes that may need to be modified to replace the NU or SEU fuel cycles with one based on Thorium. The paper reviews some of these requirements and the associated practical design solutions. These modifications can either be incorporated into the design prior to construction or, for currently operational reactors, during a refurbishment outage. In parallel with reactor modifications, various Thorium fuel cycles, either based on mixed bundles (homogeneous) or mixed channels (heterogeneous) have been assessed for technical and economic viability. Potential applications of a
REGENERATION OF FISSION-PRODUCT-CONTAINING MAGNESIUM-THORIUM ALLOYS
Chiotti, P.
1964-02-01
A process of regenerating a magnesium-thorium alloy contaminated with fission products, protactinium, and uranium is presented. A molten mixture of KCl--LiCl-MgCl/sub 2/ is added to the molten alloy whereby the alkali, alkaline parth, and rare earth fission products (including yttrium) and some of the thorium and uranium are chlorinated and
Thorium-U Recycle Facility (7930)
Federal Laboratory Consortium — The Thorium-U Recycle Facility (7930), along with the Transuranic Processing Facility (7920). comprise the Radiochemical Engineering Development Complex. 7930 is a...
Determination of the total nitrate content of thorium nitrate solution with a selective electrode
International Nuclear Information System (INIS)
Wirkner, F.M.
1979-01-01
The nitrate content of thorium nitrate solutions is determined with a liquid membrane nitrate selective electrode utilizing the known addition method in 0.1 M potassium fluoride medium as ionic strength adjustor. It is studied the influence of pH and the presence of chloride, sulphate, phosphate, meta-silicate, thorium, rare earths, iron, titanium, uranium and zirconium at the same concentrations as for the aqueous feed solutions in the thorium purification process. The method is tested in synthetic samples and in samples proceeding from nitric dissolutions of thorium hidroxide and thorium oxicarbonate utilized as thorium concentrates to be purified [pt
Computer simulations for thorium doped tungsten crystals
Energy Technology Data Exchange (ETDEWEB)
Eberhard, Bernd
2009-07-17
Tungsten has the highest melting point among all metals in the periodic table of elements. Furthermore, its equilibrium vapor pressure is by far the lowest at the temperature given. Thoria, ThO{sub 2}, as a particle dopant, results in a high temperature creep resistant material. Moreover, thorium covered tungsten surfaces show a drastically reduced electronic work function. This results in a tremendous reduction of tip temperatures of cathodes in discharge lamps, and, therefore, in dramatically reduced tungsten vapor pressures. Thorium sublimates at temperatures below those of a typical operating cathode. For proper operation, a diffusional flow of thorium atoms towards the surface has to be maintained. This atomic flux responds very sensitively on the local microstructure, as grain boundaries as well as dislocation cores offer ''short circuit paths'' for thorium atoms. In this work, we address some open issues of thoriated tungsten. A molecular dynamics scheme (MD) is used to derive static as well as dynamic material properties which have their common origin in the atomistic behavior of tungsten and thorium atoms. The interatomic interactions between thorium and tungsten atoms are described within the embedded atom model (EAM). So far, in literature no W-Th interaction potentials on this basis are described. As there is no alloying system known between thorium and tungsten, we have determined material data for the fitting of these potentials using ab-initio methods. This is accomplished using the full potential augmented plane wave method (FLAPW), to get hypothetical, i.e. not occurring in nature, ''alloy'' data of W-Th. In order to circumvent the limitations of classical (NVE) MD schemes, we eventually couple our model systems to external heat baths or volume reservoirs (NVT, NPT). For the NPT ensemble, we implemented a generalization of the variable cell method in combination with the Langevin piston, which results in a
Thorium based fuel options for the generation of electricity: Developments in the 1990s
International Nuclear Information System (INIS)
2000-05-01
The IAEA has maintained an interest in the thorium fuel cycle and its worldwide utilization within its framework of activities. Periodic reviews have assessed the current status of this fuel cycle, worldwide applications, economic benefits, and perceived advantages with respect to other nuclear fuel cycles. Since 1994, the IAEA convened a number of technical meetings on the thorium fuel cycle and related issues. Between 1995 and 1997 individual contributions on the thorium fuel cycle were elicited from experts from France, Germany, India, Japan, the Russian Federation and the USA. These contributions included evaluations of the status of the thorium fuel cycle worldwide; the new incentives to use thorium due to large stockpiles of plutonium produced in nuclear reactors; new reactor concepts utilizing thorium; strategies for thorium use; and an evaluation of toxicity of the thorium fuel cycle waste compared to that from other fuel cycles. The results of this updated evaluation are summarized in this publication
Thorium Molten Salt Nuclear Energy Synergetic System (THORIMS-NES)
International Nuclear Information System (INIS)
Yoshioka, Ritsuo; Mitachi, Koshi
2013-01-01
The authors have been promoting nuclear energy technology based on thorium molten salt as Thorium Molten Salt Nuclear Energy Synergetic System (THORIMS-NES). This system is a combination of fission power reactor of Molten Salt Reactor (MSR), and Accelerator Molten Salt Breeder (AMSB) for production of fissile 233 U with connecting chemical processing facility. In this paper, concept of THORIMS-NES, advantages of thorium and molten salt recent MSR design results such as FUJI-U3 using 233 U fuel, FUJI-Pu, large sized super-FUJI, pilot plant miniFUJI, AMSB, and chemical processing facility are described. (author)
Separation of protactinum, actinium, and other radionuclides from proton irradiated thorium target
Fassbender, Michael E.; Radchenko, Valery
2018-04-24
Protactinium, actinium, radium, radiolanthanides and other radionuclide fission products were separated and recovered from a proton-irradiated thorium target. The target was dissolved in concentrated HCl, which formed anionic complexes of protactinium but not with thorium, actinium, radium, or radiolanthanides. Protactinium was separated from soluble thorium by loading a concentrated HCl solution of the target onto a column of strongly basic anion exchanger resin and eluting with concentrated HCl. Actinium, radium and radiolanthanides elute with thorium. The protactinium that is retained on the column, along with other radionuclides, is eluted may subsequently treated to remove radionuclide impurities to afford a fraction of substantially pure protactinium. The eluate with the soluble thorium, actinium, radium and radiolanthanides may be subjected to treatment with citric acid to form anionic thorium, loaded onto a cationic exchanger resin, and eluted. Actinium, radium and radiolanthanides that are retained can be subjected to extraction chromatography to separate the actinium from the radium and from the radio lanthanides.
Dynamic Analysis of the Thorium Fuel Cycle in CANDU Reactors
International Nuclear Information System (INIS)
Jeong, Chang Joon; Park, Chang Je
2006-02-01
The thorium fuel recycle scenarios through the Canada deuterium uranium (CANDU) reactor have been analyzed for two types of thorium fuel: homogeneous ThO 2 UO 2 and ThO 2 UO 2 -DUPIC fuels. The recycling is performed through the dry process fuel technology which has a proliferation resistance. For the once-through fuel cycle model, the existing nuclear power plant construction plan was considered up to 2016, while the nuclear demand growth rate from the year 2016 was assumed to be 0%. After setting up the once-through fuel cycle model, the thorium fuel CANDU reactor was modeled to investigate the fuel cycle parameters. In this analysis, the spent fuel inventory as well as the amount of plutonium, minor actinides and fission products of the multiple recycling fuel cycle were estimated and compared to those of the once-through fuel cycle. From the analysis results, it was found that the closed or partially closed thorium fuel cycle can be constructed through the dry process technology. Also, it is known that both the homogeneous and heterogeneous thorium fuel cycles can reduce the SF accumulation and save the natural uranium resource compared with the once-through cycle. From the material balance view point, the heterogeneous thorium fuel cycle seems to be more feasible. It is recommended, however, the economic analysis should be performed in future
Dynamic Analysis of the Thorium Fuel Cycle in CANDU Reactors
Energy Technology Data Exchange (ETDEWEB)
Jeong, Chang Joon; Park, Chang Je
2006-02-15
The thorium fuel recycle scenarios through the Canada deuterium uranium (CANDU) reactor have been analyzed for two types of thorium fuel: homogeneous ThO{sub 2}UO{sub 2} and ThO{sub 2}UO{sub 2}-DUPIC fuels. The recycling is performed through the dry process fuel technology which has a proliferation resistance. For the once-through fuel cycle model, the existing nuclear power plant construction plan was considered up to 2016, while the nuclear demand growth rate from the year 2016 was assumed to be 0%. After setting up the once-through fuel cycle model, the thorium fuel CANDU reactor was modeled to investigate the fuel cycle parameters. In this analysis, the spent fuel inventory as well as the amount of plutonium, minor actinides and fission products of the multiple recycling fuel cycle were estimated and compared to those of the once-through fuel cycle. From the analysis results, it was found that the closed or partially closed thorium fuel cycle can be constructed through the dry process technology. Also, it is known that both the homogeneous and heterogeneous thorium fuel cycles can reduce the SF accumulation and save the natural uranium resource compared with the once-through cycle. From the material balance view point, the heterogeneous thorium fuel cycle seems to be more feasible. It is recommended, however, the economic analysis should be performed in future.
A review on the heterogeneous thorium fuel concept for PWR applications
International Nuclear Information System (INIS)
Joo, H. K.; Noh, J. M.; Yoo, J. W.; Kim, K. H.
2001-08-01
Seed-blanket unit (SBU) and whole assembly seed and blanket (WASB) are being investigated for the PWR application as well as homogeneous thorium fuel under the US NERI program. For the verification of HELIOS capability for thorium analysis, the characteristics of heterogeneous thorium fuels was evaluated by HELIOS color-set calculation and compared with the calculation results of the US NERI. The infinite multiplication factors from HELIOS calculation are in good agreement with CASMO-4 except for SBU which uses metallic fuel for seed material. The maximum relative difference in power distribution is occurred in WASB case, and is about 5% compared to MCNP. The isotopic concentrations for Am-241, Am-243, and Cm-244 of HELIOS agree well with CASMO-4's, but show a significant discrepancy from MOCUP mainly caused by the old data of cross section and decay constants in ORIGEN. The nonproliferation characteristic of thorium-based fuel such as critical mass, spontaneous fission rate, decay heat generation rate are superior to the conventional uranium fuel. Even though the diversion of U-233 produced in blanket is a technically difficult, the enrichment of uranium isotopes including U-233 is slightly over the limit for safeguard aspects. The urnaium contents in thorium fuel is need to be adjusted in order to meet the safeguard limit. A preliminary assessment of fuel economics was performed based on the uranium utilization and SWU utilization. The natural uranium utilization factors of heterogeneous thorium-based fuel increased by 10δ18%, but the SWU utilization factor decreased by 6-δ11% compared to uranium fuel. The cost of uranium purchase of 50USI/KgU and SWU cost of 110USI/SWU-Kg, recommended by OECD/NEA, gives a comparable economics of thorium-based fuel to uraium fuel. The detailed fuel cycle analysis will take account of the other factors like the variation of uranium purchase cost and SWU cost, fabrication cost of thorium fuel, thorium purchase cost, the capcity
A review on the heterogeneous thorium fuel concept for PWR applications
Energy Technology Data Exchange (ETDEWEB)
Joo, H. K.; Noh, J. M.; Yoo, J. W.; Kim, K. H
2001-08-01
Seed-blanket unit (SBU) and whole assembly seed and blanket (WASB) are being investigated for the PWR application as well as homogeneous thorium fuel under the US NERI program. For the verification of HELIOS capability for thorium analysis, the characteristics of heterogeneous thorium fuels was evaluated by HELIOS color-set calculation and compared with the calculation results of the US NERI. The infinite multiplication factors from HELIOS calculation are in good agreement with CASMO-4 except for SBU which uses metallic fuel for seed material. The maximum relative difference in power distribution is occurred in WASB case, and is about 5% compared to MCNP. The isotopic concentrations for Am-241, Am-243, and Cm-244 of HELIOS agree well with CASMO-4's, but show a significant discrepancy from MOCUP mainly caused by the old data of cross section and decay constants in ORIGEN. The nonproliferation characteristic of thorium-based fuel such as critical mass, spontaneous fission rate, decay heat generation rate are superior to the conventional uranium fuel. Even though the diversion of U-233 produced in blanket is a technically difficult, the enrichment of uranium isotopes including U-233 is slightly over the limit for safeguard aspects. The urnaium contents in thorium fuel is need to be adjusted in order to meet the safeguard limit. A preliminary assessment of fuel economics was performed based on the uranium utilization and SWU utilization. The natural uranium utilization factors of heterogeneous thorium-based fuel increased by 10{delta}18%, but the SWU utilization factor decreased by 6-{delta}11% compared to uranium fuel. The cost of uranium purchase of 50USI/KgU and SWU cost of 110USI/SWU-Kg, recommended by OECD/NEA, gives a comparable economics of thorium-based fuel to uraium fuel. The detailed fuel cycle analysis will take account of the other factors like the variation of uranium purchase cost and SWU cost, fabrication cost of thorium fuel, thorium purchase cost
An optical chemical sensor for thorium (IV) determination based on thorin
International Nuclear Information System (INIS)
Rastegarzadeh, S.; Pourreza, N.; Saeedi, I.
2010-01-01
A selective method for the determination of thorium (IV) using an optical sensor is described. The sensing membrane is prepared by immobilization of thorin-methyltrioctylammonium ion pair on triacetylcellulose polymer. The sensor produced a linear response for thorium (IV) concentration in the range of 6.46 x 10 -6 to 9.91 x 10 -5 mol L -1 with detection limit of 1.85 x 10 -6 mol L -1 . The regeneration of optode was accomplished completely at a short time (less than 20 s) with 0.1 mol L -1 of oxalate ion solution. The relative standard deviation for ten replicate measurements of 2.15 x 10 -5 and 8.62 x 10 -5 mol L -1 of thorium was 2.71 and 1.65%, respectively. The optode membrane exhibits good selectivity for thorium (IV) over several other ionic species and are comparable to those obtained in case of spectrophotometric determination of thorium using thorin in solution. A good agreement with the ICP-MS and spiked method was achieved when the proposed optode was applied to the determination of thorium (IV) in dust and water samples.
An optical chemical sensor for thorium (IV) determination based on thorin.
Rastegarzadeh, S; Pourreza, N; Saeedi, I
2010-01-15
A selective method for the determination of thorium (IV) using an optical sensor is described. The sensing membrane is prepared by immobilization of thorin-methyltrioctylammonium ion pair on triacetylcellulose polymer. The sensor produced a linear response for thorium (IV) concentration in the range of 6.46 x 10(-6) to 9.91 x 10(-5)mol L(-1) with detection limit of 1.85 x 10(-6)mol L(-1). The regeneration of optode was accomplished completely at a short time (less than 20s) with 0.1 mol L(-1) of oxalate ion solution. The relative standard deviation for ten replicate measurements of 2.15 x 10(-5) and 8.62 x 10(-5)mol L(-1) of thorium was 2.71 and 1.65%, respectively. The optode membrane exhibits good selectivity for thorium (IV) over several other ionic species and are comparable to those obtained in case of spectrophotometric determination of thorium using thorin in solution. A good agreement with the ICP-MS and spiked method was achieved when the proposed optode was applied to the determination of thorium (IV) in dust and water samples.
Evaluation of thorium based nuclear fuel. Chemical aspects
International Nuclear Information System (INIS)
Konings, R.J.M.; Blankenvoorde, P.J.A.M.; Cordfunke, E.H.P.; Bakker, K.
1995-07-01
This report describes the chemical aspects of a thorium-based fuel cycle. It is part of a series devoted to the study of thorium-based fuel as a means to achieve a considerable reduction of the radiotoxicity of the waste from nuclear power production. Therefore special emphasis is placed on fuel (re-)fabrication and fuel reprocessing in the present work. (orig.)
Evaluation of thorium based nuclear fuel. Chemical aspects
Energy Technology Data Exchange (ETDEWEB)
Konings, R.J.M.; Blankenvoorde, P.J.A.M.; Cordfunke, E.H.P.; Bakker, K.
1995-07-01
This report describes the chemical aspects of a thorium-based fuel cycle. It is part of a series devoted to the study of thorium-based fuel as a means to achieve a considerable reduction of the radiotoxicity of the waste from nuclear power production. Therefore special emphasis is placed on fuel (re-)fabrication and fuel reprocessing in the present work. (orig.).
The thorium fuel cycle in water-moderated reactor systems
International Nuclear Information System (INIS)
Critoph, E.
1977-05-01
Thorium and uranium cycles are compared with regard to reactor characteristics and technology, fuel-cycle technology, economic parameters, fuel-cycle costs, and system characteristics. In heavy-water reactors (HWRs) thorium cycles having uranium requirements at equilibrium ranging from zero to a quarter of those for the natural-uranium once-through cycle appear feasible. An 'inventory' of uranium of between 1 and 2 Mg/MW(e) is required for the transition to equilibrium. The cycles with the lowest uranium requirements compete with the others only at high uranium prices. Using thorium in light-water reactors, uranium requirements can be reduced by a factor of between two and three from the once-through uranium cycle. The light-water breeder reactor, promising zero uranium requirements at equilibrium, is being developed. Larger uranium inventories are required than for the HWRs. The lead time, from a decision to use thorium to significant impact on uranium utilization (compared to uranium cycle, recycling plutonium) is some two decades
Economic analysis of thorium-uranium fuel cycle introduced into PWRs
International Nuclear Information System (INIS)
Fan Li; Sun Qian
2014-01-01
Using PWR of Daya Bay Unit l as the reference reactor, a validated computer code was used to calculate the fuel cycle costs for uranium fuel cycle and thorium-uranium fuel cycle over the following 20 0perational years respectively. The calculation results show that the thorium-uranium fuel cycle is economically competitive with the uranium fuel cycle when reprocessing mode is adopted. For thorium-uranium fuel cycle, if the price of natural uranium is higher than 120 $ /pound U_3O_8, the fuel cycle cost of the direct disposal mode is greater than that of the reprocessing mode. Therefore, when the uranium price may maintain a high level long-termly, adopting reprocessing mode will benefit the economic advantage for the thorium-uranium fuel cycle introduced into PWRs. (authors)
Reprocessing in the thorium fuel cycle
International Nuclear Information System (INIS)
Merz, E.
1984-01-01
An overview of the authors personal view is presented on open questions in regard to still required research and development work for the thorium fuel cycle before its application in a technical-industrial scale may be tackled. For a better understanding, all stations of the back-end of the thorium fuel cycle are briefly illustrated and their special features discussed. They include storage and transportation measures, all steps of reprocessing, as well as the entire radioactive waste treatment. Knowledge gaps are, as far as they are obvious, identified and proposals put forward for additional worthwile investigations. (orig.) [de
Effect of Thorium on Growth and Uptake of Some Elements by Maize Plant
International Nuclear Information System (INIS)
Al-Shobaki, M.E.E.
2012-01-01
A pot experiment (sand culture) was carried out to investigate the effect of thorium on maize dry matter yield, contents and uptake of N,P ,K, Na and Fe and thorium accumulation in maize plant.The pots were contaminated by thorium as Thorium Nitrate(Th (NO 3 ) 4 ,H 2 O)at concentrations 0,5,10,11,12,13,14,15 and 50 ppm. Pots irrigated by 1/10 Hogland solution for 15 days, increased tol/4 Hogland solution after that.The results show that the dry matter (shoot, root and whole plant)decreased with increasing thorium concentration in soil up to 12 ppm and slightly increased with increasing Th to 13 ppm . The Nitrogen content and its uptake decreased with increasing thorium concentration in media growth up to 11 ppm .They were slightly increased at Th concentration between 11-14 ppm in maize shoot and root. The shoots always contained N-content and uptake more than that found in roots . P- uptake decreased in both shoots and roots with increasing in thorium concentration in media growth.
International Nuclear Information System (INIS)
Guo Pengran; Jia Xiaoyu; Duan Taicheng; Xu Jingwei; Chen Hangting
2010-01-01
Harm of thorium to living organisms is governed by its bioavailability. Thorium bioavailability in the soil-plant system of Baotou rare earth industrial area was studied using pot experiments of wheat and single extraction methods. The effects of wheat growth stage and phosphate on thorium bioavailability were also investigated. Based on extractabilities of various extraction methods (CaCl 2 , NH 4 NO 3 , EDTA, HOAc) and correlation analysis of thorium uptake by wheat plant and extractable thorium, a mixture of 0.02 M EDTA + 0.5 M NH 4 OAc (pH 4.6) was found suitable for evaluation of thorium bioavailability in Baotou soil, which could be predicted quantitatively by multiple regression models. Because of differences of wheat root activities, thorium bioavailability in rhizosphere soil was higher than in bulk soil at tillering stage, but the reverse occurred at jointing stage. Phosphate addition induced the mineralization of soluble thorium by forming stable thorium phosphate compounds, and reduced thorium bioavailability in soil.
Energy Technology Data Exchange (ETDEWEB)
Guo Pengran [State Key Laboratory of Electroanalytical Chemistry, Changchun Institute of Applied Chemistry, Chinese Academy of Science, 5625 Renmin Street, Changchun, Jilin 130022 (China); School of Environmental Science and Engineering, Sun Yat-sen University, Guangzhou 510275 (China); Jia Xiaoyu; Duan Taicheng; Xu Jingwei [State Key Laboratory of Electroanalytical Chemistry, Changchun Institute of Applied Chemistry, Chinese Academy of Science, 5625 Renmin Street, Changchun, Jilin 130022 (China); Chen Hangting, E-mail: guopengran@gmail.co [State Key Laboratory of Electroanalytical Chemistry, Changchun Institute of Applied Chemistry, Chinese Academy of Science, 5625 Renmin Street, Changchun, Jilin 130022 (China)
2010-09-15
Harm of thorium to living organisms is governed by its bioavailability. Thorium bioavailability in the soil-plant system of Baotou rare earth industrial area was studied using pot experiments of wheat and single extraction methods. The effects of wheat growth stage and phosphate on thorium bioavailability were also investigated. Based on extractabilities of various extraction methods (CaCl{sub 2}, NH{sub 4}NO{sub 3}, EDTA, HOAc) and correlation analysis of thorium uptake by wheat plant and extractable thorium, a mixture of 0.02 M EDTA + 0.5 M NH{sub 4}OAc (pH 4.6) was found suitable for evaluation of thorium bioavailability in Baotou soil, which could be predicted quantitatively by multiple regression models. Because of differences of wheat root activities, thorium bioavailability in rhizosphere soil was higher than in bulk soil at tillering stage, but the reverse occurred at jointing stage. Phosphate addition induced the mineralization of soluble thorium by forming stable thorium phosphate compounds, and reduced thorium bioavailability in soil.
Evaluation of plutonium, uranium, and thorium use in power reactor fuel cycles
International Nuclear Information System (INIS)
Kasten, P.R.; Homan, F.J.
1977-01-01
The increased cost of uranium and separative work has increased the attractiveness of plutonium use in both uranium and thorium fuel cycles in thermal reactors. A technology, fuel utilization, and economic evaluation is given for uranium and thorium fuel cycles in various reactor types, along with the use of plutonium and 238 U. Reactors considered are LWRs, HWRs, LWBRs, HTGRs, and FBRs. Key technology factors are fuel irradiation performance and associated physical property values. Key economic factors are unit costs for fuel fabrication and reprocessing, and for refabrication of recycle fuels; consistent cost estimates are utilized. In thermal reactors, the irradiation performance of ceramic fuels appears to be satisfactory. At present costs for uranium ore and separative work, recycle of plutonium with thorium rather than uranium is preferable from fuel utilization and economic viewpoints. Further, the unit recovery cost of plutonium is lower from LWR fuels than from natural-uranium HWR fuels; use of LWR product permits plutonium/thorium fueling to compete with uranium cycles. Converting uranium cycles to thorium cycles increases the energy which can be extracted from a given uranium resource. Thus, additional fuel utilization improvement can be obtained by fueling all thermal reactors with thorium, but this requires use of highly enriched uranium; use of 235 U with thorium is most economic in HTGRs followed by HWRs and then LWRs. Marked improvement in long-term fuel utilization can be obtained through high thorium loadings and short fuel cycle irradiations as in the LWBR, but this imposes significant economic penalties. Similar operating modes are possible in HWRs and HTGRs. In fast reactors, use of the plutonium-uranium cycle gives advantageous fuel resource utilization in both LMFBRs and GCFRs; use of the thorium cycle provides more negative core reactivity coefficients and more flexibility relative to use of recycle fuels containing uranium of less than 20
Thorium cycles and proliferation
International Nuclear Information System (INIS)
Lovins, A.B.
1979-01-01
This paper analyzes several prevalent misconceptions about nuclear fuel cycles that breed fissile uranium-233 from thorium. Its main conclusions are: U-233, despite the gamma radioactivity of associated isotopes, is a rather attractive material for making fission bombs, and is a credible material for subnational as well as national groups to use for this purpose; (2) pure thorium cycles, which in effect merely substitute U-233 for Pu, would take many decades and much U to establish, and offer no significant safeguards advantage over Pu, cycles; (3) denatured Th-U cycles, which dilute the U-233 with inert U-238 to a level not directly usable in bombs, are not an effective safeguard even against subnational bomb-making; (4) several other features of mixed Th-U cycles are rather unattractive from a safeguards point of view; (5) thus, Th cycles of any kind are not a technical fix for proliferation (national or subnational) and, though probably more safeguardable than Pu cycles, are less so than once-through U cycles that entail no reprocessing; (6) while thorium cycles have some potential technical advantages, including flexibility, they cannot provide major savings in nuclear fuel resources compared to simpler ways of saving neutrons and U; and (7) while advocates of nuclear power may find Th cycles worth exploring, such cycles do not differ fundamentally from U cycles in any of the respects--including safeguards and fuel resources--that are relevant to the broader nuclear debate, and should not be euphorically embraced as if they did
Feasibility and desirability of employing the thorium fuel cycle for power generation - 254
International Nuclear Information System (INIS)
Sehgal, B.R.
2010-01-01
Thorium fuel cycle for nuclear power generation has been considered since the very start of the nuclear power era. In spite of a very large amount of research, experimentation, pilot scale and prototypic scale installations, the thorium fuel was not adopted for large scale power generation [1,2]. This paper reviews the developments over the years on the front and the back-end of the thorium fuel cycle and describes the pros and cons of employing the thorium fuel cycle for large generation of nuclear power. It examines the feasibility and desirability of employing the thorium fuel cycle in concert with the uranium fuel cycle for power generation. (authors)
Introduction of Thorium in the Nuclear Fuel Cycle. Short- to long-term considerations
International Nuclear Information System (INIS)
Allibert, M.; Merle-Lucotte, E.; Ghetta, V.; Ault, T.; Krahn, S.; Wymer, R.; Croff, A.; Baron, P.; Chauvin, N.; Eschbach, R.; Rimpault, G.; Serp, J.; Bergeron, A.; Bromley, B.; Floyd, M.; Hamilton, H.; Hyland, B.; Wojtaszek, D.; McDonald, M.; Collins, E.; Cornet, S.; Michel-Sendis, F.; ); Feinberg, O.; Ignatiev, V.; Hesketh, K.; Kelly, J.F.; Porsch, D.; Vidal, J.; Taiwo, T.; Uhlir, J.; Van Den Durpel, L.; Van Den Eynde, G.; Vitanza, C.; Butler, Gregg; Cornet, Stephanie; Dujardin, Thierry; Greneche, Dominique; Nordborg, Claes; Rimpault, Gerald; Van Den Durpel, Luc; Michel-Sendis, Franco
2015-01-01
Since the beginning of the nuclear era, significant scientific attention has been given to thorium's potential as a nuclear fuel. Although the thorium fuel cycle has never been fully developed, the opportunities and challenges that might arise from the use of thorium in the nuclear fuel cycle are still being studied in many countries and in the context of diverse international programmes around the world. This report provides a scientific assessment of thorium's potential role in nuclear energy both in the short to longer term, addressing diverse options, potential drivers and current impediments to be considered if thorium fuel cycles are to be pursued. (authors)
Determination of traces of thorium in ammonium/sodium diuranate by ICP-AES method
International Nuclear Information System (INIS)
Nair, V.R.; Kartha, K.N.M.
1999-01-01
Full text: Indian Rare Earths Ltd., Alwaye, produces ammonium diuranate from the thorium concentrate, obtained during monazite processing. This process involves a series of steps. The final uranium product obtained always contains microgram amounts of thorium as impurity. An analytical procedure has been standardised for the estimation of microgram amounts of thorium in ammonium/sodium diuranate. The method involves solvent extraction of uranium by using a tertiary amine followed by the determination of thorium by ICP-AES method in the raffinate. The recoveries of thorium were checked by standard addition to the uranium matrix. Limit of detection is adequate for the analysis of nuclear grade material
Mechanical structure and problem of thorium molten salt reactor
International Nuclear Information System (INIS)
Kamei, Takashi
2011-01-01
After Fukushima Daiichi accident, there became great interest in Thorium Molten Salt Reactor (MSR) for the safety as station blackout leading to auto drainage of molten salts with freeze valve. This article described mechanical structure of MSR and problems of materials and pipes. Material corrosion problem by molten salts would be solved using modified Hastelloy N with Ti and Nb added, which should be confirmed by operation of an experimental reactor. Trends in international activities of MSR were also referred including China declaring MSR development in January 2011 to solve thorium contamination issues at rare earth production and India rich in thorium resources. (T. Tanaka)
Integral benchmarks with reference to thorium fuel cycle
International Nuclear Information System (INIS)
Ganesan, S.
2003-01-01
This is a power point presentation about the Indian participation in the CRP 'Evaluated Data for the Thorium-Uranium fuel cycle'. The plans and scope of the Indian participation are to provide selected integral experimental benchmarks for nuclear data validation, including Indian Thorium burn up benchmarks, post-irradiation examination studies, comparison of basic evaluated data files and analysis of selected benchmarks for Th-U fuel cycle
Uranium and thorium recovery from a sub-product of monazite industrial processing
International Nuclear Information System (INIS)
Gomiero, L.A.; Ribeiro, J.S.; Scassiotti Filho, W.
1994-01-01
In the monazite alkaline leaching industrial process for the production of rare earth elements, a by-product is formed, which has a high concentration of thorium and a lower but significant one of uranium. A procedure for recovery of the thorium and uranium contents in this by-product is presented. The first step of this procedure is the leaching with sulfuric acid, followed by uranium extraction from the acid liquor with a tertiary amine, stripping with a Na Cl solutions and precipitation as ammonium diuranate with N H 4 O H. In order to obtain thorium concentrates with higher purity, it is performed by means of the extraction of thorium from the acid liquor, with a primary amine, stripping by a Na Cl solution and precipitation as thorium hydroxide or oxalate. (author)
Component activities in the system thorium nitrate-nitric acid-water at 25oC
International Nuclear Information System (INIS)
Lemire, R.J.; Brown, C.P.
1982-01-01
The equilibrium composition of the vapor above thorium nitrate-nitric acid-water mixtures has been studied as a function of the concentrations of thorium nitrate and nitric acid using a transpiration technique. At 25 o C, the thorium nitrate concentrations m T ranged from 0.1 to 2.5 molal and the nitric acid concentrations m N from 0.3 to 25 molal. The vapor pressure of the nitric acid was found to increase with increasing thorium nitrate concentration for a constant molality of nitric acid in aqueous solution. At constant m T , the nitric acid vapor pressure was particularly enhanced at low nitric acid concentrations. The water vapor pressures decreased regularly with increasing concentrations of both nitric acid and thorium nitrate. The experimental data were fitted to Scatchard's ion-component model, and to empirical multiparameter functions. From the fitting parameters, and available literature data for the nitric acid-water and thorium nitrate-water systems at 25 o C, expressions were calculated for the variation of water and thorium nitrate activities, as functions of the nitric acid and thorium nitrate concentrations, using the Gibbs-Duhem equation. Calculated values for the thorium nitrate activities were strongly dependent on the form of the function originally used to fit the vapor pressure data. (author)
A PWR Thorium Pin Cell Burnup Benchmark
Energy Technology Data Exchange (ETDEWEB)
Weaver, Kevan Dean; Zhao, X.; Pilat, E. E; Hejzlar, P.
2000-05-01
As part of work to evaluate the potential benefits of using thorium in LWR fuel, a thorium fueled benchmark comparison was made in this study between state-of-the-art codes, MOCUP (MCNP4B + ORIGEN2), and CASMO-4 for burnup calculations. The MOCUP runs were done individually at MIT and INEEL, using the same model but with some differences in techniques and cross section libraries. Eigenvalue and isotope concentrations were compared on a PWR pin cell model up to high burnup. The eigenvalue comparison as a function of burnup is good: the maximum difference is within 2% and the average absolute difference less than 1%. The isotope concentration comparisons are better than a set of MOX fuel benchmarks and comparable to a set of uranium fuel benchmarks reported in the literature. The actinide and fission product data sources used in the MOCUP burnup calculations for a typical thorium fuel are documented. Reasons for code vs code differences are analyzed and discussed.
Thorium: in search of a global solution
Antonella Del Rosso
2013-01-01
Last week, an international conference held at CERN brought together the world’s main experts in the field of alternative nuclear technology for the first time to discuss the use of thorium for the production of energy and the destruction of nuclear waste. Among the different technologies presented and discussed at the conference was ADS (Accelerator-Driven Systems) which relies primarily on particle accelerators. The conference Chair (far left), the organisers and some of the distinguished participants of the ThEC13 conference held at CERN from 27 to 31 October 2013. “CERN has always been interested in finding ways in which fundamental research can help to resolve the problems of society,” says Jean-Pierre Revol, a physicist at the ALICE experiment who recently retired from CERN and is President of iThEC, the international not-for-profit organisation which promotes research and development in the field of thorium and which organised the Thorium Energy 2013 (Th...
International Nuclear Information System (INIS)
Rama Mohana Rao, D.; Rawat, Neetika; Manna, D.; Sawant, R.M.; Ghanty, T.K.; Tomar, B.S.
2013-01-01
Highlights: ► The thermodynamic parameters have been determined for the first time. ► The Th-picolinate complexation was exothermic in nature. ► The complexation of Th(IV) with the other two isomers was endothermic process. ► Isonicotinate forms stronger complexes than nicotinate with Th(IV). ► The theoretically calculated values are in line with the experimental results. -- Abstract: Complexation of thorium with pyridine monocarboxylates namely picolinic acid (pyridine-2-carboxylic acid), nicotinic acid (pyridine-3-carboxylic acid) and isonicotinic acid (pyridine-4-carboxylic acid) has been studied by potentiometry and calorimetry to determine the thermodynamic parameters (log K, ΔG, ΔH and ΔS) of complexation. All the studies were carried out at 1.0 M ionic strength adjusted by NaClO 4 and at a temperature of 298 K. The detailed analysis of potentiometric data by Hyperquad confirmed the formation of four complexes, ML i (i = 1–4) in case of picolinate but only one complex (ML) in case of nicotinate and isonicotinate. The stepwise formation constant for ML complex (log K ML ) of thorium-picolinate is higher than those of thorium-nicotinate and thorium-isonicotinate complexes. Further the changes in enthalpy during formation of thorium-picolinate complexes are negative whereas the same for the complexes of thorium with the other two isomers was positive. This difference in the complexation process is attributed to chelate formation in case of thorium-picolinate complexes in which the thorium ion is bound to the picolinate through both the nitrogen in the pyridyl ring and one of the carboxylate oxygen atoms. The complexation process of thorium-nicotinate and thorium-isonicotinate are found to be endothermic in nature and are entropy driven confirming the similar binding nature as in simple carboxylate complexes of thorium. The complexation energies, bond lengths and charges on each atom in the complexes of various possible geometries were calculated
Technology of thorium concentrates purification and their transformation in pure nuclear products
International Nuclear Information System (INIS)
Ikuta, A.
1977-01-01
An experimental study for the purification of thorium concentrates by solvent extraction is presented. The product of purification is appropriate for utilization in the fabrication of nuclear reactor fuel elements. The experiments are carried out in a laboratory scale and the following operations are studied: dissolution, extraction-scrubbing, stripping-scrubbing, thorium oxalate precipitation, and thorium nitrate coagulation [pt
Simulating evaporation of surface atoms of thorium-alloyed tungsten in strong electronic fields
International Nuclear Information System (INIS)
Bochkanov, P.V.; Mordyuk, V.S.; Ivanov, Yu.I.
