WorldWideScience

Sample records for thallium 210

  1. 210

    Science.gov (United States)

    Romańczyk, Grzegorz; Boryło, Alicja

    2017-02-01

    The results of the research indicated that the 210 Po activity concentration in sweat samples was between 0.22 ± 0.03 to 2.10 ± 0.15 mBq·g -1 d.w. The obtained results of the studies showed that smoking and eating fish led to higher activity concentrations of 210 Po in sweat in comparison to the control group. Statistical analysis of 210 Po activity concentrations in sweat samples showed significant differences between control, smoking, fish eating and age groups, while no significant differences was found for 210 Po between volunteers as far as gender is concerned. Copyright © 2016. Published by Elsevier Ltd.

  2. 210

    Science.gov (United States)

    Chuangao, Wang; Ruirui, Liu; Jinfeng, Li; Zhijun, Huang; Jingshun, Pan; Zhiping, Luo; Ling, Chen; Zhongwen, Wang; Ziqiang, Pan

    2017-05-01

    In this paper, the distribution of 210 Po after high temperature processes in six units of coal-fired power plants (CFPs) were evaluated. The coal, bottom ashes, fly ashes from electrostatic precipitators (ESP), and flue gases from stacks were sampled from four CFPs and analyzed for 210 Po contents. The results showed that 210 Po was mainly captured by the ESP, with little left in the bottom ash, and a small fraction of 210 Po was directly discharged into the environment through the stacks, accounting for 0.06%-0.6%, which was consistent with the reported data. It was also found that part of the 210 Po could not be accounted for in the mass balance analysis for the whole combustion process in CFPs, which was also in line with the reported data. The results obtained in this study provided essential basic data for environmental radiological risk analysis for CFPs. Copyright © 2017 Elsevier Ltd. All rights reserved.

  3. Extracorporeal treatment for thallium poisoning

    DEFF Research Database (Denmark)

    Ghannoum, Marc; Nolin, Thomas D; Goldfarb, David S

    2012-01-01

    The EXtracorporeal TReatments In Poisoning (EXTRIP) workgroup was formed to provide recommendations on the use of extracorporeal treatment (ECTR) in poisoning. To test and validate its methods, the workgroup reviewed data for thallium (Tl)....

  4. Usefulness of Thallium Scan for Differential Diagnosis of Breast Mass

    Energy Technology Data Exchange (ETDEWEB)

    Bae, Sang Kyun; Yum, Ha Yong; Lee, Chung Han; Choi, Kyung Hyun [Kosin University College of Medicine, Pusan (Korea, Republic of)

    1994-07-15

    The purpose of this study is to evaluate thallium scanning as a potential test in differentiating malignant from benign lesions of breast. Thirty-one female patients underwent thallium scan of the breast. After intravenous injection of 74-111 MBq(2-3 mCi)of thallium-201, anterior and lateral images were obtained. We compared thallium scans with pathological results. Of 11 patients with breast cancers, 10 cases (90.9%) were detected using thallium scan. Thallium scan obtained in one patient who had breast cancer but received several cycles of chemotherapy did not show thallium uptake. The smallest detectable cancer was 1.5 cm in diameter. In contrast, there is no thallium accumulation in breasts of 17 of 20 patients with benign disease (85%), Three cases of 13 fibrocystic disease show thallium uptake in their breast. In conclusion, thallium scan is an effective test in differentiating benign from malignant lesion.

  5. Thallium contamination of water in Canada

    Energy Technology Data Exchange (ETDEWEB)

    Cheam, V. [National Water Research Institute Branch, Burlington, ON (Canada). Aquatic Ecosystems Protection Research Branch

    2001-07-01

    A highly sensitive instrument, a Laser-Excited Atomic Fluorescence Spectrometer, has been developed to study thallium contamination in some important Canadian ecosystems from the Arctic (containing very low thallium concentration) to coal-related industries across Canada and even to the study of thallium toxicity in an invertebrate, Hyalella azteca. Overall, the data indicate that the coal power plants and mines contain higher thallium concentrations than the other ecosystems studied, and the eastern region has the highest Tl concentrations compared to other regions. The range of thallium concentration in ng/L for the Arctic snow and ice was between not detected and 8.4, for the Great Lakes waters 0.9 to 48, for pore waters 0.1 to 213, for western coal power plants and mines 0.1 to 1326, for central coal power plants 1.2 to 175, for eastern coal power plants and mines 0.2 to 23605, and for miscellaneous sites across Canada not detected to 4390 ng/L. Some of these high concentrations and those high ones reported in industrial wastewaters exceeded the chronic toxicity endpoints for Hyalella azteca mortality, growth and reproduction, and thus can cause serious distress to the environment. All data were integrated into a map of thallium distribution, the first one in Canada. Natural background level of thallium for the Arctic was estimated to be 0.02 to 0.03 pg/g.

  6. IRIS Toxicological Review of Thallium and Compounds ...

    Science.gov (United States)

    Thallium compounds are used in the semiconductor industry, the manufacture of optic lenses and low-melting glass, low-temperature thermometers, alloys, electronic devices, mercury lamps, fireworks, and imitation germs, and clinically as an imaging agent in the diagnosis of certain tumors. EPA's assessment of noncancer health effects and carcinogenic potential of thallium compounds was last prepared and added to the IRIS database between 1988 and 1990. The IRIS program is preparing an assessment that will incorporate current health effects information available for thallium and compounds, and current risk assessment methods. The IRIS assessment for thallium compounds will consist of a Toxicological Review and IRIS Summary. The Toxicological Review is a critical review of the physiochemical and toxicokinetic properties of a chemical, and its toxicity in humans and experimental systems. The assessment will present reference values for the noncancer effects of thallium compounds (RfD and Rfc), and a cancer assessment. The Toxicological Review and IRIS Summary have been subject to Agency review, Interagency review, and external scientific peer review. The final product will reflect the Agency opinion on the overall toxicity of thallium and compounds. EPA is undertaking an Integrated Risk Information System (IRIS) health assessment for thallium and compounds. IRIS is an EPA database containing Agency scientific positions on potential adverse human health effec

  7. Repeat thallium-201 SPECT in cerebral lymphoma.

    Science.gov (United States)

    Borggreve, F; Dierckx, R A; Crols, R; Mathijs, R; Appel, B; Vandevivere, J; Mariën, P; Martin, J J; De Deyn, P P

    1993-01-01

    The authors report on the contribution of Thallium-201 brain SPECT in the diagnosis and follow-up of a non-immunosuppressed patient, presenting with primary cerebral lymphoma. The tumoral process was at first not diagnosed on CT-scan, but Thallium-201 SPECT suggested a tumoral invasion. During corticosteroid treatment the tumor volume on CT-scan decreased, while on Thallium-201 SPECT there was an enhancement of the accumulation and an increasing tumor to non-tumor ratio. These scintigraphical findings more closely reflected the clinical course and the postmortem results.

  8. Thallium poisoning from maliciously contaminated food.

    Science.gov (United States)

    Meggs, W J; Hoffman, R S; Shih, R D; Weisman, R S; Goldfrank, L R

    1994-01-01

    Four young adults presented two days after one of them had received marzipan balls packaged in a box from an expensive candy manufacturer. Two ate one candy ball, while two others shared a third. The next day, variable gastrointestinal symptoms developed. On the third day, two patients developed painful paresthesiae of the hands and feet, an early but nonspecific clinical marker of thallium poisoning. A tentative diagnosis of thallium poisoning was made based on symptoms, and treatment was initiated. The remaining candies were radiographed. Metallic densities in the candies supported the diagnosis, and atomic absorption spectroscopy was used to quantitate thallium content. Each candy contained a potentially fatal dose. Five to seven days later, hypertension and tachycardia developed in the two patients who had ingested an entire candy. All patients developed alopecia but recovered without overt neurologic or other sequelae. While the diagnosis of thallium poisoning is often delayed until alopecia develops, an early diagnosis favors an effective treatment strategy.

  9. Thallium in mineral resources extracted in Poland

    Directory of Open Access Journals (Sweden)

    Bojakowska I.

    2013-04-01

    Full Text Available Thallium concentrations in primary mineral commodities extracted in Poland and processed in high temperatures were determined by ICP-MS method. Samples of hard and brown coal, copper-silver and zinclead ores, argillaceous and calcareous rocks of different genesis and age were analyzed. The highest thallium concentrations occur in the zinc-lead ores, the average content being of 52.1 mg/kg. The copper ores contain in average 1.4 mg/kg of thallium. Hard coals from the Upper Silesian Coal Basin display higher thallium content than those exploited in the Lublin Coal Basin. Brown coals from Turow deposit distinguish by much higher values, 0.7 mg/kg Tl, than those from huge Bełchatów and smaller Konin-Turek region deposits. Average thallium concentrations in clays used for ceramic materials are lower than 1 mg/kg, except of Mio-Pliocene Slowiany deposit. The average content of thallium in the studied limestone and dolomite raw materials for cement, lime, and metallurgical flux, and refractories is very low in comparison to the average amounts in the world carbonate rocks.

  10. Examining of Thallium in Cigarette Smokers.

    Science.gov (United States)

    Ghaderi, Amir; NasehGhafoori, Payam; Rasouli-Azad, Morad; Sehat, Mojtaba; Mehrzad, Fateme; Nekuei, Mina; Aaseth, Jan; Banafshe, Hamid Reza; Mehrpour, Omid

    2017-08-01

    Smoking is one of the sources of thallium which is considered as a toxic heavy metal. The aim of this study was to determine urinary thallium levels and related variables in smokers, compared to a control group. The study was conducted on 56 participants who had smoked continuously during the year before they were referred to Kashan Smoking Cessation Clinic. Fifty-three nonsmokers who were family members or friends of the smokers were selected as the control group. Urinary thallium was measured in both groups (n = 109) using atomic absorption spectrophotometry. The mean value (with SD) for urinary thallium in the smokers (10.16 ± 1.82 μg/L) was significantly higher than in the control group (2.39 ± 0.63 μg/L). There was a significant relationship between smoking duration and urinary thallium levels (P = 0.003). In a subgroup of smokers who was addicted to opium and opium residues (n = 9), the mean level of thallium (37.5 ± 13.09 μg/L) was significantly higher than in the other smokers (4.93 ± 4.45; P = 0.001). Multiple regression analysis showed opioid abuse, insomnia, and chronic obstructive pulmonary disease (COPD), together were strong predictors of urinary thallium levels in smokers. There was no significant difference in thallium level in hookah smokers (P = 0.299) or in those with COPD compared to other smokers (P = 0.375). Urinary thallium levels of smokers with clinical signs of depression, sleep disorders, memory loss, and sweating were higher than those of smokers without these signs. Since thallium, as other toxic metals is accumulated in the body, and cigarette smoking also involves carcinogenic exposures and health hazards for passively exposed people, the need for cigarette control policies is emphasized.

  11. Thallium-201 scintigraphy in unstable angina pectoris

    Energy Technology Data Exchange (ETDEWEB)

    Wackers, F.J.T.; Lie, K.I.; Liem, K.L.; Sokole, E.B.; Samson, G.; Van Der Schoot, J.B.; Durrer, D.

    1978-04-01

    Thallium-201 scintigraphy was performed during the pain free period in 98 patients with unstable angina. Scintiscans were positive in 39 patients, questionable in 27 patients and normal in 32 patients. Eighty-one patients responded favorably to treatment (group I). Seventeen patients had complicated courses (group II) and despite maximal treatment with propranolol either developed infarction (six patients) or continued to have angina necessitating coronary surgery (11 patients). In group I during the pain free period 26 of 81 patients had positive thallium-201 scans, whereas 20 patients had an abnormal ECG at that time; during angina 18 patients had transient ECG changes. In group II during the pain free period 13 of 17 patients had positive scans, whereas two patients had abnormal ECG at that time; during angina 12 patients showed transient ECG changes. The sensitivity to recognize group II was 76% for thallium-201 scintigraphy, 11% for ECG during the pain free period; 70% for ECG during angina; 94% for the combination of either positive scans or abnormal ECG. Thus, positive thallium-201 scans occur in patients with unstable angina, positive scans can be obtained during the pain free period, thallium-201 scans are more frequently positive in patients with complicated course.

  12. Thallium-201 uptake in a benign thymoma

    Energy Technology Data Exchange (ETDEWEB)

    Campeau, R.J.; Ey, E.H.; Varma, D.G.

    1986-07-01

    A 68-year-old woman was admitted with atypical angina. A chest radiograph showed an anterior mediastinal mass that was confirmed on CT. The mass was relatively avascular and separate from the heart and great vessels. She underwent stress thallium testing that demonstrated no exercise-induced ischemia; however, an abnormal focus of thallium activity was present in the anterior mediastinum on stress and redistribution images. Cardiac catheterization demonstrated a normal left ventriculogram, coronary arteries and thoracic aorta. Subsequent surgery and pathologic examination revealed the mass to be a benign thymoma arising in the right lobe of the thymus gland.

  13. Endogenous thiols enhance thallium toxicity

    Energy Technology Data Exchange (ETDEWEB)

    Montes, Sergio; Rios, Camilo [Instituto Nacional de Neurologia y Neurocirugia, ' ' Manuel Velasco Suarez' ' , Departamento de Neuroquimica, Mexico, D.F (Mexico); Soriano, Luz; Monroy-Noyola, Antonio [Universidad Autonoma del Estado de Morelos, Laboratorio de Neuroproteccion, Facultad de Farmacia, Cuernavaca, Morelos (Mexico)

    2007-10-15

    Either L-methionine (L-met) or L-cysteine (L-cys), given alone and in combination with Prussian blue (PB) was characterized as treatment against acute thallium (Tl) toxicity in rats. Animals were intoxicated with 32 mg/kg Tl acetate corresponding to rat LD{sub 50}. Antidotal treatments were administered during 4 days, as follows: (1) vehicle, (2) L-met 100 mg/kg i.p. twice a day, (3) L-cys 100 mg/kg i.p. twice a day, (4) PB 50 mg/kg oral, twice a day, (5) L-met + PB and (6) L-cys + PB. Mortality was as follows: control 50%; L-met 80%; L-cys 80%; PB 20%; L-met + PB 90% and L-cys + PB 100%. In a different experiment, using 16 mg/kg of Tl, tissue levels of this metal were analyzed. PB treatment statistically diminished Tl content in body organs and brain regions (P < 0.01). Whereas, separate treatments of L-met and L-cys failed to decrease Tl content in organs and brain regions; while its administration in combination with PB (L-met + PB and L-cys + PB groups) lowered Tl levels in body organs in the same extent as PB group. Results indicate that L-met and L-cys administered alone or in combination with PB should not be considered suitable treatments against acute Tl toxic effects because this strategy failed to prevent mortality and Tl accumulation in brain. (orig.)

  14. Thallium in fractions of soil formed on floodplain terraces.

    Science.gov (United States)

    Jakubowska, Monika; Pasieczna, Anna; Zembrzuski, Wlodzimierz; Swit, Zbigniew; Lukaszewski, Zenon

    2007-01-01

    Two soils formed on the floodplain terrace of a rivulet flowing through the zinc-lead ore exploration area polluted with thallium and one soil from a floodplain terrace of the reference area were investigated in terms of thallium distribution between soil fractions. Such type of soil is formed on river floodplain terraces next to the main river channel and its composition records the history of river pollution. A sequential extraction of soil according to the BCR protocol was performed with an additional initial stage of extraction with water. Apart from labile thallium, thallium entrapped in the residual parent matter was also determined. Thallium was determined by flow-injection differential-pulse anodic stripping voltammetry. In all three cases, the major fraction is thallium entrapped in parent matter. Top soil from the polluted area contains 49.3% thallium entrapped in the residual parent matter, the bottom soil contains 41% while the reference soil contains 80% in this fraction. The major part of labile thallium is located in the reducible fraction (27.7% of total thallium in the top soil, 27% in the bottom soil and 12.4% of the reference soil). Second in terms of significance is the fraction of oxidizable thallium. The top soil contains 12% of total thallium concentration, the bottom soil contains 19% of total concentration, while the reference soil contains 4.1% of total concentration. The acid soluble/exchangeable fraction of thallium has almost the same significance as the oxidizable fraction. The top soil contains 10.4% of the total concentration, while the bottom soil contains 12% of the total concentration. Water soluble thallium concentration is very small. Comparison of the top and the bottom soil show that thallium has not been transported from the river channel onto the floodplain terrace over a long period.

  15. Characteristics of photoconductivity in thallium monosulfide single ...

    Indian Academy of Sciences (India)

    journal of. March 2007 physics pp. 467–479. Characteristics of photoconductivity in thallium monosulfide single crystals. I M ASHRAF, H A ELSHAIKH and A M BADR. Physics Department ... pendencies of carrier lifetime on light intensity, applied voltage and temperature are also ..... 14, 797 (1935) (in Japanese). [10] A T ...

  16. Extraction separation of thallium (III) from thallium (I) with n-octylaniline.

    Science.gov (United States)

    Shilimkar, Tulshidas N; Anuse, Mansing A; Patil, Kesharsingh J

    2002-01-01

    A novel method is developed for the extraction separation of thallium(III) from salicylate medium with n-octylaniline dissolved in toluene as an extractant. The optimum conditions have been determined by making a critical study of weak acid concentration, extractant concentration, period of equilibration and effect of solvent on the equilibria. The thallium (III) from the pregnant organic phase is stripped with acetate buffer solution (pH 4.7) and determined complexometrically with EDTA. The method affords the sequential separation of thallium(III) from thallium(I) and also commonly associated metal ions such as Al(III), Ga(III), In(III), Fe(III), Bi(III), Sb(III) and Pb(II). It is used for analysis of synthetic mixtures of associated metal ions and alloys. The method is highly selective, simple and reproducible. The reaction takes place at room temperature and requires 15-20 min for extraction and determination of thallium(III).

  17. Thallium bromide iodide crystal acoustic anisotropy examination.

    Science.gov (United States)

    Mantsevich, S N

    2017-03-01

    Thallium bromide iodide crystal also known as KRS-5 is the well known material used in far infrared radiation applications for optical windows and lenses fabrication. The main advantage of this material is the transparency in wide band of wavelengths from 0.53 to 50μm. Despite such advantages as transparency and large acousto-optic figure of merit values, KRS-5 is rarely used in acousto-optics. Nevertheless this material seems to be promising for far infrared acousto-optic applications. The acoustic and acousto-optic properties of KRS-5 needed for the full use in optoelectronics are not well understood to date. In this paper the detailed examination of thallium bromide iodide crystal acoustic properties is presented. Copyright © 2016 Elsevier B.V. All rights reserved.

  18. Thallium and its contents in Remata carbonate rocks

    Directory of Open Access Journals (Sweden)

    Kondelová Marcela

    1996-09-01

    Full Text Available The article presents at first the list of thallium own minerals and its isomorphic content in other minerals, especially in Slovakian ore deposits. This trace element was found in numerous dolomite-rock samples from Remata massif near Handlová. An interesting level of Tl content was analyzed in nonsilicified rocks; the highest content of Tl (and Ag are along the E – W line of disturbance. The presence of thallium in some limonitic aggregates in close Kremnica-gold deposit indicate any continuous relation. Some similarities to type gold deposits Carlin ( USA are discussed, even if no gold and discrete thallium phases were in Remata determined yet.

  19. Tracing thallium contamination in soils using isotopes

    Science.gov (United States)

    Vaněk, Aleš; Grösslová, Zuzana; Mihaljevič, Martin; Ettler, Vojtěch; Trubač, Jakub; Teper, Leslaw; Cabala, Jerzy; Rohovec, Jan; Penížek, Vít; Zádorová, Tereza; Pavlů, Lenka; Holubík, Ondřej; Drábek, Ondřej; Němeček, Karel; Houška, Jakub; Ash, Christopher

    2017-04-01

    We report the thallium (Tl) isotope record in moderately contaminated soils, which have been historically affected by emissions from coal-fired power plants. Our findings clearly demonstrate that Tl of anthropogenic (high-temperature) origin with light isotope composition was deposited onto the studied soils, where heavier Tl (ɛ205Tl -1) naturally occurs. The results show a positive linear relationship (R2 = 0.71) between 1/Tl and the isotope record, as determined for all the soils and bedrocks, also indicative of binary Tl mixing between two dominant reservoirs. We also identified significant Tl isotope variations within the products from coal combustion and thermo-desorption experiments with local Tl-rich coal pyrite. Bottom ash exhibited the heaviest Tl isotope composition (ɛ205Tl 0), followed by fly ash (ɛ205Tl between -2.5 and -2.8) and volatile Tl fractions (ɛ205Tl between -6.2 and -10.3), suggesting partial Tl isotope fractionations. Despite the evident role of soil processes in the isotope redistribution, we demonstrate that Tl contamination can be traced in soils, and propose that the isotope data represent a possible tool to aid our understanding of post-depositional Tl dynamics in surface environments for the future. This research was supported by the Czech Science Foundation (grant no. 14-01866S and 17-03211S).

  20. Catalytic properties of Thallium-containing mesoporous silicas

    Directory of Open Access Journals (Sweden)

    A. Baradji

    2017-02-01

    Full Text Available The benzylation of benzene by benzyl chloride over a series of Thallium-containing mesoporous silicas with different Tl contents has been investigated. These materials (Tl-HMS-n have been characterized by chemical analysis, N2 adsorption/desorption isotherm and X-ray diffraction (XRD. The mesoporous Thallium-containing materials showed both high activity and high selectivity for the benzylation of benzene. More interesting is the observation that these catalysts are always active and selective for large molecules like naphthenic compounds such as methoxynaphthalene.

  1. A comparison of the clinical relevance of thallium201 and ...

    African Journals Online (AJOL)

    Thallium-201 is at present the radiotracer of choice for the clinical evaluation of myocardial blood flow. Although different technetium-99m-isonitrile agents have been synthesised recently, only 99mTc-melhoxyisobutyl-isonitrile (99mTc_MIBI) has proved to hold promise for clinical implementation. The myocardial distribution ...

  2. Een bepalingsmethode voor thallium in regenwater met behulp van voltammetrie

    NARCIS (Netherlands)

    Struijs; J.; Wolfs; P.M.; Esseveld; F.G.van

    1985-01-01

    In dit rapport wordt een bepalingmethode beschreven voor thallium in het nanogram/liter-gebied, waarbij gebruik wordt gemaakt van differentiele pulse-anodic stripping voltammetry (DPASV) aan de dunne kwikfilm. Met deze techniek blijkt het mogelijk om de concentratie van dit element rechtstreeks

  3. IRIS Toxicological Review of Thallium and Compounds (External Review Draft)

    Science.gov (United States)

    Thallium compounds are used in the semiconductor industry, the manufacture of optic lenses and low-melting glass, low-temperature thermometers, alloys, electronic devices, mercury lamps, fireworks, and imitation germs, and clinically as an imaging agent in the diagnosis of certai...

  4. Band-Structure of Thallium by the LMTO Method

    DEFF Research Database (Denmark)

    Holtham, P. M.; Jan, J. P.; Skriver, Hans Lomholt

    1977-01-01

    The relativistic band structure of thallium has been calculated using the linear muffin-tin orbital (LMTO) method. The positions and extents of the bands were found to follow the Wigner-Seitz rule approximately, and the origin of the dispersion of the bands was established from the canonical s...

  5. A Simple and Rapid Complexometric Determination of Thallium(III ...

    African Journals Online (AJOL)

    A simple, rapid and selective complexometric method is proposed for the determination of thallium(III), using mercaptoethane(EtSH) as demasking agent. The sample solution containing Tl(III) is first complexed with excess EDTA and the surplus EDTA is removed by titration at pH 5–6 with zinc sulphate solution using ...

  6. Selective Thallium (I Ion Sensor Based on Functionalised ZnO Nanorods

    Directory of Open Access Journals (Sweden)

    Z. H. Ibupoto

    2012-01-01

    Full Text Available Well controlled in length and highly aligned ZnO nanorods were grown on the gold-coated glass substrate by hydrothermal growth method. ZnO nanorods were functionalised with selective thallium (I ion ionophore dibenzyldiaza-18-crown-6 (DBzDA18C6. The thallium ion sensor showed wide linear potentiometric response to thallium (I ion concentrations ( M to  M with high sensitivity of 36.87 ± 1.49 mV/decade. Moreover, thallium (I ion demonstrated fast response time of less than 5 s, high selectivity, reproducibility, storage stability, and negligible response to common interferents. The proposed thallium (I ion-sensor electrode was also used as an indicator electrode in the potentiometric titration, and it has shown good stoichiometric response for the determination of thallium (I ion.

  7. A Simple and Rapid Complexometric Determination of Thallium(III ...

    African Journals Online (AJOL)

    NJD

    2005-10-08

    Oct 8, 2005 ... surplus EDTA is removed by titration at pH 5–6 with zinc sulphate solution using xylenol orange as indicator. ... Reproducible and accurate results are obtained in the concentration range 4–80 mg of thallium with a relative error ≤ ±0.6% .... soluble and stable 1:1 complex with Tl(I) so formed.22 This was.

  8. Thallium in the hydrosphere of south west England

    Energy Technology Data Exchange (ETDEWEB)

    Law, Sin [School of Geography, Earth and Environmental Sciences, University of Plymouth, Drake Circus, Plymouth PL4 8AA (United Kingdom); Turner, Andrew, E-mail: aturner@plymouth.ac.uk [School of Geography, Earth and Environmental Sciences, University of Plymouth, Drake Circus, Plymouth PL4 8AA (United Kingdom)

    2011-12-15

    Thallium is a highly toxic metal whose environmental concentrations, distributions and behaviour are not well understood. In the present study we measure the concentrations of Tl in filtered and unfiltered samples of rain, tap, river, estuarine and waste waters collected from south west England. Dissolved Tl was lowest (<20 ng L{sup -1}) in tap water, rain water, treated sewage and landfill effluents, estuarine waters, and rivers draining catchments of sandstones and shales. Concentrations up to about 450 ng L{sup -1} were observed in rivers whose catchments are partly mineralized and where metal mining was historically important, and the highest concentration ({approx}1400 ng L{sup -1}) was measured in water abstracted directly from an abandoned mine. Compared with other trace metals measured (e.g. As, Cd, Co, Cr, Cu, Ni, Pb, Zn), Tl has a low affinity for suspended particles and undergoes little removal by conventional (hydroxide precipitation) treatment of mine water. - Highlights: > Thallium concentrations have been measured in natural and waste waters from south west England. > Dissolved concentrations spanned three orders of magnitude and were highest in water from an abandoned mine. > Inputs associated with historical metal mine workings are the most important to the regional hydrosphere. - Concentrations of dissolved thallium in waters of south west England span two orders of magnitude and are greatest in water from an abandoned mine.

  9. Standardisation of 210Pb

    Science.gov (United States)

    Woods; Bowles; Jerome; de Lavison P; Lineham; Makepeace; Woodman; Woods

    2000-03-01

    The standardisation of 210Pb is complicated by the presence of the daughters, 210Bi and 210Po. In addition, the low energies of the beta emissions from 210Pb make it difficult to obtain high detection efficiencies in an atmospheric proportional counter and hence produce the need for large extrapolations with consequential large uncertainties when extrapolating to unit efficiency with the conventional 4pi(PC)-gamma-coincidence technique. In order to produce a reliable standardisation, it is necessary to remove the daughter products. A solution of 210Pb was therefore chemically separated from its daughters and then standardised using the conventional 4pi(LS)-gamma-coincidence technique. The low energy (46 keV) and low emission probability (4%) of the associated photon emissions effectively rules out the possibility of using ionisation chambers as secondary standard transfer instruments for this nuclide. A germanium spectrometer therefore was calibrated for this purpose using 241Am as a normalising agent. The results of this work are presented together with an analysis of the standardisation uncertainties that can be achieved in practice.

  10. Sodium dithionite as a selective demasking agent for the complexometric determination of thallium

    Directory of Open Access Journals (Sweden)

    PRAKASH SHETTY

    2005-11-01

    Full Text Available Sodium dithionite is proposed as a new demasking agent for the rapid and selective complexometric determination of thallium(III. In the presence of diverse metal ions, thallium (III was first complexed with excess EDTA and the surplus EDTAwas then titrated with a standard zinc sulphate solution at pH 5–6 (hexamine buffer using Xylenol Orange as the indicator. The EDTAequivalent to thallium was then released selectively with sodium dithionite and back titrated with a standard zinc sulphate solution as before. Reproducible and accurate results were obtained in the range 4–100 mg of thallium with a relative error of ±27 % and a coefficient of variation (n = 6 of not more than 0.30 %. The effects of various diverse ions were studied. The method was applied to the determination of thallium in its complexes and in alloys.

  11. [Efficiency of hemoperfusion on clearing thallium based on atomic absorption spectrometry].

    Science.gov (United States)

    Tian, Tian; Wang, Yongan; Nie, Zhiyong; Wang, Jiao; Peng, Xiaobo; Yuan, Ye; Li, Wanhua; Qiu, Zewu; Xue, Yanping; Xiong, Yiru

    2015-04-01

    To determine thallium in whole blood by atomic absorption detection method, and to investigate the eliminating effect of hemoperfusion (HP) for thallium in blood. The blood of Beagle dogs which had not exposed to thallium before were obtained for preparation of thallium nitrate ( TlNO3 )-containing solution in three concentrations according to the conversion formula based on animal weight and volume of blood. HP was performed in the simulated in vivo environment. The content of TlNO3 in blood of the next group was determined on the amount of TlNO3 for the last HP of the former dose group. Thallium quantity in different samples was measured with atomic absorption spectrometer blood samples before and after HP. Finally, the thallium concentration in blood was analyzed statistically. Thallium concentrations showed a good linear relationship in the range of 0-200 μg/L (r = 0.998 4). The intra-day precision (RSD) was lower than 4.913%, the intra-day recovery rate was 96.2%-111.9%; the inter-day precision (RSD) was lower than 7.502%, the inter-day recovery rate was 89.6%-105.2%. The concentration of thallium in blood was significantly reduced after HP per time in high, middle, and low dose groups [(453.43 ± 27.80) mg/L to (56.09 ± 14.44) mg/L in high dose group, F = 8.820, P = 0.003; (64.51 ± 13.60) mg/L to (3.19 ± 0.23) mg/L in middle dose group, F = 36.312, P = 0.000; (5.40 ± 0.98) mg/L to (0.38 ± 0.25) mg/L in low dose group, F = 46.240, P = 0.000 ]. The adsorption rate of four times of HP in high, middle and low dose group were (87.63 ± 2.48 )%, (95.06 ± 1.54 )% and (92.76 ± 4.87)%, respectively, without significant difference (F = 4.231, P = 0.070). The method for measuring thallium was established, and it shows a very stable, simple, sensitive for determination of thallium. HP can effectively remove thallium from blood. Thallium concentration can be reduced by 90% after four times of HP. HP is also effective even when thallium concentration is not high.

  12. 210Pb dating

    Science.gov (United States)

    Swarzenski, Peter W.

    2014-01-01

    Roughly fifty years ago, a small group of scientists from Belgium and the United States, trying to better constrain ice sheet accumulation rates, attempted to apply what was then know about environmental lead as a potential geochronometer. Thus Goldberg (1963) developed the first principles of the 210Pb dating method, which was soon followed by a paper by Crozaz et al. (1964), who examined accumulation history of Antarctic snow using 210Pb. Shortly thereafter, Koide et al. (1972, 1973) adapted this technique to unravel sediment deposition and accumulation records in deep-sea environments. Serendipitously, they chose to work in a deep basin off California, where an independent and robust age model had already been developed. Krishanswami et al. (1971) extended the use of this technique to lacustrine deposits to reconstruct depositional histories of lake sediment, and maybe more importantly, contaminant inputs and burial. Thus, the powerful tool for dating recent (up to about one century old) sediment deposits was established and soon widely adopted. Today almost all oceanographic or limnologic studies that address recent depositional reconstructions employ 210Pb as one of several possible geochronometers (Andrews et al., 2009; Gale, 2009; Baskaran, 2011; Persson and Helms, 2011). This paper presents a short overview of the principles of 210Pb dating and provides a few examples that illustrate the utility of this tracer in contrasting depositional systems. Potential caveats and uncertainties (Appleby et al., 1986; Binford, 1990; Binford et al., 1993; Smith, 2001; Hancock et al., 2002) inherent to the use and interpretation of 210Pb-derived age-models are also introduced. Recommendations as to best practices for most reliable uses and reporting are presented in the summary.

  13. Left ventricular dilatation and pulmonary thallium uptake after single-photon emission computer tomography using thallium-201 during adenosine-induced coronary hyperemia

    Energy Technology Data Exchange (ETDEWEB)

    Iskandrian, A.S.; Heo, J.; Nguyen, T.; Lyons, E.; Paugh, E. (Philadelphia Heart Institute, PA (USA))

    1990-10-01

    This study examined the implications of left ventricular (LV) dilatation and increased pulmonary thallium uptake during adenosine-induced coronary hyperemia. The lung-to-heart thallium ratio in the initial images was significantly higher in patients with coronary artery disease (CAD) than normal subjects; 0.48 +/- 0.16 in 3-vessel disease (n = 16), 0.43 +/- 0.10 in 2-vessel disease (n = 20), 0.43 +/- 0.08 in 1-vessel disease (n = 16) and 0.36 +/- 0.05 in normal subjects (n = 7) (p less than 0.001, 0.09 and 0.06, respectively). There was a significant correlation between the severity and the extent of the perfusion abnormality (determined from the polar maps) and the lung-to-heart thallium ratio (r = 0.51 and 0.52, respectively, p less than 0.0002). There was also a significant correlation between lung thallium washout and lung-to-heart thallium ratio (r = 0.42, p = 0.0009) and peak heart rate (r = -0.49, p less than 0.0001). The LV dilatation was mostly due to an increase in cavity dimension (30% increase) and to a lesser extent (6% increase) due to increase in LV size. (The cavity dimensions were measured from the short-axis slices at the midventricular level in the initial and delayed images). The dilation was seen in patients with CAD but not in the normal subjects. These changes correlated with the extent and severity of the thallium perfusion abnormality. Thus, adenosine-induced coronary hyperemia may cause LV dilation and increased lung thallium uptake on the basis of subendocardial ischemia.

  14. Early detection of restenosis after successful percutaneous transluminal coronary angioplasty by exercise-redistribution Thallium scintigraphy

    NARCIS (Netherlands)

    W. Wijns (William); P.W.J.C. Serruys (Patrick); J.H.C. Reiber (Johan); P.J. de Feyter (Pim); M.J.B.M. van den Brand (Marcel); M.L. Simoons (Maarten); P.G. Hugenholtz (Paul)

    1985-01-01

    textabstractThe value of exercise testing and thallium scintigraphy in predicting recurrence of angina pectoris and restenosis after a primary successful transluminal coronary angioplasty (PTCA) was prospectively evaluated. In 89 patients, a symptom-limited exercise electrocardiogram (ECG) and

  15. Oral zinc sulphate in treatment of patients with thallium poisoning: A clinical therapeutic trial

    Directory of Open Access Journals (Sweden)

    Ahmed A. Al-Mohammadi

    2011-06-01

    Full Text Available Thallium poisoning is usually associated with typical dermatological features simulating that of zinc deficiency. The aim of this study was to evaluate the role of oral zinc sulphate in the treatment of patients with thallium poisoning.Materials and methods: This clinical therapeutic trial study was conducted in Departments of Dermatology of Baghdad and Basrah Teaching Hospitals from February 2008 - February 2010, where a total of 37 patients with thallium poisoning were enrolled.A detailed history was taken from all patients and complete clinical examination was performed. All patients received zinc sulphate in a dose of 5 mg/kg three times a day few days before confirming the diagnosis of thallium poisoning. Thallium in urine had been measured using the colorimetric method and was positive in all patients. After confirming the diagnosis of thallium poisoning, thallium antidotes Prussian blue was given to 32 patients.Results: Age range of 37 patients was 5-33 (24±5.3 years. The dermatological findings were mainly: anagen hair loss affected the scalp and limbs. Also, dusky ecchymotic red dermatitis like rash was observed on the face and dorsum of hands and legs, while neurological manifestations were mainly of peripheral neuropathy, were reported in 21 (55% patients. All patients but two responded promptly to a trial of zinc sulphate within few days.Conclusion: Oral Zinc sulphate appears to be an effective and safe treatment for thallium poisoning particularly for skin and hair features and in reducing its lethal progression and complications. J Clin Exp Invest 2011;2(2:133-7

  16. Fate of Thallium(I) in Reverse Osmosis and Chlorinated Water Matrices

    Science.gov (United States)

    2014-02-01

    THALLIUM(I) IN REVERSE OSMOSIS AND CHLORINATED WATER MATRICES ECBC-TR-1127 Approved for public release; distribution is unlimited...3. DATES COVERED (From - To) Apr 2010 - Dec 2011 4. TITLE AND SUBTITLE Fate of Thallium(I) in Reverse Osmosis and Chlorinated Water Matrices... osmosis (RO) and RO water with added chlorine (RO-Cl) was measured using inductively coupled plasma optical emission spectroscopy (ICP-OES) for a period of

  17. {sup 210}Pb and {sup 210}Po in Finnish cereals

    Energy Technology Data Exchange (ETDEWEB)

    Turtiainen, Tuukka, E-mail: tuukka.turtiainen@stuk.f [STUK, Radiation and Nuclear Safety Authority, P.O. Box 14, 00881 Helsinki (Finland); Kostiainen, Eila, E-mail: eila.kostiainen@stuk.f [STUK, Radiation and Nuclear Safety Authority, P.O. Box 14, 00881 Helsinki (Finland); Hallikainen, Anja, E-mail: anja.hallikainen@evira.f [Finnish Food Safety Authority Evira, Mustialankatu 3, 00790 Helsinki (Finland)

    2011-05-15

    A survey was carried out on the activity concentrations of {sup 210}Pb and {sup 210}Po in cereal grains produced in Finland. The cereal species were wheat (Triticum aestivum), rye (Secale cereale), oats (Avena sativa) and barley (Hordeum vulgare), which account for 90% of the Finnish consumption of cereal products. The survey consisted of 18 flour and 13 unprocessed cereal samples and one hulled grain sample from 22 flour mills. According to the results, the mean {sup 210}Pb/{sup 210}Po concentrations in wheat grains, wheat flour, rye flour, oat grains and barley grains were 0.29, 0.12, 0.29, 0.36 and 0.36 Bq kg{sup -1}, respectively. Combined with the consumption rates of the products, we assess that the mean effective doses from {sup 210}Pb and {sup 210}Po in cereal products for the adult male and female population are 22 and 17 {mu}Sv per year, respectively.

  18. Thallium in the hydrosphere of south west England.

    Science.gov (United States)

    Law, Sin; Turner, Andrew

    2011-12-01

    Thallium is a highly toxic metal whose environmental concentrations, distributions and behaviour are not well understood. In the present study we measure the concentrations of Tl in filtered and unfiltered samples of rain, tap, river, estuarine and waste waters collected from south west England. Dissolved Tl was lowest (<20 ng L(-1)) in tap water, rain water, treated sewage and landfill effluents, estuarine waters, and rivers draining catchments of sandstones and shales. Concentrations up to about 450 ng L(-1) were observed in rivers whose catchments are partly mineralized and where metal mining was historically important, and the highest concentration (~1400 ng L(-1)) was measured in water abstracted directly from an abandoned mine. Compared with other trace metals measured (e.g. As, Cd, Co, Cr, Cu, Ni, Pb, Zn), Tl has a low affinity for suspended particles and undergoes little removal by conventional (hydroxide precipitation) treatment of mine water. Copyright © 2011 Elsevier Ltd. All rights reserved.

  19. Qualitative evaluation of coronary flow during anesthetic induction using thallium-201 perfusion scans

    Energy Technology Data Exchange (ETDEWEB)

    Kleinman, B.; Henkin, R.E.; Glisson, S.N.; el-Etr, A.A.; Bakhos, M.; Sullivan, H.J.; Montoya, A.; Pifarre, R.

    1986-02-01

    Qualitative distribution of coronary flow using thallium-201 perfusion scans immediately postintubation was studied in 22 patients scheduled for elective coronary artery bypass surgery. Ten patients received a thiopental (4 mg/kg) and halothane induction. Twelve patients received a fentanyl (100 micrograms/kg) induction. Baseline thallium-201 perfusion scans were performed 24 h prior to surgery. These scans were compared with the scans performed postintubation. A thallium-positive scan was accepted as evidence of relative hypoperfusion. Baseline hemodynamic and ECG data were obtained prior to induction of anesthesia. These data were compared with the data obtained postintubation. Ten patients developed postintubation thallium-perfusion scan defects (thallium-positive scan), even though there was no statistical difference between their baseline hemodynamics and hemodynamics at the time of intubation. There was no difference in the incidence of thallium-positive scans between those patients anesthetized by fentanyl and those patients anesthetized with thiopental-halothane. The authors conclude that relative hypoperfusion, and possibly ischemia, occurred in 45% of patients studied, despite stable hemodynamics, and that the incidence of these events was the same with two different anesthetic techniques.

  20. Nuclear Data Sheets for A = 210

    Energy Technology Data Exchange (ETDEWEB)

    Shamsuzzoha Basunia, M.

    2014-09-15

    Evaluated spectroscopic data for {sup 210}Au, {sup 210}Hg, {sup 210}Tl, {sup 210}Pb, {sup 210}Bi, {sup 210}Po, {sup 210}At, {sup 210}Rn, {sup 210}Fr, {sup 210}Ra, {sup 210}Ac, and {sup 210}Th and corresponding level schemes from radioactive decay and reaction studies are presented. This evaluation supersedes the previous evaluation by E. Browne (2003Br13). Highlights of this publication are the identification of new μs isomers of {sup 210}Hg by 2013Go10 and measurement of an excited level energy at 1709 keV 30 of {sup 210}Rn from {sup 214}Rn α decay: 68.6 μs by 2006Ku26 denoted as x+1664.6 in the Adopted Levels. Earlier experimental limits for x≤50 keV was proposed in 1979Po19 and 1982Po03 – (HI,xnγ)

  1. Comparison of thallium deposition with segmental perfusion in pigs with chronic hibernating myocardium.

    Science.gov (United States)

    Baldwa, Sunil; Rana, Muzamil; Canty, John M; Fallavollita, James A

    2008-12-01

    Viable, chronically dysfunctional myocardium with reduced resting flow (or hibernating myocardium) is an important prognostic factor in ischemic heart disease. Although thallium-201 imaging is frequently used to assess myocardial viability in patients with ischemic cardiomyopathy, there are limited data regarding its deposition in hibernating myocardium, and this data suggest that thallium retention may be supernormal compared with control myocardium. Accordingly, pigs (n=7) were chronically instrumented with a 1.5 mm Delrin stenosis on the proximal left anterior descending coronary artery (LAD) to produce hibernating myocardium. Four months later, severe anteroapical hypokinesis was documented with contrast ventriculography (wall motion score, 0.7+/-0.8; normal=3), and microsphere measurements confirmed reduced resting flow (LAD subendocardium, 0.78+/-0.34 vs. 0.96+/-0.24 ml.min(-1).g(-1) in remote; P<0.001). Absolute deposition of thallium-201 and insulin-stimulated [18F]-2 fluoro-2-deoxyglucose (FDG) were assessed over 1 h and compared with resting flow (n=704 samples). Thallium-201 deposition was only weakly correlated with perfusion (r2=0.20; P<0.001) and was more homogeneously distributed (relative dispersion, 0.12+/-0.03 vs. 0.29+/-0.10 for microsphere flow; P<0.01). Thus after 1 h relative thallium-201 (subendocardium LAD/remote, 0.96+/-0.16) overestimated relative perfusion (0.78+/-0.32; P<0.0001) and underestimated the relative reduction in flow. Viability was confirmed by both histology and preserved FDG uptake. We conclude that under resting conditions, thallium-201 redistribution in hibernating myocardium is nearly complete within 1 h, with similar deposition to remote myocardium despite regional differences in flow. These data suggest that in this time frame thallium-201 deposition may not discriminate hibernating myocardium from dysfunction myocardium with normal resting flow. Since hibernating myocardium has been associated with a worse prognosis

  2. Thallium uptake and biological behaviour in childhood brain tumours

    Energy Technology Data Exchange (ETDEWEB)

    Bernard, E.J.; Howman-Giles, R.; Kellie, S.; Uren, R.F. [Royal Alexandra Hospital for Children, Sydney, NSW (Australia)

    1998-03-01

    Full text: The histopathological grade and radiological appearance of the diverse cerebral neoplasms in childhood frequently poorly reflect their biological behaviour. We examined thallium accumulation prior to treatment (and in several cases, at intervals there after) in 13 children to determine its usefulness as a tumour marker. 23 SPECT studies were acquired 20 minutes after the injection of 1-3 mCi of {sup 201}TI. Thallium index (TI), the ratio of counts in tumour/normal brain, was calculated. No uptake was seen in two patients (pts) with a Grade 1 cerebellar astrocytomas (disease free at 4/12 f/u). Three pts with medulloblastomas were studied. One pt showed intense uptake (Tl =12). His tumour (proliferative antigen stain Ki67 = 50%) recurred early after debulking surgery (Tl +ve prior to CT or MRI changes). The second pt was imaged at relapse (Ki67 = 60%) and showed intense uptake, Tl = 17. The third pt showed lower level uptake (Tl = 2), Ki67 = 5%, and is disease-free at 5/12 (as per {sup 201}TI and MRI). One pt with a Grade 1 brainstem glioma showed Tl = 5 and has progressed rapidly despite low grade histology. Four pts with chiasmatic-hypothalamic gliomas have been studied. Although these neoplasms are usually low grade histologically, their growth properties vary greatly. Two pts with Tl<2.5 have been conservatively managed because of slow tumour growth. The other two pts have Tl>3.5 and have required aggressive treatment for rapid disease progression. One pt with a large pilocytic astrocytoma of the optic chiasm showed Tl = 9.5. Active treatment was not undertaken. One pt with a pineal germ cell tumour showed avid {sup 201}TI uptake (Tl not performed) and has had two normal studies, and is clinically well, since BMT. Avid {sup 201}TI uptake also seen in one pt with cerebral neuroblastoma. (Died at 8/12 after Dx.) Thus, {sup 201}TI accumulates in histologically diverse paediatric neoplasms. The Tl appears to reflect biological behaviour in the limited

  3. Evaluation of muscular lesions in connective tissue diseases: thallium 201 muscular scans

    Energy Technology Data Exchange (ETDEWEB)

    Guillet, G.; Guillet, J.; Sanciaume, C.; Maleville, J.; Geniaux, M.; Morin, P.

    1988-04-01

    We performed thallium 201 muscle scans to assess muscular involvement in 40 patients with different connective tissue diseases (7 with dermatomyositis, 7 with systemic lupus erythematosus, 12 with progressive systemic scleroderma, 2 with calcinosis, Raynaud's phenomenon, esophageal involvement, sclerodactyly, and telangiectasia (CREST) syndrome, 3 with monomelic scleroderma, 6 with morphea, and 3 with Raynaud's disease). Only 12 of these patients complained of fatigability and/or myalgia. Electromyography was performed and serum levels of muscle enzymes were measured in all patients. Comparison of thallium 201 exercise recording with the other tests revealed that scan sensitivity is greater than electromyographic and serum muscle enzymes levels. Thallium 201 scans showed abnormal findings in 32 patients and revealed subclinical lesions in 18 patients, while electromyography findings were abnormal in 25 of these 32 patients. Serum enzyme levels were raised in only 8 patients. Thallium 201 scanning proved to be a useful guide for modifying therapy when laboratory data were conflicting. It was useful to evaluate treatment efficacy. Because our data indicate a 100% positive predictive value, we believe that thallium 201 scanning should be advised for severe systemic connective tissue diseases with discordant test results.

  4. Exercise-induced thallium-201 myocardial perfusion defects in angina pectoris without significant coronary artery stenosis

    Energy Technology Data Exchange (ETDEWEB)

    Nakazato, Masayasu; Maruoka, Yuji; Sunagawa, Osahiko; Kinjo, Kunihiko; Tomori, Masayuki; Fukiyama, Koshiro (Ryukyu Univ., Nishihara, Okinawa (Japan). School of Medicine)

    1990-01-01

    We performed exercise thallium-201 myocardial scintigraphy in 32 patients with angina pectoris to study the incidence of perfusion defects, who had no significant organic stenosis on coronary angiography. None of them had myocardial infarction or cardiomyopathy. Thallium-201 myocardial scintigraphy and 12-lead ECG recording were performed during supine bicycle ergometer exercise. Perfusion defects in thallium-201 scintigrams in SPECT images were assessed during visual analysis by two observers. In the coronary angiograms obtained during intravenous infusion of nitroglycerin, the luminal diameter of 75% stenosis or less in the AHA classification was regarded as an insignificant organic stenosis. Myocardial perfusion defects in the thallium-201 scintigrams were detected in eight (25%) of the 32 patients. Six of these eight patients had variant angina documented during spontaneous attacks with ST elevations in standard 12-lead ECGs. Perfusion defects were demonstrated at the inferior or infero-posterior regions in six patients, one of whom had concomitant anteroseptal defect. The defects were not always accompanied by chest pain. All but one patient demonstrating inferior or inferoposterior defects showed ST depression in leads II, III and aV{sub F} on their ECGs, corresponding to inferior wall ischemia. The exception was a case with right bundle branch block. Thus, 25% of the patients with angina pectoris, who had no evidence of significant organic stenosis on their coronary angiograms, exhibited exercise-induced perfusion defects in their thallium-201 scintigrams. Coronary spasms might have caused myocardial ischemia in these patients. (author).

  5. Advanced crystal growth techniques for thallium bromide semiconductor radiation detectors

    Science.gov (United States)

    Datta, Amlan; Becla, Piotr; Guguschev, Christo; Motakef, Shariar

    2018-02-01

    Thallium Bromide (TlBr) is a promising room-temperature radiation detector candidate with excellent charge transport properties. Currently, Travelling Molten Zone (TMZ) technique is widely used for growth of semiconductor-grade TlBr crystals. However, there are several challenges associated with this type of crystal growth process including lower yield, high thermal stress, and low crystal uniformity. To overcome these shortcomings of the current technique, several different crystal growth techniques have been implemented in this study. These include: Vertical Bridgman (VB), Physical Vapor Transport (PVT), Edge-defined Film-fed Growth (EFG), and Czochralski Growth (Cz). Techniques based on melt pulling (EFG and Cz) were demonstrated for the first time for semiconductor grade TlBr material. The viability of each process along with the associated challenges for TlBr growth has been discussed. The purity of the TlBr crystals along with its crystalline and electronic properties were analyzed and correlated with the growth techniques. Uncorrected 662 keV energy resolutions around 2% were obtained from 5 mm x 5 mm x 10 mm TlBr devices with virtual Frisch-grid configuration.

  6. Thallium distribution in sediments from the Pearl river basin, China

    Energy Technology Data Exchange (ETDEWEB)

    Liu, Juan [Guangzhou University, Key Laboratory of Waters Safety and Protection in the Pearl River Delta, Ministry of Education, Guangzhou (China); Forschungszentrum Dresden-Rossendorf (FZD), Institute of Radiochemistry, Research Site Leipzig, Leipzig (Germany); Wang, Jin; Chen, Yongheng [Guangzhou University, Key Laboratory of Waters Safety and Protection in the Pearl River Delta, Ministry of Education, Guangzhou (China); Qi, Jianying [Department of Environmental Science and Engineering, Guangzhou University, Guangzhou (China); Lippold, Holger [Forschungszentrum Dresden-Rossendorf (FZD), Institute of Radiochemistry, Research Site Leipzig, Leipzig (Germany); Wang, Chunlin [Guangdong Provincial Academy of Environmental Science, Guangzhou (China)

    2010-10-15

    Thallium (Tl) is a rare element of high toxicity. Sediments sampled in three representative locations near industries utilizing Tl-containing raw materials from the Pearl River Basin, China were analyzed for their total Tl contents and the Tl contents in four sequentially extracted fractions (i.e., weak acid exchangeable, reducible, oxidizable, and residual fraction). The results reveal that the total Tl contents (1.25-19.1 {mu}g/g) in the studied sediments were slightly high to quite high compared with those in the Chinese background sediments. This indicates the apparent Tl contamination of the investigated sediments. However, with respect to the chemical fractions, Tl is mainly associated with the residual fraction (>60%) of the sediments, especially of those from the mining area of Tl-bearing pyrite minerals, indicating the relatively low mobility, and low bioavailability of Tl in these sediments. This obviously contrasts with the previous findings that Tl is mainly entrapped in the first three labile fractions of the contaminated samples. Possible reasons were given for the dominating association of Tl with the residual fraction (>95%) of the mining area sediments. The significant role of certain K-containing silicates or minerals of these sediments on retaining Tl in the residual fraction, discovered by this study, provides a special field of research opportunity for the Tl-containing wastewater treatment. (Copyright copyright 2010 WILEY-VCH Verlag GmbH and Co. KGaA, Weinheim)

  7. [Graphite furnace atomic absorption spectrometry for determination of thallium in blood].

    Science.gov (United States)

    Zhang, Q L; Gao, G

    2016-04-20

    Colloidal palladium was used as chemical modifier in the determination of blood thallium by graphite furnace atomic absorption spectrometry. Blood samples were precipitated with 5% (V/V)nitric acid, and then determined by GFAAS with colloidal palladium used as a chemical modifier. 0.2% (W/V)sodium chloride was added in the standard series to improve the matrix matching between standard solution and sample. The detection limit was 0.2 μg/L. The correlation coefficient was 0.9991. The recoveries were between 93.9% to 101.5%.The relative standard deviations were between 1.8% to 2.7%.The certified reference material of whole blood thallium was determined and the result was within the reference range Conclusion: The method is accurate, simple and sensitive, and it can meet the needs of detection thallium in blood entirely.

  8. Myocardial perfusion defect on thallium-201 imaging in patients with chronic obstructive pulmonary disease

    Energy Technology Data Exchange (ETDEWEB)

    Mehrotra, P.P.; Weaver, Y.J.; Higginbotham, E.A.

    1983-08-01

    Six patients with angina pectoris had reversible perfusion defects on stress and redistribution thallium imaging. Three patients had a positive electrocardiographic response to exercise. No significant coronary artery lesions were seen on coronary arteriography in any of the six patients. All had mild to moderate hypoxemia at rest and physiologic evidence of chronic obstructive pulmonary disease as defined by the decrease in the ratio of forced expiratory volume at 1 second to forced vital capacity (FEV1/FVC X 100) or decrease in the forced midexpiratory flow rate (FEF25-75), or both. None had clinical findings suggestive of any of the reported causes of positive thallium scans in patients with normal coronary arteriograms. Cellular dysfunction produced by hypoxemia affecting the uptake of thallium seems to be the most likely mechanism of this abnormality.

  9. Early and delayed thallium-201 scintigraphy in thyroid nodules: the relationship between early thallium-201 uptake and perfusion

    Energy Technology Data Exchange (ETDEWEB)

    Derebek, E. [Dept. of Nuclear Medicine, Dokuz Eylul Univ., School of Medicine, Izmir (Turkey); Biberoglu, S. [Dept. of Internal Medicine, Div. of Endocrinology, Dokuz Eylul Univ., School of Medicine, Izmir (Turkey); Kut, O. [Dept. of Nuclear Medicine, Dokuz Eylul Univ., School of Medicine, Izmir (Turkey); Yesil, S. [Dept. of Internal Medicine, Div. of Endocrinology, Dokuz Eylul Univ., School of Medicine, Izmir (Turkey); Saydam, S. [Dept. of Surgery, Dokuz Eylul Univ., School of Medicine, Izmir (Turkey); Yilmaz, M. [Dept. of Nuclear Medicine, Dokuz Eylul Univ., School of Medicine, Izmir (Turkey); Yenici, O. [Dept. of Nuclear Medicine, Dokuz Eylul Univ., School of Medicine, Izmir (Turkey); Igci, E. [Dept. of Radiology, Dokuz Eylul Univ., School of Medicine, Izmir (Turkey); Gokce, O. [Dept. of Surgery, Dokuz Eylul Univ., School of Medicine, Izmir (Turkey); Canda, S. [Dept. of Pathology, Dokuz Eylul Univ., School of Medicine, Izmir (Turkey); Bueyuekgebiz, A. [Dept. of Pediatrics, Dokuz Eylul Univ., School of Medicine, Izmir (Turkey); Dogan, A.S. [Dept. of Nuclear Medicine, Dokuz Eylul Univ., School of Medicine, Izmir (Turkey); Durak, H. [Dept. of Nuclear Medicine, Dokuz Eylul Univ., School of Medicine, Izmir (Turkey)

    1996-05-01

    Seventy-six patients with tyroid nodules were studied. Initially, 75 MBq of thallium-201 was injected. The thyroid gland was imaged 15 min (early) and 3 h (delayed) after the injection. Thereafter, 185 MBq technetium-99m pertechnetate was injected. Immediately after the injection, a 1-min perfusion image was acquired, followed by an image at 20 min. Increased early and delayed {sup 201}Tl uptake compared with the contralateral thyroid tissue was adopted as the criterion for malignancy. Sensitivity, specificity and negative predictive values were found to be 85%, 64% and 78%, respectively, in operated patients, but these values were 86%, 87% and 95%, respectively, in the whole group, including patients followed with fine-needle aspiration biopsy. With the purpose of investigating the relationship between perfusion and early {sup 201}Tl uptake, bot perfusion and early images were graded comparing nodular activity with contralateral thyroid activity. There was a poor correlation between perfusion and {sup 201}Tl uptake. The correlation was even worse in hyperactive nodules. It is concluded that early and delayed {sup 201}Tl imaging should not be used in the differential diagnosis of cold nodules and that early {sup 201}Tl uptake seems to be more closely related to factors other than perfusion. (orig.)

  10. Overlapping toxic effect of long term thallium exposure on white mustard (Sinapis alba L.) photosynthetic activity.

    Science.gov (United States)

    Mazur, Radosław; Sadowska, Monika; Kowalewska, Łucja; Abratowska, Agnieszka; Kalaji, Hazem M; Mostowska, Agnieszka; Garstka, Maciej; Krasnodębska-Ostręga, Beata

    2016-09-02

    Heavy metal exposure affect plant productivity by interfering, directly and indirectly, with photosynthetic reactions. The toxic effect of heavy metals on photosynthetic reactions has been reported in wide-ranging studies, however there is paucity of data in the literature concerning thallium (Tl) toxicity. Thallium is ubiquitous natural trace element and is considered the most toxic of heavy metals; however, some plant species, such as white mustard (Sinapis alba L.) are able to accumulate thallium at very high concentrations. In this study we identified the main sites of the photosynthetic process inhibited either directly or indirectly by thallium, and elucidated possible detoxification mechanisms in S. alba. We studied the toxicity of thallium in white mustard (S. alba) growing plants and demonstrated that tolerance of plants to thallium (the root test) decreased with the increasing Tl(I) ions concentration in culture media. The root growth of plants exposed to Tl at 100 μg L(-1) for 4 weeks was similar to that in control plants, while in plants grown with Tl at 1,000 μg L(-1) root growth was strongly inhibited. In leaves, toxic effect became gradually visible in response to increasing concentration of Tl (100 - 1,000 μg L(-1)) with discoloration spreading around main vascular bundles of the leaf blade; whereas leaf margins remained green. Subsequent structural analyses using chlorophyll fluorescence, microscopy, and pigment and protein analysis have revealed different effects of varying Tl concentrations on leaf tissue. At lower concentration partial rearrangement of the photosynthetic complexes was observed without significant changes in the chloroplast structure and the pigment and protein levels. At higher concentrations, the decrease of PSI and PSII quantum yields and massive oxidation of pigments was observed in discolored leaf areas, which contained high amount of Tl. Substantial decline of the photosystem core proteins and disorder of the

  11. Stable room-temperature thallium bromide semiconductor radiation detectors

    Science.gov (United States)

    Datta, A.; Fiala, J.; Becla, P.; Motakef, Shariar

    2017-10-01

    Thallium bromide (TlBr) is a highly efficient ionic semiconductor with excellent radiation detection properties. However, at room temperature, TlBr devices polarize under an applied electric field. This phenomenon not only degrades the charge collection efficiency of the detectors but also promotes chemical reaction of the metal electrodes with bromine, resulting in an unstable electric field and premature failure of the device. This drawback has been crippling the TlBr semiconductor radiation detector technology over the past few decades. In this exhaustive study, this polarization phenomenon has been counteracted using innovative bias polarity switching schemes. Here the highly mobile Br- species, with an estimated electro-diffusion velocity of 10-8 cm/s, face opposing electro-migration forces during every polarity switch. This minimizes the device polarization and availability of Br- ions near the metal electrode. Our results indicate that it is possible to achieve longer device lifetimes spanning more than 17 000 h (five years of 8 × 7 operation) for planar and pixelated radiation detectors using this technique. On the other hand, at constant bias, 2500 h is the longest reported lifetime with most devices less than 1000 h. After testing several biasing switching schemes, it is concluded that the critical bias switching frequency at an applied bias of 1000 V/cm is about 17 μHz. Using this groundbreaking result, it will now be possible to deploy this highly efficient room temperature semiconductor material for field applications in homeland security, medical imaging, and physics research.

  12. Thallium pollution in China: A geo-environmental perspective.

    Science.gov (United States)

    Xiao, Tangfu; Yang, Fei; Li, Shehong; Zheng, Baoshan; Ning, Zengping

    2012-04-01

    It is well known that thallium (Tl) is a non-essential and toxic metal to human health, but less is known about the geo-environmentally-induced Tl pollution and its associated health impacts. High concentrations of Tl that are primarily associated with the epithermal metallogenesis of sulfide minerals have the potential of producing Tl pollution in the environment, which has been recognized as an emerging pollutant in China. This paper aims to review the research progress in China on Tl pollution in terms of the source, mobility, transportation pathway, and health exposure of Tl and to address the environmental concerns on Tl pollution in a geo-environmental perspective. Tl associated with the epithermal metallogenesis of sulfide minerals has been documented to disperse readily and accumulate through the geo-environmental processes of soil enrichment, water transportation and food crop growth beyond a mineralized zone. The enrichments of Tl in local soil, water, and crops may result in Tl pollution and consequent adverse health effects, e.g. chronic Tl poisoning. Investigation of the baseline Tl in the geo-environment, proper land use and health-related environmental planning and regulation are critical to prevent the Tl pollution. Examination of the human urinary Tl concentration is a quick approach to identify exposure of Tl pollution to humans. The experiences of Tl pollution in China can provide important lessons for many other regions in the world with similar geo-environmental contexts because of the high mobility and toxicity of Tl. Copyright © 2011 Elsevier B.V. All rights reserved.

  13. Stable room-temperature thallium bromide semiconductor radiation detectors

    Directory of Open Access Journals (Sweden)

    A. Datta

    2017-10-01

    Full Text Available Thallium bromide (TlBr is a highly efficient ionic semiconductor with excellent radiation detection properties. However, at room temperature, TlBr devices polarize under an applied electric field. This phenomenon not only degrades the charge collection efficiency of the detectors but also promotes chemical reaction of the metal electrodes with bromine, resulting in an unstable electric field and premature failure of the device. This drawback has been crippling the TlBr semiconductor radiation detector technology over the past few decades. In this exhaustive study, this polarization phenomenon has been counteracted using innovative bias polarity switching schemes. Here the highly mobile Br− species, with an estimated electro-diffusion velocity of 10−8 cm/s, face opposing electro-migration forces during every polarity switch. This minimizes the device polarization and availability of Br− ions near the metal electrode. Our results indicate that it is possible to achieve longer device lifetimes spanning more than 17 000 h (five years of 8 × 7 operation for planar and pixelated radiation detectors using this technique. On the other hand, at constant bias, 2500 h is the longest reported lifetime with most devices less than 1000 h. After testing several biasing switching schemes, it is concluded that the critical bias switching frequency at an applied bias of 1000 V/cm is about 17 μHz. Using this groundbreaking result, it will now be possible to deploy this highly efficient room temperature semiconductor material for field applications in homeland security, medical imaging, and physics research.

  14. Medical geology of arsenic, selenium and thallium in China.

    Science.gov (United States)

    Li, Shehong; Xiao, Tangfu; Zheng, Baoshan

    2012-04-01

    Arsenic (As), selenium (Se) and thallium (Tl) are three trace metals (metalloids) of high concern in China because deficiency or excess expose can cause a range of endemic diseases, such as endemic arsenism, selenosis, Keshan disease (KD), Kashin-Beck disease (KBD) and thallotoxicosis. These specific endemic diseases were attributable for overabundance or deficiency (mainly referring to selenium) of these three elements in the local environment as a result of natural geochemical processes and/or anthropologic activities. The geochemistry and human health impacts of these three trace elements have been intensively studied since the 1970s in China, in terms of geochemical sources, distribution, transportation, health impact pathways, and prevention/remediation measures. Endemic arsenism in China are induced from the exposures of high As in either drinking water or domestic combustion of As-rich coals. Both endemic selenium deficiency and selenosis occurred in China. The KD and KBD were related to the deficiency of Se in the low-Se geological belt with Se contents in soil less than 0.125mg/kg stretching from northeast to southwest of China. Endemic selenosis occurred in areas with high Se concentrations in soils derived from the Se-enriched black carbonaceous siliceous rocks, carbonaceous shale and slate. Endemic Tl poisoning occurred in southwestern China due to Tl contamination in local drinking water and vegetables surrounding the Tl-rich sulfide mineralized areas. Some measures have been taken to control and remedy the endemic diseases with significant effects in reducing health risk and damage of As, Se and Tl. However, the states of the endemic diseases of As, Se and Tl in China are still serious in some areas, and substantial research efforts regarding the health impacts of these elements are further required. This paper reviews the progress of medical geology of As, Se and Tl in China, and provides with some outlooks for future research directions. Copyright

  15. 7 CFR 210.13 - Facilities management.

    Science.gov (United States)

    2010-01-01

    ... 7 Agriculture 4 2010-01-01 2010-01-01 false Facilities management. 210.13 Section 210.13... Participation § 210.13 Facilities management. Link to an amendment published at 74 FR 66216, Dec. 15, 2009. (a..., the added text is set forth as follows: § 210.13 Facilities management. (c) Food safety program. The...

  16. New CZT cardiac cameras and myocardial perfusion imaging with thallium 201; Nouvelles cameras cardiaques a semi-conducteur cadmium -zinc- telluride (CZT) et scintigraphies myocardiques au thallium 201

    Energy Technology Data Exchange (ETDEWEB)

    Songy, B. [Service de medecine et imagerie nucleaire, centre cardiologique du Nord (CCN), 93 - Saint-Denis (France)

    2010-08-15

    Myocardial perfusion imaging is widely used for management of coronary artery disease. However, it suffers from technical limitations. New cardiac cameras using CZT detectors are now available and increase spatial (x2) and energy (x2) resolutions and photons sensitivity (x5). We describe here the General Electric Discovery NM 530c new camera and summarize the validation studies with technetium agents and with thallium 201, protocols to reduce doses, ultrafast protocols and perspectives offered with this new technology. (author)

  17. Standardisation of {sup 210}Pb

    Energy Technology Data Exchange (ETDEWEB)

    Woods, D.H. E-mail: denise.woods@npl.co.uk; Bowles, N.E.; Jerome, S.M.; Lavison, P. de; Lineham, S.; Makepeace, J.L.; Woodman, A.P.; Woods, M.J

    2000-03-01

    The standardisation of {sup 210}Pb is complicated by the presence of the daughters, {sup 210}Bi and {sup 210}Po. In addition, the low energies of the beta emissions from {sup 210}Pb make it difficult to obtain high detection efficiencies in an atmospheric proportional counter and hence produce the need for large extrapolations with consequential large uncertainties when extrapolating to unit efficiency with the conventional 4{pi}(PC)-{gamma}-coincidence technique. In order to produce a reliable standardisation, it is necessary to remove the daughter products. A solution of {sup 210}Pb was therefore chemically separated from its daughters and then standardised using the conventional 4{pi}(LS)-{gamma}-coincidence technique. The low energy (46 keV) and low emission probability (4%) of the associated photon emissions effectively rules out the possibility of using ionisation chambers as secondary standard transfer instruments for this nuclide. A germanium spectrometer therefore was calibrated for this purpose using {sup 241}Am as a normalising agent. The results of this work are presented together with an analysis of the standardisation uncertainties that can be achieved in practice.

  18. Genotoxic and mutagenic effects of the diagnostic use of thallium-201 in nuclear medicine

    Energy Technology Data Exchange (ETDEWEB)

    Kelsey, K.T. (Harvard School of Public Health, Boston, MA (United States)); Donohoe, K.J. (Beth Israel Hospital, Boston, MA (United States). Div. of Nuclear Medicine); Baxter, Barbara; Memisoglu, Asli; Little, J.B.; Caggana, Michele; Liber, H.L. (Harvard School of Public Health, Boston, MA (United States))

    1991-07-01

    In order to investigate possible mutagenetic effects of in vivo exposure to low levels of ionizing radiation used in nuclear medicine, the authors examined hypoxanthine guanine phosphoribosyl transferase (hprt) mutant fraction (MF) and chromosome aberration (CA) frequency in 24 nuclear medicine patients before and after injection of thallium-201. The mean MF of the thallium-201-exposed cohort was 5.2{+-}4.4 x 10{sup -6} before injection exposure. No significant difference in MF was observed 24 h later. In 11 patients who were studied on a 3rd occasion, 30 days after thallium-201 exposure, there was again no significant difference in post-exposure as compared with the pre-exposure MF. The frequency of CA in peripheral blood lymphocytes was not significantly different, comparing pre- and 24h to 1 month post-radionuclide exposure . Thus, thallium-201 exposure was not associated with significant elevations in MF or CA frequency in lymphocytes of exposed individuals. (author). 40 refs.; 3 tabs.

  19. Systematics of c-axis Phonons in the Thallium- and Bismuth-Based Cuprate Superconductors

    NARCIS (Netherlands)

    Tsvetkov, A. A; Dulic, D.; Marel, D. van der; Damascelli, A.; Kaljushnaia, G. A.; Gorina, J. I.; Senturina, N. N.; Kolesnikov, N. N.; Ren, Z. F.; Wang, J. H.; Menovsky, A. A.; Palstra, T. T. M.

