WorldWideScience

Sample records for terminal erythroid differentiation

  1. A hanging drop culture method to study terminal erythroid differentiation.

    Science.gov (United States)

    Gutiérrez, Laura; Lindeboom, Fokke; Ferreira, Rita; Drissen, Roy; Grosveld, Frank; Whyatt, David; Philipsen, Sjaak

    2005-10-01

    To design a culture method allowing the quantitative and qualitative analysis of terminal erythroid differentiation. Primary erythroid progenitors derived either from mouse tissues or from human umbilical cord blood were differentiated using hanging drop cultures and compared to methylcellulose cultures. Cultured cells were analyzed by FACS to assess differentiation. We describe a practical culture method by adapting the previously described hanging drop culture system to conditions allowing terminal differentiation of primary erythroid progenitors. Using minimal volumes of media and small numbers of cells, we obtained quantitative terminal erythroid differentiation within two days of culture in the case of murine cells and 4 days in the case of human cells. The established methods for ex vivo culture of primary erythroid progenitors, such as methylcellulose-based burst-forming unit-erythroid (BFU-E) and colony-forming unit-erythroid (CFU-E) assays, allow the detection of committed erythroid progenitors but are of limited value to study terminal erythroid differentiation. We show that the application of hanging drop cultures is a practical alternative that, in combination with clonogenic assays, enables a comprehensive assessment of the behavior of primary erythroid cells ex vivo in the context of genetic and drug-induced perturbations.

  2. Studies of globin gene expression in differentiating erythroid cells

    International Nuclear Information System (INIS)

    Sullivan, T.D.

    1985-01-01

    The author has addressed questions concerning globin gene expression and the loss of protein synthesis in the terminal stages of erythroid development. (1) The hypothesis that the rate of cell division affects the relative synthesis of γ and β globin in erythroid cells was investigated. The effect of hydroxyurea, aminopterin, or low culture temperature on the in vitro growth of erythroid progenitor cells and on the relative synthesis of γ and β globin was measured. No consistent change in γ globin synthesis was detected. (2) The hypothesis that the ratio of γ and β globin synthesis decreases during erythroid maturation because of differential mRNA stability was investigated. The half-lives of γ and β globin mRNAs and γ and β globin protein synthesis were measured in cultured reticulocytes. γ and β globin mRNAs were assayed by solution hybridization and by in vitro translation. Globin synthesis was determined by 3 H-leucine incorporation into the γ and β globin chains. γ and β globin mRNAs decay with similar half-lives in cultured reticulocytes. Therefore, the change in the ratio of γ and β globin synthesis during erythroid maturation cannot be explained by differences in mRNA stability and is likely to result from asynchronous transcription of the genes. These data suggest that protein synthesis in maturing reticulocytes is not limited by the quantity of mRNA but by the availability of translation factors. (3) The hypothesis was tested that the initiation factor GEF becomes limiting for protein synthesis during reticulocyte maturation

  3. Activated Fps/Fes tyrosine kinase regulates erythroid differentiation and survival.

    Science.gov (United States)

    Sangrar, Waheed; Gao, Yan; Bates, Barbara; Zirngibl, Ralph; Greer, Peter A

    2004-10-01

    A substantial body of evidence implicates the cytoplasmic protein tyrosine kinase Fps/Fes in regulation of myeloid differentiation and survival. In this study we wished to determine if Fps/Fes also plays a role in the regulation of erythropoiesis. Mice tissue-specifically expressing a "gain-of-function" mutant fps/fes transgene (fps(MF)) encoding an activated variant of Fps/Fes (MFps), were used to explore the in vivo biological role of Fps/Fes. Erythropoiesis in these mice was assessed by hematological analysis, lineage marker analysis, bone-marrow colony assays, and biochemical approaches. fps(MF) mice displayed reductions in peripheral red cell counts. However, there was an accumulation of immature erythroid precursors, which displayed increased survival. Fps/Fes and the related Fer kinase were both detected in early erythroid progenitors/blasts and in mature red cells. Fps/Fes was also activated in response to erythropoietin (EPO) and stem cell factor (SCF), two critical factors in erythroid development. In addition, increased Stat5A/B activation and reduced Erk1/2 phosphorylation was observed in fps(MF) primary erythroid cells in response to EPO or SCF, respectively. These data support a role for Fps/Fes in regulating the survival and differentiation of erythroid cells through modulation of Stat5A/B and Erk kinase pathways induced by EPO and SCF. The increased numbers and survival of erythroid progenitors from fps(MF) mice, and their differential responsiveness to SCF and EPO, implicates Fps/Fes in the commitment of multilineage progenitors to the erythroid lineage. The anemic phenotype in fps(MF) mice suggests that downregulation of Fps/Fes activity might be required for terminal erythroid differentiation.

  4. Erythroid differentiation and commitment in rat erythroleukemia cells with hypertonic culture conditions.

    OpenAIRE

    Yamaguchi, Y; Kluge, N; Ostertag, W; Furusawa, M

    1981-01-01

    Cell cultures of 7,12-dimethylbenz[a]anthracene-induced rat erythroleukemia can be stimulated to synthesize hemoglobin when cultured in hypertonic media. During hypertonic treatment the intracellular osmotic conditions immediately readjust to those of the extracellular medium. None of the Friend virus-induced mouse erythroleukemia cell lines was inducible for differentiation with the same hypertonic culture conditions used for rat cells. Earliest commitment to erythroid terminal differentiati...

  5. Erythroid differentiation of human induced pluripotent stem cells is independent of donor cell type of origin.

    Science.gov (United States)

    Dorn, Isabel; Klich, Katharina; Arauzo-Bravo, Marcos J; Radstaak, Martina; Santourlidis, Simeon; Ghanjati, Foued; Radke, Teja F; Psathaki, Olympia E; Hargus, Gunnar; Kramer, Jan; Einhaus, Martin; Kim, Jeong Beom; Kögler, Gesine; Wernet, Peter; Schöler, Hans R; Schlenke, Peter; Zaehres, Holm

    2015-01-01

    Epigenetic memory in induced pluripotent stem cells, which is related to the somatic cell type of origin of the stem cells, might lead to variations in the differentiation capacities of the pluripotent stem cells. In this context, induced pluripotent stem cells from human CD34(+) hematopoietic stem cells might be more suitable for hematopoietic differentiation than the commonly used fibroblast-derived induced pluripotent stem cells. To investigate the influence of an epigenetic memory on the ex vivo expansion of induced pluripotent stem cells into erythroid cells, we compared induced pluripotent stem cells from human neural stem cells and human cord blood-derived CD34(+) hematopoietic stem cells and evaluated their potential for differentiation into hematopoietic progenitor and mature red blood cells. Although genome-wide DNA methylation profiling at all promoter regions demonstrates that the epigenetic memory of induced pluripotent stem cells is influenced by the somatic cell type of origin of the stem cells, we found a similar hematopoietic induction potential and erythroid differentiation pattern of induced pluripotent stem cells of different somatic cell origin. All human induced pluripotent stem cell lines showed terminal maturation into normoblasts and enucleated reticulocytes, producing predominantly fetal hemoglobin. Differences were only observed in the growth rate of erythroid cells, which was slightly higher in the induced pluripotent stem cells derived from CD34(+) hematopoietic stem cells. More detailed methylation analysis of the hematopoietic and erythroid promoters identified similar CpG methylation levels in the induced pluripotent stem cell lines derived from CD34(+) cells and those derived from neural stem cells, which confirms their comparable erythroid differentiation potential. Copyright© Ferrata Storti Foundation.

  6. The role of DNA methylation in catechol-enhanced erythroid differentiation of K562 cells

    Energy Technology Data Exchange (ETDEWEB)

    Li, Xiao-Fei; Wu, Xiao-Rong; Xue, Ming; Wang, Yan; Wang, Jie; Li, Yang; Suriguga,; Zhang, Guang-Yao; Yi, Zong-Chun, E-mail: yizc@buaa.edu.cn

    2012-11-15

    Catechol is one of phenolic metabolites of benzene in vivo. Catechol is also widely used in pharmaceutical and chemical industries. In addition, fruits, vegetables and cigarette smoke also contain catechol. Our precious study showed that several benzene metabolites (phenol, hydroquinone, and 1,2,4-benzenetriol) inhibited erythroid differentiation of K562 cells. In present study, the effect of catechol on erythroid differentiation of K562 cells was investigated. Moreover, to address the role of DNA methylation in catechol-induced effect on erythroid differentiation in K562 cells, methylation levels of erythroid-specific genes were analyzed by Quantitative MassARRAY methylation analysis platform. Benzidine staining showed that exposure to catechol enhanced hemin-induced hemoglobin accumulation in K562 cells in concentration- and time-dependent manners. The mRNA expression of erythroid specific genes, including α-globin, β-globin, γ-globin, erythroid 5-aminolevulinate synthase, erythroid porphobilinogen deaminase, and transcription factor GATA-1 genes, showed a significant concentration-dependent increase in catechol-treated K562 cells. The exposure to catechol caused a decrease in DNA methylation levels at a few CpG sites in some erythroid specific genes including α-globin, β-globin and erythroid porphobilinogen deaminase genes. These results indicated that catechol improved erythroid differentiation potency of K562 cells at least partly via up-regulating transcription of some erythroid related genes, and suggested that inhibition of DNA methylation might be involved in up-regulated expression of some erythroid related genes. -- Highlights: ► Catechol enhanced hemin-induced hemoglobin accumulation. ► Exposure to catechol resulted in up-regulated expression of erythroid genes. ► Catechol reduced methylation levels at some CpG sites in erythroid genes.

  7. The role of DNA methylation in catechol-enhanced erythroid differentiation of K562 cells

    International Nuclear Information System (INIS)

    Li, Xiao-Fei; Wu, Xiao-Rong; Xue, Ming; Wang, Yan; Wang, Jie; Li, Yang; Suriguga,; Zhang, Guang-Yao; Yi, Zong-Chun

    2012-01-01

    Catechol is one of phenolic metabolites of benzene in vivo. Catechol is also widely used in pharmaceutical and chemical industries. In addition, fruits, vegetables and cigarette smoke also contain catechol. Our precious study showed that several benzene metabolites (phenol, hydroquinone, and 1,2,4-benzenetriol) inhibited erythroid differentiation of K562 cells. In present study, the effect of catechol on erythroid differentiation of K562 cells was investigated. Moreover, to address the role of DNA methylation in catechol-induced effect on erythroid differentiation in K562 cells, methylation levels of erythroid-specific genes were analyzed by Quantitative MassARRAY methylation analysis platform. Benzidine staining showed that exposure to catechol enhanced hemin-induced hemoglobin accumulation in K562 cells in concentration- and time-dependent manners. The mRNA expression of erythroid specific genes, including α-globin, β-globin, γ-globin, erythroid 5-aminolevulinate synthase, erythroid porphobilinogen deaminase, and transcription factor GATA-1 genes, showed a significant concentration-dependent increase in catechol-treated K562 cells. The exposure to catechol caused a decrease in DNA methylation levels at a few CpG sites in some erythroid specific genes including α-globin, β-globin and erythroid porphobilinogen deaminase genes. These results indicated that catechol improved erythroid differentiation potency of K562 cells at least partly via up-regulating transcription of some erythroid related genes, and suggested that inhibition of DNA methylation might be involved in up-regulated expression of some erythroid related genes. -- Highlights: ► Catechol enhanced hemin-induced hemoglobin accumulation. ► Exposure to catechol resulted in up-regulated expression of erythroid genes. ► Catechol reduced methylation levels at some CpG sites in erythroid genes.

  8. Expression of assayable residual stem cell damage in erythroid differentiation

    International Nuclear Information System (INIS)

    Huebner, G.E.; Miller, M.E.; Cronkite, E.P.

    1985-01-01

    In rodents, residual damage is inducible in hematopoietic stem cells by exposure to ionizing radiation or alkylating agents. This damage can b e assayed in mice by transferring bone marrow into lethally irradiated syngeneic recipients and subsequently measuring the incremental increase of-( 125 I)iodo-2'-deoxyuridine incorporation in spleens. In this study, bone marrow from mice treated 3 weeks previously with Methylnitrosourea (50 mg/kg) or 450 rad was injected into recipients in order to determine possible residual effects of treatment of erythroid cell differentiation following stem cell seeding. Such effects were detected by a reduced amount of 59 Fe incorporation into spleens, thus indicatin g transfer of residual stem cell damage to differentiating cells. (orig.)

  9. Serum-free Erythroid Differentiation for Efficient Genetic Modification and High-Level Adult Hemoglobin Production.

    Science.gov (United States)

    Uchida, Naoya; Demirci, Selami; Haro-Mora, Juan J; Fujita, Atsushi; Raines, Lydia N; Hsieh, Matthew M; Tisdale, John F

    2018-06-15

    In vitro erythroid differentiation from primary human cells is valuable to develop genetic strategies for hemoglobin disorders. However, current erythroid differentiation methods are encumbered by modest transduction rates and high baseline fetal hemoglobin production. In this study, we sought to improve both genetic modification and hemoglobin production among human erythroid cells in vitro . To model therapeutic strategies, we transduced human CD34 + cells and peripheral blood mononuclear cells (PBMCs) with lentiviral vectors and compared erythropoietin-based erythroid differentiation using fetal-bovine-serum-containing media and serum-free media. We observed more efficient transduction (85%-93%) in serum-free media than serum-containing media (20%-69%), whereas the addition of knockout serum replacement (KSR) was required for serum-free media to promote efficient erythroid differentiation (96%). High-level adult hemoglobin production detectable by electrophoresis was achieved using serum-free media similar to serum-containing media. Importantly, low fetal hemoglobin production was observed in the optimized serum-free media. Using KSR-containing, serum-free erythroid differentiation media, therapeutic adult hemoglobin production was detected at protein levels with β-globin lentiviral transduction in both CD34 + cells and PBMCs from sickle cell disease subjects. Our in vitro erythroid differentiation system provides a practical evaluation platform for adult hemoglobin production among human erythroid cells following genetic manipulation.

  10. Carbon monoxide induced erythroid differentiation of K562 cells mimics the central macrophage milieu in erythroblastic islands.

    Directory of Open Access Journals (Sweden)

    Shlomi Toobiak

    Full Text Available Growing evidence supports the role of erythroblastic islands (EI as microenvironmental niches within bone marrow (BM, where cell-cell attachments are suggested as crucial for erythroid maturation. The inducible form of the enzyme heme oxygenase, HO-1, which conducts heme degradation, is absent in erythroblasts where hemoglobin (Hb is synthesized. Yet, the central macrophage, which retains high HO-1 activity, might be suitable to take over degradation of extra, harmful, Hb heme. Of these enzymatic products, only the hydrophobic gas molecule--CO can transfer from the macrophage to surrounding erythroblasts directly via their tightly attached membranes in the terminal differentiation stage.Based on the above, the study hypothesized CO to have a role in erythroid maturation. Thus, the effect of CO gas as a potential erythroid differentiation inducer on the common model for erythroid progenitors, K562 cells, was explored. Cells were kept under oxygen lacking environment to mimic BM conditions. Nitrogen anaerobic atmosphere (N₂A served as control for CO atmosphere (COA. Under both atmospheres cells proliferation ceased: in N₂A due to cell death, while in COA as a result of erythroid differentiation. Maturation was evaluated by increased glycophorin A expression and Hb concentration. Addition of 1%CO only to N₂A, was adequate for maintaining cell viability. Yet, the average Hb concentration was low as compared to COA. This was validated to be the outcome of diversified maturation stages of the progenitor's population.In fact, the above scenario mimics the in vivo EI conditions, where at any given moment only a minute portion of the progenitors proceeds into terminal differentiation. Hence, this model might provide a basis for further molecular investigations of the EI structure/function relationship.

  11. Erythroid differentiation of fetal, newborn and adult haemopoietic stem cells

    International Nuclear Information System (INIS)

    Rencricca, N.J.; Howard, D.; Kubanek, B.; Stohlman, F.; Department of Biological Sciences, University of Lowell, Lowell, Massachusetts, USA)

    1976-01-01

    Erythroid regeneration was studied in lethally irradiated mice given transplants containing equivalent numbers of haemopoietic stem cells (i.e. CFU) from fetal liver, neonatal marrow or adult marrow. Adult marrow was taken from normal control mice, whose CFU for the most part were not in active cell cycle, as well as from phenylhydrazine-treated groups whose CFU were in similar state of proliferation (i.e. approximately 40-50% in DNA synthesis) as those derived from fetal liver and neonatal marrow. Splenic and femoral radioiron ( 59 Fe) incorporation were measured at intervals after transplantation and were found to begin earliest in mice given fetal liver, then in animals given neonatal marrow and latest in recipients of adult marrow. Peripheral reticulocytes showed a similar pattern of recovery. The data reported herein suggest that the differences in erythroid regeneration evoked by transplants of fetal liver, neonatal marrow or adult marrow, are not solely attributed to the degree of proliferation in the pluripotential stem cell compartment. These data may, however, suggest a shorter doubling time for cells comprising the fetal and newborn committed erythroid compartments. (author)

  12. Erythroid differentiation of fetal, newborn, and adult haemopoietic stem cells

    Energy Technology Data Exchange (ETDEWEB)

    Rencricca, N J; Howard, D; Kubanek, B; Stohlman, F [Boston Univ., Mass. (USA). School of Medicine; Department of Biological Sciences, University of Lowell, Lowell, Massachusetts, USA)

    1976-01-01

    Erythroid regeneration was studied in lethally irradiated mice given transplants containing equivalent numbers of haemopoietic stem cells (i.e. CFU) from fetal liver, neonatal marrow or adult marrow. Adult marrow was taken from normal control mice, whose CFU for the most part were not in active cell cycle, as well as from phenylhydrazine-treated groups whose CFU were in similar state of proliferation (i.e. approximately 40-50% in DNA synthesis) as those derived from fetal liver and neonatal marrow. Splenic and femoral radioiron (/sup 59/Fe) incorporation were measured at intervals after transplantation and were found to begin earliest in mice given fetal liver, then in animals given neonatal marrow and latest in recipients of adult marrow. Peripheral reticulocytes showed a similar pattern of recovery. The data reported herein suggest that the differences in erythroid regeneration evoked by transplants of fetal liver, neonatal marrow or adult marrow, are not solely attributed to the degree of proliferation in the pluripotential stem cell compartment. These data may, however, suggest a shorter doubling time for cells comprising the fetal and newborn committed erythroid compartments.

  13. Selective toxicity of dihydroartemisinin on human CD34+ erythroid cell differentiation

    International Nuclear Information System (INIS)

    Finaurini, Sara; Ronzoni, Luisa; Colancecco, Alessandra; Cattaneo, Alessandra; Cappellini, Maria Domenica; Ward, Stephen A.; Taramelli, Donatella

    2010-01-01

    Artemisinins are safely used in the combination therapy for uncomplicated malaria, but their employment during pregnancy is still controversial. In fact, animal studies reported that the active metabolite, dihydroartemisinin (DHA), causes embryonic erythrocytes depletion, when the treatment is performed during a critical period of time. The present study investigates the effect of DHA on human developmental erythropoiesis in order to characterize the target erythroid stage and to predict the window of susceptibility in human pregnancy. As a model for human developmental erythropoiesis, peripheral blood purified, CD34+ cells were committed towards erythrocytes and DHA (0.5 or 2 μM) was added to different erythroid stages during 14 days culture. Erythroid differentiation was investigated by cytofluorimetric analysis of Glycophorin A expression, by morphological analysis and erythroid globin gene expression analysis with real-time PCR. It was found that the effect of DHA was dependent on the maturation stage of erythroid cells. In fact when DHA was added to the pro- and basophilic erythroblasts caused a significant dose-dependent inhibition of cell proliferation and a significant delay of erythroid differentiation, as measured by morphological analysis, expression of Glycophorin A by immunofluorescence and of erythroid globin genes by real-time PCR. In contrast, the inhibition of stem cells and of early progenitors was transient and masked by the subsequent exponential cell growth. No effect was observed on mature erythroid stages. This is the first demonstration that DHA affects human erythropoiesis in vitro, in a dose- and time-dependent manner; the target population seems to be the pro-erythroblast and basophilic erythroblast stage, suggesting that DHA toxicity is limited to primitive human erythropoiesis. These findings outline the relevance of DHA dosage and timing to prevent embryotoxicity and support current WHO recommendations of avoiding malaria treatment

  14. Dynamics of GATA1 binding and expression response in a GATA1-induced erythroid differentiation system

    Directory of Open Access Journals (Sweden)

    Deepti Jain

    2015-06-01

    Full Text Available During the maturation phase of mammalian erythroid differentiation, highly proliferative cells committed to the erythroid lineage undergo dramatic changes in morphology and function to produce circulating, enucleated erythrocytes. These changes are caused by equally dramatic alterations in gene expression, which in turn are driven by changes in the abundance and binding patterns of transcription factors such as GATA1. We have studied the dynamics of GATA1 binding by ChIP-seq and the global expression responses by RNA-seq in a GATA1-dependent mouse cell line model for erythroid maturation, in both cases examining seven progressive stages during differentiation. Analyses of these data should provide insights both into mechanisms of regulation (early versus late targets and the consequences in cell physiology (e.g., distinctive categories of genes regulated at progressive stages of differentiation. The data are deposited in the Gene Expression Omnibus, series GSE36029, GSE40522, GSE49847, and GSE51338.

  15. Dimethyl sulfoxide-inducible cytoplasmic factor involved in erythroid differentiation in mouse erythroleukemia (Friend) cells

    International Nuclear Information System (INIS)

    Watanabe, T.; Oishi, M.

    1987-01-01

    A previous report described an intracellular factor (differentiation-inducing factor I, or DIF-I) that seem to play a role in erythroid differentiation in mouse erythroleukemia (MEL) cells. The authors have detected another erythroid-inducing factor in cell-free extracts from dimethyl sulfoxide- or hexamethylenebis(acetamide)-treated MEL cells, which acts synergistically with DIF-I. The partially purified factor (termed DIF-II) triggered erythroid differentiation when introduced into undifferentiated MEL cells that had been potentiated by the induction of DIF-I. The activity in the extracts appeared in an inducible manner after addition of dimethyl sulfoxide or hexamethylenebis(acetamide), reached a maximum at 6 hr, and then rapidly decreased. The induction was inhibited by phorbol 12-myristate 13-acetate and also by cycloheximide. No induction was observed in a mutant MEL cell line defective in erythroid differentiation. These characteristics are consistent with the supposition that DIF-II is one of the putative dimethyl sulfoxide-inducible factors detected in previously reported cell-fusion and cytoplast-fusion experiments. The role of DIF-II in MEL-cell differentiation and in vitro differentiation in general is discussed

  16. Hypoxia-inducible factor 1-mediated human GATA1 induction promotes erythroid differentiation under hypoxic conditions.

    Science.gov (United States)

    Zhang, Feng-Lin; Shen, Guo-Min; Liu, Xiao-Ling; Wang, Fang; Zhao, Ying-Ze; Zhang, Jun-Wu

    2012-08-01

    Hypoxia-inducible factor promotes erythropoiesis through coordinated cell type-specific hypoxia responses. GATA1 is essential to normal erythropoiesis and plays a crucial role in erythroid differentiation. In this study, we show that hypoxia-induced GATA1 expression is mediated by HIF1 in erythroid cells. Under hypoxic conditions, significantly increased GATA1 mRNA and protein levels were detected in K562 cells and erythroid induction cultures of CD34(+) haematopoietic stem/progenitor cells. Enforced HIF1α expression increased GATA1 expression, while HIF1α knockdown by RNA interference decreased GATA1 expression. In silico analysis revealed one potential hypoxia response element (HRE). The results from reporter gene and mutation analysis suggested that this element is necessary for hypoxic response. Chromatin immunoprecipitation (ChIP)-PCR showed that the putative HRE was recognized and bound by HIF1 in vivo. These results demonstrate that the up-regulation of GATA1 during hypoxia is directly mediated by HIF1.The mRNA expression of some erythroid differentiation markers was increased under hypoxic conditions, but decreased with RNA interference of HIF1α or GATA1. Flow cytometry analysis also indicated that hypoxia, desferrioxamine or CoCl(2) induced expression of erythroid surface markers CD71 and CD235a, while expression repression of HIF1α or GATA1 by RNA interference led to a decreased expression of CD235a. These results suggested that HIF1-mediated GATA1 up-regulation promotes erythropoiesis in order to satisfy the needs of an organism under hypoxic conditions. © 2011 The Authors Journal of Cellular and Molecular Medicine © 2011 Foundation for Cellular and Molecular Medicine/Blackwell Publishing Ltd.

  17. The role of catechol-O-methyltransferase in catechol-enhanced erythroid differentiation of K562 cells

    International Nuclear Information System (INIS)

    Suriguga,; Li, Xiao-Fei; Li, Yang; Yu, Chun-Hong; Li, Yi-Ran; Yi, Zong-Chun

    2013-01-01

    Catechol is widely used in pharmaceutical and chemical industries. Catechol is also one of phenolic metabolites of benzene in vivo. Our previous study showed that catechol improved erythroid differentiation potency of K562 cells, which was associated with decreased DNA methylation in erythroid specific genes. Catechol is a substrate for the catechol-O-methyltransferase (COMT)-mediated methylation. In the present study, the role of COMT in catechol-enhanced erythroid differentiation of K562 cells was investigated. Benzidine staining showed that exposure to catechol enhanced hemin-induced hemoglobin accumulation and induced mRNA expression of erythroid specific genes in K562 cells. Treatment with catechol caused a time- and concentration-dependent increase in guaiacol concentration in the medium of cultured K562 cells. When COMT expression was knocked down by COMT shRNA expression in K562 cells, the production of guaiacol significantly reduced, and the sensitivity of K562 cells to cytotoxicity of catechol significantly increased. Knockdown of COMT expression by COMT shRNA expression also eliminated catechol-enhanced erythroid differentiation of K562 cells. In addition, the pre-treatment with methyl donor S-adenosyl-L-methionine or its demethylated product S-adenosyl-L-homocysteine induced a significant increase in hemin-induced Hb synthesis in K562 cells and the mRNA expression of erythroid specific genes. These findings indicated that O-methylation catalyzed by COMT acted as detoxication of catechol and involved in catechol-enhanced erythroid differentiation of K562 cells, and the production of S-adenosyl-L-homocysteine partly explained catechol-enhanced erythroid differentiation. - Highlights: • Catechol enhanced hemin-induced hemoglobin accumulation. • COMT-catalyzed methylation acted as detoxication of catechol. • COMT involved in catechol-enhanced erythroid differentiation

  18. The role of catechol-O-methyltransferase in catechol-enhanced erythroid differentiation of K562 cells

    Energy Technology Data Exchange (ETDEWEB)

    Suriguga,; Li, Xiao-Fei; Li, Yang; Yu, Chun-Hong; Li, Yi-Ran; Yi, Zong-Chun, E-mail: yizc@buaa.edu.cn

    2013-12-15

    Catechol is widely used in pharmaceutical and chemical industries. Catechol is also one of phenolic metabolites of benzene in vivo. Our previous study showed that catechol improved erythroid differentiation potency of K562 cells, which was associated with decreased DNA methylation in erythroid specific genes. Catechol is a substrate for the catechol-O-methyltransferase (COMT)-mediated methylation. In the present study, the role of COMT in catechol-enhanced erythroid differentiation of K562 cells was investigated. Benzidine staining showed that exposure to catechol enhanced hemin-induced hemoglobin accumulation and induced mRNA expression of erythroid specific genes in K562 cells. Treatment with catechol caused a time- and concentration-dependent increase in guaiacol concentration in the medium of cultured K562 cells. When COMT expression was knocked down by COMT shRNA expression in K562 cells, the production of guaiacol significantly reduced, and the sensitivity of K562 cells to cytotoxicity of catechol significantly increased. Knockdown of COMT expression by COMT shRNA expression also eliminated catechol-enhanced erythroid differentiation of K562 cells. In addition, the pre-treatment with methyl donor S-adenosyl-L-methionine or its demethylated product S-adenosyl-L-homocysteine induced a significant increase in hemin-induced Hb synthesis in K562 cells and the mRNA expression of erythroid specific genes. These findings indicated that O-methylation catalyzed by COMT acted as detoxication of catechol and involved in catechol-enhanced erythroid differentiation of K562 cells, and the production of S-adenosyl-L-homocysteine partly explained catechol-enhanced erythroid differentiation. - Highlights: • Catechol enhanced hemin-induced hemoglobin accumulation. • COMT-catalyzed methylation acted as detoxication of catechol. • COMT involved in catechol-enhanced erythroid differentiation.

  19. The first trimester human placenta is a site for terminal maturation of primitive erythroid cells.

    Science.gov (United States)

    Van Handel, Ben; Prashad, Sacha L; Hassanzadeh-Kiabi, Nargess; Huang, Andy; Magnusson, Mattias; Atanassova, Boriana; Chen, Angela; Hamalainen, Eija I; Mikkola, Hanna K A

    2010-10-28

    Embryonic hematopoiesis starts via the generation of primitive red blood cells (RBCs) that satisfy the embryo's immediate oxygen needs. Although primitive RBCs were thought to retain their nuclei, recent studies have shown that primitive RBCs in mice enucleate in the fetal liver. It has been unknown whether human primitive RBCs enucleate, and what hematopoietic site might support this process. Our data indicate that the terminal maturation and enucleation of human primitive RBCs occurs in first trimester placental villi. Extravascular ζ-globin(+) primitive erythroid cells were found in placental villi between 5-7 weeks of development, at which time the frequency of enucleated RBCs was higher in the villous stroma than in circulation. RBC enucleation was further evidenced by the presence of primitive reticulocytes and pyrenocytes (ejected RBC nuclei) in the placenta. Extravascular RBCs were found to associate with placental macrophages, which contained ingested nuclei. Clonogenic macrophage progenitors of fetal origin were present in the chorionic plate of the placenta before the onset of fetoplacental circulation, after which macrophages had migrated to the villi. These findings indicate that placental macrophages may assist the enucleation process of primitive RBCs in placental villi, implying an unexpectedly broad role for the placenta in embryonic hematopoiesis.

  20. Induction of erythroid differentiation in human erythroleukemia cells by depletion of malic enzyme 2.

    Directory of Open Access Journals (Sweden)

    Jian-Guo Ren

    2010-09-01

    Full Text Available Malic enzyme 2 (ME2 is a mitochondrial enzyme that catalyzes the conversion of malate to pyruvate and CO2 and uses NAD as a cofactor. Higher expression of this enzyme correlates with the degree of cell de-differentiation. We found that ME2 is expressed in K562 erythroleukemia cells, in which a number of agents have been found to induce differentiation either along the erythroid or the myeloid lineage. We found that knockdown of ME2 led to diminished proliferation of tumor cells and increased apoptosis in vitro. These findings were accompanied by differentiation of K562 cells along the erythroid lineage, as confirmed by staining for glycophorin A and hemoglobin production. ME2 knockdown also totally abolished growth of K562 cells in nude mice. Increased ROS levels, likely reflecting increased mitochondrial production, and a decreased NADPH/NADP+ ratio were noted but use of a free radical scavenger to decrease inhibition of ROS levels did not reverse the differentiation or apoptotic phenotype, suggesting that ROS production is not causally involved in the resultant phenotype. As might be expected, depletion of ME2 induced an increase in the NAD+/NADH ratio and ATP levels fell significantly. Inhibition of the malate-aspartate shuttle was insufficient to induce K562 differentiation. We also examined several intracellular signaling pathways and expression of transcription factors and intermediate filament proteins whose expression is known to be modulated during erythroid differentiation in K562 cells. We found that silencing of ME2 leads to phospho-ERK1/2 inhibition, phospho-AKT activation, increased GATA-1 expression and diminished vimentin expression. Metabolomic analysis, conducted to gain insight into intermediary metabolic pathways that ME2 knockdown might affect, showed that ME2 depletion resulted in high orotate levels, suggesting potential impairment of pyrimidine metabolism. Collectively our data point to ME2 as a potentially novel

  1. The role of catechol-O-methyltransferase in catechol-enhanced erythroid differentiation of K562 cells.

    Science.gov (United States)

    Suriguga; Li, Xiao-Fei; Li, Yang; Yu, Chun-Hong; Li, Yi-Ran; Yi, Zong-Chun

    2013-12-15

    Catechol is widely used in pharmaceutical and chemical industries. Catechol is also one of phenolic metabolites of benzene in vivo. Our previous study showed that catechol improved erythroid differentiation potency of K562 cells, which was associated with decreased DNA methylation in erythroid specific genes. Catechol is a substrate for the catechol-O-methyltransferase (COMT)-mediated methylation. In the present study, the role of COMT in catechol-enhanced erythroid differentiation of K562 cells was investigated. Benzidine staining showed that exposure to catechol enhanced hemin-induced hemoglobin accumulation and induced mRNA expression of erythroid specific genes in K562 cells. Treatment with catechol caused a time- and concentration-dependent increase in guaiacol concentration in the medium of cultured K562 cells. When COMT expression was knocked down by COMT shRNA expression in K562 cells, the production of guaiacol significantly reduced, and the sensitivity of K562 cells to cytotoxicity of catechol significantly increased. Knockdown of COMT expression by COMT shRNA expression also eliminated catechol-enhanced erythroid differentiation of K562 cells. In addition, the pre-treatment with methyl donor S-adenosyl-L-methionine or its demethylated product S-adenosyl-L-homocysteine induced a significant increase in hemin-induced Hb synthesis in K562 cells and the mRNA expression of erythroid specific genes. These findings indicated that O-methylation catalyzed by COMT acted as detoxication of catechol and involved in catechol-enhanced erythroid differentiation of K562 cells, and the production of S-adenosyl-L-homocysteine partly explained catechol-enhanced erythroid differentiation. © 2013.

  2. Proteomic analysis of erythroid differentiation induced by hexamethylene bisacetamide in murine erythroleukemia cells

    Czech Academy of Sciences Publication Activity Database

    Petrák, J.; Myslivcová, D.; Man, Petr; Čmejlová, J.; Čmejla, R.; Vyoral, D.

    2007-01-01

    Roč. 35, - (2007), s. 193-202 ISSN 0301-472X R&D Projects: GA MŠk LC545 Grant - others:CZ(CZ) 023736; GA ČR(CZ) GA303/04/0003; GA MŠk(CZ) LC06044 Institutional research plan: CEZ:AV0Z50200510 Source of funding: V - iné verejné zdroje ; V - iné verejné zdroje ; V - iné verejné zdroje Keywords : murine erythroleukemia cells * erythroid differentiation * hexamethylene bisacetamide Subject RIV: EE - Microbiology, Virology Impact factor: 3.147, year: 2007

  3. Comparison of different methods for erythroid differentiation in the K562 cell line.

    Science.gov (United States)

    Shariati, Laleh; Modaress, Mehran; Khanahmad, Hossein; Hejazi, Zahra; Tabatabaiefar, Mohammad Amin; Salehi, Mansoor; Modarressi, Mohammad Hossein

    2016-08-01

    To compare methods for erythroid differentiation of K562 cells that will be promising in the treatment of beta-thalassemia by inducing γ-globin synthesis. Cells were treated separately with: RPMI 1640 medium without glutamine, RPMI 1640 medium without glutamine supplemented with 1 mM sodium butyrate, RPMI 1640 medium supplemented with 1 mM sodium butyrate, 25 µg cisplatin/ml, 0.1 µg cytosine arabinoside/ml. The highest differentiation (84 %) with minimum toxicity was obtained with cisplatin at 15 µg /ml. Real-time RT-PCR showed that expression of the γ-globin gene was significantly higher in the cells differentiated with cisplatin compared to undifferentiated cells (P < 0.001). Cisplatin is useful in the experimental therapy of ß-globin gene defects and can be considered for examining the basic mechanism of γ-reactivation.

  4. Parvovirus B19 Replication and Expression in Differentiating Erythroid Progenitor Cells.

    Directory of Open Access Journals (Sweden)

    Gloria Bua

    Full Text Available The pathogenic Parvovirus B19 (B19V is characterized by a strict adaptation to erythroid progenitor cells (EPCs, a heterogeneous population of differentiating cells with diverse phenotypic and functional properties. In our work, we studied the dynamics of B19V infection in EPCs in dependence on the cell differentiation stage, in terms of distribution of infected cells, synthesis of viral nucleic acids and production of infectious virus. EPCs at early differentiation stage led to an abortive infection, without viral genome replication and a very low transcriptional activity. EPCs at later stages were permissive, with highest levels of viral replicative activity at day 9 (+3.0 Log from 2 to 48 hpi and lower levels at day 18 (+1.5 Log from 2 to 48 hpi. B19V DNA increment was in accordance with the percentage of cells positive to flow-FISH assay (41.4% at day 9, 1.1% at day 18. Quantitation of total RNA indicated a close association of genome replication and transcription with viral RNA accumulation within infected cells related to viral DNA increase during the course of infection. Analysis of the different classes of mRNAs revealed two distinct pattern of genome expression profile with a fine regulation in the frequency utilization of RNA processing signals: an early phase, when cleavage at the proximal site leading to a higher relative production of mRNA for NS protein, and a late phase, when cleavage at the distal site was more frequent leading to higher relative abundance of mRNA for VP and 11 kDA proteins. Infectious virus was released from cells at day 6-15, but not at day 18. Our results, providing a detailed description of B19V replication and expression profile in differentiating EPCs, highlight the very tight adaptation of B19V to a specific cellular target defined both by its erythroid lineage and its differentiation stage.

  5. Parvovirus B19 Replication and Expression in Differentiating Erythroid Progenitor Cells

    Science.gov (United States)

    Bua, Gloria; Manaresi, Elisabetta; Bonvicini, Francesca; Gallinella, Giorgio

    2016-01-01

    The pathogenic Parvovirus B19 (B19V) is characterized by a strict adaptation to erythroid progenitor cells (EPCs), a heterogeneous population of differentiating cells with diverse phenotypic and functional properties. In our work, we studied the dynamics of B19V infection in EPCs in dependence on the cell differentiation stage, in terms of distribution of infected cells, synthesis of viral nucleic acids and production of infectious virus. EPCs at early differentiation stage led to an abortive infection, without viral genome replication and a very low transcriptional activity. EPCs at later stages were permissive, with highest levels of viral replicative activity at day 9 (+3.0 Log from 2 to 48 hpi) and lower levels at day 18 (+1.5 Log from 2 to 48 hpi). B19V DNA increment was in accordance with the percentage of cells positive to flow-FISH assay (41.4% at day 9, 1.1% at day 18). Quantitation of total RNA indicated a close association of genome replication and transcription with viral RNA accumulation within infected cells related to viral DNA increase during the course of infection. Analysis of the different classes of mRNAs revealed two distinct pattern of genome expression profile with a fine regulation in the frequency utilization of RNA processing signals: an early phase, when cleavage at the proximal site leading to a higher relative production of mRNA for NS protein, and a late phase, when cleavage at the distal site was more frequent leading to higher relative abundance of mRNA for VP and 11 kDA proteins. Infectious virus was released from cells at day 6–15, but not at day 18. Our results, providing a detailed description of B19V replication and expression profile in differentiating EPCs, highlight the very tight adaptation of B19V to a specific cellular target defined both by its erythroid lineage and its differentiation stage. PMID:26845771

  6. Dihydroartemisinin inhibits the human erythroid cell differentiation by altering the cell cycle

    International Nuclear Information System (INIS)

    Finaurini, Sara; Basilico, Nicoletta; Corbett, Yolanda; D’Alessandro, Sarah; Parapini, Silvia; Olliaro, Piero; Haynes, Richard K.; Taramelli, Donatella

    2012-01-01

    Artemisinin derivatives such as dihydroartemisinin (DHA) induce significant depletion of early embryonic erythroblasts in animal models. We have reported previously that DHA specifically targets pro-erythroblasts and basophilic erythroblasts, when human CD34+ stem cells are differentiated toward the erythroid lineage, indicating that a window of susceptibility to artemisinins may exist also in human developmental erythropoiesis during pregnancy. To better investigate the toxicity of artemisinin derivatives, the structure–activity relationship was evaluated against the K562 leukaemia cell line, used as a model for differentiating early human erythroblasts. All artemisinins derivatives, except deoxyartemisinin, inhibited both spontaneous and induced erythroid differentiation, confirming that the peroxide bridge is responsible for the erythro-toxicity. On the contrary, cell growth was markedly reduced by DHA, artemisone and artesunate but not by artemisinin, 10-deoxoartemisinin or deoxy-artemisinin. The substituent at position C-10 is responsible only for the anti-proliferative effect, since 10-deoxoartemisinin did not reduce cell growth but arrested the differentiation of K562 cells. In particular, the results showed that DHA resulted the most potent and rapidly acting compound of the drug family, causing (i) the decreased expression of GpA surface receptors and the down regulation the γ-globin gene; (ii) the alteration of S phase of cell cycle and (iii) the induction of programmed cell death of early erythroblasts in a dose dependent manner within 24 h. In conclusion, these findings confirm that the active metabolite DHA is responsible for the erythro-toxicity of most of artemisinins used in therapy. Thus, as long as no further clinical data are available, current WHO recommendations of avoiding malaria treatment with artemisinins during the first trimester of pregnancy remain valid.

  7. Erythroid Differentiation Regulator 1 as a Novel Biomarker for Hair Loss Disorders.

    Science.gov (United States)

    Woo, Yu Ri; Hwang, Sewon; Jeong, Seo Won; Cho, Dae Ho; Park, Hyun Jeong

    2017-02-03

    Erythroid differentiation regulator 1 (Erdr1) is known to be involved in the inflammatory process via regulating the immune system in many cutaneous disorders, such as psoriasis and rosacea. However, the role of Erdr1 in various hair loss disorders remains unclear. The aim of this study was to investigate the putative role of Erdr1 in alopecias. Skin samples from 21 patients with hair loss disorders and five control subjects were retrieved, in order to assess their expression levels of Erdr1. Results revealed that expression of Erdr1 was significantly downregulated in the epidermis and hair follicles of patients with hair loss disorders, when compared to that in the control group. In particular, the expression of Erdr1 was significantly decreased in patients with alopecia areata. We propose that Erdr1 downregulation might be involved in the pathogenesis of hair loss, and could be considered as a novel biomarker for hair loss disorders.

  8. MiR-27a Promotes Hemin-Induced Erythroid Differentiation of K562 Cells by Targeting CDC25B

    Directory of Open Access Journals (Sweden)

    Dongsheng Wang

    2018-03-01

    Full Text Available Background/Aims: MicroRNAs (miRNAs play a crucial role in erythropoiesis. MiR-23a∼27a∼24-2 clusters have been proven to take part in erythropoiesis via some proteins. CDC25B (cell division control Cdc2 phosphostase B is also the target of mir-27a; whether it regulates erythropoiesis and its mechanism are unknown. Methods: To evaluate the potential role of miR-27a during erythroid differentiation, we performed miR-27a gain- and loss-of-function experiments on hemin-induced K562 cells. We detected miR-27a expression after hemin stimulation at different time points. At the same time, the γ-globin gene also was measured via real-time PCR. According to the results of the chips, we screened the target protein of miR-27a through a dual-luciferase reporter assay and identified it via Western blot analyses. To evaluate the function of CDC25B, benzidine staining and flow cytometry were employed to detect the cell differentiation and cell cycle. Results: We found that miR-27a promotes hemin-induced erythroid differentiation of human K562 cells by targeting cell division cycle 25 B (CDC25B. Overexpression of miR-27a promotes the differentiation of hemin-induced K562 cells, as demonstrated by γ-globin overexpression. The inhibition of miR-27a expression suppresses erythroid differentiation, thus leading to a reduction in the γ-globin gene. CDC25B was identified as a new target of miR-27a during erythroid differentiation. Overexpression of miR-27a led to decreased CDC25B expression after hemin treatment, and CDC25B was up-regulated when miR-27a expression was inhibited. Moreover, the inhibition of CDC25B affected erythroid differentiation, as assessed by γ-globin expression. Conclusion: This study is the first report of the interaction between miR-27a and CDC25B, and it improves the understanding of miRNA functions during erythroid differentiation.

  9. Leukemic blast cell colony formation in semisolid culture with erythropoietin: a case report of acute poorly differentiated erythroid leukemia.

    Science.gov (United States)

    Tomonaga, M; Jinnai, I; Tagawa, M; Amenomori, T; Nishino, K; Yao, E; Nonaka, H; Kuriyama, K; Yoshida, Y; Matsuo, T

    1987-02-01

    The bone marrow of a patient with acute undifferentiated leukemia developed unique colonies after a 14-day culture in erythropoietin (EPO)-containing methylcellulose. The colonies consisted of 20 to 200 nonhemoglobinized large blast cells. Cytogenetic analysis of single colonies revealed hypotetraploid karyotypes with several marker chromosomes that were identical to those found in directly sampled bone marrow. The concurrently formed erythroid bursts showed only normal karyotypes. No leukemic colony formation was observed in other culture systems with either colony-stimulating activity (CSA) or phytohemagglutinin-stimulated leukocyte-conditioned medium (PHA-LCM). The leukemic colonies exhibited a complete EPO-dose dependency similar to that of the patient's normal BFU-E. Although cytochemical and immunologic marker studies of the bone marrow cells failed to clarify the cell lineage of the leukemic cells with extraordinarily large cell size, ultrastructural study revealed erythroid differentiation such as siderosome formation in the cytoplasm and ferritin particles in the rhophecytosis invaginations. These findings indicate that the patient had poorly differentiated erythroid leukemia and that some of the clonogenic cells might respond to EPO in vitro. Corresponding to this biological feature, the leukemic cells were markedly decreased in number in response to repeated RBC transfusions, and partial remission was obtained. These observations suggest that erythroid leukemia distinct from erythroleukemia (M6) with a myeloblastic component, can develop as a minor entity of human acute leukemia.

  10. The first trimester human placenta is a site for terminal maturation of primitive erythroid cells

    OpenAIRE

    Van Handel, Ben; Prashad, Sacha L.; Hassanzadeh-Kiabi, Nargess; Huang, Andy; Magnusson, Mattias; Atanassova, Boriana; Chen, Angela; Hamalainen, Eija I.; Mikkola, Hanna K. A.

    2010-01-01

    Embryonic hematopoiesis starts via the generation of primitive red blood cells (RBCs) that satisfy the embryo's immediate oxygen needs. Although primitive RBCs were thought to retain their nuclei, recent studies have shown that primitive RBCs in mice enucleate in the fetal liver. It has been unknown whether human primitive RBCs enucleate, and what hematopoietic site might support this process. Our data indicate that the terminal maturation and enucleation of human primitive RBCs occurs in fir...

  11. Delayed Mesoderm and Erythroid Differentiation of Murine Embryonic Stem Cells in the Absence of the Transcriptional Regulator FUBP1

    Directory of Open Access Journals (Sweden)

    Josephine Wesely

    2017-01-01

    Full Text Available The transcriptional regulator far upstream binding protein 1 (FUBP1 is essential for fetal and adult hematopoietic stem cell (HSC self-renewal, and the constitutive absence of FUBP1 activity during early development leads to embryonic lethality in homozygous mutant mice. To investigate the role of FUBP1 in murine embryonic stem cells (ESCs and in particular during differentiation into hematopoietic lineages, we generated Fubp1 knockout (KO ESC clones using CRISPR/Cas9 technology. Although FUBP1 is expressed in undifferentiated ESCs and during spontaneous differentiation following aggregation into embryoid bodies (EBs, absence of FUBP1 did not affect ESC maintenance. Interestingly, we observed a delayed differentiation of FUBP1-deficient ESCs into the mesoderm germ layer, as indicated by impaired expression of several mesoderm markers including Brachyury at an early time point of ESC differentiation upon aggregation to EBs. Coculture experiments with OP9 cells in the presence of erythropoietin revealed a diminished differentiation capacity of Fubp1 KO ESCs into the erythroid lineage. Our data showed that FUBP1 is important for the onset of mesoderm differentiation and maturation of hematopoietic progenitor cells into the erythroid lineage, a finding that is supported by the phenotype of FUBP1-deficient mice.

  12. Erythroid precursors from patients with low-risk myelodysplasia demonstrate ultrastructural features of enhanced autophagy of mitochondria

    NARCIS (Netherlands)

    Houwerzijl, E. J.; Pol, H-W D.; Blom, N. R.; van der Want, J. J. L.; de Wolf, J. Thm; Vellenga, E.

    Recent studies in erythroid cells have shown that autophagy is an important process for the physiological clearance of mitochondria during terminal differentiation. However, autophagy also plays an important role in removing damaged and dysfunctional mitochondria. Defective mitochondria and impaired

  13. Role of the mitochondrial amino acid pool in the differential sensitivity of erythroid and myeloid cells to chloramphenicol

    International Nuclear Information System (INIS)

    Abou-Khalil, S.; Abou-Khalil, W.H.; Whitney, P.L.; Yunis, A.A.

    1986-01-01

    Previous studies in the authors laboratory have suggested that mitochondrial amino acid (AA) pool is involved in the differential sensitivity of erythroid and myeloid cells to chloramphenicol (CAP). The present study examines the role of AA pool by analysis of its composition and testing the effects of its major components. The endogenous AA composition of isolated mitochondria protein was determined using a JEOL 5AH AA analyzer. L-( 14 C) leucine incorporation into mitochondrial protein was used to measure the rate of protein synthesis. Analysis of the endogenous pool in erythroleukemia (EM) and chloroleukemia (CM) mitochrondria showed similar total amount of AAs. However, some AAs were present in significantly higher or lower quantity within EM and CM (i.e. EM had about 2-fold higher glycine content). When compensating for each low AA addition of that particular acid to the reaction medium, only glycine and serine had significant effect. Thus, the addition of increasing concentrations of glycine or serine enhanced the sensitivity to CAP from 14% to 49-51% in CM but not in EM. Other AAs gave little or no effect. Since glycine is one of the first reactants in heme biosynthesis within mitochondria and is interconvertible with serine, it would appear that erythroid cells sensitivity to CAP is determined by the mitochondrial glycine-serine pool and may be somehow related of the pathway to heme biosynthesis in these cells

  14. Nuclear Factor Erythroid 2 Regulates Human HSC Self-Renewal and T Cell Differentiation by Preventing NOTCH1 Activation.

    Science.gov (United States)

    Di Tullio, Alessandro; Passaro, Diana; Rouault-Pierre, Kevin; Purewal, Sukhveer; Bonnet, Dominique

    2017-07-11

    Nuclear factor erythroid-derived 2 (NF-E2) has been associated with megakaryocyte maturation and platelet production. Recently, an increased in NF-E2 activity has been implicated in myeloproliferative neoplasms. Here, we investigate the role of NF-E2 in normal human hematopoiesis. Knockdown of NF-E2 in the hematopoietic stem and progenitor cells (HSPCs) not only reduced the formation of megakaryocytes but also drastically impaired hematopoietic stem cell activity, decreasing human engraftment in immunodeficient (NSG) mice. This phenotype is likely to be related to both increased cell proliferation (p21-mediated) and reduced Notch1 protein expression, which favors HSPC differentiation over self-renewal. Strikingly, although NF-E2 silencing in HSPCs did not affect their myeloid and B cell differentiation in vivo, it almost abrogated T cell production in primary hosts, as confirmed by in vitro studies. This effect is at least partly due to Notch1 downregulation in NF-E2-silenced HSPCs. Together these data reveal that NF-E2 is an important driver of human hematopoietic stem cell maintenance and T lineage differentiation. Copyright © 2017 The Author(s). Published by Elsevier Inc. All rights reserved.

  15. Nuclear Factor Erythroid 2 Regulates Human HSC Self-Renewal and T Cell Differentiation by Preventing NOTCH1 Activation

    Directory of Open Access Journals (Sweden)

    Alessandro Di Tullio

    2017-07-01

    Full Text Available Nuclear factor erythroid-derived 2 (NF-E2 has been associated with megakaryocyte maturation and platelet production. Recently, an increased in NF-E2 activity has been implicated in myeloproliferative neoplasms. Here, we investigate the role of NF-E2 in normal human hematopoiesis. Knockdown of NF-E2 in the hematopoietic stem and progenitor cells (HSPCs not only reduced the formation of megakaryocytes but also drastically impaired hematopoietic stem cell activity, decreasing human engraftment in immunodeficient (NSG mice. This phenotype is likely to be related to both increased cell proliferation (p21-mediated and reduced Notch1 protein expression, which favors HSPC differentiation over self-renewal. Strikingly, although NF-E2 silencing in HSPCs did not affect their myeloid and B cell differentiation in vivo, it almost abrogated T cell production in primary hosts, as confirmed by in vitro studies. This effect is at least partly due to Notch1 downregulation in NF-E2-silenced HSPCs. Together these data reveal that NF-E2 is an important driver of human hematopoietic stem cell maintenance and T lineage differentiation.

  16. Possible interaction between B1 retrotransposon-containing sequences and β(major) globin gene transcriptional activation during MEL cell erythroid differentiation.

    Science.gov (United States)

    Vizirianakis, Ioannis S; Tezias, Sotirios S; Amanatiadou, Elsa P; Tsiftsoglou, Asterios S

    2012-01-01

    Repetitive sequences consist of >50% of mammalian genomic DNAs and among these SINEs (short interspersed nuclear elements), e.g. B1 elements, account for 8% of the mouse genome. In an effort to delineate the molecular mechanism(s) involved in the blockade of the in vitro differentiation program of MEL (murine erythroleukaemia) cells by treatment with methylation inhibitors, we detected a DNA region of 559 bp in chromosome 7 located downstream of the 3'-end of the β(major) globin gene (designated B1-559) with unique characteristics. We have fully characterized this B1-559 region that includes a B1 element, several repeats of ATG initiation codons and consensus DNA-binding sites for erythroid-specific transcription factors NF-E2 (nuclear factor-erythroid-derived 2), GATA-1 and EKLF (erythroid Krüppel-like factor). Fragments derived from B1-559 incubated with nuclear extracts form protein complexes in both undifferentiated and differentiated MEL cells. Transient reporter-gene experiments in MEL and human erythroleukaemia K-562 cells with recombinant constructs containing B1-559 fragments linked to HS-2 (hypersensitive site-2) sequences of human β-globin gene LCR (locus control region) indicated potential cooperation upon erythropoiesis and globin gene expression. The possible interaction between the B1-559 region and β(major) globin gene transcriptional activation upon execution of erythroid MEL cell differentiation programme is discussed. © The Author(s) Journal compilation © 2012 Portland Press Limited

  17. Regulator of differentiation 1 (ROD1) binds to the amphipathic C-terminal peptide of thrombospondin-4 and is involved in its mitogenic activity.

    Science.gov (United States)

    Sadvakassova, Gulzhakhan; Dobocan, Monica C; Difalco, Marcos R; Congote, Luis F

    2009-09-01

    The matrix protein thrombospondin-4 has an acidic amphipathic C-terminal peptide (C21) which stimulates erythroid cell proliferation. Here we show that C21 stimulates red cell formation in anemic mice in vivo. In vitro experiments indicated that the peptide-mediated increase of erythroid colony formation in cultures of human CD34+ hematopoietic progenitor cells was possible only under continuous presence of erythropoietin. In the absence of this cytokine, C21 stimulated exclusively myeloid colony formation. Therefore, the peptide is not a specific erythroid differentiation factor. In fact, it is mitogenic in non-erythroid cells, such as skin fibroblasts and kidney epithelial cells. In erythroleukemic TF-1 cells, it actually decreased the production of the erythroid differentiation marker glycophorin A. C21-affinity chromatography revealed regulator of differentiation 1 (ROD1) as a major C21-binding protein. ROD1 is the hematopoietic cell paralog of polypyrimidine tract binding proteins (PTBs), RNA splice regulators which regulate differentiation by repressing tissue-specific exons. ROD1 binding to C21 was strongly inhibited by synthetic RNAs in the order poly A > poly U > poly G = poly C and was weakly inhibited by a synthetic phosphorylated peptide mimicking the C-terminal domain of RNA polymerase II. Cellular overexpression or knockdown experiments of ROD1 suggest a role for this protein in the mitogenic activity of C21. Since the nuclear proteins ROD1 and PTBs regulate differentiation at a posttranscriptional level and there is a fast nuclear uptake of C21, we put forward the idea that the peptide is internalized, goes to the nucleus and maintains cells in a proliferative state by supporting ROD1-mediated inhibition of differentiation.

  18. TMEM14C is required for erythroid mitochondrial heme metabolism.

    Science.gov (United States)

    Yien, Yvette Y; Robledo, Raymond F; Schultz, Iman J; Takahashi-Makise, Naoko; Gwynn, Babette; Bauer, Daniel E; Dass, Abhishek; Yi, Gloria; Li, Liangtao; Hildick-Smith, Gordon J; Cooney, Jeffrey D; Pierce, Eric L; Mohler, Kyla; Dailey, Tamara A; Miyata, Non; Kingsley, Paul D; Garone, Caterina; Hattangadi, Shilpa M; Huang, Hui; Chen, Wen; Keenan, Ellen M; Shah, Dhvanit I; Schlaeger, Thorsten M; DiMauro, Salvatore; Orkin, Stuart H; Cantor, Alan B; Palis, James; Koehler, Carla M; Lodish, Harvey F; Kaplan, Jerry; Ward, Diane M; Dailey, Harry A; Phillips, John D; Peters, Luanne L; Paw, Barry H

    2014-10-01

    The transport and intracellular trafficking of heme biosynthesis intermediates are crucial for hemoglobin production, which is a critical process in developing red cells. Here, we profiled gene expression in terminally differentiating murine fetal liver-derived erythroid cells to identify regulators of heme metabolism. We determined that TMEM14C, an inner mitochondrial membrane protein that is enriched in vertebrate hematopoietic tissues, is essential for erythropoiesis and heme synthesis in vivo and in cultured erythroid cells. In mice, TMEM14C deficiency resulted in porphyrin accumulation in the fetal liver, erythroid maturation arrest, and embryonic lethality due to profound anemia. Protoporphyrin IX synthesis in TMEM14C-deficient erythroid cells was blocked, leading to an accumulation of porphyrin precursors. The heme synthesis defect in TMEM14C-deficient cells was ameliorated with a protoporphyrin IX analog, indicating that TMEM14C primarily functions in the terminal steps of the heme synthesis pathway. Together, our data demonstrate that TMEM14C facilitates the import of protoporphyrinogen IX into the mitochondrial matrix for heme synthesis and subsequent hemoglobin production. Furthermore, the identification of TMEM14C as a protoporphyrinogen IX importer provides a genetic tool for further exploring erythropoiesis and congenital anemias.

  19. Chromatin condensation in terminally differentiating mouse erythroblasts does not involve special architectural proteins but depends on histone deacetylation

    Energy Technology Data Exchange (ETDEWEB)

    Popova, Evgenya Y.; Krauss, Sharon Wald; Short, Sarah A.; Lee, Gloria; Villalobos, Jonathan; Etzell, Joan; Koury, Mark J.; Ney, Paul A.; Chasis, Joel Anne; Grigoryev, Sergei A.

