DEFF Research Database (Denmark)
Houmann, Jens Christian Gylden; Nicklow, R.M.
1969-01-01
Abstract only given substantially as follows. Neutron diffraction results are presented for the phonon dispersion relation of terbium......Abstract only given substantially as follows. Neutron diffraction results are presented for the phonon dispersion relation of terbium...
Luminescent properties of terbium complex with phenylanthranilic acid
International Nuclear Information System (INIS)
Alakaeva, L.A.; Kalazhokova, I.A.; Naurzhanova, F.Kh.
1990-01-01
Existence of terbium luminescence reaction in complex with phenanthranilic acid (FAA) is ascertained. The optimal conditions of terbium complexing with FAA are found. The ratio of components in the complex is 1:1. The influence of foreign rare earth in terbium luminescence intensity in complex with FAA is studied
Chen, Yuxiang; Liu, Chao; Ma, Fang; Qi, Dongdong; Liu, Qingyun; Sun, Hao-Ling; Jiang, Jianzhuang
2018-04-23
The non-peripherally substituted 1,4,8,11,15,18,22,25-octa(butoxy)-phthalocyanine-involved unsymmetrical heteroleptic bis(phthalocyaninato) terbium double-decker, Tb(Pc){H[Pc(α-OC 4 H 9 ) 8 ]} (Pc=unsubstituted phthalocyanine) (1), was revealed to exhibit typical single ion magnet (SIM) behavior with effective energy barrier, 180 K (125 cm -1 ), and blocking temperature, 2 K, due to the severe deviation of the terbium coordination polyhedron from square-antiprismatic geometry. Fabrication of this double-decker compound into the novel tetrakis(phthalocyaninato) terbium pseudo-quadruple-decker Na 2 {Tb(Pc)[Pc(α-OC 4 H 9 ) 8 ]} 2 (2) single molecule magnet (SMM) not only optimizes the coordination polyhedron of terbium ion towards the square-antiprismatic geometry and intensifies the coordination field strength, but more importantly significantly enhances the molecular magnetic anisotropy in the unsymmetrical bis(phthalocyaninato) double-decker unit, along with the change of the counter cation from H + of 1 to Na + of 2, leading to an significantly enhanced magnetic behavior with spin-reversal energy barrier, 528 K (367 cm -1 ), and blocking temperature, 25 K. The present result is surely helpful towards developing novel tetrapyrrole lanthanide SMMs through rational design and self-assembly from bis(tetrapyrrole) lanthanide single ion magnet (SIM) building block. © 2018 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.
Production and separation of terbium-149 and terbium-152 for targeted cancer therapy
International Nuclear Information System (INIS)
Sarkar, S.; Leigh, J.
1997-01-01
This work reports the production and separation of useful quantities of 149 , 152 Tb from natural neodymium ( nat Nd) and 141 Pr for in vitro studies by bombarding the targets with 12 C projectiles. The physical, chemical and nuclear properties of radionuclides determine their efficacy in therapy and diagnosis. Tb-149 is an alpha-emitter with a half-life of 4.1h and 152 Tb is a positron emitter with a half-life of 17.5 h. Both of the isotopes have suitable gamma emission with good branching ratio suggesting their application to diagnosis apart from therapy. Alpha-emitters are effective in controlling cancer because of their short range and high Relative Biological Effectiveness. Long-lived positron emitters are effective in studying physiological function in positron emission tomography other than therapy. The aim of this work is to optimise the production and carrier free separation of terbium. Because of the presence of other stable isotopes in nat Nd, a number of other lanthanides are produced by secondary reactions during the production of terbium. In order to remove the secondary products, α-hydroxyisobutyric acid of pH 5 was used as eluent. satisfactory separation of terbium was achieved and demonstrate that useful quantities of 144,152 Tb can be produced by Tandem accelerator from 141 Pr and nat Nd targets
Luminescent determination of trace amounts of terbium using diantipyrylmethane and salicylic acid
Energy Technology Data Exchange (ETDEWEB)
Tishchenko, M A; Gerasimenko, G I; Poluehktov, N S [AN Ukrainskoj SSR, Odessa. Inst. Obshchej i Neorganicheskoj Khimii
1978-01-01
To elucidate the possibility of using pyrazolone-5-diantipyril-methane (DAM) derivative for determination of terbium microimpurities, the conditions have been studied of luminescent determination of terbium in complex compounds containing an ion of rare-earth element, diantipyrilmethane, and salicylic acid (Sal.). The ratio between the components in the complex REE-DAM-Sal is 1:1:3. La, Y, Gd do not affect the luminescence intensity of terbium complex. A luminescent method of determining terbium traces in highly pure oxides of lanthanum, gadolinium, lutetium, and yttrium has been developed in which suspensions of complex precipitation are used. The amount of terbium determined in oxide of lanthanum, gadolinium, and lutetium is (1-5)x10/sup -6/% and (2-3)x10/sup -5/% in yttrium oxide.
Fine structure studies of terbium atoms
International Nuclear Information System (INIS)
Abhay Kumar; Bandyopadhyay, Krishnanath; Niraj Kumar
2012-01-01
Terbium (Z = 65) is a typical rare-earth element. Fine structure of spectural lines of terbium (Tb) are presented using the laser optogalvanic spectroscopic technique. Altogether eighty transitions in the 5686-6367 A range have been observed in the fine structure spectrum of 159 Tb. Wavelengths of all the observed transitions have been determined. Out of 80 transitions of Tb, a total of 59 transitions are being reported for the first time. Classifications of 39 new transitions have been provided using the known energy levels, Doppler-limited optogalvanic spectroscopic technique is employed to study the fine structure (fs) 159 Tb. (author)
Energy Technology Data Exchange (ETDEWEB)
Kharlamova, M.V.; Kramberger, C.; Mittelberger, A. [University of Vienna, Faculty of Physics, Vienna (Austria)
2017-04-15
In the present work, the doping effect of terbium chloride, terbium bromide, and terbium iodide on single-walled carbon nanotubes (SWCNTs) was compared by Raman spectroscopy. A precise investigation of the doping-induced alterations of the Raman modes of the filled SWCNTs was conducted. The shifts of the components of the Raman modes and modification of their profiles allowed concluding that the inserted terbium halogenides have acceptor doping effect on the SWCNTs, and the doping efficiency increases in the line with terbium iodide, terbium bromide, and terbium chloride. (orig.)
Optical properties of phosphorescent nano-silicon electrochemically doped with terbium
Energy Technology Data Exchange (ETDEWEB)
Gelloz, Bernard [Nagoya University, Furo-cho, Chikusa-ku, Nagoya, Aichi 464-8603 (Japan); Mentek, Romain; Koshida, Nobuyoshi [Tokyo University A and T, 2-24-16 Nakacho, Koganei, Tokyo 184-8588 (Japan)
2012-12-15
Hybrid thin films consisting of oxidized nano-silicon doped with terbium have been fabricated. Nano-silicon was formed by electrochemical etching of silicon wafers. Terbium was incorporated into nano-silicon pores by electrochemical deposition. Different oxidizing thermal treatments were applied to the films. The samples treated by high-pressure water vapor annealing (HWA) exhibited strong blue emission with a phosphorescent component, as previously reported by our group. The low temperature (260 C) HWA also led to strong emission from Tb{sup 3+} ions, whereas typical high temperature (900 C) treatment generally used to activate Tb{sup 3+} ions in silicon-based materials led to less luminescent samples. Spectroscopic and dynamic analyses suggest that terbium was incorporated as a separate oxide phase in the pores of the porous nano-silicon. The PL of the terbium phase and nano-silicon phase exhibit different temperature and excitation power dependences suggesting little optical or electronic interaction between the two phases. The luminescence of terbium is better activated at low temperature (260 C) than at high temperature (900 C). The hybrid material may find some applications in photonics, for instance as a display material. (copyright 2012 WILEY-VCH Verlag GmbH and Co. KGaA, Weinheim) (orig.)
Improved terbium-doped, lithium-loaded glass scintillator fibers
International Nuclear Information System (INIS)
Spector, G.B.; McCollum, T.; Spowart, A.R.
1993-01-01
An improved terbium-doped, 6 Li-loaded glass scintillator has been drawn into fibers. Tests indicate that the neutron detection response of the fibers is superior to the response with fibers drawn from the original terbium-doped glass. The new fibers offer less attenuation (1/e length of ∝40 cm) and improved gamma ray/neutron discrimination. The improved fibers will be incorporated in a scintillator fiber optic long counter for neutron detection. (orig.)
DEFF Research Database (Denmark)
Houmann, Jens Christian Gylden; Nicklow, R.M.
1970-01-01
The frequency-wave-vector dispersion relation for the normal modes of vibration of terbium at room temperature has been measured by means of slow-neutron inelastic scattering techniques. The triple-axis spectrometer at the Oak Ridge high flux isotope reactor was used, mostly in the constant-Q mode...
Direct determination of graphene quantum dots based on terbium-sensitized luminescence
Llorent-Martínez, Eulogio J.; Molina-García, Lucía; Durán, Gema M.; Ruiz-Medina, Antonio; Ríos, Ángel
2018-06-01
Graphene quantum dots (GQD) were determined in water samples using terbium-sensitized luminescence (TSL). Terbium ions complex with GQD due to the carboxylic groups that are usually present in these nanomaterials, increasing the luminescence signal of terbium. In Tb(III)-GQD complexes, GQD absorb energy at their characteristic excitation wavelength and transfer it to terbium ion, which emits at its particular emission wavelength. The analytical signal, measured at λexc = 257 nm and λem = 545 nm, increases proportionally to GQD concentration between 50 and 500 μg L-1. Under optimum conditions, the proposed method presents a detection limit of 15 μg L-1 and is selective to GQD in the presence of other nanomaterials of similar size. As GQD are highly water-soluble, they are potential contaminants in environmental or drinking waters water samples, and hence the method was applied to the analysis of different drinking waters which were the target samples for the application of the developed method.
International Nuclear Information System (INIS)
Mazzucotelli, A.; Dadone, A.; Frache, R.; Baffi, F.; Genoa Univ.
1982-01-01
A detailed study of isocratic and gradient elution separations of lanthanides has been carried out. Analyses of industrially and scientifically interesting products such as luminescent phosphors have been carried out by gradient elution with DL-2-hydroxyisobutyric acid. The determination of small amounts of terbium in gadolinium oxide sulphide phosphors is described in which an HCl solution was eluted through a stainless steel column packed with microparticulate silica, with bonded cation-exchange groups. Complete separation of gadolinium and terbium is achieved. Detection is with a variable wavelength detector following post-column complex formation with 4-(2-pyridylazo)-resorcinol monosodium salt. Results obtained on test solutions show good reproducilbity and sensitivtiy and the method may be considered sufficiently reliable to be used in routine quality control procedures. (orig.)
Isomer spectroscopy of neutron-rich 168 Tb 103
Energy Technology Data Exchange (ETDEWEB)
Gurgi, L. A.; Regan, P. H.; Söderström, P. -A.; Watanabe, H.; Walker, P. M.; Podolyák, Zs.; Nishimura, S.; Berry, T. A.; Doornenbal, P.; Lorusso, G.; Isobe, T.; Baba, H.; Xu, Z. Y.; Sakurai, H.; Sumikama, T.; Catford, W. N.; Bruce, A. M.; Browne, F.; Lane, G. J.; Kondev, F. G.; Odahara, A.; Wu, J.; Liu, H. L.; Xu, F. R.; Korkulu, Z.; Lee, P.; Liu, J. J.; Phong, V. H.; Yag, A.; Zhang, G. X.; Alharbi, T.; Carroll, R. J.; Chae, K. Y.; Dombradi, Zs.; Estrade, A.; Fukuda, N.; Griffin, C.; Ideguchi, E.; Inabe, N.; Kanaoka, H.; Kojouharov, I.; Kubo, T.; Kubono, S.; Kurz, N.; Kuti, I.; Lalkovski, S.; Lee, E. J.; Lee, C. S.; Lotay, G.; Moon, C. -B.; Nishizuka, I.; Nita, C. R.; Patel, Z.; Roberts, O. J.; Schaffner, H.; Shand, C. M.; Suzuki, H.; Takeda, H.; Terashima, S.; Vajta, Zs.; Yoshida, S.; Valiente-Dòbon, J. J.
2017-11-01
In-flight fission of a 345 MeV per nucleon 238U primary beam on a 2 mm thick 9Be target has been used to produce and study the decays of a range of neutron-rich nuclei centred around the doubly mid-shell nucleus 170Dy at the RIBF Facility, RIKEN, Japan. The produced secondary fragments of interest were identified event-by-event using the BigRIPS separator. The fragments were implanted into the WAS3ABI position sensitive silicon active stopper which allowed pixelated correlations between implants and their subsequent β-decay. Discrete γ-ray transitions emitted following decays from either metastable states or excited states populated following beta decay were identified using the 84 coaxial high-purity germanium (HPGe) detectors of the EURICA spectrometer, which was complemented by 18 additional cerium-doped lanthanum bromide (LaBr3) fast-timing scintillation detectors from the FATIMA collaboration. This paper presents the internal decay of a metastable isomeric excited state in the odd-odd nucleus 168Tb, which corresponds to a single proton-neutron hole configuration in the valence maximum nucleus 170Dy. These data represent the first information on excited states in this nucleus, which is the most neutron-rich odd-odd isotope of terbium (Z=65) studied to date. Nilsson configurations associated with an axially symmetric, prolate-deformed nucleus are proposed for the 168Tb ground state the observed isomeric state by comparison with Blocked BCS-Nilsson calculations.
Magneto-elastic interactions in terbium
DEFF Research Database (Denmark)
Jensen, J.
1971-01-01
. These calculations agree semi-quantitatively with the results of experimental measurements. The author has examined the extent to which this simple picture is applicable to explain the magnon-phonon interactions in terbium, which have been observed at finite wave vectors by inelastic neutron scattering...
Highly n -doped graphene generated through intercalated terbium atoms
Daukiya, L.; Nair, M. N.; Hajjar-Garreau, S.; Vonau, F.; Aubel, D.; Bubendorff, J. L.; Cranney, M.; Denys, E.; Florentin, A.; Reiter, G.; Simon, L.
2018-01-01
We obtained highly n -type doped graphene by intercalating terbium atoms between graphene and SiC(0001) through appropriate annealing in ultrahigh vacuum. After terbium intercalation angle-resolved-photoelectron spectroscopy (ARPES) showed a drastic change in the band structure around the K points of the Brillouin zone: the well-known conical dispersion band of a graphene monolayer was superposed by a second conical dispersion band of a graphene monolayer with an electron density reaching 1015cm-2 . In addition, we demonstrate that atom intercalation proceeds either below the buffer layer or between the buffer layer and the monolayer graphene. The intercalation of terbium below a pure buffer layer led to the formation of a highly n -doped graphene monolayer decoupled from the SiC substrate, as evidenced by ARPES and x-ray photoelectron spectroscopy measurements. The band structure of this highly n -doped monolayer graphene showed a kink (a deviation from the linear dispersion of the Dirac cone), which has been associated with an electron-phonon coupling constant one order of magnitude larger than those usually obtained for graphene with intercalated alkali metals.
Terbium and dysprosium complexes luminescence at low temperatures
Energy Technology Data Exchange (ETDEWEB)
Meshkova, S B; Kravchenko, T B; Kononenko, L.I.; Poluehktov, N S [AN Ukrainskoj SSR, Odessa. Fiziko-Khimicheskij Inst.
1979-01-01
The variation is studied of the luminescence intensity of terbium and dysprosium complexes used in the analysis as solutions are cooled down to the liquid nitrogen temperature. Three groups of methods have been studied: observation of fluorescence of aqueous solutions, precipitate and extract suspensions in organic solvents. The brightest luminescence and greatest increase in luminescence intensity are observed at freezing of complex solvents with 1,2-dioxybenzene-3,5-disulfonic acid (DBSA) and iminodiacetic acid (IDA) and DBSA+EDTA, as well as in the case of benzene extracting of complexes with phenanthroline and salicylic acid. Otherwise the intensity increases 2-14-fold and for the complex of terbium with acetoacetic ester 36-fold.
Critical scattering of neutrons from terbium
DEFF Research Database (Denmark)
Als-Nielsen, Jens Aage; Dietrich, O.W.; Marshall, W.
1968-01-01
The inelasticity of the critical scattering of neutrons in terbium has been measured above the Neél temperature at the (0, 0, 2−Q) satellite position. The results show that dynamic slowing down of the fluctuations does occur in a second‐order phase transition in agreement with the general theory...
DEFF Research Database (Denmark)
Spichkin, Y.I.; Bohr, Jakob; Tishin, A.M.
1996-01-01
The temperature dependence of the Young modulus along the crystallographic axes b and c (E(b) and E(c)), and the internal friction of a terbium single crystal have been measured. At 4.2 K, E(b) and E(c) are equal to 38 and 84.5 GPa, respectively. The lattice part of the Young modulus and the Debye...... temperature has been calculated. The origin of the Young modulus anomalies arising at the transition to the magnetically ordered state is discussed....
International Nuclear Information System (INIS)
Gajfutdinova, R.K.; Sharafutdinova, A.A.; Murinov, Yu.I.
1988-01-01
The isothermal cross section method at 25 and 50 deg C is applied to study pyridine hydrochloride-terbium chloride-water (1) piperidine hydrochloride-dysprosium chloride-water (2), piperazine dihydrochloride-dysprosium chloride-water (3) and morpholine hydrochloride-terbium chloride (4) systems. Solubility isotherma prove the formation of incongruently soluble compound of the TbCl 3 x6C 5 H 5 NxHCl composition systems (1). The individuality of the new solid phase is proved by the chemical and DTA methods. Systems (2-4) are of a simple eutonic type
Investigation of terbium scandate as an alternative gate dielectric in fully depleted transistors
Roeckerath, M.; Lopes, J. M. J.; Durgun Özben, E.; Urban, C.; Schubert, J.; Mantl, S.; Jia, Y.; Schlom, D.G.
2010-01-01
Terbium scandate thin films were deposited by e-gun evaporation on (100) silicon substrates. Rutherford backscattering spectrometry and x-ray diffraction studies revealed homogeneous chemical compositions of the films. A dielectric constant of 26 and CV-curves with small hystereses were measured as well as low leakage current densities of < 1 nA/cm(2). Fully depleted n-type field-effect transistors on thin silicon-on-insulator substrates with terbium scandate gate dielectrics were fabricated ...
Infrared X-ray and thermal analysis of terbium soaps
International Nuclear Information System (INIS)
Mehrotra, K.N.; Sharma, N.
1996-01-01
Terbium sops (laureate, myristate and palmitate) were synthesized by direct metathesis of corresponding potassium soap with an aqueous solution of terbium nitrate. The physico-chemical characteristics of soaps in solid state were investigated by IR spectra, X-ray diffraction patterns and TGA measurements. The IR results revealed that the fatty acids exist in dimeric state through hydrogen bonding while the soaps possess partial ionic character. The X-ray analysis showed that the soaps have double layer structure with molecular axes slightly inclined to the basal plane. The thermal analysis suggested that the decomposition of soaps occur in two steps. The energy of activation, order of reaction and various kinetic parameters (i.e. frequency factor, entropy of activation and free energy) for the thermal decomposition of soaps were evaluated. (author). 26 refs, 4 figs, 4 tabs
International Nuclear Information System (INIS)
Yang, Tianlin; Gao, Min; Yang, Jinhui; Qin, Wenwu
2010-01-01
A benzimidazole ligand with a tripodal structure, N, N', N' -tris (2-benzimidazolmethyl) amine, and its terbium (III) complex has been synthesized. The complex has been characterized by element analysis, IR spectra, mass spectra, thermal analysis and molar conductivity. The terbium ion is found to coordinate with the nitrogen atoms (= N-) of imidazole ring and the bridgehead nitrogen atom. The fluorescence properties of the complex in aqueous solutions have been studied. Under excitation of UV light, the complex exhibits characteristic fluorescence of terbium ion. The luminescence of terbium complex in aqueous solutions is strongly enhanced by H + concentration. This phenomenon makes the new complex favorable for use in fluorescence switches and sensors. The mechanism of the fluorescence enhancement by protonation of the nitrogen atoms (-NH-) of imidazole ring is due to the suppressed photoinduced electron transfer fluorescence quenching on addition of acid. (author)
Nuclear magnetic resonance in ferromagnetic terbium metal
International Nuclear Information System (INIS)
Cha, C.L.T.
1974-01-01
The magnetic properties of terbium were studied by the method of zero field nuclear magnetic resonance at 1.5 to 4 and 85 to 160 0 K. Two unconventional experimental techniques have been employed: the swept frequency and the swept temperature technique. Near 4 0 K, triplet resonance line structures were found and interpreted in terms of the magnetic domain and wall structures of ferromagnetic terbium. In the higher temperature range, temperature dependence of the resonance frequency and the quadrupole splitting were measured. The former provides a measurement of the temperature dependence of the magnetization M, and it agrees with bulk M measurements as well as the latest spin wave theory of M(T) (Brooks 1968). The latter agrees well with a calculation using a very general single ion density matrix for collective excitations (Callen and Shtrikman 1965). In addition, the small temperature-independent contribution to the electric field gradient at the nucleus due to the lattice and conduction electrons was untangled from the P(T) data. Also an anomalous and unexplained relaxation phenomenon was also observed
International Nuclear Information System (INIS)
Ostakhov, S.S.; Kolosnitsyn, V.S.; Krasnogorskaya, N.N.; Kazakov, V.P.
2000-01-01
Quenching of terbium nitrate luminescence by anionic dye, eosin, in the presence of lithium perchlorate in sulfolane solutions was studied. Temperature dependence of terbium nitrate luminescence in sulfolane solutions in the presence of perchlorate anions were considered. The values of energy required for water molecular substitution in Tb 3+ ion coordination sphere for solvent molecule in electrolyte solution were ascertained [ru
Semiconductor composition containing iron, dysprosium, and terbium
Pooser, Raphael C.; Lawrie, Benjamin J.; Baddorf, Arthur P.; Malasi, Abhinav; Taz, Humaira; Farah, Annettee E.; Kalyanaraman, Ramakrishnan; Duscher, Gerd Josef Mansfred; Patel, Maulik K.
2017-09-26
An amorphous semiconductor composition includes 1 to 70 atomic percent iron, 15 to 65 atomic percent dysprosium, 15 to 35 atomic percent terbium, balance X, wherein X is at least one of an oxidizing element and a reducing element. The composition has an essentially amorphous microstructure, an optical transmittance of at least 50% in at least the visible spectrum and semiconductor electrical properties.
Low-temperature thermal conductivity of terbium-gallium garnet
International Nuclear Information System (INIS)
Inyushkin, A. V.; Taldenkov, A. N.
2010-01-01
Thermal conductivity of paramagnetic Tb 3 Ga 5 O 12 (TbGG) terbium-gallium garnet single crystals is investigated at temperatures from 0.4 to 300 K in magnetic fields up to 3.25 T. A minimum is observed in the temperature dependence κ(T) of thermal conductivity at T min = 0.52 K. This and other singularities on the κ(T) dependence are associated with scattering of phonons from terbium ions. The thermal conductivity at T = 5.1 K strongly depends on the magnetic field direction relative to the crystallographic axes of the crystal. Experimental data are considered using the Debye theory of thermal conductivity taking into account resonance scattering of phonons from Tb 3+ ions. Analysis of the temperature and field dependences of the thermal conductivity indicates the existence of a strong spin-phonon interaction in TbGG. The low-temperature behavior of the thermal conductivity (field and angular dependences) is mainly determined by resonance scattering of phonons at the first quasi-doublet of the electron spectrum of Tb 3+ ion.
Automated spectrofluorimetric determinations of terbium and dysprosium in rare earth mixtures
Energy Technology Data Exchange (ETDEWEB)
Lyle, S.J.; Za' tar, N. (Kent Univ., Canterbury (UK))
1983-12-01
Several methods involving the use of water-soluble binary and ternary complexes have been proposed for the spectrofluorimetric determination based on terbium(III) emission at 545 nm. These are terbium(III) with (A) ethylenediamine-N,N'-bis(o-hydroxyphenylacetic acid), (B) o-hydroxyphenyliminodiacetic acid, (C) EDTA + 5-sulphosalicylic acid, (D) EDTA + 1,2-dihydroxybenzene-3,5-disulphonic acid disodium salt (Tiron), and (E) iminodiacetic acid (IDA) + Tiron. Two of the reagent mixtures (D and E) can also be used for the fluorimetric determination of dysprosium(III) at 582 nm. A comparison has been made of these methods in order to select the most satisfactory procedure with respect to selectivity, sensitivity and suitability for adaption to automatic operation. Results are given and discussed.
Energy Technology Data Exchange (ETDEWEB)
Brandt, K.D.; Schnobrich, K.E.; Johnson, D.K. (Abbott Laboratories, Department 90M, Abbott Park, IL (United States))
1991-01-01
Fluorescence titrations were performed by adding varying mole ratios of terbium(III) to antibody conjugates formed by benzyl isothiocyanate derivatives of three different polyaminopolycarboxylate chelators (NTA, EDTA, and DTPA) and the results compared to values for average chelator content obtained by cobalt-57 binding assays. For two different murine monoclonal antibodies, the average chelator content obtained by terbium fluorescence titration correlated closely with that measured by the cobalt-57 binding assay. It is concluded that lanthanide fluorescence titrations provide a useful alternative to radiometal binding assays for the determination of chelator content in protein-chelator conjugates.
International Nuclear Information System (INIS)
Brandt, K.D.; Schnobrich, K.E.; Johnson, D.K.
1991-01-01
Fluorescence titrations were performed by adding varying mole ratios of terbium(III) to antibody conjugates formed by benzyl isothiocyanate derivatives of three different polyaminopolycarboxylate chelators (NTA, EDTA, and DTPA) and the results compared to values for average chelator content obtained by cobalt-57 binding assays. For two different murine monoclonal antibodies, the average chelator content obtained by terbium fluorescence titration correlated closely with that measured by the cobalt-57 binding assay. It is concluded that lanthanide fluorescence titrations provide a useful alternative to radiometal binding assays for the determination of chelator content in protein-chelator conjugates
X-ray fluorescence analysis of terbium oxide for rare earth impurities
International Nuclear Information System (INIS)
Chandola, L.C.; Machado, I.J.; Mohile, A.N.
1975-01-01
A method for the determination of Sm 2 O 3 , Eu 2 O 3 , Gd 2 O 3 , Dy 2 O 3 , Ho 2 O 3 and Y 2 O 3 in terbium oxide is described. The sample is converted to terbium oxalate, mixed with boric acid binder in the ratio 2:1, pelleted at a pressure of 20 tons over a boric acid backing pellet and irradiated with x-rays from a tungsten tube operated by Philips PW 1140 generator. The secondary x-rays thus generated are analysed by a LiF (200) crystal in Philips PW 1220 x-ray fluorescence spectrometer using suitable detectors. The minimum determination limit (MDL) is 0.01% for all rare earth oxides determined except for Y 2 O 3 for which it is 0.005%. (author)
Investigation of terbium scandate as an alternative gate dielectric in fully depleted transistors
Roeckerath, M.; Lopes, J. M. J.; Özben, E. Durǧun; Urban, C.; Schubert, J.; Mantl, S.; Jia, Y.; Schlom, D. G.
2010-01-01
Terbium scandate thin films were deposited by e-gun evaporation on (100) silicon substrates. Rutherford backscattering spectrometry and x-ray diffraction studies revealed homogeneous chemical compositions of the films. A dielectric constant of 26 and CV-curves with small hystereses were measured as well as low leakage current densities of <1 nA/cm2. Fully depleted n-type field-effect transistors on thin silicon-on-insulator substrates with terbium scandate gate dielectrics were fabricated with a gate-last process. The devices show inverse subthreshold slopes of 80 mV/dec and a carrier mobility for electrons of 225 cm2/V•s was extracted.
Magneto-optical studies of valence instability in europium and terbium phosphors
Czech Academy of Sciences Publication Activity Database
Rodrigues, L.C.v.; Hölsä, J.; Brito, H.F.; Maryško, Miroslav; Matos, J.R.; Paturi, P.; Rodrigues, R.V.; Lastusaari, M.