1984-01-01
By the Monte Carlo method simulating evaporation of surface atoms of thorium - alloyed tungsten in strong electric fields is realized. The strongest evaporation of surface atoms of pure tungsten as compared with thorium-alloyed tungsten in the contentration range of thorium atoms in tungsten matrix (1.5-15%) is shown. The evaporation rate increases with thorium atoms concentration. Determined is in relative units the surface atoms evaporation rate depending on surface temperature and electric field stront
Lifescience Database Archive (English)
Full Text Available SL (Link to library) SLH220 (Link to dictyBase) - - - Contig-U15409-1 SLH220F (Link to Original site) SLH2...20F 510 - - - - - - Show SLH220 Library SL (Link to library) Clone ID SLH220 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLH2-A/SLH220Q.Seq.d/ Representative seq. ID SLH22...0F (Link to Original site) Representative DNA sequence >SLH220 (SLH220Q) /CSM/SL/SLH2-A/SLH220Q.Seq.d/ GAAGA...gnificant alignments: (bits) Value SLH220 (SLH220Q) /CSM/SL/SLH2-A/SLH220Q.Seq.d/
Study of treatment of a thorium and rare earths residue by extraction chromatography
International Nuclear Information System (INIS)
Zini, Josiane; Abrao, Alcidio; Carvalho, Fatima Maria Sequeira de; Freitas, Antonio Alves de; Scapin, Marcos Antonio
2005-01-01
In the 70's was established at IPEN the project of a thorium compounds purification pilot plant that had the goal of fulfilling the nuclear technology purity standards. The used method was the purification by extraction with solvents in pulsed columns. The thorium remaining in the organic phase was back extracted as thorium nitrate with a high degree of purity. Impurities, thorium non-extracted and practically all rare earths in aqueous phase of this chemical process were precipitated as hydroxide, generating a product containing thorium and rare earths, that was denominated RETOTER (residue of thorium and rare earths). This residue was accumulated and today there are 25 (twenty-five) metric tons of this by product stored in the safeguard storage shed at IPEN that must to be treated due to the radiation of the thorium and mainly his daughters. The average composition of this residue is, 68% in thorium oxide (ThO 2 ), 5% in rare earths oxides (R 2 O 3 ), 0,3% in uranium oxide (U 3 O 8 ) and common impurities such as phosphorus, iron, titanium, lead and sodium. In this work a new method is presented for separation and purification of thorium from this residue, obtaining a concentrate with high degree of purity for nuclear and non-nuclear use. This process will contribute to establish a decreasing of residue volumes, to have a mind to the minimization of environmental impacts, the reduction of worker's exposition and reduction of the storage costs. In this process the separation and purification of uranium and thorium is done by chromatography extraction, being used polymeric resins, that are previously functionalized with organic solvent (extractor agent). The effluent of this process is a concentrate of rare earths that can be reprocessed in a subsequent fractionating for to obtaining the individual fractions. (author)
2010-01-01
... 7 Agriculture 10 2010-01-01 2010-01-01 false Collections. 1280.220 Section 1280.220 Agriculture... INFORMATION ORDER Lamb Promotion, Research, and Information Order Assessments § 1280.220 Collections. (a) Each first handler and each exporter responsible for the collection of assessments under this subpart shall...
Self-Sustaining Thorium Boiling Water Reactors
International Nuclear Information System (INIS)
Greenspan, Ehud; Gorman, Phillip M.; Bogetic, Sandra; Seifried, Jeffrey E.; Zhang, Guanheng; Varela, Christopher R.; Fratoni, Massimiliano; Vijic, Jasmina J.; Downar, Thomas; Hall, Andrew; Ward, Andrew; Jarrett, Michael; Wysocki, Aaron; Xu, Yunlin; Kazimi, Mujid; Shirvan, Koroush; Mieloszyk, Alexander; Todosow, Michael; Brown, Nicolas; Cheng, Lap
2015-01-01
The primary objectives of this project are to: Perform a pre-conceptual design of a core for an alternative to the Hitachi proposed fuel-self- sustaining RBWR-AC, to be referred to as a RBWR-Th. The use of thorium fuel is expected to assure negative void coefficient of reactivity (versus positive of the RBWR-AC) and improve reactor safety; Perform a pre-conceptual design of an alternative core to the Hitachi proposed LWR TRU transmuting RBWR-TB2, to be referred to as the RBWR-TR. In addition to improved safety, use of thorium for the fertile fuel is expected to improve the TRU transmutation effectiveness; Compare the RBWR-Th and RBWR-TR performance against that of the Hitachi RBWR core designs and sodium cooled fast reactor counterparts - the ARR and ABR; and, Perform a viability assessment of the thorium-based RBWR design concepts to be identified along with their associated fuel cycle, a technology gap analysis, and a technology development roadmap. A description of the work performed and of the results obtained is provided in this Overview Report and, in more detail, in the Attachments. The major findings of the study are summarized.
Self-Sustaining Thorium Boiling Water Reactors
Energy Technology Data Exchange (ETDEWEB)
Greenspan, Ehud [Univ. of California, Berkeley, CA (United States); Gorman, Phillip M. [Univ. of California, Berkeley, CA (United States); Bogetic, Sandra [Univ. of California, Berkeley, CA (United States); Seifried, Jeffrey E. [Univ. of California, Berkeley, CA (United States); Zhang, Guanheng [Univ. of California, Berkeley, CA (United States); Varela, Christopher R. [Univ. of California, Berkeley, CA (United States); Fratoni, Massimiliano [Univ. of California, Berkeley, CA (United States); Vijic, Jasmina J. [Univ. of California, Berkeley, CA (United States); Downar, Thomas [Univ. of Michigan, Ann Arbor, MI (United States); Hall, Andrew [Univ. of Michigan, Ann Arbor, MI (United States); Ward, Andrew [Univ. of Michigan, Ann Arbor, MI (United States); Jarrett, Michael [Univ. of Michigan, Ann Arbor, MI (United States); Wysocki, Aaron [Univ. of Michigan, Ann Arbor, MI (United States); Xu, Yunlin [Univ. of Michigan, Ann Arbor, MI (United States); Kazimi, Mujid [Massachusetts Inst. of Technology (MIT), Cambridge, MA (United States); Shirvan, Koroush [Massachusetts Inst. of Technology (MIT), Cambridge, MA (United States); Mieloszyk, Alexander [Massachusetts Inst. of Technology (MIT), Cambridge, MA (United States); Todosow, Michael [Brookhaven National Lab. (BNL), Upton, NY (United States); Brown, Nicolas [Brookhaven National Lab. (BNL), Upton, NY (United States); Cheng, Lap [Brookhaven National Lab. (BNL), Upton, NY (United States)
2015-03-15
The primary objectives of this project are to: Perform a pre-conceptual design of a core for an alternative to the Hitachi proposed fuel-self- sustaining RBWR-AC, to be referred to as a RBWR-Th. The use of thorium fuel is expected to assure negative void coefficient of reactivity (versus positive of the RBWR-AC) and improve reactor safety; Perform a pre-conceptual design of an alternative core to the Hitachi proposed LWR TRU transmuting RBWR-TB2, to be referred to as the RBWR-TR. In addition to improved safety, use of thorium for the fertile fuel is expected to improve the TRU transmutation effectiveness; Compare the RBWR-Th and RBWR-TR performance against that of the Hitachi RBWR core designs and sodium cooled fast reactor counterparts - the ARR and ABR; and, Perform a viability assessment of the thorium-based RBWR design concepts to be identified along with their associated fuel cycle, a technology gap analysis, and a technology development roadmap. A description of the work performed and of the results obtained is provided in this Overview Report and, in more detail, in the Attachments. The major findings of the study are summarized.
Partial thorium loading in the initial core of Kakrapar atomic power reactor
International Nuclear Information System (INIS)
Balakrishnan, M.R.
1993-01-01
The first unit of Kakrapar nuclear power station has gone critical with some thorium oxide fuel bundles loaded in its core. The thorium helps to flatten the power by reducing neutron flux in the centre of the reactor. However, the placing of the thorium had to be planned with care, because if the neutron flux at a point where a safety rod is located is depressed, the reactivity worth of the safety rod gets reduced. Using a dynamic programing approach, the Reactor Engineering Division of Bhabha Atomic Research Centre worked out a satisfactory configuration for loading the thorium bundles
Thorium determination by X-ray Fluorescence Spectrometry in simulated thorex process solutions
International Nuclear Information System (INIS)
Yamaura, M.; Matsuda, H.T.
1989-01-01
The X-ray fluorescence method for thorium determination in aqueous and organic (TBP-n-dodecane) solutions is described. The thin film-technique for sample preparation and a suitable internal standard have been used. Some parameters as analytical line, internal standard, filter paper, paper geometry, sample volume and measurement conditions were studied. Uranium, fission products, corrosion products and thorex reagent components were studied as interfering elements in the thorium analysis, as well as the matrix effect by using the thorex process simulated solutions the method to thorium determination in irradiated thorium solutions was applied. (M.J.C.) [pt
Once-through thorium cycles in Candu reactors
International Nuclear Information System (INIS)
Milgram, M.S.
1982-01-01
In once-through thorium cycles pure thorium fuel bundles can be irradiated conjointly with uranium fuel bundles in a CANDU reactor with parameters judiciously chosen such that the overall fuel cycle cost is competitive with other possibilities - notably low-enriched uranium. Uranium 233 can be created and stockpiled for possible future use with no imperative that it be used unless future conditions warrant, and a stockpile can be begun independently of the state of reprocessing technology. The existence and general properties of these cycles are discussed
Chromatographic behavior of carbonate complexes of lanthanides and of thorium in alumina
International Nuclear Information System (INIS)
Tomida, E.K.
1977-01-01
The chromatographic behavior of some rare earth elements and thorium on alumina is studied in order to evaluate the possibility of separation from concentration of trace rare earths from high-purity thorium compounds. The effect of some factors on complex thorium carbonate formation and the extent of thorium solubility in sodium and potassium carbonate solutions investigated. The sorption of rare earth elements and thoriuum on alumina from alkali carbonate solution is observed, despite the reports that alumina acts as a cation exchanger in alkali media and that thorium and rare earths form stable anionic carbonate complexes. The formation of these elements between alumina and potassium carbonate solutions is studied as a function of pH, carbonate concentration and metal ion concentration. Also the elution of rare earths from alumina is studied and the best results are obtained with mineral acids and EDTA plus alkali carbonate solutions. The effect of some parameters as column aging, mixed solvents, column treatment with organic solvents, temperature, aluant concentration is investigated. Attempting to understand this sorption mechanism, some experiments with strongly basic anion exchanger and cation exchangers of strongly acid and weakly acid type are accomplished. It is observed that there are significant differences, in some conditions, between the behavior of rare earths and of thorium, pointing our the possibility of separation of one lanthanide from others and of these from thorium [pt
Effectiveness of intragastric administration of 8102 for removal of thorium-234 in rats
International Nuclear Information System (INIS)
Luo Meichu; Li Landi; Sun Meizhen; Ye Qian; Liu Yi
1992-01-01
8102, a 1,2-dihydroxy-3,6-bismethylamino diacetic derivative, is a new chelating agent for decorporation of radionuclides. The effectiveness of intragastric administration of this drug at different doses (50-1000 mg/kg of body) and at different times before or after giving thorium-234 in rats was reported. The results show that for rats given intragastricly 1000 mg/kg of 8102, the excretion of thorium-234 in urine for first two days is 4.5 times more than that for control rats and accumulations of thorium-234 in liver, skeleton and kidney for these rats were 30%, 62% and 68% as those for control rats, respectively. The effectiveness was reduced with decrease in dosage of 8102. Administration of 8102 at 1 or 2 h before injection of thorium-234 can improve the effectiveness for decorporation of thorium-234: accumulation of thorium-234 in liver was markedly less than that for rats given 8102 immediately after injection of thorium-234. Delayed administration of 9102 resulted in reduction of the effectiveness. The practicality of oral administration of 8102 in clinic for decorporation of radionuclides was discussed
Transmutation of minor actinide using thorium fueled BWR core
International Nuclear Information System (INIS)
Susilo, Jati
2002-01-01
One of the methods to conduct transmutation of minor actinide is the use of BWR with thorium fuel. Thorium fuel has a specific behaviour of producing a little secondary minor actinides. Transmutation of minor actinide is done by loading it in the BWR with thorium fuel through two methods, namely close recycle and accumulation recycle. The calculation of minor actinide composition produced, weigh of minor actinide transmuted, and percentage of reminder transmutation was carried SRAC. The calculations were done to equivalent cell modeling from one fuel rod of BWR. The results show that minor actinide transmutation is more effective using thorium fuel than uranium fuel, through both close recycle and accumulation recycle. Minor actinide transmutation weight show that the same value for those recycle for 5th recycle. And most of all minor actinide produced from 5 unit BWR uranium fuel can transmuted in the 6 t h of close recycle. And, the minimal value of excess reactivity of the core is 12,15 % Δk/k, that is possible value for core operation
Controlled synthesis of thorium and uranium oxide nano-crystals
International Nuclear Information System (INIS)
Hudry, Damien; Apostolidis, Christos; Walter, Olaf; Gouder, Thomas; Courtois, Eglantine; Kubel, Christian; Meyer, Daniel
2013-01-01
Very little is known about the size and shape effects on the properties of actinide compounds. As a consequence, the controlled synthesis of well-defined actinide-based nano-crystals constitutes a fundamental step before studying their corresponding properties. In this paper, we report on the non-aqueous surfactant-assisted synthesis of thorium and uranium oxide nano-crystals. The final characteristics of thorium and uranium oxide nano-crystals can be easily tuned by controlling a few experimental parameters such as the nature of the actinide precursor and the composition of the organic system (e.g., the chemical nature of the surfactants and their relative concentrations). Additionally, the influence of these parameters on the outcome of the synthesis is highly dependent on the nature of the actinide element (thorium versus uranium). By using optimised experimental conditions, monodisperse isotropic uranium oxide nano-crystals with different sizes (4.5 and 10.7 nm) as well as branched nano-crystals (overall size ca. 5 nm), nano-dots (ca. 4 nm) and nano-rods (with ultra-small diameters of 1 nm) of thorium oxide were synthesised. (authors)
Use of thorium for high temperature gas-cooled reactors
Energy Technology Data Exchange (ETDEWEB)
Guimarães, Cláudio Q., E-mail: claudio_guimaraes@usp.br [Universidade de São Paulo (USP), SP (Brazil). Instituto de Física; Stefani, Giovanni L. de, E-mail: giovanni.stefani@ipen.br [Instituto de Pesquisas Energéticas e Nucleares (IPEN/CNEN-SP), São Paulo, SP (Brazil); Santos, Thiago A. dos, E-mail: thiago.santos@ufabc.edu.br [Universidade Federal do ABC (UFABC), Santo André, SP (Brazil)
2017-07-01
The HTGR ( High Temperature Gas-cooled Reactor) is a 4{sup th} generation nuclear reactor and is fuelled by a mixture of graphite and fuel-bearing microspheres. There are two competitive designs of this reactor type: The German “pebble bed” mode, which is a system that uses spherical fuel elements, containing a graphite-and-fuel mixture coated in a graphite shell; and the American version, whose fuel is loaded into precisely located graphite hexagonal prisms that interlock to create the core of the vessel. In both variants, the coolant consists of helium pressurised. The HTGR system operates most efficiently with the thorium fuel cycle, however, so relatively little development has been carried out in this country on that cycle for HTGRs. In the Nuclear Engineering Centre of IPEN (Instituto de Pesquisas Energéticas e Nucleares), a study group is being formed linked to thorium reactors, whose proposal is to investigate reactors using thorium for {sup 233}U production and rejects burning. The present work intends to show the use of thorium in HTGRs, their advantages and disadvantages and its feasibility. (author)
Design and evaluation of a thorium (IV) selective optode
International Nuclear Information System (INIS)
Safavi, Afsaneh; Sadeghi, Marzieh
2006-01-01
A novel optical sensor has been proposed for sensitive determination of thorium (IV) ion in aqueous solutions. The thorium sensing membrane was prepared by incorporating 4-(p-nitrophenyl azo)-pyrocatechol (NAP) as ionophore in the plasticized PVC membrane containing tributyl phosphate (TBP) as plasticizer. The membrane responds to thorium ion by changing color reversibly from yellow to red-brown in glycine buffer solution at pH 3.5. The proposed sensor displays a linear range of 8.66 x 10 -6 -2.00 x 10 -4 M with a limit of detection of 6 x 10 -6 M. The response time of the optode was about 8.8-12.5 min, depending on the concentration of Th (IV) ions. The selectivity of optode to Th (IV) ions in glycine buffer is good. The sensor can readily be regenerated by exposure to a solution mixture of sodium fluoride and 5-sulfosalicylic acid (dihydrate) (0.01 M each). The optode is fully reversible. The proposed optode was applied to the determination of thorium (IV) in environmental water samples
Flowchart evaluations of irradiated fuel treatment process of low burnup thorium
International Nuclear Information System (INIS)
Linardi, M.
1987-01-01
A literature survey has been carried out, on some versions of the acid-thorex process. Flowsheets of the different parts of the process were evaluated with mixer-settlers experiments. A low burnup thorium fuel (mass ratio Th/U∼100/1), proposed for Brazilian fast breeder reactor initial program, was considered. The behaviour of some fission products was studied by irradiated tracers techniques. Modifications in some of the process parameters were necessary to achieve low losses of 233 U and 232 U and 232 Th. A modified acid-thorex process flowsheet, evaluated in a complete operational cycle, for the treatment of low burnup thorium fuels, is presented. High decontamination factors of thorium in uranium, with reasonable decontamination of uranium in thorium, were achieved. (author) [pt
DH-1a: a certified uranium-thorium reference ore
International Nuclear Information System (INIS)
Steger, H.F.; Bowman, W.S.; Zechanowitsch, G.
1981-09-01
A 122-kg sample of uranium-thorium ore, DH-1a, from Elliot Lake, Ontario, was prepared as a compositional reference material to replace the similar certified ore, DH-1. DH-1a was ground to minus 74μm, blended in one lot, and bottled in 200 g units. The homogeneity of DH-1a with respect to uranium was confirmed using the volumetric umpire method. The recommended value for uranium is based on the data from the confirmation of homogeneity. For thorium, twelve laboratories provided results in a free choice analytical program. A statistical analysis of the data gave a recommended value of 0.263 percent for uranium and 0.091 percent for thorium
Separation of thorium from cerium by the ion-exchange sorption method. Pt. 3
International Nuclear Information System (INIS)
Sozanski, A.
1981-01-01
The method is described of separation of trace-quantities of thorium from chloride and ceric sulfate solutions. Thorium is sorbed selectively on the ion exchanger chelating Vofatite MC-50. Thorium-free ceric solutions were achieved and after ionite eluation concentrates of oxides were considerably enriched. (author)
49 CFR 173.426 - Excepted packages for articles containing natural uranium or thorium.
2010-10-01
... outer surface of the uranium or thorium is enclosed in an inactive sheath made of metal or other durable... uranium or thorium. 173.426 Section 173.426 Transportation Other Regulations Relating to Transportation....426 Excepted packages for articles containing natural uranium or thorium. A manufactured article in...
2010-01-01
... 14 Aeronautics and Space 1 2010-01-01 2010-01-01 false Discovery. 13.220 Section 13.220... INVESTIGATIVE AND ENFORCEMENT PROCEDURES Rules of Practice in FAA Civil Penalty Actions § 13.220 Discovery. (a) Initiation of discovery. Any party may initiate discovery described in this section, without the consent or...
2010-01-01
... 7 Agriculture 4 2010-01-01 2010-01-01 false Administration. 220.3 Section 220.3 Agriculture... CHILD NUTRITION PROGRAMS SCHOOL BREAKFAST PROGRAM § 220.3 Administration. (a) Within the Department, FNS shall act on behalf of the Department in the administration of the Program covered by this part. Within...
Historical and perspectives of thorium compounds production and purification at IPEN-CNEN/SP
International Nuclear Information System (INIS)
Lainetti, Paulo E.O.; Abrao, A.; Freitas, Antonio A.; Carvalho, Fatima M.S. de; Bergamaschi, Vanderlei S.; Cunha, Edgar F.; Ayoub, Jamil M.S.; Mindrisz, Ana C.
2000-01-01
The production and purification of some thorium compounds has been performed in the IPEN in the last 15 years. Some raw materials have been employed in this production, obtained from the monazite exploitation in industrial scale that it was performed in Sao paulo during the period 1948 until 1994. More than 160 t of high purity thorium nitrate were produced, purified by the solvent extraction process. The thorium nitrate has been supplied for the Brazilian portable gaslight industry to the production of Welsbach Mantle. Nowadays, a new facility is being designed and built. The main concern is the recovering of the production capacity, lost after some years of operation without suitable maintenance. This activity has an important strategic role, considering the huge Brazilian thorium resources and the renewed interest in thorium fuel cycle. This paper describes a brief historical background of thorium activities in the IPEN as well as their perspectives. (author)
Thorium Energy Resources and its Potential of Georgian Republic, The Caucasus
Gogoladze, Salome; Okrostsvaridze, Avtandil
2017-04-01
Energy resources, currently consumed by modern civilization, are represented by hydrocarbons - 78-80 %, however these reserves are exhausting. In light of these challenges, search of new energy resources is vital importance problem for the modern civilization. Based on the analysis of existing energy reserves and potential, as the main energy resources for the future of our civilization, the renewable and nuclear energy should be considered. However, thorium has a number of advantages compared to Uranium (Kazimi, 2003; et al.): It is concentrated in the earth crust 4-5 times more than uranium; extraction and enrichment of thorium is much cheaper than uranium's; It is less radioactive; complete destruction of its waste products is possible; thorium yields much more energy than uranium. Because of unique properties and currently existed difficult energetic situation thorium is considered as the main green energy resource in the 3rd millennium of the human civilization (Martin, 2009). Georgia republic, which is situated in the central part of Caucasus, poor of hydrocarbons, but has a thorium resource important potential. In general the Caucasus represents a collisional orogen, that formed along the Eurasian North continental margin and extends over 1200 km from Caspian to Black Sea. Three major units are distinguished in its construction: the Greater and Lesser Caucasian mobile belts and the Transcaucasus microplate. Currently it represents the Tethyan segment connecting the Mediterranean and Iran-Himalayan orogenic belts, between the Gondvana-derived Arabian plate and East European platform. Now in Georgian Republic are marked thorium four ore occurrences (Okrostsvaridze, 2014): 1- in the Sothern slope of the Greater Caucasus, in the quartz -plagioclases veins (Th concentrations vary between 51g/t - 3882 g/t); 2- in the Transcaucasus Dzirula massif hydrothermally altered rocks of the Precambrian quartz-diorite gneisses (Th concentrations vary between 117 g/t -266 g
Certain distribution characteristics of uranium and thorium in apatite-carbonate ores
Energy Technology Data Exchange (ETDEWEB)
Kharitonova, R Sh; Faizullin, R N; Kozlov, E N; Berman, I B
1979-01-01
A study of the total radioactivity, uranium content, thorium content, U/Th ratio, and the spatial distribution of uranium by the f-radiographic method has demonstrated that the apatite ores of the deposit contain elevated concentrations of radioactive elements that are essentially of thorium origin. The main concentration of uranium and thorium is in the cinnemon-brown apatite. Elevated uranium concentrations are also found in hematite and accessory minerals (monacite, zirconium, titanite). Dolomite, quartz, martite, and second generation apatite were found to be weakly radioactive. The uranium and thorium concentration is correlated to the concentration of phosphorus and other petrogenic elements. An analysis of uranium, thorium, and Th/U distribution indicates that the concentration of radioactive elements is not caused by their primary content in carbonate rock but by the outside introduction of these elements together with phosphorus. The cited analyses confirm the chemogenic-sedimentary origin of the dolomite substrate and the metamorphogenic hydrothermal genesis of apatite mineralization. The data on radioactivity may be used as a reliable exploratory criterion for apatite potential. 3 references, 3 figures.
2010-10-01
..., or has caused death or injury, a penalty not to exceed $100,000 per violation may be assessed; and... 49 Transportation 4 2010-10-01 2010-10-01 false Penalty. 220.7 Section 220.7 Transportation Other... TRANSPORTATION RAILROAD COMMUNICATIONS General § 220.7 Penalty. Any person (including but not limited to a...
2010-01-01
... 9 Animals and Animal Products 2 2010-01-01 2010-01-01 false Buildings. 354.220 Section 354.220... CERTIFICATION VOLUNTARY INSPECTION OF RABBITS AND EDIBLE PRODUCTS THEREOF Buildings and Plant Facilities § 354.220 Buildings. The buildings shall be of sound construction and kept in good repair, and shall be of...
2010-07-01
... operations. The accumulation of surplus stocks shall be avoided by proper materiel control, inventory and... physical inventory that has not been credited to NPSL operations under § 220.015(a)(2) shall be credited to... 30 Mineral Resources 2 2010-07-01 2010-07-01 false Inventories. 220.032 Section 220.032 Mineral...
Determination of thorium 230Th in soils
International Nuclear Information System (INIS)
Alvarez, A.; Palomares, J.
1988-01-01
A method for the determination of 230 Th in environmental soils is described. Hydroxides formed, previous fusion with sodium peroxide are dissolved with HNO 3 8N. The thorium is coprecipitated with F 3 La and purified by anion exchange (AG 1x8 50-100 mesh). Thorium is electroplated onto a stainless steel disc, 230 Th is counted by alpha spectrometry and 234 Th used as a tracer by beta counting. The chemical yield for 1g of soil sample is 60-80%. Minimum detectable activities are about 2 mBq/g. (Author)
Thorium deposits in the commonwealth of independent states and their prospective characteristics
International Nuclear Information System (INIS)
Kotova, V.M.; Skorovarov, J.I.
1997-01-01
Since 1956, the All-Russian Research Institute of Chemical Technology has been engaged in the research of assessing thorium deposits and ore occurrence, as well as developing its production technology from various ore types. From the known CIS thorium and thorium-bearing deposits and occurrences (2500) only 241 sites have their resources estimated. They include 132 monazite placers of the Quarternary age, 6 complex Quarternary deposits of placer type (4 polarite, 1 uranium-thorianite and 1 thorium-platinum placers), 66 endogenous deposits and occurrences and 38 complex ones (including zircon-ilmenite Tertiary and older buried placers). This paper gives a summary of the author's attempt to classify thorium deposits according to their genetic types. The proposed classification scheme is based on formational principles and integrates geological-tectonic, magmatic and other criterions. The deposits is based on formation principles and integrates geological-tectonic, magmatic and other criterions. The deposits which are located in igneous, metamorphic and sedimentary rocks are further observed according to their geological setting and types of mother rocks. Thorium deposits are known in the numerous metallogenetic provinces of the CIS. (author). 1 tab
Separation of Protactinium from Neutron Irradiated Thorium Oxide
International Nuclear Information System (INIS)
Dominguez, G.; Gutierrez, L.; Ropero, M.
1983-01-01
The chemical separation of thorium and protactinium can be carried out by leaching most of the last one, about 95%, with aqueous HF from neutron irradiated thorium oxide. This leaching reaction la highly favored by the transformation reaction of the ThO 2 material into ThF 4 . For both reactions, leaching and transformation, the reagents concentration, agitation speed and temperature influences were studied and the activation energies were found. (Author) 18 refs
Uranium and thorium recovery in thorianite ore-preliminary results
Energy Technology Data Exchange (ETDEWEB)
Gaiotte, Joao V.M. [Universidade Federal de Alfenas, Pocos de Caldas, MG (Brazil); Villegas, Raul A.S.; Fukuma, Henrique T., E-mail: rvillegas@cnen.gov.br, E-mail: htfukuma@cnen.gov.br [Comissao Nacional de Energia Nuclear (CNEN), Pocos de Caldas, MG (Brazil). Lab. de Pocos de Caldas
2011-07-01
This work presents the preliminary results of the studies aiming to develop a hydrometallurgical process to produce uranium and thorium concentrates from thorianite ore from Amapa State, Brazil. This process comprises two major parts: acid leaching and Th/U recovery using solvent extraction strategies. Thorianite ore has a typical composition of 60 - 70% of thorium, 8 - 10% lead and 7 - 10% uranium. Sulfuric acid leaching operational conditions were defined as follows: acid/ore ratio 7.5 t/t, ore size below 65 mesh (Tyler), 2 hours leaching time and temperature of 100 deg C. Leaching tests results showed that uranium and thorium recovery exceeded 95%, whereas 97% of lead ore content remained in the solid form. Uranium and thorium simultaneous solvent extraction is necessary due to high sulfate concentration in the liquor obtained from leaching, so the Primene JM-T primary anime was used for this extraction step. Aqueous raffinate from extraction containing sulfuric acid was recycled to the leaching step, reducing acid uptake around 60%, to achieve a net sulfuric acid consumption of 3 t/t of ore. Uranium and thorium simultaneous stripping was performed using sodium carbonate solution. In the aqueous stripped it was added sulfuric acid at pH 1.5, followed by a second solvent extraction step using the tertiary amine Alamine 336. The following stripping step was done with a solution of sodium chloride, resulting in a final solution of 23 g L-1 uranium. (author)
Spectrophotometric Determination of Thorium in Low Grade Minerals and Ores
Energy Technology Data Exchange (ETDEWEB)
Arnfelt, A L; Edmundsson, I
1960-08-15
The following method is intended for the determination of microgram quantities of thorium in samples of minerals and ores. The mineral sample is decomposed by repeated sintering with sodium peroxide. After digestion with water thorium peroxide hydrate is recovered by centrifugation and dissolved in hydrochloric acid. Thorium is determined spectrophotometrically with naphtarson after its separation from metals forming chloro complexes which are adsorbed on a strongly basic anion exchange resin. Interferences from a few different ions have been studied. The time required for the analysis of one sample is about 4 hours, when analysing 12 samples simultaneously
Spectrophotometric Determination of Thorium in Low Grade Minerals and Ores
International Nuclear Information System (INIS)
Arnfelt, A.L.; Edmundsson, I.
1960-08-01
The following method is intended for the determination of microgram quantities of thorium in samples of minerals and ores. The mineral sample is decomposed by repeated sintering with sodium peroxide. After digestion with water thorium peroxide hydrate is recovered by centrifugation and dissolved in hydrochloric acid. Thorium is determined spectrophotometrically with naphtarson after its separation from metals forming chloro complexes which are adsorbed on a strongly basic anion exchange resin. Interferences from a few different ions have been studied. The time required for the analysis of one sample is about 4 hours, when analysing 12 samples simultaneously
Energy Technology Data Exchange (ETDEWEB)
Freitas, Antonio Alves de
2008-07-01
As consequence of the operation of a Thorium purification facility, for pure Thorium Nitrate production, the IPEN (Instituto de Pesquisas Energeticas e Nucleares) has stored away a solid residue called RETOTER (REsiduo de TOrio e TErras Raras). The RETOTER is rich in Rare-Earth Elements and significant amount of Thorium-232 and minor amount of Uranium. Furthermore it contains several radionuclides from the natural decay series. Significant radioactivity contribution is generated by the Thorium descendent, mainly the Radium-228(T{sub 1/2}=5.7y), known as meso thorium and Thorium-228(T{sub 1/2} 1.90y). An important thorium daughter is the Lead-208, a stable isotope present with an expressive quantity. After the enclosure of the operation of the Thorium purification facility, many researches have been developed for the establishment of methodologies for recovery of Thorium, Rare-Earth Elements and Lead-208 from the RETOTER. This work presents a method for RETOTER decontamination, separating and bordering upon some radioactive isotopes. The residue was digested with nitric acid and the Radium-228 was separated by the Barium Sulphate co-precipitation procedure. Finally, the Thorium was separated by the peroxide precipitation and the Rare-Earth Elements were also recovered by the Rare-Earth peroxide precipitation in the filtrate solution.(author)
Review of problems associated with the utilization of available thorium resources
International Nuclear Information System (INIS)
O'Hara, F.A.; Gray, R.A.
1975-01-01
Portions of the U. S. Thorium Stockpile are in danger of literally ''going to waste.'' These raw materials, with their high concentrations of thorium, are valuable resources which can be utilized to fuel thermal converter reactors. A portion of this stockpile was transferred to Mound Laboratory in the early 1950's. In 1972, the material was determined to be excess to all present and foreseeable future national requirements. Disposal by burial was recommended by the AEC. Following a detailed study of the potential usefulness of the material and the costs associated with land burial, the AEC agreed to offer the material on surplus sale. Risks and benefits associated with retention of the thorium stockpile are described. Nuclear Materials Managers are uniquely situated to exercise influence and direct the future course of remaining thorium reserves
Thorium content of a mineral ore from Morro do Ferro by fission track technique
International Nuclear Information System (INIS)
Oliveira, C.A.N. de.
1980-10-01
The feasibility to determine thorium concentrations by fission track technique in samples of mineral ore has been demonstrated. The literature registers only the application of the fission track technique to mineral ore in the case where the fissionable element is uranium. The technique was applied to determine the thorium concentration of an ore sample from Morro do Ferro, taking advantage of the high thorium to uranium ratio in that mineral. The sample analysed presented a thorium concentration of 2467 +- 400 mg Th/Kg ore. The so called wet method was adopted by using the Bayer made Makrofol KG 10μm thick, as the detector foil, immersed in the thorium solution. The technique is also useful to determine thorium concentrations in environmental samples because of the following aspects: high sensitivity; fast chemical separation of interfering elements; low cost; and operational simplicity. (Author) [pt
Activities of the research committee on thorium cycle in atomic energy society of Japan
International Nuclear Information System (INIS)
Hohki, Shiro
1985-01-01
In 1978 the Research Committee on Thorium Cycle was established as one of committees of the Atomic Energy Society of Japan, and the Committee published a report titled 'The Thorium Cycle - Present Status and Future Prospect' in October 1980 as a result of investigations on the status of the thoirum cycle in Japan as well as that in overseas. Based on this investigation, the Committee is intending to evaluate synthetically the thorium utilization in Japan under the prospect for the middle and long term by intensifying the activities of the Committee. Furthermore, from this viewpoint, the author supplements comments on following three points: (1) Reasons why the thorium utilization has not received positive evaluation in Japan; (2) Reasons why Japan has to pay attention to thorium; (3) How the technology on thorium should be developed in Japan. (author)
A study on the structure of thorium salt solutions
International Nuclear Information System (INIS)
Magini, M.; Cabrini, A.; Di Bartolomeo, A.
1975-01-01
The structure of highly hydrolyzed thorium salt solutions has been investigated by large and small angle X-ray scattering techniques. The diffraction data obtained with large angle measurements show the presence in solution of microcrystalline particles with the thorium oxide structure. Particles larger than those were discovered by small angle measurements. A possible shape of these colloidal particles has been discussed
Thorium spectrophotometric analysis with high precision
International Nuclear Information System (INIS)
Palmieri, H.E.L.
1983-06-01
An accurate and precise determination of thorium is proposed. Precision of about 0,1% is required for the determination of macroquantities of thorium processed. After an extensive literature search concerning this subject, spectrophotometric titration has been chosen, using disodium ethylenediaminetetraacetate (EDTA) solution and alizarin S as indicator. In order to obtain such a precision, an amount of 0,025 M EDTA solution precisely measured has been added and the titration was completed with less than 5 ml of 0,0025 M EDTA solution. It is usual to locate the end-point graphically, by plotting added titrant versus absorbance. The non-linear minimum square fit, using the Fletcher e Powell's minimization process and a computer program. (author)
Virginia ADS consortium - thorium utilization
International Nuclear Information System (INIS)
Myneni, Ganapati
2015-01-01
A Virginia ADS consortium, consisting of Virginia Universities (UVa, VCU, VT), Industry (Casting Analysis Corporation, GEM*STAR, MuPlus Inc.), Jefferson Lab and not-for-profit ISOHIM, has been organizing International Accelerator-Driven Sub-Critical Systems (ADS) and Thorium Utilization (ThU) workshops. The third workshop of this series was hosted by VCU in Richmond, Virginia, USA Oct 2014 with CBMM and IAEA sponsorship and was endorsed by International Thorium Energy Committee (IThEC), Geneva and Virginia Nuclear Energy Consortium Authority. In this presentation a brief summary of the successful 3 rd International ADS and ThU workshop proceedings and review the worldwide ADS plans and/or programs is given. Additionally, a report on new start-ups on Molten Salt Reactor (MSR) systems is presented. Further, a discussion on potential simplistic fertile 232 Th to fissile 233 U conversion is made
Performance of Energy Multiplier Module (EM2) with long-burn thorium fuel cycle
International Nuclear Information System (INIS)
Choi, Hangbok; Schleicher, Robert; Gupta, Puja
2015-01-01
Energy Multiplier Module (EM 2 ) is a helium-cooled fast reactor being developed by General Atomics for the 21 st century grid. It is designed as a modular plant with a net electric output of 265 MWe with an evaporative heat sink and 240 MWe with an air-cooled heat sink. EM 2 core performance is examined for the baseline loading of low-enriched uranium (LEU) as fissile material with depleted uranium (DU) as fertile material and compared to the alternate LEU with thorium loading. The latter has two options: a heterogeneous loading of thorium fuel in the place of DU that produces a longer fuel cycle, and homogeneously mixed thorium-uranium fuel loading. Compared to the baseline LEU/DU core, the cycle length of both thorium options is reduced due to higher neutron absorptions by thorium. However, for both, heterogeneous and homogenous thorium loading options, the fuel cycle length is over 24 years without refueling or reshuffling of fuel assemblies. The physics properties of the EM 2 thorium core are close to those of the baseline core which constitute low excess reactivity, negative fuel temperature coefficient, and very small void reactivity. However, unlike the case of baseline EM 2 , the homogeneous thorium fuel loading provides additional advantage in reducing the power peaking of the core, which in turn reduces the cladding material neutron damage rate by 23%. It is interpreted that the relatively slow 233 U buildup as compared to 239 Pu for baseline core retards reactivity increase without the need for a complicated fuel loading pattern of the heterogeneous fuel loading, while maintaining the peak power density low. Therefore both the heterogeneous and homogeneous thorium loading options will be feasible in the EM 2
Mishra, Rosaline; Sapra, B K; Prajith, R; Rout, R P; Jalaluddin, S; Mayya, Y S
2015-09-01
In India, High Background Radiation Areas (HBRAs) due to enhanced levels of naturally occurring radionuclides in soil (thorium and, to a lesser extent, uranium), are located along some parts of the coastal tracts viz. the coastal belt of Kerala, Tamilnadu and Odisha. It is conjectured that these deposits will result in higher emissions of radon isotopes ((222)Rn and (220)Rn) and their daughter products as compared to Normal Background Radiation Areas (NBRAs). While the annual external dose rates contributed by gamma radiations in these areas are about 5-10 times higher, the extent of increase in the inhalation dose rates attributable to (222)Rn and (220)Rn and their decay products is not well quantified. Towards this, systematic indoor surveys were conducted wherein simultaneous measurements of time integrated (222)Rn and (220)Rn gas and their decay product concentrations was carried out in around 800 houses in the HBRAs of Kerala and Odisha to estimate the inhalation doses. All gas measurements were carried out using pin-hole cup dosimeters while the progeny measurements were with samplers and systems based on the Direct radon/thoron Progeny sensors (DRPS/DTPS). To corroborate these passive measurements of decay products concentrations, active sampling was also carried out in a few houses. The results of the surveys provide a strong evidence to conclude that the inhalation doses due to (222)Rn and (220)Rn gas and their decay products in these HBRAs are in the same range as observed in the NBRAs in India. Copyright © 2015 Elsevier Ltd. All rights reserved.