    2006-01-01

    Published in: Phys. Rev. B 60 (1999) 13196 Citing articles (CrossRef) citations recorded in [Science Citation Index] Abstract: We present grazing incidence reflectivity measurements in the far infrared region at temperatures above and below Tc for a series of thallium (Tl2Ba2CuO6, Tl2Ba2CaCu2O8) and

  20. Dipyridamole-thallium-201 tomography documenting improved myocardial perfusion with therapy in Kawasaki disease

    Energy Technology Data Exchange (ETDEWEB)

    Nienaber, C.A.; Spielmann, R.P.; Hausdorf, G.

    1988-12-01

    Thallium-201 tomographic perfusion studies after pharmacologic vasodilation were performed in seven children (aged 2 years 8 months to 8 years 7 months), 3 to 20 months after the acute stage of the disease. In all patients coronary aneurysms were seen on cross-sectional echocardiograms. The scintigrams of six children showed no significant regional reduction of myocardial thallium-201 uptake. These children had remained asymptomatic in the follow-up period after the acute inflammatory stage of Kawasaki disease. Persistent and transient thallium defects were present in one child with acute posterolateral myocardial infarction; obstruction of two coronary vessels supplying the defect zones was confirmed by contrast angiography. After 8 months of treatment a follow-up nuclear scan showed marked reduction in the size of the defect and almost complete abolishment of the ischemic reaction. Thus tomographic thallium-201 perfusion scintigraphy in conjunction with vasodilation stress is useful to assess myocardial perfusion in children with Kawasaki disease and demonstrates marked improvement in regional perfusion after adequate medical therapy.

  1. Complexometric determination of thallium(III using ethanethiol as a selective masking agent

    Directory of Open Access Journals (Sweden)

    Karthikeyan J.

    2006-01-01

    Full Text Available A simple and selective complexometric method for the determination of thallium in presence of other metal ions is proposed based on the selective masking ability of ethanethiol towards thallium(III. Thallium present in a given sample solution is first complexed with a known excess of EDTA and the surplus EDTA is titrated with standard zinc sulphate solution at pH 5-6(hexamine using xylenol orange as the indicator. A 0.3% aqueous solution of ethanethiol is then added to displace EDTA from the Tl(III-EDTA complex. The released EDTA is titrated with standard zinc sulphate solution as before. Reproducible and accurate results are obtained for 3.70 mg to 74.07 mg of Tl (III with relative error less than ? 0.44% and coefficient of variation not more than 0.27%. The interference of various ions was studied and the method was used for the analysis of thallium in its synthetic alloy mixtures and also in complexes.

  2. Thallium-201: Autoradiography in pigmented mice and melanin-binding in vitro

    Energy Technology Data Exchange (ETDEWEB)

    Tjaelve, H.; Nilsson, M.; Larsson, B. (Uppsala Univ. (Sweden))

    1982-01-01

    Autoradiography with /sup 201/Tl/sup +/ in C57Bl mice showed a strong labelling of the eye melanin and of pigmented hair follicles. An analysis of the affinity of thallium for pigment from cow eyes indicated a binding to three groups of sites and showed a marked sensitivity to the addition of H/sup +/-ions. The results are consistent with the conception that a binding of thallium occurs to the free carboxyl groups of the melanin and that the structure of the polymer has a marked influence on the affinity. Similar results have previously been obtained with other cations. There was no indication that the strong in vivo affinity of thallium to melanin is due to a more firm binding than for other cations which do not localize on melanin in vivo. Instead, the ability of cations to pass the melanocyte membranes and reach the melanin granules is probably decisive for whether a melanin-binding will take place in vivo. Toxic effects on the eye and epilation are symptoms of thallium intoxication which may be related to its melanin-binding. The fate of /sup 201/Tl/sup +/ in some other tissues is also described and discussed.

  3. Laser-assisted decay and optical spectroscopy studies of neutron-deficient thallium isotopes

    CERN Document Server

    Van Beveren, Céline; Huyse, Mark

    The neutron-deficient thallium isotopes with one proton less than the Z = 82 shell closure, are situated in an interesting region of the nuclear chart, notorious for intruder states and shape coexistence. Shape coexistence is the remarkable phenomenon in which two or more distinct types of deformation occur at low energy in the same atomic nucleus. Shape coexistence has been studied intensively, experimentally as well as theoretically in different nuclei in the light-lead region and the isomerism in the thallium isotopes was among the first indications of this phenomenon. Different shapes, whose structure has been linked to specific proton orbitals above and below the Z = 82 shell closure, are present at low energy in the neutron-deficient odd-mass thallium nuclei. In the odd-odd nuclei, the coupling of an unpaired proton and unpaired neutron gives rise to multiplets of low-lying states from which some can be isomeric. Since thallium has one proton missing in the major proton shell, and when approaching neutr...

  4. Clinical features and applications of thallium-201. With reference to scintigraphy

    Energy Technology Data Exchange (ETDEWEB)

    Fujii, Tadashige

    1988-12-01

    Thallium-201 is not only used widely in myocardial imaging but also has a great potential in other various nuclear medicine imaging studies. This paper presents clinical features and applications of thallium-201, focusing on clinical trials with thallium-201 at the Shinshu University School of Medicine. Thallium-201 myocardial scintigraphy offers information on (1) ventricular position and morphology, (2) hypertrophy or dilatation of the left ventricle, (3) hypertrophy or dilatation of the right ventricle, (4) site and extent of myocardial ischemia and infarct, (5) myocardial blood flow, (6) pulmonary congestion or interstitial pulmonary edema, and (7) pericardial effusion. It can be used in the following evaluation or diagnosis: (1) acute or old myocardial infarction, (2) angina pectoris, (3) treatment strategy or prognosis of ischemic heart disease, (4) treatment strategy or observation of bypass graft or drug therapy, (5) hypertrophic or dilated idiopathic cardiomyopathy, (6) myocardial lesions induced by sarcoidosis, collagen disease, and neuro-muscular disease, (7) ventricular hypertrophy and pulmonary edema, and (9) pericarditis, pericardial effusion, and systolic pericarditis associated with underlying disease. The significance of tumor, liver, bone marrow scintigraphies is also referred to. (Namekawa, K) 69 refs.

  5. Optimised thallium precipitation in a waste water treatment system of the flue gas desulphurisation; Optimierte Thalliumabscheidung einer RAA

    Energy Technology Data Exchange (ETDEWEB)

    Ritzerfeld, Guenter [RWE Power AG, Bergheim (Germany); Birngruber, Ingolf [RWE Power AG, Hamm (Germany); Muelder, Thomas [RWE Power AG, Ibbenbueren (Germany)

    2011-07-01

    When co-combusting substitute fuels in power plants, the element Thallium should be checked in the drain of the waste water treatment system of flue gas desulphurisation. In 2005 Thallium-concentrations exceeding the limit value were determined for the first time as a consequence of the modified analysis of the supervisory authority. The previous lower Thallium concentrations with graphite tube-atomic absorption spectrometry were caused by the high chloride concentration in RAA waste water. The RAA operating mode was checked and changed. Equipment-related weak spots were detected and corrected. (orig.)

  6. Studies of the balance 210Pb - 210Po in glasses; Estudios del equilibrio 210Pb - 210Po en vidrios

    Energy Technology Data Exchange (ETDEWEB)

    Torre Pérez, J. de la; Martín Sánchez, A.; Ruano Sánchez, A.B.

    2014-07-01

    Retrospective dosimetry requires measurement methods allowing the determination of Radon concentration in the past. One of the such methods is based on the direct measurement of 210Po implanted on the surface of objects, whose activity concentration (Bq/m2), is directly related to the cumulative exposure due to the concentration of 222Rn (Bq/m3) for long time. These determinations are possible taking into consideration the equilibrium between 210Po (T1/2 = 138.378 days) and its parent 210Pb (T1/2 = 22.3 years), being both radionuclides from the 222Rn progeny. In previous works about the determination of the conversion factor (ratio between the concentration of 210Po in objects and the retrospective 222Rn concentration in air), Corresponding equilibria between descendants were assumed. In this work, an experimental study about the equilibrium 210Pb - 210Po in glasses, which were previously exposed to some radon concentrations, has been performed. Two scenarios were studied: a place with, and another place without, continuous cumulative 222Rn concentration. Results were compared with those reached by theoretical calculations from the (Bateman) activity evolution equations. [Spanish] La dosimetría retrospectiva requiere métodos de medida que permitan la determinación de la concentración de radón en el pasado. Uno de estos métodos está basado en la medida directa del 210Po implantado sobre la superficie de objetos, cuya concentración de actividad (Bq/m2), está directamente relacionada con la exposición acumulativa debida a la concentración de 222Rn (Bq/m3) durante largos períodos de tiempo. Estas determinaciones son posibles gracias al equilibrio entre el 210Po (T1/2 = 138,378 días) y su progenitor, el 210Pb (T1/2 = 22,3 años), siendo ambos radionúclidos descendientes del 222Rn. En trabajos anteriores sobre la determinación del factor de conversión (relación entre la concentración de 210Po en los objetos y la concentración de 222Rn retrospectivo en

  7. Comparison of Polythionates as Precursors for the Formation of Thallium Sulfide Layers

    Directory of Open Access Journals (Sweden)

    Vitalijus JANICKIS

    2011-11-01

    Full Text Available The processes of obtaining layers of thallium, sulfides, TlxSy, by the sorption-diffusion method on polyamide 6 using solutions of lower polythionates - sodium trithionate and tetrathionate, Na2S3O6, Na2S4O6, potassium pentathionate, K2S5O6, and of dodecathionic acid, H2S12O6, as precursors of sulfur are compared. The concentration of sorbed sulfur increases with increasing the duration of treatment, the concentration and temperature of precursor solution. It rather significantly also depends on the nature - sulfurity of polythionate, i. e. on the number of sulfur atoms in the polythionate anion: effectiveness of sulfurization using solutions of dodecathionic acid is significantly higher than that of lower polythionates. Thallium sulfide layers are formed on the surface of polyamide after the treatment of sulfurized polymer with Tl(I salt solution. The concentration of thallium in the layer increases with the increase of initial sulfurization duration and in case of H2S12O6 solution used - on the temperature of this process. The results of X-ray diffraction analysis confirmed the formation of thallium sulfide layers in the surface of polyamide 6. The phase composition of layer changes depending on the conditions of initial treatment in a H2S12O6 solution. Five thallium sulfide phases, two forms of TlS, Tl2S2, Tl4S3 and Tl2S5 were identified in the composition of the layers treated for different time with a solution of dodecathionic acid at the temperature of 20 °C and 30 °C and then with Tl(I salt solution by X-ray diffraction but the maxima of TlS and Tl2S5 phases predominate in the diffractograms.http://dx.doi.org/10.5755/j01.ms.17.4.774

  8. Multi-year Surface Deposition of {sup 210}Pb and {sup 210}Po at Lisbon - Atmospheric Depositions of {sup 210}Pb and {sup 210}Po in Lisbon, Portugal

    Energy Technology Data Exchange (ETDEWEB)

    Carvalho, Fernando P.; Oliveira, Joao M.; Alberto, G. [Instituto Superior Tecnico/ Campus Tecnologico e Nuclear, Universidade Tecnica de Lisboa, E.N. 10, 2686-953 Sacavem (Portugal)

    2014-07-01

    The long lived radon daughters {sup 210}Pb and {sup 210}Po were determined in samples of total atmospheric depositions obtained with surface collectors continuously operated during 5 years, near Lisbon. The average annual {sup 210}Pb flux was 66±12 Bq m{sup -2}, and the average annual {sup 210}Po flux was 8±3 Bq m{sup -2}, with an overall {sup 210}Po/{sup 210}Pb activity ratio of 0.15±0.06. Direct determination of the {sup 210}Pb atmospheric flux was compared with the {sup 210}Pb excess determined in soil surface layers along with atmospheric depositions of {sup 137}Cs. The deposition of atmospheric {sup 210}Pb was positively correlated with seasonal rainfall, while {sup 210}Po was mainly originated in soil particles re-suspension throughout the year and also in seasonal forest fires. Unusually high {sup 210}Po/{sup 210}Pb activity ratios, higher than unity, were occasionally recorded in atmospheric depositions and the sources and causes are discussed. Long time-series of {sup 210}Pb and {sup 210}Po deposition fluxes, as presented herein are useful to test and constrain parameters of the atmospheric Global Circulation Models. (authors)

  9. Applications of PB-210/RA-226 and PO-210/PB-210 disequilibria in the study of marine geochemical processes

    Energy Technology Data Exchange (ETDEWEB)

    Bacon, M. P.

    1976-02-01

    The distribution of /sup 210/Pb and /sup 210/Po in dissolved (less than 0.4 micron) and particulate (greater than 0.4 micron) phases was measured at ten stations in the tropical and eastern North Atlantic and at two stations in the Pacific. Both radionuclides occur principally in the dissolved phase. Unsupported /sup 210/Pb activities, maintained by flux from the atmosphere, were present in the surface mixed layer and penetrated into the thermocline to depths of about 500 m. Dissolved /sup 210/Po was ordinarily present in the mixed layer at less than equilibrium concentrations, suggesting rapid biological removal of this nuclide. Particulate matter was enriched in /sup 210/Po, with /sup 210/Po//sup 210/Pb activity ratios greater than 1.0, similar to those reported for phytoplankton. Box-model calculations yield a 2-y residence time for /sup 210/Pb and a 0.6-y residence time for /sup 210/Po in the mixed layer. These residence times are considerably longer than the time calculated for turnover of particles in the mixed layer (about 0.1 y). At depths of 100 to 300 m, /sup 210/Po maxima occurred and unsupported /sup 210/Po was frequently present. Calculations indicate that at least 50 percent of the /sup 210/Po removed from the mixed layer is re-cycled within the thermocline. Similar calculations for /sup 210/Pb suggest much lower re-cycling efficiencies.

  10. Thermodynamic Study of Tl6SBr4 Compound and Some Regularities in Thermodynamic Properties of Thallium Chalcohalides

    Directory of Open Access Journals (Sweden)

    Dunya Mahammad Babanly

    2017-01-01

    Full Text Available The solid-phase diagram of the Tl-TlBr-S system was clarified and the fundamental thermodynamic properties of Tl6SBr4 compound were studied on the basis of electromotive force (EMF measurements of concentration cells relative to a thallium electrode. The EMF results were used to calculate the relative partial thermodynamic functions of thallium in alloys and the standard integral thermodynamic functions (-ΔfG0, -ΔfH0, and S0298 of Tl6SBr4 compound. All data regarding thermodynamic properties of thallium chalcogen-halides are generalized and comparatively analyzed. Consequently, certain regularities between thermodynamic functions of thallium chalcogen-halides and their binary constituents as well as degree of ionization (DI of chemical bonding were revealed.

  11. A calixarene-based ion-selective electrode for thallium(I) detection

    Energy Technology Data Exchange (ETDEWEB)

    Chester, Ryan [Nanochemistry Research Institute, Department of Chemistry, Curtin University, GPO Box U1987, Perth, Western Australia 6845 (Australia); Sohail, Manzar [Faculty of Science, Health, Education and Engineering, University of the Sunshine Coast, Locked Bag 4, Maroochydore DC, Queensland 4556 (Australia); Ogden, Mark I.; Mocerino, Mauro [Nanochemistry Research Institute, Department of Chemistry, Curtin University, GPO Box U1987, Perth, Western Australia 6845 (Australia); Pretsch, Ernö [ETH Zürich, Institute of Biogeochemistry and Pollutant Dynamics (IBP), Universitätstrasse 16, CH-8092, Zürich (Switzerland); De Marco, Roland, E-mail: rdemarc1@usc.edu.au [Nanochemistry Research Institute, Department of Chemistry, Curtin University, GPO Box U1987, Perth, Western Australia 6845 (Australia); Faculty of Science, Health, Education and Engineering, University of the Sunshine Coast, Locked Bag 4, Maroochydore DC, Queensland 4556 (Australia)

    2014-12-03

    Highlights: • Tuning of metal binding cavities in thallium(I) calixarene ionophores. • Novel calixarene-based ionophores with improved selectivity for thallium(I). • Sandwich membrane characterization of thallium(I) binding in novel calixarenes. • Improved selectivity and sensitivity with novel thallium(I) calixarene ionophores. • Solid contact ion-selective electrodes for novel thallium(I) calixarene ionophores. - Abstract: Three new calixarene Tl{sup +} ionophores have been utilized in Tl{sup +} ion-selective electrodes (ISEs) yielding Nernstian response in the concentration range of 10{sup −2}–10{sup −6} M TlNO{sub 3} with a non-optimized filling solution in a conventional liquid contact ISE configuration. The complex formation constants (log β{sub IL}) for two of the calixarene derivatives with thallium(I) (i.e. 6.44 and 5.85) were measured using the sandwich membrane technique, with the other ionophore immeasurable due to eventual precipitation of the ionophore during these long-term experiments. Furthermore, the unbiased selectivity coefficients for these ionophores displayed excellent selectivity against Zn{sup 2+}, Ca{sup 2+}, Ba{sup 2+}, Cu{sup 2+}, Cd{sup 2+} and Al{sup 3+} with moderate selectivity against Pb{sup 2+}, Li{sup +}, Na{sup +}, H{sup +}, K{sup +}, NH{sub 4}{sup +} and Cs{sup +}, noting that silver was the only significant interferent with these calixarene-based ionophores. When optimizing the filling solution in a liquid contact ISE, it was possible to achieve a lower limit of detection of approximately 8 nM according to the IUPAC definition. Last, the new ionophores were also evaluated in four solid-contact (SC) designs leading to Nernstian response, with the best response noted with a SC electrode utilizing a gold substrate, a poly(3-octylthiophene) (POT) ion-to-electron transducer and a poly(methyl methacrylate)–poly(decyl methacrylate) (PMMA–PDMA) co-polymer membrane. This electrode exhibited a slope of 58.4 mV decade

  12. 7 CFR 210.14 - Resource management.

    Science.gov (United States)

    2010-01-01

    ... 7 Agriculture 4 2010-01-01 2010-01-01 false Resource management. 210.14 Section 210.14 Agriculture... Participation § 210.14 Resource management. (a) Nonprofit school food service. School food authorities shall.... Expenditures of nonprofit school food service revenues shall be in accordance with the financial management...

  13. 46 CFR 132.210 - Classification.

    Science.gov (United States)

    2010-10-01

    ... 46 Shipping 4 2010-10-01 2010-10-01 false Classification. 132.210 Section 132.210 Shipping COAST... Portable and Semiportable Fire Extinguishers § 132.210 Classification. (a) Each portable fire extinguisher... Classification Type Size Halon 1211, 1301, and 1211-1301 mixtures kgs. (lbs.) Foam, liters (gallons) Carbon...

  14. 12 CFR 347.210 - Asset maintenance.

    Science.gov (United States)

    2010-01-01

    ... 12 Banks and Banking 4 2010-01-01 2010-01-01 false Asset maintenance. 347.210 Section 347.210 Banks and Banking FEDERAL DEPOSIT INSURANCE CORPORATION REGULATIONS AND STATEMENTS OF GENERAL POLICY INTERNATIONAL BANKING Foreign Banks § 347.210 Asset maintenance. (a) An insured branch of a foreign bank shall...

  15. 19 CFR 210.19 - Intervention.

    Science.gov (United States)

    2010-04-01

    ... 19 Customs Duties 3 2010-04-01 2010-04-01 false Intervention. 210.19 Section 210.19 Customs Duties UNITED STATES INTERNATIONAL TRADE COMMISSION INVESTIGATIONS OF UNFAIR PRACTICES IN IMPORT TRADE ADJUDICATION AND ENFORCEMENT Motions § 210.19 Intervention. Any person desiring to intervene in an...

  16. 28 CFR 36.210 - Smoking.

    Science.gov (United States)

    2010-07-01

    ... 28 Judicial Administration 1 2010-07-01 2010-07-01 false Smoking. 36.210 Section 36.210 Judicial... COMMERCIAL FACILITIES General Requirements § 36.210 Smoking. This part does not preclude the prohibition of, or the imposition of restrictions on, smoking in places of public accommodation. ...

  17. 21 CFR 173.210 - Acetone.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 3 2010-04-01 2009-04-01 true Acetone. 173.210 Section 173.210 Food and Drugs..., Lubricants, Release Agents and Related Substances § 173.210 Acetone. A tolerance of 30 parts per million is established for acetone in spice oleoresins when present therein as a residue from the extraction of spice. ...

  18. 46 CFR 184.210 - Heating equipment.

    Science.gov (United States)

    2010-10-01

    ... 46 Shipping 7 2010-10-01 2010-10-01 false Heating equipment. 184.210 Section 184.210 Shipping COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED) SMALL PASSENGER VESSELS (UNDER 100 GROSS TONS) VESSEL CONTROL AND MISCELLANEOUS SYSTEMS AND EQUIPMENT Cooking and Heating § 184.210 Heating equipment...

  19. 22 CFR 210.670 - Suspension.

    Science.gov (United States)

    2010-04-01

    ... 22 Foreign Relations 1 2010-04-01 2010-04-01 false Suspension. 210.670 Section 210.670 Foreign... (FINANCIAL ASSISTANCE) Definitions § 210.670 Suspension. Suspension means an action taken by a Federal agency..., subpart 9.4) and the common rule, Government-wide Debarment and Suspension (Nonprocurement), that...

  20. 7 CFR 210.3 - Administration.

    Science.gov (United States)

    2010-01-01

    ... 7 Agriculture 4 2010-01-01 2010-01-01 false Administration. 210.3 Section 210.3 Agriculture... CHILD NUTRITION PROGRAMS NATIONAL SCHOOL LUNCH PROGRAM General § 210.3 Administration. (a) FNS. FNS will act on behalf of the Department in the administration of the Program. Within FNS, the CND will be...

  1. 40 CFR 211.210 - Requirements.

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 24 2010-07-01 2010-07-01 false Requirements. 211.210 Section 211.210 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) NOISE ABATEMENT PROGRAMS PRODUCT NOISE LABELING Hearing Protective Devices § 211.210 Requirements. ...

  2. 42 CFR 93.210 - Good faith.

    Science.gov (United States)

    2010-10-01

    ... 42 Public Health 1 2010-10-01 2010-10-01 false Good faith. 93.210 Section 93.210 Public Health... MISCONDUCT Definitions § 93.210 Good faith. Good faith as applied to a complainant or witness, means having a... allegation or cooperation with a research misconduct proceeding is not in good faith if made with knowing or...

  3. 32 CFR 210.4 - Responsibilities.

    Science.gov (United States)

    2010-07-01

    ... 32 National Defense 2 2010-07-01 2010-07-01 false Responsibilities. 210.4 Section 210.4 National Defense Department of Defense (Continued) OFFICE OF THE SECRETARY OF DEFENSE (CONTINUED) MISCELLANEOUS ENFORCEMENT OF STATE TRAFFIC LAWS ON DOD INSTALLATIONS § 210.4 Responsibilities. (a) The Assistant Secretary...

  4. Thallium Flux Assay for Measuring the Activity of Monovalent Cation Channels and Transporters.

    Science.gov (United States)

    Weaver, C David

    2018-01-01

    Monovalent cation channels are critically important for physiological processes ranging from the control of neuronal excitability to the maintenance of solute balance. Mutations in these channels are associated with a multiplicity of diseases and monovalent cation channel-modulating drugs are used as therapeutics. Techniques that allow the measurement of the activity of these ion channels are useful for exploring their many biological roles as well as enabling the discovery and characterization of ion channel modulators for the purposes of drug discovery. Although there are numerous techniques for measuring the activity of monovalent cation channels, the thallium flux assay technique is a widely used fluorescence-based approach. Described herein is a method for using the thallium-flux technique for detecting and quantifying the activity of small-molecule potassium channel modulators in 384-well plates.

  5. Comparative studies on right ventricular pressure and volume overloading by thallium-201 myocardial scintigraphy

    Energy Technology Data Exchange (ETDEWEB)

    Owada, K.; Tsukahara, Y.; Kijima, M.; Miyazaki, Y.; Ono, K. (Fukushima Medical Coll. (Japan))

    1982-03-01

    Thallium-201 myocardial scintigraphy was performed in 44 patients with various heart diseases including mitral stenosis, atrial septal defect, primary pulmonary hypertension, and left atrial myxoma. The morphological findings of right ventricular (RV) free wall on the scintigram and RV/IVS (interventricular septum) uptake ratio of the images obtained from the left anterior oblique projection were studied in the patients with RV pressure or volume overloading.

  6. Tunable frequency-stabilization of UV laser using a Hallow-Cathode Lamp of atomic thallium

    CERN Document Server

    Chen, Tzu-Ling; Shy, Jow-Tsong; Liu, Yi-Wei

    2013-01-01

    A frequency-stabilized ultraviolet laser system, locked to the thallium resonant transition of 377.5 nm, was demonstrated using a novel bichromatic spectroscopy technique for tuning the zero-crossing laser-lock point. The atomic thallium system is a promising candidate in atomic parity violation and permanent electric dipole moment experiments, and its 377.5 nm 6P1/2->7S1/2 transition is important for thallium laser cooling and trapping experiment. The pressure shift, owing to the high pressure bu?er gas of the hollow-cathode lamp, was observed using an atomic beam resonance as reference. Such a shift was corrected by adjusting the peak ratio of the two Doppler-free saturation pro?les resulted from two pumping beams with a 130 MHz frequency di?erence. The resulted frequency stability of the ultraviolet laser is ?0.5 MHz at 0.1 sec integration time. This scheme is compact and versatile for stabilizing UV laser systems, which acquire a sub-MHz stability and frequency tunability.

  7. Detection of human collateral circulation by vasodilation-thallium-201 tomography

    Energy Technology Data Exchange (ETDEWEB)

    Nienaber, C.A.; Salge, D.; Spielmann, R.P.; Montz, R.; Bleifeld, W. (University Hospital Eppendorf, Hamburg (Germany, F.R.))

    1990-04-15

    Coronary arteriolar vasodilation may provoke redistribution of flow to collateral-dependent jeopardized myocardium. To assess the physiologic significance of collaterals, 80 consecutive post-infarction patients (age 58 +/- 8 years) underwent vasodilation-redistribution thallium-201 tomographic imaging after administration of 0.56 mg of intravenous dipyridamole/kg body weight. Circumferential profile analysis of thallium-201 uptake and redistribution in representative left ventricular tomograms provided quantitative assessment of transient and fixed defects and separation between periinfarctional and distant inducible hypoperfusion. Tomographic perfusion data were correlated to wall motion and collateral circulation between distinct anatomic perfusion territories. Patients were grouped according to presence (59%) or absence (41%) of angiographically visible collateral channels to jeopardized myocardium. In the presence of collaterals, distant reversible defects were larger than in absence of collaterals (p less than 0.05); the extent of combined periinfarctional and distant redistribution was also larger in collateralized patients (p less than 0.025), whereas the size of the persistent perfusion defect was similar in both groups. By prospective analysis the tomographic perfusion pattern of combined periinfarctional and distant redistribution revealed a sensitivity of 85% and a specificity of 78% for the detection of significant collateral circulation in this group of patients. Thus, using the exhausted flow reserve as a diagnostic tool, vasodilation-thallium-201 tomography has the potential to identify and quantitate collateralized myocardium in post-infarction patients and may guide diagnostic and therapeutic decision-making.

  8. Dicty_cDB: CHB210 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available library) CHB210 (Link to dictyBase) - - - Contig-U15820-1 CHB210P (Link to Original site) CHB210F 128 CHB210Z...CHB210Z 568 CHB210P 676 - - Show CHB210 Library CH (Link to library) Clone ID CHB210 (Link to dictyBase)...biol.tsukuba.ac.jp/CSM/CH/CHB2-A/CHB210Q.Seq.d/ Representative seq. ID CHB210P (Link to Original site)...site) Representative DNA sequence >CHB210 (CHB210Q) /CSM/CH/CHB2-A/CHB210Q.Seq.d/ ACTGTTGGCCTACTGGNAAAAA.../CSM/SL/SLC4-A/SLC418Q.Seq.d/ 1106 0.0 CHB210 (CHB210Q) /CSM/CH/CHB2-A/CHB210Q.Seq.d/ 1106 0.0 CHC647 (CHC647Q)

  9. [Characterization of kale (Brassica oberacea var acephala) under thallium stress by in situ attenuated total reflection FTIR].

    Science.gov (United States)

    Yao, Yan; Zhang, Ping; Wang, Zhen-Chun; Chen, Yong-Heng

    2009-01-01

    The experiment was designed based on consumption of carbon dioxide through the photosynthesis of Brassica oberacea var acephala leaf, and the photosynthesis of kale leaf under thallium stress was investigated by in situ attenuated total reflection FTIR (in situ ATR-FTIR). The ATR-FTIR showed that the absorption peaks of leaves had no obvious difference between plants growing in thallium stress soil and plants growing in non-thallium pollution soil, and the strong peaks at 3,380 cm(-1) could be assigned to the absorption of water, carbohydrate, protein or amide; the strong peaks at 2,916 and 2,850 cm(-1) assigned to the absorption of carbohydrate or aliphatic compound; the peaks at 1,640 cm(-1) assigned to the absorption of water. However, as detected by the in situ ATR-FTIR, the double peaks (negative peaks) at 2,360 and 2,340 cm(-1) that are assigned to the absorption of CO2 appeared and became high gradually. It was showed that kale was carrying photosynthesis. At the same time, the carbon dioxide consumption speed of leaf under thallium stress was obviously larger than that of the blank It was expressed that photosynthesis under thallium stress was stronger than the blank All these represented that kale had certain tolerance to the heavy metal thallium. Meanwhile, the carbon dioxide consumption of grown-up leaf was more than that of young leaf whether or not under thallium stress. It was also indicated that the intensity of photosynthesis in grown-up leaf is higher than that in young leaf.

  10. Thallium and manganese complexes involved in the luminescence emission of potassium-bearing aluminosilicates

    Energy Technology Data Exchange (ETDEWEB)

    Gomez-Gonzalez, Miguel A., E-mail: miguel.gomez@mncn.csic.es [Museo Nacional de Ciencias Naturales, CSIC, Jose Gutierrez Abascal 2, Madrid E-28006 (Spain); Garcia-Guinea, Javier, E-mail: guinea@mncn.csic.es [Museo Nacional de Ciencias Naturales, CSIC, Jose Gutierrez Abascal 2, Madrid E-28006 (Spain); Garrido, Fernando, E-mail: fernando.garrido@mncn.csic.es [Museo Nacional de Ciencias Naturales, CSIC, Jose Gutierrez Abascal 2, Madrid E-28006 (Spain); Townsend, Peter D., E-mail: pdtownsend@gmail.com [School of Science and Technology, University of Sussex, Brighton BN1 9QH (United Kingdom); Marco, Jose-Francisco, E-mail: jfmarco@iqfr.csic.es [Instituto de Química-Física Rocasolano, CSIC, Calle Serrano 119, Madrid E-28006 (Spain)

    2015-03-15

    The luminescence emission at 285 nm in natural K-feldspar has been studied by Russian groups and associated with thallium ions in structural positions of K{sup +} sites as artificially thallium-doped feldspars display the same emission band. Here attention is focussed on spectra of CL emission bands centered near 285 and 560 nm from paragenetic adularia, moscovite and quartz micro-inclusions. With accesorial thallium they show clear resemblances to each other. Associated sedimentary and hydrothermal aluminosilicate samples collected from Guadalix (Madrid, Spain) were analyzed with a wide range of experimental techniques including Environmental Scanning Electron Microscopy (ESEM) with an attached X-Ray Energy-Dispersive Spectrometer (EDS) and a cathodoluminescence probe (CL) and Electron Probe Microanalysis (EPMA), X-Ray Fluorescence Spectrometry (XRF), Inductively Coupled Plasma-Optical Emission Spectrometry (ICP-OES), Differential and Thermogravimetric Analyses (DTA-TG), radioluminescence (RL), Mössbauer spectroscopy and X-Ray Photoelectron Spectrometry (XPS). The luminescence emission bands at 285 and 560 nm seem to be associated with hydrous thallium–manganese complexes bonded to potassium-bearing aluminosilicates since various minerals such as K-feldspar, moscovite and quartz micro-inclusions display similar CL spectra, accesorial thallium and hydroxyl groups. The presence of iron introduces a brown color which is attributed to submicroscopic iron oxides detectable in the optical and chemical microanalysis, but this does not contribute to the luminescence emission. The XPS Mn 2p spectrum of the adularia sample at room temperature is composed of a spin–orbit doublet plus clear shake-up satellite structure ∼4 eV above the main photoemision lines and is consistent with Mn{sup 2+} in good agreement with the observed luminescence emission at 560 nm for aluminosilicates produced by a {sup 4}T1({sup 4}G)→{sup 6}A1({sup 6}S) transition in tetrahedrally

  11. Diagnostic value of 123I-phenylpentadecanoic acid (IPPA) metabolic and thallium 201 perfusion imaging in stable coronary artery disease.

    Science.gov (United States)

    Walamies, M; Turjanmaa, V; Koskinen, M; Uusitalo, A

    1993-08-01

    The diagnostic value of 123I-phenylpentadecanoic acid (IPPA) metabolic cardiac imaging was studied in a group (n = 29) of patients with angiographically confirmed CAD using single photon emission computed tomography (SPECT). A symptom-limited exercise test was first done with IPPA, and 2 days later with thallium. Medications were not withheld during testing. Fourteen healthy control subjects participated in parallel IPPA and 15 in thallium tests. Data acquisition and output were comparable in the two imaging modalities. By testing various relatively simple criteria for abnormality we found that the semiquantitative interpretation was more accurate than the visual readings. The best compromise of accuracy with the scored criteria consisted of a sensitivity of 86% and a specificity of 86%, obtained with IPPA polar tomograms (mild exercise defect) and a sensitivity of 86% and a specificity of 80% obtained with thallium (regionally decreased washout). With visual interpretation alone, a sensitivity of 83% and a specificity of 71% was detected with IPPA (mild exercise defect) and 72% and 73%, respectively, with thallium (partial reversibility). The sensitivity of the exercise ECG alone was 62%. The results of this study imply that IPPA imaging could be a rational, uncomplicated clinical method for non-invasive diagnosis of CAD. The diagnostic ability of IPPA is at least as good as that of thallium, and it is possible to use them in succession.

  12. Dilatation of the left ventricular cavity on dipyridamole thallium-201 imaging: A new marker of triple-vessel disease

    Energy Technology Data Exchange (ETDEWEB)

    Takeishi, Y.; Tono-oka, I.; Ikeda, K.; Komatani, A.; Tsuiki, K.; Yasui, S. (Yamagata Univ. School of Medicine (Japan))

    1991-02-01

    To investigate the significance and mechanism of dilatation of the left ventricular cavity on dipyridamole thallium-201 imaging, we performed both dipyridamole thallium-201 imaging and dipyridamole radionuclide angiography on 83 patients with known angiograms. The dipyridamole/delayed ratio of the left ventricular dimension from the thallium-201 image was defined as the left ventricular dilatation ratio (LVDR). An LVDR greater than the mean + two standard deviations in patients without coronary artery disease was defined as abnormal. Twenty-two of 83 patients showed an abnormal LVDR, and 18 of the 22 patients (82%) had triple-vessel disease. By defect and washout analysis, the sensitivity and specificity for correctly identifying the patients as having triple-vessel disease was 72% and 76%, respectively, whereas LVDR had a sensitivity of 72% and a specificity of 93%. When LVDR was used in combination with the defect and washout criteria, sensitivity increased to 84% without a loss of specificity. In those 22 patients with abnormal LVDRs, end-diastolic volume measured by radionuclide angiography did not change after dipyridamole infusion. Dilatation of the left ventricular cavity on dipyridamole thallium-201 imaging reflected relative subendocardial hypoperfusion induced by dipyridamole rather than actual chamber enlargement. The LVDR was moderately sensitive and highly specific for triple-vessel disease and provided complementary information to dipyridamole thallium-201 imaging.

  13. 17 CFR 210.3A-01 - Application of § 210.3A-01 to § 210.3A-05.

    Science.gov (United States)

    2010-04-01

    ... Financial Statements § 210.3A-01 Application of § 210.3A-01 to § 210.3A-05. Sections 210.3A-01 to 210.3A-05 shall govern the presentation of consolidated and combined financial statements. ... COMMISSION FORM AND CONTENT OF AND REQUIREMENTS FOR FINANCIAL STATEMENTS, SECURITIES ACT OF 1933, SECURITIES...

  14. Carcinogenic risk of lead-210 and polonium-210 in tobacco smoke: a selected, annotated bibliography

    Energy Technology Data Exchange (ETDEWEB)

    Travis, C.C.; Etnier, E.L.; Kirkscey, K.A.

    1978-05-01

    This bibliography is concerned with the possible carcinogenic risk to man from the presence of lead-210 and polonium-210 in tobacco smoke. It includes a data base on such topics as background levels of lead-210 and polonium-210 in tobacco and tobacco smoke, tobacco plant uptake of lead-210 and polonium-210 from soil, metabolic models, and dose estimates. This data base should be of interest to those concerned with assessing the health effects resulting from the emanation of radan-222 from natural and technologically enhanced sources.

  15. Is ecological food also radioecological? - 210Po and 210Pb studies.

    Science.gov (United States)

    Strumińska-Parulska, Dagmara; Olszewski, Grzegorz

    2018-01-01

    Presented are results of a study on accumulation of naturally occurring 210Po and 210Pb in ecological and conventional farming food products in Poland: fruits, vegetables and cereals. The main idea behind this research was to determine the activity concentrations of 210Po and 210Pb in ecological and commercial food as well as calculate and compare the effective dose (radiation) connected to different origin of analyzed food products consumption. The studies showed the majority of all compared food samples contained similar 210Po and 210Pb activities and statistically, the consumption of organic and commercial food would give similar annual effective dose. Copyright © 2017 Elsevier Ltd. All rights reserved.

  16. 210Po and 210Pb in Forest Soil and in Wild Berries in Finland

    Science.gov (United States)

    Vaaramaa, Kaisa; Solatie, Dina; Aro, Lasse; Lehto, Jukka

    2008-08-01

    The behaviour of 210Po and 210Pb was investigated in forests in the Southern Finland site and in the Northern Finland site. Sampling sites were in Scots pine (Pinus sylvestris) forests. Maximum activities of 210Po and 210Pb in soil columns were found in organic layers. According to preliminary results of wild berry samples, the lowest 210Po concentrations were found in berries. The highest concentration of 210Po was found in stems of the blueberry (Vaccinium myrtillus) and the lingonberry (Vaccinium vitis-idaea) samples.

  17. Dicty_cDB: SSF210 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SS (Link to library) SSF210 (Link to dictyBase) - - - Contig-U16581-1 SSF210P (Link to Original site) SSF...210F 183 SSF210Z 197 SSF210P 380 - - Show SSF210 Library SS (Link to library) Clone ID SSF... URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SS/SSF2-A/SSF210Q.Seq.d/ Representative seq. ID SSF...210P (Link to Original site) Representative DNA sequence >SSF210 (SSF210Q) /CSM/SS/SSF2-A/SSF2...TA sequence update 1998.10. 1 Translated Amino Acid sequence inkkkkkkikknlisfkmv*

  18. Aspects on the analysis of 210Po

    DEFF Research Database (Denmark)

    Henricsson, F.; Ranebo, Y.; Holm, E.

    2011-01-01

    , no radiochemical yield determinant was used and it was generally supposed that the yield was 100% after two depositions. Counting was often done using ZnS scintillation counter coupled to a photomultiplier tube. However, the use of the yield determinants 208Po and 209Po and the development of alpha spectrometry...... and the waiting time between deposition and measurement of the sample. A further consequence of this is that in the assessment of the 210Pb content in the sample, very often the remaining liquid is stored after deposition for build-up of 210Po. Since some 210Pb is lost on the disc, the result for 210Pb...

  19. 17 CFR 210.9-01 - Application of §§ 210.9-01 to 210.9-07

    Science.gov (United States)

    2010-04-01

    ... COMMISSION FORM AND CONTENT OF AND REQUIREMENTS FOR FINANCIAL STATEMENTS, SECURITIES ACT OF 1933, SECURITIES....9-01 Application of §§ 210.9-01 to 210.9-07 This article is applicable to consolidated financial statements filed for bank holding companies and to any financial statements of banks that are included in...

  20. A preliminary investigation and evaluation of the thallium environmental impacts of the unmined Xiangquan thallium-only deposit in Hexian, China

    Science.gov (United States)

    Zhou, Taofa; Fan, Yu; Yuan, Feng; Cooke, David; Zhang, Xin; Li, Liangjun

    2008-03-01

    The Xiangquan Thallium-only deposit in Hexian, east China is a newly found near-surface and unmined shallow-seated thallium deposit. The 250t Tl deposit is hosted in Lower Ordovician Lunshan Group as lenticular and confined by northeast F1, F2 faults. The metallic minerals are dominated by pyrite, more than 95% Tl occurs in pyrite as tiny individual grains or as ‘‘invisible thallium”. Tl and other trace elements pollution in ecosystems such as soils, surface and ground waters and water sediments, plants and crops, and animal and human beings in Xiangquan near the Tl ore deposit have been investigated and evaluated. Results show that Tl as well as As and Sb in ecosystems in Xiangquan around the deposit have enriched, they came from Tl-pyrite in the ore bodies and in the parent rocks of weathered soils on top of the ore bodies and went into the nearby ecosystems through weathering, leaching and dissolving. In 2 km2 around the Xiaolongwang Mountain where the Tl ore deposit seated, soils, vegetables, crops have been polluted or heavily polluted by Tl, As and Sb. Farmlands near the ore body are not fit to grow vegetables and crops. Thermal Spring water in Xiangquan town and pond water close to the Tl deposit are not potable. Tl also enriches in human hair and urinate of villagers who live close to the Tl deposit. Even through the Tl-only deposit has put clear environmental impacts on the local environment and ecosystems around it, no serious consequences of Tl pollution have so far taken place due to unmining of the Tl deposit as well as the screen effect of the silicficious breccia cap on top of it. All this work adds new knowledge to understand Tl behavior in unmined Tl deposit, and also benefit to the local environmental protection and the future mineral resources exploration.

  1. 210Po and 210Pb disequilibrium at the PN section in the East China Sea.

    Science.gov (United States)

    Su, Kaijun; Du, Jinzhou; Baskaran, Mark; Zhang, Jing

    2017-08-01

    Lead-210 and 210Po have been widely used as tracers for quantifying particulate scavenging in the upper layer of the oceanic water column. In this study, we investigated the 210Po/210Pb disequilibrium in the water column of the PN section in the East China Sea (ECS) during autumn 2013. In most of the water column, a deficiency of 210Po was observed with respect to its parent nuclide 210Pb (i.e., a 210Po/210Pb activity ratio < 1.0). The (210Po/210Pb)dissolved, (210Po/210Pb)particulate and (210Po/210Pb)total activity ratios ranged from 0.29 to 0.71 (average: 0.53 ± 0.13, n = 27), 0.31 to 1.42 (average: 0.70 ± 0.27, n = 27) and 0.22 to 0.62 (average: 0.50 ± 0.12, n = 27), respectively. The distribution coefficients (Kd) of 210Po and 210Pb were 12.1× 104 ml g-1 and 8.8× 104 ml g-1, with an average (210Po/210Pb) total activity ratio of (0.50 ± 0.12, n = 27). However, over the continental shelf, planktonic detritus and fecal pellets appear to be the main carriers for 210Po, which preferentially scavenges 210Po and produces a lower (210Po/210Pb) total activity ratio (0.49 ± 0.12, n = 22) with a Kd for 210Po of 13.8× 104 ml g-1 in the water column. The variations in the fractionation factor (1.48 ± 0.66) of 210Po/210Pb reveal distinct differences between the distribution and scavenging of 210Po and 210Pb by particulate matter in different marine environments: in the estuarine zone (a high turbidity area), terrigenous suspended particulate matter scavenges 210Pb from the water column, while in areas dominated by biogenic particular matter, 210Po is preferentially scavenged from the water column. Using the 210Po/210Pb disequilibrium in the water column, we estimated the removal fluxes of POC from the upper waters downward to be 25.0 mg C m-2 d-1, comparable to those in other marginal seas. Moreover, a decreasing trend of POC removal fluxes was observed with increasing distance offshore. Copyright © 2016 Elsevier Ltd. All rights

  2. {sup 201}Thallium SPECT, accuracy in astrocytoma diagnosis and treatment evaluation

    Energy Technology Data Exchange (ETDEWEB)

    Kaellen, K

    1999-10-01

    The aims of the studies included in this thesis were: - to investigate the reliability of {sup 201}Thallium single photon emission computed tomography. Tl SPECT for preoperative diagnosis and histological staging of malignant astrocytomas in comparison with CT; - to develop a method for quantification of cerebral thallium uptake, and to evaluate the quantitative measurement in comparison with CT, for astrocytoma treatment follow-up purposes; - to compare quantitative Tl SPECT and proton magnetic resonance spectroscopy (H-MRS) with conventional MR imagingfor astrocytoma monitoring, and to evaluate associations between change of morphological tumour characteristics during treatment and changes of cerebral thallium uptake and metabolic ratios. Results and conclusions: - High TI-index, calculated as a ratio comparing tumour uptake to uptake in the contralateral hemisphere, is an indicator of highly malignant astrocytoma. Differentiation between the high-grade astrocytomas, the low-grade astrocytomas, and infectious lesions is only partial, with an overlap of Tl-indexes between these groups. High-grade astrocytomas that do not show contrast enhancement on CT, and astrocytomas with central necrosis and moderate ring-enhancement, tend to be underestimated when evaluated by Tl-index calculation. Tl SPECT is not a reliable method for non-invasive tumour staging among the group of highly malignant astrocytomas. - Quantification of cerebral TI-uptake, defining the volume of viable tumour tissue, is a new method for astrocytoma chemotherapy monitoring. Results suggest that the method provides prognostic information, and information of treatment efficacy, at an earlier stage than CT. - We did not find a higher accuracy of quantitative Tl SPECT than of MR for monitoring purposes and our results indicated that treatment induced MR changes were interrelated with TI-uptake variations. - Multi-voxel H-MRS was difficult to apply for astrocytoma treatment monitoring, due to the

  3. A Novel Ion - selective Polymeric Membrane Sensor for Determining Thallium(I) With High Selectivity

    Science.gov (United States)

    Kassim, Anuar; Rezayi, Majid; Ahmadzadeh, Saeid; Rounaghi, Gholamhossein; Mohajeri, Masoomeh; Azah Yusof, Noor; Tee, Tan Wee; Yook Heng, Lee; Halim Abdullah, Abd

    2011-02-01

    Thallium is a toxic metal that introduced into the environment mainly as a waste from the production of zinc, cadmium, and lead and by combustion of coal. Thallium causes gastrointestinal irritation and nerve damage when people are exposed to it for relatively short period of time. For long term, thallium has the potential to cause the following effects: change in blood chemistry, damage to liver, kidney, intestinal and testicular tissue, and hair loss. In this work a membrane was prepared by use of 4'-nitrobenzo -18-crown-6 (4'NB18C6) as an ion carrier, polyvinylchloride (PVC) as a matrix, and diocthylphetalate (DOP) as a plasticizer for making an ion selective electrode for measurement of Tl+ cation in solutions. The amount of 4'-nitrobenzo-18C6 and polyvinylchloride were optimized in the preparation of the membrane. The response of the electrode was Nernstian within the concentration range 1.0 × 10-8 to 1.0 × 10-1M. This sensor displays a drift in Nernstian response for this cation with increasing the amount of ionophore and decreasing the amount of polyvinylchloride.The results of potentiometric measurements showed that, this electrode also responses to Cu2+ Ni2+ and Pb2+ cations, but the electrode has a wider dynamic range and a lower detection limit to Tl+ cation. The effects of various parameters such as pH, different cations interferences, effect of the amount of ionophore and polyvinylchloride and time on response of the coated ion selective electrode were investigated. Finally the constructed electrode was used in complexometric and precipitation titrations of Tl+ cation with EDTA and KBr, respectively. The response of the fabricated electrode at concentration range from 1.0 × 10-8 to 1.0 × 10-1M is linear with a Nernstian slope of 57.27 mV.

  4. Oxidative stress and DNA damage in broad bean (Vicia faba L.) seedlings induced by thallium.

    Science.gov (United States)

    Radić, Sandra; Cvjetko, Petra; Glavas, Katarina; Roje, Vibor; Pevalek-Kozlina, Branka; Pavlica, Mirjana

    2009-01-01

    Thallium (Tl) is a metal of great toxicological concern because it is highly toxic to all living organisms through mechanisms that are yet poorly understood. Since Tl is accumulated by important crops, the present study aimed to analyze the biological effects induced by bioaccumulation of Tl in broad bean (Vicia faba L.) as well as the plant's antioxidative defense mechanisms usually activated by heavy metals. Thallium toxicity was related to production of reactive oxygen species in leaves and roots of broad bean seedlings following short-term (72 h) exposure to thallium (I) acetate (0, 0.5, 1, 5, and 10 mg/L) by evaluating DNA damage and oxidative stress parameters as well as antioxidative response. The possible antagonistic effect of potassium (K) was tested by combined treatment with 5 mg/L of Tl (Tl+) and 10 mg/L of potassium (K+) acetate. Accumulation of Tl+ in roots was 50 to 250 times higher than in broad bean shoots and was accompanied by increase in dry weight and proline. Despite responsive antioxidative defense (increased activities of superoxide dismutase, ascorbate peroxidase, and pyrogallol peroxidase), Tl+ caused oxidative damage to lipids and proteins as evaluated by malondialdehyde and carbonyl group levels, and induced DNA strand breaks. Combined treatment caused no oxidative alternations to lipids and proteins though it induced DNA damage. The difference in Tl-induced genotoxicity following both acellular and cellular exposure implies indirect DNA damage. Results obtained indicate that oxidative stress is involved in the mechanism of Tl toxicity and that the tolerance of broad bean to Tl is achieved, at least in part, through the increased activity of antioxidant enzymes.

  5. Thallium Intoxication Treated with Long-Term Hemodialysis, Forced Diuresis and Prussian Blue

    DEFF Research Database (Denmark)

    Larsen, Elfinn; Solgaard, Per Bent; Freund, L. Gade

    1978-01-01

    A 56 yr old woman, who ingested 2 g of thallium sulfate, was successfully treated with long-term hemodialysis for 200 h during 10 days, combined with forced diuresis and Prussian blue. The effect of the artificial kidney dialysis was determined by repeated analysis of the Tl concentration...... in the dialysis bath and in blood samples. During the 1st 120 h of hemodialysis, 143 mg of Tl was eliminated via the artificial kidney and 110 mg via the urinary tract. The present case of acute Tl intoxication is the 1st in which long-term hemodialysis has been used in the acute phase...

  6. Experimental excitation functions of deuteron induced reactions on natural thallium up to 50 MeV

    Energy Technology Data Exchange (ETDEWEB)

    Adam Rebeles, R., E-mail: radamreb@vub.ac.be [Cyclotron Laboratory, Vrije Universiteit Brussel, B-1090 Brussels (Belgium); Van den Winkel, P.; Hermanne, A. [Cyclotron Laboratory, Vrije Universiteit Brussel, B-1090 Brussels (Belgium); Tarkanyi, F.; Takacs, S. [Institute of Nuclear Research of the Hungarian Academy of Sciences, Debrecen H-4026 (Hungary)

    2012-10-01

    Excitation functions of deuteron induced reactions on natural thallium leading to the formation of {sup 204m,203m2+m1+g,202m,201m+g,200}Pb and {sup 202,201m+g,200m+g}Tl isotopes were determined up to 50 MeV. The cross sections were measured by an activation technique using stacked foil irradiation. The excitation functions of the investigated reactions are compared with data reported in literature and also with the theoretical results of TALYS nuclear reaction code. From the measured cross section data, the thick target yield for the medical interesting {sup 203}Pb isotope is calculated.

  7. Polonium-210 and lead-210 in the terrestrial environment: a historical review.

    Science.gov (United States)

    Persson, Bertil R R; Holm, Elis

    2011-05-01

    The radionuclides (210)Po and (210)Pb widely present in the terrestrial environment are the final long-lived radionuclides in the decay of (238)U in the earth's crust. Their presence in the atmosphere is due to the decay of (222)Rn diffusing from the ground. The range of activity concentrations in ground level air for (210)Po is 0.03-0.3 Bq m(-3) and for (210)Pb 0.2-1.5 Bq m(-3). In drinking water from private wells the activity concentration of (210)Po is in the order of 7-48 mBq l(-1) and for (210)Pb around 11-40 mBq l(-1). From water works, however, the activity concentration for both (210)Po and (210)Pb is only in the order of 3 mBq l(-1). Mosses, lichens and peat have a high efficiency in capturing (210)Po and (210)Pb from atmospheric fallout and exhibit an inventory of both (210)Po and (210)Pb in the order of 0.5-5 kBq m(-2) in mosses and in lichens around 0.6 kBq m(-2). The activity concentrations in lichens lies around 250 Bq kg(-1), dry mass. Reindeer and caribou graze lichen which results in an activity concentration of (210)Po and (210)Pb of about 1-15 Bq kg(-1) in meat from these animals. The food chain lichen-reindeer or caribou, and Man constitutes a unique model for studying the uptake and retention of (210)Po and (210)Pb in humans. The effective annual dose due to (210)Po and (210)Pb in people with high consumption of reindeer/caribou meat is estimated to be around 260 and 132 μSv a(-1) respectively. In soils, (210)Po is adsorbed to clay and organic colloids and the activity concentration varies with soil type and also correlates with the amount of atmospheric precipitation. The average activity concentration levels of (210)Po in various soils are in the range of 20-240 Bq kg(-1). Plants become contaminated with radioactive nuclides both by absorption from the soil (supported Po) and by deposition of radioactive fallout on the plants directly (unsupported Po). In fresh leafy plants the level of (210)Po is particularly high as the result of the

  8. 22 CFR 210.640 - Employee.

    Science.gov (United States)

    2010-04-01

    ... 22 Foreign Relations 1 2010-04-01 2010-04-01 false Employee. 210.640 Section 210.640 Foreign...) All indirect charge employees, unless their impact or involvement in the performance of work under the.... (b) This definition does not include workers not on the payroll of the recipient (e.g., volunteers...

  9. 13 CFR 134.210 - Intervention.

    Science.gov (United States)

    2010-01-01

    ... 13 Business Credit and Assistance 1 2010-01-01 2010-01-01 false Intervention. 134.210 Section 134... BEFORE THE OFFICE OF HEARINGS AND APPEALS Rules of Practice for Most Cases § 134.210 Intervention. (a) By... intervention to protect such interest. An interested person is any individual, business entity, or governmental...

  10. 22 CFR 210.650 - Grant.

    Science.gov (United States)

    2010-04-01

    ... 22 Foreign Relations 1 2010-04-01 2010-04-01 false Grant. 210.650 Section 210.650 Foreign Relations AGENCY FOR INTERNATIONAL DEVELOPMENT GOVERNMENTWIDE REQUIREMENTS FOR DRUG-FREE WORKPLACE... Federal agency and the recipient when carrying out the activity contemplated by the award. ...

  11. 33 CFR 183.210 - Reference areas.

    Science.gov (United States)

    2010-07-01

    ... 33 Navigation and Navigable Waters 2 2010-07-01 2010-07-01 false Reference areas. 183.210 Section... of More Than 2 Horsepower General § 183.210 Reference areas. (a) The forward reference area of a boat...) The aft reference area of a boat is the aft most two feet of the top surface of the hull or deck, as...

  12. 31 CFR 210.2 - Definitions.

    Science.gov (United States)

    2010-07-01

    ... 31 Money and Finance: Treasury 2 2010-07-01 2010-07-01 false Definitions. 210.2 Section 210.2 Money and Finance: Treasury Regulations Relating to Money and Finance (Continued) FISCAL SERVICE... or received by an agency. (l) Green Book means the manual issued by the Service which provides...

  13. 31 CFR 210.3 - Governing law.

    Science.gov (United States)

    2010-07-01

    ... 31 Money and Finance: Treasury 2 2010-07-01 2010-07-01 false Governing law. 210.3 Section 210.3 Money and Finance: Treasury Regulations Relating to Money and Finance (Continued) FISCAL SERVICE... Green Book. The Treasury Financial Manual is available for downloading at the Service's web site at http...

  14. 31 CFR 800.210 - Effective date.

    Science.gov (United States)

    2010-07-01

    ... 31 Money and Finance: Treasury 3 2010-07-01 2010-07-01 false Effective date. 800.210 Section 800.210 Money and Finance: Treasury Regulations Relating to Money and Finance (Continued) OFFICE OF INVESTMENT SECURITY, DEPARTMENT OF THE TREASURY REGULATIONS PERTAINING TO MERGERS, ACQUISITIONS, AND...

  15. 47 CFR 73.210 - Station classes.

    Science.gov (United States)

    2010-10-01

    ... 47 Telecommunication 4 2010-10-01 2010-10-01 false Station classes. 73.210 Section 73.210 Telecommunication FEDERAL COMMUNICATIONS COMMISSION (CONTINUED) BROADCAST RADIO SERVICES RADIO BROADCAST SERVICES FM... forth in § 73.211. If a station has an ERP and an antenna HAAT such that it cannot be classified using...

  16. 40 CFR 86.210-94 - [Reserved

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 18 2010-07-01 2010-07-01 false 86.210-94 Section 86.210-94 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) AIR PROGRAMS (CONTINUED) CONTROL OF... Year Gasoline-Fueled New Light-Duty Vehicles, New Light-Duty Trucks and New Medium-Duty Passenger...

  17. 31 CFR 537.210 - Exempt transactions.

    Science.gov (United States)

    2010-07-01

    ... 31 Money and Finance: Treasury 3 2010-07-01 2010-07-01 false Exempt transactions. 537.210 Section 537.210 Money and Finance: Treasury Regulations Relating to Money and Finance (Continued) OFFICE OF... personal and household effects set forth in §§ 537.511 and 537.514. ...

  18. 31 CFR 210.11 - Limited liability.

    Science.gov (United States)

    2010-07-01

    ... 31 Money and Finance: Treasury 2 2010-07-01 2010-07-01 false Limited liability. 210.11 Section 210.11 Money and Finance: Treasury Regulations Relating to Money and Finance (Continued) FISCAL SERVICE, DEPARTMENT OF THE TREASURY FINANCIAL MANAGEMENT SERVICE FEDERAL GOVERNMENT PARTICIPATION IN THE AUTOMATED...

  19. 31 CFR 210.8 - Financial institutions.

    Science.gov (United States)

    2010-07-01

    ... 31 Money and Finance: Treasury 2 2010-07-01 2010-07-01 false Financial institutions. 210.8 Section 210.8 Money and Finance: Treasury Regulations Relating to Money and Finance (Continued) FISCAL SERVICE, DEPARTMENT OF THE TREASURY FINANCIAL MANAGEMENT SERVICE FEDERAL GOVERNMENT PARTICIPATION IN THE AUTOMATED...

  20. 31 CFR 210.10 - RDFI liability.

    Science.gov (United States)

    2010-07-01

    ... 31 Money and Finance: Treasury 2 2010-07-01 2010-07-01 false RDFI liability. 210.10 Section 210.10 Money and Finance: Treasury Regulations Relating to Money and Finance (Continued) FISCAL SERVICE, DEPARTMENT OF THE TREASURY FINANCIAL MANAGEMENT SERVICE FEDERAL GOVERNMENT PARTICIPATION IN THE AUTOMATED...

  1. 31 CFR 210.6 - Agencies.

    Science.gov (United States)

    2010-07-01

    ... 31 Money and Finance: Treasury 2 2010-07-01 2010-07-01 false Agencies. 210.6 Section 210.6 Money and Finance: Treasury Regulations Relating to Money and Finance (Continued) FISCAL SERVICE, DEPARTMENT OF THE TREASURY FINANCIAL MANAGEMENT SERVICE FEDERAL GOVERNMENT PARTICIPATION IN THE AUTOMATED...

  2. 41 CFR 101-29.210 - Product.

    Science.gov (United States)

    2010-07-01

    ... 41 Public Contracts and Property Management 2 2010-07-01 2010-07-01 true Product. 101-29.210... FEDERAL PROPERTY MANAGEMENT REGULATIONS SUPPLY AND PROCUREMENT 29-FEDERAL PRODUCT DESCRIPTIONS 29.2-Definitions § 101-29.210 Product. The term product is any end item, either manufactured or produced, and also...

  3. Inhalation of {sup 210}Po and {sup 210}Pb from cigarette smoking in Poland

    Energy Technology Data Exchange (ETDEWEB)

    Skwarzec, B. E-mail: bosk@chemik.chem.univ.gda.pl; Ulatowski, J.; Struminska, D.I.; Borylo, A

    2001-07-01

    The carcinogenic effect of {sup 210}Po and {sup 210}Pb with respect to lung cancer is an important problem in many countries with very high cigarette consumption. Poland has one of the highest consumptions of cigarettes in the world. The results of {sup 210}Po determination on the 14 most frequently smoked brands of cigarettes which constitute over 70% of the total cigarette consumption in Poland are presented and discussed. Moreover, the polonium content in cigarette smoke was estimated on the basis of its activity in fresh tobaccos, ash, fresh filters and post-smoking filters. The annual effective doses were calculated on the basis of {sup 210}Po and {sup 210}Pb inhalation with the cigarette smoke. The results of this work indicate that Polish smokers who smoke one pack (20 cigarettes) per day inhale from 20 to 215 mBq of {sup 210}Po and {sup 210}Pb each. The mean values of the annual effective dose for smokers were estimated to be 35 and 70 {mu}Sv from {sup 210}Po and {sup 210}Pb, respectively. For persons who smoke two packs of cigarettes with higher radionuclide concentrations, the effective dose is much higher (471 {mu}Sv yr{sup -1}) in comparison with the intake in diet. Therefore, cigarettes and the absorption through the respiratory system are the main sources and the principal pathway of {sup 210}Po and {sup 210}Pb intake of smokers in Poland.

  4. Influence of submarine groundwater discharge on (210)Po and (210)Pb bioaccumulation in fish tissues.

    Science.gov (United States)

    Garcia-Orellana, J; López-Castillo, E; Casacuberta, N; Rodellas, V; Masqué, P; Carmona-Catot, G; Vilarrasa, M; García-Berthou, E

    2016-05-01

    This study presents the results of the accumulation of (210)Po and (210)Pb in fish tissues and organs in a brackish-water marshland that is characterized by high concentrations of (222)Rn and (226)Ra supplied by submarine groundwater discharge (SGD). Tissues and organs from Cyprinus carpio, Chelon labrosus and Carassius auratus in the wetland were significantly enriched by both (210)Pb and (210)Po (up to 55 and 66 times, respectively) compared to blanks. The major input route of (210)Pb and (210)Po into the fish body seems to be through ingestion, due to the high levels of (210)Pb and (210)Po found in the gut content as well as in organs involved in digestion and metabolism (i.e. gut, kidney and hepatopancreas). Results showed that (210)Po was more accumulated in all fish tissues and organs except for the spine, which showed a higher affinity for (210)Pb, due to its capacity to replace Ca from apatite in bones. Over all the variables analyzed, fish tissues/organs and, secondarily, fish species were the most important factors explaining the concentration of radionuclides, whereas fish length and the sampling location played a minor role. The relationship of the two radionuclides varied markedly among tissues and their concentration levels were only correlated in gills, gut and, marginally, in spines. In general, the highest values of (210)Pb and (210)Po concentrations in tissues were found on C. labrosus tissues rather C. auratus and C. carpio. This study demonstrates that inputs of natural radionuclides supplied by SGD to coastal semi-enclosed areas (such as marshlands, lagoons or ponds) may significantly increase the contents of (210)Pb and (210)Po in fish tissues/organs. Thus, this study represents one of the first evidences of direct ecological effects derived from SGD. Copyright © 2016 Elsevier Ltd. All rights reserved.

  5. Application of Hyphenated Techniques in Speciation Analysis of Arsenic, Antimony, and Thallium

    Science.gov (United States)

    Michalski, Rajmund; Szopa, Sebastian; Jabłońska, Magdalena; Łyko, Aleksandra

    2012-01-01

    Due to the fact that metals and metalloids have a strong impact on the environment, the methods of their determination and speciation have received special attention in recent years. Arsenic, antimony, and thallium are important examples of such toxic elements. Their speciation is especially important in the environmental and biomedical fields because of their toxicity, bioavailability, and reactivity. Recently, speciation analytics has been playing a unique role in the studies of biogeochemical cycles of chemical compounds, determination of toxicity and ecotoxicity of selected elements, quality control of food products, control of medicines and pharmaceutical products, technological process control, research on the impact of technological installation on the environment, examination of occupational exposure, and clinical analysis. Conventional methods are usually labor intensive, time consuming, and susceptible to interferences. The hyphenated techniques, in which separation method is coupled with multidimensional detectors, have become useful alternatives. The main advantages of those techniques consist in extremely low detection and quantification limits, insignificant interference, influence as well as high precision and repeatability of the determinations. In view of their importance, the present work overviews and discusses different hyphenated techniques used for arsenic, antimony, and thallium species analysis, in different clinical, environmental and food matrices. PMID:22654649

  6. Evaluation of myocardial abnormalities in collagen diseases by thallium-201 myocardial scintigraphy

    Energy Technology Data Exchange (ETDEWEB)

    Yamano, Shigeru; Kagoshima, Tadashi; Sugihara, Kiyotaka (Nara Medical Univ., Kashihara (Japan)) (and others)

    1993-12-01

    This study was performed to evaluate myocardial abnormalities in patients with collagen diseases by exercise and rest thallium-201 myocardial scintigrams. A total of 65 patients without ischemic ECG changes, consisting of 18 with systemic lupus erythematosus (SLE), 18 with polymyositis (PM), 8 with progressive systemic sclerosis (PSS), and 21 with Sjoegren's syndrome (SjS), was enrolled in this study. Reversible exercise-induced defects scintigraphically suggesting myocardial ischemia were noted in 8 cases of SLE, 4 cases of PM, 4 cases of PSS, and 3 cases of SjS. Nineteen patients had exercise-induced defects and underwent cardiac catheterization, 8 of whom had normal coronary angiograms. Fixed hypoperfusion areas were observed in one case of SLE, 6 cases of PM and 3 cases of SjS. Rest thallium-201 myocardial scintigram disclosed hypoperfusion areas which were not induced by exercise in 2 cases of SLE, 3 cases of PM, one case of PSS and 5 cases of SjS. Echocardiogram showed no significant differences in ejection fraction and % fractional shortening between the disease groups and healthy control group. These findings suggest that patients with collagen diseases have abnormalities of coronary circulation at the level of the intramural vasculature before cardiac function impairment, myocardial fibrosis and functional abnormalities at the cell membrane. (author).

  7. Follow-up Thallium-201 scintigraphy after mantle field radiotherapy for Hodgkin's disease

    Energy Technology Data Exchange (ETDEWEB)

    Pierga, J.Y.; Girinski, T.; Henry-Amar, M. (Institut Gustave Roussy, Villejuif (France)); Maunoury, C.; Valette, H.; Tchernia, G.; Desgrez, A. (Centre Hospitalier de Bicetre, Le Kremlin-Bicetre (France)); Socie, G. (Institut Gustave Roussy, Villejuif (France) Hopital St Louis, Paris (France)); Cosset, J.M. (Institut Gustave Roussy, Villejuif (France) Institut Curie, Paris (France))

    1993-04-02

    Assessment of the long-term cardiac effects of mediastinal radiotherapy for Hodgkin's disease, by Thallium scintigraphy. 32 patients (14 males and 18 females) who underwent mantle field radiotherapy for Hodgkin's disease were included in this study. Twenty patients received 4 fractions of 2.5 Gy per week and 12, five fraction of 2 Gy per week, delivered on alternate days. All the patients, except three, performed exercise testing electrocardiogram and Thallium-201 tomoscintigraphy. The average time interval from completion of treatment to the study was 7 years (range 3--13 years). No patients had clinical symptoms of cardiac disease. Mean age at the time of the study was 35 years (range 23--48 years). Two electrocardiograms revealed left bundle branch block and the patients were excluded from the study. Only one out of 27 exercise electrocardiograms was abnormal in a patient with mitral valve prolapse, who was also excluded from the study. Twenty-six scintigraphies were evaluable. Twenty-two (85%) were clearly abnormal with partial or complete redistribution on delayed images. The anterior region was affected in 19 of these cases (86%). Four explorations were undoubtedly normal. Coronary angiography was not performed for ethical reasons in these asymptomatic patients. Despite possible false positive tests, the high rate of abnormality (85%) in this small series is striking. These preliminary data justify larger studies and a close long-term follow-up of these patients. 24 refs., 1 fig., 2 tabs.

  8. Thallium occurrence and partitioning in soils and sediments affected by mining activities in Madrid province (Spain)

    Energy Technology Data Exchange (ETDEWEB)

    Gomez-Gonzalez, M.A.; Garcia-Guinea, J. [National Museum of Natural Sciences, CSIC, Jose Gutierrez Abascal 2, 28006 Madrid (Spain); Laborda, F. [Group of Analytical Spectroscopy and Sensors Group, Institute of Environmental Sciences, University of Zaragoza, Pedro Cerbuna 12, 50009 Zaragoza (Spain); Garrido, F., E-mail: fernando.garrido@mncn.csic.es [National Museum of Natural Sciences, CSIC, Jose Gutierrez Abascal 2, 28006 Madrid (Spain)

    2015-12-01

    Thallium (Tl) and its compounds are toxic to biota even at low concentrations but little is known about Tl concentration and speciation in soils. An understanding of the source, mobility, and dispersion of Tl is necessary to evaluate the environmental impact of Tl pollution cases. In this paper, we examine the Tl source and dispersion in two areas affected by abandoned mine facilities whose residues remain dumped on-site affecting to soils and sediments of natural water courses near Madrid city (Spain). Total Tl contents and partitioning in soil solid phases as determined by means of a sequential extraction procedure were also examined in soils along the riverbeds of an ephemeral and a permanent streams collecting water runoff and drainage from the mines wastes. Lastly, electronic microscopy and cathodoluminescence probe are used as a suitable technique for Tl elemental detection on thallium-bearing phases. Tl was found mainly bound to quartz and alumino-phyllosilicates in both rocks and examined soils. Besides, Tl was also frequently found associated to organic particles and diatom frustules in all samples from both mine scenarios. These biogenic silicates may regulate the transfer of Tl into the soil-water system. - Highlights: • Abandoned mine residues are Tl sources in soils of Madrid catchment area. • Tl was associated to quartz and aluminosilicates in both rocks and soils. • Tl was frequently found associated to organic particles and diatom frustules. • Cathodoluminescence is a suitable technique for Tl detection on soils and rocks.