2016-01-01
Roč. 170, Feb (2016), 701-706 ISSN 0022-2313 Institutional support: RVO:68378271 Keywords : valence * europium * terbium * oxysulfide and -sulfate * phosphors * paramagnetic susceptibility Subject RIV: BM - Solid Matter Physics ; Magnetism Impact factor: 2.686, year: 2016
Cross sections from 800 MeV proton irradiation of terbium
Energy Technology Data Exchange (ETDEWEB)
Engle, J.W., E-mail: jwengle@lanl.gov [Los Alamos National Laboratory, Los Alamos, NM 87545 (United States); Mashnik, S.G.; Bach, H.; Couture, A.; Jackman, K.; Gritzo, R.; Ballard, B.D.; Fassbender, M.; Smith, D.M.; Bitteker, L.J.; Ullmann, J.L.; Gulley, M.S.; Pillai, C.; John, K.D.; Birnbaum, E.R. [Los Alamos National Laboratory, Los Alamos, NM 87545 (United States); Nortier, F.M., E-mail: meiring@lanl.gov [Los Alamos National Laboratory, Los Alamos, NM 87545 (United States)
2012-11-02
Terbium foils were irradiated with 800 MeV protons to ascertain the potential for production of lanthanide isotopes of interest in medical, astrophysical, and basic science research and to contribute to nuclear data repositories. Isotopes produced in the foil were quantified by gamma spectroscopy. Cross sections for 35 isotopes produced in the irradiation are reported and compared with predictions by the MCNP6 transport code using the CEM03.03, Bertini and INCL + ABLA event generators. Our results indicate the need to accurately consider fission and fragmentation of relatively light target nuclei like terbium in the modeling of nuclear reactions at 800 MeV. The predictive power of the code was found to be different for each event generator tested but was satisfactory for most of the product yields in the mass region where spallation reactions dominate. However, none of the event generators' results are in complete agreement with measured data.
Interaction of terbium group metal oxides with carbon
International Nuclear Information System (INIS)
Vodop'yanov, A.G.; Baranov, S.V.; Kozhevnikov, G.N.
1990-01-01
Mechanism of carbothermal reduction of terbium group metals from oxides is investigated using thermodynamic and kinetic analyses. Interaction of metal oxides with carbon covers dissociation of metal oxides and reduction by carbon monoxide, which contribution into general reduction depends on CO pressure. Temperatures of reaction beginning for batch initial components at P=1.3x10 -4 and P CO =0.1 MPa and of formation of oxycarbide melts are determined
Terbium oxide at high pressures
International Nuclear Information System (INIS)
Dogra, Sugandha; Sharma, Nita Dilawar; Singh, Jasveer; Bandhyopadhyay, A.K.
2011-01-01
In this work we report the behaviour of terbium oxide at high pressures. The as received sample was characterized at ambient by X-ray diffraction and Raman spectroscopy. The X-ray diffraction showed the sample to be predominantly cubic Tb 4 O 7 , although a few peaks also match closely with Tb 2 O 3 . In fact in a recent study done on the same sample, the sample has been shown to be a mixture of Tb 4 O 7 and Tb 2 O 3 . The sample was subjected to high pressures using a Mao-Bell type diamond anvil cell upto a pressure of about 42 GPa with ruby as pressure monitor
Terbium(III) ions as sensitizers of oxidation of indole and its derivatives in Fenton system
Energy Technology Data Exchange (ETDEWEB)
Kaczmarek, Małgorzata, E-mail: mkaczmar@amu.edu.pl; Staninski, Krzysztof
2017-03-15
Oxidation of indole and its derivatives in the Fenton system as a source of oxidising agents, in the presence of terbium(III) ions was studied by chemiluminescence methods to get the kinetic curves of emission decay and spectral distributions of chemiluminescence. Terbium(III) ions acted as a sensitizer of the mixtures Tb(III)-Fe(II)/Fe(III)-H{sub 2}O{sub 2}-indole or its derivative (tryptophan, tryptamine, indole-3-acetic acid and indole-3-acetyl aspartic acid). For the above indolic compounds, linear dependencies of integrated intensity of chemiluminescence on concentration of indolic compound in water and in water-acetonitrile solution were obtained. The limits of detection (LOD) and quantification (LOQ) of the indolic compounds studied were found to be by one or two orders of magnitude lower in the system with terbium(III) ions than without them. - Highlights: • Chemiluminescence emitted on oxidation of indolic compounds in Fenton system. • Tb (III) ions as sensitizers of indolic compounds oxidation in solutions. • Linear relations between CL intensity and indolic compound concentration.
International Nuclear Information System (INIS)
Teslyuk, O.I.; Egorova, A.V.; Yagodkin, B.N.; Bel'tyukova, S.V.
2007-01-01
Luminescence properties of the complexes of terbium(III) with nonsteroidal anti-inflammatory drugs (ibuprofen and orthofen) were studied. It was demonstrated that in the presence of organic bases (2,2'-dipyridyl and 1,10-phenanthroline) mixed-ligand complexes are formed and the luminescence intensity of terbium(III) increases by a factor of up to 250. The optimum complexation conditions were determined. It was proposed to use these complexes as analytical forms for the luminescence determination of nonsteroidal anti-inflammatory drugs (ibuprofen and orthofen) in pharmaceutical dosage forms. The detection limits are 2 and 0.05 μg/ml, respectively [ru
Green light emission in aluminum oxide powders doped with different terbium concentrations
Energy Technology Data Exchange (ETDEWEB)
Mariscal B, L; Falcony, C. [IPN, Centro de Investigacion y de Estudios Avanzados, 07360 Ciudad de Mexico (Mexico); Carmona T, S.; Murrieta, H.; Sanchez A, M. A. [UNAM, Instituto de Fisica, 04510 Ciudad de Mexico (Mexico); Vazquez A, R. [IPN, Escuela Superior de Computo, 07738 Ciudad de Mexico (Mexico); Garcia R, C. M., E-mail: mariscal2005@gmail.com [UNAM, Facultad de Ciencias, 04510 Ciudad de Mexico (Mexico)
2016-11-01
Different emission intensities presented in aluminum oxide phosphors corresponding to different concentrations of doping performed with terbium are analyzed. The phosphors were synthesized by the evaporation technique and were characterized by photo and cathodoluminescence, X-ray diffraction and EDS techniques for different incorporation percentages of terbium as dopant; they show characteristic transitions in 494, 543, 587 and 622 nm, corresponding to {sup 5}D{sub 4} → {sup 7}F{sub 6}, {sup 5}D{sub 4} → {sup 7}F{sub 5}, {sup 5}D{sub 4} → {sup 7}F{sub 4} and {sup 5}D{sub 4} → {sup 7}F{sub 3}, respectively when they are excited with λ{sub exc} = 380 nm wavelength at room temperature. The results of X-ray diffraction show the presence of α-Al{sub 2}O{sub 3} phases with peaks located at 2θ = 25.78, 35.34, 37.96, 43.56, 45.8, 52.74, 57.7, 61.5, 66.74, 68.44, 77.12 and 80.94, and the δ-Al{sub 2}O-3 phase 2θ = 32.82, 45.8, 61.36 and 66.74. These compounds were heat treated for two hours at 1100 degrees Celsius. EDS analyzes indicate that these compounds have close to 60% oxygen around of 40% aluminum in the presence of terbium as dopant which indicates a stoichiometry close to the expected one for alumina. (Author)
Energy Technology Data Exchange (ETDEWEB)
Gupta, V.K.; Singh, A.K.; Gupta, Barkha [Indian Institute of Technology-Roorkee, Department of Chemistry, Roorkee (India)
2008-04-15
A new highly selective terbium(III) electrode was prepared with a polymeric film doped using S-2-benzothiazolyl-2-amino-{alpha}-(methoxyimino)-4-thiazolethiol acetate as an electroactive material, benzyl acetate (BA) as a plasticizer, and potassium tetrakis(4-chlorophenyl) borate (KTpClPB) as an anionic site in the percentage ratio 3.17:1.58:63.4:31.7 (ionophore-KTpClPB-BA-PVC, w/w). The electrode exhibited a linear response with a near Nernstian slope of 19.5 mV/decade within the concentration range 1.5 x 10{sup -7}-1.0 x 10{sup -2} M terbium ions, with a working pH range from 2.0 to 8.0, and a fast response time of 10 s and presented satisfactory reproducibility. The limit of detection was 9.3 x 10{sup -8} M. The results show that this electrode can be used in ethanol media up to 30% (v/v) concentration without interference. It can be used for 3 months without any considerable divergence in the potentials. Selectivity coefficients for terbium(III) with respect to many cations were investigated. The electrode is highly selective for terbium(III) ions over a large number of monovalent, bivalent, and trivalent cations. This shows the valuable property of the proposed electrode. The stability constant of the ionophore towards Tb{sup 3+} ions was determined with the sandwich membrane method. It was successfully used as an indicator electrode in potentiometric determination of terbium(III) ions with EDTA and in direct determination in tap water and binary mixtures with quantitative results. The utility of the proposed electrode was also determined in the presence of ionic and nonionic surfactants and in the presence of fluoride ions in four pharmaceutical (mouthwash) preparations. (orig.)
International Nuclear Information System (INIS)
Gupta, V.K.; Singh, A.K.; Gupta, Barkha
2008-01-01
A new highly selective terbium(III) electrode was prepared with a polymeric film doped using S-2-benzothiazolyl-2-amino-α-(methoxyimino)-4-thiazolethiol acetate as an electroactive material, benzyl acetate (BA) as a plasticizer, and potassium tetrakis(4-chlorophenyl) borate (KTpClPB) as an anionic site in the percentage ratio 3.17:1.58:63.4:31.7 (ionophore-KTpClPB-BA-PVC, w/w). The electrode exhibited a linear response with a near Nernstian slope of 19.5 mV/decade within the concentration range 1.5 x 10 -7 -1.0 x 10 -2 M terbium ions, with a working pH range from 2.0 to 8.0, and a fast response time of 10 s and presented satisfactory reproducibility. The limit of detection was 9.3 x 10 -8 M. The results show that this electrode can be used in ethanol media up to 30% (v/v) concentration without interference. It can be used for 3 months without any considerable divergence in the potentials. Selectivity coefficients for terbium(III) with respect to many cations were investigated. The electrode is highly selective for terbium(III) ions over a large number of monovalent, bivalent, and trivalent cations. This shows the valuable property of the proposed electrode. The stability constant of the ionophore towards Tb 3+ ions was determined with the sandwich membrane method. It was successfully used as an indicator electrode in potentiometric determination of terbium(III) ions with EDTA and in direct determination in tap water and binary mixtures with quantitative results. The utility of the proposed electrode was also determined in the presence of ionic and nonionic surfactants and in the presence of fluoride ions in four pharmaceutical (mouthwash) preparations. (orig.)
A terbium(III)-organic framework for highly selective sensing of cytidine triphosphate.
Zhao, Xi Juan; He, Rong Xing; Li, Yuan Fang
2012-11-21
Highly selective sensing of cytidine triphosphate (CTP) against other triphosphate nucleosides including ATP, GTP and UTP is successfully achieved with a luminescent terbium(III)-organic framework (TbOF) of [Tb(2)(2,3-pzdc)(2)(ox)(H(2)O)(2)](n) (2,3-pzdc(2-) = 2,3-pyrazinedicarboxylate, ox(2-) = oxalate).
2010-04-01
... 21 Food and Drugs 2 2010-04-01 2010-04-01 false Lactose. 168.122 Section 168.122 Food and Drugs... § 168.122 Lactose. (a) Lactose is the carbohydrate normally obtained from whey. It may be anhydrous or... the following specifications: (1) The lactose content is not less than 98.0 percent, mass over mass (m...
Raman spectra of terbium trichloride, phosphorus pentachloride and their molten mixtures
International Nuclear Information System (INIS)
Salyulev, A.B.; Zakir'yanova, I.D.
2008-01-01
Raman spectroscopy was used to study in situ the behavior of individual terbium trichloride and phosphorus pentachloride in different aggregative states as a function of temperature, and of solutions of PCl 5 vapors in molten TbCl 3 . A conclusion is drawn about their structure and the nature of phase transformations and chemical reactions in wide ranges of temperature and saturated vapor pressures [ru
Alexander, Dinu; Joy, Monu; Thomas, Kukku; Sisira, S.; Biju, P. R.; Unnikrishnan, N. V.; Sudarsanakumar, C.; Ittyachen, M. A.; Joseph, Cyriac
2018-06-01
Design and synthesis of Lanthanide based metal organic framework is a frontier area of research owing to their structural diversity enabling specific applications. The luminescence properties of rare earths, tuned by the structural features of Ln-MOFs are investigated extensively. Rare earth oxalates which can be synthesized in a facile method, ensuring the structural features of MOFs with excellent photoluminescence characteristics deserves much attention. This work is the first time report on the single crystal structure and Judd-Ofelt (JO) theoretical analysis - their correlation with the intense and sharp green luminescence of Terbium oxalate crystals. The intense green luminescence observed for Terbium oxalate crystals for a wide range of excitation from DUV to visible region despite the luminescence limiting factors are discussed. The absence of concentration quenching and lifting up of forbidden nature of f-f transitions, allowing direct excitation of Terbium ions is analysed with the help of JO theory and single crystal structure analysis. The JO analysis predicted the asymmetry of Terbium sites, allowing the electric dipole transitions and from the JO intensity parameters, promising spectroscopic parameters - emission cross section, branching ratio, gain band width and gain coefficient of the material were calculated. The single crystal structure analysis revealed the asymmetry of Tb sites and structure of Terbium oxalate is formed by the hydrogen bonded stacking of overlapped six Terbium membered rings connected by the oxalate ligands. The molecularly thick layers thus formed on the crystal surface are imaged by the atomic force microscopy. The presence of water channels in the structure and the effect of lattice water molecules on the luminescence intensity are also investigated.
Spectrofluorimetric determination of cefixime using terbium-danofloxacin probe
Directory of Open Access Journals (Sweden)
Jamshid L Manzoori
2014-04-01
Full Text Available Objective(s:Cefixime (Cfx, is a semi-synthetic third-generation oral cephalosporin antibiotic that is prescribed for the treatment of susceptible infections. There are some procedures for the determination of Cfx in pharmaceutical formulations and biological samples. Herein a spectrofluorimetric method was proposed for Cfx determination based on the fluorescence quenching of terbium-danofloxacin (Tb3+-Dano in the presence of Cfx. Materials and Methods: Cfx was detected based on fluorescence quenching of terbium-danofloxacin (Tb3+-Dano in the presence of Cfx with maximum excitation and emission wavelengths at 347 nm and 545 nm, respectively. The quenched fluorescence intensity of Tb3+- Dano system is proportional to the concentration of Cfx. The optimum conditions for the determination of Cfx were studied. Results: The maximum response was achieved under optimum conditions of [Tris buffer]= 0.008 mol/l (pH 6.5, [Tb3+]=1×10-4 mol/l and [Dano]=1×10-4 mol/l. The developed method was evaluated in terms of accuracy, precision and limit of detection. The linear concentration ranges for quantification of Cfx were 8.8×10-8-8.8×10-7 mol/l and 1.1×10-7-8.8×10-7 mol/l in standard and human serum samples with the detection limits (S/N=3 of 2.8×10-8 mol/l and 3.9×10-8 mol/l, respectively. The Cfx was determined in pharmaceutical tablets and spiked serum samples and the results were satisfactory. Conclusion: This method is simple, practical and relatively interference-free for determination of Cfx in pharmaceutical tablets and serum samples.
46 CFR 168.15-10 - Construction.
2010-10-01
... 46 Shipping 7 2010-10-01 2010-10-01 false Construction. 168.15-10 Section 168.15-10 Shipping COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED) NAUTICAL SCHOOLS CIVILIAN NAUTICAL SCHOOL VESSELS Accommodations § 168.15-10 Construction. (a) The accommodations provided must be securely constructed, properly...
Lotfi, Ali; Manzoori, Jamshid L
2016-11-01
In this study, a simple and sensitive spectrofluorimetric method is presented for the determination of fluoxetine based on the enhancing effect of silver nanoparticles (AgNPs) on the terbium-fluoxetine fluorescence emission. The AgNPs were prepared by a simple reduction method and characterized by UV-Vis spectroscopy and transmission electron microscopy. It was indicated that these AgNPs have a remarkable amplifying effect on the terbium-sensitized fluorescence of fluoxetine. The effects of various parameters such as AgNP and Tb 3+ concentration and the pH of the media were investigated. Under obtained optimal conditions, the fluorescence intensity of the terbium-fluoxetine-AgNP system was enhanced linearly by increasing the concentration of fluoxetine in the range of 0.008 to 19 mg/L. The limit of detection (b + 3s) was 8.3 × 10 -4 mg/L. The interference effects of common species found in real samples were also studied. The method had good linearity, recovery, reproducibility and sensitivity, and was satisfactorily applied for the determination of fluoxetine in tablet formulations, human urine and plasma samples. Copyright © 2016 John Wiley & Sons, Ltd. Copyright © 2016 John Wiley & Sons, Ltd.
International Nuclear Information System (INIS)
Sierra-Rodero, Marina; Fernández -Romero, Juan Manuel; Gómez -Hens, Agustina
2014-01-01
We report on the time-resolved detection of the three fluoroquinolone (FQs) antibiotics ciprofloxacin (CIP), enrofloxacin (ENR) and flumequine (FLU). On addition of terbium(III) ions, the terbium(III)-FQs chelates are formed in-situ in an on-capillary derivatization reaction of a microfluidic system. The laser-induced terbium(III)-sensitized luminescence of the chelates is measured at excitation/emission wavelengths of 337/545 nm. The analytes can be separated and quantified within less than 4 min. A solid phase extraction step for analyte preconcentration can be included prior to chelation and microchip capillary electrophoresis. The analytical ranges of the calibration graphs for CIP, ENR and FLU are from 10.6 to 60.0, 10.3 to 51.0, and 11.5 to 58.8 ng mL −1 , respectively, and the detection limits are 3.2, 3.1 and 3.6 ng mL −1 , respectively. The precision was established at two concentration levels of each analyte and revealed relative standard deviations in the range from 3.0 to 10.2 %. The method was applied to the analysis of FQ-spiked water samples. (author)
2010-07-01
... 32 National Defense 1 2010-07-01 2010-07-01 false Definition. 168a.3 Section 168a.3 National Defense Department of Defense OFFICE OF THE SECRETARY OF DEFENSE DEFENSE CONTRACTING NATIONAL DEFENSE SCIENCE AND ENGINEERING GRADUATE FELLOWSHIPS § 168a.3 Definition. Sponsoring Agency. A DoD Component or an...
25 CFR 168.14 - Livestock trespass.
2010-04-01
... 25 Indians 1 2010-04-01 2010-04-01 false Livestock trespass. 168.14 Section 168.14 Indians BUREAU... PARTITIONED LANDS AREA § 168.14 Livestock trespass. The owner of any livestock grazing in trespass on the Hopi... Hopi Partitioned Lands of any livestock without an approved grazing or crossing permit; (b) Allowing...
28 CFR 16.8 - Business information.
2010-07-01
... 28 Judicial Administration 1 2010-07-01 2010-07-01 false Business information. 16.8 Section 16.8... Procedures for Disclosure of Records Under the Freedom of Information Act § 16.8 Business information. (a) In general. Business information obtained by the Department from a submitter will be disclosed under the FOIA...
21 CFR 168.111 - Dextrose monohydrate.
2010-04-01
... 21 Food and Drugs 2 2010-04-01 2010-04-01 false Dextrose monohydrate. 168.111 Section 168.111 Food... Table Sirups § 168.111 Dextrose monohydrate. (a) Dextrose monohydrate is purified and crystallized D.../mass (m/m), and the reducing sugar content (dextrose equivalent), expressed as D-glucose, is not less...
2010-04-01
... 21 Food and Drugs 2 2010-04-01 2010-04-01 false Maple sirup. 168.140 Section 168.140 Food and... § 168.140 Maple sirup. (a) Maple sirup is the liquid food derived by concentration and heat treatment of the sap of the maple tree (Acer) or by solution in water of maple sugar (mapel concrete) made from...
21 CFR 168.110 - Dextrose anhydrous.
2010-04-01
... 21 Food and Drugs 2 2010-04-01 2010-04-01 false Dextrose anhydrous. 168.110 Section 168.110 Food... Table Sirups § 168.110 Dextrose anhydrous. (a) Dextrose anhydrous is purified and crystallized D-glucose... solids content is not less than 98.0 percent m/m. (b) The name of the food is “Dextrose anhydrous” or...
{alpha}-particle induced reactions on yttrium and terbium
Energy Technology Data Exchange (ETDEWEB)
Mukherjee, S.; Kumar, B.B. [School of Studies in Physics, Vikram University, Ujjain-456010 (India); Rashid, M.H. [Variable Energy Cyclotron Center, 1/AF, Bidhan Nagar, Calcutta (India); Chintalapudi, S.N. [Inter-University Consortium for DAE Facilities, 3/LB, Bidhan Nagar, Calcutta (India)
1997-05-01
The stacked foil activation technique has been employed for the investigation of {alpha}-particle induced reactions on the target elements yttrium and terbium up to 50 MeV. Six excitation functions for the ({alpha},xn) type of reactions were studied using high-resolution HPGe {gamma}-ray spectroscopy. A comparison with Blann{close_quote}s geometric dependent hybrid model has been made using the initial exciton number n{sub 0}=4(4p0h) and n{sub 0}=5(5p0h). A broad general agreement is observed between the experimental results and theoretical predictions with an initial exciton number n{sub 0}=4(4p0h). {copyright} {ital 1997} {ital The American Physical Society}
α-particle induced reactions on yttrium and terbium
International Nuclear Information System (INIS)
Mukherjee, S.; Kumar, B.B.; Rashid, M.H.; Chintalapudi, S.N.
1997-01-01
The stacked foil activation technique has been employed for the investigation of α-particle induced reactions on the target elements yttrium and terbium up to 50 MeV. Six excitation functions for the (α,xn) type of reactions were studied using high-resolution HPGe γ-ray spectroscopy. A comparison with Blann close-quote s geometric dependent hybrid model has been made using the initial exciton number n 0 =4(4p0h) and n 0 =5(5p0h). A broad general agreement is observed between the experimental results and theoretical predictions with an initial exciton number n 0 =4(4p0h). copyright 1997 The American Physical Society
Cerium(terbium, erbium)chloride-choline chloride aqueous systems
International Nuclear Information System (INIS)
Gajfutdinova, R.K.; Zhuravlev, E.F.; Bikbaeva, G.G.; Domrachev, V.N.; Vanskova, G.I.
1985-01-01
To clarify the effect of rare earth nature on mutual solubility of rare earth salts and amines the solubility of solid phases in the systems, consisting of choline chloride, water and cerium, terbium, erbium chlorides, has been studied. It is established, that solubility isotherms of all the systems, testify to the formation of new solid phases of the composition: Ce(Tb, Er)xCl 3 x2C 5 H 14 ONClx3H 2 O. Individuality of new solid phases is proved by DTA method, the composition is confirmed by chemical analysis and data of PMR spectra, for choline chloride and its complexes with rare earth chlorides of the given composition PMR and IR spectra are studied
A thermoluminescence study of Z2-centres in terbium-doped NaCl crystals
International Nuclear Information System (INIS)
Reddy, K.N.; Ahmed, I.M.; Pandaraiah, N.; Rao, U.V.S.; Babu, V.H.
1983-01-01
Thermoluminescence (TL), optical absorption are used to correlate thermal annealing of Z 2 -centres with TL peak occurring around 110 0 C in terbium-doped NaCl crystals. The TL glow peak occurring around 190 0 C is attributed to the thermal annealing of F-centres. The thermal activation parameters are calculated for both Z 2 - and F-centre peaks. (author)
7 CFR 3015.168 - Disposal of equipment.
2010-01-01
..., DEPARTMENT OF AGRICULTURE UNIFORM FEDERAL ASSISTANCE REGULATIONS Property § 3015.168 Disposal of equipment. When original or replacement equipment is no longer to be used in projects or programs currently or... 7 Agriculture 15 2010-01-01 2010-01-01 false Disposal of equipment. 3015.168 Section 3015.168...
32 CFR 644.168 - Exercise of options.
2010-07-01
... 32 National Defense 4 2010-07-01 2010-07-01 true Exercise of options. 644.168 Section 644.168... ESTATE HANDBOOK Acquisition Procurement of Options Prior to Real Estate Directives (military) § 644.168 Exercise of options. Upon issuance of a real estate directive for acquisition of the optioned real property...
Prognostic impact of CD168 expression in gastric cancer
International Nuclear Information System (INIS)
Ishigami, Sumiya; Yoshiaki, Kita; Kijima, Yuko; Kitazono, Masaki; Natsugoe, Shoji; Ueno, Shinichi; Nishizono, Yuka; Matsumoto, Masataka; Kurahara, Hiroshi; Arigami, Takaaki; Uchikado, Yasuto; Setoyama, Tetsuro; Arima, Hideo
2011-01-01
Interactions of stromal hyaluronic acid (HA) with its binding protein RHAMM (receptor for HA-mediated motility) (CD168) have been reported to affect tumor extension and the migration of crucial molecules to promote tumor progression and metastases. Cancerous CD168 expression is correlated with aggressive biological features in several cancers. However, the clinical implications of CD168 positivity in gastric cancer have remained unclear. We examined the CD168 expression of 196 consecutive gastric cancer patients by immunohistochemistry. According to CD168 positivity, the 196 gastric cancer patients were divided into two groups (57 CD168-positive and 139 CD168-negative patients). The correlation between CD168 expression and clinicopathological factors (age, sex, histology, tumor depth, lymph node status, and vessel invasion) was evaluated according to the Japanese Classification of Gastric Carcinoma. Cancerous CD168 expression was detectable in 57 of the 196 tumors (29%). CD168 positivity was significantly correlated with the depth of invasion, nodal involvement, and vessel invasion (p < 0.01). Survival analysis of the 196 gastric cancer patients showed that the CD168-positive group had a significantly higher mortality than the CD168-negative group (p < 0.01). In terms of a correlation with CD168 positivity at separate clinical stages, a significance difference was only found in stages II and III. Multivariate analysis revealed that CD168 expression was a significant independent prognostic marker (p = 0.013) after depth of invasion (p < 0.005) and nodal involvement (p < 0.01). Our results suggest that cancerous CD168 positivity is strongly related to the invasion and metastasis of gastric cancer tumors. These results suggest that cancerous CD168 expression can be used as a prognostic marker of gastric cancer owing to its interactions with stromal hyaluronic acid
Innocenzi, Valentina; Ippolito, Nicolò Maria; De Michelis, Ida; Medici, Franco; Vegliò, Francesco
2016-12-15
Terbium and rare earths recovery from fluorescent powders of exhausted lamps by acid leaching with hydrochloric acid was the objective of this study. In order to investigate the factors affecting leaching a series of experiments was performed in according to a full factorial plan with four variables and two levels (4 2 ). The factors studied were temperature, concentration of acid, pulp density and leaching time. Experimental conditions of terbium dissolution were optimized by statistical analysis. The results showed that temperature and pulp density were significant with a positive and negative effect, respectively. The empirical mathematical model deducted by experimental data demonstrated that terbium content was completely dissolved under the following conditions: 90 °C, 2 M hydrochloric acid and 5% of pulp density; while when the pulp density was 15% an extraction of 83% could be obtained at 90 °C and 5 M hydrochloric acid. Finally a flow sheet for the recovery of rare earth elements was proposed. The process was tested and simulated by commercial software for the chemical processes. The mass balance of the process was calculated: from 1 ton of initial powder it was possible to obtain around 160 kg of a concentrate of rare earths having a purity of 99%. The main rare earths elements in the final product was yttrium oxide (86.43%) following by cerium oxide (4.11%), lanthanum oxide (3.18%), europium oxide (3.08%) and terbium oxide (2.20%). The estimated total recovery of the rare earths elements was around 70% for yttrium and europium and 80% for the other rare earths. Copyright © 2016 Elsevier Ltd. All rights reserved.
10 CFR 26.168 - Blind performance testing.
2010-01-01
... 10 Energy 1 2010-01-01 2010-01-01 false Blind performance testing. 26.168 Section 26.168 Energy... and Human Services § 26.168 Blind performance testing. (a) Each licensee and other entity shall submit blind performance test samples to the HHS-certified laboratory. (1) During the initial 90-day period of...
25 CFR 168.7 - Kind of livestock.
2010-04-01
... 25 Indians 1 2010-04-01 2010-04-01 false Kind of livestock. 168.7 Section 168.7 Indians BUREAU OF... LANDS AREA § 168.7 Kind of livestock. Unless determined otherwise by the Area Director for conservation purposes, the Hopi Tribe may determine, subject to the authorized carrying capacity, the kind of livestock...
International Nuclear Information System (INIS)
Dantas, E.S.K.
1990-01-01
A graphite furnace atomic-absorption spectrometry method for the determination of neodymium, europium, terbium, dysprosium and yttrium at trace level in samarium oxide; of samarium, europium, dysprosium, holmium, erbium and yttrium in terbium oxide and of europium, terbium, holmium, erbium and yttrium in dysprosium oxide was established. The best pyrolysis and atomization temperatures were determined for each lanthanide considered. Calibration curves were obtained for the pure elements, for binary mixtures formed by the matrix and each of the lanthanides studied and, finally, for the complex mixtures constituted by the matrix and all the other lanthanide of the group under scrutiny. This study has been carried out to examine the interference of the presence of one lanthanide on the behaviour of the other, since a lack of linearity on the calibration curves has been observed in some cases. Detection and determination limits have been determined as well. The detection limits encountered were within the range 0.002 to 0.3% for different elements. The precision of the method expressed as the relative standard deviation was calculated for each element present in each of the matrices studied. The conclusion arrived at is that the method can be applied for determining the above mentioned lanthanides present in the matrices studied with purity up to 99.50%. (author)
46 CFR 168.15-35 - Hospital space.
2010-10-01
... 46 Shipping 7 2010-10-01 2010-10-01 false Hospital space. 168.15-35 Section 168.15-35 Shipping... VESSELS Accommodations § 168.15-35 Hospital space. (a) Each vessel must be provided with a hospital space. This space must be situated with due regard for the comfort of the sick so that they may receive proper...