Use of thorium in the generation IV Molten Salt reactors and perspectives for Brazil
International Nuclear Information System (INIS)
Seneda, Jose A.; Lainetti, Paulo E.O.
2013-01-01
Interest in thorium stems mainly from the fact that it is expected a substantial increase in uranium prices over the next fifty years. The reactors currently in operation consume 65,500 tons of uranium per year. Each electrical gigawatt (GWe) additional need about 200 tU mined per year. So advanced fuel cycles, which increase the reserves of nuclear materials are interesting, particularly the use of thorium to produce the fissile isotope 233 U. It is important to mention some thorium advantages. Thorium is three to five times more abundant than uranium in the earth's crust. Thorium has only one oxidation state. Additionally, thoria produces less radiotoxicity than the UO 2 because it produces fewer amounts of actinides, reducing the radiotoxicity of long life nuclear waste. ThO 2 has higher corrosion resistance than UO 2 , besides being chemically stable due to their low water solubility. The burning of Pu in a reactor based in thorium also decreases the inventories of Pu from the current fuel cycles, resulting in lower risks of material diversion for use in nuclear weapons. There are some ongoing projects in the world, taking into consideration the proposed goals for Generation IV reactors, namely: sustainability, economics, safety and reliability, proliferation resistance and physical protection. Some developments on the use of thorium in reactors are underway, with the support of the IAEA and some governs. Can be highlighted some reactor concepts using thorium as fuel: CANDU; ADTR -Accelerator Driven Thorium Reactor; AHWR -Advanced Heavy Water Reactor proposed by India (light water cooled and moderated by heavy water) and the MSR -Molten Salt Reactor. The latter is based on a reactor concept that has already been successfully tested in the U.S. in the 50s, for use in aircrafts. In this paper, we discuss the future importance of thorium, particularly for Brazil, which has large mineral reserves of this strategic element, the characteristics of the molten salt
Use of thorium in the generation IV Molten Salt reactors and perspectives for Brazil
Energy Technology Data Exchange (ETDEWEB)
Seneda, Jose A.; Lainetti, Paulo E.O., E-mail: jaseneda@ipen.br [Instituto de Pesquisas Energeticas e Nucleares (IPEN/CNEN-SP), Sao Paulo, SP (Brazil)
2013-07-01
Interest in thorium stems mainly from the fact that it is expected a substantial increase in uranium prices over the next fifty years. The reactors currently in operation consume 65,500 tons of uranium per year. Each electrical gigawatt (GWe) additional need about 200 tU mined per year. So advanced fuel cycles, which increase the reserves of nuclear materials are interesting, particularly the use of thorium to produce the fissile isotope {sup 233}U. It is important to mention some thorium advantages. Thorium is three to five times more abundant than uranium in the earth's crust. Thorium has only one oxidation state. Additionally, thoria produces less radiotoxicity than the UO{sub 2} because it produces fewer amounts of actinides, reducing the radiotoxicity of long life nuclear waste. ThO{sub 2} has higher corrosion resistance than UO{sub 2}, besides being chemically stable due to their low water solubility. The burning of Pu in a reactor based in thorium also decreases the inventories of Pu from the current fuel cycles, resulting in lower risks of material diversion for use in nuclear weapons. There are some ongoing projects in the world, taking into consideration the proposed goals for Generation IV reactors, namely: sustainability, economics, safety and reliability, proliferation resistance and physical protection. Some developments on the use of thorium in reactors are underway, with the support of the IAEA and some governs. Can be highlighted some reactor concepts using thorium as fuel: CANDU; ADTR -Accelerator Driven Thorium Reactor; AHWR -Advanced Heavy Water Reactor proposed by India (light water cooled and moderated by heavy water) and the MSR -Molten Salt Reactor. The latter is based on a reactor concept that has already been successfully tested in the U.S. in the 50s, for use in aircrafts. In this paper, we discuss the future importance of thorium, particularly for Brazil, which has large mineral reserves of this strategic element, the
Recovery of Ra-223 from natural thorium irradiated by protons
Energy Technology Data Exchange (ETDEWEB)
Vasiliev, Aleksandr N.; Ostapenko, Valentina S. [Lomonosov Moscow State Univ. (Russian Federation); Russian Academy of Sciences, Moscow-Troitsk (Russian Federation). Inst. for Nuclear Research; Lapshina, Elena V.; Ermolaev, Stanislav V.; Zhuikov, Boris L. [Russian Academy of Sciences, Moscow-Troitsk (Russian Federation). Inst. for Nuclear Research; Danilov, Sergey S. [Lomonosov Moscow State Univ. (Russian Federation); Kalmykov, Stepan N. [Lomonosov Moscow State Univ. (Russian Federation); National Research Center ' Kurchatov Institute' (NRC ' Kurchatov Institute' ), Moscow (Russian Federation)
2016-11-01
Irradiation of natural thorium with medium-energy protons is considered to be a prospective approach to large-scale production of {sup 225}Ac and {sup 223}Ra. In addition to the earlier-developed method of {sup 225}Ac isolation, the present work focuses on the simultaneous recovery of {sup 223}Ra from the same thorium target. Radiochemical procedure is based on liquid-liquid extraction, cation exchange and extraction chromatography. The procedure provides separation of radium from spallation and fission products generated in the thorium target. High chemical yield (85-90%) and radionuclide purity of {sup 223}Ra (> 99.8% except {sup 224}Ra and {sup 225}Ra isotopes) have been achieved.
Determination of rare earth impurities in thorium by spectrographic methods
Energy Technology Data Exchange (ETDEWEB)
Wray, L W
1957-08-15
A method for determining rare earth impurities in thorium in the fractional ppm range is described. Before spectrographic examination is possible, the impurities must be freed from the thorium matrix. This is accomplished by removing the bulk of the thorium by extraction with TBP-CCl{sub 4} and the remainder by extraction with TTA-C{sub 6}H{sub 6}. This results in a consistent recovery of rare earths of about 85% with an average sensitivity of 0.2 ppm. The experimental error is within 10%. Details of the procedure are given together with working curves for the major neutron absorbing rare earths; i.e. dysprosium, europium, gadolinium and samarium. (author)
Uranium- and thorium-bearing pegmatites of the United States
International Nuclear Information System (INIS)
Adams, J.W.; Arengi, J.T.; Parrish, I.S.
1980-04-01
This report is part of the National Uranium Resource Evaluation (NURE) Program designed to identify criteria favorable for the occurrence of the world's significant uranium deposits. This project deals specifically with uranium- and thorium-bearing pegmatites in the United States and, in particular, their distribution and origin. From an extensive literature survey and field examination of 44 pegmatite localities in the United States and Canada, the authors have compiled an index to about 300 uranium- and thorium-bearing pegmatites in the United States, maps giving location of these deposits, and an annotated bibliography to some of the most pertinent literature on the geology of pegmatites. Pegmatites form from late-state magma differentiates rich in volatile constituents with an attendant aqueous vapor phase. It is the presence of an aqueous phase which results in the development of the variable grain size which characterizes pegmatites. All pegmatites occur in areas of tectonic mobility involving crustal material usually along plate margins. Those pegmatites containing radioactive mineral species show, essentially, a similar distribution to those without radioactive minerals. Criteria such as tectonic setting, magma composition, host rock, and elemental indicators among others, all serve to help delineate areas more favorable for uranium- and thorium-bearing pegmatites. The most useful guide remains the radioactivity exhibited by uranium- and thorium-bearing pegmatites. Although pegmatites are frequently noted as favorable hosts for radioactive minerals, the general paucity and sporadic distribution of these minerals and inherent mining and milling difficulties negate the resource potential of pegmatites for uranium and thorium
Uranium- and thorium-bearing pegmatites of the United States
Energy Technology Data Exchange (ETDEWEB)
Adams, J.W.; Arengi, J.T.; Parrish, I.S.
1980-04-01
This report is part of the National Uranium Resource Evaluation (NURE) Program designed to identify criteria favorable for the occurrence of the world's significant uranium deposits. This project deals specifically with uranium- and thorium-bearing pegmatites in the United States and, in particular, their distribution and origin. From an extensive literature survey and field examination of 44 pegmatite localities in the United States and Canada, the authors have compiled an index to about 300 uranium- and thorium-bearing pegmatites in the United States, maps giving location of these deposits, and an annotated bibliography to some of the most pertinent literature on the geology of pegmatites. Pegmatites form from late-state magma differentiates rich in volatile constituents with an attendant aqueous vapor phase. It is the presence of an aqueous phase which results in the development of the variable grain size which characterizes pegmatites. All pegmatites occur in areas of tectonic mobility involving crustal material usually along plate margins. Those pegmatites containing radioactive mineral species show, essentially, a similar distribution to those without radioactive minerals. Criteria such as tectonic setting, magma composition, host rock, and elemental indicators among others, all serve to help delineate areas more favorable for uranium- and thorium-bearing pegmatites. The most useful guide remains the radioactivity exhibited by uranium- and thorium-bearing pegmatites. Although pegmatites are frequently noted as favorable hosts for radioactive minerals, the general paucity and sporadic distribution of these minerals and inherent mining and milling difficulties negate the resource potential of pegmatites for uranium and thorium.
The cohesive energy of uranium dioxide and thorium dioxide
International Nuclear Information System (INIS)
Childs, B.G.
1958-08-01
Theoretical values have been calculated of the heats of formation of uranium dioxide and thorium dioxide on the assumption that the atomic binding forces in these solids are predominantly ionic in character. The good agreement found between the theoretical and observed values shows that the ionic model may, with care, be used in calculating the energies of defects in the uranium and thorium dioxide crystal structures. (author)
International Nuclear Information System (INIS)
Kuroda, Rokuro; Kurosaki, Mayumi; Hayashibe, Yutaka; Ishimaru, Satomi
1990-01-01
A derivative spectrophotometric method has been developed for the simultaneous determination of microgram quantities of uranium and thorium with Arsenazo III in hydrochloric acid medium. The second-derivative absorbances of the uranium and thorium Arsenazo III complexes at 679.5 and 684.4 nm are used for their quantification. Uranium and thorium, both in the range 0.1-0.7 μg/ml have been determined simultaneously with good precision. The procedure does not require separation of uranium and thorium, and allows the determination of both metals in the presence of alkaline-earth metals and zirconium, but lanthanides interfere. (author)
Study of the thorium incorporation by inhalation in individuals occupationally exposed
International Nuclear Information System (INIS)
Holanda e Vasconcellos Carvalho, B. de.
1983-01-01
A mathematical model describing the metabolism of inhaled thorium in the human body was developed. Through this model theoretical limits of excretion were calculated for workers of a monazite plant (Usina Santo Amaro). This limits were based on International Commission on Radiological Protection publication 30, 1979. Excreta samples from twelve workers of Usina Santo Amaro were collected and analysed for thorium. All samples were bellow the theoretical limits of excretion indicating that Usina Santo Amaro workers are exposed to thorium levels bellow the Annual Limits of Intake recommended by ICRP, publication 30. (author)
Global recovery process of thorium and rare earths in a nitrate medium
International Nuclear Information System (INIS)
Cailly, F.; Mottot, Y.
1993-01-01
The aqueous solution of thorium and rare earth nitrates, obtained by leaching the ore with nitric acid, is extracted by an organic phosphorous compound (phosphate, phosphonate, phosphinate or phosphine oxide) and a cationic extractant chosen among phosphoric acid di-esters. Extraction of thorium and rare earths is possible even in presence of phosphate ions in the aqueous solution. Thorium and rare earths are separated by liquid-liquid extraction of the organic phase
Recovery of thorium along with uranium 233 from Thorex waste solution employing Chitosan
International Nuclear Information System (INIS)
Priya, S.; Reghuram, D.; Kumaraguru, K.; Vijayan, K.; Jambunathan, U.
2003-01-01
The low level waste solution, generated from Thorex process during the processing of U 233 , contains thorium along with traces of Th 228 and U 233 . Chitosan, a natural bio-polymer derived from Chitin, was earlier used to recover the uranium and americium. The studies were extended to find out its thorium sorption characteristics. Chitosan exhibited very good absorption of thorium (350 mg/g). Chitosan was equilibrated directly with the low level waste solution at different pH after adjusting its pH, for 60 minutes with a Chitosan to aqueous ratio of 1:100 and the raffinates were filtered and analysed. The results showed more than 99% of thorium and U 233 could be recovered by Chitosan between pH 4 and 5. Loaded thorium and uranium could be eluted from the Chitosan by 1M HNO 3 quantitatively. (author)
Lifescience Database Archive (English)
Full Text Available VH (Link to library) VHK220 (Link to dictyBase) - - - - - (Link to Original site) VHK2...20F 530 - - - - - - Show VHK220 Library VH (Link to library) Clone ID VHK220 (Link to dictyBase) Atlas ID... - NBRP ID - dictyBase ID - Link to Contig - Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/VH/VHK2-A/VHK2...20Q.Seq.d/ Representative seq. ID - (Link to Original site) Representative DNA sequence >VHK2...20 (VHK220Q) /CSM/VH/VHK2-A/VHK220Q.Seq.d/ AACTCTCGAGTGCAAAAAAAGTAAAGTACAAAATGGTTAATTTCA
Indirect complexometric determination of thorium(IV) using sodium fluoride as masking agent
International Nuclear Information System (INIS)
Sreekumar, N.V.; Nazareth, R.A.; Narayana, B.; Hegde, P.; Manjunatha, B.R.
2002-01-01
A complexometric method for the determination of thorium(IV) in presence of other metal ions based on the selective masking ability of sodium fluoride towards thorium is described. Thorium(IV) present in a given sample solution is first complexed with a known excess of EDTA and the surplus EDTA is titrated against bismuth nitrate solution at pH 2-3 using xylenol orange as indicator. A known excess of sodium fluoride (5 %) is then added and the EDTA released from the Th-EDTA complex is titrated against standard bismuth nitrate solution. Reproducible and accurate results are obtained for 5 mg to 280 mg of thorium with relative errors ±0.65 % and standard deviations /leq 0.75 mg. The interference of various ions was studied. (author)
Neutronic design of a plutonium-thorium burner small nuclear reactor
International Nuclear Information System (INIS)
Hartanto, Donny
2010-02-01
A small nuclear reactor using thorium and plutonium fuel has been designed from the neutronic point of view. The thermal power of the reactor is 150 MWth and it is proposed to be used to supply electricity in an island in Indonesia. Thorium and plutonium fuel was chosen because in recent years the thorium fuel cycle is one of the promising ways to deal with the increasing number of plutonium stockpiles, either from the utilization of uranium fuel cycle or from nuclear weapon dismantling. A mixed fuel of thorium and plutonium will not generate the second generation of plutonium which will be a better way to incinerate the excess plutonium compared with the MOX fuel. Three kinds of plutonium grades which are the reactor grade (RG), weapon grade (WG), and spent fuel grade (SFG) plutonium, were evaluated as the thorium fuel mixture in the 17x17 Westinghouse PWR Fuel assembly. The evaluated parameters were the multiplication factor, plutonium depletion, fissile buildup, neutron spectrum, and temperature reactivity feedback. An optimization was also done to increase the plutonium depletion by changing the Moderator to Fuel Ratio (MFR). The computer codes TRITON (coupled NEWT and ORIGEN-S) in SCALE version 6 were used as the calculation tool for this assembly level. From the evaluation and optimization of the fuel assembly, the whole core was designed. The core was consisted of 2 types of thorium fuel with different plutonium grade and it followed the checkerboard loading pattern. A new concept of enriched burnable poison was also introduced to the core. The core life is 6.4 EFPY or 75 GWd/MTHM. It can burn up to 58% of its total mass of initial plutonium. VENTURE was used as the calculation tool for the core level
49 CFR 220.2 - Preemptive effect.
2010-10-01
... 49 Transportation 4 2010-10-01 2010-10-01 false Preemptive effect. 220.2 Section 220.2 Transportation Other Regulations Relating to Transportation (Continued) FEDERAL RAILROAD ADMINISTRATION, DEPARTMENT OF TRANSPORTATION RAILROAD COMMUNICATIONS General § 220.2 Preemptive effect. Link to an amendment...
Resistivity recovery of neutron-irradiated and cold-worked thorium
International Nuclear Information System (INIS)
Tang, J.T.
1977-02-01
Results from a study of the resistivity recovery of neutron-irradiated and cold-worked thorium on isochronal annealing, activation energies, and isothermal annealing and kinetics are discussed. The nature and extent of radiation effects on the resistivity of thorium at 80 0 K, interpretation of stage II recovery above 80 0 K, and activation energy and interpretation of stage III recovery are also discussed. There are 79 references
The use of thorium as an alternative nuclear fuel
International Nuclear Information System (INIS)
Wilson, D.J.
1982-04-01
The use of thorium as an alternative or supplementary nuclear fuel is examined and compared with uranium. A description of various reactor types and their suitability to thorium fuel, and a description of various aspects of the fuel cycle from mining to waste disposal, are included. Comments are made on the safety and economics of each aspect of the fuel cycle and the extension of the lifetime of nuclear fuel
The evolutionary adoption of thorium beginning with its application in niche LWR fuels
International Nuclear Information System (INIS)
Drera, Saleem
2015-01-01
Since the inception of nuclear energy, the use of thorium as a nuclear fuel has been envisioned. Thorium boasts benefits, however, drawbacks which are both economic and technical including its the lack of a naturally occurring fissile isotope implies that its utility is inherently more difficult. The implementation of thorium as a nuclear fuel requires that it must provide sound technical advantages in combination with attractive economics as compared to standard uranium fuel. Revolutionary thorium concepts such as molten salt reactors and accelerator driven systems may provide theoretical merit, however, their exotic nature and associated technical challenges label them as long-term solutions at best. A near-to-medium term solution for thorium must be based on an evolutionary approach utilizing light/heavy water reactor platforms. While thorium does not provide a near-to-medium term complete replacement of uranium, it does provide substantial benefit within niche applications. To license and bring to market these niche fuels, Thor Energy and an international consortium of entities (including: Fortum, KAERI, Westinghouse, NNL, ITU, IFE, and a few other minor entities) have initiated a fuel development and irradiation test program to characterize the performance of these thoria-containing fuels. (author)
Study of thorium uptake by inhabitants of a high background radiation area
International Nuclear Information System (INIS)
Melo, D.R.; Lipsztein, J.L.; Juliao, L.M.Q.C.; Lourenco, M.C.; Lauria, D.
2002-01-01
Buena, located in the North of Rio de Janeiro, is characterized by its high natural radiation background, due to large deposits of monazite sand. The foodstuffs consumed by the population are basically composed of local products, which contain significant amounts of thorium. The analysis of complete cooked meals have shown an average daily intake of 18 mBq.d -1 of 232 Th and 189 mBq.d -1 of 228 Th. The average urine to feces ratio of 232 Th from samples of volunteers was found equal to 7.5x10 -2 . The comparison of the experimental data with the predicted urine to feces ratios derived using the biokinetic model for thorium described by the ICRP publication 69 and simulating inhalation and ingestion separately, lead to the conclusion that the thorium intake is a combination of inhalation and ingestion. The clearance rate of thorium of monazite in lungs has apparently behaved as Type M compound. Inhalation is the biggest contributor for the committed effective dose due to thorium internal exposure. (author)
Energy Technology Data Exchange (ETDEWEB)
Bathellier, A; Sontag, R; Chesne, A [Commissariat a l' Energie Atomique, Saclay (France).Centre d' Etudes Nucleaires
1961-07-01
A rapid method for the quantitative determination of uranium-233 in irradiated thorium is described. A 30 per cent solution of trilaurylamine in xylene is used to extract the uranium from an aqueous hydrochloric acid solution and separate it from the thorium. This may be followed by {alpha} counting or fluorimetry. The practical operating conditions of the separation are discussed in detail. (author) [French] Une methode rapide de dosage de l'uranium-233 contenu dans le thorium irradie est decrite. Elle utilise la trilauryfamine a 30 pour cent dans le xylene pour extraire l'uranium d'une dissolution aqueuse chlorhydrique et le separer du thorium. Le comptage {alpha} ou la fluorimetrie sont alors possibles. Les conditions operatoires de la separation sont discutees et precisees. (auteur)
46 CFR 129.220 - Basic safety.
2010-10-01
... 46 Shipping 4 2010-10-01 2010-10-01 false Basic safety. 129.220 Section 129.220 Shipping COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED) OFFSHORE SUPPLY VESSELS ELECTRICAL INSTALLATIONS General Requirements § 129.220 Basic safety. (a) Electrical equipment and installations must be suitable...
The Growth of Monoraphidium sp. and Scenedesmus sp. Cells in the Presence of Thorium
Directory of Open Access Journals (Sweden)
Juliana Cristina de Queiroz
2012-01-01
Full Text Available Toxicity of thorium by Monoraphidium sp. and Scenedesmus sp. was studied. Microalgal cultures were inoculated in ASM-1 medium in presence and absence of thorium. Its effect was monitored by direct counting on Fuchs-Rosenthal chamber and with software. The toxicity of thorium over the species was observed for concentrations over 50.0 mg/L. After 30 days, Monoraphidium cells decreased their concentration from 4.23×106 to 4.27×105 and 8.57×105 cells/mL, in the presence of 50.0 and 100.0 mg/L of thorium, respectively. Scenedesmus sp. cells were more resistant to thorium: for an initial cell concentration of 7.65×104 cells/mL it was observed a change to 5.25×105 and 5.12×105 cells/mL, in the presence of thorium at 50.0 and 100.0 mg/L, respectively. This is an indication that low concentrations of the radionuclide favored the growth, and that Scenedesmus cells are more resistant to thorium than Monoraphidium cells. The software used for comparison with direct count method proved to be useful for the improvement of accuracy of the results obtained, a decrease in the uncertainty and allowed recording of the data. The presence of thorium suggests that low concentrations have a positive effect on the growth, due to the presence of the nitrate, indicating its potential for ecotoxicological studies.
The Growth of Monoraphidium sp. and Scenedesmus sp. Cells in the Presence of Thorium
de Queiroz, Juliana Cristina; Ferreira, Ana Cristina de Melo; da Costa, Antonio Carlos Augusto
2012-01-01
Toxicity of thorium by Monoraphidium sp. and Scenedesmus sp. was studied. Microalgal cultures were inoculated in ASM-1 medium in presence and absence of thorium. Its effect was monitored by direct counting on Fuchs-Rosenthal chamber and with software. The toxicity of thorium over the species was observed for concentrations over 50.0 mg/L. After 30 days, Monoraphidium cells decreased their concentration from 4.23 × 106 to 4.27 × 105 and 8.57 × 105 cells/mL, in the presence of 50.0 and 100.0 mg/L of thorium, respectively. Scenedesmus sp. cells were more resistant to thorium: for an initial cell concentration of 7.65 × 104 cells/mL it was observed a change to 5.25 × 105 and 5.12 × 105 cells/mL, in the presence of thorium at 50.0 and 100.0 mg/L, respectively. This is an indication that low concentrations of the radionuclide favored the growth, and that Scenedesmus cells are more resistant to thorium than Monoraphidium cells. The software used for comparison with direct count method proved to be useful for the improvement of accuracy of the results obtained, a decrease in the uncertainty and allowed recording of the data. The presence of thorium suggests that low concentrations have a positive effect on the growth, due to the presence of the nitrate, indicating its potential for ecotoxicological studies. PMID:22649297
Recovery of thorium from monazite
International Nuclear Information System (INIS)
Karve, V.M.; Mukherjee, T.K.
1997-01-01
The process practised in the monazite processing plant involves caustic soda digestion of finely ground monazite followed by aqueous processing to recover mixed rare earth chloride solution, thorium and uranium values in the form of hydroxide cake and tri sodium phosphate as a byproduct
Feasibility study and economic analysis on thorium utilization in heavy water reactors
International Nuclear Information System (INIS)
1978-07-01
Even though natural uranium is a more easily usable fuel in heavy water reactors, thorium fuel cycles have also been considered owing to certain attractive features of the thorium fuel cycle in heavy water reactors. The relatively higher fission neutron yield per thermal neutron absorption in 233 U combined with the very low neutron absorption cross section of heavy water make it possible to achieve breeding in a heavy water reactor operating on Th- 233 U fuel cycle. Even if the breeding ratio is very low, once a self-sustaining cycle is achieved, thereafter dependence on uranium can be completely eliminated. Thus, with a self-sustaining Th- 233 U fuel cycle in heavy water reactors, a given quantity of natural uranium will be capable of supporting a much larger installed generating capacity to significantly longer period of time. However, since thorium does not contain any fissile isotope, fissile material has to be added at the beginning. Concentrated fissile material is considerably more expensive than the 235 U contained in natural uranium. This makes the fuel cycle cost higher with thorium fuel cycle, at least during the initial stages. The situation is made worse by the fact that, because of its higher thermal neutron absorption cross section, thorium requires a higher concentration of fissile material than 238 U. Nevertheless, because of the superior nuclear characteristics of 233 U, once uranium becomes more expensive, thorium fuel cycle in heavy water reactors may become economically acceptable. Furthermore, the energy that can be made available from a given quantity of uranium is considerably increased with a self-sustaining thorium fuel cycle
Uranium and thorium determination in water samples taken along River Kura
International Nuclear Information System (INIS)
Ahmadov, M.M.; Ibadov, N.A.; Safarova, K.S.; Humbatov, F.Y.; Suleymanov, B.A.
2014-01-01
Full text : In the present investigation, uranium and thorium concentration in rivers water of Azerbaijan has been measured using inductively coupled plasma mass spectrometry. The Agilent 7700x series ICP-MS applied for analysis of water samples. This method is based on direct introduction of samples, without any chemical pre-treatment, into an inductively coupled plasma plasma mass spectrometer. Uranium and thorium was determined at the mass mass numbers of 238 and 232 respectively using Bi-209 as internal standard. The main purpose of the study is to measure the level of uranium and thorium in water samples taken along river Kura
Mechanism of thorium biosorption by the cells of the soil fungal isolate Geotrichum sp. dwc-1
Energy Technology Data Exchange (ETDEWEB)
Ding, Congcong; Feng, Su [Sichuan Univ., Chengdu (China). Key Laboratory of Biological Resource and Ecological Environment; Li, Xiaolong [Sichuan Univ., Chengdu (China). Key Laboratory of Radiation Physics and Technology; and others
2014-04-01
In order to understand the impact of microorganisms on the fate of thorium in soils, we investigated the thorium biosorption behavior and the corresponding mechanisms by the cells of Geotrichum sp. dwc-1, one of the dominant species of fungal group isolated from 3.5 m depth soil layer in Southwest China. It was observed that fast thorium adsorption onto cells of G. sp. dwc-1 could take place, with a high distribution coefficient K{sub d} (0.93 mL/mg) obtained, when Geotrichum sp. dwc-1and thorium concentrations were 5 g/L and 10 mg/L, respectively. The thorium biosorption behavior was dependent on the pH value, and the lower pH could disrupt cell membrane of G. sp. dwc-1. At pH 1, thorium was accumulated in the cytoplasmic region of the cells. When pH was higher than 1, thorium was adsorbed on the cell surface of G. sp. dwc-1, like in periplasmic region or in the outer membrane. FTIR study combined with biosorption experiments further indicated that the thorium distribution and binding behavior on cell surface were associated with amino, hydroxyl groups and phosphate or sulphur functional groups, and might also be governed by electrostatic interaction. Moreover, PIXE and EPBS showed that ion-exchange mechanism contributed to the thorium biosorption process, in which the tetravalent thorium ions replaced smaller counter-ions (K{sup +}, Ca{sup 2+} and Fe{sup 3+}) occuring on the cell surface. (orig.)
36 CFR 223.220 - Quantity determination.
2010-07-01
... 36 Parks, Forests, and Public Property 2 2010-07-01 2010-07-01 false Quantity determination. 223.220 Section 223.220 Parks, Forests, and Public Property FOREST SERVICE, DEPARTMENT OF AGRICULTURE SALE AND DISPOSAL OF NATIONAL FOREST SYSTEM TIMBER Special Forest Products § 223.220 Quantity determination...
Decontamination of liquid radioactive waste by thorium phosphate
International Nuclear Information System (INIS)
Rousselle, J.; Grandjean, S.; Dacheux, N.; Genet, M.
2004-01-01
In the field of the complete reexamination of the chemistry of thorium phosphate and of the improvement of the homogeneity of Thorium Phosphate Diphosphate (TPD, Th 4 (PO 4 ) 4 P 2 O 7 ) prepared at high temperature, several crystallized compounds were prepared as initial powdered precursors. Due to the very low solubility products associated to these phases, their use in the field of the efficient decontamination of high-level radioactive liquid waste containing actinides (An) was carefully considered. Two main processes (called 'oxalate' and 'hydrothermal' chemical routes) were developed through a new concept combining the decontamination of liquid waste and the immobilization of the actinides in a ceramic matrix (TPD). In phosphoric media ('hydrothermal route'), the key-precursor was the Thorium Phosphate Hydrogen Phosphate hydrate (Th 2 (PO 4 ) 2 (HPO 4 ). H 2 O, TPHP, solubility product log(K S,0 0 ) ∼ - 67). The replacement of thorium by other tetravalent actinides (U, Np, Pu) in the structure, leading to the preparation of Th 2-x/2 An x/2 (PO 4 ) 2 (HPO 4 ). H 2 O solid solutions, was examined. A second method was also considered in parallel to illustrate this concept using the more well-known precipitation of oxalate as the initial decontamination step. For this method, the final transformation to single phase TPD containing actinides was purchased by heating a mixture of phosphate ions with the oxalate precipitate at high temperature. (authors)
Investigation of the use of thorium in LWRs for improving reactor core performance
International Nuclear Information System (INIS)
Lau, Cheuk Wah
2012-01-01
Thorium is a fertile material and most of the past research has focused on breeding thorium into fissile material to achieve a more sustainable use of nuclear power. However, the focus in this report is on using thorium to improve reactor core performance. The improvement of reactor core performance is achieved by increasing the thermal margins by homogeneously distributing thorium in the fuel pellets. A proposed uranium-thorium-based fuel assembly is simulated for the Swedish Ringhals-3 PWR core in a realistic demonstration. In order to fully grasp the benefits and drawbacks of the newly proposed uranium-thorium-based fuel, a reload safety evaluation has been performed. For a real core, the Swedish Radiation Safety Authority would require an identical evaluation method to ensure that safety criteria are met during the whole cycle. In this report, only a few key safety parameters, such as isothermal- and Doppler-temperature coefficients of reactivity, pin peak power, boron worth, shutdown margins, and core average beta-effective are presented. The calculations were performed by the two-dimensional transport code CASMO-4E, and the two group three dimensional nodal code SIMULATE-3K from Studsvik Scandpower. The results showed that the uranium-thorium-based fuel assembly improves the thermal margins, both in the pin peak power and the local power (Fq). The improved thermal margins would allow more flexible core loading patterns with less neutron leakage, and could be used in power uprated cores to offer better safety margins
Investigation of the use of thorium in LWRs for improving reactor core performance
Energy Technology Data Exchange (ETDEWEB)
Lau, Cheuk Wah
2012-07-01
Thorium is a fertile material and most of the past research has focused on breeding thorium into fissile material to achieve a more sustainable use of nuclear power. However, the focus in this report is on using thorium to improve reactor core performance. The improvement of reactor core performance is achieved by increasing the thermal margins by homogeneously distributing thorium in the fuel pellets. A proposed uranium-thorium-based fuel assembly is simulated for the Swedish Ringhals-3 PWR core in a realistic demonstration. In order to fully grasp the benefits and drawbacks of the newly proposed uranium-thorium-based fuel, a reload safety evaluation has been performed. For a real core, the Swedish Radiation Safety Authority would require an identical evaluation method to ensure that safety criteria are met during the whole cycle. In this report, only a few key safety parameters, such as isothermal- and Doppler-temperature coefficients of reactivity, pin peak power, boron worth, shutdown margins, and core average beta-effective are presented. The calculations were performed by the two-dimensional transport code CASMO-4E, and the two group three dimensional nodal code SIMULATE-3K from Studsvik Scandpower. The results showed that the uranium-thorium-based fuel assembly improves the thermal margins, both in the pin peak power and the local power (Fq). The improved thermal margins would allow more flexible core loading patterns with less neutron leakage, and could be used in power uprated cores to offer better safety margins.
Lifescience Database Archive (English)
Full Text Available 0Z (Link to Original site) Representative DNA sequence >SFL220 (SFL220Q) /CSM/SF/SFL2-A/SFL220Q.Seq.d/ XXXXXXXXXXGTCCANATTTCCATANA...end seq. - 3' end seq. ID SFL220Z 3' end seq. >SFL220Z.Seq ----------GTCCANATTTCCATANATGTGTTTAAAAACGTGGNGGNA
46 CFR 184.220 - Cooking equipment.
2010-10-01
... 46 Shipping 7 2010-10-01 2010-10-01 false Cooking equipment. 184.220 Section 184.220 Shipping...) VESSEL CONTROL AND MISCELLANEOUS SYSTEMS AND EQUIPMENT Cooking and Heating § 184.220 Cooking equipment. (a) Doors on a cooking appliance must be provided with hinges and locking devices to prevent...
Assessment of the thorium fuel cycle in power reactors
International Nuclear Information System (INIS)
Kasten, P.R.; Homan, F.J.; Allen, E.J.
1977-01-01
A study was conducted at Oak Ridge National Laboratory to evaluate the role of thorium fuel cycles in power reactors. Three thermal reactor systems were considered: Light Water Reactors (LWRs); High-Temperature Gas-Cooled Reactors (HTGRs); and Heavy Water Reactors (HWRs) of the Canadian Deuterium Uranium Reactor (CANDU) type; most of the effort was on these systems. A summary comparing thorium and uranium fuel cycles in Fast Breeder Reactors (FBRs) was also compiled
Use of nuclear recoil for separating 228Ra, 224Ra, and 233Pa from colloidal thorium
International Nuclear Information System (INIS)
Beydon, J.; Gratot, I.
1968-01-01
By using α-recoil it is possible to separate by dialysis the α disintegration products (224 Ra; 228 Ra) of thorium from colloidal thorium hydroxide.The use of n, γ recoil allows the separation of 233 Pa produced by the neutron irradiation of thorium, on condition that the colloidal thorium hydroxide is irradiated in the presence of a dispersing. (author) [fr
Physicochemical studies as thorium soaps in solid state
International Nuclear Information System (INIS)
Mehrotra, K.N.; Gahlaut, A.S.; Sharma, M.