  9. [Detecting Thallium in Water Samples using Dispersive Liquid Phase Microextraction-Graphite Furnace Atomic Absorption Spectroscopy].

    Science.gov (United States)

    Zhu, Jing; Li, Yan; Zheng, Bo; Tang, Wei; Chen, Xiao; Zou, Xiao-li

    2015-11-01

    To develope a method of solvent demulsification dispersive liquid phase microextraction (SD-DLPME) based on ion association reaction coupled with graphite furnace atomic absorption spectroscopy (GFAAS) for detecting thallium in water samples. Methods Thallium ion in water samples was oxidized to Tl(III) with bromine water, which reacted with Cl- to form TlCl4-. The ionic associated compound with trioctylamine was obtained and extracted. DLPME was completed with ethanol as dispersive solvent. The separation of aqueous and organic phase was achieved by injecting into demulsification solvent without centrifugation. The extractant was collected and injected into GFAAS for analysis. With palladium colloid as matrix modifier, a two step drying and ashing temperature programming process was applied for high precision and sensitivity. The linear range was 0.05-2.0 microg/L, with a detection limit of 0.011 microg/L. The relative standard derivation (RSD) for detecting Tl in spiked water sample was 9.9%. The spiked recoveries of water samples ranged from 94.0% to 103.0%. The method is simple, sensitive and suitable for batch analysis of Tl in water samples.

  10. The learning machine in quantitative chemical analysis : Part I. Anodic Stripping Voltammetry of Cadmium, Lead and Thallium

    NARCIS (Netherlands)

    Bos, M.; Jasink, G.

    1978-01-01

    The linear learning machine method was applied to the determination of cadmium, lead and thallium down to 10-8 M by anodic stripping voltammetry at a hanging mercury drop electrode. With a total of three trained multicategory classifiers, concentrations of Cd, Pb and Tl could be predicted with an

  11. Thallium chloride 201Tl combined with single photon emission computed tomography (SPECT) in the evaluation of vestibular schwannoma growth

    DEFF Research Database (Denmark)

    Charabi, Samih Ahmed; Lassen, N A; Thomsen, J

    1997-01-01

    Thallium chloride 201Tl combined with SPECT was performed in a series of 29 patients with neuroradiological evidence of vestibular schwannoma (VS). The relative tumor uptake (U) and relative tumor concentration (C) of the radiotracer 201Tl was determined, and the cerebellum served as a reference...

  12. Determination of {sup 210}Pb and {sup 210}Po in cigarette tobacco; Determinacao de {sup 210}Pb e {sup 210}Po em tabaco de cigarros nacionais

    Energy Technology Data Exchange (ETDEWEB)

    Peres, Ana Claudia

    1999-07-01

    Cigarette smoking is one of the important pathways that could contribute to enhance the radiation dose to man, due to the relatively large concentrations of {sup 210}Pb and {sup 210}Po found in tobacco leaves. In this work, concentrations of these two radionuclides were determined in eight of the most commercialized cigarette brands produced in Brazil. The samples analyzed were bought randomly in the market. The {sup 210}Pb was determined by counting the beta activity of the {sup 210}Bi in a gas flow proportional detector, after radiochemical separation and precipitation of the PbCr0{sub 4}. The {sup 210}Po was determined by alpha spectrometry, using a surface barrier detector, after radiochemical separation and spontaneous deposition of Po in copper disk. The results showed concentrations ranging from 11,9 to 30,2 mBq per gram of dry tobacco for {sup 210}Pb and from 10,9 to 27,4 mBq per gram of dry tobacco for {sup 210}Po. (author)

  13. 24 CFR 1710.210 - Roads.

    Science.gov (United States)

    2010-04-01

    ... (INTERSTATE LAND SALES REGISTRATION PROGRAM) LAND REGISTRATION Reporting Requirements § 1710.210 Roads. (a) State the estimated cost to the developer of the proposed road system. (b) If the developer is to...

  14. 5 CFR 551.210 - Computer employees.

    Science.gov (United States)

    2010-01-01

    ....210 Administrative Personnel OFFICE OF PERSONNEL MANAGEMENT CIVIL SERVICE REGULATIONS PAY... consist of: (1) The application of systems analysis techniques and procedures, including consulting with users, to determine hardware, software or system functional specifications; (2) The design, development...

  15. 19 CFR 210.16 - Default.

    Science.gov (United States)

    2010-04-01

    ... ADJUDICATION AND ENFORCEMENT Motions § 210.16 Default. (a) Definition of default. (1) A party shall be found in... effect of such order(s) upon the public health and welfare, competitive conditions in the U.S. economy...

  16. 29 CFR 1603.210 - Discovery.

    Science.gov (United States)

    2010-07-01

    ... STATE AND LOCAL GOVERNMENT EMPLOYEE COMPLAINTS OF EMPLOYMENT DISCRIMINATION UNDER SECTION 304 OF THE GOVERNMENT EMPLOYEE RIGHTS ACT OF 1991 Hearings § 1603.210 Discovery. (a) Unless otherwise ordered by the...

  17. Aspects on the analysis of 210Po.

    Science.gov (United States)

    Henricsson, F; Ranebo, Y; Holm, E; Roos, P

    2011-05-01

    There has been little development regarding analysis of polonium (Po) in environmental samples since the 1960 ies. This is due to the straightforward spontaneous deposition of this element on silver (Ag), nickel (Ni) or copper (Cu) without any radiochemical separation. For many years, no radiochemical yield determinant was used and it was generally supposed that the yield was 100% after two depositions. Counting was often done using ZnS scintillation counter coupled to a photomultiplier tube. However, the use of the yield determinants (208)Po and (209)Po and the development of alpha spectrometry showed that the yield was lower. Furthermore, the tendency of Po to volatilize at low temperatures constrains the sample preparation techniques; dry-ashing cannot be used. But during the wet-ashing procedure, there are still some losses. The aim of this study was to evaluate the Po losses during wet-ashing by the use of a double-tracer technique. We have found that the losses were about 30% when open glass beakers were used and about 17% when the samples were digested in microwave oven. When long-necked bottles (Kjeldahl flasks) were used, a loss of about 20% was registered. It has also been observed that (210)Pb to some extent is plating out together with its daughter nuclide Po during the electrochemical deposition. This will result in a systematic error since an unknown amount of supported (210)Po will be produced from the (210)Pb decay depending on the fraction of (210)Pb being deposited on the disc and the waiting time between deposition and measurement of the sample. A further consequence of this is that in the assessment of the (210)Pb content in the sample, very often the remaining liquid is stored after deposition for build-up of (210)Po. Since some (210)Pb is lost on the disc, the result for (210)Pb will be too low. Both these systematic errors give rise to a too high (210)Po/(210)Pb ratio. The fraction of (210)Pb which is plating out has been assessed in this

  18. Dicty_cDB: VHF210 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available VH (Link to library) VHF210 (Link to dictyBase) - - - Contig-U12400-1 | Contig-U16431-1 VHF...210P (Link to Original site) VHF210F 613 VHF210Z 636 VHF210P 1229 - - Show VHF210 Library VH (Link to library) Clone ID VHF...400-1 | Contig-U16431-1 Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/VH/VHF2-A/VHF...210Q.Seq.d/ Representative seq. ID VHF210P (Link to Original site) Representative DNA sequence >VHF210 (VHF...210Q) /CSM/VH/VHF2-A/VHF210Q.Seq.d/ AATAAAATGATAAGATCATCAATAAAAAATAAAATAACAACAACAAAAAGTTTATCATGT

  19. Bis(2-mercapto-1-R-imidazolyl)hydroborato complexes of aluminium, gallium, indium and thallium: compounds possessing gallium-gallium bonds and a trivalent thallium alkyl.

    Science.gov (United States)

    Yurkerwich, Kevin; Coleman, Fergal; Parkin, Gerard

    2010-08-14

    The reactions of bis(mercaptoimidazolyl)hydroborato derivatives [Bm(R)]M' (R = Me, Bu(t); M' = Li, Na, Tl) with MX(3) trihalides of aluminium, gallium and indium yield both 1:1 and 2:1 complexes of the types [Bm(R)]MX(2) and [Bm(R)](2)MX, respectively. Structurally characterized examples of the [Bm(R)]MX(2) series include [Bm(Me)]AlCl(2), [Bm(Me)]GaI(2), [Bm(Me)]InI(2), [Bm(Bu(t))]AlCl(2) and [Bm(Bu(t))]GaX(2) (X = Cl, Br, I), while structurally characterized examples of the [Bm(R)](2)MX series include [Bm(Bu(t))](2)InX (X = Cl, Br, I). In addition to the halide complexes, the trivalent dimethyl thallium complex [Bm(Bu(t))]TlMe(2) has been synthesized via the reaction of [Bm(Bu(t))]Tl with Me(2)TlCl. The reactions of [Bm(R)]M' with the monovalent halides, "GaI", InCl and InI, result in disproportionation. In the case of indium, the mononuclear complexes [Bm(Bu(t))](2)InI and [Bm(Bu(t))]InCl(kappa(2)-mim(Bu(t))) are obtained, whereas for gallium, dinuclear compounds that feature Ga-Ga bonds, namely [Bm(R)](GaI)(GaI)[Bm(R)] (R = Me, Bu(t)) have been isolated.

  20. Levels and transfer of {sup 210}Po and {sup 210}Pb in Nordic terrestrial ecosystems

    Energy Technology Data Exchange (ETDEWEB)

    Brown, J.E., E-mail: justin.brown@nrpa.n [Norwegian Radiation Protection Authority, PO Box 55, N-1332, Osteras (Norway); Gjelsvik, R. [Norwegian Radiation Protection Authority, PO Box 55, N-1332, Osteras (Norway); Roos, P. [RISO-DTU P.O. Box 49 DK-4000 Roskilde (Denmark); Kalas, J.A. [Norwegian Institute for Nature Research (NINA), Tungasletta 2, 7485 Trondheim (Norway); Outola, I. [STUK, Laippatie 4/P.O. BOX 14, 00881 Helsinki (Finland); Holm, E. [Norwegian Radiation Protection Authority, PO Box 55, N-1332, Osteras (Norway)

    2011-05-15

    Recent developments regarding environmental impact assessment methodologies for radioactivity have precipitated the need for information on levels of naturally occurring radionuclides within and transfer to wild flora and fauna. The objectives of this study were therefore to determine activity concentrations of the main dose forming radionuclides {sup 210}Po and {sup 210}Pb in biota from terrestrial ecosystems thus providing insight into the behaviour of these radioisotopes. Samples of soil, plants and animals were collected at Dovrefjell, Central Norway and Olkiluoto, Finland. Soil profiles from Dovrefjell exhibited an approximately exponential fall in {sup 210}Pb activity concentrations from elevated levels in humus/surface soils to 'supported' levels at depth. Activity concentrations of {sup 210}Po in fauna (invertebrates, mammals, birds) ranged between 2 and 123 Bq kg{sup -1} d.w. and in plants and lichens between 20 and 138 Bq kg{sup -1} d.w. The results showed that soil humus is an important reservoir for {sup 210}Po and {sup 210}Pb and that fauna in close contact with this media may also exhibit elevated levels of {sup 210}Po. Concentration ratios appear to have limited applicability with regards to prediction of activity concentrations of {sup 210}Po in invertebrates and vertebrates. Biokinetic models may provide a tool to explore in a more mechanistic way the behaviour of {sup 210}Po in this system.

  1. Thallium stress testing does not predict cardiovascular risk in diabetic patients with end-stage renal disease undergoing cadaveric renal transplantation

    Energy Technology Data Exchange (ETDEWEB)

    Holley, J.L.; Fenton, R.A.; Arthur, R.S. (Univ. of Pittsburgh, PA (USA))

    1991-05-01

    This study assessed the usefulness of thallium stress testing as a predictor of perioperative cardiovascular risk in diabetic patients with end-stage renal disease undergoing cadaveric renal transplantation. Demographic factors influencing the exercise performance in these patients were also examined. The medical records of 189 consecutive patients with diabetic nephropathy who were evaluated for cadaveric renal transplantation were reviewed. Thallium stress testing was the initial examination of cardiovascular status in 141 patients. An adequate examination was one in which at least 70% of maximum heart rate was achieved. A thallium stress test was normal if there were no ST segment depressions on the electrocardiogram and no perfusion abnormalities on the thallium scan. Forty-four patients underwent cardiac catheterization as the initial evaluation (Group C) and four patients underwent transplantation without a formal cardiovascular evaluation (Group D). Sixty-four of the 141 patients undergoing thallium stress testing had an adequate and normal examination (Group A). The incidence of perioperative cardiac events in this group was 2%. Seventy-seven patients (Group B) had an abnormal (n = 41) or an inadequate (n = 36) thallium stress test and most (n = 61) then underwent coronary angiography. The use of beta-blockers was the only predictor of an abnormal or inadequate thallium stress test. Forty-three percent of patients with inadequate or abnormal thallium stress tests had significant coronary artery disease on cardiac catheterization. The perioperative risk of cardiac events was not different in Group A versus Groups B, C, and D combined. Survival of Group A and B patients was not different but was significantly longer than that of Group C patients.

  2. Evaluation of thallium-201 scanning for detection of latent coronary artery disease

    Science.gov (United States)

    Johnson, P. C.; Leblanc, A.; Deboer, L.; Jhingran, S.

    1978-01-01

    The use of thallium imaging as a noninvasive method to accurately screen shuttle passengers for latent coronary artery disease was investigated. All radionuclide procedures were performed using an Anger type camera with a high resolution collimator. A minimum of 200,000 counts were collected for each image using a 20% window centered on the 69-83 keV X-rays. For the images obtained following injection with the patient at rest, the testing was begun 10 minutes after injection. Injections of TT during exercise were made at a point near the termination of the treadmill procedure as determined by either the appearance of ST segment changes on the electrocardiogram consistant with subendocardial ischemia, the appearance of angina-like chest pain in the patient or fatigue in the patient which required cessation of the test. The severity of heart disease was based on the medical history, physical exam, exercise electrocardiograms, chest X-rays and the coronary arteriogram.

  3. Thallium Analysis in Environmental Samples by Inductively Coupled Plasma Mass Spectrometry; Analisis de Talio en Muestras Ambientales por Espectrometria de Masas con Fuente de Plasma de Acoplamiento Inductivo

    Energy Technology Data Exchange (ETDEWEB)

    Higueras, I.; Fernandez, M.; Conde, E.; Gajate, A.

    2008-08-06

    Due to its high toxicity, thallium has been considered by the US Environmental Protection Agency as one of the priority pollutants to be controlled. While being a highly toxic element, thallium has been studied to a much lesser degree than other toxic elements, mainly because thallium is often undetected by classical analytical methods. Thallium is a rare and dispersed element that occurs mainly in sulfur-containing ores. Thus, it is a potential pollutant to surrounding environment, if Tl-rich mineral and/or their industrial wastes are not properly disposed. In this work an Inductively Coupled Plasma Mass Spectrometry analytical procedure has been developed in order to determine thallium in environmental solid samples and its application to the study of this element as a potential pollutant associated with natural and anthropogenic activities. The analytical procedure has been validated by the use of appropriate reference materials, and through the isotope dilution technique as a primary method of measurement. Finally, the developed procedure has been applied to several samples from a mining area, as one of the scenarios where thallium it is likely to occur. (Author) 87 refs.

  4. 17 CFR 210.11-03 - Presentation of financial forecast.

    Science.gov (United States)

    2010-04-01

    ... forecast. 210.11-03 Section 210.11-03 Commodity and Securities Exchanges SECURITIES AND EXCHANGE COMMISSION... Information § 210.11-03 Presentation of financial forecast. (a) A financial forecast may be filed in lieu of the pro forma condensed statements of income required by § 210.11-02(b)(1). (1) The financial forecast...

  5. A Case-Control Study of Prenatal Thallium Exposure and Low Birth Weight in China.

    Science.gov (United States)

    Xia, Wei; Du, Xiaofu; Zheng, Tongzhang; Zhang, Bin; Li, Yuanyuan; Bassig, Bryan A; Zhou, Aifen; Wang, Youjie; Xiong, Chao; Li, Zhengkuan; Yao, Yuanxiang; Hu, Jie; Zhou, Yanqiu; Liu, Juan; Xue, Weiyan; Ma, Yue; Pan, Xinyun; Peng, Yang; Xu, Shunqing

    2016-01-01

    Thallium (Tl) is a highly toxic heavy metal widely present in the environment. Case reports have suggested that maternal exposure to high levels of Tl during pregnancy is associated with low birth weight (LBW), but epidemiological data are limited. This study was designed to evaluate whether prenatal Tl exposure is associated with an increased risk of LBW. This case-control study involving 816 study participants (204 LBW cases and 612 matched controls) was conducted in Hubei Province, China, in 2012-2014. Tl concentrations were measured in maternal urine collected at delivery, and associations with LBW were evaluated using conditional logistic regression. Higher maternal urinary Tl levels were significantly associated with increased risk of LBW [crude odds ratio (OR) = 1.52; 95% CI: 1.00, 2.30 for the highest vs. lowest tertile], and the association was similarly elevated after adjustment for potential confounders (adjusted OR = 1.90; 95% CI: 1.01, 3.58 for the highest vs. lowest tertile). Stratified analyses showed slightly higher risk estimates for LBW associated with higher Tl levels for mothers case-control study to investigate the association between prenatal Tl exposure and LBW. The results suggest that prenatal exposure to high levels of Tl may be associated with an increased risk of LBW. Xia W, Du X, Zheng T, Zhang B, Li Y, Bassig BA, Zhou A, Wang Y, Xiong C, Li Z, Yao Y, Hu J, Zhou Y, Liu J, Xue W, Ma Y, Pan X, Peng Y, Xu S. 2016. A case-control study of prenatal thallium exposure and low birth weight in China. Environ Health Perspect 124:164-169; http://dx.doi.org/10.1289/ehp.1409202.

  6. Evaluation of myocardial abnormalities in patients with collagen diseases by thallium-201 myocardial scintigram

    Energy Technology Data Exchange (ETDEWEB)

    Yamano, Shigeru (Nara Medical Univ., Kashihara (Japan))

    1992-08-01

    This study was performed to evaluate myocardial lesions in patients with collagen diseases by rest and exercise thallium-201 myocardial scintigraphies. A total of 76 patients without ischemic ECG changes, consisting of 27 cases of systemic lupus erythematosus (SLE), 17 cases of polymyositis or dermatomyositis (PM[center dot]DM), 11 cases of progressive systemic sclerosis (PSS), and 21 cases of Sjoegren's syndrome (SjS), were enrolled in this study. Reversible exercise-induced defects suggesting myocardial ischemia were noted in 12 cases of SLE, 5 cases of PM[center dot]DM, 3 cases of PSS, and 3 cases of SjS. Of the 23 patients who had exercise-induced defects, 9 patients showed normal coronary angiograms by cardiac catheterization. Fixed hypoperfusion areas were observed in 5 cases of SLE, 6 cases of PM[center dot]DM, 4 cases of PSS and 3 cases of SjS. Rest thallium-201 myocardial scintigraphy disclosed hypoperfusion areas, which were not induced by exercise, in 1 case of SLE, 4 cases of PM[center dot]DM, 1 case of PSS and 5 cases of SjS. Endomyocardial biopsy was performed on 20 patients. Myocardial lesions in PM[center dot]DM and PSS were more severe and wide spread than in SLE. Ejection fraction and fractional shortening evaluated by echocardiography had no significant differences between each disease group and the healthy control group. These findings suggest that patients with collagen diseases show the presence of abnormalities of coronary circulation at the level of the intramyocardial vasculature in the stage before impairment of cardiac function, myocardial fibrosis and functional abnormalities of the cell membrane level that were not dependent on myocardial ischemia. (author).

  7. Development and Applications of Thallium isotopes: a new proxy tracking the extent of manganese oxide burial

    Science.gov (United States)

    Owens, J. D.; Nielsen, S.; Ostrander, C.; Peterson, L. C.; Anbar, A. D.

    2015-12-01

    Thallium (Tl) isotopes are a new and potential powerful paleoredox proxy with the possibility to track bottom water oxygen conditions based on the burial flux of manganese oxides. Thallium has a residence time of ~20 thousand years, which is long enough to render modern oxic seawater conservative with respect to concentration and isotopes. The isotopic signature of Tl in the global ocean is driven mainly by two outputs (1) adsorption onto manganese oxides and (2) low temperature oceanic crust alteration. Importantly, the isotopic inputs of Tl are all nearly the same value; thus, the isotopic composition and flux of the outputs almost exclusively set the seawater signature. For relatively short term redox events it is reasonable to assume that the dominant isotope fractionation process is associated with manganese oxide precipitation because low temperature alteration is controlled by long-term average ocean crust production rates. We present a broad range of modern samples that span several open ocean profiles combined with water column and sediment profiles from the permanently anoxic basins of the Black Sea and Cariaco Basins. The open ocean shows no variation in depth profiles that encompass most of the major water masses in the Atlantic and Southern Oceans. The anoxic basins, however, reveal Tl isotope signatures closer to their inputs, which is likely due to basinal restriction. The authigenic fraction of organic-rich sediments from the Black Sea and Cariaco Basin capture the Tl isotope value of the overlying water column, which shows that Tl isotopes could be applied as a faithful deep time redox proxy. For the first time, we will present new data showing that Tl isotopes is tracking bottom water ocean oxygenation. We are applying this isotope system to ancient samples, testing the spatial and temporal variability of ocean oxygenation coinciding with major biogeochemical events.

  8. Thallium myocardial tomoscintigraphy: detection of ischemia during weaning from mechanical ventilation in patients with chronic obstructive pulmonary disease. Tomoscintigraphie myocardique au thallium: detection de l'ischemie provoquee par le sevrage de la ventilation assistee chez le bronchiteux chronique

    Energy Technology Data Exchange (ETDEWEB)

    Andre, L.; Valette, H.; Obama, S.; Archambaud, F.; Richard, C.; Teboul, J.L.; Hebert, J.L.; Auzepy, P.; Desgrez, A. (Hopital de Bicetre, 94 - Le Kremlin-Bicetre (FR))

    1990-01-01

    In order to evidence myocardial ischemia-leading to ventricular dysfunction-during weaning from mechanical ventilation in patients with chronic obstructive pulmonary disease, thallium myocardial tomography and gated blood pool studies were performed in 9 patients during mechanical ventilation and during weaning from mechanical ventilation. During the latter, results of gated blood pool studies showed a diffuse homogeneous left ventricular dysfunction. A fixed lower thallium uptake in the septum than in the lateral wall was found with the quantitative analysis of myocardial tomograms. Partial volume effect is likely the cause of this septal defect. The hypothesis of a diffuse ischemia cannot be excluded; but, without the absolute quantification of tomographic data, it cannot be proven.

  9. Radioactive {sup 210}Po in magnesium supplements

    Energy Technology Data Exchange (ETDEWEB)

    Struminska-Parulska, Dagmara Ida [Gdansk Univ. (Poland). Environmental Chemistry and Radiochemistry Chair

    2016-08-01

    The aim of this pioneer study was to determine polonium {sup 210}Po in the most popular magnesium supplements in Poland and estimate the possible related dose assessment to the consumers. The analyzed magnesium pharmaceutics contained organic or inorganic magnesium compounds; some from natural sources. The objectives of this research were to investigate the naturally occurring {sup 210}Po activity concentrations in magnesium supplements, find the correlations between {sup 210}Po concentration in medicament and magnesium chemical form, and calculate the effective radiation dose connected to analyzed magnesium supplement consumption. The highest {sup 210}Po activity concentrations were determined in mineral tablets made from sedimentary rocks, namely dolomite - 3.84 ± 0.15 mBq g{sup -1} (sample Mg17). The highest annual radiation dose from {sup 210}Po taken with 1 tablet of magnesium supplement per day or with 400 mg of pure Mg daily would come from sample Mg17 (dolomite) - 1.35 ± 0.5 and 8.44 ± 0.33 μSv year{sup -1} respectively.

  10. Studies of photon spectra from a thallium-204 foil source as an aid to dosimetry and shielding

    CERN Document Server

    Francis, T M

    1976-01-01

    Beta ray foil sources incorporating nuclides such as thallium-204, promethium-147 and strontium-90 plus yttrium-90 ar increasingly used in industrial devices such as thickness gauges. These sources are so constructed that they give rise to complex photon spectra containing low energy Bremsstrahlung and X-rays characteristic of the constructional materials. The energy response of practical monitoring instruments is such that they are likely to underestimate the dose due to such spectra unless they are calibrated using appropriate spectra. This report describes a series of measurements carried out on a commercially available thallium-204 foil source and five commonly used shielding materials. The measurements made with a NaI(T1) spectrometer have been corrected for instrumental distortions to obtain the photon spectra in air. These spectra are presented and have been used to compute dose in air with the help of published data on mass energy-absorption coefficients. Also included in the report are data derived f...

  11. Septal myocardial perfusion imaging with thallium-201 in the diagnosis of proximal left anterior descending coronary artery disease

    Energy Technology Data Exchange (ETDEWEB)

    Pichard, A.D.; Wiener, I.; Martinez, E.; Horowitz, S.; Patterson, R.; Meller, J.; Goldsmith, S.J.; Gorlin, R.; Herman, M.V.

    1981-07-01

    The use of myocardial perfusion imaging (MPI) to identify obstructive coronary disease of the left anterior descending coronary artery proximal to the first septal perforator (prox LAD) was studied in 60 patients. Perfusion of the septum and anteroapical areas with thallium-201 injected during exercise was compared to results of coronary arteriography. Septal MPI defect was found in 92.3% of patients with obstruction of the proximal LAD, 27.7% of patients with obstruction of LAD distal to first septal perforator, 0% in patients with obstructions involving right or circumflex arteries, and in 10.5% of patients without coronary disease. Anteroapical MPI defects were found with similar frequency in the three groups with obstructive coronary disease. Septal MPI defect had a sensitivity of 92.3% and specificity of 85.4% in the diagnosis of proximal LAD disease. Normal septal perfusion with thallium-201 virtually excluded proximal LAD disease.

  12. Usefulness of rest-redistribution thallium scan for the indication of PTCA in an interesting case with acute myocardial infarction

    Energy Technology Data Exchange (ETDEWEB)

    Chiba, Hiroshi; Nishimura, Tsunehiko; Mitani, Isao; Matsuo, Takeshi; Uehara, Toshiisa; Hayashida, Kohei; Sumiyoshi, Tetsuya; Haze, Kazuo

    1988-04-01

    A 72-year-old woman with acute myocardial infarction was received coronary thrombolytic therapy. After percutaneous transluminal coronary recanalization (PTCR), the stenosis of LAD became from 99 % to 90 %. Left ventriculogram showed dyskinesis of anterior wall in acute phase. After PTCR, she complained of postinfarctional angina. Thus, in order to evaluate the viability of anterior wall, serial thallium scintigraphy was performed at rest, which showed perfusion defect and redistribution of anterior wall. After percutaneous transluminal coronary angioplasty (PTCA), anterior wall motion became almost normal. The perfusion defect of anterior wall was also gradually disappeared. The serial thallium scintigraphy at rest is an useful method not only to evaluate the viability of myocardium in acute myocardial infarction, but also to follow the effect of PTCA.

  13. Polonium-210 and lead-210 in the terrestrial environment: a historical review

    Energy Technology Data Exchange (ETDEWEB)

    Persson, Bertil R.R., E-mail: bertil_r.persson@med.lu.s [Dept. of Medical Radiation Physics, Lund University, Barngatan 2, SE-221 85 Lund (Sweden); Holm, Elis [Norwegian Radiation Protection Authority, Osteras (Norway)

    2011-05-15

    The radionuclides {sup 210}Po and {sup 210}Pb widely present in the terrestrial environment are the final long-lived radionuclides in the decay of {sup 238}U in the earth's crust. Their presence in the atmosphere is due to the decay of {sup 222}Rn diffusing from the ground. The range of activity concentrations in ground level air for {sup 210}Po is 0.03-0.3 Bq m{sup -3} and for {sup 210}Pb 0.2-1.5 Bq m{sup -3}. In drinking water from private wells the activity concentration of {sup 210}Po is in the order of 7-48 mBq l{sup -1} and for {sup 210}Pb around 11-40 mBq l{sup -1}. From water works, however, the activity concentration for both {sup 210}Po and {sup 210}Pb is only in the order of 3 mBq l{sup -1}. Mosses, lichens and peat have a high efficiency in capturing {sup 210}Po and {sup 210}Pb from atmospheric fallout and exhibit an inventory of both {sup 210}Po and {sup 210}Pb in the order of 0.5-5 kBq m{sup -2} in mosses and in lichens around 0.6 kBq m{sup -2}. The activity concentrations in lichens lies around 250 Bq kg{sup -1}, dry mass. Reindeer and caribou graze lichen which results in an activity concentration of {sup 210}Po and {sup 210}Pb of about 1-15 Bq kg{sup -1} in meat from these animals. The food chain lichen-reindeer or caribou, and Man constitutes a unique model for studying the uptake and retention of {sup 210}Po and {sup 210}Pb in humans. The effective annual dose due to {sup 210}Po and {sup 210}Pb in people with high consumption of reindeer/caribou meat is estimated to be around 260 and 132 {mu}Sv a{sup -1} respectively. In soils, {sup 210}Po is adsorbed to clay and organic colloids and the activity concentration varies with soil type and also correlates with the amount of atmospheric precipitation. The average activity concentration levels of {sup 210}Po in various soils are in the range of 20-240 Bq kg{sup -1}. Plants become contaminated with radioactive nuclides both by absorption from the soil (supported Po) and by deposition of radioactive

  14. Rearrangement of beta,gamma-unsaturated esters with thallium trinitrate: synthesis of indans bearing a beta-keto ester moiety

    Directory of Open Access Journals (Sweden)

    Silva Jr. Luiz F.

    2006-01-01

    Full Text Available The rearrangement of beta,gamma-unsaturated esters, such as 2-(3,4-dihydronaphthalen-1-yl-propionic acid ethyl ester, with thallium trinitrate (TTN in acetic acid leads to 3-indan-1-yl-2-methyl-3-oxo-propionic acid ethyl ester in good yield, through a ring contraction reaction. The new indans thus obtained feature a beta-keto ester moiety, which would be useful for further functionalization.

  15. Formic acid electrooxidation on thallium-decorated shape-controlled platinum nanoparticles: an improvement in electrocatalytic activity

    OpenAIRE

    Busó-Rogero, Carlos; Perales-Rondón, Juan V.; Farias, Manuel J.S.; Vidal-Iglesias, Francisco J.; Solla-Gullón, José; Herrero, Enrique; Feliu, Juan M.

    2014-01-01

    Thallium modified shape-controlled Pt nanoparticles were prepared and their electrocatalytic activity towards formic acid electrooxidation was evaluated in 0.5 M sulfuric acid. The electrochemical and in situ FTIR spectroscopic results show a remarkable improvement in the electrocatalytic activity, especially in the low potential region (around 0.1–0.2 V vs. RHE). Cubic Pt nanoparticles modified with Tl were found to be more active than the octahedral Pt ones in the entire range of Tl coverag...

  16. Usefulness and limitations of thallium-201 myocardial scintigraphy in delineating location and size of prior myocardial infarction

    Energy Technology Data Exchange (ETDEWEB)

    Niess, G.S.; Logic, J.R.; Russell, R.O. Jr.; Rackley, C.E.; Rogers, W.J.

    1979-05-01

    Thirty-two patients were evaluated at a mean of 7 +- 2 months after infarction with a 12-lead ECG, resting /sup 201/Tl myocardial scintigram, biplane left ventriculogram, and coronary angiograms. From the left ventriculogram, asynergy was quantified as percent abnormally contracting segment (% ACS), the percent of end-diastolic circumference which was either akinetic or dyskinetic. Using a computerized planimetry system, we expressed /sup 201/Tl perfusion defects as a percentage of total potential thallium uptake. Of 21 patients with ECG evidence of prior transmural infarction, a /sup 201/Tl defect was present in 20, and angiographic asynergy was present in all 21. The site of prior infarction by ECG agreed with the /sup 201/T1 defect location in 24 of 32 patients and with site of angiographic asynergy in 23 of 32 patients. Scintigraphic defects were present in only four of 10 patients with ACS less than or equal to 6%, but scintigraphic defects were found in 20 of 22 patients with ACS > 6%. Thallium defect size correlated marginally with angiographic left ventricular ejection fraction but correlated closely with angiographic % ACS. Thallium defect size was similar among patients with one-, two-, or three-vessel coronary artery disease (greater than or equal to 70% stenosis), but thallium defect size was larger in patients with electrocardiographic evidence of transmural infarction or pulmonary capillary wedge pressure > 12 mm Hg. Thus, resting /sup 201/T1 myocardial scintigraphy is useful in localizing and quantifying the extent of prior myocardial infarction, but is insensitive to small infarcts (ACS < 6%).

  17. Determination of thallium at ultra-trace levels in water and biological samples using solid phase spectrophotometry.

    Science.gov (United States)

    Amin, Alaa S; El-Sharjawy, Abdel-Azeem M; Kassem, Mohammed A

    2013-06-01

    A new simple, very sensitive, selective and accurate procedure for the determination of trace amounts of thallium(III) by solid-phase spectrophotometry (SPS) has been developed. The procedure is based on fixation of Tl(III) as quinalizarin ion associate on a styrene-divinylbenzene anion-exchange resin. The absorbance of resin sorbed Tl(III) ion associate is measured directly at 636 and 830 nm. Thallium(I) was determined by difference measurements after oxidation of Tl(I) to Tl(III) with bromine. Calibration is linear over the range 0.5-12.0 μg L(-1) of Tl(III) with relative standard deviation (RSD) of 1.40% (n=10). The detection and quantification limits are 150 and 495 ng L(-1) using 0.6 g of the exchanger. The molar absorptivity and Sandell sensitivity are also calculated and found to be 1.31×10(7) L mol(-1)cm(-1) and 0.00156 ng cm(-2), respectively. The proposed procedure has been successfully applied to determine thallium in water, urine and serum samples. Copyright © 2013 Elsevier B.V. All rights reserved.

  18. The efficient removal of thallium from sintering flue gas desulfurization wastewater in ferrous metallurgy using emulsion liquid membrane.

    Science.gov (United States)

    Yang, Li; Xiao, Jiangping; Shen, Yi; Liu, Xian; Li, Wensong; Wang, Weiyan; Yang, Yunquan

    2017-11-01

    The removal of thallium ions in flue gas desulfurization wastewater from ferrous metallurgic industry was studied by emulsion liquid membrane (ELM) method using 2-ethylhexyl phosphoric acid-2-ethylhexyl ester (P507) as carrier, aviation kerosene (AK) as organic solvent, polyisobutylene succinimide (T154) as surfactant, polyisobutylene (PIB) as additive, and sulfuric acid as internal reagent. Some important influence parameters such as concentrations of carrier, surfactant and stripping agent, agitation speed, extraction time, volume ratios of feed solution to emulsion phase and internal phase to membrane phase, and their effects on the removal efficiency of Tl in the ELM process were investigated and optimized. Under the optimum operating conditions of 2% of carrier, 5% of surfactant, 0.5 M of stripping agent, 350 rpm of agitation speed, 12.5:1 of volume ratio of feed solution to emulsion phase, and 3:1 volume ratio of membrane to internal phase, the maximum extraction efficiency of thallium reached 99.76% within 15-min reaction time. The ICP-MS analysis indicated that the thallium concentration in treated wastewater was below 5 μg/L and could meet the emission standard demand for industrial wastewater enacted by the local government of Hunan province of China. Meanwhile, the extraction of impurity ions calcium and magnesium in the ELM system was investigated. The result showed that an acidic environment would be in favor of the removal of Tl from calcium and magnesium contained in wastewater. Graphical abstract ᅟ.

  19. Thallium isotopes in metallurgical wastes/contaminated soils: A novel tool to trace metal source and behavior.

    Science.gov (United States)

    Vaněk, Aleš; Grösslová, Zuzana; Mihaljevič, Martin; Ettler, Vojtěch; Trubač, Jakub; Chrastný, Vladislav; Penížek, Vít; Teper, Leslaw; Cabala, Jerzy; Voegelin, Andreas; Zádorová, Tereza; Oborná, Vendula; Drábek, Ondřej; Holubík, Ondřej; Houška, Jakub; Pavlů, Lenka; Ash, Christopher

    2018-02-05

    Thallium (Tl) concentration and isotope data have been recorded for contaminated soils and a set of industrial wastes that were produced within different stages of Zn ore mining and metallurgical processing of Zn-rich materials. Despite large differences in Tl levels of the waste materials (1-500mgkg-1), generally small changes in ε205Tl values have been observed. However, isotopically lighter Tl was recorded in fly ash (ε205Tl∼-4.1) than in slag (ε205Tl∼-3.3), implying partial isotope fractionation during material processing. Thallium isotope compositions in the studied soils reflected the Tl contamination (ε205Tl∼-3.8), despite the fact that the major pollution period ended more than 30 years ago. Therefore, we assume that former industrial Tl inputs into soils, if significant, can potentially be traced using the isotope tracing method. We also suggest that the isotope redistributions occurred in some soil (subsurface) horizons, with Tl being isotopically heavier than the pollution source, due to specific sorption and/or precipitation processes, which complicates the discrimination of primary Tl. Thallium isotope analysis proved to be a promising tool to aid our understanding of Tl behavior within the smelting process, as well as its post-depositional dynamics in the environmental systems (soils). Copyright © 2017 Elsevier B.V. All rights reserved.

  20. Kidney disease in beagles injected with polonium-210

    Energy Technology Data Exchange (ETDEWEB)

    Bruenger, F.W.; Lloyd, R.D.; Taylor, G.N.; Miller, S.C.; Mays, C.W. (Univ. of Utah School of Medicine, Salt Lake City (USA))

    1990-06-01

    An unusually high incidence of kidney disease (tubular degeneration and necrosis with fibrous replacement) was observed among 24 beagles injected at about 5 years of age with 116 or 329 kBq 226Ra kg-1 but not among an additional 10 beagles given about 39 kBq 226Ra kg-1. This 226Ra solution also contained 210Pb, 210Bi, and 210Po. To determine whether the kidney disease was related to the radiation from 226Ra and its short-lived progeny or to the alpha radiation from 210Po, 2 beagles about 7 years of age were injected with 451 kBq 226Ra kg-1 of 210Po citrate. Measurements of polonium retention in the kidneys of 4 additional beagles given 210Bi citrate enabled us to model the retention of these emitters in the dog kidney and to estimate the kidney dose from the alpha radiation of 210Po following injection of either 226Ra + 210Bi + 210Po or 210Po only. Autoradiography revealed that almost equal concentrations of 210Po were in the tubular epithelium and/or its basement membrane and in the glomeruli, but very little of the 210Bi deposited in kidney tissue was present in the glomeruli. Radiation damage to the kidneys similar to that observed previously in beagles given 226Ra solutions that also contained 210Bi and 210Po was seen among the beagles given 210Po but not in the dogs given purified 226Ra. The analysis of these data indicated that the relatively high incidence of kidney disease among the mature beagles injected with 226Ra and its accompanying 210Bi and 210Po resulted from alpha irradiation of the kidneys by the substantial amount of 210Po that was in the injection solution.

  1. Thallium-isotopic compositions of euxinic sediments as a proxy for global manganese-oxide burial

    Science.gov (United States)

    Owens, Jeremy D.; Nielsen, Sune G.; Horner, Tristan J.; Ostrander, Chadlin M.; Peterson, Larry C.

    2017-09-01

    Thallium (Tl) isotopes are a new and potentially powerful paleoredox proxy that may track bottom water oxygen conditions based on the global burial flux of manganese oxides. Thallium has a residence time of ∼20 thousand years, which is longer than the ocean mixing time, and it has been inferred that modern oxic seawater is conservative with respect to both concentration and isotopes. Marine sources of Tl have nearly identical isotopic values. Therefore, the Tl sinks, adsorption onto manganese oxides and low temperature oceanic crust alteration (the dominant seawater output), are the primary controls of the seawater isotopic composition. For relatively short-term, ∼million years, redox events it is reasonable to assume that the dominant mechanism that alters the Tl isotopic composition of seawater is associated with manganese oxide burial because large variability in low temperature ocean crust alteration is controlled by long-term, multi-million years, average ocean crust production rates. This study presents new Tl isotope data for an open ocean transect in the South Atlantic, and depth transects for two euxinic basins (anoxic and free sulfide in the water column), the Cariaco Basin and Black Sea. The Tl isotopic signature of open ocean seawater in the South Atlantic was found to be homogeneous with ε205Tl = -6.0 ± 0.3 (±2 SD, n = 41) while oxic waters from Cariaco and the Black Sea are -5.6 and -2.2, respectively. Combined with existing data from the Pacific and Arctic Oceans, our Atlantic data establish the conservatism of Tl isotopes in the global ocean. In contrast, partially- and predominantly-restricted basins reveal Tl isotope differences that vary between open-ocean (-6) and continental material (-2) ε205Tl, scaling with the degree of restriction. Regardless of the differences between basins, Tl is quantitatively removed from their euxinic waters below the chemocline. The burial of Tl in euxinic sediments is estimated to be an order of magnitude

  2. 6 CFR 27.210 - Submissions schedule.

    Science.gov (United States)

    2010-01-01

    ... Domestic Security DEPARTMENT OF HOMELAND SECURITY, OFFICE OF THE SECRETARY CHEMICAL FACILITY ANTI-TERRORISM STANDARDS Chemical Facility Security Program § 27.210 Submissions schedule. (a) Initial Submission. The... of any of the chemicals listed in appendix A at or above the STQ for any applicable Security Issue...

  3. 7 CFR 210.19 - Additional responsibilities.

    Science.gov (United States)

    2010-01-01

    ... reveals that a school food authority's failure to meet the nutrition standards of § 210.10 is... AGRICULTURE CHILD NUTRITION PROGRAMS NATIONAL SCHOOL LUNCH PROGRAM Requirements for State Agency Participation... with School Year 1996-1997, State agencies shall evaluate compliance, over the school week, with the...

  4. 7 CFR 210.18 - Administrative reviews.

    Science.gov (United States)

    2010-01-01

    ... are specified under § 210.29 of this part. (b) Definitions. The following definitions are provided in... Assistance for Needy Families (TANF) office which certifies that the children are currently members of... Households on Indian Reservations (FDPIR) or Temporary Assistance for Needy Families (TANF) benefits. (C...

  5. 5 CFR 430.210 - OPM responsibilities.

    Science.gov (United States)

    2010-01-01

    ... MANAGEMENT Performance Appraisal for General Schedule, Prevailing Rate, and Certain Other Employees § 430.210 OPM responsibilities. (a) OPM shall review and approve an agency's performance appraisal system(s). (b) OPM may evaluate the operation and application of an agency's performance appraisal system(s) and...

  6. Thallium isotopes as a potential tracer for the origin of cratonic eclogites

    Science.gov (United States)

    Nielsen, Sune G.; Williams, Helen M.; Griffin, William L.; O'Reilly, Suzanne Y.; Pearson, Norman; Viljoen, Fanus

    2009-12-01

    Cratonic eclogites are inferred to originate either from subducted ocean crust or mantle melts accreted onto the roots of continents. These models have different implications for the growth of continents, but it is currently difficult to determine the origin of individual eclogite suites. Upper ocean crust altered at low temperatures and marine sediments both display high thallium (Tl) concentrations and strongly fractionated Tl isotope signatures relative to the ambient upper mantle. In this study we carry out the first examination of the suitability of Tl isotopes as a tracer for an ocean-crust origin of cratonic eclogites. We have analysed the Tl isotope composition of clinopyroxene and garnet in six eclogites from the Kaalvallei and Bellsbank kimberlite pipes in South Africa. Minerals were pre-cleaned with an HCl leaching technique and the leachates display variably light Tl isotope ratios. These most likely reflect low-temperature hydrothermal alteration occurring after eruption of the kimberlite that carried the eclogites to the surface. The leached mineral pairs all display identical Tl isotope ratios, strongly suggesting that the source of the analysed Tl is identical for each mineral pair. It is, however, not possible to exclude the possibility that the analysed Tl originates from kimberlitic material that was not removed by the cleaning procedure. Only one of the six samples exhibits a Tl isotope composition different from ambient mantle. Assuming that the Tl isotope signatures indeed represent the eclogite minerals and not any form of contamination, the Tl isotope composition in this sample is consistent with containing a minor component (low temperatures. Thallium isotopes may become one of the most sensitive indicators for the presence of low-T altered ocean crust because of the stark contrast in Tl concentration and isotopic composition between the mantle and altered ocean crust. In fact, no other chemical or isotopic tracer could have provided an

  7. Thallium-201 SPECT in the diagnosis of head and neck cancer.

    Science.gov (United States)

    Valdés Olmos, R A; Balm, A J; Hilgers, F J; Koops, W; Loftus, B M; Tan, I B; Muller, S H; Hoefnagel, C A; Gregor, R T

    1997-06-01

    The accuracy of SPECT with 201Tl-chloride for the diagnosis of primary tumors, lymph node metastases and recurrences in head and neck cancer was evaluated for clinical applicability. SPECT images, obtained 60 min after administration of 150 MBq 201Tl-chloride, were compared with clinical, CT and/or MRI and histology results. In addition, whole-body images were obtained to detect distant metastases. In 79 patients studied for primary tumors (principally larynix, hypopharynx, oropharynx, nasopharynx and oral cavity), 201Tl SPECT correctly identified 69 of 73 (95% versus 88% for CT/MRI) histologically confirmed malignancies including 63 squamous-cell carcinomas. The method localized four occult naso- and oropharynx carcinomas not seen on CT/MRI and was correctly negative in two patients without tumor and in three of four patients with no confirmed primary tumor in the head and neck. With respect to regional spread, only patients who had cervical lymph node dissection were evaluated, and the findings were recorded per side of the neck. Thallium-201 SPECT correctly identified metastases in 31 of 36 neck dissections with proven lymph node involvement (86%), was correctly negative in nine and false-positive in one. Although the sensitivity of CT/MRI was clearly higher (97%), considerably more false-positive cases affected its accuracy (81% versus 87% for SPECT). In 30 patients investigated for recurrences, 201Tl SPECT correctly identified 27 of 29 microscopically confirmed tumor sites (93%) and was correctly negative in seven. Sensitivity of CT/MRI was lower (76%), and a greater number of false-positives (seven versus three for SPECT) further decreased its accuracy (64% versus 87% for SPECT). Distant metastases were detected in five patients. Thallium-201 SPECT appears to be an accurate method for the diagnosis of head and neck cancer. The method is particularly useful for detection of occult head and neck tumors and for assessing recurrences. It also may be of

  8. Thallium in spawn, juveniles, and adult common toads (Bufo bufo) living in the vicinity of a zinc-mining complex, Poland.

    Science.gov (United States)

    Dmowski, Krzysztof; Rossa, Monika; Kowalska, Joanna; Krasnodębska-Ostręga, Beata

    2015-01-01

    A breeding population of the common toad Bufo bufo living in the vicinity of a Zn-Pb smelting works in Bukowno, Poland was studied for the presence of thallium. Tl concentration was measured in the bottom sediments of the spawning pond, in the laid eggs, in juveniles after metamorphosis, and in the selected tissues of the adult individuals. A very high concentration of Tl was detected in the spawn (13.97 ± 8.90 mg/kg d.w.). In 50% of the spawn samples, levels exceeded 20 mgTl/kg d.w. The issue of maternal transfer of thallium from females to oocytes is discussed. Due to a significant accumulation of thallium, spawn analysis can be used as a sensitive indicator of the presence of this element in the environment and may replace more invasive methods that involve the killing of adult animals. In those regions that are abundant in Zn-Pb ores, the spawn of amphibians may be a very important source of thallium contamination for predators. From among all tissues of the Bukowno adult toads, the livers have shown the highest accumulation of thallium (mean 3.98 mg/kg d.w. and maximum value--18.63). For as many as 96.5% of livers, concentrations exceeded 1.0 mgTl/kg d.w. which is treated as indicative of poisoning.

  9. In-situ pre-concentration through repeated sampling and pyrolysis for ultrasensitive determination of thallium in drinking water by electrothermal atomic absorption spectrometry.

    Science.gov (United States)

    Liu, Liwei; Zheng, Huaili; Xu, Bincheng; Xiao, Lang; Chigan, Yong; Zhangluo, Yilan

    2018-03-01

    In this paper, a procedure for in-situ pre-concentration in graphite furnace by repeated sampling and pyrolysis is proposed for the determination of ultra-trace thallium in drinking water by graphite furnace atomic absorption spectrometry (GF-AAS). Without any other laborious enrichment processes that routinely result in analyte loss and contamination, thallium was directly concentrated in the graphite furnace automatically and subsequently subject to analysis. The effects of several key factors, such as the temperature for pyrolysis and atomization, the chemical modifier, and the repeated sampling times were investigated. Under the optimized conditions, a limit of detection of 0.01µgL -1 was obtained, which fulfilled thallium determination in drinking water by GB 5749-2006 regulated by China. Successful analysis of thallium in certified water samples and drinking water samples was demonstrated, with analytical results in good agreement with the certified values and those by inductively coupled plasma mass spectrometry (ICP-MS), respectively. Routine spike-recovery tests with randomly selected drinking water samples showed satisfactory results of 80-96%. The proposed method is simple and sensitive for screening of ultra-trace thallium in drinking water samples. Copyright © 2017. Published by Elsevier B.V.

  10. Hair and feathers as indicator of internal contamination of 210Po and 210Pb

    Energy Technology Data Exchange (ETDEWEB)

    Holm, E. (ed.); Gwynn, J.; Zaborska, A.; Gaefvert, T. (Norwegian Radiation Protection Authority (Norway)); Roos, P. (Technical Univ. of Denmark, Risoe National Lab. for Sustainable Energy, Roskilde (Denmark)); Henricsson, F. (Lund Univ., Lund (Sweden))

    2010-03-15

    The activities of the NKS-B HAIRPOL project is summarised in this report. The objective was to investigate if hair and feathers were suitable matrices for the estimation of the intake of 210Po. Human hair from people of different sex and age was analysed for 210Po showing concentrations between 0.4 to 11 Bq/kg dry weight. Samples from horses, mane, fur and tail showed concentration from 6 to 17 Bq/kg with no significant difference between the different sample types. Musk ox from Greenland showed much higher concentrations since the animal has to graze a large surface. In fur the concentration was 260 Bq/kg. A considerable fraction of the total 210Po in this animal is contained in the hair. Also different organs were analysed and the highest concentration was found in kidney, 2 700 Bq/kg. The 210Pb concentration in hair was estimated to about 20 Bq/kg. Three different seabirds from Svalbard were analysed. Feathers from all three seabird species show increasing activity concentrations of 210Po and 210Pb from the base to the tip of the feather, but it was difficult to relate feather concentrations to muscle concentrations due to a number of complicating factors. (author)

  11. Dicty_cDB: CHF210 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available CH (Link to library) CHF210 (Link to dictyBase) - - - Contig-U16313-1 - (Link to Original site) CHF...210F 122 - - - - - - Show CHF210 Library CH (Link to library) Clone ID CHF210 (Link to dicty...iol.tsukuba.ac.jp/CSM/CH/CHF2-A/CHF210Q.Seq.d/ Representative seq. ID - (Link to ...Original site) Representative DNA sequence >CHF210 (CHF210Q) /CSM/CH/CHF2-A/CHF210Q.Seq.d/ AATTATCCCTTAAAATA...3a: 0.00 m3b: 0.00 m_ : 1.00 68.0 %: nuclear 24.0 %: cytoplasmic 4.0 %: mitochondrial 4.0 %: plasma membrane >> prediction for CHF

  12. 8 CFR 210.4 - Status and benefits.

    Science.gov (United States)

    2010-01-01

    ... lawful temporary resident under section 210 of the Act has the right to reside in the United States, to... her inadmissible as an immigrant, unless a waiver is secured pursuant to § 210.3(e)(2) of this part...

  13. The ECG component of Thallium-201 exercise testing impacts on cardiac intervention rates

    Energy Technology Data Exchange (ETDEWEB)

    Deague, J.; Salehi, N.; Grigg, L.; Lichtenstein, M.; Better, N. [Royal Melbourne Hospital, Parkville, VIC (Australia). Departments of Nuclear Medicine and Cardiology

    1998-06-01

    Full text: Thallium exercise testing (Tlex) offers superior sensitivity and specificity to exercise electrocardiography (ECG), but the value of the ECG data in Tlex remains poorly studied. While a normal Tlex is associated with an excellent prognosis, patients with a positive Tlex have a higher cardiac event rate. We aimed to see if a negative ECG Component of the Tlex (ECGTl) was associated with an improved outcome compared with a positive ECGTl, in those patients with a reversible Tlex defect. We followed 100 consecutive patients retrospectively with a reversible defect on Tlex (50 with negative and 50 with positive ECGTI) for 12 months. The ECG was reviewed as positive (1mm ST depression 0.08 seconds after J point or >2mm if on digoxin or prior ECG changes), negative, equivocal or uninterpretable. We excluded patients with pharmacological testing, and those with equivocal or uninterpretable ECGs. End-points included angiography, cardiac interventions and cardiac event rate (CER) incorporating unstable angina, acute myocardial infarction, and cardiac death. In conclusion 24% of patients with reversible defects on Tlex who had a negative ECGTI still proceeded to PTCA or CABG. Those with a positive ECGTI had a higher incidence of angiography and cardiac revascularisation, but this difference was only evident in patients with mild to moderate reversibility

  14. Redox-controlled release dynamics of thallium in periodically flooded arable soil.

    Science.gov (United States)

    Antić-Mladenović, Svetlana; Frohne, Tina; Kresović, Mirjana; Stärk, Hans-Joachim; Savić, Dubravka; Ličina, Vlado; Rinklebe, Jörg

    2017-07-01

    To our knowledge, this is the first work to mechanistically study the impact of the redox potential (E H ) and principal factors, such as pH, iron (Fe), manganese (Mn), dissolved organic carbon (DOC), dissolved inorganic carbon (DIC), chlorides (Cl - ) and sulfates (SO 4 2- ), on the release dynamics of thallium (Tl) in periodically flooded soil. We simulated flooding using an automated biogeochemical microcosm system that allows for systematical control of pre-defined redox windows. The E H value was increased mechanistically at intervals of approximately 100 mV from reducing (-211 mV) to oxidizing (475 mV) conditions. Soluble Tl levels (0.02-0.28 μg L -1 ) increased significantly with increases in E H (r = 0.80, p soils along with a determination of the Tl species and monitoring of the Tl content in plants to achieve more detailed insight into soluble Tl behavior. Copyright © 2017 Elsevier Ltd. All rights reserved.

  15. EFFECTS OF THALLIUM ON THE LARVAL DEVELOPMENT OF LUCILIA SERICATA MEIGEN 1826 AND PMI ESTIMATION

    Directory of Open Access Journals (Sweden)

    Arif Gökhan BAŞARAN

    2011-08-01

    Full Text Available Determination of larval growth rate of and forensic analysis of the age of Calliphoridae larvae on a corpse are useful evidence in legal investigations for the estimation of exact death time and time duration after death; post mortem interval. However many factors, such as temperature, tissue type and contamination of drugs and toxins, effect larval development of blow fly larvae and consequently theestimation of post mortem interval. The present study examined the larval growth rate of a forensically important blow fly species, Lucilia sericata Meigen 1826 in different concentrations (0,12; 0,25; 0,50; 1 and 2 μg/g of toxic heavy metal Thallium under controlled laboratory conditions. Body length and weight, death ratio of larvae and pupa between experimental and control groups were compared. Results demonstrated that the development rate of larvae between uncontaminated and contaminated diets varies significantly. In short, they molted later, reached maximum length more slowly and sometimesproduced significantly smaller pupae in contaminated food source. These results emphasized that the importance of determining the contamination rate of toxins in tissue for the forensic entomologist,while using development rates from standard curves based on larvae fed non-contaminated mediums.

  16. Value of transient dilation of the left ventricular cavity on stress thallium scintigraphy

    Energy Technology Data Exchange (ETDEWEB)

    Sugihara, Hiroki; Shiga, Kouji; Umamoto, Ikuo (Kyoto Prefectural Univ. of Medicine (Japan)) (and others)

    1991-02-01

    This study was undertaken to evaluate the value of transient dilation of the left ventricular cavity on stress thallium scintigraphy in 80 patients with ischemic heart disease (IHD) and 50 with hypertrophic cardiomyopathy (HCM). Twenty persons without either coronary artery stenosis or heart disease were served as controls. Areas surrounded by maximum count points on the line of each 10deg on the short axis slice through the mid-cavity of the left ventricle were obtained at 10 minutes and at 3 hours after exercise. Transient dilation index (TDI) was obtained by dividing the area on early image by that on delayed image. TDI was significantly higher in patients with two or three vessel disease in the IHD group than the control group. High TDI was observed in 8% for one vessel disease, 40% for two vessel disease, and 80% for three vessel disease, contributing to the detection of multivessel IHD. In the HCM group of 80 patients, 24 (48%) had high TDI which was frequently associated with a history of chest pain and positive ECG findings at exercise. When these 24 HCM patients underwent exercise blood pool scintiscanning, left ventricular enddiastolic volume was similar before and at 10 minutes after exercise. These findings suggest that transient dilation of the left ventricular cavity after exercise may reflect subendocardial ischemia in both IHD and HCM. TDI would become a useful indicator for transient dilation of the left ventricular cavity. (N.K.).

  17. Clinicopathologic correlation study of thallium-201 myocardial scintigraphy in diagnosis of myocardial infarction

    Energy Technology Data Exchange (ETDEWEB)

    Chida, Kouji; Sugiura, Masaya; Ohkawa, Shin-ichiro

    1987-05-01

    In a series of 1,000 consecutive autopsy cases, we evaluated the clinical utility of thallium-201 (Tl-201) myocardial scintigraphy and electrocardiography (ECG) in 101 patients who had been studied while alive. Fifty-five cases had myocardial infarctions (MI) at autopsy. The Tl-201 scintigram and ECG in diagnosis of MI showed sensitivities of 68 % and 60 %, specificities of 87 % and 83 %, and diagnostic accuracies of 76 % and 70 %, respectively. The sensitivity of the Tl-201 scintigram was 70 % in anterior MI, 80 % in postero-inferior MI, 25 % in lateral and subendocardial infarction. The sensitivity was 88 % for large massive MI, but was low in scattered (50 %) or middle-sized MI (17 %). The diagnostic limit of the resolution of Tl-201 scintigrams was 4.5 cm in long diameter. All 8 cases with MI of less than 4 cm could not be diagnosed with the technique. There were 48 cases of large MI (more than 5 cm), but 8 cases could not be diagnosed by scintigraphy because of non-transmural or scattered MI. A comparison of the Tl-201 scintigram and ECG showed that 27 cases out of 60 cases were diagnosed by both methods, 14 only by the Tl-201 scintigram, 9 only by ECG and 10 by neither method.

  18. Evaluation of myocardial damage in Duchenne's muscular dystrophy with thallium-201 myocardial SPECT

    Energy Technology Data Exchange (ETDEWEB)

    Tamura, Takuhisa; Shibuya, Noritoshi (Kawatana National Hospital, Nagasaki (Japan)); Hashiba, Kunitake; Oku, Yasuhiko; Mori, Hideki; Yano, Katsusuke

    1993-01-01

    Myocardial damage and cardiopulmonary functions in patients with Duchenne's muscular dystrophy (DMD) were assessed using thallium-201 myocardial single-photon emission computed tomography (SPECT) and technetium-99m multigated radionuclide angiography. Twenty-five patients with DMD were divided into 4 groups according to percent of perfusion defect (%PD) calculated by the bull's-eye method and age. PD was detected in 24 (96.0%) of 25 patients with DMD, and it spread from the left ventricular lateral wall to the anterior wall and/or interventricular septum. PD was detected even in a 6-year-old DMD boy. Patients in Group I (%PD[>=]10% and age<15 years old) were shown to have a higher risk of left-sided heart failure without respiratory failure. Patients in Group II (%PD[>=]10 and age[>=]15) showed decreased pulmonary function and worsened arterial blood gas values as compared with Group IV (%PD<10 and age[>=]15). There was no significant difference in cardiac function among the 4 groups. It is postulated that myocardial damage in Group II patients is dependent primarily on a deficiency of dystrophin and on chronic respiratory failure, and that some of them are at risk of cardiopulmonary failure. It is concluded that myocardial SPECT is useful for the early diagnosis of myocardial damage and evaluation of cardiopulmonary function in DMD patients. (author).

  19. Role of relativity in high-pressure phase transitions of thallium.

    Science.gov (United States)

    Kotmool, Komsilp; Chakraborty, Sudip; Bovornratanaraks, Thiti; Ahuja, Rajeev

    2017-02-20

    We demonstrate the relativistic effects in high-pressure phase transitions of heavy element thallium. The known first phase transition from h.c.p. to f.c.c. is initially investigated by various relativistic levels and exchange-correlation functionals as implemented in FPLO method, as well as scalar relativistic scheme within PAW formalism. The electronic structure calculations are interpreted from the perspective of energetic stability and electronic density of states. The full relativistic scheme (FR) within L(S)DA performs to be the scheme that resembles mostly with experimental results with a transition pressure of 3 GPa. The s-p hybridization and the valence-core overlapping of 6s and 5d states are the primary reasons behind the f.c.c. phase occurrence. A recent proposed phase, i.e., a body-centered tetragonal (b.c.t.) phase, is confirmed with a small distortion from the f.c.c. phase. We have also predicted a reversible b.c.t. → f.c.c. phase transition at 800 GPa. This finding has been suggested that almost all the III-A elements (Ga, In and Tl) exhibit the b.c.t. → f.c.c. phase transition at extremely high pressure.

  20. Separation of 210Pb, 210Bi and 210Po by ion exchange and their Iiquid scintillation standardization; Separacion del 210Pb, 210Bi y 2I0Po mediante columna de cambio ionico y su calibracion por centelleo liquido

    Energy Technology Data Exchange (ETDEWEB)

    Rodriguez, L.; Jimenez, A.; Grau, A.

    1996-07-01

    We applied the CIEMAT/NIST method and alpha/beta discrimination to ''210Pb samples in equilibrium with its daughters, by preparing homogeneous and gel samples. The stability of samples was tested in different available cocktails, HiSafe''TM II, HiSafe''TM III, Ultima-Gold''TM, Ultima-Gold''TM XR, Ultima-Gold''TM AB, Insta-Gel''R and e Insta-Gel''R lI. Also we analyzed the disequilibrium of the radioactive chain 210Pb+210Bi+210Po, achieving an excellent agreement between the results of the spectrum unfolding method and the experimental values. (Author) 13 refs.

  1. 46 CFR 28.210 - First aid equipment and training.

    Science.gov (United States)

    2010-10-01

    ... 46 Shipping 1 2010-10-01 2010-10-01 false First aid equipment and training. 28.210 Section 28.210....210 First aid equipment and training. (a) Each vessel must have on board a complete first aid manual... location. (b) First aid and cardiopulmonary resuscitation (CPR) course certification. Certification in...

  2. 7 CFR 3560.210 - Special note rents (SNRs).

    Science.gov (United States)

    2010-01-01

    ... 7 Agriculture 15 2010-01-01 2010-01-01 false Special note rents (SNRs). 3560.210 Section 3560.210... AGRICULTURE DIRECT MULTI-FAMILY HOUSING LOANS AND GRANTS Rents § 3560.210 Special note rents (SNRs). When a... the borrower to charge an SNR, which is less than note rent but higher than basic rent, to attract or...

  3. 19 CFR 210.31 - Requests for admission.

    Science.gov (United States)

    2010-04-01

    ... 19 Customs Duties 3 2010-04-01 2010-04-01 false Requests for admission. 210.31 Section 210.31... TRADE ADJUDICATION AND ENFORCEMENT Discovery and Compulsory Process § 210.31 Requests for admission. (a) Form, content, and service of request for admission. Any party may serve on any other party a written...

  4. 42 CFR 59.210 - Inventions or discoveries.

    Science.gov (United States)

    2010-10-01

    ... 42 Public Health 1 2010-10-01 2010-10-01 false Inventions or discoveries. 59.210 Section 59.210... PLANNING SERVICES Grants for Family Planning Service Training § 59.210 Inventions or discoveries. Any grant.... Laboratory notes, related technical data, and information pertaining to inventions and discoveries shall be...

  5. 7 CFR 210.16 - Food service management companies.

    Science.gov (United States)

    2010-01-01

    ... 7 Agriculture 4 2010-01-01 2010-01-01 false Food service management companies. 210.16 Section 210... Authority Participation § 210.16 Food service management companies. (a) General. Any school food authority... management company to manage its food service operation in one or more of its schools. However, no school or...

  6. 22 CFR 210.635 - Drug-free workplace.

    Science.gov (United States)

    2010-04-01

    ... 22 Foreign Relations 1 2010-04-01 2010-04-01 false Drug-free workplace. 210.635 Section 210.635 Foreign Relations AGENCY FOR INTERNATIONAL DEVELOPMENT GOVERNMENTWIDE REQUIREMENTS FOR DRUG-FREE WORKPLACE (FINANCIAL ASSISTANCE) Definitions § 210.635 Drug-free workplace. Drug-free workplace means a site for the...

  7. 22 CFR 210.645 - Federal agency or agency.

    Science.gov (United States)

    2010-04-01

    ... 22 Foreign Relations 1 2010-04-01 2010-04-01 false Federal agency or agency. 210.645 Section 210.645 Foreign Relations AGENCY FOR INTERNATIONAL DEVELOPMENT GOVERNMENTWIDE REQUIREMENTS FOR DRUG-FREE WORKPLACE (FINANCIAL ASSISTANCE) Definitions § 210.645 Federal agency or agency. Federal agency or agency...

  8. Improved optimum condition for recovery and measurement of 210 ...

    African Journals Online (AJOL)

    The aim of this study was to determine the optimum conditions for deposition of 210Po and evaluate the accuracy and precision of the results for its determination in environmental samples. To improve the technique for measurement of polonium-210(210Po) in environmental samples. The optimization of five factors (volume ...

  9. 20 CFR 637.210 - Incentive bonus program applications.

    Science.gov (United States)

    2010-04-01

    ... 20 Employees' Benefits 3 2010-04-01 2010-04-01 false Incentive bonus program applications. 637.210 Section 637.210 Employees' Benefits EMPLOYMENT AND TRAINING ADMINISTRATION, DEPARTMENT OF LABOR PROGRAMS UNDER TITLE V OF THE JOB TRAINING PARTNERSHIP ACT Program Planning and Operation § 637.210 Incentive...

  10. 7 CFR 3565.210 - Maximum interest rate.

    Science.gov (United States)

    2010-01-01

    ... 7 Agriculture 15 2010-01-01 2010-01-01 false Maximum interest rate. 3565.210 Section 3565.210... AGRICULTURE GUARANTEED RURAL RENTAL HOUSING PROGRAM Loan Requirements § 3565.210 Maximum interest rate. The interest rate for a guaranteed loan must not exceed the maximum allowable rate specified by the Agency in...

  11. 31 CFR 210.7 - Federal Reserve Banks.

    Science.gov (United States)

    2010-07-01

    ... 31 Money and Finance: Treasury 2 2010-07-01 2010-07-01 false Federal Reserve Banks. 210.7 Section 210.7 Money and Finance: Treasury Regulations Relating to Money and Finance (Continued) FISCAL SERVICE... CLEARING HOUSE General § 210.7 Federal Reserve Banks. (a) Fiscal Agents. Each Federal Reserve Bank serves...

  12. Assessment of {sup 210}Po and {sup 210}Pb in marine biota of the Mallipattinam ecosystem of Tamil Nadu, India

    Energy Technology Data Exchange (ETDEWEB)

    Suriyanarayanan, S. [Center for Water and Health, JSS University, SS Nagara, Mysore 570 015, Karnataka (India); Brahmanandhan, G.M., E-mail: brahma_king@yahoo.co [Nagasaki University Radioisotope Research Center, Radio Isotope Center, 1-12-4, Sakamoto, Nagasaki 852-8523 (Japan); Samivel, K. [Environmental Research Lab, P.G. Department of Zoology, Jamal Mohamed College, Tiruchirappalli-620 020, Tamil Nadu (India); Ravikumar, S. [Faculty of Biotechnology, PRIST University, Thanjavur 613 403, Tamil Nadu (India); Hameed, P. Shahul [Environment Research Center, JJ College of Engineering and Technology, Tiruchirappalli 620 009, Tamil Nadu (India)

    2010-11-15

    To provide baseline data on background radiation levels for the future assessment of the impact of nuclear and thermal power stations, a systematic study was carried out in the Mallipattinam ecosystem of Tamil Nadu, India. Mallipattinam is located between the Kudankulam and Kalpakkam nuclear power plants and near to Tuticorin thermal power plant. Water, sediments, seaweeds, crustaceans, molluscs, and fish were collected to measure the concentrations of {sup 210}Po and {sup 210}Pb. The concentrations of {sup 210}Po and {sup 210}Pb in most samples are comparable to values reported worldwide. In fish, the concentrations of {sup 210}Po and {sup 210}Pb are in the range 16-190 Bq kg{sup -1} and 8-153 Bq kg{sup -1}, respectively. The concentration factors of {sup 210}Po and {sup 210}Pb for the biotic components ranges from 10{sup 3} to 10{sup 6}.

  13. High thallium concentrations in soils from sites of historical Ag, Pb, and Zn mining in western Małopolska (S Poland

    Directory of Open Access Journals (Sweden)

    Woch M. W.