On-line experience with the 168/E
International Nuclear Information System (INIS)
Carroll, J.T.; Brau, J.E.; Maruyama, T.; Parker, D.B.; Chima, J.S.; Price, D.R.; Rankin, P.; Hatley, R.W.
1981-04-01
Current 20 GeV/c photoproduction experiments at the SLAC Hybrid Facility require a decision to take a picture within 150 to 300 μs after the beam pulse. A charged track trigger is provided by a 168/E processor which finds tracks in a downstream PWC system. To meet trigger time requirements the 168/E SNOOP module CAMAC interface is augmented by a CAMAD Auxiliary Controller and dedicated I/0 cards in the 168/E chassis. Between beam pulses a floating point Fortran program executing on a 168/E monitors data acquisition. Experiences with software development and application are reviewed
42 CFR 423.168 - Accreditation organizations.
2010-10-01
... 42 Public Health 3 2010-10-01 2010-10-01 false Accreditation organizations. 423.168 Section 423.168 Public Health CENTERS FOR MEDICARE & MEDICAID SERVICES, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) MEDICARE PROGRAM VOLUNTARY MEDICARE PRESCRIPTION DRUG BENEFIT Cost Control and Quality...
40 CFR 68.168 - Five-year accident history.
2010-07-01
... 40 Protection of Environment 15 2010-07-01 2010-07-01 false Five-year accident history. 68.168 Section 68.168 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) AIR PROGRAMS (CONTINUED) CHEMICAL ACCIDENT PREVENTION PROVISIONS Risk Management Plan § 68.168 Five-year accident history...
7 CFR 987.168 - Handler records.
2010-01-01
... 7 Agriculture 8 2010-01-01 2010-01-01 false Handler records. 987.168 Section 987.168 Agriculture Regulations of the Department of Agriculture (Continued) AGRICULTURAL MARKETING SERVICE (Marketing Agreements... weight and destination or name and address of the person to whom each shipment was sent; (c) If different...
46 CFR 168.15-45 - Heating and cooling.
2010-10-01
... 46 Shipping 7 2010-10-01 2010-10-01 false Heating and cooling. 168.15-45 Section 168.15-45 Shipping COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED) NAUTICAL SCHOOLS CIVILIAN NAUTICAL SCHOOL VESSELS Accommodations § 168.15-45 Heating and cooling. All quarters must be adequately heated and cooled...
46 CFR 168.10-5 - Civilian nautical school.
2010-10-01
... 46 Shipping 7 2010-10-01 2010-10-01 false Civilian nautical school. 168.10-5 Section 168.10-5 Shipping COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED) NAUTICAL SCHOOLS CIVILIAN NAUTICAL SCHOOL VESSELS Definitions of Terms Used in This Part § 168.10-5 Civilian nautical school. The term civilian...
International Nuclear Information System (INIS)
Liu Ping; Huang Mingsheng; Pan Wanzhang; Zhang Yamin; Hu Jianhua; Deng Wenji
2006-01-01
With an aim to develop novel luminescence materials, europium and terbium complexes of 2,5-(2-thiophene)-pyridine (TPY) and 5,5'-bis(5-(2,2'-bithiophene))-2,2'-bipyridine (B2TBPY) were synthesized, and their luminescence properties studied. The complexes exhibit ligand-sensitized emission, which is typical of Eu(III) and Tb(III) ions
2010-01-01
... 12 Banks and Banking 1 2010-01-01 2010-01-01 false Small issues. 16.8 Section 16.8 Banks and....8 Small issues. (a) The OCC will deem offers and sales of bank issued securities that satisfy the requirements of Commission Regulation A (17 CFR part 230, Regulation A—Conditional Small Issues Exemption) to...
Using the MMPI 168 with Medical Inpatients
Erickson, Richard C.; Freeman, Charles
1976-01-01
Explores the potential utility of the MMPI 168 with two inpatient medical populations. Correlations and clinically relevant comparisons suggest that the MMPI 168 predicted the standard MMPI with a high degree accuracy. (Editor/RK)
Does the MMPI-168 exaggerate psychotic pathology?
Dingemans, P. M.; Wekking, E. M.
1996-01-01
Three scoring versions of the MMPI, scored on the same protocol, were compared in a multivariate design with 198 psychiatric patients. The MMPI-168 schizophrenia scale had a statistically higher elevation than the Dutch and American scoring versions. This makes MMPI-168 profiles more often
Directory of Open Access Journals (Sweden)
Devender Singh
2016-12-01
Full Text Available A series of new solid ternary complexes of terbium(III ion based on β-diketone ligand acetylacetone (acac and monodentate auxiliary ligands (aqua/urea/triphenylphosphineoxide/pyridine-N-oxide had been prepared. The structural characterizations of synthesized ternary compounds were studied by means of elemental analysis, infrared (IR, and proton nuclear magnetic resonance (NMR spectral techniques. The optical characteristics were investigated with absorption as well as photoluminescence spectroscopy. Thermal behavior of compounds was examined by TGA/DTA analysis and all metal complexes were found to have good thermal stability. The luminescence decay time of complexes were also calculated by monitoring at emission wavelength corresponding to 5D4 → 7F5 transition. A comparative inspection of the luminescent behavior of prepared ternary compounds was performed in order to determine the function of auxiliary ligands in the enhancement of luminescence intensity produced by central terbium(III ion. The color coordinates values suggested that compounds showed bright green emission in visible region in electromagnetic spectrum. Complexes producing green light could play a significant role in the fabrication of efficient light conversion molecular devices for display purposes and lightning systems.
Autofluorescence-Free Live-Cell Imaging Using Terbium Nanoparticles.
Cardoso Dos Santos, M; Goetz, J; Bartenlian, H; Wong, K-L; Charbonnière, L J; Hildebrandt, N
2018-04-18
Fluorescent nanoparticles (NPs) have become irreplaceable tools for advanced cellular and subcellular imaging. While very bright NPs require excitation with UV or visible light, which can create strong autofluorescence of biological components, NIR-excitable NPs without autofluorescence issues exhibit much lower brightness. Here, we show the application of a new type of surface-photosensitized terbium NPs (Tb-NPs) for autofluorescence-free intracellular imaging in live HeLa cells. The combination of exceptionally high brightness, high photostability, and long photoluminecence (PL) lifetimes for highly efficient suppression of the short-lived autofluorescence allowed for time-gated PL imaging of intracellular vesicles over 72 h without toxicity and at extremely low Tb-NP concentrations down to 12 pM. Detection of highly resolved long-lifetime (ms) PL decay curves from small (∼10 μm 2 ) areas within single cells within a few seconds emphasized the unprecedented photophysical properties of Tb-NPs for live-cell imaging that extend well beyond currently available nanometric imaging agents.
Energy Technology Data Exchange (ETDEWEB)
Arnaud, N.; Georges, J
2003-01-10
The luminescent properties of terbium complexes with furosemide (FR), flufenamic (FF) acid, tolfenamic (TF) acid and mefenamic (MF) acid have been investigated in aqueous solutions. For all four compounds, complexation occurs when the carboxylic acid of the aminobenzoic group is dissociated and is greatly favoured in the presence of trioctylphosphine oxide as co-ligand and Triton X-100 as surfactant. Under optimum conditions, luminescence of the lanthanide ion is efficiently sensitised and the lifetime of the {sup 5}D{sub 4} resonance level of terbium in the complex is ranging between 1 and 1.9 ms, against 0.4 ms for the aqua ion. The sensitivity of the method for the determination of anthranilic acid derivatives is improved by one to two orders of magnitude with respect to that achieved using native fluorescence or terbium-sensitised luminescence in methanol. The limits of detection are 2x10{sup -10}, 5x10{sup -10} and 2x10{sup -9} mol l{sup -1} for flufenamic acid, furosemide and tolfenamic acid, and mefenamic acid, respectively, with within-run RSD values of less than 1%. The method has been applied to the determination of flufenamic acid in spiked calf sera with and without sample pretreatment. Depending on the method and the analyte concentration, the recovery was ranging between 83 and 113% and the lowest concentration attainable in serum samples was close to 1x10{sup -7} mol l{sup -1}.
The Use of the MMPI-168 with Delinquent Adolescents.
Lueger, Robert J.
1983-01-01
Compared the standard MMPI and MMPI-168 scores of 90 male delinquent adolescents. Raw score and T-score correlations were high and within acceptable limits, which indicates that MMPI-168 scores are useful with delinquent adolescents. However, two-point codetypes derived from standard MMPIs and MMPI-168s were in agreement less than half the time.…
International Nuclear Information System (INIS)
Nur Ubaidah Saidin; Muhamad Daud; Siti Radiah Mohd Kamarudin
2011-01-01
This report explained the test conducted in salt fog chamber to evaluate the effectiveness of mild steel, coated with rust converter, for 168 hours in artificial seawater exposure. The samples were compared with mild steel coated with commercial primer. The tests were conducted followed ASTM B117. Individual pictures were taken of each sample before the tests began, at 24, 48, 72, 96, 120, 144 and 168 hours to see the progression of the corrosion. Results showed that the samples coated with rust converter provide a good significant protection against corrosion phenomenon than the samples coated with commercial primer that available in the market. (author)
Czech Academy of Sciences Publication Activity Database
Výprachtický, Drahomír; Mikeš, F.; Lokaj, Jan; Pokorná, Veronika; Cimrová, Věra
2015-01-01
Roč. 160, April (2015), s. 27-34 ISSN 0022-2313 R&D Projects: GA ČR GAP106/12/0827; GA ČR(CZ) GA13-26542S Institutional support: RVO:61389013 Keywords : energy transfer * terbium luminescence * quinolinone donor Subject RIV: CD - Macromolecular Chemistry Impact factor: 2.693, year: 2015
Detection of Bacterial Endospores in Soil by Terbium Fluorescence
Directory of Open Access Journals (Sweden)
Andrea Brandes Ammann
2011-01-01
Full Text Available Spore formation is a survival mechanism of microorganisms when facing unfavorable environmental conditions resulting in “dormant” states. We investigated the occurrence of bacterial endospores in soils from various locations including grasslands (pasture, meadow, allotment gardens, and forests, as well as fluvial sediments. Bacterial spores are characterized by their high content of dipicolinic acid (DPA. In the presence of terbium, DPA forms a complex showing a distinctive photoluminescence spectrum. DPA was released from soil by microwaving or autoclaving. The addition of aluminium chloride reduced signal quenching by interfering compounds such as phosphate. The highest spore content (up to 109 spores per gram of dry soil was found in grassland soils. Spore content is related to soil type, to soil depth, and to soil carbon-to-nitrogen ratio. Our study might provide a basis for the detection of “hot spots” of bacterial spores in soil.
Magnetoresistance in terbium and holmium single crystals
International Nuclear Information System (INIS)
Singh, R.L.; Jericho, M.H.; Geldart, D.J.W.
1976-01-01
The longitudinal magnetoresistance of single crystals of terbium and holmium metals in their low-temperature ferromagnetic phase has been investigated in magnetic fields up to 80 kOe. Typical magnetoresistance isotherms exhibit a minimum which increases in depth and moves to higher fields as the temperature increases. The magnetoresistance around 1 0 K, where inelastic scattering is negligible, has been interpreted as the sum of a negative contribution due to changes in the domain structure and a positive contribution due to normal magnetoresistance. At higher temperatures, a phenomenological approach has been developed to extract the inelastic phonon and spin-wave components from the total measured magnetoresistance. In the temperature range 4--20 0 K (approximately), the phonon resistivity varies as T 3 . 7 for all samples. Approximate upper and lower bounds have been placed on the spin-wave resistivity which is also found to be described by a simple power law in this temperature range. The implications of this result for theoretical treatments of spin-wave resistivity due to s-f exchange interactions are considered. It is concluded that the role played by the magnon energy gap is far less transparent than previously suggested
Sun, L; Jiang, S; Marciante, J R
2010-06-07
A compact all-fiber Faraday isolator and a Faraday mirror are demonstrated. At the core of each of these components is an all-fiber Faraday rotator made of a 4-cm-long, 65-wt%-terbium-doped silicate fiber. The effective Verdet constant of the terbium-doped fiber is measured to be -32 rad/(Tm), which is 27 x larger than that of silica fiber. This effective Verdet constant is the largest value measured to date in any fiber and is 83% of the Verdet constant of commercially available crystal used in bulk optics-based isolators. Combining the all-fiber Faraday rotator with fiber polarizers results in a fully fusion spliced all-fiber isolator whose isolation is measured to be 19 dB. Combining the all-fiber Faraday rotator with a fiber Bragg grating results in an all-fiber Faraday mirror that rotates the polarization state of the reflected light by 88 +/- 4 degrees .
Livebearing or egg-laying mammals: 27 decisive nucleotides of FAM168.
Pramanik, Subrata; Kutzner, Arne; Heese, Klaus
2017-05-23
In the present study, we determine comprehensive molecular phylogenetic relationships of the novel myelin-associated neurite-outgrowth inhibitor (MANI) gene across the entire eukaryotic lineage. Combined computational genomic and proteomic sequence analyses revealed MANI as one of the two members of the novel family with sequence similarity 168 member (FAM168) genes, consisting of FAM168A and FAM168B, having distinct genetic differences that illustrate diversification in its biological function and genetic taxonomy across the phylogenetic tree. Phylogenetic analyses based on coding sequences of these FAM168 genes revealed that they are paralogs and that the earliest emergence of these genes occurred in jawed vertebrates such as Callorhinchus milii. Surprisingly, these two genes are absent in other chordates that have a notochord at some stage in their lives, such as branchiostoma and tunicates. In the context of phylogenetic relationships among eukaryotic species, our results demonstrate the presence of FAM168 orthologs in vertebrates ranging from Callorhinchus milii to Homo sapiens, displaying distinct taxonomic clusters, comprised of fish, amphibians, reptiles, birds, and mammals. Analyses of individual FAM168 exons in our sample provide new insights into the molecular relationships between FAM168A and FAM168B (MANI) on the one hand and livebearing and egg-laying mammals on the other hand, demonstrating that a distinctive intermediate exon 4, comprised of 27 nucleotides, appears suddenly only in FAM168A and there in the livebearing mammals only but is absent from all other species including the egg-laying mammals.
Data acquisition using the 168/E
International Nuclear Information System (INIS)
Carroll, J.T.; Cittolin, S.; Demoulin, M.; Fucci, A.; Martin, B.; Norton, A.; Porte, J.P.; Rossi, P.; Storr, K.M.
1983-03-01
Event sizes and data rates at the CERN anti p p collider compose a formidable environment for a high level trigger. A system using three 168/E processors for experiment UA1 real-time event selection is described. With 168/E data memory expanded to 512K bytes, each processor holds a complete event allowing a FORTRAN trigger algorithm access to data from the entire detector. A smart CAMAC interface reads five Remus branches in parallel transferring one word to the target processor every 0.5 μs. The NORD host computer can simultaneously read an accepted event from another processor
Origin of gigantic magnetostriction and crystal field effects in terbium dititanate
International Nuclear Information System (INIS)
Aleksandrov, I.V.; Lidskij, B.V.; Mamsurova, L.G.
1985-01-01
The temperature and magnetic field dependences of the magnetostriction and magnetization and the temperature dependences of the magnetic susceptibility, specific heat and lattice parameter are investigated experimentally in a broad range of temperature and field strength for polycrystalline and single crystal Tb 2 Ti 2 O 7 . A conclusion is drawn regarding the structure of the energy levels of Tb 3+ in Tb 2 Ti 2 O 7 . A qualitative and quantitative explanation of all observed magnetic effects, and in particular of gigantic magnetostriction in Tb 2 Ti 2 O 7 , is presented which is based on the crystal field theory. It is shown that the huge magnitude of the magnetostriction in terbium dititanate is due to the specificity of the energy spectrum of Tb 3+ in Tb 2 Ti 2 O 7
A 168E emulator for off-line production
CERN PhotoLab
1982-01-01
By the end of 1982 seven such processors each with 184 kbyte memory were made available to a few experiments for about 3500 hours of equivalent IBM 370/168 equivalent time, at a cost of about 300 hours of equivalent IBM 370/168 time on the Computer Centre IBM. See Annual Report 1982 p. 81. In front of the computer, Christiane Ball
Vitali, Lucia; Fabris, Stefano; Conte, Adriano Mosca; Brink, Susan; Ruben, Mario; Baroni, Stefano; Kern, Klaus
2008-10-01
The electronic structure of isolated bis(phthalocyaninato) terbium(III) molecules, a novel single-molecular-magnet (SMM), supported on the Cu(111) surface has been characterized by density functional theory and scanning tunneling spectroscopy. These studies reveal that the interaction with the metal surface preserves both the molecular structure and the large spin magnetic moment of the metal center. The 4f electron states are not perturbed by the adsorption while a strong molecular/metal interaction can induce the suppression of the minor spin contribution delocalized over the molecular ligands. The calculations show that the inherent spin magnetic moment of the molecule is only weakly affected by the interaction with the surface and suggest that the SMM character might be preserved.
Folate Receptor Targeted Alpha-Therapy Using Terbium-149
Müller, Cristina; Haller, Stephanie; Dorrer, Holger; Köster, Ulli; Johnston, Karl; Zhernosekov, Konstantin; Türler, Andreas; Schibli, Roger
2014-01-01
Terbium-149 is among the most interesting therapeutic nuclides for medical applications. It decays by emission of short-range α-particles (Eα = 3.967 MeV) with a half-life of 4.12 h. The goal of this study was to investigate the anticancer efficacy of a 149Tb-labeled DOTA-folate conjugate (cm09) using folate receptor (FR)-positive cancer cells in vitro and in tumor-bearing mice. 149Tb was produced at the ISOLDE facility at CERN. Radiolabeling of cm09 with purified 149Tb resulted in a specific activity of ~1.2 MBq/nmol. In vitro assays performed with 149Tb-cm09 revealed a reduced KB cell viability in a FR-specific and activity concentration-dependent manner. Tumor-bearing mice were injected with saline only (group A) or with 149Tb-cm09 (group B: 2.2 MBq; group C: 3.0 MBq). A significant tumor growth delay was found in treated animals resulting in an increased average survival time of mice which received 149Tb-cm09 (B: 30.5 d; C: 43 d) compared to untreated controls (A: 21 d). Analysis of blood parameters rev...
Directory of Open Access Journals (Sweden)
Thaiane Gregório
2017-02-01
Full Text Available Two new mononuclear cationic complexes in which the TbIII ion is bis-chelated by the tripodal alcohol 1,1,1-tris(hydroxymethylpropane (H3LEt, C6H14O3 were prepared from Tb(NO33·5H2O and had their crystal and molecular structures solved by single-crystal X-ray diffraction analysis after data collection at 100 K. Both products were isolated in reasonable yields from the same reaction mixture by using different crystallization conditions. The higher-symmetry complex dinitratobis[1,1,1-tris(hydroxymethylpropane]terbium(III nitrate dimethoxyethane hemisolvate, [Tb(NO32(H3LEt2]NO3·0.5C4H10O2, 1, in which the lanthanide ion is 10-coordinate and adopts an s-bicapped square-antiprismatic coordination geometry, contains two bidentate nitrate ions bound to the metal atom; another nitrate ion functions as a counter-ion and a half-molecule of dimethoxyethane (completed by a crystallographic twofold rotation axis is also present. In product aquanitratobis[1,1,1-tris(hydroxymethylpropane]terbium(III dinitrate, [Tb(NO3(H3LEt2(H2O](NO32, 2, one bidentate nitrate ion and one water molecule are bound to the nine-coordinate terbium(III centre, while two free nitrate ions contribute to charge balance outside the tricapped trigonal-prismatic coordination polyhedron. No free water molecule was found in either of the crystal structures and, only in the case of 1, dimethoxyethane acts as a crystallizing solvent. In both molecular structures, the two tripodal ligands are bent to one side of the coordination sphere, leaving room for the anionic and water ligands. In complex 2, the methyl group of one of the H3LEt ligands is disordered over two alternative orientations. Strong hydrogen bonds, both intra- and intermolecular, are found in the crystal structures due to the number of different donor and acceptor groups present.
Hyperfine structure of the odd parity level system in the terbium atom
International Nuclear Information System (INIS)
Stefanska, D; Furmann, B
2017-01-01
Within this work new experimental results concerning the hyperfine structure ( hfs ) in the terbium atom are presented, concerning the odd parity levels system, hitherto only scarcely investigated (apart from the ground term). hfs constants A and B for 113 levels were determined for the first time, and for another 16 levels, which already occurred in our earlier works, supplementary results were obtained; additionally, our earlier results for 93 levels were compiled. The hfs of the odd parity levels was investigated using the method of laser induced fluorescence in a hollow cathode discharge. The hfs of 165 spectral lines, where the levels in question were involved as the upper levels, was recorded. Literature values of hfs constants of the even-parity lower levels (including our own earlier results) greatly facilitated the present data evaluation. (paper)
Terbium fluorescence as a sensitive, inexpensive probe for UV-induced damage in nucleic acids
International Nuclear Information System (INIS)
El-Yazbi, Amira F.; Loppnow, Glen R.
2013-01-01
Graphical abstract: -- Highlights: •Simple, inexpensive, mix-and-read assay for positive detection of DNA damage. •Recognition of undamaged DNA via hybridization to a hairpin probe. •Terbium(III) fluorescence reports the amount of damage by binding to ssDNA. •Tb/hairpin is a highly selective and sensitive fluorescent probe for DNA damage. -- Abstract: Much effort has been focused on developing methods for detecting damaged nucleic acids. However, almost all of the proposed methods consist of multi-step procedures, are limited, require expensive instruments, or suffer from a high level of interferences. In this paper, we present a novel simple, inexpensive, mix-and-read assay that is generally applicable to nucleic acid damage and uses the enhanced luminescence due to energy transfer from nucleic acids to terbium(III) (Tb 3+ ). Single-stranded oligonucleotides greatly enhance the Tb 3+ emission, but duplex DNA does not. With the use of a DNA hairpin probe complementary to the oligonucleotide of interest, the Tb 3+ /hairpin probe is applied to detect ultraviolet (UV)-induced DNA damage. The hairpin probe hybridizes only with the undamaged DNA. However, the damaged DNA remains single-stranded and enhances the intrinsic fluorescence of Tb 3+ , producing a detectable signal directly proportional to the amount of DNA damage. This allows the Tb 3+ /hairpin probe to be used for sensitive quantification of UV-induced DNA damage. The Tb 3+ /hairpin probe showed superior selectivity to DNA damage compared to conventional molecular beacons probes (MBs) and its sensitivity is more than 2.5 times higher than MBs with a limit of detection of 4.36 ± 1.2 nM. In addition, this probe is easier to synthesize and more than eight times cheaper than MBs, which makes its use recommended for high-throughput, quantitative analysis of DNA damage
β-γ and isomeric decay spectroscopy of 168Dy
Directory of Open Access Journals (Sweden)
Zhang G.X.
2018-01-01
Full Text Available This contribution will report on the experimental work on the level structure of 168Dy. The experimental data have been taken as part of the EURICA decay spectroscopy campaign at RIBF, RIKEN in November 2014. In the experiment, a 238U primary beam is accelerated up to 345 MeV/u with an average intensity of 12 pnA. The nuclei of interest are produced by in-flight fission of 238U impinging on Be target with a thickness of 5 mm. The excited states of 168Dy have been populated through the decay from a newly identified isomeric state and via the β decay from 168Tb. In this contribution, scientific motivations, experimental procedure and some preliminary results for this study are presented.
β-γ and isomeric decay spectroscopy of 168Dy
Zhang, G. X.; Watanabe, H.; Kondev, F. G.; Lane, G. J.; Regan, P. H.; Söderström, P.-A.; Walker, P. M.; Kanaoka, H.; Korkulu, Z.; Lee, P. S.; Liu, J. J.; Nishimura, S.; Wu, J.; Yagi, A.; Ahn, D. S.; Alharbi, T.; Baba, H.; Browne, F.; Bruce, A. M.; Carroll, R. J.; Chae, K. Y.; Dombradi, Zs.; Doornenbal, P.; Estrade, A.; Fukuda, N.; Griffin, C.; Ideguchi, E.; Inabe, N.; Isobe, T.; Kanaya, S.; Kojouharov, I.; Kubo, T.; Kubono, S.; Kurz, N.; Kuti, I.; Lalkovski, S.; Lee, C. S.; Lee, E. J.; Lorusso, G.; Lotay, G.; Moon, C.-B.; Nishizuka, I.; Nita, C. R.; Odahara, A.; Patel, Z.; Phong, V. H.; Podolyák, Zs.; Roberts, O. J.; Sakurai, H.; Schaffner, H.; Shand, C. M.; Shimizu, Y.; Sumikama, T.; Suzuki, H.; Takeda, H.; Terashima, S.; Vajta, Zs.; Valiente-Dóbon, J. J.; Xu, Z. Y.
2018-05-01
This contribution will report on the experimental work on the level structure of 168Dy. The experimental data have been taken as part of the EURICA decay spectroscopy campaign at RIBF, RIKEN in November 2014. In the experiment, a 238U primary beam is accelerated up to 345 MeV/u with an average intensity of 12 pnA. The nuclei of interest are produced by in-flight fission of 238U impinging on Be target with a thickness of 5 mm. The excited states of 168Dy have been populated through the decay from a newly identified isomeric state and via the β decay from 168Tb. In this contribution, scientific motivations, experimental procedure and some preliminary results for this study are presented.
26 CFR 5c.168(f)(8)-4 - Minimum investment of lessor.
2010-04-01
... 26 Internal Revenue 14 2010-04-01 2010-04-01 false Minimum investment of lessor. 5c.168(f)(8)-4....168(f)(8)-4 Minimum investment of lessor. (a) Minimum investment. Under section 168(f)(8)(B)(ii), an... has a minimum at risk investment which, at the time the property is placed in service under the lease...
Elantkowska, Magdalena; Ruczkowski, Jarosław; Sikorski, Andrzej; Dembczyński, Jerzy
2017-11-01
A parametric analysis of the hyperfine structure (hfs) for the even parity configurations of atomic terbium (Tb I) is presented in this work. We introduce the complete set of 4fN-core states in our high-performance computing (HPC) calculations. For calculations of the huge hyperfine structure matrix, requiring approximately 5000 hours when run on a single CPU, we propose the methods utilizing a personal computer cluster or, alternatively a cluster of Microsoft Azure virtual machines (VM). These methods give a factor 12 performance boost, enabling the calculations to complete in an acceptable time.
Energy Technology Data Exchange (ETDEWEB)
Nikelski, Tanja; Schleid, Thomas [Institut fuer Anorganische Chemie der Universitaet Stuttgart (Germany)
2003-06-01
The terbium meta-oxoborate Tb(BO{sub 2}){sub 3} ({identical_to} TbB{sub 3}O{sub 6}) is obtained as single crystals by the reaction of terbium, Tb{sub 4}O{sub 7} and TbCl{sub 3} with an excess of B{sub 2}O{sub 3} in gastight sealed platinum ampoules at 950 C after three weeks. The compound appears to be air- and water-resistant and crystallizes as long, thin, colourless needles which tend to growth-twinning due to their marked fibrous habit. The crystal structure of Tb(BO{sub 2}){sub 3} (orthorhombic, Pnma; a = 1598.97(9), b = 741.39(4), c = 1229.58(7) pm; Z = 16) contains strongly corrugated oxoborate layers {sub {infinity}}{sup 2}{l_brace}(BO{sub 2}){sup -}{r_brace} built of vertex-linked [BO{sub 4}]{sup 5-} tetrahedra (d(B-O) = 143 - 154 pm, and angsph;(O-B-O) = 102-115 ) which spread out parallel (100). The four crystallographically different Tb{sup 3+} cations all exhibit coordination numbers of eight towards the oxygen atoms (d(Tb-O) = 228-287 pm). The corresponding metal cation polyhedra [TbO{sub 8}]{sup 13+} too convene to layers (composition: {sub {infinity}}{sup 2}{l_brace}(Tb{sub 2}O{sub 11}){sup 16-}{r_brace}) which are likewise oriented parallel to the (100) plane. (Abstract Copyright [2003], Wiley Periodicals, Inc.) [German] Das Terbium-meta-Oxoborat Tb(BO{sub 2}){sub 3} ({identical_to} TbB{sub 3}O{sub 6}) entsteht einkristallin bei der Reaktion von Terbium, Tb{sub 4}O{sub 7} und TbCl{sub 3} mit einem Ueberschuss von B{sub 2}O{sub 3} in gasdicht verschlossenen Platinampullen nach drei Wochen bei 950 C. Die Verbindung ist luft- und wasserstabil und faellt in langen, duennen, farblosen Nadeln an, die aufgrund ihres ausgepraegt faserigen Habitus zur Wachstumsverzwillingung neigen. Die Kristallstruktur von Tb(BO{sub 2}){sub 3} (orthorhombisch, Pnma; a = 1598, 97(9), b = 741, 39(4), c = 1229, 58(7) pm; Z = 16) enthaelt parallel (100) verlaufende, stark gewellte Oxoborat-Schichten {sub {infinity}}{sup 2}{l_brace}(BO{sub 2}){sup -}{r_brace} aus
25 CFR 168.16 - Impoundment and disposal of unauthorized livestock.
2010-04-01
... 25 Indians 1 2010-04-01 2010-04-01 false Impoundment and disposal of unauthorized livestock. 168... REGULATIONS FOR THE HOPI PARTITIONED LANDS AREA § 168.16 Impoundment and disposal of unauthorized livestock. Unauthorized livestock within any range unit of the Hopi Partitioned Lands which are not removed therefrom...