1987-01-01
The thermal decomposition of thorium soaps is kinetically of zero order and the energy of activation for the decomposition process lies in the range of 6-11 kcal mol -1 . Infrared spectral data indicate that the fatty acids exist with dimeric structure through hydrogen bonding between the carboxyl groups of acid molecules whereas the metal soaps have an ionic character. The X-ray diffraction studies of these soaps revealed that thorium soaps have double layer structure with molecular axes slightly inclined to the basal plane. (author). 10 refs., 5 figures
Thorium Fuel Performance in a Tight-Pitch Light Water Reactor Lattice
International Nuclear Information System (INIS)
Kim, Taek Kyum; Downar, Thomas J.
2002-01-01
Research on the utilization of thorium-based fuels in the intermediate neutron spectrum of a tight-pitch light water reactor (LWR) lattice is reported. The analysis was performed using the Studsvik/Scandpower lattice physics code HELIOS. The results show that thorium-based fuels in the intermediate spectrum of tight-pitch LWRs have considerable advantages in terms of conversion ratio, reactivity control, nonproliferation characteristics, and a reduced production of long-lived radiotoxic wastes. Because of the high conversion ratio of thorium-based fuels in intermediate spectrum reactors, the total fissile inventory required to achieve a given fuel burnup is only 11 to 17% higher than that of 238 U fertile fuels. However, unlike 238 U fertile fuels, the void reactivity coefficient with thorium-based fuels is negative in an intermediate spectrum reactor. This provides motivation for replacing 238 U with 232 Th in advanced high-conversion intermediate spectrum LWRs, such as the reduced-moderator reactor or the supercritical reactor
Development of an automated method for determination of thorium in soil samples and aerosols
International Nuclear Information System (INIS)
Stuart, J.E.; Robertson, R.
1986-09-01
Methodology for determining trace thorium levels in a variety of sample types was further developed. Thorium in filtered water samples is concentrated by ferric hydroxide precipitation followed by dissolution and co-precipitation with lanthanum fluoride. Aerosols on glass fibre, cellulose ester, or teflon filters and solid soil and sediment samples are acid digested. Subsequently thorium is concentrated by lanthanum fluoride co-precipitation. Chemical separation and measurement is then done on a Technicon AA11-C autoanalyzer, using solvent extraction into thenoyltrifuoroacetone in kerosene followed by back extraction into 2 N H NO 3 , and colourometric measurement of the thorium arsenazo III complex. Chemical yields are determined by the addition of thorium-234 tracer using gamma-ray spectrometry. The sensitivities of the methods for water, aerosol and solid samples are approximately 1.0 μg/L, 0.5 μg/g and 1.0 μg/g respectively. At thorium levels about ten times the detection limit, accuracy is estimated to be ± 10% for liquids and aerosols and ± 15% for solid samples, and precision ± 5% for all samples
Studies on supercritical fluid extraction behaviour of uranium and thorium nitrates using amides
International Nuclear Information System (INIS)
Sujatha, K.; Kumar, R.; Sivaraman, N.; Srinivasan, T.G.; Vasudeva Rao, P.R.
2007-01-01
Supercritical fluid extraction studies of uranyl nitrate and thorium nitrate in mixture were carried out using various amides such as N,N-di(2-ethylhexyl) isobutyramide (D2EHIBA),N,N-dihexyl octanamide (DHOA) and Diisooctyl Butanamide (DiOBA). These studies established a preferential extraction of uranium over thorium. Among the various amides studied, D2EHIBA offered the best rate of preferential extraction of uranium over thorium. (author)
45 CFR 148.220 - Excepted benefits.
2010-10-01
... 45 Public Welfare 1 2010-10-01 2010-10-01 false Excepted benefits. 148.220 Section 148.220 Public... FOR THE INDIVIDUAL HEALTH INSURANCE MARKET Preemption; Excepted Benefits § 148.220 Excepted benefits... provision of the benefits described in paragraphs (a) and (b) of this section (or any combination of the...
2010-10-01
... 49 Transportation 2 2010-10-01 2010-10-01 false Welding. 179.220-10 Section 179.220-10... Specifications for Non-Pressure Tank Car Tanks (Classes DOT-111AW and 115AW) § 179.220-10 Welding. (a) All joints... of this subchapter). Welding procedures, welders, and fabricators shall be approved. (b) Radioscopy...
7 CFR 58.220 - Drying systems.
2010-01-01
... 7 Agriculture 3 2010-01-01 2010-01-01 false Drying systems. 58.220 Section 58.220 Agriculture....220 Drying systems. (a) Spray dryers. Spray dryers shall be of a continuous discharge type and all... filter system shall comply with the applicable requirements of the 3-A Accepted Practices for Milk and...
Study on removal technology for thorium in the waste gas-lamp mantle
International Nuclear Information System (INIS)
Shi Yucheng; Wang Chengbao; Zhang Ping; Xu Lingqi; Jiang Shangen
1999-01-01
The author describes thorium removal technology and its application in the handling of the waste gas-lamp mantle that produced during the production of gas-lamp process. After laboratory test, pilot test, trial run and engineering scale use, the thorium removal technology is mainly as follows: soak the waste gas-lamp mantle into the ceramic vat with the nitric acid solution twice and wash it with the tap water twice. The volume of the ceramic vat is 500 L and the concentration of the nitric acid solution is 2 mol/L. After handling, the thorium removal rate can reach 99.97% and the residual thorium will be less than 160 Bq/kg. The waste gas-lamp mantle can be buried under the ground or be handled in the other ways just as the harmless waste. The nitric acid solution, in which gas-lamp mantle has been soaked, should be extracted with TBP, then back extracted with diluted hydrochloric acid. After supplementing the thorium nitrate into the back extracted liquid, the liquid can be reused in the gas-lamp mantle production. The waste water from the handling process can be handled together with waste water from production process
46 CFR 121.220 - Cooking equipment.
2010-10-01
... 46 Shipping 4 2010-10-01 2010-10-01 false Cooking equipment. 121.220 Section 121.220 Shipping... SYSTEMS AND EQUIPMENT Cooking and Heating § 121.220 Cooking equipment. (a) Doors on a cooking appliance... cooking appliance must be installed to prevent movement in heavy seas. (c) For a grill or similar type of...
A competitive thorium fuel cycle for pressurized water reactors of current technology
International Nuclear Information System (INIS)
Galperin, A.; Radkowsky, A.; Todosow, M.
2002-01-01
Two important issues may influence the development and public acceptance of the nuclear power worldwide: a reduction of proliferation potential and spent fuel disposal requirements of the nuclear fuel cycle. Both problems may be addressed effectively by replacement of uranium by thorium fertile part of the fuel. A practical and competitive fuel design to satisfy the described design objectives and constraints may be achieved by seed-blanket core, proposed by A. Radkowsky and implemented in Shippingport reactors. The main idea is to separate spatially the uranium part of the core (seed) from the thorium part of the core (blanket), and thus allow two separate fuel management routes for uranium and thorium parts of the fuel. The uranium part (seed) is optimized to supply neutrons to the subcritical thorium blanket. The blanket is designed to generate and bum insitu 233 U. (author)
Performance of a 229Thorium solid-state nuclear clock
International Nuclear Information System (INIS)
Kazakov, G A; Schreitl, M; Winkler, G; Schumm, T; Litvinov, A N; Romanenko, V I; Yatsenko, L P; Romanenko, A V
2012-01-01
The 7.8 eV nuclear isomer transition in 229 thorium has been suggested as a clock transition in a new type of optical frequency standard. Here we discuss the construction of a ‘solid-state nuclear clock’ from thorium nuclei implanted into single crystals transparent in the vacuum ultraviolet range. We investigate crystal-induced line shifts and broadening effects for the specific system of calcium fluoride. At liquid nitrogen temperatures, the clock performance will be limited by decoherence due to magnetic coupling of the thorium nuclei to neighboring nuclear moments, ruling out the commonly used Rabi or Ramsey interrogation schemes. We propose clock stabilization based on a fluorescence spectroscopy method and present optimized operation parameters. Taking advantage of the large number of quantum oscillators under continuous interrogation, a fractional instability level of 10 −19 might be reached within the solid-state approach. (paper)
International Nuclear Information System (INIS)
Wang, Yug-Yea; Yu, C.
1992-01-01
Three contaminated bulk surface soils were used for investigating the effect of solution pH and complexing reagents on uranium and thorium desorption. At a low solution pH, the major chemical species of uranium and thorium, uranyl UO 2 +2 , thorium dihydroxide Th(OH) 2 +2 , and thorium hydroxide Th(OH) +3 , tend to form complexes with acetates in the solution phase, which increases the fractions of uranium and thorium desorbed into this phase. At a high solution pH, important uranium and thorium species such as uranyl tricarbonate complex UO 2 (CO) 33 -4 and thorium tetrahydroxide complex Th(OH) 4 tend to resist complexation with acetates. The presence of complexing reagents in solution can release radionuclides such as uranium and/or thorium from the soil to the solution by forming soluble complexes. Sodium bicarbonate (NaHCO 3 ) and diethylenetriaminepentaacetic acid (DTPA) are strong complex formers that released 38% to 62% of total uranium activity and 78% to 86% of total thorium activity, respectively, from the soil samples investigated. Solutions of 0.1 molar sodium nitrate (NaNO 3 ) and 0.1 molar sodium sulfate (Na 2 SO 4 ) were not effective complex formers with uranium and thorium under the experimental conditions. Fractions of uranium and thorium desorbed by 0.15g/200ml humic acid ranged from 4.62% to 6.17% and 1.59% to 7.09%, respectively. This work demonstrates the importance of a knowledge of solution chemistry in investigating the desorption of radionuclides
Thorium-based Molten Salt Reactor (TMSR) project in China
International Nuclear Information System (INIS)
Dai, Zhimin; Liu, Wei
2013-01-01
Making great efforts in development of nuclear energy is one of the long-term-plan in China's energy strategies. The advantages of Thorium-based nuclear energy are: rich resource in nature, less nuclear waste, low toxicity, nuclear non-proliferation and so on. Furthermore, China is a country with abundant thorium, thus it is necessary to develop the Thorium-based Molten Salt Reactor (TMSR) in China. Shanghai Institute of Applied Physics, Chinese Academy of Sciences (SINAP) had designed and constructed the first China's light-water reactor and developed a zero-power thorium-based molten salt reactor successfully in the early 1970s. The applied research project 'thorium molten salt reactor nuclear power system' by SINAP together with several other institutes had been accepted and granted by China government in 2011. The whole project has been divided into three stages: Firstly, built a 2 MW-zero-power high temperature solid molten salt reactor in 2015 and a 2 MW-zero-power high temperature liquid molten salt reactor in 2017. Secondly, in 2020 built a 10 MW high temperature liquid molten salt reactor. Thirdly, on the base of previous work, a 100 MW high temperature molten salt reactor should be achieving in 2030. After more than one years of efforts, a high quality scientific research team has been formed, which is able to design the molten salt reactor, the molten salt loop and related key equipment, the systems of molten salt preparation, purification and the radioactive gas removal. In the past one year, the initial physical design of high temperature molten salt reactor has been completed; the nuclear chemistry and radiation chemical laboratory has been built, a high temperature salt (HTS) loop and radioactive gas removal experiment device system have been successfully developed and constructed. Further, the preliminary study on reactor used carbon-carbon composite material has been investigated. (author)
Operation of CANDU power reactor in thorium self-sufficient fuel cycle
Indian Academy of Sciences (India)
This paper presents the results of calculations for CANDU reactor operation in thorium fuel cycle. Calculations are performed to estimate the feasibility of operation of heavy-water thermal neutron power reactor in self-sufficient thorium cycle. Parameters of active core and scheme of fuel reloading were considered to be the ...
Short history of radioactivity. No. XIII. The actinium and thorium series
Energy Technology Data Exchange (ETDEWEB)
Chalmers, T W
1950-06-16
Discussions of the actinium disintegration series (about 1905), the /sup 235/U or actinium series (as it is accepted today), the disintegration of thorium (about 1905), the thorium series in the modern form, and the 4n, 4n + 1, 4n + 2, and 4n + 3 series are presented.
International Nuclear Information System (INIS)
Genet, M.; Brandel, V.
1988-01-01
The optimum pH and concentration values of thorium salts and oxoacids or oxoacid salts which lead to transparent and stable inorganic gels have been determined. The isotherm drying process of the gel at 50 0 C leads successively to a partly dehydrated gel, then, to the formation of an unusual liquid phase and, finally to a dry amorphous solid phase which is still transparent. This kind of transparent inorganic gels and amorphous phase can be used as matrices for spectroscopic studies [fr
2010-04-01
... 21 Food and Drugs 3 2010-04-01 2009-04-01 true Flectol H. 189.220 Section 189.220 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) FOOD FOR HUMAN... Addition to Human Food Through Food-Contact Surfaces § 189.220 Flectol H. (a) Flectol H is the chemical 1,2...
Energy Technology Data Exchange (ETDEWEB)
Kumar, J [Agra Coll. (India). Dept. of Physics
1977-03-01
In the present work, a local model pseudopotential has been proposed to study the lattice dynamics of thorium. The model potential depends on the core and ionic radii, and accounts for the s-d-f hybridization effects in a phenomenological way. When this form of potential is applied to derive the photon dispersion curves of Th, sufficiently good agreement is found between the computed and experimental results.
Uranium production in thorium/denatured uranium fueled PWRs
International Nuclear Information System (INIS)
Arthur, W.B.
1977-01-01
Uranium-232 buildup in a thorium/denatured uranium fueled pressurized water reactor, PWR(Th), was studied using a modified version of the spectrum-dependent zero dimensional depletion code, LEOPARD. The generic Combustion Engineering System 80 reactor design was selected as the reactor model for the calculations. Reactors fueled with either enriched natural uranium and self-generated recycled uranium or uranium from a thorium breeder and self-generated recycled uranium were considered. For enriched natural uranium, concentrations of 232 U varied from about 135 ppM ( 232 U/U weight basis) in the zeroth generation to about 260 ppM ( 232 U/U weight basis) at the end of the fifth generation. For the case in which thorium breeder fuel (with its relatively high 232 U concentration) was used as reactor makeup fuel, concentrations of 232 U varied from 441 ppM ( 232 U/U weight basis) at discharge from the first generation to about 512 ppM ( 232 U/U weight basis) at the end of the fifth generation. Concentrations in freshly fabricated fuel for this later case were 20 to 35% higher than the discharge concentration. These concentrations are low when compared to those of other thorium fueled reactor types (HTGR and MSBR) because of the relatively high 238 U concentration added to the fuel as a denaturant. Excellent agreement was found between calculated and existing experimental values. Nevertheless, caution is urged in the use of these values because experimental results are very limited, and the relevant nuclear data, especially for 231 Pa and 232 U, are not of high quality
Self-Sustaining Thorium Boiling Water Reactors
Directory of Open Access Journals (Sweden)
Ehud Greenspan
2012-10-01
Full Text Available A thorium-fueled water-cooled reactor core design approach that features a radially uniform composition of fuel rods in stationary fuel assembly and is fuel-self-sustaining is described. This core design concept is similar to the Reduced moderation Boiling Water Reactor (RBWR proposed by Hitachi to fit within an ABWR pressure vessel, with the following exceptions: use of thorium instead of depleted uranium for the fertile fuel; elimination of the internal blanket; and elimination of absorbers from the axial reflectors, while increasing the length of the fissile zone. The preliminary analysis indicates that it is feasible to design such cores to be fuel-self-sustaining and to have a comfortably low peak linear heat generation rate when operating at the nominal ABWR power level of nearly 4000 MWth. However, the void reactivity feedback tends to be too negative, making it difficult to have sufficient shutdown reactivity margin at cold zero power condition. An addition of a small amount of plutonium from LWR used nuclear fuel was found effective in reducing the magnitude of the negative void reactivity effect and enables attaining adequate shutdown reactivity margin; it also flattens the axial power distribution. The resulting design concept offers an efficient incineration of the LWR generated plutonium in addition to effective utilization of thorium. Additional R&D is required in order to arrive at a reliable practical and safe design.
Thorium in the workplace measurement intercomparison
International Nuclear Information System (INIS)
Modna, D.K.; Jerome, S.M.; White, M.A.; Woods, M.J.
2000-01-01
The monitoring of radionuclides in the nuclear industry has been recognized as the most straightforward way of assessing health and safety issues associated with the exposure of the workforce to potentially harmful radiation doses. Much of this is achieved by measurements in the workplace itself and by the bioassay and monitoring of workers in the industry. However, there also exists a significant 'non-nuclear' industry where workers are exposed to radioactive materials, for example where this involves thorium, which is made wide use of in the aerospace and other high technology industries. As such work involves the processing of thorium bearing materials, the workforce is potentially exposed to 232 Th and its daughter nuclides. Thus, to monitor the workforce effectively, it is important to be able to measure both 232 Th and the decay products of 232 Th where they are in an unknown state of radioactive equilibrium and this is where monitoring laboratories may experience some difficulty. Accordingly, the Health and Safety Laboratory in the UK has organized a EC wide project on the monitoring of thorium in the 'non-nuclear' workplace; this project is currently ongoing. We report the results of the first intercomparison of this project involving two solutions of 232 Th, one in radioactive equilibrium and one not in equilibrium with its daughters. The results are presented with some comments on how this intercomparison has progressed and how these first results will inform the rest of the project
Atomization of thorium in a hollow-cathode type discharge
International Nuclear Information System (INIS)
Pianarosa, P.; Demers, Y.; Gagne, J.M.
1984-01-01
The atomization of thorium metal in a hollow-cathode electrical discharge has been investigated. Laser absorption spectroscopy with the laser tuned on the 5760.55 A (0-17355 1 cm -1 ) transition of Th I was used to evaluate the density of atoms in the 3 F 2 ground state. The results obtained (densities up to 10 13 atoms cm -3 ) show that our discharge tube is a suitable source of thorium metal atoms for laser assisted spectroscopic analysis of this element. (author)
Potential of Melastoma malabathricum as bio-accumulator for uranium and thorium from soil
Energy Technology Data Exchange (ETDEWEB)
Saat, Ahmad, E-mail: ahmad183@salam.uitm.edu.my [Institute of Science, Universiti Teknologi MARA, 40450 Shah Alam (Malaysia); Faculty of Applied Sciences, Universiti Teknologi MARA, 40450 Shah Alam (Malaysia); Kamsani, Ain Shaqina; Kamri, Wan Nur Aina Nadzira; Talib, Nur Hasyimah Mat; Wood, Ab Khalik; Hamzah, Zaini [Faculty of Applied Sciences, Universiti Teknologi MARA, 40450 Shah Alam (Malaysia)
2015-04-29
Uranium and Thorium are naturally occuring radionuclides. However, due to anthropogenic activities in some locations their concentrations in the soils could be elevated. This study explores the potential of Melastoma malabathricum (locally known as ‘pokok senduduk’) as bio-accumulator of uranium and thorium from soils of three different study areas, namely former tin mining, industrial and residential/commercial areas in Peninsular Malaysia. The study found elevated concentrations of uranium and thorium in former tin mining soils as compared to natural abundance. However in industral and residential/commercial areas the concentrations are within the range of natural abundance. In terms of transfer factor (TF), in ex-mining areas TF > 1 for uranium in the leaf, stem and roots, indicating accumulation of uranium from soil. However for thorium TF < 1, indicating the occurence of transfer from soil to root, stem and leaf, but no accumulation. For other areas only transfer of uranium and thorium were observed. The results indicated the potential of Melastoma malabathricum to be used as bio-accumulatior of uranium, especially in areas of elevated concentration.
Potential of Melastoma malabathricum as bio-accumulator for uranium and thorium from soil
International Nuclear Information System (INIS)
Saat, Ahmad; Kamsani, Ain Shaqina; Kamri, Wan Nur Aina Nadzira; Talib, Nur Hasyimah Mat; Wood, Ab Khalik; Hamzah, Zaini
2015-01-01
Uranium and Thorium are naturally occuring radionuclides. However, due to anthropogenic activities in some locations their concentrations in the soils could be elevated. This study explores the potential of Melastoma malabathricum (locally known as ‘pokok senduduk’) as bio-accumulator of uranium and thorium from soils of three different study areas, namely former tin mining, industrial and residential/commercial areas in Peninsular Malaysia. The study found elevated concentrations of uranium and thorium in former tin mining soils as compared to natural abundance. However in industral and residential/commercial areas the concentrations are within the range of natural abundance. In terms of transfer factor (TF), in ex-mining areas TF > 1 for uranium in the leaf, stem and roots, indicating accumulation of uranium from soil. However for thorium TF < 1, indicating the occurence of transfer from soil to root, stem and leaf, but no accumulation. For other areas only transfer of uranium and thorium were observed. The results indicated the potential of Melastoma malabathricum to be used as bio-accumulatior of uranium, especially in areas of elevated concentration
Investigation and analytical application of thorium and uranium complexes with amino acids
International Nuclear Information System (INIS)
Korenman, I.M.; Sergeev, G.M.
1979-01-01
The coordination is investigated of thorium (4) and uranium (6) with aminoacids, particularly, with aspartic acid. With the latter the metals form chelates, which have a particular structure and a stationary inner sphere. A description is made of the composition, conditions of formation (gr H), and a stability of some asparaginate complexes of actinoids, the coordination methods of aspartic acid. An asparaginatometric method is proposed for a direct complexometric titration of microgram amounts of thorium in the presence of uranium, zirconium and rare earth elements with photometric indication. As metal-chromic indicators the sulfophthaleins are applied. The given procedure allows measurement of impurities of accompanying elements, viz., beryllium (up to 1%) in thorium preparations. Application of aspartic acid and arsenazo 1 indicator permits us to define Be(2) with a relative error not higher than 5% in thorium compounds, which exclude the analysis by other methods
Some processes affecting the mobility of thorium in natural ground waters
International Nuclear Information System (INIS)
Oesthols, E.
1994-04-01
Thorium is a useful model element for tetravalent actinides such as U(IV), Pu(IV) and Np(IV) which are important constituents of spent nuclear fuel. Thorium is also an important tracer element for particle pathways in natural environments. In order to correctly model the transport of Th in the environment, it is important to have quantitative models for processes that effect its mobility. Some of these processes have been experimentally investigated in laboratory studies, and interpreted with quantitative models where possible. The carbonate complexation in aqueous solution of Th has been investigated through solubility studies of ThO 2 in carbonate media. It is shown, that thorium carbonate complexes are likely to be predominant in many natural waters. They also increase solubility of the oxide significantly, and hence the mobility of Th. Carbonate also increases the dissolution rate of thorium oxide. This effect will only be important in environments with a pH and total carbonate alkalinity higher than those of most natural aquatic environments. Solubility studies of thorium oxide in phosphate media show that phosphate does not significantly increase the mobility of Th in aqueous media. The presence of phosphate may cause the precipitation of sparingly soluble thorium phosphates which will decrease the mobility of Th. The pentahydroxo complex for Th is shown to be significant up to pH 13. Potentiometric studies of Th sorption on amorphous colloidal silica indicate, that pure aluminosilicates will probably not be efficient scavengers of tetravalent actinides above pH values of approximately 6. In neutral to alkaline solutions, iron (hydr)oxides are likely to be the predominant sorbents. Th binds to the silica surface through corner-sharing bonds, where Th and Si share one, but not more oxygen atoms. 72 refs
Durability of adhesive bonds to uranium alloys, tungsten, tantalum, and thorium
International Nuclear Information System (INIS)
Childress, F.G.
1975-01-01
Long-term durability of epoxy bonds to alloys of uranium (U-Nb and Mulberry), nickel-plated uranium, thorium, tungsten, tantalum, tantalum--10 percent tungsten, and aluminum was evaluated. Significant strengths remain after ten years of aging; however, there is some evidence of bond deterioration with uranium alloys and thorium stored in ambient laboratory air
2010-01-01
... 2 Grants and Agreements 1 2010-01-01 2010-01-01 false What contracts and subcontracts, in addition to those listed in 2 CFR 180.220, are covered transactions? 801.220 Section 801.220 Grants and... DEBARMENT AND SUSPENSION Covered Transactions § 801.220 What contracts and subcontracts, in addition to...
Process for selectively concentrating the radioactivity of thorium containing magnesium slag
International Nuclear Information System (INIS)
Wilson, D.A.; Christiansen, S.H.; Simon, J.; Morin, D.W.
1993-01-01
In a process for separating magnesium from a magnesium slag using water and carbon dioxide, the improvement described comprises: (a) forming an aqueous magnesium slurry from the magnesium slag, which slag contains radioactive thorium and its daughters, and water; (b) solubilizing magnesium from the magnesium slurry by reacting the aqueous magnesium slurry with carbon dioxide wherein the carbon dioxide is at a pressure from greater than ambient to about 1,000 psig (about 7,000 kPa); (c) selectively concentrating by filtering the radioactive thorium and its daughters such that the radioactive thorium and its daughters are separated from the solubilized magnesium filtrate; and (d) reducing volume and/or weight of radioactive solids for disposal as radioactive waste
Some thorium fuel cycle strategies
International Nuclear Information System (INIS)
Duret, M.F.; Hatton, H.
1979-02-01
The report deals with the problem of introducing an advanced nuclear fuel cycle based on thorium in Canada. It is pointed out that timing and introduction rate are important considerations, certain choices of these variables leading to undesirable business fluctuations in some of the industries involved in the production of nuclear energy. (author)
International Nuclear Information System (INIS)
Miller, T.P.; Bunker, C.M.
1976-01-01
Large granitic Cretaceous plutons are exposed along and adjacent to an arcuate belt of igneous and high-grade metamorphic rocks in the southeastern Seward Peninsula of Alaska. Reconnaissance studies of these plutons have shown that the Darby pluton has well above average amounts of uranium and thorium (11.2 ppm and 58.7 ppm, respectively), the Kachauik pluton contains average to above average uranium and thorium (5.7 ppm and 22.5 ppm, respectively), and the Bendeleben pluton contains average amounts of uranium and thorium (3.4 ppm and 16.7 ppm, respectively). The three plutons show compositional and textural differences indicative of different source materials that may have controlled the distribution of uranium and thorium. The high uranium and thorium contents of the Darby pluton, similar to those of the Conway Granite of New Hampshire which has been mentioned as a possible low-grade thorium resource, suggest that this pluton may be a favorable area for economic concentrations of uranium and thorium
International Nuclear Information System (INIS)
Hakkila, E.A.; Barnes, J.W.; Dayem, H.A.; Dietz, R.J.; Shipley, J.P.
1978-10-01
This report addresses preliminary concepts for coordinated safeguards materials management in a typical generic thorium--uranium-fueled light-water reactor (LWR) fuels reprocessing plant. The reference facility is designed to recover thorium and uranium from first-generation (denatured 235 U) startup fuels, first-recycle and equilibrium (denatured 233 U) thorium--uranium LWR fuels, and to recover the plutonium generated in the 238 U denaturant as well. 12 figures, 3 tables
Feasibility assessment of the once-through thorium fuel cycle for the PTVM LWR concept
International Nuclear Information System (INIS)
Rachamin, R.; Fridman, E.; Galperin, A.
2015-01-01
Highlights: • The PTVM LWR is an innovation reactor concept operating in a “breed & burn” mode. • An advanced once-through thorium fuel cycle for the PTVM LWR concept is proposed. • The PTVM LWR concept makes use of a seed-blanket geometry. • A novel fuel management scheme based on two separate fuel flow routes is analyzed. • The analysis indicates a potential for utilizing the fuel in an efficient manner. - Abstract: This paper investigates the feasibility of a once-through thorium fuel cycle for the novel reactor-design concept named the pressure tube light water reactor with variable moderator control (PTVM LWR). The PTVM LWR operates in a “breed & burn” mode, which makes it an attractive system for utilizing thorium fuel in a once-through mode. The “breed & burn” mode can emphasize the in situ generation as well as incineration of 233 U, which are the basic foundations of the once-through thorium fuel cycle. The PTVM LWR concept makes use of a seed–blanket geometry, whereby the core is divided into separated regions of thorium-based fuel channel assemblies (blanket) and low-enriched uranium (LEU) based fuel channel assemblies (seed). A novel fuel in-core management scheme based on two separate fuel flow routes (i.e., seed route and blanket route) is proposed and analyzed. Neutronic performance analysis indicates that the proposed novel fuel in-core management scheme has the potential to utilize both LEU- and thorium-based fuel in an efficient manner. The once-through thorium cycle, presented and discussed in this paper, provide interesting research leads and can serve as a bridge between current LEU-based fuel cycles and a thorium fuel cycle based on recycling of 233 U
2010-10-01
... general railroad system of transportation; or (2) Rapid transit operations in an urban area that are not... 49 Transportation 4 2010-10-01 2010-10-01 false Application. 220.3 Section 220.3 Transportation Other Regulations Relating to Transportation (Continued) FEDERAL RAILROAD ADMINISTRATION, DEPARTMENT OF...
Directory of Open Access Journals (Sweden)
F. Lidman
2012-11-01
Full Text Available The concentrations of uranium and thorium in ten partly nested streams in the boreal forest region were monitored over a two-year period. The investigated catchments ranged from small headwaters (0.1 km2 up to a fourth-order stream (67 km2. Considerable spatiotemporal variations were observed, with little or no correlation between streams. The fluxes of both uranium and thorium varied substantially between the subcatchments, ranging from 1.7 to 30 g km−2 a−1 for uranium and from 3.2 to 24 g km−2 a−1 for thorium. Airborne gamma spectrometry was used to measure the concentrations of uranium and thorium in surface soils throughout the catchment, suggesting that the concentrations of uranium and thorium in mineral soils are similar throughout the catchment. The fluxes of uranium and thorium were compared to a wide range of parameters characterising the investigated catchments and the chemistry of the stream water, e.g. soil concentrations of these elements, pH, TOC (total organic carbon, Al, Si and hydrogen carbonate, but it was concluded that the spatial variabilities in the fluxes of both uranium and thorium mainly were controlled by wetlands. The results indicate that there is a predictable and systematic accumulation of both uranium and thorium in boreal wetlands that is large enough to control the transport of these elements. On the landscape scale approximately 65–80% of uranium and 55–65% of thorium entering a wetland were estimated to be retained in the peat. Overall, accumulation in mires and other types of wetlands was estimated to decrease the fluxes of uranium and thorium from the boreal forest landscape by 30–40%, indicating that wetlands play an important role for the biogeochemical cycling of uranium and thorium in the boreal forest landscape. The atmospheric deposition of uranium and thorium was also quantified, and its contribution to boreal streams was
Fabrication of thorium nitrate at the factory at the Bouchet
International Nuclear Information System (INIS)
Braun, C.; Lorrain, Ch.; Mahut, R.; Mariette, R.; Muller, J.; Prugnard, J.
1958-01-01
A urano-thorianite mineral from Madagascar is industrially treated at the factory of the Bouchet in order to obtain pure thorium in the form of the nitrate and a uranium concentrate in the form of uranate. The required factory was designed and constructed in 1955 and 1956 by the firm Potasse et Engrais Chimiques (P.E.C.) on behalf of the French Atomic Energy authority. The mineral which has previously undergone a gravimetric sorting and enrichment at the mine, is in the form of a heavy rock (the density can be as high as 10), having a cubic structure. It consists principally of a mixture of thorium oxide and uranium oxide and contains between 50 and 75 per cent thorium and between 5 and 20 per cent of uranium. On the same sample a high content in either thorium or uranium in general corresponds to a low content in the other of the two metals; this rule is not however always obeyed absolutely. Among other elements present we shall only mention the Pb, Fe, Ce, Ra and other radioactive elements, since their presence influences the treatment of the mineral. We shall first briefly describe the process, which has already been described in previous publications, we consider to be worthy of attention. (author) [fr
Verification of a Subgroup Generation Method for Thorium Fuel Assemblies
International Nuclear Information System (INIS)
Sim, Ohsung; Kim, Myunghyun
2013-01-01
Resonance parameter consists of subgroup level and weight. The subgroup weight is obtained by solving the ultrafine slowing down equation and fixed source problem. That means this cross section library procedure considers conservation of the shielded cross section for pin-cell in order to obtain subgroup parameters. There are some isotopes to be concerned for research such as actinides and thorium. Minor actinides(MA) are existing with very small amount in a spent fuel, but effect is not negligible in a high burnup fuel assemblies. Some MAs have high fission cross sections under thermal neutron spectrum. Thorium isotopes was not investigated as much as uranium, but it has high potential for future application. In this study, a new cross section library to be replaced with HELIOS library was generated and compared for the assembly calculation, specially for assembly with thorium. An average capture cross section value at a certain fuel pin and multiplication factor of assembly were compared with nTRACER calculation with HELIOS library and Monte Carlo calculation of MCNP with ENDF-B/II. The accuracy of library data generated for thorium isotope in nTRACER calculation was tested for WASB model. There was a great improvement in K-eff and capture cross section for this assembly compared with old library, HELIOS library
Gold, uranium and thorium in zones of greenschist displacement metamorphism
International Nuclear Information System (INIS)
Gavrilenko, B.V.; Savitskij, A.V.; Titov, V.V.
1987-01-01
Distribution of gold, uranium (bar and mobile) and thorium in 15 zones of greenschist dislocated metamorphism in different structures of the Karelo-Kola region carried out by geologic formations of the Early-Archean-Late-Proterozoic age has been studied. More than 200 samples of well core from 0-200 m depths have been analyzed. The results obtained testify to the increase of gold, uranium and less thorium content in zones of green-schist dislocated metamorphism in comparison with the enclosing rocks 1.4-3.1 times. The variation coefficient of gold, uranium and thorium content in green-schist dislocated tectonites increases 1.5-2.9 times. The correlation coefficient of Au/U mob. pair is +0.69, and Au/U bar pair -+0.87. Essential correlation between concentrations of all three elements in enclosing rocks is absent
38 CFR 52.220 - Transportation.
2010-07-01
... 38 Pensions, Bonuses, and Veterans' Relief 2 2010-07-01 2010-07-01 false Transportation. 52.220... FOR ADULT DAY HEALTH CARE OF VETERANS IN STATE HOMES Standards § 52.220 Transportation. Transportation... management must provide or contract for transportation to enable participants, including persons with...
Preliminary design needs for pilot plant of Monazite processing into Thorium Oxide (ThO_2)
International Nuclear Information System (INIS)
Hafni Lissa Nuri; Prayitno; Abdul Jami; M-Pancoko
2014-01-01
Data and information collection aimed in order to meet the needs of the initial design for pilot plant of monazite processing into thorium oxide (ThO_2). The content of thorium in monazite is high in Indonesia between 2.9 to 4.1% and relatively abundant in Bangka Belitung Islands. Thorium can be used as fuel because of its potential is more abundant instead of uranium. Plant of thorium oxide commercially from monazite established starting from pilot uranium. Plant of thorium oxide commercially from monazite established starting from pilot plant in order to test laboratory data. Pilot plant design started from initial design, basic design, detailed design, procurement and construction. Preliminary design needs includes data feed and products, a block diagram of the process, a description of the process, the determination of process conditions and type of major appliance has been conducted. (author)
Thermodynamics of dehydration process of uranyl nitrate pentahydrate of thorium
International Nuclear Information System (INIS)
Khamidov, F.A.; Mirsaidov, I.U.; Nazarov, K.M.; Nasriddinov, S.K.; Badalov, A.B.
2010-01-01
Present article is devoted to thermodynamics of dehydration process of uranyl nitrate pentahydrate of thorium. The results of researches of dehydration process of uranyl nitrate pentahydrate of thorium Th(NO_3)_4·5H_2O were considered. The researches were carried out by means of tensimeter method with membrane zero-manometer under equilibrium conditions and at 300-450 K temperature ranges. The thermodynamic characteristics of dehydration process of initial crystalline hydrate was defined.
Studies on biamperometric determination of thorium using EDTA as titrant
International Nuclear Information System (INIS)
Jayachandran, Kavitha; Nair, P.R.; Noronha, D.M.; Xavier, Mary; Aggarwal, S.K.
2009-01-01
A method is described for the determination of thorium at sub milligram levels by EDTA complexometric titration using biamperometric end point detection. The methodology is based on the electroactive behaviour of EDTA observed at pH 2-3, suggesting a reversible electron transfer reaction at potential ≥ 200 mV applied between twin Pt electrodes. Accuracy and precision of better than 2% were obtained for thorium amounts in the 100-500 μg range. (author)
X-Ray Fluorescence Spectrometry. I. Determination of thorium in ores
International Nuclear Information System (INIS)
Bermudez Polonio, J.; Crus Castillo, F. de la; Fernandez Cellini, R.
1961-01-01
A X-ray spectrometric method has been developed for analysis of thorium in ores in the range of concentration from 0.01 to 0.5 percent ThO 2 , using selenium as a internal standard. The concentration of thorium is determined in a working curve prepared by plotting the percentage of ThO 2 against the ratio intensity of the Th Lα 1 line to Sek β 1 line. (Author) 17 refs
Soil as a source of indoor 220Rn
International Nuclear Information System (INIS)
Li, Y.; Schery, S.D.; Turk, B.