    2008-08-21

    Terminal erythroid differentiation in vertebrates is characterized by progressive heterochromatin formation, chromatin condensation and, in mammals, culminates in nuclear extrusion. To date, although mechanisms regulating avian erythroid chromatin condensation have been identified, little is known regarding this process during mammalian erythropoiesis. To elucidate the molecular basis for mammalian erythroblast chromatin condensation, we used Friend virus-infected murine spleen erythroblasts that undergo terminal differentiation in vitro. Chromatin isolated from early and late stage erythroblasts had similar levels of linker and core histones, only a slight difference in nucleosome repeats, and no significant accumulation of known developmentally-regulated architectural chromatin proteins. However, histone H3(K9) dimethylation markedly increased while histone H4(K12) acetylation dramatically decreased and became segregated from the histone methylation as chromatin condensed. One histone deacetylase, HDAC5, was significantly upregulated during the terminal stages of Friend virus-infected erythroblast differentiation. Treatment with histone deacetylase inhibitor, trichostatin A, blocked both chromatin condensation and nuclear extrusion. Based on our data, we propose a model for a unique mechanism in which extensive histone deacetylation at pericentromeric heterochromatin mediates heterochromatin condensation in vertebrate erythroblasts that would otherwise be mediated by developmentally-regulated architectural proteins in nucleated blood cells.

  20. Identification of Stages of Erythroid Differentiation in Bone Marrow and Erythrocyte Subpopulations in Blood Circulation that Are Preferentially Lost in Autoimmune Hemolytic Anemia in Mouse.

    Directory of Open Access Journals (Sweden)

    Sreoshi Chatterjee

    Full Text Available Repeated weekly injections of rat erythrocytes produced autoimmune hemolytic anemia (AIHA in C57BL/6 mice after 5-6 weeks. Using the double in vivo biotinylation (DIB technique, recently developed in our laboratory, turnover of erythrocyte cohorts of different age groups during AIHA was monitored. Results indicate a significant decline in the proportion of reticulocytes, young and intermediate age groups of erythrocytes, but a significant increase in the proportion of old erythrocytes in blood circulation. Binding of the autoantibody was relatively higher to the young erythrocytes and higher levels of intracellular reactive oxygen species (ROS were also seen in these cells. Erythropoietic activity in the bone marrows and the spleen of AIHA induced mice was examined by monitoring the relative proportion of erythroid cells at various stages of differentiation in these organs. Cells at different stages of differentiation were enumerated flow cytometrically by double staining with anti-Ter119 and anti-transferrin receptor (CD71 monoclonal antibodies. Erythroid cells in bone marrow declined significantly in AIHA induced mice, erythroblast C being most affected (50% decline. Erythroblast C also recorded high intracellular ROS level along with increased levels of membrane-bound autoantibody. No such decline was observed in spleen. A model of AIHA has been proposed indicating that binding of autoantibodies may not be a sufficient condition for destruction of erythroid cells in bone marrow and in blood circulation. Last stage of erythropoietic differentiation in bone marrow and early stages of erythrocytes in blood circulation are specifically susceptible to removal in AIHA.

  1. Antisense myb inhibition of purified erythroid progenitors in development and differentiation is linked to cycling activity and expression of DNA polymerase alpha

    International Nuclear Information System (INIS)

    Valtieri, M.; Venturelli, D.; Care, A.; Fossati, C.; Pelosi, E.; Labbaye, C.; Mattia, G.; Gewirtz, A.M.; Calabretta, B.; Peschle, C.

    1991-01-01

    These studies aimed to determine the expression and functional role of c-myb in erythroid progenitors with different cycling activities. In the first series of experiments the erythroid burst-forming unit (BFU-E) and colony-forming unit (CFU-E) populations from adult peripheral blood (PB), bone marrow (BM), and embryonic-fetal liver (FL) were treated with either c-myb antisense oligomers or 3H-thymidine (3H-TdR). A direct correlation was always observed between the inhibitory effect of anti-myb oligomers and the level of cycling activity. Thus, the inhibitory effect of antisense c-myb on the number of BFU-E colonies was 28.3% +/- 15.8% in PB, 53.4% +/- 9.3% in BM, and 68.2% +/- 24.5% in FL. Both adult and embryonic CFU-E were markedly inhibited. Using purified PB progenitors, we observed a similar pattern, although with slightly lower inhibitory effects. In the 3H-TdR suicide assay the killing index of BFU-E was 8.9% +/- 4.2% in PB, 29.4% +/- 6.5% in BM, and 40.1% +/- 9.6% in FL. The values for adult and embryonic CFU-E were 55.7% +/- 7.9% and 60.98% +/- 6.6%, respectively. We then investigated the kinetics of c-myb mRNA level during the erythroid differentiation of purified adult PB and FL BFU-E, as evaluated in liquid-phase culture by reverse transcription-polymerase chain reaction. Adult erythroid precursors showed a gradual increase of c-myb mRNA from day 4 through day 8 of culture and a sharp decrease at later times, whereas the expression of c-myb mRNA and protein in differentiation embryonic precursors peaked 2 days earlier. In both cases, c-myb mRNA level peaked at the CFU-E stage of differentiation. Finally, highly purified adult PB BFU-E were stimulated into cycling by a 3-day treatment with interleukin-3 in liquid phase: both the sensitivity to c-myb antisense oligomers and the 3H-TdR suicide index showed a gradual, strictly parallel increase

  2. Distinct roles of the receptor tyrosine kinases c-ErbB and c-Kit in regulating the balance between erythroid cell proliferation and differentiation

    NARCIS (Netherlands)

    Wessely, O.; Mellitzer, G.; von Lindern, M.; Levitzki, A.; Gazit, A.; Ischenko, I.; Hayman, M. J.; Beug, H.

    1997-01-01

    In the bone marrow, multipotent and committed hematopoietic progenitors have to closely regulate their balance between sustained proliferation without differentiation (self renewal) and entering a terminal differentiation pathway. A useful model to analyze this regulation at the molecular level is

  3. Unravelling pathways downstream Sox6 induction in K562 erythroid cells by proteomic analysis

    KAUST Repository

    Barbarani, Gloria

    2017-10-20

    The Sox6 transcription factor is crucial for terminal maturation of definitive red blood cells. Sox6-null mouse fetuses present misshapen and nucleated erythrocytes, due to impaired actin assembly and cytoskeleton stability. These defects are accompanied with a reduced survival of Sox6-/- red blood cells, resulting in a compensated anemia. Sox6-overexpression in K562 cells and in human primary ex vivo erythroid cultures enhances erythroid differentiation and leads to hemoglobinization, the hallmark of erythroid maturation. To obtain an overview on processes downstream to Sox6 expression, we performed a differential proteomic analysis on human erythroid K562 cells overexpressing Sox6. Sox6-overexpression induces dysregulation of 64 proteins, involved in cytoskeleton remodeling and in protein synthesis, folding and trafficking, key processes for erythroid maturation. Moreover, 43 out of 64 genes encoding for differentially expressed proteins contain within their proximal regulatory regions sites that are bound by SOX6 according to ENCODE ChIP-seq datasets and are possible direct SOX6 targets. SAR1B, one of the most induced proteins upon Sox6 overexpression, shares a conserved regulatory module, composed by a double SOX6 binding site and a GATA1 consensus, with the adjacent SEC24 A gene. Since both genes encode for COPII components, this element could concur to the coordinated expression of these proteins during erythropoiesis.

  4. Extended flow cytometry characterization of normal bone marrow progenitor cells by simultaneous detection of aldehyde dehydrogenase and early hematopoietic antigens: implication for erythroid differentiation studies

    Directory of Open Access Journals (Sweden)

    Pascariello Caterina

    2008-05-01

    Full Text Available Abstract Background Aldehyde dehydrogenase (ALDH is a cytosolic enzyme highly expressed in hematopoietic precursors from cord blood and granulocyte-colony stimulating factor mobilized peripheral blood, as well as in bone marrow from patients with acute myeloblastic leukemia. As regards human normal bone marrow, detailed characterization of ALDH+ cells has been addressed by one single study (Gentry et al, 2007. The goal of our work was to provide new information about the dissection of normal bone marrow progenitor cells based upon the simultaneous detection by flow cytometry of ALDH and early hematopoietic antigens, with particular attention to the expression of ALDH on erythroid precursors. To this aim, we used three kinds of approach: i multidimensional analytical flow cytometry, detecting ALDH and early hematopoietic antigens in normal bone marrow; ii fluorescence activated cell sorting of distinct subpopulations of progenitor cells, followed by in vitro induction of erythroid differentiation; iii detection of ALDH+ cellular subsets in bone marrow from pure red cell aplasia patients. Results In normal bone marrow, we identified three populations of cells, namely ALDH+CD34+, ALDH-CD34+ and ALDH+CD34- (median percentages were 0.52, 0.53 and 0.57, respectively. As compared to ALDH-CD34+ cells, ALDH+CD34+ cells expressed the phenotypic profile of primitive hematopoietic progenitor cells, with brighter expression of CD117 and CD133, accompanied by lower display of CD38 and CD45RA. Of interest, ALDH+CD34- population disclosed a straightforward erythroid commitment, on the basis of three orders of evidences. First of all, ALDH+CD34- cells showed a CD71bright, CD105+, CD45- phenotype. Secondly, induction of differentiation experiments evidenced a clear-cut expression of glycophorin A (CD235a. Finally, ALDH+CD34- precursors were not detectable in patients with pure red cell aplasia (PRCA. Conclusion Our study, comparing surface antigen expression of

  5. Recombinant human parvovirus B19 vectors: erythroid cell-specific delivery and expression of transduced genes.

    Science.gov (United States)

    Ponnazhagan, S; Weigel, K A; Raikwar, S P; Mukherjee, P; Yoder, M C; Srivastava, A

    1998-06-01

    A novel packaging strategy combining the salient features of two human parvoviruses, namely the pathogenic parvovirus B19 and the nonpathogenic adeno-associated virus type 2 (AAV), was developed to achieve erythroid cell-specific delivery as well as expression of the transduced gene. The development of such a chimeric vector system was accomplished by packaging heterologous DNA sequences cloned within the inverted terminal repeats of AAV and subsequently packaging the DNA inside the capsid structure of B19 virus. Recombinant B19 virus particles were assembled, as evidenced by electron microscopy as well as DNA slot blot analyses. The hybrid vector failed to transduce nonerythroid human cells, such as 293 cells, as expected. However, MB-02 cells, a human megakaryocytic leukemia cell line which can be infected by B19 virus following erythroid differentiation with erythropoietin (N. C. Munshi, S. Z. Zhou, M. J. Woody, D. A. Morgan, and A. Srivastava, J. Virol. 67:562-566, 1993) but lacks the putative receptor for AAV (S. Ponnazhagan, X.-S. Wang, M. J. Woody, F. Luo, L. Y. Kang, M. L. Nallari, N. C. Munshi, S. Z. Zhou, and A. Srivastava, J. Gen. Virol. 77:1111-1122, 1996), were readily transduced by this vector. The hybrid vector was also found to specifically target the erythroid population in primary human bone marrow cells as well as more immature hematopoietic progenitor cells following erythroid differentiation, as evidenced by selective expression of the transduced gene in these target cells. Preincubation with anticapsid antibodies against B19 virus, but not anticapsid antibodies against AAV, inhibited transduction of primary human erythroid cells. The efficiency of transduction of primary human erythroid cells by the recombinant B19 virus vector was significantly higher than that by the recombinant AAV vector. Further development of the AAV-B19 virus hybrid vector system should prove beneficial in gene therapy protocols aimed at the correction of inherited and

  6. Recombinant Human Parvovirus B19 Vectors: Erythroid Cell-Specific Delivery and Expression of Transduced Genes

    Science.gov (United States)

    Ponnazhagan, Selvarangan; Weigel, Kirsten A.; Raikwar, Sudhanshu P.; Mukherjee, Pinku; Yoder, Mervin C.; Srivastava, Arun

    1998-01-01

    A novel packaging strategy combining the salient features of two human parvoviruses, namely the pathogenic parvovirus B19 and the nonpathogenic adeno-associated virus type 2 (AAV), was developed to achieve erythroid cell-specific delivery as well as expression of the transduced gene. The development of such a chimeric vector system was accomplished by packaging heterologous DNA sequences cloned within the inverted terminal repeats of AAV and subsequently packaging the DNA inside the capsid structure of B19 virus. Recombinant B19 virus particles were assembled, as evidenced by electron microscopy as well as DNA slot blot analyses. The hybrid vector failed to transduce nonerythroid human cells, such as 293 cells, as expected. However, MB-02 cells, a human megakaryocytic leukemia cell line which can be infected by B19 virus following erythroid differentiation with erythropoietin (N. C. Munshi, S. Z. Zhou, M. J. Woody, D. A. Morgan, and A. Srivastava, J. Virol. 67:562–566, 1993) but lacks the putative receptor for AAV (S. Ponnazhagan, X.-S. Wang, M. J. Woody, F. Luo, L. Y. Kang, M. L. Nallari, N. C. Munshi, S. Z. Zhou, and A. Srivastava, J. Gen. Virol. 77:1111–1122, 1996), were readily transduced by this vector. The hybrid vector was also found to specifically target the erythroid population in primary human bone marrow cells as well as more immature hematopoietic progenitor cells following erythroid differentiation, as evidenced by selective expression of the transduced gene in these target cells. Preincubation with anticapsid antibodies against B19 virus, but not anticapsid antibodies against AAV, inhibited transduction of primary human erythroid cells. The efficiency of transduction of primary human erythroid cells by the recombinant B19 virus vector was significantly higher than that by the recombinant AAV vector. Further development of the AAV-B19 virus hybrid vector system should prove beneficial in gene therapy protocols aimed at the correction of inherited

  7. Forkhead Box C1 Regulates Human Primary Keratinocyte Terminal Differentiation.

    Directory of Open Access Journals (Sweden)

    Lianghua Bin

    Full Text Available The epidermis serves as a critical protective barrier between the internal and external environment of the human body. Its remarkable barrier function is established through the keratinocyte (KC terminal differentiation program. The transcription factors specifically regulating terminal differentiation remain largely unknown. Using a RNA-sequencing (RNA-seq profiling approach, we found that forkhead box c 1 (FOXC1 was significantly up-regulated in human normal primary KC during the course of differentiation. This observation was validated in human normal primary KC from several different donors and human skin biopsies. Silencing FOXC1 in human normal primary KC undergoing differentiation led to significant down-regulation of late terminal differentiation genes markers including epidermal differentiation complex genes, keratinization genes, sphingolipid/ceramide metabolic process genes and epidermal specific cell-cell adhesion genes. We further demonstrated that FOXC1 works down-stream of ZNF750 and KLF4, and upstream of GRHL3. Thus, this study defines FOXC1 as a regulator specific for KC terminal differentiation and establishes its potential position in the genetic regulatory network.

  8. Osteogenic cell differentiation on H-terminated and O-terminated nanocrystalline diamond films

    Directory of Open Access Journals (Sweden)

    Liskova J

    2015-01-01

    Full Text Available Jana Liskova,1 Oleg Babchenko,2 Marian Varga,2 Alexander Kromka,2 Daniel Hadraba,1 Zdenek Svindrych,1 Zuzana Burdikova,1 Lucie Bacakova1 1Institute of Physiology, Academy of Sciences of the Czech Republic, Prague, Czech Republic; 2Institute of Physics, Academy of Sciences of the Czech Republic, Prague, Czech Republic Abstract: Nanocrystalline diamond (NCD films are promising materials for bone implant coatings because of their biocompatibility, chemical resistance, and mechanical hardness. Moreover, NCD wettability can be tailored by grafting specific atoms. The NCD films used in this study were grown on silicon substrates by microwave plasma-enhanced chemical vapor deposition and grafted by hydrogen atoms (H-termination or oxygen atoms (O-termination. Human osteoblast-like Saos-2 cells were used for biological studies on H-terminated and O-terminated NCD films. The adhesion, growth, and subsequent differentiation of the osteoblasts on NCD films were examined, and the extracellular matrix production and composition were quantified. The osteoblasts that had been cultivated on the O-terminated NCD films exhibited a higher growth rate than those grown on the H-terminated NCD films. The mature collagen fibers were detected in Saos-2 cells on both the H-terminated and O-terminated NCD films; however, the quantity of total collagen in the extracellular matrix was higher on the O-terminated NCD films, as were the amounts of calcium deposition and alkaline phosphatase activity. Nevertheless, the expression of genes for osteogenic markers – type I collagen, alkaline phosphatase, and osteocalcin – was either comparable on the H-terminated and O-terminated films or even lower on the O-terminated films. In conclusion, the higher wettability of the O-terminated NCD films is promising for adhesion and growth of osteoblasts. In addition, the O-terminated surface also seems to support the deposition of extracellular matrix proteins and extracellular matrix

  9. The death effector domains of caspase-8 induce terminal differentiation.

    Directory of Open Access Journals (Sweden)

    Ainhoa Mielgo

    2009-11-01

    Full Text Available The differentiation and senescence programs of metazoans play key roles in regulating normal development and preventing aberrant cell proliferation, such as cancer. These programs are intimately associated with both the mitotic and apoptotic pathways. Caspase-8 is an apical apoptotic initiator that has recently been appreciated to coordinate non-apoptotic roles in the cell. Most of these functions are attributed to the catalytic domain, however, the amino-terminal death effector domains (DEDs, which belong to the death domain superfamily of proteins, can also play key roles during development. Here we describe a novel role for caspase-8 DEDs in regulating cell differentiation and senescence. Caspase-8 DEDs accumulate during terminal differentiation and senescence of epithelial, endothelial and myeloid cells; genetic deletion or shRNA suppression of caspase-8 disrupts cell differentiation, while re-expression of DEDs rescues this phenotype. Among caspase-8 deficient neuroblastoma cells, DED expression attenuated tumor growth in vivo and proliferation in vitro via disruption of mitosis and cytokinesis, resulting in upregulation of p53 and induction of differentiation markers. These events occur independent of caspase-8 catalytic activity, but require a critical lysine (K156 in a microtubule-binding motif in the second DED domain. The results demonstrate a new function for the DEDs of caspase-8, and describe an unexpected mechanism that contributes to cell differentiation and senescence.

  10. Bmi-1 Regulates Extensive Erythroid Self-Renewal

    Directory of Open Access Journals (Sweden)

    Ah Ram Kim

    2015-06-01

    Full Text Available Red blood cells (RBCs, responsible for oxygen delivery and carbon dioxide exchange, are essential for our well-being. Alternative RBC sources are needed to meet the increased demand for RBC transfusions projected to occur as our population ages. We previously have discovered that erythroblasts derived from the early mouse embryo can self-renew extensively ex vivo for many months. To better understand the mechanisms regulating extensive erythroid self-renewal, global gene expression data sets from self-renewing and differentiating erythroblasts were analyzed and revealed the differential expression of Bmi-1. Bmi-1 overexpression conferred extensive self-renewal capacity upon adult bone-marrow-derived self-renewing erythroblasts, which normally have limited proliferative potential. Importantly, Bmi-1 transduction did not interfere with the ability of extensively self-renewing erythroblasts (ESREs to terminally mature either in vitro or in vivo. Bmi-1-induced ESREs can serve to generate in vitro models of erythroid-intrinsic disorders and ultimately may serve as a source of cultured RBCs for transfusion therapy.

  11. Epigenetic heterochromatin markers distinguish terminally differentiated leukocytes from incompletely differentiated leukemia cells in human blood

    Czech Academy of Sciences Publication Activity Database

    Popova, Evgenya Y.; Claxton, David F.; Lukášová, Emilie; Bird, Philip I.; Grigoryev, Sergei A.

    2006-01-01

    Roč. 34, č. 4 (2006), s. 453-462 ISSN 0301-472X R&D Projects: GA AV ČR(CZ) 1QS500040508 Institutional research plan: CEZ:AV0Z50040507 Keywords : terminal cell differentiation * chromatin structure * chronic myeloid leukemia Subject RIV: BO - Biophysics Impact factor: 3.408, year: 2006

  12. PU.1 silencing leads to terminal differentiation of erythroleukemia cells

    International Nuclear Information System (INIS)

    Atar, Orna; Levi, Ben-Zion

    2005-01-01

    The transcription factor PU.1 plays a central role in development and differentiation of hematopoietic cells. Evidence from PU.1 knockout mice indicates a pivotal role for PU.1 in myeloid lineage and B-lymphocyte development. In addition, PU.1 is a key player in the development of Friend erythroleukemia disease, which is characterized by proliferation and differentiation arrest of proerythrocytes. To study the role of PU.1 in erythroleukemia, we have used murine erythroleukemia cells, isolated from Friend virus-infected mice. Expression of PU.1 small interfering RNA in these cells led to significant inhibition of PU.1 levels. This was accompanied by inhibition of proliferation and restoration in the ability of the proerythroblastic cells to produce hemoglobin, i.e., reversion of the leukemic phenotype. The data suggest that overexpression of PU.1 gene is the immediate cause for maintaining the leukemic phenotype of the disease by retaining the self-renewal capacity of transformed erythroblastic cells and by blocking the terminal differentiation program towards erythrocytes

  13. Mechanisms of dealing with DNA damage in terminally differentiated cells

    Energy Technology Data Exchange (ETDEWEB)

    Fortini, P. [Department of Environment and Primary Prevention, Istituto Superiore di Sanita, Viale Regina Elena 299, 00161 Rome (Italy); Dogliotti, E., E-mail: eugenia.dogliotti@iss.it [Department of Environment and Primary Prevention, Istituto Superiore di Sanita, Viale Regina Elena 299, 00161 Rome (Italy)

    2010-03-01

    To protect genomic integrity living cells that are continuously exposed to DNA-damaging insults are equipped with an efficient defence mechanism termed the DNA damage response. Its function is to eliminate DNA damage through DNA repair and to remove damaged cells by apoptosis. The DNA damage response has been investigated mainly in proliferating cells, in which the cell cycle machinery is integrated with the DNA damage signalling. The current knowledge of the mechanisms of DNA repair, DNA damage signalling and cell death of post-mitotic cells that have undergone irreversible cell cycle withdrawal will be reviewed. Evidence will be provided that the protection of the genome integrity in terminally differentiated cells is achieved by different strategies than in proliferating cells.

  14. Mechanisms of dealing with DNA damage in terminally differentiated cells

    International Nuclear Information System (INIS)

    Fortini, P.; Dogliotti, E.

    2010-01-01

    To protect genomic integrity living cells that are continuously exposed to DNA-damaging insults are equipped with an efficient defence mechanism termed the DNA damage response. Its function is to eliminate DNA damage through DNA repair and to remove damaged cells by apoptosis. The DNA damage response has been investigated mainly in proliferating cells, in which the cell cycle machinery is integrated with the DNA damage signalling. The current knowledge of the mechanisms of DNA repair, DNA damage signalling and cell death of post-mitotic cells that have undergone irreversible cell cycle withdrawal will be reviewed. Evidence will be provided that the protection of the genome integrity in terminally differentiated cells is achieved by different strategies than in proliferating cells.

  15. Unravelling pathways downstream Sox6 induction in K562 erythroid cells by proteomic analysis

    KAUST Repository

    Barbarani, Gloria; Ronchi, Antonella; Ruoppolo, Margherita; Santorelli, Lucia; Steinfelder, Robert; Elangovan, Sudharshan; Fugazza, Cristina; Caterino, Marianna

    2017-01-01

    are accompanied with a reduced survival of Sox6-/- red blood cells, resulting in a compensated anemia. Sox6-overexpression in K562 cells and in human primary ex vivo erythroid cultures enhances erythroid differentiation and leads to hemoglobinization, the hallmark

  16. The effect of dexamethasone and triiodothyronine on terminal differentiation of primary bovine chondrocytes and chondrogenically differentiated mesenchymal stem cells.

    Science.gov (United States)

    Randau, Thomas M; Schildberg, Frank A; Alini, Mauro; Wimmer, Matthias D; Haddouti, El-Mustapha; Gravius, Sascha; Ito, Keita; Stoddart, Martin J

    2013-01-01

    The newly evolved field of regenerative medicine is offering solutions in the treatment of bone or cartilage loss and deficiency. Mesenchymal stem cells, as well as articular chondrocytes, are potential cells for the generation of bone or cartilage. The natural mechanism of bone formation is that of endochondral ossification, regulated, among other factors, through the hormones dexamethasone and triiodothyronine. We investigated the effects of these hormones on articular chondrocytes and chondrogenically differentiated mesenchymal stem cells, hypothesizing that these hormones would induce terminal differentiation, with chondrocytes and differentiated stem cells being similar in their response. Using a 3D-alginate cell culture model, bovine chondrocytes and chondrogenically differentiated stem cells were cultured in presence of triiodothyronine or dexamethasone, and cell proliferation and extracellular matrix production were investigated. Collagen mRNA expression was measured by real-time PCR. Col X mRNA and alkaline phosphatase were monitored as markers of terminal differentiation, a prerequisite of endochondral ossification. The alginate culture system worked well, both for the culture of chondrocytes and for the chondrogenic differentiation of mesenchymal stem cells. Dexamethasone led to an increase in glycosaminoglycan production. Triiodothyronine increased the total collagen production only in chondrocytes, where it also induced signs of terminal differentiation, increasing both collagen X mRNA and alkaline phosphatase activity. Dexamethasone induced terminal differentiation in the differentiated stem cells. The immature articular chondrocytes used in this study seem to be able to undergo terminal differentiation, pointing to their possible role in the onset of degenerative osteoarthritis, as well as their potential for a cell source in bone tissue engineering. When chondrocyte-like cells, after their differentiation, can indeed be moved on towards terminal

  17. BET bromodomain inhibition rescues erythropoietin differentiation of human erythroleukemia cell line UT7

    International Nuclear Information System (INIS)

    Goupille, Olivier; Penglong, Tipparat; Lefèvre, Carine; Granger, Marine; Kadri, Zahra; Fucharoen, Suthat; Maouche-Chrétien, Leila; Leboulch, Philippe; Chrétien, Stany

    2012-01-01

    Highlights: ► UT7 erythroleukemia cells are known to be refractory to differentiate. ► Brief JQ1 treatment initiates the first steps of erythroid differentiation program. ► Engaged UT7 cells then maturate in the presence of erythropoietin. ► Sustained JQ1 treatment inhibits both proliferation and erythroid differentiation. -- Abstract: Malignant transformation is a multistep process requiring oncogenic activation, promoting cellular proliferation, frequently coupled to inhibition of terminal differentiation. Consequently, forcing the reengagement of terminal differentiation of transformed cells coupled or not with an inhibition of their proliferation is a putative therapeutic approach to counteracting tumorigenicity. UT7 is a human leukemic cell line able to grow in the presence of IL3, GM-CSF and Epo. This cell line has been widely used to study Epo-R/Epo signaling pathways but is a poor model for erythroid differentiation. We used the BET bromodomain inhibition drug JQ1 to target gene expression, including that of c-Myc. We have shown that only 2 days of JQ1 treatment was required to transitory inhibit Epo-induced UT7 proliferation and to restore terminal erythroid differentiation. This study highlights the importance of a cellular erythroid cycle break mediated by c-Myc inhibition before initiation of the erythropoiesis program and describes a new model for BET bromodomain inhibitor drug application.

  18. BET bromodomain inhibition rescues erythropoietin differentiation of human erythroleukemia cell line UT7

    Energy Technology Data Exchange (ETDEWEB)

    Goupille, Olivier [CEA, Institute of Emerging Diseases and Innovative Therapies, Fontenay-aux-Roses (France); UMR INSERM U.962, University Paris XI, CEA, Fontenay-aux-Roses (France); Penglong, Tipparat [CEA, Institute of Emerging Diseases and Innovative Therapies, Fontenay-aux-Roses (France); UMR INSERM U.962, University Paris XI, CEA, Fontenay-aux-Roses (France); Thalassemia Research Center and Department of Clinical Pathology, Faculty of Medicine, Ramathibodi Hospital, Mahidol University (Thailand); Lefevre, Carine; Granger, Marine; Kadri, Zahra [CEA, Institute of Emerging Diseases and Innovative Therapies, Fontenay-aux-Roses (France); UMR INSERM U.962, University Paris XI, CEA, Fontenay-aux-Roses (France); Fucharoen, Suthat [Thalassemia Research Center and Department of Clinical Pathology, Faculty of Medicine, Ramathibodi Hospital, Mahidol University (Thailand); Maouche-Chretien, Leila [CEA, Institute of Emerging Diseases and Innovative Therapies, Fontenay-aux-Roses (France); UMR INSERM U.962, University Paris XI, CEA, Fontenay-aux-Roses (France); Leboulch, Philippe [CEA, Institute of Emerging Diseases and Innovative Therapies, Fontenay-aux-Roses (France); UMR INSERM U.962, University Paris XI, CEA, Fontenay-aux-Roses (France); Genetics Division, Department of Medicine, Brigham and Women' s Hospital and Harvard Medical School, Boston, MA (United States); Chretien, Stany, E-mail: stany.chretien@cea.fr [CEA, Institute of Emerging Diseases and Innovative Therapies, Fontenay-aux-Roses (France); UMR INSERM U.962, University Paris XI, CEA, Fontenay-aux-Roses (France)

    2012-12-07

    Highlights: Black-Right-Pointing-Pointer UT7 erythroleukemia cells are known to be refractory to differentiate. Black-Right-Pointing-Pointer Brief JQ1 treatment initiates the first steps of erythroid differentiation program. Black-Right-Pointing-Pointer Engaged UT7 cells then maturate in the presence of erythropoietin. Black-Right-Pointing-Pointer Sustained JQ1 treatment inhibits both proliferation and erythroid differentiation. -- Abstract: Malignant transformation is a multistep process requiring oncogenic activation, promoting cellular proliferation, frequently coupled to inhibition of terminal differentiation. Consequently, forcing the reengagement of terminal differentiation of transformed cells coupled or not with an inhibition of their proliferation is a putative therapeutic approach to counteracting tumorigenicity. UT7 is a human leukemic cell line able to grow in the presence of IL3, GM-CSF and Epo. This cell line has been widely used to study Epo-R/Epo signaling pathways but is a poor model for erythroid differentiation. We used the BET bromodomain inhibition drug JQ1 to target gene expression, including that of c-Myc. We have shown that only 2 days of JQ1 treatment was required to transitory inhibit Epo-induced UT7 proliferation and to restore terminal erythroid differentiation. This study highlights the importance of a cellular erythroid cycle break mediated by c-Myc inhibition before initiation of the erythropoiesis program and describes a new model for BET bromodomain inhibitor drug application.

  19. The aryl hydrocarbon receptor and estrogen receptor alpha differentially modulate nuclear factor erythroid-2-related factor 2 transactivation in MCF-7 breast cancer cells

    Energy Technology Data Exchange (ETDEWEB)

    Lo, Raymond; Matthews, Jason, E-mail: jason.matthews@utoronto.ca

    2013-07-15

    Nuclear factor erythroid-2-related factor 2 (NRF2; NFE2L2) plays an important role in mediating cellular protection against reactive oxygen species. NRF2 signaling is positively modulated by the aryl hydrocarbon receptor (AHR) but inhibited by estrogen receptor alpha (ERα). In this study we investigated the crosstalk among NRF2, AHR and ERα in MCF-7 breast cancer cells treated with the NRF2 activator sulforaphane (SFN), a dual AHR and ERα activator, 3,3′-diindolylmethane (DIM), 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD) or 17β-estradiol (E2). SFN-dependent increases in NADPH-dependent oxidoreductase 1 (NQO1) and heme oxygenase I (HMOX1) mRNA levels were significantly reduced after co-treatment with E2. E2-dependent repression of NQO1 and HMOX1 was associated with increased ERα but reduced p300 recruitment and reduced histone H3 acetylation at both genes. In contrast, DIM + SFN or TCDD + SFN induced NQO1 and HMOX1 mRNA expression to levels higher than SFN alone, which was prevented by RNAi-mediated knockdown of AHR. DIM + SFN but not TCDD + SFN also induced recruitment of ERα to NQO1 and HMOX1. However, the presence of AHR at NQO1 and HMOX1 restored p300 recruitment and histone H3 acetylation, thereby reversing the ERα-dependent repression of NRF2. Taken together, our study provides further evidence of functional interplay among NRF2, AHR and ERα signaling pathways through altered p300 recruitment to NRF2-regulated target genes. - Highlights: • We examined crosstalk among ERα, AHR, and NRF2 in MCF-7 breast cancer cells. • AHR enhanced the mRNA expression levels of two NRF2 target genes – HMOX1 and NQO1. • ERα repressed HMOX1 and NQO1 expression via decreased histone acetylation. • AHR prevented ERα-dependent repression of HMOX1 and NQO1.

  20. The aryl hydrocarbon receptor and estrogen receptor alpha differentially modulate nuclear factor erythroid-2-related factor 2 transactivation in MCF-7 breast cancer cells

    International Nuclear Information System (INIS)

    Lo, Raymond; Matthews, Jason

    2013-01-01

    Nuclear factor erythroid-2-related factor 2 (NRF2; NFE2L2) plays an important role in mediating cellular protection against reactive oxygen species. NRF2 signaling is positively modulated by the aryl hydrocarbon receptor (AHR) but inhibited by estrogen receptor alpha (ERα). In this study we investigated the crosstalk among NRF2, AHR and ERα in MCF-7 breast cancer cells treated with the NRF2 activator sulforaphane (SFN), a dual AHR and ERα activator, 3,3′-diindolylmethane (DIM), 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD) or 17β-estradiol (E2). SFN-dependent increases in NADPH-dependent oxidoreductase 1 (NQO1) and heme oxygenase I (HMOX1) mRNA levels were significantly reduced after co-treatment with E2. E2-dependent repression of NQO1 and HMOX1 was associated with increased ERα but reduced p300 recruitment and reduced histone H3 acetylation at both genes. In contrast, DIM + SFN or TCDD + SFN induced NQO1 and HMOX1 mRNA expression to levels higher than SFN alone, which was prevented by RNAi-mediated knockdown of AHR. DIM + SFN but not TCDD + SFN also induced recruitment of ERα to NQO1 and HMOX1. However, the presence of AHR at NQO1 and HMOX1 restored p300 recruitment and histone H3 acetylation, thereby reversing the ERα-dependent repression of NRF2. Taken together, our study provides further evidence of functional interplay among NRF2, AHR and ERα signaling pathways through altered p300 recruitment to NRF2-regulated target genes. - Highlights: • We examined crosstalk among ERα, AHR, and NRF2 in MCF-7 breast cancer cells. • AHR enhanced the mRNA expression levels of two NRF2 target genes – HMOX1 and NQO1. • ERα repressed HMOX1 and NQO1 expression via decreased histone acetylation. • AHR prevented ERα-dependent repression of HMOX1 and NQO1.

  1. v-erbA overexpression is required to extinguish c-erbA function in erythroid cell differentiation and regulation of the erbA target gene CAII

    DEFF Research Database (Denmark)

    Disela, C; Glineur, C; Bugge, T

    1991-01-01

    The v-erbA oncoprotein represents a retrovirus-transduced oncogenic version of the thyroid hormone (T3/T4) receptor c-erbA (type alpha). It contributes to virus-induced erythroleukemia by efficiently arresting differentiation of red cell progenitors and by suppressing transcription of erythrocyte...... of this CAII reporter construct could only be suppressed by very high amounts of v-erbA. Our results suggest that overexpression of v-erbA is required for its function as an oncoprotein....

  2. Calorie Restriction Attenuates Terminal Differentiation of Immune Cells.

    Science.gov (United States)

    White, Matthew J; Beaver, Charlotte M; Goodier, Martin R; Bottomley, Christian; Nielsen, Carolyn M; Wolf, Asia-Sophia F M; Boldrin, Luisa; Whitmore, Charlotte; Morgan, Jennifer; Pearce, Daniel J; Riley, Eleanor M

    2016-01-01

    Immune senescence is a natural consequence of aging and may contribute to frailty and loss of homeostasis in later life. Calorie restriction increases healthy life-span in C57BL/6J (but not DBA/2J) mice, but whether this is related to preservation of immune function, and how it interacts with aging, is unclear. We compared phenotypic and functional characteristics of natural killer (NK) cells and T cells, across the lifespan, of calorie-restricted (CR) and control C57BL/6 and DBA/2 mice. Calorie restriction preserves a naïve T cell phenotype and an immature NK cell phenotype as mice age. The splenic T cell populations of CR mice had higher proportions of CD11a - CD44 lo cells, lower expression of TRAIL, KLRG1, and CXCR3, and higher expression of CD127, compared to control mice. Similarly, splenic NK cells from CR mice had higher proportions of less differentiated CD11b - CD27 + cells and correspondingly lower proportions of highly differentiated CD11b + CD27 - NK cells. Within each of these subsets, cells from CR mice had higher expression of CD127, CD25, TRAIL, NKG2A/C/E, and CXCR3 and lower expression of KLRG1 and Ly49 receptors compared to controls. The effects of calorie restriction on lymphoid cell populations in lung, liver, and lymph nodes were identical to those seen in the spleen, indicating that this is a system-wide effect. The impact of calorie restriction on NK cell and T cell maturation is much more profound than the effect of aging and, indeed, calorie restriction attenuates these age-associated changes. Importantly, the effects of calorie restriction on lymphocyte maturation were more marked in C57BL/6 than in DBA/2J mice indicating that delayed lymphocyte maturation correlates with extended lifespan. These findings have implications for understanding the interaction between nutritional status, immunity, and healthy lifespan in aging populations.

  3. Erythroblastic Sarcoma Presenting as Bilateral Ovarian Masses in an Infant with Pure Erythroid Leukemia

    Science.gov (United States)

    Wang, Huan-You; Huang, Lily Jun-shen; Garcia, Rolando; Li, Shiyong; Galliani, Carlos A.

    2010-01-01

    Pure erythroid leukemia is a rare subtype of acute erythroid leukemia that is characterized by a predominant erythroid population, and erythroblastic sarcoma has not yet been described in the English literature. Here we report a first case of erythroblastic sarcoma which presented as bilateral ovarian masses in a three and half month old baby girl with pure erythroid leukemia. Bone marrow aspirate and biopsy showed the marrow was completely replaced by large-sized blasts consistent with erythroblasts. Immunophenotypically, both the tumor cells from the ovarian mass and bone marrow blasts were positive for CD117, glycophorin A, and hemoglobin A, demonstrating erythroid differentiation. Reverse transcriptase polymerase chain reaction showed the tumor cells from ovarian mass expressed hemoglobin F and α1 spectrin, confirming their erythroid lineage. Conventional karyotype of the bone marrow aspirates revealed del(6) (q23q25) and trisomy 7 in all 21 cells examined. Fluorescence in situ hybridization of the ovarian mass demonstrated loss of C-MYB at 6q23 locus in 41% of the cells, and deletion of chromosome 7 and 7q in 37% and 66% of cells, respectively. Taken together, we showed, for the first time, that pure erythroid leukemia presented as a myeloid sarcoma in the form of ovarian masses. PMID:21237494

  4. Different requirements of functional telomeres in neural stem cells and terminally differentiated neurons.

    Science.gov (United States)

    Lobanova, Anastasia; She, Robert; Pieraut, Simon; Clapp, Charlie; Maximov, Anton; Denchi, Eros Lazzerini

    2017-04-01

    Telomeres have been studied extensively in peripheral tissues, but their relevance in the nervous system remains poorly understood. Here, we examine the roles of telomeres at distinct stages of murine brain development by using lineage-specific genetic ablation of TRF2, an essential component of the shelterin complex that protects chromosome ends from the DNA damage response machinery. We found that functional telomeres are required for embryonic and adult neurogenesis, but their uncapping has surprisingly no detectable consequences on terminally differentiated neurons. Conditional knockout of TRF2 in post-mitotic immature neurons had virtually no detectable effect on circuit assembly, neuronal gene expression, and the behavior of adult animals despite triggering massive end-to-end chromosome fusions across the brain. These results suggest that telomeres are dispensable in terminally differentiated neurons and provide mechanistic insight into cognitive abnormalities associated with aberrant telomere length in humans. © 2017 Lobanova et al.; Published by Cold Spring Harbor Laboratory Press.

  5. Differential BPFs with Multiple Transmission Zeros Based on Terminated Coupled Lines

    Science.gov (United States)

    Niu, Yiming; Yang, Guo; Wu, Wen

    2018-04-01

    Differential bandpass filters (BPFs) named Filter A and Filter B based on Terminated Coupled Lines (TCLs) are proposed in this letter. The TCLs contributes to not only three poles in differential-mode (DM) for wideband filtering response but also multiple zeros in both DM and common-mode (CM) offering wide DM out-of-band rejection and good CM suppression. Fabricated filters centred at 3.5 GHz with wide DM passband and wideband CM suppression have been designed and measured. The filters improved the noise suppression capability of the communication and radiometer systems. The simulated and measured results are in good agreement.

  6. Let-7 microRNAs are developmentally regulated in circulating human erythroid cells

    Directory of Open Access Journals (Sweden)

    Reed Christopher

    2009-11-01

    Full Text Available Abstract Background MicroRNAs are ~22nt-long small non-coding RNAs that negatively regulate protein expression through mRNA degradation or translational repression in eukaryotic cells. Based upon their importance in regulating development and terminal differentiation in model systems, erythrocyte microRNA profiles were examined at birth and in adults to determine if changes in their abundance coincide with the developmental phenomenon of hemoglobin switching. Methods Expression profiling of microRNA was performed using total RNA from four adult peripheral blood samples compared to four cord blood samples after depletion of plasma, platelets, and nucleated cells. Labeled RNAs were hybridized to custom spotted arrays containing 474 human microRNA species (miRBase release 9.1. Total RNA from Epstein-Barr virus (EBV-transformed lymphoblastoid cell lines provided a hybridization reference for all samples to generate microRNA abundance profile for each sample. Results Among 206 detected miRNAs, 79% of the microRNAs were present at equivalent levels in both cord and adult cells. By comparison, 37 microRNAs were up-regulated and 4 microRNAs were down-regulated in adult erythroid cells (fold change > 2; p let-7 miRNA family consistently demonstrated increased abundance in the adult samples by array-based analyses that were confirmed by quantitative PCR (4.5 to 18.4 fold increases in 6 of 8 let-7 miRNA. Profiling studies of messenger RNA (mRNA in these cells additionally demonstrated down-regulation of ten let-7 target genes in the adult cells. Conclusion These data suggest that a consistent pattern of up-regulation among let-7 miRNA in circulating erythroid cells occurs in association with hemoglobin switching during the fetal-to-adult developmental transition in humans.

  7. SHP2 regulates chondrocyte terminal differentiation, growth plate architecture and skeletal cell fates.

    Directory of Open Access Journals (Sweden)

    Margot E Bowen

    Full Text Available Loss of PTPN11/SHP2 in mice or in human metachondromatosis (MC patients causes benign cartilage tumors on the bone surface (exostoses and within bones (enchondromas. To elucidate the mechanisms underlying cartilage tumor formation, we investigated the role of SHP2 in the specification, maturation and organization of chondrocytes. Firstly, we studied chondrocyte maturation by performing RNA-seq on primary chondrocyte pellet cultures. We found that SHP2 depletion, or inhibition of the ERK1/2 pathway, delays the terminal differentiation of chondrocytes from the early-hypertrophic to the late-hypertrophic stage. Secondly, we studied chondrocyte maturation and organization in mice with a mosaic postnatal inactivation of Ptpn11 in chondrocytes. We found that the vertebral growth plates of these mice have expanded domains of early-hypertrophic chondrocytes that have not yet terminally differentiated, and their enchondroma-like lesions arise from chondrocytes displaced from the growth plate due to a disruption in the organization of maturation and ossification zones. Furthermore, we observed that lesions from human MC patients also display disorganized chondrocyte maturation zones. Next, we found that inactivation of Ptpn11 in Fsp1-Cre-expressing fibroblasts induces exostosis-like outgrowths, suggesting that loss of SHP2 in cells on the bone surface and at bone-ligament attachment sites induces ectopic chondrogenesis. Finally, we performed lineage tracing to show that exostoses and enchondromas in mice likely contain mixtures of wild-type and SHP2-deficient chondrocytes. Together, these data indicate that in patients with MC, who are heterozygous for inherited PTPN11 loss-of-function mutations, second-hit mutations in PTPN11 can induce enchondromas by disrupting the organization and delaying the terminal differentiation of growth plate chondrocytes, and can induce exostoses by causing ectopic chondrogenesis of cells on the bone surface. Furthermore, the

  8. A function for Rac1 in the terminal differentiation and pigmentation of hair

    DEFF Research Database (Denmark)

    Behrendt, Kristina; Klatte, Jennifer; Pofahl, Ruth

    2012-01-01

    in the regulation of terminal hair follicle differentiation. To address this, we have expressed a constitutively active mutant of Rac1, L61Rac1, only in the basal epidermal layer and outer root sheath of mice possessing an epidermis-specific deletion of endogenous Rac1, which experience severe hair loss......The small GTPase Rac1 is ubiquitously expressed in proliferating and differentiating layers of the epidermis and hair follicles. Previously, Rac1 was shown to regulate stem cell behaviour in these compartments. We have asked whether Rac1 has, in addition, a specific, stem-cell-independent function....... The resulting 'rescue' mice exhibited a hair coat throughout their lives. Therefore, expression of Rac1 activity in the keratin-14-positive compartment of the skin is sufficient for the formation of hair follicles and hair in normal quantities. The quality of hair formed in rescue mice was, however, not normal...

  9. SAM pointed domain ETS factor (SPDEF) regulates terminal differentiation and maturation of intestinal goblet cells

    Energy Technology Data Exchange (ETDEWEB)

    Noah, Taeko K.; Kazanjian, Avedis [Gastroenterology, Hepatology and Nutrition, Cincinnati Children' s Hospital Medical Center and University of Cincinnati College of Medicine, Cincinnati, OH (United States); Whitsett, Jeffrey [Developmental Biology, Cincinnati Children' s Hospital Medical Center and University of Cincinnati College of Medicine, Cincinnati, OH (United States); Neonatology and Pulmonary Biology, Cincinnati Children' s Hospital Medical Center and University of Cincinnati College of Medicine, Cincinnati, OH (United States); Shroyer, Noah F., E-mail: noah.shroyer@cchmc.org [Gastroenterology, Hepatology and Nutrition, Cincinnati Children' s Hospital Medical Center and University of Cincinnati College of Medicine, Cincinnati, OH (United States); Developmental Biology, Cincinnati Children' s Hospital Medical Center and University of Cincinnati College of Medicine, Cincinnati, OH (United States)

    2010-02-01

    Background and Aims: SPDEF (also termed PDEF or PSE) is an ETS family transcription factor that regulates gene expression in the prostate and goblet cell hyperplasia in the lung. Spdef has been reported to be expressed in the intestine. In this paper, we identify an important role for Spdef in regulating intestinal epithelial cell homeostasis and differentiation. Methods: SPDEF expression was inhibited in colon cancer cells to determine its ability to control goblet cell gene activation. The effects of transgenic expression of Spdef on intestinal differentiation and homeostasis were determined. Results: In LS174T colon cancer cells treated with Notch/{gamma}-secretase inhibitor to activate goblet cell gene expression, shRNAs that inhibited SPDEF also repressed expression of goblet cell genes AGR2, MUC2, RETLNB, and SPINK4. Transgenic expression of Spdef caused the expansion of intestinal goblet cells and corresponding reduction in Paneth, enteroendocrine, and absorptive enterocytes. Spdef inhibited proliferation of intestinal crypt cells without induction of apoptosis. Prolonged expression of the Spdef transgene caused a progressive reduction in the number of crypts that expressed Spdef, consistent with its inhibitory effects on cell proliferation. Conclusions: Spdef was sufficient to inhibit proliferation of intestinal progenitors and induce differentiation into goblet cells; SPDEF was required for activation of goblet cell associated genes in vitro. These data support a model in which Spdef promotes terminal differentiation into goblet cells of a common goblet/Paneth progenitor.

  10. [Stimulation of maturing and terminal differentiation by concanavalin A in rabbit permanent chondrocyte cultures].

    Science.gov (United States)

    Yan, W Q; Yang, T S; Hou, L Z; Susuki, F; Kato, Y

    1994-12-01

    The effect of concanavalin A (Con A) on maturing and terminal differentiation in permanent chondrocyte cultures were examined. Chondrocytes isolated from permanent cartilage were seeded at low density and grown in MEM medium containing 10% fetal bovine serum, 50 micrograms/ml of ascorbic acid and antibiotics, at 37 degrees C under 50% CO2 in air. At 0.3% of low serum concentration, addition of Con A to the culture medium increased by 3- to 4-fold the incorporation of [35S] sulfate into large chondroitin sulfate proteoglycan that characteristically found in cartilage. Chemical analysis showed a 4-fold increase in the accumulation of macromolecular containing hexuronic acid in Con A-maintained cultures. The effect of Con A on [35S]sulfate incorporation into proteoglycan was greater than that of various growth factor or hormones. Brief exposure of the permanent chondrocytes to Con A (5 micrograms/ml) for 24 hours and subsequent incubation in its absence for 5-10 days resulted in 10- to 100-fold increase in alkaline phosphatase and binding of 1.25 (OH)2 vitamin D3 to cells. Treatment with Con A also resulted in 10- to 20-fold increase in calcium content and 45Ca incorporation into insoluble material. Methyl-D-mannopyranoside reversed the effect of Con A on [35S]sulfate incorporation into proteoglycan and alkaline phosphatase activity. Since other lectins, such as wheat germ agglutinin, lentil lectin, phytohemagglutinin, Ulex europeasu agglutinin and garden pea lectin had been tested to have little effect on [35S]sulfate incorporation into proteoglycans and induction of alkaline phosphatase activity, the Con A action on chondrocytes seems specific. These results indicate that Con A is a potent modulator of differentiation of chondrocytes, which induces the onset on a maturing and a terminal differentiation in chondrocytes, leading to extensive calcification of the extracellular matrix.

  11. Human Cord Blood and Bone Marrow CD34+ Cells Generate Macrophages That Support Erythroid Islands.

    Directory of Open Access Journals (Sweden)

    Eyayu Belay

    Full Text Available Recently, we developed a small molecule responsive hyperactive Mpl-based Cell Growth Switch (CGS that drives erythropoiesis associated with macrophages in the absence of exogenous cytokines. Here, we compare the physical, cellular and molecular interaction between the macrophages and erythroid cells in CGS expanded CD34+ cells harvested from cord blood, marrow or G-CSF-mobilized peripheral blood. Results indicated that macrophage based erythroid islands could be generated from cord blood and marrow CD34+ cells but not from G-CSF-mobilized CD34+ cells. Additional studies suggest that the deficiency resides with the G-CSF-mobilized CD34+ derived monocytes. Gene expression and proteomics studies of the in vitro generated erythroid islands detected the expression of erythroblast macrophage protein (EMP, intercellular adhesion molecule 4 (ICAM-4, CD163 and DNASE2. 78% of the erythroblasts in contact with macrophages reached the pre reticulocyte orthochromatic stage of differentiation within 14 days of culture. The addition of conditioned medium from cultures of CD146+ marrow fibroblasts resulted in a 700-fold increase in total cell number and a 90-fold increase in erythroid cell number. This novel CD34+ cell derived erythroid island may serve as a platform to explore the molecular basis of red cell maturation and production under normal, stress and pathological conditions.

  12. Tfe3 expression is closely associated to macrophage terminal differentiation of human hematopoietic myeloid precursors

    International Nuclear Information System (INIS)

    Zanocco-Marani, Tommaso; Vignudelli, Tatiana; Gemelli, Claudia; Pirondi, Sara; Testa, Anna; Montanari, Monica; Parenti, Sandra; Tenedini, Elena; Grande, Alexis; Ferrari, Sergio

    2006-01-01

    The MItf-Tfe family of basic helix-loop-helix leucine zipper (bHLH-Zip) transcription factors encodes four family members: MItf, Tfe3, TfeB and TfeC. In vitro, each protein of the family binds DNA in a homo- or heterodimeric form with other family members. Tfe3 is involved in chromosomal translocations recurrent in different tumors and it has been demonstrated, by in vivo studies, that it plays, redundantly with MItf, an important role in the process of osteoclast formation, in particular during the transition from mono-nucleated to multi-nucleated osteoclasts. Since mono-nucleated osteoclasts derive from macrophages we investigated whether Tfe3 might play a role upstream during hematopoietic differentiation. Here we show that Tfe3 is able to induce mono-macrophagic differentiation of U937 cells, in association with a decrease of cell proliferation and an increase of apoptosis. We also show that Tfe3 does not act physiologically during commitment of CD34+ hematopoietic stem cells (HSCs), since it is not able to direct HSCs toward a specific lineage as observed by clonogenic assay, but is a strong actor of terminal differentiation since it allows human primary myeloblasts' maturation toward the macrophage lineage

  13. Cardiac injury of the newborn mammalian heart accelerates cardiomyocyte terminal differentiation

    DEFF Research Database (Denmark)

    Zebrowski, David C.; Jensen, Charlotte H.; Becker, Robert

    2017-01-01

    exhibited midbody formation consistent with successful abscission, whereas those from 3 day-old cardiomyocytes after apical resection exhibited midbody formation consistent with abscission failure. Lastly, injured hearts failed to fully regenerate as evidenced by persistent scarring and reduced wall motion......After birth cardiomyocytes undergo terminal differentiation, characterized by binucleation and centrosome disassembly, rendering the heart unable to regenerate. Yet, it has been suggested that newborn mammals regenerate their hearts after apical resection by cardiomyocyte proliferation. Thus, we...... increased rate of binucleation there was a nearly 2-fold increase in the number of cardiomyocytes in mitosis indicating that the majority of injury-induced cardiomyocyte cell cycle activity results in binucleation, not proliferation. Concurrently, cardiomyocytes undergoing cytokinesis from embryonic hearts...

  14. Glucose-ABL1-TOR Signaling Modulates Cell Cycle Tuning to Control Terminal Appressorial Cell Differentiation.

    Science.gov (United States)

    Marroquin-Guzman, Margarita; Sun, Guangchao; Wilson, Richard A

    2017-01-01

    The conserved target of rapamycin (TOR) pathway integrates growth and development with available nutrients, but how cellular glucose controls TOR function and signaling is poorly understood. Here, we provide functional evidence from the devastating rice blast fungus Magnaporthe oryzae that glucose can mediate TOR activity via the product of a novel carbon-responsive gene, ABL1, in order to tune cell cycle progression during infection-related development. Under nutrient-free conditions, wild type (WT) M. oryzae strains form terminal plant-infecting cells (appressoria) at the tips of germ tubes emerging from three-celled spores (conidia). WT appressorial development is accompanied by one round of mitosis followed by autophagic cell death of the conidium. In contrast, Δabl1 mutant strains undergo multiple rounds of accelerated mitosis in elongated germ tubes, produce few appressoria, and are abolished for autophagy. Treating WT spores with glucose or 2-deoxyglucose phenocopied Δabl1. Inactivating TOR in Δabl1 mutants or glucose-treated WT strains restored appressorium formation by promoting mitotic arrest at G1/G0 via an appressorium- and autophagy-inducing cell cycle delay at G2/M. Collectively, this work uncovers a novel glucose-ABL1-TOR signaling axis and shows it engages two metabolic checkpoints in order to modulate cell cycle tuning and mediate terminal appressorial cell differentiation. We thus provide new molecular insights into TOR regulation and cell development in response to glucose.

  15. Constitutive β-catenin activation in osteoblasts impairs terminal osteoblast differentiation and bone quality

    Energy Technology Data Exchange (ETDEWEB)

    Bao, Quanwei; Chen, Sixu; Qin, Hao [State Key Laboratory of Trauma, Burn and Combined injury, Department of Trauma Surgery, Daping Hospital, Third Military Medical University, ChongQing 400042 (China); Feng, Jianquan [Department of Biomedical Sciences, Baylor College of Dentistry, Texas A& M Health Science Center, Dallas, TX 75246 (United States); Liu, Huayu; Liu, Daocheng; Li, Ang; Shen, Yue; Zhong, Xiaozheng; Li, Junfeng [State Key Laboratory of Trauma, Burn and Combined injury, Department of Trauma Surgery, Daping Hospital, Third Military Medical University, ChongQing 400042 (China); Zong, Zhaowen, E-mail: zongzhaowen@sina.cn [State Key Laboratory of Trauma, Burn and Combined injury, Department of Trauma Surgery, Daping Hospital, Third Military Medical University, ChongQing 400042 (China)

    2017-01-01

    Accumulating evidence suggests that Wnt/β-catenin signaling plays a central role in controlling bone mass. We previously reported that constitutive activation of β-catenin (CA-β-catenin) in osteoblasts potentially has side effects on the bone growth and bone remodeling process, although it could increase bone mass. The present study aimed to observe the effects of osteoblastic CA-β-catenin on bone quality and to investigate possible mechanisms of these effects. It was found that CA-β-catenin mice exhibited lower mineralization levels and disorganized collagen in long bones as confirmed by von Kossa staining and sirius red staining, respectively. Also, bone strength decreased significantly in CA-β-catenin mice. Then the effect of CA-β-catenin on biological functions of osteoblasts were investigated and it was found that the expression levels of osteocalcin, a marker for the late differentiation of osteoblasts, decreased in CA-β-catenin mice, while the expression levels of osterix and alkaline phosphatase, two markers for the early differentiation of osteoblasts, increased in CA-β-catenin mice. Furthermore, higher proliferation rate were revealed in osteoblasts that were isolated from CA-β-catenin mice. The Real-time PCR and western blot examination found that the expression level of c-myc and cyclin D1, two G1 progression-related molecules, increased in osteoblasts that were isolated from the CA-β-catenin mice, and the expression levels of CDK14 and cyclin Y, two mitotic-related molecules that can accelerate cells entering into S and G2/M phases, increased in osteoblasts that were isolated from the CA-β-catenin mice. In summary, osteoblastic CA-β-catenin kept osteoblasts in high proliferative state and impaired the terminal osteoblast differentiation, and this led to changed bone structure and decreased bone strength. - Highlights: • Wnt/β-catenin signaling plays a central role in controlling bone mass. • CA-β-catenin has side effects on the bone

  16. Community effect triggers terminal differentiation of myogenic cells derived from muscle satellite cells by quenching Smad signaling

    Energy Technology Data Exchange (ETDEWEB)

    Yanagisawa, Michiko [Department of Regenerative Medicine, National Institute for Longevity Sciences, National Center for Geriatrics and Gerontology, 35 Gengo, Morioka, Oobu, Aichi 474-8522 (Japan); Aging Research, Nagoya University Graduate School of Medicine, 65 Tsurumai-cho, Showa-ku, Nagoya, Aichi 466-8550 (Japan); Mukai, Atsushi; Shiomi, Kosuke [Department of Regenerative Medicine, National Institute for Longevity Sciences, National Center for Geriatrics and Gerontology, 35 Gengo, Morioka, Oobu, Aichi 474-8522 (Japan); Song, Si-Yong [Institute of Neuroscience, Faculty of Pharmaceutical Sciences at Kagawa, Tokushima Bunri University, 1314-1 Shido, Sanuki-shi, Kagawa 769-2193 (Japan); Hashimoto, Naohiro, E-mail: nao@ncgg.go.jp [Department of Regenerative Medicine, National Institute for Longevity Sciences, National Center for Geriatrics and Gerontology, 35 Gengo, Morioka, Oobu, Aichi 474-8522 (Japan)

    2011-01-15

    A high concentration of bone morphogenetic proteins (BMPs) stimulates myogenic progenitor cells to undergo heterotopic osteogenic differentiation. However, the physiological role of the Smad signaling pathway during terminal muscle differentiation has not been resolved. We report here that Smad1/5/8 was phosphorylated and activated in undifferentiated growing mouse myogenic progenitor Ric10 cells without exposure to any exogenous BMPs. The amount of phosphorylated Smad1/5/8 was severely reduced during precocious myogenic differentiation under the high cell density culture condition even in growth medium supplemented with a high concentration of serum. Inhibition of the Smad signaling pathway by dorsomorphin, an inhibitor of Smad activation, or noggin, a specific antagonist of BMP, induced precocious terminal differentiation of myogenic progenitor cells in a cell density-dependent fashion even in growth medium. In addition, Smad1/5/8 was transiently activated in proliferating myogenic progenitor cells during muscle regeneration in rats. The present results indicate that the Smad signaling pathway is involved in a critical switch between growth and differentiation of myogenic progenitor cells both in vitro and in vivo. Furthermore, precocious cell density-dependent myogenic differentiation suggests that a community effect triggers the terminal muscle differentiation of myogenic cells by quenching the Smad signaling.