Sensitive luminescent determination of DNA using the terbium(III)-difloxacin complex
International Nuclear Information System (INIS)
Yegorova, Alla V.; Scripinets, Yulia V.; Duerkop, Axel; Karasyov, Alexander A.; Antonovich, Valery P.; Wolfbeis, Otto S.
2007-01-01
The interaction of the terbium-difloxacin complex (Tb-DFX) with DNA has been examined by using UV-vis absorption and luminescence spectroscopy. The Tb-DFX complex shows an up to 85-fold enhancement of luminescence intensity upon titration with DNA. The long decay times allow additional detection schemes like time-resolved measurements in microplate readers to enhance sensitivity by off-gating short-lived background luminescence. Optimal conditions are found at equimolar concentrations of Tb 3+ and DFX (0.1 or 1 μM) at pH 7.4. Under these conditions, the luminescence intensity is linearly dependent on the concentration of ds-DNAs and ss-DNA between 1-1500 ng mL -1 and 4.5-270 ng mL -1 , respectively. The detection limit is 0.5 ng mL -1 for ds-DNAs and 2 ng mL -1 for ss-DNA. The mechanism for the luminescence enhancement was also studied
25 CFR 168.15 - Control of livestock diseases and parasites.
2010-04-01
... 25 Indians 1 2010-04-01 2010-04-01 false Control of livestock diseases and parasites. 168.15... REGULATIONS FOR THE HOPI PARTITIONED LANDS AREA § 168.15 Control of livestock diseases and parasites. Whenever... parasites or have been exposed thereto, such livestock must be treated and the movement thereof restricted...
Monoxides of small terbium clusters: A density functional theory investigation
Energy Technology Data Exchange (ETDEWEB)
Zhang, G. L.; Yuan, H. K., E-mail: yhk10@swu.edu.cn; Chen, H.; Kuang, A. L.; Li, Y.; Wang, J. Z.; Chen, J. [School of Physical Science and Technology, Southwest University, Chongqing 400715 (China)
2014-12-28
To investigate the effect of oxygen atom on the geometrical structures, electronic, and magnetic properties of small terbium clusters, we carried out the first-principles calculations on Tb{sub n}O (n = 1-14) clusters. The capping of an oxygen atom on one trigonal-facet of Tb{sub n} structures is always favored energetically, which can significantly improve the structural stability. The far-infrared vibrational spectroscopies are found to be different from those of corresponding bare clusters, providing a distinct signal to detect the characteristic structures of Tb{sub n}O clusters. The primary effect of oxygen atom on magnetic properties is to change the magnetic orderings among Tb atoms and to reduce small of local magnetic moments of the O-coordinated Tb atoms, both of which serve as the key reasons for the experimental magnetic evolution of an oscillating behavior. These calculations are consistent with, and help to account for, the experimentally observed magnetic properties of monoxide Tb{sub n}O clusters [C. N. Van Dijk et al., J. Appl. Phys. 107, 09B526 (2010)].
SNOOP module CAMAC interface to the 168/E microprocessor
International Nuclear Information System (INIS)
Bernstein, D.; Carroll, J.T.; Mitnick, V.H.; Paffrath, L.; Parker, D.B.
1979-10-01
A pair of 168/E microprocessors will be used to meet the realtime computing requirements of the SLAC Hybrid Facility. A SNOOP module and 168/E Interface provide the link between the host computer and the microprocessors. By eavesdropping on normal CAMAC read operations, the SNOOP provides a direct data transfer from CAMAC to microprocessor memory. The host computer controls the processors using standard CAMAC programmed I/O to the SNOOP
Lifescience Database Archive (English)
Full Text Available TAACAAAAACTAGTAATTTAAAAA AAAAAAAAACCNAAAAAAAAAXXXXXXXXXXAATGTCCANATTTCCATANATGTGT...>SFG168Z.Seq ----------AATGTCCANATTTCCATANATGTGTTNAAANACGTGGTGGTATNTTAAGN TGTGAATTTNANCCNCCAAGACAACCAAGATCCC...GTAAAATCAATTTGTAACAAAAACTAGTAATTTAAAAA AAAAAAAAACCNAAAAAAAAA----------AATGTCCANATTTCCATANATGTGTTNAA ANACGTGG
26 CFR 1.168(h)-1 - Like-kind exchanges involving tax-exempt use property.
2010-04-01
... property. 1.168(h)-1 Section 1.168(h)-1 Internal Revenue INTERNAL REVENUE SERVICE, DEPARTMENT OF THE... and Corporations § 1.168(h)-1 Like-kind exchanges involving tax-exempt use property. (a) Scope. (1... property (as defined in section 168(h)) at the time of the transfer; and (ii) Property that does not become...
Hart, Matthew
This paper develops scenarios of future rare-earth-magnet metal (neodymium, dysprosium, terbium, and praseodymium) consumption in the permanent magnets used in wind turbines and hybrid electric vehicles. The scenarios start with naive base-case scenarios for growth in wind-turbine and hybrid-electric-vehicle sales over the period 2011 to 2020, using historical data for each good. These naive scenarios assume that future growth follows time trends in historical data and does not depend on any exogenous variable. Specifically, growth of each technological market follows historical time trends, and the amount of rare earths used per unit of technology remains fixed. The chosen reference year is 2010. Implied consumptions of the rare earth magnet metals are calculated from these scenarios. Assumptions are made for the material composition of permanent magnets, the market share of permanent-magnet wind turbines and vehicles, and magnet weight per unit of technology. Different scenarios estimate how changes in factors like the material composition of magnets, growth of the economy, and the price of a substitute could affect future consumption. Each scenario presents a different method for reducing rare earth consumption and could be interpreted as potential policy choices. In 2010, the consumption (metric tons, rare-earth-oxide equivalent) of each rare-earth-magnet metal was as follows. Total neodymium consumption in the world for both technologies was 995 tons; dysprosium consumption was 133 tons; terbium consumption was 50 tons; praseodymium consumption was zero tons. The base scenario for wind turbines shows there could be strong, exponential growth in the global wind turbine market. New U.S. sales of hybrid vehicles would decline (in line with the current economic recession) while non-U.S. sales increase through 2020. There would be an overall increase in the total amount of magnetic rare earths consumed in the world. Total consumption of each rare earth in the short
29 CFR 4.168 - Wage payments-deductions from wages paid.
2010-07-01
... 29 Labor 1 2010-07-01 2010-07-01 true Wage payments-deductions from wages paid. 4.168 Section 4... Standards Compliance with Compensation Standards § 4.168 Wage payments—deductions from wages paid. (a) The wage requirements of the Act will not be met where unauthorized deductions, rebates, or refunds reduce...
Energy Technology Data Exchange (ETDEWEB)
Lotfi, Ali, E-mail: alilotfi67@gmail.com [Young Researchers and Elite Club, Tabriz Branch, Islamic Azad University, Tabriz (Iran, Islamic Republic of); Manzoori, Jamshid L. [Department of Chemistry, Tabriz Branch, Islamic Azad University, Tabriz (Iran, Islamic Republic of); Mohagheghi, Arash [Clinical Psychiatry Research Center, Tabriz University of Medical Sciences, Tabriz (Iran, Islamic Republic of)
2017-05-15
Sertraline is an antidepressant widely prescribed for major depressive disorders. In this contribution we report a novel, rapid and sensitive spectrofluorimetric technique, developed and validated for the determination of sertraline in pharmaceutical, human urine and human plasma samples, based on the fluorescence enhancement of the sertraline by 1, 10-phenanthroline-terbium probe with Ag nanoparticles (AgNPs). The effect of pH, buffer concentration, the order of addition of reagents, terbium and 1, 10-phenanthroline concentrations, and concentration of Ag nanoparticles (AgNPs) as well as reaction time on the fluorescence intensity were investigated and the optimum conditions were determined. The linear range for determination of sertraline was obtained as 0.001–3 mg L{sup −1}. The limit of detection (b+3s) and the limit of quantification was calculated as 2.9×10{sup −4} mg L{sup −1} and 9.8×10{sup −4} mg L{sup −1}, respectively. The interference effects of common excipients found in pharmaceutical preparations were studied. The presented technique was used to determine the sertraline in pharmaceutical samples, human urine and plasma as real samples. The presented method was indicated a comparable results with the standard analytical techniques for sertraline. Good linearity, reproducibility, recovery and limit of detection have made this method suitable for determination of sertraline in various types of samples.
International Nuclear Information System (INIS)
Lotfi, Ali; Manzoori, Jamshid L.; Mohagheghi, Arash
2017-01-01
Sertraline is an antidepressant widely prescribed for major depressive disorders. In this contribution we report a novel, rapid and sensitive spectrofluorimetric technique, developed and validated for the determination of sertraline in pharmaceutical, human urine and human plasma samples, based on the fluorescence enhancement of the sertraline by 1, 10-phenanthroline-terbium probe with Ag nanoparticles (AgNPs). The effect of pH, buffer concentration, the order of addition of reagents, terbium and 1, 10-phenanthroline concentrations, and concentration of Ag nanoparticles (AgNPs) as well as reaction time on the fluorescence intensity were investigated and the optimum conditions were determined. The linear range for determination of sertraline was obtained as 0.001–3 mg L −1 . The limit of detection (b+3s) and the limit of quantification was calculated as 2.9×10 −4 mg L −1 and 9.8×10 −4 mg L −1 , respectively. The interference effects of common excipients found in pharmaceutical preparations were studied. The presented technique was used to determine the sertraline in pharmaceutical samples, human urine and plasma as real samples. The presented method was indicated a comparable results with the standard analytical techniques for sertraline. Good linearity, reproducibility, recovery and limit of detection have made this method suitable for determination of sertraline in various types of samples.
Self-assembly of Terbium(III)-based metal-organic complexes with two-photon absorbing active
Li, Dandan; Shao, Nanqi; Sun, Xianshun; Zhang, Guocui; Li, Shengli; Zhou, Hongping; Wu, Jieying; Tian, Yupeng
2014-12-01
Hybrid complexes based on D-π-A type dyes p-aminostyryl-pyridinum and Terbium(III) complex anion (1, 2) have been synthesized by ionic exchange reaction. Meanwhile two different alkyl-substituted amino groups were used as electron donors in organic dyes cations. The synthesized complexes were characterized by element analysis. In addition, the structural features of them were systematic studied by single crystal X-ray diffraction analysis. Their linear properties have been systematically investigated by absorption spectra and fluorescence, the results show that the energy transfer takes place from the trans-4-[4‧-(N,N-diethylamino)styryl]-N-methyl pyridinium (2‧) cation to Tb(III). In addition, complex 2 exhibit a large two-photon absorption coefficient β: 0.044 cm/GW at 710 nm.
International Nuclear Information System (INIS)
Kalinovskaya, I.V.; Karasev, V.E.
2000-01-01
Effect of solvents and parameters of mechanical treatment on basic regularities of synthesis of rare earth compounds with nitrogen-containing heterocyclic compounds is studied. It is shown that interaction on europium (3) and terbium (3) nitrates with nitrogen-containing heterocyclic compounds leads to formation of compounds of Ln(NO 3 )·2D composition, where Ln=Eu, Tb; D=2,2-dipyridyl, 1,10-phenanthroline, diphenylguanidine. Effect of conditions of mechanical treatment and different additions on process and yield of products is studied. Compounds prepared are characterized by the methods of chemical element analysis, IR spectroscopy and luminescent spectroscopy [ru
Centrifugal stretching along the ground state band of 168Hf
International Nuclear Information System (INIS)
Costin, A.; Pietralla, N.; Reese, M.; Moeller, O.; Ai, H.; Casten, R. F.; Heinz, A.; McCutchan, E. A.; Meyer, D. A.; Qian, J.; Werner, V.; Dusling, K.; Fitzpatrick, C. R.; Guerdal, G.; Petkov, P.; Rainovski, G.
2009-01-01
The lifetimes of the J π =4 + , 6 + , 8 + , and 10 + levels along the ground state band in 168 Hf were measured by means of the recoil distance Doppler shift (RDDS) method using the New Yale Plunger Device (NYPD) and the SPEEDY detection array at Wright Nuclear Structure Laboratory of Yale University. Excited states in 168 Hf were populated using the 124 Sn( 48 Ti,4n) fusion evaporation reaction. The new lifetime values are sufficiently precise to clearly prove the increase of quadrupole deformation as a function of angular momentum in the deformed nucleus 168 Hf. The data agree with the predictions from the geometrical confined β-soft (CBS) rotor model that involves centrifugal stretching in a soft potential
40 CFR 35.168 - Award limitations.
2010-07-01
... STATE AND LOCAL ASSISTANCE Environmental Program Grants Water Pollution Control (section 106) § 35.168...) The State monitors and compiles, analyzes, and reports water quality data as described in section 106... October 18, 1972, a summary report of the current status of the State pollution control program, including...
Akiyama, Y.; Heyde, K.; Arima, A.; Yoshinaga, N.
1986-05-01
Extending the interacting boson model by incorporating besides s and d, also the g-boson, we can describe the population of positive parity states of 168Er in the 166Er(t,P) 168Er reaction rather well. In particular, the excitation of I,Kπi = 4,3 +1; 2,2 +2; 0,0 +3 and 0,0 +4 states is much improved over the sd-IBM approach.
42 CFR 460.168 - Reinstatement in other Medicare and Medicaid programs.
2010-10-01
... 42 Public Health 4 2010-10-01 2010-10-01 false Reinstatement in other Medicare and Medicaid programs. 460.168 Section 460.168 Public Health CENTERS FOR MEDICARE & MEDICAID SERVICES, DEPARTMENT OF... Reinstatement in other Medicare and Medicaid programs. To facilitate a participant's reinstatement in other...
Luminescent hybrid films obtained by covalent grafting of terbium complex to silica network
International Nuclear Information System (INIS)
Liu Fengyi; Fu Lianshe; Wang Jun; Liu Ze; Li Huanrong; Zhang Hongjie
2002-01-01
Luminescent hybrid thin films consisting of terbium complex covalently bonded to a silica-based network have been obtained in situ via a sol-gel approach. A new monomer, N-(4-benzoic acid-yl), N'-(propyltriethoxysilyl)urea (PABI), has been synthesized by grafting isocyanatopropyltriethoxysilane (ICPTES) to p-aminobenzoic acid and characterized by 1 H NMR, IR and MS. The monomer acts as a ligand for Tb 3+ ion and as a sol-gel precursor. Band emission from Tb 3+ ion due to an efficient ligand-to-metal energy transfer was observed by UV excitation. The decay curves of Tb 3+ in the hybrid films were measured. The energy difference between the triplet state energy of PABI and the 5 D 4 level of Tb 3+ ion falls in the exciting range to sensitize Tb 3+ ion fluorescence
Gu, Qing-Yang; Qiu, Xiao; Liu, Jing-Jing; Fu, Min; Chao, Jian-Ping; Ju, Rui-Jun; Li, Xue-Tao
2018-08-01
Diclofenac sodium (abrr. DS) and indomethacin (abrr. IMC) have been intercalated into the layered terbium hydroxide (LTbH) by anion exchange method. Chemical compositions, thermostability, morphology, luminescence property, release behaviors and cytotoxic effects have been investigated. The DS molecules may embed between layers with a bilayered arrangement and the IMC may correspond to a monolayered arrangement. The Tb3+ luminescence in DS-LTbH and IMC-LTbH composites were enhanced compared with LTbH precusor and the luminescence intensity increases with the deprotonation degree. Drug release was measured with HPLC, and LTbH showed sustained release behavior on both drugs. Further In Vitro evaluation were carried out on cancer cells. Cytotoxic effect of LTbH was observed with a sulforhodamine B colorimetric assay on a variety of cancer cell lines, which revealed that the LTbH showed little cytotoxic effect. Results indicate LTbH may offer a potential vehicle as an effective drug delivery system along with diagnostic integration.
Energy Technology Data Exchange (ETDEWEB)
Salyulev, A B; Zakir' yanova, I D [UrO RAN, Inst. Vysokotemperaturnoj Ehlektrokhimii, Ekaterinburg (Russian Federation)
2008-03-15
Raman spectroscopy was used to study in situ the behavior of individual terbium trichloride and phosphorus pentachloride in different aggregative states as a function of temperature, and of solutions of PCl{sub 5} vapors in molten TbCl{sub 3}. A conclusion is drawn about their structure and the nature of phase transformations and chemical reactions in wide ranges of temperature and saturated vapor pressures.
Clinical and Biological Manifestation of RNF168 Deficiency in Two Polish Siblings
Directory of Open Access Journals (Sweden)
Barbara Pietrucha
2017-12-01
Full Text Available Germline mutations in the RING finger protein gene RNF168 have been identified in a combined immunodeficiency disorder called RIDDLE syndrome. Since only two patients have been described with somewhat different phenotypes, there is need to identify further patients. Here, we report on two Polish siblings with RNF168 deficiency due to homozygosity for a novel frameshift mutation, c.295delG, that was identified through exome sequencing. Both patients presented with immunoglobulin deficiency, telangiectasia, cellular radiosensitivity, and increased alpha-fetoprotein (AFP levels. The younger sibling had a more pronounced neurological and morphological phenotype, and she also carried an ATM gene mutation in the heterozygous state. Immunoblot analyses showed absence of RNF168 protein, whereas ATM levels and function were proficient in lymphoblastoid cells from both patients. Consistent with the absence of RNF168 protein, 53BP1 recruitment to DNA double-strand breaks (DSBs after irradiation was undetectable in lymphoblasts or primary fibroblasts from either of the two patients. γH2AX foci accumulated normally but they disappeared with significant delay, indicating a severe defect in DSB repair. A comparison with the two previously identified patients indicates immunoglobulin deficiency, cellular radiosensitivity, and increased AFP levels as hallmarks of RNF168 deficiency. The variability in its clinical expression despite similar cellular phenotypes suggests that some manifestations of RNF168 deficiency may be modified by additional genetic or epidemiological factors.
9 CFR 381.168 - Maximum percent of skin in certain poultry products.
2010-01-01
... poultry products. 381.168 Section 381.168 Animals and Animal Products FOOD SAFETY AND INSPECTION SERVICE, DEPARTMENT OF AGRICULTURE AGENCY ORGANIZATION AND TERMINOLOGY; MANDATORY MEAT AND POULTRY PRODUCTS INSPECTION AND VOLUNTARY INSPECTION AND CERTIFICATION POULTRY PRODUCTS INSPECTION REGULATIONS Definitions and...
Thermoluminescence of cerium and terbium -doped calcium pyrophosphate
Energy Technology Data Exchange (ETDEWEB)
Roman L, J.; Cruz Z, E. [UNAM, Instituto de Ciencias Nucleares, Circuito Exterior, Ciudad Universitaria, 04510 Mexico D. F. (Mexico); Lozano R, I. B.; Diaz G, J. A. I., E-mail: jesus.roman@nucleares.unam.mx [IPN, Centro de Investigacion en Ciencia Aplicada y Tecnologia Avanzada, Av. Legaria No. 694, 11500 Mexico D. F. (Mexico)
2015-10-15
The aim of this work is to report the thermoluminescence (Tl) response of Calcium Pyrophosphate phosphor doped with Cerium and Terbium impurities (Ca{sub 2}P{sub 2}O{sub 7}:Ce{sup 3+},Tb{sup 3+}). The phosphors were synthesized using the co-precipitation method and annealed at 900 degrees C by two hours for obtain the β phase. The intentional doping with Ce and Tb ions was 1 at.% and 0.1 at.%, whereas in the EDS results the concentration of impurities was 0.39 at.% and 0.05 at.%, respectively. The superficial morphology of phosphor is mainly composed by thin wafers of different size. All samples were exposed to gamma rays from {sup 60}Co in the Gammacell-200 irradiator. The Tl response of the phosphor was measured from Rt up to 350 degrees C and under nitrogen atmosphere in a Harshaw TLD 3500 reader. The glow curves of the Ca{sub 2}P{sub 2}O{sub 7}:Ce{sup 3+},Tb{sup 3+} powders showed a broad intense Tl peak centered at 165 degrees C and a shoulder at approximate 260 degrees C was observed. A linear Tl response in the range of absorbed dose of 0.2 to 10 Gy was obtained. Tl glow curves were analyzed using the initial rise (IR)and computerized glow curve deconvolution methods to evaluate the kinetics parameters such as activation energy (E), frequency factor (s) and kinetic order (b). (Author)
Effects of time on the magnetic properties of terbium-doped LaMnO3
International Nuclear Information System (INIS)
Liu Weibin; Zhang Yingtang; Guan Wen; Kinsman, William; Yuan Xinqiang; Chen Ziyu
2012-01-01
The magnetic properties of the perovskite form of LaMnO 3 have been shown strong interest in recent years due to its high potential for use in magnetic devices. In this paper, the magnetic properties of a 30% terbium-doped LaMnO 3 (LMTO) perovskite manganite synthesized by a conventional solid-state reaction were investigated. Data on these properties was recorded periodically via SQUID and VSM to reveal it to be best described magnetically as a spin glass system. Thus, the time effect must be taken into consideration in instantaneously determining this material’s spin glass state as well as the overall magnetic properties in the absence of a magnetic field. The results of this paper point to a more in-depth understanding of the change in magnetic properties associated with doped LaMnO 3 .
Energy Technology Data Exchange (ETDEWEB)
Bick, Jens-Peter; Michels, Andreas [Universitaet des Saarlandes, D-66041 Saarbruecken (Germany); University of Luxembourg, L-1511 Luxembourg (Luxembourg); Ferdinand, Adrian; Birringer, Rainer [Universitaet des Saarlandes, D-66041 Saarbruecken (Germany); Baller, Joerg; Sanctuary, Roland [University of Luxembourg, L-1511 Luxembourg (Luxembourg); Philippi, Stefan [Leibniz Institute for Solid State and Materials Research, D-01069 Dresden (Germany); Lott, Dieter [GKSS Research Center, D-21502 Geesthacht (Germany); Balog, Sandor [Paul Scherrer Institute, CH-5232 Villigen (Switzerland); Rotenberg, Eli [Lawrence Berkeley National Laboratory, California 94720 (United States); Kaindl, Guenter [Freie Universitaet Berlin, D-14195 Berlin-Dahlem (Germany); Doebrich, Kristian M. [Freie Universitaet Berlin, D-14195 Berlin-Dahlem (Germany); Max-Born-Institut, D-12489 Berlin (Germany)
2011-07-01
We report on the results of grain-size and temperature-dependent magnetization, specific-heat, neutron-scattering, and angle-resolved photoelectron spectroscopy (ARPES) experiments on the heavy rare-earth metals terbium and holmium, with particular emphasis on the temperature regions where the helical antiferromagnetic phases exist. In contrast to Ho, we find that the helical structure in Tb is relative strongly affected by microstructural disorder, specifically, it can no longer be detected for the smallest studied grain size of D=18 nm. Moreover, in coarse-grained Tb a helical structure persists even in the ferromagnetic regime, down to about T=215 K, in agreement with the ARPES data, which reveal a nesting feature of the Fermi surface at the L point of the Brillouin zone at T=210 K.
Image collection: 168 [Togo Picture Gallery[Archive
Lifescience Database Archive (English)
Full Text Available 168 Choloepus_didactylus_NL.png フタユビナマケモノ Toed sloth Choloepus didactylus 27675 生物アイコン,脊索動物門,脊椎動物亜門,哺乳綱,獣亜綱,真獣下綱
27 CFR 24.168 - Identification of tanks.
2010-04-01
..., DEPARTMENT OF THE TREASURY LIQUORS WINE Construction and Equipment § 24.168 Identification of tanks. (a) General. Each tank, barrel, puncheon, or similar bulk container, used to ferment wine or used to process or store wine, spirits, or wine making materials will have the contents marked and will be marked as...
Energy Technology Data Exchange (ETDEWEB)
Akiyama, Y.; Heyde, K.; Arima, A.; Yoshinaga, N.
1986-05-29
Extending the interacting boson model by incorporating besides s and d, also the g-boson, we can describe the population of positive parity states of /sup 168/Er in the /sup 166/Er(t,P)/sup 168/Er reaction rather well. In particular, the excitation of I,Ksub(i)sup(..pi..) = 4,3/sub 1//sup +/; 2,2/sub 2//sup +/; 0,0/sub 3//sup +/ and 0,0/sub 4//sup +/ states is much improved over the sd-IBM appraoch.
Effects of time on the magnetic properties of terbium-doped LaMnO{sub 3}
Energy Technology Data Exchange (ETDEWEB)
Liu Weibin [Department of Physics, Beijing University of Aeronautics and Astronautics, Beijing 100191 (China); Zhang Yingtang, E-mail: zhangyingtang76@mail.xjtu.edu.cn [School of Material Science and Engineering, Institute of Functional Material, Shaanxi University of Technology, Hanzhong 723003 (China); State Key Laboratory of Electrical Insulation and Power Equipment and MOE Key Laboratory for Nonequilibrium Synthesis and Modulation of Condensed Matter, Xi' an Jiaotong University, Xi' an 710049 (China); Guan Wen [State Key Laboratory of Electrical Insulation and Power Equipment and MOE Key Laboratory for Nonequilibrium Synthesis and Modulation of Condensed Matter, Xi' an Jiaotong University, Xi' an 710049 (China); Kinsman, William [Department of Materials Science and Engineering, Pennsylvania State University, University Park, PA 16802 (United States); Yuan Xinqiang [School of Material Science and Engineering, Institute of Functional Material, Shaanxi University of Technology, Hanzhong 723003 (China); Chen Ziyu [Department of Physics, Beijing University of Aeronautics and Astronautics, Beijing 100191 (China)
2012-09-01
The magnetic properties of the perovskite form of LaMnO{sub 3} have been shown strong interest in recent years due to its high potential for use in magnetic devices. In this paper, the magnetic properties of a 30% terbium-doped LaMnO{sub 3} (LMTO) perovskite manganite synthesized by a conventional solid-state reaction were investigated. Data on these properties was recorded periodically via SQUID and VSM to reveal it to be best described magnetically as a spin glass system. Thus, the time effect must be taken into consideration in instantaneously determining this material's spin glass state as well as the overall magnetic properties in the absence of a magnetic field. The results of this paper point to a more in-depth understanding of the change in magnetic properties associated with doped LaMnO{sub 3}.
1983-01-01
Five 168/E processors and associated specialized interface hardware made an importartant contribution to the UA1 experiment. The processors provided an online event display facility, and also flagged candidate events. See Annual Report 1983 p. 75, and photo 8305815X, 8395813X. This photo shows the team including DD personnel and UA1 members. On the foreground left, is Michel Demoulin. On the background, 3rd from left, is Adolfo Fucci, last Sergio Cittolin.
Directory of Open Access Journals (Sweden)
Kequan Fu
Full Text Available Transmembrane protein 168 (TMEM168 comprises 697 amino acid residues, including some putative transmembrane domains. It is reported that TMEM168 controls methamphetamine (METH dependence in the nucleus accumbens (NAc of mice. Moreover, a strong link between METH dependence-induced adaptive changes in the brain and mood disorders has been evaluated. In the present study, we investigated the effects of accumbal TMEM168 in a battery of behavioral paradigms. The adeno-associated virus (AAV Tmem168 vector was injected into the NAc of C57BL/6J mice (NAc-TMEM mice. Subsequently, the accumbal TMEM168 mRNA was increased approximately by seven-fold when compared with the NAc-Mock mice (controls. The NAc-TMEM mice reported no change in the locomotor activity, cognitive ability, social interaction, and depression-like behaviors; however, TMEM168 overexpression enhanced anxiety in the elevated-plus maze and light/dark box test. The increased anxiety was reversed by pretreatment with the antianxiety drug diazepam (0.3 mg/kg i.p.. Moreover, the NAc-TMEM mice exhibited decreased prepulse inhibition (PPI in the startle response test, and the induced schizophrenia-like behavior was reversed by pretreatment with the antipsychotic drug risperidone (0.01 mg/kg i.p.. Furthermore, accumbal TMEM168 overexpression decreased the basal levels of extracellular GABA in the NAc and the high K+ (100 mM-stimulated GABA elevation; however, the total contents of GABA in the NAc remained unaffected. These results suggest that the TMEM168-regulated GABAergic neuronal system in the NAc might become a novel target while studying the etiology of anxiety and sensorimotor gating deficits.