1992-01-01
Two suggestions for sources of indoor 220Rn (thoron) have appeared in the literature: (1) building materials and outside air, and (2) soil beneath the house. Due to the difficulty of 220Rn measurement and limited data, both suggestions lack sufficient supporting evidence. We have investigated sources of indoor 220Rn in seven occupied houses in northern New Mexico, U.S. A two-filter system was used to measure indoor 220Rn levels continuously, and 220Rn progeny were measured with single filters and specialized alpha-track detectors. The amount of 220Rn entry from soil was curtailed by cutting off soil gas flow to the indoor air with subfloor depressurization mitigation systems. Four of the houses showed significant reductions in 220Rn with mitigation systems on. The average effect for these houses was to reduce indoor 220Rn levels by 70%. The other three houses had no clear reductions but in one of these houses, the mitigation system was not effective for stopping soil gas flow. Our results provide some of the most clear evidence to date supporting soil as an important source of indoor 220Rn
49 CFR 220.38 - Communication equipment failure.
2010-10-01
... 49 Transportation 4 2010-10-01 2010-10-01 false Communication equipment failure. 220.38 Section 220.38 Transportation Other Regulations Relating to Transportation (Continued) FEDERAL RAILROAD... § 220.38 Communication equipment failure. (a) Any radio or wireless communication device found not to be...
24 CFR 220.801 - Initial insurance endorsement.
2010-04-01
... 24 Housing and Urban Development 2 2010-04-01 2010-04-01 false Initial insurance endorsement. 220.801 Section 220.801 Housing and Urban Development Regulations Relating to Housing and Urban... AREAS Contract Rights and Obligations-Projects Insured Project Improvement Loans § 220.801 Initial...
High precision spectrophotometric analysis of thorium
International Nuclear Information System (INIS)
Palmieri, H.E.L.
1984-01-01
An accurate and precise determination of thorium is proposed. Precision of about 0,1% is required for the determination of macroquantities of thorium when processed. After an extensive literature search concerning this subject, spectrophotometric titration has been chosen, using dissodium ethylenediaminetetraacetate (EDTA) solution and alizarin-S as indicator. In order to obtain such a precision, an amount of 0,025 M EDTA solution precisely measured has been added and the titration was completed with less than 5 ml of 0,0025 M EDTA solution. It is usual to locate the end-point graphically, by plotting added titrant versus absorbance. The non-linear minimum square fit, using the Fletcher e Powell's minimization process and a computer programme. Besides the equivalence point, other parameters of titration were determined: the indicator concentration, the absorbance of the metal-indicator complex, and the stability constants of the metal-indicator and the metal-EDTA complexes. (Author) [pt
New development of spectrophotometric analysis of thorium
International Nuclear Information System (INIS)
Yang Xiangzhen
1992-01-01
This review covers new development of spectrophotometric determination of thorium since 1980's. The methods include general spectrophotometry, double wavelength spectrophotometry, catalytic spectrophotometry, total differential spectrophotometry, derivative spectrophotometry and fluorescent spectrophotometry, etc
Core Design and Deployment Strategy of Heavy Water Cooled Sustainable Thorium Reactor
Directory of Open Access Journals (Sweden)
Naoyuki Takaki
2012-08-01
Full Text Available Our previous studies on water cooled thorium breeder reactor based on matured pressurized water reactor (PWR plant technology concluded that reduced moderated core by arranging fuel pins in a triangular tight lattice array and using heavy water as coolant is appropriate for achieving better breeding performance and higher burn-up simultaneously [1–6]. One optimum core that produces 3.5 GW thermal energy using Th-233U oxide fuel shows a breeding ratio of 1.07 and averaged burn-up of about 80 GWd/t with long cycle length of 1300 days. The moderator to fuel volume ratio is 0.6 and required enrichment of 233U for the fresh fuel is about 7%. The coolant reactivity coefficient is negative during all cycles despite it being a large scale breeder reactor. In order to introduce this sustainable thorium reactor, three-step deployment scenario, with intermediate transition phase between current light water reactor (LWR phase and future sustainer phase, is proposed. Both in transition phase and sustainer phase, almost the same core design can be applicable only by changing fissile materials mixed with thorium from plutonium to 233U with slight modification in the fuel assembly design. Assuming total capacity of 60 GWe in current LWR phase and reprocessing capacity of 800 ton/y with further extensions to 1600 ton/y, all LWRs will be replaced by heavy water cooled thorium reactors within about one century then thorium reactors will be kept operational owing to its potential to sustain fissile fuels while reprocessing all spent fuels until exhaustion of massive thorium resource.
Biomedical and environmental aspects of the thorium fuel cycle: a selected, annotated bibliography
International Nuclear Information System (INIS)
Faust, R.A.; Fore, C.S.; Cone, M.V.; Meyer, H.R.; Till, J.E.
1979-07-01
This bibliography was compiled to assist in the evaluation of the health and environmental consequences of high specific activity thorium and related nuclides which could be released to the environment by activities related to the Thorium Fuel Cycle. The general scope covers studies regarding potential releases, environmental transport, metabolism, dosimetry, dose assessment, and overall risk assessment for radionuclides specific to the NASAP project. This publication of 740 abstracted references highlights the biological and medical aspects of thorium 228 and thorium 232 in man and animals. Similar studies on related nuclides such as radium 224, radium 226, radium 228, and thorium 230 are also emphasized. Additional categories relevant to these radionuclides are included as follows: chemical analysis; ecological aspects; energy; geological aspects; instrumentation; legal and political aspects; monitoring, measurement and analysis; physical aspects; production; radiation safety and control; and waste disposal and management. Environmental assessment and sources categories were used for entries which contain a multiple use of categories. Leading authors appear alphabetically within each category. Indexes are provided for : author(s), geographic location, keywords, title, and publication description. The bibliography contains literature dating from December 1925 to February 1978
Biomedical and environmental aspects of the thorium fuel cycle: a selected, annotated bibliography
Energy Technology Data Exchange (ETDEWEB)
Faust, R.A.; Fore, C.S.; Cone, M.V.; Meyer, H.R.; Till, J.E.
1979-07-01
This bibliography was compiled to assist in the evaluation of the health and environmental consequences of high specific activity thorium and related nuclides which could be released to the environment by activities related to the Thorium Fuel Cycle. The general scope covers studies regarding potential releases, environmental transport, metabolism, dosimetry, dose assessment, and overall risk assessment for radionuclides specific to the NASAP project. This publication of 740 abstracted references highlights the biological and medical aspects of thorium 228 and thorium 232 in man and animals. Similar studies on related nuclides such as radium 224, radium 226, radium 228, and thorium 230 are also emphasized. Additional categories relevant to these radionuclides are included as follows: chemical analysis; ecological aspects; energy; geological aspects; instrumentation; legal and political aspects; monitoring, measurement and analysis; physical aspects; production; radiation safety and control; and waste disposal and management. Environmental assessment and sources categories were used for entries which contain a multiple use of categories. Leading authors appear alphabetically within each category. Indexes are provided for : author(s), geographic location, keywords, title, and publication description. The bibliography contains literature dating from December 1925 to February 1978.
Thorium and uranium separation from Rare Earth complex minerals in Turkey
International Nuclear Information System (INIS)
Uzmen, R.
2014-01-01
Conclusion: • Thorium and uranium separation from a REEs solution is possible in by using simple traditional methods. • Main advantage of this method is to separate with high recovery yield uraniumand almost completely thorium which is an undesirable element due to its radioactive property in the different REEs group or individual REE. • Separation of thorium before any other step of REE’s group or individual element separation is crucial. • By using this flowsheet it would be possible to obtain uranium and other valuable elements (Zr, Ti, etc.) as coproducts of REEs. • Another important point, during REEs production, it is avoided to accumalate U and Th contaminated process wastes. • Thus, in the contrary, radioactive elements are refined and contained for safe storage.
International Nuclear Information System (INIS)
Akyuz, T; Bolcal, C.; Akyuz, S.; Mukhamedshina, N.M.; Mirsagatova, A.A
2006-01-01
Full text: The Black Sea is an inland sea between south-eastern Europe and Asia minor. It is the largest anoxic marine basin in the word and connected to the Mediterranean Sea by the Bosporus and the Sea of Marmara, to the Sea of Azov by the Strait of Kerch. One of the most useful approaches to long-term monitoring of aquatic systems is the analysis of marine sediments. In this study the abundance of uranium, thorium and some rare earth elements was analysed in surface sediments of the Southern part of the Black Sea using instrumental neutron activation analysis. The spatial distribution patterns of the elements studied were investigated. The surficial sediment samples (0-4 cm) were collected during 1999-2005, from 18 sampling stations of the Turkish Coast of the Black Sea, by using a Lenz Bottom Sampler and were deposited into plastic bags. The samples were dried at 40 degrees Celcius for 24 hours, crushed and homogenised prior to the analysis and were irradiated simultaneously with reference materials at a fission spectra neutron flux of the density of 5.10 1 3 cm - 2.s - 1 (WWR-SM) nuclear reactor of Institute of Nuclear Physics, Tashkent, Uzbekistan. The gamma-spectra were measured in a gamma-spectrometer. A linear regression correlation test was performed to investigate the correlation between the elemental concentrations of our sediment samples. Correlation analysis revealed close relationships between Th and U (r=0.82), Th and La (r=0.87), Th and Ce (r=0.89). In nature, rare earth elements are often associated to thorium, thus the results indicate that Th and Lanthanides have a natural origin. The mean values of thorium (8.38) to uranium (3.80) is found to be Th/U= 2.20
Toxicology of thorium cycle nuclides
International Nuclear Information System (INIS)
Ballou, J.E.
1984-01-01
The purpose of this project is to investigate the biological hazards associated with uranium-thorium breeder fuels and fuel recycle process solutions. Initial studies emphasize the metabolism and long-term biological effects of inhaled 233 U- 232 U nitrate and oxide fuel materials and of 231 Pa, a major, long-lived, radioactive waste product. 1 figure, 3 tables
49 CFR 220.301 - Purpose and application.
2010-10-01
... being distracted by the inappropriate use of electronic devices, such as mobile telephones (cell phones... 49 Transportation 4 2010-10-01 2010-10-01 false Purpose and application. 220.301 Section 220.301..., DEPARTMENT OF TRANSPORTATION RAILROAD COMMUNICATIONS Electronic Devices § 220.301 Purpose and application. (a...
20 CFR 220.63 - Conflict of interest.
2010-04-01
... 20 Employees' Benefits 1 2010-04-01 2010-04-01 false Conflict of interest. 220.63 Section 220.63 Employees' Benefits RAILROAD RETIREMENT BOARD REGULATIONS UNDER THE RAILROAD RETIREMENT ACT DETERMINING DISABILITY Consultative Examinations § 220.63 Conflict of interest. All implications of possible conflict of...
International Nuclear Information System (INIS)
Biswas, Sujoy; Rupawate, V.H.; Hareendran, K.N.; Roy, S.B.
2014-01-01
A new process based on solvent extraction has been developed for separation of uranium, thorium and rare earths from monazite leach solution using organophosphorous extractants. The Thorium cake coming from monazite source was dissolved in HNO 3 medium in presence of trace amount of HF for feed preparation. The separation of U(VI) was carried out by liquid-liquid extraction using tris-2-ethyl hexyl phosphoric acid (TEHP) in dodecane leaving thorium and rare earths elements in the raffinate. The thorium from raffinate was selectively extracted using 1M tri iso amyl phosphate (TiAP) in dodecane in organic phase leaving all rare earths elements in aqueous solution. The uranium and thorium from organic medium was quantitatively stripped using 0.05 M HNO 3 counter current mode. Results indicate the quantitative separation of uranium, thorium and rare earths from thorium cake (monazite source) using organophosphorous extractant in counter current mode
Thorium, UNFC (3,3,3) In Brasil
International Nuclear Information System (INIS)
Villas-Bôas, Roberto C.
2014-01-01
Types of thorium UNFC (3,3,3) in Brasil: • Placer, shoreline; • Placer, alluvial; • Carbonatite with residual enrichment (Barreiro,Catalao); • Carbonatite (Salitre, MG); • Pitinga granites (AM); • Alkalic Igneous
International Nuclear Information System (INIS)
Chen Xingan; Cheng Yonge; Zhen Rong
2002-01-01
The long-term monitoring of thorium inhaled by workers and assessment of their thorium lung burden has been carried out in China since 1960. Various monitoring methods have been adopted, such as chemical analysis of thorium concentration in urine samples: assessing thorium lung burden by measurement of 212 Pb etc. using a whole-body counter: measurement of exhaled thoron using a ZnS detector; or exhaled thoron decay products using an electrostatic collection system. Our experience over more than 20 years has shown that the last named measurement system is the best method for monitoring and assessing the lung burden of thorium (ThO 2 ) inhaled by miners and workers. (author)
7 CFR 3052.220 - Frequency of audits.
2010-01-01
... 7 Agriculture 15 2010-01-01 2010-01-01 false Frequency of audits. 3052.220 Section 3052.220 Agriculture Regulations of the Department of Agriculture (Continued) OFFICE OF THE CHIEF FINANCIAL OFFICER, DEPARTMENT OF AGRICULTURE AUDITS OF STATES, LOCAL GOVERNMENTS, AND NON-PROFIT ORGANIZATIONS Audits § 3052.220...
2010-01-01
... 12 Banks and Banking 1 2010-01-01 2010-01-01 false Scope. 19.220 Section 19.220 Banks and Banking COMPTROLLER OF THE CURRENCY, DEPARTMENT OF THE TREASURY RULES OF PRACTICE AND PROCEDURE Procedures for... the OCC pursuant to section 38 of the Federal Deposit Insurance Act and this part. ...
2010-04-01
... term is defined in the Social Security Act. In making these decisions the Board must apply the... Services in making disability decisions under the Social Security Act. Regulations of the Social Security... 20 Employees' Benefits 1 2010-04-01 2010-04-01 false Introduction. 220.35 Section 220.35 Employees...
Data base for a CANDU-PHW operating on the thorium cycle
International Nuclear Information System (INIS)
1979-07-01
This report, prepared for INFCE, gives data for an extrapolated 1000 MW(e) CANDU-PHW design operating on various thorium cycles. In all these cycles thorium is the main fertile component of the fuel and all assume recycling of the uranium component. In the reference cycle, the requirements for externally supplied fissile material are met using U-235, with the feed adjusted to provide a fuel burnup of approximately 30,000 MW.d/t(U). Two versions of the reference cycle are treated. In one, the U-235 is supplied in a highly enriched form (93% U-235 in uranium); in the other, the U-235 is supplied at a lower enrichment, such that the uranium present in the feed fuel is ''denatured''. The effects of varying the fuel burnup and the recycle delay time are discussed for the reference cases. Data are also given for thorium cycles using plutonium instead of U-235 to meet requirements for externally supplied fissile material. The special case of ''self sufficient equilibrium thorium cycles'', which require no external source of fissile material for equilibrium operation, is also treated
Ault, Timothy M.
The environment, health, and safety properties of thorium-uranium-based (''thorium'') fuel cycles are estimated and compared to those of analogous uranium-plutonium-based (''uranium'') fuel cycle options. A structured assessment methodology for assessing and comparing fuel cycle is refined and applied to several reference fuel cycle options. Resource recovery as a measure of environmental sustainability for thorium is explored in depth in terms of resource availability, chemical processing requirements, and radiological impacts. A review of available experience and recent practices indicates that near-term thorium recovery will occur as a by-product of mining for other commodities, particularly titanium. The characterization of actively-mined global titanium, uranium, rare earth element, and iron deposits reveals that by-product thorium recovery would be sufficient to satisfy even the most intensive nuclear demand for thorium at least six times over. Chemical flowsheet analysis indicates that the consumption of strong acids and bases associated with thorium resource recovery is 3-4 times larger than for uranium recovery, with the comparison of other chemical types being less distinct. Radiologically, thorium recovery imparts about one order of magnitude larger of a collective occupational dose than uranium recovery. Moving to the entire fuel cycle, four fuel cycle options are compared: a limited-recycle (''modified-open'') uranium fuel cycle, a modified-open thorium fuel cycle, a full-recycle (''closed'') uranium fuel cycle, and a closed thorium fuel cycle. A combination of existing data and calculations using SCALE are used to develop material balances for the four fuel cycle options. The fuel cycle options are compared on the bases of resource sustainability, waste management (both low- and high-level waste, including used nuclear fuel), and occupational radiological impacts. At steady-state, occupational doses somewhat favor the closed thorium option while low
International Nuclear Information System (INIS)
El-Naggar, I.M.; El-Absy, M.A.; Abdel-Hamid, M.M.; Aly, H.F.
1993-01-01
The kinetics of sorption of uranium and thorium from aqueous nitrate solutions on cryptomelane-type hydrous manganese dioxide (CRYMO) was studied. The exchange of uranium is particle diffusion controlled while that of thorium is chemical reaction at the exchange sites. Sorption of uranium and thorium by CRYMO has been also studied as a function of metal concentrations and temperature. The sorption of both cations is found to be an endothermic process and increases markedly with temperature between 30 and 60 degree C. The sorption results have been analysed by the langmuir adsorption isotherm over the entire range of uranium and thorium concentrations investigated. 35 refs., 8 figs., 5 tabs
International Nuclear Information System (INIS)
Lainetti, Paulo E.O.; Mindrisz, Ana C.; Freitas, Antonio A.
2011-01-01
Globally, the 80's and 90's years were characterized by a significant reduction in the rate of growth of nuclear energy. However, from the 2000's, there has been a significant change in the international arena, with the 'renaissance' of interest in nuclear energy, even in countries that had abandoned nuclear power. To answer questions like security, reducing the generation of radioactive waste, control of proliferation risks and long-term sustainability, some initiatives have been adopted by some countries. In 2000, the Department of Energy - DOE - United States created the GIF - Generation IV International Forum for Nuclear Reactors. Six reactor concepts were selected based on criteria such as: reduction of radioactive wastes, safety and cost effective to meet the increasing energy demand on a sustainable basis, being resistant to diversion of materials for nuclear weapons proliferation and safer against terrorist attacks. In this context, it becomes important to use thorium as nuclear fuel for the Generation IV Advanced Reactors, with startup scheduled for 2030. Although the thorium does not present significant commercial value nowadays, in a not too distant future it will probably be an important commodity. Unfortunately, contrarily to what is happening in most developed countries in recent years, Brazil is paying little attention to the thorium, even less than in the past, despite its large reserves. Thorium is three to four times more abundant than uranium in the Earth's crust and, although not fissile, all thorium can be used to produce 233 U, by absorption of neutrons and subsequent radioactive decay. This uranium isotope is an excellent fuel for use in almost all types of nuclear reactors. It is possible that the thorium constitutes the largest Brazilian energy reserve, supplanting much oil (despite the findings of the pre-salt) and uranium. Brazil has a long tradition in the thorium technology, from mining of monazite until the obtainment of high purity
A fertile material, plentiful in nature. The thorium sector, energy for the next millenniums
International Nuclear Information System (INIS)
Perrier, Raymond
2014-01-01
Thorium exhibits very interesting properties. It is weakly radioactive, mainly emits weakly penetrating alpha radiations, produces 70 times more energy than uranium, is between three and four times more plentiful than uranium, and is consumed at 99 per cent in reactors whereas uranium is consumed at 1 per cent. This article first discusses the future of the uranium sector, and then presents the properties of thorium. It discusses ore types and the characteristics of the different types of deposits. It evokes world reserves and indicates the different types of nuclear reactors and the main isotopes they use. It describes the uranium sector related to nuclear reactors. It presents the principle of a thorium-fuelled nuclear reactor, recalls experiments performed since the 1950's in different countries (USA, Germany, India, so on) as well as the existence of some commercial reactors using thorium. It evokes more recent projects: proton accelerator reactors, molten salt reactors. It outlines the benefits and drawbacks of this last reactor type, and that Europe is late in the development of thorium-fuelled reactors with respect to China, USA and India
Distribution of uranium and thorium in sediments and plants from a granitic fluvial area
International Nuclear Information System (INIS)
Vargas, M.J.; Tome, F.V.; Sanchez, A.M.; Vazquez, M.T.C.; Murillo, J.L.G.
1997-01-01
A study of the presence of natural uranium and thorium isotopes in sediments and plants belonging to a granitic fluvial region of the Ortigas river (west of Spain) has been carried out. The existence of two uranium mines in the neighbourhood of the sampled sites and the granitic characteristics of the zone produce significant concentrations of natural radionuclides. Temporal and spatial variations of uranium and thorium concentrations and the activity ratios 234 U/ 238 U, 228 Th/ 232 Th and Th/U were studied to better understand the mobilization mechanisms such as leaching and transport at play in the studied system. These determinations were made using alpha-particle spectrometry with silicon detectors. The measurements were also compared with the results previously found for waters of this fluvial area. Uranium in sediments showed variations due to changes in rainfall, but thorium content was nearly constant. Uranium and thorium concentrations in plants were lower after rainfall. Incorporation of uranium into the plants seemed to be mainly from water, whereas incorporation of thorium seemed to be from both sediments and water. (Author)
Critical review of analytical techniques for safeguarding the thorium-uranium fuel cycle
International Nuclear Information System (INIS)
Hakkila, E.A.
1978-10-01
Conventional analytical methods applicable to the determination of thorium, uranium, and plutonium in feed, product, and waste streams from reprocessing thorium-based nuclear reactor fuels are reviewed. Separations methods of interest for these analyses are discussed. Recommendations concerning the applicability of various techniques to reprocessing samples are included. 15 tables, 218 references
46 CFR 402.220 - Registration of pilots.
2010-10-01
... 46 Shipping 8 2010-10-01 2010-10-01 false Registration of pilots. 402.220 Section 402.220 Shipping... ORDERS Registration of Pilots § 402.220 Registration of pilots. (a) Each applicant pilot must complete the number of round trips specified in this section prior to registration as a U.S. registered pilot...
46 CFR 401.220 - Registration of pilots.
2010-10-01
... 46 Shipping 8 2010-10-01 2010-10-01 false Registration of pilots. 401.220 Section 401.220 Shipping... Registration of Pilots § 401.220 Registration of pilots. (a) The Director shall determine the number of pilots... waters of the Great Lakes and to provide for equitable participation of United States Registered Pilots...
29 CFR 99.220 - Frequency of audits.
2010-07-01
... 29 Labor 1 2010-07-01 2010-07-01 true Frequency of audits. 99.220 Section 99.220 Labor Office of the Secretary of Labor AUDITS OF STATES, LOCAL GOVERNMENTS, AND NON-PROFIT ORGANIZATIONS Audits § 99.220 Frequency of audits. Except for the provisions for biennial audits provided in paragraphs (a) and...
Energy Technology Data Exchange (ETDEWEB)
Braun, C; Lorrain, Ch; Mahut, R; Mariette, R; Muller, J; Prugnard, J [Commissariat a l' Energie Atomique, Usine du Bouchet, Saclay (France). Centre d' Etudes Nucleaires
1958-07-01
A urano-thorianite mineral from Madagascar is industrially treated at the factory of the Bouchet in order to obtain pure thorium in the form of the nitrate and a uranium concentrate in the form of uranate. The required factory was designed and constructed in 1955 and 1956 by the firm Potasse et Engrais Chimiques (P.E.C.) on behalf of the French Atomic Energy authority. The mineral which has previously undergone a gravimetric sorting and enrichment at the mine, is in the form of a heavy rock (the density can be as high as 10), having a cubic structure. It consists principally of a mixture of thorium oxide and uranium oxide and contains between 50 and 75 per cent thorium and between 5 and 20 per cent of uranium. On the same sample a high content in either thorium or uranium in general corresponds to a low content in the other of the two metals; this rule is not however always obeyed absolutely. Among other elements present we shall only mention the Pb, Fe, Ce, Ra and other radioactive elements, since their presence influences the treatment of the mineral. We shall first briefly describe the process, which has already been described in previous publications, we consider to be worthy of attention. (author)Fren. [French] Le minerai d'uranothorianite en provenance de Madagascar est traite industriellement a l'Usine du Bouchet en vue de l'obtentionn sel de thorium pur, le nitrate, et d'un concentre d'uranium, un uranate. L'etude et la construction de l'atelier destine a cet effet ont ete realisees en 1955 et 1956 par la Societe Potasse et Engrais chimiques pour le Commissariat a l'Energie atomique. Le minerai, scheide ou enrichi a la mine par voie gravimetrique, se presente comme une roche dense (la densite peut atteindre 10), de structure cubique. Il est constitue essentiellement d'un melange d'oxyde de thorium et d'oxyde d'uranium qui titre 50 a 75 pour cent de Th et 5 a 20 pour cent d'uranium. A une forte teneur d'un element correspond dans le meme minerai une basse
International Nuclear Information System (INIS)
Sarika Verma; Amritphalae, S.S.
2016-01-01
For the first time (Patent application filed in India vide N/F No-0018NF2015) a novel process for the synthesis of 'Designed Molecular Precursor' (DMP) of thorium has been developed, which involves the unique combination of two different (dual) capping agents, one is biomolecule: Cytosine and other is non biomolecule: cetyl trimethyl ammonium bromide. The DMP essentially consists of hybrid nanosized thorium oxalate and alkaline thorate whose application lies in the area of making thorium metal, densified thorium oxide, carbide and nitride, anhydrous thorium complexes and thorium boron silicates glasses. (author)
Alpha spectrometry and the secondary ion mass spectrometry of thorium
International Nuclear Information System (INIS)
Strisovska, J.; Kuruc, J.; Galanda, D.; Matel, L.; Aranyosiova, M.; Velic, D.
2009-01-01
The main objective of this master thesis was preparation of samples with thorium content on the steel discs by electrodeposition for determination of natural thorium isotope by alpha spectrometry and the secondary ion mass spectrometry and finding out their possible linear correlation between these methods. The samples with electrolytically excluded isotope of 232 Th were prepared by electrodeposition from solution Th(NO 3 ) 4 ·12 H2 O on steel discs in electrodeposition cell with use of solutions Na 2 SO 4 , NaHSO 4 , KOH and (NH 4 ) 2 (C 2 O 4 ) by electric current 0.75 A. Discs were measured by alpha spectrometer. Activity was calculated from the registered impulses for 232 Th and surface's weight. After alpha spectrometry measurements discs were analyzed by TOF-SIMS IV which is installed in the International Laser Centre in Bratislava. Intensities of isotope of 232 Th and ions of ThO + , ThOH + , ThO 2 H + , Th 2 O 4 H + , ThO 2 - , ThO 3 H - , ThH 3 O 3 - and ThN 2 O 5 H - were identified. The linear correlation is between surface's weights of Th and intensities of ions of Th + from SIMS, however the correlation coefficient has relatively low value. We found out with SIMS method that oxidized and hydride forms of thorium are significantly represented in samples with electroplated thorium. (authors)
Thorium-based fuel cycles: Reassessment of fuel economics and proliferation risk
Energy Technology Data Exchange (ETDEWEB)
Serfontein, Dawid E., E-mail: Dawid.Serfontein@nwu.ac.za [Senior Lecturer at the School of Mechanical and Nuclear Engineering, North West University (PUK-Campus), PRIVATE BAG X6001, Internal Post Box 360, Potchefstroom 2520 (South Africa); Mulder, Eben J. [Professor at the School of Mechanical and Nuclear Engineering, North West University (South Africa)
2014-05-01
At current consumption and current prices, the proven reserves for natural uranium will last only about 100 years. However, the more abundant thorium, burned in breeder reactors, such as large High Temperature Gas-Cooled Reactors, and followed by chemical reprocessing of the spent fuel, could stretch the 100 years for uranium supply to 15,000 years. Thorium-based fuel cycles are also viewed as more proliferation resistant compared to uranium. However, several barriers to entry caused all countries, except India and Russia, to abandon their short term plans for thorium reactor projects, in favour of uranium/plutonium fuel cycles. In this article, based on the theory of resonance integrals and original analysis of fast fission cross sections, the breeding potential of {sup 232}Th is compared to that of {sup 238}U. From a review of the literature, the fuel economy of thorium-based fuel cycles is compared to that of natural uranium-based cycles. This is combined with a technical assessment of the proliferation resistance of thorium-based fuel cycles, based on a review of the literature. Natural uranium is currently so cheap that it contributes only about 10% of the cost of nuclear electricity. Chemical reprocessing is also very expensive. Therefore conservation of natural uranium by means of the introduction of thorium into the fuel is not yet cost effective and will only break even once the price of natural uranium were to increase from the current level of about $70/pound yellow cake to above about $200/pound. However, since fuel costs constitutes only a small fraction of the total cost of nuclear electricity, employing reprocessing in a thorium cycle, for the sake of its strategic benefits, may still be a financially viable option. The most important source of the proliferation resistance of {sup 232}Th/{sup 233}U fuel cycles is denaturisation of the {sup 233}U in the spent fuel by {sup 232}U, for which the highly radioactive decay chain potentially poses a large
Thermodynamic studies of thorium carbide fuel preparation and fuel-clad comptability
International Nuclear Information System (INIS)
Besmann, T.M.; Beahm, E.C.
1979-01-01
The carbothermic reduction of thorium and uranium-thorium dioxide to monocarbide has been assessed. Equilibrium calculations have yielded Th-C-O and U-Th-C-O phase equilibria and (CO) pressures generated during reduction. The (CO) pressures were found to be at least five orders of magnitude greater than any of the other 15 gaseous species considered. This confirms that the monocarbide can successfully be prepared by carbothermic reduction. The chemical compatibility of thorium carbides with the Cr-Fe-Ni content of clad alloys has been thermodynamically avaluated. Solid solutions of 5 > and 5 > and of 7 C 3 > and 7 C 3 > were the principal reaction products. The Cr-Fe-Ni content of 316 stainless steel showed much less reaction product than that for any of the other six alloys considered. (orig.) [de
12 CFR 220.6 - Good faith account.
2010-01-01
... 12 Banks and Banking 3 2010-01-01 2010-01-01 false Good faith account. 220.6 Section 220.6 Banks... BY BROKERS AND DEALERS (REGULATION T) § 220.6 Good faith account. In a good faith account, a creditor...) Securities entitled to good faith margin—(1) Permissible transactions. A creditor may effect and finance...
International Nuclear Information System (INIS)
McLemore, V.T.
1983-09-01
The following compilation of uranium and thorium occurrences, prospects, deposits, and mines and their descriptions is the most comprehensive tabulation of natural-occurring radioactive occurrences in New Mexico to date. It is possible that many additional occurrences will be discovered in the future. For the purposes of this compilation any locality where uranium or thorium mineralization is reported or produced, or where uranium or thorium concentration exceeds 0.001%, or where the radioactivity is twice background radioactivity or greater is considered an occurrence
Geological development and uranium and thorium evolutions in volcanic basin No.460
International Nuclear Information System (INIS)
Zhou Dean.
1989-01-01
On the basis of summarizing the geological features and the developmental history of tectono-magmatic activity, the uranium and thorium evolutional rules of rocks in different times are studied. It is suggested that the uranium and thorium increments caused by potassic migmatization of late Archean basement rocks in this area is the material base which affected the subsequent evolution of the cover of volcanic rocks and uranium mineralization. The Upper Jurassic acid volcanic cover belonging to crustal remelting origin constituted the favorable stratigraphic background for uranium mineralization in this area due to its wide distribution, large thickness, various rock associations and lithological sequences, as well as high content of uranium and thorium. During the late Yanshanian stage acid subvolanic rocks or small intrusions with high uranium intruded along the regional fractures are the decisive factors for the emplacement of uranium mineralization in this area, which othen became the favorable wall rocks for preserving ores itself. During the late stage the hydrothermal uranium mineralization was the main geological process from which uranium and thorium in stratigraphy and terrain were finally separated
Thorium(IV) and zirconium(IV) complexes of oxygen donor ligands. Pt. 12
International Nuclear Information System (INIS)
Agarwal, R.K.; Jain, P.C.; Kapur, V.; Sharma, S.; Srivastava, A.K.
1980-01-01
Crystalline thorium (IV) chelates with mono N-oxides of 2,2'-bipyridine (bipyNO) and 1,10-phenanthroline (phenNO), ThX 4 x 2L(X = Cl,Br,NO 3 or NCS) and ThX 4 x 3L(X = I or ClO 4 and L = bipyNO or phenNO) have been synthesised and characterized on the basis of i.r. spectra, molar conductance, molecular weights, t.g.a. and d.t.a. data. All the complexes are weakly diamagnetic and contain bipyNO and phenNO bonded to thorium(IV) through nitrogen and oxygen. The coordination number of thorium(IV) varies from six to twelve depending on the nature of the anions. (orig.) [de
Processing of Indian monazite for the recovery of thorium and uranium values
International Nuclear Information System (INIS)
Mukherjee, T.K.
2004-01-01
The mineral monazite, a phosphate of rare earths and thorium with significant quantity of uranium is one of the six heavy minerals present in the beach sands of specific coastal areas of India. Indian Rare Earths Ltd is mining and processing monazite at its Rare Earths Division for the last many decades with an aim of building up enough stock of thorium concentrate for its future use in the three stage nuclear power programme of the country. The present paper briefly describes the monazite resource position of he country, the past and present modified processing schemes and the future programme commensurate with the requirement of the country for quality thorium and uranium bearing nuclear materials
24 CFR 220.811 - Date of default.
2010-04-01
... 24 Housing and Urban Development 2 2010-04-01 2010-04-01 false Date of default. 220.811 Section... and Obligations-Projects Insured Project Improvement Loans § 220.811 Date of default. For the purposes of §§ 220.800 et seq., the date of default shall be considered as: (a) The date of the first...
24 CFR 220.812 - Notice of default.
2010-04-01
... 24 Housing and Urban Development 2 2010-04-01 2010-04-01 false Notice of default. 220.812 Section... and Obligations-Projects Insured Project Improvement Loans § 220.812 Notice of default. (a) If the default as defined in § 220.810 is not cured within the 30 day grace period, the lender shall, within 30...
Krakeli, Tor-Arne
2013-01-01
- Det har blitt kjøpt inn et nytt spektrofotometer (Evolution 220, Thermo Scientific) til BioLab Nofima. I den forbindelsen har det blitt utført en validering som involverer kalibreringsstandarder fra produsenten og en test på normal distribusjon (t-test) på to metoder (Total fosfor, Tryptofan). Denne valideringen fant Evolution 220 til å være et akseptabelt alternativ til det allerede benyttede spektrofotometeret (Helios Beta). På bakgrunn av noen instrumentbegrensninger må de aktuelle an...
Study of thorium internal monitoring program by radiotoxicological analysis
International Nuclear Information System (INIS)
Gaburo, J.; Sordi, G.-M.A.A.
1986-01-01
The aim of this work is the establishment of a bioassay routine monitoring program for thorium occupationally exposed personnel. A simple and economic method for the analytical determination of the concentration of Th-232 in excreta samples was adopted, using Th-229 as a tracer. The mean yield of the method was 80%. Thorium concentration in excreta samples of non occupationally exposed Rio de Janeiro and Sao Paulo inhabitants was compared with data provenient from Nuclemon workers, with a exposition history to the nuclide of more than ten years and from IPEN workers only recently occupationally exposed to the nuclide. (Author) [pt
Demonstration of iron and thorium in autopsy tissues by x-ray microanalysis
International Nuclear Information System (INIS)
Landas, S.; Turner, J.W.; Moore, K.C.; Mitros, F.A.
1984-01-01
We performed x-ray microanalysis of autopsy specimens using a scanning-transmission electron microscopy mode. Tissues were obtained at necropsy from a patient with history of angiography using thorium dioxide and from a patient with hemochromatosis. X-ray microanalysis confirmed the presence of thorium and iron in their respective tissues. Effects of staining reagents were examined
International Nuclear Information System (INIS)
Min, Duck Kee; Choi, Byung Il; Ro, Seung Gy; Eom, Tae Yoon; Kim, Zong Goo
1986-01-01
Densities of a large number of mixed uranyl nitrate-thorium nitrate solutions were measured with pycnometer. By the least squares analysis of the experimental result, an empirical formula for determining water content of mixed uranyl nitrate-thorium nitrate solutions as functions of uranium concentration, thorium concentration and nitric acid normality is derived; W=1.0-0.3580 C u -0.4538 C Th -0.0307H + where W, C u , C Th , and H + stand for water content(g/cc), uranium concentration (g/cc), thorium concentration(g/cc), and nitric acid normality, respectively. Water contents of the mixed uranyl nitrate-thorium nitrate solutions are calculated by using the empirical formular, and compared with the values calculated by Bouly's equation in which an additional data, solution density, is required. The two results show good agreements within 2.7%. (Author)
Determination of low concentrations of thorium in granites using X-ray fluorescence technique
International Nuclear Information System (INIS)
Shigematsu, H.M.; Sato, I.M.; Iyer, S.S.