  17. Community effect triggers terminal differentiation of myogenic cells derived from muscle satellite cells by quenching Smad signaling

    International Nuclear Information System (INIS)

    Yanagisawa, Michiko; Mukai, Atsushi; Shiomi, Kosuke; Song, Si-Yong; Hashimoto, Naohiro

    2011-01-01

    A high concentration of bone morphogenetic proteins (BMPs) stimulates myogenic progenitor cells to undergo heterotopic osteogenic differentiation. However, the physiological role of the Smad signaling pathway during terminal muscle differentiation has not been resolved. We report here that Smad1/5/8 was phosphorylated and activated in undifferentiated growing mouse myogenic progenitor Ric10 cells without exposure to any exogenous BMPs. The amount of phosphorylated Smad1/5/8 was severely reduced during precocious myogenic differentiation under the high cell density culture condition even in growth medium supplemented with a high concentration of serum. Inhibition of the Smad signaling pathway by dorsomorphin, an inhibitor of Smad activation, or noggin, a specific antagonist of BMP, induced precocious terminal differentiation of myogenic progenitor cells in a cell density-dependent fashion even in growth medium. In addition, Smad1/5/8 was transiently activated in proliferating myogenic progenitor cells during muscle regeneration in rats. The present results indicate that the Smad signaling pathway is involved in a critical switch between growth and differentiation of myogenic progenitor cells both in vitro and in vivo. Furthermore, precocious cell density-dependent myogenic differentiation suggests that a community effect triggers the terminal muscle differentiation of myogenic cells by quenching the Smad signaling.

  18. The glucocorticoid receptor cooperates with the erythropoietin receptor and c-Kit to enhance and sustain proliferation of erythroid progenitors in vitro

    NARCIS (Netherlands)

    von Lindern, M.; Zauner, W.; Mellitzer, G.; Steinlein, P.; Fritsch, G.; Huber, K.; Löwenberg, B.; Beug, H.

    1999-01-01

    Although erythropoietin (Epo) is essential for the production of mature red blood cells, the cooperation with other factors is required for a proper balance between progenitor proliferation and differentiation. In avian erythroid progenitors, steroid hormones cooperate with tyrosine kinase receptors

  19. Establishment of immortalized human erythroid progenitor cell lines able to produce enucleated red blood cells.

    Directory of Open Access Journals (Sweden)

    Ryo Kurita

    Full Text Available Transfusion of red blood cells (RBCs is a standard and indispensable therapy in current clinical practice. In vitro production of RBCs offers a potential means to overcome a shortage of transfusable RBCs in some clinical situations and also to provide a source of cells free from possible infection or contamination by microorganisms. Thus, in vitro production of RBCs may become a standard procedure in the future. We previously reported the successful establishment of immortalized mouse erythroid progenitor cell lines that were able to produce mature RBCs very efficiently. Here, we have developed a reliable protocol for establishing immortalized human erythroid progenitor cell lines that are able to produce enucleated RBCs. These immortalized cell lines produce functional hemoglobin and express erythroid-specific markers, and these markers are upregulated following induction of differentiation in vitro. Most importantly, these immortalized cell lines all produce enucleated RBCs after induction of differentiation in vitro, although the efficiency of producing enucleated RBCs remains to be improved further. To the best of our knowledge, this is the first demonstration of the feasibility of using immortalized human erythroid progenitor cell lines as an ex vivo source for production of enucleated RBCs.

  20. PCBP1 and NCOA4 regulate erythroid iron storage and heme biosynthesis.

    Science.gov (United States)

    Ryu, Moon-Suhn; Zhang, Deliang; Protchenko, Olga; Shakoury-Elizeh, Minoo; Philpott, Caroline C

    2017-05-01

    Developing erythrocytes take up exceptionally large amounts of iron, which must be transferred to mitochondria for incorporation into heme. This massive iron flux must be precisely controlled to permit the coordinated synthesis of heme and hemoglobin while avoiding the toxic effects of chemically reactive iron. In cultured animal cells, iron chaperones poly rC-binding protein 1 (PCBP1) and PCBP2 deliver iron to ferritin, the sole cytosolic iron storage protein, and nuclear receptor coactivator 4 (NCOA4) mediates the autophagic turnover of ferritin. The roles of PCBP, ferritin, and NCOA4 in erythroid development remain unclear. Here, we show that PCBP1, NCOA4, and ferritin are critical for murine red cell development. Using a cultured cell model of erythroid differentiation, depletion of PCBP1 or NCOA4 impaired iron trafficking through ferritin, which resulted in reduced heme synthesis, reduced hemoglobin formation, and perturbation of erythroid regulatory systems. Mice lacking Pcbp1 exhibited microcytic anemia and activation of compensatory erythropoiesis via the regulators erythropoietin and erythroferrone. Ex vivo differentiation of erythroid precursors from Pcbp1-deficient mice confirmed defects in ferritin iron flux and heme synthesis. These studies demonstrate the importance of ferritin for the vectorial transfer of imported iron to mitochondria in developing red cells and of PCBP1 and NCOA4 in mediating iron flux through ferritin.

  1. Impaired terminal differentiation of hippocampal granule neurons and defective contextual memory in PC3/Tis21 knockout mice.

    Directory of Open Access Journals (Sweden)

    Stefano Farioli-Vecchioli

    Full Text Available Neurogenesis in the dentate gyrus of the adult hippocampus has been implicated in neural plasticity and memory, but the molecular mechanisms controlling the proliferation and differentiation of newborn neurons and their integration into the synaptic circuitry are still largely unknown. To investigate this issue, we have analyzed the adult hippocampal neurogenesis in a PC3/Tis21-null mouse model. PC3/Tis21 is a transcriptional co-factor endowed with antiproliferative and prodifferentiative properties; indeed, its upregulation in neural progenitors has been shown to induce exit from cell cycle and differentiation. We demonstrate here that the deletion of PC3/Tis21 causes an increased proliferation of progenitor cells in the adult dentate gyrus and an arrest of their terminal differentiation. In fact, in the PC3/Tis21-null hippocampus postmitotic undifferentiated neurons accumulated, while the number of terminally differentiated neurons decreased of 40%. As a result, PC3/Tis21-null mice displayed a deficit of contextual memory. Notably, we observed that PC3/Tis21 can associate to the promoter of Id3, an inhibitor of proneural gene activity, and negatively regulates its expression, indicating that PC3/Tis21 acts upstream of Id3. Our results identify PC3/Tis21 as a gene required in the control of proliferation and terminal differentiation of newborn neurons during adult hippocampal neurogenesis and suggest its involvement in the formation of contextual memories.

  2. miR-24-mediated down-regulation of H2AX suppresses DNA repair in terminally differentiated blood cells

    Science.gov (United States)

    Lal, Ashish; Pan, Yunfeng; Navarro, Francisco; Dykxhoorn, Derek M.; Moreau, Lisa; Meire, Eti; Bentwich, Zvi; Lieberman, Judy; Chowdhury, Dipanjan

    2010-01-01

    Terminally differentiated cells have reduced capacity to repair double strand breaks (DSB), but the molecular mechanism behind this down-regulation is unclear. Here we find that miR-24 is consistently up-regulated during post-mitotic differentiation of hematopoietic cell lines and regulates the histone variant H2AX, a key DSB repair protein that activates cell cycle checkpoint proteins and retains DSB repair factors at DSB foci. The H2AX 3’UTR contains conserved miR-24 binding sites regulated by miR-24. Both H2AX mRNA and protein are substantially reduced during hematopoietic cell terminal differentiation by miR-24 up-regulation both in in vitro differentiated cells and primary human blood cells. miR-24 suppression of H2AX renders cells hypersensitive to γ-irradiation and genotoxic drugs. Antagonizing miR-24 in differentiating cells protects them from DNA damage-induced cell death, while transfecting miR-24 mimics in dividing cells increases chromosomal breaks and unrepaired DNA damage and reduces viability in response to DNA damage. This DNA repair phenotype can be fully rescued by over-expressing miR-24-insensitive H2AX. Therefore, miR-24 up-regulation in post-replicative cells reduces H2AX and thereby renders them highly vulnerable to DNA damage. PMID:19377482

  3. Correlation of initiating potency of skin carcinogens with potency to induce resistance to terminal differentiation in cultured mouse keratinocytes

    International Nuclear Information System (INIS)

    Kilkenny, A.E.; Morgan, D.; Spangler, E.F.; Yuspa, S.H.

    1985-01-01

    The induction by chemical carcinogens of resistance to terminal differentiation in cultured mouse keratinocytes has been proposed to represent a cellular change associated with the initiation phase of skin carcinogenesis. Previous results with this culture model indicated that the number of differentiation-resistant foci was correlated with the dose and known potency for several chemical carcinogens. Assay conditions were optimized to provide quantitative results for screening a variety of carcinogens for their potency as inducers of foci resistant to terminal differentiation. Eight skin initiators of varying potency and from different chemical classes and ultraviolet light were studied for their activity to induce this alteration in cultured epidermal cells from newborn BALB/c mice. There was an excellent positive correlation for the potency of these agents as initiators in vivo and as inducers of altered differentiation in vitro. The induction of resistant foci was independent of the relative cytotoxic effects of each agent except where cytotoxicity was extensive and reduced the number of foci. The results support the hypothesis that initiation of carcinogenesis in skin results in an alteration in the program of epidermal cell differentiation. The results also suggest that the assay is useful for identifying relative potency classes (strong, moderate, weak) of initiating agents

  4. Molecular pathways of early CD105-positive erythroid cells as compared with CD34-positive common precursor cells by flow cytometric cell-sorting and gene expression profiling

    International Nuclear Information System (INIS)

    Machherndl-Spandl, S; Suessner, S; Danzer, M; Proell, J; Gabriel, C; Lauf, J; Sylie, R; Klein, H-U; Béné, M C; Weltermann, A; Bettelheim, P

    2013-01-01

    Special attention has recently been drawn to the molecular network of different genes that are responsible for the development of erythroid cells. The aim of the present study was to establish in detail the immunophenotype of early erythroid cells and to compare the gene expression profile of freshly isolated early erythroid precursors with that of the CD34-positive (CD34 + ) compartment. Multiparameter flow cytometric analyses of human bone marrow mononuclear cell fractions (n=20) defined three distinct early erythroid stages. The gene expression profile of sorted early erythroid cells was analyzed by Affymetrix array technology. For 4524 genes, a differential regulation was found in CD105-positive erythroid cells as compared with the CD34 + progenitor compartment (2362 upregulated genes). A highly significant difference was observed in the expression level of genes involved in transcription, heme synthesis, iron and mitochondrial metabolism and transforming growth factor-β signaling. A comparison with recently published data showed over 1000 genes that as yet have not been reported to be upregulated in the early erythroid lineage. The gene expression level within distinct pathways could be illustrated directly by applying the Ingenuity software program. The results of gene expression analyses can be seen at the Gene Expression Omnibus repository

  5. Adipogenic differentiation and EGFP gene transfection of amniotic fluid-derived stem cells from goat fetus at terminal gestational age.

    Science.gov (United States)

    He, Xiao-Ying; Zheng, Yue-Mao; Qiu, Shuang; Qi, Ying-Pei; Zhang, Yong

    2011-08-01

    The aims of this study were to determine whether stem cells could be isolated from amniotic fluid of goat fetus at terminal gestational age and to determine if these stem cells could differentiate into adipogenic cells and be transfected with a reporter gene, EGFP (enhanced green fluorescent protein). The stem cells were isolated from amniotic fluid of goat fetus at terminal gestational age, induced to differentiate into adipogenic cells in vitro and transfected with the EGFP gene using lipofection. Markers associated with undifferentiated AFS (amniotic fluid-derived stem) cells were tested by RT (reverse transcription)-PCR. The results demonstrated that AFS cells could be isolated from amniotic fluid of goat fetus at terminal gestational age and could differentiate into adipogenic cells. The EGFP gene was transfected into AFS cells successfully. EGFP gene transfection efficiency of the three groups of transgenic AFS cells were 26.0, 29.9 and 30.5%, respectively. Both transgenic and wild-type AFS cells could express Hes1 (hairy and enhancer of split 1), Oct4 (octamer-binding protein 4) and Nanog.

  6. Transcriptional profiling in response to terminal drought stress reveals differential responses along the wheat genome

    Directory of Open Access Journals (Sweden)

    Ferrari Francesco

    2009-06-01

    Full Text Available Abstract Background Water stress during grain filling has a marked effect on grain yield, leading to a reduced endosperm cell number and thus sink capacity to accumulate dry matter. The bread wheat cultivar Chinese Spring (CS, a Chinese Spring terminal deletion line (CS_5AL-10 and the durum wheat cultivar Creso were subjected to transcriptional profiling after exposure to mild and severe drought stress at the grain filling stage to find evidences of differential stress responses associated to different wheat genome regions. Results The transcriptome analysis of Creso, CS and its deletion line revealed 8,552 non redundant probe sets with different expression levels, mainly due to the comparisons between the two species. The drought treatments modified the expression of 3,056 probe sets. Besides a set of genes showing a similar drought response in Creso and CS, cluster analysis revealed several drought response features that can be associated to the different genomic structure of Creso, CS and CS_5AL-10. Some drought-related genes were expressed at lower level (or not expressed in Creso (which lacks the D genome or in the CS_5AL-10 deletion line compared to CS. The chromosome location of a set of these genes was confirmed by PCR-based mapping on the D genome (or the 5AL-10 region. Many clusters were characterized by different level of expression in Creso, CS and CS_AL-10, suggesting that the different genome organization of the three genotypes may affect plant adaptation to stress. Clusters with similar expression trend were grouped and functional classified to mine the biological mean of their activation or repression. Genes involved in ABA, proline, glycine-betaine and sorbitol pathways were found up-regulated by drought stress. Furthermore, the enhanced expression of a set of transposons and retrotransposons was detected in CS_5AL-10. Conclusion Bread and durum wheat genotypes were characterized by a different physiological reaction to water

  7. Glioblastoma Stem Cells Respond to Differentiation Cues but Fail to Undergo Commitment and Terminal Cell-Cycle Arrest

    Directory of Open Access Journals (Sweden)

    Helena Carén

    2015-11-01

    Full Text Available Glioblastoma (GBM is an aggressive brain tumor whose growth is driven by stem cell-like cells. BMP signaling triggers cell-cycle exit and differentiation of GBM stem cells (GSCs and, therefore, might have therapeutic value. However, the epigenetic mechanisms that accompany differentiation remain poorly defined. It is also unclear whether cell-cycle arrest is terminal. Here we find only a subset of GSC cultures exhibit astrocyte differentiation in response to BMP. Although overtly differentiated non-cycling astrocytes are generated, they remain vulnerable to cell-cycle re-entry and fail to appropriately reconfigure DNA methylation patterns. Chromatin accessibility mapping identified loci that failed to alter in response to BMP and these were enriched in SOX transcription factor-binding motifs. SOX transcription factors, therefore, may limit differentiation commitment. A similar propensity for cell-cycle re-entry and de-differentiation was observed in GSC-derived oligodendrocyte-like cells. These findings highlight significant obstacles to BMP-induced differentiation as therapy for GBM.

  8. Sustained Low-Dose Treatment with the Histone Deacetylase Inhibitor LBH589 Induces Terminal Differentiation of Osteosarcoma Cells

    Directory of Open Access Journals (Sweden)

    Jason E. Cain

    2013-01-01

    Full Text Available Histone deacetylase inhibitors (HDACi were identified nearly four decades ago based on their ability to induce cellular differentiation. However, the clinical development of these compounds as cancer therapies has focused on their capacity to induce apoptosis in hematologic and lymphoid malignancies, often in combination with conventional cytotoxic agents. In many cases, HDACi doses necessary to induce these effects result in significant toxicity. Since osteosarcoma cells express markers of terminal osteoblast differentiation in response to DNA methyltransferase inhibitors, we reasoned that the epigenetic reprogramming capacity of HDACi might be exploited for therapeutic benefit. Here, we show that continuous exposure of osteosarcoma cells to low concentrations of HDACi LBH589 (Panobinostat over a three-week period induces terminal osteoblast differentiation and irreversible senescence without inducing cell death. Remarkably, transcriptional profiling revealed that HDACi therapy initiated gene signatures characteristic of chondrocyte and adipocyte lineages in addition to marked upregulation of mature osteoblast markers. In a mouse xenograft model, continuous low dose treatment with LBH589 induced a sustained cytostatic response accompanied by induction of mature osteoblast gene expression. These data suggest that the remarkable capacity of osteosarcoma cells to differentiate in response to HDACi therapy could be exploited for therapeutic benefit without inducing systemic toxicity.

  9. RNase L controls terminal adipocyte differentiation, lipids storage and insulin sensitivity via CHOP10 mRNA regulation

    DEFF Research Database (Denmark)

    Fabre, Odile Martine Julie; Salehzada, T; Lambert, K

    2012-01-01

    Adipose tissue structure is altered during obesity, leading to deregulation of whole-body metabolism. Its function depends on its structure, in particular adipocytes number and differentiation stage. To better understand the mechanisms regulating adipogenesis, we have investigated the role...... is associated with CHOP10 mRNA and regulates its stability. CHOP10 expression is conserved in RNase L(-/-)-MEFs, maintaining preadipocyte state while impairing their terminal differentiation. RNase L(-/-)-MEFs have decreased lipids storage capacity, insulin sensitivity and glucose uptake. Expression of ectopic...... RNase L in RNase L(-/-)-MEFs triggers CHOP10 mRNA instability, allowing increased lipids storage, insulin response and glucose uptake. Similarly, downregulation of CHOP10 mRNA with CHOP10 siRNA in RNase L(-/-)-MEFs improves their differentiation in adipocyte. In vivo, aged RNase L(-)/(-) mice present...

  10. Two different in vitro growth patterns for erythroid precursors in 18 patients with pure erythrocytosis

    International Nuclear Information System (INIS)

    Clement, S.; Eberlin, A.; Najean, Y.; Chedeville, A.

    1982-01-01

    Growth patterns of marrow and blood erythroid progenitors were studied in 18 cases of pure erythrocytosis using different doses of erythropoietin. 8 cases demonstrated ''spontaneous'' growth of CFU-E and blood BFU-E as observed in myeloproliferative disorders, but without an excess of circulating CFU-GM. 3 of these patients also had other symptoms of a pan-myelopathy. All these cases showed good sensitivity to 32 P myelo-suppression. 10 cases demonstrated growth patterns of erythroid progenitors similar to those observed in normal subjects, except for an excess of blood BFU-E, which suggests an abnormality of homeostatic regulation. In 5 of these cases, myelo-suppression was not effective. It is suggested that a stem cell study could differentiate patients with pure erythrocytosis due to ''autonomous'' abnormal stem cell growth from cases due to abnormal regulation factors, and that such a discrimination might be usefull for the choice of theraphy. (authors)

  11. Differential subcellular localization of insulin receptor substrates depends on C-terminal regions and importin β

    International Nuclear Information System (INIS)

    Kabuta, Tomohiro; Take, Kazumi; Kabuta, Chihana; Hakuno, Fumihiko; Takahashi, Shin-Ichiro

    2008-01-01

    Insulin receptor substrates (IRSs) play essential roles in signal transduction of insulin and insulin-like growth factors. Previously, we showed that IRS-3 is localized to the nucleus as well as the cytosol, while IRS-1 and 2 are mainly localized to the cytoplasm. In the present study, we found that importin β directly interacts with IRS-3 and is able to mediate nuclear transport of IRS-3. Importin β interacted with the pleckstrin homology domain, the phosphotyrosine binding domain and the C-terminal region of IRS-3; indeed all of these fragments exhibited predominant nuclear localization. By contrast, almost no interaction of importin β with IRS-1 and -2 was observed, and their C-terminal regions displayed discrete spotty images in the cytosol. In addition, using chimeric proteins between IRS-1 and IRS-3, we revealed that the C-terminal regions are the main determinants of the differing subcellular localizations of IRS-1 and IRS-3.

  12. Terminal Differentiation of Adult Hippocampal Progenitor Cells Is a Step Functionally Dissociable from Proliferation and Is Controlled by Tis21, Id3 and NeuroD2

    OpenAIRE

    Laura Micheli; Manuela Ceccarelli; Roberta Gioia; Giorgio D’Andrea; Stefano Farioli-Vecchioli; Marco Costanzi; Daniele Saraulli; Daniele Saraulli; Vincenzo Cestari; Felice Tirone

    2017-01-01

    Cell proliferation and differentiation are interdependent processes. Here, we have asked to what extent the two processes of neural progenitor cell amplification and differentiation are functionally separated. Thus, we analyzed whether it is possible to rescue a defect of terminal differentiation in progenitor cells of the dentate gyrus, where new neurons are generated throughout life, by inducing their proliferation and/or their differentiation with different stimuli appropriately timed. As ...

  13. Interleukin-6 enhances human Ig production, but not as a terminal differentiation factor for B lymphocytes

    NARCIS (Netherlands)

    van Kooten, C.; van Oers, M. H.; Aarden, L. A.

    1990-01-01

    Most B-cell differentiation systems are complicated by the fact that they are both T-cell- and monocyte-dependent. Immobilized anti-CD3 antibodies induce monocyte-independent T-cell activation, allowing investigation of the role of interleukin-6 (IL6) in the process of B-cell differentiation. We

  14. Terminal Differentiation of Adult Hippocampal Progenitor Cells Is a Step Functionally Dissociable from Proliferation and Is Controlled by Tis21, Id3 and NeuroD2

    Directory of Open Access Journals (Sweden)

    Laura Micheli

    2017-07-01

    Full Text Available Cell proliferation and differentiation are interdependent processes. Here, we have asked to what extent the two processes of neural progenitor cell amplification and differentiation are functionally separated. Thus, we analyzed whether it is possible to rescue a defect of terminal differentiation in progenitor cells of the dentate gyrus, where new neurons are generated throughout life, by inducing their proliferation and/or their differentiation with different stimuli appropriately timed. As a model we used the Tis21 knockout mouse, whose dentate gyrus neurons, as demonstrated by us and others, have an intrinsic defect of terminal differentiation. We first tested the effect of two proliferative as well as differentiative neurogenic stimuli, one pharmacological (fluoxetine, the other cognitive (the Morris water maze (MWM training. Both effectively enhanced the number of new dentate gyrus neurons produced, and fluoxetine also reduced the S-phase length of Tis21 knockout dentate gyrus progenitor cells and increased the rate of differentiation of control cells, but neither factor enhanced the defective rate of differentiation. In contrast, the defect of terminal differentiation was fully rescued by in vivo infection of proliferating dentate gyrus progenitor cells with retroviruses either silencing Id3, an inhibitor of neural differentiation, or expressing NeuroD2, a proneural gene expressed in terminally differentiated dentate gyrus neurons. This is the first demonstration that NeuroD2 or the silencing of Id3 can activate the differentiation of dentate gyrus neurons, complementing a defect of differentiation. It also highlights how the rate of differentiation of dentate gyrus neurons is regulated genetically at several levels and that a neurogenic stimulus for amplification of neural stem/progenitor cells may not be sufficient in itself to modify this rate.

  15. Cytoskeletal Linker Protein Dystonin Is Not Critical to Terminal Oligodendrocyte Differentiation or CNS Myelination.

    Directory of Open Access Journals (Sweden)

    Samantha F Kornfeld

    Full Text Available Oligodendrocyte differentiation and central nervous system myelination require massive reorganization of the oligodendrocyte cytoskeleton. Loss of specific actin- and tubulin-organizing factors can lead to impaired morphological and/or molecular differentiation of oligodendrocytes, resulting in a subsequent loss of myelination. Dystonin is a cytoskeletal linker protein with both actin- and tubulin-binding domains. Loss of function of this protein results in a sensory neuropathy called Hereditary Sensory Autonomic Neuropathy VI in humans and dystonia musculorum in mice. This disease presents with severe ataxia, dystonic muscle and is ultimately fatal early in life. While loss of the neuronal isoforms of dystonin primarily leads to sensory neuron degeneration, it has also been shown that peripheral myelination is compromised due to intrinsic Schwann cell differentiation abnormalities. The role of this cytoskeletal linker in oligodendrocytes, however, remains unclear. We sought to determine the effects of the loss of neuronal dystonin on oligodendrocyte differentiation and central myelination. To address this, primary oligodendrocytes were isolated from a severe model of dystonia musculorum, Dstdt-27J, and assessed for morphological and molecular differentiation capacity. No defects could be discerned in the differentiation of Dstdt-27J oligodendrocytes relative to oligodendrocytes from wild-type littermates. Survival was also compared between Dstdt-27J and wild-type oligodendrocytes, revealing no significant difference. Using a recently developed migration assay, we further analysed the ability of primary oligodendrocyte progenitor cell motility, and found that Dstdt-27J oligodendrocyte progenitor cells were able to migrate normally. Finally, in vivo analysis of oligodendrocyte myelination was done in phenotype-stage optic nerve, cerebral cortex and spinal cord. The density of myelinated axons and g-ratios of Dstdt-27J optic nerves was normal, as

  16. Methyl CpG–binding proteins induce large-scale chromatin reorganization during terminal differentiation

    Science.gov (United States)

    Brero, Alessandro; Easwaran, Hariharan P.; Nowak, Danny; Grunewald, Ingrid; Cremer, Thomas; Leonhardt, Heinrich; Cardoso, M. Cristina

    2005-01-01

    Pericentric heterochromatin plays an important role in epigenetic gene regulation. We show that pericentric heterochromatin aggregates during myogenic differentiation. This clustering leads to the formation of large chromocenters and correlates with increased levels of the methyl CpG–binding protein MeCP2 and pericentric DNA methylation. Ectopic expression of fluorescently tagged MeCP2 mimicked this effect, causing a dose-dependent clustering of chromocenters in the absence of differentiation. MeCP2-induced rearrangement of heterochromatin occurred throughout interphase, did not depend on the H3K9 histone methylation pathway, and required the methyl CpG–binding domain (MBD) only. Similar to MeCP2, another methyl CpG–binding protein, MBD2, also increased during myogenic differentiation and could induce clustering of pericentric regions, arguing for functional redundancy. This MeCP2- and MBD2-mediated chromatin reorganization may thus represent a molecular link between nuclear genome topology and the epigenetic maintenance of cellular differentiation. PMID:15939760

  17. Hemozoin (malarial pigment directly promotes apoptosis of erythroid precursors.

    Directory of Open Access Journals (Sweden)

    Abigail A Lamikanra

    2009-12-01

    Full Text Available Severe malarial anemia is the most common syndrome of severe malaria in endemic areas. The pathophysiology of chronic malaria is characterised by a striking degree of abnormal development of erythroid precursors (dyserythropoiesis and an inadequate erythropoietic response in spite of elevated levels of erythropoietin. The cause of dyserythropoiesis is unclear although it has been suggested that bone-marrow macrophages release cytokines, chemokines or lipo-peroxides after exposure to hemozoin, a crystalloid form of undigested heme moieties from malarial infected erythrocytes, and so inhibit erythropoiesis. However, we have previously shown that hemozoin may directly inhibit erythroid development in vitro and the levels of hemozoin in plasma from patients with malarial anemia and hemozoin within the bone marrow was associated with reduced reticulocyte response. We hypothesized that macrophages may reduce, not enhance, the inhibitory effect of hemozoin on erythropoiesis. In an in vitro model of erythropoiesis, we now show that inhibition of erythroid cell development by hemozoin isolated from P. falciparum is characterised by delayed expression of the erythroid markers and increased apoptosis of progenitor cells. Crucially, macrophages appear to protect erythroid cells from hemozoin, consistent with a direct contribution of hemozoin to the depression of reticulocyte output from the bone marrow in children with malarial anemia. Moreover, hemozoin isolated from P. falciparum in vitro inhibits erythroid development independently of inflammatory mediators by inducing apoptotic pathways that not only involve activation of caspase 8 and cleavage of caspase 3 but also loss of mitochondrial potential. Taken together these data are consistent with a direct effect of hemozoin in inducing apoptosis in developing erythroid cells in malarial anemia. Accumulation of hemozoin in the bone marrow could therefore result in inadequate reticulocytosis in children that

  18. Differential Tus-Ter binding and lock formation: implications for DNA replication termination in Escherichia coli.

    Science.gov (United States)

    Moreau, Morgane J J; Schaeffer, Patrick M

    2012-10-01

    In E. coli, DNA replication termination occurs at Ter sites and is mediated by Tus. Two clusters of five Ter sites are located on each side of the terminus region and constrain replication forks in a polar manner. The polarity is due to the formation of the Tus-Ter-lock intermediate. Recently, it has been shown that DnaB helicase which unwinds DNA at the replication fork is preferentially stopped at the non-permissive face of a Tus-Ter complex without formation of the Tus-Ter-lock and that fork pausing efficiency is sequence dependent, raising two essential questions: Does the affinity of Tus for the different Ter sites correlate with fork pausing efficiency? Is formation of the Tus-Ter-lock the key factor in fork pausing? The combined use of surface plasmon resonance and GFP-Basta showed that Tus binds strongly to TerA-E and G, moderately to TerH-J and weakly to TerF. Out of these ten Ter sites only two, TerF and H, were not able to form significant Tus-Ter-locks. Finally, Tus's resistance to dissociation from Ter sites and the strength of the Tus-Ter-locks correlate with the differences in fork pausing efficiency observed for the different Ter sites by Duggin and Bell (2009).

  19. A Plastid Terminal Oxidase Associated with Carotenoid Desaturation during Chromoplast Differentiation1

    Science.gov (United States)

    Josse, Eve-Marie; Simkin, Andrew J.; Gaffé, Joël; Labouré, Anne-Marie; Kuntz, Marcel; Carol, Pierre

    2000-01-01

    The Arabidopsis IMMUTANS gene encodes a plastid homolog of the mitochondrial alternative oxidase, which is associated with phytoene desaturation. Upon expression in Escherichia coli, this protein confers a detectable cyanide-resistant electron transport to isolated membranes. In this assay this activity is sensitive to n-propyl-gallate, an inhibitor of the alternative oxidase. This protein appears to be a plastid terminal oxidase (PTOX) that is functionally equivalent to a quinol:oxygen oxidoreductase. This protein was immunodetected in achlorophyllous pepper (Capsicum annuum) chromoplast membranes, and a corresponding cDNA was cloned from pepper and tomato (Lycopersicum esculentum) fruits. Genomic analysis suggests the presence of a single gene in these organisms, the expression of which parallels phytoene desaturase and ζ-carotene desaturase gene expression during fruit ripening. Furthermore, this PTOX gene is impaired in the tomato ghost mutant, which accumulates phytoene in leaves and fruits. These data show that PTOX also participates in carotenoid desaturation in chromoplasts in addition to its role during early chloroplast development. PMID:10938359

  20. Regulation of Silk Genes by Hox and Homeodomain Proteins in the Terminal Differentiated Silk Gland of the Silkworm Bombyx mori

    Science.gov (United States)

    Takiya, Shigeharu; Tsubota, Takuya; Kimoto, Mai

    2016-01-01

    The silk gland of the silkworm Bombyx mori is a long tubular organ that is divided into several subparts along its anteroposterior (AP) axis. As a trait of terminal differentiation of the silk gland, several silk protein genes are expressed with unique regional specificities. Most of the Hox and some of the homeobox genes are also expressed in the differentiated silk gland with regional specificities. The expression patterns of Hox genes in the silk gland roughly correspond to those in embryogenesis showing “colinearity”. The central Hox class protein Antennapedia (Antp) directly regulates the expression of several middle silk gland–specific silk genes, whereas the Lin-1/Isl-1/Mec3 (LIM)-homeodomain transcriptional factor Arrowhead (Awh) regulates the expression of posterior silk gland–specific genes for silk fiber proteins. We summarize our results and discuss the usefulness of the silk gland of Bombyx mori for analyzing the function of Hox genes. Further analyses of the regulatory mechanisms underlying the region-specific expression of silk genes will provide novel insights into the molecular bases for target-gene selection and regulation by Hox and homeodomain proteins. PMID:29615585

  1. Regulation of Silk Genes by Hox and Homeodomain Proteins in the Terminal Differentiated Silk Gland of the Silkworm Bombyx mori

    Directory of Open Access Journals (Sweden)

    Shigeharu Takiya

    2016-05-01

    Full Text Available The silk gland of the silkworm Bombyx mori is a long tubular organ that is divided into several subparts along its anteroposterior (AP axis. As a trait of terminal differentiation of the silk gland, several silk protein genes are expressed with unique regional specificities. Most of the Hox and some of the homeobox genes are also expressed in the differentiated silk gland with regional specificities. The expression patterns of Hox genes in the silk gland roughly correspond to those in embryogenesis showing “colinearity”. The central Hox class protein Antennapedia (Antp directly regulates the expression of several middle silk gland–specific silk genes, whereas the Lin-1/Isl-1/Mec3 (LIM-homeodomain transcriptional factor Arrowhead (Awh regulates the expression of posterior silk gland–specific genes for silk fiber proteins. We summarize our results and discuss the usefulness of the silk gland of Bombyx mori for analyzing the function of Hox genes. Further analyses of the regulatory mechanisms underlying the region-specific expression of silk genes will provide novel insights into the molecular bases for target-gene selection and regulation by Hox and homeodomain proteins.

  2. Enhancement of erythroid colony growth in culture by hemin

    International Nuclear Information System (INIS)

    Porter, P.N.; Meints, R.H.; Mesner, K.

    1979-01-01

    Hemin was found to enhance the growth of murine erythroid colonies in culture. In the presence of 100 mU/ml erythropoietin (EPO), the addition of hemin (0.05-0.2 mM) resulted in the growth of twice as many colonies as were obtained with EPO alone. Hemin also significantly increased erythroid colony formation in culture in the absence of added EPO. Hemoblobin synthesis as measured by the incorporation of 59 Fe into cyclohexanone extractable heme was augmented in culture by hemin. Neither Δ-aminolevulinic acid, a hemin precursor, nor FeCl 3 increased colony number. (author)

  3. N-Terminal Pro-B-Type Natriuretic Peptide and Phonocardiography in Differentiating Innocent Cardiac Murmurs from Congenital Cardiac Anomalies in Asymptomatic Puppies

    NARCIS (Netherlands)

    Marinus, S M; Engelen, H.G.H.; Szatmári, V.

    2017-01-01

    Background: Differentiating innocent cardiac murmurs from murmurs caused by congenital cardiac anomalies can be challenging with auscultation alone in asymptomatic puppies. Hypothesis: Plasma N-terminal pro-B-type natriuretic peptide (NT-proBNP) concentrations and phonocardiograms recorded by an

  4. Fbxw7-associated drug resistance is reversed by induction of terminal differentiation in murine intestinal organoid culture

    Directory of Open Access Journals (Sweden)

    Federica Lorenzi

    2016-01-01

    Full Text Available Colorectal cancer (CRC is one of the top three cancer-related causes of death worldwide. FBXW7 is a known tumor-suppressor gene, commonly mutated in CRC and in a variety of other epithelial tumors. Low expression of FBXW7 is also associated with poor prognosis. Loss of FBXW7 sensitizes cancer cells to certain drugs, while making them more resistant to other types of chemotherapies. However, is not fully understood how epithelial cells within normal gut and primary tumors respond to potential cancer therapeutics. We have studied genetically engineered mice in which the fbxw7 gene is conditionally knocked-out in the intestine (fbxw7ΔG. To further investigate the mechanism of Fbxw7-action, we grew intestinal crypts from floxed-fbxw7 (fbxw7fl/fl and fbxw7ΔG mice, in a Matrigel-based organoid (mini-gut culture. The fbxw7ΔG organoids exhibited rapid budding events in the crypt region. Furthermore, to test organoids for drug response, we exposed day 3 intestinal organoids from fbxw7fl/fl and fbxw7ΔG mice, to various concentrations of 5-fluorouracil (5-FU for 72 hours. 5-FU triggers phenotypic differences in organoids including changing shape, survival, resistance, and death. 5-FU however, rescues the drug-resistance phenotype of fbxw7ΔG through the induction of terminal differentiation. Our results support the hypothesis that a differentiating therapy successfully targets FBXW7-mutated CRC cells.

  5. Abrupt onset of mutations in a developmentally regulated gene during terminal differentiation of post-mitotic photoreceptor neurons in mice.

    Directory of Open Access Journals (Sweden)

    Ivette M Sandoval

    Full Text Available For sensitive detection of rare gene repair events in terminally differentiated photoreceptors, we generated a knockin mouse model by replacing one mouse rhodopsin allele with a form of the human rhodopsin gene that causes a severe, early-onset form of retinitis pigmentosa. The human gene contains a premature stop codon at position 344 (Q344X, cDNA encoding the enhanced green fluorescent protein (EGFP at its 3' end, and a modified 5' untranslated region to reduce translation rate so that the mutant protein does not induce retinal degeneration. Mutations that eliminate the stop codon express a human rhodopsin-EGFP fusion protein (hRho-GFP, which can be readily detected by fluorescence microscopy. Spontaneous mutations were observed at a frequency of about one per retina; in every case, they gave rise to single fluorescent rod cells, indicating that each mutation occurred during or after the last mitotic division. Additionally, the number of fluorescent rods did not increase with age, suggesting that the rhodopsin gene in mature rod cells is less sensitive to mutation than it is in developing rods. Thus, there is a brief developmental window, coinciding with the transcriptional activation of the rhodopsin locus, in which somatic mutations of the rhodopsin gene abruptly begin to appear.

  6. Myeloblastic leukemia cells conditionally blocked by myc-estrogen receptor chimeric transgenes for terminal differentiation coupled to growth arrest and apoptosis.

    Science.gov (United States)

    Selvakumaran, M; Liebermann, D; Hoffman-Liebermann, B

    1993-05-01

    Conditional mutants of the myeloblastic leukemic M1 cell line, expressing the chimeric mycer transgene, have been established. It is shown that M1 mycer cells, like M1, undergo terminal differentiation coupled to growth arrest and programmed cell death (apoptosis) after treatment with the physiologic differentiation inducer interleukin-6. However, when beta-estradiol is included in the culture medium, M1 mycer cells respond to differentiation inducers like M1 myc cell lines, where the differentiation program is blocked at an intermediate stage. By manipulating the function of the mycer transgene product, it is shown that there is a 10-hour window during myeloid differentiation, from 30 to 40 hours after the addition of the differentiation inducer, when the terminal differentiation program switches from being dependent on c-myc suppression to becoming c-myc suppression independent, where activation of c-myc has no apparent effect on mature macrophages. M1 mycer cell lines provide a powerful tool to increase our understanding of the role of c-myc in normal myelopoiesis and in leukemogenesis, also providing a strategy to clone c-myc target genes.

  7. Massive splenomegaly in acute erythroid leukaemia (FAB Class-M6): an unusual presentation.

    Science.gov (United States)

    Sherazi, Syed Furqan Haider; Butt, Zeeshan

    2012-09-01

    AML-M6 has a peak incidence in the seventh decade with slight male preponderance, and can also present at a younger age. The usual features are anaemia, thrombocytopenia, malaise, fatigue, easy bruising, epistaxis and petechiae. Splenomegaly may occur in 20-40 % of the cases but massive splenomegaly is rare presentation and have been only reported once in humans and once in animals. A 22 year Asian female, presented with fatigue, pallor, mild jaundice, exertional dyspnoea, epigastric pain, tender right hypochondrium and massive splenomegaly. Investigations revealed anaemia and thrombocytopenia, tear drop cells, basophilic stippling, piokilocytosis and anisochromia; increased uric acid and LDH. Abdominal ultrasound showed enlarged liver (22cm) and spleen (20cm). Bone marrow aspiration revealed 51% erythroid and 24% non-erythroid precursors, depressed leukopoeisis and megakarypoeisis. Erythroblasts were PAS and CD71 positive and also reacted to Antihaemoglobin-Antibody. This report highlights characteristic features and diagnostic criteria of erythroleukaemia, differential diagnosis of massive splenomegaly and their rare association.

  8. Synthesis of novel vitamin K derivatives with alkylated phenyl groups introduced at the ω-terminal side chain and evaluation of their neural differentiation activities.

    Science.gov (United States)

    Sakane, Rie; Kimura, Kimito; Hirota, Yoshihisa; Ishizawa, Michiyasu; Takagi, Yuta; Wada, Akimori; Kuwahara, Shigefumi; Makishima, Makoto; Suhara, Yoshitomo

    2017-11-01

    Vitamin K is an essential cofactor of γ-glutamylcarboxylase as related to blood coagulation and bone formation. Menaquinone-4, one of the vitamin K homologues, is biosynthesized in the body and has various biological activities such as being a ligand for steroid and xenobiotic receptors, protection of neuronal cells from oxidative stress, and so on. From this background, we focused on the role of menaquinone in the differentiation activity of progenitor cells into neuronal cells and we synthesized novel vitamin K derivatives with modification of the ω-terminal side chain. We report here new vitamin K analogues, which introduced an alkylated phenyl group at the ω-terminal side chain. These compounds exhibited potent differentiation activity as compared to control. Copyright © 2017 The Author(s). Published by Elsevier Ltd.. All rights reserved.

  9. IL-27 Receptor Signalling Restricts the Formation of Pathogenic, Terminally Differentiated Th1 Cells during Malaria Infection by Repressing IL-12 Dependent Signals

    Science.gov (United States)

    Villegas-Mendez, Ana; de Souza, J. Brian; Lavelle, Seen-Wai; Gwyer Findlay, Emily; Shaw, Tovah N.; van Rooijen, Nico; Saris, Christiaan J.; Hunter, Christopher A.; Riley, Eleanor M.; Couper, Kevin N.

    2013-01-01

    The IL-27R, WSX-1, is required to limit IFN-γ production by effector CD4+ T cells in a number of different inflammatory conditions but the molecular basis of WSX-1-mediated regulation of Th1 responses in vivo during infection has not been investigated in detail. In this study we demonstrate that WSX-1 signalling suppresses the development of pathogenic, terminally differentiated (KLRG-1+) Th1 cells during malaria infection and establishes a restrictive threshold to constrain the emergent Th1 response. Importantly, we show that WSX-1 regulates cell-intrinsic responsiveness to IL-12 and IL-2, but the fate of the effector CD4+ T cell pool during malaria infection is controlled primarily through IL-12 dependent signals. Finally, we show that WSX-1 regulates Th1 cell terminal differentiation during malaria infection through IL-10 and Foxp3 independent mechanisms; the kinetics and magnitude of the Th1 response, and the degree of Th1 cell terminal differentiation, were comparable in WT, IL-10R1−/− and IL-10−/− mice and the numbers and phenotype of Foxp3+ cells were largely unaltered in WSX-1−/− mice during infection. As expected, depletion of Foxp3+ cells did not enhance Th1 cell polarisation or terminal differentiation during malaria infection. Our results significantly expand our understanding of how IL-27 regulates Th1 responses in vivo during inflammatory conditions and establishes WSX-1 as a critical and non-redundant regulator of the emergent Th1 effector response during malaria infection. PMID:23593003

  10. Differential isotope dansylation labeling combined with liquid chromatography mass spectrometry for quantification of intact and N-terminal truncated proteins

    International Nuclear Information System (INIS)

    Tang, Yanan; Li, Liang

    2013-01-01

    Graphical abstract: -- Highlights: •LC–MS was developed for quantifying protein mixtures containing both intact and N-terminal truncated proteins. • 12 C 2 -Dansylation of the N-terminal amino acid of proteins was done first, followed by microwave-assisted acid hydrolysis. •The released 12 C 2 -dansyl labeled N-terminal amino acid was quantified using 13 C 2 -dansyl labeled amino acid standards. •The method provided accurate and precise results for quantifying intact and N-terminal truncated proteins within 8 h. -- Abstract: The N-terminal amino acids of proteins are important structure units for maintaining the biological function, localization, and interaction networks of proteins. Under different biological conditions, one or several N-terminal amino acids could be cleaved from an intact protein due to processes, such as proteolysis, resulting in the change of protein properties. Thus, the ability to quantify the N-terminal truncated forms of proteins is of great importance, particularly in the area of development and production of protein-based drugs where the relative quantity of the intact protein and its truncated form needs to be monitored. In this work, we describe a rapid method for absolute quantification of protein mixtures containing intact and N-terminal truncated proteins. This method is based on dansylation labeling of the N-terminal amino acids of proteins, followed by microwave-assisted acid hydrolysis of the proteins into amino acids. It is shown that dansyl labeled amino acids are stable in acidic conditions and can be quantified by liquid chromatography mass spectrometry (LC–MS) with the use of isotope analog standards

  11. Differential isotope dansylation labeling combined with liquid chromatography mass spectrometry for quantification of intact and N-terminal truncated proteins

    Energy Technology Data Exchange (ETDEWEB)

    Tang, Yanan; Li, Liang, E-mail: Liang.Li@ualberta.ca

    2013-08-20

    Graphical abstract: -- Highlights: •LC–MS was developed for quantifying protein mixtures containing both intact and N-terminal truncated proteins. •{sup 12}C{sub 2}-Dansylation of the N-terminal amino acid of proteins was done first, followed by microwave-assisted acid hydrolysis. •The released {sup 12}C{sub 2}-dansyl labeled N-terminal amino acid was quantified using {sup 13}C{sub 2}-dansyl labeled amino acid standards. •The method provided accurate and precise results for quantifying intact and N-terminal truncated proteins within 8 h. -- Abstract: The N-terminal amino acids of proteins are important structure units for maintaining the biological function, localization, and interaction networks of proteins. Under different biological conditions, one or several N-terminal amino acids could be cleaved from an intact protein due to processes, such as proteolysis, resulting in the change of protein properties. Thus, the ability to quantify the N-terminal truncated forms of proteins is of great importance, particularly in the area of development and production of protein-based drugs where the relative quantity of the intact protein and its truncated form needs to be monitored. In this work, we describe a rapid method for absolute quantification of protein mixtures containing intact and N-terminal truncated proteins. This method is based on dansylation labeling of the N-terminal amino acids of proteins, followed by microwave-assisted acid hydrolysis of the proteins into amino acids. It is shown that dansyl labeled amino acids are stable in acidic conditions and can be quantified by liquid chromatography mass spectrometry (LC–MS) with the use of isotope analog standards.

  12. Genetic manipulation of RPS5 gene expression modulates the initiation of commitment of MEL cells to erythroid maturation: Implications in understanding ribosomopathies.

    Science.gov (United States)

    Vizirianakis, Ioannis S; Papachristou, Eleni T; Andreadis, Panagiotis; Zopounidou, Elena; Matragkou, Christina N; Tsiftsoglou, Asterios S

    2015-07-01

    Impairment of ribosome biogenesis contributes to the molecular pathophysiology of ribosomopathies by deregulating cell-lineage specific proliferation, differentiation and apoptosis decisions of haematopoietic progenitor cells. Here, using pro-erythroblast-like murine erythroleukemia (MEL) cells, a model system of erythroid maturation, we aimed to investigate whether genetic manipulation of RPS5 expression affects the capacity of cells to grow and differentiate in culture. Parental MEL cells stably transfected with full length RPS5 cDNA in sense (MEL-C14 culture) or antisense (MEL-antisenseRPS5 culture) orientation, as well as MEL cells transiently transfected with siRNAs specific for RPS5 gene silencing (MEL-RPS5siRNA culture) were assessed for their ability to fully execute their erythroid maturation program in culture. The data obtained thus far indicate that: a) MEL-antisenseRPS5 exhibit a pronounced delay in the initiation of differentiation, as well as an impairment of commitment, since the continuous presence of the inducer in culture is required for the cells to fully execute their erythroid maturation program. b) RNAi-mediating silencing of RPS5 gene expression resulted in the inability of MEL cells to differentiate; however, when these cells were allowed to recapitulate normal RPS5 gene expression levels they regained their differentiation capacity by accumulating high proportion of erythroid mature cells. c) Interestingly the latter, is accompanied by morphological changes of cells and an impairment of their proliferation and apoptosis potential. Such data for the first time correlate the RPS5 gene expression levels with the differentiation capacity of MEL cells in vitro, a fact that might also have implications in understanding ribosomopathies.

  13. Embryoid body attachment to reconstituted basement membrane induces a genetic program of epithelial differentiation via jun N-terminal kinase signaling.

    Science.gov (United States)

    Ho, Hoang-Yen; Moffat, Ryan C; Patel, Rupal V; Awah, Franklin N; Baloue, Kaitrin; Crowe, David L

    2010-09-01

    Embryonic stem (ES) cells are derived from early stage mammalian embryos and have broad developmental potential. These cells can be manipulated experimentally to generate cells of multiple tissue types which could be important in treating human diseases. The ability to produce relevant amounts of these differentiated cell populations creates the basis for clinical interventions in tissue regeneration and repair. Understanding how embryonic stem cells differentiate also can reveal important insights into cell biology. A previously reported mouse embryonic stem cell model demonstrated that differentiated epithelial cells migrated out of embryoid bodies attached to reconstituted basement membrane. We used genomic technology to profile ES cell populations in order to understand the molecular mechanisms leading to epithelial differentiation. Cells with characteristics of cultured epithelium migrated from embryoid bodies attached to reconstituted basement membrane. However, cells that comprised embryoid bodies also rapidly lost ES cell-specific gene expression and expressed proteins characteristic of stratified epithelia within hours of attachment to basement membrane. Gene expression profiling of sorted cell populations revealed upregulation of the BMP/TGFbeta signaling pathway, which was not sufficient for epithelial differentiation in the absence of basement membrane attachment. Activation of c-jun N-terminal kinase 1 (JNK1) and increased expression of Jun family transcription factors was observed during epithelial differentiation of ES cells. Inhibition of JNK signaling completely blocked epithelial differentiation in this model, revealing a key mechanism by which ES cells adopt epithelial characteristics via basement membrane attachment. Copyright (c) 2010 Elsevier B.V. All rights reserved.

  14. Visualization of living terminal hypertrophic chondrocytes of growth plate cartilage in situ by differential interference contrast microscopy and time-lapse cinematography.

    Science.gov (United States)

    Farnum, C E; Turgai, J; Wilsman, N J

    1990-09-01

    The functional unit within the growth plate consists of a column of chondrocytes that passes through a sequence of phases including proliferation, hypertrophy, and death. It is important to our understanding of the biology of the growth plate to determine if distal hypertrophic cells are viable, highly differentiated cells with the potential of actively controlling terminal events of endochondral ossification prior to their death at the chondro-osseous junction. This study for the first time reports on the visualization of living hypertrophic chondrocytes in situ, including the terminal hypertrophic chondrocyte. Chondrocytes in growth plate explants are visualized using rectified differential interference contrast microscopy. We record and measure, using time-lapse cinematography, the rate of movement of subcellular organelles at the limit of resolution of this light microscopy system. Control experiments to assess viability of hypertrophic chondrocytes include coincubating organ cultures with the intravital dye fluorescein diacetate to assess the integrity of the plasma membrane and cytoplasmic esterases. In this system, all hypertrophic chondrocytes, including the very terminal chondrocyte, exist as rounded, fully hydrated cells. By the criteria of intravital dye staining and organelle movement, distal hypertrophic chondrocytes are identical to chondrocytes in the proliferative and early hypertrophic cell zones.

  15. Differential functions of C- and N-terminal hepatitis B x protein in liver cells treated with doxorubicin in normoxic or hypoxic condition.

    Directory of Open Access Journals (Sweden)

    Davor Kin-Fan Chau

    Full Text Available Hepatitis viral B x protein (HBx, a hepatocarcinogen, is frequently mutated. Hypoxia influences the growth of HCC and also the sensitivity of tumor cells to treatments. We aimed to test the role of HBx and acute hypoxia in the efficacy of chemotherapy. In this study, we established 4 Chang liver cell lines with the full-length HBx (HBx, the first 50 amino acids of N-terminal HBx (HBx/50, the last 104 amino acids of C-terminal HBx (HBx/51 and empty vector (CL, respectively. MTT and TNUEL assays were used to assess cell viability and apoptosis respectively. Western blot was used to determine the expression of relevant proteins. Results showed that among 4 cell lines, doxorubicin was most effective in decreasing the viability and enhancing apoptosis in HBx/51 cells, while HBx/50 cells were most resistant to the treatment. Cells in hypoxia were more susceptible to doxorubicin than cells in normoxia. Hypoxia facilitated the Bid cleavage especially in HBx/51 cells via phosphorylating p38 MAPK. p38 MAPK inhibitor significantly reduced the tBid level and increased cell viability. In conclusion, N-terminal HBx and C-terminal HBx function differentially in their ability to regulate cell growth, with the former being promotive but the latter being inhibitory. The acute hypoxia may overcome the HBx-induced resistance and facilitate the chemotherapy.

  16. Increased numbers of preexisting memory CD8 T cells and decreased T-bet expression can restrain terminal differentiation of secondary effector and memory CD8 T cells.

    Science.gov (United States)

    Joshi, Nikhil S; Cui, Weiguo; Dominguez, Claudia X; Chen, Jonathan H; Hand, Timothy W; Kaech, Susan M

    2011-10-15

    Memory CD8 T cells acquire effector memory cell properties after reinfection and may reach terminally differentiated, senescent states ("Hayflick limit") after multiple infections. The signals controlling this process are not well understood, but we found that the degree of secondary effector and memory CD8 T cell differentiation was intimately linked to the amount of T-bet expressed upon reactivation and preexisting memory CD8 T cell number (i.e., primary memory CD8 T cell precursor frequency) present during secondary infection. Compared with naive cells, memory CD8 T cells were predisposed toward terminal effector (TE) cell differentiation because they could immediately respond to IL-12 and induce T-bet, even in the absence of Ag. TE cell formation after secondary (2°) or tertiary infections was dependent on increased T-bet expression because T-bet(+/-) cells were resistant to these phenotypic changes. Larger numbers of preexisting memory CD8 T cells limited the duration of 2° infection and the amount of IL-12 produced, and consequently, this reduced T-bet expression and the proportion of 2° TE CD8 T cells that formed. Together, these data show that over repeated infections, memory CD8 T cell quality and proliferative fitness is not strictly determined by the number of serial encounters with Ag or cell divisions, but is a function of the CD8 T cell differentiation state, which is genetically controlled in a T-bet-dependent manner. This differentiation state can be modulated by preexisting memory CD8 T cell number and the intensity of inflammation during reinfection. These results have important implications for vaccinations involving prime-boost strategies.

  17. Enhanced electrochemical response in oxidative differential pulse voltammetry of dopamine in the presence of ascorbic acid at carboxyl-terminated boron-doped diamond electrodes

    International Nuclear Information System (INIS)

    Kondo, Takeshi; Niwano, Yu; Tamura, Akira; Imai, Junichi; Honda, Kensuke; Einaga, Yasuaki; Tryk, Donald A.; Fujishima, Akira; Kawai, Takeshi

    2009-01-01

    The differential pulse voltammetric (DPV) peak for dopamine (DA) oxidation was found to be highly amplified by the addition of ascorbic acid (AA) when carboxyl-terminated boron-doped diamond (BDD) electrodes were used as the working electrode. The DP voltammogram for a solution containing DA and AA obtained using a 4-pentenoic acid-modified BDD (4PA-BDD) electrode showed well-separated oxidation peaks for DA and AA at 0.4 and 0.6 V vs. Ag/AgCl, respectively. In addition, as the DA concentration increased at constant AA concentration, a simultaneous increase in the DA peak current density and decrease in the AA peak current density were observed. The slope of the calibration curve for the [DA] range of 1-10 μM in the presence of AA (500 μM) was seven times larger than that obtained in the absence of AA. Such an enhancement was found to be more efficient at 4PA-BDD than at oxidized-BDD, partly due to simple electrostatic effects and partly due to suppression of the polymerization of DA oxidation products by the terminal carboxyl groups. The enhanced detection method using a carboxyl-terminated BDD electrode should be an effective analytical tool, especially for determining low concentrations of DA in the presence of high concentrations of AA

  18. Enhanced electrochemical response in oxidative differential pulse voltammetry of dopamine in the presence of ascorbic acid at carboxyl-terminated boron-doped diamond electrodes

    Energy Technology Data Exchange (ETDEWEB)

    Kondo, Takeshi [Department of Industrial Chemistry, Faculty of Engineering, Tokyo University of Science, 1-3 Kagurazaka, Shinjuku-ku, Tokyo 162-8601 (Japan)], E-mail: t.kondo@ci.kagu.tus.ac.jp; Niwano, Yu; Tamura, Akira; Imai, Junichi [Department of Industrial Chemistry, Faculty of Engineering, Tokyo University of Science, 1-3 Kagurazaka, Shinjuku-ku, Tokyo 162-8601 (Japan); Honda, Kensuke [Department of Chemistry and Earth Sciences, Faculty of Science, Yamaguchi University, 1677-1 Yoshida, Yamaguchi-shi, Yamaguchi 753-8521 (Japan); Einaga, Yasuaki [Department of Chemistry, Faculty of Science and Technology, Keio University, 3-14-1 Hiyoshi, Yokohama 223-0012 (Japan); Tryk, Donald A. [Fuel Cell Nanomaterials Center, University of Yamanashi, Takeda 4-3-11, Kofu, Yamanashi 400-8511 (Japan); Fujishima, Akira [Kanagawa Academy of Science and Technology (KAST), 3-2-1 Sakado, Takatsu-ku, Kawasaki, Kanagawa 213-0012 (Japan); Kawai, Takeshi [Department of Industrial Chemistry, Faculty of Engineering, Tokyo University of Science, 1-3 Kagurazaka, Shinjuku-ku, Tokyo 162-8601 (Japan)

    2009-03-01

    The differential pulse voltammetric (DPV) peak for dopamine (DA) oxidation was found to be highly amplified by the addition of ascorbic acid (AA) when carboxyl-terminated boron-doped diamond (BDD) electrodes were used as the working electrode. The DP voltammogram for a solution containing DA and AA obtained using a 4-pentenoic acid-modified BDD (4PA-BDD) electrode showed well-separated oxidation peaks for DA and AA at 0.4 and 0.6 V vs. Ag/AgCl, respectively. In addition, as the DA concentration increased at constant AA concentration, a simultaneous increase in the DA peak current density and decrease in the AA peak current density were observed. The slope of the calibration curve for the [DA] range of 1-10 {mu}M in the presence of AA (500 {mu}M) was seven times larger than that obtained in the absence of AA. Such an enhancement was found to be more efficient at 4PA-BDD than at oxidized-BDD, partly due to simple electrostatic effects and partly due to suppression of the polymerization of DA oxidation products by the terminal carboxyl groups. The enhanced detection method using a carboxyl-terminated BDD electrode should be an effective analytical tool, especially for determining low concentrations of DA in the presence of high concentrations of AA.