2013-01-01
Background Mycoplasma hyopneumoniae is the causative agent of porcine enzootic pneumonia (EP), a mild, chronic pneumonia of swine. Despite presenting with low direct mortality, EP is responsible for major economic losses in the pig industry. To identify the virulence-associated determinants of M. hyopneumoniae, we determined the whole genome sequence of M. hyopneumoniae strain 168 and its attenuated high-passage strain 168-L and carried out comparative genomic analyses. Results We performed the first comprehensive analysis of M. hyopneumoniae strain 168 and its attenuated strain and made a preliminary survey of coding sequences (CDSs) that may be related to virulence. The 168-L genome has a highly similar gene content and order to that of 168, but is 4,483 bp smaller because there are 60 insertions and 43 deletions in 168-L. Besides these indels, 227 single nucleotide variations (SNVs) were identified. We further investigated the variants that affected CDSs, and compared them to reported virulence determinants. Notably, almost all of the reported virulence determinants are included in these variants affected CDSs. In addition to variations previously described in mycoplasma adhesins (P97, P102, P146, P159, P216, and LppT), cell envelope proteins (P95), cell surface antigens (P36), secreted proteins and chaperone protein (DnaK), mutations in genes related to metabolism and growth may also contribute to the attenuated virulence in 168-L. Furthermore, many mutations were located in the previously described repeat motif, which may be of primary importance for virulence. Conclusions We studied the virulence attenuation mechanism of M. hyopneumoniae by comparative genomic analysis of virulent strain 168 and its attenuated high-passage strain 168-L. Our findings provide a preliminary survey of CDSs that may be related to virulence. While these include reported virulence-related genes, other novel virulence determinants were also detected. This new information will form
33 CFR 110.168 - Hampton Roads, Virginia and adjacent waters (Datum: NAD 83).
2010-07-01
... 33 Navigation and Navigable Waters 1 2010-07-01 2010-07-01 false Hampton Roads, Virginia and adjacent waters (Datum: NAD 83). 110.168 Section 110.168 Navigation and Navigable Waters COAST GUARD..., Virginia and adjacent waters (Datum: NAD 83). (a) Anchorage Grounds—(1) Anchorage A [Naval Anchorage]. The...
Energy Technology Data Exchange (ETDEWEB)
Cao, Xin; Chen, Xueli, E-mail: xlchen@xidian.edu.cn, E-mail: jimleung@mail.xidian.edu.cn; Cao, Xu; Zhan, Yonghua; Liang, Jimin, E-mail: xlchen@xidian.edu.cn, E-mail: jimleung@mail.xidian.edu.cn [Engineering Research Center of Molecular and Neuro Imaging of the Ministry of Education and School of Life Science and Technology, Xidian University, Xi' an, Shaanxi 710071 (China); Kang, Fei; Wang, Jing [Department of Nuclear Medicine, Xijing Hospital, Fourth Military Medical University, Xi' an, Shaanxi 710032 (China); Wu, Kaichun [Department of Digestive Diseases, Xijing Hospital, Fourth Military Medical University, Xi' an, Shaanxi 710032 (China)
2015-05-25
Our previous study showed a great attenuation for the Cerenkov luminescence endoscope (CLE), resulting in relatively low detection sensitivity of radiotracers. Here, a kind of radioluminescence nanoparticles (RLNPs), terbium doped Gd{sub 2}O{sub 2}S was mixed with the radionuclide {sup 68}Ga to enhance the intensity of emitted luminescence, which finally improved the detection sensitivity of the CLE by using the radioluminescence imaging technique. With the in vitro and in vivo pseudotumor experiments, we showed that the use of RLNPs mixed with the radionuclide {sup 68}Ga enabled superior sensitivity compared with the radionuclide {sup 68}Ga only, with 50-fold improvement on detection sensitivity, which guaranteed meeting the demands of the clinical diagnosis of gastrointestinal tract tumors.
32 CFR 168a.4 - Policy and procedures.
2010-07-01
... to pursue graduate degrees in science, engineering, or other fields of study that are designated, in... DEFENSE SCIENCE AND ENGINEERING GRADUATE FELLOWSHIPS § 168a.4 Policy and procedures. (a) Sponsoring... nationwide competition in which all appropriate actions have been taken to encourage applications from...
Sobhani-Nasab, Ali; Rahimi-Nasrabadi, Mehdi; Naderi, Hamid Reza; Pourmohamadian, Vafa; Ahmadi, Farhad; Ganjali, Mohammad Reza; Ehrlich, Hermann
2018-07-01
Sonochemically prepared nanoparticles of terbium tungstate (TWNPs) were evaluated through scanning electron microscopy (SEM), thermogravimetric analysis (TGA), X-ray diffraction (XRD) and Fourier transform infrared spectroscopy (FT-IR), UV-Vis spectroscopy, and the optimal products were further characterized in terms of their electrochemical properties using conventional and continuous cyclic voltammetry (CV, and CCV), galvanostatic charge/discharge technique, and electrochemical impedance spectroscopy (EIS). The CV studies indicated the TWNPs to have specific capacitance (SC) values of 336 and 205 F g -1 at 1 and 200 mV s -1 , and galvanostatic charge-discharge tests revealed the SC of the TWNP-based electrodes to be 300 F g -1 at 1 Ag -1 . Also continuous cyclic voltammetry evaluations proved the sample as having a capacitance retention value of 95.3% after applying 4000 potential cycles. In the light of the results TWNPs were concluded as favorable electrode materials for use in hybrid vehicle systems. Copyright © 2018 Elsevier B.V. All rights reserved.
33 CFR 165.168 - Safety Zones; Coast Guard Captain of the Port New York Fireworks Displays.
2010-07-01
... of the Port New York Fireworks Displays. 165.168 Section 165.168 Navigation and Navigable Waters... Guard District § 165.168 Safety Zones; Coast Guard Captain of the Port New York Fireworks Displays. (a... Upper New York Bay within a 360-yard radius of the fireworks barge in approximate position 40°41′16.5″ N...
Li, Wei; Cui, Xiao; Meng, Zhaolu; Huang, Xiahe; Xie, Qi; Wu, Heng; Jin, Hailing; Zhang, Dabing; Liang, Wanqi
2012-03-01
The accumulation of a number of small RNAs in plants is affected by abscisic acid (ABA) and abiotic stresses, but the underlying mechanisms are poorly understood. The miR168-mediated feedback regulatory loop regulates ARGONAUTE1 (AGO1) homeostasis, which is crucial for gene expression modulation and plant development. Here, we reveal a transcriptional regulatory mechanism by which MIR168 controls AGO1 homeostasis during ABA treatment and abiotic stress responses in Arabidopsis (Arabidopsis thaliana). Plants overexpressing MIR168a and the AGO1 loss-of-function mutant ago1-27 display ABA hypersensitivity and drought tolerance, while the mir168a-2 mutant shows ABA hyposensitivity and drought hypersensitivity. Both the precursor and mature miR168 were induced under ABA and several abiotic stress treatments, but no obvious decrease for the target of miR168, AGO1, was shown under the same conditions. However, promoter activity analysis indicated that AGO1 transcription activity was increased under ABA and drought treatments, suggesting that transcriptional elevation of MIR168a is required for maintaining a stable AGO1 transcript level during the stress response. Furthermore, we showed both in vitro and in vivo that the transcription of MIR168a is directly regulated by four abscisic acid-responsive element (ABRE) binding factors, which bind to the ABRE cis-element within the MIR168a promoter. This ABRE motif is also found in the promoter of MIR168a homologs in diverse plant species. Our findings suggest that transcriptional regulation of miR168 and posttranscriptional control of AGO1 homeostasis may play an important and conserved role in stress response and signal transduction in plants.
Coulomb-nuclear interference measurements of hexadecapole deformations in 168Yb and 178,180Hf
International Nuclear Information System (INIS)
Nettles, W.G.; Mississippi Coll., Clinton; Ramayya, A.V.; Hamilton, J.H.
1988-01-01
Coulomb-nuclear interference studies of 168 Yb and 178,180 Hf have been carried out with alpha particles from the Pittsburgh tandem. From coupled channel fits to the data at 18 MeV for 168 Yb and 19.5 MeV for 178,180 Hf, β 4 c values of -0.030(20), -0.166(18), and -0.180(6) were obtained, respectively. These data agree with the positive M 04 value from sub-Coulomb studies of 168 Yb but with the large negative M 04 values from sub-Coulomb studies of 178,180 Hf. (author)
International Nuclear Information System (INIS)
Ronjat, M.; Lacapere, J.J.; Dufour, J.P.; Dupont, Y.
1987-01-01
The plasma membrane of yeasts contains an H+-ATPase similar to the other cation transport ATPases of eukaryotic organisms. This enzyme has been purified and shows H+ transport in reconstituted vesicles. In the presence of Mg2+, formycin triphosphate (FTP) is hydrolyzed by the H+-ATPase and supports H+ transport. When combined with terbium ion, FTP (Tb-FTP) and ATP (Tb-ATP) are no longer hydrolyzed. Competition between Mg-ATP and Tb-FTP for ATP hydrolysis indicates that terbium-associated nucleotides bind to the catalytic site of the H+-ATPase. The fluorescent properties of the Tb-FTP complex were used to study the active site of the H+-ATPase. Fluorescence of Tb-FTP is greatly enhanced upon binding into the nucleotide site of H+-ATPase with a dissociation constant of 1 microM. Tb-ATP, Tb-ADP, and Tb-ITP are competitive inhibitors of Tb-FTP binding with Ki = 4.5, 5.0, and 6.0 microM, respectively. Binding of Tb-FTP is observed only in the presence of an excess of Tb3+ with an activation constant Ka = 25 microM for Tb3+. Analysis of the data reveals that the sites for Tb-FTP and Tb3+ binding are independent entities. In standard conditions these sites would be occupied by Mg-ATP and Mg2+, respectively. These findings suggest an important regulatory role of divalent cations on the activity of H+-ATPase. Replacement of H 2 O by D 2 O in the medium suggests the existence of two types of nucleotide binding sites differing by the hydration state of the Tb3+ ion in the bound Tb-FTP complex
Lifetimes Measurements in 160Yb,162Yb,164Yb,166Yb,168Yb
International Nuclear Information System (INIS)
Araddad, S. Y.; El-barouni, A. M.; Rateb, G. M.; Mosbah, D. S.; Elahrash, M. S.; Sergiwa, S. M.
2004-01-01
From our measurements of the lifetimes of high spin states in 168 Yb along with the published lifetime data for the nearby even even ytterbium isotopes, 160-168 Yb using the Recoil Distance Method (RDM) and the Doppler Shift Attenuation Method (DSAM) present a great opportunity to probe systematically the relationship between the nuclear shape changes and the reduction in collectivity. (authors)
Majeed, Hassaan; Shaheen, Amrozia; Anwar, Muhammad Sabieh
2013-10-21
We report the complete determination of the polarization changes caused in linearly polarized incident light due to propagation in a magneto-optically active terbium gallium garnet (TGG) single crystal, at temperatures ranging from 6.3 to 300 K. A 28-fold increase in the Verdet constant of the TGG crystal is seen as its temperature decreases to 6.3 K. In contrast with polarimetry of light emerging from a Faraday material at room temperature, polarimetry at cryogenic temperatures cannot be carried out using the conventional fixed polarizer-analyzer technique because the assumption that ellipticity is negligible becomes increasingly invalid as temperature is lowered. It is shown that complete determination of light polarization in such a case requires the determination of its Stokes parameters, otherwise inaccurate measurements will result with negative implications for practical devices.
Energy Technology Data Exchange (ETDEWEB)
Welch, Jan M. [TU Wien, Atominstitut, Vienna (Austria); Mueller, Danny; Knoll, Christian; Wilkovitsch, Martin; Weinberger, Peter [TU Wien, Institute of Applied Synthetic Chemistry, Vienna (Austria); Giester, Gerald [University of Vienna, Institute of Mineralogy and Crystallography, Vienna (Austria); Ofner, Johannes; Lendl, Bernhard [TU Wien, Institute of Chemical Technologies and Analytics, Vienna (Austria); Steinhauser, Georg [Leibniz Universitaet Hannover, Institute of Radioecology and Radiation Protection (Germany)
2017-10-16
The crystallization of terbium 5,5{sup '}-azobis[1H-tetrazol-1-ide] (ZT) in the presence of trace amounts (ca. 50 Bq, ca. 1.6 pmol) of americium results in 1) the accumulation of the americium tracer in the crystalline solid and 2) a material that adopts a different crystal structure to that formed in the absence of americium. Americium-doped [Tb(Am)(H{sub 2}O){sub 7}ZT]{sub 2} ZT.10 H{sub 2}O is isostructural to light lanthanide (Ce-Gd) 5,5{sup '}-azobis[1H-tetrazol-1-ide] compounds, rather than to the heavy lanthanide (Tb-Lu) 5,5{sup '}-azobis[1H-tetrazol-1-ide] (e.g., [Tb(H{sub 2}O){sub 8}]{sub 2}ZT{sub 3}.6 H{sub 2}O) derivatives. Traces of Am seem to force the Tb compound into a structure normally preferred by the lighter lanthanides, despite a 10{sup 8}-fold Tb excess. The americium-doped material was studied by single-crystal X-ray diffraction, vibrational spectroscopy, radiochemical neutron activation analysis, and scanning electron microscopy. In addition, the inclusion properties of terbium 5,5{sup '}-azobis[1H-tetrazol-1-ide] towards americium were quantified, and a model for the crystallization process is proposed. (copyright 2017 Wiley-VCH Verlag GmbH and Co. KGaA, Weinheim)
Solar Thermochemical Hydrogen Production via Terbium Oxide Based Redox Reactions
Directory of Open Access Journals (Sweden)
Rahul Bhosale
2016-01-01
Full Text Available The computational thermodynamic modeling of the terbium oxide based two-step solar thermochemical water splitting (Tb-WS cycle is reported. The 1st step of the Tb-WS cycle involves thermal reduction of TbO2 into Tb and O2, whereas the 2nd step corresponds to the production of H2 through Tb oxidation by water splitting reaction. Equilibrium compositions associated with the thermal reduction and water splitting steps were determined via HSC simulations. Influence of oxygen partial pressure in the inert gas on thermal reduction of TbO2 and effect of water splitting temperature (TL on Gibbs free energy related to the H2 production step were examined in detail. The cycle (ηcycle and solar-to-fuel energy conversion (ηsolar-to-fuel efficiency of the Tb-WS cycle were determined by performing the second-law thermodynamic analysis. Results obtained indicate that ηcycle and ηsolar-to-fuel increase with the decrease in oxygen partial pressure in the inert flushing gas and thermal reduction temperature (TH. It was also realized that the recuperation of the heat released by the water splitting reactor and quench unit further enhances the solar reactor efficiency. At TH=2280 K, by applying 60% heat recuperation, maximum ηcycle of 39.0% and ηsolar-to-fuel of 47.1% for the Tb-WS cycle can be attained.
Qi, Yan-Xia; Zhang, Min; Zhu, Anwei; Shi, Guoyue
2015-08-21
In this work, a novel ratiometric fluorescent probe was developed for rapid, highly accurate, sensitive and selective detection of mercury(II) (Hg(2+)) based on terbium(III)/gold nanocluster conjugates (Tb(3+)/BSA-AuNCs), in which bovine serum albumin capped gold nanoclusters (BSA-AuNCs) acted as the signal indicator and terbium(III) (Tb(3+)) was used as the build-in reference. Our proposed ratiometric fluorescent probe exhibited unique specificity toward Hg(2+) against other common environmentally and biologically important metal ions, and had high accuracy and sensitivity with a low detection limit of 1 nM. In addition, our proposed probe was effectively employed to detect Hg(2+) in the biological samples from the artificial Hg(2+)-infected rats. More significantly, an appealing paper-based visual sensor for Hg(2+) was designed by using filter paper embedded with Tb(3+)/BSA-AuNC conjugates, and we have further demonstrated its feasibility for facile fluorescent sensing of Hg(2+) in a visual format, in which only a handheld UV lamp is used. In the presence of Hg(2+), the paper-based visual sensor, illuminated by a handheld UV lamp, would undergo a distinct fluorescence color change from red to green, which can be readily observed with naked eyes even in trace Hg(2+) concentrations. The Tb(3+)/BSA-AuNC-derived paper-based visual sensor is cost-effective, portable, disposable and easy-to-use. This work unveiled a facile approach for accurate, sensitive and selective measuring of Hg(2+) with self-calibration.
28 CFR 0.168 - Redelegation by Assistant Attorneys General.
2010-07-01
..., Penalties, and Forfeitures § 0.168 Redelegation by Assistant Attorneys General. (a) Assistant Attorneys... the Assistant Attorney General level must be presented to the Assistant Attorney General for... the Deputy Attorney General or the Associate Attorney General, as appropriate, before taking effect...
Energy Technology Data Exchange (ETDEWEB)
Song Lixin; Du Pingfan [Key Laboratory of Advanced Textile Materials and Manufacturing Technology (Zhejiang Sci-Tech University), Ministry of Education, Hangzhou 310018 (China); Xiong Jie, E-mail: jxiong@zstu.edu.cn [Key Laboratory of Advanced Textile Materials and Manufacturing Technology (Zhejiang Sci-Tech University), Ministry of Education, Hangzhou 310018 (China); Fan Xiaona; Jiao Yuxue [Key Laboratory of Advanced Textile Materials and Manufacturing Technology (Zhejiang Sci-Tech University), Ministry of Education, Hangzhou 310018 (China)
2012-01-15
Terbium-doped lanthanum oxide (La{sub 2}O{sub 3}:Tb{sup 3+}) nanofibers were prepared by electrospinning followed by calcination at high temperature. Thermogravimetric analyzer (TGA), field emission scanning electron microscopy (FE-SEM), X-ray diffraction (XRD), Fourier transform infrared spectroscopy (FT-IR), and photoluminescence (PL) were used to characterize the obtained fibers. The results reveal that the nanofibers have an average diameter of ca. 95{+-}25 nm and are composed of pure La{sub 2}O{sub 3} phase. Under the excitation of 274 nm light, the La{sub 2}O{sub 3}:Tb{sup 3+} nanofibers exhibit the characteristic emission resulting from the {sup 5}D{sub 4}{yields}{sup 7}F{sub J} (J=3, 4, 5, 6) transitions of Tb{sup 3+} ions. And the PL emission intensity is stronger than that of their nanoparticle counterparts. - Highlights: > Tb{sup 3+}-doped La{sub 2}O{sub 3} (La{sub 2}O{sub 3}:Tb{sup 3+}) fluorescent nanofibers were prepared via a simple electrospinning technique. > Luminescent properties and other characteristics of the nanofibers were investigated in details. > Potential applications of La{sub 2}O{sub 3}:Tb{sup 3+} nanofibers and electrospinning technique described in this paper are suggested.
Energy Technology Data Exchange (ETDEWEB)
Wang Hong; Yi Chongyue; Li Xue; Fang Fang [School of Chemistry and Chemical Engineering, Huazhong University of Science and Technology, Wuhan 430074 (China); Yang Yajiang, E-mail: yjyang@mail.hust.edu.c [School of Chemistry and Chemical Engineering, Huazhong University of Science and Technology, Wuhan 430074 (China)
2011-04-15
Luminescence enhancement of terbium-ion prulifloxacin complexes (Tb(III)-PUFX) in supramolecular hydrogels formed by assembly of 1,3:2,4-di-O-benzylidene-D-sorbitol (DBS) was investigated by steady-state fluorescence, varying temperature fluorescence and time-resolved fluorescence. The luminescence images show that Tb(III)-PUFX were dispersed in the DBS gels. The luminescence intensity of Tb(III)-PUFX in the DBS gels was significantly increased in comparison with that in corresponding aqueous solutions. The varying temperature fluorescent spectra show that the luminescence intensity of Tb(III)-PUFX decreased with an increase in the temperature. This implies that the luminescence enhancement of Tb(III)-PUFX is related to the dissociation and the formation of the DBS assemblies. Time-resolved fluorescence measurements show slower rotational motion in DBS gels in comparison with that in the corresponding aqueous solutions. This may be ascribed to a unique microstructure of three-dimensional network formed by DBC aggregates, resulting in deactivation of the nonradiative relaxation. The images of field emission scanning electron microscopy and polarized optical microscopy indicate that the morphology of the DBS assemblies was not influenced upon addition of Tb(III)-PUFX to the DBS gels.
The 168/E at CERN and the MARK 2. An improved processor design
International Nuclear Information System (INIS)
Kunz, P.; Botterill, D.R.; Lord, D.; Edwards, A.; Fucci, A.; Lee, G.; Martin, B.; Mornacchi, G.; Scharff-Hansen, P.; Storr, M.
1981-01-01
In the first part of this paper the history of the 168/E work at CERN is reviewed, this is followed by a short description of the hardware and software in use and finally some examples of future applications are given. In the second part of the paper the limitations of the present 168/E design are discussed and the ways that a new design, Mark 2, could overcome them are presented. (orig.)
Li, Wei; Cui, Xiao; Meng, Zhaolu; Huang, Xiahe; Xie, Qi; Wu, Heng; Jin, Hailing; Zhang, Dabing; Liang, Wanqi
2012-01-01
The accumulation of a number of small RNAs in plants is affected by abscisic acid (ABA) and abiotic stresses, but the underlying mechanisms are poorly understood. The miR168-mediated feedback regulatory loop regulates ARGONAUTE1 (AGO1) homeostasis, which is crucial for gene expression modulation and plant development. Here, we reveal a transcriptional regulatory mechanism by which MIR168 controls AGO1 homeostasis during ABA treatment and abiotic stress responses in Arabidopsis (Arabidopsis thaliana). Plants overexpressing MIR168a and the AGO1 loss-of-function mutant ago1-27 display ABA hypersensitivity and drought tolerance, while the mir168a-2 mutant shows ABA hyposensitivity and drought hypersensitivity. Both the precursor and mature miR168 were induced under ABA and several abiotic stress treatments, but no obvious decrease for the target of miR168, AGO1, was shown under the same conditions. However, promoter activity analysis indicated that AGO1 transcription activity was increased under ABA and drought treatments, suggesting that transcriptional elevation of MIR168a is required for maintaining a stable AGO1 transcript level during the stress response. Furthermore, we showed both in vitro and in vivo that the transcription of MIR168a is directly regulated by four abscisic acid-responsive element (ABRE) binding factors, which bind to the ABRE cis-element within the MIR168a promoter. This ABRE motif is also found in the promoter of MIR168a homologs in diverse plant species. Our findings suggest that transcriptional regulation of miR168 and posttranscriptional control of AGO1 homeostasis may play an important and conserved role in stress response and signal transduction in plants. PMID:22247272
Energy Technology Data Exchange (ETDEWEB)
Jia Zhen [Key Laboratory of Colloid and Interface Chemistry of Education Ministry, School of Chemistry and Chemical Engineering, Shandong University, Jinan 250100 (China); Department of Chemistry, Dezhou University, Dezhou 253023 (China); Yang Jinghe [Key Laboratory of Colloid and Interface Chemistry of Education Ministry, School of Chemistry and Chemical Engineering, Shandong University, Jinan 250100 (China)]. E-mail: yjh@sdu.edu.cn; Wu Xia [Key Laboratory of Colloid and Interface Chemistry of Education Ministry, School of Chemistry and Chemical Engineering, Shandong University, Jinan 250100 (China); Wang Fei [Key Laboratory of Colloid and Interface Chemistry of Education Ministry, School of Chemistry and Chemical Engineering, Shandong University, Jinan 250100 (China); Guo Changying [Key Laboratory of Colloid and Interface Chemistry of Education Ministry, School of Chemistry and Chemical Engineering, Shandong University, Jinan 250100 (China); Liu Shufang [Key Laboratory of Colloid and Interface Chemistry of Education Ministry, School of Chemistry and Chemical Engineering, Shandong University, Jinan 250100 (China)
2006-12-15
It is found that in hexamethylene tetramine (HMTA)-HCl buffer of pH=8.00, proteins can enhance the fluorescence of terbium (III) (Tb{sup 3+})-2-thenoyltrifluoroacetone (TTA)-sodium dodecyl benzene sulfonate (SDBS) system. Based on this, a sensitive method for the determination of proteins is proposed. The experiments indicate that under the optimum conditions, the enhanced fluorescence intensity is in proportion to the concentration of proteins in the range of 4.0x10{sup -9}-7.5x10{sup -6}g/mL for bovine serum albumin (BSA), 5.0x10{sup -9}-1.5x10{sup -5}g/mL for human serum albumin (HSA), 1.0x10{sup -8}-7.5x10{sup -6}g/mL for egg albumin (EA). Their detection limits (S/N=3) are 0.5, 0.8 and 2.0ng/mL, respectively. The interaction mechanism is also studied.
International Nuclear Information System (INIS)
Bian Weiwei; Wang Yusheng; Zhu Xiaojing; Jiang Chongqiu
2006-01-01
A new spectrofluorimetric method was developed for the determination of trace amount of nicotinamide adenine dinucleotide phosphate (NADP). Using terbium ion (Tb 3+ )-ciprofloxacin (CIP) complex as a fluorescent probe, in the buffer solution of pH=9.00, NADP can remarkably enhance the fluorescence intensity of the Tb 3+ -CIP complex at λ=545nm and the enhanced fluorescence intensity of Tb 3+ ion is in proportion to the concentration of NADP. Optimum conditions for the determination of NADP were also investigated. The dynamic range for the determination of NADP is 4.9x10 -7 -3.7x10 -6 molL -1 with detection limit of 1.3x10 -7 molL -1 . This method is simple, practical and relatively free interference from coexisting substances and can be successfully applied to determination of NADP in synthetic water samples. Moreover, the enhancement mechanisms of the fluorescence intensity in the Tb 3+ -CIP system and the Tb 3+ -CIP-NADP system have been also discussed
International Nuclear Information System (INIS)
Meadows, J.W.; Smith, D.L.; Ikeda, Y.; Konno, C.
1990-01-01
Identical sample packets, each containing samples of elemental copper, silver, europium, terbium, and hafnium, as well as titanium, iron and nickel as dosimeters, have been irradiated in three distinct accelerator neutron fields (at Argonne National Laboratory and Los Alamos National Laboratory in the U.S.A., and Japan Atomic Energy Research Institute, Tokai, Japan) as part of an interlaboratory research collaboration to search for the production of long-lived radionuclides for fusion waste disposal applications. This paper is a progress report on this project. To date, we have detected the following activities, and have obtained preliminary experimental cross section values for several of these: Ag-106m,108m,110m; Eu-150m,152g,154; Tb-158,160; and Hf-175,178m2,179m2,181. (author). 11 refs, 1 fig., 4 tabs
Bermuda Triangle: a subsystem of the 168/E interfacing scheme used by Group B at SLAC
International Nuclear Information System (INIS)
Oxoby, G.J.; Levinson, L.J.; Trang, Q.H.
1979-12-01
The Bermuda Triangle system is a method of interfacing several 168/E microprocessors to a central system for control of the processors and overlaying their memories. The system is a three-way interface with I/O ports to a large buffer memory, a PDP11 Unibus and a bus to the 168/E processors. Data may be transferred bidirectionally between any two ports. Two Bermuda Triangles are used, one for the program memory and one for the data memory. The program buffer memory stores the overlay programs for the 168/E, and the data buffer memory, the incoming raw data, the data portion of the overlays, and the outgoing processed events. This buffering is necessary since the memories of 168/E microprocessors are small compared to the main program and the amount of data being processed. The link to the computer facility is via a Unibus to IBM channel interface. A PDP11/04 controls the data flow. 7 figures, 4 tables
26 CFR 1.168(i)-4 - Changes in use.
2010-04-01
... property because the equipment was used by Z in its steam production plant for 8 months in 2004. If the... classification of the equipment under section 168(e) changes from 7-year property to 5-year property and the... equipment in its combustion turbine production plant for 4 months and then uses the equipment in its steam...
A Terbium Sensitized Luminescence Method for the Assay of Flubiprofen in Pharmaceutical Formulations
Directory of Open Access Journals (Sweden)
Salma M.Z. Al-Kindy
2014-12-01
Full Text Available A sensitive time-resolved luminescence method for the determination of flubiprofen (FLP in methanol and in aqueous solution is described. The method is based on the luminescence sensitization of terbium (Tb3+ by the formation of a ternary complex with FLP in the presence of 4,7 diphenyl 1,10 phenanthroline (DPP as co-ligand, and Tween-20 as surfactant. The signal for Tb-FLP-DPP was monitored at λex = 285 nm and λem = 552 nm. Optimum conditions for the formation of the complex in an aqueous system were TRIS buffer, pH 8.0, DPP (2.5Å~10−7 M, Tween-20 (0.30% and 4Å~10-5 mol L-1 of Tb3+ which allowed the determination of 20–1000 ng mL-1 of FLP with a limit of detection (LOD of 10 ng mL-1 . The relative standard deviations of the method ranged between 0.6 and 1.4% indicating excellent reproducibility of the method. The proposed method was successfully applied for the assays of FLP in pharmaceutical formulations and spiked tap water samples with average recoveries of 87% – 95%.