    2013-04-01

    Full Text Available The aim of this study was to assess thallium concentration in topsoil originating from sites of historical mining of Ag, Pb and Zn in western Małopolska (S Poland. Soil samples were collected from 63 sites, sieved, ground and digested in hot HClO4. Thallium concentration was measured with an atomic absorption spectrometer. Thallium concentrations averaged 20.84 mg kg-1 and varied from 4.42 to 49.82 mg kg-1. In all studied soils they exceeded values typical for uncontaminated soils (0.02 to 2.8 mg Tl kg-1. This indicates that Tl contamination may threaten the environment and public health. Routine monitoring of Tl contamination in southern Poland is required.

  14. Preconcentration of thallium(III) with 2,6-bis( N-phenyl carbamoyl) pyridine on microcrystalline naphthalene prior to its trace determination in human serum spectrophotometrically

    Science.gov (United States)

    Rezaei, B.; Meghdadi, S.; Majidi, N.

    2007-05-01

    A novel, simple, sensitive and effective method has been developed for preconcentration of thallium on 2,6-bis( N-phenyl carbamoyl)pyridine-naphthalene adsorbent in the pH range 5.0-10.0, prior to its spectrophotometric determination, based on the oxidation of bromopyrogallol red at λ = 518 nm. This method makes it possible to quantitize thallium in the range of 3.0 × 10 -9 to 1.0 × 10 -5 M, with a detection limit (S/N = 3) of 1.2 × 10 -9 M. This procedure has been successfully applied to determine the ultra trace levels of thallium in the environmental and biological samples, free from the interference of some diverse ions. The precision, expressed as relative standard deviation of three measurements is better than 4.17%.

  15. Distribution of {sup 210}Pb and {sup 210}Po concentrations in wild berries and mushrooms in boreal forest ecosystems

    Energy Technology Data Exchange (ETDEWEB)

    Vaaramaa, Kaisa, E-mail: Kaisa.Vaaramaa@Helsinki.fi [Laboratory of Radiochemistry, Department of Chemistry, P.O. Box 55, FI-00014 University of Helsinki (Finland); Solatie, Dina [STUK-Radiation and Nuclear Safety Authority, Regional Laboratory in Northern Finland, FI-96500 Rovaniemi (Finland); Aro, Lasse [Finnish Forest Research Institute (METLA), Parkano Research Unit, FI-39700 Parkano (Finland)

    2009-12-15

    The activity concentrations and distribution of {sup 210}Pb and {sup 210}Po in wild berries and edible mushrooms were investigated in Finnish forests. The main study areas were located in Scots pine (Pinus sylvestris L.) forests in southern and northern Finland. The activity concentrations of {sup 210}Pb and {sup 210}Po in blueberry (Vaccinium myrtillus L.) and lingonberry (Vaccinium vitis-idaea L.) samples decreased in the order: stems > leaves > berries (i.e. fruits). The activity ratios of {sup 210}Po/{sup 210}Pb in the wild berry samples were mainly higher than one, indicating elevated activity concentrations of polonium in the samples. In mushrooms the activity concentrations of {sup 210}Pb and especially {sup 210}Po were higher than in fruits of the wild berries. The highest activity concentration of {sup 210}Pb was detected in Cortinarius armillatus L. (16.2 Bq kg{sup -1} d.w.) and the lowest in Leccinum vulpinum L. (1.38 Bq kg{sup -1} d.w.). The {sup 210}Po activity concentrations of the whole fruiting bodies ranged from 7.14 Bq kg{sup -1} d.w. (Russula paludosa L.) to 1174 Bq kg{sup -1} d.w. (L. vulpinum L.). In general, the highest activity concentrations of {sup 210}Po were recorded in boletes. The caps of mushrooms of the Boletaceae family showed higher activity concentrations of {sup 210}Po compared to the stipes. In most of the mushrooms analyzed, the activity concentrations of {sup 210}Po were higher than those of {sup 210}Pb. {sup 210}Po and {sup 210}Pb dominate the radiation doses received via ingestion of wild berries and mushrooms in northern Finland, while in southern Finland the ingested dose is dominated by {sup 137}Cs from the Chernobyl fallout.

  16. Distribution of 210Pb and 210Po concentrations in wild berries and mushrooms in boreal forest ecosystems.

    Science.gov (United States)

    Vaaramaa, Kaisa; Solatie, Dina; Aro, Lasse

    2009-12-15

    The activity concentrations and distribution of 210Pb and 210Po in wild berries and edible mushrooms were investigated in Finnish forests. The main study areas were located in Scots pine (Pinus sylvestris L.) forests in southern and northern Finland. The activity concentrations of 210Pb and 210Po in blueberry (Vaccinium myrtillus L.) and lingonberry (Vaccinium vitis-idaea L.) samples decreased in the order: stems>leaves>berries (i.e. fruits). The activity ratios of 210Po/210Pb in the wild berry samples were mainly higher than one, indicating elevated activity concentrations of polonium in the samples. In mushrooms the activity concentrations of 210Pb and especially 210Po were higher than in fruits of the wild berries. The highest activity concentration of 210Pb was detected in Cortinarius armillatus L. (16.2 Bq kg(-1) d.w.) and the lowest in Leccinum vulpinum L. (1.38 Bq kg(-1) d.w.). The 210Po activity concentrations of the whole fruiting bodies ranged from 7.14 Bq kg(-1) d.w. (Russula paludosa L.) to 1174 Bq kg(-1) d.w. (L. vulpinum L.). In general, the highest activity concentrations of 210Po were recorded in boletes. The caps of mushrooms of the Boletaceae family showed higher activity concentrations of 210Po compared to the stipes. In most of the mushrooms analyzed, the activity concentrations of 210Po were higher than those of 210Pb. 210Po and 210Pb dominate the radiation doses received via ingestion of wild berries and mushrooms in northern Finland, while in southern Finland the ingested dose is dominated by 137Cs from the Chernobyl fallout.

  17. Assessment of soil contamination by (210)Po and (210)Pb around heavy oil and natural gas fired power plants.

    Science.gov (United States)

    Al-Masri, M S; Haddad, Kh; Doubal, A W; Awad, I; Al-Khatib, Y

    2014-06-01

    Soil contamination by (210)Pb and (210)Po around heavy oil and natural gas power plants has been investigated; fly and bottom ash containing enhanced levels of (210)Pb and (210)Po were found to be the main source of surface soil contamination. The results showed that (210)Pb and (210)Po in fly-ash (economizer, superheater) is highly enriched with (210)Pb and (210)Po, while bottom-ash (boiler) is depleted. The highest (210)Pb and (210)Po activity concentrations were found to be in economizer ash, whereas the lowest activity concentration was in the recirculator ash. On the other hand, (210)Pb and (210)Po activity concentrations in soil samples were found to be higher inside the plant site area than those samples collected from surrounding areas. The highest levels were found in the vicinity of Mhardeh and Tishreen power plants; both plants are operated by heavy oil and natural fuels, while the lowest values were found to be in those samples collected from Nasrieh power plant, which is only operated by one type of fuel, viz. natural gas. In addition, the levels of surface soil contamination have decreased as the distance from the power plant site center increased. Copyright © 2014 Elsevier Ltd. All rights reserved.

  18. Natural radionuclides (210)Po and (210)Pb in the Delaware and Chesapeake Estuaries: modeling scavenging rates and residence times.

    Science.gov (United States)

    Marsan, D; Rigaud, S; Church, T

    2014-12-01

    During the spring and summer months of 2012, (210)Po and (210)Pb activity were measured in the dissolved and particulate phases from the Delaware and upper Chesapeake estuaries. The upper Delaware estuary, near the freshwater end member, was characterized by high-suspended matter concentrations that scavenged dissolved (210)Po and (210)Pb. Box models were applied using mass balance calculations to assess the nuclides residence times in each estuary. Only 60% of the dissolved (210)Po and 55% of the dissolved (210)Pb from the Delaware estuary were exported to coastal waters. A large fraction of soluble (210)Po and (210)Pb within the estuary was either reversibly adsorbed onto suspended particles, trapped in sediment accumulation zones (such as intertidal marshes), bioaccumulated into phytoplankton and discharged to the coastal ocean. The upper Chesapeake estuary was largely characterized by sub-oxic bottom waters that contained higher concentrations of dissolved (210)Po and (210)Pb, hypothesized to be subjected to redox cycling of manganese. The Delaware and Chesapeake estuary mean residence times for (210)Po differed significantly at 86 ± 7 and 126 ± 10 days respectively, while they were similar for (210)Pb (67 ± 6-55 ± 5 days). The difference in residence times corresponds to the greater extent of biogeochemical scavenging and regeneration processes within the upper Chesapeake. Copyright © 2014 Elsevier Ltd. All rights reserved.

  19. Quantitation of lead-210 (210Pb) using lead-203 (203Pb) as a "Massless" yield tracer.

    Science.gov (United States)

    May, D; Nelson, A N; Schultz, M K

    2017-05-01

    Determination of Pb-210 (210Pb) in aqueous solution is a common radioanalytical challenge in environmental science. Widely used methods for undertaking these analyses (e.g., ASTM D7535) rely on the use of stable lead (Pb) as a yield tracer that takes into account losses of 210Pb that inevitably occur during elemental/radiochemical separations of the procedures. Although effective, these methods introduce technical challenges that can be difficult to track and potentially introduce uncertainty that can be difficult to quantify. Examples of these challenges include interference from endogenous stable Pb in complex sample matrices; contamination of stable Pb carrier with 210Pb; and high detection limits due to counting efficiency limitations. We hypothesized that many of these challenges could be avoided by the use of the electron-capture, gamma-emitting isotope, 203Pb as a chemical yield tracer in the analysis of 210Pb. A series of experiments were performed to evaluate the efficacy of 203Pb as a tracer. Four different matrices were analyzed, including a complex matrix (hydraulic-fracturing produced fluids); and samples comprising less complicated matrices (i.e., river water, deionized water, and tap water). Separation techniques and counting methodologies were also compared and optimized. Due to a relatively short-half life (52 h), 203Pb tracer is effectively massless for the purposes of chemical separations, allowing for reduced chromatography column resin bed volumes. Because 203Pb is a gamma emitter (279 keV; 81% intensity), recovery can be determined non-destructively in a variety of matrices, including liquid scintillation cocktail. The use of liquid scintillation as a counting methodology allowed for determination of 210Pb activities via 210Pb or 210Po; and recoveries of greater than 90% are routinely achievable using this approach. The improved method for the analysis of 210Pb in aqueous matrices allows for the analysis of complex matrices, at reduced cost

  20. Biphasic thallium 201 SPECT-imaging for the noninvasive diagnosis of myocardial perfusion abnormalities in a child with Kawasaki disease--a case report

    Energy Technology Data Exchange (ETDEWEB)

    Hausdorf, G.; Nienaber, C.A.; Spielman, R.P.

    1988-02-01

    The mucocutaneous lymph node syndrome (Kawasaki disease) is of increasing importance for the pediatric cardiologist, for coronary aneurysms with the potential of thrombosis and subsequent stenosis can develop in the course of the disease. The authors report a 2 1/2-year-old female child in whom, fourteen months after the acute phase of Kawasaki disease, myocardial infarction occurred. Biphasic thallium 201 SPECT-imaging using dipyridamole depicted anterior wall ischemia and inferolateral infarction. This case demonstrates that noninvasive vasodilation-redistribution thallium 201 SPECT-imaging has the potential to predict reversible myocardial perfusion defects and myocardial necrosis, even in small infants with Kawasaki disease.

  1. Influence of the Dirac-Hartree-Fock starting potential on the parity-nonconserving electric-dipole-transition amplitudes in cesium and thallium

    Science.gov (United States)

    Perger, W. F.; Das, B. P.

    1987-01-01

    The parity-nonconserving electric-dipole-transition amplitudes for the 6s1/2-7s1/2 transition in cesium and the 6p1/2-7p1/2 transition in thallium have been calculated by the Dirac-Hartree-Fock method. The effects of using different Dirac-Hartree-Fock atomic core potentials are examined and the transition amplitudes for both the length and velocity gauges are given. It is found that the parity-nonconserving transition amplitudes exhibit a greater dependence on the starting potential for thallium than for cesium.

  2. Assessment of myocardial viability by dynamic tomographic iodine 123 iodophenylpentadecanoic acid imaging: comparison with rest-redistribution thallium 201 imaging.

    Science.gov (United States)

    Iskandrian, A S; Powers, J; Cave, V; Wasserleben, V; Cassell, D; Heo, J

    1995-01-01

    This study examined the ability of dynamic 123I-labeled iodophenylpentadecanoic acid (IPPA) imaging to detect myocardial viability in patients with left ventricular (LV) dysfunction caused by coronary artery disease. Serial 180-degree single-photon emission computed tomographic (SPECT) images (five sets, 8 minutes each) were obtained starting 4 minutes after injection of 2 to 6 mCi 123I at rest in 21 patients with LV dysfunction (ejection fraction [EF] 34% +/- 11%). The segmental uptake was compared with that of rest-redistribution 201Tl images (20 segments/study). The number of perfusion defects (reversible and fixed) was similar by IPPA and thallium (11 +/- 5 vs 10 +/- 5 segments/patient; difference not significant). There was agreement between IPPA and thallium for presence or absence (kappa = 0.78 +/- 0.03) and nature (reversible, mild fixed, or severe fixed) of perfusion defects (kappa = 0.54 +/- 0.04). However, there were more reversible IPPA defects than reversible thallium defects (7 +/- 4 vs 3 +/- 4 segments/patient; p = 0.001). In 14 patients the EF (by gated pool imaging) improved after coronary revascularization from 33% +/- 11% to 39% +/- 12% (p = 0.002). The number of reversible IPPA defects was greater in the seven patients who had improvement in EF than in the patients without such improvement (10 +/- 4 vs 5 +/- 4 segments/patient; p = 0.075). 123I-labeled IPPA SPECT imaging is a promising new technique for assessment of viability. Reversible defects predict recovery of LV dysfunction after coronary revascularization.

  3. Temporal changes of {sup 210}Po in temperate coastal waters

    Energy Technology Data Exchange (ETDEWEB)

    Wildgust, M.A.; White, K.N. [School of Biological Sciences, The University of Manchester, Manchester (United Kingdom); McDonald, P. [Westlakes Research Limited, Westlakes Science and Technology Park, Cumbria (United Kingdom)

    1998-06-18

    The temporal variation of Polonium-210 ({sup 210}Po) was examined in coastal sea water, the mussel Mytilus edulis, the winkle Littorina littorea and green algae Ulva lactuca in order to investigate the entry of {sup 210}Po into the marine food chain. More than 99% of {sup 210}Po in the water column occurred in the particulate phase. Dissolved {sup 210}Po concentrations peaked during the spring phytoplankton bloom and it is suggested this is related to preferential scavenging of {sup 210}Po by the increased numbers of bacteria, viruses and small dissolved particulates. Changes in L. Littorea {sup 210}Po specific activity are thought not to be related to food, but to a drop in body weight following spawning. Much of the {sup 210}Po accumulated by M. edulis was located in the digestive gland. The specific activity of {sup 210}Po in the digestive gland of M. edulis was shown to be strongly correlated with changes in sea water suspended particulate specific activity. Examination of other trace metal (Ag, Al, As, Ca, Cd, Cr, Co, Cu, Fe, Hg, K, Mg, Mn, Na, Ni Sb, Se, Sn and Zn) variations in the digestive gland revealed that class B and borderline metals had a strong positive correlation with {sup 210}Po. On-going work is investigating whether the accumulation and loss of {sup 210}Po is affected by the presence of metallothioneins

  4. Self-propagating high-temperature synthesis (SHS) and microwave-assisted combustion synthesis (MACS) of the thallium superconducting phases

    Science.gov (United States)

    Bayya, S. S.; Snyder, R. L.

    1994-05-01

    This paper explores the speed of reaction as a parameter to minimizing thallium loss. Self-propagating high-temperature synthesis (SHS) and microwave-assisted combustion synthesis (MACS) were developed for the synthesis of Tl-2212 and Tl-2223 superconductors using Cu metal powder as a fuel. A kitchen microwave oven was used to carry out MACS reactions. The samples were reacted for few seconds and led to the formation of the superconducting phases. Further explorations and modifications in the processing could lead to the formation of single phases by MACS.

  5. Tracking along-arc sediment inputs to the Aleutian arc using thallium isotopes

    Science.gov (United States)

    Nielsen, Sune G.; Yogodzinski, Gene; Prytulak, Julie; Plank, Terry; Kay, Suzanne M.; Kay, Robert W.; Blusztajn, Jerzy; Owens, Jeremy D.; Auro, Maureen; Kading, Tristan

    2016-05-01

    Sediment transport from the subducted slab to the mantle wedge is an important process in understanding the chemical and physical conditions of arc magma generation. The Aleutian arc offers an excellent opportunity to study sediment transport processes because the subducted sediment flux varies systematically along strike (Kelemen et al., 2003) and many lavas exhibit unambiguous signatures of sediment addition to the sub-arc mantle (Morris et al., 1990). However, the exact sediment contribution to Aleutian lavas and how these sediments are transported from the slab to the surface are still debated. Thallium (Tl) isotope ratios have great potential to distinguish sediment fluxes in subduction zones because pelagic sediments and low-temperature altered oceanic crust are highly enriched in Tl and display heavy and light Tl isotope compositions, respectively, compared with the upper mantle and continental crust. Here, we investigate the Tl isotope composition of lavas covering almost the entire Aleutian arc a well as sediments outboard of both the eastern (DSDP Sites 178 and 183) and central (ODP Hole 886C) portions of the arc. Sediment Tl isotope compositions change systematically from lighter in the Eastern to heavier in the Central Aleutians reflecting a larger proportion of pelagic sediments when distal from the North American continent. Lavas in the Eastern and Central Aleutians mirror this systematic change to heavier Tl isotope compositions to the west, which shows that the subducted sediment composition is directly translated to the arc east of Kanaga Island. Moreover, quantitative mixing models of Tl and Pb, Sr and Nd isotopes reveal that bulk sediment transfer of ∼0.6-1.0% by weight in the Eastern Aleutians and ∼0.2-0.6% by weight in the Central Aleutians can account for all four isotope systems. Bulk mixing models, however, require that fractionation of trace element ratios like Ce/Pb, Cs/Tl, and Sr/Nd in the Central and Eastern Aleutians occurs after

  6. Controls on thallium uptake during hydrothermal alteration of the upper ocean crust

    Science.gov (United States)

    Coggon, Rosalind M.; Rehkämper, Mark; Atteck, Charlotte; Teagle, Damon A. H.; Alt, Jeffrey C.; Cooper, Matthew J.

    2014-11-01

    Hydrothermal circulation is a fundamental component of global biogeochemical cycles. However, the magnitude of the high temperature axial hydrothermal fluid flux remains disputed, and the lower temperature ridge flank fluid flux is difficult to quantify. Thallium (Tl) isotopes behave differently in axial compared to ridge flank systems, with Tl near-quantitatively stripped from the intrusive crust by high temperature hydrothermal reactions, but added to the lavas during low temperature reaction with seawater. This contrasting behavior provides a unique approach to determine the fluid fluxes associated with axial and ridge flank environments. Unfortunately, our understanding of the Tl isotopic mass balance is hindered by poor knowledge of the mineralogical, physical and chemical controls on Tl-uptake by the ocean crust. Here we use analyses of basaltic volcanic upper crust from Integrated Ocean Drilling Program Hole U1301B on the Juan de Fuca Ridge flank, combined with published analyses of dredged seafloor basalts and upper crustal basalts from Holes 504B and 896A, to investigate the controls on Tl-uptake by mid-ocean ridge basalts and evaluate when in the evolution of the ridge flank hydrothermal system Tl-uptake occurs. Seafloor basalts indicate an association between basaltic uptake of Tl from cold seawater and uptake of Cs and Rb, which are known to partition into K-rich phases. Although there is no clear relationship between Tl and K contents of seafloor basalts, the data do not rule out the incorporation of at least some Tl into the same minerals as the alkali elements. In contrast, we find no relationship between the Tl content and either the abundance of secondary phyllosilicate minerals, or the K, Cs or Rb contents in upper crustal basalts. We conclude that the uptake of Tl and alkali elements during hydrothermal alteration of the upper crust involves different processes and/or mineral phases compared to those that govern seafloor weathering. Furthermore

  7. {sup 210}Pb and {sup 210}Po as tracers of particle transport mechanisms on continental margins

    Energy Technology Data Exchange (ETDEWEB)

    Radakovitch, O.; Heussner, S. [Perpignan Univ., 66 (France). Lab. de Sedimentologie et Geochimie Marines; Biscaye, P.; Abassi, A. [Columbia Univ., Palisades, NY (United States). Lamont Doherty Earth Observatory

    1997-12-31

    The natural radionuclides {sup 210}Po and {sup 210}Pb, members of the {sup 238}U decay chain, are particularly helpful to the understanding of particle transport processes in the ocean. These isotopes were analysed on sediment trap particles collected during 3 one-year experiments on continental margins. In the Bay of Biscay (Northeastern Atlantic) and in the Gulf of Lion (Northwestern Mediterranean Sea) both as part of the French ECOMARGE programme, and in the Middle Atlantic Bight (Northwestern Atlantic) as part of the SEEP programme. They yielded great insights into scenarios of particle transfer at each site, mainly based on the spatial and temporal distribution of {sup 210}Pb particulate concentrations and fluxes. (author) 11 refs.

  8. Chemistry and phase evolution during roasting of toxic thallium-bearing pyrite.

    Science.gov (United States)

    Lopez-Arce, Paula; Garcia-Guinea, Javier; Garrido, Fernando

    2017-08-01

    In the frame of a research project on microscopic distribution and speciation of geogenic thallium (Tl) from contaminated mine soils, Tl-bearing pyrite ore samples from Riotinto mining district (Huelva, SW Spain) were experimentally fired to simulate a roasting process. Concentration and volatility behavior of Tl and other toxic heavy metals was determined by quantitative ICP-MS, whereas semi-quantitative mineral phase transitions were identified by in situ thermo X-Ray Diffraction (HT-XRD) and Scanning Electron Microscopy with Energy Dispersive Spectroscopy (SEM-EDS) analyses after each firing temperature. Sample with initial highest amount of quartz (higher Si content), lowest quantity of pyrite and traces of jarosite (lower S content) developed hematite and concentrated Tl (from 10 up to 72 mg kg-1) after roasting at 900 °C in an oxidizing atmosphere. However, samples with lower or absent quartz content and higher pyrite amount mainly developed magnetite, accumulating Tl between 400 and 500 °C and releasing Tl from 700 up to 900 °C (from 10-29 mg kg-1 down to 4-1 mg kg-1). These results show the varied accumulative, or volatile, behaviors of one of the most toxic elements for life and environment, in which oxidation of Tl-bearing Fe sulfides produce Fe oxides wastes with or without Tl. The initial chemistry and mineralogy of pyrite ores should be taken into account in coal-fired power stations, cement or sulfuric acid production industry involving pyrite roasting processes, and steel, brick or paint industries, which use iron ore from roasted pyrite ash, where large amounts of Tl entail significant environmental pollution. Copyright © 2017 Elsevier Ltd. All rights reserved.

  9. Measurement of the parity nonconserving neutral weak interaction in atomic thallium

    Energy Technology Data Exchange (ETDEWEB)

    Bucksbaum, P.H.

    1980-11-01

    This thesis describes an experiment to measure parity nonconservation in atomic thallium. A frequency doubled, flashlamp pumped tunable dye laser is used to excite the 6P/sub 1/2/(F = 0) ..-->.. 7P/sub 1/2/(F = 1) transition at 292.7 nm, with circularly polarized light. An electrostatic field E of 100 to 300 V/cm causes this transition to occur via Stark induced electric dipole. Two field free transitions may also occur: a highly forbidden magnetic dipole M, and a parity nonconserving electric dipole epsilon/sub P/. The latter is presumed to be due to the presence of a weak neutral current interaction between the 6p valence electron and the nucleus, as predicted by gauge theories which unite the electromagnetic and weak interactions. Both M and epsilon/sub P/ interfere with the Stark amplitude ..beta..E to produce a polarization of the 7P/sub 1/2/ state. This is measured with a circularly polarized infrared laser beam probe, tuned to the 7P/sub 1/2/ ..-->.. 8S/sub 1/2/ transition. This selectively excites m/sub F/ = +1 or -1 components of the 7P/sub 1/2/ state, and the polarization is seen as an asymmetry in 8S ..-->.. 6P/sub 3/2/ fluorescence when the probe helicity is reversed. The polarization due to M is ..delta../sub M/ = -2M/(BETAE). It is used to calibrate the analyzing efficiency. The polarization due to epsilon/sub P/ is ..delta../sub P/ = 2i epsilon/sub P//(..beta..E), and can be distinguished from ..delta../sub M/ by its properties under reversal of the 292.7 nm photon helicity and reversal of the laser direction. A preliminary measurement yielded a parity violation in agreement with the gauge theory of Weinberg and Salam.

  10. MRI and thallium-201 SPECT in the prediction of survival in glioma

    Energy Technology Data Exchange (ETDEWEB)

    Vos, Maaike J. [VU University Medical Center, Department of Neurology, Amsterdam (Netherlands); Medical Center Haaglanden, Department of Neurology, PO Box 432, The Hague (Netherlands); Berkhof, Johannes [VU University Medical Center, Department of Epidemiology and Biostatistics, Amsterdam (Netherlands); Hoekstra, Otto S. [VU University Medical Center, Department of Nuclear Medicine and PET Research, Amsterdam (Netherlands); Bosma, Ingeborg; Sizoo, Eefje M.; Heimans, Jan J.; Reijneveld, Jaap C.; Postma, Tjeerd J. [VU University Medical Center, Department of Neurology, Amsterdam (Netherlands); Sanchez, Esther [VU University Medical Center, Department of Radiology, Amsterdam (Netherlands); Lagerwaard, Frank J. [VU University Medical Center, Department of Radiation Oncology, Amsterdam (Netherlands); Buter, Jan [VU University Medical Center, Department of Medical Oncology, Amsterdam (Netherlands); Noske, David P. [VU University Medical Center, Department of Neurosurgery and Neuro-Oncology Research Group, Amsterdam (Netherlands)

    2012-06-15

    This paper aims to study the value of MRI and Thallium 201 ({sup 201}Tl) single-photon emission computed tomography (SPECT) in the prediction of overall survival (OS) in glioma patients treated with temozolomide (TMZ) and to evaluate timing of radiological follow-up. We included patients treated with TMZ chemoradiotherapy for newly diagnosed glioblastoma multiforme (GBM) and with TMZ for recurrent glioma. MRIs and {sup 201}Tl SPECTs were obtained at regular intervals. The value of both imaging modalities in predicting OS was examined using Cox regression analyses. Altogether, 138 MRIs and 113 {sup 201}Tl SPECTs in 46 patients were performed. Both imaging modalities were strongly related to OS (P {<=} 0.02). In newly diagnosed GBM patients, the last follow-up MRI (i.e., after six adjuvant TMZ courses) and SPECT (i.e., after three adjuvant TMZ courses) were the strongest predictors of OS (P = 0.01). In recurrent glioma patients, baseline measurements appeared to be the most predictive of OS (P < 0.01). The addition of one imaging modality to the other did not contribute to the prediction of OS. Both MRI and {sup 201}Tl SPECT are valuable in the prediction of OS. It is adequate to restrict to one of both modalities in the radiological follow-up during treatment. In the primary GBM setting, MRI after six adjuvant TMZ courses contributes significantly to the prediction of survival. In the recurrent glioma setting, baseline MRI appears to be a powerful predictor of survival, whereas follow-up MRIs during TMZ seem to be of little additional value. (orig.)

  11. Synthesis, calorimetric, structural and conductivity studies in a new thallium selenate tellurate adduct compound

    Energy Technology Data Exchange (ETDEWEB)

    Ktari, L. [Laboratoire de l' Etat Solide (LES), Faculte des Sciences de Sfax, 3000 Sfax (Tunisia); Abdelhedi, M. [Laboratoire de l' Etat Solide (LES), Faculte des Sciences de Sfax, 3000 Sfax (Tunisia); Laboratoire Leon Brouillon LLB, CEA Saclay, 91191 Gif-Sur-Yvette Cedex (France); Bouhlel, N. [Laboratoire de l' Etat Solide (LES), Faculte des Sciences de Sfax, 3000 Sfax (Tunisia); Dammak, M., E-mail: meddammak@yahoo.fr [Laboratoire de l' Etat Solide (LES), Faculte des Sciences de Sfax, 3000 Sfax (Tunisia); Cousson, A. [Laboratoire Leon Brouillon LLB, CEA Saclay, 91191 Gif-Sur-Yvette Cedex (France)

    2009-08-05

    The crystal structure of the thallium selenate tellurate Tl{sub 2}SeO{sub 4}.Te(OH){sub 6} (TlSeTe) was determined by X-ray diffraction method. The title compound crystallizes in the monoclinic system with P2{sub 1}/c space group. The following parameters are: a = 12.358(3) A; b = 7.231(1) A; c = 11.986(2) A; {beta} = 111.092(2){sup o}; Z = 4. The structure can be regarded as being built of isolated TeO{sub 6} octahedra and SeO{sub 4} tetrahedra. The Tl{sup +} cations are intercalated between these kinds of polyhedra. The main feature of this structure is the coexistence of two different and independent anions (SeO{sub 4}{sup 2-} and TeO{sub 6}{sup 6-}) in the same unit cell. The structure is stable due to O-H...O hydrogen bonds which link tetrahedral and octahedral groups. Crystals of Tl{sub 2}SeO{sub 4}.Te(OH){sub 6} undergo three endothermal transitions at 373, 395 and 437 K. These transitions are detected by DSC and analyzed by dielectric measurements with impedance spectroscopy. The evolution of conductivity versus temperature showed the presence of a protonic conduction phase transition at 437 K. The phase transition at 373 K can be related to a structural phase transition, whereas the one at 395 K is ascribed as likely due to a ferroelectric-paraelectric phase transition.

  12. Electrochemical properties of modified copper-thallium hexacyanoferrate electrode in the presence of different univalent cations

    Energy Technology Data Exchange (ETDEWEB)

    Rutkowska, Iwona A.; Stroka, Jadwiga [Department of Chemistry, University of Warsaw, Pasteura 1, PL-02-093 Warsaw (Poland); Galus, Zbigniew [Department of Chemistry, University of Warsaw, Pasteura 1, PL-02-093 Warsaw (Poland)], E-mail: zbgalus@chem.uw.edu.pl

    2008-04-20

    The preparation of copper(II) hexacyanoferrate (CuHCF) films on the surface of gold electrodes as well as their characterization in solutions of various alkali metal and NH{sub 4}{sup +} cations and in the presence of thallium(I) are described. The electrochemical quartz crystal microbalance and cyclic voltammetric techniques were used. In 0.50 M lithium nitrate, even at submillimolar concentration of Tl(I), the formal potential of CuHCF was shifted to more positive values. At higher Tl(I) concentrations, the formal potential of the CuHCF redox reaction changed linearly with the logarithm of Tl(I) concentration (in the 0.50 M solution of lithium or another alkali metal nitrate). From such dependencies, selectivity coefficients K{sub Tl/M} were calculated, and they show that the CuHCF film on the gold electrode interacts preferentially with Tl(I). High affinity of Tl(I) to copper hexacyanoferrate, that was observed in the presence of alkali metal cations, was explained by relatively strong donor-acceptor interactions of Tl(I) ions with nitrogen in CN groups of the CuHCF film. It was also shown for simple M{sub 4}[Fe(CN){sub 6}] metal ferrocyanate salts (where M = Li{sup +}, Na{sup +}, K{sup +}, Rb{sup +}, Cs{sup +} and Tl{sup +}) that there is a preferential interaction of Tl{sup +} with CN group consistent with formation of a Tl-NC-Fe bridge.

  13. Quantitative evaluation of thallium-201 myocardial scintigram in coronary artery diseases

    Energy Technology Data Exchange (ETDEWEB)

    Mikada, Ken-etsu (Akita Univ. (Japan). School of Medicine)

    1992-11-01

    Quantitative indices from circumferential profile curves of thallium-201 ([sup 201]Tl) myocardial scintigram were evaluated for diagnostic utility in coronary artery diseases (CAD). Myocardial [sup 201]Tl scintigrams with single photon emission computed tomography (SPECT) were obtained 5 minutes (early) and 4 hours (delayed) after exercise in 20 normal subjects and 66 cases of CAD, of which 20 were angina pectoris without myocardial infarction (AP), 14 were subendocardial infarction (non-QMI) and 32 were Q-wave infarction (QMI). Tl counts, %Tl uptake and washout ratio (WR) were measured in 81 segments (9 apical segments of the slice from the longitudinal axis and all 72 segments of two slices from the short axis). A mean early defect (MED), a mean delayed defect (MDD), a mean delta washout rate (MDR), and a [Sigma] delayed defect ([Sigma]DD) were calculated from the areas which were below the two standard deviations of the mean %Tl uptake in normal subjects. A mean filling-in (MFI) was calculated from the difference of the %Tl uptake between early and delayed curves in each patient. In patients with CAD, the MED and MFI were higher, but MDW was lower with a more severe coronary stenosis, indicating that these indices were useful to detect myocardial hypo-perfuion. In severely stenotic regions, the MDD was higher in QMI than in AP and non-QMI, indicating that the ratio of infarct to the myocardium in the region was higher in QMI. In QMI, [Sigma]DD correlated well (r=0.723) with Total Wall Motion Scores with two-dimentional echocardiography which was directly related with infarct size. Further, MED, MFI and MDW were improved after aortocoronary bypass only in patients with patent graft. It is concluded that this quantitative evaluation with [sup 201]Tl-SPECT can provide an objective and quantitative estimate of regional myocardial ischemia and infarct. (author).

  14. Thallium-201 for cardiac stress tests: residual radioactivity worries patients and security.

    Science.gov (United States)

    Geraci, Matthew J; Brown, Norman; Murray, David

    2012-12-01

    A 47-year-old man presented to the Emergency Department (ED) in duress and stated he was "highly radioactive." There were no reports of nuclear disasters, spills, or mishaps in the local area. This report discusses the potential for thallium-201 (Tl-201) patients to activate passive radiation alarms days to weeks after nuclear stress tests, even while shielded inside industrial vehicles away from sensors. Characteristics of Tl-201, as used for medical imaging, are described. This patient was twice detained by Homeland Security Agents and searched after he activated radiation detectors at a seaport security checkpoint. Security agents deemed him not to be a threat, but they expressed concern regarding his health and level of personal radioactivity. The patient was subsequently barred from his job and sent to the hospital. Tl-201 is a widely used radioisotope for medical imaging. The radioactive half-life of Tl-201 is 73.1h, however, reported periods of extended personal radiation have been seen as far out as 61 days post-administration. This case describes an anxious, but otherwise asymptomatic patient presenting to the ED with detection of low-level personal radiation. Documentation should be provided to and carried by individuals receiving radionuclides for a minimum of five to six half-lives of the longest-lasting isotope provided. Patients receiving Tl-201 should understand the potential for security issues; reducing probable tense moments, confusion, and anxiety to themselves, their employers, security officials, and ED staff. Copyright © 2012 Elsevier Inc. All rights reserved.

  15. Usefulness of thallium-201 SPECT in the evaluation of tumor natures in intracranial meningiomas

    Energy Technology Data Exchange (ETDEWEB)

    Takeda, Tetsuji; Nakano, Takahiro; Asano, Kenichiroh; Shimamura, Norihito; Ohkuma, Hiroki [Hirosaki University Graduate School of Medicine, Department of Neurosurgery, Hirosaki (Japan)

    2011-11-15

    Although intracranial meningiomas are regarded as benign tumors, some of them behave clinically as malignant tumors. Past reports suggest that MIB 1 and vascular endothelial growth factor (VEGF) in postoperative tumor specimens correlate with the aggressive nature of tumors, but preoperative prediction of such a nature is more useful for therapeutic planning for the tumor. The purpose of this study was to assess the usefulness of preoperative thallium-201 chloride single-photon emission computed tomography (Tl SPECT) to evaluate biological behavior in intracranial meningiomas. Tl SPECT was performed on 39 patients with intracranial meningioma and Tl uptake indices were calculated. The difference in the Tl uptake index between atypical meningiomas and other pathological types of meningioma was evaluated. Moreover, correlation of Tl uptake indices with the MIB1 labeling index was estimated. Tl uptake indices were also compared between VEGF strongly positive and weakly positive meningiomas. The delayed index of atypical meningioma was significantly higher than that of the other pathological types (p = 0.036). Significant correlation was found between the Tl uptake index in the delayed image and MIB1 labeling index (p < 0.0001, R{sup 2} = 0.36). Moreover, VEGF strongly positive meningiomas exhibited a significantly higher Tl uptake index compared to VEGF weakly positive meningiomas in both the early image and the delayed image (p = 0.029, 0.023, respectively). Tl uptake index may be a possible preoperative surrogate marker of MIB1 and VEGF that is useful in detecting aggressive natures in intracranial meningiomas. (orig.)

  16. Effective removal of trace thallium from surface water by nanosized manganese dioxide enhanced quartz sand filtration.

    Science.gov (United States)

    Huangfu, Xiaoliu; Ma, Chengxue; Ma, Jun; He, Qiang; Yang, Chun; Zhou, Jian; Jiang, Jin; Wang, Yaan

    2017-12-01

    Thallium (Tl) has drawn wide concern due to its high toxicity even at extremely low concentrations, as well as its tendency for significant accumulation in the human body and other organisms. The need to develop effective strategies for trace Tl removal from drinking water is urgent. In this study, the removal of trace Tl (0.5 μg L -1 ) by conventional quartz sand filtration enhanced by nanosized manganese dioxide (nMnO 2 ) has been investigated using typical surface water obtained from northeast China. The results indicate that nMnO 2 enhanced quartz sand filtration could remove trace Tl(I) and Tl(III) efficiently through the adsorption of Tl onto nMnO 2 added to a water matrix and onto nMnO 2 attached on quartz sand surfaces. Tl(III)-HA complexes might be responsible for higher residual Tl(III) in the effluent compared to residual Tl(I). Competitive Ca 2+ cations inhibit Tl removal to a certain extent because the Ca 2+ ions will occupy the Tl adsorption site on nMnO 2 . Moreover, high concentrations of HA (10 mgTOC L -1 ), which notably complexes with and dissolves nMnO 2 (more than 78%), resulted in higher residual Tl(I) and Tl(III). Tl(III)-HA complexes might also enhance Tl(III) penetration to a certain extent. Additionally, a higher pH level could enhance the removal of trace Tl from surface water. Finally, a slight increase of residual Tl was observed after backwash, followed by the reduction of the Tl concentration in the effluent to a "steady" state again. The knowledge obtained here may provide a potential strategy for drinking water treatment plants threatened by trace Tl. Copyright © 2017. Published by Elsevier Ltd.

  17. Reduced left ventricular cavitary activity ("black hole sign") in thallium-201 SPECT perfusion images of anteroapical transmural myocardial infarction.

    Science.gov (United States)

    Civelek, A C; Shafique, I; Brinker, J A; Durski, K; Weiss, J L; Links, J M; Natarajan, T K; Ozguven, M A; Wagner, H N

    1991-11-01

    Apparently reduced left ventricular (LV) cavitary thallium activity in both planar and tomographic perfusion images has been previously observed by these and other investigators. With single-photon emission computerized tomography, we have clinically noted that this "black hole sign" was associated with an aneurysm in the setting of a transmural anterior or anteroapical perfusion defect. We have now prospectively studied the etiology and predictive value of this sign in 84 consecutive patients with an anterior, anteroapical transmural perfusion defect. Of the 84 patients, 49 had both LV aneurysm (confirmed by contrast ventriculography, echocardiography or gated blood pool studies) and a black hole sign. Only 1 patient with an aneurysm did not have the black hole sign, and 2 without aneurysm did. Thus, it is concluded that this sign is highly accurate in diagnosing LV aneurysm. Because thallium-201 single-photon emission computerized tomography imaging is often performed as one of the first diagnostic tests soon after myocardial infarction, this has important clinical management implications.

  18. The analysis of thallium in geological materials by radiochemical neutron activation and x-ray fluorescence spectrometry: a comparison

    Energy Technology Data Exchange (ETDEWEB)

    McGoldrick, P.J.; Robinson, P. [Tasmania Univ., Sandy Bay, TAS (Australia)

    1993-12-31

    Carrier-based radiochemical neutron activation (RNAA) is a precise and accurate technique for the analysis of Tl in geological materials. For about a decade, until the mid-80s, a procedure modified from Keays et al. (1974) was used at the University of Melbourne to analyse for Tl in a wide variety of geological materials. Samples of powdered rock weighing several hundred milligrams each were irradiated in HIFAR for between 12 hours and 1 week, and subsequently fused with a sodium hydroxide - sodium peroxide mixture and several milligrams of inactive Tl carrier. Following acid digestion of the fusion mixture anion exchange resin was used to separate Tl from the major radioactive rock constituents. The Tl was then stripped from the resin and purified as thallium iodide and a yield measured gravimetrically. Activity from {sup 204}Tl (a {beta}-emitter with a 3 8 year half-life) was measured and Tl determined by reference to pure chemical standards irradiated and processed along with the unkowns. Detection limits for the longer irradiations were about one part per billion. Precision was monitored by repeat analyses of `internal standard` rocks and was estimated to be about five to ten percent (one standard deviation). On the other hand, X-ray fluorescence spectrometry (XRF) was seen as an excellent cost-effective alternative for thallium analysis in geological samples, down to 1 ppm. 6 refs. 1 tab., 1 fig.

  19. Pentoxifylline (Trental) does not inhibit dipyridamole-induced coronary hyperemia: Implications for dipyridamole-thallium-201 myocardial imaging

    Energy Technology Data Exchange (ETDEWEB)

    Brown, K.A.; Slinker, B.K. (Univ. of Vermont College of Medicine, Burlington (USA))

    1990-06-01

    Dipyridamole-thallium-201 imaging is often performed in patients unable to exercise because of peripheral vascular disease. Many of these patients are taking pentoxifylline (Trental), a methylxanthine derivative which may improve intermittent claudication. Whether pentoxifylline inhibits dipyridamole-induced coronary hyperemia like other methylxanthines such as theophylline and should be stopped prior to dipyridamole-thallium-201 imaging is unknown. Therefore, we studied the hyperemic response to dipyridamole in seven open-chest anesthetized dogs after pretreatment with either pentoxifylline (0, 7.5, or 15 mg/kg i.v.) or theophylline (3 mg/kg i.v.). Baseline circumflex coronary blood flows did not differ significantly among treatment groups. Dipyridamole significantly increased coronary blood flow before and after 7.5 or 15 mm/kg i.v. pentoxifylline (p less than 0.002). Neither dose of pentoxifylline significantly decreased the dipyridamole-induced hyperemia, while peak coronary blood flow was significantly lower after theophylline (p less than 0.01). We conclude that pentoxyifylline does not inhibit dipyridamole-induced coronary hyperemia even at high doses.

  20. Behaviour of 210Po in the marine environment

    Science.gov (United States)

    Wildgust, Mark Antony

    The naturally occurring alpha-emitter polonium-210 (210Po) is one of the most radiotoxic elements in the environment. Moreover, it contributes more than 150 times towards the effective radiation dosage received by humans from the consumption of fish and shellfish than from anthropogenic 137Cs. Polonium-210 is known to be strongly accumulated by marine organisms but its biochemistry is poorly understood. The research described here had two main aims: first, to investigate the factors causing temporal variations of 210Po in the temperate coastal waters and marine biota and second, to examine the biokinetics of 210Po in the marine mussel Mytilus edulis. These questions were investigated by a field study and a series of laboratory experiments. In the field study more than 99% of 210Po in the water column occurred in the particulate phase. Dissolved 210Po levels peaked during the phytoplankton bloom and I proposed that this was related to preferential scavenging of 210Po by increased numbers of bacteria, viruses and small dissolved particulates. Changes in 210Po specific activity in the winkle Liittorina littorea are thought to be related to a fall in body weight following spawning. The specific activity of 210Po in the digestive gland of M. edulis was strongly correlated with changes in seawater suspended particulate specific activity. Examination of other trace metals revealed correlations between class B and Borderline metals. In the laboratory digestion of 210Po-labelled Isochrysis galbana occurred via a biphasic process, characteristic of a rapid (extracellular) and slow (intracellular) digestion typical of marine bivalves. The mantle/gill and foot have no known digestive role, yet their 210Po specific activities increased after 24 hours. I proposed that this increase in 210Po specific activity was related to 210Po incorporated into these tissues from that assimilated from I. galbana during extracellular digestion. I also propose that the linear loss of 210Po

  1. Thallium-201 scintigraphy after dipyridamole infusion with low-level exercise. III Clinical significance and additional diagnostic value of ST segment depression and angina pectoris during the test

    NARCIS (Netherlands)

    G-J. Laarman (GertJan); P.W.J.C. Serruys (Patrick); J.F. Verzijlbergen (Fred); C.A.P.L. Ascoop (Carl); J. Azar

    1990-01-01

    textabstractIntravenous dipyridamole thallium testing is a useful alternative procedure for assessing coronary artery disease (CAD) in patients who are unable to perform maximal exercise tests. Ischaemic ST segment depression and angina pectoris are frequently observed during the test, in particular

  2. Indium-111 antimyosin antibody imaging and thallium-201 imaging. A comparative myocardial scintigraphic study using single-photon emission computed tomography in patients with myocarditis and dilated cardiomyopathy

    Energy Technology Data Exchange (ETDEWEB)

    Yamada, Takehiko; Matsumori, Akira; Nohara, Ryuji; Konishi, Junji; Sasayama, Shigetake [Kyoto Univ. (Japan). Faculty of Medicine; Tamaki, Nagara

    1997-10-01

    Indium-111 antimyosin antibody imaging (a tracer of myocardial necrosis) and thallium-201 imaging (a tracer of myocardial perfusion) were compared in patients with myocarditis and dilated cardiomyopathy. The distribution of each tracer and antimyosin/thallium-201 overlapping were evaluated with single-photon emission computed tomography (SPECT). Scintigraphic data were classified into 5 patterns according to the distribution of both images and were compared with histologic findings of endomyocardial biopsy: AM-D, intense and diffuse antimyosin uptake and no perfusion abnormality (active myocarditis); AM-L, localized antimyosin uptake and no perfusion abnormality (active myocarditis); HM, no antimyosin uptake with or without perfusion abnormality (healed myocarditis); DCM-NH, diffuse antimyosin uptake and inhomogeneous thallium-201 uptake (dilated cardiomyopathy); DCM-PD, diffuse or localized antimyosin uptake and myocardial perfusion defect(s) (dilated cardiomyopathy). Patients with dilated-phase hypertrophic cardiomyopathy were frequently found in the DCM-PD group. Taken together, comparative antimyosin/thallium-201 SPECT images are useful for evaluating the activity of myocarditis and ongoing myocardial damage even in areas with no perfusion in patients with dilated cardiomyopathy. (author)

  3. Thallium-201 myocardial scintigraphy in patients with normal coronary arteries and normal left ventriculogram. Comparison with hemodynamic, metabolic and morphologic findings

    Energy Technology Data Exchange (ETDEWEB)

    Loesse, B.; Kuhn, H.; Rafflenbeul, D.; Kroenert, H.; Hort, W.; Feinendegen, L.E.; Loogen, F.

    1980-01-01

    36 consecutive patients with chest pain and/or severe ventricular dysrhythmias, but normal coronary arteries and normal left ventriculogram, underwent thallium-201 myocardial imaging at rest and during exercise. The myocardial scintigram was abnormal in 27 patients (group A) and normal in only 9 patients (group B).

  4. Preconcentration of thallium (I) by single drop microextraction with electrothermal atomic absorption spectroscopy detection using dicyclohexano-18-crown-6 as extractant system.

    Science.gov (United States)

    Chamsaz, Mahmoud; Arbab-Zavar, Mohammad Hossien; Darroudi, Abolfazl; Salehi, Thiery

    2009-08-15

    A simple single drop liquid-phase microextraction (SDME) technique, combined with electrothermal atomic absorption spectroscopy (ETAAS) is developed both to preconcentrate and determine thallium (I) ions in aqueous solutions. The ions were transferred from 10.0 ml of aqueous sample (donor phase) containing 0.5 ml of 1% picric acid as the ion-pair agent into a 3 microl microdrop of nitrobenzene (acceptor phase) containing dicyclohexano-18-crown-6 as the complexing agent. The latter will help to improve the extraction efficiency of the analyte. After the ions have been extracted, the acceptor drop was directly injected into a graphite furnace for thallium (I) determination. Several parameters such as the extracting solvent, extraction time, temperature, concentration of picric acid and crown ether, drop volume and stirring rate were examined. Under the optimized experimental conditions, the detection limit (L.O.D.) was 0.7 ng ml(-1). The relative standard deviation for five replicate analysis of 10 ng ml(-1) of thallium (I) was 5.1%. The calibration curve was linear in the range of 3-22 ng ml(-1). The results for determination of thallium in reference material, spiked tap water and seawater demonstrated the accuracy, recovery and applicability of the presented method. The enrichment factor was 50.

  5. Polonium ({sup 210}Po) and lead ({sup 210}Pb) in marine organisms and their transfer in marine food chains

    Energy Technology Data Exchange (ETDEWEB)

    Carvalho, Fernando P., E-mail: carvalho@itn.p [Instituto Tecnologico e Nuclear, Departamento de Proteccao Radiologica e Seguranca Nuclear, E.N. 10, 2686-953 Sacavem (Portugal)

    2011-05-15

    The determination of {sup 210}Po and {sup 210}Pb was performed in marine organisms from the seashore to abyssal depths, encompassing a plethora of species from the microscopic plankton to the sperm whale. Concentrations of those radionuclides ranged from low values of about 5 x 10{sup -1} Bq kg{sup -1} (wet wt.) in jellyfish, to very high values of about of 3 x 10{sup 4} Bq kg{sup -1} (wet wt.) in the gut walls of sardines, with a common pattern of {sup 210}Po > {sup 210}Pb.These radionuclides are primarily absorbed from water and concentrated by phyto- and microzooplankton, and then are transferred to the next trophic level along marine food chains. Investigation in epipelagic, mesopelagic, bathypelagic and abyssobenthic organisms revealed that {sup 210}Po is transferred in the marine food webs with transfer factors ranging from 0.1 to 0.7, and numerically similar to those of the energy transfer in the marine food chains. As {sup 210}Po preferentially binds to amino acids and proteins, its transfer in food chains likely traces protein transfer and, thus, {sup 210}Po transfer factors are similar to ecotrophic coefficients. {sup 210}Pb is transferred less efficiently in marine food chains and this contributes to increased {sup 210}Po:{sup 210}Pb activity ratios in some trophic levels.

  6. 210Po and 210Pb Activity Concentrations in Cigarettes Produced in Vietnam and Their Estimated Dose Contribution Due to Smoking

    Science.gov (United States)

    Tran, Thuy-Ngan N.; Le, Cong-Hao; Chau, Van-Tao

    Smoking cigarettes contributes significantly to the increase of radiation in human body because 210Po and 210Pb exist relatively high in tobacco leaves. Therefore, these two radioisotopes in eighteen of the most frequently sold cigarette brands produced in Vietnam were examined in this study. 210Po was determined by alpha spectroscopy using a passivated implanted planar silicon (PIPS) detector after a procedure including radiochemical separation and spontaneous deposition of polonium on a copper disc (the deposition efficiency of 210Po on a copper disc was approximately 94%). Sequentially, 210Pb was determined through the ingrowth of 210Po after storing the sample solutions for approximately six months. The activity concentrations of 210Po in cigarettes ranged from 13.8 to 82.6 mBq/cigarette (the mean value was 26.4 mBq/cigarette) and the activity concentrations of 210Pb in cigarettes ranged from 13.9 to 78.8 mBq/cigarette (the mean value was 25.8 mBq/cigarette). The annual committed effective dose for smokers who smoke one pack per day was also estimated to be 295.4 µSv/year (223.0 µSv/year and 72.4 µSv/year from 210Po and 210Pb, respectively). These indicated that smoking increased the risk of developing lung cancer was approximately 60 times greater for smokers than for non-smokers.

  7. Association between radionuclides (210Po and 210Pb) and antioxidant enzymes in oak (Quercus coccifera) and mastic tree (Pistacia lentiscus).

    Science.gov (United States)

    Uğur Görgün, A; Aslan, E; Kül, M; İlhan, S; Dimlioğlu, G; Bor, M; Özdemir, F

    2017-08-01

    The activity levels of naturally occurring radionuclides Polonium-210 and lead-210 in different subjects including plant species have direct or indirect impact on human beings. High levels of ionising radiation cause oxidative stress and the interaction between antioxidative defense and radionuclides is not well established in plant systems. In this study, we aimed to understand the impact of oxidative stress caused by 210Po and 210Pb in two Mediterranean plants; Quercus coccifera and Pistacia lentiscus. We analysed the constitutive and seasonal levels of 210Po, 210Pb, lipid peroxidation levels, superoxide dismutase (SOD) and ascorbate peroxidase (APX) activities in the field-collected samples. The highest activity concentrations of 210Po and 210Pb were detected in both plants in summer and Q. coccifera had higher levels than that of P. lentiscus. SOD and APX activity trends were different between oak and mastic; as compared to P. lentiscus, Q. coccifera efficiently used the two major components of antioxidative defense. Lipid peroxidation levels were low in both plants in all seasons except that of spring which were in good agreement with high antioxidant enzyme activities. In conclusion, we found that high 210Po and 210Pb activity concentrations in oak and mastic did not interfere with their growth and life cycles. The ability of both plants for survival and adaptation to Mediterranean environmental constraints provided an additional advantage for coping radionuclide induced oxidative stress as well. Copyright © 2016 Elsevier Ltd. All rights reserved.

  8. Mobility indices and doses from 210Po and 210Pb activity concentrations data in Brazilian spas groundwaters.

    Science.gov (United States)

    Bonotto, Daniel Marcos; Oliveira, Ana Maria Marinello Assis de

    2017-06-01

    210Po and 210Pb activity concentrations in spas groundwaters occurring at São Paulo (SP) and Minas Gerais (MG) states, Brazil, have been reported in this paper with a dual purpose: to compare different indices for evaluating the radionuclides mobility into waters and to evaluate the drinking water quality from dose calculations. The waters (75 sampling points) are extensively used for drinking in public places, bottling and bathing purposes, among other. The samples were taken from springs and wells drilled at different aquifer systems inserted in Paraná and Southeastern Shield hydrogeological provinces. The WHO guideline reference value for 210Pb and 210Po of 0.1 Bq/L in drinking water was not reached for 210Pb but the 210Po levels were equal or above it in four spas groundwaters from MG State. The maximum WHO guidance dose level of 0.1 mSv/yr was also reached or surpassed in them. The 210Pb "mobility index" taking into account the ratio of the weight of the dissolved 210Pb per unit volume of solution to its weight per unit weight of the rock matrix yielded values in the range of 0.01-5.2 kg/m3. Another "mobility index" (Preference Ratio) expressing the ratio of 210Pb and 238U in the waters divided by the ratio of 210Pb and 238U in the rock matrices provided values between 0.004 and 7994. The 210Pb/238U activity ratios of some spas groundwaters suggested preferential 238U transport relative to 210Pb into the liquid phase, whereas the ratio of the 210Pb to 238U mobility indices indicated the opposite. Such finding showed a better usefulness of the mobility indices for evaluating processes affecting the radionuclides release into the liquid phase during the water/rock interactions. Copyright © 2017 Elsevier Ltd. All rights reserved.

  9. Human skeletal uptake of natural alpha radioactivity from {sup 210}Pb-supported {sup 210}Po

    Energy Technology Data Exchange (ETDEWEB)

    Oyedepo, A.C

    1998-06-01

    This thesis contributes to increasing knowledge on the dosimetry of natural alpha-particle radiation in skeletal tissues, particularly in utero, and associated risks of malignancy. Alpha-particle radiation is an established aetiological factor of cancer. In the human body, polonium-210 decayed from skeletal lead-210 ({sup 210}Pb/{sup 210}Po) is the predominant natural alpha-emitter. {sup 210}Pb displaces calcium (Ca) in mineral hydroxyapatite, especially during periods of rapid bone growth and remodelling when Ca is laid down. It was therefore necessary to study alpha activity uptake and calcification concurrently within bone. Human studies were undertaken on: fetal vertebrae, 17 - 42 weeks of gestation, 74 samples; adult vertebrae, 40 - 95 years, 40 samples; and adult ribs, 20 - 95 years, 51 samples. Specimens were unconcentrated and weighed <5 g each. TASTRAK alpha-particle autoradiography was used to assess the bone activity concentration and spatial microdistribution of {sup 210}Pb/{sup 210}Po. Alpha track data were resolved by specially written software named SPATS (Selection Program for Analysing Track Structures). Ca and phosphorus (P) were biochemically determined. Results were examined for trends in bone type, gender and chronological ageing in humans. The main research findings were: 1) The Ca content of fetal vertebrae increased linearly at a weekly rate of 0.2g Ca 100 g{sup -1} wet bone (typical values of 2, 4, 6 g 100 g{sup -1} at 16, 26 and 36 weeks). 2) The P concentration also increased with advancing fetal age. 3) The Ca:P bone weight ratio rose from 1.7 to 2.2 by 32 gestational weeks. 4) The overall range in bone {sup 210}Pb/{sup 210}Po alpha activity was 0.25 - 1.1 Bq kg{sup -1} with correlation between activity concentration and fetal age (0.47 {+-} 0.05 Bq kg{sup -1} for 17 - 26 weeks, 0.67 {+-} 0.04 Bq kg{sup -1} for 32 - 42 weeks). 5) The correlation between increased alpha radioactivity and increased Ca concentration approximating to 0

  10. Synthesis and application of a novel nanostructured ion-imprinted polymer for the preconcentration and determination of thallium(I) ions in water samples

    Energy Technology Data Exchange (ETDEWEB)

    Fayazi, M., E-mail: maryamfayazi64@yahoo.com [Young Researchers and Elite Club, Kerman Branch, Islamic Azad University, Kerman (Iran, Islamic Republic of); Ghanei-Motlagh, M. [Young Researchers and Elite Club, Kerman Branch, Islamic Azad University, Kerman (Iran, Islamic Republic of); Taher, M.A. [Department of Chemistry, Faculty of Sciences, Shahid Bahonar University of Kerman, Kerman (Iran, Islamic Republic of); Ghanei-Motlagh, R. [Department of Pathobiology, Faculty of Veterinary Medicine, Ferdowsi University of Mashhad, Mashhad (Iran, Islamic Republic of); Salavati, M.R. [Department of Chemistry, Faculty of Science, Ferdowsi University of Mashhad, Mashhad (Iran, Islamic Republic of)

    2016-05-15

    Highlights: • A novel nanostructured thallium(I)-imprinted polymer was evaluated for trace detection of Tl(I). • The prepared sorbent displayed rapid extraction rate, high sensitivity and good reproducibility. • The proposed methodology was applied for quantification of Tl(I) in different water samples. - Abstract: A novel synthesized nanostructured ion-imprinted polymer (IIP) was investigated for the determination of trace amount of thallium(I). For this purpose, the thallium(I) IIP particles were synthesized using methacrylic acid (MAA) as the functional monomer, ethylene glycol dimethacrylate (EGDMA) as the cross-linker, methyl-2-[2-(2-2-[2-(methoxycarbonyl) phenoxy] ethoxyethoxy) ethoxy] benzoate as the chelating agent and 2,2-azobisisobutyronitrile (AIBN) as the initiator. The prepared IIP particles were characterized by field emission scanning electron microscopy (FE-SEM), Fourier transform infrared spectroscopy (FT-IR) and thermo gravimetric analysis (TGA). Various experimental factors such as pH, the amount of IIP particles, sorption and desorption time, sample volume, elution condition, and potentially interfering ions systematically examined. Under the optimum conditions, a sensitive response to Tl(I) within a wide concentration range (0.05–18 μg L{sup −1}) was achieved. The limit of detection (LOD, 3S{sub b}/m) was 6.3 ng L{sup −1}. The maximum adsorption capacity of the novel imprinted adsorbent for Tl(I) was calculated to be 18.3 mg g{sup −1}. The relative standard deviation (RSD) for eight replicate detections of 0.1 μg L{sup −1} of thallium(I) was found to be 4.0%. An enrichment factor (EF) of 100 was obtained by this method. The proposed technique was successfully applied to monitoring thallium in different water samples and the certified reference material.

  11. L-Tyrosine immobilized on multiwalled carbon nanotubes: A new substrate for thallium separation and speciation using stabilized temperature platform furnace-electrothermal atomic absorption spectrometry

    Energy Technology Data Exchange (ETDEWEB)

    Pacheco, Pablo H.; Gil, Raul A. [Departamento de Quimica Analitica, Facultad de Quimica, Bioquimica y Farmacia, Universidad Nacional de San Luis, Chacabuco y Pedernera, P.O. Box 375, 5700 San Luis (Argentina); Instituto de Quimica de San Luis (INQUISAL-CONICET), Chacabuco y Pedernera, CP 5700, San Luis (Argentina); Smichowski, Patricia, E-mail: smichows@cnea.gov.ar [Consejo Nacional de Investigaciones Cientificas y Tecnicas (CONICET), Rivadavia 1917, CP C1033 AAJ, Ciudad de Buenos Aires (Argentina); Comision Nacional de Energia Atomica, Gerencia Quimica, Av. Gral. Paz 1499, B1650KNA San Martin (Argentina); Polla, Griselda [Comision Nacional de Energia Atomica, Gerencia de Investigacion y Aplicaciones, Av.Gral. Paz 1499, B1650KNA San Martin (Argentina); Martinez, Luis D., E-mail: ldm@unsl.edu.ar [Departamento de Quimica Analitica, Facultad de Quimica, Bioquimica y Farmacia, Universidad Nacional de San Luis, Chacabuco y Pedernera, P.O. Box 375, 5700 San Luis (Argentina); Instituto de Quimica de San Luis (INQUISAL-CONICET), Chacabuco y Pedernera, CP 5700, San Luis (Argentina)

    2009-12-10

    An approach for the separation and determination of inorganic thallium species is described. A new sorbent, L-tyrosine-carbon nanotubes (L-tyr-CNTs), was used and applied to the analysis of tap water samples. At pH 5.0, L-tyr was selective only towards Tl(III), while total thallium was determined directly by stabilized temperature platform furnace-electrothermal atomic absorption spectrometry (STPF-ETAAS). The Tl(III) specie, which was retained by L-tyrosine, was quantitatively eluted from the column with 10% of nitric acid. An on-line breakthrough curve was used to determine the column capacity, which resulted to be 9.00 {mu}mol of Tl(III) g{sup -1} of L-tyr-CNTs with a molar ratio of 0.14 (moles of Tl bound to moles of L-tyr at pH 5). Transient peak areas revealed that Tl stripping from the column occurred instantaneously. Effects of sample flow rate, concentration and flow rate of the eluent, and interfering ions on the recovery of the analyte were systematically investigated. The detection limit for the determination of total thallium (3{sigma}) by STPF-ETAAS was 150 ng L{sup -1}. The detection limit (3{sigma}) for Tl(III) employing the separation system was 3 ng L{sup -1}, with an enrichment factor of 40. The precision of the method expressed as the relative standard deviation (RSD) resulted to be 3.4%. The proposed method was applied to the speciation and determination of inorganic thallium in tap water samples. The found concentrations were in the range of 0.88-0.91 {mu}g L{sup -1} of Tl(III), and 3.69-3.91 {mu}g L{sup -1} of total thallium.

  12. Tracing subducted sediment inputs to the Ryukyu arc-Okinawa Trough system: Evidence from thallium isotopes

    Science.gov (United States)

    Shu, Yunchao; Nielsen, Sune G.; Zeng, Zhigang; Shinjo, Ryuichi; Blusztajn, Jerzy; Wang, Xiaoyuan; Chen, Shuai

    2017-11-01

    Sediments are actively subducted in virtually every arc worldwide. However, quantifying their contributions to arc lavas and thereby establishing budgets of how sediments participate in slab-mantle interaction is challenging. In this contribution we use thallium (Tl) abundances and isotopic compositions of lavas from the Ryukyu arc (including south Kyushu) and its back-arc basin, Okinawa Trough, to investigate the influence of sediments from arc to back-arc. We also present extensive geochemical data for sediments and altered oceanic crust (AOC) outboard of the northern (DSDP Sites 296, 442B, 443 and 444) and central (DSDP Sites 294 and 295) part of the Ryukyu arc. The Tl isotopic compositions of sediments change systematically from lighter outboard of northern Ryukyu arc to heavier outboard of central Ryukyu arc. The feature reflects the dominance of terrigenous material and pelagic sedimentation outboard of the northern and central Ryukyu arc, respectively. Central and northern sections of Ryukyu arc and Okinawa Trough display larger range of Tl isotopic variation than southern section, which is consistent with more pelagic provenance for sediments outboard of central and northern Ryukyu arcs than that of expected sediments outboard of southern Ryukyu arc. Identical Tl, Sr, Nd and Pb isotope variations are found when comparing arc and back arc lavas, which indicates that sediments fluxes also account for the Tl isotopic variations in the Okinawa Trough lavas. Two-end-member mixing models of Tl with Pb, Sr and Nd isotopes require sediment inputs ofsediment end members predict very similar sediment fluxes when using Tl, Sr, Nd and Pb isotopes, which indicates that fractionation of these elements must have happened after mixing between mantle and sediments. This conclusion is corroborated by model calculations of mixing between sediment melts with fractionated Sr/Nd ratios and mantle wedge, which show that no arc lava plot on such mixing lines. Thus bulk sediment

  13. Comparison of arbutamine stress and treadmill exercise thallium-201 SPECT: Hemodynamics, safety profile and diagnostic accuracy

    Energy Technology Data Exchange (ETDEWEB)

    Kiat, H.; Berman, D.S. [Cedars-Sinai Medical Centre, Los Angeles, California, LA (United States)

    1998-02-01

    Full text: Arbutamine (ARB), a new pharmacologic stress agent with enhanced chronotropic property compared to dobutamine, was compared with treadmill (TM) exercise testing (Ex) in a multicenter study using thallium-201 (Tl) SPECT. Of the total of 184 patients who underwent ARB, 69 also had TM stress and quantitative coronary angiography. Fifty-eight patients with a low pretest likelihood of CAD also underwent ARB study for evaluation of test specificity (normalcy rate). Tl scans were scored by a central laboratory using a 20 segment (seg)/scan visual analysis (5 point system: 0=normal, 4-absent uptake). Maximum heart rate (HR) by ARB and Ex was 122 vs 141 bpm (p<0.05). Mean %HR change from baseline was similar (79% vs 82%, respectively, p=ns). Maximum systolic BP for ARB and Ex was 173 vs 175 mmHg, and mean % change from baseline was 24% vs 28% (p=ns). Sensitivity for detecting CAD (270% stenosis) by ARB Tl was 94% and 97% by Ex Tl (p=ns). Stress Tl SPECT segmental agreement for presence of defect between ARB and Ex was 92% (kappa=0.8, p<0.001). Exact segmental stress Tl score (0-4 grading) agreement was 83 % (kappa=0.7, p<0.001). Among 346 segs with stress defects by both ARB and Ex defect reversibility agreement was 86% (kappa=0.7, p<0.001). The normalcy rate for ARB TI-SPECT among patients with a low likelihood of CAD was 90%. Adverse events were mostly mild (tremor: 23%, flushing: 10%, headache: 10%, paraesthesia: 8%, dizziness: 8%, hot flushes: 4%). Arrhythimia of clinical concern occurred in 8% (10/122) of ARB patients who had cardiac catheterisation and in 1.4% (1/69) of patients who had stress Tl. Of all 184 patients with ARB stress, ARB was discontinued due to arrhythmia in 7(5%) and 1 patient had IV Metoprolol for frequent ventricular couplets. Sustained arrhythmias were not observed

  14. Thallium Isotopes Tracking Mn-Oxide Burial - A Proxy for Deoxygenation During Oceanic Anoxic Event 2

    Science.gov (United States)

    Ostrander, C.; Owens, J. D.; Nielsen, S.

    2015-12-01

    Thallium (Tl) is proving to be a useful paleoredox proxy given that the Tl isotope composition of seawater is highly dependent on the magnitude of manganese (Mn) oxide burial in the ocean. In turn, Mn oxides require oxygen at the sediment-water interface to precipitate, linking the Tl isotope cycle to ocean oxygenation. Currently, the marine residence time of Tl is ~20kyrs and the Tl isotope composition of seawater is invariant, which suggests Tl isotopes could be a global tracer of marine Mn-oxide burial. Importantly, recent research suggests sediments deposited under a euxinic water column faithfully record the Tl isotope value of the overlying oxic water column (e.g. Black Sea and Cariaco Basin). Therefore, analysis of organic-rich black shales may prove useful in evaluating the seawater Tl isotope composition of past oceans and, hence, large-scale burial of Mn-oxides and the extent of bottom water ocean oxygenation. A logical test for this proxy is during the well-studied Cenomanian-Turonian boundary event termed Oceanic Anoxic Event 2 (OAE-2) at ~94 Ma. It is known that the global extent of anoxia and euxinia increased during this event, however, to what extent global bottom water deoxygenation occured is unconstrained. If deep water deoxygenation occurred, it would be hypothesized that Mn-oxide precipitation would decrease, resulting in a positive Tl isotope excursion during OAE-2. We have analyzed the Tl isotope composition of organic-rich black shales from Site 1258 of the Ocean Drilling Program (ODP) spanning the period before, during, and after OAE-2. Based on Fe redox proxies, the entire section is euxinic and thus no Mn-oxides are present (i.e. no local redox changes). Before the event, Tl isotope compositions are similar or slightly heavier than modern seawater values. Just prior to the onset of OAE-2, a positive shift occurs and is maintained until recovery, slightly before the termination of the event. The shift to heavier values and subsequent

  15. Geochemical translocation of thallium in the sediments from the North River, China

    Science.gov (United States)

    Liu, J.