  19. Expression of P190 and P210 BCR/ABL1 in normal human CD34(+) cells induces similar gene expression profiles and results in a STAT5-dependent expansion of the erythroid lineage

    DEFF Research Database (Denmark)

    Järås, Marcus; Johnels, Petra; Agerstam, Helena

    2009-01-01

    OBJECTIVE: The P190 and P210 BCR/ABL1 fusion genes are mainly associated with different types of hematologic malignancies, but it is presently unclear whether they are functionally different following expression in primitive human hematopoietic cells. MATERIALS AND METHODS: We investigated...... and systematically compared the effects of retroviral P190 BCR/ABL1 and P210 BCR/ABL1 expression on cell proliferation, differentiation, and global gene expression in human CD34(+) cells from cord blood. RESULTS: Expression of either P190 BCR/ABL1 or P210 BCR/ABL1 resulted in expansion of erythroid cells...... and stimulated erythropoietin-independent burst-forming unit-erythroid colony formation. By using a lentiviral anti-signal transducer and activator of transcription 5 (STAT5) short-hairpin RNA, we found that both P190 BCR/ABL1- and P210 BCR/ABL1-induced erythroid cell expansion were STAT5-dependent. Under...

  20. TGF-β receptors, in a Smad-independent manner, are required for terminal skeletal muscle differentiation

    International Nuclear Information System (INIS)

    Droguett, Rebeca; Cabello-Verrugio, Claudio; Santander, Cristian; Brandan, Enrique

    2010-01-01

    Skeletal muscle differentiation is strongly inhibited by transforming growth factor type β (TGF-β), although muscle formation as well as regeneration normally occurs in an environment rich in this growth factor. In this study, we evaluated the role of intracellular regulatory Smads proteins as well as TGF-β-receptors (TGF-β-Rs) during skeletal muscle differentiation. We found a decrease of TGF-β signaling during differentiation. This phenomenon is explained by a decline in the levels of the regulatory proteins Smad-2, -3, and -4, a decrease in the phosphorylation of Smad-2 and lost of nuclear translocation of Smad-3 and -4 in response to TGF-β. No change in the levels and inhibitory function of Smad-7 was observed. In contrast, we found that TGF-β-R type I (TGF-β-RI) and type II (TGF-β-RII) increased on the cell surface during skeletal muscle differentiation. To analyze the direct role of the serine/threonine kinase activities of TGF-β-Rs, we used the specific inhibitor SB 431542 and the dominant-negative form of TGF-β-RII lacking the cytoplasmic domain. The TGF-β-Rs were important for successful muscle formation, determined by the induction of myogenin, creatine kinase activity, and myosin. Silencing of Smad-2/3 expression by specific siRNA treatments accelerated myogenin, myosin expression, and myotube formation; although when SB 431542 was present inhibition in myosin induction and myotube formation was observed, suggesting that these last steps of skeletal muscle differentiation require active TGF-β-Rs. These results suggest that both down-regulation of Smad regulatory proteins and cell signaling through the TGF-β receptors independent of Smad proteins are essential for skeletal muscle differentiation.

  1. TGF-{beta} receptors, in a Smad-independent manner, are required for terminal skeletal muscle differentiation

    Energy Technology Data Exchange (ETDEWEB)

    Droguett, Rebeca; Cabello-Verrugio, Claudio; Santander, Cristian [Centro de Regulacion Celular y Patologia, Centro de Regeneracion y Envejecimiento (CARE), Departamento de Biologia Celular y Molecular, MIFAB, Pontificia Universidad Catolica de Chile, Santiago (Chile); Brandan, Enrique, E-mail: ebrandan@bio.puc.cl [Centro de Regulacion Celular y Patologia, Centro de Regeneracion y Envejecimiento (CARE), Departamento de Biologia Celular y Molecular, MIFAB, Pontificia Universidad Catolica de Chile, Santiago (Chile)

    2010-09-10

    Skeletal muscle differentiation is strongly inhibited by transforming growth factor type {beta} (TGF-{beta}), although muscle formation as well as regeneration normally occurs in an environment rich in this growth factor. In this study, we evaluated the role of intracellular regulatory Smads proteins as well as TGF-{beta}-receptors (TGF-{beta}-Rs) during skeletal muscle differentiation. We found a decrease of TGF-{beta} signaling during differentiation. This phenomenon is explained by a decline in the levels of the regulatory proteins Smad-2, -3, and -4, a decrease in the phosphorylation of Smad-2 and lost of nuclear translocation of Smad-3 and -4 in response to TGF-{beta}. No change in the levels and inhibitory function of Smad-7 was observed. In contrast, we found that TGF-{beta}-R type I (TGF-{beta}-RI) and type II (TGF-{beta}-RII) increased on the cell surface during skeletal muscle differentiation. To analyze the direct role of the serine/threonine kinase activities of TGF-{beta}-Rs, we used the specific inhibitor SB 431542 and the dominant-negative form of TGF-{beta}-RII lacking the cytoplasmic domain. The TGF-{beta}-Rs were important for successful muscle formation, determined by the induction of myogenin, creatine kinase activity, and myosin. Silencing of Smad-2/3 expression by specific siRNA treatments accelerated myogenin, myosin expression, and myotube formation; although when SB 431542 was present inhibition in myosin induction and myotube formation was observed, suggesting that these last steps of skeletal muscle differentiation require active TGF-{beta}-Rs. These results suggest that both down-regulation of Smad regulatory proteins and cell signaling through the TGF-{beta} receptors independent of Smad proteins are essential for skeletal muscle differentiation.

  2. Reduction of erythroid progenitors in protein-energy malnutrition.

    Science.gov (United States)

    Borelli, Primavera; Blatt, Solange; Pereira, Juliana; de Maurino, Beatriz Beutler; Tsujita, Maristela; de Souza, Ana Cristina; Xavier, José Guilherme; Fock, Ricardo Ambrósio

    2007-02-01

    Protein-energy malnutrition is a syndrome in which anaemia together with multivitamin and mineral deficiency may be present. The pathophysiological mechanisms involved have not, however, yet been completely elucidated. The aim of the present study was to evaluate the pathophysiological processes that occur in this anaemia in animals that were submitted to protein-energy malnutrition, in particular with respect to Fe concentration and the proliferative activity of haemopoietic cells. For this, histological, histochemical, cell culture and immunophenotyping techniques were used. Two-month-old male Swiss mice were submitted to protein-energy malnutrition with a low-protein diet (20 g/kg) compared with control diet (400 g/kg). When the experimental group had attained a 20 % loss of their original body weight, the animals from both groups received, intravenously, 20 IU erythropoietin every other day for 14 d. Malnourished animals showed a decrease in red blood cells, Hb concentration and reticulocytopenia, as well as severe bone marrow and splenic atrophy. The results for serum Fe, total Fe-binding capacity, transferrin and erythropoietin in malnourished animals were no different from those of the control animals. Fe reserves in the spleen, liver and bone marrow were found to be greater in the malnourished animals. The mixed colony-forming unit assays revealed a smaller production of granulocyte-macrophage colony-forming units, erythroid burst-forming units, erythroid colony-forming units and CD45, CD117, CD119 and CD71 expression in the bone marrow and spleen cells of malnourished animals. These findings suggest that, in this protein-energy malnutrition model, anaemia is not caused by Fe deficiency or erythropoietin deficiency, but is a result of ineffective erythropoiesis.

  3. Thrombopoietin has a differentiative effect on late-stage human erythropoiesis.

    Science.gov (United States)

    Liu, W; Wang, M; Tang, D C; Ding, I; Rodgers, G P

    1999-05-01

    To further explore the mechanism of the effect of thrombopoietin (TPO) on erythropoiesis, we used a two-phase culture system to investigate the effect of TPO on late-stage human erythroid lineage differentiation. In serum-free suspension and semisolid cultures of human peripheral blood derived erythroid progenitors, TPO alone did not produce benzidine-positive cells. However, in serum-containing culture, TPO alone stimulated erythroid cell proliferation and differentiation, demonstrated by erythroid colony formation, production of benzidine-positive cells and haemoglobin (Hb) synthesis. Monoclonal anti-human erythropoietin antibody and anti-human erythropoietin receptor antibody completely abrogated the erythroid differentiative ability of TPO in the serum-containing systems. This implied that binding of EPO and EPO-R was essential for erythropoiesis and the resultant signal transduction may be augmented by the signals emanating from TPO-c-Mpl interaction. Experiment of withdrawal of TPO further demonstrated the involvement of TPO in late-stage erythropoiesis. RT-PCR results showed that there was EPO-R but not c-Mpl expression on developing erythroblasts induced by TPO in serum-containing system. Our results establish that TPO affects not only the proliferation of erythroid progenitors but also the differentiation of erythroid progenitors to mature erythroid cells.

  4. IRF8 Transcription Factor Controls Survival and Function of Terminally Differentiated Conventional and Plasmacytoid Dendritic Cells, Respectively

    DEFF Research Database (Denmark)

    Sichien, Dorine; Scott, Charlotte L; Martens, Liesbet

    2016-01-01

    Interferon regulatory factor-8 (IRF8) has been proposed to be essential for development of monocytes, plasmacytoid dendritic cells (pDCs) and type 1 conventional dendritic cells (cDC1s) and remains highly expressed in differentiated DCs. Transcription factors that are required to maintain the ide...

  5. Characterisation of cell cycle arrest and terminal differentiation in a maximally proliferative human epithelial tissue: Lessons from the human hair follicle matrix.

    Science.gov (United States)

    Purba, Talveen S; Brunken, Lars; Peake, Michael; Shahmalak, Asim; Chaves, Asuncion; Poblet, Enrique; Ceballos, Laura; Gandarillas, Alberto; Paus, Ralf

    2017-09-01

    Human hair follicle (HF) growth and hair shaft formation require terminal differentiation-associated cell cycle arrest of highly proliferative matrix keratinocytes. However, the regulation of this complex event remains unknown. CIP/KIP family member proteins (p21 CIP1 , p27 KIP1 and p57 KIP2 ) regulate cell cycle progression/arrest, endoreplication, differentiation and apoptosis. Since they have not yet been adequately characterized in the human HF, we asked whether and where CIP/KIP proteins localise in the human hair matrix and pre-cortex in relation to cell cycle activity and HF-specific epithelial cell differentiation that is marked by keratin 85 (K85) protein expression. K85 expression coincided with loss or reduction in cell cycle activity markers, including in situ DNA synthesis (EdU incorporation), Ki-67, phospho-histone H3 and cyclins A and B1, affirming a post-mitotic state of pre-cortical HF keratinocytes. Expression of CIP/KIP proteins was found abundantly within the proliferative hair matrix, concomitant with a role in cell cycle checkpoint control. p21 CIP1 , p27 KIP1 and cyclin E persisted within post-mitotic keratinocytes of the pre-cortex, whereas p57 KIP2 protein decreased but became nuclear. These data imply a supportive role for CIP/KIP proteins in maintaining proliferative arrest, differentiation and anti-apoptotic pathways, promoting continuous hair bulb growth and hair shaft formation in anagen VI. Moreover, post-mitotic hair matrix regions contained cells with enlarged nuclei, and DNA in situ hybridisation showed cells that were >2N in the pre-cortex. This suggests that CIP/KIP proteins might counterbalance cyclin E to control further rounds of DNA replication in a cell population that has a propensity to become tetraploid. These data shed new light on the in situ-biography of human hair matrix keratinocytes on their path of active cell cycling, arrest and terminal differentiation, and showcase the human HF as an excellent, clinically

  6. Genome-wide mapping of Sox6 binding sites in skeletal muscle reveals both direct and indirect regulation of muscle terminal differentiation by Sox6

    Directory of Open Access Journals (Sweden)

    An Chung-Il

    2011-10-01

    Full Text Available Abstract Background Sox6 is a multi-faceted transcription factor involved in the terminal differentiation of many different cell types in vertebrates. It has been suggested that in mice as well as in zebrafish Sox6 plays a role in the terminal differentiation of skeletal muscle by suppressing transcription of slow fiber specific genes. In order to understand how Sox6 coordinately regulates the transcription of multiple fiber type specific genes during muscle development, we have performed ChIP-seq analyses to identify Sox6 target genes in mouse fetal myotubes and generated muscle-specific Sox6 knockout (KO mice to determine the Sox6 null muscle phenotype in adult mice. Results We have identified 1,066 Sox6 binding sites using mouse fetal myotubes. The Sox6 binding sites were found to be associated with slow fiber-specific, cardiac, and embryonic isoform genes that are expressed in the sarcomere as well as transcription factor genes known to play roles in muscle development. The concurrently performed RNA polymerase II (Pol II ChIP-seq analysis revealed that 84% of the Sox6 peak-associated genes exhibited little to no binding of Pol II, suggesting that the majority of the Sox6 target genes are transcriptionally inactive. These results indicate that Sox6 directly regulates terminal differentiation of muscle by affecting the expression of sarcomere protein genes as well as indirectly through influencing the expression of transcription factors relevant to muscle development. Gene expression profiling of Sox6 KO skeletal and cardiac muscle revealed a significant increase in the expression of the genes associated with Sox6 binding. In the absence of the Sox6 gene, there was dramatic upregulation of slow fiber-specific, cardiac, and embryonic isoform gene expression in Sox6 KO skeletal muscle and fetal isoform gene expression in Sox6 KO cardiac muscle, thus confirming the role Sox6 plays as a transcriptional suppressor in muscle development

  7. The role of p38 MAP kinase and c-Jun N-terminal protein kinase signaling in the differentiation and apoptosis of immortalized neural stem cells

    International Nuclear Information System (INIS)

    Yang, Se-Ran; Cho, Sung-Dae; Ahn, Nam-Shik; Jung, Ji-Won; Park, Joon-Suk; Jo, Eun-Hye; Hwang, Jae-Woong; Kim, Sung-Hoon; Lee, Bong-Hee; Kang, Kyung-Sun; Lee, Yong-Soon

    2005-01-01

    The two distinct members of the mitogen-activated protein (MAP) kinase family c-Jun N-terminal protein kinase (JNK) and p38 MAP kinase, play an important role in central nervous system (CNS) development and differentiation. However, their role and functions are not completely understood in CNS. To facilitate in vitro study, we have established an immortal stem cell line using SV40 from fetal rat embryonic day 17. In these cells, MAP kinase inhibitors (SP600125, SB202190, and PD98059) were treated for 1, 24, 48, and 72 h to examine the roles of protein kinases. Early inhibition of JNK did not alter phenotypic or morphological changes of immortalized cells, however overexpression of Bax and decrease of phosphorylated AKT was observed. The prolonged inhibition of JNK induced polyploidization of immortalized cells, and resulted in differentiation and inhibition of cell proliferation. Moreover, JNK and p38 MAP kinase but not ERK1/2 was activated, and p21, p53, and Bax were overexpressed by prolonged inhibition of JNK. These results indicate that JNK and p38 MAP kinase could play dual roles on cell survival and apoptosis. Furthermore, this established cell line could facilitate study of the role of JNK and p38 MAP kinase on CNS development or differentiation/apoptosis

  8. Differential recognition of terminal extracellular Plasmodium falciparum VAR2CSA domains by sera from multigravid, malaria-exposed Malian women.

    Science.gov (United States)

    Travassos, Mark A; Coulibaly, Drissa; Bailey, Jason A; Niangaly, Amadou; Adams, Matthew; Nyunt, Myaing M; Ouattara, Amed; Lyke, Kirsten E; Laurens, Matthew B; Pablo, Jozelyn; Jasinskas, Algis; Nakajima, Rie; Berry, Andrea A; Takala-Harrison, Shannon; Kone, Abdoulaye K; Kouriba, Bourema; Rowe, J Alexandra; Doumbo, Ogobara K; Thera, Mahamadou A; Laufer, Miriam K; Felgner, Philip L; Plowe, Christopher V

    2015-06-01

    The Plasmodium falciparum erythrocyte membrane protein 1 (PfEMP1) family mediates parasite sequestration in small capillaries through tissue-specific cytoadherence. The best characterized of these proteins is VAR2CSA, which is expressed on the surface of infected erythrocytes that bind to chondroitin sulfate in the placental matrix. Antibodies to VAR2CSA prevent placental cytoadherence and protect against placental malaria. The size and complexity of the VAR2CSA protein pose challenges for vaccine development, but smaller constitutive domains may be suitable for subunit vaccine development. A protein microarray was printed to include five overlapping fragments of the 3D7 VAR2CSA extracellular region. Malian women with a history of at least one pregnancy had antibody recognition of four of these fragments and had stronger reactivity against the two distal fragments than did nulliparous women, children, and men from Mali, suggesting that the C-terminal extracellular VAR2CSA domains are a potential focus of protective immunity. With carefully chosen sera from longitudinal studies of pregnant women, this approach has the potential to identify seroreactive VAR2CSA domains associated with protective immunity against pregnancy-associated malaria. © The American Society of Tropical Medicine and Hygiene.

  9. A novel Atoh1 "self-terminating" mouse model reveals the necessity of proper Atoh1 level and duration for hair cell differentiation and viability.

    Directory of Open Access Journals (Sweden)

    Ning Pan

    Full Text Available Atonal homolog1 (Atoh1 is a bHLH transcription factor essential for inner ear hair cell differentiation. Targeted expression of Atoh1 at various stages in development can result in hair cell differentiation in the ear. However, the level and duration of Atoh1 expression required for proper hair cell differentiation and maintenance remain unknown. We generated an Atoh1 conditional knockout (CKO mouse line using Tg(Atoh1-cre, in which the cre expression is driven by an Atoh1 enhancer element that is regulated by Atoh1 protein to "self-terminate" its expression. The mutant mice show transient, limited expression of Atoh1 in all hair cells in the ear. In the organ of Corti, reduction and delayed deletion of Atoh1 result in progressive loss of almost all the inner hair cells and the majority of the outer hair cells within three weeks after birth. The remaining cells express hair cell marker Myo7a and attract nerve fibers, but do not differentiate normal stereocilia bundles. Some Myo7a-positive cells persist in the cochlea into adult stages in the position of outer hair cells, flanked by a single row of pillar cells and two to three rows of disorganized Deiters cells. Gene expression analyses of Atoh1, Barhl1 and Pou4f3, genes required for survival and maturation of hair cells, reveal earlier and higher expression levels in the inner compared to the outer hair cells. Our data show that Atoh1 is crucial for hair cell mechanotransduction development, viability, and maintenance and also suggest that Atoh1 expression level and duration may play a role in inner vs. outer hair cell development. These genetically engineered Atoh1 CKO mice provide a novel model for establishing critical conditions needed to regenerate viable and functional hair cells with Atoh1 therapy.

  10. Differential structural properties of GLP-1 and exendin-4 determine their relative affinity for the GLP-1 receptor N-terminal extracellular domain.

    Science.gov (United States)

    Runge, Steffen; Schimmer, Susann; Oschmann, Jan; Schiødt, Christine Bruun; Knudsen, Sanne Möller; Jeppesen, Claus Bekker; Madsen, Kjeld; Lau, Jesper; Thøgersen, Henning; Rudolph, Rainer

    2007-05-15

    Glucagon-like peptide-1 (GLP-1) and exendin-4 (Ex4) are homologous peptides with established potential for treatment of type 2 diabetes. They bind and activate the pancreatic GLP-1 receptor (GLP-1R) with similar affinity and potency and thereby promote insulin secretion in a glucose-dependent manner. GLP-1R belongs to family B of the seven transmembrane G-protein coupled receptors. The N-terminal extracellular domain (nGLP-1R) is a ligand binding domain with differential affinity for Ex4 and GLP-1: low affinity for GLP-1 and high affinity for exendin-4. The superior affinity of nGLP-1R for Ex4 was previously explained by an additional interaction between nGLP-1R and the C-terminal Trp-cage of Ex4. In this study we have combined biophysical and pharmacological approaches thus relating structural properties of the ligands in solution to their relative binding affinity for nGLP-1R. We used both a tracer competition assay and ligand-induced thermal stabilization of nGLP-1R to measure the relative affinity of full length, truncated, and chimeric ligands for soluble refolded nGLP-1R. The ligands in solution and the conformational consequences of ligand binding to nGLP-1R were characterized by circular dichroism and fluorescence spectroscopy. We found a correlation between the helical content of the free ligands and their relative binding affinity for nGLP-1R, supporting the hypothesis that the ligands are helical at least in the segment that binds to nGLP-1R. The Trp-cage of Ex4 was not necessary to maintain a superior helicity of Ex4 compared to GLP-1. The results suggest that the differential affinity of nGLP-1R is explained almost entirely by divergent residues in the central part of the ligands: Leu10-Gly30 of Ex4 and Val16-Arg36 of GLP-1. In view of our results it appears that the Trp-cage plays only a minor role for the interaction between Ex4 and nGLP-1R and for the differential affinity of nGLP-1R for GLP-1 and Ex4.

  11. Hydroxyurea inhibits parvovirus B19 replication in erythroid progenitor cells.

    Science.gov (United States)

    Bonvicini, Francesca; Bua, Gloria; Conti, Ilaria; Manaresi, Elisabetta; Gallinella, Giorgio

    2017-07-15

    Parvovirus B19 (B19V) infection is restricted to erythroid progenitor cells (EPCs) of the human bone marrow, leading to transient arrest of erythropoiesis and severe complications mainly in subjects with underlying hematological disorders or with immune system deficits. Currently, there are no specific antiviral drugs for B19V treatment, but identification of compounds inhibiting B19V replication can be pursued by a drug repositioning strategy. In this frame, the present study investigates the activity of hydroxyurea (HU), the only disease-modifying therapy approved for sickle cell disease (SCD), towards B19V replication in the two relevant cellular systems, the UT7/EpoS1 cell line and EPCs. Results demonstrate that HU inhibits B19V replication with EC 50 values of 96.2µM and 147.1µM in UT7/EpoS1 and EPCs, respectively, providing experimental evidence of the antiviral activity of HU towards B19V replication, and confirming the efficacy of a drug discovery process by drug repositioning strategy. The antiviral activity occurs in vitro at concentrations lower than those affecting cellular DNA replication and viability, and at levels measured in plasma samples of SCD patients undergoing HU therapy. HU might determine a dual beneficial effect on SCD patients, not only for the treatment of the disease but also towards a virus responsible for severe complications. Copyright © 2017 Elsevier Inc. All rights reserved.

  12. Nuclear RNA sequencing of the mouse erythroid cell transcriptome.

    Directory of Open Access Journals (Sweden)

    Jennifer A Mitchell

    Full Text Available In addition to protein coding genes a substantial proportion of mammalian genomes are transcribed. However, most transcriptome studies investigate steady-state mRNA levels, ignoring a considerable fraction of the transcribed genome. In addition, steady-state mRNA levels are influenced by both transcriptional and posttranscriptional mechanisms, and thus do not provide a clear picture of transcriptional output. Here, using deep sequencing of nuclear RNAs (nucRNA-Seq in parallel with chromatin immunoprecipitation sequencing (ChIP-Seq of active RNA polymerase II, we compared the nuclear transcriptome of mouse anemic spleen erythroid cells with polymerase occupancy on a genome-wide scale. We demonstrate that unspliced transcripts quantified by nucRNA-seq correlate with primary transcript frequencies measured by RNA FISH, but differ from steady-state mRNA levels measured by poly(A-enriched RNA-seq. Highly expressed protein coding genes showed good correlation between RNAPII occupancy and transcriptional output; however, genome-wide we observed a poor correlation between transcriptional output and RNAPII association. This poor correlation is due to intergenic regions associated with RNAPII which correspond with transcription factor bound regulatory regions and a group of stable, nuclear-retained long non-coding transcripts. In conclusion, sequencing the nuclear transcriptome provides an opportunity to investigate the transcriptional landscape in a given cell type through quantification of unspliced primary transcripts and the identification of nuclear-retained long non-coding RNAs.

  13. [Update on the biology of heme synthesis in erythroid cells].

    Science.gov (United States)

    Fujiwara, Tohru; Harigae, Hideo

    2015-02-01

    Heme is a prosthetic group of hemoproteins playing important roles in oxygen transport, detoxification, circadian rhythm, microRNA processing, regulation of transcription, and translation. The majority of heme (-85%) is synthesized in red blood cells mainly for hemoglobin production, whereas hepatocytes account for most of the rest, functioning primarily in the synthesis of cytochrome P450 enzymes and mitochondrial respiratory enzymes. Thus, failure of heme biosynthesis causes severe inherited or acquired disorders in humans, including porphyria and sideroblastic anemia. The heme biosynthetic pathway is composed of eight enzymes that work in either mitochondria or the cytoplasm, which have been extensively researched and frequently reviewed. On the other hand, the mechanisms governing transport and intracellular trafficking of heme intermediates, as well as their potential links to human diseases, are poorly understood. Herein, we focus on recent understanding of the heme biosynthetic pathway and on human disorders due to defective heme synthesis in erythroid cells, such as X-linked sideroblastic anemia and erythropoietic protoporphyria.

  14. Prospective identification of erythroid elements in cultured peripheral blood.

    Science.gov (United States)

    Miller, J L; Njoroge, J M; Gubin, A N; Rodgers, G P

    1999-04-01

    We have developed a prospective approach to identify the generation of erythroid cells derived from cultured peripheral blood mononuclear cells (PBMC) by monitoring the expression of the cell surface protein CD48. Unpurified populations of PBMC obtained from the buffy coats of normal volunteers were grown in suspension culture in the absence or presence of erythropoietin. A profile of surface CD48 expression permitted a flow cytometric identification of erythropoietin responsive populations at various stages of their maturation. In the absence of erythropoietin (EPO) supplemented media, the CD48- cells represented <5% of the total population of PBMC remaining in culture. In cultures supplemented with 1 U/mL EPO, the mean percentage of CD48- cells increased to 34.7 + 14.9% (p < 0.01) after 14 days in culture. Coordinated CD34 and CD71 (transferrin receptor) expression, morphology, gamma-globin transcription, and colony formation in methylcellulose were observed during the 14-day culture period. Flow cytometric monitoring of bulk cultured PBMC provides a simple and reliable means for the prospective or real-time study of human erythropoiesis.

  15. Genes encoded within 8q24 on the amplicon of a large extrachromosomal element are selectively repressed during the terminal differentiation of HL-60 cells.

    Science.gov (United States)

    Hirano, Tetsuo; Ike, Fumio; Murata, Takehide; Obata, Yuichi; Utiyama, Hiroyasu; Yokoyama, Kazunari K

    2008-04-02

    Human acute myeloblastic leukemia HL-60 cells become resistant to differentiation during long-term cultivation. After 150 passages, double minute chromosomes (dmins) found in early-passaged cells are replaced by large extrachromosomal elements (LEEs). In a DNA library derived from a purified fraction of LEEs, 12.6% (23/183) of clones were assigned to 8q24 and 9.2% (17/183) were assigned to 14q11 in the human genome. Fluorescence in situ hybridization (FISH) revealed a small aberrant chromosome, which had not been found in early-passaged cells, in addition to the purified LEEs. We determined that each LEE consisted of six discontinuous segments in a region that extended for 4.4Mb over the 8q24 locus. Five genes, namely, Myc (a proto-oncogene), NSMCE2 (for a SUMO ligase), CCDC26 (for a retinoic acid-dependent modulator of myeloid differentiation), TRIB1 (for a regulator of MAPK kinase) and LOC389637 (for a protein of unknown function), were encoded by the amplicon. Breaks in the chromosomal DNA within the amplicon were found in the NSMCE2 and CCDC26 genes. The discontinuous structure of the amplicon unit of the LEEs was identical with that of dmins in HL-60 early-passaged cells. The difference between them seemed, predominantly, to be the number (10-15 copies per LEE versus 2 or 3 copies per dmin) of constituent units. Expression of the Myc, NSMCE2, CCDC26 and LOC389637 and TRIB1 genes was constitutive in all lines of HL-60 cells and that of the first four genes was repressed during the terminal differentiation of early-passaged HL-60 cells. We also detected abnormal transcripts of CCDC26. Our results suggest that these genes were selected during the development of amplicons. They might be amplified and, sometimes, truncated to contribute to the maintenance of HL-60 cells in an undifferentiated state.

  16. CD8αα expression marks terminally differentiated human CD8+ T cells expanded in chronic viral infection

    Directory of Open Access Journals (Sweden)

    Lucy Jane Walker

    2013-08-01

    Full Text Available The T cell co-receptor CD8αβ enhances T cell sensitivity to antigen, however studies indicate CD8αα has the converse effect and acts as a co-repressor. Using a combination of Thymic Leukaemia antigen (TL tetramer, which directly binds CD8αα, anti-CD161 and anti-Vα7.2 antibodies we have been able for the first time to clearly define CD8αα expression on human CD8 T cells subsets. In healthy controls CD8αα is most highly expressed by CD161 bright (CD161++ mucosal associated invariant T (MAIT cells, with CD8αα expression highly restricted to the TCR Vα7.2+ cells of this subset. We also identified CD8αα-expressing populations within the CD161 mid (CD161+ and negative (CD161- non-MAIT CD8 T cell subsets and show TL-tetramer binding to correlate with expression of CD8β at low levels in the context of maintained CD8α expression (CD8α+CD8βlow. In addition, we found CD161-CD8α+CD8βlow populations to be significantly expanded in the peripheral blood of HIV-1 and hepatitis B (mean of 47% and 40% of CD161- T cells respectively infected individuals. Such CD8αα expressing T cells are an effector-memory population (CD45RA-, CCR7-, CD62L- that express markers of activation and maturation (HLA-DR+, CD28-, CD27-, CD57+ and are functionally distinct, expressing greater levels of TNF-α and IFN-γ on stimulation and perforin at rest than their CD8α+CD8βhigh counterparts. Antigen-specific T cells in HLA-B*4201+HIV-1 infected patients are found within both the CD161-CD8α+CD8βhigh and CD161-CD8α+CD8βlow populations. Overall we have clearly defined CD8αα expressing human T cell subsets using the TL-tetramer, and have demonstrated CD161-CD8α+CD8βlow populations, highly expanded in disease settings, to co-express CD8αβ and CD8αα. Co-expression of CD8αα on CD8αβ T cells may impact on their overall function in-vivo and contribute to the distinctive phenotype of highly differentiated populations in HBV and HIV-1 infection.

  17. Epidermal cell-shape regulation and subpopulation kinetics during butyrate-induced terminal maturation of normal and SV40-transformed human keratinocytes: epithelial models of differentiation therapy.

    Science.gov (United States)

    Staiano-Coico, L; Steinberg, M; Higgins, P J

    1990-10-15

    Recent data indicate that malignant human epidermal cells may be appropriate targets for sodium butyrate (NaB)-mediated differentiation therapy. The response of pre- and post-crisis populations of SV40-transformed human keratinocytes (SVKs) to this differentiation-inducing agent was assessed, therefore, within the framework of NaB-directed normal human keratinocyte (NHK) maturation. NaB augmented cornified envelope (CE) production in NHK and pre-crisis SVK cultures; the time-course and efficiency of induced maturation were similar in the 2 cell systems. In NHKs, the percentage of amplifying ("B" substate) cells decreased with time in NaB correlating with increases in both "C" stage keratinocytes and CEs. The latter formed over one or 2 layers of nucleated basal-like cells. Inductions were accompanied by immediate cell cycle blocks (in both the G1 and G2/M phases), reorganization within the actin cytoskeleton, and transient early increases in cellular actin content. Increased NHK and pre-crisis SVK cytoskeletal-associated actin reached a maximum approximately 48 hr after NaB addition and preceded development of CEs. The CE precursors, thus, probably reside in the "B" substate. Post-crisis SVKs, in contrast, were refractive to NaB-induced terminal maturation or cell-cycle perturbation, failed to initiate actin filament rearrangements, and retained a basal cell-like phenotype. Stable transformation of human SVKs in post-crisis phase, therefore, appears to be associated with loss of maturation "competence" within the "B" keratinocyte subpopulation.

  18. Acute erythroid neoplastic proliferations. A biological study based on 62 patients.

    Science.gov (United States)

    Domingo-Claros, Alicia; Larriba, Itziar; Rozman, Maruja; Irriguible, Dolors; Vallespí, Teresa; Aventin, Anna; Ayats, Ramon; Millá, Fuensanta; Solé, Francesc; Florensa, Lourdes; Gallart, Miquel; Tuset, Esperanza; Lopez, Carmen; Woessner, Soledad

    2002-02-01

    The terms acute erythroleukemia and AML-M6 are defined in the FAB classification as proliferations of dysplastic erythroid elements mixed with blasts of myeloid origin, but pure erythroid leukemias are not included. The recent WHO classification has a category of acute myeloid leukemia not otherwise categorized, which includes acute erythroid leukemia (M6) of two subtypes: M6a-erythroleukemia (erythroid/myeloid) and M6b-pure erythroid leukemia. The aims of this co-operative study were to discover the incidences of these different subtypes, and pay special attention to the morphology of these entities. We reviewed a series of 62 patients with erythroid neoplastic proliferations. Previous medical history, age, sex, peripheral blood and bone marrow cell counts, cytochemical stains, immunophenotype, and cytogenetics were evaluated at presentation. We analyzed the incidence of erythrocyte, leukocyte and platelet abnormalities in the peripheral blood. In bone marrow we analyzed dysplastic features of erythroblasts, granulocytic elements and the megakaryocytic lineage. Fifty-three patients met the criteria of M6a subtype of the WHO classification, and 2 were classified as having pure erythremia (M6b); 7 cases could not be classified according to the WHO criteria. Fifty-five patients presented with de novo acute leukemia, and seven patients had secondary acute leukemia. The most frequent dysplastic features in blood smears were: schistocytes, tear-drop and pincered cells in erythrocytes; hypogranulation and hyposegmentation in leukocytes; gigantism and hypogranulation in platelets. In bone marrow, megaloblastic changes, multinuclearity, karyorrhexis and basophilic stippling in erythroblasts; hypogranulation and gigantism in granulocytic series, and micromegakaryocytes and unconnected nuclei in megakarocytes were the most dysplastic features. A positive PAS reaction and increase of bone marrow iron with ring sideroblasts were common features. Trilineage dysplasia was

  19. A novel way to induce erythroid progenitor self renewal: cooperation of c-Kit with the erythropoietin receptor

    NARCIS (Netherlands)

    Wessely, O.; Bauer, A.; Quang, C. T.; Deiner, E. M.; von Lindern, M.; Mellitzer, G.; Steinlein, P.; Ghysdael, J.; Beug, H.

    1999-01-01

    Red blood cells are of vital importance for oxygen transport in vertebrates. Thus, their formation during development and homeostasis requires tight control of both progenitor proliferation and terminal red cell differentiation. Self renewal (i.e. long-term proliferation without differentiation) of

  20. A Rare Case of Pure Erythroid Sarcoma in a Pediatric Patient: Case Report and Literature Review

    Directory of Open Access Journals (Sweden)

    Pablo Manresa

    2017-12-01

    Full Text Available We describe an exceptional case of erythroid sarcoma in a pediatric patient as a growing orbital mass with no evidence of morphologic bone marrow involvement, who was finally diagnosed of pure erythroid sarcoma based on histopathology and flow cytometry criteria. We discuss the contribution of standardized eight-color flow cytometry as a rapid and reliable diagnostic method. The use of normal bone marrow databases allowed us to identify small aberrant populations in bone marrow and later confirm the diagnosis in the neoplastic tissue.

  1. THE EFFECTS OF IL-1 AND IL-4 ON THE EPO-INDEPENDENT ERYTHROID PROGENITOR IN POLYCYTHEMIA-VERA

    NARCIS (Netherlands)

    DEWOLF, JTM; HENDRIKS, DW; ESSELINK, MT; HALIE, MR; VELLENGA, E

    1994-01-01

    Human recombinant interleukin-1 (IL-1) was studied for its effects on the erythroid progenitors from normal subjects and from patients with polycythaemia vera (PV). No supportive effect of IL-1 was noticed on the normal, erythropoietin (Epo) dependent, erythroid burst-forming unit (BFU-E) using

  2. Fusion of ZMYND8 and RELA genes in acute erythroid leukemia

    DEFF Research Database (Denmark)

    Panagopoulos, Ioannis; Micci, Francesca; Thorsen, Jim

    2013-01-01

    Acute erythroid leukemia was diagnosed in a 4-month-old boy. Cytogenetic analysis of bone marrow (BM) cells showed a t(11;20)(p11;q11) translocation. RNA extracted from the BM was sequenced and analyzed for fusion transcripts using the software FusionMap. A ZMYND8-RELA fusion was ranked first. RT...

  3. Probing Conformational Stability and Dynamics of Erythroid and Nonerythroid Spectrin: Effects of Urea and Guanidine Hydrochloride

    Science.gov (United States)

    Patra, Malay; Mukhopadhyay, Chaitali; Chakrabarti, Abhijit

    2015-01-01

    We have studied the conformational stability of the two homologous membrane skeletal proteins, the erythroid and non-erythroid spectrins, in their dimeric and tetrameric forms respectively during unfolding in the presence of urea and guanidine hydrochloride (GuHCl). Fluorescence and circular dichroism (CD) spectroscopy have been used to study the changes of intrinsic tryptophan fluorescence, anisotropy, far UV-CD and extrinsic fluorescence of bound 1-anilinonapthalene-8-sulfonic acid (ANS). Chemical unfolding of both proteins were reversible and could be described as a two state transition. The folded erythroid spectrin and non-erythroid spectrin were directly converted to unfolded monomer without formation of any intermediate. Fluorescence quenching, anisotropy, ANS binding and dynamic light scattering data suggest that in presence of low concentrations of the denaturants (up-to 1M) hydrogen bonding network and van der Waals interaction play a role inducing changes in quaternary as well as tertiary structures without complete dissociation of the subunits. This is the first report of two large worm like, multi-domain proteins obeying twofold rule which is commonly found in small globular proteins. The free energy of stabilization (ΔGu H 2 0) for the dimeric spectrin has been 20 kcal/mol lesser than the tetrameric from. PMID:25617632

  4. Hematopoietic differentiation: a coordinated dynamical process towards attractor stable states

    Directory of Open Access Journals (Sweden)

    Rossi Simona

    2010-06-01

    Full Text Available Abstract Background The differentiation process, proceeding from stem cells towards the different committed cell types, can be considered as a trajectory towards an attractor of a dynamical process. This view, taking into consideration the transcriptome and miRNome dynamics considered as a whole, instead of looking at few 'master genes' driving the system, offers a novel perspective on this phenomenon. We investigated the 'differentiation trajectories' of the hematopoietic system considering a genome-wide scenario. Results We developed serum-free liquid suspension unilineage cultures of cord blood (CB CD34+ hematopoietic progenitor cells through erythroid (E, megakaryocytic (MK, granulocytic (G and monocytic (Mo pathways. These cultures recapitulate physiological hematopoiesis, allowing the analysis of almost pure unilineage precursors starting from initial differentiation of HPCs until terminal maturation. By analyzing the expression profile of protein coding genes and microRNAs in unilineage CB E, MK, G and Mo cultures, at sequential stages of differentiation and maturation, we observed a coordinated, fully interconnected and scalable character of cell population behaviour in both transcriptome and miRNome spaces reminiscent of an attractor-like dynamics. MiRNome and transcriptome space differed for a still not terminally committed behaviour of microRNAs. Conclusions Consistent with their roles, the transcriptome system can be considered as the state space of a cell population, while the continuously evolving miRNA space corresponds to the tuning system necessary to reach the attractor. The behaviour of miRNA machinery could be of great relevance not only for the promise of reversing the differentiated state but even for tumor biology.

  5. Hemopoietic regeneration in murine spleen following transfusion of normal and irradiated marrow: different response of granulocyte/macrophage and erythroid precursors

    International Nuclear Information System (INIS)

    Wangenheim, K.-H. von; Peterson, H.-P.; Huebner, G.E.; Feinendegen, L.E.

    1987-01-01

    To investigate cell proliferation in regenerating spleen, bone marrow of normal and gamma-irradiated donor mice (3 weeks after 5 Gy) was transfused into lethally irradiated recipients. In the donors and in the recipient spleens numbers of CFU-S and progenitor cells were determined. In the irradiated donors the progenitors were at control level after 3 weeks of recovery although CFU-S were still at 50% of control. Recipients of the irradiated marrow received therefore an increased proportion of progenitors. CFU-C appeared to be self-renewing and/or increased in number due to enhanced CFU-S differentiation, but not the erythroid progenitors. CFU-S self-renewal was reduced after 5 Gy. The data suggest that cell differentiation and maturation proceed during early splenic regeneration. The quantity of CFU-C does not necessarily mirror the situation in the stem cell compartment. (author)

  6. Differential cellulolytic activity of native-form and C-terminal tagged-form cellulase derived from coptotermes formosanus and expressed in E. coli

    Science.gov (United States)

    The endogenous cellulase gene (CfEG3a) of Coptotermes formosanus, an economically important pest termite, was cloned and overexpressed in both native form (nCfEG) and C-terminal His-tagged form (tCfEG) in E.coli. Both forms of recombinant cellulases showed hydrolytic activity on cellulosic substrate...

  7. Increased numbers of pre-existing memory CD8 T cells and decreased T-bet expression can restrain terminal differentiation of secondary effector and memory CD8 T cells1

    Science.gov (United States)

    Joshi, Nikhil S.; Cui, Weiguo; Dominguez, Claudia; Chen, Jonathan H.; Hand, Timothy W.; Kaech, Susan M.

    2011-01-01

    Memory CD8 T cells acquire TEM properties following reinfection, and may reach terminally differentiated, senescent states (“Hayflick limit”) after multiple infections. The signals controlling this process are not well understood, but we found that the degree of 2o effector and memory CD8 T cell differentiation was intimately linked to the amount of T-bet expressed upon reactivation and pre-existing memory CD8 T cell number (i.e., 1o memory CD8 T cell precursor frequency) present during secondary infection. Compared to naïve cells, memory CD8 T cells were predisposed towards terminal effector (TE) cell differentiation because they could immediately respond to IL-12 and induce T-bet, even in the absence of antigen. TE cell formation following 2o or 3o infections was dependent on increased T-bet expression because T-bet+/− cells were resistant to these phenotypic changes. Larger numbers of pre-existing memory CD8 T cells limited the duration of 2o infection and the amount of IL-12 produced, and consequently, this reduced T-bet expression and the proportion of 2o TE CD8 T cells that formed. Together, these data show that, over repeated infections, memory CD8 T cell quality and proliferative fitness is not strictly determined by the number of serial encounters with antigen or cell divisions, but is a function of the CD8 T cell differentiation state, which is genetically controlled in a T-bet-dependent manner. This differentiation state can be modulated by pre-existing memory CD8 T cell number and the intensity of inflammation during reinfection. These results have important implications for vaccinations involving prime-boost strategies. PMID:21930973

  8. Dexamethasone targeted directly to macrophages induces macrophage niches that promote erythroid expansion

    DEFF Research Database (Denmark)

    Falchi, Mario; Varricchio, Lilian; Martelli, Fabrizio

    2015-01-01

    Cultures of human CD34(pos) cells stimulated with erythroid growth factors plus dexamethasone, a model for stress erythropoiesis, generate numerous erythroid cells plus a few macrophages (approx. 3%; 3:1 positive and negative for CD169). Interactions occurring between erythroblasts and macrophages...... in these cultures and the biological effects associated with these interactions were documented by live phase-contrast videomicroscopy. Macrophages expressed high motility interacting with hundreds/thousands of erythroblasts per hour. CD169(pos) macrophages established multiple rapid 'loose' interactions...... with proerythroblasts leading to formation of transient erythroblastic island-like structures. By contrast, CD169(neg) macrophages established 'tight' interactions with mature erythroblasts and phagocytosed these cells. 'Loose' interactions of CD169(pos) macrophages were associated with proerythroblast cytokinesis (the...

  9. Eto2/MTG16 and MTGR1 are heteromeric corepressors of the TAL1/SCL transcription factor in murine erythroid progenitors

    Energy Technology Data Exchange (ETDEWEB)

    Cai, Ying; Xu, Zhixiong; Xie, Jingping [Department of Medicine, Vanderbilt University Medical Center, Nashville, TN 37232 (United States); Ham, Amy-Joan L. [Department of Biochemistry, Vanderbilt University Medical Center, Nashville, TN 37232 (United States); Koury, Mark J. [Department of Medicine, Vanderbilt University Medical Center, Nashville, TN 37232 (United States); Tennessee Valley VA Healthcare System, Nashville, TN 37212 (United States); Hiebert, Scott W. [Department of Biochemistry, Vanderbilt University Medical Center, Nashville, TN 37232 (United States); Vanderbilt-Ingram Cancer Center, Vanderbilt University Medical Center, Nashville, TN 37232 (United States); Brandt, Stephen J., E-mail: stephen.brandt@vanderbilt.edu [Department of Medicine, Vanderbilt University Medical Center, Nashville, TN 37232 (United States); Department of Cell and Developmental Biology, Vanderbilt University Medical Center, Nashville, TN 37232 (United States); Department of Cancer Biology, Vanderbilt University Medical Center, Nashville, TN 37232 (United States); Vanderbilt-Ingram Cancer Center, Vanderbilt University Medical Center, Nashville, TN 37232 (United States); Tennessee Valley VA Healthcare System, Nashville, TN 37212 (United States)

    2009-12-11

    The TAL1 (or SCL) gene, originally discovered through its involvement by a chromosomal translocation in T-cell acute lymphoblastic leukemia, encodes a basic helix-loop-helix (bHLH) transcription factor essential for hematopoietic and vascular development. To identify its interaction partners, we expressed a tandem epitope-tagged protein in murine erythroleukemia (MEL) cells and characterized affinity-purified Tal1-containing complexes by liquid chromatography-tandem mass spectrometry analysis. In addition to known interacting proteins, two proteins related to the Eight-Twenty-One (ETO) corepressor, Eto2/Mtg16 and Mtgr1, were identified from the peptide fragments analyzed. Tal1 interaction with Eto2 and Mtgr1 was verified by coimmunoprecipitation analysis in Tal1, Eto2-, and Mtgr1-transfected COS-7 cells, MEL cells expressing V5 epitope-tagged Tal1 protein, and non-transfected MEL cells. Mapping analysis with Gal4 fusion proteins demonstrated a requirement for the bHLH domain of Tal1 and TAF110 domain of Eto2 for their interaction, and transient transfection and glutathione S-transferase pull-down analysis showed that Mtgr1 and Eto2 enhanced the other's association with Tal1. Enforced expression of Eto2 in differentiating MEL cells inhibited the promoter of the Protein 4.2 (P4.2) gene, a direct target of TAL1 in erythroid progenitors, and transduction of Eto2 and Mtgr1 augmented Tal1-mediated gene repression. Finally, chromatin immunoprecipitation analysis revealed that Eto2 occupancy of the P4.2 promoter in MEL cells decreased with differentiation, in parallel with a decline in Eto2 protein abundance. These results identify Eto2 and Mtgr1 as authentic interaction partners of Tal1 and suggest they act as heteromeric corepressors of this bHLH transcription factor during erythroid differentiation.

  10. Eto2/MTG16 and MTGR1 are heteromeric corepressors of the TAL1/SCL transcription factor in murine erythroid progenitors

    International Nuclear Information System (INIS)

    Cai, Ying; Xu, Zhixiong; Xie, Jingping; Ham, Amy-Joan L.; Koury, Mark J.; Hiebert, Scott W.; Brandt, Stephen J.

    2009-01-01

    The TAL1 (or SCL) gene, originally discovered through its involvement by a chromosomal translocation in T-cell acute lymphoblastic leukemia, encodes a basic helix-loop-helix (bHLH) transcription factor essential for hematopoietic and vascular development. To identify its interaction partners, we expressed a tandem epitope-tagged protein in murine erythroleukemia (MEL) cells and characterized affinity-purified Tal1-containing complexes by liquid chromatography-tandem mass spectrometry analysis. In addition to known interacting proteins, two proteins related to the Eight-Twenty-One (ETO) corepressor, Eto2/Mtg16 and Mtgr1, were identified from the peptide fragments analyzed. Tal1 interaction with Eto2 and Mtgr1 was verified by coimmunoprecipitation analysis in Tal1, Eto2-, and Mtgr1-transfected COS-7 cells, MEL cells expressing V5 epitope-tagged Tal1 protein, and non-transfected MEL cells. Mapping analysis with Gal4 fusion proteins demonstrated a requirement for the bHLH domain of Tal1 and TAF110 domain of Eto2 for their interaction, and transient transfection and glutathione S-transferase pull-down analysis showed that Mtgr1 and Eto2 enhanced the other's association with Tal1. Enforced expression of Eto2 in differentiating MEL cells inhibited the promoter of the Protein 4.2 (P4.2) gene, a direct target of TAL1 in erythroid progenitors, and transduction of Eto2 and Mtgr1 augmented Tal1-mediated gene repression. Finally, chromatin immunoprecipitation analysis revealed that Eto2 occupancy of the P4.2 promoter in MEL cells decreased with differentiation, in parallel with a decline in Eto2 protein abundance. These results identify Eto2 and Mtgr1 as authentic interaction partners of Tal1 and suggest they act as heteromeric corepressors of this bHLH transcription factor during erythroid differentiation.

  11. Non-erythroid alpha spectrin prevents telomere dysfunction after DNA interstrand cross-link damage

    OpenAIRE

    Zhang, Pan; Herbig, Utz; Coffman, Frederick; Lambert, Muriel W.

    2013-01-01

    Telomere integrity is critical for telomere function and genomic stability. We previously demonstrated that non-erythroid ?-spectrin (?IISp) is present in mammalian cell nuclei where it is important in repair of DNA interstrand cross-links (ICLs) and chromosome stability. We now demonstrate that ?IISp is also important for telomere maintenance after ICL damage. It localizes to telomeres in S phase after ICL damage where it has enhanced association with TRF1 and TRF2 and is required for recrui...

  12. Determination of the state of operating mechanical stresses acting on surface piping with problems of differential collapses in the Venta de Carpio Terminal; Determinacion del estado de esfuerzos mecanicos actuantes en tuberias superficiales con problemas de hundimientos diferenciales en la Terminal Venta de Carpio

    Energy Technology Data Exchange (ETDEWEB)

    Neri B, Ernesto R; Garcia E, Nairoby [Instituto de Investigaciones Electricas, Cuernavaca, Morelos (Mexico)

    2004-07-01

    The Venta de Carpio Terminal is located in the Northern part of the old Texcoco Lake, State of Mexico, in highly compressible soil. In it, it is received, regulated, measured and distributed natural gas, LP gas and PEMEX Refinacion products that are supplied to distribution terminals of and consumption centers located in the central area of the country, that encompasses the states of Puebla, Tlaxcala, Mexico, Hidalgo, Queretaro and a small part of the Federal District. The construction of the Venta de Carpio station dates from 1960; since then, it has presented important regional settlements, mainly due to the water extraction of the subsoil, that have imposed deformations to the piping systems connected to the surface facilities that have been piloted in the terminal. Equally, other surface piping systems and facilities present deformations by differential settlement between their supports. [Spanish] La Terminal Venta de Carpio se ubica en la parte norte del antiguo Lago de Texcoco, Estado de Mexico, en terreno altamente compresible. En ella, se recibe, regula, mide y distribuye gas natural, gas LP y productos de Pemex Refinacion que se suministran a terminales de distribucion y centros de consumo localizados en el area central del pais, que comprende los estados de Puebla, Tlaxcala, Mexico, Hidalgo, Queretaro y una pequena parte del Distrito Federal. La construccion de la estacion Venta de Carpio data de 1960; desde entonces, se han presentado asentamientos regionales importantes debidos, principalmente a la extraccion de agua del subsuelo, que han impuesto deformaciones a los sistemas de tuberias conectados con las instalaciones superficiales que han sido piloteadas en la terminal. De igual modo, otros sistemas de tuberias e instalaciones superficiales presentan deformaciones por hundimientos diferenciales entre sus apoyos.

  13. Polyherbal EMSA ERITIN Promotes Erythroid Lineages and Lymphocyte Migration in Irradiated Mice

    Directory of Open Access Journals (Sweden)

    Ibrahim Mansur

    2016-01-01

    Full Text Available Radiotherapy is commonly used to kill malignant cells, but it can significantly deplete hematopoietic and splenic erythroblasts. Radioprotective agents are therefore very important in clinical radiotherapy. We examined the effect of poly-herbal EMSA ERITIN on immunological responses when administered to sublethally irradiated mice with the aim of highlighting promotes erythroid lineages and lymphocytes migration in irradiated mice with the parameter are TER119+CD123+in bone marrow and SDF-1 in bone marrow and spleen organ. Normal BALB/c mice were sublethally irradiated with 600 rad. EMSA ERITIN was administered orally at different doses:(1.04, 3.125 and 9.375 mg/g body weight for 15 days. On day 16 erythroid lineages (TER-119+CD123+ were observed in bone marrow and lymphocytes migration by the production of SDF-1 in spleen and bone marrow. Lymphocytes migration was indicated by the production of SDF-1 in spleen and bone marrow using flow cytometry analysis. EMSA ERITIN increased the generation of erythroid lineage cells marked by TER119+CD123+ and promoted lymphocyte migration by increasing SDF-1 production in bone marrow and spleen. EMSA ERITIN appears to be a powerful medicinal herb with potential as a food supplement to normalize homeostasis and erythropoiesis after radiation.

  14. DJ-1 Modulates Nuclear Erythroid 2-Related Factor-2-Mediated Protection in Human Primary Alveolar Type II Cells in Smokers.

    Science.gov (United States)

    Bahmed, Karim; Messier, Elise M; Zhou, Wenbo; Tuder, Rubin M; Freed, Curt R; Chu, Hong Wei; Kelsen, Steven G; Bowler, Russell P; Mason, Robert J; Kosmider, Beata

    2016-09-01

    Cigarette smoke (CS) is a main source of oxidative stress and a key risk factor for emphysema, which consists of alveolar wall destruction. Alveolar type (AT) II cells are in the gas exchange regions of the lung. We isolated primary ATII cells from deidentified organ donors whose lungs were not suitable for transplantation. We analyzed the cell injury obtained from nonsmokers, moderate smokers, and heavy smokers. DJ-1 protects cells from oxidative stress and induces nuclear erythroid 2-related factor-2 (Nrf2) expression, which activates the antioxidant defense system. In ATII cells isolated from moderate smokers, we found DJ-1 expression by RT-PCR, and Nrf2 and heme oxygenase (HO)-1 translocation by Western blotting and immunocytofluorescence. In ATII cells isolated from heavy smokers, we detected Nrf2 and HO-1 cytoplasmic localization. Moreover, we found high oxidative stress, as detected by 4-hydroxynonenal (4-HNE) (immunoblotting), inflammation by IL-8 and IL-6 levels by ELISA, and apoptosis by terminal deoxynucleotidyl transferase dUTP nick end labeling (TUNEL) assay in ATII cells obtained from heavy smokers. Furthermore, we detected early DJ-1 and late Nrf2 expression after ATII cell treatment with CS extract. We also overexpressed DJ-1 by adenovirus construct and found that this restored Nrf2 and HO-1 expression and induced nuclear translocation in heavy smokers. Moreover, DJ-1 overexpression also decreased ATII cell apoptosis caused by CS extract in vitro. Our results indicate that DJ-1 activates the Nrf2-mediated antioxidant defense system. Furthermore, DJ-1 overexpression can restore the impaired Nrf2 pathway, leading to ATII cell protection in heavy smokers. This suggests a potential therapeutic strategy for targeting DJ-1 in CS-related lung diseases.

  15. The negative impact of Wnt signaling on megakaryocyte and primitive erythroid progenitors derived from human embryonic stem cells

    Directory of Open Access Journals (Sweden)

    Prasuna Paluru

    2014-03-01

    Full Text Available The Wnt gene family consists of structurally related genes encoding secreted signaling molecules that have been implicated in many developmental processes, including regulation of cell fate and patterning during embryogenesis. Previously, we found that Wnt signaling is required for primitive or yolk sac-derived-erythropoiesis using the murine embryonic stem cell (ESC system. Here, we examine the effect of Wnt signaling on the formation of early hematopoietic progenitors derived from human ESCs. The first hematopoietic progenitor cells in the human ESC system express the pan-hematopoietic marker CD41 and the erythrocyte marker, glycophorin A or CD235. We have developed a novel serum-free, feeder-free, adherent differentiation system that can efficiently generate large numbers of CD41 + CD235+ cells. We demonstrate that this cell population contains progenitors not just for primitive erythroid and megakaryocyte cells but for the myeloid lineage as well and term this population the primitive common myeloid progenitor (CMP. Treatment of mesoderm-specified cells with Wnt3a led to a loss of hematopoietic colony-forming ability while the inhibition of canonical Wnt signaling with DKK1 led to an increase in the number of primitive CMPs. Canonical Wnt signaling also inhibits the expansion and/or survival of primitive erythrocytes and megakaryocytes, but not myeloid cells, derived from this progenitor population. These findings are in contrast to the role of Wnt signaling during mouse ESC differentiation and demonstrate the importance of the human ESC system in studying species-specific differences in development.