Energy Technology Data Exchange (ETDEWEB)
Liang, Jinfu, E-mail: liang.shi2007@163.com [School of Physics and Electronic Science, Guizhou Normal University, Guiyang 550001 (China); Chen, Weizhong, E-mail: wzchen@nju.edu.cn [The Key Laboratory of Modern Acoustics, Ministry of Education, Institution of Acoustics, Nanjing University, Nanjing 210093 (China); Wang, Xun; Yang, Jing; Chen, Zhan [The Key Laboratory of Modern Acoustics, Ministry of Education, Institution of Acoustics, Nanjing University, Nanjing 210093 (China)
2016-12-16
Highlights: • Time-resolved spectra of SBSL were obtained for Tb{sup 3+} ions emission lines. • Mass exchange between inside and outside of SL bubble was probed via Tb{sup 3+} ions lines. • The argon rectification hypothesis was tested by time-resolved spectra of SBSL. • The rate of mass exchange inside an SBSL bubble increases with increasing sound pressure. - Abstract: Spectra of single-bubble sonoluminescence (SBSL) were obtained for Tb{sup 3+} ions emission lines from bubbles in an aqueous solution of terbium chloride (TbCl{sub 3}). The spectra provide experimental evidence to prove that an air bubble driven by strong ultrasound will not eventually become a rectified pure argon bubble, which is not as predicted by the argon rectification hypothesis. The time-resolved spectra of SBSL show a mass exchange of material such as Tb{sup 3+} ions between the inside and outside of the bubble. With increasing sound pressure, the rate of mass exchange and the SBSL intensity increases.
Investigation of the 168Hf electron capture decay using fast radiochemical separation
International Nuclear Information System (INIS)
Trubert, D.; Hussonnois, M.; Brillard, L.; Barci, V.; Ardisson, G.; Szeglowski, Z.; Constantinescu, O.
1995-01-01
The (EC + β + ) decay of 168 Hf, produced by the 156 Gd ( 16 O,4n) reaction, has been studied, with high efficiency HPGe coaxial detectors, using on-line measurements carried out with the RACHEL setup, built to investigate the chemical properties of transactinide elements. Off-line measurements were also carried out using catcher collection technique. Energies and intensities of 119 γ-lines are reported among which only two were known in the earlier study of Chu and Reednick. The 168 Lu level scheme built on the basis of single and γ-γ coincidence measurements, allows the interpretation of more than 79 γ-transitions, between 38 excited states reported for the first time. (orig.)
Yin, Qiwei; Lu, Huadong; Su, Jing; Peng, Kunchi
2016-05-01
The thermal lens effect of terbium gallium garnet (TGG) crystal in a high power single-frequency laser severely limits the output power and the beam quality of the laser. By inserting a potassium dideuterium phosphate (DKDP) slice with negative thermo-optical coefficient into the laser resonator, the harmful influence of the thermal lens effect of the TGG crystal can be effectively mitigated. Using this method, the stable range of the laser is broadened, the bistability phenomenon of the laser during the process of changing the pump power is completely eliminated, the highest output power of an all-solid-state continuous-wave intracavity-frequency-doubling single-frequency laser at 532 nm is enhanced to 30.2 W, and the beam quality of the laser is significantly improved.
International Nuclear Information System (INIS)
Kononenko, L.I.; Bel'tyukova, S.V.; Meshkova, S.B.; Kravchenko, T.B.; Poluehktov, N.S.
1978-01-01
An investigation is made of the effect of different solvents on the ratio of the intensity of luminescence spectrum bands of terbium and dysprosium ions, corresponding and not corresponding to ''supersensitive'' transitions in complex compounds with acetoacetic ether. A dependence is established between these values and the dielectric constant of the solvent, and also parallels in their changes, which indicate the similar manifestation of the effect of solvents in both elements. A correlation is observed between ratios of the intensity of luminescence spectrum bands and values of forces of neodymium complex absorption band oscillators in different solvents
Ma, Mengjiao; Li, Congcong; Shu, Dengkun; Wang, Chaohua; Xi, Peng
2018-02-01
A photoluminescent terbium (Tb) complex involving a novel benzoic-acid compound with a unique coordinated structure, namely 1,4-bis(carbonylmethyl)terephthalate (BCMT), has been designed and synthesized. The new coordinate structure and energy-transfer mechanism between the ligand and Tb(III) ions were investigated in detail. The results demonstrated that the BCMT-Tb(III) complex shows strong fluorescence intensity (4 × 106 a.u.) and long fluorescence lifetime (1.302 ms), owing to the favorable degree of energy matching between the triplet excited level of the ligand and the resonant level of Tb(III) ions. Based on the analysis of three-dimensional luminescence spectra, the as-prepared Tb(III) complex can be effectively excited in the range of 250-310 nm, and it shows high color purity, with a bright green appearance.
Ocular Toxicity Profile of ST-162 and ST-168 as Novel Bifunctional MEK/PI3K Inhibitors.
Smith, Andrew; Pawar, Mercy; Van Dort, Marcian E; Galbán, Stefanie; Welton, Amanda R; Thurber, Greg M; Ross, Brian D; Besirli, Cagri G
2018-04-30
ST-162 and ST-168 are small-molecule bifunctional inhibitors of MEK and PI3K signaling pathways that are being developed as novel antitumor agents. Previous small-molecule and biologic MEK inhibitors demonstrated ocular toxicity events that were dose limiting in clinical studies. We evaluated in vitro and in vivo ocular toxicity profiles of ST-162 and ST-168. Photoreceptor cell line 661W and adult retinal pigment epithelium cell line ARPE-19 were treated with increasing concentrations of bifunctional inhibitors. Western blots, cell viability, and caspase activity assays were performed to evaluate MEK and PI3K inhibition and dose-dependent in vitro toxicity, and compared with monotherapy. In vivo toxicity profile was assessed by intravitreal injection of ST-162 and ST-168 in Dutch-Belted rabbits, followed by ocular examination and histological analysis of enucleated eyes. Retinal cell lines treated with ST-162 or ST-168 exhibited dose-dependent inhibition of MEK and PI3K signaling. Compared with inhibition by monotherapies and their combinations, bifunctional inhibitors demonstrated reduced cell death and caspase activity. In vivo, both bifunctional inhibitors exhibited a more favorable toxicity profile when compared with MEK inhibitor PD0325901. Novel MEK and PI3K bifunctional inhibitors ST-162 and ST-168 demonstrate favorable in vitro and in vivo ocular toxicity profiles, supporting their further development as potential therapeutic agents targeting multiple aggressive tumors.
The sdg interacting-boson model applied to 168Er
Yoshinaga, N.; Akiyama, Y.; Arima, A.
1986-03-01
The sdg interacting-boson model is applied to 168Er. Energy levels and E2 transitions are calculated. This model is shown to solve the problem of anharmonicity regarding the excitation energy of the first Kπ=4+ band relative to that of the first Kπ=2+ one. The level scheme including the Kπ=3+ band is well reproduced and the calculated B(E2)'s are consistent with the experimental data.
Schlichting, Wolfgang; Stevens, Kevin; Foundos, Greg; Payne, Alexis
2017-10-01
Many scientific lasers and increasingly industrial laser systems operate in manufacture. However, for high-power laser applications TGG is limited by its absorption at 1064nm and its thermo-optic coefficient, dn/dT. Specifically, thermal lensing and depolarization effects become a limiting factor at high laser powers. While TGG absorption has improved significantly over the past few years, there is an intrinsic limit. Now, SYNOPTICS is commercializing the enhanced new crystal Potassium Terbium Fluoride KTF (KTb3F10) that exhibits much smaller nonlinear refractive index and thermo-optic coefficients, and still exhibits a Verdet constant near that of TGG. This cubic crystal has relatively low absorption and thermo-optic coefficients. It is now fully characterized and available for select production orders. At OPTIFAB in October 2017 we present recent results comparing the performance of KTF to TGG in optical isolators and show SYNOPTICS advances in large volume crystal growth and the production ramp up.
Identification of excited states in 167Os and 168Os: shape coexistence at extreme neutron deficiency
International Nuclear Information System (INIS)
Joss, D.T.; King, S.L.; Page, R.D.; Simpson, J.; Keenan, A.; Amzal, N.; Baeck, T.; Bentley, M.A.; Cederwall, B.; Cocks, J.F.C.; Cullen, D.M.; Greenlees, P.T.; Helariutta, K.; Jones, P.M.; Julin, R.; Juutinen, S.; Kankaanpaeae, H.; Kettunen, H.; Kuusiniemi, P.; Leino, M.; Muikku, M.; Savelius, A.; Uusitalo, J.; Williams, S.J.
2001-01-01
Excited states in the very neutron-deficient isotopes 167 Os and 168 Os have been observed using the reaction 112 Sn( 58 Ni, 2pxn). The JUROSPHERE γ-ray spectrometer array was used in conjunction with the RITU gas-filled recoil separator to collect prompt γ radiation in coincidence with recoils implanted in a silicon strip detector located at the focal plane of RITU. Using a selective recoil decay tagging technique it has been possible to unambiguously assign γ-ray transitions to 167 Os and 168 Os through the characteristic α radioactivity of these nuclides. The high-spin structure of the bands is discussed in terms of quasiparticle configurations within the framework of the cranked shell model. The role of shape coexistence in 168 Os is examined with phenomenological three-band mixing calculations
BEPS redesign of 168 commercial buildings: summary report
Energy Technology Data Exchange (ETDEWEB)
Stoops, J.L.; Deringer, J.J.; Moreno, S.; Misuriello, H.P.
1984-05-01
The objective of this report is to present, in usable form, summary data from the Building Energy Performance Standards (BEPS) Phase II commercial buildings energy research conducted in 1978-1979. Summary data presented were obtained from two major research efforts: the BEPS Phase II Redesign experiment; and the related research on ASHRAE Standard 90-75R. The bulk of this report consists of data tabulations of key energy parameters for the 168 sample buildings, which were tabulated from computer-stored files of the 1978-1979 data. Two kinds of tabulations are included: numerical tabulations that extracted information from the computer-stored data base for the 168 sample buildings; and graphic presentations of the computer-generated data, plus data extracted from other sources. The intent is to provide a single data compendium of key energy-related factors from the 1978 redesign experiment and the associated 1978-1979 ASHRAE Standard 90-75R research. This report also supplements the information for which there was not space in the magazine articles. Thus, for some building types, additional analysis, comments, and data tabulations are included that could not be included in the articles because space was limited. These additional analysis items are not consistent across building types because both the energy conservation opportunities and the design strategies applied by the building designers varied considerably by building type. The chapters have been entered individually into EDB and ERA.
New levels in 168Er: Use of a Compton-suppressed Ge array with the (n,γ) reaction
International Nuclear Information System (INIS)
Gill, R.L.; Casten, R.F.; Phillips, W.R.; Varley, B.J.; Lister, C.J.; Durell, J.L.; Shannon, J.A.; Warner, D.D.
1996-01-01
For the first time an (n,γ) reaction has been extensively studied using a large array of Compton-suppressed Ge detectors (the TESSA array). The nucleus 168 Er was studied and the data show substantial improvement, in both quantity and quality, over previous coincidence data. Even though 168 Er is perhaps the best studied deformed nucleus, over 250 new coincidence relations and a number of new levels in 168 Er were disclosed, demonstrating the usefulness of this approach. Nuclear physics applications relate to the extension of nearly complete spectroscopy to higher excitation energies and to the study of statistical and chaotic features of the decay of low spin compound nuclear levels. copyright 1996 The American Physical Society
26 CFR 1.168(k)-1 - Additional first year depreciation deduction.
2010-04-01
... 26 Internal Revenue 2 2010-04-01 2010-04-01 false Additional first year depreciation deduction. 1... Corporations § 1.168(k)-1 Additional first year depreciation deduction. (a) Scope and definitions—(1) Scope. This section provides the rules for determining the 30-percent additional first year depreciation...
Yamabayashi, Tsutomu; Katoh, Keiichi; Breedlove, Brian K; Yamashita, Masahiro
2017-06-15
Single-molecule magnet (SMM) properties of crystals of a terbium(III)-phthalocyaninato double-decker complex with different molecular packings ( 1 : TbPc₂, 2 : TbPc₂·CH₂Cl₂) were studied to elucidate the relationship between the molecular packing and SMM properties. From single crystal X-ray analyses, the high symmetry of the coordination environment of 2 suggested that the SMM properties were improved. Furthermore, the shorter intermolecular Tb-Tb distance and relative collinear alignment of the magnetic dipole in 2 indicated that the magnetic dipole-dipole interactions were stronger than those in 1 . This was confirmed by using direct current magnetic measurements. From alternating current magnetic measurements, the activation energy for spin reversal for 1 and 2 were similar. However, the relaxation time for 2 is three orders of magnitude slower than that for 1 in the low- T region due to effective suppression of the quantum tunneling of the magnetization. These results suggest that the SMM properties of TbPc₂ highly depend on the molecular packing.
2010-04-01
... 25 Indians 2 2010-04-01 2010-04-01 false Is it mandatory to go through the information phase before initiating the negotiation phase? 1000.168 Section 1000.168 Indians OFFICE OF THE ASSISTANT SECRETARY, INDIAN AFFAIRS, DEPARTMENT OF THE INTERIOR ANNUAL FUNDING AGREEMENTS UNDER THE TRIBAL SELF-GOVERNMENT ACT AMENDMENTS TO THE INDIAN...
2013-08-16
... DEPARTMENT OF LABOR Employee Benefits Security Administration 168th Meeting of the Advisory Council on Employee Welfare and Pension Benefit Plans; Notice of Teleconference Meeting Pursuant to the.... 1142, the 168th open meeting of the Advisory Council on Employee Welfare and Pension Benefit Plans...
International Nuclear Information System (INIS)
Nakada, Shinichiro
2016-01-01
The E3 ubiquitin ligases ring finger protein (RNF) 8 and RNF168 transduce the DNA double-strand break (DSB) response (DDR) signal by ubiquitinating DSB sites. The depletion of RNF8 or RNF168 suppresses the accumulation of DNA-repair regulating factors such as 53BP1 and RAP80 at DSB sites, suggesting roles for RNF8- and RNF168-mediated ubiquitination in DSB repair. This mini-review provides a brief overview of the RNF8- and RNF168-dependent DDR-signaling and DNA-repair pathways. The choice of DNA-repair pathway when RNF8- and RNF168-mediated ubiquitination-dependent DDR signaling is negatively regulated by deubiquitinating enzymes (DUBs) is reviewed to clarify how the opposing roles of RNF8/RNF168 and DUBs regulate ubiquitination-dependent DDR signaling and the choice of DNA-repair pathway
Jeong, Seon-Ju; Park, Ji Yeong; Lee, Jae Yong; Lee, Kang Wook; Cho, Kye Man; Kim, Gyoung Min; Shin, Jung-Hye; Kim, Jong-Sang; Kim, Jeong Hwan
2015-11-01
Fibrinolytic enzyme genes (aprE2, aprE176, and aprE179) were introduced into the Bacillus subtilis 168 chromosome without any antibiotic resistance gene. An integration vector, pDG1662, was used to deliver the genes into the amyE site of B. subtilis 168. Integrants, SJ3-5nc, SJ176nc, and SJ179nc, were obtained after two successive homologous recombinations. The integration of each fibrinolytic gene into the middle of the amyE site was confirmed by phenotypes (Amy(-), Spec(S)) and colony PCR results for these strains. The fibrinolytic activities of the integrants were higher than that of B. subtilis 168 by at least 3.2-fold when grown in LB broth. Cheonggukjang was prepared by inoculating each of B. subtilis 168, SJ3-5nc, SJ176nc, and SJ179nc, and the fibrinolytic activity of cheonggukjang was 4.6 ± 0.7, 10.8 ± 0.9, 7.0 ± 0.6, and 8.0 ± 0.2 (U/g of cheonggukjang), respectively at 72 h. These results showed that construction of B. subtilis strains with enhanced fibrinolytic activities is possible by integration of a strong fibrinolytic gene via a marker-free manner.
International Nuclear Information System (INIS)
Furtado, L.M.L.
1991-01-01
It was investigated a series of pigments of general composition Ce 1-x Pr x O 2 , and Ce x Tb y O 2 , exhibiting radish and brown colors, respectively, and high temperature stability. The pigments were obtained by dissolving appropriate amounts of the pure lanthanide oxides in acids and precipitating the rare earths as mixed oxalates, which were isolated and calcined under air, at 1000 0 C. X-Ray powder diffractograms were consistent with a cubic structure for the pigments. Magnetic susceptibility measurements, using Gouy method, indicated the presence of Pr(IV) ions in the Ce 1-x Pr x O 2 pigments and of Terbium predominantly as Tb(III) ions in the Ce-tb mixed oxides. A new method, based on suspension of solid samples in PVA-STB gels (STB = sodium tetradecaborate), was employed for the measurements of the electronic spectra of the pigments. The thermal behaviour the pigments was investigated by the calcination of the oxalates in the temperature range of 500 to 1200 O C, from 10 to 60 minutes. (author)
High-spin spectroscopy of {sup 168}Yb and the reduction of pairing correlations
Energy Technology Data Exchange (ETDEWEB)
Oliveira, J R.B. [Sao Paulo Univ., SP (Brazil); Stephens, F S; Deleplanque, M A; Diamond, R M [Lawrence Berkeley Lab., CA (United States); Draper, J E; Rubel, E; Duyar, C [California Univ., Davis, CA (United States); Beacker, J A; Henry, E A; Roy, N [Lawrence Livermore National Lab., CA (United States); Beausang, C W [Liverpool Univ. (United Kingdom); Frauendorf, S [Institut fur Kern und Hadronen Physik, F2-Rossendorf, Dresden (Germany)
1992-08-01
The high spin states of {sup 168}Yb were investigated by means of in-beam gamma spectroscopy with the High Energy Resolution Array at the 88 in. cyclotron of the Lawrence Berkeley Laboratory. The {sup 168}Yb nucleus was produced in the reaction {sup 48}Ca({sup 124}Sn,4n) at 210 MeV. Five bands previously reported were confirmed; additionally, four other bands, two extending to spins as high as 36 {Dirac_h} were observed. Cranked shell models suggest that one of the new bands can be interpreted as the continuation of the ground state band (above the AB crossing frequency) crossing into the four-quasiparticle band ABCD at about 0.38 MeV. Both relative alignment and Routhians are in good agreement with the experimental values. However, these calculations were done at constant pairing strength, which is not expected to be good at high rotational frequencies where one or more crossings have occurred in each band. Particle-hole calculations (with no pairing) were done for {sup 168}Yb as well as for other N {approx_equal} 98 nuclei for which good experimental data are available. In most cases, it is possible to associate a particle-hole configuration for each band observed at very high rotational frequencies, and the overall description is good. At frequencies below the first crossing, a full pairing calculation is necessary to describe the bands properly. At intermediate frequencies, the pairing strength is believed to be intermediate. 3 figs.
Impact of UK NICE clinical guidelines 168 on referrals to a specialist academic leg ulcer service.
Davies, Huw Ob; Popplewell, Matthew; Bate, Gareth; Kelly, Lisa; Darvall, Katy; Bradbury, Andrew W
2018-03-01
Background Leg ulcers are a common cause of morbidity and disability and result in significant health and social care expenditure. The UK National Institute for Health and Care Excellence (NICE) Clinical Guideline (CG)168, published in July 2013, sought to improve care of patients with leg ulcers, recommending that patients with a break in the skin below the knee that had not healed within two weeks be referred to a specialist vascular service for diagnosis and management. Aim Determine the impact of CG168 on referrals to a leg ulcer service. Methods Patients referred with leg ulceration during an 18-month period prior to CG168 (January 2012-June 2013) and an 18-month period commencing six months after (January 2014-June 2015) publication of CG168 were compared. Results There was a two-fold increase in referrals (181 patients, 220 legs vs. 385 patients, 453 legs) but no change in mean age, gender or median-duration of ulcer at referral (16.6 vs. 16.2 weeks). Mean-time from referral to specialist appointment increased (4.8 vs. 6 weeks, p = 0.0001), as did legs with superficial venous insufficiency (SVI) (36% vs. 44%, p = 0.05). There was a trend towards more SVI endovenous interventions (32% vs. 39%, p = 0.271) with an increase in endothermal (2 vs. 32 legs, p = 0.001) but no change in sclerotherapy (24 vs. 51 legs) treatments. In both groups, 62% legs had compression. There was a reduction in legs treated conservatively with simple dressings (26% vs. 15%, p = 0.0006). Conclusions Since CG168, there has been a considerable increase in leg ulcer referrals. However, patients are still not referred until ulceration has been present for many months. Although many ulcers are multi-factorial and the mainstay of treatment remains compression, there has been an increase in SVI endovenous intervention. Further efforts are required to persuade community practitioners to refer patients earlier, to educate patients and encourage further investment in
26 CFR 5c.168(f)(8)-7 - Reporting of income, deductions and investment tax credit; at risk rules.
2010-04-01
... tax credit; at risk rules. 5c.168(f)(8)-7 Section 5c.168(f)(8)-7 Internal Revenue INTERNAL REVENUE... investment tax credit; at risk rules. (a) In general. The fact that the lessor's payments of interest and... property shall be limited to the extent the at risk rules under the investment tax credit provisions and...
International Nuclear Information System (INIS)
Caires, A.C.F.
1985-01-01
A study for determination of samarium, europium, terbium, dysprosium and yttrium in a gadolinium oxide matrix by atomic absorption spectrophotometry using a graphite furnace is presented. The best charrring and atomization conditions were estabilished for each element, the most convenient ressonance lines being selected as well. The study was carried out for the mentioned lanthanides both when pure and when in binary mixtures with gadolinium, besides those where all for them were together with gadolinium. The determination limits for pure lanthanides were found to be between 1.3 and 9.6 ng assuming a 20% relative standard deviation as acceptable. The detection limits were in the range 0.51 and 7.5 ng, assuming as positive any answer higher than twofold the standard deviation. (author) [pt
Chen, Fuchao; Fang, Baoxia; Li, Peng; Zhu, Xuesong; Zhou, Benhong
2014-08-01
This study was to investigate the physical and chemical compatibility of butorphanol with tramadol or fentanyl in 0.9% sodium chloride injections for patient controlled analgesia administration. The solutions were prepared in polyvinyl chloride (PVC) infusion bags and stored without protected from light exposure at room temperature (25 degrees C) or refrigerated (4 degrees C). Over a period of 168 hours, stabilities were determined by visual inspection, pH measurement, and high-pressure liquid chromatography (HPLC) assay of drug concentrations. At both temperatures, admixtures of butorphanol-tramadol and butorphanol-fentanyl were clear in appearance, and no color change or precipitation was observed during the study period. The maximum losses obtained were lower than 5% for the three drugs after 168 hours of storage. The results indicate that, at ambient or refrigerated storage conditions, the drug mixtures of butorphanol-tramadol and butorphanol-fentanyl in 0.9% sodium chloride injections were physically and chemically stable for at least 168 hours when stored in PVC syringes.
Sparkle/PM3 for the modeling of europium(III), gadolinium(III), and terbium(III) complexes
International Nuclear Information System (INIS)
Freire, Ricardo O.; Rocha, Gerd B.; Simas, Alfredo M.
2009-01-01
The Sparkle/PM3 model is extended to europium(III), gadolinium(III), and terbium(III) complexes. The validation procedure was carried out using only high quality crystallographic structures, for a total of ninety-six Eu(III) complexes, seventy Gd(III) complexes, and forty-two Tb(III) complexes. The Sparkle/PM3 unsigned mean error, for all interatomic distances between the trivalent lanthanide ion and the ligand atoms of the first sphere of coordination, is: 0.080 A for Eu(III); 0.063 A for Gd(III); and 0.070 A for Tb(III). These figures are similar to the Sparkle/AM1 ones of 0.082 A, 0.061 A, and 0.068 A respectively, indicating they are all comparable parameterizations. Moreover, their accuracy is similar to what can be obtained by present-day ab initio effective core potential full geometry optimization calculations on such lanthanide complexes. Finally, we report a preliminary attempt to show that Sparkle/PM3 geometry predictions are reliable. For one of the Eu(III) complexes, BAFZEO, we created hundreds of different input geometries by randomly varying the distances and angles of the ligands to the central Eu(III) ion, which were all subsequently fully optimized. A significant trend was unveiled, indicating that more accurate local minima geometries cluster at lower total energies, thus reinforcing the validity of sparkle model calculations. (author)
International Nuclear Information System (INIS)
Lisiecki, Radosław
2013-01-01
The KGd 2 F 7 :Tb and KGd 2 F 7 :Tb,Eu samples were obtained using a solid state reaction. Excitation spectra and emission spectra are reported and analyzed within the VUV–UV–vis spectral range. The intense green luminescence is observed in the KGd 2 F 7 :Tb while the combined emission of terbium and europium in the KGd 2 F 7 :Tb,Eu covers substantially the region of white light. The materials under study can be effectively excited making use of intense f–d transitions of Tb 3+ in the VUV–UV region. Experimental lifetimes of luminescent levels have been measured and discussed. It was found that the considerable energy transfer from Tb 3+ to Eu 3+ occurs. -- Highlights: • The prospective green and white emitting phosphors. • The effective VUV and UV–vis excitation process. • The considerable energy transfer among optically active ions. • The influence of (Tb, Eu) co-doping on relaxation dynamic of excited states
Moulin, Jean-Claude; Silvano, Jérémy; Barban, Véronique; Riou, Patrice; Allain, Caroline
2013-07-01
The neurovirulence of two new candidate 17D-204 Stamaril™ working seed lots and that of two reference preparations were compared. The Stamaril™ working seed lots have been used for more than twenty years for the manufacturing of vaccines of acceptable safety and efficacy. The preparation designated RK 168-73 and provided by the Robert Koch Institute was used as a reference. It was confirmed that RK 168-73 strain was not a good virus control in our study because it has a very low neurovirulence regarding both the clinical and histopathological scores in comparison with Stamaril™ strain and is not representative of a vaccine known to be satisfactory in use. The results were reinforced by the phenotypic characterization by plaque assay demonstrating that RK 168-73 was very different from the Stamaril™ vaccine, and by sequencing results showing 4 mutations between Stamaril™ and RK 168-73 viruses leading to amino acid differences in the NS4B and envelop proteins. Copyright © 2013 The International Alliance for Biological Standardization. Published by Elsevier Ltd. All rights reserved.
Directory of Open Access Journals (Sweden)
Samah Al-Qaisi
Full Text Available First-principles investigations of the Terbium oxide TbO are performed on structural, elastic, mechanical and thermodynamic properties. The investigations are accomplished by employing full potential augmented plane wave FP-LAPW method framed within density functional theory DFT as implemented in the WIEN2k package. The exchange-correlation energy functional, a part of the total energy functional, is treated through Perdew Burke Ernzerhof scheme of the Generalized Gradient Approximation PBEGGA. The calculations of the ground state structural parameters, like lattice constants a0, bulk moduli B and their pressure derivative B′ values, are done for the rock-salt RS, zinc-blende ZB, cesium chloride CsCl, wurtzite WZ and nickel arsenide NiAs polymorphs of the TbO compound. The elastic constants (C11, C12, C13, C33, and C44 and mechanical properties (Young’s modulus Y, Shear modulus S, Poisson’s ratio σ, Anisotropic ratio A and compressibility β, were also calculated to comprehend its potential for valuable applications. From our calculations, the RS phase of TbO compound was found strongest one mechanically amongst the studied cubic structures whereas from hexagonal phases, the NiAs type structure was found stronger than WZ phase of the TbO. To analyze the ductility of the different structures of the TbO, Pugh’s rule (B/SH and Cauchy pressure (C12–C44 approaches are used. It was found that ZB, CsCl and WZ type structures of the TbO were of ductile nature with the obvious dominance of the ionic bonding while RS and NiAs structures exhibited brittle nature with the covalent bonding dominance. Moreover, Debye temperature was calculated for both cubic and hexagonal structures of TbO in question by averaging the computed sound velocities. Keywords: DFT, TbO, Elastic properties, Thermodynamic properties
On-line use of the 168/E emulator at the CERN ISR SFM detector
International Nuclear Information System (INIS)
Bertuzzi, C.; Drijard, D.; Frehse, H.; Gavillet, P.; Gokieli, R.; Innocenti, P.G.; Messerli, R.; Mornacchi, G.; Norton, A.; Porte, J.P.
1981-01-01
The Split Field Magnet Detector at the CERN ISR has been used in recent years to study events with a high transverse momentum charged particle. As a first level computer based trigger a linear estimate of the track momentum by fixed point arithmethic was calculated on-line by a minicomputer. In addition appreciable further rejection was obtained by off-line filtering on the IBM-370/168, using pattern recognition and a fit of the triggering particle in the magnetic field. The availability of the 168/E emulator makes it possible to transfer the proven methods used off-line to real time data reduction. Preliminary results on filter efficiency and speed for an experiment triggering on a high Psub(T) hadron at 10 to 20 0 with respect to the outgoing beam (Exp. R 419) are given. Possible improvements and extensions are discussed. (orig.)