1981-03-01
An analytical method for the accurate determination of low concentrations of thorium in rocks using X-ray fluorescence technique, was developed. A tungsten tube was utilized for the production of X-rays. The samples were prepared in the form of double layer pressed pellets using boric acid as a binding agent. The concentration of thorium was determined by measuring the intensity of the characteristic first order Th L α line. The calibration was carried out with USGS rock standards AGV-1, GSP-1 and G-2. Seven granite rocks samples from Granite Mountains of Wyoming, USA, supplied by Dr. Stuckless. Also were analysed. The results obtained were compared with values obtained in others laboratories using different analytical methods. The analyses show that the thorium is concentrated in accessory minerals and presented a non-uniform distribution, making sampling an important factor in the analysis of thorium. A discussion of the precision and accuracy of the method is presented. (Author) [pt
Uranium and thorium deposits of Northern Ontario
International Nuclear Information System (INIS)
Robertson, J.A.; Gould, K.L.
1983-01-01
This, the second edition of the uranium-thorium deposit inventory, describes briefly the deposits of uranium and/or thorium in northern Ontario, which for the purposes of this circular is defined as that part of Ontario lying north and west of the Grenville Front. The most significant of the deposits described are fossil placers lying at or near the base of the Middle Precambrian Huronian Supergroup. These include the producing and past-producing mines of the Elliot Lake - Agnew Lake area. Also included are the pitchblende veins spatially associated with Late Precambrian (Keweenawan) diabase dikes of the Theano Point - Montreal River area. Miscellaneous Early Precambrian pegmatite, pitchblende-coffinite-sulphide occurrences near the Middle-Early Precambrian unconformity fringing the Lake Superior basin, and disseminations in diabase, granitic rocks, alkalic complexes and breccias scattered throughout northern Ontario make up the rest of the occurrences
Lanthanides, thorium, iodine in terrestrail invertebrates
International Nuclear Information System (INIS)
Zhulidov, A.V.; Pokarzhevskij, A.D.; Katargin, N.V.; AN SSSR, Moscow
1991-01-01
It is shown that among examined terrestrial invertebrates the highest levels on lanthanide and thorium concentration are typical for animals, feeding on plant tissues - earthworms, molluscs, diploid. It is shown that there are no reasons to hope, that regularities of migration of transuranium elements and lanthanides in tropic chains are identical
International Nuclear Information System (INIS)
Zini, Josiane
2010-01-01
In the 70's a pilot plant for studies of different concentrates processing obtained from the chemical processing of monazite was operated at IPEN / CNEN-SP, with a view to obtaining thorium of nuclear purity. This unity was operated on an industrial scale since 1985, generating around 25 metric tons of residue and was closed in 2002. This waste containing thorium and rare earths was named Retoter (Rejeito de Torio e Terras Raras, in portuguese) and stored in the IPEN Safeguards shed. This paper studies the treatment of the waste, aimed at environmental, radiological and technology. Were studied two cases for the chromatographic separation of thorium from rare earths. One of them was the chromatographic extraction, where the extracting agent tributyl phosphate was supported on polymeric resins Amberlite XAD16. The other method is studied for comparison purposes, since the material used in chromatographic extraction is unprecedented with regard to the separation of thorium, was the ion-exchange chromatography using DOWEX 1-X8 strong cationic resin. Was studied also the chromatographic process of extraction with the extracting agent DEHPA supported on Amberlite XAD16 for the fractionation in groups of rare earths elements. Thorium was separated with high purity for strategic purposes and rare earths recovered free from thorium, were tested as a catalyst for ethanol reforming to hydrogen obtaining which is used in fuel cells for power generation. (author)
CompTIA A+ complete study guide exams 220-801 and 220-802
Docter, Quentin; Skandier, Toby
2012-01-01
CompTIA Authorized, fully updated Study Guide for the leading IT certification: CompTIA A+ CompTIA A+ is the de facto certification for IT technicians. Some vendors even require employees to achieve certification as part of their job training. This book prepares you for both required exams: 220-801 and 220-802. Totally updated to cover the 2012 exams, this popular prep guide covers all the exam objectives. Readers will also have access to additional study tools, including the Sybex Test Engine with bonus practice exams, electronic flashcards, and a glossary of important terms in searchable PD
Determination of thorium in native gold by radiochemical neutron activation analysis
International Nuclear Information System (INIS)
Liu, Y.; Kraehenbuehl, U.
1995-01-01
Thorium concentrations in 11 native gold samples from different sources, e.g. placer gold, vein and lode gold were determined. Thorium was determined by radiochemical separation and measurement of protactinium from irradiated native gold samples. The chemical yield of the separation procedures is 90%. Other elements were measured by gamma-ray spectroscopy. The radiochemical separation procedures described in this work make accurate determination of Th concentrations in native gold at picogram concentrations possible. (orig.)
International Nuclear Information System (INIS)
Syed, H.S.
1999-01-01
Adsorption studies of thorium and uranium radionuclides on 9 different pure clay minerals and 4 local Malaysian soil sediments were conducted. Solution containing dissolved thorium and uranium at pH 4.90 was prepared from concentrate sludges from a long term storage facility at a local mineral processing plant. The sludges are considered as low level radioactive wastes. The results indicated that the 9 clay minerals adsorbed more uranium than thorium at pH ranges from 3.74 to 5.74. Two local Malaysian soils were observed to adsorb relatively high concentration of both radionuclides at pH 3.79 to 3.91. The adsorption value 23.27 to 27.04 ppm for uranium and 33.1 to 50.18 ppm for thorium indicated that both soil sediments can be considered as potential enhanced barrier material for sites disposing conditioned wastes containing uranium and thorium. (author)
Thor, a thorium-reflected plutonium-metal critical assembly
International Nuclear Information System (INIS)
Hansen, G.E.; Paxton, H.C.
1979-01-01
Critical specifications of Thor, an old assembly of thorium-reflected plutonium, have been refined. These specifications are brought together with void coefficients, Rossi-alpha values, fission traverses, and spectral indices
International Nuclear Information System (INIS)
Misdaq, M.A.; Ouabi, H.; Merzouki, A.
2007-01-01
Uranium ( 238 U) and thorium ( 232 Th) concentrations as well as radon ( 222 Rn) and thoron ( 220 Rn) alpha-activities per unit volume have been measured inside various potable water samples collected from nineteen cities in Morocco by using CR-39 and LR-115 type II solid state nuclear track detectors (SSNTDs). Measured radon alpha-activities ranged from (0.37 ± 0.02) Bq l -1 to (13.6 ± 1.10) Bq l -1 for the potable water samples studied. Alpha-activities due to radon from the ingestion of the studied potable water samples were determined in different compartments of the gastrointestinal system by using the ICRP compartmental model for radon. Annual committed equivalent doses due to radon were evaluated in the gastrointestinal compartments from the ingestion of the potable water samples studied. The influence of the target tissue mass, radon intake and alpha-activity integral due to radon on the annual committed equivalent doses in the gastrointestinal compartments was investigated
Packed-fluidized-bed blanket concept for a thorium-fueled commercial tokamak hybrid reactor
International Nuclear Information System (INIS)
Chi, J.W.H.; Miller, J.W.; Karbowski, J.S.; Chapin, D.L.; Kelly, J.L.
1980-09-01
A preliminary design of a thorium blanket was carried out as a part of the Commercial Tokamak Hybrid Reactor (CTHR) study. A fixed fuel blanket concept was developed as the reference CTHR blanket with uranium carbide fuel and helium coolant. A fixed fuel blanket was initially evaluated for the thorium blanket study. Subsequently, a new type of hybrid blanket, a packed-fluidized bed (PFB), was conceived. The PFB blanket concept has a number of unique features that may solve some of the problems encountered in the design of tokamak hybrid reactor blankets. This report documents the thorium blanket study and describes the feasibility assessment of the PFB blanket concept
Origin of blue emission in thorium oxide nanorods
International Nuclear Information System (INIS)
Gupta, Santosh K.; Natarajan, V.; Ghosh, P.S.; Arya, A.
2014-01-01
Thorium oxide, ThO 2 , has long been an important material in the nuclear industry and has more recently found utility in the design of a variety of new materials, including catalysts, electrodes, fuel cell, electrolytes and sensors. Thorium dioxide is an interesting host matrix for a variety of reasons like its low phonon energy (∼450 cm -1 ), which reduces the non-radiative losses. Among all the chemical processes, the micro emulsion processing (reverse micelles synthesis) has been demonstrated as a very versatile and reproducible method. Luminescence of pure metal oxides is usually assigned to crystal lattice defects formed by oxygen vacancies but the obvious experimental evidences for this assumption are absent. Optical properties of stoichiometric and oxygen-deficient thoria have never been investigated previously
International Nuclear Information System (INIS)
Kennedy, James; Kutsch, John
2014-01-01
Full Spectrum Rare Earth Production & fully integrated Value Chain: Developing low value rare earth deposits with high direct cost is not economically viable. High value, low-cost, byproduct resources are abundant and available. Thorium bearing Rare Earth Phosphates could meet 50% or more of global demand if the Thorium issue could be resolved. There is no need to develop any new RE mining operations – just fix the Thorium Problem. Fully Integrated Value Chain Capabilities are Paramount: All efforts must focus on developing a fully integrated value chain.
Sahoo, B K; Sudeep Kumara, K; Karunakara, N; Gaware, J J; Sapra, B K; Mayya, Y S
2017-06-01
Regulating the environmental discharge of 220 Rn (historically known as thoron) and its decay products from thorium processing facilities is important for protection of environment and general public living in the vicinities. Activated charcoal provides an effective solution to this problem because of its high adsorption capacity to gaseous element like radon. In order to design and develop a charcoal based Thoron Mitigation System, a mathematical model has been developed in the present work for studying the 220 Rn transport and adsorption in a flow through charcoal bed and estimating the 220 Rn mitigation factor (MF) as a function of system and operating parameters. The model accounts for inter- and intra-grain diffusion, advection, radioactive decay and adsorption processes. Also, the effects of large void fluctuation and wall channeling on the mitigation factor have been included through a statistical model. Closed form solution has been provided for the MF in terms of adsorption coefficient, system dimensions, grain size, flow rate and void fluctuation exponent. It is shown that the delay effects due to intra grain diffusion plays a significant role thereby rendering external equilibrium assumptions unsuitable. Also, the application of the statistical model clearly demonstrates the transition from the exponential MF to a power-law form and shows how the occurrence of channels with low probability can lower mitigation factor by several orders of magnitude. As a part of aiding design, the model is further extended to optimise the bed dimensions in respect of pressure drop and MF. The application of the results for the design and development of a practically useful charcoal bed is discussed. Copyright © 2017 Elsevier Ltd. All rights reserved.
Spectrographic determination of some rare earths in thorium compounds
International Nuclear Information System (INIS)
Brito, J. de.
1977-01-01
A method for spectrographic determination of Gd, Sm, Dy, Eu, Y, Yb, Tm and Lu in thorium compounds has been developed. Sensibilities of 0.01 μg rare earths/g Th02 were achieved. The rare earth elements were chromatographycally separated in a nitric acid-ether-cellulose system. The solvent mixture was prepared by dissolving 11% of concentrated nitric acid in ether. The method is based upon the sorption of the rare earths on activated cellulose, the elements being eluted together with 0.01 M HNO 3 . The retention of the 152 , 154 Eu used as tracer was 99,4%. The other elements showed recoveries varying from 95 to 99%. A direct carrier destillation procedure for the spectrochemical determination of the mentioned elements was used. Several concentrations of silver chloride were used to study the volatility behavior of the rare earths. 2%AgCl was added to the matrix as definite carrier, being lantanum selected as internal standard. The average coefficient of variation for this method was +- -+ 7%. The method has been appleid to the analysis of rare earths in thorium coumpounds prepared by Thorium Purification Pilot Plant at Atomic Energy Institute, Sao Paulo [pt
The selective uptake of uranium and thorium from the environment by some vegetables
International Nuclear Information System (INIS)
Yusof, A.M.; Ghazali, Z.; Abdul-Rahman, S.; Sharif, J.
1991-01-01
An attempt was made to establish baseline information on environmental pollution in locally-grown vegetables by uranium and thorium. Lowland and highland species together with soil and fertilizer samples were collected and analyzed using fluorimetry, spectrophotometry and delayed neutron counting techniques. All leafy vegetables observed showed high uranium and thorium uptake especially those grown in the lowlands. Those grown in the highlands reflected no direct relationship in uranium and thorium contents. Several species common in both sampling areas exhibited direct relationship between these two elements making them as potential bio-indicators. Figures calculated for fruit-type and leafy vegetables were not only comparatively low but bore no direct correlation between the two elements. The use of phosphate-based fertilizers on some of the leafy species in the lowlands did not enhance the uptake of these elements in spite of the higher uranium and thorium contents in soil samples from the lowlands, between 20-85 μg/g for uranium and 43-226 μg/g thorium compared to about 13-20 μg/g and 35-55 μg/g respectively for soil samples in the highlands. Statistical analysis was done to substantiate these findings. Climatic conditions were also taken into account as one of the factors affecting selective uptake of these elements in the vegetables
Uranium and thorium mining and milling: material security and risk assessment
International Nuclear Information System (INIS)
Steinhaeusler, F.; Zaitseva, L.
2005-01-01
Full text: At present physical protection for the front end of the nuclear fuel cycle is typically at a significantly lower level than at any other part of the nuclear fuel cycle. In view of past experiences (Israel, South Africa, Pakistan, India) it is feasible to take into consideration some generic threat scenarios, potentially resulting in loss of control over uranium or thorium, respectively their concentrates, such as: illegal mining of an officially closed uranium- or thorium mine; covert diversion of uranium- or thorium ore whilst officially mining another ore; covert transport of radioactive ore or product, using means of public rail, road, ship, or air transport; covert en route diversion of an authorized uranium- or thorium transport; covert removal of uranium-or thorium ore or concentrate from an abandoned facility. The Stanford-Salzburg database on nuclear smuggling, theft, and orphan radiation sources (DSTO) contains information on trafficking incidents involving mostly uranium, but also some thorium, from 30 countries in five continents with altogether 113 incidents in the period 1991 to 2004. These activities range from uranium transported in backpacks by couriers in Afghanistan, to a terrorist organization purchasing land in order to mine covertly for uranium in Australia, and the clandestine shipment of almost two tons of uranium hexafluoride from Asia to Africa, using the services of a national airline. Potential participants in such illegal operations range from entrepreneurs to members of organized crime, depending on the level of sophistication of the operation. End-users and 'customers' of such illegal operations are suspected to be non-state actors, organizations or governments involved in a covert operation with the ultimate aim to acquire a sufficient amount of nuclear material for a nuclear device. The actual risk for these activities to succeed in the acquisition of an adequate amount of suitable radioactive material depends on one or
Energy Technology Data Exchange (ETDEWEB)
Chesne, A; Regnaut, P [Commissariat a l' Energie Atomique, Saclay (France). Centre d' Etudes Nucleaires
1955-07-01
Description of the conditions of separation of the thorium, of the uranium 233 and of the protactinium 233 in hydrochloric solution by absorption then selective elution on anion exchange resin. A precipitation of the thorium by the oxalic acid permits the recuperation of the hydrochloric acid which is recycled, the main, raw material consumed being the oxalic acid. (authors) [French] Description des conditions de separation du thorium, de l'uranium 233 et du protactinium 233 en solution chlorhydrique par absorption puis elution selective sur resine echangeuse d'anions. Une precipitation du thoriun par l'acide oxalique permet la recuperation de l'acide chlorhydrique qui est recycle, la principale matiere premiere consommee etant l'acide oxalique. (auteurs)
International Nuclear Information System (INIS)
Huang, Jie; Ding, Ming
2017-01-01
Highlights: • Four-level of spatial separation is described in a block-type thorium-loaded HTR. • A traditional two-step calculation scheme is used to get the neutronic performance. • Fuel cycle cost is calculated by the levelised lifetime cost method. • Fuel cycle cost decreases with the increase of separation level or thorium content. • Effective enrichment basically determines the fuel cycle cost. - Abstract: With nuclear energy’s rapid development in recent years, supply of nuclear fuel has become increasingly important. Thorium has re-gained attention because of its abundant reserves and excellent physical properties. Compared to the homogeneous Th/U MOX fuel, separation of thorium and uranium in space is a better use of thorium. Therefore, this paper describes four-level spatial separation – no separation, tristructural-isotropic (TRISO) level, channel level and block level – in a block-type thorium-loaded helium-cooled high-temperature reactor (HTR). A traditional two-step calculation scheme, lattice calculation followed by core calculation, is used to get the neutronic performance of the equilibrium cycle, including uranium enrichment, mass of fuel, effective multiplication factor, and average conversion ratio. Based on these data, the fuel cycle cost of different-scale spatial separation can be calculated by the levelised lifetime cost method as a function of thorium content. As the separation level increases from no separation to channel level, the effective enrichment decreases 15% due to the increase of resonance escape probability. So there is a 13% drop for the fuel cycle cost. For TRISO-level separation, as the thorium content increases from 9 to 57%, the effective enrichment decreases 14% because of the superior breeding capacity of U-233. As a result, the fuel cycle cost also has about a 12% decrease. From the perspective of fuel cycle economics, channel-level separation with 60% thorium content is suggested.
Radiotoxicity Characterization of Multi-Recycled Thorium Fuel - 12394
Energy Technology Data Exchange (ETDEWEB)
Franceschini, F.; Wenner, M. [Westinghouse Electric Company, Cranberry Township, PA (United States); Fiorina, C. [Polytechnic of Milano, Milan (Italy); Paul Sherrer Institute (Switzerland); Huang, M.; Petrovic, B. [Georgia Technology University, Atlanta, GA (United States); Krepel, J. [Paul Sherrer Institute (Switzerland)
2012-07-01
As described in companion papers, Westinghouse is proposing the implementation of a thorium based fuel cycle to burn the transuranic (TRU) contained in the used nuclear fuel. The potential of thorium as a TRU burner is described in another paper presented at this conference. This paper analyzes the long-term impact of thorium on the front-end and backend of the fuel cycle. This is accomplished by an assessment of the isotopic make-up of Th in a closed cycle and its impact on representative metrics, such as radiotoxicity, decay heat and gamma heat. The behavior in both thermal and fast neutron energy ranges has been investigated. Irradiation in a Th fuel PWR has been assumed as representative of the thermal range, while a Th fuel fast reactor (FR) has been employed to characterize the behavior in the high-energy range. A comparison with a U-fuel closed-cycle FR has been undertaken in an attempt of a more comprehensive evaluation of each cycle's long-term potential. As the Th fuel undergoes multiple cycles of irradiation, the isotopic composition of the recycled fuel changes. Minor Th isotopes are produced; U-232 and Pa-231 build up; the U vector gradually shifts towards increasing amounts of U-234, U-235 etc., eventually leading to the production of non negligible amounts of TRU isotopes, especially Pu-238. The impact of the recycled fuel isotopic makeup on the in-core behavior is mild, and for some aspects beneficial, i.e. the reactivity swing during irradiation is reduced as the fertile characteristics of the fuel increase. On the other hand, the front and the back-end of the fuel cycle are negatively affected due to the presence of Th-228 and U-232 and the build-up of higher actinides (Pu-238 etc.). The presence of U-232 can also be seen as advantageous as it represents an obstacle to potential proliferators. Notwithstanding the increase in the short-term radiotoxicity and decay heat in the multi-recycled fuel, the Th closed cycle has some potentially
Comparison of the radiological impacts of thorium and uranium nuclear fuel cycles
International Nuclear Information System (INIS)
Meyer, H.R.; Witherspoon, J.P.; McBride, J.P.; Frederick, E.J.
1982-03-01
This report compares the radiological impacts of a fuel cycle in which only uranium is recycled, as presented in the Final Generic Environmental Statement on the Use of Recycle Plutonium in Mixed Oxide Fuel in Light Water Cooled Reactors (GESMO), with those of the light-water breeder reactor (LWBR) thorium/uranium fuel cycle in the Final Environmental Statement, Light Water Breeder Reactor Program. The significant offsite radiological impacts from routine operation of the fuel cycles result from the mining and milling of thorium and uranium ores, reprocessing spent fuel, and reactor operations. The major difference between the impacts from the two fuel cycles is the larger dose commitments associated with current uranium mining and milling operations as compared to thorium mining and milling. Estimated dose commitments from the reprocessing of either fuel type are small and show only moderate variations for specific doses. No significant differences in environmental radiological impact are anticipated for reactors using either of the fuel cycles. Radiological impacts associated with routine releases from the operation of either the thorium or uranium fuel cycles can be held to acceptably low levels by existing regulations
A general overview of generation IV molten salt reactor (MSR) and the use of thorium as fuel
Energy Technology Data Exchange (ETDEWEB)
Yamaguchi, Carlos H.; Stefani, Giovanni L.; Santos, Thiago A., E-mail: carlos.yamaguchi@usp.br, E-mail: giovanni.stefani@ipen.br, E-mail: thiago.santos@ufabc.edu.br [Universidade de Sao Paulo (USP), SP (Brazil). Instituto de Fisica; Instituto de Pesquisas Energeticas e Nucleares (IPEN/CNEN-SP), Sao Paulo, SP (Brazil); Universidade Federal do ABC (CECS/UFABC), Santo Andre, SP (Brazil). Centro de Engenharia, Modelagem e Ciencias Sociais Aplicadas
2017-07-01
The molten salt reactors (MSRs) make use of fluoride salt as primary cooler, at low pressure. Although considered a generation IV reactor, your concept isn't new, since in the 1960 years the Oak Ridge National Laboratory created a little prototype of 8MWt. Over the 20{sup th} century, other countries, like UK, Japan, Russia, China and France also did research in the area, especially with the use of thorium as fuel. This goes with the fact that Brazil possess the biggest reserve of thorium in the world. In the center of nuclear engineering at IPEN is being created a study group connected to thorium reactors, which purpose is to investigate reactors using thorium to produce {sup 233}U and tailing burn, thus making the MSR using thorium as fuel, an object of study. This present work searches to do a general summary about the researches of MSR's, having as focus the utilization of thorium with the goal being to show it's efficiency and utilization is doable. (author)
International Nuclear Information System (INIS)
Iida, T.; Ikebe, Y.; Okamoto, K.; Guo, Q.; Yamasaki, T.
1996-01-01
A pair of passive cup monitors with a different air exchange openings was developed for measuring simultaneously 222 Rn and 220 Rn concentrations. Indoor 220 Rn concentrations were very high in traditional Japanese dwellings with soil walls. The 220 Rn concentration decreases exponentially with the distance from wall. The effective diffusion coefficient of 220 Rn in dwelling and the exhalation rate of 220 Rn from wall were evaluated from the distribution of the 220 Rn concentrations. Then, indoor 220 Rn progeny concentration could be estimated from the 220 Rn concentration at a 20 cm distance from wall. From the results of the surveys. the average annual effective dose equivalent due to 220 Rn progeny was expected to be 0.67 mSv/year in the traditional Japanese dwellings. (author)
DE-NE0000735 - FINAL REPORT ON THORIUM FUEL CYCLE NEUP PROJECT
Energy Technology Data Exchange (ETDEWEB)
Krahn, Steven [Vanderbilt Univ., Nashville, TN (United States); Ault, Timothy [Vanderbilt Univ., Nashville, TN (United States); Worrall, Andrew [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States)
2017-09-30
The report is broken into six chapters, including this executive summary chapter. Following an introduction, this report discusses each of the project’s three major components (Fuel Cycle Data Package (FCDP) Development, Thorium Fuel Cycle Literature Analysis and Database Development, and the Thorium Fuel Cycle Technical Track and Proceedings). A final chapter is devoted to summarization. Various outcomes, publications, etc. originating from this project can be found in the Appendices at the end of the document.
PRETREATING THORIUM FOR ELECTROPLATING
Beach, J.G.; Schaer, G.R.
1959-07-28
A method is presented for pretreating a thorium surface prior to electroplating the surface. The pretreatment steps of the invention comprise cleaning by vapor blasting the surface, anodically pickling in a 5 to 15% by volume aqueous hydrochloric acid bath with a current of 125 to 250 amp/sq ft for 3 to 5 min at room temperature, chemically pickling the surface in a 5 to 15% by volume of aqueous sulfuric acid for 3 to 5 min at room temperature, and rinsing the surface with water.
40 CFR 300.220 - Related Title III issues.
2010-07-01
... 40 Protection of Environment 27 2010-07-01 2010-07-01 false Related Title III issues. 300.220 Section 300.220 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) SUPERFUND, EMERGENCY... PLAN Planning and Preparedness § 300.220 Related Title III issues. Other related Title III requirements...
Doses from the use of welding electrodes alloyed with thorium oxide
International Nuclear Information System (INIS)
Stranden, E.
1980-01-01
In tungsten inert gas welding the electrodes are alloyed with 1-2% thorium oxide to improve the welding properties. This has been found to form an aerosol with average particle size of about 0.1 μm. Previously reported values for activity in air near the head and thorax of a welder are used to calculate the radiation dose from inhalation under both conservative and realistic conditions. These values are compared with the annual limit of intake (ALI) specified by the ICRP in 1979 for thorium 232 and thorium 230, giving a conservative estimate of 48% of the ALI and a realistic estimate of 7%. It is concluded that there is no reason to forbid the use of thoriom alloyed welding electrodes at present, but that the matter should be followed up, and the use of these electrodes limited as far as possible. (JIW)
International Nuclear Information System (INIS)
Kamei, Takashi
2011-01-01
Progressive economic growth as well as prodigious consumption of energy are expected among Asian countries. Nuclear power has myriad advantages, among them particularly being its status as a low carbon technology and therefore nuclear power would make a significant contribution to curtailing CO 2 emissions. However, the prospects for nuclear power are hindered by some unresolved problems: perceived adverse safety, environmental, and health effects; potential security risks stemming from proliferation; and unresolved challenges in long-term management of nuclear wastes. Thorium utilization as a nuclear fuel will serve as a cornerstone of circumventing such problems, because thorium produces less radioactive waste (i.e. less plutonium) and thus safety, which is of paramount concern, will be enhanced. The deployment of electric vehicles (EVs) as an alternative to supplant gasoline engine cars in the transportation network, will significantly contribute in the reduction of global CO 2 emissions. Rare-earth materials such as neodymium and dysprosium will be essential as a new material for electric automobiles. Thorium is often obtained as a by-product of rare-earth metals, but it is still not utilized as a nuclear fuel currently due to the lack of its own fissionable isotopes and as such, it cannot be employed in the production of nuclear weapons. Recent trends of nuclear disarmament and accumulation of plutonium from uranium fuel cycle can propel the deployment of thorium. The implementation capacity of thorium nuclear power is estimated to be about 392 GWe at 2050. The utilization of thorium will both help to provide clean energy and to supply rare-earth materials for clean automobiles. In order for us to effect the commercial deployment of thorium resources, establishment of an international framework to supply resources from developing countries as well as to supply technology from developed countries is indeed imperative. Herein, the author propose 'The Bank
International Nuclear Information System (INIS)
Guzman-Mar, J.L.; Aracely Hernandez-Ramirez; Lopez-Chuken, U.J.; Lopez-de-Alba, P.L.; Victor Cerda
2011-01-01
A fast and simple multisyringe flow injection analysis (MSFIA) method for routine determination of thorium in water samples was developed. The methodology was based on the complexation reaction of thorium with arsenazo (III) at pH 2.0. Thorium concentrations were spectrophotometrically detected at 665 nm. Under optimal conditions, Beer's law was obeyed over the range from 0.2 to 4.5 μg mL -1 thorium, a 3σ detection limit of 0.05 μg mL -1 , and a 10σ quantification limit of 0.2 μg mL -1 were obtained. The relative standard deviations (RSD, %) at 0.5, 2.5 and 4.5 μg mL -1 was 2.8, 1.5 and 0.8%, respectively (n = 10). It was found that most of the common metal ions and anions did not interfere with the thorium determination. The proposed method was successfully applied to its analysis in various water samples. (author)
Energy Technology Data Exchange (ETDEWEB)
Baeza, A. [Department of Physics, Faculty of Veterinary, University of Extremadura, Avda. Universidad s/n, 10071 Caceres (Spain)]. E-mail: ymiralle@unex.es; Guillen, J. [Department of Physics, Faculty of Veterinary, University of Extremadura, Avda. Universidad s/n, 10071 Caceres (Spain)
2006-09-15
The soil-mushroom transfer of thorium and uranium was analyzed in two ecologically similar but geographically separated Spanish ecosystems by means of the transfer factor, TF. Uranium TF values were in the range 0.043-0.49, and thorium TF values in the range 0.030-0.62. These values were similar to those of {sup 9}Sr, {sup 239+24}Pu, and {sup 241}Am found previously in the same ecosystems. Given the low availability of uranium and thorium, the available transfer factors, ATF, were also determined. These were higher than the TF values by one order of magnitude for {sup 234,238}U, and by 2-3 orders of magnitude for {sup 228,230,232}Th. The ATF value of thorium was similar to that of {sup 137}Cs, and that of uranium similar to that of {sup 4}K. Hebeloma cylindrosporum presented the highest uranium and thorium transfer factors, confirming this species as a good bioindicator of a soil's radioactive content.
International Nuclear Information System (INIS)
Ammerich, Marc; Frot, Patricia; Gambini, Denis-Jean; Gauron, Christine; Moureaux, Patrick; Herbelet, Gilbert; Lahaye, Thierry; Pihet, Pascal; Rannou, Alain; Vial, Eric
2013-12-01
This sheet belongs to a collection which relates to the use of radionuclides essentially in unsealed sources. Its goal is to gather on a single document the most relevant information as well as the best prevention practices to be implemented. These sheets are made for the persons in charge of radiation protection: users, radioprotection-skill persons, labor physicians. Each sheet treats of: 1 - the radio-physical and biological properties; 2 - the main uses; 3 - the dosimetric parameters; 4 - the measurement; 5 - the protection means; 6 - the areas delimitation and monitoring; 7 - the personnel classification, training and monitoring; 8 - the effluents and wastes; 9 - the authorization and declaration administrative procedures; 10 - the transport; and 11 - the right conduct to adopt in case of incident or accident. This sheet deals specifically with Thorium-232
The measurements of critical mass with uranium fuel elements and thorium rods
International Nuclear Information System (INIS)
Yao Zhiquan; Chen Zhicheng; Yao Zewu; Ji Huaxiang; Bao Borong; Zhang Jiahua
1991-01-01
The critical experiments with uranium elements and Thorium rods have been performed in zero power reactor at Shanghai Institute of Nuclear Research. The critical masses have been measured in various U/Th ratios. The fuels are 3% 235 U-enriched uranium. The Thorium rods are made from power of ThF 4 . Ratios of calculated values to experimental values are nearly constant at 0.995
Quantitative analysis of thorium-containing materials using an Industrial XRF analyzer
International Nuclear Information System (INIS)
Hasikova, J.; Titov, V.; Sokolov, A.
2014-01-01
Thorium (Th) as nuclear fuel is clean and safe and offers significant advantages over uranium. The technology for several types of thorium reactors is proven but still must be developed on a commercial scale. In the case of commercialization of thorium nuclear reactor thorium raw materials will be on demand. With this, mining and processing companies producing Th and rare earth elements will require prompt and reliable methods and instrumentation for Th quantitative on-line analysis. Potential applicability of X-ray fluorescence conveyor analyzer CON-X series is discussed for Th quantitative or semi-quantitative on-line measurement in several types of Th-bearing materials. Laboratory study of several minerals (zircon sands and limestone as unconventional Th resources; monazite concentrate as Th associated resources and uranium ore residues after extraction as a waste product) was performed and analyzer was tested for on-line quantitative measurements of Th contents along with other major and minor components. Th concentration range in zircon sand is 50-350 ppm; its detection limit at this level is estimated at 25- 50 ppm in 5 minute measurements depending on the type of material. On-site test of the CON-X analyzer for continuous analysis of thorium traces along with other elements in zircon sand showed that accuracy of Th measurements is within 20% relative. When Th content is higher than 1% as in the concentrate of monazite ore (5-8% ThO_2) accuracy of Th determination is within 1% relative. Although preliminary on-site test is recommended in order to address system feasibility at a large scale, provided results show that industrial conveyor XRF analyzer CON-X series can be effectively used for analytical control of mining and processing streams of Th-bearing materials. (author)
Alkaline autoclave leaching of refractory uranium-thorium minerals
International Nuclear Information System (INIS)
Milani, S. A.; Sam, S.
2011-01-01
This paper deals with the study of an innovative method for processing the Oman placer ores by alkaline leaching in ball mill autoclaves, where grinding and leaching of the refractory minerals take place simultaneously. This was followed by the selective separation of thorium and uranium from lanthanides by autoclave leaching of the hydroxide cake with ammonium carbonate-bicarbonate solutions. The introduced method is based on the fact that thorium and uranium form soluble carbonate complexes with ammonium carbonate, while lanthanides form sparingly soluble double carbonates. It was found that a complete alkaline leaching of Oman placer ores (98.0 P ercent ) was attained at 150 and 175 d egree C within 2.5 and 2h, respectively. Oman placer ores leaching was intensified and accelerated in a ball mill autoclaves as a result of the grinding action of steel balls, removal of the hydroxide layer covering ores grains and the continuous contact of fresh ore grains with alkaline solution. The study of selective carbonate processing of hydroxide cake with ammonium carbonate-bicarbonate solutions on autoclave under pressure revealed that the complete thorium recovery (97.5 P ercent ) with uranium recovery (90.8 P ercent ) and their separation from the lanthanides were attained at 70-80 d egree C during l-2h. The extraction of lanthanides in carbonate solution was low and did not exceed 4.6 P ercent .
7 CFR 220.1 - General purpose and scope.
2010-01-01
... 7 Agriculture 4 2010-01-01 2010-01-01 false General purpose and scope. 220.1 Section 220.1 Agriculture Regulations of the Department of Agriculture (Continued) FOOD AND NUTRITION SERVICE, DEPARTMENT OF AGRICULTURE CHILD NUTRITION PROGRAMS SCHOOL BREAKFAST PROGRAM § 220.1 General purpose and scope. This part...
Factorisation of RSA-220 with CADO-NFS
Bai , Shi; Gaudry , Pierrick; Kruppa , Alexander; Thomé , Emmanuel; Zimmermann , Paul
2016-01-01
We give details of the factorization of RSA-220 with CADO-NFS. This is a new record computation with this open-source software. We report on the factorization of RSA-220 (220 decimal digits), which is the 3rd largest integer factorization with the General Number Field Sieve (GNFS), after the factorization of RSA-768 (232 digits) in December 2009 [3], and that of 3 697 + 1 (221 digits) in February 2015 by NFS@home.
Distribution of thorium in soils surrounding the rare-earth tailings reservoir in Baotou, China
International Nuclear Information System (INIS)
Rou-yu Li; Sheng Chen; De-zhi Sun; Feng-chang Wu; Hai-qing Liao
2014-01-01
Thorium distribution was investigated in the soils surrounding the rare-earth (RE) tailings reservoir near the Baotou grassland of Inner Mongolia, northern China. Totally 77 soil samples were collected from 8 different directions in the periphery of the RE tailings reservoir, and then were determined for 232 Th. The 232 Th activity degree ranges from 9.1 to 307.1 Bq kg -1 with an average value of 42.4 Bq kg -1 . In some samples, the degree is higher than that of global average, showing that these soils were polluted by thorium. There is a high linear correlation coefficient between the thorium diffusion coefficient parameter and the wind intensity parameter which indicates that the distribution of 232 Th is mainly correlated with wind speed and direction. The geo-accumulation index method was used to evaluate the level of thorium pollution, and the Kriging method was applied to estimate the land area at each level. By calculation, result shows that the area at each pollution level is 2.10 km 2 with medium-strong pollution, 38.29 km 2 with medium pollution, and 47.19 km 2 with slight pollution. The remaining 738.63 km 2 of land investigated is clear from thorium pollution. (author)
The future role of thorium in assuring CANDU fuel supplies
International Nuclear Information System (INIS)
Slater, J.B.
1985-01-01
Atomic Energy of Canada Limited (AECL), in partnership with Canadian industry and power utilities, has developed the CANDU reactor as a safe, reliable and economic means of transforming nuclear fuel into useable power. The use of thorium/uranium-233 recycle gives the possibility of a many-fold increase in energy yield over that which can be obtained from the use of uranium in once-through cycles. The neutronic properties of uranium-233 combine with the inherent neutron economy of the CANDU reactor to offer the possibility of near-breeder cycles in which there is no net consumption of fissile material under equilibrium fuelling conditions. Use of thorium cycles in CANDU will limit the impact of higher uranium prices. When combined with the potential for significant reductions in CANDU capital costs, then the long-term prospect is for generating costs near to current levels. Development of thorium cycles in CANDU will safeguard against possible uranium shortages in the next century, and will maintain and continue the commercial viability of CANDU as a long-term energy technology. (author)
Photoluminescent nano-sized ternary and quaternary complexes of thorium(IV)
International Nuclear Information System (INIS)
Baranwal, B.P.; Jain, A.K.; Varma, A.; Singh, A.K.; Fatma, T.