  16. Production of β-globin and adult hemoglobin following G418 treatment of erythroid precursor cells from homozygous β039 thalassemia patients

    Science.gov (United States)

    Salvatori, Francesca; Breveglieri, Giulia; Zuccato, Cristina; Finotti, Alessia; Bianchi, Nicoletta; Borgatti, Monica; Feriotto, Giordana; Destro, Federica; Canella, Alessandro; Brognara, Eleonora; Lampronti, Ilaria; Breda, Laura; Rivella, Stefano; Gambari, Roberto

    2013-01-01

    In several types of thalassemia (including β039-thalassemia), stop codon mutations lead to premature translation termination and to mRNA destabilization through nonsense-mediated decay. Drugs (for instance aminoglycosides) can be designed to suppress premature termination, inducing a ribosomal readthrough. These findings have introduced new hopes for the development of a pharmacologic approach to the cure of this disease. However, the effects of aminoglycosides on globin mRNA carrying β-thalassemia stop mutations have not yet been investigated. In this study, we have used a lentiviral construct containing the β039- thalassemia globin gene under control of the β-globin promoter and a LCR cassette. We demonstrated by fluorescence-activated cell sorting (FACS) analysis the production of β-globin by K562 cell clones expressing the β039-thalassemia globin gene and treated with G418. More importantly, after FACS and high-performance liquid chromatography (HPLC) analyses, erythroid precursor cells from β039-thalassemia patients were demonstrated to be able to produce β-globin and adult hemoglobin after treatment with G418. This study strongly suggests that ribosomal readthrough should be considered a strategy for developing experimental strategies for the treatment of β0-thalassemia caused by stop codon mutations. PMID:19810011

  17. Terminal Ballistics

    CERN Document Server

    Rosenberg, Zvi

    2012-01-01

    This book covers the important issues of terminal ballistics in a comprehensive way combining experimental data, numerical simulations and analytical modeling. The first chapter reviews the experimental equipment which are used for ballistic tests and the diagnostics for material characterization under impulsive loading conditions. The second chapter covers essential features of the codes which are used for terminal ballistics such as the Euler vs. Lagrange schemes and meshing techniques, as well as the most popular material models. The third chapter, devoted to the penetration mechanics of rigid penetrators, brings the update of modeling in this field. The fourth chapter deals with plate perforation and the fifth chapter deals with the penetration mechanics of shaped charge jets and eroding long rods. The last two chapters discuss several techniques for the disruption and defeating of the main threats in armor design. Throughout the book the authors demonstrate the advantages of numerical simulations in unde...

  18. Terminal structure

    Science.gov (United States)

    Schmidt, Frank [Langenhagen, DE; Allais, Arnaud [Hannover, DE; Mirebeau, Pierre [Villebon sur Yvette, FR; Ganhungu, Francois [Vieux-Reng, FR; Lallouet, Nicolas [Saint Martin Boulogne, FR

    2009-10-20

    A terminal structure (2) for a superconducting cable (1) is described. It consists of a conductor (2a) and an insulator (2b) that surrounds the conductor (2a), wherein the superconducting cable (1) has a core with a superconducting conductor (5) and a layer of insulation that surrounds the conductor (5), and wherein the core is arranged in such a way that it can move longitudinally in a cryostat. The conductor (2a) of the terminal structure (2) is electrically connected with the superconducting conductor (5) or with a normal conductor (6) that is connected with the superconducting conductor (5) by means of a tubular part (7) made of an electrically conductive material, wherein the superconducting conductor (5) or the normal conductor (6) can slide in the part (7) in the direction of the superconductor.

  19. Lysophospholipid Receptors Are Differentially Expressed in Rat Terminal Schwann Cells, As Revealed by a Single Cell RT-PCR and In Situ Hybridization

    International Nuclear Information System (INIS)

    Kobashi, Hiroaki; Yaoi, Takeshi; Oda, Ryo; Okajima, Seiichiro; Fujiwara, Hiroyoshi; Kubo, Toshikazu; Fushiki, Shinji

    2006-01-01

    Terminal Schwann cells (TSCs) that cover motor neuron terminals, are known to play an important role in maintaining neuromuscular junctions, as well as in the repair process after nerve injury. However, the molecular characteristics of TSCs remain unknown, because of the difficulties in analyzing them due to their paucity. By using our previously reported method of selectively and efficiently collecting TSCs, we have analyzed the difference in expression patterns of lysophospholipid (LPL) receptor genes (LPA 1 , LPA 2 , LPA 3 , S1P 1 , S1P 2 , S1P 3 , S1P 4 , and S1P 5 ) between TSCs and myelinating Schwann cells (MSCs). LPL, which includes lysophosphatidic acid (LPA) and sphingosine 1-phosphate (S1P), is the bioactive lipid that induces a myriad of cellular responses through specific members of G-protein coupled receptors for LPA. It turned out that LPA 3 was expressed only in TSCs, whereas S1P 1 was expressed in TSCs and skeletal muscle, but not in MSCs. Other types of LPL receptor genes, including LPA 1 , S1P 2 , S1P 3 , S1P 4 , were expressed in both types of Schwann cells. None of the LPL receptor gene family showed MSCs-specific expression

  20. Termination unit

    Energy Technology Data Exchange (ETDEWEB)

    Traeholt, Chresten; Willen, Dag; Roden, Mark; Tolbert, Jerry C.; Lindsay, David; Fisher, Paul W.; Nielsen, Carsten Thidemann

    2016-05-03

    Cable end section comprises end-parts of N electrical phases/neutral, and a thermally-insulation envelope comprising cooling fluid. The end-parts each comprises a conductor and are arranged with phase 1 innermost, N outermost surrounded by the neutral, electrical insulation being between phases and N and neutral. The end-parts comprise contacting surfaces located sequentially along the longitudinal extension of the end-section. A termination unit has an insulating envelope connected to a cryostat, special parts at both ends comprising an adapter piece at the cable interface and a closing end-piece terminating the envelope in the end-section. The special parts houses an inlet and/or outlet for cooling fluid. The space between an inner wall of the envelope and a central opening of the cable is filled with cooling fluid. The special part at the end connecting to the cryostat houses an inlet or outlet, splitting cooling flow into cable annular flow and termination annular flow.

  1. Generation of erythroid cells from polyploid giant cancer cells: re-thinking about tumor blood supply.

    Science.gov (United States)

    Yang, Zhigang; Yao, Hong; Fei, Fei; Li, Yuwei; Qu, Jie; Li, Chunyuan; Zhang, Shiwu

    2018-04-01

    During development and tumor progression, cells need a sufficient blood supply to maintain development and rapid growth. It is reported that there are three patterns of blood supply for tumor growth: endothelium-dependent vessels, mosaic vessels, and vasculogenic mimicry (VM). VM was first reported in highly aggressive uveal melanomas, with tumor cells mimicking the presence and function of endothelial cells forming the walls of VM vessels. The walls of mosaic vessels are randomly lined with both endothelial cells and tumor cells. We previously proposed a three-stage process, beginning with VM, progressing to mosaic vessels, and eventually leading to endothelium-dependent vessels. However, many phenomena unique to VM channel formation remain to be elucidated, such as the origin of erythrocytes before VM vessels connect with endothelium-dependent vessels. In adults, erythroid cells are generally believed to be generated from hematopoietic stem cells in the bone marrow. In contrast, embryonic tissue obtains oxygen through formation of blood islands, which are largely composed of embryonic hemoglobin with a higher affinity with oxygen, in the absence of mature erythrocytes. Recent data from our laboratory suggest that embryonic blood-forming mechanisms also exist in cancer tissue, particularly when these tissues are under environmental stress such as hypoxia. We review the evidence from induced pluripotent stem cells in vitro and in vivo to support this previously underappreciated cell functionality in normal and cancer cells, including the ability to generate erythroid cells. We will also summarize the current understanding of tumor angiogenesis, VM, and our recent work on polyploid giant cancer cells, with emphasis on their ability to generate erythroid cells and their association with tumor growth under hypoxia. An alternative embryonic pathway to obtain oxygen in cancer cells exists, particularly when they are under hypoxic conditions.

  2. Gamma-interferon alters globin gene expression in neonatal and adult erythroid cells

    International Nuclear Information System (INIS)

    Miller, B.A.; Perrine, S.P.; Antognetti, G.; Perlmutter, D.H.; Emerson, S.G.; Sieff, C.; Faller, D.V.

    1987-01-01

    The effect of gamma-interferon on fetal hemoglobin synthesis by purified cord blood, fetal liver, and adult bone marrow erythroid progenitors was studied with a radioligand assay to measure hemoglobin production by BFU-E-derived erythroblasts. Coculture with recombinant gamma-interferon resulted in a significant and dose-dependent decrease in fetal hemoglobin production by neonatal and adult, but not fetal, BFU-E-derived erythroblasts. Accumulation of fetal hemoglobin by cord blood BFU-E-derived erythroblasts decreased up to 38.1% of control cultures (erythropoietin only). Synthesis of both G gamma/A gamma globin was decreased, since the G gamma/A gamma ratio was unchanged. Picograms fetal hemoglobin per cell was decreased by gamma-interferon addition, but picograms total hemoglobin was unchanged, demonstrating that a reciprocal increase in beta-globin production occurred in cultures treated with gamma-interferon. No toxic effect of gamma-interferon on colony growth was noted. The addition of gamma-interferon to cultures resulted in a decrease in the percentage of HbF produced by adult BFU-E-derived cells to 45.6% of control. Fetal hemoglobin production by cord blood, fetal liver, and adult bone marrow erythroid progenitors, was not significantly affected by the addition of recombinant GM-CSF, recombinant interleukin 1 (IL-1), recombinant IL-2, or recombinant alpha-interferon. Although fetal progenitor cells appear unable to alter their fetal hemoglobin program in response to any of the growth factors added here, the interaction of neonatal and adult erythroid progenitors with gamma-interferon results in an altered expression of globin genes

  3. Iron overload promotes erythroid apoptosis through regulating HIF-1a/ROS signaling pathway in patients with myelodysplastic syndrome.

    Science.gov (United States)

    Zheng, Qing-Qing; Zhao, You-Shan; Guo, Juan; Zhao, Si-da; Song, Lu-Xi; Fei, Cheng-Ming; Zhang, Zheng; Li, Xiao; Chang, Chun-Kang

    2017-07-01

    Erythroid apoptosis increases significantly in myelodysplastic syndrome (MDS) patients with iron overload, but the underlying mechanism is not fully clear. In this study, we aim to explore the effect of HIF-1a/ROS on erythroid apoptosis in MDS patients with iron overload. We found that iron overload injured cellular functions through up-regulating ROS levels in MDS/AML cells, including inhibited cell viability, increased cell apoptosis and blocked cell cycle at G0/G1 phase. Interestingly, overexpression of hypoxia inducible factor-1a (HIF-1a), which was under-expressed in iron overload models, reduced ROS levels and attenuated cell damage caused by iron overload in MDS/AML cells. And gene knockdown of HIF-1a got the similar results as iron overload in MDS/AML cells. Furthermore, iron overload caused high erythroid apoptosis was closely related with ROS in MDS patients. Importantly, the HIF-1a protein levels of erythrocytes elevated obviously after incubation with desferrioxamine (DFO) from MDS patients with iron overload, accompanied by ROS levels inhibited and erythroid apoptosis reduced. Taken together, our findings determine that the HIF-1a/ROS signaling pathway plays a key role in promoting erythroid apoptosis in MDS patients with iron overload. Copyright © 2017 Elsevier Ltd. All rights reserved.

  4. PRV-1, erythroid colonies and platelet Mpl are unrelated to thrombosis in essential thrombocythaemia

    DEFF Research Database (Denmark)

    Vannucchi, Alessandro M; Pancrazzi, Alessandro; Antonioli, Elisabetta

    2004-01-01

    markers of ET, namely PRV-1 overexpression, endogenous erythroid colony (EEC) formation, and reduced platelet Mpl content. Fifty-three (60%) of 88 subjects studied had monoclonal myelopoiesis and presented a 32% incidence of major thrombosis compared with 6% of polyclonal subjects (P = 0.......009). The frequency of abnormalities of PRV-1, EEC, or Mpl was similar in monoclonal and polyclonal subjects (respectively, 28%, 48%, 75%, and 37%, 27%, 63%), and none of them correlated with thrombosis. We conclude that the exploited epigenetic markers constitute independent phenotypic variations...

  5. Analysis of the differentially expressed low molecular weight peptides in human serum via an N-terminal isotope labeling technique combining nano-liquid chromatography/matrix-assisted laser desorption/ionization mass spectrometry.

    Science.gov (United States)

    Leng, Jiapeng; Zhu, Dong; Wu, Duojiao; Zhu, Tongyu; Zhao, Ningwei; Guo, Yinlong

    2012-11-15

    Peptidomics analysis of human serum is challenging due to the low abundance of serum peptides and interference from the complex matrix. This study analyzed the differentially expressed (DE) low molecular weight peptides in human serum integrating a DMPITC-based N-terminal isotope labeling technique with nano-liquid chromatography and matrix-assisted laser desorption/ionization mass spectrometry (nano-LC/MALDI-MS). The workflow introduced a [d(6)]-4,6-dimethoxypyrimidine-2-isothiocyanate (DMPITC)-labeled mixture of aliquots from test samples as the internal standard. The spiked [d(0)]-DMPITC-labeled samples were separated by nano-LC then spotted on the MALDI target. Both quantitative and qualitative studies for serum peptides were achieved based on the isotope-labeled peaks. The DMPITC labeling technique combined with nano-LC/MALDI-MS not only minimized the errors in peptide quantitation, but also allowed convenient recognition of the labeled peptides due to the 6 Da mass difference. The data showed that the entire research procedure as well as the subsequent data analysis method were effective, reproducible, and sensitive for the analysis of DE serum peptides. This study successfully established a research model for DE serum peptides using DMPITC-based N-terminal isotope labeling and nano-LC/MALDI-MS. Application of the DMPITC-based N-terminal labeling technique is expected to provide a promising tool for the investigation of peptides in vivo, especially for the analysis of DE peptides under different biological conditions. Copyright © 2012 John Wiley & Sons, Ltd.

  6. Erythroid cells in vitro: from developmental biology to blood transfusion products.

    Science.gov (United States)

    Migliaccio, Anna Rita; Whitsett, Carolyn; Migliaccio, Giovanni

    2009-07-01

    Red blood cells (RBCs) transfusion plays a critical role in numerous therapies. Disruption of blood collection by political unrest, natural disasters and emerging infections and implementation of restrictions on the use of erythropoiesis-stimulating agents in cancer may impact blood availability in the near future. These considerations highlight the importance of developing alternative blood products. Knowledge about the processes that control RBC production has been applied to the establishment of culture conditions allowing ex-vivo generation of RBCs in numbers close to those (2.5 x 10 cells/ml) present in a transfusion, from cord blood, donated blood units or embryonic stem cells. In addition, experimental studies demonstrate that such cells protect mice from lethal bleeding. Therefore, erythroid cells generated ex vivo may be suitable for transfusion provided they can be produced safely in adequate numbers. However, much remains to be done to translate a theoretical production of approximately 2.5 x 10 RBCs in the laboratory into a 'clinical grade production process'. This review summarizes the state-of-the-art in establishing ex-vivo culture conditions for erythroid cells and discusses the most compelling issues to be addressed to translate this progress into a clinical grade transfusion product.

  7. Characterization of human erythroid burst-promoting activity derived from bone marrow conditioned media

    International Nuclear Information System (INIS)

    Porter, P.N.; Ogawa, M.

    1982-01-01

    Bone marrow conditioned media (BMCM) increases burst number and the incorporation of 59 Fe into heme by bursts when peripheral blood or bone marrow cells are cultured at limiting serum concentrations. Burst-promoting activity (BPA) has now been purified approximately 300-fold from this source by ion-exchange chromatography on DEAE-Sephadex and absorption chromatography on hydroxyapatite agarose gel. Marrow BPA increased burst number and hemoglobin (Hb) synthesis in a dose-dependent manner. A larger increase in Hb synthesis than in burst number was consistently observed, which was probably a consequence of the increase in the number of cells per burst that occurs in the presence of BPA. The role of BPA in culture could be distinguished from erythropoietin (Ep), since no bursts grew in the absence of Ep, whether or not BPA was present, and since it had no effect on the growth of erythroid colonies scored at day 5 of culture. Our purified fraction did not support the growth of CFU-C in culture. Activity was stable at temperatures of 70 degrees C or lower for 10 min; exposure to 80 degrees C resulted in approximately 50% loss of activity. BPA was completely inactivated by treatment at 100 degrees C for 10 min. Thus, human bone marrow cells produce a heat-sensitive factor that specifically promotes the growth of early erythroid progenitors in culture

  8. Enhanced inhibition of parvovirus B19 replication by cidofovir in extendedly exposed erythroid progenitor cells.

    Science.gov (United States)

    Bonvicini, Francesca; Bua, Gloria; Manaresi, Elisabetta; Gallinella, Giorgio

    2016-07-15

    Human parvovirus B19 (B19V) commonly induces self-limiting infections but can also cause severe clinical manifestations in patients with underlying haematological disorders or with immune system deficits. Currently, therapeutic options for B19V entirely rely on symptomatic and supportive treatments since a specific antiviral therapy is not yet available. Recently a first step in the research for active compounds inhibiting B19V replication has allowed identifying the acyclic nucleoside phosphonate cidofovir (CDV). Herein, the effect of CDV against B19V replication was characterized in human erythroid progenitor cells (EPCs) cultured and infected following different experimental approaches to replicate in vitro the infection of an expanding erythroid cell population in the bone marrow. B19V replication was selectively inhibited both in infected EPCs extendedly exposed to CDV 500μM (viral inhibition 82%) and in serially infected EPCs cultures with passage of the virus progeny, constantly under drug exposure (viral inhibition 99%). In addition, a potent inhibitory effect against B19V (viral inhibition 92%) was assessed in a short-term infection of EPCs treated with CDV 500μM 1day before viral infection. In the evaluated experimental conditions, the enhanced effect of CDV against B19V might be ascribed both to the increased intracellular drug concentration achieved by extended exposure, and to a progressive reduction in efficiency of the replicative process within treated EPCs population. Copyright © 2016 Elsevier B.V. All rights reserved.

  9. Parvovirus B19 integration into human CD36+ erythroid progenitor cells.

    Science.gov (United States)

    Janovitz, Tyler; Wong, Susan; Young, Neal S; Oliveira, Thiago; Falck-Pedersen, Erik

    2017-11-01

    The pathogenic autonomous human parvovirus B19 (B19V) productively infects erythroid progenitor cells (EPCs). Functional similarities between B19V nonstructural protein (NS1), a DNA binding endonuclease, and the Rep proteins of Adeno-Associated Virus (AAV) led us to hypothesize that NS1 may facilitate targeted nicking of the human genome and B19 vDNA integration. We adapted an integration capture sequencing protocol (IC-Seq) to screen B19V infected human CD36+ EPCs for viral integrants, and discovered 40,000 unique B19V integration events distributed throughout the human genome. Computational analysis of integration patterns revealed strong correlations with gene intronic regions, H3K9me3 sites, and the identification of 41 base pair consensus sequence with an octanucleotide core motif. The octanucleotide core has homology to a single region of B19V, adjacent to the P6 promoter TATA box. We present the first direct evidence that B19V infection of erythroid progenitor cells disrupts the human genome and facilitates viral DNA integration. Copyright © 2017 Elsevier Inc. All rights reserved.

  10. Genes encoded within 8q24 on the amplicon of a large extrachromosomal element are selectively repressed during the terminal differentiation of HL-60 cells

    OpenAIRE

    Hirano, Tetsuo; Ike, Fumio; Murata, Takehide; Obata, Yuichi; Utiyama, Hiroyasu; Yokoyama, Kazunari K.

    2008-01-01

    Human acute myeloblastic leukemia HL-60 cells become resistant to differentiation during long­term cultivation. After 150 passages, double minute chromosomes (dmins) found in early­-passaged cells are replaced by large extrachromosomal elements (LEEs). In a DNA library derived from a purified fraction of LEEs, 12.6% (23/183) of clones were assigned to 8q24 and 9.2% (17/183) were assigned to 14q11 in the human genome. Fluorescence in situ hybridization (FISH) revealed a small aberrant chromos...

  11. Terminal ballistics

    CERN Document Server

    Rosenberg, Zvi

    2016-01-01

    This book comprehensively discusses essential aspects of terminal ballistics, combining experimental data, numerical simulations and analytical modeling. Employing a unique approach to numerical simulations as a measure of sensitivity for the major physical parameters, the new edition also includes the following features: new figures to better illustrate the problems discussed; improved explanations for the equation of state of a solid and for the cavity expansion process; new data concerning the Kolsky bar test; and a discussion of analytical modeling for the hole diameter in a thin metallic plate impacted by a shaped charge jet. The section on thick concrete targets penetrated by rigid projectiles has now been expanded to include the latest findings, and two new sections have been added: one on a novel approach to the perforation of thin concrete slabs, and one on testing the failure of thin metallic plates using a hydrodynamic ram.

  12. RECOMBINANT HUMAN MAST-CELL GROWTH-FACTOR SUPPORTS ERYTHROID COLONY FORMATION IN POLYCYTHEMIA-VERA IN THE PRESENCE AND ABSENCE OF ERYTHROPOIETIN AND SERUM

    NARCIS (Netherlands)

    MULLER, EW; DEWOLF, JTM; HENDRIKS, DW; ESSELINK, MT; HALIE, MR; VELLENGA, E

    The effect of mast cell growth factor (MGF) was studied on erythropoietin (Epo)-dependent and Epo-independent (''spontaneous'') erythroid colony formation in patients with polycythemia vera (PV). MGF stimulated both Epo-dependent and Epo-independent erythroid colony formation from PV peripheral

  13. Ctr9, a Key Component of the Paf1 Complex, Affects Proliferation and Terminal Differentiation in the Developing Drosophila Nervous System

    Directory of Open Access Journals (Sweden)

    Shahrzad Bahrampour

    2016-10-01

    Full Text Available The Paf1 protein complex (Paf1C is increasingly recognized as a highly conserved and broadly utilized regulator of a variety of transcriptional processes. These include the promotion of H3K4 and H3K36 trimethylation, H2BK123 ubiquitination, RNA Pol II transcriptional termination, and also RNA-mediated gene silencing. Paf1C contains five canonical protein components, including Paf1 and Ctr9, which are critical for overall complex integrity, as well as Rtf1, Leo1, and Cdc73/Parafibromin(Hrpt2/Hyrax. In spite of a growing appreciation for the importance of Paf1C from yeast and mammalian studies, there has only been limited work in Drosophila. Here, we provide the first detailed phenotypic study of Ctr9 function in Drosophila. We found that Ctr9 mutants die at late embryogenesis or early larval life, but can be partly rescued by nervous system reexpression of Ctr9. We observed a number of phenotypes in Ctr9 mutants, including increased neuroblast numbers, increased nervous system proliferation, as well as downregulation of many neuropeptide genes. Analysis of cell cycle and regulatory gene expression revealed upregulation of the E2f1 cell cycle factor, as well as changes in Antennapedia and Grainy head expression. We also found reduction of H3K4me3 modification in the embryonic nervous system. Genome-wide transcriptome analysis points to additional downstream genes that may underlie these Ctr9 phenotypes, revealing gene expression changes in Notch pathway target genes, cell cycle genes, and neuropeptide genes. In addition, we find significant effects on the gene expression of metabolic genes. These findings reveal that Ctr9 is an essential gene that is necessary at multiple stages of nervous system development, and provides a starting point for future studies of the Paf1C in Drosophila.

  14. Termination unit

    Science.gov (United States)

    Traeholt, Chresten [Frederiksberg, DK; Willen, Dag [Klagshamn, SE; Roden, Mark [Newnan, GA; Tolbert, Jerry C [Carrollton, GA; Lindsay, David [Carrollton, GA; Fisher, Paul W [Heiskell, TN; Nielsen, Carsten Thidemann [Jaegerspris, DK

    2014-01-07

    This invention relates to a termination unit comprising an end-section of a cable. The end section of the cable defines a central longitudinal axis and comprising end-parts of N electrical phases, an end-part of a neutral conductor and a surrounding thermally insulation envelope adapted to comprising a cooling fluid. The end-parts of the N electrical phases and the end-part of the neutral conductor each comprising at least one electrical conductor and being arranged in the cable concentrically around a core former with a phase 1 located relatively innermost, and phase N relatively outermost in the cable, phase N being surrounded by the neutral conductor, electrical insulation being arrange between neighboring electrical phases and between phase N and the neutral conductor, and wherein the end-parts of the neutral conductor and the electrical phases each comprise a contacting surface electrically connected to at least one branch current lead to provide an electrical connection: The contacting surfaces each having a longitudinal extension, and being located sequentially along the longitudinal extension of the end-section of the cable. The branch current leads being individually insulated from said thermally insulation envelope by individual electrical insulators.

  15. Phosphorylated STAT5 directly facilitates parvovirus B19 DNA replication in human erythroid progenitors through interaction with the MCM complex.

    Science.gov (United States)

    Ganaie, Safder S; Zou, Wei; Xu, Peng; Deng, Xuefeng; Kleiboeker, Steve; Qiu, Jianming

    2017-05-01

    Productive infection of human parvovirus B19 (B19V) exhibits high tropism for burst forming unit erythroid (BFU-E) and colony forming unit erythroid (CFU-E) progenitor cells in human bone marrow and fetal liver. This exclusive restriction of the virus replication to human erythroid progenitor cells is partly due to the intracellular factors that are essential for viral DNA replication, including erythropoietin signaling. Efficient B19V replication also requires hypoxic conditions, which upregulate the signal transducer and activator of transcription 5 (STAT5) pathway, and phosphorylated STAT5 is essential for virus replication. In this study, our results revealed direct involvement of STAT5 in B19V DNA replication. Consensus STAT5-binding elements were identified adjacent to the NS1-binding element within the minimal origins of viral DNA replication in the B19V genome. Phosphorylated STAT5 specifically interacted with viral DNA replication origins both in vivo and in vitro, and was actively recruited within the viral DNA replication centers. Notably, STAT5 interacted with minichromosome maintenance (MCM) complex, suggesting that STAT5 directly facilitates viral DNA replication by recruiting the helicase complex of the cellular DNA replication machinery to viral DNA replication centers. The FDA-approved drug pimozide dephosphorylates STAT5, and it inhibited B19V replication in ex vivo expanded human erythroid progenitors. Our results demonstrated that pimozide could be a promising antiviral drug for treatment of B19V-related diseases.

  16. The effect of ceruloplasmin on erythroid precursor cells in the marrow of irradiated mice

    International Nuclear Information System (INIS)

    Suda, Toshio; Miura, Yasusada; Ozawa, Keiya; Yamada, Masaaki.

    1981-01-01

    The effect of ceruloplasmine on erythroid colony forming unit (CFU-e) of irradiated mice was investigated. Whole body #betta# ray irradiation of 100rad decreased the number of CFU-e from 154 to 40 per 4 * 10 4 myeloid nucleated cells. When human #betta#-globulin of 1 mg/kg or ceruloplasmin of 1 mg/kg was administrated immediately after irradiation, the number of CFU-e increased to that of more than normal and normal value in 2 days, respectively. In the case where ceruloplasmin was begun to administrated 7 days before irradiation, though the CFU-e number decreased from 144 to 44, the number increased to 317 after 2 days, and gradually decreased to the normal value by 16 days after irradiation. (Nakanishi, T)

  17. Erythroid cell mitochondria receive endosomal iron by a "kiss-and-run" mechanism.

    Science.gov (United States)

    Hamdi, Amel; Roshan, Tariq M; Kahawita, Tanya M; Mason, Anne B; Sheftel, Alex D; Ponka, Prem

    2016-12-01

    In erythroid cells, more than 90% of transferrin-derived iron enters mitochondria where ferrochelatase inserts Fe 2+ into protoporphyrin IX. However, the path of iron from endosomes to mitochondrial ferrochelatase remains elusive. The prevailing opinion is that, after its export from endosomes, the redox-active metal spreads into the cytosol and mysteriously finds its way into mitochondria through passive diffusion. In contrast, this study supports the hypothesis that the highly efficient transport of iron toward ferrochelatase in erythroid cells requires a direct interaction between transferrin-endosomes and mitochondria (the "kiss-and-run" hypothesis). Using a novel method (flow sub-cytometry), we analyze lysates of reticulocytes after labeling these organelles with different fluorophores. We have identified a double-labeled population definitively representing endosomes interacting with mitochondria, as demonstrated by confocal microscopy. Moreover, we conclude that this endosome-mitochondrion association is reversible, since a "chase" with unlabeled holotransferrin causes a time-dependent decrease in the size of the double-labeled population. Importantly, the dissociation of endosomes from mitochondria does not occur in the absence of holotransferrin. Additionally, mutated recombinant holotransferrin, that cannot release iron, significantly decreases the uptake of 59 Fe by reticulocytes and diminishes 59 Fe incorporation into heme. This suggests that endosomes, which are unable to provide iron to mitochondria, cause a "traffic jam" leading to decreased endocytosis of holotransferrin. Altogether, our results suggest that a molecular mechanism exists to coordinate the iron status of endosomal transferrin with its trafficking. Besides its contribution to the field of iron metabolism, this study provides evidence for a new intracellular trafficking pathway of organelles. Copyright © 2016 Elsevier B.V. All rights reserved.

  18. CTCF and CohesinSA-1 Mark Active Promoters and Boundaries of Repressive Chromatin Domains in Primary Human Erythroid Cells.

    Directory of Open Access Journals (Sweden)

    Laurie A Steiner

    Full Text Available CTCF and cohesinSA-1 are regulatory proteins involved in a number of critical cellular processes including transcription, maintenance of chromatin domain architecture, and insulator function. To assess changes in the CTCF and cohesinSA-1 interactomes during erythropoiesis, chromatin immunoprecipitation coupled with high throughput sequencing and mRNA transcriptome analyses via RNA-seq were performed in primary human hematopoietic stem and progenitor cells (HSPC and primary human erythroid cells from single donors.Sites of CTCF and cohesinSA-1 co-occupancy were enriched in gene promoters in HSPC and erythroid cells compared to single CTCF or cohesin sites. Cell type-specific CTCF sites in erythroid cells were linked to highly expressed genes, with the opposite pattern observed in HSPCs. Chromatin domains were identified by ChIP-seq with antibodies against trimethylated lysine 27 histone H3, a modification associated with repressive chromatin. Repressive chromatin domains increased in both number and size during hematopoiesis, with many more repressive domains in erythroid cells than HSPCs. CTCF and cohesinSA-1 marked the boundaries of these repressive chromatin domains in a cell-type specific manner.These genome wide data, changes in sites of protein occupancy, chromatin architecture, and related gene expression, support the hypothesis that CTCF and cohesinSA-1 have multiple roles in the regulation of gene expression during erythropoiesis including transcriptional regulation at gene promoters and maintenance of chromatin architecture. These data from primary human erythroid cells provide a resource for studies of normal and perturbed erythropoiesis.

  19. Sustained enhancement of OCTN1 transporter expression in association with hydroxyurea induced gamma-globin expression in erythroid progenitors

    OpenAIRE

    Walker, Aisha L.; Ofori-Acquah, Solomon

    2016-01-01

    The clinical benefits of hydroxyurea treatment in patients with sickle cell disease (SCD) are due largely to increased gamma-globin expression. However, mechanisms that control gamma-globin expression by hydroxyurea in erythroid progenitors are incompletely understood. Here, we investigated the role of two hydroxyurea transporters, urea transporter B (UTB) and organic cation/carnitine transporter 1 (OCTN1), in this process. Endogenous expression of both transporters peaked towards the end of ...

  20. Biosynthesis of heme in immature erythroid cells. The regulatory step for heme formation in the human erythron

    International Nuclear Information System (INIS)

    Gardner, L.C.; Cox, T.M.

    1988-01-01

    Heme formation in reticulocytes from rabbits and rodents is subject to end product negative feedback regulation: intracellular free heme has been shown to control acquisition of transferrin iron for heme synthesis. To identify the site of control of heme biosynthesis in the human erythron, immature erythroid cells were obtained from peripheral blood and aspirated bone marrow. After incubation with human 59Fe transferrin, 2-[14C]glycine, or 4-[14C]delta-aminolevulinate, isotopic incorporation into extracted heme was determined. Addition of cycloheximide to increase endogenous free heme, reduced incorporation of labeled glycine and iron but not delta-aminolevulinate into cell heme. Incorporation of glycine and iron was also sensitive to inhibition by exogenous hematin (Ki, 30 and 45 microM, respectively) i.e. at concentrations in the range which affect cell-free protein synthesis in reticulocyte lysates. Hematin treatment rapidly diminished incorporation of intracellular 59Fe into heme by human erythroid cells but assimilation of 4-[14C]delta-aminolevulinate into heme was insensitive to inhibition by hematin (Ki greater than 100 microM). In human reticulocytes (unlike those from rabbits), addition of ferric salicylaldehyde isonicotinoylhydrazone, to increase the pre-heme iron pool independently of the transferrin cycle, failed to promote heme synthesis or modify feedback inhibition induced by hematin. In human erythroid cells (but not rabbit reticulocytes) pre-incubation with unlabeled delta-aminolevulinate or protoporphyrin IX greatly stimulated utilization of cell 59Fe for heme synthesis and also attenuated end product inhibition. In human erythroid cells heme biosynthesis is thus primarily regulated by feedback inhibition at one or more steps which lead to delta-aminolevulinate formation

  1. Myelo-erythroid commitment after burn injury is under β-adrenergic control via MafB regulation.

    Science.gov (United States)

    Hasan, Shirin; Johnson, Nicholas B; Mosier, Michael J; Shankar, Ravi; Conrad, Peggie; Szilagyi, Andrea; Gamelli, Richard L; Muthumalaiappan, Kuzhali

    2017-03-01

    Severely injured burn patients receive multiple blood transfusions for anemia of critical illness despite the adverse consequences. One limiting factor to consider alternate treatment strategies is the lack of a reliable test platform to study molecular mechanisms of impaired erythropoiesis. This study illustrates how conditions resulting in a high catecholamine microenvironment such as burns can instigate myelo-erythroid reprioritization influenced by β-adrenergic stimulation leading to anemia. In a mouse model of scald burn injury, we observed, along with a threefold increase in bone marrow LSK cells (lin neg Sca1 + cKit + ), that the myeloid shift is accompanied with a significant reduction in megakaryocyte erythrocyte progenitors (MEPs). β-Blocker administration (propranolol) for 6 days after burn, not only reduced the number of LSKs and MafB + cells in multipotent progenitors, but also influenced myelo-erythroid bifurcation by increasing the MEPs and reducing the granulocyte monocyte progenitors in the bone marrow of burn mice. Furthermore, similar results were observed in burn patients' peripheral blood mononuclear cell-derived ex vivo culture system, demonstrating that commitment stage of erythropoiesis is impaired in burn patients and intervention with propranolol (nonselective β1,2-adrenergic blocker) increases MEPs. Also, MafB + cells that were significantly increased following standard burn care could be mitigated when propranolol was administered to burn patients, establishing the mechanistic regulation of erythroid commitment by myeloid regulatory transcription factor MafB. Overall, results demonstrate that β-adrenergic blockers following burn injury can redirect the hematopoietic commitment toward erythroid lineage by lowering MafB expression in multipotent progenitors and be of potential therapeutic value to increase erythropoietin responsiveness in burn patients. Copyright © 2017 the American Physiological Society.

  2. Disruption of the 5S RNP-Mdm2 interaction significantly improves the erythroid defect in a mouse model for Diamond-Blackfan anemia.

    OpenAIRE

    Jaako, Pekka; Debnath, Shubhranshu; Olsson, Karin; Zhang, Y; Flygare, Johan; Lindström, M S; Bryder, David; Karlsson, Stefan

    2015-01-01

    Diamond-Blackfan anemia (DBA) is a congenital erythroid hypoplasia caused by haploinsufficiency of genes encoding ribosomal proteins (RPs). Perturbed ribosome biogenesis in DBA has been shown to induce a p53-mediated ribosomal stress response. However, the mechanisms of p53 activation and its relevance for the erythroid defect remain elusive. Previous studies have indicated that activation of p53 is caused by the inhibition of Mdm2, the main negative regulator of p53, by the 5S ribonucleoprot...

  3. Therapeutic γ-globin inducers reduce transcriptional repression in hemoglobinopathy erythroid progenitors through distinct mechanisms

    Science.gov (United States)

    Dai, Yan; Sangerman, Jose; Hong, Yuan Luo; Fuchareon, Suthat; Chui, David H.K.; Faller, Douglas V.; Perrine, Susan P.

    2015-01-01

    Pharmacologic augmentation of γ-globin expression sufficient to reduce anemia and clinical severity in patients with diverse hemoglobinopathies has been challenging. In studies here, representative molecules from four chemical classes, representing several distinct primary mechanisms of action, were investigated for effects on γ-globin transcriptional repressors, including components of the NuRD complex (LSD1 and HDACs 2-3), and the downstream repressor BCL11A, in erythroid progenitors from hemoglobinopathy patients. Two HDAC inhibitors (MS-275 and SB939), a short-chain fatty acid derivative (sodium dimethylbutyrate [SDMB]), and an agent identified in high-throughput screening, Benserazide, were studied. These therapeutics induced γ globin mRNA in progenitors above same subject controls up to 20-fold, and increased F-reticulocytes up to 20%. Cellular protein levels of BCL11A, LSD-1, and KLF1 were suppressed by the compounds. Chromatin immunoprecipitation assays demonstrated a 3.6-fold reduction in LSD1 and HDAC3 occupancy in the γ-globin gene promoter with Benserazide exposure, 3-fold reduction in LSD-1 and HDAC2 occupancy in the γ-globin gene promoter with SDMB exposure, while markers of gene activation (histone H3K9 acetylation and H3K4 demethylation), were enriched 5.7-fold. These findings identify clinical-stage oral therapeutics which inhibit or displace major co-repressors of γ-globin gene transcription and may suggest a rationale for combination therapy to produce enhanced efficacy. PMID:26603726

  4. FHL2 interacts with CALM and is highly expressed in acute erythroid leukemia

    International Nuclear Information System (INIS)

    Pašaliç, Z; Greif, P A; Jurinoviç, V; Mulaw, M; Kakadia, P M; Tizazu, B; Fröhlich-Archangelo, L; Krause, A; Bohlander, S K

    2011-01-01

    The t(10;11)(p13;q14) translocation results in the fusion of the CALM (clathrin assembly lymphoid myeloid leukemia protein) and AF10 genes. This translocation is observed in acute myeloblastic leukemia (AML M6), acute lymphoblastic leukemia (ALL) and malignant lymphoma. Using a yeast two-hybrid screen, the four and a half LIM domain protein 2 (FHL2) was identified as a CALM interacting protein. Recently, high expression of FHL2 in breast, gastric, colon, lung as well as in prostate cancer was shown to be associated with an adverse prognosis. The interaction between CALM and FHL2 was confirmed by glutathione S-transferase-pulldown assay and co-immunoprecipitation experiments. The FHL2 interaction domain of CALM was mapped to amino acids 294–335 of CALM. The transcriptional activation capacity of FHL2 was reduced by CALM, but not by CALM/AF10, which suggests that regulation of FHL2 by CALM might be disturbed in CALM/AF10-positive leukemia. Extremely high expression of FHL2 was seen in acute erythroid leukemia (AML M6). FHL2 was also highly expressed in chronic myeloid leukemia and in AML with complex aberrant karyotype. These results suggest that FHL2 may play an important role in leukemogenesis, especially in the case of AML M6

  5. Human primary erythroid cells as a more sensitive alternative in vitro hematological model for nanotoxicity studies: Toxicological effects of silver nanoparticles.

    Science.gov (United States)

    Rujanapun, Narawadee; Aueviriyavit, Sasitorn; Boonrungsiman, Suwimon; Rosena, Apiwan; Phummiratch, Duangkamol; Riolueang, Suchada; Chalaow, Nipon; Viprakasit, Vip; Maniratanachote, Rawiwan

    2015-12-01

    Although immortalized cells established from cancerous cells have been widely used for studies in nanotoxicology studies, the reliability of the results derived from immortalized cells has been questioned because of their different characteristics from normal cells. In the present study, human primary erythroid cells in liquid culture were used as an in vitro hematological cell model for investigation of the nanotoxicity of silver nanoparticles (AgNPs) and comparing the results to the immortalized hematological cell lines HL60 and K562. The AgNPs caused significant cytotoxic effects in the primary erythroid cells, as shown by the decreased cell viability and induction of intracellular ROS generation and apoptosis, whereas they showed much lower cytotoxic and apoptotic effects in HL60 and K562 cells and did not induced ROS generation in these cell lines. Scanning electron microcopy revealed an interaction of AgNPs to the cell membrane in both primary erythroid and immortalized cells. In addition, AgNPs induced hemolysis in the primary erythroid cells in a dose-dependent manner, and transmission electron microcopy analysis revealed that AgNPs damaged the erythroid cell membrane. Taken together, these results suggest that human primary erythroid cells in liquid culture are a more sensitive alternative in vitro hematological model for nanotoxicology studies. Copyright © 2015 Elsevier B.V. All rights reserved.

  6. Assessment of a bedside test for N-terminal pro B-type natriuretic peptide (NT-proBNP) to differentiate cardiac from non-cardiac causes of pleural effusion in cats.

    Science.gov (United States)

    Wurtinger, Gabriel; Henrich, Estelle; Hildebrandt, Nicolai; Wiedemann, Nicola; Schneider, Matthias; Hassdenteufel, Esther

    2017-12-20

    Cats with pleural effusion represent common emergencies in small animal practice. The aim of this prospective study was to investigate the diagnostic ability of a point-of-care ELISA (POC-ELISA) for the measurement of N-terminal pro B-type natriuretic peptide (NT-proBNP) to differentiate cardiac from non-cardiac disease in cats with pleural effusion. The sample material for use of this rapid test was either plasma or diluted pleural effusion. Twenty cats with moderate to severe pleural effusion were prospectively recruited. The cats were grouped into two groups, with or without congestive heart failure (CHF; N-CHF), after complete work-up. Blood and effusion were collected in EDTA tubes. Plasma and pleural effusion supernatants were transferred into stabilizer tubes and frozen. POC-ELISA for NT-proBNP was performed with plasma and diluted effusion (1:1). Quantitative NT-proBNP measurement was performed in plasma and diluted and undiluted effusions. Six cats were assigned to the CHF group. Of the 14 cats in the N-CHF group, 6 had concurrent cardiac abnormalities that were not responsible for the effusion. For the detection of CHF, the test displayed respective sensitivities and specificities of 100% and 79% in plasma and 100% and 86% in diluted pleural fluid. Receiver operating characteristic (ROC) analysis for quantitative NT-proBNP measurement of plasma and diluted and undiluted pleural effusions displayed areas under the curve of 0.98, sensitivities of 100% and specificities of 86%. The optimum cut-off was calculated at 399 pmol/l in plasma and 229 pmol/l in the diluted effusion and 467 pmol/l in the undiluted effusion. POC-ELISA for NT-proBNP in both plasma and diluted pleural effusion was suitable to differentiate cardiac from non-cardiac causes of feline pleural effusion. According to our results, use of pleural effusion is feasible, but dilution of the effusion before measurement seems to improve specificity.

  7. DJ-1 Modulates Nuclear Erythroid 2–Related Factor-2–Mediated Protection in Human Primary Alveolar Type II Cells in Smokers

    Science.gov (United States)

    Bahmed, Karim; Messier, Elise M.; Zhou, Wenbo; Tuder, Rubin M.; Freed, Curt R.; Chu, Hong Wei; Kelsen, Steven G.; Bowler, Russell P.; Mason, Robert J.

    2016-01-01

    Cigarette smoke (CS) is a main source of oxidative stress and a key risk factor for emphysema, which consists of alveolar wall destruction. Alveolar type (AT) II cells are in the gas exchange regions of the lung. We isolated primary ATII cells from deidentified organ donors whose lungs were not suitable for transplantation. We analyzed the cell injury obtained from nonsmokers, moderate smokers, and heavy smokers. DJ-1 protects cells from oxidative stress and induces nuclear erythroid 2–related factor-2 (Nrf2) expression, which activates the antioxidant defense system. In ATII cells isolated from moderate smokers, we found DJ-1 expression by RT-PCR, and Nrf2 and heme oxygenase (HO)-1 translocation by Western blotting and immunocytofluorescence. In ATII cells isolated from heavy smokers, we detected Nrf2 and HO-1 cytoplasmic localization. Moreover, we found high oxidative stress, as detected by 4-hydroxynonenal (4-HNE) (immunoblotting), inflammation by IL-8 and IL-6 levels by ELISA, and apoptosis by terminal deoxynucleotidyl transferase dUTP nick end labeling (TUNEL) assay in ATII cells obtained from heavy smokers. Furthermore, we detected early DJ-1 and late Nrf2 expression after ATII cell treatment with CS extract. We also overexpressed DJ-1 by adenovirus construct and found that this restored Nrf2 and HO-1 expression and induced nuclear translocation in heavy smokers. Moreover, DJ-1 overexpression also decreased ATII cell apoptosis caused by CS extract in vitro. Our results indicate that DJ-1 activates the Nrf2-mediated antioxidant defense system. Furthermore, DJ-1 overexpression can restore the impaired Nrf2 pathway, leading to ATII cell protection in heavy smokers. This suggests a potential therapeutic strategy for targeting DJ-1 in CS-related lung diseases. PMID:27093578

  8. Hemistepsin A ameliorates acute inflammation in macrophages via inhibition of nuclear factor-κB and activation of nuclear factor erythroid 2-related factor 2.

    Science.gov (United States)

    Kim, Jae Kwang; Lee, Ji Eun; Jung, Eun Hye; Jung, Ji Yun; Jung, Dae Hwa; Ku, Sae Kwang; Cho, Il Je; Kim, Sang Chan

    2018-01-01

    Hemistepsin A (HsA) is a sesquiterpene lactone isolated from Hemistepta lyrata (Bunge) Bunge. We investigated the anti-inflammatory effects of HsA and sought to determine its mechanisms of action in macrophages. HsA pretreatment inhibited nitric oxide production, and reduced the expression of iNOS and COX-2 in Toll-like receptor ligand-stimulated RAW 264.7 cells. Additionally, HsA decreased the secretion of proinflammatory cytokines in lipopolysaccharide (LPS)-stimulated Kupffer cells as well as in RAW 264.7 cells. HsA inhibited phosphorylation of IKKα/β and degradation of IκBα, resulting in decreased nuclear translocation of nuclear factor-κB (NF-κB) and its transcriptional activity. Moreover, HsA phosphorylated nuclear factor erythroid 2-related factor 2 (Nrf2), increased expression levels of antioxidant genes, and attenuated LPS-stimulated H 2 O 2 production. Phosphorylation of p38 and c-Jun N-terminal kinase was required for HsA-mediated Nrf2 phosphorylation. In a D-galactosamine/LPS-induced liver injury model, HsA ameliorated D-galactosamine/LPS-induced hepatocyte degeneration and inflammatory cells infiltration. Moreover, immunohistochemical analyses using nitrotyrosine, 4-hydroxynonenal, and cleaved poly (ADP-ribose) polymerase antibodies revealed that HsA protected the liver from oxidative stress. Furthermore, HsA reduced the numbers of proinflammatory cytokine-positive cells in hepatic tissues. Thus, these results suggest HsA may be a promising natural product to manage inflammation-mediated tissue injuries through inhibition of NF-κB and activation of Nrf2. Copyright © 2017 Elsevier Ltd. All rights reserved.

  9. DMPD: A role for caspases in the differentiation of erythroid cells and macrophages. [Dynamic Macrophage Pathway CSML Database

    Lifescience Database Archive (English)

    Full Text Available ges. Droin N, Cathelin S, Jacquel A, Guery L, Garrido C, Fontenay M, Hermine O,Solary E. Biochimie. 2008 Feb... Garrido C, Fontenay M, Hermine O,Solary E. Publication Biochimie. 2008 Feb;90(2):416-22. Epub 2007 Sep 2. P

  10. Antioxidant mechanism of black garlic extract involving nuclear factor erythroid 2-like factor 2 pathway.

    Science.gov (United States)

    Ha, Ae Wha; Kim, Woo Kyoung

    2017-06-01

    Although studies have revealed that black garlic is a potent antioxidant, its antioxidant mechanism remains unclear. The objective of this study was to determine black garlic's antioxidant activities and possible antioxidant mechanisms related to nuclear factor erythroid 2-like factor 2 (Nrf2)-Keap1 complex. After four weeks of feeding rats with a normal fat diet (NF), a high-fat diet (HF), a high-fat diet with 0.5% black garlic extract (HF+BGE 0.5), a high-fat diet with 1.0% black garlic extract (HF+BGE 1.0), or a high-fat diet with 1.5% black garlic extract (HF+BGE 1.5), plasma concentrations of glucose, insulin,homeostatic model assessment of insulin resistance (HOMA-IR) were determined. As oxidative stress indices, plasma concentrations of thiobarbituric acid reactive substances (TBARS) and 8-isoprostaglandin F2α (8-iso-PGF) were determined. To measure antioxidant capacities, plasma total antioxidant capacity (TAC) and activities of antioxidant enzymes in plasma and liver were determined. The mRNA expression levels of antioxidant related proteins such as Nrf2, NAD(P)H: quinone-oxidoreductase-1 (NQO1), heme oxygenase-1 (HO-1), glutathione reductase (GR), and glutathione S-transferase alpha 2 (GSTA2) were examined. Plasma glucose level, plasma insulin level, and HOMA-IR in black garlic supplemented groups were significantly ( P concentration and TAC in the HF+BGE 1.5 group were significantly decreased compared to those of the HF group. The activities of catalase and glutathione peroxidase were significantly ( P antioxidant systems in rats fed with black garlic extract were related to mRNA expression levels of Nrf2 related genes.

  11. No changes in heme synthesis in human Friedreich´s ataxia erythroid progenitor cells.

    Science.gov (United States)

    Steinkellner, Hannes; Singh, Himanshu Narayan; Muckenthaler, Martina U; Goldenberg, Hans; Moganty, Rajeswari R; Scheiber-Mojdehkar, Barbara; Sturm, Brigitte

    2017-07-20

    Friedreich's ataxia (FRDA) is a neurodegenerative disease caused by reduced expression of the protein frataxin. Frataxin is thought to play a role in iron-sulfur cluster biogenesis and heme synthesis. In this study, we used erythroid progenitor stem cells obtained from FRDA patients and healthy donors to investigate the putative role, if any, of frataxin deficiency in heme synthesis. We used electrochemiluminescence and qRT-PCR for frataxin protein and mRNA quantification. We used atomic absorption spectrophotometry for iron levels and a photometric assay for hemoglobin levels. Protoporphyrin IX and Ferrochelatase were analyzed using auto-fluorescence. An "IronChip" microarray analysis followed by a protein-protein interaction analysis was performed. FRDA patient cells showed no significant changes in iron levels, hemoglobin synthesis, protoporphyrin IX levels, and ferrochelatase activity. Microarray analysis presented 11 genes that were significantly changed in all patients compared to controls. The genes are especially involved in oxidative stress, iron homeostasis and angiogenesis. The mystery about the involvement of frataxin on iron metabolism raises the question why frataxin deficiency in primary FRDA cells did not lead to changes in biochemical parameters of heme synthesis. It seems that alternative pathways can circumvent the impact of frataxin deficiency on heme synthesis. We show for the first time in primary FRDA patient cells that reduced frataxin levels are still sufficient for heme synthesis and possibly other mechanisms can overcome reduced frataxin levels in this process. Our data strongly support the fact that so far no anemia in FRDA patients was reported. Copyright © 2017 Elsevier B.V. All rights reserved.

  12. kosh Terminal Aerodrome Forecast

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — TAF (terminal aerodrome forecast or terminal area forecast) is a format for reporting weather forecast information, particularly as it relates to aviation. TAFs are...

  13. kpdt Terminal Aerodrome Forecast

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — TAF (terminal aerodrome forecast or terminal area forecast) is a format for reporting weather forecast information, particularly as it relates to aviation. TAFs are...

  14. kewr Terminal Aerodrome Forecast

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — TAF (terminal aerodrome forecast or terminal area forecast) is a format for reporting weather forecast information, particularly as it relates to aviation. TAFs are...

  15. kiso Terminal Aerodrome Forecast

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — TAF (terminal aerodrome forecast or terminal area forecast) is a format for reporting weather forecast information, particularly as it relates to aviation. TAFs are...

  16. kpga Terminal Aerodrome Forecast

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — TAF (terminal aerodrome forecast or terminal area forecast) is a format for reporting weather forecast information, particularly as it relates to aviation. TAFs are...

  17. kbkw Terminal Aerodrome Forecast

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — TAF (terminal aerodrome forecast or terminal area forecast) is a format for reporting weather forecast information, particularly as it relates to aviation. TAFs are...

  18. ktcl Terminal Aerodrome Forecast

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — TAF (terminal aerodrome forecast or terminal area forecast) is a format for reporting weather forecast information, particularly as it relates to aviation. TAFs are...

  19. pgwt Terminal Aerodrome Forecast

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — TAF (terminal aerodrome forecast or terminal area forecast) is a format for reporting weather forecast information, particularly as it relates to aviation. TAFs are...

  20. kpsp Terminal Aerodrome Forecast

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — TAF (terminal aerodrome forecast or terminal area forecast) is a format for reporting weather forecast information, particularly as it relates to aviation. TAFs are...

  1. kbih Terminal Aerodrome Forecast

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — TAF (terminal aerodrome forecast or terminal area forecast) is a format for reporting weather forecast information, particularly as it relates to aviation. TAFs are...

  2. kdnl Terminal Aerodrome Forecast

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — TAF (terminal aerodrome forecast or terminal area forecast) is a format for reporting weather forecast information, particularly as it relates to aviation. TAFs are...

  3. kart Terminal Aerodrome Forecast

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — TAF (terminal aerodrome forecast or terminal area forecast) is a format for reporting weather forecast information, particularly as it relates to aviation. TAFs are...

  4. kilm Terminal Aerodrome Forecast

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — TAF (terminal aerodrome forecast or terminal area forecast) is a format for reporting weather forecast information, particularly as it relates to aviation. TAFs are...

  5. kpne Terminal Aerodrome Forecast

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — TAF (terminal aerodrome forecast or terminal area forecast) is a format for reporting weather forecast information, particularly as it relates to aviation. TAFs are...

  6. kabi Terminal Aerodrome Forecast

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — TAF (terminal aerodrome forecast or terminal area forecast) is a format for reporting weather forecast information, particularly as it relates to aviation. TAFs are...

  7. ptpn Terminal Aerodrome Forecast

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — TAF (terminal aerodrome forecast or terminal area forecast) is a format for reporting weather forecast information, particularly as it relates to aviation. TAFs are...

  8. kblf Terminal Aerodrome Forecast

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — TAF (terminal aerodrome forecast or terminal area forecast) is a format for reporting weather forecast information, particularly as it relates to aviation. TAFs are...

  9. panc Terminal Aerodrome Forecast

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — TAF (terminal aerodrome forecast or terminal area forecast) is a format for reporting weather forecast information, particularly as it relates to aviation. TAFs are...

  10. kpbi Terminal Aerodrome Forecast

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — TAF (terminal aerodrome forecast or terminal area forecast) is a format for reporting weather forecast information, particularly as it relates to aviation. TAFs are...

  11. kgdv Terminal Aerodrome Forecast

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — TAF (terminal aerodrome forecast or terminal area forecast) is a format for reporting weather forecast information, particularly as it relates to aviation. TAFs are...

  12. kcmx Terminal Aerodrome Forecast

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — TAF (terminal aerodrome forecast or terminal area forecast) is a format for reporting weather forecast information, particularly as it relates to aviation. TAFs are...

  13. kdls Terminal Aerodrome Forecast

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — TAF (terminal aerodrome forecast or terminal area forecast) is a format for reporting weather forecast information, particularly as it relates to aviation. TAFs are...

  14. koaj Terminal Aerodrome Forecast

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — TAF (terminal aerodrome forecast or terminal area forecast) is a format for reporting weather forecast information, particularly as it relates to aviation. TAFs are...

  15. krhi Terminal Aerodrome Forecast

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — TAF (terminal aerodrome forecast or terminal area forecast) is a format for reporting weather forecast information, particularly as it relates to aviation. TAFs are...

  16. kbpk Terminal Aerodrome Forecast

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — TAF (terminal aerodrome forecast or terminal area forecast) is a format for reporting weather forecast information, particularly as it relates to aviation. TAFs are...

  17. khuf Terminal Aerodrome Forecast

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — TAF (terminal aerodrome forecast or terminal area forecast) is a format for reporting weather forecast information, particularly as it relates to aviation. TAFs are...

  18. kbpi Terminal Aerodrome Forecast

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — TAF (terminal aerodrome forecast or terminal area forecast) is a format for reporting weather forecast information, particularly as it relates to aviation. TAFs are...

  19. ktrk Terminal Aerodrome Forecast

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — TAF (terminal aerodrome forecast or terminal area forecast) is a format for reporting weather forecast information, particularly as it relates to aviation. TAFs are...

  20. kwmc Terminal Aerodrome Forecast

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — TAF (terminal aerodrome forecast or terminal area forecast) is a format for reporting weather forecast information, particularly as it relates to aviation. TAFs are...

  1. katy Terminal Aerodrome Forecast

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — TAF (terminal aerodrome forecast or terminal area forecast) is a format for reporting weather forecast information, particularly as it relates to aviation. TAFs are...

  2. tjmz Terminal Aerodrome Forecast

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — TAF (terminal aerodrome forecast or terminal area forecast) is a format for reporting weather forecast information, particularly as it relates to aviation. TAFs are...

  3. kdet Terminal Aerodrome Forecast

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — TAF (terminal aerodrome forecast or terminal area forecast) is a format for reporting weather forecast information, particularly as it relates to aviation. TAFs are...

  4. kcxp Terminal Aerodrome Forecast

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — TAF (terminal aerodrome forecast or terminal area forecast) is a format for reporting weather forecast information, particularly as it relates to aviation. TAFs are...

  5. kbur Terminal Aerodrome Forecast

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — TAF (terminal aerodrome forecast or terminal area forecast) is a format for reporting weather forecast information, particularly as it relates to aviation. TAFs are...

  6. krkd Terminal Aerodrome Forecast

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — TAF (terminal aerodrome forecast or terminal area forecast) is a format for reporting weather forecast information, particularly as it relates to aviation. TAFs are...

  7. pawg Terminal Aerodrome Forecast

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — TAF (terminal aerodrome forecast or terminal area forecast) is a format for reporting weather forecast information, particularly as it relates to aviation. TAFs are...

  8. kloz Terminal Aerodrome Forecast

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — TAF (terminal aerodrome forecast or terminal area forecast) is a format for reporting weather forecast information, particularly as it relates to aviation. TAFs are...