International Nuclear Information System (INIS)
Hu, Yumei; Jia, Shiru; Ren, Feifei; Huang, Chun-Hsiang; Ko, Tzu-Ping; Mitchell, Douglas A.; Guo, Rey-Ting; Zheng, Yingying
2012-01-01
A bacteria biofilm formation involved enzyme, BsYisP, from Bacillus subtilis subsp. subtilis strain 168, was crystallized and diffracted to 1.92 Å. YisP is an enzyme involved in the pathway of biofilm formation in bacteria and is predicted to possess squalene synthase activity. A BlastP search using the YisP protein sequence from Bacillus subtilis subsp. subtilis strain 168 shows that it shares 23% identity with the dehydrosqualene synthase from Staphylococcus aureus. The YisP from B. subtilis 168 was expressed in Escherichia coli and the recombinant protein was purified and crystallized. The crystals, which belong to the orthorhombic space group P2 1 2 1 2 1 , with unit-cell parameters a = 43.966, b = 77.576, c = 91.378 Å, were obtained by the sitting-drop vapour-diffusion method and diffracted to 1.92 Å resolution. Structure determination using MAD and MIR methods is in progress
Zeng, Cheng-Hui; Yang, Yang-Yi; Zhu, Yi-Min; Wang, Hong-Ming; Chu, Tian-Shu; Ng, Seik Weng
2012-01-01
A new dinuclear terbium complex [Tb(2)(4-msal)(6)(H(2)O)(4)]·6H(2)O (1) (4-msal = 4-methylsalcylate) was synthesized. Its structure was determined by single crystal X-ray diffraction, and the complex was characterized by PXRD, FT-IR, fluorescence, TGA and DTA. Complex 1 exists as discrete molecules that are linked by extensive O-H … O hydrogen bonds into a 3D network. The luminescence lifetimes of 3 μM methanol solution and solid sample of 1 are 1.321 and 1.009 ms, respectively. The quantum yield of solid sample is 6.0%. The luminescence quenched more than 50% when 3% (vol/vol) different impurities (acetone, acetonitrile, chloroform, dichloromethane, dioxane, DMF, DMSO, ethanol, ether, ethyl acetate, glycol, H(2)O, hexane, TEA, THF and toluene or their mixture) were added. The inverse linear relationship between the Lg value of fluorescence intensity and the volume ratio of the minor component (to a maximum of 20%) is interpreted in terms of LgI = a-bX (I: luminescence intensity; X: volume ratio of impurities in methanol; a, b are constants). So 1 is a potential luminescent sensor for analyzing the purity of methanol. © 2012 Wiley Periodicals, Inc. Photochemistry and Photobiology © 2012 The American Society of Photobiology.
DEFF Research Database (Denmark)
Mosbech, Anna; Lukas, Claudia; Bekker-Jensen, Simon
2013-01-01
Protein recruitment to DNA double-strand breaks (DSBs) relies on ubiquitylation of the surrounding chromatin by the RING finger ubiquitin ligases RNF8 and RNF168. Flux through this pathway is opposed by several deubiquitylating enzymes (DUBs), including OTUB1 and USP3. By analyzing the effect...... of individually overexpressing the majority of human DUBs on RNF8/RNF168-mediated 53BP1 retention at DSB sites, we found that USP44 and USP29 powerfully inhibited this response at the level of RNF168 accrual. Both USP44 and USP29 promoted efficient deubiquitylation of histone H2A, but unlike USP44, USP29...... displayed non-specific reactivity towards ubiquitylated substrates. Moreover, USP44 but not other H2A DUBs was recruited to RNF168-generated ubiquitylation products at DSB sites. Individual depletion of these DUBs only mildly enhanced accumulation of ubiquitin conjugates and 53BP1 at DSBs, suggesting...
DEFF Research Database (Denmark)
Smeenk, G.; Wiegant, W.W.; Luijsterburg, M.S.
2013-01-01
Ionizing radiation (IR)-induced DNA double-strand breaks (DSBs) arising in native chromatin elicit an RNF8/RNF168-dependent ubiquitylation response, which triggers the recruitment of various repair factors. Precisely how this response is regulated in the context of chromatin remains largely...... unexplored. Here, we show that SMARCA5/SNF2H, the catalytic subunit of ISWI chromatin remodeling complexes, is recruited to DSBs in a poly(ADP-ribose) polymerase 1 (PARP1)-dependent manner. Remarkably, PARP activity, although dispensable for the efficient spreading of νH2AX into damaged chromatin......, selectively promotes spreading of SMARCA5, the E3 ubiquitin ligase RNF168, ubiquitin conjugates and the ubiquitin-binding factors RAD18 and the RAP80-BRCA1 complex throughout DSB-flanking chromatin. This suggests that PARP regulates the spatial organization of the RNF168-driven ubiquitin response to DNA...
Measurement on K-electron capture probabilities in the decay of [sup 183]Re and [sup 168]Tm
Energy Technology Data Exchange (ETDEWEB)
Prasad, N.V.S.V.; Rao, M.V.S.C.; Reddy, S.B.; Satyanarayana, G.; Sastry, D.L. (Andhra Univ., Visakhapatnam (India). Swami Jnanananda Labs. for Nuclear Research); Murty, G.S.K. (UNDNJ, Newark, NJ (United States). Dept. of Radiology); Chintalapudi, S.N. (Inter University Consortium for DAE Facilities, Calcutta (India))
1994-03-01
The K-electron capture probabilities for the 5/2[sup +] to 3/2[sup -]transition in the electron capture decay of [sup 183]Re to the 208.805 keV level in the daughter [sup 183]W and for the 3[sup (+)] to 3[sup -]and 3[sup (+)] to 4[sup -] transitions in the electron capture decay of [sup 168]Tm to the 1541.4 keV and 1093.0 keV levels, respectively, in the daughter [sup 168]Er were measured for the first time using an x-[gamma] summing method. The experimental P[sub K] values are reported in this paper, together with those due to theory, and discussed. (Author).
2010-07-01
... 40 Protection of Environment 23 2010-07-01 2010-07-01 false Advertising of unregistered pesticides... ENFORCEMENT POLICIES AND INTERPRETATIONS Advertising § 168.22 Advertising of unregistered pesticides.... EPA interprets these provisions as extending to advertisements in any advertising medium to which...
Directory of Open Access Journals (Sweden)
Naser Soltani
2016-03-01
Full Text Available Background: Analysis of biomolecules is required in many biomedical research areas. A spectrofluorimetric method is proposed for determination of calf thymus DNA (ctDNA based on the fluorescence enhancement of terbium-danofloxacin (Tb3+-Dano in the presence of ctDNA. Methods: A probe with maximum excitation and emission wavelengths of 347 nm and 545 nm, respectively, was developed. The enhanced fluorescence intensity of Tb3+-Dano system was proportional to the concentration of ctDNA. The effective factors and the optimum conditions for the determination of ctDNA were studied. Under the optimum conditions of [Tris buffer]= 0.01 mol L-1 (pH 7.8, [ Tb3+]= 1×10-5 mol L-1 and [Dano]= 5×10-5 mol L-1, the maximum response was achieved. The developed method was evaluated in terms of accuracy, precision and limit of detection. Results: The linear concentration range for quantification of ctDNA was 36-3289 ng mL-1 and the detection limit (S/N=3 was 8 ng mL-1. The concentration of DNA extracted from Escherichia coli as an extracted sample was also determined using the developed probe. The concentration of DNA in extracted sample was determined using UV assay and developed method, the results were satisfactory. Conclusion: The proposed method is a simple, practical and relatively interference free method to follow up the concentrations of ctDNA.
Energy Technology Data Exchange (ETDEWEB)
Wang, Yafei; Zhou, Wentao; Zhang, Jinsuo, E-mail: zhang.3558@osu.edu
2016-09-15
Thermodynamic properties of rare earth metals in LiCl-KCl molten salt electrolyte are crucial to the development of electrochemical separation for the treatment of used nuclear fuels. In the present study, activity coefficient, apparent potential, and diffusion coefficient of lanthanum, yttrium, scandium, and terbium in the molten salt (58 at% LiCl and 42 at% KCl) were calculated by the method of molecular dynamics simulation up to a concentration around 3 at% at temperatures of 723 K and 773 K. It was found that the activity coefficient and the apparent potential increase with the species concentration while diffusion coefficient shows a trend of increase followed by decrease. The calculated results were validated by available measurement data of dilution cases. This research extends the range of data to a wide component and would provide further insight to the pyroprocessing design and safeguards. - Highlights: • Investigation of activity coefficient, apparent potential and diffusion coefficient at different concentrations. • MD simulation was studied for the calculation of thermodynamic properties of rare earth elements in molten salt. • The present study is a pioneering work focusing on the concentration dependence of thermodynamic properties.
Lifetime measurement in {sup 168}Yb using the recoil distance Doppler shift (RDDS) method
Energy Technology Data Exchange (ETDEWEB)
Reese, Michael; Moeller, Oliver; Pietralla, Norbert [TU Darmstadt (Germany); Dewald, Alfred; Pissulla, Thomas [Universitaet Koeln (Germany); Petkov, Pavel [Universitaet Koeln (Germany); INRNE, Bulgarian Academy of Sciences, Sofia (Bulgaria)
2009-07-01
In the analysis of coincidence RDDS experiments one uses the Differential Decay Curve (DDC) Method to determine lifetimes of excited states. Experiments with small recoil velocities, thus small Doppler shifts, enforce the use of narrow coincidence gates to determine peak intensities. This results in a loss of statistics. As an alternative to the application of gates, we present the fit of 2-dimensional functions to the {gamma}{gamma} coincidence data. This approach has been studied on data taken in a RDDS measurement for the ground state band of {sup 168}Yb. The {sup 18}O({sup 154}Sm,4n){sup 168}Yb{sup *} fusion evaporation reaction was induced by an 80 MeV ion beam of the tandem accelerator facility in Cologne. The target was mounted in the Cologne coincidence plunger device. Lifetimes from the 4{sub 1}{sup +} to the 10{sub 1}{sup +} states have been extracted. The method is discussed and the results are compared to the CBS rotor model in the context of centrifugal stretching.
Energy Technology Data Exchange (ETDEWEB)
Hosseini, Morteza, E-mail: smhosseini@khayam.ut.ac.ir [Department of Chemistry, Islamic Azad University, Savadkooh Branch, Savadkooh (Iran, Islamic Republic of); Ganjali, Mohammad Reza [Center of Excellence in Electrochemistry, Faculty of Chemistry, University of Tehran, Tehran (Iran, Islamic Republic of); Endocrinology and Metabolism Research Center, Tehran University of Medical Sciences, Tehran (Iran, Islamic Republic of); Veismohammadi, Bahareh [Center of Excellence in Electrochemistry, Faculty of Chemistry, University of Tehran, Tehran (Iran, Islamic Republic of); Faridbod, Farnoush [Endocrinology and Metabolism Research Center, Tehran University of Medical Sciences, Tehran (Iran, Islamic Republic of); Abkenar, Shiva Dehghan [Department of Chemistry, Islamic Azad University, Savadkooh Branch, Savadkooh (Iran, Islamic Republic of); Norouzi, Parviz [Endocrinology and Metabolism Research Center, Tehran University of Medical Sciences, Tehran (Iran, Islamic Republic of); Center of Excellence in Electrochemistry, Faculty of Chemistry, University of Tehran, Tehran (Iran, Islamic Republic of)
2010-04-07
For the first time a highly sensitive and selective fluorimetric optode membrane was prepared for determination of trace amounts of Tb(III) ions in phosphate rock samples. The Tb(III) sensing system was constructed by incorporating 5-(dimethylamino)-N'-(2-hydroxy-1-naphthoyl) naphthalene-1-sulfonohydrazine (L) as a neutral Tb(III)-selective fluoroionophore, in the plasticized PVC membrane containing sodium tetraphenyl borate as a liphophilic anionic additive. The response of the optode is based on the strong fluorescence quenching of L by Tb{sup 3+} ions. At a pH value of 5.0, the optode displays a wide concentration range of 1.0 x 10{sup -7} to 1.0 x 10{sup -2} M, with a relatively fast response time of less than 45 s. In addition, to high stability and reproducibility, the sensor shows a unique selectivity towards Tb{sup 3+} ion with respect to common cations. The optode was applied successfully to the trace determination of terbium ion in binary mixture and water samples and the determination of Tb{sup 3+} in phosphate rock samples.
Directory of Open Access Journals (Sweden)
Niko Hildebrandt
2011-10-01
Full Text Available Förster resonance energy transfer (FRET from luminescent terbium complexes (LTC as donors to semiconductor quantum dots (QDs as acceptors allows extraordinary large FRET efficiencies due to the long Förster distances afforded. Moreover, time-gated detection permits an efficient suppression of autofluorescent background leading to sub-picomolar detection limits even within multiplexed detection formats. These characteristics make FRET-systems with LTC and QDs excellent candidates for clinical diagnostics. So far, such proofs of principle for highly sensitive multiplexed biosensing have only been performed under optimized buffer conditions and interactions between real-life clinical media such as human serum or plasma and LTC-QD-FRET-systems have not yet been taken into account. Here we present an extensive spectroscopic analysis of absorption, excitation and emission spectra along with the luminescence decay times of both the single components as well as the assembled FRET-systems in TRIS-buffer, TRIS-buffer with 2% bovine serum albumin, and fresh human plasma. Moreover, we evaluated homogeneous LTC-QD FRET assays in QD conjugates assembled with either the well-known, specific biotin-streptavidin biological interaction or, alternatively, the metal-affinity coordination of histidine to zinc. In the case of conjugates assembled with biotin-streptavidin no significant interference with the optical and binding properties occurs whereas the histidine-zinc system appears to be affected by human plasma.
Rotational bands in the nuclear sup(168)Er and some remarks on their interpretation
International Nuclear Information System (INIS)
Davidson, W.F.; Dixon, W.R.; Storey, R.S.
1984-01-01
Further analysis of previously published data on sup(168)Er, together with results of new measurements of selected portions of the neutron capture γ-ray spectrum, has resulted in the construction of an improved level spectrum for this nucleus. Altogether 127 excited levels have now been established and grouped into 36 rotational bands. Some remarks on their interpretation are advanced
About octupole states in the 158Dy and the 168Er nuclei
International Nuclear Information System (INIS)
Kvasil, Ya.; Chariev, M.M.; Choriev, B.
1984-01-01
The properties of negative parity low-lying states in 158 Dy and 168 Er in the random phase approximation based on the cranking model are investigated. Octupole-octupole forces have been used as a residual interaction. Calculated energy levels are compared with the experimental ones, and also with the energy values obtained with making allowance for dipole-dipole, octupole-octupole and dipole-octupole type forces. The resuits of calculation by the used model permit to understand the nature of negative parity low-lying states
Hosseini, Morteza; Ganjali, Mohammad Reza; Veismohammadi, Bahareh; Faridbod, Farnoush; Abkenar, Shiva Dehghan; Norouzi, Parviz
2010-04-07
For the first time a highly sensitive and selective fluorimetric optode membrane was prepared for determination of trace amounts of Tb(III) ions in phosphate rock samples. The Tb(III) sensing system was constructed by incorporating 5-(dimethylamino)-N'-(2-hydroxy-1-naphthoyl) naphthalene-1-sulfonohydrazine (L) as a neutral Tb(III)-selective fluoroionophore, in the plasticized PVC membrane containing sodium tetraphenyl borate as a liphophilic anionic additive. The response of the optode is based on the strong fluorescence quenching of L by Tb(3+) ions. At a pH value of 5.0, the optode displays a wide concentration range of 1.0 x 10(-7) to 1.0 x 10(-2)M, with a relatively fast response time of less than 45 s. In addition, to high stability and reproducibility, the sensor shows a unique selectivity towards Tb(3+) ion with respect to common cations. The optode was applied successfully to the trace determination of terbium ion in binary mixture and water samples and the determination of Tb(3+) in phosphate rock samples. Crown Copyright 2010. Published by Elsevier B.V. All rights reserved.
International Nuclear Information System (INIS)
Semenov, V.V.; Cherepennikova, N.F.; Kuznetsova, O.V.; Melenskova, N.V.; Bushuk, B.A.; Bushuk, S.B.; Kal'vinkovskaya, Yu.A.; Duglas, V.E.
2007-01-01
A reaction of 3-aminopropyl(triethoxy)silane with acetylacetone gave a mixture of two isomeric carbon-functionalized organosilicon compounds capable of complexation and sol-gel polymerization. These were 4-(3'-triethoxysilylpropylimino)pent-2-en-2-ol (EtO) 3 Si-CH 2 CH 2 CH 2 -N=C(Me)CH=C(Me)OH (Ia, 83%) and 4-(3'-triethoxysilylpropylamino)pent-3-en-2-one (EtO) 3 Si-CH 2 CH 2 CH 2 -NH-C(Me)=CH-C(O)Me (Ib, 17%). With acetylacetone trimethylsilyl ether instead of acetylacetone itself, compound Ia and silylated derivatives (Me 3 SiO) n (EtO) 3-n Si-CH 2 CH 2 CH 2 -N=C(Me)CH=C(Me)OH were obtained as admixture in 84 and 16% yields, respectively. Reactions of ligands Ia and Ib with europium and terbium propan-2-olates afforded the corresponding complexes. Formulations of lanthanide complexes, oligodimethylsiloxanediols, and 3-aminopropyl(triethoxy)silane were used to prepare transparent sol-gel films. The photoluminescence spectra of the films show narrow bands due to Eu 3+ or Tb 3+ emission. Emission from the organosilicon matrix appears as a broad band at 430 to 435 nm [ru
International Nuclear Information System (INIS)
Takahashi, Ryouta; Ishiguro, Shin-ichi
1991-01-01
The formation of chloro, bromo and iodo complexes of yttrium(III), and bromo and iodo complexes of lanthanum(III), neodymium(III), terbium(III) and thulium(III) has been studied by precise titration calorimetry in N,N-dimethylformamide (DMF) at 25 o C. The formation of [YCl] 2+ , [YCl 2 ] + , [YCl 3 ] and [YCl 4 ] - , and [MBr] 2+ and [MBr 2 ] + (M = Y, La, Nd, Tb, Tm) was revealed, and their formation constants, enthalpies and entropies were determined. It is found that the formation enthalpies change in the sequence ΔH o (Cl) > ΔH o (l), which is unusual for hard metal (III) ions. This implies that, unlike the chloride ion, the bromide ion forms outer-sphere complexes with the lanthanide(III) and yttrium(III) ions in DMF. Evidence for either an inner- or outer-sphere complex was obtained from 89 Y NMR spectra for Y(ClO 4 ) 3 , YCl 3 and YBr 3 DMF solutions at room temperature. (author)
26 CFR 1.168(i)-0 - Table of contents for the general asset account rules.
2010-04-01
... 26 Internal Revenue 2 2010-04-01 2010-04-01 false Table of contents for the general asset account... and Corporations § 1.168(i)-0 Table of contents for the general asset account rules. This section...) Irrevocable election. (2) Time for making election. (3) Manner of making election. (l) Effective date. (1) In...
Bekker, Pirow; Dairaghi, Daniel; Seitz, Lisa; Leleti, Manmohan; Wang, Yu; Ertl, Linda; Baumgart, Trageen; Shugarts, Sarah; Lohr, Lisa; Dang, Ton; Miao, Shichang; Zeng, Yibin; Fan, Pingchen; Zhang, Penglie; Johnson, Daniel; Powers, Jay; Jaen, Juan; Charo, Israel; Schall, Thomas J
2016-01-01
The complement 5a receptor has been an attractive therapeutic target for many autoimmune and inflammatory disorders. However, development of a selective and potent C5aR antagonist has been challenging. Here we describe the characterization of CCX168 (avacopan), an orally administered selective and potent C5aR inhibitor. CCX168 blocked the C5a binding, C5a-mediated migration, calcium mobilization, and CD11b upregulation in U937 cells as well as in freshly isolated human neutrophils. CCX168 retains high potency when present in human blood. A transgenic human C5aR knock-in mouse model allowed comparison of the in vitro and in vivo efficacy of the molecule. CCX168 effectively blocked migration in in vitro and ex vivo chemotaxis assays, and it blocked the C5a-mediated neutrophil vascular endothelial margination. CCX168 was effective in migration and neutrophil margination assays in cynomolgus monkeys. This thorough in vitro and preclinical characterization enabled progression of CCX168 into the clinic and testing of its safety, tolerability, pharmacokinetic, and pharmacodynamic profiles in a Phase 1 clinical trial in 48 healthy volunteers. CCX168 was shown to be well tolerated across a broad dose range (1 to 100 mg) and it showed dose-dependent pharmacokinetics. An oral dose of 30 mg CCX168 given twice daily blocked the C5a-induced upregulation of CD11b in circulating neutrophils by 94% or greater throughout the entire day, demonstrating essentially complete target coverage. This dose regimen is being tested in clinical trials in patients with anti-neutrophil cytoplasmic antibody-associated vasculitis. Trial Registration ISRCTN registry with trial ID ISRCTN13564773.
2010-04-01
... investment tax credit to a party other than the ultimate user of the property. [Reserved] 5c.168(f)(8)-9...) INCOME TAX (CONTINUED) TEMPORARY INCOME TAX REGULATIONS UNDER THE ECONOMIC RECOVERY TAX ACT OF 1981 § 5c.168(f)(8)-9 Pass-through leases—transfer of only the investment tax credit to a party other than the...
Omony, Jimmy; de Jong, Anne; Krawczyk, Antonina O; Eijlander, Robyn T; Kuipers, Oscar P
2018-02-09
Sporulation is a survival strategy, adapted by bacterial cells in response to harsh environmental adversities. The adaptation potential differs between strains and the variations may arise from differences in gene regulation. Gene networks are a valuable way of studying such regulation processes and establishing associations between genes. We reconstructed and compared sporulation gene co-expression networks (GCNs) of the model laboratory strain Bacillus subtilis 168 and the food-borne industrial isolate Bacillus amyloliquefaciens. Transcriptome data obtained from samples of six stages during the sporulation process were used for network inference. Subsequently, a gene set enrichment analysis was performed to compare the reconstructed GCNs of B. subtilis 168 and B. amyloliquefaciens with respect to biological functions, which showed the enriched modules with coherent functional groups associated with sporulation. On basis of the GCNs and time-evolution of differentially expressed genes, we could identify novel candidate genes strongly associated with sporulation in B. subtilis 168 and B. amyloliquefaciens. The GCNs offer a framework for exploring transcription factors, their targets, and co-expressed genes during sporulation. Furthermore, the methodology described here can conveniently be applied to other species or biological processes.
26 CFR 1.168A-6 - Depreciation of portion of emergency facility not subject to amortization.
2010-04-01
... 26 Internal Revenue 2 2010-04-01 2010-04-01 false Depreciation of portion of emergency facility... for Individuals and Corporations § 1.168A-6 Depreciation of portion of emergency facility not subject... in lieu of any deduction for depreciation which would otherwise be allowable under section 167 is...
Directory of Open Access Journals (Sweden)
Pirow Bekker
Full Text Available The complement 5a receptor has been an attractive therapeutic target for many autoimmune and inflammatory disorders. However, development of a selective and potent C5aR antagonist has been challenging. Here we describe the characterization of CCX168 (avacopan, an orally administered selective and potent C5aR inhibitor. CCX168 blocked the C5a binding, C5a-mediated migration, calcium mobilization, and CD11b upregulation in U937 cells as well as in freshly isolated human neutrophils. CCX168 retains high potency when present in human blood. A transgenic human C5aR knock-in mouse model allowed comparison of the in vitro and in vivo efficacy of the molecule. CCX168 effectively blocked migration in in vitro and ex vivo chemotaxis assays, and it blocked the C5a-mediated neutrophil vascular endothelial margination. CCX168 was effective in migration and neutrophil margination assays in cynomolgus monkeys. This thorough in vitro and preclinical characterization enabled progression of CCX168 into the clinic and testing of its safety, tolerability, pharmacokinetic, and pharmacodynamic profiles in a Phase 1 clinical trial in 48 healthy volunteers. CCX168 was shown to be well tolerated across a broad dose range (1 to 100 mg and it showed dose-dependent pharmacokinetics. An oral dose of 30 mg CCX168 given twice daily blocked the C5a-induced upregulation of CD11b in circulating neutrophils by 94% or greater throughout the entire day, demonstrating essentially complete target coverage. This dose regimen is being tested in clinical trials in patients with anti-neutrophil cytoplasmic antibody-associated vasculitis. Trial Registration ISRCTN registry with trial ID ISRCTN13564773.
Study of quantum dot based on tin/yttrium mixed oxide doped with terbium to be used as biomarker
International Nuclear Information System (INIS)
Paganini, Paula P.; Felinto, Maria Claudia F.C.; Kodaira, Claudia A.; Brito, Hermi F.; Nunes, Luiz Antonio O.
2009-01-01
Quantum dots (semiconductors nanocrystals) have brought a promising field to develop a new generation of luminescent biomarkers. The use of lanthanides ions as luminescent markers has many advantages, for example a security method, low cost, high specificity and also the luminescence can be promptly measured with high sensibility and accuracy. These luminescent dots are functionalized with biomolecules. For the luminophore particle to be connect with biologicals molecules (for example covalent antibody) is necessary a previous chemical treatment to modify luminophore particle surface and this process is called functionalization. A prior chemical treatment with changes on the surface luminophore particle is necessary to couple the luminophore to biological molecules. This process can be used as coating which can protect these particles from being dissolved by acid as well as provide functional groups for biological conjugation. This work presents a photoluminescence study of nanoparticles based on tin/yttrium mixed oxides doped with terbium (SnO 2 /Y 2 O 3 :Tb 3+ ), synthesized by coprecipitation method. The nanoparticles were submitted to thermal treatment and characterized by X-Ray Powder Diffraction (XRD) that showed cassiterite phase formation and the influence of thermal treatment on nanoparticles structures. These nanoparticles going to be functionalized with a natural polysaccharide (chitosan) in order to form microspheres. These microspheres going to be irradiated with gamma radiation to sterilization and it can be evaluated if the nanoparticles are resistant to irradiation and they do not lose functionality with this process. (author)
Energy Technology Data Exchange (ETDEWEB)
Gao Feng [College of Chemistry and Materials Science, Anhui Key Laboratory of Chemo/Biosensing, Anhui Normal University, Wuhu 241000 (China)], E-mail: summit8848cn@hotmail.com; Luo Fabao; Tang Lijuan; Dai Lu [College of Chemistry and Materials Science, Anhui Key Laboratory of Chemo/Biosensing, Anhui Normal University, Wuhu 241000 (China); Wang Lun [College of Chemistry and Materials Science, Anhui Key Laboratory of Chemo/Biosensing, Anhui Normal University, Wuhu 241000 (China)], E-mail: wanglun@mail.ahnu.edu.cn
2008-03-15
Terbium-europium Tb-Eu/acetylacetone(acac)/poly(acrylamide) (PAM) co-luminescence composite nanoparticles were successfully prepared using the ultrasonic approach. The as-prepared composite nanoparticles show the characteristic emission spectra of Tb{sup 3+}, located at 496 and 549 nm. Furthermore, the nanoparticles are water soluble, stable and have extremely narrow emission bands and high internal fluorescence quantum yield due to the co-luminescence effect. Further studies indicate that proteins can interact with the nanoparticles and induce the fluorescence quenching of the nanoparticles. Based on the fluorescence quenching of nanopaticles in the presence of proteins, a novel method for the sensitive determination of trace amounts of proteins was proposed. Under the optimal experimental conditions, the linear ranges of calibration curves are 0-3.5 {mu}g mL{sup -1} for human serum albumin (HSA) and 0-4.0 {mu}g mL{sup -1} for {gamma}-globulin ({gamma}-IgG), respectively. The limits of detection are 7.1 for HSA and 6.7ng mL{sup -1} for {gamma}-IgG, respectively. The method was applied to the quantification of proteins in synthetic samples and actual human serum samples with satisfactory results. This proposed method is sensitive, simple and has potential application in the clinical assay of proteins.
International Nuclear Information System (INIS)
Minyu, T.; Ning, T.; Yingli, Z.; Jiyuan, B.