    2016-12-01

    Thallium (Tl) is a highly toxic rare heavy metal. As a sulphophile element, it usually occurs in numerous sulphide minerals (such as pyrite, galena, sphlerite). Guangdong north region, known as the hometown of nonferrous metals, has abundant containing Tl mineral resources. Numerous industrial activities, such as mining, smelting, and electroplating are also flourishing. In 2010, a serious Tl pollution in the North River (a major river in the Northern Guangdong Province) shocked the society. The Tl pollution in water appeared to be under control after that incident. But in fact, even if the wastewater discharge of pollution sources has been controlled, the potential risk of heavy metal pollution in the sediments of the North River still exists, for the metals are easy to precipitate and accumulate into sediment from water. So far, Tl pollution in sediments has been studied to a very limited extent. In this paper, we investigated the content and vertical distribution characteristics of Tl and some other related heavy metals in a typical sediment profile from the North River by using inductively coupled plasma mass spectrometry (ICP-MS). Then the Pb isotopic compositions in the sediments were measured by using multi-inductively coupled plasma mass spectrometry (MC-ICP-MS). Several sediments from typical layers were also subjected to sequential extraction procedure for investigating the geochemical fractions of Tl. The risk of Tl and other metal pollution was finally assessed by calculating geo-accumulation indexes (Igeo) and potential ecological risk. The results showed that: (1) Tl concentrations range 1.03 mg/kg to 3.13 mg/kg with a mean of 1.89 mg/kg, three times higher than that in local background soil; (2) Tl content generally increased with depth with some fluctuations and significant correlations were found between Tl and Pb, Zn, Cd, Cu, and Ni; (3) About 46 % to 70 % in sediment cores were resided in the residual fraction; (4) Igeo showed that the studied

  16. Distribution and biokinetic analysis of {sup 210}Pb and {sup 210}Po in poultry due to ingestion of dicalcium phosphate

    Energy Technology Data Exchange (ETDEWEB)

    Casacuberta, N., E-mail: Nuria.Casacuberta@uab.es [Departament de Fisica and Institut de Ciencia i Tecnologia Ambientals, Universitat Autonoma de Barcelona, 08193 Bellaterra (Spain); Traversa, F.L. [Departament d' Electronica, Escola Tecnica Superior d' Enginyeria, Universitat Autonoma de Barcelona, 08193 Bellaterra (Spain); Masque, P.; Garcia-Orellana, J. [Departament de Fisica and Institut de Ciencia i Tecnologia Ambientals, Universitat Autonoma de Barcelona, 08193 Bellaterra (Spain); Anguita, M.; Gasa, J. [Departament de Ciencia Animal i dels Aliments, Universitat Autonoma de Barcelona, 08193 Bellaterra (Spain); Garcia-Tenorio, R. [Universidad de Sevilla, Avda. Reina Mercedes s/n, 41012 Sevilla (Spain)

    2010-09-15

    Dicalcium phosphate (DCP) is used as a calcium supplement for food producing animals (i.e., cattle, poultry and pig). When DCP is produced via wet acid digestion of the phosphate rock and depending on the acid used in the industrial process, the final product can result in enhanced {sup 210}Pb and {sup 210}Po specific activities ({approx} 2000 Bq.kg{sup -1}). Both {sup 210}Pb and {sup 210}Po are of great interest because their contribution to the dose received by ingestion is potentially large. The aims of this work are to examine the accumulation of {sup 210}Pb and {sup 210}Po in chicken tissues during the first 42 days of life and to build a suitable single-compartment biokinetic model to understand the behavior of both radionuclides within the entire animal using the experimental results. Three commercial corn-soybean-based diets containing different amounts and sources of DCP were fed to broilers during a period of 42 days. The results show that diets containing enhanced concentrations of {sup 210}Pb and {sup 210}Po lead to larger specific accumulation in broiler tissues compared to the blank diet. Radionuclides do not accumulate homogeneously within the animal body: {sup 210}Pb follows the calcium pathways to some extent and accumulates largely in bones, while {sup 210}Po accumulates to a large extent in liver and kidneys. However, the total amount of radionuclide accumulation in tissues is small compared to the amounts excreted in feces. The single-compartment non-linear biokinetic model proposed here for {sup 210}Pb and {sup 210}Po in the whole animal takes into account the size evolution and is self-consistent in that no fitting parameterization of intake and excretions rates is required.

  17. Compact Miniaturized Antenna for 210 MHz RFID

    Science.gov (United States)

    Lee, Richard Q.; Chun, Kue

    2008-01-01

    This paper describes the design and simulation of a miniaturized square-ring antenna. The miniaturized antenna, with overall dimensions of approximately one tenth of a wavelength (0.1 ), was designed to operate at around 210 MHz, and was intended for radio-frequency identification (RFID) application. One unique feature of the design is the use of a parasitic element to improve the performance and impedance matching of the antenna. The use of parasitic elements to enhance the gain and bandwidth of patch antennas has been demonstrated and reported in the literature, but such use has never been applied to miniaturized antennas. In this work, we will present simulation results and discuss design parameters and their impact on the antenna performance.

  18. Source and distribution of sedimentary thallium in the Bohai Sea: Implications for hydrodynamic forces and anthropogenic impact

    Science.gov (United States)

    Hu, Ningjing; Liu, Jihua; Shi, Xuefa

    2015-04-01

    Source and distribution of sedimentary thallium in the Bohai Sea: Implications for hydrodynamic forces and anthropogenic impact Hu Ningjing, Liu Jihua, Shi Xuefa First Institute of Oceanography, State Oceanic Administration, Qingdao 266061, China Thallium (Tl), a non-essential and highly toxic trace metal, is listed as priority toxic pollutant by the United States Environmental Protection Agency (USEPA) (Keith and Telliard, 1979). However, its geochemical cycling in aquatic environment has received far less attention than that of many other trace metals. This has been attributed to relatively little commercial interest in Tl and, until recently, problems inherent in its detection at environmental concentrations (Meeravali and Jiang, 2008). In this study, we investigated the sources, distribution and fate of Tl in surface sediments of the Bohai Sea (BS), China, based on the datasets of total Tl and chemical speciation of Tl of 408 surface sediment samples in the total entire BS. The enrichment factors and chemical speciation of Tl indicated that Tl in BS was dominated by natural Tl, although anthropogenic Tl contamination was observed in the Liuguhe River mouth; the mud deposits are the sinks of Tl and the regional currents and tide systems play a key role on the accumulation of Tl in BS. The distribution of Tl consistent with that of MnO and Fe2O3 as well as the level of Fe-Mn fraction is relatively high, indicating MnO and Fe2O3 influence the geochemical behaviors of Tl in the BS. Although the positive correlation between Tl and TOC is observed for the samples in the BS, however, level of Tl in oxidizable faction could be neglected, suggesting TOC might not be a major factor affecting the concentration of Tl in BS. The low proportion of Tl in the non-residual fraction dominated by the Fe-Mn oxides suggested that the labile Tl was controlled by the Fe-Mn oxides and Tl has a low bioavailability and a minor potential threat to biota in BS. Acknowledgements: this work

  19. Separation and electrodeposited of {sup 210} Po; Separacion y electrodeposito de {sup 210} Po

    Energy Technology Data Exchange (ETDEWEB)

    Ordonez R, E.; Iturbe G, J.L

    1991-12-15

    Presently work it was determined the selective separation of the {sup 210} Po that is in an uraniferous mineral, by means of acid leaching of the mineral and the purification was carried out by means of partition chromatography whose stationary phase is 2-ethylhexyl phosphoric acid (D{sub 2}EHPA), it has been possible to isolate the {sup 210} Po of the rest of the radioactive elements that conform the family 4 N{sup +2}, the optimal elutriation conditions of this element were settled down of manner of not dragging other radioelements. Another of the achievements presented in this communication has been the electrodeposition of this element has more than enough stainless steel discs with a superior yield to 95%. (Author)

  20. 48 CFR 2152.210-70 - Investment income.

    Science.gov (United States)

    2010-10-01

    ... 48 Federal Acquisition Regulations System 6 2010-10-01 2010-10-01 true Investment income. 2152.210... CONTRACT CLAUSES Text of Provisions and Clauses 2152.210-70 Investment income. As prescribed in 2110.7004(a), insert the following clause: Investment Income (OCT 2005) (a) The Contractor must invest and reinvest all...

  1. 46 CFR 197.210 - Designation of diving supervisor.

    Science.gov (United States)

    2010-10-01

    ... 46 Shipping 7 2010-10-01 2010-10-01 false Designation of diving supervisor. 197.210 Section 197... HEALTH STANDARDS GENERAL PROVISIONS Commercial Diving Operations General § 197.210 Designation of diving supervisor. The name of the diving supervisor for each commercial diving operation shall be— (a) Designated...

  2. 42 CFR 403.210 - NAIC model standards.

    Science.gov (United States)

    2010-10-01

    ... 42 Public Health 2 2010-10-01 2010-10-01 false NAIC model standards. 403.210 Section 403.210... model standards. (a) NAIC model standards means the National Association of Insurance Commissioners (NAIC) “Model Regulation to Implement the Individual Accident and Insurance Minimum Standards Act” (as...

  3. 41 CFR 50-210.0 - General enforcement policy.

    Science.gov (United States)

    2010-07-01

    ... 41 Public Contracts and Property Management 1 2010-07-01 2010-07-01 true General enforcement policy. 50-210.0 Section 50-210.0 Public Contracts and Property Management Other Provisions Relating to... for strict compliance with the provisions thereof and the regulations issued pursuant thereto. (c) Any...

  4. 19 CFR 210.72 - Confidentiality of information.

    Science.gov (United States)

    2010-04-01

    ... 19 Customs Duties 3 2010-04-01 2010-04-01 false Confidentiality of information. 210.72 Section 210.72 Customs Duties UNITED STATES INTERNATIONAL TRADE COMMISSION INVESTIGATIONS OF UNFAIR PRACTICES IN... Confidentiality of information. Confidential information (as defined in § 201.6(a) of this chapter) that is...

  5. 5 CFR 930.210 - Reduction in force.

    Science.gov (United States)

    2010-01-01

    ... 5 Administrative Personnel 2 2010-01-01 2010-01-01 false Reduction in force. 930.210 Section 930... § 930.210 Reduction in force. (a) Retention preference regulations. Except as modified by this section, the reduction in force regulations in part 351 of this chapter apply to administrative law judges. (b...

  6. 17 CFR 210.4-07 - Discount on shares.

    Science.gov (United States)

    2010-04-01

    ... 17 Commodity and Securities Exchanges 2 2010-04-01 2010-04-01 false Discount on shares. 210.4-07... 1940, AND ENERGY POLICY AND CONSERVATION ACT OF 1975 Rules of General Application § 210.4-07 Discount on shares. Discount on shares, or any unamortized balance thereof, shall be shown separately as a...

  7. MicroRNA-210 and its theranostic potential.

    Science.gov (United States)

    Ren, Chun-Xia; Leng, Rui-Xue; Fan, Yin-Guang; Pan, Hai-Feng; Wu, Chang-Hao; Ye, Dong-Qing

    2016-11-01

    MicroRNAs (miRNAs) are a set of small single-stranded noncoding RNAs with diverse biological functions. As a prototypical hypoxamir, human microRNA-210 (hsa-miR-210) is one of the most widely studied miRNAs thus far. In addition to its involvement in sophisticated regulation of numerous biological processes, miR-210 has also been shown to be associated with the development of different human diseases including various types of cancers, cardiovascular and cerebrovascular diseases, and immunological diseases. Given its multi-faceted functions, miR-210 may serve as a novel and promising theranostic target for prevention and treatment of diseases. Areas covered: This review aims to provide a comprehensive overview of miR-210, the regulation of its expression, biological functions and molecular mechanisms, with particular emphasis on its diagnostic and therapeutic potential. Expert opinion: Although the exact roles of miR-210 in various diseases have not been fully clarified, targeting miR-210 may be a promising therapeutic strategy. Further investigations are also needed to facilitate therapeutic-clinical applications of miR-210 in human diseases.

  8. 17 CFR 210.9-04 - Income statements.

    Science.gov (United States)

    2010-04-01

    ... on loans which are related to or are an adjustment of the loan interest rate. 2. Interest and... 17 Commodity and Securities Exchanges 2 2010-04-01 2010-04-01 false Income statements. 210.9-04 Section 210.9-04 Commodity and Securities Exchanges SECURITIES AND EXCHANGE COMMISSION FORM AND CONTENT OF...

  9. 31 CFR 210.13 - Notice to account owners.

    Science.gov (United States)

    2010-07-01

    ... 31 Money and Finance: Treasury 2 2010-07-01 2010-07-01 false Notice to account owners. 210.13 Section 210.13 Money and Finance: Treasury Regulations Relating to Money and Finance (Continued) FISCAL... any notice required by the Service to be provided to account owners as specified in the Green Book...

  10. Development of instrumentation for {sup 210} Pb dating method

    Energy Technology Data Exchange (ETDEWEB)

    Reinikainen, P.; Rekikoski, I.; Virtanen, A.; Aeystoe, J. [Institute for Environmental Research, Jyvaeskylae Univ. (Finland); Merilaeinen, J.; Witick, A. [Department of Physics, Jyvaeskylae Univ. (Finland)

    1998-08-01

    The presentation reviews shortly the project started in 1993 developing alpha- and gamma-ray spectroscopy systems and routines for a study of environmental samples. Particular interest has been focused to the {sup 210}Pb dating for lake sediments. So far, about 40 sediment profiles from all around Finland have been analysed and dated using the {sup 210}Pb method

  11. 46 CFR 16.210 - Pre-employment testing requirements.

    Science.gov (United States)

    2010-10-01

    ... test for dangerous drugs for that employer. (b) An employer may waive a pre-employment test required... 46 Shipping 1 2010-10-01 2010-10-01 false Pre-employment testing requirements. 16.210 Section 16... TESTING Required Chemical Testing § 16.210 Pre-employment testing requirements. (a) No marine employer...

  12. 24 CFR 91.210 - Housing market analysis.

    Science.gov (United States)

    2010-04-01

    ... 24 Housing and Urban Development 1 2010-04-01 2010-04-01 false Housing market analysis. 91.210...; Contents of Consolidated Plan § 91.210 Housing market analysis. (a) General characteristics. Based on... identified, either in a narrative or on one or more maps. (b) Public and assisted housing. (1) The plan must...

  13. 31 CFR 210.12 - RDFI's rights of recovery.

    Science.gov (United States)

    2010-07-01

    ... 31 Money and Finance: Treasury 2 2010-07-01 2010-07-01 false RDFI's rights of recovery. 210.12 Section 210.12 Money and Finance: Treasury Regulations Relating to Money and Finance (Continued) FISCAL SERVICE, DEPARTMENT OF THE TREASURY FINANCIAL MANAGEMENT SERVICE FEDERAL GOVERNMENT PARTICIPATION IN THE...

  14. 31 CFR 210.5 - Account requirements for Federal payments.

    Science.gov (United States)

    2010-07-01

    ... 31 Money and Finance: Treasury 2 2010-07-01 2010-07-01 false Account requirements for Federal payments. 210.5 Section 210.5 Money and Finance: Treasury Regulations Relating to Money and Finance (Continued) FISCAL SERVICE, DEPARTMENT OF THE TREASURY FINANCIAL MANAGEMENT SERVICE FEDERAL GOVERNMENT...

  15. 31 CFR 210.1 - Scope; relation to other regulations.

    Science.gov (United States)

    2010-07-01

    ... 31 Money and Finance: Treasury 2 2010-07-01 2010-07-01 false Scope; relation to other regulations. 210.1 Section 210.1 Money and Finance: Treasury Regulations Relating to Money and Finance (Continued) FISCAL SERVICE, DEPARTMENT OF THE TREASURY FINANCIAL MANAGEMENT SERVICE FEDERAL GOVERNMENT PARTICIPATION...

  16. 31 CFR 210.9 - Parties to the reclamation.

    Science.gov (United States)

    2010-07-01

    ... 31 Money and Finance: Treasury 2 2010-07-01 2010-07-01 false Parties to the reclamation. 210.9 Section 210.9 Money and Finance: Treasury Regulations Relating to Money and Finance (Continued) FISCAL SERVICE, DEPARTMENT OF THE TREASURY FINANCIAL MANAGEMENT SERVICE FEDERAL GOVERNMENT PARTICIPATION IN THE...

  17. 31 CFR 210.14 - Erroneous death information.

    Science.gov (United States)

    2010-07-01

    ... 31 Money and Finance: Treasury 2 2010-07-01 2010-07-01 false Erroneous death information. 210.14 Section 210.14 Money and Finance: Treasury Regulations Relating to Money and Finance (Continued) FISCAL SERVICE, DEPARTMENT OF THE TREASURY FINANCIAL MANAGEMENT SERVICE FEDERAL GOVERNMENT PARTICIPATION IN THE...

  18. 21 CFR 175.210 - Acrylate ester copolymer coating.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 3 2010-04-01 2009-04-01 true Acrylate ester copolymer coating. 175.210 Section 175.210 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) FOOD FOR HUMAN CONSUMPTION (CONTINUED) INDIRECT FOOD ADDITIVES: ADHESIVES AND COMPONENTS OF COATINGS Substances for Use as Components of Coatings...

  19. 7 CFR 210.12 - Student, parent and community involvement.

    Science.gov (United States)

    2010-01-01

    ... 7 Agriculture 4 2010-01-01 2010-01-01 false Student, parent and community involvement. 210.12... School Food Authority Participation § 210.12 Student, parent and community involvement. (a) General. School food authorities shall promote activities to involve students and parents in the Program. Such...

  20. 21 CFR 1311.210 - Archiving the initial record.

    Science.gov (United States)

    2010-04-01

    ... 1311.210 Food and Drugs DRUG ENFORCEMENT ADMINISTRATION, DEPARTMENT OF JUSTICE REQUIREMENTS FOR ELECTRONIC ORDERS AND PRESCRIPTIONS (Eff. 6-1-10) Electronic Prescriptions § 1311.210 Archiving the initial record. (a) Except as provided in paragraph (c) of this section, a copy of each electronic controlled...

  1. Fractionation and Mobility of Thallium in Volcanic Ashes after Eruption of Eyjafjallajökull (2010) in Iceland.

    Science.gov (United States)

    Karbowska, Bozena; Zembrzuski, Wlodzimierz

    2016-07-01

    Volcanic ash contains thallium (Tl), which is highly toxic to the biosphere. The aim of this study was to determine the Tl concentration in fractions of volcanic ash samples originating from the Eyjafjallajökull volcano. A sequential extraction scheme allowed for a study of element migration in the environment. Differential pulse anodic stripping voltammetry using a flow measuring system was selected as the analytical method to determine Tl content. The highest average content of Tl in volcanic ash was determined in the fraction entrapped in the aluminosilicate matrix (0.329 µg g(-1)), followed by the oxidizable fraction (0.173 µg g(-1)). The lowest content of Tl was found in the water soluble fraction (0.001 µg g(-1)); however, this fraction is important due to the fact that Tl redistribution among all the fractions occurs through the aqueous phase.

  2. Sinking fluxes of210Pb and210Po in the deep basin of the northern South China Sea.

    Science.gov (United States)

    Wei, Ching-Ling; Chia, Chao-Yuan; Chou, Wen-Chen; Lee, Wen-Huei

    2017-08-01

    Vertical fluxes of total mass (F mass ), particulate organic carbon (F POC ), particulate inorganic carbon (F PIC ), 210 Pb (F Pb-210 ), and 210 Po (F Po-210 ) were determined by sediment traps deployed at two depths, 2000 m and 3500 m, at SEATS (South East Asian Time-series Study, 116°00°E, 18°00°N) in the northern South China Sea during June 2008-June 2009. The F mass ranges from 12.2 to 55.1 mg m -2  d -1 and from 89.3 to 250.8 mg m -2  d -1 , at 2000 m and 3500 m, respectively, and shows seasonal and inter-annul variation. The temporal variation of F POC , F PIC , and F Pb-210 were in phase with the F mass , which was coupled with the seasonal cycles of primary production in the euphotic layer. The F Pb-210 ranges from 5 to 48 dpm m -2 d -1 and from 38 to 105 dpm m -2 d -1 , at 2000 m and 3500 m, respectively. Contrasting with 210 Pb, the F Po-210 shows poor correlation with F mass . The F Po-210 ranges from 3 to 146 dpm m -2 d -1 and from 50 to 309 dpm m -2 d -1 , at 2000 m and 3500 m, respectively. Episodic events of the settling of biological particles from the surface layer and the regeneration processes the deep layer control the 210 Po removal in the water column of the South China Sea. Strong correlations of the flux and source ratio of 210 Pb, (F/P) Pb-210 , and the particulate carbon fluxes were found, which give relationships of F POC (μg cm -2 y -1 ) = 26.8 + 371.0 (F/P) Pb-210 and F PIC (μg cm -2 y -1 ) = -1.4 + 533.1 (F/P) Pb-210 . Copyright © 2016 Elsevier Ltd. All rights reserved.

  3. Determination of {sup 210}Pb via {sup 210}Bi using a hydride generation technique combined with {beta}-spectrometry

    Energy Technology Data Exchange (ETDEWEB)

    Gogrewe, D. [Fachbereich 14 - Kernchemie, Univ. Marburg (Germany); Puetz, M. [Fachbereich 14 - Kernchemie, Univ. Marburg (Germany); Weber, R. [Fachbereich 14 - Kernchemie, Univ. Marburg (Germany); Siemon, K. [Fachbereich 14 - Kernchemie, Univ. Marburg (Germany); Esterlund, R.A. [Fachbereich 14 - Kernchemie, Univ. Marburg (Germany); Patzelt, P. [Fachbereich 14 - Kernchemie, Univ. Marburg (Germany)

    1996-10-01

    A procedure for the determination of {sup 210}Pb is presented, which is based upon the {beta}-spectrometric assay (utilizing a liquid-scintillation counter) of {sup 210}Bi in radioactive equilibrium. Separation of {sup 210}Bi from the sample matrix as well as from other {beta}-emitters is achieved quickly, simply and selectively using a purge and trap technique based upon the generation and subsequent absorption of BiH{sub 3} on a prepared filter paper. Advantages of this method include: 1. radioactive equilibrium between {sup 210}Pb and {sup 210}Bi is relatively quickly attained; 2. the external background signal in liquid-scintillation counting is very low; 3. no quenching corrections are necessary, as the sample matrix is invariant; and 4. because of the high counting efficiency, only short measuring times are required. (orig.)

  4. Recoil-deposited Po-210 in radon dwellings

    Energy Technology Data Exchange (ETDEWEB)

    Samuelsson, C.

    1990-12-31

    Short-lived decay products of Rn-222 plate out on all surfaces in a house containing radon gas. Following the subsequent alpha decays of the mother nuclei, the daughter products Pb-214 and Pb-210 are superficially and permanently absorbed. Due to its long half-life (22 y) the activity of absorbed Pb-210 accumulates in the surface. The activity of Pb-210, or its decay products, can thus reflect the past randon daughter and plate-out history of a house over several decades. Our results and experience from measurements of Po-210 and Rn-222 in 22 dwellings will be presented. In these studies the Po-210 surface activity of one plane glass sheet per dwelling (window panes were not used) has been determined and compared with the period of exposure times the mean radon concentration measured over a two-month period. Considering the large uncertainty in the integrated radon exposure estimate the surface {sup 210}Po correlates well (r=0.73) with the accumulated radon exposure. The {sup 210}Po activity of the glass samples has been measured non-destructively using an open-flow pulse ionization chamber and this detector has also been successfully applied in field exercises.

  5. Recoil-deposited Po-210 in radon dwellings

    Energy Technology Data Exchange (ETDEWEB)

    Samuelsson, C.

    1990-01-01

    Short-lived decay products of Rn-222 plate out on all surfaces in a house containing radon gas. Following the subsequent alpha decays of the mother nuclei, the daughter products Pb-214 and Pb-210 are superficially and permanently absorbed. Due to its long half-life (22 y) the activity of absorbed Pb-210 accumulates in the surface. The activity of Pb-210, or its decay products, can thus reflect the past randon daughter and plate-out history of a house over several decades. Our results and experience from measurements of Po-210 and Rn-222 in 22 dwellings will be presented. In these studies the Po-210 surface activity of one plane glass sheet per dwelling (window panes were not used) has been determined and compared with the period of exposure times the mean radon concentration measured over a two-month period. Considering the large uncertainty in the integrated radon exposure estimate the surface {sup 210}Po correlates well (r=0.73) with the accumulated radon exposure. The {sup 210}Po activity of the glass samples has been measured non-destructively using an open-flow pulse ionization chamber and this detector has also been successfully applied in field exercises.

  6. Determination of gold, indium, tellurium and thallium in the same sample digest of geological materials by atomic-absorption spectroscopy and two-step solvent extraction

    Science.gov (United States)

    Hubert, A.E.; Chao, T.T.

    1985-01-01

    A rock, soil, or stream-sediment sample is decomposed with hydrofluoric acid, aqua regia, and hydrobromic acid-bromine solution. Gold, thallium, indium and tellurium are separated and concentrated from the sample digest by a two-step MIBK extraction at two concentrations of hydrobromic add. Gold and thallium are first extracted from 0.1M hydrobromic acid medium, then indium and tellurium are extracted from 3M hydrobromic acid in the presence of ascorbic acid to eliminate iron interference. The elements are then determined by flame atomic-absorption spectrophotometry. The two-step solvent extraction can also be used in conjunction with electrothermal atomic-absorption methods to lower the detection limits for all four metals in geological materials. ?? 1985.

  7. 210Po in the human food chain; El 210Po en la cadena alimenticia humana

    Energy Technology Data Exchange (ETDEWEB)

    Diaz-Frances, I.

    2010-07-01

    210 Po is a natural ocurring radionuclide, belonging to the Uranium series, which is present in minute amounts in the different environmental compartments (water, soil, biota) and that through its route along the trophic chain can finish incorporated in the human body via ingestion of waters and or food. This radionucleid is highly radiotoxic, being one of the main contributors to the committed effective dose received by the population of Seville via consumption of bottled waters and via ingestion of typical diets is evaluated. The mentioned contribution is also compared with the contributions of other natural and and artificial radionuclides. (Author). 23 refs.

  8. Determination of lead 210 in scales from industrial processes

    Energy Technology Data Exchange (ETDEWEB)

    Faria, Lígia S.; Moreira, Rubens M.; Kastner, Geraldo F.; Barbosa, João B.S., E-mail: ligsfaria@gmail.com, E-mail: rubens@cdtn.br, E-mail: gfk@cdtn.br, E-mail: jbsb@cdtn.br [Centro de Desenvolvimento da Tecnologia Nuclear (CDTN/CNEN-MG), Belo Horizonte, MG (Brazil)

    2017-11-01

    Industrial processes such as oil and gas extraction and groundwater exploitation are examples of installations that can accumulate naturally occurring radioactive materials (NORM) during the extraction and production. Lead-210 deposits in the production can be formed by the same mechanisms that occur in the environment through the support of Radon-222, (where {sup 210}Pb is produced at {sup 222}Rn decay) or without support, as {sup 210}Pb. The objective of this work is to evaluate the mineralogical characteristics and determine the activity of lead-210 in the scales using the X-Ray Diffraction and Gamma Spectrometry techniques. Were analyzed fifteen samples, four scales from oil industry, ten scales from groundwater conductors and one for groundwater supply pipe. The highest activity found in the oil scale and groundwater conductors scale was 0.30 ± 0.06 Bq g{sup -1} and 3.80 ± 0.20 Bq g{sup -1}, respectively. (author)

  9. 17 CFR 210.9-03 - Balance sheets.

    Science.gov (United States)

    2010-04-01

    ... 1940, AND ENERGY POLICY AND CONSERVATION ACT OF 1975 Bank Holding Companies § 210.9-03 Balance sheets... (such as loans, investments, operations, administration or finance), and any other officer or person who...

  10. Pb-210 and Po-210 atmospheric releases via fly ash from oil shale-fired power plants.

    Science.gov (United States)

    Vaasma, Taavi; Loosaar, Jüri; Gyakwaa, Francis; Kiisk, Madis; Özden, Banu; Tkaczyk, Alan H

    2017-03-01

    During high temperature processes in the furnace volatile and semi-volatile elements and radionuclides are partially emitted to the environment, depending on their chemical form in the original fuel, the technological set-up of the combustion system, and the prevailing combustion conditions. Two of the world's largest oil shale-fired power plants (PPs) have been operational in Estonia from the 1960s, during which time creation of significant environmental emissions and waste containing naturally occurring radionuclides has occurred. Pb-210 and 210 Po are considered natural radionuclides with the highest emission rates from PPs and possess elevated potential radiation exposure risks to humans and the environment. These radionuclides have the highest activity concentration values in fine ash fractions, especially in fractions remaining below 2.5 μm. To determine the activity concentrations of 210 Pb and 210 Po in the PPs' outlet, sampling was conducted from boilers operating on pulverized fuel (PF) technology with novel integrated desulphurization (NID) system and bag filters as well as with electrostatic precipitators (ESPs). The 210 Pb and 210 Po activity concentrations remained around 300 Bq kg -1 for the NID system compared to 60-80 Bq kg -1 in the ESP system. The dominant ash fraction in both systems was PM2.5, constituting over 50% of the fly ash mass collected from the outlet. The authors estimate that the total atmospherically emitted activity for the modernized PPs remains dominantly below 1% of the activity that is inserted via fuel. The implementation of higher efficiency purifications systems has significantly reduced the negative effect of these PPs. Based on annually emitted fly ash and boilers' working hours, the 210 Pb and 210 Po activity released relative to energy production were up to 68.3 kBq GWh el -1 for 210 Pb and 64.6 kBq GWh el -1 for 210 Po. These values are 1 to 2 orders of magnitude lower compared to the situation in the 1980s. These

  11. Pb-210-in-vivo measurements in the human skeleton; Pb-210-in-vivo-Messungen am menschlichen Skelett

    Energy Technology Data Exchange (ETDEWEB)

    Scheler, R.; Dettmann, K. [Bundesamt fuer Strahlenschutz, Berlin (Germany)

    1998-12-31

    A suitable method for the retrospective estimation of the exposure to short-lived radon progeny is the in-vivo measurement of the decay product Pb-210. The deposited Pb-210 is estimated at the skull by measurements with a low-energy Ge-detector-array. Because the decision limit resp. minimal detectable activity of 24 Bq resp. 48 Bq the quantitative assessment of cumulated exposure is possible for long-time exposure at levels of the equilibrium equivalent radon-concentration above 500 Bqm{sup -3}. It seems that the average value of Pb-210-activity in the skeleton of individuals living in regions with increased radon-concentration exceeds the mean value of 15 Bq. A correlation with the exposure may be possible. (orig.) [Deutsch] Eine der pinzipiellen Moeglichkeiten zur retrospektiven Ermittlung der Exposition durch die kurzlebigen Rn-222-Folgeprodukte besteht in der in-vivo-Messung des Folgeproduktes Pb-210. Die Bestimmung des Pb-210 erfolgt am Schaedel mit einer Low-Energy-Ge-Detektoranordnung, deren Erkennungs- bzw. Nachweisgrenze bei Messzeiten von 7200 s fuer das Gesamtskelett 17 Bq bzw. 34 Bq Pb-210 betraegt. Die entsprechenden Grenzen von 24 bzw. 48 Bq fuer das durch Exposition entstandene Pb-210 lassen eine vernuenftige quantitative Bestimmung der kumulierten Exposition erst nach langjaehrigen Expositionen bei gleichgewichtsaequivalenten Radonkonzentrationen von mehr als 500 Bqm{sup -3} zu. Schaedelmessungen an Probanden aus Regionen mit erhoehtem Radonvorkommen deuten auf ein im Mittel hoeheres Niveau der Pb-210-Skelettaktivitaet gegenueber dem vom angegebenen Mittelwert von 15 Bq hin. Ein Zusammenhang zur Exposition ist nicht auszuschliessen. (orig.)

  12. Comparison of glucose-insulin-thallium-201 infusion single photon emission computed tomography (SPECT), stress-redistribution-reinjection thallium-201 SPECT and low dose dobutamine echocardiography for prediction of reversible dysfunction

    Energy Technology Data Exchange (ETDEWEB)

    Sakamoto, Hiroki; Kondo, Makoto; Motohiro, Masayuki; Usami, Satoru [Shimada Municipal Hospital, Shizuoka (Japan)

    2001-12-01

    The usefulness of glucose-insulin-thallium-201 (GI-Tl) infusion single photon emission computed tomography (SPECT) in predicting reversible dysfunction has not been evaluated, so the present study recruited 20 patients with regional ischemic dysfunction for investigation. All patients underwent GI-Tl SPECT, post-stress Tl reinjection imaging and low dose dobutamine echocardiography. The diagnostic accuracy of these 3 techniques in predicting functional recovery was evaluated by receiver operating characteristic (ROC) analysis. In segments with functional recovery, regional Tl activities of GI-Tl SPECT were significantly higher than those of reinjection imaging (p<0.05), although there were no significant differences in segments without recovery. The area under the ROC curve for GI-Tl SPECT (0.75{+-}0.06) was greater than that for reinjection imaging (0.68{+-}0.07). The optimal cutoff values to identify viable myocardium were considered to be 55% of peak activity for GI-Tl SPECT and 50% for reinjection imaging. At this cutoff point, the sensitivity and specificity for detection of functional recovery were, respectively, 85% and 61% for GI-Tl SPECT, and 73% and 61% for reinjection imaging. Dobutamine echocardiography had the same sensitivity (85%), but lower specificity (48%) than GI-Tl SPECT. Continuous infusion of GI-Tl solution enhances regional Tl uptake compared with conventional post-stress reinjection imaging. This study suggests that GI-Tl SPECT is superior to reinjection imaging and dobutamine echocardiography in predicting functional recovery after ischemic left ventricular dysfunction. (author)

  13. {sup 210}Po and {sup 210}Pb concentration of cigarettes traded in Hungary and their estimated dose contribution due to smoking

    Energy Technology Data Exchange (ETDEWEB)

    Kovacs, Tibor [Department of Radiochemistry, University of Pannonia, P.O. Box 158, H-8201 Veszprem (Hungary)], E-mail: kt@almos.vein.hu; Somlai, Janos [Department of Radiochemistry, University of Pannonia, P.O. Box 158, H-8201 Veszprem (Hungary); Nagy, Katalin [Department of Rheumatology, Markhot F. Heves County Hospital, Szechenyi ut 27, H-3300 Eger (Hungary); Szeiler, Gabor [Department of Radiochemistry, University of Pannonia, P.O. Box 158, H-8201 Veszprem (Hungary)

    2007-11-15

    It is known that tobacco leaves may contain {sup 210}Pb and {sup 210}Po in significant concentrations. The cumulative alpha-radiation dose due to the radioactive content of inhaled cigarette smoke and the increasing number of lung cancer cases explain the importance of the investigation. The present study investigated the activity concentrations of these two radionuclides in 29 Hungarian cigarette samples. The relation between {sup 210}Po/{sup 210}Pb activity and nicotine/tar content of these cigarettes was also examined. {sup 210}Po was determined by alpha spectrometry using a PIPS detector after chemical leaching and spontaneous deposition of {sup 210}Po on a high nickel-content (25%) stainless steel disk. The {sup 210}Pb activity was calculated from the {sup 210}Po originated from the decay of {sup 210}Pb after a waiting period of eight months. The {sup 210}Po activity concentrations of the measured types of cigarettes ranged from 10.0 to 33.5 mBq/cigarette, and the activity of {sup 210}Pb varied from 9.6 to 32.5 mBq/cigarette. The average annual committed effective dose is estimated to be 185.6{+-}70.6{mu}Sv/y and 58.7{+-}22.7{mu}Sv/y due to cigarette smoking (20 cigarettes/day) for {sup 210}Po and {sup 210}Pb, respectively.

  14. 17 CFR 210.6A-01 - Application of §§ 210.6A-01 to 210.6A-05.

    Science.gov (United States)

    2010-04-01

    ... EXCHANGE ACT OF 1934, PUBLIC UTILITY HOLDING COMPANY ACT OF 1935, INVESTMENT COMPANY ACT OF 1940, INVESTMENT ADVISERS ACT OF 1940, AND ENERGY POLICY AND CONSERVATION ACT OF 1975 Employee Stock Purchase... 210.6A-05 shall be applicable to financial statements filed for employee stock purchase, savings and...

  15. Po-210 and other radionuclides in terrestrial and freshwater environments

    Energy Technology Data Exchange (ETDEWEB)

    Gjelsvik, Runhild; Brown, Justin (eds.) (Norwegian Radiation Protection Authority (Norway)); Holm, Elis (Univ. of Lund (Sweden)); Roos, Per (Risoe DTU (Denmark)); Saxen, Ritva; Outola, Iisa (STUK - Radiation and Nuclear Safety Authority (Finland))

    2009-01-15

    This report provides new information on Po-210 (and where appropriate its grandparent Pb-210) behaviour in environmental systems including humans. This has primarily been achieved through measurements of Po-210 in aquatic and terrestrial environments that has led to the derivation of information on the levels of this radioisotope in plants, animals and the biotic components of their habitat (i.e. water, soil) providing basic information on transfer where practicable. For freshwater environments, Po-210 concentration ratios derived for freshwater benthic fish and bivalve mollusc were substantially different to values collated from earlier review work. For terrestrial environments, activity concentrations of Po-210 in small mammals (although of a preliminary nature because no correction was made for ingrowth from Pb-210) were considerably higher than values derived from earlier data compilations. It was envisaged that data on levels of naturally occurring radionuclides would render underpinning data sets more comprehensive and would thus allow more robust background dose calculations to be performed subsequently. By way of example, unweighted background dose-rates arising from internal distributions of Po-210 were calculated for small mammals in the terrestrial study. The biokinetics of polonium in humans has been studied following chronic and acute oral intakes of selected Po radioisotopes. This work has provided information on gastrointestinal absorption factors and biological retention times thus improving the database upon which committed effective doses to humans are derived. The information generated in the report, in its entirety, should be of direct relevance for both human and non-human impact assessments. (au)

  16. Detection and dosimetry of gamma ray emitted from thallium-201 and technetium-99m based on chemiluminescence technique

    Energy Technology Data Exchange (ETDEWEB)

    Shourian, Mostafa [Laboratory of Microanalysis, Institute of Biochemistry and Biophysics, University of Tehran, P.O. Box 13145-1384, Tehran (Iran, Islamic Republic of); Tavakoli, Hassan, E-mail: tavakoli@ibb.ut.ac.i [Faculty of Medicine, Department of Physiology and Biophysics, Faculty of Medicine, Baqiyatollah University of Medical Sciences, P.O. Box 19395-6558, Tehran (Iran, Islamic Republic of); Ghourchian, Hedayatollah, E-mail: hadi@ibb.ut.ac.i [Laboratory of Microanalysis, Institute of Biochemistry and Biophysics, University of Tehran, P.O. Box 13145-1384, Tehran (Iran, Islamic Republic of); Rafiee-Pour, Hossain-Ali [Laboratory of Microanalysis, Institute of Biochemistry and Biophysics, University of Tehran, P.O. Box 13145-1384, Tehran (Iran, Islamic Republic of)

    2010-09-15

    This report describes the detection and dosimetry of gamma ray emitted from Thallium-201 ({sup 201}Tl) and Technetium-99m ({sup 99m}Tc) based on chemiluminescence technique. H{sub 2}O{sub 2} produced by two gamma emitter radioisotopes of {sup 201}Tl and {sup 99m}Tc were quantitatively measured by chemiluminescence method. Upon producing H{sub 2}O{sub 2} in a luminol alkaline solution, in the presence of diperiodatocuprate, as catalyst a chemical reaction was accrued and consequently the emitted light was measured. The determined H{sub 2}O{sub 2} concentration was correlated with the gamma ray detection and dosimetry. The sensitivity of chemiluminescence technique for {sup 201}Tl and {sup 99m}Tc dosimetry was determined to be 0.20 and 0.08 MBq/l (Mega Becquerel per liter) respectively (R.S.D. = %5, N = 3). The plotted calibration curves showed detection limits of 3.24 and 1.76 MBq/l for {sup 201}Tl and {sup 99m}Tc, respectively.

  17. Myocardial infarction diagnosis with body surface potential mapping, electrocardiography, vectorcardiography and thallium-201 scintigraphy: a correlative study with left ventriculography.

    Science.gov (United States)

    Ackaoui, A; Nadeau, R; Sestier, F; Savard, P; Primeau, R; Lemieux, R; Descary, M C

    1985-01-01

    In 35 subjects with typical or atypical angina and/or documented myocardial infarction (MI), body surface potential maps (BSPMs), ECG, VCG and rest Thallium-201 (T1-201) have been compared to left ventriculography (LVG). BSPMs were recorded with 26 ECGs, and BSPM abnormalities for MI cases were considered to be areas of normally positive potentials that have become negative. Subjects with MI were classified according to the segmental localization and degree of asynergy on LVG. Moderate anterolateral and apical asynergy were found to correlate with BSPM diagnosis of anterolateral MI and ischemia, severe anterolateral and apical asynergy with BSPM diagnosis of anterolateral MI and ischemia, and moderate diaphragmatic and/or posterobasal asynergy with BSPM diagnosis of posterior MI. Simultaneous anterior and posterior asynergy were found for BSPM diagnosis of anterior with posterior MI. Subjects with no LVG asynergy had normal BSPMs. BSPM diagnosis had the highest correlation coefficient with the LVG diagnosis (r = 0.88). ECG and VCG showed similar results with r = 0.65 and 0.71 respectively, while T1-201 had r = 0.55. The examination of our BSPMs, as well as the ECG, VCG and T1-201, did not permit to detect apical damage in presence of anterior MI, and posterobasal damage in the presence of inferoposterior MI. It is concluded that BSPMs are slightly superior to ECG and VCG for diagnosis of MI.

  18. Thallium release from acid mine drainages: Speciation in river and tap water from Valdicastello mining district (northwest Tuscany).

    Science.gov (United States)

    Campanella, Beatrice; Casiot, Corinne; Onor, Massimo; Perotti, Martina; Petrini, Riccardo; Bramanti, Emilia

    2017-08-15

    In this work we present an advantageous method for the simultaneous separation and detection of Tl(I) and Tl(III) species through ion chromatography coupled with on-line inductively coupled plasma - mass spectrometry. Chromatographic separation between Tl(III) and Tl(I) was achieved in less than two minutes. The method was validated by recovery experiments on real samples, and by comparing the sum of the concentrations of individual Tl species with total thallium values obtained from continuous flow ICP-MS. The experimental procedure offers an accurate, sensitive and interference-free method for Tl speciation at trace levels in environmental samples. This allowed us to investigate the Tl speciation in acid mine drainages (AMD), surface waters and springs in a mining catchment in Valdicastello Carducci (Tuscany, Italy), where severe Tl contamination ad been evidenced previously. This study shows for the first time that Tl(III), in addition to Tl(I), is present in considerable amounts in water samples affected by acid mining outflow, raising the question of the origin of this thermodynamically unstable species. Copyright © 2017 Elsevier B.V. All rights reserved.

  19. The Radiological Impact of 210Pb and 210Po Released from the Iron- and Steel-Making Plant ILVA in Taranto (Italy on the Environment and the Public

    Directory of Open Access Journals (Sweden)

    Guogang Jia

    2013-01-01

    Full Text Available Lead-210 and 210Po are naturally occurring radionuclides. Due to volatile characteristic of lead and polonium, environmental pollution of 210Pb and 210Po released from the coal power plant, steel-making industry and refractory material industry has been an exposure problem for the members of public. In this paper studies on the activity concentrations of 210Po and 210Pb in the raw materials, dust particles, surficial soils and atmospheric particulate samples collected in the area of the Iron- and Steel-Making Plant ILVA Taranto (Italy were made. These data have been used to evaluate the source-term, distributions, inventories, mass balance, biological availability, ecological migration processes and public exposure risk of 210Pb and 210Po in the concerned environment.

  20. Natural levels of {sup 210}Po in human urine

    Energy Technology Data Exchange (ETDEWEB)

    Diaz-Frances, I.; Manjon, G.; Mantero, J.; Diaz, J. [Departament of Applied Phisic II, University of Seville, P.O. Box 41012 Seville (Spain); Garcia-Tenorio, R. [Departament of Applied Phisic II, University of Seville, P.O. Box 41012 Seville (Spain); National Accelerator Centre, P.O. Box 41092 Seville (Spain)

    2014-07-01

    Since the secret agent Alexander Litvinenko was murdered in 2006 by a {sup 210}Po lethal dose, presumably ingested, there is renovated interest on the toxicity of this radionuclide in humans. {sup 210}Po is a radioactive isotope naturally found in nature, mainly incorporated by humans via food and water ingestion, as well as inhaled through its progenitor, the {sup 222}Rn. The total amount of natural {sup 210}Po in the human body can vary from person to person depending on their lifestyle: dietary habits, drinking water source, place of residence (associated with exposure to {sup 222}Rn), etc- and therefore in the concentrations of this element to be found in urine. To analyze the influence of dietary habits on the amount of {sup 210}Po excreted in urine, two volunteers in Seville had a well-defined and time-varying diet for a month, following a daily collection of their urine and determination of the concentrations therein of this radionuclide. The results obtained and the conclusions derived from them form the core of this communication. {sup 210}Po determinations were performed daily in 200 ml aliquots of urine using the technique of high resolution alpha spectrometry. This has involved the application of a single radiochemical method for the concentration and isolation {sup 210}Po, followed by its auto-deposition on copper planchets for proper measure. Daily {sup 210}Po activity concentrations in voluntary urine analyzed during the month of study show high variability with a difference of up to an order of magnitude between maximum and minimum values obtained, and a clear dependence on the diet type followed in the various stages of the experiment. The lowest concentrations obtained are associated with a diet rich in carbohydrates and proteins 'terrestrial' (pork, beef,...), while the highest concentrations were obtained in the final phase of the experiment when the diet was enriched with presence of marine products in fair correspondence with the

  1. 210Po and 210Pb trophic transfer within the phytoplankton-zooplankton-anchovy/sardine food web: a case study from the Gulf of Lion (NW Mediterranean Sea).

    Science.gov (United States)

    Strady, Emilie; Harmelin-Vivien, Mireille; Chiffoleau, Jean François; Veron, Alain; Tronczynski, Jacek; Radakovitch, Olivier

    2015-05-01

    The transfer of (210)Po and (210)Pb in the food web of small pelagic fishes (from phytoplankton and zooplankton to anchovy Engraulis encrasicolus and sardine Sardina pilchardus) is investigated in the Gulf of Lion (GoL). We present original data of (210)Po and (210)Pb activity concentrations, C and N stable isotope ratios, measured (i) from different size classes of phytoplankton and zooplankton during spring and winter in different environments of the GoL, and (ii) in two fish species. Significant spatial patterns based on (210)Po, (210)Pb activity concentrations and (210)Po/(210)Pb ratios in the different plankton size classes are evidenced by hierarchical clustering, both in spring and winter. This variability, also observed for C and N stable isotopes ratios, is connected to local specific pelagic habitats and hydrodynamics. The sampling strategy suggests that (210)Po bioaccumulation in the GoL remains at a constant level from the first (dominated by phytoplankton) to the second trophic level (zooplankton), while (210)Pb bioaccumulation shows an increase in winter. Based on stable N isotope ratios and (210)Po activity concentrations measured in anchovies and sardines, we evidence (210)Po bio-magnification along the trophic food web of these two planktivorous pelagic fishes. Copyright © 2015 Elsevier Ltd. All rights reserved.

  2. Exposed proliferation antigen 210 (XPA-210) in renal cell carcinoma (RCC) and oncocytoma: clinical utility and biological implications.

    Science.gov (United States)

    Kruck, Stephan; Hennenlotter, Joerg; Vogel, Ulrich; Schilling, David; Gakis, Georgios; Hevler, Joachim; Kuehs, Ursula; Stenzl, Arnulf; Schwentner, Christian

    2012-02-01

    •  To determine the clinical role of the exposed proliferation antigen 210 (XPA-210) of the proliferation marker thymidine kinase 1 (TK1) in a large cohort of different renal cell carcinoma (RCC) types, oncocytomas and normal renal tissues samples, as TK1 is reported to be of clinical significance in several cancer entities and is suggested as a prognostic serum biomarker for RCC. •  Expressions of XPA-210 were determined immunohistochemically in 40 clear cell RCCs (ccRCC), 25 papillary RCCs (papRCC), 17 chromophobe RCC (chRCC), 27 oncocytomas and 64 normal renal parenchyma paraffin-embedded specimens. •  Immunohistochemistry was performed with a monoclonal anti-XPA-210 antibody. Staining was measured by the percentage of positive cells. •  Expression was compared between subgroups and correlated with respective clinical data using one-way analysis of variance with post hoc Tukey-Kramer analyses. •  XPA-210 staining in the RCC subgroup was significantly different from the oncocytomas (mean [sem] 4.1 [0.4] vs 2.2 [0.4]; P = 0.004) and from normal renal tissue (1.0 [0.1]; P oncocytomas did not differ from normal renal parenchyma staining (P = 0.18). •  Subdivided into RCC groups, only ccRCC (mean [sem] 5.1 [0.6]; P renal parenchyma, whereas chRCC (1.4 [0.3]; P = 0.99) did not. •  RCC XPA-210 staining was significantly associated with higher tumour stage (T = 3, P = 0.002) and grade (G = 3, P = 0.001). •  The malignant character of RCC is reflected by higher XPA-210 expression as compared with oncocytomas and normal kidney. •  The ccRCC and papRCC subgroups had higher XPA-210 levels. •  XPA-210 could be considered a potential marker for the assessment of the proliferative activity in primary RCC. © 2011 THE AUTHORS. BJU INTERNATIONAL © 2011 BJU INTERNATIONAL.

  3. Solid partitioning and solid-liquid distribution of {sup 210}Po and {sup 210}Pb in marine anoxic sediments: roads of Cherbourg at the northwestern France

    Energy Technology Data Exchange (ETDEWEB)

    Connan, O. [Laboratoire de Radioecologie de Cherbourg-Octeville, Institut de Radioprotection et de Surete nucleaire (IRSN), Service d' Etudes et du Comportement des Radionucleides dans l' Environnement (SECRE), rue Max Pol Fouchet, 50130 Cherbourg-Octeville (France)], E-mail: olivier.connan@irsn.fr; Boust, D. [Laboratoire de Radioecologie de Cherbourg-Octeville, Institut de Radioprotection et de Surete nucleaire (IRSN), Service d' Etudes et du Comportement des Radionucleides dans l' Environnement (SECRE), rue Max Pol Fouchet, 50130 Cherbourg-Octeville (France); Billon, G. [Laboratoire de Chimie Analytique et Marine, Universite des sciences et technologies de Lille, 59655 Villeneuve d' Ascq Cedex (France); Solier, L.; Rozet, M.; Bouderbala, S. [Laboratoire de Radioecologie de Cherbourg-Octeville, Institut de Radioprotection et de Surete nucleaire (IRSN), Service d' Etudes et du Comportement des Radionucleides dans l' Environnement (SECRE), rue Max Pol Fouchet, 50130 Cherbourg-Octeville (France)

    2009-10-15

    A sequential extraction protocol has been used to determine the solid-phase partition of {sup 210}Po and {sup 210}Pb in anoxic marine sediment from the roads of Cherbourg (France) in the central English Channel. Measurements were also obtained in pore waters, in which {sup 210}Po activities range between 1 and 20 mBq L{sup -1} and {sup 210}Pb activities between 2.4 and 3.8 mBq L{sup -1}, with highest activities in the topmost layer. These activities are higher than in seawater, suggesting that sediment act as a source of both {sup 210}Po and {sup 210}Pb for overlying water. The {sup 210}Po profile in the pore waters is apparently correlated with those obtained for Fe, Mn and SO{sub 4}{sup 2-}, suggesting an influence of early diagenetic processes on the {sup 210}Po solid-liquid distribution. In the sediment, {sup 210}Po is predominantly bound to organic matter or chromium reducible sulphides, and residuals (clay minerals and refractory oxides). Our results indicate that {sup 210}Po is not significantly bound to AVS, i.e. acid volatile sulphides: bioturbation could play a role by the early redistribution of {sup 210}Po bound to acid volatile sulphides in the sediment. {sup 210}Po, {sup 210}Pb and Pb exhibit differences in terms of distribution, probably due to a different mode of penetration in the sediment. This work provides information on solid and liquid distribution of {sup 210}Po and {sup 210}Pb in marine sediment. These data are very scarce in the litterature.

  4. Concentrations of {sup 210}Po in fish and shellfish from southern region of Japan and evaluation of {sup 210}Po intake from seafood for Japanese people

    Energy Technology Data Exchange (ETDEWEB)

    Momoshima, N.; Sugihara, S. [Kyushu Univ., Fukuoka (Japan). Radioisotope Center; Nakao, H. [Kyushu Univ., Fukuoka (Japan). Graduate School of Sciences

    2012-07-01

    Concentrations of {sup 210}Po in fish and shellfish, mostly collected from southern region of Japan were analyzed. Values ranged from 0.2 to 229 Bq/kg fresh weight and higher concentrations were observed in samples analyzed with viscera. Intake of {sup 210}Po through fish and shellfish was evaluated at different Japanese cities based on statistical consumption data. Phytoplankton, Heterosigma akashiwo was collected during a harmful algal bloom and {sup 210}Po was analyzed. The phytoplankton occupied only 4.4% of {sup 210}Po in seawater and a large fraction of {sup 210}Po was observed in the particulate form. (orig.)

  5. Thallium in spawn, juveniles, and adult common toads (Bufo bufo) living in the vicinity of a zinc-mining complex, Poland

    OpenAIRE

    Dmowski, Krzysztof; Rossa, Monika; Kowalska, Joanna; Krasnodębska-Ostręga, Beata

    2014-01-01

    A breeding population of the common toad Bufo bufo living in the vicinity of a Zn-Pb smelting works in Bukowno, Poland was studied for the presence of thallium. Tl concentration was measured in the bottom sediments of the spawning pond, in the laid eggs, in juveniles after metamorphosis, and in the selected tissues of the adult individuals. A very high concentration of Tl was detected in the spawn (13.97 ± 8.90 mg/kg d.w.). In 50 % of the spawn samples, levels exceeded 20 mgTl/kg d.w. The iss...

  6. Variations of {sup 210}Po and {sup 210}Pb in various marine organisms from Western English Channel: contribution of {sup 210}Po to the radiation dose

    Energy Technology Data Exchange (ETDEWEB)

    Connan, O. [Institut de Radioprotection et de Surete Nucleaire, Laboratoire de Radioecologie de Cherbourg-Octeville, IRSN/DEI/SECRE/LRC, Rue Max Pol Fouchet, 50130 Cherbourg-Octeville (France)], E-mail: olivier.connan@irsn.fr; Germain, P.; Solier, L.; Gouret, G. [Institut de Radioprotection et de Surete Nucleaire, Laboratoire de Radioecologie de Cherbourg-Octeville, IRSN/DEI/SECRE/LRC, Rue Max Pol Fouchet, 50130 Cherbourg-Octeville (France)

    2007-10-15

    Measurements of {sup 210}Po were carried out in various marine matrices (mussels, oysters, seaweed, fish, and abalones) and in seawater at several points along the French coast, over a period of 2 years (2003-2005). These measurements contribute to a better knowledge of this element, since few recent data exist for the French coast. Marked seasonal variations have been revealed in some species and there are differences according to the way of life of these species. Activities in mussels (Mytilus edulis) and oysters (Crassostrea gigas) are similar and varying between 90 and 600 Bq kg{sup -1} (d.w.). Activities in macroalgae (Fucus serratus) are lowest, between 4 and 16 Bq kg{sup -1} (d.w.). In oyster, abalone (Haliotis tuberculata) and fish (Solea solea, Sparus sp.), the strongest activities are measured in the digestive glands, the gills and the gonads. {sup 210}Po/{sup 210}Pb ratios in all cases have values of more than one for all species. From a significant number of measurements, CFs were calculated for seaweed (between 4.6 x 10{sup 3} and 5.0 x 10{sup 3}) and for molluscs, with highest CFs (>10{sup 5}) found for the digestive gland and gills of the oysters, the digestive gland of the abalones and the liver of fish. Finally, the activities measured have made it possible to estimate the internal dose from chronic exposure due to {sup 210}Po received by the marine organisms (0.05 {mu}G h{sup -1} for macroalgae, between 0.70 and 1.5 {mu}G h{sup -1} for mussels and oyster), and the contribution of seafood to the dose received by humans (46-129 {mu}Sv y{sup -1})

  7. Effects of potassium channel opener on the kinetics of thallium-201 in in-vitro and in-vivo

    Energy Technology Data Exchange (ETDEWEB)

    Lee, J.; Kim, E. J.; Ahn, B. C.; Chae, S. C.; Lee, K. B. [College of Medicine, Kyungpook National Univ., Taegu (Korea, Republic of); Kim, C. K. [Mt. Sinai Medical School, New York (United States)

    1997-07-01

    Potassium channel opener (K-opener) opens membrane ATP-sensitive K{sup +}-channel and induces and increase in potassium efflux from cells. K-openers are powerful smooth muscle relaxants and currently used as antihypertensive, antianginal drugs or bronchodilators in clinic. Pharmacologic potency of newly synthesized K-opener is being evaluated with efflux capacity of preincubated Rb-83 from the isolated aortic vascular tissue preparation. Thallium has similar characteristics to those of rubidium and potassium in vivo. To evaluate the effect of pinacidil (a potent K-opener) on Tl-201 biokinetics, we have performed uptake/washout studies in cultured myocytes, and mice biodistribution study. Primary culture of spontaneous contracting myocytes was undertake from hearts of newborn Sprague-Dawley rat. Different concentration of pinacidil (100nM or 10uM) was co-incubated with Tl-201 in HBSS buffer to evaluate its effect on cellular uptake, or challenged to myocyte preparations pre-incubated with Tl-201 for washout study. Pinacidil was injected into mice simultaneous or 10-min after Tl-201 injection, and organ uptake and whole body retention ratio was measured using gamma counter or dose calibrator. Co-incubation of pinacidil with Tl-201 resulted in a decrease in Tl uptake into myocytes by 1.6 - 2.5 times, and an increase in washout by 1.6 - 3.1 times. Pinacidil injection resulted in mild decrease in blood, heart and liver uptake in mice, bur renal uptake was markedly decreased in a dose dependent manner. These results suggest that the pinacidil Tl-201 kinetics and may potentially affect the interpretation of Tl-201 myocardial imaging.

  8. Functional Significance of Angiographic Collaterals in Patients with Totally Occluded Right Coronary Artery: Intracoronary Thallium-201 Scintigraphy

    Energy Technology Data Exchange (ETDEWEB)

    Lee, Do Yun; Lee, Jong Doo; Cho, Seung Yun; Shim, Won Heum; Ha, Jong Won; Kim, Han Soo; Kwon, Hyuk Moon; Jang, Yang Soo; Chung, Nam Sik; Kim, Sung Soon [Yonsei University College of Medicine, Seoul (Korea, Republic of); Park, Chang Yun; Kim, Young Soo [Inje University College of Medicine, Seoul (Korea, Republic of)

    1993-07-15

    To compare the myocardial viability in patients suffering from total occlusion of the right coronary artery (RCA) with the angiographic collaterals, intracoronary injection of Thallium-201 (T1-201) was done to 14 coronary artery disease (CAD) patients (pts) with total occlusion of RCA and into four normal subjects for control. All 14 CAD pts had Grade 2 or 3 collateral circulations. There were 14 male and 4 females, and their ages ranged from 31 to 70 years. In nine pts, T1-201 was injected into left main coronary artery (LCA) (300 approx 350 mu Ci) to evaluate the myocardial viability of RCA territory through collateral circulations. The remaining five pts received T1-201 into RCA (200-250 mu Ci) because two had intraarterial bridging collaterals and three had previous successful PTCA. Planar and SPECT myocardial perfusion images were obtained 30 minutes, and four to five hours after T1-201 reinjection. Intravenous T1-201 reinjection (six pts) or {sup 99m}Tc-MIBI (two pts) were also performed in eight CAD pts. Intracoronary myocardial perfusion images were compared with intravenous T1-201(IV T1-201) images, EGG, and ventriculography. Intracoronary TI-201 images proved to be superior to that of IV T1-201 due to better myocardial to background uptake ratio and more effective in the detection of viable tissue. We also found that perfusion defects were smaller on intracoronary T1-201 images than those on the IV T1-201. All of the 14 CAD pts had either mostly viable myocardium (seven pts) or large area of T1-201 perfusion (seven pts) in RCA territory, however ventriculographic wall motion and ECG did not correlate well with intracoronary myocardial perfusion images. In conclusion, total RCA occlusion patients with well developed collateral circulation had large area of viable myocardial in the corresponding territory.

  9. Disease stage classification in hypertrophic cardiomyopathy by dual analysis of iodine-123-labeled metaiodobenzylguanidine and thallium-201 myocardial scintigraphies

    Energy Technology Data Exchange (ETDEWEB)

    Hiasa, Go [Ehime Univ., Matsuyama (Japan). School of Medicine

    2001-08-01

    Many patients with hypertrophic cardiomyopathy (HCM) gradually changes from typical myocardial hypertrophy to dilated cardiomyopathy-like features. However, it is difficult to estimate the disease stage in HCM. To determine the disease stage, dual analysis of iodine-123-labeled metaiodobenzylguanidine ({sup 123}I-MIBG) and thallium-201 ({sup 201}Tl) myocardial scintigraphies were performed in 108 HCM patients. According to the scintigraphic distribution patterns, patients were divided into three groups. Group A (n=15): normal distributions of both {sup 123}I-MIBG and {sup 201}Tl, group B (n=71): normal {sup 201}Tl and low {sup 123}I-MIBG patterns, group C (n=22): low distributions of both scintigraphies. The decrease in {sup 201}Tl uptake was observed in only group C. Concerning {sup 123}I-MIBG, heart-to-mediastinum ratio (H/M) and washout rate (WOR) had good correlations with left ventricular systolic functions. H/M was decreased and WOR was increased in order of C, B and A groups. Left ventricular diastolic function reflected by isovolumic relaxation time was longer in group B than in group A. Attenuated left ventricular hypertrophy, enlarged left ventricular volumes, impaired left ventricular functions and serious clinical symptoms were observed in only group C. Myocardial sympathetic abnormalities in group B may be mainly due to myocardial hypertrophy, and those in group C may be due to myocardial injury. Dual analysis of {sup 123}I-MIBG and {sup 201}Tl scintigraphies may be useful to classify disease stages of HCM. (author)

  10. New quaternary thallium indium germanium selenide TlInGe2Se6: Crystal and electronic structure

    Science.gov (United States)

    Khyzhun, O. Y.; Parasyuk, O. V.; Tsisar, O. V.; Piskach, L. V.; Myronchuk, G. L.; Levytskyy, V. O.; Babizhetskyy, V. S.

    2017-10-01

    Crystal structure of a novel quaternary thallium indium germanium selenide TlInGe2Se6 was investigated by means of powder X-ray diffraction method. It was determined that the compound crystallizes in the trigonal space group R3 with the unit cell parameters a = 10.1798(2) Å, c = 9.2872(3) Å. The relationship with similar structures was discussed. The as-synthesized TlInGe2Se6 ingot was tested with X-ray photoelectron spectroscopy (XPS) and X-ray emission spectroscopy (XES). In particular, the XPS valence-band and core-level spectra were recorded for initial and Ar+ ion-bombarded surfaces of the sample under consideration. The XPS data allow for statement that the TlInGe2Se6 surface is rigid with respect to Ar+ ion-bombardment. Particularly, Ar+ ion-bombardment (3.0 keV, 5 min duration, ion current density fixed at 14 μA/cm2) did not cause substantial modifications of stoichiometry in topmost surface layers. Furthermore, comparison on a common energy scale of the XES Se Kβ2 and Ge Kβ2 bands and the XPS valence-band spectrum reveals that the principal contributions of the Se 4p and Ge 4p states occur in the upper and central portions of the valence band of TlInGe2Se6, respectively, with also their substantial contributions in other portions of the band. The bandgap energy of TlInGe2Se6 at the level of αg=103 cm-1 is equal to 2.38 eV at room temperature.

  11. 17 CFR 210.8-03 - Interim financial statements.

    Science.gov (United States)

    2010-04-01

    ... ACT OF 1934, PUBLIC UTILITY HOLDING COMPANY ACT OF 1935, INVESTMENT COMPANY ACT OF 1940, INVESTMENT ADVISERS ACT OF 1940, AND ENERGY POLICY AND CONSERVATION ACT OF 1975 Article 8 Financial Statements of... cumulative financial information from inception. Instruction 1 to § 210.8-03: Where Article 8 is applicable...

  12. 19 CFR 210.55 - Content of service copies.

    Science.gov (United States)

    2010-04-01

    ... Customs Duties UNITED STATES INTERNATIONAL TRADE COMMISSION INVESTIGATIONS OF UNFAIR PRACTICES IN IMPORT TRADE ADJUDICATION AND ENFORCEMENT Temporary Relief § 210.55 Content of service copies. (a) Any... information about each element of the violation alleged in the complaint and the motion to enable each...

  13. Pb-210 in beans grown in normal background environments

    Energy Technology Data Exchange (ETDEWEB)

    Mingote, Raquel M.; Nogueira, Regina A., E-mail: mingote@cnen.gov.br, E-mail: rnogueira@cnen.gov.br [Centro Regional de Ciencias Nucleares do Centro-Oeste (CRCN-CO/CNEN-GO), Abadia de Goias, GO (Brazil)

    2013-07-01

    A survey was carried out on the activity concentration of {sup 210}Pb in common beans (Phaseolus vulgaris L.) grown in normal background environments in Brazil. The Carioca beans and the black type were analyzed, which contribute with 90% of the Brazilian market share of the common beans. To this study 18 bean samples sowing in the Middle-Western and Southern regions of Brazil during the years 2010-2011 were analyzed. The proportion per bean type was similar to the national production: most of the Carioca beans (n=13; 72%) and black beans (n=5; 28%). Other 17 values of {sup 210}Pb activity concentration in beans grown in Southeastern region available in the GEORAD, a dataset of radioactivity in Brazil, were added to the statistic analysis of the data. Considering the information contained in censored observations (60%), representative value of {sup 210}Pb activity concentration in beans was estimated by using robust ROS, a censored data analysis method. The value 0.047 Bq kg{sup -1} fresh wt. obtained here is according to {sup 210}Pb activity concentration in grains reported by UNSCEAR 0.05 Bq kg{sup -1}. (author)

  14. 17 CFR 210.6-05 - Statements of net assets.

    Science.gov (United States)

    2010-04-01

    ... 1934, PUBLIC UTILITY HOLDING COMPANY ACT OF 1935, INVESTMENT COMPANY ACT OF 1940, INVESTMENT ADVISERS ACT OF 1940, AND ENERGY POLICY AND CONSERVATION ACT OF 1975 Registered Investment Companies § 210.6-05... assets are represented by investments in securities of unaffiliated issuers. If presented in such...

  15. 50 CFR 216.210 - Modifications to Letters of Authorization.

    Science.gov (United States)

    2010-10-01

    ... ATMOSPHERIC ADMINISTRATION, DEPARTMENT OF COMMERCE MARINE MAMMALS REGULATIONS GOVERNING THE TAKING AND IMPORTING OF MARINE MAMMALS Taking of Marine Mammals Incidental to Construction and Operation of Offshore Oil and Gas Facilities in the U.S. Beaufort Sea § 216.210 Modifications to Letters of Authorization...

  16. 21 CFR 2.10 - Examination and investigation samples.

    Science.gov (United States)

    2010-04-01

    ... each person named on the label of the article and owner thereof, who has not exercised his right under... GENERAL ADMINISTRATIVE RULINGS AND DECISIONS General Provisions § 2.10 Examination and investigation... shipment or other lot of the article from which such sample was collected was introduced or delivered for...

  17. 17 CFR 210.8-08 - Age of financial statements.

    Science.gov (United States)

    2010-04-01

    ... not yet available, the smaller reporting company reasonably and in good faith expects to report income... ACT OF 1934, PUBLIC UTILITY HOLDING COMPANY ACT OF 1935, INVESTMENT COMPANY ACT OF 1940, INVESTMENT... Smaller Reporting Companies § 210.8-08 Age of financial statements. At the date of filing, financial...

  18. 20 CFR 663.210 - How are intensive services delivered?

    Science.gov (United States)

    2010-04-01

    ... Section 663.210 Employees' Benefits EMPLOYMENT AND TRAINING ADMINISTRATION, DEPARTMENT OF LABOR ADULT AND... delivery system, including specialized One-Stop centers. Intensive services may be provided directly by the..., private for-profit, and private non-profit service providers (including specialized service providers...

  19. 7 CFR 210.17 - Matching Federal funds.

    Science.gov (United States)

    2010-01-01

    ... individual school food authorities. (f) Failure to match. If, in any school year, a State fails to meet the... AGRICULTURE CHILD NUTRITION PROGRAMS NATIONAL SCHOOL LUNCH PROGRAM Requirements for State Agency Participation § 210.17 Matching Federal funds. (a) State revenue matching. For each school year, the amount of State...

  20. 17 CFR 210.6-02 - Definition of certain terms.

    Science.gov (United States)

    2010-04-01

    ... ACT OF 1934, PUBLIC UTILITY HOLDING COMPANY ACT OF 1935, INVESTMENT COMPANY ACT OF 1940, INVESTMENT ADVISERS ACT OF 1940, AND ENERGY POLICY AND CONSERVATION ACT OF 1975 Registered Investment Companies § 210... affiliate means an affiliated person as defined in section 2(a)(3) of the Investment Company Act of 1940...

  1. 36 CFR 2.10 - Camping and food storage.

    Science.gov (United States)

    2010-07-01

    ... 36 Parks, Forests, and Public Property 1 2010-07-01 2010-07-01 false Camping and food storage. 2... RESOURCE PROTECTION, PUBLIC USE AND RECREATION § 2.10 Camping and food storage. (a) The superintendent may... revocation of the permit. (d) Food storage. The superintendent may designate all or a portion of a park area...

  2. 20 CFR 628.210 - State Job Training Coordinating Council.