2011-01-01
Some ternary and quaternary complexes of thorium(IV) with the general formula [Th(OOCCH 3 ) 2-n (SB) n (OOCC 15 H 31 ) 2 ] (HSB=Schiff bases and n=1 or 2) have been synthesized by the stepwise substitutions of acetate ions from thorium(IV) acetate, first with straight chain carboxylic acid and then with Schiff bases. The complexes are characterized by elemental analyses, spectral (electronic, infrared, 1 H NMR, FAB mass, photoluminescence and powder XRD) and TEM studies. Conductance measurements indicated non-conducting behaviour of the complexes. Structural parameters from powder XRD data for complexes 5 and 6 which indicate poorly crystalline nano-sized triclinic particles. Electronic absorption spectra of the complexes showed π → π * and n → π * charge transfer transitions. All complexes displayed fluorescence and a correlation was sought between luminescence spectra of complexes in solution at room temperature. On the basis of physico-chemical studies, coordination number 8 was assigned for thorium(IV) in the complexes. The morphology and microstructure of the complexes were examined with transmission electron microscopy (TEM) and the selected area electron diffraction (SAED). (orig.)
Two novel thorium organic frameworks constructed by bi- and tritopic ligands
Energy Technology Data Exchange (ETDEWEB)
Chen, Fei [National Institute for Radiological Protection, Beijing (China). China CDC Key Lab. of Radiological Pretection and Nuclear Emergency; Chinese Academy of Sciences, Beijing (China). Inst. of High Energy Physics; Wang, Congzhi; Lan, Jianhui; Chai, Zhifang [Chinese Academy of Sciences, Beijing (China). Inst. of High Energy Physics; Ji, Yanqin [National Institute for Radiological Protection, Beijing (China). China CDC Key Lab. of Radiological Pretection and Nuclear Emergency
2017-09-01
Two thorium organic frameworks, Th(BDC){sub 2} and Th(OH)(BCPBA) have been hydrothermally synthesized using 1,4-benzenedicarboxylic acid (H{sub 2}BDC) and 3,5-bi(4-carboxyphenoxy)benzoic acid (H{sub 3}BCPBA), respectively. The obtained two compounds were determined by single-crystal XRD, and they exhibited two new topologies. Th(BDC){sub 2} shows a 3-dimensional (4,4,8)-connected framework with the Schlaefli symbol of (4{sup 14}.6{sup 12}.8{sup 2})(4{sup 2}.6{sup 3}.8)(4{sup 4}.6{sup 2}), and it is a mononuclear thorium(IV) complex. Th(OH)(BCPBA) possesses a (4,6)-connected topology with the Schlaefli symbol of (4{sup 15}){sup 2}(4{sup 6}){sup 3}, and it has a dinuclear thorium(IV) asymmetric unit with the shortest Th-Th distances. Viewing along suitable directions, channels with different shapes can be found in the obtained two frameworks. Based on calculation with PLATON, the amount of void space is 21.9% and 13.5% in Th(BDC){sub 2} and Th(OH)(BCPBA), respectively. Density functional theory (DFT) studies revealed that the metal-ligand interactions were mainly of ionic character in both compounds and the hydroxyl ions might play an important role in the stability of dinuclear thorium(IV) of Th(OH)(BCPBA).
Geochemistry of Thorium and Uranium in Soils of the Southern Urals
Asylbaev, I. G.; Khabirov, I. K.; Gabbasova, I. M.; Rafikov, B. V.; Lukmanov, N. A.
2017-12-01
Specific features of the horizontal and vertical distribution of uranium and thorium in soils and parent materials of the Southern Urals within the Bashkortostan Republic have been studied with the use of mass spectrometry with inductively coupled plasma. The dependence of distribution patterns of these elements on the local environmental conditions is shown. A scale for soil evaluation according to the concentrations of uranium and thorium (mg/kg) is suggested: the low level, up to 3; medium, up to 9; high, up to 15; and very high, above 15 mg/kg. On the basis of to this scale, the ecological state of the soils is evaluated, and the schematic geochemical map of the region is compiled. The territory of Bashkortostan is subdivided into two parts according to the contents of radioactive elements in soils: the western part with distinct accumulation of uranium and the eastern part with predominant thorium accumulation. This finding supports the charriage (thrust fault) nature of the fault zone of the Southern Urals. The vertical distribution patterns of uranium and thorium in soils of the region are of the same character. The dependence between the contents of these two elements and rare-earth elements has been established. The results of this study are applied for assessing the ecological state of soils in the region.
International Nuclear Information System (INIS)
2015-03-01
Thorium, in combination with high enriched uranium, was used in all early high temperature reactors (HTRs). Initially, the fuel was contained in a kernel of coated particles. However, particle quality was low in the 1960s and early 1970s. Modern, high quality, tristructural isotropic (TRISO) fuel particles with thorium oxide and uranium dioxide (UO 2 ) had been manufactured since 1978 and were successfully demonstrated in irradiation and accident tests. In 1980, HTR fuels changed to low enriched uranium UO 2 TRISO fuels. The wide ranging development and demonstration programme was successful, and it established a worldwide standard that is still valid today. During the process, results of the thorium work with high quality TRISO fuel particles had not been fully evaluated or documented. This publication collects and presents the information and demonstrates the performance of thorium TRISO fuels.This publication is an outcome of the technical contract awarded under the IAEA Coordinated Research Project on Near Term and Promising Long Term Options for Deployment of Thorium Based Nuclear Energy, initiated in 2012. It is based on the compilation and analysis of available results on thorium TRISO coated particle performance in manufacturing and during irradiation and accident condition heating tests
Conceptual design study of small long-life PWR based on thorium cycle fuel
International Nuclear Information System (INIS)
Subkhi, M. Nurul; Su'ud, Zaki; Waris, Abdul; Permana, Sidik
2014-01-01
A neutronic performance of small long-life Pressurized Water Reactor (PWR) using thorium cycle based fuel has been investigated. Thorium cycle which has higher conversion ratio in thermal region compared to uranium cycle produce some significant of 233 U during burn up time. The cell-burn up calculations were performed by PIJ SRAC code using nuclear data library based on JENDL 3.3, while the multi-energy-group diffusion calculations were optimized in whole core cylindrical two-dimension R-Z geometry by SRAC-CITATION. this study would be introduced thorium nitride fuel system which ZIRLO is the cladding material. The optimization of 350 MWt small long life PWR result small excess reactivity and reduced power peaking during its operation
2010-04-01
... 24 Housing and Urban Development 1 2010-04-01 2010-04-01 false Action plan. 91.220 Section 91.220 Housing and Urban Development Office of the Secretary, Department of Housing and Urban Development..., evaluate and reduce lead-based paint hazards, reduce the number of poverty-level families, develop...
2010-07-01
... 40 Protection of Environment 18 2010-07-01 2010-07-01 false [Reserved] 86.220-94 Section 86.220-94 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) AIR PROGRAMS (CONTINUED) CONTROL OF... Year Gasoline-Fueled New Light-Duty Vehicles, New Light-Duty Trucks and New Medium-Duty Passenger...
24 CFR 220.804 - Insurance premiums.
2010-04-01
... 24 Housing and Urban Development 2 2010-04-01 2010-04-01 false Insurance premiums. 220.804 Section... and Obligations-Projects Insured Project Improvement Loans § 220.804 Insurance premiums. (a) First premium. The lender, upon the initial endorsement of the loan for insurance, shall pay to the Commissioner...
Kinetics of dissolution of thorium and uranium doped britholite ceramics
Energy Technology Data Exchange (ETDEWEB)
Dacheux, N., E-mail: nicolas.dacheux@univ-montp2.f [Groupe de Radiochimie, Institut de Physique Nucleaire d' Orsay, Bat. 100, Universite Paris-Sud-11, 91406 Orsay (France); Institut de Chimie Separative de Marcoule, UMR 5257 (Universite Montpellier 2/CNRS/CEA/ENSCM), Bat. 426, Centre de Marcoule, BP 17171, 30207 Bagnols sur ceze cedex (France); Du Fou de Kerdaniel, E. [Groupe de Radiochimie, Institut de Physique Nucleaire d' Orsay, Bat. 100, Universite Paris-Sud-11, 91406 Orsay (France); Clavier, N. [Groupe de Radiochimie, Institut de Physique Nucleaire d' Orsay, Bat. 100, Universite Paris-Sud-11, 91406 Orsay (France); Institut de Chimie Separative de Marcoule, UMR 5257 (Universite Montpellier 2/CNRS/CEA/ENSCM), Bat. 426, Centre de Marcoule, BP 17171, 30207 Bagnols sur ceze cedex (France); Podor, R. [Institut de Chimie Separative de Marcoule, UMR 5257 (Universite Montpellier 2/CNRS/CEA/ENSCM), Bat. 426, Centre de Marcoule, BP 17171, 30207 Bagnols sur ceze cedex (France); Institut Jean Lamour - Departement CP2S - Equipe 206, Faculte des Sciences et Techniques - Nancy Universite, BP 70239, 54506 Vandoeuvre les Nancy cedex (France); Aupiais, J. [CEA DAM DIF, 91297 Arpajon (France); Szenknect, S. [Institut de Chimie Separative de Marcoule, UMR 5257 (Universite Montpellier 2/CNRS/CEA/ENSCM), Bat. 426, Centre de Marcoule, BP 17171, 30207 Bagnols sur ceze cedex (France)
2010-09-01
In the field of immobilization of actinides in phosphate-based ceramics, several thorium and uranium doped britholite samples were submitted to leaching tests. The normalized dissolution rates determined for several pH values, temperatures and acidic media from the calcium release range from 4.7 x 10{sup -2} g m{sup -2} d{sup -1} to 21.6 g m{sup -2} d{sup -1}. Their comparison with that determined for phosphorus, thorium and uranium revealed that the dissolution is clearly incongruent for all the conditions examined. Whatever the leaching solution considered, calcium and phosphorus elements were always released with higher R{sub L} values than the other elements (Nd, Th, U). Simultaneously, thorium was found to quickly precipitate as alteration product, leading to diffusion phenomena for uranium. For all the media considered, the uranium release is higher than that of thorium, probably due to its oxidation from tetravalent oxidation state to uranyl. Moreover, the evaluation of the partial order related to proton concentration and the apparent energy of activation suggest that the reaction of dissolution is probably controlled by surface chemical reactions occurring at the solid/liquid interface. Finally, comparative leaching tests performed in sulphuric acid solutions revealed a significant influence of such media on the chemical durability of the leached pellets, leading to higher normalized dissolution rates for all the elements considered. On the basis of the results of chemical speciation, this difference was mainly explained in the light of higher complexion constants by sulfate ions compared to nitrate, chloride and phosphate.
Thorium, uranium and plutonium in human tissues of world-wide general population
International Nuclear Information System (INIS)
Singh, N.P.
1990-01-01
The results on the concentrations of thorium, uranium and plutonium in human tissues of world-wide general populations are summarized. The majority of thorium and uranium are accumulated in the skeleton, whereas, plutonium is divided between two major organs: the liver and skeleton. However, there is a wide variation in the fractions of plutonium in the liver and the skeleton of the different populations. (author) 44 refs.; 15 figs
Fuel-management simulations for once-through thorium fuel cycle in CANDU reactors
International Nuclear Information System (INIS)
Chan, P.S.W.; Boczar, P.G.; Ellis, R.J.; Ardeshiri, F.
1999-01-01
High neutron economy, on-power refuelling and a simple fuel bundle design result in unsurpassed fuel cycle flexibility for CANDU reactors. These features facilitate the introduction and exploitation of thorium fuel cycles in existing CANDU reactors in an evolutionary fashion. Detailed full-core fuel-management simulations concluded that a once-through thorium fuel cycle can be successfully implemented in an existing CANDU reactor without requiring major modifications. (author)
Analysis of Uranium and Thorium in Radioactive Wastes from Nuclear Fuel Cycle Process
International Nuclear Information System (INIS)
Gunandjar
2008-01-01
The assessment of analysis method for uranium and thorium in radioactive wastes generated from nuclear fuel cycle process have been carried out. The uranium and thorium analysis methods in the assessment are consist of Titrimetry, UV-VIS Spectrophotometry, Fluorimetry, HPLC, Polarography, Emission Spectrograph, XRF, AAS, Alpha Spectrometry and Mass Spectrometry methods. From the assessment can be concluded that the analysis methods of uranium and thorium content in radioactive waste for low concentration level using UV-VIS Spectrometry is better than Titrimetry method. While for very low concentration level in part per billion (ppb) can be used by Neutron Activation Analysis (NAA), Alpha Spectrometry and Mass Spectrometry. Laser Fluorimetry is the best method of uranium analysis for very low concentration level. Alpha Spectrometry and ICP-MS (Inductively Coupled Plasma Mass Spectrometry) methods for isotopic analysis are favourable in the precision and accuracy aspects. Comparison of the ICP-MS and Alpha Spectrometry methods shows that the both of methods have capability to determining of uranium and thorium isotopes content in the waste samples with results comparable very well, but the time of its analysis using ICP-MS method is faster than the Alpha Spectrometry, and also the cost of analysis for ICP-MS method is cheaper. NAA method can also be used to analyze the uranium and thorium isotopes, but this method needs the reactor facility and also the time of its analysis is very long. (author)
Data base for a CANDU-PHW operating on the thorium cycle
International Nuclear Information System (INIS)
1979-07-01
This report, prepared for INFCE, gives data for an extrapolated 1000 MW(e) CANDU-PHW design operating on various thorium cycles. In the reference cycle, the requirements for externally supplied fissile material are met using U-235, with the feed adjusted to provide a fuel burnup of approximately 30 000 MW.d/t(U). Two versions of the reference cycle are treated. In one, the U-235 is supplied in a highly enriched form (93 percent U-235 in uranium); in the other, the U-235 is supplied at a lower enrichment, such that the uranium present in the feed fuel is 'denatured'. The effects of varying the fuel burnup and the recycle delay time are discussed. Data are also given for thorium cycles using plutonium instead of U-235 to meet requirements for externally-supplied fissile material. The special case of 'self-sufficient equilibrium thorium cycles', which require no external source of fissile material for equilibrium operation, is also treated. (author)
Uranium-thorium fuel cycle in a very high temperature hybrid system
International Nuclear Information System (INIS)
Hernandez, C.R.G.; Oliva, A.M.; Fajardo, L.G.; Garcia, J.A.R.; Curbelo, J.P.; Abadanes, A.
2011-01-01
Thorium is a potentially valuable energy source since it is about three to four times as abundant as Uranium. It is also a widely distributed natural resource readily accessible in many countries. Therefore, Thorium fuels can complement Uranium fuels and ensure long term sustainability of nuclear power. The main advantages of the use of a hybrid system formed by a Pebble Bed critical nuclear reactor and two Pebble Bed Accelerator Driven Systems (ADSs) using a Uranium-Thorium (U + Th) fuel cycle are shown in this paper. Once-through and two step U + Th fuel cycle was evaluated. With this goal, a preliminary conceptual design of a hybrid system formed by a Graphite Moderated Gas-Cooled Very High Temperature Reactor and two ADSs is proposed. The main parameters related to the neutronic behavior of the system in a deep burn scheme are optimized. The parameters that describe the nuclear fuel breeding and Minor Actinide stockpile are compared with those of a simple Uranium fuel cycle. (author)
Coordination compounds of titanium, zirconium, tin, thorium and uranium
International Nuclear Information System (INIS)
Deshpande, S.G.; Jain, S.C.
1990-01-01
Reactions of isatin, furoic acid and picolinic acid have been carried out with titanium tetrachloride, tin tetrachloride, thorium tetrachloride, zirconyl chloride and uranyl nitrate. While 2:3(metal:ligand) type compounds of isatin have been obtained with Ti(IV) and Sn(IV), zirconium(IV), thorium(IV), and uranium(VI) do not react with the ligand under similar experimental conditions. Furoic acid (FAH) and picolinic acid(PicH) form various chloro furoates and picolinates when reacted with TiCl 4 , ZrOCl 2 and ThCl 4 , but do not react with SnCl 4 . The various compounds synthesised have been characterised on the basis of elemental analysis, infrared studies, conductivity and thermogravimetric measurements. (author). 1 tab., 10 refs
Winckler, G.; Serno, S.; Hayes, C.; Anderson, R. F.; Gersonde, R.; Haug, G. H.
2012-12-01
The Subarctic North Pacific is one of the three primary high-nutrient-low chlorophyll regions of the modern ocean, where the biological pump is relatively inefficient at transferring carbon from the atmosphere to the deep sea. The system is thought to be iron-limited. Aeolian dust is a significant source of iron and other nutrients that are essential for the health of marine ecosystems and potentially a controlling factor of the high-nutrient-low chlorophyll status of the Subarctic North Pacific. However, constraining the size of the dust flux to the surface ocean remains difficult. Here we apply two different approaches, based on surface sediment and water column samples, respectively, obtained during the SO202/INOPEX research cruise to the Subarctic North Pacific in 2009. We map the spatial patterns of Th/U isotopes, helium isotopes and rare earth elements across surface sediments from 37 multi-core core-top sediments across the Subarctic North Pacific. In order to deconvolve the detrital endmembers in regions of the North Pacific affected by volcanic material, IRD and hemipelagic input, we use a combination of trace elements with distinct characteristics in the different endmembers. This approach allows us to calculate the relative aeolian fraction, and in combination with Thorium230-normalized mass flux data, to quantify the dust supply. Secondly, we present an innovative approach to use paired Thorium-232 and Thorium-230 concentrations of upper-ocean seawater at 7 stations along the INOPEX track. Thorium-232 in the upper water column is dominantly derived from dissolution of aeolian dust, whereas Thorium-230 data provide a measure of the thorium removal from the surface waters and, thus, allow us to derive Thorium-232 fluxes. Combined with a mean Thorium-232 concentration in dust and estimate of the thorium solubility, the Thorium-232 flux can be translated in a dust flux to the surface ocean. Dust flux estimates for the Subarctic North Pacific will be
International Nuclear Information System (INIS)
Pichestapong, Pipat; Injareon, Uthaiwan
2007-08-01
Full text: Waste water from Rare Earth Research and Development Center (RRDC) was analyzed to determine uranium and thorium concentration using ICP spectrometry. RRDC processes monazite ore to separate uranium, thorium and rare earth elements from the ore. Water samples from the ditch surrounding the center and from the canal nearby were also analyzed. Matrix spike technique was applied in this analysis. It was found that the highest concentration of uranium and thorium in the waste water samples were 3028±11 and 439±7 ppb, respectively. The concentration of uranium and thorium in the waste water samples were higher than those in water samples from the ditch and canal
The resonance integral of thorium metal rods
Energy Technology Data Exchange (ETDEWEB)
Hellstrand, E; Weitman, J
1960-03-15
The resonance integral for thorium metal rods of different diameters has been determined by the activation method. The irradiations took place in the central channel of the reactor R1, where the energy dependence of the neutron flux had earlier been investigated with a fast chopper up to about 1 keV. The absolute calibration was made with gold as a standard. The true resonance integral for gold was taken from the literature as 1,500 {+-} 35 b. The experimental values for thorium were fitted to two alternative expressions with the following results: RI = (1.70 + 15.9{radical}(S/M)) {+-} 5.5%; RI 17.3{radical}(S/M + 0.06) {+-} 5.5 %. The measurements were made for S/M values in the range 0.14 - 0.87 cm{sup 2}/g. The main contribution to the margin of errors arises from the uncertainties in the cross sections used and in the correction for the departure of the neutron energy distribution from the 1/E form.
Phthalocyaninato complexes of thorium, protactinium and uranium
International Nuclear Information System (INIS)
Beck, O.F.
1985-01-01
For the preparation of Bis(phthalocyaninato)-actinoid(IV) complexes, AnPc 2 , a new optimizing synthesis procedure was developed, with which it was possible to prepare spectrally pure, that is, H 2 Pc-free, ThPc 2 , UPc 2 and the isostructurally similar 231 PaPc 2 .PaPc 2 . This was verified with the help of electron spectra, which were compared to preparations which were synthesized in another manner. The corresponding perfluorinated compounds were also produced for thorium and uranium by use of tetrafluorophthalic acid nitrile instead of phthalic acid nitrile as initial product. Electron and infrared spectra show the typical bands of the non-substituted complexes. By the attempt to produce a mono(phthalocyaninato)-thorium complex with the use of ThI 4 as initial material a pyridine-extracted pure ThPcI 2 (py) 2 was obtained with a typical mono(phthalocyaninato) complex electron spectrum, an extremely moisture sensitive compound which in water or acids decomposes and produces H 2 Pc. (orig./RB) [de
International Nuclear Information System (INIS)
Hudry, Damien; Griveau, Jean-Christophe; Apostolidis, Christos; Colineau, Eric; Rasmussen, Gert; Walter, Olaf; Wang, Di; Venkata Sai Kiran Chakravadhaluna; Courtois, Eglantine; Kubel, Christian
2014-01-01
One of the primary aims of the actinide community within nano-science is to develop a good understanding similar to what is currently the case for stable elements. As a consequence, efficient, reliable and versatile synthesis techniques dedicated to the formation of new actinide-based nano-objects (e.g., nano-crystals) are necessary. Hence, a 'library' dedicated to the preparation of various actinide based nano-scale building blocks is currently being developed. Nano-scale building blocks with tunable sizes, shapes and compositions are of prime importance. So far, the non-aqueous synthesis method in highly coordinating organic media is the only approach which has demonstrated the capability to provide size and shape control of actinide-based nano-crystals (both for thorium and uranium, and recently extended to neptunium and plutonium). In this paper, we demonstrate that the non-aqueous approach is also well adapted to control the chemical composition of the nano-crystals obtained when mixing two different actinides. Indeed, the controlled hot co-injection of thorium acetylacetonate and uranyl acetate (together with additional capping agents) into benzyl ether can be used to synthesize thorium/uranium mixed oxide nano-crystals covering the full compositional spectrum. Additionally, we found that both size and shape are modified as a function of the thorium/uranium ratio. Finally, the magnetic properties of the different thorium/uranium mixed oxide nano-crystals were investigated. Contrary to several reports, we did not observe any ferromagnetic behavior. As a consequence, ferromagnetism cannot be described as a universal feature of nano-crystals of non-magnetic oxides as recently claimed in the literature. (authors)
International Nuclear Information System (INIS)
Nilchi, A.; Shariati Dehaghan, T.; Rasouli Garmarodi, S.
2013-01-01
A simple and reliable method for rapid extraction and determination of uranium and thorium using octadecyl-bonded silica modified with Cyanex 302 is presented. Extraction efficiency and the influence of various parameters such as aqueous phase pH, flow rate of sample solution and amount of extractant has been investigated. The study showed that the extraction of uranium and thorium increase with increasing pH value and was found to be quantitative at pH 6; and the retention of ions was not affected significantly by the flow rate of sample solution. The extraction percent were found to be 89.55 and 86.27 % for uranium and thorium, respectively. The maximal capacity of the cartridges modified by 30 mg of Cyanex 302 was found to be 20 mg of uranium and thorium. The method was successfully applied to the extraction and determination of uranium and thorium in aqueous solutions. The percentage recovery of uranium and thorium in a number of natural as well as seawater samples of Iran were also investigated and found to be in the range of 85-95%. (author)
International Nuclear Information System (INIS)
Singh, N.P.; Zimmerman, C.J.; Lewis, L.L.; Wrenn, M.E.
1984-01-01
A radiochemical procedure for the simultaneous determination of uranium, thorium, and plutonium, in soft tissues has been developed. The weighed amounts of tissues, spiked with 232 U, 242 Pu, and 229 th tracers, are wet ashed. Uranium, thorium, and plutonium are coprecipitated with iron as hydroxides, dissolved in concentrated HCl and the acidity adjusted to 10 M. Uranium and plutonium are extracted into 20% TLA solution in xylene, leaving thorium in the aqueous phase. Plutonium is back-extracted by reducing to the trivalent state with 0.05 M NH 4 I solution in 8 M HCl, and uranium is back-extracted with 0.1 M HCl. Thorium is extracted into 20% TLA solution from 4 M HNO 3 and back-extracted with 10 M HCl. Uranium, thorium and plutonium are electrodeposited separately onto platinum discs and counted alpha-spectrometrically using surface barrier silicon diodes and a multichannel analyzer. The method was developed using bovine liver and applied to dog and human tissues. The mean radiochemical recoveries of these actinides in different organs were better than 70%. 6 references, 2 tables
Cations analysis by controlled potential coulometry. Pt. 2. Zirconium and thorium determination
International Nuclear Information System (INIS)
Harto Castano, A.; Sanchez Batanero, P.
1982-01-01
A controlled-potential coulometry method for determination of zirconium and thorium has been carried out. This method is based on the reduction of potassium ferricyanide in presence of zirconium and thorium ions in acidic media. Stoechiometric coefficients of the solid products have been determined by intensity-controlled coulometry and chemical analysis. Application range and accuracy of the coulometric method has been established and applied to determination of Zr(IV) and Th(IV) in ores [fr
Much cleaner nuclear energy from thorium
International Nuclear Information System (INIS)
Damveld, H.
1998-01-01
In Zaragoza, Spain, an experimental thorium reactor will be built, which can be an alternative for uranium reactors. A brief impression is given of activities in the Netherlands with respect to the so-called Energy Amplifier (EA), which is a combination of a nuclear power plant and an accelerator. EA is the idea of C. Rubbia of CERN in Geneva, Switzerland
Utilization of thorium in PWR type reactors
International Nuclear Information System (INIS)
Correa, F.
1977-01-01
Uranium 235 consumption is comparatively evaluated with thorium cycle for a PWR type reactor. Modifications are only made in fuels components. U-235 consumption is pratically unchanged in both cycles. Some good results are promised to the mixed U-238/Th-232 fuel cycle in 1/1 proportion [pt
Radioanalytical methods manual
International Nuclear Information System (INIS)
Chiu, N.W.; Dean, J.R.
1986-01-01
This Radioanalytical Methods manual is comprised of 12 chapters. It includes a review of the pertinent literature up to the end of 1982 pertaining to the measurement of the radioactive species listed under the terms of the contract. Included is methodology recommended for the decompositions of soils, tailings, ores, biological samples and air filters. Detailed analytical methodology for the measurement of gross alpha, gross beta, gross gamma, uranium, radium-226, radium-228, lead-210, thorium-232, thorium-230, thorium-228, total thorium, radon-222, radon-220 and radon-219 is presented
Energy Technology Data Exchange (ETDEWEB)
He, Heming [Chemistry Division, Los Alamos National Laboratory, Los Alamos, NM 87545 (United States); Majewski, Jaroslaw, E-mail: jarek@lanl.gov [MPA/CINT/Lujan Neutron Scattering Center, Los Alamos National Laboratory, Los Alamos, NM 87545 (United States); Department of Chemical Engineering, University of California Davis, Davis, CA 95616 (United States); Allred, David D., E-mail: dda@byu.edu [Department of Physics and Astronomy, Brigham Young University Provo, UT 84602 (United States); Wang, Peng [MPA/CINT/Lujan Neutron Scattering Center, Los Alamos National Laboratory, Los Alamos, NM 87545 (United States); Wen, Xiaodong [Theoretical Division, Los Alamos National Laboratory Los Alamos, NM 87545 (United States); Rector, Kirk D. [Chemistry Division, Los Alamos National Laboratory, Los Alamos, NM 87545 (United States)
2017-04-15
Oxidation of a ∼1000 Å sputter-deposited thorium thin film at 150 °C in 100 ppm of flowing oxygen in argon produces the long-sought solid form of thorium monoxide. Changes in the scattering length density (SLD) distribution in the film over the 700-min experiment measured by in-situ, dynamic neutron reflectometry (NR) shows the densities, compositions and thickness of the various thorium oxides layers formed. Screened, hybrid density-functional theory calculations of potential thorium oxides aid interpretation, providing atomic-level picture and energetics for understanding oxygen migration. NR provided evidence of the formation of substoichiometric thorium oxide, ThO{sub y} (y < 1) at the interface between the unreacted thorium metal and its dioxide overcoat which grows inward, consuming the thorium at a rate of 2.1 Å/min while y increases until reaching 1:1 oxygen-to-thorium. Its presence indicates that kinetically-favored solid-phase ThO can be preferentially generated as a majority phase under the thermodynamically-favored ThO{sub 2} top layer at conditions close to ambient. - Highlights: •The long-sought solid form of thorium monoxide forms as thin-film thorium oxidizes. •Density-functional calculations suggest that ThO forms for kinetic reasons. •A pathway to producing ThO as a majority phase for future studies is now open. •Dynamic, in-situ neutron reflectometry is valuable for studying oxidation. •At low oxygen content in the lattice octahedral sites are preferred.
International Nuclear Information System (INIS)
Ramanujam, A.; Dhami, P.S.; Gopalakrishnan, V.; Mukherjee, A.; Dhumwad, R.K.
1989-01-01
A sequential precipitation technique is reported for the separation of uranium and thorium present in the uranium product stream of a single cycle 5 per cent TBP Thorex Process. It involves the precipitation of thorium as oxalate in 1M HNO 3 medium at 60-70degC and after filtration, precipitation of uranium as ammonium diuranate at 80-90degC from the oxalate supernatant. This technique has several advantages over the ion-exchange process normally used for treating these products. In order to meet the varying feed conditions, this method has been tested for feeds containing 10 g/1 uranium and 1-50 g/1 thorium in 1-6M HNO 3 . Various parameters like feed acidities, uranium and thorium concentrations, excess oxalic acid concentrations in the oxalate supernatant, precipitation temperatures, precipitate wash volumes etc. have been optimised to obtain more than 99 per cent recovery of thorium and uranium as their oxides with less than 50 ppm uranium losses to ammonium diuranate filtrate. The distribution patterns of different fission products and stainless steel corrosion products during various steps of this procedure have also been studied. For simulating the actual Thorex plant scale operation, experiments have been conducted with 25g and 100g lots of uranium per batch. (author). 6 tabs., 8 figs., 22 refs
Kinetic study of the thorium phosphate - diphosphate dissolution
International Nuclear Information System (INIS)
Dacheux, N.; Thomas, A.C.; Brandel, V.; Genet, M.
2000-01-01
The thorium phosphate-diphosphate Th 4 (PO 4 ) 4 P 2 O 7 (TPD) structure allows the replacement of large amounts of thorium by tetravalent actinides leading to the formation of solid solutions. This compound was obtained in powdered or sintered form after pressing at room temperature at 300-800 MPa then heating at 1250 deg. C for 10-30 hours. The resistance of this material to aqueous corrosion was determined by varying several parameters such as surface, leaching flow, acidity or temperature. It was thus possible to independently determine the influence of each parameter on the leaching rate provided that the saturation of the solution was not obtained. In acidic media, the partial order related to [H 3 O + ] was found to be in the 0.31-0.35 range while, in basic media, the partial order related to [OH - ] was almost the same (0.45). The activation energy (42 kJ/mol) was determined between 4 deg. C and 120 deg. C. Moreover, the addition of phosphate in the leachate slightly increased the TPD dissolution rate. When the saturation of the solution is reached, a gelatinous precipitate controls the thorium and phosphate concentrations. The complete characterization of this solid led to the proposed general formula Th 2 (PO 4 ) 2 (HPO 4 ). n H 2 O which conventional solubility product (at I = 0 M) is very low: K * S,0 10 -66.6±1.2 even in very acidic media. (authors)
Contributions to the thorium occupational exposure in Brazil
International Nuclear Information System (INIS)
Cunha, Kenya Moore de Almeida Dias da
1997-01-01
There are around 15.000 workers in Brazil involved in the mining and milling processes of thorium bearing minerals. It is necessary to estimate the exposure of workers to airborne particulate containing thorium to estimate the risk associated with the inhalation of aerosols. The aims of this study were: - to develop a national cascade impactor and - to characterize the exposure of workers to airborne particulate containing Th in two plants and one industry that were chosen. Plant A and Pant B process niobium ore and industry C uses thorium nitrate to manufacture gas mantle. The national cascade impactor - ICN was developed to collect particulate in the range of 0,64 up to 19,4 μm. Its advantage over commercially available cascade impactors is the selections of particulate in the respirable and inhalable fractions of aerosol. The experimental calibration of the ICN agreed with the theoretical calibration. The results obtained with the ICN were compared to the ones obtained with other selective air samplers, in 3 plants. The particle size distribution and the Th mass concentration were determined in those plants. The size distribution of particulate containing Nb. U Zr, Pb. Fe, Y and Sr, and the elemental mass concentration was determined. A group of workers in installations B and C were also monitored through bioassay analysis of Th excreted in urine and feces. Air and bioassay results have shown that the systemic incorporation of Th is not significant. (author)
The Effective Resonance Integral of Thorium Oxide Rods
Energy Technology Data Exchange (ETDEWEB)
Weitman, J
1962-12-15
The effective resonance integral of thorium oxide rods has been determined as a function of their surface to mass ratio. The range of S/M values covered is 0.15 - 0.65 cm/g. An experimental technique based on the comparison of activities obtained in thermal and slowing-down neutron fluxes was employed. The shape of the resonance neutron spectrum was determined from measurements with a fast chopper and from calculations, permitting deduction of a correction factor which relates the experimental values to the ideal 1/E case. The results are summarized by the following expression: RI{sub ThO{sub 2}} (5.0 + 15.6{radical}(S/M{sub ThO{sub 2}})) {+-} 5% The main contribution to the margin of error arises from the uncertainties in the 1.5 % spectral correction applied in the 1.5 b '1/v' part deducted and in the 1520 b infinite dilution integral of gold, used as a standard. In order to compare the consistency of Dresner's first equivalence theorem and Nordheim's numerical calculations relative to our results, the resonance integral values for thorium metal rods obtained previously by Hellstrand and Weitman have been recalculated, using recent cross section and spectrum data. The new formula is Rl{sub Th} = (3.3 + 16.1{radical}(S/M{sub Th})) {+-} 5%. It differs from the old one mainly because of the proved non-1/v behaviour of the thorium cross section below the first resonance.
International Nuclear Information System (INIS)
Madane, N.S.; Mohite, B.S.
2011-01-01
A simple and selective spectrophotometric method has been developed for the extraction and separation of thorium(IV) from sodium salicylate media using Cyanex 272 in kerosene. Thorium(IV) was quantitatively extracted by 5 x 10 -4 M Cyanex 272 in kerosene from 1 x 10 -5 M sodium salicylate medium. The extracted thorium(IV) was stripped out quantitatively from the organic phase with 4.0 M hydrochloric acid and determined spectrophotometrically with arsenazo(III) at 620 nm. The effect of concentrations of sodium salicylate, extractant, diluents, metal ion and strippants has been studied. Separation of thorium(IV) from other elements was achieved from binary as well as multicomponent mixtures such as uranium(VI), strontium(II), rubidium(I), cesium(I), potassium(I), Sodium(I), lithium(I), lead(II), barium(II), beryllium(II) etc. Using this method separation and determination of thorium(IV) in geological and real samples has been carried out. The method is simple, rapid and selective with good reproducibility (approximately ±2%). (author)
Study on thorium removal from effluent by electrocoagulation
International Nuclear Information System (INIS)
Nath, Baidurjya; Swaroopa Lakshmi, Y.V.; Tiwari, S.K.; Setty, D.S.; Kalyanakrishnan, G.; Saibaba, N.
2015-01-01
Coagulation-flocculation, membrane separation and ion-exchange are traditional methods for treatment of radioactive wastewater generated primarily from the front end processes of the fuel cycle. Electrocoagulation presents a robust and novel alternative to conventional coagulation process. The present study involves the establishment of electrocoagulation as a treatment process for thorium bearing non-process effluents in batch mode. This involved an electrolytic reactor with iron electrodes. The non-process effluent was subjected to coagulation and floatation by Fe(II) ions dissolved from the anode with the resultant flocs floating on the surface after being captured by hydrogen gas bubbles generated at the cathode. The effect of various operational parameters like initial pH, residence time, current density and initial thorium concentration on the removal efficiency was investigated. Maximum decontamination factor obtained was of the order of 10 4 . (author)
A review of the uncertainties in internal radiation dose assessment for inhaled thorium
International Nuclear Information System (INIS)
Hewson, G.S.