  9. kcec Terminal Aerodrome Forecast

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — TAF (terminal aerodrome forecast or terminal area forecast) is a format for reporting weather forecast information, particularly as it relates to aviation. TAFs are...

  10. kdec Terminal Aerodrome Forecast

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — TAF (terminal aerodrome forecast or terminal area forecast) is a format for reporting weather forecast information, particularly as it relates to aviation. TAFs are...

  11. paor Terminal Aerodrome Forecast

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — TAF (terminal aerodrome forecast or terminal area forecast) is a format for reporting weather forecast information, particularly as it relates to aviation. TAFs are...

  12. kavl Terminal Aerodrome Forecast

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — TAF (terminal aerodrome forecast or terminal area forecast) is a format for reporting weather forecast information, particularly as it relates to aviation. TAFs are...

  13. kdrt Terminal Aerodrome Forecast

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — TAF (terminal aerodrome forecast or terminal area forecast) is a format for reporting weather forecast information, particularly as it relates to aviation. TAFs are...

  14. kstl Terminal Aerodrome Forecast

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — TAF (terminal aerodrome forecast or terminal area forecast) is a format for reporting weather forecast information, particularly as it relates to aviation. TAFs are...

  15. kbfi Terminal Aerodrome Forecast

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — TAF (terminal aerodrome forecast or terminal area forecast) is a format for reporting weather forecast information, particularly as it relates to aviation. TAFs are...

  16. khsv Terminal Aerodrome Forecast

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — TAF (terminal aerodrome forecast or terminal area forecast) is a format for reporting weather forecast information, particularly as it relates to aviation. TAFs are...

  17. pafa Terminal Aerodrome Forecast

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — TAF (terminal aerodrome forecast or terminal area forecast) is a format for reporting weather forecast information, particularly as it relates to aviation. TAFs are...

  18. kekn Terminal Aerodrome Forecast

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — TAF (terminal aerodrome forecast or terminal area forecast) is a format for reporting weather forecast information, particularly as it relates to aviation. TAFs are...

  19. tncm Terminal Aerodrome Forecast

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — TAF (terminal aerodrome forecast or terminal area forecast) is a format for reporting weather forecast information, particularly as it relates to aviation. TAFs are...

  20. kith Terminal Aerodrome Forecast

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — TAF (terminal aerodrome forecast or terminal area forecast) is a format for reporting weather forecast information, particularly as it relates to aviation. TAFs are...

  1. kgnv Terminal Aerodrome Forecast

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — TAF (terminal aerodrome forecast or terminal area forecast) is a format for reporting weather forecast information, particularly as it relates to aviation. TAFs are...

  2. ktoi Terminal Aerodrome Forecast

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — TAF (terminal aerodrome forecast or terminal area forecast) is a format for reporting weather forecast information, particularly as it relates to aviation. TAFs are...

  3. kgso Terminal Aerodrome Forecast

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — TAF (terminal aerodrome forecast or terminal area forecast) is a format for reporting weather forecast information, particularly as it relates to aviation. TAFs are...

  4. nstu Terminal Aerodrome Forecast

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — TAF (terminal aerodrome forecast or terminal area forecast) is a format for reporting weather forecast information, particularly as it relates to aviation. TAFs are...

  5. kmgm Terminal Aerodrome Forecast

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — TAF (terminal aerodrome forecast or terminal area forecast) is a format for reporting weather forecast information, particularly as it relates to aviation. TAFs are...

  6. khib Terminal Aerodrome Forecast

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — TAF (terminal aerodrome forecast or terminal area forecast) is a format for reporting weather forecast information, particularly as it relates to aviation. TAFs are...

  7. pavd Terminal Aerodrome Forecast

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — TAF (terminal aerodrome forecast or terminal area forecast) is a format for reporting weather forecast information, particularly as it relates to aviation. TAFs are...

  8. kfar Terminal Aerodrome Forecast

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — TAF (terminal aerodrome forecast or terminal area forecast) is a format for reporting weather forecast information, particularly as it relates to aviation. TAFs are...

  9. kluk Terminal Aerodrome Forecast

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — TAF (terminal aerodrome forecast or terminal area forecast) is a format for reporting weather forecast information, particularly as it relates to aviation. TAFs are...

  10. kwwr Terminal Aerodrome Forecast

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — TAF (terminal aerodrome forecast or terminal area forecast) is a format for reporting weather forecast information, particularly as it relates to aviation. TAFs are...

  11. klse Terminal Aerodrome Forecast

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — TAF (terminal aerodrome forecast or terminal area forecast) is a format for reporting weather forecast information, particularly as it relates to aviation. TAFs are...

  12. ksts Terminal Aerodrome Forecast

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — TAF (terminal aerodrome forecast or terminal area forecast) is a format for reporting weather forecast information, particularly as it relates to aviation. TAFs are...

  13. koth Terminal Aerodrome Forecast

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — TAF (terminal aerodrome forecast or terminal area forecast) is a format for reporting weather forecast information, particularly as it relates to aviation. TAFs are...

  14. kbfl Terminal Aerodrome Forecast

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — TAF (terminal aerodrome forecast or terminal area forecast) is a format for reporting weather forecast information, particularly as it relates to aviation. TAFs are...

  15. ksgf Terminal Aerodrome Forecast

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — TAF (terminal aerodrome forecast or terminal area forecast) is a format for reporting weather forecast information, particularly as it relates to aviation. TAFs are...

  16. kpkb Terminal Aerodrome Forecast

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — TAF (terminal aerodrome forecast or terminal area forecast) is a format for reporting weather forecast information, particularly as it relates to aviation. TAFs are...

  17. krog Terminal Aerodrome Forecast

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — TAF (terminal aerodrome forecast or terminal area forecast) is a format for reporting weather forecast information, particularly as it relates to aviation. TAFs are...

  18. kbjc Terminal Aerodrome Forecast

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — TAF (terminal aerodrome forecast or terminal area forecast) is a format for reporting weather forecast information, particularly as it relates to aviation. TAFs are...

  19. ksea Terminal Aerodrome Forecast

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — TAF (terminal aerodrome forecast or terminal area forecast) is a format for reporting weather forecast information, particularly as it relates to aviation. TAFs are...

  20. kbwi Terminal Aerodrome Forecast

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — TAF (terminal aerodrome forecast or terminal area forecast) is a format for reporting weather forecast information, particularly as it relates to aviation. TAFs are...

  1. kftw Terminal Aerodrome Forecast

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — TAF (terminal aerodrome forecast or terminal area forecast) is a format for reporting weather forecast information, particularly as it relates to aviation. TAFs are...

  2. kpuw Terminal Aerodrome Forecast

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — TAF (terminal aerodrome forecast or terminal area forecast) is a format for reporting weather forecast information, particularly as it relates to aviation. TAFs are...

  3. kabq Terminal Aerodrome Forecast

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — TAF (terminal aerodrome forecast or terminal area forecast) is a format for reporting weather forecast information, particularly as it relates to aviation. TAFs are...

  4. ksny Terminal Aerodrome Forecast

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — TAF (terminal aerodrome forecast or terminal area forecast) is a format for reporting weather forecast information, particularly as it relates to aviation. TAFs are...

  5. khio Terminal Aerodrome Forecast

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — TAF (terminal aerodrome forecast or terminal area forecast) is a format for reporting weather forecast information, particularly as it relates to aviation. TAFs are...

  6. klaf Terminal Aerodrome Forecast

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — TAF (terminal aerodrome forecast or terminal area forecast) is a format for reporting weather forecast information, particularly as it relates to aviation. TAFs are...

  7. kfoe Terminal Aerodrome Forecast

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — TAF (terminal aerodrome forecast or terminal area forecast) is a format for reporting weather forecast information, particularly as it relates to aviation. TAFs are...

  8. ksmx Terminal Aerodrome Forecast

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — TAF (terminal aerodrome forecast or terminal area forecast) is a format for reporting weather forecast information, particularly as it relates to aviation. TAFs are...

  9. kipt Terminal Aerodrome Forecast

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — TAF (terminal aerodrome forecast or terminal area forecast) is a format for reporting weather forecast information, particularly as it relates to aviation. TAFs are...

  10. klch Terminal Aerodrome Forecast

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — TAF (terminal aerodrome forecast or terminal area forecast) is a format for reporting weather forecast information, particularly as it relates to aviation. TAFs are...

  11. Organizational Relationship Termination Competence

    DEFF Research Database (Denmark)

    Ritter, Thomas; Geersbro, Jens

    2011-01-01

    termination are found to significantly affect a firm's relationship termination competence. The findings suggest that managers should regard termination as a legitimate option in customer relationship management. In order to decrease the number of unwanted customers, managers must accept termination......Most firms are involved in a number of customer relationships that drain the firm's resources. However, many firms are hesitant to address this problem. This paper investigates customer relationship termination at the organizational level. We develop and analyze the organizational dimensions...... of organizational termination in order to improve our understanding of the management of termination. The impact of these termination dimensions on the percentage of unwanted customers is developed and tested using PLS on data gathered from a cross-sectional survey of more than 800 sales representatives. We find...

  12. kink Terminal Aerodrome Forecast

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — TAF (terminal aerodrome forecast or terminal area forecast) is a format for reporting weather forecast information, particularly as it relates to aviation. TAFs are...

  13. krut Terminal Aerodrome Forecast

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — TAF (terminal aerodrome forecast or terminal area forecast) is a format for reporting weather forecast information, particularly as it relates to aviation. TAFs are...

  14. kbli Terminal Aerodrome Forecast

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — TAF (terminal aerodrome forecast or terminal area forecast) is a format for reporting weather forecast information, particularly as it relates to aviation. TAFs are...

  15. kaoo Terminal Aerodrome Forecast

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — TAF (terminal aerodrome forecast or terminal area forecast) is a format for reporting weather forecast information, particularly as it relates to aviation. TAFs are...

  16. klit Terminal Aerodrome Forecast

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — TAF (terminal aerodrome forecast or terminal area forecast) is a format for reporting weather forecast information, particularly as it relates to aviation. TAFs are...

  17. ktup Terminal Aerodrome Forecast

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — TAF (terminal aerodrome forecast or terminal area forecast) is a format for reporting weather forecast information, particularly as it relates to aviation. TAFs are...

  18. ktop Terminal Aerodrome Forecast

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — TAF (terminal aerodrome forecast or terminal area forecast) is a format for reporting weather forecast information, particularly as it relates to aviation. TAFs are...

  19. klax Terminal Aerodrome Forecast

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — TAF (terminal aerodrome forecast or terminal area forecast) is a format for reporting weather forecast information, particularly as it relates to aviation. TAFs are...

  20. kprc Terminal Aerodrome Forecast

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — TAF (terminal aerodrome forecast or terminal area forecast) is a format for reporting weather forecast information, particularly as it relates to aviation. TAFs are...

  1. katl Terminal Aerodrome Forecast

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — TAF (terminal aerodrome forecast or terminal area forecast) is a format for reporting weather forecast information, particularly as it relates to aviation. TAFs are...

  2. kmcn Terminal Aerodrome Forecast

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — TAF (terminal aerodrome forecast or terminal area forecast) is a format for reporting weather forecast information, particularly as it relates to aviation. TAFs are...

  3. kogb Terminal Aerodrome Forecast

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — TAF (terminal aerodrome forecast or terminal area forecast) is a format for reporting weather forecast information, particularly as it relates to aviation. TAFs are...

  4. kama Terminal Aerodrome Forecast

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — TAF (terminal aerodrome forecast or terminal area forecast) is a format for reporting weather forecast information, particularly as it relates to aviation. TAFs are...

  5. ptkk Terminal Aerodrome Forecast

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — TAF (terminal aerodrome forecast or terminal area forecast) is a format for reporting weather forecast information, particularly as it relates to aviation. TAFs are...

  6. kiwa Terminal Aerodrome Forecast

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — TAF (terminal aerodrome forecast or terminal area forecast) is a format for reporting weather forecast information, particularly as it relates to aviation. TAFs are...

  7. kavp Terminal Aerodrome Forecast

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — TAF (terminal aerodrome forecast or terminal area forecast) is a format for reporting weather forecast information, particularly as it relates to aviation. TAFs are...

  8. kdca Terminal Aerodrome Forecast

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — TAF (terminal aerodrome forecast or terminal area forecast) is a format for reporting weather forecast information, particularly as it relates to aviation. TAFs are...

  9. kbwg Terminal Aerodrome Forecast

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — TAF (terminal aerodrome forecast or terminal area forecast) is a format for reporting weather forecast information, particularly as it relates to aviation. TAFs are...

  10. kdfw Terminal Aerodrome Forecast

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — TAF (terminal aerodrome forecast or terminal area forecast) is a format for reporting weather forecast information, particularly as it relates to aviation. TAFs are...

  11. kssi Terminal Aerodrome Forecast

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — TAF (terminal aerodrome forecast or terminal area forecast) is a format for reporting weather forecast information, particularly as it relates to aviation. TAFs are...

  12. pahn Terminal Aerodrome Forecast

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — TAF (terminal aerodrome forecast or terminal area forecast) is a format for reporting weather forecast information, particularly as it relates to aviation. TAFs are...

  13. ksrq Terminal Aerodrome Forecast

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — TAF (terminal aerodrome forecast or terminal area forecast) is a format for reporting weather forecast information, particularly as it relates to aviation. TAFs are...

  14. kpvd Terminal Aerodrome Forecast

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — TAF (terminal aerodrome forecast or terminal area forecast) is a format for reporting weather forecast information, particularly as it relates to aviation. TAFs are...

  15. kisp Terminal Aerodrome Forecast

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — TAF (terminal aerodrome forecast or terminal area forecast) is a format for reporting weather forecast information, particularly as it relates to aviation. TAFs are...

  16. kttd Terminal Aerodrome Forecast

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — TAF (terminal aerodrome forecast or terminal area forecast) is a format for reporting weather forecast information, particularly as it relates to aviation. TAFs are...

  17. pmdy Terminal Aerodrome Forecast

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — TAF (terminal aerodrome forecast or terminal area forecast) is a format for reporting weather forecast information, particularly as it relates to aviation. TAFs are...

  18. kont Terminal Aerodrome Forecast

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — TAF (terminal aerodrome forecast or terminal area forecast) is a format for reporting weather forecast information, particularly as it relates to aviation. TAFs are...

  19. kyng Terminal Aerodrome Forecast

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — TAF (terminal aerodrome forecast or terminal area forecast) is a format for reporting weather forecast information, particularly as it relates to aviation. TAFs are...

  20. kcwa Terminal Aerodrome Forecast

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — TAF (terminal aerodrome forecast or terminal area forecast) is a format for reporting weather forecast information, particularly as it relates to aviation. TAFs are...

  1. kflg Terminal Aerodrome Forecast

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — TAF (terminal aerodrome forecast or terminal area forecast) is a format for reporting weather forecast information, particularly as it relates to aviation. TAFs are...

  2. krsw Terminal Aerodrome Forecast

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — TAF (terminal aerodrome forecast or terminal area forecast) is a format for reporting weather forecast information, particularly as it relates to aviation. TAFs are...

  3. kmyl Terminal Aerodrome Forecast

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — TAF (terminal aerodrome forecast or terminal area forecast) is a format for reporting weather forecast information, particularly as it relates to aviation. TAFs are...

  4. krbg Terminal Aerodrome Forecast

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — TAF (terminal aerodrome forecast or terminal area forecast) is a format for reporting weather forecast information, particularly as it relates to aviation. TAFs are...

  5. kril Terminal Aerodrome Forecast

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — TAF (terminal aerodrome forecast or terminal area forecast) is a format for reporting weather forecast information, particularly as it relates to aviation. TAFs are...

  6. ksus Terminal Aerodrome Forecast

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — TAF (terminal aerodrome forecast or terminal area forecast) is a format for reporting weather forecast information, particularly as it relates to aviation. TAFs are...

  7. padq Terminal Aerodrome Forecast

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — TAF (terminal aerodrome forecast or terminal area forecast) is a format for reporting weather forecast information, particularly as it relates to aviation. TAFs are...

  8. kbil Terminal Aerodrome Forecast

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — TAF (terminal aerodrome forecast or terminal area forecast) is a format for reporting weather forecast information, particularly as it relates to aviation. TAFs are...

  9. krfd Terminal Aerodrome Forecast

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — TAF (terminal aerodrome forecast or terminal area forecast) is a format for reporting weather forecast information, particularly as it relates to aviation. TAFs are...

  10. kdug Terminal Aerodrome Forecast

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — TAF (terminal aerodrome forecast or terminal area forecast) is a format for reporting weather forecast information, particularly as it relates to aviation. TAFs are...

  11. ktix Terminal Aerodrome Forecast

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — TAF (terminal aerodrome forecast or terminal area forecast) is a format for reporting weather forecast information, particularly as it relates to aviation. TAFs are...

  12. kcod Terminal Aerodrome Forecast

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — TAF (terminal aerodrome forecast or terminal area forecast) is a format for reporting weather forecast information, particularly as it relates to aviation. TAFs are...

  13. kslk Terminal Aerodrome Forecast

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — TAF (terminal aerodrome forecast or terminal area forecast) is a format for reporting weather forecast information, particularly as it relates to aviation. TAFs are...

  14. kgfl Terminal Aerodrome Forecast

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — TAF (terminal aerodrome forecast or terminal area forecast) is a format for reporting weather forecast information, particularly as it relates to aviation. TAFs are...

  15. kguc Terminal Aerodrome Forecast

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — TAF (terminal aerodrome forecast or terminal area forecast) is a format for reporting weather forecast information, particularly as it relates to aviation. TAFs are...

  16. kmlu Terminal Aerodrome Forecast

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — TAF (terminal aerodrome forecast or terminal area forecast) is a format for reporting weather forecast information, particularly as it relates to aviation. TAFs are...

  17. kbff Terminal Aerodrome Forecast

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — TAF (terminal aerodrome forecast or terminal area forecast) is a format for reporting weather forecast information, particularly as it relates to aviation. TAFs are...

  18. ksmn Terminal Aerodrome Forecast

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — TAF (terminal aerodrome forecast or terminal area forecast) is a format for reporting weather forecast information, particularly as it relates to aviation. TAFs are...

  19. kdro Terminal Aerodrome Forecast

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — TAF (terminal aerodrome forecast or terminal area forecast) is a format for reporting weather forecast information, particularly as it relates to aviation. TAFs are...

  20. kmce Terminal Aerodrome Forecast

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — TAF (terminal aerodrome forecast or terminal area forecast) is a format for reporting weather forecast information, particularly as it relates to aviation. TAFs are...

  1. ktpa Terminal Aerodrome Forecast

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — TAF (terminal aerodrome forecast or terminal area forecast) is a format for reporting weather forecast information, particularly as it relates to aviation. TAFs are...

  2. kmot Terminal Aerodrome Forecast

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — TAF (terminal aerodrome forecast or terminal area forecast) is a format for reporting weather forecast information, particularly as it relates to aviation. TAFs are...

  3. kcre Terminal Aerodrome Forecast

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — TAF (terminal aerodrome forecast or terminal area forecast) is a format for reporting weather forecast information, particularly as it relates to aviation. TAFs are...

  4. klws Terminal Aerodrome Forecast

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — TAF (terminal aerodrome forecast or terminal area forecast) is a format for reporting weather forecast information, particularly as it relates to aviation. TAFs are...

  5. kotm Terminal Aerodrome Forecast

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — TAF (terminal aerodrome forecast or terminal area forecast) is a format for reporting weather forecast information, particularly as it relates to aviation. TAFs are...

  6. khqm Terminal Aerodrome Forecast

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — TAF (terminal aerodrome forecast or terminal area forecast) is a format for reporting weather forecast information, particularly as it relates to aviation. TAFs are...

  7. kabr Terminal Aerodrome Forecast

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — TAF (terminal aerodrome forecast or terminal area forecast) is a format for reporting weather forecast information, particularly as it relates to aviation. TAFs are...

  8. klal Terminal Aerodrome Forecast

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — TAF (terminal aerodrome forecast or terminal area forecast) is a format for reporting weather forecast information, particularly as it relates to aviation. TAFs are...

  9. kelp Terminal Aerodrome Forecast

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — TAF (terminal aerodrome forecast or terminal area forecast) is a format for reporting weather forecast information, particularly as it relates to aviation. TAFs are...

  10. kecg Terminal Aerodrome Forecast

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — TAF (terminal aerodrome forecast or terminal area forecast) is a format for reporting weather forecast information, particularly as it relates to aviation. TAFs are...

  11. khbg Terminal Aerodrome Forecast

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — TAF (terminal aerodrome forecast or terminal area forecast) is a format for reporting weather forecast information, particularly as it relates to aviation. TAFs are...

  12. kpbf Terminal Aerodrome Forecast

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — TAF (terminal aerodrome forecast or terminal area forecast) is a format for reporting weather forecast information, particularly as it relates to aviation. TAFs are...

  13. konp Terminal Aerodrome Forecast

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — TAF (terminal aerodrome forecast or terminal area forecast) is a format for reporting weather forecast information, particularly as it relates to aviation. TAFs are...

  14. pkwa Terminal Aerodrome Forecast

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — TAF (terminal aerodrome forecast or terminal area forecast) is a format for reporting weather forecast information, particularly as it relates to aviation. TAFs are...

  15. ktvf Terminal Aerodrome Forecast

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — TAF (terminal aerodrome forecast or terminal area forecast) is a format for reporting weather forecast information, particularly as it relates to aviation. TAFs are...

  16. paga Terminal Aerodrome Forecast

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — TAF (terminal aerodrome forecast or terminal area forecast) is a format for reporting weather forecast information, particularly as it relates to aviation. TAFs are...

  17. khks Terminal Aerodrome Forecast

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — TAF (terminal aerodrome forecast or terminal area forecast) is a format for reporting weather forecast information, particularly as it relates to aviation. TAFs are...

  18. kdsm Terminal Aerodrome Forecast

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — TAF (terminal aerodrome forecast or terminal area forecast) is a format for reporting weather forecast information, particularly as it relates to aviation. TAFs are...

  19. kpsm Terminal Aerodrome Forecast

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — TAF (terminal aerodrome forecast or terminal area forecast) is a format for reporting weather forecast information, particularly as it relates to aviation. TAFs are...

  20. kgrb Terminal Aerodrome Forecast

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — TAF (terminal aerodrome forecast or terminal area forecast) is a format for reporting weather forecast information, particularly as it relates to aviation. TAFs are...

  1. kgmu Terminal Aerodrome Forecast

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — TAF (terminal aerodrome forecast or terminal area forecast) is a format for reporting weather forecast information, particularly as it relates to aviation. TAFs are...

  2. papg Terminal Aerodrome Forecast

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — TAF (terminal aerodrome forecast or terminal area forecast) is a format for reporting weather forecast information, particularly as it relates to aviation. TAFs are...

  3. kbgm Terminal Aerodrome Forecast

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — TAF (terminal aerodrome forecast or terminal area forecast) is a format for reporting weather forecast information, particularly as it relates to aviation. TAFs are...

  4. pamc Terminal Aerodrome Forecast

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — TAF (terminal aerodrome forecast or terminal area forecast) is a format for reporting weather forecast information, particularly as it relates to aviation. TAFs are...

  5. klrd Terminal Aerodrome Forecast

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — TAF (terminal aerodrome forecast or terminal area forecast) is a format for reporting weather forecast information, particularly as it relates to aviation. TAFs are...

  6. ksan Terminal Aerodrome Forecast

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — TAF (terminal aerodrome forecast or terminal area forecast) is a format for reporting weather forecast information, particularly as it relates to aviation. TAFs are...

  7. patk Terminal Aerodrome Forecast

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — TAF (terminal aerodrome forecast or terminal area forecast) is a format for reporting weather forecast information, particularly as it relates to aviation. TAFs are...

  8. kowb Terminal Aerodrome Forecast

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — TAF (terminal aerodrome forecast or terminal area forecast) is a format for reporting weather forecast information, particularly as it relates to aviation. TAFs are...

  9. klru Terminal Aerodrome Forecast

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — TAF (terminal aerodrome forecast or terminal area forecast) is a format for reporting weather forecast information, particularly as it relates to aviation. TAFs are...

  10. kfxe Terminal Aerodrome Forecast

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — TAF (terminal aerodrome forecast or terminal area forecast) is a format for reporting weather forecast information, particularly as it relates to aviation. TAFs are...

  11. kjct Terminal Aerodrome Forecast

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — TAF (terminal aerodrome forecast or terminal area forecast) is a format for reporting weather forecast information, particularly as it relates to aviation. TAFs are...

  12. kcrg Terminal Aerodrome Forecast

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — TAF (terminal aerodrome forecast or terminal area forecast) is a format for reporting weather forecast information, particularly as it relates to aviation. TAFs are...

  13. paaq Terminal Aerodrome Forecast

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — TAF (terminal aerodrome forecast or terminal area forecast) is a format for reporting weather forecast information, particularly as it relates to aviation. TAFs are...

  14. kaex Terminal Aerodrome Forecast

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — TAF (terminal aerodrome forecast or terminal area forecast) is a format for reporting weather forecast information, particularly as it relates to aviation. TAFs are...

  15. klbx Terminal Aerodrome Forecast

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — TAF (terminal aerodrome forecast or terminal area forecast) is a format for reporting weather forecast information, particularly as it relates to aviation. TAFs are...

  16. kmia Terminal Aerodrome Forecast

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — TAF (terminal aerodrome forecast or terminal area forecast) is a format for reporting weather forecast information, particularly as it relates to aviation. TAFs are...

  17. kpit Terminal Aerodrome Forecast

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — TAF (terminal aerodrome forecast or terminal area forecast) is a format for reporting weather forecast information, particularly as it relates to aviation. TAFs are...

  18. kcrw Terminal Aerodrome Forecast

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — TAF (terminal aerodrome forecast or terminal area forecast) is a format for reporting weather forecast information, particularly as it relates to aviation. TAFs are...

  19. paen Terminal Aerodrome Forecast

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — TAF (terminal aerodrome forecast or terminal area forecast) is a format for reporting weather forecast information, particularly as it relates to aviation. TAFs are...

  20. kast Terminal Aerodrome Forecast

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — TAF (terminal aerodrome forecast or terminal area forecast) is a format for reporting weather forecast information, particularly as it relates to aviation. TAFs are...

  1. kuin Terminal Aerodrome Forecast

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — TAF (terminal aerodrome forecast or terminal area forecast) is a format for reporting weather forecast information, particularly as it relates to aviation. TAFs are...

  2. kmht Terminal Aerodrome Forecast

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — TAF (terminal aerodrome forecast or terminal area forecast) is a format for reporting weather forecast information, particularly as it relates to aviation. TAFs are...

  3. kcys Terminal Aerodrome Forecast

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — TAF (terminal aerodrome forecast or terminal area forecast) is a format for reporting weather forecast information, particularly as it relates to aviation. TAFs are...

  4. kflo Terminal Aerodrome Forecast

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — TAF (terminal aerodrome forecast or terminal area forecast) is a format for reporting weather forecast information, particularly as it relates to aviation. TAFs are...

  5. pakn Terminal Aerodrome Forecast

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — TAF (terminal aerodrome forecast or terminal area forecast) is a format for reporting weather forecast information, particularly as it relates to aviation. TAFs are...

  6. pabt Terminal Aerodrome Forecast

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — TAF (terminal aerodrome forecast or terminal area forecast) is a format for reporting weather forecast information, particularly as it relates to aviation. TAFs are...

  7. krdg Terminal Aerodrome Forecast

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — TAF (terminal aerodrome forecast or terminal area forecast) is a format for reporting weather forecast information, particularly as it relates to aviation. TAFs are...

  8. khdn Terminal Aerodrome Forecast

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — TAF (terminal aerodrome forecast or terminal area forecast) is a format for reporting weather forecast information, particularly as it relates to aviation. TAFs are...

  9. kjac Terminal Aerodrome Forecast

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — TAF (terminal aerodrome forecast or terminal area forecast) is a format for reporting weather forecast information, particularly as it relates to aviation. TAFs are...

  10. kphx Terminal Aerodrome Forecast

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — TAF (terminal aerodrome forecast or terminal area forecast) is a format for reporting weather forecast information, particularly as it relates to aviation. TAFs are...

  11. PI3 kinase is important for Ras, MEK and Erk activation of Epo-stimulated human erythroid progenitors

    Directory of Open Access Journals (Sweden)

    Schmidt Enrico K

    2004-05-01

    Full Text Available Abstract Background Erythropoietin is a multifunctional cytokine which regulates the number of erythrocytes circulating in mammalian blood. This is crucial in order to maintain an appropriate oxygen supply throughout the body. Stimulation of primary human erythroid progenitors (PEPs with erythropoietin (Epo leads to the activation of the mitogenic kinases (MEKs and Erks. How this is accomplished mechanistically remained unclear. Results Biochemical studies with human cord blood-derived PEPs now show that Ras and the class Ib enzyme of the phosphatidylinositol-3 kinase (PI3K family, PI3K gamma, are activated in response to minimal Epo concentrations. Surprisingly, three structurally different PI3K inhibitors block Ras, MEK and Erk activation in PEPs by Epo. Furthermore, Erk activation in PEPs is insensitive to the inhibition of Raf kinases but suppressed upon PKC inhibition. In contrast, Erk activation induced by stem cell factor, which activates c-Kit in the same cells, is sensitive to Raf inhibition and insensitive to PI3K and PKC inhibitors. Conclusions These unexpected findings contrast with previous results in human primary cells using Epo at supraphysiological concentrations and open new doors to eventually understanding how low Epo concentrations mediate the moderate proliferation of erythroid progenitors under homeostatic blood oxygen levels. They indicate that the basal activation of MEKs and Erks in PEPs by minimal concentrations of Epo does not occur through the classical cascade Shc/Grb2/Sos/Ras/Raf/MEK/Erk. Instead, MEKs and Erks are signal mediators of PI3K, probably the recently described PI3K gamma, through a Raf-independent signaling pathway which requires PKC activity. It is likely that higher concentrations of Epo that are induced by hypoxia, for example, following blood loss, lead to additional mitogenic signals which greatly accelerate erythroid progenitor proliferation.

  12. Identification of a human erythroid progenitor cell population which expresses the CD34 antigen and binds the plant lectin Ulex europaeus I.

    Science.gov (United States)

    Unverzagt, K L; Martinson, J; Lee, W; Stiff, P J; Williams, S; Bender, J G

    1996-01-01

    Two and three color flow cytometry of normal human bone marrow was used to identify CD34+ progenitor cells and examine their binding to the plant lectin Ulex europaeus I (Ulex). In normal bone marrow, 48.48 +/- 17.4% of the CD34+ cells bind to Ulex. Two color flow cytometry was used to sort CD34 + cells, and subsets of CD34+ cells, CD34+ Ulex+ and CD34+ Ulex-. These populations were sorted into colony assays to assess myeloid (CFU-GM) and erythroid (BFU-E) progenitors. The CD34+ Ulex+ subset was 84 +/- 14% BFU-E colonies (mean +/- S.D.) and had the highest cloning efficiency of 28 +/- 13%. Three color analysis of CD34+ Ulex+ cells showed staining with other erythroid (CD71, GlyA) antibodies and lack of stain. ing with myeloid (CD13, CD45RA) antibodies. These studies confirmed the erythroid characteristics of this subpopulation.

  13. CONTAINER TERMINALS IN EUROPE

    Directory of Open Access Journals (Sweden)

    Bart W. WIEGMANS

    2001-01-01

    Full Text Available This paper aims to address the linkage between logistics (in particular, the management of marketing channel flows and transport markets, while also the interaction between these two markets and intermodal container terminals is analysed. The marketing channel theory is used to describe all relevant actors and flows that run through marketing channels, starting with customer needs and ending with customer satisfaction. Porter's theory of competitive advantages is used to review competitive forces in both markets. Finally, a competitor analysis is performed for the logistics and transport market. These theories are applied so as to be able to determine the competitive position of intermodal container terminals with a view to the management of marketing channel flows and the physical transport of freight flows. Hence, the central question of this paper is: Which markets are served by intermodal container terminals and with whom are they competing? At present, neither the maritime container terminals nor the continental container terminals appear to have a significant influence in the logistics service market; they concentrate mainly on the physical movement of containers (transshipment. Furthermore, maritime container terminals and continental container terminals are not dominant players in the transport service market. Our conclusion is that continental terminals are predominantly competing with unimodal road transport, with neighbouring continental terminals and with barge transport companies.

  14. Lazy Productivity via Termination

    NARCIS (Netherlands)

    Endrullis, J.; Hendriks, R.D.A.

    2011-01-01

    We present a procedure for transforming strongly sequential constructor-based term rewriting systems (TRSs) into context-sensitive TRSs in such a way that productivity of the input system is equivalent to termination of the output system. Thereby automated termination provers become available for

  15. Termination of cycle rewriting

    NARCIS (Netherlands)

    Zantema, H.; König, B.; Bruggink, H.J.S.; Dowek, G.

    2014-01-01

    String rewriting can not only be applied on strings, but also on cycles and even on general graphs. In this paper we investigate termination of string rewriting applied on cycles, shortly denoted as cycle rewriting, which is a strictly stronger requirement than termination on strings. Most

  16. Kitimat LNG terminal

    International Nuclear Information System (INIS)

    Schmaltz, I.; Boulton, R.

    2007-01-01

    Kitimat Liquefied Natural Gas (LNG) terminal is a terminal development company owned by Galveston LNG, a privately owned Canadian energy development company. This presentation provided information on Kitimat LNG with particular reference to its terminal located in Bish Cove on the Douglas Channel in British Columbia. This LNG terminal is reported to be the only fully permitted regasification terminal on the west coast of Canada and the United States. The presentation addressed market fundamentals including several graphs, such as world natural gas proved reserves in 2006; LNG supplements to Canadian gas supplies; global LNG demand for 2005-2020; average annual United States LNG imports; and global LNG liquefaction projects. Other market fundamentals were described, including that Kitimat is the only other approved terminal aside from the Costa Azul terminal in Mexico; Kitimat is the only west coast LNG import terminal that connects to midwest and eastern North American markets through existing gas pipelines; LNG producers are looking for destination diversification; and markets and marketers are looking for supply diversification. The authors noted that by 2010, western Canadian gas demand will exceed Californian demand. Other topics that were discussed in the presentation included Canadian natural gas field receipts; unadjusted bitumen production outlook; oil sands gas demand; forward basis fundamentals; and the commercial drivers of the Kitimat LNG terminal. The presentation also discussed the pacific trail pipelines, a partnership between Galveston LNG and Pacific Northern Gas to develop the natural gas transmission line from Kitimat to Summit. The presentation concluded with a discussion of the benefits of Kitimat LNG terminal such as providing access to the largest natural gas markets in the world via major gas transmission lines with spare capacity. figs

  17. Identification of Cell Type-Specific Differences in Erythropoietin Receptor Signaling in Primary Erythroid and Lung Cancer Cells.

    Directory of Open Access Journals (Sweden)

    Ruth Merkle

    2016-08-01

    Full Text Available Lung cancer, with its most prevalent form non-small-cell lung carcinoma (NSCLC, is one of the leading causes of cancer-related deaths worldwide, and is commonly treated with chemotherapeutic drugs such as cisplatin. Lung cancer patients frequently suffer from chemotherapy-induced anemia, which can be treated with erythropoietin (EPO. However, studies have indicated that EPO not only promotes erythropoiesis in hematopoietic cells, but may also enhance survival of NSCLC cells. Here, we verified that the NSCLC cell line H838 expresses functional erythropoietin receptors (EPOR and that treatment with EPO reduces cisplatin-induced apoptosis. To pinpoint differences in EPO-induced survival signaling in erythroid progenitor cells (CFU-E, colony forming unit-erythroid and H838 cells, we combined mathematical modeling with a method for feature selection, the L1 regularization. Utilizing an example model and simulated data, we demonstrated that this approach enables the accurate identification and quantification of cell type-specific parameters. We applied our strategy to quantitative time-resolved data of EPO-induced JAK/STAT signaling generated by quantitative immunoblotting, mass spectrometry and quantitative real-time PCR (qRT-PCR in CFU-E and H838 cells as well as H838 cells overexpressing human EPOR (H838-HA-hEPOR. The established parsimonious mathematical model was able to simultaneously describe the data sets of CFU-E, H838 and H838-HA-hEPOR cells. Seven cell type-specific parameters were identified that included for example parameters for nuclear translocation of STAT5 and target gene induction. Cell type-specific differences in target gene induction were experimentally validated by qRT-PCR experiments. The systematic identification of pathway differences and sensitivities of EPOR signaling in CFU-E and H838 cells revealed potential targets for intervention to selectively inhibit EPO-induced signaling in the tumor cells but leave the responses in

  18. Generation of a High Number of Healthy Erythroid Cells from Gene-Edited Pyruvate Kinase Deficiency Patient-Specific Induced Pluripotent Stem Cells

    Directory of Open Access Journals (Sweden)

    Zita Garate

    2015-12-01

    Full Text Available Pyruvate kinase deficiency (PKD is a rare erythroid metabolic disease caused by mutations in the PKLR gene. Erythrocytes from PKD patients show an energetic imbalance causing chronic non-spherocytic hemolytic anemia, as pyruvate kinase defects impair ATP production in erythrocytes. We generated PKD induced pluripotent stem cells (PKDiPSCs from peripheral blood mononuclear cells (PB-MNCs of PKD patients by non-integrative Sendai viral vectors. PKDiPSCs were gene edited to integrate a partial codon-optimized R-type pyruvate kinase cDNA in the second intron of the PKLR gene by TALEN-mediated homologous recombination (HR. Notably, we found allele specificity of HR led by the presence of a single-nucleotide polymorphism. High numbers of erythroid cells derived from gene-edited PKDiPSCs showed correction of the energetic imbalance, providing an approach to correct metabolic erythroid diseases and demonstrating the practicality of this approach to generate the large cell numbers required for comprehensive biochemical and metabolic erythroid analyses.

  19. Nonleaking battery terminals.

    Science.gov (United States)

    Snider, W. E.; Nagle, W. J.

    1972-01-01

    Three different terminals were designed for usage in a 40 ampere/hour silver zinc battery which has a 45% KOH by weight electrolyte in a plastic battery case. Life tests, including thermal cycling, electrical charge and discharge for up to three years duration, were conducted on these three different terminal designs. Tests for creep rate and tensile strength were conducted on the polyphenylene oxide plastic battery cases. Some cases were unused and others containing KOH electrolyte were placed on life tests. The design and testing of nonleaking battery terminals for use with a KOH electrolyte in a plastic case are considered.

  20. Hydrogen terminal solubility in Zircaloy-4

    International Nuclear Information System (INIS)

    Vizcaino, Pablo; Banchik, Abrahan D.

    1999-01-01

    Terminal solubility temperature of hydrogen in zirconium and its alloys is an important parameter because hydrides precipitation embrittled these materials making them susceptible to the phenomenon known as retarded hydrogen cracking. This work continues the study presented in the 25 AATN Meeting. Within this framework, a study focused on determining these curves in recrystallized Zircaloy-4, using scanning differential calorimetric technique. Terminal solubility curves for Zircaloy-4 were constructed within a concentration range from 40 to 640 ppm in hydrogen weight and comparisons with results obtained by other authors were made. (author)

  1. Generation and Characterization of Erythroid Cells from Human Embryonic Stem Cells and Induced Pluripotent Stem Cells: An Overview

    Directory of Open Access Journals (Sweden)

    Kai-Hsin Chang

    2011-01-01

    Full Text Available Because of the imbalance in the supply and demand of red blood cells (RBCs, especially for alloimmunized patients or patients with rare blood phenotypes, extensive research has been done to generate therapeutic quantities of mature RBCs from hematopoietic stem cells of various sources, such as bone marrow, peripheral blood, and cord blood. Since human embryonic stem cells (hESCs and induced pluripotent stem cells (iPSCs can be maintained indefinitely in vitro, they represent potentially inexhaustible sources of donor-free RBCs. In contrast to other ex vivo stem-cell-derived cellular therapeutics, tumorigenesis is not a concern, as RBCs can be irradiated without marked adverse effects on in vivo function. Here, we provide a comprehensive review of the recent publications relevant to the generation and characterization of hESC- and iPSC-derived erythroid cells and discuss challenges to be met before the eventual realization of clinical usage of these cells.

  2. Tyrosine kinase receptor RON functions downstream of the erythropoietin receptor to induce expansion of erythroid progenitors

    NARCIS (Netherlands)

    van den Akker, Emile; van Dijk, Thamar; Parren-van Amelsvoort, Martine; Grossmann, Katja S.; Schaeper, Ute; Toney-Earley, Kenya; Waltz, Susan E.; Löwenberg, Bob; von Lindern, Marieke

    2004-01-01

    Erythropoietin (EPO) is required for cell survival during differentiation and for progenitor expansion during stress erythropoiesis. Although signaling pathways may couple directly to docking sites on the EPO receptor (EpoR), additional docking molecules expand the signaling platform of the

  3. Nontraumatic terminal ileal perforation

    Directory of Open Access Journals (Sweden)

    Wani Rauf A

    2006-03-01

    Full Text Available Abstract Background There is still confusion and controversy over the diagnosis and optimal surgical treatment of non traumatic terminal ileal perforation-a cause of obscure peritonitis. Methods This study was a prospective study aimed at evaluating the clinical profile, etiology and optimal surgical management of patients with nontraumatic terminal ileal perforation. Results There were 79 cases of nontraumatic terminal ileal perforation; the causes for perforation were enteric fever(62%, nonspecific inflammation(26%, obstruction(6%, tuberculosis(4% and radiation enteritis (1%. Simple closure of the perforation (49% and end to side ileotransverse anastomosis(42% were the mainstay of the surgical management. Conclusion Terminal ileal perforation should be suspected in all cases of peritonitis especially in developing countries and surgical treatment should be optimized taking various accounts like etiology, delay in surgery and operative findings into consideration to reduce the incidence of deadly complications like fecal fistula.

  4. Terminated Multifamily Mortgages Database

    Data.gov (United States)

    Department of Housing and Urban Development — This dataset includes all terminated HUD Multifamily mortgages except those from the Hospital Mortgage Insurance Program. It includes the Holder and Servicer at the...

  5. Coal terminal directory

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    2008-06-15

    The directory gives a comprehensive listing of the world's coal terminals, in a total of 50 countries including information on throughput, facilities, storage capacity, and vessel size limitation.

  6. Visual communication and terminal equipment

    International Nuclear Information System (INIS)

    Kang, Cheol Hui

    1988-06-01

    This book is divided two parts about visual communication and terminal equipment. The first part introduces visual communication, which deals with foundation of visual communication, technique of visual communication, equipment of visual communication, a facsimile and pictorial image system. The second part contains terminal equipment such as telephone, terminal equipment for data transmission on constitution and constituent of terminal equipment for data transmission, input device and output device, terminal device and up-to-date terminal device.

  7. Visual communication and terminal equipment

    Energy Technology Data Exchange (ETDEWEB)

    Kang, Cheol Hui

    1988-06-15

    This book is divided two parts about visual communication and terminal equipment. The first part introduces visual communication, which deals with foundation of visual communication, technique of visual communication, equipment of visual communication, a facsimile and pictorial image system. The second part contains terminal equipment such as telephone, terminal equipment for data transmission on constitution and constituent of terminal equipment for data transmission, input device and output device, terminal device and up-to-date terminal device.

  8. Tandem Terminal Ion Source

    International Nuclear Information System (INIS)

    Harper, G.C.; Lindner, C.E.; Myers, A.W.; Wechel, T.D. van

    2000-01-01

    OAK-B135 Tandem Terminal Ion Source. The terminal ion source (TIS) was used in several experiments during this reporting period, all for the 7 Be(γ) 8 B experiment. Most of the runs used 1 H + at terminal voltages from 0.3 MV to 1.5 MV. One of the runs used 2 H + at terminal voltage of 1.4 MV. The other run used 4 He + at a terminal voltage of 1.37 MV. The list of experiments run with the TIS to date is given in table 1 below. The tank was opened four times for unscheduled source repairs. On one occasion the tank was opened to replace the einzel lens power supply which had failed. The 10 kV unit was replaced with a 15 kV unit. The second time the tank was opened to repair the extractor supply which was damaged by a tank spark. On the next occasion the tank was opened to replace a source canal which had sputtered away. Finally, the tank was opened to replace the discharge bottle which had been coated with aluminum sputtered from the exit canal

  9. Tandem Terminal Ion Source

    International Nuclear Information System (INIS)

    None

    2000-01-01

    OAK-B135 Tandem Terminal Ion Source. The terminal ion source (TIS) was used in several experiments during this reporting period, all for the(sup 7)Be((gamma))(sup 8)B experiment. Most of the runs used(sup 1)H(sup+) at terminal voltages from 0.3 MV to 1.5 MV. One of the runs used(sup 2)H(sup+) at terminal voltage of 1.4 MV. The other run used(sup 4)He(sup+) at a terminal voltage of 1.37 MV. The list of experiments run with the TIS to date is given in table 1 below. The tank was opened four times for unscheduled source repairs. On one occasion the tank was opened to replace the einzel lens power supply which had failed. The 10 kV unit was replaced with a 15 kV unit. The second time the tank was opened to repair the extractor supply which was damaged by a tank spark. On the next occasion the tank was opened to replace a source canal which had sputtered away. Finally, the tank was opened to replace the discharge bottle which had been coated with aluminum sputtered from the exit canal

  10. Windows Terminal Servers Orchestration

    Science.gov (United States)

    Bukowiec, Sebastian; Gaspar, Ricardo; Smith, Tim

    2017-10-01

    Windows Terminal Servers provide application gateways for various parts of the CERN accelerator complex, used by hundreds of CERN users every day. The combination of new tools such as Puppet, HAProxy and Microsoft System Center suite enable automation of provisioning workflows to provide a terminal server infrastructure that can scale up and down in an automated manner. The orchestration does not only reduce the time and effort necessary to deploy new instances, but also facilitates operations such as patching, analysis and recreation of compromised nodes as well as catering for workload peaks.

  11. Differential Equations as Actions

    DEFF Research Database (Denmark)

    Ronkko, Mauno; Ravn, Anders P.

    1997-01-01

    We extend a conventional action system with a primitive action consisting of a differential equation and an evolution invariant. The semantics is given by a predicate transformer. The weakest liberal precondition is chosen, because it is not always desirable that steps corresponding to differential...... actions shall terminate. It is shown that the proposed differential action has a semantics which corresponds to a discrete approximation when the discrete step size goes to zero. The extension gives action systems the power to model real-time clocks and continuous evolutions within hybrid systems....

  12. The Tiny Terminators

    Indian Academy of Sciences (India)

    Home; Journals; Resonance – Journal of Science Education; Volume 6; Issue 5. The Tiny Terminators - Mosquitoes and Diseases. P K Sumodan. General Article Volume 6 Issue 5 May 2001 pp 48-55. Fulltext. Click here to view fulltext PDF. Permanent link: https://www.ias.ac.in/article/fulltext/reso/006/05/0048-0055 ...

  13. Making Wireless Terminals Simpler

    DEFF Research Database (Denmark)

    Christensen, Søren Skovgaard; Popovski, Petar; De Carvalho, Elisabeth

    2005-01-01

    equalization in the downlink, which these requirements lead to. We propose to solve the problem by applying pre-processing at the base station, thereby rendering the terminal simple. We establish a general MIMO block transmission model, and derive different transmit/receive filters, based on the Linear Minimum...

  14. Trauma and termination.

    Science.gov (United States)

    Ferraro, F

    1995-02-01

    The author suggests a particular reading of the thesis put forward by Freud in 'Analysis terminable and interminable' that an effective and more definitive conclusion may be expected in analyses of cases with traumatic aetiology. This reading shifts the emphasis from the patient's history to the possibility of its crystallising in focal nuclei emerging within the analytic relationship under the pressure of the termination. The revival of separation anxieties which cannot be worked through, and their crystallisation in precipitating traumatic events, may give rise to decisive psychic work allowing the analysis to be brought to a conclusion. Two case histories are presented to show how the end of the analysis assumes the form of a new trauma, which reactivates in the present, traumatic anxieties from the patient's own infantile history. In the first case a premature birth and in the second a miscarriage, originally experienced as isolated automatic events without time or history, are relived in the terminal phase as vicissitudes of the transference, so that new meaning can be assigned to them and they can be withdrawn from the somatic cycle of repetition. The powerful tendency to act out and the intense countertransference pressure on the analyst are discussed in the light of the specificities of this phase, which is crucial to the success of the analysis. This leads to a re-examination, in the concluding notes, of some theoretical questions inherent in the problem of the termination and, in particular, to a discussion of the ambiguous concept of a natural ending.

  15. Prematurely terminated slug tests

    International Nuclear Information System (INIS)

    Karasaki, K.

    1990-07-01

    A solution of the well response to a prematurely terminated slug test (PTST) is presented. The advantages of a PTST over conventional slug tests are discussed. A systematized procedure of a PTST is proposed, where a slug test is terminated in the midpoint of the flow point, and the subsequent shut-in data is recorded and analyzed. This method requires a downhole shut-in device and a pressure transducer, which is no more than the conventional deep-well slug testing. As opposed to slug tests, which are ineffective when a skin is present, more accurate estimate of formation permeability can be made using a PTST. Premature termination also shortens the test duration considerably. Because in most cases no more information is gained by completing a slug test to the end, the author recommends that conventional slug tests be replaced by the premature termination technique. This study is part of an investigation of the feasibility of geologic isolation of nuclear wastes being carried out by the US Department of Energy and the National Cooperative for the Storage of Radioactive Waste of Switzerland

  16. EPO Receptor Gain-of-Function Causes Hereditary Polycythemia, Alters CD34+ Cell Differentiation and Increases Circulating Endothelial Precursors

    Science.gov (United States)

    Perrotta, Silverio; Cucciolla, Valeria; Ferraro, Marcella; Ronzoni, Luisa; Tramontano, Annunziata; Rossi, Francesca; Scudieri, Anna Chiara; Borriello, Adriana; Roberti, Domenico; Nobili, Bruno; Cappellini, Maria Domenica; Oliva, Adriana; Amendola, Giovanni; Migliaccio, Anna Rita; Mancuso, Patrizia; Martin-Padura, Ines; Bertolini, Francesco; Yoon, Donghoon; Prchal, Josef T.; Della Ragione, Fulvio

    2010-01-01

    Background Gain-of-function of erythropoietin receptor (EPOR) mutations represent the major cause of primary hereditary polycythemia. EPOR is also found in non-erythroid tissues, although its physiological role is still undefined. Methodology/Principal Findings We describe a family with polycythemia due to a heterozygous mutation of the EPOR gene that causes a G→T change at nucleotide 1251 of exon 8. The novel EPOR G1251T mutation results in the replacement of a glutamate residue by a stop codon at amino acid 393. Differently from polycythemia vera, EPOR G1251T CD34+ cells proliferate and differentiate towards the erythroid phenotype in the presence of minimal amounts of EPO. Moreover, the affected individuals show a 20-fold increase of circulating endothelial precursors. The analysis of erythroid precursor membranes demonstrates a heretofore undescribed accumulation of the truncated EPOR, probably due to the absence of residues involved in the EPO-dependent receptor internalization and degradation. Mutated receptor expression in EPOR-negative cells results in EPOR and Stat5 phosphorylation. Moreover, patient erythroid precursors present an increased activation of EPOR and its effectors, including Stat5 and Erk1/2 pathway. Conclusions/Significance Our data provide an unanticipated mechanism for autosomal dominant inherited polycythemia due to a heterozygous EPOR mutation and suggest a regulatory role of EPO/EPOR pathway in human circulating endothelial precursors homeostasis. PMID:20700488

  17. A common signaling pathway is activated in erythroid cells expressing high levels of fetal hemoglobin: a potential role for cAMP-elevating agents in β-globin disorders

    Directory of Open Access Journals (Sweden)

    Ikuta T

    2013-12-01

    Full Text Available Tohru Ikuta,1 Yuichi Kuroyanagi,1 Nadine Odo,1 Siyang Liu21Department of Anesthesiology and Perioperative Medicine, 2Department of Physiology, Medical College of Georgia, Georgia Regents University, Augusta, GA, USABackground: Although erythroid cells prepared from fetal liver, cord blood, or blood from β-thalassemia patients are known to express fetal hemoglobin at high levels, the underlying mechanisms remain elusive. We previously showed that cyclic nucleotides such as cAMP and cGMP induce fetal hemoglobin expression in primary erythroid cells. Here we report that cAMP signaling contributes to high-level fetal hemoglobin expression in erythroid cells prepared from cord blood and β-thalassemia.Methods: The status of the cAMP signaling pathway was investigated using primary erythroid cells prepared from cord blood and the mononuclear cells of patients with β-thalassemia; erythroid cells from adult bone marrow mononuclear cells served as the control.Results: We found that intracellular cAMP levels were higher in erythroid cells from cord blood and β-thalassemia than from adult bone marrow. Protein kinase A activity levels and cAMP-response element binding protein phosphorylation were higher in erythroid cells from cord blood or β-thalassemia than in adult bone marrow progenitors. Mitogen-activated protein kinase pathways, which play a role in fetal hemoglobin expression, were not consistently activated in cord blood or β-thalassemia erythroid cells. When cAMP signaling was activated in adult erythroid cells, fetal hemoglobin was induced at high levels and associated with reduced expression of BCL11A, a silencer of the β-globin gene.Conclusion: These results suggest that activated cAMP signaling may be a common mechanism among erythroid cells with high fetal hemoglobin levels, in part because of downregulation of BCL11A. Activation of the cAMP signaling pathway with cAMP-elevating agents may prove to be an important signaling mechanism to

  18. Leishmania donovani infection induces anemia in hamsters by differentially altering erythropoiesis in bone marrow and spleen.

    Directory of Open Access Journals (Sweden)

    William P Lafuse

    Full Text Available Leishmania donovani is a parasite that causes visceral leishmaniasis by infecting and replicating in macrophages of the bone marrow, spleen, and liver. Severe anemia and leucopenia is associated with the disease. Although immune defense mechanisms against the parasite have been studied, we have a limited understanding of how L. donovani alters hematopoiesis. In this study, we used Syrian golden hamsters to investigate effects of L. donovani infection on erythropoiesis. Infection resulted in severe anemia and leucopenia by 8 weeks post-infection. Anemia was associated with increased levels of serum erythropoietin, which indicates the hamsters respond to the anemia by producing erythropoietin. We found that infection also increased numbers of BFU-E and CFU-E progenitor populations in the spleen and bone marrow and differentially altered erythroid gene expression in these organs. In the bone marrow, the mRNA expression of erythroid differentiation genes (α-globin, β-globin, ALAS2 were inhibited by 50%, but mRNA levels of erythroid receptor (c-kit, EpoR and transcription factors (GATA1, GATA2, FOG1 were not affected by the infection. This suggests that infection has a negative effect on differentiation of erythroblasts. In the spleen, erythroid gene expression was enhanced by infection, indicating that the anemia activates a stress erythropoiesis response in the spleen. Analysis of cytokine mRNA levels in spleen and bone marrow found that IFN-γ mRNA is highly increased by L. donovani infection. Expression of the IFN-γ inducible cytokine, TNF-related apoptosis-inducing ligand (TRAIL, was also up-regulated. Since TRAIL induces erythroblasts apoptosis, apoptosis of bone marrow erythroblasts from infected hamsters was examined by flow cytometry. Percentage of erythroblasts that were apoptotic was significantly increased by L. donovani infection. Together, our results suggest that L. donovani infection inhibits erythropoiesis in the bone marrow by

  19. NPOESS Field Terminal Updates

    Science.gov (United States)

    Heckmann, G.; Route, G.

    2009-12-01

    The National Oceanic and Atmospheric Administration (NOAA), Department of Defense (DoD), and National Aeronautics and Space Administration (NASA) are jointly acquiring the next-generation weather and environmental satellite system; the National Polar-orbiting Operational Environmental Satellite System (NPOESS). NPOESS replaces the current Polar-orbiting Operational Environmental Satellites (POES) managed by NOAA and the Defense Meteorological Satellite Program (DMSP) managed by the DoD. The NPOESS satellites carry a suite of sensors that collect meteorological, oceanographic, climatological, and solar-geophysical observations of the earth, atmosphere, and space. The ground data processing segment for NPOESS is the Interface Data Processing Segment (IDPS), developed by Raytheon Intelligence and Information Systems. The IDPS processes NPOESS satellite data to provide environmental data products (aka, Environmental Data Records or EDRs) to NOAA and DoD processing centers operated by the United States government. The IDPS will process EDRs beginning with the NPOESS Preparatory Project (NPP) and continuing through the lifetime of the NPOESS system. IDPS also provides the software and requirements for the Field Terminal Segment (FTS). NPOESS provides support to deployed field terminals by providing mission data in the Low Rate and High Rate downlinks (LRD/HRD), mission support data needed to generate EDRs and decryption keys needed to decrypt mission data during Selective data Encryption (SDE). Mission support data consists of globally relevant data, geographically constrained data, and two line element sets. NPOESS provides these mission support data via the Internet accessible Mission Support Data Server and HRD/LRD downlinks. This presentation will illustrate and describe the NPOESS capabilities in support of Field Terminal users. This discussion will include the mission support data available to Field Terminal users, content of the direct broadcast HRD and LRD

  20. Disruption of the 5S RNP-Mdm2 interaction significantly improves the erythroid defect in a mouse model for Diamond-Blackfan anemia.

    Science.gov (United States)

    Jaako, P; Debnath, S; Olsson, K; Zhang, Y; Flygare, J; Lindström, M S; Bryder, D; Karlsson, S

    2015-11-01

    Diamond-Blackfan anemia (DBA) is a congenital erythroid hypoplasia caused by haploinsufficiency of genes encoding ribosomal proteins (RPs). Perturbed ribosome biogenesis in DBA has been shown to induce a p53-mediated ribosomal stress response. However, the mechanisms of p53 activation and its relevance for the erythroid defect remain elusive. Previous studies have indicated that activation of p53 is caused by the inhibition of mouse double minute 2 (Mdm2), the main negative regulator of p53, by the 5S ribonucleoprotein particle (RNP). Meanwhile, it is not clear whether this mechanism solely mediates the p53-dependent component found in DBA. To approach this question, we crossed our mouse model for RPS19-deficient DBA with Mdm2(C305F) knock-in mice that have a disrupted 5S RNP-Mdm2 interaction. Upon induction of the Rps19 deficiency, Mdm2(C305F) reversed the p53 response and improved expansion of hematopoietic progenitors in vitro, and ameliorated the anemia in vivo. Unexpectedly, disruption of the 5S RNP-Mdm2 interaction also led to selective defect in erythropoiesis. Our findings highlight the sensitivity of erythroid progenitor cells to aberrations in p53 homeostasis mediated by the 5S RNP-Mdm2 interaction. Finally, we provide evidence indicating that physiological activation of the 5S RNP-Mdm2-p53 pathway may contribute to functional decline of the hematopoietic system in a cell-autonomous manner over time.