    Science.gov (United States)

    2010-04-01

    ... 20 Employees' Benefits 3 2010-04-01 2010-04-01 false State Job Training Coordinating Council. 628... PROGRAMS UNDER TITLE II OF THE JOB TRAINING PARTNERSHIP ACT State Planning § 628.210 State Job Training Coordinating Council. (a) The Governor shall appoint a State Job Training Coordinating Council (SJTCC) pursuant...

  3. 48 CFR 2152.210-71 - Notice of significant events.

    Science.gov (United States)

    2010-10-01

    ... Standards or other requirements issued by OPM. (b) Upon learning of a significant event, OPM may institute... 48 Federal Acquisition Regulations System 6 2010-10-01 2010-10-01 true Notice of significant... PRECONTRACT PROVISIONS AND CONTRACT CLAUSES Text of Provisions and Clauses 2152.210-71 Notice of significant...

  4. 40 CFR 1065.210 - Work input and output sensors.

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 32 2010-07-01 2010-07-01 false Work input and output sensors. 1065... Ambient Conditions § 1065.210 Work input and output sensors. (a) Application. Use instruments as specified... sensors, transducers, and meters that meet the specifications in Table 1 of § 1065.205. Note that your...

  5. 50 CFR 600.210 - Terms of Council members.

    Science.gov (United States)

    2010-10-01

    ... 50 Wildlife and Fisheries 8 2010-10-01 2010-10-01 false Terms of Council members. 600.210 Section... Council members. Link to an amendment published at 75 FR 59151, Sept. 27, 2010. (a) Voting members (other.... A voting member's Council service of 18 months or more during a term of office will be counted as...

  6. 50 CFR 665.210 - Hawaii restricted bottomfish species.

    Science.gov (United States)

    2010-10-01

    ... 50 Wildlife and Fisheries 9 2010-10-01 2010-10-01 false Hawaii restricted bottomfish species. 665... Fisheries § 665.210 Hawaii restricted bottomfish species. Hawaii restricted bottomfish species means the following species: Local name English common name Scientific name lehi silver jaw jobfish Aphareus rutilans...

  7. 17 CFR 210.9-05 - Foreign activities.

    Science.gov (United States)

    2010-04-01

    ..., PUBLIC UTILITY HOLDING COMPANY ACT OF 1935, INVESTMENT COMPANY ACT OF 1940, INVESTMENT ADVISERS ACT OF 1940, AND ENERGY POLICY AND CONSERVATION ACT OF 1975 Bank Holding Companies § 210.9-05 Foreign... assets (net of valuation allowances) associated with foreign activities. (2) For each period for which an...

  8. 17 CFR 210.12-09 - Valuation and qualifying accounts.

    Science.gov (United States)

    2010-04-01

    ... 17 Commodity and Securities Exchanges 2 2010-04-01 2010-04-01 false Valuation and qualifying... EXCHANGE ACT OF 1934, PUBLIC UTILITY HOLDING COMPANY ACT OF 1935, INVESTMENT COMPANY ACT OF 1940... § 210.12-09 Valuation and qualifying accounts. Column A—Description 1 Column B—Balance at beginning of...

  9. 22 CFR 1203.735-210 - Gambling, betting, and lotteries.

    Science.gov (United States)

    2010-04-01

    ... 22 Foreign Relations 2 2010-04-01 2010-04-01 true Gambling, betting, and lotteries. 1203.735-210..., betting, and lotteries. An employee shall not participate, while on Government-owned or leased property or..., in conducting a lottery or pool, in a game for money or property, or in selling or purchasing a...

  10. 17 CFR 210.3-01 - Consolidated balance sheets.

    Science.gov (United States)

    2010-04-01

    ... AND CONTENT OF AND REQUIREMENTS FOR FINANCIAL STATEMENTS, SECURITIES ACT OF 1933, SECURITIES EXCHANGE... Statements § 210.3-01 Consolidated balance sheets. (a) There shall be filed, for the registrant and its... registrant's fiscal year and audited financial statements for the most recent fiscal year are not available...

  11. Synthesis, Characterization and Antibacterial Studies of N-(Benzothiazol-2-yl-4-chlorobenzenesulphonamide and Its Neodymium(III and Thallium(III Complexes

    Directory of Open Access Journals (Sweden)

    Lawrence Nnamdi Obasi

    2017-02-01

    Full Text Available N-(Benzothiazol-2-yl-4-chlorobenzenesulphonamide (NBTCS was synthesized by condensation reaction of 4-chlorobenzenesulphonyl chloride and 2-aminobenzothiazole in acetone under reflux. Neodymium(III and thallium(III complexes of the ligand were also synthesized. Both ligand and metal complexes were characterized using UV-Vis, IR, 1H- and 13C-NMR spectroscopies, elemental analysis and molar conductance measurement. IR studies revealed that the ligand is tridentate and coordinates to the metal ions through nitrogen and oxygen atoms of the sulphonamide group and nitrogen atom attached to benzothiazole ring. The neodymium(III complex displays a coordination number of eight while thallium(III complex displays a coordination number of six. The ligand and its complexes were screened in vitro for their antibacterial activities against Escherichia coli strains (E. coli 6 and E. coli 13, Proteus species, Staphylococcus aureus and Pseudomonas aeruginosa using the agar well diffusion technique. The synthesized compounds were found to be more active against the microorganisms screened relative to ciprofloxacin, gentamicin and co-trimoxazole.

  12. Comparative study of body surface isopotential map, left ventriculogram and thallium-201 myocardial scintigram in patients with old lateral myocardial infarction

    Energy Technology Data Exchange (ETDEWEB)

    Matsumoto, Naoyuki

    1988-01-01

    In 16 patients with old lateral myocardial infarction, body surface isopotential maps and 12 lead electrocardiograms were compared with left ventriculographic findings. In addition 8 of these subjects were performed thallium-201 myocardial scintigraphy in order to determine the location and extent of myocardial necrosis. Common 12 lead electrocardiographic findings of the subjects were initial Q waves more than 30 msec and inverted T waves in only aVL lead. The patients were classified into 4 groups according to the location and extent of ventricular wall motion abnormalities group I (6 cases) showed hypokinesis in the anterior segment, group II (5 cases): akinesis in the anterior segment and hypokinesis in the seg. 6, group III (4 cases): hypokinesis in the anterior segment and seg. 7, group IV (1 case): hypokinesis in the anterior segment and seg. 4, 7. And each of the 4 groups demonstrated characteristic findings of surface isopotential maps. Group II with coexisting hypokinesis in the seg. 6 showed surface isopotential maps additional pattern of anterior myocardial infarction, and group III with coexisting hypokinesis in the seg. 7 showed additional patterns of posterior myocardial infarction. The classification according to the abnormality of ventricular wall motion was also conformed with the thallium-201 myocardial scintigraphic findings except one case. These results suggest that body surface isopotential map is more useful than the 12 lead electrocardiogram in detecting the location and extent of left ventricular wall motion abnormality in patients with old lateral myocardial infarction. (author) 53 refs.

  13. Serial thallium-201 imaging at rest in patients with unstable and stable angina pectoris: relationship of myocardial perfusion at rest to presenting clinical syndrome

    Energy Technology Data Exchange (ETDEWEB)

    Brown, K.A.; Okada, R.D.; Boucher, C.A.; Phillips, H.R.; Strauss, H.W.; Pohost, G.M.

    1983-07-01

    In order to determine whether there are differences in myocardial perfusion at rest among patients with various unstable and stable angina syndromes, serial thallium-201 imaging was performed at rest in 19 patients presenting with rapidly worsening exertional angina (unstable angina, group A), 12 patients with rest angina alone without exertional symptoms (unstable angina, group B), and 34 patients with chronic stable angina. No patient had an episode of angina within 4 hours of study. Nineteen of 19 (100%) patients in group A demonstrated transient defects compared to only 3 of 12 (25%) patients in group B (p less than 0.0001) and 4 of 34 (12%) stable angina patients (p less than 0.0001). The majority of zones demonstrating transient defects in group A were associated with hypokinesis of the corresponding left ventriculogram segment without associated ECG evidence of previous infarction. There were no significant differences in the frequency of persistent thallium defects, severity of angiographic coronary artery disease, or frequency of regional wall motion abnormalities of myocardial segments supplied by stenotic coronary arteries among the three groups of patients. Transient defects have been shown to reflect reduction in regional coronary blood flow to viable myocardium. Therefore, we conclude that regional resting hypoperfusion of viable myocardium is far more common in patients with exertional unstable angina symptoms than in patients with rest angina alone or chronic stable angina.

  14. 210Po, 210Pb, 40K and 137Cs in edible wild berries and mushrooms and ingestion doses to man from high consumption rates of these wild foods.

    Science.gov (United States)

    Gwynn, Justin P; Nalbandyan, Anna; Rudolfsen, Geir

    2013-02-01

    This paper discusses activity concentrations of (210)Po, (210)Pb, (40)K and (137)Cs in edible wild berries and mushrooms collected from Øvre Dividalen national park, Northern Norway and derives committed effective ingestion doses to man based on high consumption rates of these wild foods. Edible wild berries and mushrooms accumulated similar levels of (210)Pb, but mushrooms accumulated higher levels of (210)Po and (40)K than berries. There appears to be a clear difference in the ability of Leccinum spp. of fungi to accumulate (210)Po and/or translocate (210)Po to mushrooms compared to Russula spp. of fungi. Activity concentrations of (137)Cs in edible wild berries and mushrooms from Øvre Dividalen national park reflected the lower levels of fallout of this radionuclide in Northern Norway compared to more central areas following the Chernobyl accident. For mushrooms, ingestion doses are dominated by (210)Po, while for berries, (40)K is typically the main contributor to dose. Based on high consumption rates, ingestion doses arising from the combination of (210)Po, (210)Pb and (40)K were up to 0.05 mSv/a for berries and 0.50 mSv/a for mushrooms. Consumption of such wild foods may result in a significant contribution to total annual doses when consumed in large quantities, particularly when selecting mushrooms species that accumulate high activity concentrations of (210)Po. Copyright © 2012 Elsevier Ltd. All rights reserved.

  15. Studies on the distribution of {sup 210}Po and {sup 210}Pb in the ecosystem of Point Calimere Coast (Palk Strait), India

    Energy Technology Data Exchange (ETDEWEB)

    Suriyanarayanan, S. [Environmental Research Lab, P.G. Department of Zoology, Jamal Mohamed College, Tiruchirappalli 620020, Tamil Nadu (India); Department of Environmental Sciences, Bharathiar University, Coimbatore 641046, Tamil Nadu (India); Brahmanandhan, G.M. [Solid State and Radiation Physics Laboratory, Department of Physics, Bharathiar University, Coimbatore 641046, Tamil Nadu (India)], E-mail: brahma_king@yahoo.com; Malathi, J. [Solid State and Radiation Physics Laboratory, Department of Physics, Bharathiar University, Coimbatore 641046, Tamil Nadu (India); Ravi Kumar, S.; Masilamani, V.; Shahul Hameed, P. [Environmental Research Lab, P.G. Department of Zoology, Jamal Mohamed College, Tiruchirappalli 620020, Tamil Nadu (India); Selvasekarapandian, S. [Solid State and Radiation Physics Laboratory, Department of Physics, Bharathiar University, Coimbatore 641046, Tamil Nadu (India)

    2008-04-15

    A systematic study on the natural radionuclides such as {sup 210}Po and {sup 210}Pb in the environmental matrices of Point Calimere ecosystem has been undertaken to establish a baseline data on the radiation profile of Point Calimere environment. The environmental samples such as water, sediment and biota (seaweeds, crustaceans, molluscs and fish) have been subjected to analyses. It has been observed that the concentration of {sup 210}Po and {sup 210}Pb in the water samples of Point Calimere to be 0.5 mBq/l and 1.3 mBq/l, respectively. The soft tissues of the organisms accumulated higher {sup 210}Po content while shells and bones contained more {sup 210}Pb. The bivalve molluscs Meretrix casta have been identified to accumulate higher concentration of {sup 210}Po suggesting that they could serve as bio-indicator of radionuclides like {sup 210}Po in the Point Calimere ecosystem. The concentration factor of {sup 210}Po for the biotic components ranged from {approx}10{sup 3} to 10{sup 6} while for {sup 210}Pb it ranged from {approx}10{sup 3} to 10{sup 5}.

  16. Biomonitoring of Po-210 and Pb-210 using lichens and mosses around a uraniferous coal-fired power plant in western Turkey

    Energy Technology Data Exchange (ETDEWEB)

    Ugur, A.; Ozden, B.; Sac, M.M.; Yener, G. [Ege University, Izmir (Turkey). Inst. of Nuclear Science

    2003-05-01

    Studies were realized over a wide area around the coal-fired power plant (CPP) located at Yatagan , Gokova, Turkey, to evaluate the possible increase of natural radioactivity level due to the operation of the plant. The lichens Rhizoplaca melanophthalma, Cladonia convoluta, Cladonia pyxidata and the mosses Grimmia pulvinata, Hypnum cupressiforme were investigated for potential use as bioindicators for Po-210 and Pb-210 deposition. The maximum Po-210 and Pb-210 activities were observed around the hill close to ash stacks. The capture efficiency was the highest in one of the moss species, G. pulvinata with the activity concentration ranges of 600 {+-} 19 - 1228 {+-} 36 and 446 {+-} 15 - 650 {+-} 21 Bq kg{sup -1} for Po-210 and Pb-210, respectively. Soil samples were also collected and analysed in order to investigate any possible contamination in soil profiles due to CPPs and to determine unsupported Pb-210 flux. The Pb-210 and Ra-226 concentrations in uncultivated soil profiles varied between 58 {+-} 2 and 258 {+-} 6 Bq kg{sup -1}, 50 {+-} 5 and 58 {+-} 5 Bq kg{sup -1}, respectively. The unsupported Pb-210 inventory in the core was calculated to be 3312 Bq m{sup 2}. The corresponding annual Pb-210 flux of 103 Bq m{sup -2} yr{sup -1} is high with compare to estimates of the atmospheric flux given in literature for the same region.

  17. Particle-reactive radionuclides (234Th, 210Pb, 210 as tracers for the estimation of export production in the South China Sea

    Directory of Open Access Journals (Sweden)

    P. H. Santschi

    2011-12-01

    Full Text Available The time-series station, SEATS (18° N, 116° E in the South China Sea was visited six times during October 2006–December 2008 to carry out seawater sampling and floating trap deployments for the determination of distributions and fluxes of POC, PIC, PN, 234Th, 210Pb, and 210Po in the upper 200 m of the water column. Radionuclide deficiencies resulted in removal fluxes from the euphotic layer of 1.1×103–1.8×103 dpm m−2d−1 and 7.1–40.2 dpm m−2d−1 for 234Th and 210Po, respectively. Due to atmospheric input, an excess of 210Pb relative to 226Ra is commonly observed in the upper water column. Sinking fluxes of total mass, POC, PIC, PN, 234Th, 210Pb, and 210Po measured at the euphotic depth were low in summer-fall and high in winter-spring, reflecting the seasonal variability of biological pumping. Excluding the suspiciously low primary productivity data point in July 2007, a relatively high e-ratio of 0.28–0.69 was estimated by the ratio of the POC flux at the euphotic depth and the integrated primary productivity. The ratios of 234Th, 210Pb, and 210Po to organic carbon, inorganic carbon, and nitrogen in the sinking particles were combined with the disequilibria of 234Th–238U, 210Pb–226Ra, and 210Po–210Pb to estimate export fluxes of POC, PIC, and PN from the euphotic layer. Compared with measured fluxes by the sediment trap and estimated fluxes by other approaches, it is concluded that the export production in the South China Sea, ranging from 1.8 to 21.3 mmol-C m−2d−1, can be reasonably estimated using 234Th, 210Pb, and 210Po as carbon proxies.

  18. 46 CFR 183.210 - Protection from wet and corrosive environments.

    Science.gov (United States)

    2010-10-01

    ... 46 Shipping 7 2010-10-01 2010-10-01 false Protection from wet and corrosive environments. 183.210... (UNDER 100 GROSS TONS) ELECTRICAL INSTALLATION General Requirements § 183.210 Protection from wet and... corrosion-resistant. ...

  19. 40 CFR 1068.210 - What are the provisions for exempting test engines/equipment?

    Science.gov (United States)

    2010-07-01

    ... CONTROL INFORMATION”. (ii) Your corporate name and trademark. (iii) Engine displacement, family... test engines/equipment? 1068.210 Section 1068.210 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) AIR POLLUTION CONTROLS GENERAL COMPLIANCE PROVISIONS FOR ENGINE PROGRAMS Exemptions...

  20. 210Po in Nevada groundwater and its relation to gross alpha radioactivity

    Science.gov (United States)

    Seiler, R.L.

    2011-01-01

    Polonium-210 (210Po) is a highly toxic alpha emitter that is rarely found in groundwater at activities exceeding 1 pCi/L. 210Po activities in 63 domestic and public-supply wells in Lahontan Valley in Churchill County in northern Nevada, United States, ranged from 0.01 ± 0.005 to 178 ± 16 pCi/L with a median activity of 2.88 pCi/L. Wells with high 210Po activities had low dissolved oxygen concentrations (less than 0.1 mg/L) and commonly had pH greater than 9. Lead-210 activities are low and aqueous 210Po is unsupported by 210Pb, indicating that the 210Po is mobilized from aquifer sediments. The only significant contributors to alpha particle activity in Lahontan Valley groundwater are 234/238U, 222Rn, and 210Po. Radon-222 activities were below 1000 pCi/L and were uncorrelated with 210Po activity. The only applicable drinking water standard for 210Po in the United States is the adjusted gross alpha radioactivity (GAR) standard of 15 pCi/L. 210Po was not volatile in a Nevada well, but volatile 210Po has been reported in a Florida well. Additional information on the volatility of 210Po is needed because GAR is an inappropriate method to screen for volatile radionuclides. About 25% of the samples had 210Po activities that exceed the level associated with a lifetime total cancer risk of 1× 10−4 (1.1 pCi/L) without exceeding the GAR standard. In cases where the 72-h GAR exceeds the uranium activity by more than 5 to 10 pCi/L, an analysis to rule out the presence of 210Po may be justified to protect human health even though the maximum contaminant level for adjusted GAR is not exceeded.

  1. 28 CFR 54.210 - Military and merchant marine educational institutions.

    Science.gov (United States)

    2010-07-01

    ... 28 Judicial Administration 2 2010-07-01 2010-07-01 false Military and merchant marine educational institutions. 54.210 Section 54.210 Judicial Administration DEPARTMENT OF JUSTICE (CONTINUED) NONDISCRIMINATION... Coverage § 54.210 Military and merchant marine educational institutions. These Title IX regulations do not...

  2. 17 CFR 210.8-06 - Real estate operations acquired or to be acquired.

    Science.gov (United States)

    2010-04-01

    ... 17 Commodity and Securities Exchanges 2 2010-04-01 2010-04-01 false Real estate operations acquired or to be acquired. 210.8-06 Section 210.8-06 Commodity and Securities Exchanges SECURITIES AND... Statements of Smaller Reporting Companies § 210.8-06 Real estate operations acquired or to be acquired. If...

  3. 17 CFR 210.2-05 - Examination of financial statements by more than one accountant.

    Science.gov (United States)

    2010-04-01

    ... statements by more than one accountant. 210.2-05 Section 210.2-05 Commodity and Securities Exchanges... Qualifications and Reports of Accountants § 210.2-05 Examination of financial statements by more than one accountant. If, with respect to the examination of the financial statements, part of the examination is made...

  4. 17 CFR 210.8-01 - Preliminary Notes to Article 8.

    Science.gov (United States)

    2010-04-01

    ... 17 Commodity and Securities Exchanges 2 2010-04-01 2010-04-01 false Preliminary Notes to Article 8... ADVISERS ACT OF 1940, AND ENERGY POLICY AND CONSERVATION ACT OF 1975 Article 8 Financial Statements of Smaller Reporting Companies § 210.8-01 Preliminary Notes to Article 8. Sections 210.8-01 to 210.8-08 shall...

  5. 20 CFR 404.210 - Average-indexed-monthly-earnings method.

    Science.gov (United States)

    2010-04-01

    ....210 Section 404.210 Employees' Benefits SOCIAL SECURITY ADMINISTRATION FEDERAL OLD-AGE, SURVIVORS AND DISABILITY INSURANCE (1950- ) Computing Primary Insurance Amounts Average-Indexed-Monthly-Earnings Method of Computing Primary Insurance Amounts § 404.210 Average-indexed-monthly-earnings method. (a) Who is eligible...

  6. 22 CFR 210.105 - Does this part apply to me?

    Science.gov (United States)

    2010-04-01

    ... 22 Foreign Relations 1 2010-04-01 2010-04-01 false Does this part apply to me? 210.105 Section 210.105 Foreign Relations AGENCY FOR INTERNATIONAL DEVELOPMENT GOVERNMENTWIDE REQUIREMENTS FOR DRUG-FREE WORKPLACE (FINANCIAL ASSISTANCE) Purpose and Coverage § 210.105 Does this part apply to me? (a) Portions of...

  7. 17 CFR 210.6A-04 - Statements of income and changes in plan equity.

    Science.gov (United States)

    2010-04-01

    ... changes in plan equity. 210.6A-04 Section 210.6A-04 Commodity and Securities Exchanges SECURITIES AND..., Savings and Similar Plans § 210.6A-04 Statements of income and changes in plan equity. Statements of income and changes in plan equity filed under this rule shall comply with the following provisions: 1...

  8. 17 CFR 210.3-14 - Special instructions for real estate operations to be acquired.

    Science.gov (United States)

    2010-04-01

    ... General Instructions As to Financial Statements § 210.3-14 Special instructions for real estate operations... 17 Commodity and Securities Exchanges 2 2010-04-01 2010-04-01 false Special instructions for real estate operations to be acquired. 210.3-14 Section 210.3-14 Commodity and Securities Exchanges SECURITIES...

  9. 17 CFR 210.12-28 - Real estate and accumulated depreciation. 1

    Science.gov (United States)

    2010-04-01

    ... depreciation. 1 210.12-28 Section 210.12-28 Commodity and Securities Exchanges SECURITIES AND EXCHANGE... § 210.12-28 Real estate and accumulated depreciation. 1 Column A—Description 2 Column B—Encumbrances... Land Buildings and improvements Total Column F—Accumulated depreciation Column G—Date of construction...

  10. 9 CFR 354.210 - Minimum standards for sanitation, facilities, and operating procedures in official plants.

    Science.gov (United States)

    2010-01-01

    ... 9 Animals and Animal Products 2 2010-01-01 2010-01-01 false Minimum standards for sanitation, facilities, and operating procedures in official plants. 354.210 Section 354.210 Animals and Animal Products... sanitation, facilities, and operating procedures in official plants. The provisions of §§ 354.210 to 354.247...

  11. 40 CFR 92.210 - Amending the application and certificate of conformity.

    Science.gov (United States)

    2010-07-01

    ... certificate of conformity. 92.210 Section 92.210 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY... Certification Provisions § 92.210 Amending the application and certificate of conformity. (a) The manufacturer... covered by a certificate of conformity. This notification must include a request to amend the application...

  12. 40 CFR 94.210 - Amending the application and certificate of conformity.

    Science.gov (United States)

    2010-07-01

    ... certificate of conformity. 94.210 Section 94.210 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY... Certification Provisions § 94.210 Amending the application and certificate of conformity. (a) The manufacturer... for certification are to be made to a product line covered by a certificate of conformity. This...

  13. 27 CFR 24.210 - Classes of wine other than standard wine.

    Science.gov (United States)

    2010-04-01

    ... 27 Alcohol, Tobacco Products and Firearms 1 2010-04-01 2010-04-01 false Classes of wine other than standard wine. 24.210 Section 24.210 Alcohol, Tobacco Products and Firearms ALCOHOL AND TOBACCO TAX AND TRADE BUREAU, DEPARTMENT OF THE TREASURY LIQUORS WINE Production of Other Than Standard Wine § 24.210...

  14. 25 CFR 171.210 - Where will BIA provide my irrigation service?

    Science.gov (United States)

    2010-04-01

    ... 25 Indians 1 2010-04-01 2010-04-01 false Where will BIA provide my irrigation service? 171.210 Section 171.210 Indians BUREAU OF INDIAN AFFAIRS, DEPARTMENT OF THE INTERIOR LAND AND WATER IRRIGATION OPERATION AND MAINTENANCE Irrigation Service § 171.210 Where will BIA provide my irrigation service? (a) We...

  15. 33 CFR 155.210 - Discharge removal equipment for vessels less than 400 feet in length.

    Science.gov (United States)

    2010-07-01

    ... vessels less than 400 feet in length. 155.210 Section 155.210 Navigation and Navigable Waters COAST GUARD... REGULATIONS FOR VESSELS Vessel Equipment § 155.210 Discharge removal equipment for vessels less than 400 feet in length. (a) Oil tankers and offshore oil barges with an overall length of less than 400 feet must...

  16. 210Po and 210Pb distribution, dissolved-particulate exchange rates, and particulate export along the North Atlantic US GEOTRACES GA03 section

    Science.gov (United States)

    Rigaud, S.; Stewart, G.; Baskaran, M.; Marsan, D.; Church, T.

    2015-06-01

    Vertical profiles of 210Po and 210Pb in the water column were measured in the dissolved phase (51 μm) particles at seven stations along the US GEOTRACES North Atlantic Zonal Transect (GA03). Mass balance calculations were employed to assess nuclide exchange rates at the dissolved-small particle interface and between small and large particles, and to quantify export with settling large particles. In the surface ocean, 210Po scavenging is linearly correlated with the concentration of particulate organic carbon (POC) in large particles, supporting the role of biogenic particle in 210Po bioaccumulation and export. In stations near the coast, this link is more complex due to the variable source of biogenic material and temporal changes in the surface biogeochemical and physical conditions. At depth, 210Po exhibits significant widespread deficit with respect to 210Pb that could in part be attributed to in situ 210Po scavenging and may be related to surface biological productivity. As previously reported the 210Pb scavenging rates in the surface ocean were higher at ocean margins. At depth, 210Pb scavenging increases with depth and eastward due to the increase of adsorption sites available in the benthic layers and to a regional contribution of benthic 210Pb scavenging and/or particle flux, respectively. The benthic nepheloid layer (BNL) and the Hydrothermal TAG plume distinctly enhance 210Pb scavenging due to increased surface adsorption in association with resuspended or freshly formed particles. In contrast, 210Po is not seen to be significantly scavenged in these environments due to its relatively short half-life and the long residence time of particles.

  17. Biomonitoring of {sup 210}Po and {sup 210}Pb using lichens and mosses around coal-fired power plants in Western Turkey

    Energy Technology Data Exchange (ETDEWEB)

    Sert, Emel, E-mail: emel.sert@mail.ege.edu.tr [Ege University, Institute of Nuclear Sciences, 35100 Bornova, Izmir (Turkey); Ugur, Aysun, E-mail: aysun.ugur@ege.edu.tr [Ege University, Institute of Nuclear Sciences, 35100 Bornova, Izmir (Turkey); Ozden, Banu, E-mail: banu.ozden@ege.edu.tr [Ege University, Institute of Nuclear Sciences, 35100 Bornova, Izmir (Turkey); Sac, Mueslim Murat, E-mail: muslum.murat.sac@ege.edu.tr [Ege University, Institute of Nuclear Sciences, 35100 Bornova, Izmir (Turkey); Camgoez, Berkay, E-mail: berkay.camgoz@ege.edu.tr [Ege University, Institute of Nuclear Sciences, 35100 Bornova, Izmir (Turkey)

    2011-06-15

    Mosses and lichens are useful biological indicators of environmental contamination for a variety of metals and radionuclides of both natural and artificial origin. These plants lack a well-developed root system and rely largely on atmospheric deposition for nourishment. Therefore in the study, different lichens (Cladonia convoluta, Cladonia foliacea) and mosses (Homalothecium sericeum, Hypnum lacunosum, Hypnum cupressiforme, Tortella tortuosa, Didymodon acutus, Syntrichia ruralis, Syntrichia intermedia, Pterogonium graciale, Isothecium alopecuroides, Pleurochatae squarrosa) were collected around the Yatagan (Mugla), Soma (Manisa), Seyitoemer - Tuncbilek (Kuetahya) coal-fired power plants and investigated for potential use as biomonitors for {sup 210}Po and {sup 210}Pb deposition. While the activity concentrations of {sup 210}Po and {sup 210}Pb in lichens are in the ranges of 151 {+-} 7-593 {+-} 21 and 97 {+-} 5-364 {+-} 13 Bq kg{sup -1}, for mosses the ranges for {sup 210}Po and {sup 210}Pb are 124 {+-} 5-1125 {+-} 38 and 113 {+-} 4-490 {+-} 17 Bq kg{sup -1}, respectively. In the study, the moss samples were observed to accumulate more {sup 210}Po and {sup 210}Pb compared to lichens. While the most suitable biomonitor was a moss species (H. lacunosum) for Yatagan (Mugla), it was another moss species (S. intermedia) for Soma (Manisa) and Seyitoemer - Tuncbilek (Kuetahya) sites. {sup 210}Po concentrations were found higher than {sup 210}Pb concentrations at the all sampling stations. - Highlights: > Lichens and mosses have been used as biomonitors of 210Po and 210Pb deposition. > The morphology of lichens and mosses does not vary with seasons. > Lichens and mosses retain and accumulate pollutants deposited from the atmosphere. > Canopy is an important factor causing differences in the concentrations of radionuclides.

  18. A record of atmospheric 210Pb accumulation in the industrial city

    CERN Document Server

    Buraeva, E A; Stasov, V V; Zorina, L V; Shramenko, B I

    2013-01-01

    The deposition flux of total atmospheric 210Pb in the industrial city Rostov-on-Don, Russia from 2002 to 2010 has been measured. The variations in annual 210Pb deposition flux appear to be mainly correlated with the number of rains and significant amount of anthropogenic 210Pb, polluted into the surface layer of air in the home-heating period. The average 210Pb deposition is 1.75 mBq/m3. Several meteorological parameters which are strongly associated with the fluctuations of concentrations of 210Pb are identified. These results are useful to provide typical information on the atmosphere radioactivity in an industrial city.

  19. Syndrome of diminished vasodilator reserve of the coronary microcirculation (microvascular angina or syndrome X): Diagnosis by combined atrial pacing and thallium 201 imaging--a case report

    Energy Technology Data Exchange (ETDEWEB)

    Magarian, G.J.; Palac, R.; Reinhart, S. (Veterans Administration Medical Center, Portland, OR (USA))

    1990-08-01

    Patients with angina-like chest pain without evidence of epicardial coronary artery disease or coronary arterial vasospasm are becoming increasingly recognized. These are often related to noncardiac causes including esophageal, musculoskeletal, and hyperventilatory or panic states. However, recently a subgroup of such patients are being recognized as having true myocardial ischemia and chest pain on the basis of diminished coronary microvascular vasodilatory reserve (microvascular ischemia or Syndrome X). The authors describe such a patient who was found to have replication of anginal pain associated with a reversible ischemic defect on thallium 201 imaging during atrial pacing, suggesting ischemia in this myocardial segment. Resolution of angina and ST segment electrocardiographic changes of ischemia occurred with cessation of pacing. We believe this is the first report of a patient with this form of myocardial ischemia diagnosed by this method and should be considered in patients with anginal chest pain after significant coronary artery disease and coronary vasospasm have been excluded.

  20. Determination of perfusion defect area in experimental myocardial infarction. A comparison between 201-thallium and sup 99m Tc methoxy-isobutyl-isonitril (MIBI)

    Energy Technology Data Exchange (ETDEWEB)

    Mueller, K.D.; Rohmann, S.; Bahavar, H.; Grebe, S.F.; Schaper, W.; Schlepper, M. (Kerckhoff-Klinik, Bad Nauheim (Germany))

    1991-08-01

    To assess the accuracy of two myocardial perfusion markers in quantifying defect size, the left anterior descending coronary artery (LAD) was occluded in 13 porcine hearts. Fourty minutes later 55 MBq {sup 201}TI and 370 MBq {sup 99m}Tc-MIBI were simultaneously injected i.v. in 10 animals. After injection and in vivo double nuclide SPECT acquisition, the risk area was demarcated with fluorescein (FI) dye in 5 animals. The in vitro defect area determined by {sup 201}TI was significant larger (15.8 {+-} 27%) than those of {sup 99m}Tc-MIBI, while FI compared to Tc showed no statistical difference. Thus, in a pig model Tc-MIBI was more accurate with ex vivo imaging. With SPECT thallium imaging defect size was overestimated. In vivo there was a distinct trend with Tc-MIBI studies to underestimate the defect size up to 16%. (orig.).

  1. High thallium content in rocks associated with Au-As-Hg-Tl and coal mineralization and its adverse environmental potential in SW Guizhou, China

    Energy Technology Data Exchange (ETDEWEB)

    Xiao, T.F.; Guha, J.; Boyle, D. [Chinese Academy of Science, Guiyang (China)

    2004-08-15

    This study is focused on high concentrations of Tl in rocks in SW Guizhou, China, that are related to several widely scattered disseminated gold-mercury-arsenic and coal deposits, and a primary Tl deposit within an Au-As-Hg-Tl metallogenic belt of the Huijiabao anticline. The Tl, Hg and As in the Lanmuchang Hg-Tl deposit area are associated with the abundant occurrence of sulfide minerals such as lorandite, realgar, orpiment and cinnabar. Concentrations of Tl range from 100 to 35 000 ppm in sulfide ores, and 39-490 ppm in host rocks. The enrichment of Au, Tl, Hg, As, and Sb in the Yanshang gold mineralized area reflects the occurrence of Au mineralization and its mineral assemblage of Tl-Hg-As-Sb sulfides. Thallium ranges from 0.22 to 16 ppm in Au ores and host rocks. Thallium in coals is enriched up to 46 ppm within the Au-As-Hg-TI metallogenic belt, and is derived from the regional Au-As-Hg-Tl mineralization. Mercury and As show a similar distribution to Tl with high concentrations in sulfide ores, coals and host rocks. Human populations living near and downstream of Tl deposits and Tl-bearing ore deposits are susceptible to Tl contamination because of its high toxicity and high uptake rate by crops. The dispersion of Tl, Hg and As associated with the primary mineralization of Au-As-Hg-TI can be traced through physical erosion and chemical weathering, producing secondary dispersion into sods, groundwater and surface water and crops. Mining activities compound the natural processes, readily dispersing Tl into the surface environment.

  2. Functional significance of myocardial perfusion defects induced by dipyridamole using thallium-201 single-photon emission computed tomography and two-dimensional echocardiography

    Energy Technology Data Exchange (ETDEWEB)

    Jain, A.; Suarez, J.; Mahmarian, J.J.; Zoghbi, W.A.; Quinones, M.A.; Verani, M.S. (Baylor College of Medicine, Houston, TX (USA))

    1990-10-01

    The mechanisms responsible for inhomogeneous myocardial blood flow after oral administration of a large dose (300 mg) of dipyridamole were assessed in 27 patients with serial thallium-201 single-photon emission computed tomography (SPECT) and simultaneous 2-dimensional echocardiograms. Myocardial tomographic images were obtained 50 minutes and 3 to 4 hours after administration of dipyridamole. Two-dimensional echocardiograms were recorded at baseline and then every 15 minutes for 60 minutes. Dipyridamole caused only a mild reduction in blood pressure (from 129 +/- 18 to 126 +/- 16 mm Hg) and a mild increase in heart rate (from 69 +/- 15 to 73 +/- 4 beats/min). Sixteen patients had perfusion defects after dipyridamole by SPECT, which underwent partial or total filling-in. Fourteen of these patients (87.5%) had either a new abnormality or further deterioration of a preexisting wall motion abnormality by 2-dimensional echocardiography, and thus were considered to have developed transient ischemia during dipyridamole administration. Ten of 11 patients (91%) with normal perfusion or fixed defects by SPECT had no further deterioration in wall motion after oral dipyridamole, and were thus considered to have no evidence of myocardial ischemia. In conclusion, most patients with transient thallium-201 defects after dipyridamole develop transient worsening of resting wall motion by 2-dimensional echocardiography, suggestive of true myocardial ischemia. Because myocardial oxygen demand, as indicated by the heart rate-blood pressure product, did not change significantly, the mechanism of myocardial ischemia in these patients is likely to be diminished regional blood flow related to a subendocardial steal induced by dipyridamole.

  3. 210Po concentration analysis on tobacco and cigarettes in Malaysia

    Science.gov (United States)

    Azman, Muhammad Azfar; Rahman, Irman Abdul; Yasir, Muhammad Samudi

    2013-05-01

    Tobacco or better known as the cigarette was smoked since ages. Although many efforts had been made by the Ministry of Health to prevent or reduce the cigarette problem, the smokers still consider that cigarette are not harmful to health. This work is conducted to study the concentration of radionuclides alpha in tobacco and tobacco products in Malaysia. The radionuclide sought in this study is 210Po which is an alpha emitter. The sample used are tobacco and cigarettes, the tobacco samples were taken from tobacco farms in Malaysia while the sample branded cigarettes Marlboro and Gudang Garam were bought in the supermarket. The objectives of this study are to determine the concentration of radionuclides 210Po in tobacco and tobacco products as well as to estimate the radioactivity doses contributing to the smokers in Malaysia. The results for Marlboro cigarettes and Gudang Garam were found to be on the average radionuclide concentration of 210Po is 13.3 mBq/g (Marlboro cigarettes) and 11.9 mBq/g (Gudang Garam). From the total concentration of the cigarette, the estimated annual contribution dose to smokers for every 20 cigarettes smoked per day are 111.9 ± 14.7 μSv/year for Marlboro cigarettes and 100.2 ± 3.3 μSv/year for Gudang Garam cigarettes. The average concentration of radionuclides for tobacco leaf tobacco for each area taken is 3.6 mBq / g for Bachok, 2.4 mBq / g for Tumpat and 3.1 mBq / g for Semerak district.

  4. Polonium-210 and lead-210 in the Southern Polar Ocean: Naturally occurring tracers of biological and hydrographical processes in the surface waters of the Antarctic Circumpolar Current and the Weddell Sea; Polonium-210 und Blei-210 im Suedpolarmeer: Natuerliche Tracer fuer biologische und hydrographische Prozesse im Oberflaechenwasser des Antarktischen Zirkumpolarstroms und des Weddellmeeres

    Energy Technology Data Exchange (ETDEWEB)

    Friedrich, J.

    1997-11-01

    In this thesis the distribution of {sup 210}Po and {sup 210}Pb in the upper 600 m of the Antarctic Circumpolar Current and the Weddell Sea was investigated along north-south transects in austral spring and autumn. {sup 210}Po and {sup 210}Pb can serve as sensitive tracers for the special hydrographic conditions of the Antarctic Circumpolar Current and the Weddell Sea as well as for biological processes during phytoplankton blooms. The {sup 210}Po/{sup 210}Pb disequilibrium was used as a tracer for particle export. This tracer integrates export on a timescale of 276 days because of the 138 day half-life of {sup 210}Po and complements the {sup 234}Th/{sup 238}U disequilibrium as another tracer for plankton production and export on a shorter timescale of several weeks. (orig.) [Deutsch] In der vorliegenden Arbeit wurde die Verteilung von Blei-210 und seinem Enkelnuklid Polonium-210 im Antarktischen Zirkumpolarstrom und im Weddellmeer bis 600 m Tiefe in mehreren meridionalen Transekten im australen Fruehjahr und Herbst waehrend der `Polarstern`-Expeditionen ANT-X/6 und ANT-XI/4 untersucht. Die Verteilung von {sup 210}Pb und {sup 210}Po wird von mehreren Faktoren beeinflusst, sowohl durch die Advektion von Wassermassen im Antarktischen Zirkumpolarstrom und im Weddellmeer als auch von biologischen Prozessen z.B. innerhalb einer Planktonbluete. Bevor die Verteilungsmuster von {sup 210}Pb und {sup 210}Po jedoch als Tracer fuer einen Prozess genutzt werden koennen, muss der Effekt der einzelnen Faktoren auf die Verteilung betrachtet werden. (orig.)

  5. Distribution of some chemical elements between dissolved and particulate phases in the ocean. Research period: August 1, 1975--July 31, 1976. [Fallout /sup 210/Po and /sup 210/Pb diffusion in oceans

    Energy Technology Data Exchange (ETDEWEB)

    1976-01-01

    Progress is reported on studies on the distributions of fallout /sup 210/Pb and /sup 210/Po in dissolved and particulate states in the Gulf of Maine and a transect of the equatorial North Atlantic Ocean. The ratio of /sup 210/Pb//sup 226/Ra and /sup 210/Po//sup 210/Pb in seawater and suspended particulate matter in samples collected from 10 stations in the tropical and eastern North Atlantic and two stations in the Pacific was also determined. (CH)

  6. Particle-reactive radionuclides ({sup 234}Th, {sup 210}Pb, {sup 210}Po) as tracers for the estimation of export production in the South China Sea

    Energy Technology Data Exchange (ETDEWEB)

    Wei, C.L.; Lin, S.Y.; Yi, M.C.; Wen, L.S. [National Taiwan Univ., Taipei (China). Inst. of Oceanography; Sheu, D.D.D. [National Sun Yat-sen Univ., Kaohsiung, Taiwan (China). Inst. of Marine Geology and Chemistry; Chou, W.C. [National Taiwan Ocean Univ., Keelung (China). Inst. of Marine Environmental Chemistry and Ecology; Santschi, P.H. [Texas A and M Univ., Galveston, TX (United States). Dept. of Oceanography and Marine Sciences

    2011-07-01

    The time-series station, SEATS (18 N, 116 E) in the South China Sea was visited six times during October 2006-December 2008 to carry out seawater sampling and floating trap deployments for the determination of distributions and fluxes of POC, PIC, PN, {sup 234}Th, {sup 210}Pb, and {sup 210}Po in the upper 200 m of the water column. Radionuclide deficiencies resulted in removal fluxes from the euphotic layer of 1.1 x 10{sup 3}-1.8 x 10{sup 3} dpm m{sup -2}d{sup -1} and 7.1-40.2 dpm m{sup -2}d{sup -1} for {sup 234}Th and {sup 210}Po, respectively. Due to atmospheric input, an excess of {sup 210}Pb relative to {sup 226}Ra is commonly observed in the upper water column. Sinking fluxes of total mass, POC, PIC, PN, {sup 234}Th, {sup 210}Pb, and {sup 210}Po measured at the euphotic depth were low in summer-fall and high in winter-spring, reflecting the seasonal variability of biological pumping. Excluding the suspiciously low primary productivity data point in July 2007, a relatively high e-ratio of 0.28-0.69 was estimated by the ratio of the POC flux at the euphotic depth and the integrated primary productivity. The ratios of {sup 234}Th, {sup 210}Pb, and {sup 210}Po to organic carbon, inorganic carbon, and nitrogen in the sinking particles were combined with the disequilibria of {sup 234}Th-{sup 238}U, {sup 210}Pb-{sup 226}Ra, and {sup 210}Po-{sup 210}Pb to estimate export fluxes of POC, PIC, and PN from the euphotic layer. Compared with measured fluxes by the sediment trap and estimated fluxes by other approaches, it is concluded that the export production in the South China Sea, ranging from 1.8 to 21.3 mmol-C m{sup -2}d{sup -1}, can be reasonably estimated using {sup 234}Th, {sup 210}Pb, and {sup 210}Po as carbon proxies.

  7. Transfer of {sup 40}K, {sup 238}U, {sup 210}Pb, and {sup 210}Po from soil to plant in various locations in south of Syria

    Energy Technology Data Exchange (ETDEWEB)

    Al-Masri, M.S. [Atomic Energy Commission of Syria, Damascus, P.O. Box 6091 (Syrian Arab Republic)], E-mail: scientific1@aec.org.sy; Al-Akel, B.; Nashawani, A.; Amin, Y.; Khalifa, K.H.; Al-Ain, F. [Atomic Energy Commission of Syria, Damascus, P.O. Box 6091 (Syrian Arab Republic)

    2008-02-15

    Transfer factors of {sup 40}K, {sup 238}U, {sup 210}Pb, and {sup 210}Po from soil to some agriculture crops in various locations in south of Syria (Dara'a and Assuwaydaa districts) have been determined. Soil and vegetable crops (green pepper, cucumber, tomato, and eggplant), legumes crops (lentil, chickpea, and broad bean), fruit trees (apple, grape, and olives) and cereals (barley and wheat) were collected and analyzed for {sup 238}U, {sup 210}Pb, and {sup 210}Po. The results have shown that higher transfer factors (calculated as Bq kg{sup -1} dry wt. plant material per Bq kg{sup -1} dry wt. soil) for {sup 210}Po, {sup 210}Pb and {sup 238}U were observed in vegetable leaves than fruits and cereals leaves; the highest values of transfer factor (TF) for {sup 238}U were found to be 0.1 for straw of chickpea. Transfer factors for {sup 210}Po varied between 2.8 x 10{sup -2} and 2 in fruits of eggplant and grain of barley, respectively. In addition, several parameters affecting transfer factors of the radionuclides were evaluated. The results can be considered as base values for TF of natural radionuclides in the region.

  8. Administration of microRNA-210 promotes spinal cord regeneration in mice.

    Science.gov (United States)

    Ujigo, Satoshi; Kamei, Naosuke; Hadoush, Hikmat; Fujioka, Yuki; Miyaki, Shigeru; Nakasa, Tomoyuki; Tanaka, Nobuhiro; Nakanishi, Kazuyoshi; Eguchi, Akiko; Sunagawa, Toru; Ochi, Mitsuo

    2014-06-15

    Experimental animal study of treatment of spinal cord injury (SCI). To investigate the therapeutic effects of administering microRNA-210 (miR-210) to promote angiogenesis in a mouse SCI model. Despite many previous studies regarding SCI, there is no established treatment in clinical practice. miRNAs have attracted immense attention because of their crucial role in human disease, and they have been proposed as potential new therapeutic targets for SCI. At specific times after administration, mice were analyzed by several methods to examine the distribution of miR-210, histological angiogenesis and neurogenesis, functional recovery from SCI, and the expression levels of target genes of miR-210. After injection of miR-210 into the lesion of the injured spinal cord, expression of endogenous miR-210 increased until 6 days after injection. The administration of miR-210 promoted angiogenesis and astrogliosis, and improved functional recovery after SCI compared with the noninjected controls. Furthermore, the area made up of axons and myelin in the spinal cord tissues caudal to the injury site was larger in mice injected with miR-210 than those of the controls. Apoptotic cell death was lower in mice administered miR-210. After administration of miR-210, the expressions of protein-tyrosine phosphate 1B and ephrin-A3, both gene targets of miR-210, were downregulated at the protein level and protein-tyrosine phosphate 1B expression was also downregulated at the transcriptional level. MiR-210 might contribute to spinal cord repair by promoting angiogenesis via the inhibition of protein-tyrosine phosphate 1B and ephrin-A3. N/A.

  9. Analysis of {sup 210}Pb in water samples with plastic scintillation resins

    Energy Technology Data Exchange (ETDEWEB)

    Lluch, E.; Barrera, J. [Department of Analytical Chemistry, University of Barcelona, Martí i Franqués, 1-11, E-08028, Barcelona (Spain); Tarancón, A., E-mail: alex.tarancon@ub.edu [Department of Analytical Chemistry, University of Barcelona, Martí i Franqués, 1-11, E-08028, Barcelona (Spain); Bagán, H. [Department of Pure and Applied Biochemistry, Lund University, Getingevägen 60, Hus II, 22100 SE, Lund (Sweden); García, J.F. [Department of Analytical Chemistry, University of Barcelona, Martí i Franqués, 1-11, E-08028, Barcelona (Spain)

    2016-10-12

    {sup 210}Pb is a radioactive lead isotope present in the environment as member of the {sup 238}U decay chain. Since it is a relatively long-lived radionuclide (T{sub 1/2} = 22.2 years), its analysis is of interest in radiation protection and the geochronology of sediments and artwork. Here, we present a method for analysing {sup 210}Pb using plastic scintillation resins (PSresins) packaged in solid-phase extraction columns (SPE cartridge). The advantages of this method are its selectivity, the low limit of detection, as well as reductions in the amount of time and reagents required for analysis and the quantity of waste generated. The PSresins used in this study were composed of a selective extractant (4′,4″(5″)-Di-tert-butyldicyclohexano-18-crown-6 in 1-octanol) covering the surface of plastic scintillation microspheres. Once the amount of extractant (1:1/4) and medium of separation (2 M HNO{sub 3}) were optimised, PSresins in SPE cartridges were calibrated with a standard solution of {sup 210}Pb. {sup 210}Pb could be fully separated from its daughters, {sup 210}Bi and {sup 210}Po, with a recovery value of 91(3)% and detection efficiency of 44(3)%. Three spiked water samples (one underground and two river water samples) were analysed in triplicates with deviations lower than 10%, demonstrating the validity of the PS resin method for {sup 210}Pb analysis. - Highlights: • A plastic scintillation resin for selective analysis of {sup 210}Pb has been developed. • A commercial SPE cartridge has been use for separation and scintillation counting. • {sup 210}Pb separation from {sup 210}Bi and {sup 210}Po is achieved with a 91(3)% of recovery. • The method is valid for analysis of {sup 210}Pb in river water samples.

  10. Partitioning and Fractionation of 210Pb, 210Po and 7Be During Their Interactions With Inorganic and Organic Nanoparticles in Seawater

    Science.gov (United States)

    Guo, L.; Yang, W.; Chuang, C.; Santschi, P. H.; Schumann, D.; Ayranov, M.

    2012-12-01

    Controlled laboratory experiments were carried out to examine the role of natural organic matter in regulating the partitioning and fractionation of particle-reactive radionuclides 210Pb(II), 210Po(-II, II, IV) and 7Be(II) during their interactions with colloidal or nanoparticles in seawater. Selected nanoparticles with similar sizes (20 nm), including SiO2, CaCO3, Al2O3, TiO2, and Fe2O3, and macromolecular organic matter including humic acids (HA), acid polysaccharides (APS, carrageenan type V), proteins (bovine serum albumin, BSA), and extracellular polymeric substances (EPS) were used to examine the partition coefficients (Kd) of 210Pb, 210Po and 7Be between dissolved and colloidal phases in the treatment, with 1-2 orders of magnitude difference in Kd values following the order of Po > Pb > Be. For inorganic nanoparticles, SiO2 and CaCO3 had lower affinity for both 210Po and 210Pb, while TiO2 or Fe2O3 had the highest affinity for 210Pb with an overall high Kd value. Fe2O3 also had the highest affinity for 7Be with a Kd value 400 times higher than that of CaCO3. In binary systems with both inorganic and organic nanoparticles, except for Fe2O3, the Kd values for 210Pb, 210Po and 7Be all increased by varying degrees compared to pure inorganic sorbents, implying that the interactions between organic and inorganic particles in most cases promote stronger sorption of these nuclides on nanoparticles. In contrast, experimental treatments with Fe2O3 and model organic compounds decreased the Kd values for 210Pb and 7Be, suggesting the coating of organic matter on high affinity sorbents would depress the sorption of trace elements on nanoparticle surfaces. These results highlight the importance of chemical composition and functionalities in the scavenging and fractionation of 210Pb, 210Po and 7Be in marine environments.

  11. Geochemistry of /sup 210/Pb in the southeastern, US estuarine system

    Energy Technology Data Exchange (ETDEWEB)

    Storti, F.W.

    1980-11-01

    This study was an attempt to determine the geochemical behavior of /sup 210/Pb in southeastern salt marsh estuaries. As a part of this study the /sup 210/Pb dating technique was applied to natural and anthropogenic deposits of the region. /sup 210/Pb activity of sediment and water from the Georgia coastal area was measured by alpha spectroscopy. The effects of grain size and carbon content of the sediment on /sup 210/Pb concentrations was evaluated and the activity of /sup 210/Pb in dissolved and particulate phases of rivers was measured as a function of salinity. Ages and sedimentation rates of sedimentary deposits were also determined for some deposits. /sup 210/Pb activity in dissolved and particulate phases of rivers showed no clear trends as functions of salinity. River particulate activities were three to four times higher than dissolved activities. The relationship between /sup 210/Pb activity in salt marsh sediments and grain size was highly significant. Direct application of the /sup 210/Pb method to date and determine sedimentation rates of natural and anthropogenic deposits was partially successful. The anthropogenic deposits, however, had to be dated on the basis of normalizing /sup 210/Pb activities to grain size (% silt and clay) and carbon content (% carbon).

  12. Annual effective dose of {sup 210}Po from sea food origin (Oysters and Mussels) in Korea

    Energy Technology Data Exchange (ETDEWEB)

    Cho, Bo Eum; Hong, Gi Hoon; Kim, Suk Hyun; Lee, Hyun Mi [Korea Institute of Ocean Science and Technology, Ansan (Korea, Republic of)

    2016-09-15

    Ingestion of {sup 210}Po laden seafood accounts for a substantial amount of the effective dose of {sup 210}Po. Among seafood items, mollusks, especially domestically produced oysters and mussels, are highly enriched in {sup 210}Po and are consumed in large quantities in Korea. Oysters and mussels around the Korean coasts were collected from major farm areas in November 2013. Samples were spiked with an aliquot of {sup 210}Po as a yield tracer, and they were digested with 6 mol·L{sup -1} HNO{sub 3} and H{sub 2}O{sub 2}. The {sup 210}Po and {sup 209}Po were spontaneously deposited onto a silver disc in an acidic solution of 0.5 mol·L{sup -1} HCl and measured using an alpha spectrometer. The activity concentrations of {sup 210}Pb and {sup 210}Po were decay corrected to the sampling date, accounting for the possible in-growth and decay of {sup 210}Po. {sup 210}Po activity concentrations in oysters were in a range from 41.3 to 206 Bq·(kg-ww{sup -1} and mussels in a range from 42.9 to 46.7 Bq·(kg-ww){sup -1}. The {sup 210}Po activity concentration of oysters in the turbid Western coast was higher than the Southern coast. The {sup 210}Po activity concentration of the oysters was positively correlated (R2=0.89) with those of the suspended particulate matter in the surface water. The calculated annual effective dose of {sup 210}Po from oysters and mussels consumed by the Korean population was 21-104 and 5.01-5.46 μSv·y{sup -1}. The combined effective dose due to the consumption of oysters and mussels appears to account for about 35±19% of that arising from seafood consumption in the Korean population. The annual effective dose of {sup 210}Po for oysters in the Korean population was found to be higher than other countries. The total annual effective dose of 210Po{sup 210}Po due to consumption of oysters and mussels consumed in Korea was found to be 76±42 μSv·y{sup -1}, accounting for 28±16% of the total effective dose of {sup 210}Po from food in Korea.

  13. Behavior of Po-210 in molten Pb-17Li

    Energy Technology Data Exchange (ETDEWEB)

    Feuerstein, H.; Oschinski, J.; Horn, S. (Kernforschungszentrum Karlsruhe GmbH (Germany). Hauptabt. Ingenieurtechnik)

    1992-09-01

    The behavior of Po-210 in molten Pb-17Li was investigated in evaporation experiments. It was found that polonium evaporates in form of an intermetallic compound PbPo. Because of the low vapor pressure of this polonide, evaporation rates are small. The activity coefficient for Po in Pb-17Li is given by 1n [gamma] = -4.77-(1329/T). Under conditions of a fusion reactor blanket with helium as cover gas, the evaporating fraction will be 10[sup 6] times smaller than that estimated assuming ideal solution and vacuum. In agreement with observations at a Bi-inpile loop, only a very small fraction of the total polonium will be found in cover gas spaces. (orig.).

  14. CPLOAS_2 V2.10 verification report.

    Energy Technology Data Exchange (ETDEWEB)

    Groth, Katrina M. [Sandia National Lab. (SNL-NM), Albuquerque, NM (United States)

    2014-07-01

    A series of test cases designed to verify the correct implementation of several features of the CPLOAS_2 program are documented. CPLOAS_2 is used to calculate the probability of loss of assured safety (PLOAS) for a weak link (WL)/strong link (SL) system. CPLOAS_2 takes physical properties (e.g., temperature, pressure, etc.) of a WL/SL system and uses these properties and definitions of link failure properties in probabilistic calculations to determine PLOAS. The features being tested include (i) six aleatory distribution forms, (ii) five numerical procedures for the determination of PLOAS (i.e., one quadrature procedure, two simple random sampling procedures, and two importance sampling procedures), and (iii) time and environmental margin calculations. All tests were performed with CPLOAS_2 version 2.10.

  15. MD210 Note: Creation of Hollow Bunches in the PSB

    CERN Document Server

    Oeftiger, Adrian; Findlay, Alan James; Hancock, Steven; Rumolo, Giovanni; CERN. Geneva. ATS Department

    2016-01-01

    MD210 aims for the creation of longitudinally hollow bunches in the CERN PS Booster. The first three sessions have been carried out using the radial loop feedback system in order to drive the beam on a dipolar parametric resonance (instead of the phase loop). It has been found that the damping by the phase loop inhibits the excitation of the resonance to a major extent. The hollow distributions generated under these circumstances fail to reach a satisfying bunching factor. Nonetheless, proving the principally successful application of this technique to the PS Booster promises good results once the phase loop system supports trim functions. The approach, actions and detailed results of the first three MD sessions are presented in this paper.

  16. Baseline concentration of {sup 210}Po in Sargassum from the Northern Gulf

    Energy Technology Data Exchange (ETDEWEB)

    Uddin, S.; Bebhehani, M.; Talebi, L. [Kuwait Institute for Scientific Research (Kuwait)

    2014-07-01

    The concentration of the {sup 210}Po is of enormous interest because of its large contribution to the natural radiation dose received by marine organisms and human populations consuming seafood. In fact natural {sup 210}Po is responsible for higher radiation doses to humans consuming marine products than is plutonium and other man-made radionuclides. Many marine organisms are capable of concentrating {sup 210}Po in their tissues. {sup 210}Po is an alpha emitter in the {sup 238}U series, with 138-d half-life, that is supplied to seawater from atmospheric inputs and river runoff, however, the main source of {sup 210}Po in the environment is {sup 222}Rn exhalation from the ground. Assessing the impact of radionuclides in the environment requires the establishment of baseline levels in the environmental compartments. The objective of this study was to establish baseline levels in Sargassum. Two most common species of Sargassum found in the northern Gulf were analysed for {sup 210}Po. These macro-algae were collected from three different locations during January 2013. This study sets the baseline for {sup 210}Po concentration in northern Gulf, {sup 210}Po is absorbed from water and concentrated by Phytoplankton and macro-algae. This concentrated {sup 210}Po can then be passed along to the next trophic level of the marine food web. The {sup 210}Po concentration measured in Sargassum boveanum (4.405 - 4.952 BqKg{sup -1}) was significantly higher (p>0.084) than Sargassum oligocystum (3.838 - 4.358 BqKg{sup -1}). The {sup 210}Po concentration in these seaweeds from the Arabian/Persian Gulf were substantially lower than those found in various Phytoplankton and macro-algae species from other regions; this may be due to the lower background {sup 210}Po concentration in the Kuwait marine waters (0.282 - 0.382 mBq l{sup -1}). The {sup 210}Po concentrations in seawater measured at the 3 stations during January 2013 were less than those reported previously from the same region

  17. Polonium-210 and lead-210 in food and tobacco products: a review of parameters and an estimate of potential exposure and dose

    Energy Technology Data Exchange (ETDEWEB)

    Watson, A.P.

    1983-07-01

    Food-chain transport of Pb-210 and Po-210 from soil to edible plant parts and from animal feed to meat and milk were evaluated from a review of literature. The degree of transfer was characterized by estimating concentration factors (unweighted arithmetic means) as well as the transfer coefficients B/sub v/, B/sub r/ (unweighted geometric means, f/sub m/ and f/sub f/ (unweighted arithmetic means). Global dietary intake of Pb-210 and Po-210 was also summarized, and 50-year dose estimates to target organs calculated. The greatest estimated ingestion doses were those to populations with large dietary complements of animal protein in the form of seafood (Japan) or caribou/reindeer muscle and organ meats (Arctic Eskimos and Lapps). The magnitude of this latter source illustrates the importance of simple food chains in generating significant exposures to populations dependent upon them. The origin and magnitude of inhalation exposure and dose from tobacco products was also assessed. For the majority of internal organs evaluated, the dose resulting from smoking commercially available tobacco products is comparable to or greater than the dose estimates for ingestion of naturally occurring dietary Pb-210 and Po-210.

  18. Effects of Potassium-Channel Opener on Thallium-201 Kinetics: In-vitro Study in Rat Myocyte Preparations and In-vivo Mice Biodistribution Study

    Energy Technology Data Exchange (ETDEWEB)

    Lee, Jae Tae; Kim, Eun Ji; Ahn, Byeong Cheol; Son, Kang Kyun; Lee, Kyu Bo [Kyungpook National University School of Medicine, Taegu (Korea, Republic of); Ha, Jeoung Hee [Youngnam University Medical School, Taegu (Korea, Republic of); Kim, Chun Ki [Mt. Sinai School of Medicine, New York (United States)

    1996-10-15

    Potassium channel opener (K-opener) opens ATP-sensitive K{sup +}-channel located at membrane and induces potassium efflux from cytosol, resulting in intracellular hyperpolarization. Newly synthesized K-opener is currently examined for pharmacologic potency by means of rubidium release test from smooth muscle strip preincubated with Rb-86. Since in-vive behavior of thallium is similar to that of rubidium, we hypothesized that K-opener can alter T1-201 kinetics in vivo. This study was prepared to investigate the effects of pinacidil (one of potent K-openers) on the T1-201 uptake and clearance in cultured myocyte, and in-vivo biodistribution in mice. Spontaneous contracting myocytes were prepared to imitate in-vivo condition from 20 hearts of 3-5 days old Sprague-Dawley rat and cultured for 3-5 days before use (5 X 105 cells/ml). Pinacidil was dissolved in 10% DMSO solution at a final concentration of 100nM or 10uM and was co-incubated with T1-201 in HBSS buffer for 20-min to evaluate its effect on cellular T1-uptake, or challenged to cell preparation pre-incubated with T1-201 for washout study. Two, 40 or 100 mg of pinacidil was injected intravenously into ICR mice at 10 min after 5 muCi T1-201 injection, and organ uptake and whole body retention rate were measured at different time points. Co-incubation of pinacidil with T1-201 resulted in a decrease in T1-201 uptake into cultured myocyte by 1.6 to 2.5 times, depending on pinacidil concentration and activity of T1-201 used. Pinacidil enhanced T1-201 washout by 1.6-3.1 times from myocyte preparations pre-incubated with T1-201. Pinacidil treatment appears to be resulted in mild decreases in blood and liver activity in normal mice, in contrast, renal and cardiac uptake were mildly decreased in a dose dependent manner. Whole body retention ratios of T1-201 were lower at 24 hour after injection with 100 mg of pinacidil than control. These results suggest that treatment with K-opener may affect the interpretation of T1

  19. 17 CFR 210.6-03 - Special rules of general application to registered investment companies.

    Science.gov (United States)

    2010-04-01

    ... application to registered investment companies. 210.6-03 Section 210.6-03 Commodity and Securities Exchanges... ACT OF 1933, SECURITIES EXCHANGE ACT OF 1934, PUBLIC UTILITY HOLDING COMPANY ACT OF 1935, INVESTMENT COMPANY ACT OF 1940, INVESTMENT ADVISERS ACT OF 1940, AND ENERGY POLICY AND CONSERVATION ACT OF 1975...

  20. 9 CFR 205.210 - Effect of EFS outside State in which filed.

    Science.gov (United States)

    2010-01-01

    ... 9 Animals and Animal Products 2 2010-01-01 2010-01-01 false Effect of EFS outside State in which filed. 205.210 Section 205.210 Animals and Animal Products GRAIN INSPECTION, PACKERS AND STOCKYARDS... system subject to the security interest in that product whether or not they know about it, even if they...

  1. 30 CFR 210.353 - Monthly report of sales and royalty.

    Science.gov (United States)

    2010-07-01

    ... MANAGEMENT FORMS AND REPORTS Geothermal Resources § 210.353 Monthly report of sales and royalty. A completed... sold or utilized, together with the royalties due the United States. ... 30 Mineral Resources 2 2010-07-01 2010-07-01 false Monthly report of sales and royalty. 210.353...

  2. 13 CFR 120.210 - What percentage of a loan may SBA guarantee?

    Science.gov (United States)

    2010-01-01

    ... 13 Business Credit and Assistance 1 2010-01-01 2010-01-01 false What percentage of a loan may SBA guarantee? 120.210 Section 120.210 Business Credit and Assistance SMALL BUSINESS ADMINISTRATION BUSINESS... percent, except as otherwise authorized by law. ...

  3. 31 CFR 538.210 - Prohibited transactions relating to petroleum and petrochemical industries.

    Science.gov (United States)

    2010-07-01

    ... petroleum and petrochemical industries. 538.210 Section 538.210 Money and Finance: Treasury Regulations... relating to the petroleum or petrochemical industries in Sudan, including, but not limited to, oilfield... relating to the petroleum or petrochemical industries in Sudan is prohibited. ...

  4. Root uptake of lead by Norway spruce grown on Pb-210 spiked soils

    DEFF Research Database (Denmark)

    Hovmand, M.F.; Nielsen, Sven Poul; Johnsen, I.

    2009-01-01

    The root uptake of lead (Pb) by trees and the transfer of Pb by leaf litter deposition to the forest floor were investigated through a pot experiment with Norway spruce. Natural Pb and radio isotopic lead (210Pb) were determined in needles and twigs and in the pot soil spiked with 210Pb...

  5. 23 CFR 973.210 - Indian lands bridge management system (BMS).

    Science.gov (United States)

    2010-04-01

    ... 23 Highways 1 2010-04-01 2010-04-01 false Indian lands bridge management system (BMS). 973.210... HIGHWAYS MANAGEMENT SYSTEMS PERTAINING TO THE BUREAU OF INDIAN AFFAIRS AND THE INDIAN RESERVATION ROADS PROGRAM Bureau of Indian Affairs Management Systems § 973.210 Indian lands bridge management system (BMS...

  6. 17 CFR 210.2-03 - Examination of financial statements by foreign government auditors.

    Science.gov (United States)

    2010-04-01

    ... 17 Commodity and Securities Exchanges 2 2010-04-01 2010-04-01 false Examination of financial statements by foreign government auditors. 210.2-03 Section 210.2-03 Commodity and Securities Exchanges... auditors. Notwithstanding any requirements as to examination by independent accountants, the financial...

  7. 40 CFR 158.210 - Experimental use permit data requirements for product chemistry.

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 23 2010-07-01 2010-07-01 false Experimental use permit data requirements for product chemistry. 158.210 Section 158.210 Protection of Environment ENVIRONMENTAL PROTECTION... Experimental use permit data requirements for product chemistry. All product chemistry data, as described in...

  8. 31 CFR 20.210 - To whom must I distribute my drug-free workplace statement?

    Science.gov (United States)

    2010-07-01

    ... 31 Money and Finance: Treasury 1 2010-07-01 2010-07-01 false To whom must I distribute my drug-free workplace statement? 20.210 Section 20.210 Money and Finance: Treasury Office of the Secretary of the Treasury GOVERNMENTWIDE REQUIREMENTS FOR DRUG-FREE WORKPLACE (FINANCIAL ASSISTANCE) Requirements...

  9. 46 CFR 120.210 - Protection from wet and corrosive environments.

    Science.gov (United States)

    2010-10-01

    ... 46 Shipping 4 2010-10-01 2010-10-01 false Protection from wet and corrosive environments. 120.210... INSTALLATION General Requirements § 120.210 Protection from wet and corrosive environments. (a) Electrical... environments must be of suitable construction and corrosion-resistant. ...

  10. 46 CFR 129.210 - Protection from wet and corrosive environments.

    Science.gov (United States)

    2010-10-01

    ... 46 Shipping 4 2010-10-01 2010-10-01 false Protection from wet and corrosive environments. 129.210... ELECTRICAL INSTALLATIONS General Requirements § 129.210 Protection from wet and corrosive environments. (a... exposed to corrosive environments must be of suitable construction and must be resistant to corrosion. ...

  11. 23 CFR 970.210 - Federal lands bridge management system (BMS).

    Science.gov (United States)

    2010-04-01

    ... Section 970.210 Highways FEDERAL HIGHWAY ADMINISTRATION, DEPARTMENT OF TRANSPORTATION FEDERAL LANDS HIGHWAYS NATIONAL PARK SERVICE MANAGEMENT SYSTEMS National Park Service Management Systems § 970.210... needs using, as a minimum, the following components: (1) A database and an ongoing program for the...

  12. 23 CFR 971.210 - Federal lands bridge management system (BMS).

    Science.gov (United States)

    2010-04-01

    ... Section 971.210 Highways FEDERAL HIGHWAY ADMINISTRATION, DEPARTMENT OF TRANSPORTATION FEDERAL LANDS HIGHWAYS FOREST SERVICE MANAGEMENT SYSTEMS Forest Highway Program Management Systems § 971.210 Federal... components, as a minimum, as a basic framework for a BMS: (1) A database and an ongoing program for the...

  13. 19 CFR 210.33 - Failure to make or cooperate in discovery; sanctions.

    Science.gov (United States)

    2010-04-01

    ...; sanctions. 210.33 Section 210.33 Customs Duties UNITED STATES INTERNATIONAL TRADE COMMISSION INVESTIGATIONS OF UNFAIR PRACTICES IN IMPORT TRADE ADJUDICATION AND ENFORCEMENT Discovery and Compulsory Process... other non-monetary sanction available under Rule 37(b) of the Federal Rules of Civil Procedure. Any such...

  14. 17 CFR 210.3-20 - Currency for financial statements of foreign private issuers.

    Science.gov (United States)

    2010-04-01

    ... statements of foreign private issuers. 210.3-20 Section 210.3-20 Commodity and Securities Exchanges... private issuers. (a) A foreign private issuer, as defined in § 230.405 of this chapter, shall state... the financial statements. If dividends on publicly-held equity securities will be declared in a...

  15. 45 CFR 170.210 - Standards for health information technology to protect electronic health information created...