1989-01-01
Present assessments of internal radiation dose to designated radiation workers in the mineral sands industry, calculated using ICRP 26/30 methodology and data, indicate that some workers approach and exceed statutory radiation dose limits. Such exposures are indicative of the need for a critical assessment of work and operational procedures and also of metabolic and dosimetric models used to estimate internal dose. This paper reviews past occupational exposure experience with inhaled thorium compounds, examines uncertainties in the underlying radiation protection models, and indicates the effect of alternative assumptions on the calculation of committed effective dose equivalent. The extremely low recommended inhalation limits for thorium in air do not appear to be well supported by studies on the health status of former thorium refinery workers who were exposed to thorium well in excess of presently accepted limits. The effect of cautious model assumptions is shown to result in internal dose assessments that could be up to an order of magnitude too high. It is concluded that the effect of such uncertainty constrains the usefulness of internal dose estimates as a reliable indicator of actual health risk. 26 refs., 5 figs., 3 tabs
International Nuclear Information System (INIS)
Nakamura, Yasushi; Kobayashi, Yoshio; Kakurai, Yousuke
1993-01-01
A method has been developed for determining the 0.01 ng g -1 level of uranium and thorium in aluminium and aluminium alloys by electrothermal vaporization (ETV)/ICP-MS. This method was found to be significantly interfered with any matrices or other elements contained. An ion-exchange technique was therefore applied to separate uranium and thorium from aluminium and other elements. It was known that uranium are adsorbed on an anion-exchange resin and thorium are adsorbed on cation-exchange resin. However, aluminium and copper were eluted with 6 M hydrochloric acid. Dissolve the sample with hydrochloric acid containing copper which was added for analysis of pure aluminium, and oxidize with hydrogen peroxide. Concentration of hydrochloric acid in the solution was adjusted to 6 M, and then passed the solution through the mixed ion-exchange resin column. After the uranium and thorium were eluted with 1 M hydrofluoric acid-0.1 M hydrochloric acid, the solution was evaporated to dryness. It was then dissolved with 1 M hydrochloric acid. Uranium and thorium were analyzed by ETV/ICP-MS using tungsten and molybdenum boats, respectively, since the tungsten boat contained high-level thorium and the molybdenum boat contained uranium. The determination limit of uranium and thorium were 0.003 and 0.005 ng g -1 , respectively. (author)
Sorption of Uranium(VI and Thorium(IV by Jordanian Bentonite
Directory of Open Access Journals (Sweden)
Fawwaz I. Khalili
2013-01-01
Full Text Available Purification of raw bentonite was done to remove quartz. This includes mixing the raw bentonite with water and then centrifuge it at 750 rpm; this process is repeated until white purified bentonite is obtained. XRD, XRF, FTIR, and SEM techniques will be used for the characterization of purified bentonite. The sorption behavior of purified Jordanian bentonite towards and Th4+ metal ions in aqueous solutions was studied by batch experiment as a function of pH, contact time, temperature, and column techniques at 25.0∘C and . The highest rate of metal ions uptake was observed after 18 h of shaking, and the uptake has increased with increasing pH and reached a maximum at . Bentonite has shown high metal ion uptake capacity toward uranium(VI than thorium(IV. Sorption data were evaluated according to the pseudo- second-order reaction kinetic. Sorption isotherms were studied at temperatures 25.0∘C, 35.0∘C, and 45.0∘C. The Langmuir, Freundlich, and Dubinin-Radushkevich (D-R sorption models equations were applied and the proper constants were derived. It was found that the sorption process is enthalpy driven for uranium(VI and thorium(IV. Recovery of uranium(VI and thorium(IV ions after sorption was carried out by treatment of the loaded bentonite with different concentrations of HNO3 1.0 M, 0.5 M, 0.1 M, and 0.01 M. The best percent recovery for uranium(VI and thorium(IV was obtained when 1.0 M HNO3 was used.
Investigation of colourless complexes of thorium, hafnium and zirconium
International Nuclear Information System (INIS)
Kiciak, S.; Stefanowicz, T.; Gontarz, H.; Swit, Z.
1980-01-01
The investigations conducted in the Institute of General Chemistry of Poznan Technical University in partial cooperation with Kharkhof Technical University related with thorium, hafnium and zirconium complexes are reviewed. (author)
Thorium molten-salt nuclear energy synergetics
International Nuclear Information System (INIS)
Furukawa, Kazuo
1989-01-01
One of the most practical and rational approaches for establishing the idealistic Thorium resource utilization program has been presented, which might be effective to solve the principal energy problems, concerning safety, proliferation and terrorism, resource, power size and fuel cycle economy, for the next century. The first step will be the development of Small Molten-Salt Reactors as a flexible power station, which is suitable for early commercialization of Th reactors not necessarily competing with proven Large Solid-Fuel Reactors. Therefore, the more detailed design works and practical R and D planning should be performed under the international cooperations soon, soundly depending on the basic technology established by ORNL already. R and D cost would be surprisingly low. This reactor(MSR) seems to be idealistic not only in power-size, siting, safety, safeguard and economy, but also as an effective partner of Molten-Salt Fissile Breeders(MSB) in order to establish the simplest and economical Thorium molten-salt breeding fuel cycle named THORIMS-NES in all over the world including the developing countries and isolated areas. This would be one of the most practical replies to the Lilienthal's appeal of 'A NEW START' in Nuclear Energy. (author)
Different periods of uranium and thorium occurrence in Madagascar (1960)
International Nuclear Information System (INIS)
Moreau, M.
1960-01-01
In Madagascar, the first typical occurrences of thorium and uranium are about 500 million years old. Previously thorium and uranium were rather concentrated in the granitic and charnockitic zones, chiefly in minerals such as monazite, apatite and zircon. At the end of the Precambrian period, metasomatic granites occur especially in the anticlinal series (Andriba orthite granite). The granitization is followed by the formation of the main pegmatitic areas in the Island with Th-U niobotantalates, uraninite and beryl. The pegmatites are well developed in the synclinal series with a poor migmatization or no migmatization at all. In the same time a large uranium and thorium province with uranothorianite deposits appears within the calcomagnesian series of the Southern part of Madagascar. Later, large amounts of monazite were carried down to the detritic Karroo sediments during tile erosion of the metamorphic precambrian rocks. Monazite has been concentrated again by frequent marine incursions, till the present time. In the medium Karroo, near Folakara, uranium minerals occur in direct relation with carbonaceous material. Finally we must note the uranium occurrence in the pleistocene carbonaceous shales of Antsirabe basin, in contact with crystalline rocks. (author) [fr
Energy Technology Data Exchange (ETDEWEB)
Cerles, J M
1973-03-15
In a previous report, it was shown that the Uranium cycle could be used as well with multi-hole block (GGA type) as with tubular elements. Now, in a F.S.V. geometry, a comparison is made between Thorium cycle and Uranium cycle. This comparison will be concerned with the physical properties of the materials, the needs of natural Uranium, the fissile material inventory and, at last, an attempt of economical considerations. In this report the cycle will be characterizd by the fertile material. So, we write ''Thorium cycle'' for Highly Enriched Uranium - Thorium cycle and ''Uranium cycle'' for low Enrichment Uranium cycle.
Point defects in thorium nitride: A first-principles study
Energy Technology Data Exchange (ETDEWEB)
Pérez Daroca, D., E-mail: pdaroca@tandar.cnea.gov.ar [Gerencia de Investigación y Aplicaciones, Comisión Nacional de Energía Atómica (Argentina); Consejo Nacional de Investigaciones Científicas y Técnicas (Argentina); Llois, A.M. [Gerencia de Investigación y Aplicaciones, Comisión Nacional de Energía Atómica (Argentina); Consejo Nacional de Investigaciones Científicas y Técnicas (Argentina); Mosca, H.O. [Gerencia de Investigación y Aplicaciones, Comisión Nacional de Energía Atómica (Argentina); Instituto de Tecnología Jorge A. Sabato, UNSAM-CNEA (Argentina)
2016-11-15
Thorium and its compounds (carbides and nitrides) are being investigated as possible materials to be used as nuclear fuels for Generation-IV reactors. As a first step in the research of these materials under irradiation, we study the formation energies and stability of point defects in thorium nitride by means of first-principles calculations within the framework of density functional theory. We focus on vacancies, interstitials, Frenkel pairs and Schottky defects. We found that N and Th vacancies have almost the same formation energy and that the most energetically favorable defects of all studied in this work are N interstitials. These kind of results for ThN, to the best authors' knowledge, have not been obtained previously, neither experimentally, nor theoretically.
Point defects in thorium nitride: A first-principles study
International Nuclear Information System (INIS)
Pérez Daroca, D.; Llois, A.M.; Mosca, H.O.
2016-01-01
Thorium and its compounds (carbides and nitrides) are being investigated as possible materials to be used as nuclear fuels for Generation-IV reactors. As a first step in the research of these materials under irradiation, we study the formation energies and stability of point defects in thorium nitride by means of first-principles calculations within the framework of density functional theory. We focus on vacancies, interstitials, Frenkel pairs and Schottky defects. We found that N and Th vacancies have almost the same formation energy and that the most energetically favorable defects of all studied in this work are N interstitials. These kind of results for ThN, to the best authors' knowledge, have not been obtained previously, neither experimentally, nor theoretically.
Decommissioning of nuclear facilities involving operations with uranium and thorium
International Nuclear Information System (INIS)
Shum, E.Y.; Neuder, S.M.
1990-01-01
When a licensed nuclear facility ceases operation, the U.S. Nuclear Regulatory Commission (NRC) ensures that the facility and its site are decontaminated to acceptable levels so they may safely be released for unrestricted public use. Because specific environmental standards or broad federal guidelines governing release of residual radioactive contamination have not been issued, NRC has developed ad hoc cleanup criteria for decommissioning nuclear facilities that involved uranium and thorium. Cleanup criteria include decontamination of buildings, equipment, and land. We will address cleanup criteria and their rationale; procedures for decommissioning uranium/thorium facilities; radiological survey designs and procedures; radiological monitoring and measurement; and cost-effectiveness to demonstrate compliance
Thorium determination in water and biological materials by fission track
International Nuclear Information System (INIS)
Melo Ferreira, A.C. de.
1989-01-01
As a segment of a research programme on the study of bioaccumulation of radionuclides, in animals and vegetables from Morro do Ferro, Pocos de Caldas, MG, a fission track method for the determination of low levels of thorium in environmental samples was developed as an alternative for alpha spectroscopy. The study was carried out in early alpha spectroscopy samples, containing high levels of 228 Th activity, which makes difficult the 232 Th determination. A dry way method for thorium evaluation was developed. Pieces of membrane filters, containing La F 3 (Th), coupled to Makrofol detectors, were irradiated in the core of a research reactor, IEA-R1 (IPEN). (author)
Construction and characterization of the TL/TH thorium calibration pads
International Nuclear Information System (INIS)
Steele, W.D.
1987-09-01
The Technical Measurements Center (TMC) was established and was tasked with developing and/or recommending measurement methods for use in support of remedial action programs. Since one aspect of this technical support is the provision of calibration facilities for standardization of field measurements, four sets of thorium-232 enriched pads (two pads per set) were constructed for use by remedial action contractors in calibrating portable field instruments that are used to make direct, in-situ measurements of radium-226, thorium-232, and potassium-40. This report presents the design, construction, and characterization data of the eight calibration pads. 17 refs., 8 figs., 15 tabs
Determination of uranium and thorium isotopes by solid phase extraction and alpha spectrometry
International Nuclear Information System (INIS)
Kuruc, J.; Kovacova, M.; Strisovska, J.; Galanda, D.
2013-01-01
The aim of this work was to test the modified method suitable for the separation of isotopes of uranium and thorium samples of rocks, including gold ore and gold concentrate using of extraction chromatography method, after digestion of the sample, concentrating, separate the isotopes of uranium and thorium isotopes to prepare sources for the measurement of alpha spectra. Samples of rocks, gold ore and gold concentrate were digered in microwave decomposition in the environment of hydrogen peroxide and concentrated nitric acid. For the separation of uranium and thorium the vacuum box with cartridges DGA Resin and Resin(R) UTEVA (Triskem International, France) was used. Both sorbents allow separation of uranium from thorium. The results confirmed that the both sorbents give the same results within expanded uncertainty. The mass activity of monitored uranium and thorium radioisotopes was determined by alpha spectrometry method. The yields of separation were determined using uranium-232 as a tracer radionuclide; the activity of 232 U was 0.1438 Bq. Alpha spectra were measured on the Alpha spectrometer EG and G ORTEC 576A with the software MAESTRO, MCA Emulator and Gamma Vision-32 for Windows, USA. Mass activities of radionuclides were converted to mass concentration of isotopes 238 U, 234 U, 232 Th, 230 Th and 228 Th. The highest concentration of 238 U was sampled in granodiorite (Tunnel S-XIV-2, southwards, mining of Cu ore, not working there since 1990), where m( 238 U) = (0.81 ± 0.09) mg kg -1 (DGA Resin) and m( 238 U) = (0.90 ± 0.09) mg kg -1 (UTEVA(R) Resin), as well as m( 232 Th) = (18.8 ± 1.7) mg kg -1 (DGA Resin) and m( 232 Th) = (17.8 ± 1.5) mg kg -1 (UTEVA(R) Resin). In other samples of rocks, gold ore and gold concentrates have specific masses of isotopes of uranium and thorium two-to ten-folds lower. It can be concluded that the rocks, gold ores and concentrates of gold from the 'Rozalia' mine contain lower concentrations of uranium several times against
Studies of the competition for thorium ion between chelating agents and bovine serum albumin
International Nuclear Information System (INIS)
Luo Meichu; Zhang Meizhen; Sun Meizhen; Chen Shijie
1995-01-01
Fourteen chelation agents (polyaminopolcarboxylate type--TTHA, DTPA, EDTA; phenolicpolycarboxylate type--811, 8102, 7601, 7602, 7603, 7616, 7711, 7724, 7803, 7804, 8307) were studied their competitive ability to mobilize the thorium with bovine serum albumin (BSA). The experimental results showed that the competitive ability of TTHA, 8102, 811 to chelate Thorium with BSA were the strongest, and EDTA was the worst in all chelating agents. The measured order of the competitive ability of chelators is basically consistent with animal experimental results in vivo. The parameter F is defined as the competitive ability of chelators. F is taken as a screening criterion for de-corporate thorium which is simple, quick and effective method in vitro
Once-through thorium fuel cycle evaluation for TVA's Browns Ferry-3 Boiling Water Reactor
International Nuclear Information System (INIS)
Hopkins, G.C.
1982-05-01
This report documents benchmark evaluations to test thorium lattice predictive methods and neutron cross sections against available data and summarizes specific evaluations of the once-through thorium cycle when applied to the Browns Ferry-3 BWR. It was concluded that appreciable uncertainties in thorium cycle nuclear data cloud the ability to reliably predict the fuel cycle performance and that power reactor irradiations of ThO 2 rods in BWRs are desirable to resolve uncertainties. Benchmark evaluations indicated that the ENDF/B-IV data used in the evaluations should cause an underprediction of U-233/ThO 2 fuel reactivity, and, therefore, the results of the preliminary evaluations completed under the program should be conservative
Energy Technology Data Exchange (ETDEWEB)
Korgaonkar, V. [Commissariat a l' Energie Atomique, Saclay (France). Centre d' Etudes Nucleaires
1967-10-01
The exchange of thorium and uranium between a strong base anion resin and a mixed water + ethanol solvent containing nitrate ions is studied. It is assumed that in the resin the thorium and uranium are fixed in the form of the complexes Th(NO{sub 3}){sub 6}{sup 2-} and UO{sub 2}(NO{sub 3}){sub 4}{sup 2-} in solution these elements are present in the form of complexes having the general formula: Th(NO{sub 3}){sub 6-n}{sup n-2} and UO{sub 2}(NO{sub 3}){sub 4-n}{sup n-2} It has been possible to deduce a law for the changes in the partition functions of thorium and uranium as a function of the concentrations of the various species in solution and of the complexing ion NO{sub 3}. From this has been deduced the optimum operational conditions for separating a mixture of these two elements. Finally, in these conditions, the influence of a few interfering ions has been studied: Ba, Bi, Ce, La, Mo, Pb, Zr. The method proposed can be used either as a preparation, or for the dosage of thorium by a quantitative separation. (author) [French] On etudie l'echange du thorium et de l'uranium entre une resine anion base forte et un solvant mixte eau + ethanol charge en ions nitrates. On a suppose que, dans la resine, le thorium et l'uranium sont fixes sous forme de complexes Th(NO{sub 3}){sub 6}{sup 2-} et UO{sub 2}(NO{sub 3}){sub 4}{sup 2-} en solution, ces elements sont engages dans des complexes de formule generale: Th(NO{sub 3}){sub 6-n}{sup n-2} and UO{sub 2}(NO{sub 3}){sub 4-n}{sup n-2} On a pu degager une loi de variation des coefficients de partage du thorium et de l'uranium en fonction des concentrations des diverses especes en solution et de l'anion complexant NO{sub 3}{sup -}. On en a deduit les conditions operatoires optimales necessaires pour separer les deux elements a partir de leurs melanges. Enfin, dans ces conditions, on a etudie l'influence de quelques elements genants: Ba, Bi, Ce, La, Mo, Pb, Zr. La methode preconisee peut etre
Energy Technology Data Exchange (ETDEWEB)
Monreal, Marisa J.; Seaman, Lani A.; Goff, George S.; Michalczyk, Ryszard; Morris, David E.; Scott, Brian L.; Kiplinger, Jaqueline L. [Los Alamos National Laboratory, Los Alamos, NM (United States)
2016-03-07
Two organometallic 1D infinite coordination polymers and two organometallic monometallic complexes of thorium diazide have been synthesized and characterized. Steric control of these self-assembled arrays, which are dense in thorium and nitrogen, has also been demonstrated: infinite chains can be circumvented by using steric bulk either at the metallocene or with a donor ligand in the wedge.
Evaluation of U-Zr hydride fuel for a thorium fuel cycle in an RTR concept
Energy Technology Data Exchange (ETDEWEB)
Lee, Kyung Taek; Cho, Nam Zin [Korea Advanced Institute of Science and Technology, Taejon (Korea, Republic of)
1999-12-31
In this paper, we performed a design study of a thorium fueled reactor according to the design concept of the Radkowsky Thorium Reactor (RTR) and evaluated its overall performance. To enhance its performance and alleviate its problems, we introduced a new metallic uranium fuel, uranium-zirconium hydride (U-ZrH{sub 1.6}), as a seed fuel. For comparison, typical ABB/CE-type PWR based on SYSTEM 80+and standard RTR-type thorium reactor were also studied. From the results of performance analysis, we could ascertain advantages of RTR-type thorium fueled reactor in proliferation resistance, fuel cycle economics, and back-end fuel cycle. Also, we found that enhancement of proliferation resistance and safer operating conditions may be achieved by using the U-ZrH{sub 1.6} fuel in the seed region without additional penalties in comparison with the standard RTR`s U-Zr fuel. 6 refs., 2 figs., 6 tabs. (Author)
The EC thematic network on the analysis of thorium and its isotopes in workplace materials
International Nuclear Information System (INIS)
Howe, A.M.; Bernot, C.; Woods, M.J.
2001-01-01
Accurate measurements of workplace exposure to 232 Th and its progeny are required to estimate internal radiation doses received by persons working with thorium-containing materials. However, a small intercomparison carried out in the mid-nineteen nineties raised doubts about the reliability of results obtained by methods available for measurement of thorium. An EC-funded thematic network was therefore established to bring together experts in the field of thorium analysis in order to coordinate research activity and identify best analytical practice, requirements for reference materials, etc. This network has now successfully completed its work programme, which included a survey to determine future research needs; a series of intercomparisons to test the performance of methods for measuring thorium in workplace materials, and a workshop held to promote best practice and transfer information to regulatory authorities and industry. Results of the work have been used to make various recommendations concerning future needs in this field. (author)
Evaluation of U-Zr hydride fuel for a thorium fuel cycle in an RTR concept
Energy Technology Data Exchange (ETDEWEB)
Lee, Kyung Taek; Cho, Nam Zin [Korea Advanced Institute of Science and Technology, Taejon (Korea, Republic of)
1998-12-31
In this paper, we performed a design study of a thorium fueled reactor according to the design concept of the Radkowsky Thorium Reactor (RTR) and evaluated its overall performance. To enhance its performance and alleviate its problems, we introduced a new metallic uranium fuel, uranium-zirconium hydride (U-ZrH{sub 1.6}), as a seed fuel. For comparison, typical ABB/CE-type PWR based on SYSTEM 80+and standard RTR-type thorium reactor were also studied. From the results of performance analysis, we could ascertain advantages of RTR-type thorium fueled reactor in proliferation resistance, fuel cycle economics, and back-end fuel cycle. Also, we found that enhancement of proliferation resistance and safer operating conditions may be achieved by using the U-ZrH{sub 1.6} fuel in the seed region without additional penalties in comparison with the standard RTR`s U-Zr fuel. 6 refs., 2 figs., 6 tabs. (Author)
Thorium fuel performance assessment in HTRs
Energy Technology Data Exchange (ETDEWEB)
Allelein, H.-J. [Forschungszentrum Jülich, D-52425 Jülich (Germany); RWTH Aachen, D-52072 Aachen (Germany); Kania, M.J.; Nabielek, H. [Forschungszentrum Jülich, D-52425 Jülich (Germany); Verfondern, K., E-mail: k.verfondern@fz-juelich.de [Forschungszentrum Jülich, D-52425 Jülich (Germany)
2014-05-01
Thorium as a nuclear fuel is receiving renewed interest, because of its widespread availability and the good irradiation performance of Th and mixed (Th,U) oxide compounds as fuels in nuclear power systems. Early HTR development employed thorium together with high-enriched uranium. After 1980, most HTR fuel systems switched to low-enriched uranium. After completing fuel development for AVR and THTR with BISO coated particles, the German program expanded efforts on a new program utilizing thorium and high-enriched uranium TRISO coated particles for advanced HTR concepts for process heat applications (PNP) and direct-cycle electricity production (HHT). The combination of LTI inner and outer pyrocarbon layers surrounding a strong, stable SiC layer greatly improved manufacturing conditions and the subsequent contamination and defective particle fractions in production fuel elements. In addition, this combination provided improved mechanical strength and a higher degree of solid fission product retention, not known previously with HTI-BISO coatings. The improved performance of the HEU (Th,U)O{sub 2} TRISO fuel system was successfully demonstrated in three primary areas of development: manufacturing, irradiation testing under normal operating conditions, and accident simulation testing. In terms of demonstrating performance for advanced HTR applications, the experimental failure statistic from manufacture and irradiation testing are significantly below the coated particle requirements specified for PNP and HHT designs at the time. Covering a range to 1300 °C in normal operations and 1600 °C in accidents, with burnups up to 13% FIMA and fast fluences to 8 × 10{sup 25} m{sup −2} (E > 16 fJ), the results exceed the design limits on manufacturing and operational requirements for the German HTR Modul concept, which were: <6.5 × 10{sup −5} for manufacturing; <2 × 10{sup −4} for normal operating conditions; and <5 × 10{sup −4} for accident conditions. These
Energy Technology Data Exchange (ETDEWEB)
Ghafar, M
1995-11-30
The thorium and neptunium (IV) phosphate complexes formation in acidic media has been investigated, essentially at the indicator`s level with {sup 227} Th, {sup 234} Th, {sup 235} Np and {sup 239} Np. Solvent extraction, a commonly used method for determining stability constants in solutions, was used with HDEHP in toluene. In order to get a better understanding of inorganic transparent gels formation in phosphoric aqueous solutions, the effect of the thorium concentration is also studied. Specific experimental conditions have been chosen in order to avoid the formation of chelate and hydrolysis in the aqueous solution. The equilibrium constants and stability constants are calculated, and the results are compared with literature. The results show that increasing the thorium concentration does not lead to polymer forms. refs., 42 figs., 19 tabs.
Radiation protection in thorium industry
International Nuclear Information System (INIS)
Moraes, A.
1977-01-01
The evaluation of radiation doses in a monazite processing plant (thorium production cycle) aiming to getting information on the exposure levels to beta and gamma radiation, is discussed. It is observed that, excluding places where monazite is stored,or during transportation, or in silos, or waste deposits, or in places where high activity materials are stored or treated, the externa exposure stay below the maximum pemissible limit. Some recommendations are made based on the results found and according to radiation protection standards
International Nuclear Information System (INIS)
Busron Masduki; Didiek Herhady, R.
2002-01-01
It was carried out thorium-uranium extraction using one stage mixer settler to investigate the influenced of salting out agent of nitric acid and nitric aluminium. The result of this experiment showed the salting out of agent for nitric aluminium of 0.5 M much more significantly increase the distribution coefficient of uranium, but not for the thorium. The distribution coefficient of thorium much more significantly increased after nitric aluminium addition ≥1.0 M. There was not any meaningly differences the waste volume between nitric acid and nitric aluminium in its utilization. Reductor agent of ion Fe 2+ for chromi and decontaminate agent for protactinium in feed extraction, did not any influences of thorium and uranium distribution coefficient. (author)
Potency of Thorium and Uranium in West Bangka Region
International Nuclear Information System (INIS)
Ngadenin; Heri Syaeful; Kurnia Setiawan Widana; Muhammad Nurdin
2014-01-01
Thorium and uranium in Bangka Island are mainly found in monazite mineral. In the geological point of view the monazite formed in S type granite, sandstones and alluvial deposits. In Bangka Barat where several S types granite and also alluvial deposits and this area considered as a potential area for monazite placer. S type granites are predicted as a source of monazite while alluvial deposits are considered as a dispersion place for deposition of monazite. The purpose of this study is to determine the geological information and to know the hypothetical potency of thorium and uranium resources in alluvial deposits. The methods used in this study are geological mapping, measurement of thorium and uranium contents in the rock, sampling of granite for petrographic analysis, sampling of heavy mineral in alluvial deposits for grain size analysis. Results of the research show that the lithology of West Bangka region composed of schist unit, meta-sandstone unit, granite intrusion, diabase intrusion, sandstone unit and alluvial deposits. Monazite is found in granite intrusion, sandstone unit and alluvial deposits. Evolving fault strand to northwest-southeast, northeast-southwest and west-east. The results of the grain size analysis of heavy mineral shows the average percentage of monazite in the heavy mineral is 6.34%. Other potential minerals contained in placer deposits are zircon 36.65%, ilmenite 19.67% and cassiterite 14.75%. (author)
Acid pressure leaching of a concentrate containing uranium, thorium and rare earth elements
International Nuclear Information System (INIS)
Lan Xinghua; Peng Ruqing.
1987-01-01
The acid pressure leaching of a concentrate containing rinkolite for recovering uranium, thorium and rare earth elements is described. The laboratory and the pilot plant test results are given. Under the optimum leaching conditions, the recovery of uranium, thorium and rare earth elements are 82.9%, 86.0% and 88.3% respectively. These results show that the acid pressure leaching process is a effective process for treating the concentrate
36 CFR 2.20 - Skating, skateboards, and similar devices.
2010-07-01
... 36 Parks, Forests, and Public Property 1 2010-07-01 2010-07-01 false Skating, skateboards, and similar devices. 2.20 Section 2.20 Parks, Forests, and Public Property NATIONAL PARK SERVICE, DEPARTMENT OF THE INTERIOR RESOURCE PROTECTION, PUBLIC USE AND RECREATION § 2.20 Skating, skateboards, and...
International Nuclear Information System (INIS)
Misdaq, M.A.; Bakhchi, A.; Ktata, A.; Koutit, A.; Lamine, J.; Ait nouh, F.; Oufni, L.
2000-01-01
A method based on using solid state nuclear track detectors (SSNTD) CR- 39 and LR-115 type II and calculating the probabilities for the alpha particles emitted by the uranium and thorium series to reach and be registered on these films was utilized for uranium and thorium contents determination in various geological samples. The distribution of uranium and thorium in different volcanic rocks has been investigated using the track fission method. In this work, the uranium and thorium contents have been determined in different volcanic rock samples by using CR-39 and LR-115 type II solid state nuclear track detectors (SSNTD). The mean critical angles of etching of the solid state nuclear track detectors utilized have been calculated. A petrographical study of the volcanic rock thin layers studied has been conducted. The uranium and thorium distribution inside different rock thin layers has been studied. The mechanism of inclusion of the uranium and thorium nuclei inside the volcanic rock samples studied has been investigated. (author)
Damahuri, Abdul Hannan Bin; Mohamed, Hassan; Aziz Mohamed, Abdul; Idris, Faridah
2018-01-01
The use of thorium as nuclear fuel has been an appealing prospect for many years and will be great significance to nuclear power generation. There is an increasing need for more research on thorium as Malaysian government is currently active in the national Thorium Flagship Project, which was launched in 2014. The thorium project, which is still in phase 1, focuses on the research and development of the thorium extraction from mineral processing ore. Thus, the aim of the study is to investigate other alternative TRIGA PUSPATI Reactor (RTP) core designs that can fully utilize thorium. Currently, the RTP reactor has an average neutron flux of 2.797 x 1012 cm-2/s-1 and an effective multiplication factor, k eff, of 1.001. The RTP core has a circular array core configuration with six circular rings. Each ring consists of 6, 12, 18, 24, 30 or 36 U-ZrH1.6 fuel rods. There are three main type of uranium weight, namely 8.5, 12 and 20 wt.%. For this research, uranium zirconium hydride (U-ZrH1.6) fuel rods in the RTP core were replaced by thorium (ThO2) fuel rods. Seven core configurations with different thorium fuel rods placements were modelled in a 2D structure and simulated using Monte Carlo n-particle (MCNPX) code. Results show that the highest initial criticality obtained is around 1.35101. Additionally there is a significant discrepancy between results from previous study and the work because of the large estimated leakage probability of approximately 21.7% and 2D model simplification.
36 CFR 220.7 - Environmental assessment and decision notice.
2010-07-01
... 36 Parks, Forests, and Public Property 2 2010-07-01 2010-07-01 false Environmental assessment and decision notice. 220.7 Section 220.7 Parks, Forests, and Public Property FOREST SERVICE, DEPARTMENT OF AGRICULTURE NATIONAL ENVIRONMENTAL POLICY ACT (NEPA) COMPLIANCE § 220.7 Environmental assessment and decision notice. (a) Environmental assessment...
Kinetic study of the thorium phosphate - diphosphate dissolution
Energy Technology Data Exchange (ETDEWEB)
Dacheux, N.; Thomas, A.C.; Brandel, V.; Genet, M. [Paris-11 Univ., 91 - Orsay (France). Inst. de Physique Nucleaire; Aupiais, J. [CEA/DAM-Ile de France, Dept. Analyse Surveillance Environnement, DASE, Service Radioanalyses Chimie Environnement, 91 - Bruyeres-Le-Chatel (France)
2000-07-01
The thorium phosphate-diphosphate Th{sub 4}(PO{sub 4}){sub 4}P{sub 2}O{sub 7} (TPD) structure allows the replacement of large amounts of thorium by tetravalent actinides leading to the formation of solid solutions. This compound was obtained in powdered or sintered form after pressing at room temperature at 300-800 MPa then heating at 1250 deg. C for 10-30 hours. The resistance of this material to aqueous corrosion was determined by varying several parameters such as surface, leaching flow, acidity or temperature. It was thus possible to independently determine the influence of each parameter on the leaching rate provided that the saturation of the solution was not obtained. In acidic media, the partial order related to [H{sub 3}O{sup +}] was found to be in the 0.31-0.35 range while, in basic media, the partial order related to [OH{sup -}] was almost the same (0.45). The activation energy (42 kJ/mol) was determined between 4 deg. C and 120 deg. C. Moreover, the addition of phosphate in the leachate slightly increased the TPD dissolution rate. When the saturation of the solution is reached, a gelatinous precipitate controls the thorium and phosphate concentrations. The complete characterization of this solid led to the proposed general formula Th{sub 2}(PO{sub 4}){sub 2}(HPO{sub 4}). n H{sub 2}O which conventional solubility product (at I = 0 M) is very low: K{sup *}{sub S,0} 10{sup -66.6{+-}}{sup 1.2} even in very acidic media. (authors)
20 CFR 220.132 - Physical exertion requirements.
2010-04-01
... 20 Employees' Benefits 1 2010-04-01 2010-04-01 false Physical exertion requirements. 220.132 Section 220.132 Employees' Benefits RAILROAD RETIREMENT BOARD REGULATIONS UNDER THE RAILROAD RETIREMENT... of walking and standing is often necessary in carrying out job duties. Jobs are sedentary if walking...
International Nuclear Information System (INIS)
You Jiannan
2000-01-01
A method for separation by CL-TBP levextrel resin and determination of trace thorium in uranium-containing waste water by fully-differential spectrophotometry is developed. In 4 mol/L HNO 3 medium, in presence of tartaric acid, CL-TBP levextrel resin is used for adsorption of thorium and separating from other elements. The thorium on the resin is stripped by 4 mol/L HCl, with oxalic acid and urea as screening agent, thorium forms red complex with arsenazo III. The maximum absorption of the complex is at 668 nm, and the molar absorptivity is 1.27 x 10 5 L/(mol·cm) . The complex can be steady for 2.5 h. By regulating micro-current of differential spectrophotometry, the method can realize determination with high precision. Sensitivity of this method increase 10 times than usual spectrophotometry. The relative standard deviation is better than +- 5% and recovery of thorium is 99%-107%
On the development of fast breeder reactors and the use of thorium in Brazil
International Nuclear Information System (INIS)
Ishiguro, Y.
1986-10-01
This work presents a discussion on the possibility of construction of fast breeder reactors in Brazil. It is specially concerned with the use of thorium which is abundant in our country. The main advantages of this projects are: develop fuel and reactor technology in Brazil, increase thorium research, demonstrate the safety of LMFBR and promote its public acceptance. (A.C.A.S.)
An extraction method of uranium 233 from the thorium irradiates in a reactor core
International Nuclear Information System (INIS)
Chesne, A.; Regnaut, P.
1955-01-01
Description of the conditions of separation of the thorium, of the uranium 233 and of the protactinium 233 in hydrochloric solution by absorption then selective elution on anion exchange resin. A precipitation of the thorium by the oxalic acid permits the recuperation of the hydrochloric acid which is recycled, the main, raw material consumed being the oxalic acid. (authors) [fr
A passive technique using SSNTDs for Estimation of thorium to uranium ratios in rocks
International Nuclear Information System (INIS)
Kenawy, M.A.; Sayyah, T.A.; Said, A.F.; Hafez, A.F.
2005-01-01
A passive technique using plastic nuclear track detectors (CR-39 and LR-115) is presented to estimate Th/U ratios and consequently the thorium and uranium content in granites taken from uranium exploration mines in Egyptian desert. The registration sensitivities of both CR-39 and LR-115 detector for close contact alpha-radiography uranium and thorium concentrations in ppm were computed
International Nuclear Information System (INIS)
Yang, S.K.; Tan, N.; Yan, X.M.; Chen, F.; Lin, Y.C.
2013-01-01
The adsorption of thorium(IV) from aqueous solution by mangrove endophytic fungus Fusarium sp. ZZF51 is studied by using a batch experiments. The parameters that affect the thorium(IV) sorption, such as solution pH, initial thorium(IV) concentration, contact time, and biomass dose, are discussed in detail. The maximum biosorption of thorium(IV) and the equilibrium sorption capacity are found to be 91 ± 1 % and 11.35 mg g -1 respectively at pH 3.0, contact time 20 min, initial thorium(IV) concentration 50 mg L -1 and non-living biomass dose 4.0 g L -1 . Kinetics data follow the pseudo-second-order model and equilibrium data agree with the Temkin isotherm model very well. FT-IR analysis indicates that hydroxyl and carbonyl groups play an important role in the biosorption process. (author)
Energy Technology Data Exchange (ETDEWEB)
Seneda, Jose Antonio
2006-07-01
Brazil has a long tradition in thorium technology, from mineral dressing (monazite) to the nuclear grade thorium compounds. The estimate reserves are 1200,000. ton of ThO{sub 2}. As a consequence from the work of thorium purification pilot plant at Instituto de Pesquisas Energeticas e Nucleares-CNEN/IPEN-SP, about 25 ton of a sludge containing thorium and rare earths was accumulated. It comes as a raffinate and washing solutions from thorium solvent extraction. This sludge, a crude hydroxide named RETOTER contains thorium, rare earths and minor impurities including the radiogenic lead-208, with abundance 88.34 %. This work discusses the results of the studies and main parameters for its recovery by anionic ion exchange technique in the hydrochloric system. The isotope abundance of this lead was analyzed by high resolution mass spectrometer (ICPMS) and thermoionic mass spectrometer (TIMS) and the data was used to calculate the thermal neutron capture cross section. The value of {sigma}{gamma}{sup 0} = 14.6{+-}0.7 mb was found, quite different from the {sigma}{gamma}{sup 0} = 174.2 {+-} 7.0 mb measure cross section for the natural lead. Preliminary study for the thorium and rare earths separation and recovery was discussed as well. (author)
Energy from thorium?! Reconnoitering a new possibility : FEA
van Klinken, J.
1998-01-01
The worldwide increasing energy consumption depends largely on fossil resources and is not sustainable. Section 1 starts with a reflection on this precarious situation as an introduction to a recently proposed possibility of a thorium-fueled sub-critical reactor driven by a proton accelerator. In