  1. Synergistic Effect of Sodium Butyrate and Thalidomide in the Induction of Fetal Hemoglobin Expression in Erythroid Progenitors Derived from Cord Blood CD133 + Cells

    Directory of Open Access Journals (Sweden)

    Ali Dehghanifard

    2012-07-01

    Full Text Available Background: The use of drugs with the ability to induce production of fetal hemoglobin as a novel therapeutic approach in treating β-Hemoglobinopathies is considered. γ-globin gene expression inducer drugs including sodium butyrate and thalidomide can reduce additional α-globin chains accumulation in erythroid precursors. Materials and Methods: In this experimental study, MACS kit was used to isolate CD133+ cells of umbilical cord blood. Further, the effect of two drugs of thalidomide and sodium butyrate were separately and combined studied on the induction of quantitative expression of β-globin and γ-globin genes in erythroid precursor cells derived from CD133+ stem cells in-vitro. For this purpose, the technique SYBR green Real-time PCR was used.Results: Flow cytometry results showed that approximately 95% of purified cells were CD133+. Real-time PCR results also showed the increased levels of γ-globin mRNA in the cell groups treated with thalidomide, sodium butyrate and combination of drugs as 2.6 and 1.2 and 3.5 times respectively, and for β-globin gene, it is respectively 1.4 and 1.3 and 1.6 times compared with the control group (p<0.05.Conclusion: The study results showed that the mentioned drug combination can act as a pharmaceutical composition affecting the induction of fetal hemoglobin expression in erythroid precursor cells derived from CD133 + cells.

  2. The effects of erythropoietin signaling on telomerase regulation in non-erythroid malignant and non-malignant cells

    International Nuclear Information System (INIS)

    Uziel, Orit; Kanfer, Gil; Beery, Einat; Yelin, Dana; Shepshelovich, Daniel; Bakhanashvili, Mary; Nordenberg, Jardena; Lahav, Meir

    2014-01-01

    Highlights: • We assumed that some of erythropoietin adverse effects may be mediated by telomerase activity. • EPO administration increased telomerase activity, cells proliferation and migration. • The inhibition of telomerase modestly repressed the proliferative effect of erythropoietin. • Telomere shortening caused by long term inhibition of the enzyme totally abolished that effect. • This effect was mediated via the Lyn–AKT axis and not by the canonical JAK2–STAT pathway. - Abstract: Treatment with erythropoietin (EPO) in several cancers is associated with decreased survival due to cancer progression. Due to the major importance of telomerase in cancer biology we hypothesized that some of these effects may be mediated through EPO effect on telomerase. For this aim we explored the possible effects of EPO on telomerase regulation, cell migration and chemosensitivity in non-erythroid malignant and non-malignant cells. Cell proliferation, telomerase activity (TA) and cell migration increased in response to EPO. EPO had no effect on cancer cells sensitivity to cisplatinum and on the cell cycle status. The inhibition of telomerase modestly repressed the proliferative effect of EPO. Telomere shortening caused by long term inhibition of the enzyme abolished the effect of EPO, suggesting that EPO effects on cancer cells are related to telomere dynamics. TA was correlated with the levels of Epo-R. The increase in TA was mediated post-translationally through the Lyn-Src and not the canonical JAK2 pathway

  3. A protective role of nuclear factor-erythroid 2-related factor-2 (Nrf2) in inflammatory disorders

    International Nuclear Information System (INIS)

    Kim, Jiyoung; Cha, Young-Nam; Surh, Young-Joon

    2010-01-01

    Nuclear factor-erythroid 2-related factor-2 (Nrf2) is a key transcription factor that plays a central role in cellular defense against oxidative and electrophilic insults by timely induction of antioxidative and phase-2 detoxifying enzymes and related stress-response proteins. The 5'-flanking regions of genes encoding these cytoprotective proteins contain a specific consensus sequence termed antioxidant response element (ARE) to which Nrf2 binds. Recent studies have demonstrated that Nrf2-ARE signaling is also involved in attenuating inflammation-associated pathogenesis, such as autoimmune diseases, rheumatoid arthritis, asthma, emphysema, gastritis, colitis and atherosclerosis. Thus, disruption or loss of Nrf2 signaling causes enhanced susceptibility not only to oxidative and electrophilic stresses but also to inflammatory tissue injuries. During the early-phase of inflammation-mediated tissue damage, activation of Nrf2-ARE might inhibit the production or expression of pro-inflammatory mediators including cytokines, chemokines, cell adhesion molecules, matrix metalloproteinases, cyclooxygenase-2 and inducible nitric oxide synthase. It is likely that the cytoprotective function of genes targeted by Nrf2 may cooperatively regulate the innate immune response and also repress the induction of pro-inflammatory genes. This review highlights the protective role of Nrf2 in inflammation-mediated disorders with special focus on the inflammatory signaling modulated by this redox-regulated transcription factor.

  4. A protective role of nuclear factor-erythroid 2-related factor-2 (Nrf2) in inflammatory disorders

    Energy Technology Data Exchange (ETDEWEB)

    Kim, Jiyoung [National Research Laboratory, College of Pharmacy, Graduate School of Convergence Science and Technology, Seoul National University, Seoul 151-742 (Korea, Republic of); Cha, Young-Nam [Inha University College of Medicine, Incheon 382-751 (Korea, Republic of); Surh, Young-Joon, E-mail: surh@plaza.snu.ac.kr [National Research Laboratory, College of Pharmacy, Graduate School of Convergence Science and Technology, Seoul National University, Seoul 151-742 (Korea, Republic of); Department of Molecular Medicine and Biopharmaceutical Sciences, Graduate School of Convergence Science and Technology, Seoul National University, Seoul 151-742 (Korea, Republic of); Cancer Research Institute, Seoul National University, Seoul 110-799 (Korea, Republic of)

    2010-08-07

    Nuclear factor-erythroid 2-related factor-2 (Nrf2) is a key transcription factor that plays a central role in cellular defense against oxidative and electrophilic insults by timely induction of antioxidative and phase-2 detoxifying enzymes and related stress-response proteins. The 5'-flanking regions of genes encoding these cytoprotective proteins contain a specific consensus sequence termed antioxidant response element (ARE) to which Nrf2 binds. Recent studies have demonstrated that Nrf2-ARE signaling is also involved in attenuating inflammation-associated pathogenesis, such as autoimmune diseases, rheumatoid arthritis, asthma, emphysema, gastritis, colitis and atherosclerosis. Thus, disruption or loss of Nrf2 signaling causes enhanced susceptibility not only to oxidative and electrophilic stresses but also to inflammatory tissue injuries. During the early-phase of inflammation-mediated tissue damage, activation of Nrf2-ARE might inhibit the production or expression of pro-inflammatory mediators including cytokines, chemokines, cell adhesion molecules, matrix metalloproteinases, cyclooxygenase-2 and inducible nitric oxide synthase. It is likely that the cytoprotective function of genes targeted by Nrf2 may cooperatively regulate the innate immune response and also repress the induction of pro-inflammatory genes. This review highlights the protective role of Nrf2 in inflammation-mediated disorders with special focus on the inflammatory signaling modulated by this redox-regulated transcription factor.

  5. Role of Nuclear Factor (Erythroid-Derived 2-Like 2 Signaling for Effects of Fumaric Acid Esters on Dendritic Cells

    Directory of Open Access Journals (Sweden)

    Anna Hammer

    2017-12-01

    Full Text Available To date, the intracellular signaling pathways involved in dendritic cell (DC function are poorly understood. The antioxidative transcription factor nuclear factor (erythroid-derived 2-like 2 (Nrf2 has been shown to affect maturation, function, and subsequent DC-mediated T cell responses of murine and human DCs. In experimental autoimmune encephalomyelitis (EAE, as prototype animal model for a T helper cell-mediated autoimmune disease, antigen presentation, cytokine production, and costimulation by DCs play a major role. We explore the role of Nrf2 in DC function, and DC-mediated T cell responses during T cell-mediated autoimmunity of the central nervous system using genetic ablation and pharmacological activation in mice and men to corroborate our data in a translational setting. In murine and human DCs, monomethyl fumarate induced Nrf2 signaling inhibits DC maturation and DC-mediated T cell proliferation by reducing inflammatory cytokine production and expression of costimulatory molecules. In contrast, Nrf2-deficient DCs generate more activated T helper cells (Th1/Th17 but fewer regulatory T cells and foster T cell proliferation. Transfer of DCs with Nrf2 activation during active EAE reduces disease severity and T cell infiltration. Our data demonstrate that Nrf2 signaling modulates autoimmunity in murine and human systems via inhibiting DC maturation and function thus shedding further light on the mechanism of action of antioxidative stress pathways in antigen-presenting cells.

  6. Nuclear factor erythroid 2-related factor-2 activity controls 4-hydroxynonenal metabolism and activity in prostate cancer cells.

    Science.gov (United States)

    Pettazzoni, Piergiorgio; Ciamporcero, Eric; Medana, Claudio; Pizzimenti, Stefania; Dal Bello, Federica; Minero, Valerio Giacomo; Toaldo, Cristina; Minelli, Rosalba; Uchida, Koji; Dianzani, Mario Umberto; Pili, Roberto; Barrera, Giuseppina

    2011-10-15

    4-Hydroxynonenal (HNE) is an end product of lipoperoxidation with antiproliferative and proapoptotic properties in various tumors. Here we report a greater sensitivity to HNE in PC3 and LNCaP cells compared to DU145 cells. In contrast to PC3 and LNCaP cells, HNE-treated DU145 cells showed a smaller reduction in growth and did not undergo apoptosis. In DU145 cells, HNE did not induce ROS production and DNA damage and generated a lower amount of HNE-protein adducts. DU145 cells had a greater GSH and GST A4 content and GSH/GST-mediated HNE detoxification. Nuclear factor erythroid 2-related factor-2 (Nrf2) is a regulator of the antioxidant response. Nrf2 protein content and nuclear accumulation were higher in DU145 cells compared to PC3 and LNCaP cells, whereas the expression of KEAP1, the main negative regulator of Nrf2 activity, was lower. Inhibition of Nrf2 expression with specific siRNA resulted in a reduction in GST A4 expression and GS-HNE formation, indicating that Nrf2 controls HNE metabolism. In addition, Nrf2 knockdown sensitized DU145 cells to HNE-mediated antiproliferative and proapoptotic activity. In conclusion, we demonstrated that increased Nrf2 activity resulted in a reduction in HNE sensitivity in prostate cancer cells, suggesting a potential mechanism of resistance to pro-oxidant therapy. Copyright © 2011 Elsevier Inc. All rights reserved.

  7. The effects of erythropoietin signaling on telomerase regulation in non-erythroid malignant and non-malignant cells

    Energy Technology Data Exchange (ETDEWEB)

    Uziel, Orit, E-mail: Oritu@clalit.org.il [Felsenstein Medical Research Center, Sackler School of Medicine, Tel-Aviv University, Ramat-Aviv (Israel); Kanfer, Gil [Felsenstein Medical Research Center, Sackler School of Medicine, Tel-Aviv University, Ramat-Aviv (Israel); Dep. of Human Molecular Genetics and Biochemistry, Sackler School of Medicine, Tel-Aviv University, Ramat-Aviv (Israel); Beery, Einat [Felsenstein Medical Research Center, Sackler School of Medicine, Tel-Aviv University, Ramat-Aviv (Israel); Yelin, Dana; Shepshelovich, Daniel [Medicine A, Sackler School of Medicine, Tel-Aviv University, Ramat-Aviv (Israel); Bakhanashvili, Mary [Unit of Infectious Diseases, Sheba Medical Center, Tel-Hashomer (Israel); Nordenberg, Jardena [Felsenstein Medical Research Center, Sackler School of Medicine, Tel-Aviv University, Ramat-Aviv (Israel); Dep. of Human Molecular Genetics and Biochemistry, Sackler School of Medicine, Tel-Aviv University, Ramat-Aviv (Israel); Endocrinology Laboratory, Beilinson Medical Center, Petah-Tikva (Israel); Lahav, Meir [Felsenstein Medical Research Center, Sackler School of Medicine, Tel-Aviv University, Ramat-Aviv (Israel); Medicine A, Sackler School of Medicine, Tel-Aviv University, Ramat-Aviv (Israel)

    2014-07-18

    Highlights: • We assumed that some of erythropoietin adverse effects may be mediated by telomerase activity. • EPO administration increased telomerase activity, cells proliferation and migration. • The inhibition of telomerase modestly repressed the proliferative effect of erythropoietin. • Telomere shortening caused by long term inhibition of the enzyme totally abolished that effect. • This effect was mediated via the Lyn–AKT axis and not by the canonical JAK2–STAT pathway. - Abstract: Treatment with erythropoietin (EPO) in several cancers is associated with decreased survival due to cancer progression. Due to the major importance of telomerase in cancer biology we hypothesized that some of these effects may be mediated through EPO effect on telomerase. For this aim we explored the possible effects of EPO on telomerase regulation, cell migration and chemosensitivity in non-erythroid malignant and non-malignant cells. Cell proliferation, telomerase activity (TA) and cell migration increased in response to EPO. EPO had no effect on cancer cells sensitivity to cisplatinum and on the cell cycle status. The inhibition of telomerase modestly repressed the proliferative effect of EPO. Telomere shortening caused by long term inhibition of the enzyme abolished the effect of EPO, suggesting that EPO effects on cancer cells are related to telomere dynamics. TA was correlated with the levels of Epo-R. The increase in TA was mediated post-translationally through the Lyn-Src and not the canonical JAK2 pathway.

  8. Reduced Expression of Siglec-7, NKG2A, and CD57 on Terminally Differentiated CD56-CD16+ Natural Killer Cell Subset Is Associated with Natural Killer Cell Dysfunction in Chronic HIV-1 Clade C Infection.

    Science.gov (United States)

    Zulu, Michael Z; Naidoo, Kewreshini K; Mncube, Zenele; Jaggernath, Manjeetha; Goulder, Philip J R; Ndung'u, Thumbi; Altfeld, Marcus; Thobakgale, Christina F

    2017-12-01

    HIV-1 viremia has been shown to induce several phenotypic and functional abnormalities in natural killer (NK) cells. To assess immune defects associated with HIV viremia, we examined NK cell function, differentiation status, and phenotypic alterations based on expression of inhibitory and activating receptors on NK cells in HIV-1 subtype C chronically infected participants from Durban, South Africa. NK cell phenotypic profiles were characterized by assessing sialic acid-binding immunoglobulin-like lectin-7 (Siglec-7), NKG2A, and NKG2C markers on frozen peripheral blood mononuclear cells from viremic, antiretroviral therapy (ART)-naive HIV-1 chronically infected participants (n = 23), HIV-1 chronically infected participants who had been on combination antiretroviral therapy (cART) for at least 12 months (n = 23) compared with healthy donors (n = 23). NK cell differentiation was assessed by measurement of killer immunoglobulin receptor (KIR) and NKG2A expression; CD57 and CD107a measurements were carried out in HIV viremic and healthy donors. All phenotypic and functional assessments were analyzed by using multicolor flow cytometry. HIV-1-infected participants displayed greater frequencies of the CD56 - CD16 + (CD56negative) NK cell subset compared with healthy donors (p < .0001). Downregulation of Siglec-7 and NKG2A and upregulation of NKG2C were more pronounced in the CD56negative NK cell subset of viremic participants. The CD56negative subset demonstrated a differentiated (KIR + NKG2A - ) phenotype with reduced CD57 expression and lower degranulation capacity in HIV-1-infected participants compared with healthy donors. HIV-1 infection induces the expansion of the CD56negative NK cell subset marked by altered receptor expression profiles that are indicative of impaired function and may explain the overall NK cell dysfunction observed in chronic HIV-1 infection.

  9. Antecedents of Customer Relationship Termination

    DEFF Research Database (Denmark)

    Geersbro, Jens; Ritter, Thomas

    To end business relationships, or to more actively terminate relationships, has long been acknowledged as part of customer relationship management. However, compared to other elements such as initiation and maintenance of relationships, little is known about the termination of business...... relationships as a managerial task. This paper contributes by (1) developing a conceptualization of relationship termination competence and (2) analyzing its antecedents. The empirical results identify termination acceptance, definition non-customers, organizational relationship termination routines......, and motivation as significant antecedents. Because of this, managers need to develop their organizations in order to use relationship termination as a vital strategy....

  10. Evaluation of effects of various drugs on platelet functions using phorbol 12-myristate 13-acetate-induced megakaryocytic human erythroid leukemia cells

    Directory of Open Access Journals (Sweden)

    Tada T

    2016-09-01

    Full Text Available Tomoki Tada,1 Kensaku Aki,2 Wataru Oboshi,1,3 Kazuyoshi Kawazoe,4 Toshiyuki Yasui,5 Eiji Hosoi2 1Subdivision of Biomedical Laboratory Sciences, Graduate School of Health Sciences, Tokushima University, 2Department of Cells and Immunity Analytics, Institute of Biomedical Sciences, Tokushima University Graduate School, Tokushima, 3Department of Medical Technology, Kagawa Prefectural University of Health Sciences, Kagawa, 4Department of Clinical Pharmacy Practice Pedagogy, Institute of Biomedical Sciences, 5Department of Reproductive and Menopausal Medicine, Institute of Biomedical Sciences, Tokushima University Graduate School, Tokushima, Japan Background: The hyperfunction and activation of platelets have been strongly implicated in the development and recurrence of arterial occlusive disease, and various antiplatelet drugs are used to treat and prevent such diseases. New antiplatelet drugs and many other drugs have been developed, but some drugs may have adverse effects on platelet functions. Objective: The aim of this study was to establish an evaluation method for evaluating the effect and adverse effect of various drugs on platelet functions. Materials and methods: Human erythroid leukemia (HEL cells were used after megakaryocytic differentiation with phorbol 12-myristate 13-acetate as an alternative to platelets. Drugs were evaluated by changes in intracellular Ca2+ concentration ([Ca2+]i mobilization in Fura2-loaded phorbol 12-myristate 13-acetate-induced HEL cells. Aspirin and cilostazol were selected as antiplatelet drugs and ibuprofen and sodium valproate as other drugs. Results: There was a positive correlation between [Ca2+]i and platelet aggregation induced by thrombin. Aspirin (5.6–560 µM and cilostazol (5–10 µM significantly inhibited thrombin-induced increases in [Ca2+]i in a concentration-dependent manner. On the other hand, ibuprofen (8–200 µM and sodium valproate (50–1,000 µg/mL also significantly inhibited

  11. Synthesis and characterization of phenylethynylcarbonyl terminated novel thermosetting imide compound

    Directory of Open Access Journals (Sweden)

    H. Kimura

    2013-02-01

    Full Text Available Phenylethynyl terminated novel imide compound based on 1,3-bis(3-aminophenoxybenzene (APB and phenylethynyl trimellitic anhydride (PETA were prepared. The curing behavior of phenylethynyl terminated imide compound was investigated by differential scanning calorimetry and Fourier transform infrared spectrometry. The curing reaction of phenylethynylcarbonyl end group completed at 220°C, and proceeded much faster than that of phenylethynyl end group. Glass transition temperature of the thermosetting resin from phenylethynylcarbonyl terminated novel imide compound determined by dynamic mechanical analysis was almost the same as that of o-cresolnovolac type epoxy resin. In addition, the thermosetting resin from phenylethynylcarbonyl terminated novel imide compound exhibited excellent thermal and dimensional stabilities. These excellent properties of these phenylethynyl terminated imide compound might be due to the incorporation of alkene group or aromatic ring substitutes in the backbones, which might enhance the chain interaction (molecular packing and reduce the molecular chain mobility.

  12. One-dimensional TRFLP-SSCP is an effective DNA fingerprinting strategy for soil Archaea that is able to simultaneously differentiate broad taxonomic clades based on terminal fragment length polymorphisms and closely related sequences based on single stranded conformation polymorphisms.

    Science.gov (United States)

    Swanson, Colby A; Sliwinski, Marek K

    2013-09-01

    DNA fingerprinting methods provide a means to rapidly compare microbial assemblages from environmental samples without the need to first cultivate species in the laboratory. The profiles generated by these techniques are able to identify statistically significant temporal and spatial patterns, correlations to environmental gradients, and biological variability to estimate the number of replicates for clone libraries or next generation sequencing (NGS) surveys. Here we describe an improved DNA fingerprinting technique that combines terminal restriction fragment length polymorphisms (TRFLP) and single stranded conformation polymorphisms (SSCP) so that both can be used to profile a sample simultaneously rather than requiring two sequential steps as in traditional two-dimensional (2-D) gel electrophoresis. For the purpose of profiling Archaeal 16S rRNA genes from soil, the dynamic range of this combined 1-D TRFLP-SSCP approach was superior to TRFLP and SSCP. 1-D TRFLP-SSCP was able to distinguish broad taxonomic clades with genetic distances greater than 10%, such as Euryarchaeota and the Thaumarchaeal clades g_Ca. Nitrososphaera (formerly 1.1b) and o_NRP-J (formerly 1.1c) better than SSCP. In addition, 1-D TRFLP-SSCP was able to simultaneously distinguish closely related clades within a genus such as s_SCA1145 and s_SCA1170 better than TRFLP. We also tested the utility of 1-D TRFLP-SSCP fingerprinting of environmental assemblages by comparing this method to the generation of a 16S rRNA clone library of soil Archaea from a restored Tallgrass prairie. This study shows 1-D TRFLP-SSCP fingerprinting provides a rapid and phylogenetically informative screen of Archaeal 16S rRNA genes in soil samples. © 2013.

  13. Review paper. Terminal lucidity

    Directory of Open Access Journals (Sweden)

    Chiriboga-Oleszczak Boris Alejandro

    2017-03-01

    Full Text Available Terminal lucidity is a term used in the medical literature to determine the improvement of mental functioning shortly before death, even among patients with serious and long-term disorders. In 19th century, cases of mind clarity recovery shortly before death, were often recognized by doctors and interpreted as a sign of an impending death. In 20th century, the interest in this phenomenon decreased and then, virtually disappear. In recent years, on the wave of publications concerning near death experiences and related events such as the end of life experiences, papers about the improvement of mental functioning shortly before death, exponentially grew and got a new name, terminal lucidity. In this paper, an overview of the available literature is presented to outline the historical, phenomenological and clinical picture of this phenomenon and its possible implications for medical care and future studies.

  14. Scandium Terminal Imido Chemistry.

    Science.gov (United States)

    Lu, Erli; Chu, Jiaxiang; Chen, Yaofeng

    2018-02-20

    Research into transition metal complexes bearing multiply bonded main-group ligands has developed into a thriving and fruitful field over the past half century. These complexes, featuring terminal M═E/M≡E (M = transition metal; E = main-group element) multiple bonds, exhibit unique structural properties as well as rich reactivity, which render them attractive targets for inorganic/organometallic chemists as well as indispensable tools for organic/catalytic chemists. This fact has been highlighted by their widespread applications in organic synthesis, for example, as olefin metathesis catalysts. In the ongoing renaissance of transition metal-ligand multiple-bonding chemistry, there have been reports of M═E/M≡E interactions for the majority of the metallic elements of the periodic table, even some actinide metals. In stark contrast, the largest subgroup of the periodic table, rare-earth metals (Ln = Sc, Y, and lanthanides), have been excluded from this upsurge. Indeed, the synthesis of terminal Ln═E/Ln≡E multiple-bonding species lagged behind that of the transition metal and actinide congeners for decades. Although these species had been pursued since the discovery of a rare-earth metal bridging imide in 1991, such a terminal (nonpincer/bridging hapticities) Ln═E/Ln≡E bond species was not obtained until 2010. The scarcity is mainly attributed to the energy mismatch between the frontier orbitals of the metal and the ligand atoms. This renders the putative terminal Ln═E/Ln≡E bonds extremely reactive, thus resulting in the formation of aggregates and/or reaction with the ligand/environment, quenching the multiple-bond character. In 2010, the stalemate was broken by the isolation and structural characterization of the first rare-earth metal terminal imide-a scandium terminal imide-by our group. The double-bond character of the Sc═N bond was unequivocally confirmed by single-crystal X-ray diffraction. Theoretical investigations revealed the presence

  15. Andrographolide stimulates p38 mitogen-activated protein kinase-nuclear factor erythroid-2-related factor 2-heme oxygenase 1 signaling in primary cerebral endothelial cells for definite protection against ischemic stroke in rats.

    Science.gov (United States)

    Yen, Ting-Lin; Chen, Ray-Jade; Jayakumar, Thanasekaran; Lu, Wan-Jung; Hsieh, Cheng-Ying; Hsu, Ming-Jen; Yang, Chih-Hao; Chang, Chao-Chien; Lin, Yen-Kuang; Lin, Kuan-Hung; Sheu, Joen-Rong

    2016-04-01

    Stroke pathogenesis involves complex oxidative stress-related pathways. The nuclear factor erythroid-2-related factor 2 (Nrf2) and heme oxygenase 1 (HO-1) pathways have been considered molecular targets in pharmacologic intervention for ischemic diseases. Andrographolide, a labdane diterpene, has received increasing attention in recent years because of its various pharmacologic activities. We determined that andrographolide modulates the mitogen-activated protein kinase (MAPK)-Nrf2-HO-1 signaling cascade in primary cerebral endothelial cells (CECs) to provide positive protection against middle cerebral artery occlusion (MCAO)-induced ischemic stroke in rats. In the present study, andrographolide (10 μM) increased HO-1 protein and messenger RNA expressions, Nrf2 phosphorylation, and nuclear translocation in CECs, and these activities were disrupted by a p38 MAPK inhibitor, SB203580, but not by the extracellular signal-regulated kinase inhibitor PD98059 or c-Jun amino-terminal kinase inhibitor SP600125. Similar results were observed in confocal microscopy analysis. Moreover, andrographolide-induced Nrf2 and HO-1 protein expressions were significantly inhibited by Nrf2 small interfering RNA. Moreover, HO-1 knockdown attenuated the protective effect of andrographolide against oxygen-glucose deprivation-induced CEC death. Andrographolide (0.1 mg/kg) significantly suppressed free radical formation, blood-brain barrier disruption, and brain infarction in MCAO-insulted rats, and these effects were reversed by the HO-1 inhibitor zinc protoporphyrin IX. The mechanism is attributable to HO-1 activation, as directly evidenced by andrographolide-induced pronounced HO-1 expression in brain tissues, which was highly localized in the cerebral capillary. In conclusion, andrographolide increased Nrf2-HO-1 expression through p38 MAPK regulation, confirming that it provides protection against MCAO-induced brain injury. These findings provide strong evidence that andrographolide could

  16. Differential Effects of Ethanol on c-Jun N-Terminal Kinase, 14-3-3 Proteins, and Bax in Postnatal Day 4 and Postnatal Day 7 Rat Cerebellum

    Science.gov (United States)

    Heaton, Marieta Barrow; Paiva, Michael; Kubovic, Stacey; Kotler, Alexandra; Rogozinski, Jonathan; Swanson, Eric; Madorsky, Vladimir; Posados, Michelle

    2011-01-01

    These studies investigated ethanol effects on upstream cellular elements and interactions which contribute to Bax-related apoptosis in neonatal rat cerebellum at ages of peak ethanol sensitivity (postnatal day 4 [P4]), compared to later ages of relative resistance (P7). Analyses were made of basal levels of the pro-apoptotic c-jun N-termimal kinase (JNK), Bax, and the 14-3-3 anchoring proteins, as well as the responsiveness of these substances to ethanol at P4 versus P7. Dimerization of Bax with 14-3-3 was also investigated at the two ages following ethanol treatment, a process which sequesters Bax in the cytosol, thus inhibiting its mitochondrial translocation and disruption of the mitochondrial membrane potential. Cultured cerebellar granule cells were used to examine the protective potential of JNK inhibition on ethanol-mediated cell death. Basal levels of JNK were significantly higher at P4 than P7, but no differences in the other proteins were found. Activated JNK, and cytosolic and mitochondrially-translocated Bax were increased in P4 but not P7 animals following ethanol exposure, while protective 14-3-3 proteins were increased only at P7. Ethanol treatment resulted in decreases in Bax:14-3-3 heterodimers at P4, but not at P7. Inhibition of JNK activity in vitro provided partial protection against ethanol neurotoxicity. Thus, differential temporal vulnerability to ethanol in this CNS region correlates with differences in both levels of apoptosis-related substances (e.g., JNK), and differential cellular responsiveness, favoring apoptosis at the most sensitive age and survival at the resistant age. The upstream elements contributing to this vulnerability can be targets for future therapeutic strategies. PMID:22169498

  17. Terminal-Dependent Statistical Inference for the FBSDEs Models

    Directory of Open Access Journals (Sweden)

    Yunquan Song

    2014-01-01

    Full Text Available The original stochastic differential equations (OSDEs and forward-backward stochastic differential equations (FBSDEs are often used to model complex dynamic process that arise in financial, ecological, and many other areas. The main difference between OSDEs and FBSDEs is that the latter is designed to depend on a terminal condition, which is a key factor in some financial and ecological circumstances. It is interesting but challenging to estimate FBSDE parameters from noisy data and the terminal condition. However, to the best of our knowledge, the terminal-dependent statistical inference for such a model has not been explored in the existing literature. We proposed a nonparametric terminal control variables estimation method to address this problem. The reason why we use the terminal control variables is that the newly proposed inference procedures inherit the terminal-dependent characteristic. Through this new proposed method, the estimators of the functional coefficients of the FBSDEs model are obtained. The asymptotic properties of the estimators are also discussed. Simulation studies show that the proposed method gives satisfying estimates for the FBSDE parameters from noisy data and the terminal condition. A simulation is performed to test the feasibility of our method.

  18. Nurses' attitudes to terminally ill patients.

    Science.gov (United States)

    Román, E M; Sorribes, E; Ezquerro, O

    2001-05-01

    The care of terminally ill patients is a challenge for nurses that has raised special interest in recent years. Several studies have shown a stereotyped negative attitude in nurses towards terminally ill patients. However, all have used methods with several limitations. The aim of the study presented in this paper was to identify the nurses' attitude to the terminally ill patient in Catalonia, Spain, and the relationship of this attitude to different socio-demographic data (type of centre, shift, years of experience, age and sex) by means of a new quantitative method based on the free word-association test. One hundred and seventy-five nurses working in 18 hospitals and hospices in Catalonia, Spain were included in the study. Data were analysed by the Associative Semantic Field Differential method by means of the computer programme CONTEXT and a quantitative evaluation of the degree of attitudes positivity was obtained. The study revealed a general slight negative trend in attitudes towards the terminally ill patient. A more positive attitude was observed in older caregivers and in women. The positivity in attitude decreased from morning to night shift. No differences were observed between nurses working in hospitals and those working in hospices. We conclude that nursing attitudes can be analysed by methods such as that used in this study. Attempts can be made to modify this attitude in caregivers by means of training programmes and stimulating awareness of an adequate professional approach.

  19. LNG TERMINAL SAFE OPERATION MANAGEMENT

    OpenAIRE

    Andrzej ADAMKIEWICZ; Włodzimierz KAMIŃSKI

    2012-01-01

    This article presents the significance of LNG terminal safety issues in natural gas sea transport. It shows particular requirements for LNG transmission installations resulting from the specific properties of LNG. Out of the multi‐layer critical safety areas comprising structural elements of the terminal safety system, possibilities to decrease the risk of emergency occurrence on LNG terminals have been selected. Tasks performed by the LNG terminal, together with its own personnel and the out...

  20. Nuclear factor erythroid 2-related factor 2 deletion impairs glucose tolerance and exacerbates hyperglycemia in type 1 diabetic mice.

    Science.gov (United States)

    Aleksunes, Lauren M; Reisman, Scott A; Yeager, Ronnie L; Goedken, Michael J; Klaassen, Curtis D

    2010-04-01

    The transcription factor nuclear factor erythroid 2-related factor 2 (Nrf2) induces a battery of cytoprotective genes after oxidative stress. Nrf2 aids in liver regeneration by altering insulin signaling; however, whether Nrf2 participates in hepatic glucose homeostasis is unknown. Compared with wild-type mice, mice lacking Nrf2 (Nrf2-null) have lower basal serum insulin and prolonged hyperglycemia in response to an intraperitoneal glucose challenge. In the present study, blood glucose, serum insulin, urine flow rate, and hepatic expression of glucose-related genes were quantified in male diabetic wild-type and Nrf2-null mice. Type 1 diabetes was induced with a single intraperitoneal dose (200 mg/kg) of streptozotocin (STZ). Histopathology and serum insulin levels confirmed depleted pancreatic beta-cells in STZ-treated mice of both genotypes. Five days after STZ, Nrf2-null mice had higher blood glucose levels than wild-type mice. Nine days after STZ, polyuria occurred in both genotypes with more urine output from Nrf2-null mice (11-fold) than wild-type mice (7-fold). Moreover, STZ-treated Nrf2-null mice had higher levels of serum beta-hydroxybutyrate, triglycerides, and fatty acids 10 days after STZ compared with wild-type mice. STZ reduced hepatic glycogen in both genotypes, with less observed in Nrf2-null mice. Increased urine output and blood glucose in STZ-treated Nrf2-null mice corresponded with enhanced gluconeogenesis (glucose-6-phosphatase and phosphoenolpyruvate carboxykinase)- and reduced glycolysis (pyruvate kinase)-related mRNA expression in their livers. Furthermore, the Nrf2 activator oltipraz lowered blood glucose in wild-type but not Nrf2-null mice administered STZ. Collectively, these data indicate that the absence of Nrf2 worsens hyperglycemia in type I diabetic mice and Nrf2 may represent a therapeutic target for reducing circulating glucose levels.

  1. Inhibition of erythroid cell growth by allogeneic murine lymphocytes. Evidence for a synergism between lymph node cells and thymocytes

    International Nuclear Information System (INIS)

    Blomgren, H.; Jacobsson, H.

    1974-01-01

    Murine lymphoid cells from thymus and lymph nodes were tested for synergistic response in a graft-vs-host test. The test is based on the principle that allogeneic lymphocytes inhibit erythroid cell proliferation in the spleens of irradiated mice infused with syngeneic bone marrow cells. Mixtures of thymocytes and lymph node cells from the same parental strain yielded graft-vs-host responses in irradiated F 1 -hybrids higher than expected by summing the responses of the two cell populations tested separately. A similar synergistic response was obtained using mixtures of thymocytes and lymph node cells obtained from the two parental strains of the hybrid, whereas such an effect was not detected using mixtures of lymph node cells or mixtures of thymocytes from the two parental strains. Nor could synergy be demonstrated between parental strain lymph node cells and thymocytes syngeneic with the bone marrow target cells. Thymocytes obtained from one parental strain which was injected into its irradiated F 1 -hybrid transformed into a population of sensitized cells in the spleens of the recipients. This transformation was suppressed by the simultaneous injection of lymph node cells from the second parental strain. Since there is a synergistic immune response by such cell mixtures it is concluded that thymocytes may enhance the graft-vs-host response of lymph node cells. Parental strain thymocytes and lymph node cells, the latter being specifically immunologically tolerant to the bone marrow target cells, failed to give a synergistic response indicating that thymocytes do not transform unresponsive lymphocytes into responsive, but rather enhance the reactivity of existing, specifically responsive cells. The results thus show that thymocytes may enhance the response of lymph node cells in this specific graft-vs-host assay

  2. LNG TERMINAL SAFE OPERATION MANAGEMENT

    Directory of Open Access Journals (Sweden)

    Andrzej ADAMKIEWICZ

    2012-07-01

    Full Text Available This article presents the significance of LNG terminal safety issues in natural gas sea transport. It shows particular requirements for LNG transmission installations resulting from the specific properties of LNG. Out of the multi‐layer critical safety areas comprising structural elements of the terminal safety system, possibilities to decrease the risk of emergency occurrence on LNG terminals have been selected. Tasks performed by the LNG terminal, together with its own personnel and the outside one, have been defined. General theses for LNG terminal safety have been formulated.

  3. The potential role of ribosomal protein S5 on cell cycle arrest and initiation of murine erythroleukemia cell differentiation.

    Science.gov (United States)

    Matragkou, Christina N; Papachristou, Eleni T; Tezias, Sotirios S; Tsiftsoglou, Asterios S; Choli-Papadopoulou, Theodora; Vizirianakis, Ioannis S

    2008-07-01

    Evidence now exists to indicate that some ribosomal proteins besides being structural components of the ribosomal subunits are involved in the regulation of cell differentiation and apoptosis. As we have shown earlier, initiation of erythroid differentiation of murine erythroleukemia (MEL) cells is associated with transcriptional inactivation of genes encoding ribosomal RNAs and ribosomal proteins S5 (RPS5) and L35a. In this study, we extended these observations and investigated whether transfection of MEL cells with RPS5 cDNA affects the onset of initiation of erythroid maturation and their entrance in cell cycle arrest. Stably transfected MEL cloned cells (MEL-C14 and MEL-C56) were established and assessed for their capacity to produce RPS5 RNA transcript and its translated product. The impact of RPS5 cDNA transfection on the RPS5 gene expression patterns and the accumulation of RPS5 protein in inducible transfected MEL cells were correlated with their ability to: (a) initiate differentiation, (b) enter cell cycle arrest at G(1)/G(0) phase, and (c) modulate the level of cyclin-dependent kinases CDK2, CDK4, and CDK6. The data presented indicate that deregulation of RPS5 gene expression (constitutive expression) affects RPS5 protein level and delays both the onset of initiation of erythroid maturation and entrance in cell cycle arrest in inducer-treated MEL cells. 2008 Wiley-Liss, Inc.

  4. Terminal weather information management

    Science.gov (United States)

    Lee, Alfred T.

    1990-01-01

    Since the mid-1960's, microburst/windshear events have caused at least 30 aircraft accidents and incidents and have killed more than 600 people in the United States alone. This study evaluated alternative means of alerting an airline crew to the presence of microburst/windshear events in the terminal area. Of particular interest was the relative effectiveness of conventional and data link ground-to-air transmissions of ground-based radar and low-level windshear sensing information on microburst/windshear avoidance. The Advanced Concepts Flight Simulator located at Ames Research Center was employed in a line oriented simulation of a scheduled round-trip airline flight from Salt Lake City to Denver Stapleton Airport. Actual weather en route and in the terminal area was simulated using recorded data. The microburst/windshear incident of July 11, 1988 was re-created for the Denver area operations. Six experienced airline crews currently flying scheduled routes were employed as test subjects for each of three groups: (1) A baseline group which received alerts via conventional air traffic control (ATC) tower transmissions; (2) An experimental group which received alerts/events displayed visually and aurally in the cockpit six miles (approx. 2 min.) from the microburst event; and (3) An additional experimental group received displayed alerts/events 23 linear miles (approx. 7 min.) from the microburst event. Analyses of crew communications and decision times showed a marked improvement in both situation awareness and decision-making with visually displayed ground-based radar information. Substantial reductions in the variability of decision times among crews in the visual display groups were also found. These findings suggest that crew performance will be enhanced and individual differences among crews due to differences in training and prior experience are significantly reduced by providing real-time, graphic display of terminal weather hazards.

  5. The Heliospheric Termination Shock

    Science.gov (United States)

    Jokipii, J. R.

    2013-06-01

    The heliospheric termination shock is a vast, spheroidal shock wave marking the transition from the supersonic solar wind to the slower flow in the heliosheath, in response to the pressure of the interstellar medium. It is one of the most-important boundaries in the outer heliosphere. It affects energetic particles strongly and for this reason is a significant factor in the effects of the Sun on Galactic cosmic rays. This paper summarizes the general properties and overall large-scale structure and motions of the termination shock. Observations over the past several years, both in situ and remote, have dramatically revised our understanding of the shock. The consensus now is that the shock is quite blunt, is with the front, blunt side canted at an angle to the flow direction of the local interstellar plasma relative to the Sun, and is dynamical and turbulent. Much of this new understanding has come from remote observations of energetic charged particles interacting with the shock, radio waves and radiation backscattered from interstellar neutral atoms. The observations and the implications are discussed.

  6. Effects of trichostatins on differentiation of murine erythroleukemia cells

    International Nuclear Information System (INIS)

    Yoshida, M.; Nomura, S.; Beppu, T.

    1987-01-01

    The fungistatic antibiotics trichostatins (TS) A and C were isolated from culture broth of Streptomyces platensis No. 145 and were found to be potent inducers of differentiation in murine erythroleukemia (Friend and RV133) cells at concentrations of 1.5 X 10(-8) M for TSA and 5 X 10(-7) M for TSC. Differentiation induced by TS was cooperatively enhanced by UV irradiation but not by treatment with dimethyl sulfoxide. This enhanced activity was completely inhibited by adding cycloheximide to the culture medium 2 h after exposure to TS, suggesting that TS are dimethyl sulfoxide-type inducers of erythroid differentiation. No inhibitory effect of TS was observed on macromolecular synthesis in cultured cells

  7. Monomethylfumarate induces γ-globin expression and fetal hemoglobin production in cultured human retinal pigment epithelial (RPE) and erythroid cells, and in intact retina.

    Science.gov (United States)

    Promsote, Wanwisa; Makala, Levi; Li, Biaoru; Smith, Sylvia B; Singh, Nagendra; Ganapathy, Vadivel; Pace, Betty S; Martin, Pamela M

    2014-05-13

    Sickle retinopathy (SR) is a major cause of vision loss in sickle cell disease (SCD). There are no strategies to prevent SR and treatments are extremely limited. The present study evaluated (1) the retinal pigment epithelial (RPE) cell as a hemoglobin producer and novel cellular target for fetal hemoglobin (HbF) induction, and (2) monomethylfumarate (MMF) as an HbF-inducing therapy and abrogator of oxidative stress and inflammation in SCD retina. Human globin gene expression was evaluated by RT-quantitative (q)PCR in the human RPE cell line ARPE-19 and in primary RPE cells isolated from Townes humanized SCD mice. γ-Globin promoter activity was monitored in KU812 stable dual luciferase reporter expressing cells treated with 0 to 1000 μM dimethylfumarate, MMF, or hydroxyurea (HU; positive control) by dual luciferase assay. Reverse transcriptase-qPCR, fluorescence-activated cell sorting (FACS), immunofluorescence, and Western blot techniques were used to evaluate γ-globin expression and HbF production in primary human erythroid progenitors, ARPE-19, and normal hemoglobin producing (HbAA) and homozygous β(s) mutation (HbSS) RPE that were treated similarly, and in MMF-injected (1000 μM) HbAA and HbSS retinas. Dihydroethidium labeling and nuclear factor (erythroid-derived 2)-like 2 (Nrf2), IL-1β, and VEGF expression were also analyzed. Retinal pigment epithelial cells express globin genes and synthesize adult and fetal hemoglobin MMF stimulated γ-globin expression and HbF production in cultured RPE and erythroid cells, and in HbSS mouse retina where it also reduced oxidative stress and inflammation. The production of hemoglobin by RPE suggests the potential involvement of this cell type in the etiology of SR. Monomethylfumarate influences multiple parameters consistent with improved retinal health in SCD and may therefore be of therapeutic potential in SR treatment. Copyright 2014 The Association for Research in Vision and Ophthalmology, Inc.

  8. ABO alleles are linked with haplotypes of an erythroid cell-specific regulatory element in intron 1 with a few exceptions attributable to genetic recombination.

    Science.gov (United States)

    Nakajima, T; Sano, R; Takahashi, Y; Watanabe, K; Kubo, R; Kobayashi, M; Takahashi, K; Takeshita, H; Kominato, Y

    2016-01-01

    Recent investigation of transcriptional regulation of the ABO genes has identified a candidate erythroid cell-specific regulatory element, named the +5·8-kb site, in the first intron of ABO. Six haplotypes of the site have been reported previously. The present genetic population study demonstrated that each haplotype was mostly linked with specific ABO alleles with a few exceptions, possibly as a result of hybrid formation between common ABO alleles. Thus, investigation of these haplotypes could provide a clue to further elucidation of ABO alleles. © 2015 International Society of Blood Transfusion.

  9. Resolution and termination

    Directory of Open Access Journals (Sweden)

    Adina FOLTIŞ

    2012-01-01

    Full Text Available The resolution, the termination and the reduction of labour conscription are regulated by articles 1549-1554 in the new Civil Code, which represents the common law in this matter. We appreciate that the new regulation does not conclusively clarify the issue related to whether the existence of liability in order to call upon the resolution is necessary or not, because the existence of this condition has been inferred under the previous regulation from the fact that the absence of liability shifts the inexecution issue on the domain of fortuitous impossibility of execution, situation in which the resolution of the contract is not in question, but that of the risk it implies.

  10. Mobile Termination and Mobile Penetration

    OpenAIRE

    Hurkens, Sjaak; Jeon, Doh-Shin

    2009-01-01

    In this paper, we study how access pricing affects network competition when subscription demand is elastic and each network uses non-linear prices and can apply termination-based price discrimination. In the case of a fixed per minute termination charge, we find that a reduction of the termination charge below cost has two oppos- ing effects: it softens competition but helps to internalize network externalities. The former reduces mobile penetration while the latter boosts it. We find that fi...

  11. Mobile termination and mobile penetration

    OpenAIRE

    Hurkens, Sjaak

    2009-01-01

    In this paper, we study how access pricing affects network competition when subscription demand is elastic and each network uses non-linear prices and can apply termination-based price discrimination. In the case of a fixed per minute termination charge, we find that a reduction of the termination charge below cost has two opposing effects: it softens competition but helps to internalize network externalities. The former reduces mobile penetration while the latter boosts it. We find that firm...

  12. The Stigma of Dying: Attitudes Toward the Terminally Ill

    Science.gov (United States)

    Epley, Rita J.; McCaghy, Charles H.

    1978-01-01

    Using a range of semantic differential adjectives, 233 college students indicated attitudes toward young and old people who were healthy, ill, or terminally ill. Attitudes toward each state of health category separate into three factors: attitudes toward healthy, ill, and dying persons. (Author)

  13. Hydroxyurea responsiveness in β-thalassemic patients is determined by the stress response adaptation of erythroid progenitors and their differentiation propensity

    NARCIS (Netherlands)

    F. Pourfarzad, F. (Farzin); M.M. von Lindern (Marieke); A. Azarkeivan (Azita); J. Hou (Jun); S.K. Kia; F. Esteghamat (Fatemehsadat); W.F.J. van IJcken (Wilfred); J.N.J. Philipsen (Sjaak); H. Najmabadi (Hossein); F.G. Grosveld (Frank)

    2013-01-01

    textabstractβ-thalassemia is caused by mutations in the β-globin locus resulting in loss of, or reduced, hemoglobin A (adult hemoglobin, HbA, α2β2) production. Hydroxyurea treatment increases fetal γ-globin (fetal hemoglobin, HbF, α2γ2) expression in postnatal life substituting for the missing adult

  14. Hydroxyurea responsiveness in β-thalassemic patients is determined by the stress response adaptation of erythroid progenitors and their differentiation propensity

    NARCIS (Netherlands)

    Pourfarzad, Farzin; von Lindern, Marieke; Azarkeivan, Azita; Hou, Jun; Kia, Sima Kheradmand; Esteghamat, Fatemehsadat; van Ijcken, Wilfred; Philipsen, Sjaak; Najmabadi, Hossein; Grosveld, Frank

    2013-01-01

    β-thalassemia is caused by mutations in the β-globin locus resulting in loss of, or reduced, hemoglobin A (adult hemoglobin, HbA, α2β2) production. Hydroxyurea treatment increases fetal γ-globin (fetal hemoglobin, HbF, α2γ2) expression in postnatal life substituting for the missing adult β-globin

  15. Effects of low-level (1.0 R) x-irradiation on the erythroid response of the rat bone marrow

    International Nuclear Information System (INIS)

    Gong, J.K.; Glomski, C.A.; Frederiksen, N.L.; Lawson, A.J.; Daley, J.P.

    1976-01-01

    The levels of normoblasts in the bone marrow of six groups of female Sprague--Dawley rats previously exposed to a 1.0 R dose of x rays were compared with those in sham-exposed animals at intervals from 14 hr to 10 weeks postirradiation. Four parameters were analyzed, the percentage of normoblasts in Wright's Giemsa stained marrow smears, and the number of erythroid precursors per milligram of isolated marrow sample, per whole femur, and per entire skeleton. The studies were based on marrow examinations and on 59 Fe tracer data. At all intervals except the earliest, [14 hr], significant elevations in the percentage of normoblasts were found in the bone marrow. In addition, at 6 and 10 weeks postirradiation increases were found in the number of normoblasts in the isolated marrow samples, whole femurs, and total skeletons. When compared 81 hr after phlebotomy, subnormal increases in normoblast levels were found in all four parameters of the irradiated subjects. The results suggest that x irradiation at this dose level can induce an abnormal marrow function manifested by an elevated number of normoblasts and, after phlebotomy, by a subnormal proliferation of the erythroid precursors

  16. Natural killer cells recognize friend retrovirus-infected erythroid progenitor cells through NKG2D-RAE-1 interactions In Vivo.

    Science.gov (United States)

    Ogawa, Tatsuya; Tsuji-Kawahara, Sachiyo; Yuasa, Takae; Kinoshita, Saori; Chikaishi, Tomomi; Takamura, Shiki; Matsumura, Haruo; Seya, Tsukasa; Saga, Toshihiko; Miyazawa, Masaaki

    2011-06-01

    Natural killer (NK) cells function as early effector cells in the innate immune defense against viral infections and also participate in the regulation of normal and malignant hematopoiesis. NK cell activities have been associated with early clearance of viremia in experimental simian immunodeficiency virus and clinical human immunodeficiency virus type 1 (HIV-1) infections. We have previously shown that NK cells function as major cytotoxic effector cells in vaccine-induced immune protection against Friend virus (FV)-induced leukemia, and NK cell depletion totally abrogates the above protective immunity. However, how NK cells recognize retrovirus-infected cells remains largely unclear. The present study demonstrates a correlation between the expression of the products of retinoic acid early transcript-1 (RAE-1) genes in target cells and their susceptibility to killing by NK cells isolated from FV-infected animals. This killing was abrogated by antibodies blocking the NKG2D receptor in vitro. Further, the expression of RAE-1 proteins on erythroblast surfaces increased early after FV inoculation, and administration of an RAE-1-blocking antibody resulted in increased spleen infectious centers and exaggerated pathology, indicating that FV-infected erythroid cells are recognized by NK cells mainly through the NKG2D-RAE-1 interactions in vivo. Enhanced retroviral replication due to host gene-targeting resulted in markedly increased RAE-1 expression in the absence of massive erythroid cell proliferation, indicating a direct role of retroviral replication in RAE-1 upregulation.

  17. Selection of Air Terminal Device

    DEFF Research Database (Denmark)

    Nielsen, Peter V.

    This paper discusses the selection of the air terminal device for the experiments and numerical prediction in the International Energy Agency Annex 20 work: Air Flow Pattern within Buildings,......This paper discusses the selection of the air terminal device for the experiments and numerical prediction in the International Energy Agency Annex 20 work: Air Flow Pattern within Buildings,...

  18. The practice of terminal discharge.

    Science.gov (United States)

    Radha Krishna, Lalit Kumar; Murugam, Vengadasalam; Quah, Daniel Song Chiek

    2017-01-01

    'Terminal discharges' are carried out in Singapore for patients who wish to die at home. However, if due diligence is not exercised, parallels may be drawn with euthanasia. We present a theoretical discussion beginning with the definition of terminal discharges and the reasons why they are carried out in Singapore. By considering the intention behind terminal discharges and utilising a multidisciplinary team to deliberate on the clinical, social and ethical intricacies with a patient- and context-specific approach, euthanasia is avoided. It is hoped that this will provide a platform for professionals in palliative medicine to negotiate challenging issues when arranging a terminal discharge, so as to avoid the pitfall of committing euthanasia in a country such as Singapore where euthanasia is illegal. It is hoped that a set of guidelines for terminal discharges may someday be realised to assist professionals in Singapore and around the world.

  19. Osteogenic cell differentiation on H-terminated and O-terminated nanocrystalline diamond films

    Czech Academy of Sciences Publication Activity Database

    Lišková, Jana; Babchenko, Oleg; Varga, Marián; Kromka, Alexander; Hadraba, Daniel; Švindrych, Zdeněk; Burdíková, Zuzana; Bačáková, Lucie

    2015-01-01

    Roč. 10, č. 2015 (2015), s. 869-884 E-ISSN 1178-2013 R&D Projects: GA MŠk(CZ) EE2.3.30.0025; GA ČR(CZ) GBP108/12/G108 Institutional support: RVO:67985823 ; RVO:68378271 Keywords : nanocrystalline diamond film * osteoblast * Saos-2 Subject RIV: EI - Biotechnology ; Bionics Impact factor: 4.320, year: 2015

  20. Ports and Terminals : Planning and Functional Design

    NARCIS (Netherlands)

    Groenveld, R.; Velsink, H.

    1993-01-01

    1. Maritime transport, means and commodities 3. Principles of integrated port planning 4. Planning and design of a port's water areas 5. Port terminals - introduction 6. Conventional general cargo terminals 7. Container terminals 8. Oil & liquid gas terminals 9. Dry bulk cargo terminals 10. Fishery

  1. Definitive hematopoietic stem/progenitor cells manifest distinct differentiation output in the zebrafish VDA and PBI.

    Science.gov (United States)

    Jin, Hao; Sood, Raman; Xu, Jin; Zhen, Fenghua; English, Milton A; Liu, P Paul; Wen, Zilong

    2009-02-01

    One unique feature of vertebrate definitive hematopoiesis is the ontogenic switching of hematopoietic stem cells from one anatomical compartment or niche to another. In mice, hematopoietic stem cells are believed to originate in the aorta-gonad-mesonephros (AGM), subsequently migrate to the fetal liver (FL) and finally colonize the bone marrow (BM). Yet, the differentiation potential of hematopoietic stem cells within early niches such as the AGM and FL remains incompletely defined. Here, we present in vivo analysis to delineate the differentiation potential of definitive hematopoietic stem/progenitor cells (HSPCs) in the zebrafish AGM and FL analogies, namely the ventral wall of dorsal aorta (VDA) and the posterior blood island (PBI), respectively. Cell fate mapping and analysis of zebrafish runx1(w84x) and vlad tepes (vlt(m651)) mutants revealed that HSPCs in the PBI gave rise to both erythroid and myeloid lineages. However, we surprisingly found that HSPCs in the VDA were not quiescent but were uniquely adapted to generate myeloid but not erythroid lineage cells. We further showed that such distinct differentiation output of HSPCs was, at least in part, ascribed to the different micro-environments present in these two niches. Our results highlight the importance of niche in shaping the differentiation output of developing HSPCs.

  2. Forced differentiation of CFU-s by iron-55 erythrocytocide

    International Nuclear Information System (INIS)

    Reincke, U.; Brookoff, D.; Burlington, H.; Cronkite, E.P.

    1978-01-01

    Cascades of Auger electrons are emitted in the decay of 55 Fe and absorbed in tissue within a 1 μm radius. Cytocidal amounts of 55 Fe can therefore eliminate erythroid precursors with minimal damage to adjacent cells. Early events leave the granuloid series undisturbed but they are accompanied by a precipitous fall of pluripotent stem cells levels (CFU-s) in bone marrow, spleen, and blood. The pretreatment levels of CFU-s are not restored. Gradual decline of CFU-s is associated with intermittently increased turnover rate and reduced settings of cell production, yet unimpaired capacity for quick restoration of blood loss. The precipitous initial stem cell decrease is not caused by irradiation damage as shown in a separate experimental series which uses the frozen-storage cytocide technique. Only over several weeks could 55 Fe radiation accumulate to lethal levels in nondividing stem cells. This irradiation is attributed to incorporation of small amounts of 55 Fe into CFU-s from where it is slowly cleared. The stem cell loss immediately following 55 Fe injection is in our interpretation caused by rapid differentiation along the erythroid pathway in a response that involves all progenitor populations. Data are consistent with the hypothesis of limited cell renewal capacity which thereby gains further support

  3. Mechanisms of DNA replication termination.

    Science.gov (United States)

    Dewar, James M; Walter, Johannes C

    2017-08-01

    Genome duplication is carried out by pairs of replication forks that assemble at origins of replication and then move in opposite directions. DNA replication ends when converging replication forks meet. During this process, which is known as replication termination, DNA synthesis is completed, the replication machinery is disassembled and daughter molecules are resolved. In this Review, we outline the steps that are likely to be common to replication termination in most organisms, namely, fork convergence, synthesis completion, replisome disassembly and decatenation. We briefly review the mechanism of termination in the bacterium Escherichia coli and in simian virus 40 (SV40) and also focus on recent advances in eukaryotic replication termination. In particular, we discuss the recently discovered E3 ubiquitin ligases that control replisome disassembly in yeast and higher eukaryotes, and how their activity is regulated to avoid genome instability.

  4. Leukemic transformation of normal murine erythroid progenitors: v- and c-ErbB act through signaling pathways activated by the EpoR and c-Kit in stress erythropoiesis

    NARCIS (Netherlands)

    von Lindern, M.; Deiner, E. M.; Dolznig, H.; Parren-van Amelsvoort, M.; Hayman, M. J.; Mullner, E. W.; Beug, H.

    2001-01-01

    Primary erythroid progenitors can be expanded by the synergistic action of erythropoietin (Epo), stem cell factor (SCF) and glucocorticoids. While Epo is required for erythropoiesis in general, glucocorticoids and SCF mainly contribute to stress erythropoiesis in hypoxic mice. This ability of normal

  5. JCO criticality accident termination operation

    OpenAIRE

    金盛 正至

    2010-01-01

    In 2001, we summarized the circumstances surrounding termination of the JCO criticality accident based on testimony in the Mito District Court on December 17, 2001. JCO was the company for uranium fuels production in Japan. That document was assembled based on actual testimony in the belief that a description of the work involved in termination of the accident would be useful in some way for preventing nuclear disasters in the future. This year is the tenth year of the JCO criticality acciden...

  6. Hemolytic disease of the fetus and newborn due to anti-Ge3: combined antibody-dependent hemolysis and erythroid precursor cell growth inhibition.

    Science.gov (United States)

    Blackall, Douglas P; Pesek, Gina D; Montgomery, Matthew M; Oza, Krishna K; Arndt, Patricia A; Garratty, George; Shahcheraghi, Ali; Denomme, Gregory A

    2008-10-01

    The Gerbich (Ge) antigens are a collection of high-incidence antigens carried on the red blood cell membrane glycoproteins, glycophorins C and D. Antibodies against these antigens are uncommon, and there have been only rare case reports of hemolytic disease of the fetus and newborn due to anti-Ge. In this case report, we present a neonate with severe anemia and hyperbilirubinemia due to anti-Ge3. Routine and special laboratory studies undertaken in this case suggested two mechanisms for the patient's hemolysis and persistent anemia. Antibody-dependent hemolysis was associated with early-onset hyperbilirubinemia, anemia, and a mild reticulocytosis, and inhibition of erythroid progenitor cell growth was associated with late anemia and normal bilirubin and reticulocyte values. Though rare, anti-Ge3 can be a dangerous antibody in pregnancy. Affected neonates may require intensive initial therapy and close follow-up for at least several weeks after delivery.