    Science.gov (United States)

    2010-10-01

    ... 45 Public Welfare 1 2010-10-01 2010-10-01 false Standards for health information technology to protect electronic health information created, maintained, and exchanged. 170.210 Section 170.210 Public Welfare DEPARTMENT OF HEALTH AND HUMAN SERVICES HEALTH INFORMATION TECHNOLOGY HEALTH INFORMATION TECHNOLOGY STANDARDS, IMPLEMENTATION SPECIFICATION...

  16. 7 CFR Appendix C to Part 210 - Child Nutrition Labeling Program

    Science.gov (United States)

    2010-01-01

    ... 7 Agriculture 4 2010-01-01 2010-01-01 false Child Nutrition Labeling Program C Appendix C to Part..., DEPARTMENT OF AGRICULTURE CHILD NUTRITION PROGRAMS NATIONAL SCHOOL LUNCH PROGRAM Pt. 210, App. C Appendix C to Part 210—Child Nutrition Labeling Program 1. The Child Nutrition (CN) Labeling Program is a...

  17. MicroRNA-210 alleviates oxidative stress-associated cardiomyocyte apoptosis by regulating BNIP3.

    Science.gov (United States)

    Diao, Hongying; Liu, Bin; Shi, Yongfeng; Song, Chunli; Guo, Ziyuan; Liu, Ning; Song, Xianjing; Lu, Yang; Lin, Xiaoye; Li, Zhuoran

    2017-09-01

    Oxidative stress-induced myocardial apoptosis and necrosis are involved in ischemia/reperfusion (I/R) injury. This study was performed to investigate microRNA (miR)-210's role in oxidative stress-related myocardial damage. The expression of miR-210 was upregulated in myocardial tissues of I/R rats, while that of Bcl-2 adenovirus E1B 19kDa-interacting protein 3 (BNIP3) was downregulated. To simulate in vivo oxidative stress, H9c2 cells were treated with H2O2 for 48 h. MiR-210 level was increased upon H2O2 stimulation, peaked at 8 h, and then decreased. An opposite expression pattern of BNIP3 was observed. BNIP3 was demonstrated as a direct target of miR-210 via luciferase reporter assay. H2O2-induced cell apoptosis was attenuated by miR-210 mimics, whereas aggravated by miR-210 inhibitor. MiR-210 knockdown-induced cell apoptosis in presence of H2O2 was attenuated by BNIP3 siRNA. Our work demonstrates that miR-210 plays a protective role in H2O2-induced cardiomyocyte apoptosis at least by regulating the pro-apoptotic BNIP3.

  18. 33 CFR 150.210 - What are the restrictions on serving in more than one position?

    Science.gov (United States)

    2010-07-01

    ... 33 Navigation and Navigable Waters 2 2010-07-01 2010-07-01 false What are the restrictions on serving in more than one position? 150.210 Section 150.210 Navigation and Navigable Waters COAST GUARD... What are the restrictions on serving in more than one position? No person may serve in more than one of...

  19. PAC-1 and its derivative WF-210 Inhibit Angiogenesis by inhibiting VEGF/VEGFR pathway.

    Science.gov (United States)

    Wang, Fangyang; Wang, Lihui; Li, Yi; Wang, Nannan; Wang, Yating; Cao, Qi; Gong, Ping; Yang, Jingyu; Wu, Chunfu

    2017-12-19

    Procaspase Activating Compound-1 (PAC-1) and its derivative WF-210 induce apoptosis in cancer cells by activating procaspase-3 to caspase-3. The aim of this study was to extend current knowledge about the mechanisms of PAC-1 and WF-210, particularly about their effects on tumor angiogenesis. PAC-1 and WF-210 restrained VEGF-induced human umbilical vascular endothelial cells (HUVECs) proliferation, invasion, and tube formation. PAC-1 and WF-210 abrogated VEGF-induced vessel sprouting from rat aortic rings and inhibited vascular formation in the Matrigel plug assay. PAC-1 and WF-210 suppressed phosphorylation of VEGFR2 and its downstream protein kinases c-Src, FAK, and AKT in both HUVECs and U-87 cells. When given to mice bearing subcutaneous or orthotopic xenograft, PAC-1 and WF-210 inhibited the tumor growth and tumor angiogenesis. Further tests showed that PAC-1 and WF-210 inhibited stemness and induced autophagy flux of U-87 cells. This study revealed mechanisms of PAC-1 and WF-210 other than inducing apoptosis, which provides additional support for their using in the clinic. Copyright © 2017. Published by Elsevier B.V.

  20. Polonium-210 in mussels and fish from the Baltic-North Sea estuary

    DEFF Research Database (Denmark)

    Dahlgaard, H.

    1996-01-01

    Polonium-210 has been measured in Danish fish meat caught in the North Sea, the Kattegat and the Baltic in 1991-1994. Average values of 0.35, 0.65 and 0.96 Bq Po-210 kg(-1) fresh weight were observed for cod, herring and plaice fillets, respectively. The difference between species is statisticall...

  1. Using natural radionuclides 210Po and 210Pb in GEOTRACES data from the North Atlantic to estimate particulate and biologically reactive trace element scavenging and regeneration

    Science.gov (United States)

    Rigaud, Sylvain; Church, Thomas

    2016-04-01

    Central to understanding the coupling of oceanic carbon and nutrient cycles are trace elements that can limit ocean production and ultimately climate change. These include elements that are both lithogenic (particle reactive) and biogenic (biologically reactive) central to particle scavenging, exchange and bioavailability. The natural 210Po and 210Pb radionuclide (granddaughter/parent) pair provides the radiometric means to model particle scavenging and exchange in the ocean on monthly to annual time scales. Data on dissolved (0.2 μm, >53μm) 210Po (t1/2= 138.4 d) and 210Pb (T1/2 = 22.3 y) are available from seven complete water profiles during two U.S. GEOTRACES cruises that transited the North Atlantic during fall 2010 and 2011. The transects correspond to a wide range of marine environments: coastal slopes at the western and eutrophic up-welling at the eastern margins, Saharan dust sources from the east, hydro-thermal vents in the TAG plume on the Mid-Atlantic Ridge, and oligotrophic gyres in both the western and eastern basins. Steady state box modeling at each depth interval was employed to estimate radionuclide exchange rates at the fine-large particle and fine particulate-dissolved interface, in terms of biological uptake, and net of radioactive support or decay. By proxy, the results should predict the rates of biological (210Po) and particle reactive (210Pb) trace element adsorption and resorption, vertical particulate and carbon export, and respective residence times. The model results show the contrasting chemical behaviour of the two nuclides over the large range of oceanic conditions encountered in the North Atlantic. In the surface ocean, 210Po scavenging is linearly correlated with the concentration of particulate organic carbon (POC) in large particles, supporting the role of biogenic particles in 210Po bioaccumulation and export. At depth, 210Po exhibits significant widespread deficit with respect to 210Pb, which could in part be attributed to in

  2. Determination of particle mass deposition according to Bergerhoff; Performance characteristics of the measurement of particle mass deposition and its portions of lead, cadmium, zinc and thallium. Bestimmung des Staubniederschlags nach Bergerhoff; Verfahrenskenngroessen fuer die Messung des Staubniederschlags und seiner Anteile an Blei, Cadmium, Zink und Thallium

    Energy Technology Data Exchange (ETDEWEB)

    Gehrig, R. (Eidgenoessische Materialpruefungs- und Forschungsanstalt, Duebendorf (Switzerland). Abt. fuer Luftfremdstoffe); Faesi, C. (Eidgenoessische Materialpruefungs- und Forschungsanstalt, Duebendorf (Switzerland). Abt. fuer Luftfremdstoffe); Hofer, P. (Eidgenoessische Materialpruefungs- und Forschungsanstalt, Duebendorf (Switzerland). Abt. fuer Luftfremdstoffe)

    1993-05-01

    The requirements concerning quality assurance have increased considerably in the field of immission control. Well founded values for detection limits and confidence limits have to be given. Based on the statistical analysis of long term data series of deposition measurements of particle mass (Berghoff method), lead, cadmium, zinc and thallium performance characteristics were established for very differently polluted sites. The resulting detection limits as well as confidence limits are low enough for a reliable control of the respective immission limit values. It is further shown that the use of plastic buckets instead of the glass buckets required by the VDI guideline or the addition of a protecting agent to avoid freezing does not affect the measurements significantly. (orig.)

  3. SP-R210 (Myo18A Isoforms as Intrinsic Modulators of Macrophage Priming and Activation.

    Directory of Open Access Journals (Sweden)

    Linlin Yang

    Full Text Available The surfactant protein (SP-A receptor SP-R210 has been shown to increase phagocytosis of SP-A-bound pathogens and to modulate cytokine secretion by immune cells. SP-A plays an important role in pulmonary immunity by enhancing opsonization and clearance of pathogens and by modulating macrophage inflammatory responses. Alternative splicing of the Myo18A gene results in two isoforms: SP-R210S and SP-R210L, with the latter predominantly expressed in alveolar macrophages. In this study we show that SP-A is required for optimal expression of SP-R210L on alveolar macrophages. Interestingly, pre-treatment with SP-A prepared by different methods either enhances or suppresses responsiveness to LPS, possibly due to differential co-isolation of SP-B or other proteins. We also report that dominant negative disruption of SP-R210L augments expression of receptors including SR-A, CD14, and CD36, and enhances macrophages' inflammatory response to TLR stimulation. Finally, because SP-A is known to modulate CD14, we used a variety of techniques to investigate how SP-R210 mediates the effect of SP-A on CD14. These studies revealed a novel physical association between SP-R210S, CD14, and SR-A leading to an enhanced response to LPS, and found that SP-R210L and SP-R210S regulate internalization of CD14 via distinct macropinocytosis-like mechanisms. Together, our findings support a model in which SP-R210 isoforms differentially regulate trafficking, expression, and activation of innate immune receptors on macrophages.

  4. Preparation, Characterization, and In Vivo Pharmacoscintigraphy Evaluation of an Intestinal Release Delivery System of Prussian Blue for Decorporation of Cesium and Thallium

    Directory of Open Access Journals (Sweden)

    Nidhi Sandal

    2017-01-01

    Full Text Available Background. Prussian blue (PB, ferric hexacyanoferrate is approved by US-FDA for internal decorporation of Cesium-137 (137Cs and Thallium-201 (201Tl. Aim. Since PB is a costly drug, pH-dependent oral delivery system of PB was developed using calcium alginate matrix system. Methods. Alginate (Alg beads containing PB were optimized by gelation of sodium alginate with calcium ions and effect of varying polymer concentration on encapsulation efficiency and release profile was investigated. Scanning electron microscopy (SEM was carried out to study surface morphology. Adsorption efficacy of Alg-PB beads for 201Tl was evaluated and compared with native PB. In vivo pH-dependent release of the formulation was studied in humans using gamma scintigraphy. Results. Encapsulation efficiencies of Alg-PB beads with 0.5, 1.0, 1.5, and 2.0% polymer solution were 99.9, 91, 92, and 93%, respectively. SEM and particle size analysis revealed differences between formulations in their appearance and size distribution. No drug release was seen in acidic media (pH of 1-2 while complete release was observed at pH of 6.8. Dissolution data was fitted to various mathematical models and beads were found to follow Hixson-Crowell mechanism of release. The pH-dependent release of beads was confirmed in vivo by pharmacoscintigraphy in humans.

  5. Replacement of a photomultiplier tube in a 2-inch thallium-doped sodium iodide gamma spectrometer with silicon photomultipliers and a light guide

    Directory of Open Access Journals (Sweden)

    Chankyu Kim

    2015-06-01

    Full Text Available The thallium-doped sodium iodide [NaI(Tl] scintillation detector is preferred as a gamma spectrometer in many fields because of its general advantages. A silicon photomultiplier (SiPM has recently been developed and its application area has been expanded as an alternative to photomultiplier tubes (PMTs. It has merits such as a low operating voltage, compact size, cheap production cost, and magnetic resonance compatibility. In this study, an array of SiPMs is used to develop an NaI(Tl gamma spectrometer. To maintain detection efficiency, a commercial NaI(Tl 2′ × 2′ scintillator is used, and a light guide is used for the transport and collection of generated photons from the scintillator to the SiPMs without loss. The test light guides were fabricated with polymethyl methacrylate and reflective materials. The gamma spectrometer systems were set up and included light guides. Through a series of measurements, the characteristics of the light guides and the proposed gamma spectrometer were evaluated. Simulation of the light collection was accomplished using the DETECT 97 code (A. Levin, E. Hoskinson, and C. Moison, University of Michigan, USA to analyze the measurement results. The system, which included SiPMs and the light guide, achieved 14.11% full width at half maximum energy resolution at 662 keV.

  6. Myocardial scintigraphy with iodine-123 phenylpentadecanoic acid and thallium-201 in patients with coronary artery disease: a comparative dual-isotope study.

    Science.gov (United States)

    Zimmermann, R; Rauch, B; Kapp, M; Bubeck, B; Neumann, F J; Seitz, F; Stokstad, P; Mall, G; Tillmanns, H; Kübler, W

    1992-01-01

    To characterise the clinical usefulness of serial myocardial scintigraphy with iodine-123 phenylpentadecanoic acid (IPPA) in comparison with thallium-201, dual-isotope investigations were performed in 41 patients with angiographically documented coronary artery disease. Both tracers were administered simultaneously during symptom-limited ergometry. Planar scintigrams were acquired immediately after stress, and delayed imaging was performed after 1 h for IPPA and 4 h for 201Tl. Scintigrams were evaluated both qualitatively and quantitatively using a newly developed algorithm for automated image superposition. Initial myocardial uptake of both tracers was closely correlated (r = 0.75, p or = 75% (IP-PA: 70.0%, 201Tl: 66.3%, P = NS) with identical specificity (69.8%). The number of persistent defects, however, was significantly higher with IPPA (P = 0.021), suggesting that visual analysis of serial IPPA scintigrams may overestimate the presence of myocardial scar tissue. On the other hand, previous Q wave myocardial infarction was associated with a decreased regional IPPA clearance (29% +/- 11% vs 44% +/- 11% in normal myocardium, P IPPA is essentially as sensitive as scintigraphy with 201Tl for the detection of stress-induced perfusion abnormalities. Quantitative analysis of myocardial IPPA kinetics, however, is required for the evaluation of tissue viability.

  7. Dynamic low dose I-123-iodophenylpentadecanoic acid metabolic cardiac imaging; Comparison to myocardial biopsy and reinjection SPECT thallium in ischemic cardiomyopathy and cardiac transplantation

    Energy Technology Data Exchange (ETDEWEB)

    Murray, G.L.; Magill, H.L. [Baptist Memorial Hospital (United States); Schad, N.C.

    1993-12-01

    Recognition of stunned and hibernating myocardium is essential in this era of cardiac revascularization. Positron emission tomography (PET) accurately identifies viability but is costly and unavailable to most patients. Dynamic low dose I-123-iodophenylpentadecanoic acid (IPPA) metabolic cardiac imaging is a potentially cost-effective alternative to PET. Using transmural myocardial biopsies obtained during coronary bypass surgery as the viability gold standard, resting IPPA imaging agreed with 39/43 (91%) biopsies, with a sensitivity for viability of 33/36(92%) and a specificity of 6/7 (86%) in patients with severe ischemic cardiomyopathy. Eighty percent of IPPA viable, infarcted segments improved wall motion postoperatively. Furthermore, when compared to reinjection thallium (SPECT-Tl) scans after myocardial infarction, there was IPPA-Tl concordance in 27/35 (77%)(Kappa=0.536, p=0.0003). Similar to PET, IPPA demonstrated more viability than SPECT-Tl, 26/35 (74%) vs. 18/35 (51%)(p=0.047). Finally, when compared to transvenous endomyocardial biopsy for detecting rejection following cardiac transplantation, IPPA sensitivity for {>=}Grade II rejection was 100%, and IPPA screening assessment for the necessity of biopsy could result in a 31% cost-savings. Therefore, IPPA metabolic cardiac imaging is a safe, inexpensive technique with a promising future. (author).

  8. Myocardial scintigraphy with iodine-123 phenylpentadecanoic acid and thallium-201 in patients with coronary artery disease: A comparative dual-isotope study

    Energy Technology Data Exchange (ETDEWEB)

    Zimmermann, R.; Rauch, B.; Kapp, M.; Neumann, F.J.; Seitz, F.; Kuebler, W. (Heidelberg Univ. (Germany). Dept. of Cardiology); Bubeck, B. (Heidelberg Univ. (Germany). Dept. of Nuclear Medicine); Mall, G. (Heidelberg Univ. (Germany). Dept. of Pathology); Tillmanns, H. (Giessen Univ. (Germany). Dept. of Cardiology); Stokstad, P.

    1992-11-01

    To characterise the clinical usefulness of serial myocardial scintigraphy with iodine-123 phenylpentadecanoic acid (IPPA) in comparison with thallium-201, dual-isotope investigations were performed in 41 patients with angiographically documented coronary artery disease. Both tracers were adminstered simultaneously during symptom-limited ergometry. Planar scintigrams were acquired immediately after stress, and delayed imaging was performed after 1 h for IPPA and 4 h for {sup 201}Tl. Scintigrams were evaluated both qualitatively and quantitatively using a newly developed algorithm for automated image superposition. Initial myocardial uptake of both tracers was closely correlated (r=0.75, p<0.001). Both tracers also revealed a similar sensitivity for the identification of individual coronary artery stenoses {>=}75% (IPPA: 70%, {sup 201}Tl: 66.3%, P=NS) with identical specificity (69.8%). The number of persistent defects, however, was significantly higher with IPPA (P=0.021), suggesting that visual analysis of serial IPPA scintigrams may overestimate the presence of myocardial scar tissue. On the other hand, previous Q wave myocardial infarction was associated with a decreased regional IPPA clearance (29%{+-}11% vs 44%{+-}11% in normal myocardium, P<0.05). The data indicate that serial myocardial scintigraphy with IPPA is essentially as sensitive as scintigraphy with {sup 201}Tl for the detection of stress-induced perfusion abnormalities. Quantitative analysis of myocardial IPPA kinetics, however, is required for the evaluation of tissue viability. (orig.).

  9. Myocardial viability assessment with dynamic low-dose iodine-123-iodophenylpentadecanoic acid metabolic imaging: comparison with myocardial biopsy and reinjection SPECT thallium after myocardial infarction.

    Science.gov (United States)

    Murray, G L; Schad, N C; Magill, H L; Vander Zwaag, R

    1994-04-01

    Aggressive cardiac revascularization requires recognition of stunned and hibernating myocardium, and cost considerations may well govern the technique used. Dynamic low-dose (1 mCi) [123I]iodophenylpentadecanoic acid (IPPA) metabolic imaging is a potential alternative to PET using either 18FDG or 15O-water. Resting IPPA images were obtained from patients with severe ischemic cardiomyopathy, and transmural myocardial biopsies were obtained during coronary bypass surgery to confirm viability. Thirty-nine of 43 (91%) biopsies confirmed the results of the IPPA images with a sensitivity for viability of 33/36 (92%) and a specificity of 6/7 (86%). Postoperatively, wall motion improved in 80% of IPPA-viable, dysfunctional segments. Furthermore, when compared to reinjection thallium (SPECT-TI) scans after myocardial infarction, IPPA-SPECT-TI concordance occurred in 27/35 (77%) (K = 0.536, p = 0.0003). Similar to PET, IPPA demonstrated more viability than SPECT-TI, 26/35 (74%) versus 18/35 (51%) (p = 0.047). Metabolic IPPA cardiac viability imaging is a safe, inexpensive technique that may be a useful alternative to PET.

  10. Identification and Decay Studies of New, Neutron-Rich Isotopes of Bismuth, Lead and Thallium by means of a Pulsed Release Element Selective Method

    CERN Multimedia

    Mills, A; Kugler, E; Van duppen, P L E; Lettry, J

    2002-01-01

    % IS354 \\\\ \\\\ It is proposed to produce, identify and investigate at ISOLDE new, neutron-rich isotopes of bismuth, lead and thallium at the mass numbers A=215 to A=218. A recently tested operation mode of the PS Booster-ISOLDE complex, taking an advantage of the unique pulsed proton beam structure, will be used together with a ThC target in order to increase the selectivity. The decay properties of new nuclides will be studied by means of $\\beta$-, $\\gamma$- and X- ray spectroscopy methods. The expected information on the $\\beta$-half-lives and excited states will be used for testing and developing the nuclear structure models ``south-east'' of $^{208}$Pb, and will provide input data for the description of the r-process path at very heavy nuclei. The proposed study of the yields and the decay properties of those heavy nuclei produced in the spallation of $^{232}$Th by a 1~GeV proton beam contributes also the data necessary for the simulations of a hybrid accelerator-reactor system.

  11. Thallium contamination in arable soils and vegetables around a steel plant-A newly-found significant source of Tl pollution in South China.

    Science.gov (United States)

    Liu, Juan; Luo, Xuwen; Wang, Jin; Xiao, Tangfu; Chen, Diyun; Sheng, Guodong; Yin, Meiling; Lippold, Holger; Wang, Chunlin; Chen, Yongheng

    2017-05-01

    Thallium (Tl) is a highly toxic rare element. Severe Tl poisoning can cause neurological brain damage or even death. The present study was designed to investigate contents of Tl and other associated heavy metals in arable soils and twelve common vegetables cultivated around a steel plant in South China, a newly-found initiator of Tl pollution. Potential health risks of these metals to exposed population via consumption of vegetables were examined by calculating hazard quotients (HQ). The soils showed a significant contamination with Tl at a mean concentration of 1.34 mg/kg. The Tl levels in most vegetables (such as leaf lettuce, chard and pak choy) surpassed the maximum permissible level (0.5 mg/kg) according to the environmental quality standards for food in Germany. Vegetables like leaf lettuce, chard, pak choy, romaine lettuce and Indian beans all exhibited bioconcentration factors (BCF) and transfer factors (TF) for Tl higher than 1, indicating a hyperaccumulation of Tl in these plants. Although the elevated Tl levels in the vegetables at present will not immediately pose significant non-carcinogenic health risks to residents, it highlights the necessity of a permanent monitoring of Tl contamination in the steel-making areas. Copyright © 2017 Elsevier Ltd. All rights reserved.

  12. Thallium-201 is comparable to technetium-99m-sestamibi for estimating cardiac function in patients with abnormal myocardial perfusion imaging

    Directory of Open Access Journals (Sweden)

    Ming-Che Wu

    2015-11-01

    Full Text Available We analyzed the left-ventricular functional data obtained by cardiac-gated single-photon emission computed tomography myocardial perfusion imaging (MPI with thallium-201 (Tl-201 and technetium-99m-sestamibi (MIBI protocols in different groups of patients, and compared the data between Tl-201 and MIBI. Two hundred and seventy-two patients undergoing dipyridamole stress/redistribution Tl-201 MPI and 563 patients undergoing 1-day rest/dipyridamole stress MIBI MPI were included. Higher mean stress ejection fraction (EF, rest EF, and change in EF (ΔEF were noticed in the normal MPI groups by both Tl-201 and MIBI protocols. Higher mean EF was observed in the females with normal MPI results despite their higher mean age. Comparisons between the Tl-201 and MIBI groups suggested a significant difference in all functional parameters, except for the rest end diastolic volume/end systolic volume and ΔEF between groups with negative MPI results. For the positive MPI groups, there was no significant difference in all parameters, except for the change in end diastolic volume and change in end systolic volume after stress between both protocols. The Tl-201 provides comparable left-ventricular functional data to MIBI cardiac-gated single-photon emission computed tomography in patients with positive MPI results, and may therefore be undertaken routinely for incremental functional information that is especially valuable to this patient group.

  13. Usefulness of thallium-201 myocardial scintigraphy during hyperventilation and accelerated exercise test in patients with vasospastic angina and nearly normal coronary artery

    Energy Technology Data Exchange (ETDEWEB)

    Sueda, Shozo; Mineoi, Kazuaki; Kondou, Tadashi [Takanoko Hospital, Matsuyama, Ehime (Japan)] [and others

    1998-04-01

    The usefulness of thallium-201 ({sup 201}Tl) myocardial scintigraphy was studied in 109 patients with vasospastic angina who had nearly normal coronary arteries (degree of stenosis <50%). Coronary spasm was confirmed by pharmacologic agents in all 109 patients from January 1991 to June 1996. The appearance rate of visual redistribution on {sup 201}Tl myocardial scintigraphy was compared between four groups, 34 patients performing graded bicycle ergometer exercise starting at a work load of 50 W with increments of 25 W every 3 min (Ergo(3) group), 14 patients performing hyperventilation for 5 min (HV(5) group), 31 patients performing bicycle ergometer exercise with increments of 25 W every 1 min after 5 min hyperventilation (HV(5)+Ergo(1) group), and 30 patients at rest (Rest group). The value of the visual redistribution rate on {sup 201}Tl myocardial scintigrams in the HV(5)+Ergo(l) group (65%) was higher than that in the patients of other groups (Ergo(3) 41%, HV(5) 43%, Rest 33%). However, there were no significant differences between the four groups. Stress {sup 201}Tl imaging after hyperventilation and accelerated exercise is useful to disclose ischemic evidence in about two thirds of patients with vasospastic angina and nearly normal coronary arteries, whereas about 40% of patients had visual redistribution on {sup 201}Tl myocardial scintigrams by performing standard procedures. (author)

  14. On-line preconcentration of ultra-trace thallium(I in water samples with titanium dioxide nanoparticles and determination by graphite furnace atomic absorption spectrometry

    Directory of Open Access Journals (Sweden)

    Saeid Asadpour

    2016-11-01

    Full Text Available A new method has been developed for the determination of Tl(I based on simultaneous sorption and preconcentration with a microcolumn packed with TiO2 nanoparticle with a high specific surface area prepared by Sonochemical synthesis prior to its determination by graphite furnace atomic absorption spectrometry (GFAAS. The optimum experimental parameters for preconcentration of thallium, such as elution condition, pH, and sample volume and flow rate have been investigated. Tl(I can be quantitatively retained by TiO2 nanoparticles at pH 9.0, then eluted completely with 1.0 mol L−1 HCl. The adsorption capacity of TiO2 nanoparticles for Tl(I was found to be 25 mg g−1. Also detection limit, precision (RSD, n = 8 and enrichment factor for Tl(I were 87 ng L−1, 6.4% and 100, respectively. The method has been applied for the determination of trace amounts of Tl(I in some environmental water samples with satisfactory results.

  15. Thallium-201 single photon emission computed tomography (SPECT) in patients with Duchenne's progressive muscular dystrophy. A histopathologic correlation study

    Energy Technology Data Exchange (ETDEWEB)

    Nishimura, Toru; Yanagisawa, Atsuo; Sakata, Konomi; Shimoyama, Katsuya; Yoshino, Hideaki; Ishikawa, Kyozo [Kyorin Univ., Mitaka, Tokyo (Japan). School of Medicine; Sakata, Hitomi; Ishihara, Tadayuki

    2001-02-01

    The pathomorphologic mechanism responsible for abnormal perfusion imaging during thallium-201 myocardial single photon emission computed tomography ({sup 201}Tl-SPECT) in patients with Duchenne's progressive muscular dystrophy (DMD) was investigated. Hearts from 7 patients with DMD were evaluated histopathologically at autopsy and the results correlated with findings on initial and delayed resting {sup 201}Tl-SPECT images. The location of segments with perfusion defects correlated with the histopathologically abnormal segments in the hearts. Both the extent and degree of myocardial fibrosis were severe, especially in the posterolateral segment of the left ventricle. Severe transmural fibrosis and severe fatty infiltration were common in segments with perfusion defects. In areas of redistribution, the degree of fibrosis appeared to be greater than in areas of normal perfusion; and intermuscular edema was prominent. Thus, the degree and extent of perfusion defects detected by {sup 201}Tl-SPECT were compatible with the histopathology. The presence of the redistribution phenomenon may indicate ongoing fibrosis. Initial and delayed resting {sup 201}Tl-SPECT images can predict the site and progress of myocardial degeneration in patients with DMD. (author)

  16. POC export from ocean surface waters by means of 234Th/ 238U and 210Po/ 210Pb disequilibria: A review of the use of two radiotracer pairs

    Science.gov (United States)

    Verdeny, Elisabet; Masqué, Pere; Garcia-Orellana, Jordi; Hanfland, Claudia; Kirk Cochran, J.; Stewart, Gillian M.

    2009-08-01

    234Th ( T1/2=24.1 d) and 210Po ( T1/2=138.4 d) are particle reactive radioisotopes that are used as tracers for particle cycling in the upper ocean. Particulate organic carbon (POC) export has frequently been estimated using 234Th/ 238U disequilibrium. Recent evidence suggests that 210Po/ 210Pb disequilibrium may be used as an additional tool to examine particle export, given the direct biological uptake of 210Po into cellular material. Differences in these two radioisotope pairs with regard to their half-lives, particle reactivity and scavenging affinity in seawater should provide complementary information to be obtained on the processes occurring in the water column. Here, we review eight different studies that have simultaneously used both approaches to estimate POC export fluxes from the surface ocean. Our aim is to provide a complete "dataset" of all the existing POC flux data derived from the coupled use of both 234Th and 210Po and to evaluate the advantages and limitations of each tracer pair. Our analysis suggests that the simultaneous use of both radiotracers provides more useful comparative data than can be derived from the use of a single tracer alone. The difference in half-lives of 234Th and 210Po enables the study of export production rates over different time scales. In addition, their different biogeochemical behaviour and preferred affinity for specific types of particles leads to the conclusion that 234Th is a better tracer of total mass flux, whereas 210Po tracks POC export more specifically. The synthesis presented here is also intended to provide a basis for planning future sampling strategies and promoting further work in this field to help reveal the more specific application of each tracer under specific water column biogeochemistries.

  17. 210Po in the marine environment with emphasis on its behaviour within the biosphere.

    Science.gov (United States)

    Fowler, Scott W

    2011-05-01

    The distribution and behaviour of the natural-series alpha-emitter polonium-210 in the marine environment has been under study for many years primarily due to its enhanced bioaccumulation, its strong affinity for binding with certain internal tissues, and its importance as a contributor to the natural radiation dose received by marine biota as well as humans consuming seafoods. Results from studies spanning nearly 5 decades show that (210)Po concentrations in organisms vary widely among the different phylogenic groups as well as between the different tissues of a given species. Such variation results in (210)Po concentration factors ranging from approximately 10(3) to over 10(6) depending upon the organism or tissue considered. (210)Po/(210)Pb ratios in marine species are generally greater than unity and tend to increase up the food chain indicating that (210)Po is preferentially taken up by organisms compared to its progenitor (210)Pb. The effective transfer of (210)Po up the food chain is primarily due to the high degree of assimilation of the radionuclide from ingested food and its subsequent strong retention in the organisms. In some cases this mechanism may lead to an apparent biomagnification of (210)Po at the higher trophic level. Various pelagic species release (210)Po and (210)Pb packaged in organic biodetrital particles that sink and remove these radionuclides from the upper water column, a biogeochemical process which, coupled with scavenging rates of this radionuclide pair, is being examined as a possible proxy for estimating downward organic carbon fluxes in the sea. Data related to preferential bioaccumulation in various organisms, their tissues, resultant radiation doses to these species, and the processes by which (210)Po is transferred and recycled through the food web are discussed. In addition, the main gaps in our present knowledge and proposed areas for future studies on the biogeochemical behaviour of (210)Po and its use as a tracer of

  18. Etiology of epilepsy a prospective study of 210 cases

    Directory of Open Access Journals (Sweden)

    Walter Oleschko Arruda

    1991-09-01

    Full Text Available The objective of this study was to establish the etiology of epilepsy in 210 chronic epileptics (110 female, 100 male, aged 14-82 years (34.2±13.3. Patients less than 10 years-old and alcoholism were excluded. All underwent neurological examination, routine blood tests, EEG and CT-scan. Twenty patients (10.5% were submitted to spinal tap for CSF examination. Neurological examination was abnormal in 26 (12.4%, the EEG in 68 (45.5%, and CT-scan in 93 (44.3%. According to the International Classification of Epileptic Seizures (1981, 101 (48.1% have generalized seizures, 66 (31.4% partial seizures secondarily generalized, 25 (11.8% simple partial and complex partial seizures, and 14 (6.6% generalized and partial seizures. Four patients (2.0% could not be classified. In 125 (59.5% patients the etiology was unknown. Neurocysticercosis accounted for 57 (27.1% of cases, followed by cerebrovascular disease 8 (3.8%, perinatal damage 5 (2.4%, familial epilepsy 4 (1.9%, head injury 4 (1.9%, infective 1 (0.5%, and miscelanea 6 (2.8%.

  19. 210Po in Human Saliva of Smokeless Tobacco Users.

    Science.gov (United States)

    Meli, Maria Assunta; Desideri, Donatella; Roselli, Carla; Feduzi, Laura

    2017-01-01

    The occurrence and mobility of Po in oral smokeless tobacco products (STPs) were determined because its effects on human health must be taken into account. This research was subdivided into two parts: determination by alpha spectrometry of the Po activity concentration in 16 oral smokeless tobacco products of different brands purchased in local specialty stores in Europe and evaluation of its percent extraction into an artificial salivary gland during sucking or chewing operations. Polonium-210 was detected in all samples, and its concentrations ranged from 3.46 to 14.8 Bq kg (mean value of 7.45 ± 3.82 Bq kg). The highest concentration was found in chewing tobacco. The samples showed no significant difference in the content of Po level. The data obtained in this study show that the polonium, although poorly extracted (12.8 ± 8.96%) by artificial saliva, is not totally retained within the smokeless tobacco products, with a consequent potential health hazard associated with oral use of these products.

  20. Primary electron transfer in reaction centers of YM210L and YM210L/HL168L mutants of Rhodobacter sphaeroides.

    Science.gov (United States)

    Yakovlev, A G; Vasilieva, L G; Khmelnitskaya, T I; Shkuropatova, V A; Shkuropatov, A Ya; Shuvalov, V A

    2010-07-01

    The role of tyrosine M210 in charge separation and stabilization of separated charges was studied by analyzing of the femtosecond oscillations in the kinetics of decay of stimulated emission from P* and of a population of the primary charge separated state P(+)B(A)(-) in YM210L and YM210L/HL168L mutant reaction centers (RCs) of Rhodobacter sphaeroides in comparison with those in native Rba. sphaeroides RCs. In the mutant RCs, TyrM210 was replaced by Leu. The HL168L mutation placed the redox potential of the P(+)/P pair 123 mV below that of native RCs, thus creating a theoretical possibility of P(+)B(A)(-) stabilization. Kinetics of P* decay at 940 nm of both mutants show a significant slowing of the primary charge separation reaction in comparison with native RCs. Distinct damped oscillations in these kinetics with main frequency bands in the range of 90-150 cm(-1) reflect mostly nuclear motions inside the dimer P. Formation of a very small absorption band of B(A)(-) at 1020 nm is registered in RCs of both mutants. The formation of the B(A)(-) band is accompanied by damped oscillations with main frequencies from ~10 to ~150 cm(-1). Only a partial stabilization of the P(+)B(A)(-) state is seen in the YM210L/HL168L mutant in the form of a small non-oscillating background of the 1020-nm kinetics. A similar charge stabilization is absent in the YM210L mutant. A model of oscillatory reorientation of the OH-group of TyrM210 in the electric fields of P(+) and B(A)(-) is proposed to explain rapid stabilization of the P(+)B(A)(-) state in native RCs. Small oscillatory components at ~330-380 cm(-1) in the 1020-nm kinetics of native RCs are assumed to reflect this reorientation. We conclude that the absence of TyrM210 probably cannot be compensated by lowering of the P(+)B(A)(-) free energy that is expected for the double YM210L/HL168L mutant. An oscillatory motion of the HOH55 water molecule under the influence of P(+) and B(A)(-) is assumed to be another potential

  1. Orientating investigation to Polonium-210 and other radionuclides in Dutch aquatic ecosystems. Orienterend onderzoek naar Polonium-210 en andere radionucliden in Nederlandse aquatische ecosystemen

    Energy Technology Data Exchange (ETDEWEB)

    Koester, H.W.; Marwitz, P.A. (Rijksinstituut voor Volksgezondheid en Milieuhygiene, Bilthoven (Netherlands)); Berger, G.W. (Netherlands Inst. for Sea Research, Den Burg (Netherlands)); Weers, A.W. van (Netherlands Energy Research Foundation, Petten (Netherlands)); Hagel, P. (RIVO (Netherlands)); Nieuwenhuize, J. (DIHO (Netherlands))

    1990-08-01

    In 1985/86 reconnaissance investigations were carried out of Po-210, Pb-210, Ra-226, Th-230 of the U-238 series, and of Th-232 and its daughter Th-228. In the lower reaches of the Rhine, Westerschelde, and Hoogoven(furnace)-channel concentrations were markedly elevated. The average Po-210 concentrations of these waters were between 3-4 Bq.m{sup -3} dissolved in water, between 200-500 Bq.kg{sup -1} in dry suspended matter, between 300-400 Bq.kg{sup -1} in mussels dry matter. These elevated levels could be ascribed to emissions on these waters by the phosphate rock and iron-ore-processing industries. In bottom sediment of waterways or of docks close to these industries Pb-210 and Po-210 concentrations varied from 150 to 750 Bq.kg{sup -1} dry sediment. The lowest average Po-210 concentrations were found in the Oosterschelde: 0.8 Bq.m{sup -3} dissolved in water, 70 Bq.kg{sup -1} in dry suspended matter, 100 Bq.kg{sup -1} in mussels dry matter. It was found that several organisms incorporate Po-210 more strongly than the other natural radionuclides. Po-210 also contributes most to the radiation burden caused by the consumption of fish products, in particular mussels and shrimps. Consumption of 1 kg. a{sup -1} of shrimps from the Oosterschelde or from the coastal area causes respectively a radiation exposure of 10 {mu}Sv.a{sup -1} or 30 {mu}Sv.a{sup -1}. This study points out the necessity for further studies of the emissions of Po-210 and other U-238 daughters and their dispersal and/or accumulation in the aquatic environment. Furthermore it is important to identify critical groups with respect to the radiation exposure caused by the consumption of mussels and other fish products, and the contribution to this radiation exposure by the industries. (author). 43 refs.; 58 figs.; 52 tabs.

  2. Impact of northern and southern air mass transport on the temporal distribution of atmospheric (210)Po and (210)Pb in the east coast of Johor, Malaysia.

    Science.gov (United States)

    Sabuti, Asnor Azrin; Mohamed, Che Abd Rahim

    2016-09-01

    Concentration activities of (210)Pb and (210)Po in the PM10 were determined to discuss their distribution and chemical behavior in relation to meteorological parameters especially in air mass transport during monsoon events. Marine aerosol samples were collected between January 2009 and December 2010 at the coastal region of Mersing, which is located in the southern South China Sea and is about 160 km northeast of Johor Bahru, as part of the atmosphere-ocean interaction program in Malaysia. About 47 PM10 samples were collected using the Sierra-Andersen model 1200 PM10 sampler over a 2-year sampling campaign between January 2009 and December 2010. Samples were processed using acid digestion sequential extraction techniques to analyze various fractions such as Fe and Mn oxides, organic matter, and residual fractions. While, (210)Pb and (210)Po activities were measured with the Gross Alpha/Beta Counting System model XLB-5 Tennelec® Series 5 and the Alpha Spectrometry (model Alpha Analyst Spectroscopy system with a silicon-surface barrier detector), respectively. The distribution activities of (210)Pb and (210)Po in the PM10 samples were varied from 162 to 881 μBq/m(3) with mean value of 347 ± 170 μBq/m(3) and from 85 to 1009 μBq/m(3) with mean value of 318 ± 202 μBq/m(3), respectively. The analysis showed that (210)Po activity in our samples lies in a border and higher range than global distribution values due to contributions from external sources injected to the atmosphere. The speciation of (210)Pb and (210)Po in marine aerosol corresponds to transboundary haze; e.g., biomass burning especially forest fires and long-range air mass transport of terrestrial dust has enriched concentrations of particle mass in the local atmosphere. The monsoon seems to play an important role in transporting terrestrial dust from Indo-China and northern Asia especially during the northeast monsoon, as well as biogenic pollutants originating from Sumatra and the southern

  3. A record of atmospheric {sup 210}Pb deposition in The Netherlands

    Energy Technology Data Exchange (ETDEWEB)

    Beks, J.P.; Eisma, D. [Netherlands Institute for Sea Research (NIOZ), PO box 59, 1790 AB Den Burg Texel (Netherlands); Plicht, J. van der [Isotope Research Centre (CIO), University Groningen, Nijenborgh 4, 9747 AG Groningen (Netherlands)

    1998-10-15

    The deposition flux of total atmospheric {sup 210}Pb has been measured at two sites in The Netherlands: Texel from 1992 to 1996 and Groningen from 1989 to 1994. With predominant westerly oceanic winds, the annual {sup 210}Pb deposition is relatively low as {sup 222}Rn, the source for atmospheric {sup 210}Pb, is mainly exhaled by the continents. The daily fluctuations in {sup 210}Pb deposition are determined by the almost random daily fluctuations in precipitation and the concentration in groundlevel air. The variations in annual {sup 210}Pb deposition flux appear to be mainly correlated with the number of heavy rains or thunder storms. This explains the variations in annual deposition at short distance. The average {sup 210}Pb deposition at Groningen (1987-1994) is 200 mBq m{sup -2} day{sup -1}. The {sup 210}Pb deposition over the North Sea is estimated to be 115 mBq m{sup -2} day{sup -1} in the same period. The deposition velocity in Groningen is 1.0 cm s{sup -1}, which is similar to measurements in Virginia and Connecticut. (Copyright (c) 1998 Elsevier Science B.V., Amsterdam. All rights reserved.)

  4. A record of atmospheric {sup 210}Pb deposition in The Netherlands

    Energy Technology Data Exchange (ETDEWEB)

    Beks, J.P.; Eisma, D. [Netherlands Institute for Sea Research (NIOZ), PO box 59, 1790 AB Den Burg, Texel (Netherlands); Van der Plicht, J. [Isotope Research Centre (CIO), University Groningen, Nijenborgh 4, 9747 AG Groningen (Netherlands)

    1998-10-15

    The deposition flux of total atmospheric {sup 210}Pb has been measured at two sites in The Netherlands: Texel from 1992 to 1996 and Groningen from 1989 to 1994. With predominant westerly oceanic winds, the annual {sup 210}Pb deposition is relatively low as {sup 222}Rn, the source for atmospheric {sup 210}Pb, is mainly exhaled by the continents. The daily fluctuations in {sup 210}Pb deposition are determined by the almost random daily fluctuations in precipitation and the concentration in groundlevel air. The variations in annual {sup 210}Pb deposition flux appear to be mainly correlated with the number of heavy rains or thunder storms. This explains the variations in annual deposition at short distance. The average {sup 210}Pb deposition at Groningen (1987-1994) is 200 mBq m{sup -2} day{sup -1}. The {sup 210}Pb deposition over the North Sea is estimated to be 115 mBq m{sup -2} day{sup -1} in the same period. The deposition velocity in Groningen is 1.0 cm s{sup -1}, which is similar to measurements in Virginia and Connecticut

  5. Distributions of 210Pb around a uraniferous coal-fired power plant in Western Turkey.

    Science.gov (United States)

    Uğur, A; Ozden, B; Yener, G; Saç, M M; Kurucu, Y; Altinbaş, U; Bolca, M

    2009-02-01

    In the present study the spatial and the vertical distributions of 210Pb were investigated in the soils around a uranifereous coal fired power plant (CPP) in Yatagan Basin, in Western Turkey. The variation of 226Ra activity along the soil profiles was studied to assess the unsupported 210Pb distribution in the same samples. 226Ra was measured by gamma spectroscopy and 210Pb activities were determined from 210Po activities using radiochemical deposition and alpha spectroscopy. The total 210Pb activity concentrations in bulk core samples varied in the range of 38-250 Bq kg(-1) in the study sites and of 22-78 Bq kg(-1) in reference site. In the sectioned cores sampled from the study areas the ranges for activity concentrations of 226Ra, total 210Pb and unsupported 210Pb are 24-77; 39-344 and 4-313 Bq kg(-1), respectively. Corresponding ranges for reference site are 37-39; 39-122 and 1-83 Bq kg(-1).

  6. 17 CFR 210.6A-02 - Special rules applicable to employee stock purchase, savings and similar plans.

    Science.gov (United States)

    2010-04-01

    ... employee stock purchase, savings and similar plans. 210.6A-02 Section 210.6A-02 Commodity and Securities..., INVESTMENT COMPANY ACT OF 1940, INVESTMENT ADVISERS ACT OF 1940, AND ENERGY POLICY AND CONSERVATION ACT OF 1975 Employee Stock Purchase, Savings and Similar Plans § 210.6A-02 Special rules applicable to...

  7. 22 CFR 210.300 - What must I do to comply with this part if I am an individual recipient?

    Science.gov (United States)

    2010-04-01

    ... 22 Foreign Relations 1 2010-04-01 2010-04-01 false What must I do to comply with this part if I am an individual recipient? 210.300 Section 210.300 Foreign Relations AGENCY FOR INTERNATIONAL... Recipients Who Are Individuals § 210.300 What must I do to comply with this part if I am an individual...

  8. 28 CFR 5.210 - Amount of detail required in information relating to registrant's activities and expenditures.

    Science.gov (United States)

    2010-07-01

    ... 28 Judicial Administration 1 2010-07-01 2010-07-01 false Amount of detail required in information relating to registrant's activities and expenditures. 5.210 Section 5.210 Judicial Administration... § 5.210 Amount of detail required in information relating to registrant's activities and expenditures...

  9. 33 CFR 334.210 - Chesapeake Bay, in vicinity of Tangier Island; naval guided missiles test operations area.

    Science.gov (United States)

    2010-07-01

    ... Tangier Island; naval guided missiles test operations area. 334.210 Section 334.210 Navigation and... RESTRICTED AREA REGULATIONS § 334.210 Chesapeake Bay, in vicinity of Tangier Island; naval guided missiles test operations area. (a) The danger zone—(1) Prohibited area. A circle 1,000 yards in radius with its...

  10. 17 CFR 210.2-02T - Accountants' reports and attestation reports on internal control over financial reporting.

    Science.gov (United States)

    2010-04-01

    ... 17 Commodity and Securities Exchanges 2 2010-04-01 2010-04-01 false Accountants' reports and attestation reports on internal control over financial reporting. 210.2-02T Section 210.2-02T Commodity and... attestation reports on internal control over financial reporting. (a) The requirements of § 210.2-02(f) shall...

  11. 20 CFR 30.210 - What are the criteria for eligibility for benefits relating to radiogenic cancer?

    Science.gov (United States)

    2010-04-01

    ... benefits relating to radiogenic cancer? 30.210 Section 30.210 Employees' Benefits OFFICE OF WORKERS... Cancer Under Parts B and E of Eeoicpa § 30.210 What are the criteria for eligibility for benefits relating to radiogenic cancer? (a) To establish eligibility for benefits for radiogenic cancer under Part B...

  12. Elevation of circulating miR-210-3p in high-altitude hypoxic environment

    Directory of Open Access Journals (Sweden)

    Yan eYan

    2016-03-01

    Full Text Available Background: The induction of miR-210-3p, a master hypoxamir, is a consistent feature of the hypoxic response in both normal and malignant cells. However, whether miR-210-3p acts as a circulating factor in response to a hypoxic environment remains unknown. The current study aimed to examine the effect of a high-altitude hypoxic environment on circulating miR-210-3p.Methods: We examined and compared the levels of miR-210-3p using TaqMan-based qRT-PCR in both peripheral blood cells and plasma from 84 ethnic Chinese Tibetans residing at 3560 m, 46 newly arrived migrant Han Chinese (Tibet Han and 82 Han Chinese residing at 8.9 m (Nanjing Han. Furthermore, we analyzed the correlations of miR-210-3p with hematological indices. Results: The relative concentrations of miR-210-3p to internal reference U6 in blood cells were significantly higher in the Tibet Han group (1.01±0.11, P<0.001 and in the Tibetan group (1.17±0.09, P<0.001 than in the Nanjing Han group (0.51±0.04. The absolute concentrations of plasma miR-210-3p were also markedly elevated in the Tibet Han group (503.54±42.95 fmol/L, P=0.004 and in the Tibetan group (557.78±39.84 fmol/L, P<0.001 compared to the Nanjing Han group (358.39±16.16 fmol/L. However, in both blood cells and plasma, miR-210-3p levels were not significantly different between the Tibet Han group and the Tibetan group (P=0.280, P=0.620, respectively. Plasma miR-210-3p concentrations were positively correlated with miR-210-3p levels in blood cells (r=0.192, P=0.005. Furthermore, miR-210-3p levels in both blood cells and plasma showed strong positive correlations with red blood cell counts and hemoglobin and hematocrit values. Conclusion: These data demonstrated, for the first time, that miR-210-3p might act as a circulating factor in response to hypoxic environments and could be associated with human adaptation to life at high altitudes.

  13. Scientific Opinion on Flavouring Group Evaluation 210 Revision 2 (FGE.210Rev2): Consideration of genotoxic potential for α,β-unsaturated alicyclic ketones and precursors from chemical subgroup 2.4 of FGE.19

    DEFF Research Database (Denmark)

    Beltoft, Vibe Meister; Nørby, Karin Kristiane

    Safety Authority was requested to evaluate the genotoxic potential of 14 flavouring substances in Flavouring Group Evaluation 210 (FGE.210). In FGE.210, the Panel concluded that the genotoxic potential could not be ruled out for any of the flavouring substances. In FGE.210 Revision1, the Panel.......226 and 07.231] the concern for genotoxicity remains and additional data were requested. The Flavour Industry has submitted additional genotoxicity data for allyl a-ionone [FL-no: 07.061], that are evaluated in the present revision of FGE.210 (Revision 2). Based on these new data the Panel concluded...

  14. Concentration of {sup 210}Po in the hair of Brazilian population; Teores de {sup 210}Po no cabelo da populacao brasileira

    Energy Technology Data Exchange (ETDEWEB)

    Kelecom, Alphonse; Gouvea, Rita C.S.; Santos, Pedro L. [Universidade Federal Fluminense, Niteroi, RJ (Brazil). Dept. de Biologia Geral. Lab. de Radiobiologia e Radiometria

    2000-07-01

    {sup 210}Po concentrations have been determined in the hair of 118 people (57 women and 61 men), whose ages ranged from 8 to 90 years (mean: 39y). {sup 210}Po levels varied from 2,15 mBq.g{sup -1} for a medium long-haired female nonsmoker to 38,33 mBq.g{sup -1} for a 65 cigarettes-a-day male smoker (66 years old) whose diet is rich in fish. The overall mean concentration of {sup 210}Po in hair was of 7,39{+-}5,13 mBq.g{sup -1}, and was slightly higher for men (8,37{+-}6,11 mBq.g{sup -1}) than for women (6,34{+-}3,57 mBq.g{sup -1}). (author)

  15. Thallium in the marine environment: first ecotoxicological assessments in the Guadalquivir estuary and its potential adverse effect on the donana european natural reserve after the Aznalcollar mining spill (SW Spain); Talio en el medio marino: primera valoracion ecotoxicologica en el estuario del Guadalquivir y su efecto potencial adverso en la reserva natural de donana despues del vertido minero de Aznalcollar (SW de Espana).

    Energy Technology Data Exchange (ETDEWEB)

    DelValls, T.A [Departamento de Quimica Fisica, Facultad de Ciencias del Mar, Universidad de Cadiz, Puerto Real, Cadiz (Spain); Saenz, V; Arias, A.M; Blasco, J [Instituto de Ciencias Marinas de Andalucia, CSIC, Puerto Real, Cadiz (Spain)

    1999-06-01

    Thallium (Tl) is an extremely toxic but little-studied element in the marine environment and practically no information has been reported on the levels of Tl in marine organisms. After the Aznalcollar mining Spill (April 1998), high levels of metals were put into the environment. This acud-contaminated medium was responsible for the initial pollution effects measured in the Guadiamar River, which is an affluent of the Guadalquivir River and very close to the biggest natural reserve in Europe (Donana). Four different species were used in the monitoring from April to September 1998 and a sediment field bioassay to check bioacumulation was performed. We present the first ecotoxicological evaluation of the mining spill in the Guadalquivir River, with reference to Tl, a little-known metal. Also, Pb and Cd data were compared to Tl during field sediment testing. Results show low levels of this metal in all of the organisms studied and they do not show any increase in the level of this metal, ranging from 40 to 90 ng g{sup -}1, 80 to 210 ng g{sup -}1, 15 to 98 ng g{sup -}1 and 75 to 125 whole body dry weight for Scrobicularia plana, Liza ramada (muscle), Crassostrea angulata and Uca Tangeri, respectively. These are the first field data of Tl concentration measured using estuarine organisms. Field sediment toxicity test results confirm those obtained during the monitoring: Tl is not bioaccumulated by the organisms (C. angulata) used in the test. The sequence in bioaccumulation of metals was Cd > Pb > Tl. Both studies, bioaccumulation and sediment toxicity, should be maintained during the next few years to really evaluate the potential effect of the mining spill on the ecosystem and society. [Spanish] El talio (Tl) es un elemento extremadamente toxico aunque poco estudiado en el medio marino y la informacion sobre niveles de Tl en organismos marinos con anterioridad al presente trabajo es practicamente nula. Despues del vertido minero de Aznalcollar (abril de 1998) se

  16. 210Po and 210Pb distribution,dissolved-particulate exchangerates, and particulate export along the North Atlantic US GEOTRACES GA03 section

    OpenAIRE

    RIGAUD, Sylvain; Stewart, Gillian; Baskaran, Mark; Marsan, D; Church, Thomas

    2015-01-01

    International audience; North Atlantic Ocean Hydrothermal plume Benthic nepheloid layer GEOTRACES a b s t r a c t Vertical profiles of 210 Po and 210 Pb in the water column were measured in the dissolved phase (o0.45 mm), and small (0.8–51 mm) and large (4 51 mm) particles at seven stations along the US GEOTRACES North Atlantic Zonal Transect (GA03). Mass balance calculations were employed to assess nuclide exchange rates at the dissolved-small particle interface and between small and large p...

  17. Iodine-123 phenylpentadecanoic acid and single photon emission computed tomography in identifying left ventricular regional metabolic abnormalities in patients with coronary heart disease: comparison with thallium-201 myocardial tomography.

    Science.gov (United States)

    Hansen, C L; Corbett, J R; Pippin, J J; Jansen, D E; Kulkarni, P V; Ugolini, V; Henderson, E; Akers, M; Buja, L M; Parkey, R W

    1988-07-01

    Iodine-123 phenylpentadecanoic acid (IPPA) is a synthetic long chain fatty acid with myocardial kinetics similar to palmitate. Two hypotheses were tested in this study. The first hypothesis was that IPPA imaging with single photon emission computed tomography (SPECT) is useful in the identification of patients with coronary artery disease. Fourteen normal volunteers (aged 27 +/- 2 years) and 33 patients (aged 54 +/- 11 years) with stable symptomatic coronary artery disease and at least one major coronary artery with luminal diameter narrowing greater than or equal to 70% were studied with symptom-limited maximal exercise testing. The IPPA (6 to 8 mCi) was injected 1 min before the termination of exercise, and tomographic imaging was performed beginning at 9 min and repeated at 40 min after the injection of IPPA. Nine of the normal volunteers and 13 of the patients had a second examination performed at rest on another day. Using the limits of normal as 2 SD from the normal mean values, 27 of the 33 patients with coronary artery disease demonstrated abnormalities in either the initial distribution or the clearance of IPPA, or both. Nineteen of the 33 patients had a maximal variation of activity distribution of greater than or equal to 25% on the 9 min IPPA images. Twenty-two of the 33 patients had a maximal variation in IPPA washout greater than 17% and 17 had a washout rate less than or equal to 2%. There was good agreement between the location of significant coronary artery stenoses and abnormalities in the initial distribution and clearance of IPPA. The second hypothesis tested was that IPPA imaging is as or more sensitive and, therefore, complementary to thallium-201 imaging in the identification of exercise-induced ischemia in patients. Twenty-five of the 33 patients underwent both thallium-201 and IPPA tomographic imaging after symptom-limited maximal exercise testing. The amount of exercise performed by each patient during both studies was similar. Twenty

  18. 44 CFR 19.210 - Military and merchant marine educational institutions.

    Science.gov (United States)

    2010-10-01

    ... 44 Emergency Management and Assistance 1 2010-10-01 2010-10-01 false Military and merchant marine... the merchant marine. ... PROGRAMS OR ACTIVITIES RECEIVING FEDERAL FINANCIAL ASSISTANCE Coverage § 19.210 Military and merchant...

  19. 30 CFR 210.54 - Must I submit this royalty report electronically?

    Science.gov (United States)

    2010-07-01

    ... MINERALS REVENUE MANAGEMENT FORMS AND REPORTS Royalty Reports-Oil, Gas, and Geothermal Resources § 210.54... media types, unless MMS instructs you differently: (1) Electronic Data Interchange (EDI)—The direct...

  20. 20 CFR 665.210 - What are allowable Statewide workforce investment activities?

    Science.gov (United States)

    2010-04-01

    ... five percent administrative cost limitation at 20 CFR 667.210(a)(1). (b) Providing capacity building... assist in skills upgrading; and (2) Programs targeted to Empowerment Zones and Enterprise Communities. (e...

  1. Luminescent one- and two-dimensional extended structures and a loosely associated dimer based on platinum(II)-thallium(I) backbones.

    Science.gov (United States)

    Forniés, Juan; García, Ana; Lalinde, Elena; Moreno, M Teresa

    2008-05-05

    Neutralization reactions between (NBu4)2[ trans-Pt(C 6F5)2(CN)2] 1 and (NBu4)2[cis-Pt(C6F5)2(CN)2] 2 with TlPF 6 have been carried out, and the resulting structures of [trans,trans,trans-Tl2{Pt(C6F5)2(CN)2}.(CH3COCH3) ] n [4.(CH3COCH3)2] n and {Tl[Tl{cis-Pt(C6F5)2(CN)2}].(H2O)} n [5.(H2O)] n have been determined by X-ray crystallography. Remarkably, the change from trans to cis geometry on the platinum substrate causes a significant decrease in the Pt(II)...Tl(I) metallophilic interaction. Thus, the platinum center in the trans fragment easily connects with two Tl(I) ions forming a distorted pseudo-octahedron PtTl2, which generates a final two-dimensional layered structure by secondary additional intermolecular Tl(I)...N(CN) interactions. However, the [cis-Pt(C6F5)2(CN)2] (2-) fragment interacts strongly with just one Tl center leading to an extended helical [-Pt-Tl-Pt-Tl-] n(n-) chain. In this case, the second thallium center neutralizes the anionic chain mainly through Tl...N(CN) ( intra) and Tl...F(C 6F 5) (intra and inter)actions. The reaction of TlPF 6 with the monoanionic fragment (NBu4)[cis-Pt(C6F5)2(CN)(PPh2C[triple bond]CPh)] 3 yields the discrete associated dimer [Tl{cis-Pt(C6F5)2(CN)(PPh2C[triple bond]CPh)}] 2 [ 6] 2. Dimer [ 6] 2 could be described as two square pyramids with the thallium atoms in the apical positions, connected through Tl...N(cyano) interactions. The final heteropolynuclear Pt-Tl complexes, except 4 at room temperature, show bright emission in the solid state when irradiated with UV-vis radiation, in contrast to the precursors 1 and 3, which are not luminescent. This difference indicates that the emissions in 4- 6 are presumably related to the interaction between the metal centers. The Pt-Tl bonding interactions and, consequently, the emissive properties are lost in solution at room temperature, as shown by the conductivity and NMR measurements. However, variable-concentration luminescence measurements in glassy acetonitrile solutions

  2. Rapid determination of 210Po in water samples

    Energy Technology Data Exchange (ETDEWEB)

    Maxwell, Sherrod L.; Culligan, Brian K.; Hutchison, Jay B.; Utsey, Robin C.; McAlister, Daniel R.

    2013-08-02

    A new rapid method for the determination of 210Po in water samples has been developed at the Savannah River National Laboratory (SRNL) that can be used for emergency response or routine water analyses. If a radiological dispersive device (RDD) event or a radiological attack associated with drinking water supplies occurs, there will be an urgent need for rapid analyses of water samples, including drinking water, ground water and other water effluents. Current analytical methods for the assay of 210Po in water samples have typically involved spontaneous auto-deposition of 210Po onto silver or other metal disks followed by counting by alpha spectrometry. The auto-deposition times range from 90 minutes to 24 hours or more, at times with yields that may be less than desirable. If sample interferences are present, decreased yields and degraded alpha spectrums can occur due to unpredictable thickening in the deposited layer. Separation methods have focused on the use of Sr Resin, often in combination with 210Pb analysis. A new rapid method for 210Po in water samples has been developed at the Savannah River National Laboratory (SRNL) that utilizes a rapid calcium phosphate co-precipitation method, separation using DGA Resin (N,N,N,N-tetraoctyldiglycolamide extractant-coated resin, Eichrom Technologies or Triskem-International), followed by rapid microprecipitation of 210Po using bismuth phosphate for counting by alpha spectrometry. This new method can be performed quickly with excellent removal of interferences, high chemical yields and very good alpha peak resolution, eliminating any potential problems with the alpha source preparation for emergency or routine samples. A rapid sequential separation method to separate 210Po and actinide isotopes was also developed. This new approach, rapid separation with DGA Resin plus microprecipitation for alpha source preparation, is a significant advance in

  3. Small Molecule Inhibition of microRNA-210 Reprograms an Oncogenic Hypoxic Circuit.

    Science.gov (United States)

    Costales, Matthew G; Haga, Christopher L; Velagapudi, Sai Pradeep; Childs-Disney, Jessica L; Phinney, Donald G; Disney, Matthew D

    2017-03-08

    A hypoxic state is critical to the metastatic and invasive characteristics of cancer. Numerous pathways play critical roles in cancer maintenance, many of which include noncoding RNAs such as microRNA (miR)-210 that regulates hypoxia inducible factors (HIFs). Herein, we describe the identification of a small molecule named Targapremir-210 that binds to the Dicer site of the miR-210 hairpin precursor. This interaction inhibits production of the mature miRNA, derepresses glycerol-3-phosphate dehydrogenase 1-like enzyme (GPD1L), a hypoxia-associated protein negatively regulated by miR-210, decreases HIF-1α, and triggers apoptosis of triple negative breast cancer cells only under hypoxic conditions. Further, Targapremir-210 inhibits tumorigenesis in a mouse xenograft model of hypoxic triple negative breast cancer. Many factors govern molecular recognition of biological targets by small molecules. For protein, chemoproteomics and activity-based protein profiling are invaluable tools to study small molecule target engagement and selectivity in cells. Such approaches are lacking for RNA, leaving a void in the understanding of its druggability. We applied Chemical Cross-Linking and Isolation by Pull Down (Chem-CLIP) to study the cellular selectivity and the on- and off-targets of Targapremir-210. Targapremir-210 selectively recognizes the miR-210 precursor and can differentially recognize RNAs in cells that have the same target motif but have different expression levels, revealing this important feature for selectively drugging RNAs for the first time. These studies show that small molecules can be rapidly designed to selectively target RNAs and affect cellular responses to environmental conditions, resulting in favorable benefits against cancer. Further, they help define rules for identifying druggable targets in the transcriptome.

  4. Enhanced Atomic Desorption of 209 and 210 Francium from Organic Coating

    OpenAIRE

    2017-01-01

    Controlled atomic desorption from organic Poly-DiMethylSiloxane coating is demonstrated for improving the loading efficiency of 209,210Fr magneto-optical traps. A three times increase in the cold atoms population is obtained with contact-less pulsed light-induced desorption, applied to different isotopes, either bosonic or fermionic, of Francium. A six times increase of 210Fr population is obtained with a desorption mechanism based on direct charge transfer from a triboelectric probe to the a...

  5. Plasma autoantibodies against apolipoprotein B-100 peptide 210 in subclinical atherosclerosis.

    Science.gov (United States)

    McLeod, Olga; Silveira, Angela; Fredrikson, Gunilla N; Gertow, Karl; Baldassarre, Damiano; Veglia, Fabrizio; Sennblad, Bengt; Strawbridge, Rona J; Larsson, Malin; Leander, Karin; Gigante, Bruna; Kauhanen, Jussi; Rauramaa, Rainer; Smit, Andries J; Mannarino, Elmo; Giral, Philippe; Humphries, Steve E; Tremoli, Elena; de Faire, Ulf; Ohrvik, John; Nilsson, Jan; Hamsten, Anders

    2014-01-01

    Experimental studies have suggested that autoimmunity is involved in atherosclerosis and provided evidence that both protective and pro-atherogenic immune responses exist. This concept has received support from small clinical studies implicating autoantibodies directed against apolipoprotein B-100 (apoB-100) in human atherosclerosis. We examined circulating autoantibodies directed against native and malondialdehyde (MDA)-modified epitope p210 of apoB-100 (IgG-p210nat and IgM-p210MDA) in relation to early atherosclerosis in a large, European longitudinal cohort study of healthy high-risk individuals. IgG-p210nat and IgM-p210MDA were quantified in baseline plasma samples of 3430 participants in the IMPROVE study and related to composite and segment-specific measures of severity and rate of progression of carotid intima-media thickness (cIMT) determined at baseline and after 30 months. IgM-p210MDA autoantibody levels were independently related to several cIMT measures both in the common carotid artery and in the carotid bulb, including measures of cIMT progression, higher levels being associated with lower cIMT or slower cIMT progression. Consistent inverse relationships were also found between plasma levels of IgG-p210nat and baseline composite measures of cIMT. These associations disappeared when adjusting for established and emerging risk factors, and there were no associations with rate of cIMT progression besides in certain secondary stratified analyses. The present study provides further evidence of involvement of autoantibodies against native and MDA-modified apoB-100 peptide 210 in cardiovascular disease in humans and demonstrates that these associations are present already at a subclinical stage of the disease. Copyright © 2013 Elsevier Ireland Ltd. All rights reserved.

  6. Simultaneous dual myocardial imaging with iodine-123-[beta]-methyl iodophenyl-pentadecanoic acid (BMIPP) and thallium-201 in patients with coronary heart disease

    Energy Technology Data Exchange (ETDEWEB)

    Tawarahara, Kei; Kurata, Chinori; Taguchi, Takahisa; Aoshima, Shigeyuki; Okayama, Kenichi; Kobayashi, Akira; Yamazaki, Noboru; Kaneko, Masao (Hamamatsu Univ. School of Medicine, Shizuoka (Japan))

    1994-02-01

    To assess the clinical value of simultaneous dual myocardial imaging with iodine-123-[beta]-methyl-iodophenyl-pentadecanoic acid ([sup 123]I-BMIPP) and thallium-201 ([sup 201]TL), myocardial imaging was performed at rest and during execise in seven patients with coronary heart disease. When [sup 123]I-BMIPP and [sup 201]Tl images were compared, the initial exercise and resting images agreed 87% and 64%, respectively. In the initial resting images, the regional uptake of [sup 123]I-BMIPP was frequently less than that of [sup 201]Tl. The incidence of exercise-induced reversible defects by [sup 201]Tl in the Tl>BMIPP regions was significantly higher than that in the Tl=BMIPP regions (57% vs 4%, p<0.01) and the incidence of coronary narrowing of more than 90% in the Tl>BMIPP regions was also significantly higher than that in the Tl=BMIPP regions (91% vs 38%, p<0.01). In addition, this disparity (Tl>BMIPP) was found more frequently in regions with abnormal wall motion than in regions with normal wall motion (hypokinetic regions; 68%, severe hypokinetic or akinetic regions; 50%, vs normokinetic regions; 4%, p<0.01). In contrast, the uptake of [sup 123]I-BMIPP correlated closely with that of [sup 201]Tl in normal myocardium and the uptake of both [sup 123]I-BMIPP and [sup 201]Tl was severely reduced in myocardium with severe ischemia during exercise and prior infarction. These results indicate that dual myocardial imaging with [sup 123]I-BMIPP and [sup 201]Tl may provide a unique means of identifying patients with metabolically disturbed myocardium, such as hibernating and stunned myocardium. (author).

  7. Imaging of brain tumors in AIDS patients by means of dual-isotope thallium-201 and technetium-99m sestamibi single-photon emission tomography

    Energy Technology Data Exchange (ETDEWEB)

    De La Pena, R.C.; Ketonen, L.; Villanueva-Meyer, J. [Dept. of Radiology, Univ. of Texas, Galveston (United States)

    1998-10-01

    Our aim was to evaluate the use of dual-isotope thallium-201 (Tl) and technetium-99m sestamibi (sestamibi) simultaneous acquisition in brain single-photon emission tomography (SPET) for the differentiation between brain lymphoma and benign central nervous system (CNS) lesions in AIDS patients. Thirty-six consecutive patients with enhancing mass lesions on magnetic resonance (MR) imaging were included in the study. SPET of the brain was performed to obtain simultaneous Tl and sestamibi images. Regions-of-interest were drawn around the lesion and on the contralateral side to calculate uptake ratios. The final diagnosis was reached by pathologic findings in 17 patients and clinical and/or MR follow-up in 19 patients. Of the 36 patients, 11 had brain lymphoma, 1 glioblastoma multiforme, 15 toxoplasmosis and 9 other benign CNS lesions. Correlation between SPET and the final diagnosis revealed in 10 true-positive, 23 true-negative, 1 false-positive and 2 false-negative studies. All patients with toxoplasmosis had negative scans. A patient with a purulent infection had positive scans. Tl and sestamibi scans were concordant in every lesion. The same lesions that took up Tl were also visualized with sestamibi. However, sestamibi scans showed higher lesion-to-normal tissue uptake ratios (3.7{+-}1.8) compared with those of Tl (2.3{+-}0.8, P<0.002). Simultaneous acquisition of Tl and sestamibi can help differentiate CNS lymphoma from benign brain lesions in AIDS patients. (orig.) With 2 figs., 2 tabs., 34 refs.