  7. Erythroid Kruppel-like factor (EKLF) is recruited to the γ-globin gene promoter as a co-activator and is required for γ-globin gene induction by short-chain fatty acid derivatives

    Science.gov (United States)

    Perrine, Susan P.; Mankidy, Rishikesh; Boosalis, Michael S.; Bieker, James J.; Faller, Douglas V.

    2011-01-01

    Objectives The erythroid Kruppel-like factor (EKLF) is an essential transcription factor for β-type globin gene switching, and specifically activates transcription of the adult β-globin gene promoter. We sought to determine if EKLF is also required for activation of the γ-globin gene by short-chain fatty acid (SCFA) derivatives, which are now entering clinical trials. Methods The functional and physical interaction of EKLF and co-regulatory molecules with the endogenous human globin gene promoters was studied in primary human erythroid progenitors and cell lines, using chromatin immunoprecipitation (ChIP) assays and genetic manipulation of the levels of EKLF and co-regulators. Results and conclusions Knockdown of EKLF prevents SCFA-induced expression of the γ-globin promoter in a stably expressed μLCRβprRlucAγprFluc cassette, and prevents induction of the endogenous γ-globin gene in primary human erythroid progenitors. EKLF is actively recruited to endogenous γ-globin gene promoters after exposure of primary human erythroid progenitors, and murine hematopoietic cell lines, to SCFA derivatives. The core ATPase BRG1 subunit of the human SWI/WNF complex, a ubiquitous multimeric complex that regulates gene expression by remodeling nucleosomal structure, is also required for γ-globin gene induction by SCFA derivatives. BRG1 is actively recruited to the endogenous γ-globin promoter of primary human erythroid progenitors by exposure to SCFA derivatives, and this recruitment is dependent upon the presence of EKLF. These findings demonstrate that EKLF, and the co-activator BRG1, previously demonstrated to be required for definitive or adult erythropoietic patterns of globin gene expression, are co-opted by SCFA derivatives to activate the fetal globin genes. PMID:19220418

  8. Terminal Disease: A Biolaw Management

    Directory of Open Access Journals (Sweden)

    Francisco Rivas García

    2017-10-01

    Full Text Available There are numerous and varied pathologies that can lead to a state of terminal illness, provoking numerous bioethical dilemmas that are inherent and specific to each circumstance. The objective of the present work has been to provide a current and useful analysis that can help to understand the main bioethical problems, from the perspective of biolaw that must be solved in the inevitable path towards the end of life that any terminal illness implies. The methodology used included a study of bibliographic documentation in the main databases of interest in bioethics. It can be concluded that the biolaw is a very useful tool that helps health care professionals and relatives when it comes to the analysis and decision making regarding a terminal illness. Independently of medical practice based on protocols and scientific knowledge, it is necessary to ensure that not everything that can legally be carried out is accepted in the field of biolaw.

  9. Digital autonomous terminal access communications

    Science.gov (United States)

    Novacki, S.

    1987-01-01

    A significant problem for the Bus Monitor Unit is to identify the source of a given transmission. This problem arises from the fact that the label which identifies the source of the transmission as it is put into the bus is intercepted by the Digital Autonomous Terminal Access Communications (DATAC) terminal and removed from the transmission. Thus, a given subsystem will see only data associated with a label and never the identifying label itself. The Bus Monitor must identify the source of the transmission so as to be able to provide some type of error identification/location in the event that some problem with the data transmission occurs. Steps taken to alleviate this problem by modifications to the DATAC terminal are discussed.

  10. SIRKULASI TERMINAL PENUMPANG KAPAL LAUT

    Directory of Open Access Journals (Sweden)

    Etsa Purnama Sari

    2014-01-01

    Full Text Available Wilayah Indonesia yang terdiri dari pulau dan perairan menjadikan angkutan laut menjadi salah satu sarana transportasi yang cukup efektif di negara ini. Daya angkut yang besar dan beragam serta biaya yang lebih murah dengan jarak jangkauan yang luas, membuat sarana ini banyak diminati oleh masyarakat sekaligus juga merupakan pendukung utama perkembangan kehidupan sosial budaya dan roda perekonomian. Untuk mendukung proses transportasi laut ini perlu sarana berupa pelabuhan. Pelabuhan dalam melakukan pelayanan terhadap kapal memiliki beberapa fasilitas pokok dan penunjang yang wajib dimiliki. Salah satunya adalah terminal penumpang kapal laut dengan berbagai kegiatan di dalamnya untuk kedatangan maupun keberangkatan. Masalah ketidaknyamanan dalam berkegiatan, jauhnya akses sirkulasi antara satu kegiatan dengan kegiatan kegiatan embarkasi dan debarkasi yang tidak teratur, pembagian jalur sirkulasi penumpang dan pengantar penumpang yang tidak jelas seringkali muncul akibat sirkulasi yang tidak direncanakan dengan baik pada terminal penumpang kapal laut. Bahkan tidak jarang dapat menimbulkan adanya calo tiket hingga adanya penumpang tanpa tiket yang dapat masuk ke dalam kapal hingga kapal berlayar. Perencanaan sebuah sirkulasi yang tepat pada terminal penumpang kapal laut memerlukan kajian terhadap unsur-unsur sirkulasi seperti pencapaian, pola sirkulasi, jalur sirkulasi, serta bentuk ruang sirkulasi. Kajian unsur-unsur ini selanjutnya diselidiki melalui penelusuran masalah dengan analisis deskriptif melalui penggambaran objek penelitian yang terdapat pada Terminal Penumpang Pelabuhan International Yokohama, Terminal Penumpang Pelabuhan Kobe dan Terminal Penumpang Pelabuhan Osanbashi Hall   As one of the largest archipelago country, sea transportation acts as one of the most effective means of transportation in Indonesia. Large and diverse carrying capacity, lower cost with wide range of distances, are factors which making sea

  11. Control of heme synthesis during Friend cell differentiation: role of iron and transferrin

    International Nuclear Information System (INIS)

    Laskey, J.D.; Ponka, P.; Schulman, H.M.

    1986-01-01

    In many types of cells the synthesis of σ-aminolevulinic acid (ALA) limits the rate of heme formation. However, results from this laboratory with reticulocytes suggest that the rate of iron uptake from 125 I-transferrin (Tf), rather than ALA synthase activity, limits the rate of heme synthesis in erythroid cells. To determine whether changes occur in iron metabolism and the control of heme synthesis during erythroid cell development Friend erythroleukemia cells induced to erythroid differentiation by dimethylsulfoxide (DMSO) were studied. While added ALA stimulated heme synthesis in uninduced Friend cells (suggesting ALA synthase is limiting) it did not do so in induced cells. Therefore the possibility was investigated that, in induced cells, iron uptake from Tf limits and controls heme synthesis. Several aspects of iron metabolism were investigated using the synthetic iron chelator salicylaldehyde isonicotinoyl hydrazone (SIH). Both induced and uninduced Friend cells take up and utilize Fe for heme synthesis directly from Fe-SIH without the involvement of transferrin and transferrin receptors and to a much greater extent than from saturating levels or 59 Fe-Tf (20 μM). Furthermore, in induced Friend cells 100 μM Fe-SIH stimulated 2- 14 C-glycine incorporation into heme up to 3.6-fold as compared to the incorporation observed with saturating concentrations of Fe-Tf. These results indicate that some step(s) in the pathway of iron from extracellular Tf to protoporphyrin, rather than the activity of ALA synthase, limits and controls the overall rate of heme and possibly hemoglobin synthesis in differentiating Friend erythroleukemia cells

  12. What Determines Joint Venture Termination?

    DEFF Research Database (Denmark)

    Nielsen, Bo Bernhard

    2012-01-01

    Joint venture (JV) research continues to flourish as researchers seek to advance our understanding of why so many JVs fail. Cui and Kumar (this issue) take a contingency approach to explain how and why business relatedness may provide new insights as to what determines JV termination. This commen......Joint venture (JV) research continues to flourish as researchers seek to advance our understanding of why so many JVs fail. Cui and Kumar (this issue) take a contingency approach to explain how and why business relatedness may provide new insights as to what determines JV termination...

  13. Activation of the alpha-globin gene expression correlates with dramatic upregulation of nearby non-globin genes and changes in local and large-scale chromatin spatial structure.

    Science.gov (United States)

    Ulianov, Sergey V; Galitsyna, Aleksandra A; Flyamer, Ilya M; Golov, Arkadiy K; Khrameeva, Ekaterina E; Imakaev, Maxim V; Abdennur, Nezar A; Gelfand, Mikhail S; Gavrilov, Alexey A; Razin, Sergey V

    2017-07-11

    In homeotherms, the alpha-globin gene clusters are located within permanently open genome regions enriched in housekeeping genes. Terminal erythroid differentiation results in dramatic upregulation of alpha-globin genes making their expression comparable to the rRNA transcriptional output. Little is known about the influence of the erythroid-specific alpha-globin gene transcription outburst on adjacent, widely expressed genes and large-scale chromatin organization. Here, we have analyzed the total transcription output, the overall chromatin contact profile, and CTCF binding within the 2.7 Mb segment of chicken chromosome 14 harboring the alpha-globin gene cluster in cultured lymphoid cells and cultured erythroid cells before and after induction of terminal erythroid differentiation. We found that, similarly to mammalian genome, the chicken genomes is organized in TADs and compartments. Full activation of the alpha-globin gene transcription in differentiated erythroid cells is correlated with upregulation of several adjacent housekeeping genes and the emergence of abundant intergenic transcription. An extended chromosome region encompassing the alpha-globin cluster becomes significantly decompacted in differentiated erythroid cells, and depleted in CTCF binding and CTCF-anchored chromatin loops, while the sub-TAD harboring alpha-globin gene cluster and the upstream major regulatory element (MRE) becomes highly enriched with chromatin interactions as compared to lymphoid and proliferating erythroid cells. The alpha-globin gene domain and the neighboring loci reside within the A-like chromatin compartment in both lymphoid and erythroid cells and become further segregated from the upstream gene desert upon terminal erythroid differentiation. Our findings demonstrate that the effects of tissue-specific transcription activation are not restricted to the host genomic locus but affect the overall chromatin structure and transcriptional output of the encompassing

  14. Terminal Gold-Oxo Complexes

    Energy Technology Data Exchange (ETDEWEB)

    Cao, R.; Anderson, T.M.; Piccoli, P.M.B.; Schultz, A.J.; Koetzle, T.F.; Geletii, Y.V.; Slonkina, E.; Hedman, B.; Hodgson, K.O.; Hardcastle, K.I.; Fang, X.; Kirk, M.L.; Knottenbelt, S.; Kogerler, P.; Musaev, D.G.; Morokuma, K.; Takahashi, M.; Hill, C.L.; /Emory U. /Argonne /SLAC, SSRL /New Mexico U. /Iowa State U. /Toho U.

    2007-10-19

    In contradiction to current bonding paradigms, two terminal Au-oxo molecular complexes have been synthesized by reaction of AuCl{sub 3} with metal oxide-cluster ligands that model redox-active metal oxide surfaces. Use of K{sub 10}[{alpha}{sub 2}-P{sub 2}W{sub 17}O{sub 61}] x 20H{sub 2}O and K{sub 2}WO{sub 4} (forming the [A-PW{sub 9}O{sub 34}]{sup 9-} ligand in situ) produces K{sub 15}H{sub 2}[Au(O)(OH{sub 2})P{sub 2}W{sub 18}O{sub 68}] x 25H{sub 2}O (1); use of K{sub 10}[P{sub 2}W{sub 20}O{sub 70}(OH{sub 2}){sub 2}] x 22H{sub 2}O (3) produces K{sub 7}H{sub 2}[Au(O)(OH{sub 2})P{sub 2}W{sub 20}O{sub 70}(OH{sub 2}){sub 2}] x 27H{sub 2}O (2). Complex 1 crystallizes in orthorhombic Fddd, with a = 28.594(4) Angstroms, b = 31.866(4) Angstroms, c = 38.241(5) Angstroms, V = 34844(7) Angstroms{sup 3}, Z = 16 (final R = 0.0540), and complex 2 crystallizes in hexagonal P6(3)/mmc, with a = 16.1730(9) Angstroms, b = 16.1730(9) Angstroms, c = 19.7659(15) Angstroms, V = 4477.4(5) Angstroms{sup 3}, Z = 2 (final R = 0.0634). The polyanion unit in 1 is disorder-free. Very short ({approx}1.76 Angstroms) Au-oxo distances are established by both X-ray and 30 K neutron diffraction studies, and the latter confirms oxo and trans aqua (H2O) ligands on Au. Seven findings clarify that Au and not W is present in the Au-oxo position in 1 and 2. Five lines of evidence are consistent with the presence of d8 Au(III) centers that are stabilized by the flanking polytungstate ligands in both 1 and 2: redox titrations, electrochemical measurements, 17 K optical spectra, Au L2 edge X-ray absorption spectroscopy, and Au-oxo bond distances. Variable-temperature magnetic susceptibility data for crystalline 1 and 2 establish that both solids are diamagnetic, and {sup 31}P and {sup 17}O NMR spectroscopy confirm that both remain diamagnetic in solution. Both complexes have been further characterized by FT-IR, thermogravimetric analysis (TGA), differential scanning calorimetry (DSC), and other techniques.

  15. The management of terminal delirium

    Directory of Open Access Journals (Sweden)

    Macleod A

    2006-01-01

    Full Text Available Delirium is a distressing and disturbing clinical event. Palliation of the symptoms by multi-component interventions can be effective. The goal of interventions is to raise the deliriant threshold by combined symptom relief, environmental, psychological and pharmacological interventions. Haloperidol remains the drug of choice for delirium. For intractable delirious symptoms at the end of life terminal sedation may be indicated.

  16. Constraint Differentiation

    DEFF Research Database (Denmark)

    Mödersheim, Sebastian Alexander; Basin, David; Viganò, Luca

    2010-01-01

    We introduce constraint differentiation, a powerful technique for reducing search when model-checking security protocols using constraint-based methods. Constraint differentiation works by eliminating certain kinds of redundancies that arise in the search space when using constraints to represent...... results show that constraint differentiation substantially reduces search and considerably improves the performance of OFMC, enabling its application to a wider class of problems....

  17. Differential manifolds

    CERN Document Server

    Kosinski, Antoni A

    2007-01-01

    The concepts of differential topology form the center of many mathematical disciplines such as differential geometry and Lie group theory. Differential Manifolds presents to advanced undergraduates and graduate students the systematic study of the topological structure of smooth manifolds. Author Antoni A. Kosinski, Professor Emeritus of Mathematics at Rutgers University, offers an accessible approach to both the h-cobordism theorem and the classification of differential structures on spheres.""How useful it is,"" noted the Bulletin of the American Mathematical Society, ""to have a single, sho

  18. Uhrf1 controls the self-renewal versus differentiation of hematopoietic stem cells by epigenetically regulating the cell-division modes.

    Science.gov (United States)

    Zhao, Jingyao; Chen, Xufeng; Song, Guangrong; Zhang, Jiali; Liu, Haifeng; Liu, Xiaolong

    2017-01-10

    Hematopoietic stem cells (HSCs) are able to both self-renew and differentiate. However, how individual HSC makes the decision between self-renewal and differentiation remains largely unknown. Here we report that ablation of the key epigenetic regulator Uhrf1 in the hematopoietic system depletes the HSC pool, leading to hematopoietic failure and lethality. Uhrf1-deficient HSCs display normal survival and proliferation, yet undergo erythroid-biased differentiation at the expense of self-renewal capacity. Notably, Uhrf1 is required for the establishment of DNA methylation patterns of erythroid-specific genes during HSC division. The expression of these genes is enhanced in the absence of Uhrf1, which disrupts the HSC-division modes by promoting the symmetric differentiation and suppressing the symmetric self-renewal. Moreover, overexpression of one of the up-regulated genes, Gata1, in HSCs is sufficient to phenocopy Uhrf1-deficient HSCs, which show impaired HSC symmetric self-renewal and increased differentiation commitment. Taken together, our findings suggest that Uhrf1 controls the self-renewal versus differentiation of HSC through epigenetically regulating the cell-division modes, thus providing unique insights into the relationship among Uhrf1-mediated DNA methylation, cell-division mode, and HSC fate decision.

  19. Forced differentiation of CFU-S by iron-55 erythrocytocide

    International Nuclear Information System (INIS)

    Reincke, U.; Brookoff, D.; Burlington, H.; Cronkite, E.P.; Mount Sinai School of Medicine, New York

    1979-01-01

    Cascades of Auger electrons are emitted in the decay of 55 Fe and absorbed in tissue within a 1μm radius. Cytocidal amounts of 55 Fe can therefore eliminate erythroid precursors with minimal damage to adjacent cells. A single intravenous injection leads to continued erythrocytocide in mice because the isotope is reutilized and has a 2.7 year half-life. The cytocide evokes an early compensatory response from morphologically unrecognizable precursors which differentiate into pronormoblasts. These early events leave the granuloid series undisturbed but they are accompanied by a precipitous fall in pluripotent stem cell (CFU-S) numbers in bone marrow, spleen, and blood. The pretreatment levels of CFU-S are not restored. Gradual decline of CFU-S is associated with intermittently increased turnover rates and reduced settings of cell production, yet the capacity for quick restoration of blood loss is unimpaired. The precipitous initial stem cell decrease is not caused by irradiation damage, as shown in a separate experimental series that used the frozen-storage cytocide technique. Only over several weeks could 55 Fe radiation accumulate to lethal levels in nondividing stem cells. This irradiation is attributed to incorporation of small amounts of 55 Fe into CFU-S, from where it is slowly cleared. The stem cell loss immediately following 55 Fe injection is in our interpretation caused by rapid differentiation along the erythroid pathway in a response that involves all progenitor populations. Data are consistent with the hypothesis of limited cell renewal capacity which thereby gains further support. (orig.) [de

  20. In Vitro Large Scale Production of Human Mature Red Blood Cells from Hematopoietic Stem Cells by Coculturing with Human Fetal Liver Stromal Cells

    Directory of Open Access Journals (Sweden)

    Jiafei Xi

    2013-01-01

    Full Text Available In vitro models of human erythropoiesis are useful in studying the mechanisms of erythroid differentiation in normal and pathological conditions. Here we describe an erythroid liquid culture system starting from cord blood derived hematopoietic stem cells (HSCs. HSCs were cultured for more than 50 days in erythroid differentiation conditions and resulted in a more than 109-fold expansion within 50 days under optimal conditions. Homogeneous erythroid cells were characterized by cell morphology, flow cytometry, and hematopoietic colony assays. Furthermore, terminal erythroid maturation was improved by cosculturing with human fetal liver stromal cells. Cocultured erythroid cells underwent multiple maturation events, including decrease in size, increase in glycophorin A expression, and nuclear condensation. This process resulted in extrusion of the pycnotic nuclei in up to 80% of the cells. Importantly, they possessed the capacity to express the adult definitive β-globin chain upon further maturation. We also show that the oxygen equilibrium curves of the cord blood-differentiated red blood cells (RBCs are comparable to normal RBCs. The large number and purity of erythroid cells and RBCs produced from cord blood make this method useful for fundamental research in erythroid development, and they also provide a basis for future production of available RBCs for transfusion.

  1. Kinetics of granulocytic and erythroid progenitor cells are affected differently by short-term, low-level benzene exposure

    Energy Technology Data Exchange (ETDEWEB)

    Dempster, A.M.; Snyder, C.A. (New York Univ. Medical Center, NY (United States). Inst. of Environmental Medicine)

    1991-09-01

    Mice were exposed to either air or 10 ppm benzene for 6 h/d X 5 d. Immediately after the last exposure, mice were injected, i.v., with either saline or hydroxyurea (HU). The dose of HU was sufficient to kill hematopoietic cells in or near S-phase of the cell cycle and sufficient to synchronize the surviving populations of hematopoietic cells. Three days after benzene exposure, CFU-E numbers had declined to 50% of control values while CFU-GM numbers were equal to control values at this time. The benzene exposures were sufficient to double the percentage of CFU-E in S-phase but produced no such increase among CFU-Gm. During 3 days of recovery from benzene exposure and HU treatment, the CFU-E population expanded 30-fold while the CFU-GM population expanded less than 3-fold. Following benzene exposure and HU treatment, both progenitor cells produced elevated numbers of their respective progeny. When CFU-E from benzene-exposed mice were cultured with varying concentrations of erythropoietin (EPO), the response at maximal EPO concentration was 66% of the response by control CFU-E. This strongly suggests that the CFU-E populations from benzene-exposed mice had been depleted of cells in or near S-phase. The results indicate that CFU-GM respond to low-level benzene exposure by increasing their rate of differentiation but not their rate of proliferation, while CFU-E respond by increasing both their rates of differentiation and proliferation. We speculate that it is the increase in CFU-E proliferation that renders these cells more susceptible to benzene than their granulocytic counterparts, especially those CFU-E at or near the S-phase of the cell cycle. (orig.).

  2. Reduction in DNA repair capacity following differentiation of murine proadipocytes

    International Nuclear Information System (INIS)

    Tofilon, P.J.; Meyn, R.E.

    1988-01-01

    It has been suggested that terminally differentiated mammalian cells have a decreased DNA repair capacity, compared with proliferating stem cells. To investigate this hypothesis, we have examined γ-ray-induced DNA strand breaks and their repair in the murine proadipocyte stem cell line 3T3-T. By exposure to human plasma, 3T3-T cells can be induced to undergo nonterminal and then terminal differentiation. DNA strand breaks were evaluated using the technique of alkaline elution. No difference was detected among stem, nonterminally differentiated, and terminally differentiated cells in the initial levels of radiation-induced DNA strand breaks. Each of the strand break dose responses increased as a linear function of γ-ray dose. The strand breaks induced by 4 Gy rejoined following biphasic kinetics for each cell type. At each time point examined after irradiation, however, the percentage of strand breaks that had not rejoined in terminally differentiated cells was three to six times greater than in stem cells. The rate of strand break rejoining in nonterminally differentiated cells was of an intermediate value between that of the stem and of the terminally differentiated cells. These results indicate that, at least for 3T3-T cells, differentiated cells have a reduced capacity for DNA repair

  3. Differential equations

    CERN Document Server

    Barbu, Viorel

    2016-01-01

    This textbook is a comprehensive treatment of ordinary differential equations, concisely presenting basic and essential results in a rigorous manner. Including various examples from physics, mechanics, natural sciences, engineering and automatic theory, Differential Equations is a bridge between the abstract theory of differential equations and applied systems theory. Particular attention is given to the existence and uniqueness of the Cauchy problem, linear differential systems, stability theory and applications to first-order partial differential equations. Upper undergraduate students and researchers in applied mathematics and systems theory with a background in advanced calculus will find this book particularly useful. Supplementary topics are covered in an appendix enabling the book to be completely self-contained.

  4. Identification and characterisation of a G-quadruplex forming sequence in the promoter region of nuclear factor (erythroid-derived 2)-like 2 (Nrf2)

    Energy Technology Data Exchange (ETDEWEB)

    Waller, Zoë A.E., E-mail: z.waller@uea.ac.uk; Howell, Lesley A.; MacDonald, Colin J.; O’Connell, Maria A.; Searcey, Mark, E-mail: m.searcey@uea.ac.uk

    2014-04-25

    Highlights: • Discovery of a G-quadruplex forming sequence in the promoter sequence of Nrf2. • Characterisation of the G-quadruplex by UV, CD and NMR. • Conformational switching of G-quadruplex induced by 9-aminoacridine. - Abstract: The transcription factor nuclear factor (erythroid-derived 2)-like 2 (Nrf2) regulates multiple antioxidants, Phase II detoxification enzymes and other cytoprotective enzymes in cells. Activation of Nrf2 is recognised as being of potential therapeutic benefit in inflammatory-diseases whereas more recently, it has become clear that the inhibition of Nrf2 may have benefit in the alleviation of resistance in some tumour types. A potential G-quadruplex forming sequence was identified in the promoter region of Nrf2, close to a number of putative transcription factor binding sites. Characterisation of the sequence 5’-d[GGGAAGGGAGCAAGGGCGGGAGGG]-3’ using CD spectroscopy, imino proton NMR resonances and UV melting experiments demonstrated the formation of a parallel intramolecular G-quadruplex in the presence of K{sup +} ions. Incubation with 9-aminoacridine ligands induced a switch from antiparallel to parallel forms. The presence of a G-quadruplex forming sequence in the promoter region of Nrf2 suggests an approach to targeting the production of the protein through stabilisation of the structure, thereby avoiding resistance to antitumour drugs.

  5. Lack of association between nuclear factor erythroid-derived 2-like 2 promoter gene polymorphisms and oxidative stress biomarkers in amyotrophic lateral sclerosis patients.

    Science.gov (United States)

    LoGerfo, Annalisa; Chico, Lucia; Borgia, Loredana; Petrozzi, Lucia; Rocchi, Anna; D'Amelio, Antonia; Carlesi, Cecilia; Caldarazzo Ienco, Elena; Mancuso, Michelangelo; Siciliano, Gabriele

    2014-01-01

    Oxidative stress involvement has been strongly hypothesized among the possible pathogenic mechanisms of motor neuron degeneration in amyotrophic lateral sclerosis (ALS). The intracellular redox balance is finely modulated by numerous complex mechanisms critical for cellular functions, among which the nuclear factor erythroid-derived 2-like 2 (NFE2L2/Nrf2) pathways. We genotyped, in a cohort of ALS patients (n = 145) and healthy controls (n = 168), three SNPs in Nrf2 gene promoter: -653 A/G, -651 G/A, and -617 C/A and evaluated, in a subset (n = 73) of patients, advanced oxidation protein products (AOPP), iron-reducing ability of plasma (FRAP), and plasma thiols (-SH) as oxidative damage peripheral biomarkers. Nrf2 polymorphisms were not different among patients and controls. Increased levels of AOPP (P < 0.05) and decreased levels of FRAP (P < 0.001) have been observed in ALS patients compared with controls, but no difference in -SH values was found. Furthermore, no association was found between biochemical markers of redox balance and Nrf2 polymorphisms. These data confirm an altered redox balance in ALS and indicate that, while being abnormally modified compared to controls, the oxidative stress biomarkers assessed in this study are independent from the -653 A/G, -651 G/A, and -617 C/A Nrf2 SNPs in ALS patients.

  6. Lack of Association between Nuclear Factor Erythroid-Derived 2-Like 2 Promoter Gene Polymorphisms and Oxidative Stress Biomarkers in Amyotrophic Lateral Sclerosis Patients

    Directory of Open Access Journals (Sweden)

    Annalisa LoGerfo

    2014-01-01

    Full Text Available Oxidative stress involvement has been strongly hypothesized among the possible pathogenic mechanisms of motor neuron degeneration in amyotrophic lateral sclerosis (ALS. The intracellular redox balance is finely modulated by numerous complex mechanisms critical for cellular functions, among which the nuclear factor erythroid-derived 2-like 2 (NFE2L2/Nrf2 pathways. We genotyped, in a cohort of ALS patients (n=145 and healthy controls (n=168, three SNPs in Nrf2 gene promoter: −653 A/G, −651 G/A, and −617 C/A and evaluated, in a subset (n=73 of patients, advanced oxidation protein products (AOPP, iron-reducing ability of plasma (FRAP, and plasma thiols (-SH as oxidative damage peripheral biomarkers. Nrf2 polymorphisms were not different among patients and controls. Increased levels of AOPP (P<0.05 and decreased levels of FRAP (P<0.001 have been observed in ALS patients compared with controls, but no difference in -SH values was found. Furthermore, no association was found between biochemical markers of redox balance and Nrf2 polymorphisms. These data confirm an altered redox balance in ALS and indicate that, while being abnormally modified compared to controls, the oxidative stress biomarkers assessed in this study are independent from the −653 A/G, −651 G/A, and −617 C/A Nrf2 SNPs in ALS patients.

  7. Terminal nerve: cranial nerve zero

    Directory of Open Access Journals (Sweden)

    Jorge Eduardo Duque Parra

    2006-12-01

    Full Text Available It has been stated, in different types of texts, that there are only twelve pairs of cranial nerves. Such texts exclude the existence of another cranial pair, the terminal nerve or even cranial zero. This paper considers the mentioned nerve like a cranial pair, specifying both its connections and its functional role in the migration of liberating neurons of the gonadotropic hormone (Gn RH. In this paper is also stated the hypothesis of the phylogenetic existence of a cerebral sector and a common nerve that integrates the terminal nerve with the olfactory nerves and the vomeronasals nerves which seem to carry out the odors detection function as well as in the food search, pheromone detection and nasal vascular regulation.

  8. Three-terminal superconducting devices

    International Nuclear Information System (INIS)

    Gallagher, W.J.

    1985-01-01

    The transistor has a number of properties that make it so useful. The authors discuss these and the additional properties a transistor would need to have for high performance applications at temperatures where superconductivity could contribute advantages to system-level performance. These properties then serve as criteria by which to evaluate three-terminal devices that have been proposed for applications at superconducting temperatures. FETs can retain their transistor properties at low temperatures, but their power consumption is too large for high-speed, high-density cryogenic applications. They discuss in detail why demonstrated superconducting devices with three terminals -Josephson effect based devices, injection controlled weak links, and stacked tunnel junction devices such as the superconducting transistor proposed by K. Gray and the quiteron -- each fail to have true transistor-like properties. They conclude that the potentially very rewarding search for a transistor compatible with superconductivity in high performance applications must be in new directions

  9. JCO criticality accident termination operation

    International Nuclear Information System (INIS)

    Kanamori, Masashi

    2001-12-01

    On September 30 at around 10:35 AM, criticality accident occurred at the JCO's conversion building in Tokai-mura. Since criticality accident had not been anticipated, neither devices for termination of criticality accident nor neutron detectors were available. Immediately after the information of the accident, our emergency staff (Japan Nuclear Cycle development institute staff) went to JCO site, to measure the intensity of neutrons and gammas. There were four main tasks, first one was to measure the radiation intensity, second one was to terminate the criticality accident, third one is to alert the residents surrounding the JCO site, fourth one is to evacuate the employees in the site. These tasks were successfully performed until October 1. This paper describes about how these operations were performed by the relevant staffs. (author)

  10. Dictionary of nuclear energy termination

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    1983-04-15

    This book lists termination of nuclear energy such as abbreviation, symbol, unit of nuclear energy, radiological unit, the symbol for element, isotope chart and the periodic table. This book contains about 5500 words involving to nuclear energy with index in Korean and English. It arranges alphabetically. So, with this book, it is easy and fast to find out the glossary, unit and symbol on nuclear energy.

  11. Combining norms to prove termination

    DEFF Research Database (Denmark)

    Genaim, S.; Codish, M.; Gallagher, John Patrick

    2002-01-01

    Automatic termination analysers typically measure the size of terms applying norms which are mappings from terms to the natural numbers. This paper illustrates howt o enable the use of size functions defined as tuples of these simpler norm functions. This approach enables us to simplify the probl...... of the recursive data-types in the program, is often a suitable choice. We first demonstrate the power of combining norm functions and then the adequacy of combining norms based on regular types....

  12. Dictionary of nuclear energy termination

    International Nuclear Information System (INIS)

    1983-04-01

    This book lists termination of nuclear energy such as abbreviation, symbol, unit of nuclear energy, radiological unit, the symbol for element, isotope chart and the periodic table. This book contains about 5500 words involving to nuclear energy with index in Korean and English. It arranges alphabetically. So, with this book, it is easy and fast to find out the glossary, unit and symbol on nuclear energy.

  13. War Termination: A Selected Bibliography

    Science.gov (United States)

    2010-10-01

    UA25 .L342 2009) Mandel, Robert . The Meaning of Military Victory. Boulder: Lynne Rienner, 2006. 190pp. (U163 .M266 2006) Marshall, Monty G., and...Ted Robert Gurr. Peace and Conflict 2005: A Global Survey of Armed Conflicts, Self-Determination Movements, and Democracy. College Park: Center for...18pp. (AD-A468-990) http://handle.dtic.mil/100.2/ADA468990 Raymer , James H. In Search of Lasting Results: Military War Termination Doctrine. Fort

  14. High Octane Fuel: Terminal Backgrounder

    Energy Technology Data Exchange (ETDEWEB)

    Moriarty, Kristi [National Renewable Energy Lab. (NREL), Golden, CO (United States)

    2016-02-11

    The Bioenergy Technologies Office of the U.S. Department of Energy Office of Energy Efficiency and Renewable Energy sponsored a scoping study to assess the potential of ethanol-based high octane fuel (HOF) to reduce energy consumption and greenhouse gas emissions. When the HOF blend is made with 25%-40% ethanol by volume, this energy efficiency improvement is potentially sufficient to offset the reduced vehicle range often associated with the decreased volumetric energy density of ethanol. The purpose of this study is to assess the ability of the fuel supply chain to accommodate more ethanol at fuel terminals. Fuel terminals are midstream in the transportation fuel supply chain and serve to store and distribute fuels to end users. While there are no technical issues to storing more ethanol at fuel terminals, there are several factors that could impact the ability to deploy more ethanol. The most significant of these issues include the availability of land to add more infrastructure and accommodate more truck traffic for ethanol deliveries as well as a lengthy permitting process to erect more tanks.

  15. Investigating the DNA-binding ability of GATA-1-N-terminal zinc finger

    International Nuclear Information System (INIS)

    Wong, R.; Newton, A.; Crossley, M.; Mackay, J.

    2001-01-01

    Erythroid transcription factor GATA-1 interacts with both DNA and other proteins through its zinc finger domains (ZnFs). While it has been known for me time that the C-terminal ZnF binds DNA at GATA sites, only recently has it been observed that the N-terminal finger (NF) is capable of interacting with GATC sites. Further, a number of naturally occurring mutations in NF (V205M, G208S, R216Q, D218G) that lead to anaemia and thrombocytopenia have been identified. We are interested in characterising the NF-DNA interaction and determining the effects of mutation upon this interaction. Using nuclear magnetic resonance (NMR) spectroscopy, we have observed an interaction between recombinant NF and a 16-mer DNA duplex containing a core GATC sequence. This result forms the basis from which residues in NF involved in DNA binding can be identified, and work is being carried out to improve the quality of the NMR data with the aim of determining the solution structure of the NF-DNA complex. The DNA-binding affinity of both wild-type and mutant NFs mentioned above is also being investigated using isothermal titration calorimetry. These data suggest that the strength of the interaction between NF and the 16-mer DNA duplex is in the sub-micromolar range, and comparisons between the DNA-binding affinities of the NF mutants are being made. Together, these studies will help us to understand how GATA-1 acts as a transcriptional regulator and how mutations in NF domain of GATA-1 may lead to blood disorders

  16. Magnetic resonance in the dilation of terminal ventricle; Resonancia magnetica en la dilatacion del ventriculo terminal

    Energy Technology Data Exchange (ETDEWEB)

    Eulatem d, R. G.; Martinez, M. E.; Oleaga, L.; Grande, D.

    2001-07-01

    Describe de Magnetic Resonance (MR) findings in four cases of terminal ventricle dilation. We have studied four patients, all of them women, whose mean age range was 39 years. The studies were performed with a 1 Tesla magnet and the sequences used were sagittal and axial T1 and T2 weighted and sagittal and axial T1 weighted after the administration of gadolinium. the follow-up was clinical and by MRI. The four patients studied came due to low back pain. The MRI images demonstrated the presence of a cystic lesion located in the medullary cone, with a well defined contour and one that presented no type of enhancement in the study performed with gadolinium. In three cases, we had a MRI control at two years and the images had not varied. We have no control for the fourth cases of more recent diagnosis. The terminal ventricle is an ependymoma cavity located in the medullary cone. It can present a dilation and it is necessary to know its existence, typical location and signal characteristics to be able to diagnose and differentiate it from cystic tumors in this localization, that can present a similar appearance in the MRI. (Author) 7 refs.

  17. Functionalization of hydroxyl terminated polybutadiene with ...

    Indian Academy of Sciences (India)

    CBDT), has been covalently attached at the terminal carbon atoms of the hydroxyl terminated polybutadiene (HTPB) backbone. The modification of HTPB backbone by CBDT molecule does not affect the unique physico-chemical properties such ...

  18. Differential games

    CERN Document Server

    Friedman, Avner

    2006-01-01

    This volume lays the mathematical foundations for the theory of differential games, developing a rigorous mathematical framework with existence theorems. It begins with a precise definition of a differential game and advances to considerations of games of fixed duration, games of pursuit and evasion, the computation of saddle points, games of survival, and games with restricted phase coordinates. Final chapters cover selected topics (including capturability and games with delayed information) and N-person games.Geared toward graduate students, Differential Games will be of particular interest

  19. Efficiency analysis of container ports and terminals

    OpenAIRE

    Liu, Q.

    2010-01-01

    In the past two decades the steady growth of seaborne trade has resulted in the increase of container ships, container ports and their terminals. The structure of the shipping market is, moreover, continuously evolving. On the carrier side, shipping companies form consortia and alliances; on the port side, global terminal operators and dedicated container terminals are emerging. The aim of this research is to evaluate the efficiency of container ports and terminals and to study...

  20. Kajian Kinerja Terminal Batu Ampar Kota Balikpapan

    Directory of Open Access Journals (Sweden)

    Randha Alief Chikita

    2018-01-01

    Full Text Available Batu Ampar Terminal Balikpapan is the only type A passenger terminal in Balikpapan City. The purpose of this study is to determine the operational performance of the terminal at this time and also to determine the level of service in the terminal. The results of this study indicate that for FIFO queue discipline analysis on AKDP and AKAP bus lines, it is known that ρ <1 means that there is currently no queue in the terminal. For the analysis of terminal facilities it is known that there are still some terminal facilities that are not yet available from the main facilities and supporting facilities, therefore the need for additional facilities in order to meet the standard of passenger terminal type A. In the next 15 years analysis for traffic intensity value is approaching 1 which means in the future will cause the queue in the terminal, so it is necessary for the improvement of terminal performance. For the service performance with IPA method there are 35 variables that there are 7 variables that enter in quadrant I. In the next step to do analysis to know the priority of handling by using QFD method. Keywords: Batu Ampar Terminal Balikpapan, IPA, terminal performance, QFD

  1. Strategic technology alliance termination : an empirical investigation

    NARCIS (Netherlands)

    Sadowski, B.M.; Duysters, G.M.

    2008-01-01

    There is growing consensus that overall alliance termination rates are high. However, despite this track record of termination and despite unsurpassed growth rates of strategic technology alliances, little is known about the reasons for their termination. Typically strategic alliances have been

  2. 49 CFR 374.309 - Terminal facilities.

    Science.gov (United States)

    2010-10-01

    ... 49 Transportation 5 2010-10-01 2010-10-01 false Terminal facilities. 374.309 Section 374.309... REGULATIONS Adequacy of Intercity Motor Common Carrier Passenger Service § 374.309 Terminal facilities. (a... attendants and be regularly patrolled. (b) Outside facilities. At terminals and stations that are closed when...

  3. 9 CFR 3.40 - Terminal facilities.

    Science.gov (United States)

    2010-01-01

    ... 9 Animals and Animal Products 1 2010-01-01 2010-01-01 false Terminal facilities. 3.40 Section 3.40... Pigs and Hamsters Transportation Standards § 3.40 Terminal facilities. No person subject to the Animal... animal holding areas of a terminal facility where shipments of live guinea pigs or hamsters are...

  4. 9 CFR 3.91 - Terminal facilities.

    Science.gov (United States)

    2010-01-01

    ... 9 Animals and Animal Products 1 2010-01-01 2010-01-01 false Terminal facilities. 3.91 Section 3.91... Primates 2 Transportation Standards § 3.91 Terminal facilities. (a) Placement. Any persons subject to the... with inanimate cargo or with other animals in animal holding areas of terminal facilities. Nonhuman...

  5. 9 CFR 3.65 - Terminal facilities.

    Science.gov (United States)

    2010-01-01

    ... 9 Animals and Animal Products 1 2010-01-01 2010-01-01 false Terminal facilities. 3.65 Section 3.65... Transportation Standards § 3.65 Terminal facilities. No person subject to the Animal Welfare regulations shall commingle shipments of live rabbits with inanimate cargo. All animal holding areas of a terminal facility...

  6. 9 CFR 3.18 - Terminal facilities.

    Science.gov (United States)

    2010-01-01

    ... 9 Animals and Animal Products 1 2010-01-01 2010-01-01 false Terminal facilities. 3.18 Section 3.18... Cats 1 Transportation Standards § 3.18 Terminal facilities. (a) Placement. Any person subject to the... inanimate cargo in animal holding areas of terminal facilities. (b) Cleaning, sanitization, and pest control...

  7. 46 CFR 525.2 - Terminal schedules.

    Science.gov (United States)

    2010-10-01

    ... domestic law and international conventions and agreements adopted by the United States; such terminal... their own negligence, or that impose upon others the obligation to indemnify or hold-harmless the terminals from liability for their own negligence. (2) Enforcement of terminal schedules. Any schedule that...

  8. 25 CFR 11.1114 - Termination.

    Science.gov (United States)

    2010-04-01

    ... Minor-in-Need-of-Care Procedure § 11.1114 Termination. (a) Parental rights to a child may be terminated... rights if, following efforts to prevent or eliminate the need to remove the minor, it finds such efforts... alternatives: (1) If parental rights to a child are terminated, the children's court shall place the minor in a...

  9. Disruption of Spectrin-Like Cytoskeleton in Differentiating Keratinocytes by PKCδ Activation Is Associated with Phosphorylated Adducin

    Science.gov (United States)

    Zhao, Kong-Nan; Masci, Paul P.; Lavin, Martin F.

    2011-01-01

    Spectrin is a central component of the cytoskeletal protein network in a variety of erythroid and non-erythroid cells. In keratinocytes, this protein has been shown to be pericytoplasmic and plasma membrane associated, but its characteristics and function have not been established in these cells. Here we demonstrate that spectrin increases dramatically in amount and is assembled into the cytoskeleton during differentiation in mouse and human keratinocytes. The spectrin-like cytoskeleton was predominantly organized in the granular and cornified layers of the epidermis and disrupted by actin filament inhibitors, but not by anti-mitotic drugs. When the cytoskeleton was disrupted PKCδ was activated by phosphorylation on Thr505. Specific inhibition of PKCδ(Thr505) activation with rottlerin prevented disruption of the spectrin-like cytoskeleton and the associated morphological changes that accompany differentiation. Rottlerin also inhibited specific phosphorylation of the PKCδ substrate adducin, a cytoskeletal protein. Furthermore, knock-down of endogenous adducin affected not only expression of adducin, but also spectrin and PKCδ, and severely disrupted organization of the spectrin-like cytoskeleton and cytoskeletal distribution of both adducin and PKCδ. These results demonstrate that organization of a spectrin-like cytoskeleton is associated with keratinocytes differentiation, and disruption of this cytoskeleton is mediated by either PKCδ(Thr505) phosphorylation associated with phosphorylated adducin or due to reduction of endogenous adducin, which normally connects and stabilizes the spectrin-actin complex. PMID:22163289

  10. Differential Geometry

    CERN Document Server

    Stoker, J J

    2011-01-01

    This classic work is now available in an unabridged paperback edition. Stoker makes this fertile branch of mathematics accessible to the nonspecialist by the use of three different notations: vector algebra and calculus, tensor calculus, and the notation devised by Cartan, which employs invariant differential forms as elements in an algebra due to Grassman, combined with an operation called exterior differentiation. Assumed are a passing acquaintance with linear algebra and the basic elements of analysis.

  11. The C-Terminal O-S Acyl Shift Pathway under Acidic Condition to Propose Peptide-Thioesters

    Directory of Open Access Journals (Sweden)

    Bo Mi Kim

    2016-11-01

    Full Text Available Peptide-thioester is a pivotal intermediate for peptide ligation and N-, C-terminal cyclization. In this study, desired pathway and the side products of two C-terminal handles, hydroxyethylthiol (HET and hydroxypropylthiol (HPT are described in different conditions as well as kinetic studies. In addition, a new mechanism of C-terminal residue racemization is proposed on the basis of differentiation of products derived from the two C-terminal handles in preparing peptide thioesters through an acid-catalyzed tandem thiol switch, first by an intramolecular O-S acyl shift, and then by an intermolecular S-S exchange.

  12. l-2-Oxothiazolidine-4-Carboxylic Acid or α-Lipoic Acid Attenuates Airway Remodeling: Involvement of Nuclear Factor-κB (NF-κB, Nuclear Factor Erythroid 2p45-Related Factor-2 (Nrf2, and Hypoxia-Inducible Factor (HIF

    Directory of Open Access Journals (Sweden)

    Heung Bum Lee

    2012-06-01

    Full Text Available Reactive oxygen species (ROS play a crucial role in the pathogenesis of acute and chronic respiratory diseases. Antioxidants have been found to ameliorate airway inflammation and hyperresponsiveness in animal models employing short-term exposure to allergen. However, little data are available on the effect of antioxidants on airway remodeling and signaling pathways in chronic asthma. In the present study, we used a long-term exposure murine model of allergic airway disease to evaluate the effects of an antioxidant, l-2-oxothiazolidine-4-carboxylic acid (OTC or α-lipoic acid (LA on airway remodeling, focusing on the ROS-related hypoxia-inducible signaling. Long-term challenge of ovalbumin (OVA increased ROS production, airway inflammation, and airway hyperresponsiveness, and developed features of airway remodeling such as excessive mucus secretion, subepithelial fibrosis, and thickening of the peribronchial smooth muscle layer. Administration of OTC or LA reduced these features of asthma, including airway remodeling, which was accompanied by suppression of transforming growth factor-β1, vascular endothelial growth factor, and T-helper 2 cytokines. In addition, OVA-induced activation of nuclear factor-κB (NF-κB, nuclear factor erythroid 2p45-related factor-2 (Nrf2, hypoxia-inducible factor (HIF-1α, and HIF-2α was reduced by OTC or LA. Our results also showed that OTC or LA down-regulated phosphoinositide 3-kinase activity and decreased phosphorylation of p38 mitogen-activated protein kinase but not extracellular signal-regulated kinase 1/2 or c-Jun N-terminal kinase. These findings demonstrate that OTC and LA can inhibit activation of NF-κB, Nrf2, and HIF, leading to attenuate allergen-induced airway remodeling.

  13. Response terminated displays unload selective attention.

    Science.gov (United States)

    Roper, Zachary J J; Vecera, Shaun P

    2013-01-01

    Perceptual load theory successfully replaced the early vs. late selection debate by appealing to adaptive control over the efficiency of selective attention. Early selection is observed unless perceptual load (p-Load) is sufficiently low to grant attentional "spill-over" to task-irrelevant stimuli. Many studies exploring load theory have used limited display durations that perhaps impose artificial limits on encoding processes. We extended the exposure duration in a classic p-Load task to alleviate temporal encoding demands that may otherwise tax mnemonic consolidation processes. If the load effect arises from perceptual demands alone, then freeing-up available mnemonic resources by extending the exposure duration should have little effect. The results of Experiment 1 falsify this prediction. We observed a reliable flanker effect under high p-Load, response-terminated displays. Next, we orthogonally manipulated exposure duration and task-relevance. Counter-intuitively, we found that the likelihood of observing the flanker effect under high p-Load resides with the duration of the task-relevant array, not the flanker itself. We propose that stimulus and encoding demands interact to produce the load effect. Our account clarifies how task parameters differentially impinge upon cognitive processes to produce attentional "spill-over" by appealing to visual short-term memory as an additional processing bottleneck when stimuli are briefly presented.

  14. Response terminated displays unload selective attention

    Directory of Open Access Journals (Sweden)

    Zachary Joseph Jackson Roper

    2013-12-01

    Full Text Available Perceptual load theory successfully replaced the early versus late selection debate by appealing to adaptive control over the efficiency of selective attention. Early selection is observed unless perceptual load (p-Load is sufficiently low to grant attentional ‘spill-over‘ to task-irrelevant stimuli. Many studies exploring load theory have used limited display durations that perhaps impose artificial limits on encoding processes. We extended the exposure duration in a classic p-Load task to alleviate temporal encoding demands that may otherwise tax mnemonic consolidation processes. If the load effect arises from perceptual demands alone, then freeing-up available mnemonic resources by extending the exposure duration should have little effect. The results of Experiment 1 falsify this prediction. We observed a reliable flanker effect under high p-Load, response-terminated displays. Next, we orthogonally manipulated exposure duration and task-relevance. Counter-intuitively, we found that the likelihood of observing the flanker effect under high p-Load resides with the duration of the task-relevant array, not the flanker itself. We propose that stimulus and encoding demands interact to produce the load effect. Our account clarifies how task parameters differentially impinge upon cognitive processes to produce attentional ‘spill-over’ by appealing to visual short-term memory as an additional processing bottleneck when stimuli are briefly presented.

  15. Psychotherapy Termination Practices with Older Adults: Impact of Patient and Therapist Characteristics.

    Science.gov (United States)

    Sullivan, Daniel J; Zeff, Patricia; Zweig, Richard A

    2018-02-06

    The aims of this study were to survey clinicians' opinions regarding psychotherapy practices in mutual termination with a specified population (depressed older adult outpatients) and to examine the patient and therapist characteristics that may influence such practices. We surveyed psychologists' (N = 96) psychotherapy termination practices, using a hypothetical depressed older adult as a referent, to assess consensus on the appropriateness of various guidelines to termination and to examine whether these differ as a function of patient and therapist characteristics. Several practices were generally agreed to be "extremely appropriate" when terminating psychotherapy with older adults, including collaborating to determine the end date of treatment and discussing patient growth. Data also indicate that patient factors, such as personality pathology, and therapist factors, such as having an Integrative theoretical orientation were associated with differential endorsement of termination practices. Identification as a geropsychologist or working regularly with older adults were associated with a more cautious approach to termination. There is substantial consensus regarding many approaches to termination, but modifications might be appropriate depending on patient characteristics. Clinicians agree on a set of fundamental termination practices when working with older adults, but modify these based on orientation and diagnosis.

  16. Intrinsic terminators in Mycoplasma hyopneumoniae transcription.

    Science.gov (United States)

    Fritsch, Tiago Ebert; Siqueira, Franciele Maboni; Schrank, Irene Silveira

    2015-04-08

    Mycoplasma hyopneumoniae, an important pathogen of swine, exhibits a low guanine and cytosine (GC) content genome. M. hyopneumoniae genome is organised in long transcriptional units and promoter sequences have been mapped upstream of all transcription units. These analysis provided insights into the gene organisation and transcription initiation at the genome scale. However, the presence of transcriptional terminator sequences in the M. hyopneumoniae genome is poorly understood. In silico analyses demonstrated the presence of putative terminators in 82% of the 33 monocistronic units (mCs) and in 74% of the 116 polycistronic units (pCs) considering different classes of terminators. The functional activity of 23 intrinsic terminators was confirmed by RT-PCR and qPCR. Analysis of all terminators found by three software algorithms, combined with experimental results, allowed us to propose a pattern of RNA hairpin formation during the termination process and to predict the location of terminators in the M. hyopneumoniae genome sequence. The stem-loop structures of intrinsic terminators of mycoplasma diverge from the pattern of terminators found in other bacteria due the low content of guanine and cytosine. In M. hyopneumoniae, transcription can end after a transcriptional unit and before its terminator sequence and can also continue past the terminator sequence with RNA polymerases gradually releasing the RNA.

  17. Molecular Evolution of the Nuclear Factor (Erythroid-Derived 2)-Like 2 Gene Nrf2 in Old World Fruit Bats (Chiroptera: Pteropodidae).

    Science.gov (United States)

    Yin, Qiuyuan; Zhu, Lei; Liu, Di; Irwin, David M; Zhang, Shuyi; Pan, Yi-Hsuan

    2016-01-01

    Mammals developed antioxidant systems to defend against oxidative damage in their daily life. Enzymatic antioxidants and low molecular weight antioxidants (LMWAs) constitute major parts of the antioxidant systems. Nuclear factor (erythroid-derived 2)-like 2 (Nrf2, encoded by the Nrf2 gene) is a central transcriptional regulator, regulating transcription, of many antioxidant enzymes. Frugivorous bats eat large amounts of fruits that contain high levels of LMWAs such as vitamin C, thus, a reliance on LMWAs might greatly reduce the need for antioxidant enzymes in comparison to insectivorous bats. Therefore, it is possible that frugivorous bats have a reduced need for Nrf2 function due to their substantial intake of diet-antioxidants. To test whether the Nrf2 gene has undergone relaxed evolution in fruit-eating bats, we obtained Nrf2 sequences from 16 species of bats, including four Old World fruit bats (Pteropodidae) and one New World fruit bat (Phyllostomidae). Our molecular evolutionary analyses revealed changes in the selection pressure acting on Nrf2 gene and identified seven specific amino acid substitutions that occurred on the ancestral lineage leading to Old World fruit bats. Biochemical experiments were conducted to examine Nrf2 in Old World fruit bats and showed that the amount of catalase, which is regulated by Nrf2, was significantly lower in the brain, heart and liver of Old World fruit bats despite higher levels of Nrf2 protein in Old World fruit bats. Computational predictions suggest that three of these seven amino acid replacements might be deleterious to Nrf2 function. Therefore, the results suggest that Nrf2 gene might have experienced relaxed constraint in Old World fruit bats, however, we cannot rule out the possibility of positive selection. Our study provides the first data on the molecular adaptation of Nrf2 gene in frugivorous bats in compensation to the increased levels of LWMAs from their fruit-diet.

  18. Catalase overexpression prevents nuclear factor erythroid 2-related factor 2 stimulation of renal angiotensinogen gene expression, hypertension, and kidney injury in diabetic mice.

    Science.gov (United States)

    Abdo, Shaaban; Shi, Yixuan; Otoukesh, Abouzar; Ghosh, Anindya; Lo, Chao-Sheng; Chenier, Isabelle; Filep, Janos G; Ingelfinger, Julie R; Zhang, Shao Ling; Chan, John S D

    2014-10-01

    This study investigated the impact of catalase (Cat) overexpression in renal proximal tubule cells (RPTCs) on nuclear factor erythroid 2-related factor 2 (Nrf2) stimulation of angiotensinogen (Agt) gene expression and the development of hypertension and renal injury in diabetic Akita transgenic mice. Additionally, adult male mice were treated with the Nrf2 activator oltipraz with or without the inhibitor trigonelline. Rat RPTCs, stably transfected with plasmid containing either rat Agt or Nrf2 gene promoter, were also studied. Cat overexpression normalized systolic BP, attenuated renal injury, and inhibited RPTC Nrf2, Agt, and heme oxygenase-1 (HO-1) gene expression in Akita Cat transgenic mice compared with Akita mice. In vitro, high glucose level, hydrogen peroxide, and oltipraz stimulated Nrf2 and Agt gene expression; these changes were blocked by trigonelline, small interfering RNAs of Nrf2, antioxidants, or pharmacological inhibitors of nuclear factor-κB and p38 mitogen-activated protein kinase. The deletion of Nrf2-responsive elements in the rat Agt gene promoter abolished the stimulatory effect of oltipraz. Oltipraz administration also augmented Agt, HO-1, and Nrf2 gene expression in mouse RPTCs and was reversed by trigonelline. These data identify a novel mechanism, Nrf2-mediated stimulation of intrarenal Agt gene expression and activation of the renin-angiotensin system, by which hyperglycemia induces hypertension and renal injury in diabetic mice. © 2014 by the American Diabetes Association. Readers may use this article as long as the work is properly cited, the use is educational and not for profit, and the work is not altered.

  19. Heme-dependent up-regulation of the α-globin gene expression by transcriptional repressor Bach1 in erythroid cells

    International Nuclear Information System (INIS)

    Tahara, Tsuyoshi; Sun Jiying; Igarashi, Kazuhiko; Taketani, Shigeru

    2004-01-01

    The transcriptional factor Bach1 forms a heterodimer with small Maf family, and functions as a repressor of the Maf recognition element (MARE) in vivo. To investigate the involvement of Bach1 in the heme-dependent regulation of the expression of the α-globin gene, human erythroleukemia K562 cells were cultured with succinylacetone (SA), a heme biosynthetic inhibitor, and the level of α-globin mRNA was examined. A decrease of α-globin mRNA was observed in SA-treated cells, which was restored by the addition of hemin. The heme-dependent expression of α-globin occurred at the transcriptional level since the expression of human α-globin gene promoter-reporter gene containing hypersensitive site-40 (HS-40) was decreased when K562 cells were cultured with SA. Hemin treatment restored the decrease of the promoter activity by SA. The regulation of the HS-40 activity by heme was dependent on the NF-E2/AP-1 (NA) site, which is similar to MARE. The NA site-binding activity of Bach1 in K562 increased upon SA-treatment, and the increase was diminished by the addition of hemin. The transient expression of Bach1 and mutated Bach1 lacking CP motifs suppressed the HS-40 activity, and cancellation of the repressor activity by hemin was observed when wild-type Bach1 was expressed. The expression of NF-E2 strengthened the restoration of the Bach1-effect by hemin. Interestingly, nuclear localization of Bach1 increased when cells were treated with SA, while hemin induced the nuclear export of Bach1. These results indicated that heme plays an important role in the induction of α-globin gene expression through disrupting the interaction of Bach1 and the NA site in HS-40 enhancer in erythroid cells

  20. Effect of Co-Culturing of Mice Liver Cells and Embryonic Carcinomatous Stem Cells on the Rate of Differentiation to Hematopoietic Cells

    Directory of Open Access Journals (Sweden)

    AA Pourfatollah

    2005-10-01

    Full Text Available Introduction: Considering the importance of co-culture in differentiation of embryonic stem cells, the aim of this study was evaluation of the effect of co-culturing fetal liver stroma cells with P19 cells on the line of differentiation. Materials and Methods: For this purpose, P19 cells were cultured directly in semisolid medium. These cells proliferated and primarily differentiated to colonies know as embryoid bodies (EBs after 8-12 days. The Ebs cells were trypsinized and dissociated to single or double cells. Then these cells were co-cultured on the mouse fetal liver feeder layer in the absence of exogenous factors. After 14-18 days, the colonies were studied morphologically by benzidine and giemsa staining and also counted under invert microscope. Results: The percentages of benzidine positive (or erythroid and negative colonies were 94% and 6% respectively and also the cells of colonies were studied by Giemsa staining. Results showed that they were myeloid or lymphoid type cells. Thus, the results show that in the presence of mouse fetal liver feeder layer, the number of erythroid colonies was increased. Conclusions: Therefore, this technique may be effective for differentiation of stem cells from different sources into hematopoietic cells and can be used in future for human cell therapy.