  8. Technetium-99m pyrophosphate/thallium-201 dual-isotope SPECT imaging predicts reperfusion injury in patients with acute myocardial infarction after reperfusion

    Energy Technology Data Exchange (ETDEWEB)

    Akutsu, Yasushi; Kaneko, Kyouichi; Kodama, Yusuke; Li, Hui-Ling; Nishimura, Hideki; Hamazaki, Yuji; Kobayashi, Youichi [Showa University School of Medicine, Division of Cardiology, Department of Medicine, Tokyo (Japan); Suyama, Jumpei; Shinozuka, Akira; Gokan, Takehiko [Showa University School of Medicine, Department of Radiology, Tokyo (Japan)

    2009-02-15

    Microcirculatory failure after reperfusion is clinically indicated to cause reperfusion injury whereas excessive intracellular calcium ion overload is experimentally proved as a key mechanism of reperfusion injury. We hypothesized that technetium-99m ({sup 99m}Tc) pyrophosphate (Tc-PYP) uptake in injured but viable infarct-related myocardium with preserved myocardial perfusion after reperfusion estimated by thallium-201 ({sup 201}Tl) uptake would be associated with final functional recovery. Dual-isotope Tc-PYP/{sup 201}Tl single-photon emission computed tomography (SPECT) was performed 2 days after successful reperfusion therapy in patients with first acute myocardial infarction, and 50 patients (63 {+-} 13 years old, female 22%) with preserved {sup 201}Tl uptakes of {>=}50% in reperfused myocardium was followed for 1 month. Tc-PYP uptake was assessed as the heart-to-sternum (H/S) ratio. Two-dimensional echocardiography was also performed 2 days and 1 month after reperfusion to evaluate functional recovery. High Tc-PYP uptake, defined as the H/S ratio {>=}0.81, was predictive of chronic phase no functional recovery (73.7% in 14 of 19 patients with high uptake vs 16.1% in five of 31 patients without those, p < 0.0001). After adjustment for potential confounding variables, including electrocardiographic persistent ST segment elevation at 1 h after reperfusion, high Tc-PYP uptake remained independently predictive of no functional recovery with odds ratio of 8.7 (95% confidential interval = 2 to 38.7; p = 0.005). High Tc-PYP uptake in reperfused but viable infarct-related myocardium was a powerful predictor of no functional recovery, which may reflect excessive intracellular calcium ion overload caused by reperfusion injury. Tc-PYP/{sup 201}Tl dual-isotope SPECT imaging can provide prognostic information after reperfusion. (orig.)

  9. BaHg2Tl2. An unusual polar intermetallic phase with strong differentiation between the neighboring elements mercury and thallium.

    Science.gov (United States)

    Dai, Jing-Cao; Gupta, Shalabh; Gourdon, Olivier; Kim, Hyun-Jeong; Corbett, John D

    2009-06-24

    High yields of the novel BaHg(2)Tl(2) are achieved from reactions of the appropriate cast alloys at approximately 400 degrees C. (Isotypic SrHg(2)Tl(2) also exists.) The tetragonal barium structure (P4(2)/mnm, a = 10.606 A, c = 5.159 A) was refined from both single-crystal X-ray and neutron powder diffraction data in order to ensure the atom site assignments although distances and calculated atom site population also support the results. The Hg and Tl network atoms are distinctive in their functions and bonding. Parallel chains of Hg hexagons and of Tl tetrahedra along c are constructed from polyhedra that share opposed like edges, and these are in turn interconnected by Hg-Tl bonds. Overall, the number of Tl-Tl bonds per cell exceeds the Hg-Hg type by 20:12, but these are approximately 1:2 each in bonding according to their average -ICOHP values (related to overlap populations). Barium is bound within a close 15-atom polyhedron, 12 atoms of which are the more electronegative Hg. LMTO-ASA calculations show that scalar relativistic effects are particularly important for Hg 5d-6s mixing in Hg-Hg and Hg-Tl bonding, whereas relatively separate Tl 6s and 6p states are more important in Tl-Tl interactions. The 6p states of Hg and Tl and 5d of Ba define a dominant conduction band around E(F), and the phase is metallic and Pauli-like paramagnetic. The thallium characteristics here are close to those in numerous alkali-metal-Tl cluster systems. Other active metal-mercury phases that have been studied theoretically are all distinctly electron-richer and more reduced, and without appreciable net 5d, 6s contributions to Hg-Hg bonding.

  10. Removal of 210Po from aqueous media and its thermodynamics and kinetics.

    Science.gov (United States)

    Erenturk, S Akyil; Kaygun, A Kilincarslan

    2017-08-01

    In this study, the composite adsorbent as granule was prepared by mixing of polyacrylonitrile (PAN) and a natural zeolite (clinoptilolite) in specific conditions. The prepared composite adsorbent was used for investigating the adsorption behaviour of 210Po. Adsorption of 210Po was studied in a column system. The effective parameters such as initial activity concentration of 210Po, pH of the aqueous solution, contact time and temperature of solution for adsorption behaviour of 210Po were studied. Adsorption yield of 210Po on composite adsorbent from aqueous solution in optimum conditions were determined as 75.00 ± 0.15%. The adsorption equilibrium data was examined using various well-known isotherm models such as Freundlich, Langmuir, Dubinin and Radushkevish and Tempkin, and it was observed that the experimental equilibrium data well fitted and found to be in good agreement with the Tempkin model. Adsorption thermodynamics and kinetics of the polonium were studied. It was found that the processes for 210Po were exothermic and spontaneous. The kinetic data conformed better to the pseudo-second order equation. Copyright © 2017 Elsevier Ltd. All rights reserved.

  11. Calibration and measurement of {sup 210}Pb using two independent techniques

    Energy Technology Data Exchange (ETDEWEB)

    Villa, M. [Centro de Investigacion, Tecnologia e Innovacion, CITIUS, Universidad de Sevilla, Av. Reina Mercedes 4B, 41012 Sevilla (Spain)], E-mail: mvilla@us.es; Hurtado, S. [Centro de Investigacion, Tecnologia e Innovacion, CITIUS, Universidad de Sevilla, Av. Reina Mercedes 4B, 41012 Sevilla (Spain); Manjon, G.; Garcia-Tenorio, R. [Departamento de Fisica Aplicada II, E.T.S. Arquitectura, Universidad de Sevilla, Av. Reina Mercedes 2, 41012 Sevilla (Spain)

    2007-10-15

    An experimental procedure has been developed for a rapid and accurate determination of the activity concentration of {sup 210}Pb in sediments by liquid scintillation counting (LSC). Additionally, an alternative technique using {gamma}-spectrometry and Monte Carlo simulation has been developed. A radiochemical procedure, based on radium and barium sulphates co-precipitation have been applied to isolate the Pb-isotopes. {sup 210}Pb activity measurements were done in a low background scintillation spectrometer Quantulus 1220. A calibration of the liquid scintillation spectrometer, including its {alpha}/{beta} discrimination system, has been made, in order to minimize background and, additionally, some improvements are suggested for the calculation of the {sup 210}Pb activity concentration, taking into account that {sup 210}Pb counting efficiency cannot be accurately determined. Therefore, the use of an effective radiochemical yield, which can be empirically evaluated, is proposed. {sup 210}Pb activity concentration in riverbed sediments from an area affected by NORM wastes has been determined using both the proposed method. Results using {gamma}-spectrometry and LSC are compared to the results obtained following indirect {alpha}-spectrometry ({sup 210}Po) method.

  12. Variation of {sup 210}Po daily urinary excretion for male subjects at environmental level

    Energy Technology Data Exchange (ETDEWEB)

    Hoelgye, Z.; Hyza, M.; Mihalik, J.; Rulik, P.; Skrkal, J. [National Radiation Protection Institute, Prague (Czech Republic)

    2015-05-15

    {sup 210}Po was determined in 24-h urine of seven healthy males from Prague, Czech Republic, for ten consecutive days. The results show that for each volunteer, the urinary excretion of {sup 210}Po changed only little from day to day in the studied time period. For two volunteers, the difference in the daily excreted {sup 210}Po activity for two consecutive days was not significant, given the 95 % confidence interval (two sigma) of the activity measurements. The same is valid for the excretion data of the other volunteers, except for some days where the differences were slightly higher. The range of daily urinary excretion of {sup 210}Po of each volunteer in the studied time period was quite narrow. Among the volunteers, the maximum daily urinary excretion value of {sup 210}Po was at most about a factor of 2.5 higher than the lowest excretion value. An attempt to explain the observed small inter-individual variability of {sup 210}Po excretion in daily urine is made. (orig.)

  13. The Golgin GMAP210/TRIP11 anchors IFT20 to the Golgi complex.

    Directory of Open Access Journals (Sweden)

    John A Follit

    2008-12-01

    Full Text Available Eukaryotic cells often use proteins localized to the ciliary membrane to monitor the extracellular environment. The mechanism by which proteins are sorted, specifically to this subdomain of the plasma membrane, is almost completely unknown. Previously, we showed that the IFT20 subunit of the intraflagellar transport particle is localized to the Golgi complex, in addition to the cilium and centrosome, and hypothesized that the Golgi pool of IFT20 plays a role in sorting proteins to the ciliary membrane. Here, we show that IFT20 is anchored to the Golgi complex by the golgin protein GMAP210/Trip11. Mice lacking GMAP210 die at birth with a pleiotropic phenotype that includes growth restriction, ventricular septal defects of the heart, omphalocele, and lung hypoplasia. Cells lacking GMAP210 have normal Golgi structure, but IFT20 is no longer localized to this organelle. GMAP210 is not absolutely required for ciliary assembly, but cilia on GMAP210 mutant cells are shorter than normal and have reduced amounts of the membrane protein polycystin-2 localized to them. This work suggests that GMAP210 and IFT20 function together at the Golgi in the sorting or transport of proteins destined for the ciliary membrane.

  14. Excess of polonium-210 activity in the surface urban atmosphere. Part 2: origin of ²¹⁰Po excess.

    Science.gov (United States)

    Długosz-Lisiecka, Magdalena

    2015-02-01

    The presence of significant (210)Po activity, unsupported by its grandparent radionuclide (210)Pb, in the surface atmosphere of industrialized regions can originate from human technical activities. In urban air, the activity ratio of (210)Po to (210)Pb might increase as a result of natural condensation and coagulation processes of relatively volatile (210)Po-containing species emitted during coal combustion processes. The presence of excess of (210)Po cannot be explained by its in-growth from radioactive decay of (210)Bi. About 50% of (210)Po radionuclide released during coal combustion processes can be emitted into air as gaseous or ultrafine products. Subsequently, these products are quickly attached to the surface of fine particles suspended in the air. As a result, an excess of (210)Po activity in aerosols has been reported. However, in this manner, As much as 11 GBq of (210)Po per year can enter the urban air from the local coal power plants in Lodz city, Poland.

  15. Accurate measurements of {sup 210}Pb in industrial wastes for environmental radiation risk assessment purpose

    Energy Technology Data Exchange (ETDEWEB)

    Bonczyk, Michal; Michalik, Boguslaw [Central Mining Institute, Silesian Centre for Environmental Radioactivity, Plac Gwarkow 1, 40-166 Katowice (Poland)

    2014-07-01

    Lead {sup 210}Pb is a naturally occurring radioactive nuclide element of the uranium ({sup 238}U) radioactive series. It is produced as a result of the decay of so-called short-lived progenies of {sup 222}Rn, i.e. {sup 214}Po (99.98%) and {sup 214}Bi by {sup 219}Tl (0.02%). Activity concentration of lead {sup 210}Pb could vary independently from parent radionuclides due to its physical and chemical properties, especially, due to its half-life (T{sub 1/2} = 22,3 years). Hence, its behaviour in natural environment is very complex and difficult in forecasting. Lead {sup 210}Pb in substantial amount occurs in mining, gas and oil extraction industry wastes, which are deposited in natural environment very often. Due to lack of secular equilibrium proper radiation risk assessment requires accurate concentration of {sup 210}Pb in such materials. The laboratory measurements seem to be the only reliable method in environmental radioactivity monitoring. One of the methods is gamma-ray spectrometry, which is very fast and cost-effective method to determine {sup 210}Pb concentration. On the other hand, the self-attenuation of gamma ray from {sup 210}Pb (46,5 keV) is significant and not depends only on sample density as well the chemical composition (sample matrix) is crucial. Current work describes how the self-attenuation correction factors in the case of {sup 210}Pb concentration analysis in mining wastes are important when environmental radiation risk assessment is carried out. The measurements were done for such industrial wastes as mine sediments which contain significant amount of elements with high Z-number (Barium, Lead, etc.) Experimentally obtained correction factors range between 0.51-6.96 cm{sup 2}/g. Neglecting this factor can cause a significant error or underestimations in radiological risk assessment. (authors)

  16. Variants of the Plasmodium vivax circumsporozoite protein (VK210 and VK247 in Colombian isolates

    Directory of Open Access Journals (Sweden)

    JM González

    2001-07-01

    Full Text Available Phenotypic diversity has been described in the central repeated region of the circumsporozoite protein (CSP from Plasmodium vivax. Two sequences VK210 (common and VK247 (variant have been found widely distributed in P. vivax isolates from several malaria endemic areas around the world. A third protein variant called P. vivax-like showing a sequence similar to the simian parasite P. simio-ovale has also been described. Here, using an immunofluorescent test and specific monoclonal antibodies, we assessed the presence of two of these protein variants (VK210 and VK247 in laboratory produced sporozoite. Both sequences were found in parasite isolates coming from different geographic regions of Colombia. Interestingly, sporozoites carrying the VK247 sequence were more frequently produced in Anopheles albimanus than sporozoites with the VK210 sequence. This difference in sporozoites production was statistically significant (p <0.05, Kruskal-Wallis; not correlation was found with parameters as the total number of parasites or gametocytes in blood from human donors used to feed mosquitoes. Previous studies in the same region have shown a higher prevalence of anti-VK210 antibodies which in theory may suggest their role in blocking the development of sporozoites carrying the CSP VK210 sequence.

  17. Increase of {sup 210}Po levels in human semen fluid after mussel ingestion

    Energy Technology Data Exchange (ETDEWEB)

    Kelecom, Alphonse, E-mail: lararapls@hotmail.co [Laboratory of Radiobiology and Radiometry-LARARA-PLS, Universidade Federal Fluminense, P.O.Box 100.436, 24001-970 Niteroi, RJ (Brazil); Programs in Environmental Science and Marine Biology, Universidade Federal Fluminense, Niteroi, RJ (Brazil); Gouvea, Rita de Cassia dos Santos [Laboratory of Radiobiology and Radiometry-LARARA-PLS, Universidade Federal Fluminense, P.O.Box 100.436, 24001-970 Niteroi, RJ (Brazil)

    2011-05-15

    Polonium-210 ({sup 210}Po) radioactive concentrations were determined in human semen fluid of vasectomized non-smoker volunteers. The {sup 210}Po levels ranged from 0.10 to 0.39 mBq g{sup -1} (mean: 0.23 {+-} 0.08 mBq g{sup -1}). This value decreased to 0.10 {+-} 0.02 mBq g{sup -1} (range from 0.07 to 0.13 mBq g{sup -1}) after two weeks of a controlled diet, excluding fish and seafood. Then, volunteers ate during a single meal 200 g of the cooked mussel Perna perna L., and {sup 210}Po levels were determined again, during ten days, in semen fluid samples collected every morning. Volunteers continued with the controlled diet and maintained sexual abstinence through the period of the experiment. A 300% increase of {sup 210}Po level was observed the day following mussel consumption, with a later reduction, such that the level returned to near baseline by day 4.

  18. The golgin GMAP-210 is required for efficient membrane trafficking in the early secretory pathway.

    Science.gov (United States)

    Roboti, Peristera; Sato, Keisuke; Lowe, Martin

    2015-04-15

    Golgins are coiled-coil proteins that participate in membrane-tethering events at the Golgi complex. Golgin-mediated tethering is thought to be important for vesicular trafficking and Golgi organization. However, the degree to which individual golgins contribute to these processes is poorly defined, and it has been proposed that golgins act in a largely redundant manner. Previous studies on the golgin GMAP-210 (also known as TRIP11), which is mutated in the rare skeletal disorder achondrogenesis type 1A, have yielded conflicting results regarding its involvement in trafficking. Here, we re-investigated the trafficking role of GMAP-210, and found that it is indeed required for efficient trafficking in the secretory pathway. GMAP-210 acts at both the endoplasmic reticulum (ER)-to-Golgi intermediate compartment (ERGIC) and Golgi complex during anterograde trafficking, and is also required for retrograde trafficking to the ER. Using co-depletion experiments, we also found that GMAP-210 acts in a partially redundant manner with the golgin GM130 to ensure efficient anterograde cargo delivery to the cis-Golgi. In summary, our results indicate a role for GMAP-210 in several trafficking steps at the ER-Golgi interface, some of which are partially redundant with another golgin, namely GM130 (also known as GOLGA2). © 2015. Published by The Company of Biologists Ltd.

  19. The Radial Growth Rate of Japanese Precious Corals Using Pb-210 Dating Method

    Science.gov (United States)

    Yamada, M.; Iwasaki, N.; Suzuki, A.; Aono, T.

    2014-12-01

    Precious corals belong to the subclass Octocorallia of the class Anthozoa. Its major component is calcium carbonate and the crystal structure is high-Mg calcite. Their skeletal axes are used for jewellery, rosary, amulet, etc. They are found mainly in the Japanese coast, the Mediterranean and off the Midway Islands and they are distributed at a depth of 100 m to 1500m. The growing skeletons of precious corals have potential for recording environmental change. Pb-210 is a naturally occurring radionuclide with a half-life of 22.3 years. Pb-210 is a natural sediment marker suitable for dating events that have occurred over the past 100 years and has been used to measure the sedimentation rates of lake and coastal marine sediments. The objectives of this study were to measure the Pb-210 concentration in the skeletons of Japanese red coral, pink coral and white coral and to estimate the radial growth rate using Pb-210 dating method. The radial growth rate of the skeleton can be estimated by the gradual decrease in Pb-210 concentrations measured from the surface inwards. The radial growth rate of the pink coral skeleton (Corallium elatius), collected at depths of 200 to 300 m off the coast of the Ryukyu Islands, Japan, was 0.15 mm/year, so slow that it would take as long as 50 years for a colony to grow to 15 mm in diameter.

  20. Atmospheric deposition patterns of (210)Pb and (7)Be in Cienfuegos, Cuba.

    Science.gov (United States)

    Alonso-Hernández, Carlos M; Morera-Gómez, Yasser; Cartas-Águila, Héctor; Guillén-Arruebarrena, Aniel

    2014-12-01

    The radiometric composition of bulk deposition samples, collected monthly for one year, February 2010 until January 2011, at a site located in Cienfuegos (22° 03' N, 80° 29' W) (Cuba), are analysed in this paper. Measurement of (7)Be and (210)Pb activity concentrations were carried out in 12 bulk deposition samples. The atmospheric deposition fluxes of (7)Be and (210)Pb are in the range of 13.2-132 and 1.24-8.29 Bq m(-2), and their mean values are: 56.6 and 3.97 Bq m(-2), respectively. The time variations of the different radionuclide have been discussed in relation with meteorological factors and the mean values have been compared to those published in recent literature from other sites located at different latitudes. The annual average flux of (210)Pb and (7)Be were 47 and 700 Bq m(-2) y(-1), respectively. Observed seasonal variations of deposition data are explained in terms of different environmental features. The atmospheric deposition fluxes of (7)Be and (210)Pb were moderately well correlated with precipitation and well correlated with one another. The (210)Pb/(7)Be ratios in the monthly depositions samples varied in the range of 0.05-0.10 and showed a strong correlation with the number of rainy days. Copyright © 2014 Elsevier Ltd. All rights reserved.

  1. Determination of 210Pb, 210Po, 226Ra, 228Ra and uranium isotopes in drinking water in order to comply with the requirements of the EU ‘Drinking Water Directive.

    Science.gov (United States)

    Vasile, M; Loots, H; Jacobs, K; Verheyen, L; Sneyers, L; Verrezen, F; Bruggeman, M

    2016-03-01

    The European Union published in 2013 a new Drinking Water Directive with stricter requirements for measuring natural radioactivity. In order to adhere to this, a method for sequential separation of 210Pb, 210Po, 238U and 234U in drinking water was applied using UTEVA® and Sr resins. Polonium-210, 238U and 234U were quantified using alpha-particle spectrometry and 210Pb using liquid scintillation counting. Radium-226 and 228Ra were determined using 3M Empore Radium RAD Disks, and their quantification was done using a Quantulus™ 1220 liquid scintillation counter.

  2. Relative value of thallium-201 and iodine-131 scans in the detection of recurrence or distant metastasis of well differentiated thyroid carcinoma.

    Science.gov (United States)

    Lin, J D; Kao, P F; Weng, H F; Lu, W T; Huang, M J

    1998-07-01

    Radioactive iodine (131I) has been found to be more sensitive and more specific than thallium-201 for the detection of distant metastases and thyroid remnants in the neck in cases of well-differentiated thyroid carcinoma. 201Tl has been deemed particularly useful in localizing metastases or recurrence in patients with a negative 131I scan and abnormal levels of serum thyroglobulin (Tg). This study aimed to: (1) determine the value of 201Tl imaging in localizing metastases or recurrence in patients with well-differentiated thyroid carcinoma, and (2) evaluate the false-positive and false-negative results of 131I and 201Tl scintigraphy. Sixty-two thyroid remnant ablated patients who underwent simultaneous postoperative 201Tl and 131I scans and and serum Tg determinations were evaluated. Fifty patients had papillary thyroid carcinomas and 12 had follicular thyroid carcinomas. 201Tl imaging was performed before the 131I studies. Of the 62 patients who underwent 201Tl imaging studies, 24 were found to have positive results, with local recurrence or distant metastases. Patients with positive results in the 201Tl imaging studies tended to be older, were mor often male, had higher Tg levels and had a higher recurrence rate. Of these 24 patients, ten had negative diagnostic or therapeutic 131I scans. Concurrently, serum Tg levels were less than 5 ng/ml in five of these ten patients. Three patients were deemed false positive by 201Tl scans; one had a parotid tumour, one a periodontal abscess and one lung metastasis. Among the 38 patients with negative 201Tl scans, 11 had positive findings on 131I scans. Three had distant metastases: two with lung metastases and one with bone metastases. Patients with false-positive results on 131I scans included those with biliary tract stones, ovarian cysts, and breast secretion. Of the 27 patients with negative 201Tl and 131I scans, 15 had elevated serum Tg levels. Among these, local recurrence followed by lung metastases was manifested in

  3. MRI and thallium features of pigmented villonodular synovitis and giant cell tumours of tendon sheaths: a retrospective single centre study of imaging and literature review.

    Science.gov (United States)

    Lynskey, Samuel J; Pianta, Marcus J

    2015-01-01

    The purpose of this study was to characterize the MRI and thallium-201 ((201)TI) scintigraphy attributes of pigmented villonodular synovitis (PVNS) and giant cell tumours of tendon sheaths (GCTTS). The epidemiology of these uncommon lesions was also assessed and less commonly encountered pathology reported on including multifocality, necrosis and concurrent malignancy. A retrospective single centre review of MRI and (201)TI scintigraphy findings for 83 surgically proven or biopsy-proven consecutive cases of PVNS was undertaken. Radiological findings including lesion size, (201)TI uptake (as a marker of metabolic activity), location, extent and patient demographics were correlated with biopsy and surgical specimen histology. Typical appearances are described, as well as less common imaging manifestations. The study period encompassed all patients presenting or referred to a tertiary bone and soft-tissue tumour referral centre with PVNS or GCTTS between 1 January 2007 and the 1 December 2013. Lesions occur most commonly around the knee joint in the fourth decade of life, with younger patients showing a tendency to occur in the hip. Features of PVNS and GTTS include bone erosion, ligamentous and cartilage replacement, muscle infiltration and multifocality. MR signal characteristics were variable but post-contrast enhancement was near-universal. 14 of 83 cases showed no uptake of (201)TI and revealed a statistically significant smaller average axial dimension of 19.8 mm than lesions displaying active (201)TI uptake of 36.4 mm, p = 0.016. Four lesions demonstrated central necrosis on gross histology, two of each from both the (201)TI-avid and (201)TI-non-avid groups. MR is the imaging modality of choice when considering the diagnosis of these uncommon tumours. (201)TI scintigraphy as a marker of metabolic activity further adds minimal value although small lesions can appear to lack (201)TI avidity. This article depicts typical imaging findings of PVNS/GCTTS and

  4. Relative value of thallium-201 and iodine-131 scans in the detection of recurrence or distant metastasis of well differentiated thyroid carcinoma

    Energy Technology Data Exchange (ETDEWEB)

    Lin Jen-Der; Weng Hsiao-Fen; Lu Wen-Tsoung [Division of Endocrinology and Metabolism, Chang Gung Memorial Hospital (Taiwan, Province of China); Kao Pan-Fu; Huang Miau-Ju [Department of Nuclear Medicine, Chang Gung Memorial Hospital, Taiwan (Taiwan, Province of China)

    1998-07-01

    Radioactive iodine ({sup 131}I) has been found to be more sensitive and more specific than thallium-201 for the detection of distant metastases and thyroid remnants in the neck in cases of well-differentiated thyroid carcinoma. {sup 201}Tl has been deemed particularly useful in localizing metastases or recurrence in patients with a negative {sup 131}I scan and abnormal levels of serum thyroglobulin (Tg). This study aimed to: (1) determine the value of {sup 201}Tl imaging in localizing metastases or recurrence in patients with well-differentiated thyroid carcinoma, and (2) evaluate the false-positive and false-negative results of {sup 131}I and {sup 201}Tl scintigraphy. Sixty-two thyroid remnant ablated patients who underwent simultaneous postoperative {sup 201}Tl and {sup 131}I scans and and serum Tg determinations were evaluated. Fifty patients had papillary thyroid carcinomas and 12 had follicular thyroid carcinomas. {sup 201}Tl imaging was performed before the {sup 131}I studies. Of the 62 patients who underwent {sup 201}Tl imaging studies, 24 were found to have positive results, with local recurrence or distant metastases. Patients with positive results in the {sup 201}Tl imaging studies tended to be older, were mor often male, had higher Tg levels and had a higher recurrence rate. Of these 24 patients, ten had negative diagnostic or therapeutic {sup 131}I scans. Concurrently, serum Tg levels were less than 5 ng/ml in five of these ten patients. Three patients were deemed false positive by {sup 201}Tl scans; one had a parotid tumour, one a periodontal abscess and one lung metastasis. Among the 38 patients with negative {sup 201}Tl scans, 11 had positive findings on {sup 131}I scans. Three had distant metastases: two with lung metastases and one with bone metastases. Patients with false-positive results on {sup 131}I scans included those with biliary tract stones, ovarian cysts, and breast secretion. Of the 27 patients with negative {sup 201}Tl and {sup 131}I

  5. Effects of adenosine and a selective A2A adenosine receptor agonist on hemodynamic and thallium-201 and technetium-99m-sestaMIBI biodistribution and kinetics.

    Science.gov (United States)

    Mekkaoui, Choukri; Jadbabaie, Farid; Dione, Donald P; Meoli, David F; Purushothaman, Kailasnath; Belardinelli, Luiz; Sinusas, Albert J

    2009-10-01

    The purpose of this study was to compare a selective A(2A) adenosine receptor agonist (regadenoson) with adenosine in clinically relevant canine models with regard to effects on hemodynamics and thallium-201 ((201)Tl) and technetium-99m ((99m)Tc)-sestaMIBI biodistribution and kinetics. The clinical application of vasodilator stress for perfusion imaging requires consideration of the effects of these vasodilating agents on systemic hemodynamics, coronary flow, and radiotracer uptake and clearance kinetics. Sequential imaging and arterial blood sampling was performed on control, anesthetized closed-chest canines (n = 7) to evaluate radiotracer biodistribution and kinetics after either a bolus administration of regadenoson (2.5 microg/kg) or 4.5-min infusion of adenosine (280 microg/kg). The effects of regadenoson on coronary flow and myocardial radiotracer uptake were then evaluated in an open-chest canine model of a critical stenosis (n = 7). Results from ex vivo single-photon emission computed tomography were compared with tissue well-counting. The use of regadenoson compared favorably with adenosine in regard to the duration and magnitude of the hemodynamic effects and the effect on (201)Tl and (99m)Tc-sestaMIBI biodistribution and kinetics. The arterial blood clearance half-time was significantly faster for (99m)Tc-sestaMIBI (regadenoson: 1.4 +/- 0.03 min; adenosine: 1.5 +/- 0.08 min) than for (201)Tl (regadenoson: 2.5 +/- 0.16 min, p adenosine: 2.7 +/- 0.04 min, p regadenoson stress was significantly greater than the relative perfusion defect with (99m)Tc-sestaMIBI (0.69 +/- 0.03%, p regadenoson produced a hyperemic response comparable to a standard infusion of adenosine. The biodistribution and clearance of both (201)Tl and (99m)Tc-sestaMIBI during regadenoson were similar to adenosine vasodilation. Ex vivo perfusion images under the most ideal conditions permitted detection of a critical stenosis, although (201)Tl offered significant advantages over (99m

  6. Comparison of 8-frame and 16-frame thallium-201 gated myocardial perfusion SPECT for determining left ventricular systolic and diastolic parameters.

    Science.gov (United States)

    Kurisu, Satoshi; Sumimoto, Yoji; Ikenaga, Hiroki; Watanabe, Noriaki; Ishibashi, Ken; Dohi, Yoshihiro; Fukuda, Yukihiro; Kihara, Yasuki

    2017-07-01

    The myocardial perfusion single photon emission computed tomography synchronized with the electrocardiogram (gated SPECT) has been widely used for the assessment of left ventricular (LV) systolic and diastolic functions using Quantitative gated SPECT. The aim of this study was to compare the effects of 8-frame and 16-frame thallium-201 (Tl-201) gated SPECT for determining LV systolic and diastolic parameters. The study population included 42 patients with suspected coronary artery disease who underwent gated SPECT by clinical indication. LV systolic and diastolic parameters were assessed on 8-frame and 16-frame gated SPECT. There were good correlations in end-diastolic volume (r = 0.99, p < 0.001), end-systolic volume (ESV) (r = 0.97, p < 0.001) and ejection fraction (EF) (r = 0.95, p < 0.001) between 8-frame and 16-frame gated SPECT. Bland-Altman plot showed a significant negative slope of -0.08 in EDV indicating a larger difference for larger EDV. Eight-frame gated SPECT overestimated ESV by 2.3 ml, and underestimated EF by -4.2% than 16-frame gated SPECT. There were good correlations in peak filling rate (PFR) (r = 0.87, p < 0.001), one third mean filling rate (r = 0.87, p < 0.001) and time to PFR (r = 0.61, p < 0.001) between 8-frame and 16-frame gated SPECT. Eight-frame gated SPECT underestimated PFR by -0.22 than 16-frame gated SPECT. Eight-frame gated SPECT estimated as much MFR/3 and TPFR as 16-frame gated SPECT. According to the data, the study suggested that 8-frame Tl-201 gated SPECT could underestimate systolic and/or diastolic parameter when compared with 16-frame gated SPECT.

  7. Study of the particulate matter transfer and dumping using {sup 210} Po et le {sup 210} Pb. Application to the Gulf of Biscary (NE Atlantic Ocean) and the Gulf of Lion (NW Mediterranean Sea) continental margins; Etude du transfert et du depot du materiel particulaire par le {sup 210} Po et le {sup 210} Pb. Application aux marges continentales du Golfe de Gascogne (NE Atlantique) et du Golfe du Lion (NW Mediterranee)

    Energy Technology Data Exchange (ETDEWEB)

    Radakovitch, O.

    1995-07-07

    {sup 210} Po and {sup 210} Pb activities and fluxes were measured on seawater, sediment-trapped material collected during one year and sediment. Focalization of {sup 210} Pb is clearly noticed on the Cap-Ferret canyon (Gulf of Biscary) and the Lacaze-Duthiers canyon (western part of the Gulf of Lion). In both sites, {sup 210} Pb fluxes in traps and sediment are always higher than {sup 210} Pb flux available from atmospheric and in situ production. On the contrary, Grand-Rhone canyon and its adjacent open slope exhibit a {sup 210} Pb budget near equilibrium in the near-bottom sediment traps, but focalization is important in the sediment. For the entire Gulf of Lion margin, focalization of {sup 210} Pb in the sediment occurred principally between 500 and 1500 m water depth on the slope, and on the middle shelf mud-patch. {sup 210} Po and {sup 210} Pb have been used in the Cap Ferret and Grand-Rhone canyons to characterize the origin of the particulate trapped material. Two main sources feed the water column. The first source, localized in surface waters, is constituted by biogenic particles from primary production and lithogenic material. The second source, deeper, is due to resuspension at the shelf break and/or on the open slope. In each site, {sup 210} Po and {sup 210} Pb activities of the trapped particles did not show any relations with the major constituents. Quantity of particles appeared to be the main factor regulating adsorption processes of these nuclides. Sedimentation rates based on {sup 210} Po profiles decreased with increasing water depth, from 0.4 ti 0.06 cm y-1 on the Cap Ferret canyon (400 to 3000 m water depth) and from 0.5 to 0.05 cm y-1 for the entire Gulf of Lion margin (50 to 2000 m water depth). (author). 243 refs.

  8. Linking sedimentary total organic carbon to 210Pbex chronology from Changshou Lake in the Three Gorges Reservoir Region, China.

    Science.gov (United States)

    Anjum, Raheel; Gao, Jinzhang; Tang, Qiang; He, Xiubin; Zhang, Xinbao; Long, Yi; Shi, Zhonglin; Wang, Mingfeng

    2017-05-01

    The influences of total organic carbon (TOC) and total nitrogen (TN) on Lead-210 (210Pb) dating have recently been of increasing concern in lacustrine research. Sediment core from Changshou Lake in the Longxi catchment was investigated for influence of TOC on 210Pb dating. Lead-210 excess (210Pbex), Cesium-137 (137Cs) activities, TOC, TN, and particle size were measured. We proposed a dating index based on 137Cs chronology and particle size distribution of the lake sediment profile and rainfall erosivities calculated from Longxi catchment metrological records. Increasing trends in TOC and TN were specifically caused by commercial cage fish farming after 1989. The statistically significant correlation between 210Pbex activity, TOC (0.61, p = 0.04) and TN (0.51, p = 0.04), respectively explained post-1989 210Pb scavenging. The 210Pbex activity was closely related with coupled peaks of TOC and TN from mass depth 5-10 g cm-2. Higher TOC/TN ratio (8.33) indicated submerged macrophytes and native aquatic algal growth as main source of carbon from enhanced primary productivity because of massive fertilizer use and coherent climate warming. The study supported key hypothesis on vital role of fertilizer usage and algal derived TOC in controlling sedimentary 210Pbex activity at Changshou Lake sediment. 137Cs profile and erosive events as time markers provided reliable and consistent sedimentation rate of (1.6 cm y-1). 210Pbex activity decayed exponentially after peak at mass depth 5.68 g cm-2. Therefore, violation of 210Pb dating primary assumptions made it inappropriate for sediment dating at Changshou Lake. TOC content must be considered while using 210Pb as dating tool for lake sediment profiles. Copyright © 2017 Elsevier Ltd. All rights reserved.

  9. {sup 210}Po in marine organisms consumed by the population of Seville; {sup 210}PO en organismos marinos consumidos por la poblacion sevillana

    Energy Technology Data Exchange (ETDEWEB)

    Diaz-Frances, I.; Mantero, J.; Manjon, G.; Garcia-Tenorio, R.

    2011-07-01

    The natural radionuclide {sup 210}Po is one belonging to the series of uranium, which is ubiquitously present in trace quantities in the various environmental compartments (water, soil, air) and through its route along the food chain may end incorporated into the human body via food or water intake. This radionuclide is highly radio toxic, presenting the highest value for the ingestion dose coefficient for adults. The Spanish population is an important component of their diet to marine products. found higher values of ingestion dose in the Spanish population compared to other European populations where the culture of introducing fish into your diet is not so entered. The study detailed here estimates the contribution of {sup 2}10Po to the ingestion dose received by the Sevillian population due to consumption of fish, mollusks and crustaceans. The results obtained in this study will be presented and discussed in this paper. (Author)

  10. Evaluation of the contribution of smoking to total blood polonium-210 in Saudi population

    Energy Technology Data Exchange (ETDEWEB)

    Shabana, E.I. E-mail: eshabana@kacst.edu.sa; Elaziz, M.A. Abd; Al-Arifi, M.N.; Al-Dhawailie, A.A.; Al-Bokari, M.M-A

    2000-01-01

    A preliminary study of {sup 210}Po concentrations in the blood of some smokers and nonsmokers is presented in order to evaluate the contribution of smoking to total blood {sup 210}Po in Saudi population. Blood samples were collected from 30 volunteers and analyzed by high resolution {alpha}-spectrometry using a radiochemical technique. The technique is based on the separation of polonium from other components of the sample by wet ashing with an HNO{sub 3}/H{sub 2}O{sub 2} oxidizing mixture and spontaneous deposition on a silver disc under the relevant conditions for {alpha}-particle counting. The results indicated that a significant fraction (about 30%) of blood {sup 210}Po is related to smoking.

  11. 137Cs and 210Po in Pacific Walrus and Bearded Seal from St. Lawrence Island, Alaska

    Energy Technology Data Exchange (ETDEWEB)

    Hamilton, T F; Seagars, D J; Jokela, T; Layton, D

    2005-02-02

    The activity concentration of Cesium-137 ({sup 137}Cs) and naturally-occurring Polonium-210 ({sup 210}Po) were measured in the muscle tissue, kidney and liver of Pacific walrus (Odobenus rosmarus divergens) and bearded seal (Erignathus barbatus) collected by native hunters from the Bering Sea. The mean {sup 137}Cs concentrations in muscle, liver and kidney of Pacific walrus were 0.07, 0.09 and 0.07 Bq kg{sup -1} (N= 5, wet weight), respectively, and 0.17, 0.10, and 0.17 Bq kg{sup -1} (N=2, wet weight), respectively, in bearded seal. In general, {sup 137}Cs tissue concentrations are significantly lower than those previously reported for mammals from other regions. By comparison, {sup 210}Po activity concentrations appear to be higher than those reported elsewhere but a larger variation. The mean {sup 210}Po concentration in the muscle tissue, liver and kidney of Pacific walrus (N=5, wet weight) were 28.7, 189, and 174 Bq kg{sup -1}, respectively. This compares with {sup 210}Po concentration values (N=2, wet weight) of 27, 207, and 68 Bq kg{sup -1} measured in the muscle tissue, liver and kidney, of bearded seal, respectively. Estimated bioaccumulation factors--as defined by the radionuclide concentration ratio between the target tissue to that in sea water--were two to three orders of magnitude higher for {sup 210}Po that those of {sup 137}Cs. We conclude from radiological dose estimates that ingestion of {sup 137}Cs in foods derived from walrus and seal will pose no threat to human health. This work has important implications for assessing health risks to Alaskan coastal communities concerned about the dumping of nuclear waste in the Russia Arctic.

  12. [sup 210]Po, [sup 210]Pb, [sup 226]Ra in aquatic ecosystems and polders, anthropogenic sources, distribution and enhanced radiation doses in The Netherlands

    Energy Technology Data Exchange (ETDEWEB)

    Koester, H.W.; Marwitz, P.A. (National Inst. of Public Health and Environmental Protection (RIVM), Bilthoven (Netherlands)); Berger, G.W. (Netherlands Inst. for Sea Research, Den Burg (Netherlands)); Weers, A.W. van (Netherlands Energy Research Foundation (ECN), Petten (Netherlands)); Hagel, P. (National Inst. of Fisheries Research (RIVO-DLO), Ijmuiden (Netherlands)); Nieuwenhuize, J. (Centre for Estuarine and Coastal Ecology, Yerseke (Netherlands))

    1992-01-01

    Surveys of Dutch waters show that the Oosterschelde estuary and regular fresh waters have the lowest levels of [sup 210]Po, [sup 210]Pb and [sup 226]Ra. Elsewhere effluents from phosphates and iron ore processing industries cause nearby enhancements. At a distance of 50-100 km, enhancements of [sup 210]Po in edible parts of mussels and shrimps are of the order of 100 Bq.kg[sup -1] dry weight. Estimates indicate that high consumption rates of seafood from specific waters may result in dose enhancements of 0.1-0.3 mSv.y[sup -1] which probably affect a group of less than 1000 anglers and an unknown number of frequent mussel and shrimp consumers. Harbour sludge, with probably enhanced activity levels due to the phospho-gypsum effluents, has been used as landfill in polders around Rotterdam. Here enhanced doses of 0.3-1 mSv.y[sup -1] may occur from consumption of local livestock produce and from inhalation of enhanced indoor radon. Further research is indicated to obtain information on effluent emissions, their associated environmental enhancements and risks. (author).

  13. Speech Quality Measurement of GSM Infrastructure Built on USRP N210 and OpenBTS Project

    Directory of Open Access Journals (Sweden)

    Marcel Fajkus

    2014-01-01

    Full Text Available The paper deals with the methodology for speech quality measuring in GSM networks using Perceptual Evaluation of Speech Quality (PESQ. The paper brings results of practical measurement of own GSM network build on the Universal Software Radio Peripheral (USRP N210 hardware and OpenBTS software. This OpenBTS station was installed in open terrain, and the speech quality was measured from different distances from the transmitter. The limit parameters of OpenBTS station with USRP N210 were obtained.

  14. 238U–230Th–226Ra–210Pb–210Po disequilibria constraints on magma generation, ascent, and degassing during the ongoing eruption of Kīlauea

    Science.gov (United States)

    Girard, Guillaume; Reagan, Mark K.; Sims, Kenneth W. W.; Thornber, Carl; Waters, Christopher L.; Phillips, Erin H.

    2017-01-01

    The timescales of magma genesis, ascent, storage and degassing at Kīlauea volcano, Hawai‘i are addressed by measuring 238U-series radionuclide abundances in lava and tephra erupted between 1982 and 2008. Most analyzed samples represent lavas erupted by steady effusion from Pu‘u ‘Ō‘ō and Kūpahianaha from 1983 to 2008. Also included are samples erupted at the summit in April 1982 and March 2008, along the East Rift Zone at the onset of the ongoing eruption in January 1983, and during vent shifting episodes 54 and 56, at Nāpau crater in January 1997, and Kane Nui O Hamo in June 2007. In general, samples have small (∼4%) excesses of (230Th) over (238U) and ∼3 to ∼17% excesses of (226Ra) over (230Th), consistent with melting of a garnet peridotite source at melting rates between 1 × 10–3 and 5 × 10–3 kg m–3 a–1, and melting region porosity between ∼2 and ∼10%, in agreement with previous studies of the ongoing eruption and historical eruptions. A small subset of samples has near-equilibrium (230Th/238U) values, and thus were generated at higher melting rates. Based on U–Th–Ra disequilibria and Th isotopic data from this and earlier studies, melting processes and sources have been relatively stable over at least the past two centuries or more, including during the ongoing unusually long (>30 years) and voluminous (4 km3) eruption. Lavas recently erupted from the East Rift Zone have average initial (210Pb/226Ra) values of 0·80 ± 0·11 (1σ), which we interpret to be the result of partitioning of 222Rn into a persistently generated CO2-rich gas phase over a minimum of 8 years. This (210Pb) deficit implies an average magma ascent rate of ≤3·7 km a–1 from ∼30 km depth to the surface. Spatter and lava associated with vent-opening episodes erupt with variable (210Pb) deficits ranging from 0·7 to near-equilibrium values in some samples. The samples with near-equilibrium (210Pb/226Ra) are typically more

  15. Yield and excitation function measurements of some nuclear reactions on natural thallium induced by protons leading to the production of medical radioisotopes {sup 201}Tl and {sup 203}Pb

    Energy Technology Data Exchange (ETDEWEB)

    Al-Saleh, F.S.; Al-Harbi, A.A. [Girls College of Education, Riyadh (Saudi Arabia). Physics Dept.; Azzam, A. [Nuclear Research Center, Cairo (Egypt). Nuclear Physics Dept.

    2007-07-01

    Excitation functions for {sup 201}Pb, {sup 202m}Pb, {sup 203}Pb and {sup 204m}Pb radionuclides which are formed via proton induced reactions with natural thallium target have been measured from their respective threshold (E{sub thr}) to 27.5 MeV using activation technique. Natural copper foils were used to monitor the cyclotron beam. The integral yields (MBq/{mu}A h) of the produced radionuclides were calculated from the measured excitation functions. The optimum proton energy range for the production of {sup 203}Pb with low amount of impurities is (16-10 MeV) after 5 h of EOB. The experimental cross-sections for {sup nat}Tl(p,xn) reactions were compared with the cross-sections recommended by the IAEA and with earlier published data when it was possible. (orig.)

  16. 40 CFR 5.210 - Military and merchant marine educational institutions.

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 1 2010-07-01 2010-07-01 false Military and merchant marine... FINANCIAL ASSISTANCE Coverage § 5.210 Military and merchant marine educational institutions. These Title IX... for a military service of the United States or for the merchant marine. ...

  17. 6 CFR 17.210 - Military and merchant marine educational institutions.

    Science.gov (United States)

    2010-01-01

    ... 6 Domestic Security 1 2010-01-01 2010-01-01 false Military and merchant marine educational... Coverage § 17.210 Military and merchant marine educational institutions. These Title IX regulations do not... service of the United States or for the merchant marine. ...

  18. 24 CFR 3.210 - Military and merchant marine educational institutions.

    Science.gov (United States)

    2010-04-01

    ... 24 Housing and Urban Development 1 2010-04-01 2010-04-01 false Military and merchant marine... ACTIVITIES RECEIVING FEDERAL FINANCIAL ASSISTANCE Coverage § 3.210 Military and merchant marine educational... the training of individuals for a military service of the United States or for the merchant marine. ...

  19. 22 CFR 146.210 - Military and merchant marine educational institutions.

    Science.gov (United States)

    2010-04-01

    ... 22 Foreign Relations 1 2010-04-01 2010-04-01 false Military and merchant marine educational... § 146.210 Military and merchant marine educational institutions. These Title IX regulations do not apply... service of the United States or for the merchant marine. ...

  20. 14 CFR 1253.210 - Military and merchant marine educational institutions.

    Science.gov (United States)

    2010-01-01

    ... 14 Aeronautics and Space 5 2010-01-01 2010-01-01 false Military and merchant marine educational... Coverage § 1253.210 Military and merchant marine educational institutions. These Title IX regulations do... military service of the United States or for the merchant marine. ...

  1. 15 CFR 8a.210 - Military and merchant marine educational institutions.

    Science.gov (United States)

    2010-01-01

    ... 15 Commerce and Foreign Trade 1 2010-01-01 2010-01-01 false Military and merchant marine... Coverage § 8a.210 Military and merchant marine educational institutions. These Title IX regulations do not... service of the United States or for the merchant marine. ...

  2. 43 CFR 41.210 - Military and merchant marine educational institutions.

    Science.gov (United States)

    2010-10-01

    ... 43 Public Lands: Interior 1 2010-10-01 2010-10-01 false Military and merchant marine educational... Coverage § 41.210 Military and merchant marine educational institutions. These Title IX regulations do not... service of the United States or for the merchant marine. ...

  3. 13 CFR 113.210 - Military and merchant marine educational institutions.

    Science.gov (United States)

    2010-01-01

    ... 13 Business Credit and Assistance 1 2010-01-01 2010-01-01 false Military and merchant marine... Financial Assistance Coverage § 113.210 Military and merchant marine educational institutions. These Title... individuals for a military service of the United States or for the merchant marine. ...

  4. 22 CFR 229.210 - Military and merchant marine educational institutions.

    Science.gov (United States)

    2010-04-01

    ... 22 Foreign Relations 1 2010-04-01 2010-04-01 false Military and merchant marine educational... Coverage § 229.210 Military and merchant marine educational institutions. These Title IX regulations do not... service of the United States or for the merchant marine. ...

  5. 36 CFR 1211.210 - Military and merchant marine educational institutions.

    Science.gov (United States)

    2010-07-01

    ... 36 Parks, Forests, and Public Property 3 2010-07-01 2010-07-01 false Military and merchant marine... ACTIVITIES RECEIVING FEDERAL FINANCIAL ASSISTANCE Coverage § 1211.210 Military and merchant marine... purpose is the training of individuals for a military service of the United States or for the merchant...

  6. 41 CFR 101-4.210 - Military and merchant marine educational institutions.

    Science.gov (United States)

    2010-07-01

    ... Coverage § 101-4.210 Military and merchant marine educational institutions. These Title IX regulations do... military service of the United States or for the merchant marine. ... 41 Public Contracts and Property Management 2 2010-07-01 2010-07-01 true Military and merchant...

  7. 32 CFR 196.210 - Military and merchant marine educational institutions.

    Science.gov (United States)

    2010-07-01

    ... 32 National Defense 2 2010-07-01 2010-07-01 false Military and merchant marine educational... OR ACTIVITIES RECEIVING FEDERAL FINANCIAL ASSISTANCE Coverage § 196.210 Military and merchant marine... purpose is the training of individuals for a military service of the United States or for the merchant...

  8. 45 CFR 618.210 - Military and merchant marine educational institutions.

    Science.gov (United States)

    2010-10-01

    ... 45 Public Welfare 3 2010-10-01 2010-10-01 false Military and merchant marine educational... RECEIVING FEDERAL FINANCIAL ASSISTANCE Coverage § 618.210 Military and merchant marine educational... the training of individuals for a military service of the United States or for the merchant marine. ...

  9. 49 CFR 25.210 - Military and merchant marine educational institutions.

    Science.gov (United States)

    2010-10-01

    ... 49 Transportation 1 2010-10-01 2010-10-01 false Military and merchant marine educational... Coverage § 25.210 Military and merchant marine educational institutions. These Title IX regulations do not... service of the United States or for the merchant marine. ...

  10. 45 CFR 2555.210 - Military and merchant marine educational institutions.

    Science.gov (United States)

    2010-10-01

    ... 45 Public Welfare 4 2010-10-01 2010-10-01 false Military and merchant marine educational... ACTIVITIES RECEIVING FEDERAL FINANCIAL ASSISTANCE Coverage § 2555.210 Military and merchant marine... purpose is the training of individuals for a military service of the United States or for the merchant...

  11. 10 CFR 1042.210 - Military and merchant marine educational institutions.

    Science.gov (United States)

    2010-01-01

    ... 10 Energy 4 2010-01-01 2010-01-01 false Military and merchant marine educational institutions....210 Military and merchant marine educational institutions. These Title IX regulations do not apply to... service of the United States or for the merchant marine. ...

  12. 18 CFR 1317.210 - Military and merchant marine educational institutions.

    Science.gov (United States)

    2010-04-01

    ... RECEIVING FEDERAL FINANCIAL ASSISTANCE Coverage § 1317.210 Military and merchant marine educational... the training of individuals for a military service of the United States or for the merchant marine. ... 18 Conservation of Power and Water Resources 2 2010-04-01 2010-04-01 false Military and merchant...

  13. 38 CFR 23.210 - Military and merchant marine educational institutions.

    Science.gov (United States)

    2010-07-01

    ... ACTIVITIES RECEIVING FEDERAL FINANCIAL ASSISTANCE Coverage § 23.210 Military and merchant marine educational... the training of individuals for a military service of the United States or for the merchant marine. ... 38 Pensions, Bonuses, and Veterans' Relief 2 2010-07-01 2010-07-01 false Military and merchant...

  14. 31 CFR 28.210 - Military and merchant marine educational institutions.

    Science.gov (United States)

    2010-07-01

    ... 31 Money and Finance: Treasury 1 2010-07-01 2010-07-01 false Military and merchant marine... FINANCIAL ASSISTANCE Coverage § 28.210 Military and merchant marine educational institutions. These Title IX... for a military service of the United States or for the merchant marine. ...

  15. 49 CFR 210.29 - Operation standards (moving locomotives and rail cars).

    Science.gov (United States)

    2010-10-01

    ... 49 Transportation 4 2010-10-01 2010-10-01 false Operation standards (moving locomotives and rail... REGULATIONS Inspection and Testing § 210.29 Operation standards (moving locomotives and rail cars). The operation standards for the noise emission levels of moving locomotives, rail cars, or consists of...

  16. 17 CFR 210.12-29 - Mortgage loans on real estate. 1

    Science.gov (United States)

    2010-04-01

    ... 17 Commodity and Securities Exchanges 2 2010-04-01 2010-04-01 false Mortgage loans on real estate... § 210.12-29 Mortgage loans on real estate. 1 Column A—Description 2,3,4 Column B—Interest rate Column C... mortgage loans on real estate investments has been written down or reserved against, describe the item and...

  17. 17 CFR 210.12-24 - Real estate owned and rental income. 1

    Science.gov (United States)

    2010-04-01

    ... 17 Commodity and Securities Exchanges 2 2010-04-01 2010-04-01 false Real estate owned and rental... § 210.12-24 Real estate owned and rental income. 1 Part 1—Real estate owned at end of period Column A... In a separate schedule classify by states in which the real estate owned is located the total amounts...

  18. 17 CFR 210.3-15 - Special provisions as to real estate investment trusts.

    Science.gov (United States)

    2010-04-01

    ... Financial Statements § 210.3-15 Special provisions as to real estate investment trusts. (a)(1) The income... real estate investment trust under applicable provisions of the Internal Revenue Code as amended shall... 17 Commodity and Securities Exchanges 2 2010-04-01 2010-04-01 false Special provisions as to real...

  19. Yeast Interacting Proteins Database: YOR210W, YDR527W [Yeast Interacting Proteins Database

    Lifescience Database Archive (English)

    Full Text Available YOR210W RPB10 RNA polymerase subunit ABC10-beta, common to RNA polymerases I, II, and III Rows with this...description RNA polymerase subunit ABC10-beta, common to RNA polymerases I, II, and III Rows with this

  20. 17 CFR 210.6A-05 - What schedules are to be filed.

    Science.gov (United States)

    2010-04-01

    ... ACT OF 1934, PUBLIC UTILITY HOLDING COMPANY ACT OF 1935, INVESTMENT COMPANY ACT OF 1940, INVESTMENT ADVISERS ACT OF 1940, AND ENERGY POLICY AND CONSERVATION ACT OF 1975 Employee Stock Purchase, Savings and... audited. Schedule I—Investments. A schedule substantially in form prescribed by § 210.12-12 shall be filed...

  1. 17 CFR 210.2-02 - Accountants' reports and attestation reports.

    Science.gov (United States)

    2010-04-01

    ... 17 Commodity and Securities Exchanges 2 2010-04-01 2010-04-01 false Accountants' reports and... Accountants § 210.2-02 Accountants' reports and attestation reports. (a) Technical requirements for accountants' reports. The accountant's report: (1) Shall be dated; (2) Shall be signed manually; (3) Shall...

  2. Acute hypoxia induces upregulation of microRNA-210 expression in glioblastoma spheroids

    DEFF Research Database (Denmark)

    Rosenberg, Tine Agerbo; Thomassen, Mads; Jensen, Stine Skov

    2015-01-01

    & METHODS: Glioblastoma spheroid cultures were grown in either 2 or 21% oxygen. Subsequently, miRNA profiling was performed and expression of ten stem cell markers was examined. RESULTS: MiRNA-210 was significantly upregulated in hypoxia in patient-derived spheroids. The stem cell markers displayed...

  3. 30 CFR 285.210 - How does MMS initiate the competitive leasing process?

    Science.gov (United States)

    2010-07-01

    ..., or more specific schedule of lease sales pertaining to one or more types of renewable energy. ... OFFSHORE RENEWABLE ENERGY ALTERNATE USES OF EXISTING FACILITIES ON THE OUTER CONTINENTAL SHELF Issuance of OCS Renewable Energy Leases Competitive Lease Process § 285.210 How does MMS initiate the competitive...

  4. 30 CFR 210.102 - What production reports must I submit?

    Science.gov (United States)

    2010-07-01

    ... MANAGEMENT FORMS AND REPORTS Production Reports-Oil and Gas § 210.102 What production reports must I submit? (a) Form MMS-4054, Oil and Gas Operations Report. If you operate a Federal or Indian onshore or OCS oil and gas lease or federally approved unit or communitization agreement that contains one or more...

  5. 17 CFR 210.3A-03 - Statement as to principles of consolidation or combination followed.

    Science.gov (United States)

    2010-04-01

    ... separate financial statements, including the principles followed in determining the inclusion or exclusion... AND EXCHANGE COMMISSION FORM AND CONTENT OF AND REQUIREMENTS FOR FINANCIAL STATEMENTS, SECURITIES ACT... Consolidated and Combined Financial Statements § 210.3A-03 Statement as to principles of consolidation or...

  6. 32 CFR 37.210 - To what types of recipients may I award a TIA?

    Science.gov (United States)

    2010-07-01

    ... GRANT AND AGREEMENT REGULATIONS TECHNOLOGY INVESTMENT AGREEMENTS Appropriate Use of Technology Investment Agreements § 37.210 To what types of recipients may I award a TIA? (a) As a matter of DoD policy... potential for additional self-governance is particularly good when a consortium includes multiple for-profit...

  7. 17 CFR 210.6-10 - What schedules are to be filed.

    Science.gov (United States)

    2010-04-01

    ... ACT OF 1934, PUBLIC UTILITY HOLDING COMPANY ACT OF 1935, INVESTMENT COMPANY ACT OF 1940, INVESTMENT ADVISERS ACT OF 1940, AND ENERGY POLICY AND CONSERVATION ACT OF 1975 Registered Investment Companies § 210...) Management investment companies. (1) Except as otherwise provided in the applicable form, the schedules...

  8. {sup 137}Cs and {sup 210}Pb inventories in soils and sediments from Chapala Lake (Mexico)

    Energy Technology Data Exchange (ETDEWEB)

    Ruiz-Fernandez, A.C.; Perez-Bernal, L.H. [Unidad Academica Mazatlan, Instituto de Ciencias del Mar y Limnologia, Universidad Nacional Autonoma de Mexico (Mexico); Sanchez-Cabeza, J.A. [Unidad Academica de Procesos Oceanicos y Costeros, Instituto de Ciencias del Mar y Limnologia, Universidad Nacional Autonoma de Mexico (Mexico); Ontiveros-Cuadras, J.F. [Posgrado en Ciencias del Mar y Limnologia, Instituto de Ciencias del Mar y Limnologia, Universidad Nacional Autonoma de Mexico (Mexico)

    2014-07-01

    Chapala Lake is the largest natural freshwater reservoir in Mexico and it is located in Central Mexico, at 1524 m above sea level. The lake is considered to be fairly anthropized and it has experienced periods of extremely low water level as a result of recent climate change and water extraction. The study of recent manifestations of global change in Chapala Lake requires accurate {sup 210}Pb chronological reconstructions, taking into account the expected variability of sediment accumulation rates by using the Constant Flux model. For a reliable application of this dating model, it is important that {sup 210}Pb flux values in the lacustrine sedimentary record are in correspondence with the local atmospheric fluxes. With the aim to estimate the fluxes of the fallout radionuclides {sup 210}Pb and {sup 137}Cs in the region, sediment and soil cores were collected in the Chapala Lake. Sediment profiles were evaluated and estimated fluxes in sediments and soils were compared. Some geochemical properties (e.g. grain size distribution, organic matter concentration, XRF-derived elemental composition and magnetic susceptibility) were also evaluated to understand how diagenesis changes and sediment provenance can affect the {sup 210}Pb and {sup 137}Cs depth profiles and inventories. Document available in abstract form only. (authors)

  9. Beryllium-7 and {sup 210}Pb atmospheric deposition measured in moss and dependence on cumulative precipitation

    Energy Technology Data Exchange (ETDEWEB)

    Krmar, M., E-mail: krmar@df.uns.ac.rs [Faculty of Science, Physics Department, Trg Dositeja Obradovića 4, Novi Sad (Serbia); Mihailović, D.T.; Arsenić, I. [Faculty of Agriculture, Trg Dositeja Obradovića 8, Novi Sad (Serbia); Radnović, D. [Faculty of Science, Biology Department, Trg Dositeja Obradovića 4, Novi Sad (Serbia); Pap, I. [Faculty of Agriculture, Trg Dositeja Obradovića 8, Novi Sad (Serbia)

    2016-01-15

    This paper focuses on analysis of the time series of {sup 7}Be and {sup 210}Pb activity measured in moss, and the amount, as well as duration of precipitation, to gain a better understanding of the possible relationships between airborne radionuclide deposition and precipitation. Here we consider whether the amount of these airborne radionuclides in moss samples is a cumulative measure of radionuclide deposition and decay, and a new approach for analyses of the relationships between precipitation and moss activity concentrations is suggested. Through these analyses it was shown that comparison of cumulative activity measured at one location using moss, normalized by values of cumulative amount or duration of precipitation, showed different regimes of airborne radionuclide deposition. - Graphical abstract: Correlation between cumulative activity of {sup 7}Be and {sup 210}Pb measured in moss samples normalized by the cumulative precipitation. - Highlights: • Use of mosses in measurement of airborne radionuclides deposition was investigated • Prior work indicated {sup 7}Be and {sup 210}Pb activities were not correlated with precipitation • This is unusual since radionuclides moss tissues depends on depositional fluxes. • A new method for study of {sup 7}Be and {sup 210}Pb depositional dynamics was developed • Different seasonal regimes of {sup 7}Be deposition are more noticeable in new technique.

  10. Sedimentation rates in Atibaia River basin, Sao Paulo State, Brazil, using {sup 210}Pb as geochronometer

    Energy Technology Data Exchange (ETDEWEB)

    Sabaris, T.P.P. [Departamento de Petrologia e Metalogenia, Universidade Estadual Paulista (UNESP), Av. 24-A, No. 1515, C.P. 178, CEP 13506-900, Rio Claro, Sao Paulo (Brazil); Bonotto, D.M., E-mail: danielbonotto@yahoo.com.b [Departamento de Petrologia e Metalogenia, Universidade Estadual Paulista (UNESP), Av. 24-A, No. 1515, C.P. 178, CEP 13506-900, Rio Claro, Sao Paulo (Brazil)

    2011-01-15

    The constant initial concentration (CIC) of unsupported/excess {sup 210}Pb model was successfully used to assess {sup 210}Pb data of nine sediment cores from Atibaia River basin, Sao Paulo State, Brazil. The {sup 210}Pb-based apparent sediment mass accumulation rates ranged from 47.7 to 782.4 mg/cm{sup 2} yr, whereas the average linear sedimentation rates between 0.16 and 1.32 cm/yr, which are compatible with the calculated sediment mass fluxes, i.e. a higher sediment mass accumulation rate yielded a higher linear sedimentation rate. The higher long-term based accumulation rate tended to be found in topographically softer regions. This occurs because the sediments are preferentially transported in topographically steeper regions instead of being deposited. Anthropic activities like deforestation possibly interfered with the natural/normal sedimentation processes, which increased in accordance with modifications on the channel drainage. The radionuclide geochronology as described in this paper allows determination of sedimentation rates that are compatible with values estimated elsewhere. The adoption of an appropriate factor generated from previous laboratory experiments resulted in a successful correction for the {sup 222}Rn-loss from the sediments, bringing the estimate of the parent-supported (in-situ produced) {sup 210}Pb to reliable values required by the CIC model.

  11. 19 CFR 210.30 - Requests for production of documents and things and entry upon land.

    Science.gov (United States)

    2010-04-01

    ... INVESTIGATIONS OF UNFAIR PRACTICES IN IMPORT TRADE ADJUDICATION AND ENFORCEMENT Discovery and Compulsory Process..., charts, photographs, and other data compilations from which information can be obtained), or to inspect... operation thereon, within the scope of § 210.27(b). (b) Procedure. (1) The request may be served upon any...

  12. 23 CFR 972.210 - Federal lands bridge management system (BMS).

    Science.gov (United States)

    2010-04-01

    ... Section 972.210 Highways FEDERAL HIGHWAY ADMINISTRATION, DEPARTMENT OF TRANSPORTATION FEDERAL LANDS HIGHWAYS FISH AND WILDLIFE SERVICE MANAGEMENT SYSTEMS Fish and Wildlife Service Management Systems § 972... framework for a BMS: (1) A database and an ongoing program for the collection and maintenance of the...

  13. 21 CFR 210.1 - Status of current good manufacturing practice regulations.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 4 2010-04-01 2010-04-01 false Status of current good manufacturing practice... SERVICES (CONTINUED) DRUGS: GENERAL CURRENT GOOD MANUFACTURING PRACTICE IN MANUFACTURING, PROCESSING, PACKING, OR HOLDING OF DRUGS; GENERAL § 210.1 Status of current good manufacturing practice regulations...

  14. 21 CFR 210.2 - Applicability of current good manufacturing practice regulations.

    Science.gov (United States)

    2010-04-01

    ... AND HUMAN SERVICES (CONTINUED) DRUGS: GENERAL CURRENT GOOD MANUFACTURING PRACTICE IN MANUFACTURING, PROCESSING, PACKING, OR HOLDING OF DRUGS; GENERAL § 210.2 Applicability of current good manufacturing... 21 Food and Drugs 4 2010-04-01 2010-04-01 false Applicability of current good manufacturing...

  15. 42 CFR 3.210 - Required disclosure of patient safety work product to the Secretary.

    Science.gov (United States)

    2010-10-01

    ... 42 Public Health 1 2010-10-01 2010-10-01 false Required disclosure of patient safety work product... HUMAN SERVICES GENERAL PROVISIONS PATIENT SAFETY ORGANIZATIONS AND PATIENT SAFETY WORK PRODUCT Confidentiality and Privilege Protections of Patient Safety Work Product § 3.210 Required disclosure of patient...

  16. 33 CFR 96.210 - Who does this subpart apply to?

    Science.gov (United States)

    2010-07-01

    ... VESSEL OPERATING REGULATIONS RULES FOR THE SAFE OPERATION OF VESSELS AND SAFETY MANAGEMENT SYSTEMS Company and Vessel Safety Management Systems § 96.210 Who does this subpart apply to? (a) This subpart... foreign voyage that are— (i) A vessel transporting more than 12 passengers; or (ii) A tanker, a bulk...

  17. Broadening the absorption bandwidth of metamaterial absorbers by transverse magnetic harmonics of 210 mode

    Science.gov (United States)

    Long, Chang; Yin, Sheng; Wang, Wei; Li, Wei; Zhu, Jianfei; Guan, Jianguo

    2016-01-01

    By investigating a square-shaped metamaterial structure we discover that wave diffraction at diagonal corners of such a structure excites transverse magnetic harmonics of 210 mode (TM210 harmonics). Multi-layer overlapping and deliberately regulating period length between adjacent unit cells can significantly enhance TM210 harmonics, leading to a strong absorption waveband. On such a basis, a design strategy is proposed to achieve broadband, thin-thickness multi-layered metamaterial absorbers (MMAs). In this strategy big pyramidal arrays placed in the “white blanks” of a chessboard exhibit two isolated absorption bands due to their fundamental and TM210 harmonics, which are further connected by another absorption band from small pyramidal arrays in the “black blanks” of the chessboard. The as-designed MMA at a total thickness (h) of 4.36 mm shows an absorption of above 0.9 in the whole frequency range of 7–18 GHz, which is 38% broader with respect to previous design methods at the same h. This strategy provides an effective route to extend the absorption bandwidth of MMAs without increasing h. PMID:26888365

  18. The 226 Ra, 210 Pb and essential elements bioavailability to pines at Urgeirica uranium mill tailings

    Energy Technology Data Exchange (ETDEWEB)

    Madruga, M.J.; Faria, I. [Nuclear and Technological Institute, Dept. of Radiological Protection and Nuclear Safety (Portugal)

    2006-07-01

    The objective of this study is to correlate the uptake of the natural radilides {sup 226}Ra and {sup 210}Pb with the essential elements, potassium, calcium and magnesium in the pines growing at the 'Urgeirica uranium mill tailings. It can be concluded that the potassium, calcium and magnesium mean concentration ratio values are, about two to three orders of magnitude, higher than the values obtained to {sup 226}Ra and {sup 210}Pb for pines growing on the Urgeirica uranium mill tailings. The concentration ratio values higher than 1 obtained to the potassium, calcium and magnesium elements indicate that pines are behaving as accumulators to these elements. Contrarily, the {sup 226}Ra and {sup 210}Pb concentration ratio values lower than 1 indicates that pines are behaving as excluders to these radionuclides. So, it can be concluded that this kind of plants is not suitable to a phyto remediation strategy. In general, a marginally significant correlation was observed between the potassium, calcium and magnesium concentrations, the cation-exchange capacity and the ph in the tailings and the {sup 226}Ra and {sup 210}Pb pines/tailings concentration ratios. (N.C.)

  19. C2H4 adsorption on Cu(210), revisited: bonding nature and coverage effects.

    Science.gov (United States)

    Amino, Shuichi; Arguelles, Elvis; Agerico Diño, Wilson; Okada, Michio; Kasai, Hideaki

    2016-08-24

    With the aid of density functional theory (DFT)-based calculations, we investigate the adsorption of C2H4 on Cu(210). We found two C2H4 adsorption sites, viz., the top of the step-edge atom (S) and the long bridge between two step-edge atoms (SS) of Cu(210). The step-edge atoms on Cu(210) block the otherwise active terrace sites found on copper surfaces with longer step sizes. This results in the preference for π-bonded over di-σ-bonded C2H4. We also found two stable C2H4 adsorption orientations on the S- and SS-sites, viz., with the C2H4 C[double bond, length as m-dash]C bond parallel (fit) and perpendicular (cross) to [001]. Furthermore, we found that the three peaks observed in previous temperature programmed desorption (TPD) experiment [Surf. Sci., 2011, 605, 934-940] could be attributed to C2H4 in the S-fit or S-cross, S-fit and S-cross-fit (S-cross and S-fit configurations that both exist in the same unit cell) configurations on Cu(210).

  20. Low-level gamma-ray spectrometry for the determination of 210Pb

    DEFF Research Database (Denmark)

    Markovic, Nikola; Roos, Per; Nielsen, Sven Poul

    2017-01-01

    A well High purity germanium (HPGe) gamma spectrometer with NaI(Tl) Compton anticoincidence shield recently installed at DTU Nutech and specially designed for low-level measurements was used for the 210Pb determination in environmental samples. The system is compared to standard stand-alone HPGe...