1985-01-01
The solid complexes of rare earth nitrates perchlorates and thiocyanates with 2,2'-bipyridine-N,N'-dioxide (bipyO/sub 2/) have been reported. However, the corresponding complexes of other rear earth chlorides have not been investigated except lanthanum, cerium and yttrium. As an extension of our previous work on the synthesis of complexes of praseodymium and neodymium chlorides wiht bipoyO/sub 2/, the authors have now prepared fluorescent solid complexes of samarium, europium, gadolium and terbium chlorides with biphyO/sub 2/, using methanol as a reaction medium. The new synthesized compounds have been identified by means of elemental analysis, infrared spectrometry, conductometry, differential thermal analysis (DTA), thermogravimetry (TG) and X-ray powder diffraction
International Nuclear Information System (INIS)
NSTec Environmental Restoration
2007-01-01
Corrective Action Unit (CAU) 168 is identified in the Federal Facility Agreement and Consent Order of 1996 as Area 25 and 26 Contaminated Materials and Waste Dumps. CAU 168 consists of twelve Corrective Action Sites (CASs) in Areas 25 and 26 of the Nevada Test Site, which is approximately 105 kilometers (65 miles) northwest of Las Vegas, Nevada. The CASs contain surface and subsurface debris, impacted soil, and contaminated materials. Site characterization activities were conducted in 2002, and the results are presented in the Corrective Action Decision Document (CADD) for CAU 168 (U.S. Department of Energy, National Nuclear Security Administration Nevada Site Office [NNSA/NSO], 2006). Site characterization results indicated that soil at several sites exceeded the clean-up criteria for total petroleum hydrocarbons (TPH), polychlorinated biphenyls (PCBs), and radionuclides. The Nevada Division of Environmental Protection approved the proposed corrective actions specified in the CADD (NNSA/NSO, 2006). The approved corrective actions include no further action, clean closure, and closure in place with administrative controls
Study of the role of complete fusion in the reaction of 48Ca and 56Fe with cerium and terbium
International Nuclear Information System (INIS)
Morrissey, D.J.
1978-05-01
48 Ca and 56 Fe beams from the Super HILAC accelerator were used to irradiate thick metal foils of cerium and terbium. Product gamma ray activities were detected offline and individual products were identified by half-life, gamma ray energy and gamma ray abundances. The production cross sections were iteratively fit to charge and mass dispersions to allow correction for parent decay and calculation of mass yields. From the mass yield curves contributions from quasielastic transfer, deep inelastic transfer and complete fusion reaction mechanisms were interred. Complete fusion was made up on contributions from both evaporation residue and fusion-fission products for the 48 Ca induced reactions. However, only fusion-fission products were detected in the 56 Fe induced reactions. Critical angular momenta for fusion were found to be 82 +- 8 h for 48 Ca + 159 Tb and 34 +- 5 h for 56 Fe + 140 Ce, which can be compared with 53 +- 8 h for 12 C + 197 Au (Natowitz, 1970) and 86 +- 5 h for 40 Ar + 165 Ho (Hanappe, 1973). All of these reactions lead to essentially the same compound nucleus and seem to show the dramatic decline in complete fusion for heavy ions larger than 40 Ar. The prediction of this decline was found to be beyond the model calculations of Bass and the critical distance approach of Glas and Mosel
Directory of Open Access Journals (Sweden)
Justin W Leung
2014-03-01
Full Text Available Histone ubiquitinations are critical for the activation of the DNA damage response (DDR. In particular, RNF168 and RING1B/BMI1 function in the DDR by ubiquitinating H2A/H2AX on Lys-13/15 and Lys-118/119, respectively. However, it remains to be defined how the ubiquitin pathway engages chromatin to provide regulation of ubiquitin targeting of specific histone residues. Here we identify the nucleosome acid patch as a critical chromatin mediator of H2A/H2AX ubiquitination (ub. The acidic patch is required for RNF168- and RING1B/BMI1-dependent H2A/H2AXub in vivo. The acidic patch functions within the nucleosome as nucleosomes containing a mutated acidic patch exhibit defective H2A/H2AXub by RNF168 and RING1B/BMI1 in vitro. Furthermore, direct perturbation of the nucleosome acidic patch in vivo by the expression of an engineered acidic patch interacting viral peptide, LANA, results in defective H2AXub and RNF168-dependent DNA damage responses including 53BP1 and BRCA1 recruitment to DNA damage. The acidic patch therefore is a critical nucleosome feature that may serve as a scaffold to integrate multiple ubiquitin signals on chromatin to compose selective ubiquitinations on histones for DNA damage signaling.
The purification of the rare earth metals. II
International Nuclear Information System (INIS)
Jordan, R.G.; Jones, D.W.; Hems, V.J.
1975-01-01
Solid-state electrotransport processing has been demonstrated as a technique for purifying terbium. The results show that both oxygen and nitrogen migrate rapidly in the same direction as the electron flow. Although hydrogen contamination occurs on contact with air, terbium of better than 99.9 at. % has been prepared from commercially available starting material. The preparation and characterisation of high-quality single-crystal terbium specimens is also described. (Auth.)
G. Smeenk (Godelieve); W.W. Wiegant (Wouter); J.A. Marteijn (Jurgen); M.S. Luijsterburg (Martijn); N. Sroczynski (Nicholas); T. Costelloe (Thomas); R. Romeijn (Ron); A. Pastink (Albert); N. Mailand (Niels); W. Vermeulen (Wim); H. van Attikum (Haico)
2013-01-01
textabstractIonizing radiation (IR)-induced DNA double-strand breaks (DSBs) arising in native chromatin elicit an RNF8/RNF168-dependent ubiquitylation response, which triggers the recruitment of various repair factors. Precisely how this response is regulated in the context of chromatin remains
RPA method based on the self-consistent cranking model for 168Er and 158Dy
International Nuclear Information System (INIS)
Kvasil, J.; Cwiok, S.; Chariev, M.M.; Choriev, B.
1983-01-01
The low-lying nuclear states in 168 Er and 158 Dy are analysed within the random phase approximation (RPA) method based on the self-consistent cranking model (SCCM). The moment of inertia, the value of chemical potential, and the strength constant k 1 have been obtained from the symmetry condition. The pairing strength constants Gsub(tau) have been determined from the experimental values of neutron and proton pairing energies for nonrotating nuclei. A quite good agreement with experimental energies of states with positive parity was obtained without introducing the two-phonon vibrational states
Early complications after pneumonectomy: retrospective study of 168 patients.
Alloubi, Ihsan; Jougon, Jacques; Delcambre, Frédéric; Baste, Jean Marc; Velly, Jean François
2010-08-01
The purpose of this study was to assess the mortality and risk factors of complications after pneumonectomy for lung cancer. Between 1996 and 2001, we reviewed and analysed the demographic, clinical, functional, and surgical variables of 168 patients to identify risk factors of postoperative complications by univariate and multivariate analyses with Medlog software system. The mean age was 60+/-10 years, overall mortality and morbidity rates were 4.17% and 41.6%, respectively. All frequencies of respiratory complications were 1.2% for acute respiratory failure, 10.1% for pneumonia, 2.4% for acute pulmonary oedema, 4.17% for bronchopleural fistula, 2.4% for thoracic empyema and 18.5% for left recurrent nerve injuries. Postoperative arrhythmias developed in 46% of our patients. The risk factors for cardiopulmonary morbidity and mortality with univariate analysis were advanced age (P<0.01), preoperative poor performance status (P<0.015), and chronic artery disease (P<0.008). Factors adversely affecting morbidity with multivariate analysis included age (P=0.0001), associated cardiovascular disease (P=0.001), and altered forced expiratory volume in 1 s (P=0.0005). Complications after pneumonectomy are associated with high mortality. Careful attention must be paid to patients with advanced age and heart disease. Chest physiotherapy is paramount to have uneventful outcomes.
2010-04-01
... 26 Internal Revenue 3 2010-04-01 2010-04-01 false Limitations on investment tax credit and... Limitations on investment tax credit and recovery deductions under section 168 for passenger automobiles and... the amount of investment tax credit determined under section 46(a) and recovery deductions under...
2010-10-01
... SERVICES TRIBAL SELF-GOVERNANCE Operational Provisions Audits and Cost Principles § 137.168 May the Secretary require audit or accounting standards other than those specified in § 137.167? No, no other audit... 42 Public Health 1 2010-10-01 2010-10-01 false May the Secretary require audit or accounting...
sdg interacting-boson model in the SU(3) scheme and its application to 168Er
Yoshinaga, N.; Akiyama, Y.; Arima, A.
1988-07-01
The sdg interacting-boson model is presented in the SU(3) tensor formalism. The interactions are decomposed according to their SU(3) tensor character. The existence of the SU(3)-seniority preserving operator is found to be important. The model is applied to 168Er. Energy levels and electromagnetic transitions are calculated. This model is shown to solve the problem of anharmonicity regarding the excitation energy of the first Kπ=4+ band relative to that of the first Kπ=2+ one. E4 transitions are calculated to give different predictions from those by the quasiparticle-phonon nuclear model.
Distribución de los elementos Cu-Pb-Zn en suelos de la plancha 168 (Argelia).
Sánchez-Arredondo, Luis Hernán
2014-01-01
El objetivo de este estudio fue el análisis espacial de los elementos cobre, plomo y cinc en horizontes A de suelos de la plancha geológica 168 (Argelia), región sureste del departamento de Antioquia Colombia. Las muestras utilizadas hacen parte del programa "Levantamiento y Compilación de Información Geoquímica-Mapas Regionales-Ingeominas (Colombia)" y fueron facilitadas por INGEOMINAS (hoy Servicio Geológico Colombiano) para el proyecto "Mapa Geoquímico de Antioquia". Para la elaboración de...
Wang, Meizhou; Xu, Meijuan; Rao, Zhiming; Yang, Taowei; Zhang, Xian
2015-11-01
L-Ornithine, a non-protein amino acid, is usually extracted from hydrolyzed protein as well as produced by microbial fermentation. Here, we focus on a highly efficient whole-cell biocatalyst for the production of L-ornithine. The gene argI, encoding arginase, which catalyzes the hydrolysis of L-arginine to L-ornithine and urea, was cloned from Bacillus amyloliquefaciens B10-127 and expressed in GRAS strain Bacillus subtilis 168. The recombinant strain exhibited an arginase activity of 21.9 U/mg, which is 26.7 times that of wild B. subtilis 168. The optimal pH and temperature of the purified recombinant arginase were 10.0 and 40 °C, respectively. In addition, the recombinant arginase exhibited a strong Mn(2+) preference. When using whole-cell biocatalyst-based bioconversion, a hyper L-ornithine production of 356.9 g/L was achieved with a fed-batch strategy in a 5-L reactor within 12 h. This whole-cell bioconversion study demonstrates an environmentally friendly strategy for L-ornithine production in industry.
Kitevski-Leblanc, Julianne; Fradet-Turcotte, Amélie; Kukic, Predrag; Wilson, Marcus D.; Portella, Guillem; Yuwen, Tairan; Panier, Stephanie; Duan, Shili; Canny, Marella D.; Van Ingen, Hugo; Arrowsmith, Cheryl H.; Rubinstein, John L.; Vendruscolo, Michele; Durocher, Daniel; Kay, Lewis E
2017-01-01
Site-specific histone ubiquitylation plays a central role in orchestrating the response to DNA double-strand breaks (DSBs). DSBs elicit a cascade of events controlled by the ubiquitin ligase RNF168, which promotes the accumulation of repair factors such as 53BP1 and BRCA1 on the chromatin flanking
Sdg interacting-boson model in the SU(3) scheme and its application to /sup 168/Er
International Nuclear Information System (INIS)
Yoshinaga, N.; Akiyama, Y.; Arima, A.
1988-01-01
The sdg interacting-boson model is presented in the SU(3) tensor formalism. The interactions are decomposed according to their SU(3) tensor character. The existence of the SU(3)-seniority preserving operator is found to be important. The model is applied to /sup 168/Er. Energy levels and electromagnetic transitions are calculated. This model is shown to solve the problem of anharmonicity regarding the excitation energy of the first K/sup π/ = 4 + band relative to that of the first K/sup π/ = 2 + one. E4 transitions are calculated to give different predictions from those by the quasiparticle-phonon nuclear model
Energy Technology Data Exchange (ETDEWEB)
Narjis, A., E-mail: narjis78@gmail.com [Research Group ESNPS, Physics Department, University Ibn Zohr, Faculty of Sciences, B.P 8106, Hay Dakhla, 80000 Agadir (Morocco); El Kaaouachi, A.; Limouny, L.; Dlimi, S.; Errai, M.; Sybous, A. [Research Group ESNPS, Physics Department, University Ibn Zohr, Faculty of Sciences, B.P 8106, Hay Dakhla, 80000 Agadir (Morocco); Kumaresavanji, M. [Centro Brasileiro de Pesquisas Fisicas (CBPF), Rua Dr. Xavier Sigaud, 150 Urca, Rio de Janeiro (Brazil)
2013-04-15
The transport properties in the La{sub 1.32}Sr{sub 1.68}Mn{sub 2}O{sub 7} layered manganite system have been studied in the presence of magnetic field up to 5 T. An analysis of the low temperature (T<45 K) dependence of the resistivity under hydrostatic pressure up to 25 kbars shows the spin-dependent Coulomb Blockade phenomenon. The surface phase and the link condition in grain boundaries are suggested to be responsible for the magnetoresistance data while influencing the charge transfer probability between grains. - Highlights: ►Magnetotransport in a colossal magnetoresistive material La{sub 1.32}Sr{sub 1.68}Mn{sub 2}O{sub 7}. ► The effect of the forming pressure on the magnetoresistance (MR). ► The grain size effect and charge transfer probability between grains. ► A simple model to explain the negative MR.
International Nuclear Information System (INIS)
Azmairit Aziz; Nana Suherman
2015-01-01
Currently cancer patients are increasing every year in Indonesia and become the third leading cause of death after heart disease and high blood pressure. Terbium-161 ( 161 Tb) is a low β- emitter (E β - = 0.155 MeV, T 1/2 = 6.9 d) and very similar to 177 Lu in terms of half-life, E β - energy and chemical properties.However, 161 Tb also ejects internal conversion electrons and Auger electrons which can provide a greater therapeutic effect than 177 Lu. Radioisotope of 161 Tb can be produced as a carrier-free for use in labeling of biomolecules as a targeted radiopharmaceutical for cancer therapy. 161 Tb was obtained through 160 Gd(n,γ) 161 Tb nuclear reaction by thermal neutron bombardment on 100 mg of natural gadolinium oxide target in RSG-G.A. Siwabessy at a thermal neutron flux of ~10 14 n.cm -2 .s -1 and followed by radiochemical separation of 161 Tb from Gd isotopes using extraction chromatography method. The physico-chemical characterization of 161 TbCl 3 solution was studied by determination of its radionuclide purity by means of a γ-rays spectrometry with HP-Ge detector coupled to a multichannel analyzer (MCA). Radiochemical purity was determined using paper chromatography and paper electrophoresis methods. The results showed that 161 TbCl 3 radioisotope has a pH of 2, radiochemical purity of 99.64 ± 0.34%, radionuclide purity of 99.69 ± 0.20%, specific activity and radioactive concentration at the end of irradiation (EOI) of 2.26 – 5.31 Ci/mg and 3.84 – 9.03 mCi/mL, respectively. 161 TbCl 3 solution stable for 3 weeks at room temperature with a radiochemical purity of 98.41 ± 0.42%. 161 TbCl 3 solution from irradiated natural gadolinium oxide target has the physico-chemical characteristic that meets the requirements for use as a precursor in preparation of radiopharmaceuticals. (author)
International Nuclear Information System (INIS)
Oka, Yasuyoshi; Suzuki, Keiji; Yamauchi, Motohiro; Mitsutake, Norisato; Yamashita, Shunichi
2011-01-01
Highlights: → NIPBL is recruited to DSBs. → Localization of NIPBL to DSBs is regulated by MDC1 and RNF168. → HP1γ is required for NIPBL accumulation at DSBs. -- Abstract: The cohesin loading factor NIPBL is required for cohesin to associate with chromosomes and plays a role in DNA double-strand break (DSB) repair. Although the NIPBL homolog Scc2 is recruited to an enzymatically generated DSB and promotes cohesin-dependent DSB repair in yeast, the mechanism of the recruitment remains poorly understood. Here we show that the human NIPBL is recruited to the sites of DNA damage generated by micro-irradiation as well as to the sites of DSBs induced by homing endonuclease, I-PpoI. The recruitment of NIPBL was impaired by RNAi-mediated knockdown of MDC1 or RNF168, both of which also accumulate at DSBs. We also show that the recruitment of NIPBL to the sites of DNA damage is mediated by its C-terminal region containing HEAT repeats and Heterochromatin protein 1 (HP1) interacting motif. Furthermore, NIPBL accumulation at damaged sites was also compromised by HP1γ depletion. Taken together, our study reveals that human NIPBL is a novel protein recruited to DSB sites, and the recruitment is controlled by MDC1, RNF168 and HP1γ.
Energy Technology Data Exchange (ETDEWEB)
Sahota, H S; Hasiza, M L; Mittal, R [Punjabi Univ., Patiala (India). Dept. of Physics
1976-06-01
The 2sub(..gamma..)..-->..2sub(g) transition in /sup 168/Er has been examined for the presence of electric monopole contribution. The experimental E0/E2 reduced transition probabilities and monopole matrix element have been found to be somewhat larger than the theoretical predictions of the Bohr-Mottelson model but the ratio rhosup(2)/X has been found to agree well with the theoretical value. The band mixing parameters have also been evaluated and found to be sizeable.
Levoye, Angélique; Zwier, Jurriaan M; Jaracz-Ros, Agnieszka; Klipfel, Laurence; Cottet, Martin; Maurel, Damien; Bdioui, Sara; Balabanian, Karl; Prézeau, Laurent; Trinquet, Eric; Durroux, Thierry; Bachelerie, Françoise
2015-01-01
Although G protein-coupled receptor (GPCR) internalization has long been considered as a major aspect of the desensitization process that tunes ligand responsiveness, internalization is also involved in receptor resensitization and signaling, as well as the ligand scavenging function of some atypical receptors. Internalization thus contributes to the diversity of GPCR-dependent signaling, and its dynamics and quantification in living cells has generated considerable interest. We developed a robust and sensitive assay to follow and quantify ligand-induced and constitutive-induced GPCR internalization but also receptor recycling in living cells. This assay is based on diffusion-enhanced resonance energy transfer (DERET) between cell surface GPCRs labeled with a luminescent terbium cryptate donor and a fluorescein acceptor present in the culture medium. GPCR internalization results in a quantifiable reduction of energy transfer. This method yields a high signal-to-noise ratio due to time-resolved measurements. For various GPCRs belonging to different classes, we demonstrated that constitutive and ligand-induced internalization could be monitored as a function of time and ligand concentration, thus allowing accurate quantitative determination of kinetics of receptor internalization but also half-maximal effective or inhibitory concentrations of compounds. In addition to its selectivity and sensitivity, we provided evidence that DERET-based internalization assay is particularly suitable for characterizing biased ligands. Furthermore, the determination of a Z'-factor value of 0.45 indicates the quality and suitability of DERET-based internalization assay for high-throughput screening (HTS) of compounds that may modulate GPCRs internalization.
Therapeutic use of radioactive isotopes
Caroline Duc
2013-01-01
In December, researchers from ISOLDE-CERN, the Paul Scherrer Institute (PSI) and the Institut Laue-Langevin (ILL) published the results of an in vivo study which successfully proved the effectiveness of four terbium isotopes for diagnosing and treating cancerous tumours. Four terbium isotopes suitable for clinical purposes. “ISOLDE is the only installation capable of supplying terbium isotopes of such purity and intensity in the case of three out of the four types used in this study,” explains Karl Johnson, a physicist at ISOLDE. “Producing over a thousand different isotopes, our equipment offers the widest choice of isotopes in the world!” Initially intended for fundamental physics research, ISOLDE has diversified its activities over time to invest in various projects in the materials science, biochemistry and nuclear medicine fields. The proof-of-concept study has confirmed that the four terbium isotopes 149Tb, 152Tb, 155Tb produ...
Clinical laboratorial analysis of 168 patients with galactorrhea from different etiologic conditions
International Nuclear Information System (INIS)
Pacheco, I.H.F.
1984-01-01
This paper evaluated the data of 168 patients with galactorrhea throught factorial analysis. This method consists, initially, of an intercorrelation analysis, which serves as a base for the determination of a number of factors, one of them, which could be described as the patient's risk of having a pituitary tumour. This factor was formed, basically, by four elements: the existence of radiological changes, head pain, menstrual irregularities and the prolactin level. After the global study, the patients were analysed within the etiological subgroups, in several clinical and laboratorial aspects, as menstrual abnormalities, duration of the galactorrhea, prolactin level, dynamic tests to evaluate the prolactin secretion an the pituitary reserve, and by the therapeutic aspect. The results of the tests that measures the prolactin secretion were analysed, also, in terms of it's basal hormonal level, and have shown to be more dependent on them, than on the etiological group. We have compared the surgical, radioactive and bromocriptine treatment of pituitary tumours. There wasn't a satisfactory cure rate in any of them, which reinforces the need of an earlier recognition of these tumours. (author)
Directory of Open Access Journals (Sweden)
Angélique eLEVOYE
2015-11-01
Full Text Available Although G protein-coupled receptor (GPCR internalization has long been considered a major aspect of the desensitization process that tunes ligand responsiveness, internalization is also involved in receptor resensitization and signaling, as well as the ligand scavenging function of some atypical receptors. Internalization thus contributes to the diversity of GPCR-dependent signaling, and its dynamics and quantification in living cells has generated considerable interest. We developed a robust and sensitive assay to follow and quantify ligand-induced and constitutive GPCR internalization but also receptor recycling in living cells. This assay is based on diffusion-enhanced resonance energy transfer (DERET between cell surface GPCRs labeled with a luminescent terbium cryptate donor and a fluorescein acceptor present in the culture medium. GPCR internalization results in a quantifiable reduction of energy transfer. This method yields a high signal-to-noise ratio due to time-resolved measurements. For various GPCRs belonging to different classes, we demonstrated that constitutive and ligand-induced internalization could be monitored as a function of time and ligand concentration, thus allowing accurate quantitative determination of kinetics of receptor internalization but also half-maximal effective or inhibitory concentrations of compounds. In addition to its selectivity and sensitivity, we provided evidence that DERET-based internalization assay is particularly suitable for characterizing biased ligands. Furthermore, the determination of a Z’-factor value of 0.45 indicates the quality and suitability of DERET-based internalization assay for high-throughput screening (HTS of compounds that may modulate GPCRs internalization.
An ICP AES method for determination of dysprosium and terbium in high purity yttrium oxide
International Nuclear Information System (INIS)
Rupawate, V.H.; Hareendran, K.N.; Roy, S.B.
2011-01-01
High purity yttrium finds interesting application in astronavigation, luminescence, nuclear energy and metallurgical industries. Most of these applications require yttrium oxide of highest purity. Consequently there is a need for production of high purity yttrium oxide. Separation and purification of yttrium from other rare earths is a challenging task due to their close chemical properties. Liquid-liquid extraction and ion exchange have been widely used in the production of yttrium oxide of highest purity. Determination of impurities, especially other rare earths, in ppm level is required for process development and chemical characterization of the high purity Y 2 O 3 . Many methods have been described in literature. However since the advent of ICP AES much work in this area has been carried out by this technique. This paper describes the work done for determination of dysprosium (Dy) and terbium (Tb) in yttrium oxide using a high resolution sequential ICP AES. Emission spectra of rare earth elements are very complex and due to this complexity it is important to select spectral interference free analyte lines for determination of rare earths in rare earth matrix. For the determination of Dy and Tb in Y 2 O 3 , sensitive lines of Dy and Tb are selected from the instrument wavelength table and spectral interference free emission lines for the determination is selected by scanning around the selected wavelengths using 5 g/L Y solution and 5 mg/L standard solutions of Dy and Tb prepared in 4% nitric acid. It is found 353.170 nm line of Dy and 350.917 nm line Tb is suitable for quantitative determination. The signal to background ratio increases with increase in matrix concentration, i.e. from 1 to 5 mg/L. The optimum forward power is determined and it is found to be 1100W for Dy and 1000W for Tb. The instrument is calibrated using matrix matched standards containing 5g/L of Y matrix. Samples are dissolved in nitric acid and Y concentration is maintained at 5g/L. Two
Prostate alpha/beta revisited - an analysis of clinical results from 14 168 patients
Energy Technology Data Exchange (ETDEWEB)
Dasu, Alexandru [Dept. of Radiation Physics UHL, County Council of Oestergoetland, Linkoeping (Sweden); Radiation Physics, Dept. of Medical and Health Sciences, Faculty of Health Sciences, Linkoeping Univ., Linkoeping (Sweden); Toma-Dasu, Iuliana [Medical Radiation Physics, Stockholm Univ. and Karolinska Institutet, Stockholm (Sweden)
2012-11-15
Purpose. To determine the dose response parameters and the fractionation sensitivity of prostate tumours from clinical results of patients treated with external beam radiotherapy. Material and methods. The study was based on five-year biochemical results from 14 168 patients treated with external beam radiotherapy. Treatment data from 11 330 patients treated with conventional fractionation have been corrected for overall treatment time and fitted with a logit equation. The results have been used to determine the optimum {alpha}/{beta} values that minimise differences in predictions from 2838 patients treated with hypofractionated schedules. Results. Conventional fractionation data yielded logit dose response parameters for all risk groups and for all definitions of biochemical failures. The analysis of hypofractionation data led to very low {alpha}/{beta} values (1-1.7 Gy) in all mentioned cases. Neglecting the correction for overall treatment time has little impact on the derivation of {alpha}/{beta} values for prostate cancers. Conclusions. These results indicate that the high fractionation sensitivity is an intrinsic property of prostate carcinomas and they support the use of hypofractionation to increase the therapeutic gain for these tumours.
International Nuclear Information System (INIS)
Moeller, R.; Berger, T.; Reitz, G.; Okayasu, Ryuichi
2006-01-01
This research project is aimed at correlating radiation effects induced DNA damage in Bacillus subtilis endospores with the linear energy transfer (LET) of the used radiation by investigating survival and gene activation after irradiation with high-LET particles. During the stationary growth phase Bacillus subtilis change their metabolic active state from the vegetative cells to the metabolic inactive but even more resistant endospores. If spores find optimal conditions, they could germinate and switch to the vegetative growth. With these outgrowth spores can and/or must repair the induced formed DNA damage. During germination spores lose their most resistance. In more detail, DNA repair and mutation induction events investigated will include the survivability, behaviour against specific antibiotics and their germination. DNA repair pattern will be detected during germination by using DNA microarrays, which contain the whole genome of Bacillus subtilis 168. (author)
Urinary phthalates from 168 girls and boys measured twice a year during a 5-year period
DEFF Research Database (Denmark)
Mouritsen, A; Frederiksen, H; Sørensen, K
2013-01-01
Background: Little is known about the possible deleterious effects of phthalate exposure on endogenous sex steroid levels in children. Objective: Our objective was to investigate whether urinary phthalate metabolite levels are associated with circulating adrenal androgen levels and age at puberty....... Methods: This was a longitudinal study of 168 healthy children (84 girls) examined every 6 months for 5 years. Serum levels of dehydroepiandrostenedione sulfate (DHEAS), Δ4-androstenedione, testosterone, and urinary morning excretion of 14 phthalate metabolites, corresponding to 7 different phthalate...... diesters were determined. A variation in urinary excretion of phthalates was evident in each child, which made a mean of repetitive samples more representative for long-term excretion than a single determination. Results: We found that girls with excretion of monobutyl phthalate isomers (MBP) and di(2...
Energy Technology Data Exchange (ETDEWEB)
Morrissey, D.J.
1978-05-01
/sup 48/Ca and /sup 56/Fe beams from the Super HILAC accelerator were used to irradiate thick metal foils of cerium and terbium. Product gamma ray activities were detected offline and individual products were identified by half-life, gamma ray energy and gamma ray abundances. The production cross sections were iteratively fit to charge and mass dispersions to allow correction for parent decay and calculation of mass yields. From the mass yield curves contributions from quasielastic transfer, deep inelastic transfer and complete fusion reaction mechanisms were interred. Complete fusion was made up on contributions from both evaporation residue and fusion-fission products for the /sup 48/Ca induced reactions. However, only fusion-fission products were detected in the /sup 56/Fe induced reactions. Critical angular momenta for fusion were found to be 82 +- 8 h for /sup 48/Ca + /sup 159/Tb and 34 +- 5 h for /sup 56/Fe + /sup 140/Ce, which can be compared with 53 +- 8 h for /sup 12/C + /sup 197/Au (Natowitz, 1970) and 86 +- 5 h for /sup 40/Ar + /sup 165/Ho (Hanappe, 1973). All of these reactions lead to essentially the same compound nucleus and seem to show the dramatic decline in complete fusion for heavy ions larger than /sup 40/Ar. The prediction of this decline was found to be beyond the model calculations of Bass and the critical distance approach of Glas and Mosel.
Evaluación sobre la seguridad de la acupuntura en 297.168 punturas.
Directory of Open Access Journals (Sweden)
Liliana Hernández Leal
2014-07-01
Full Text Available Con el propósito de obtener una casuística propia y de determinar la seguridad de la práctica de la acupuntura en nuestro medio, se realizó el seguimiento de la incidencia de efectos adversos en la consulta particular de un médico acupunturista con amplia experiencia clínica durante un periodo de 72 meses en el que se realizaron 24.707 consultas, encontrándose 260 eventos adversos de 297.168 punturas, con una incidencia de 0.87 por 1.000 y 7 de 2.390 puntos moxados para una incidencia de 2.92 por 1.000. El efecto adverso más frecuente para la acupuntura fue la presentación de equimosis – hematomas con una incidencia de 0.65 por 1.000. Para la moxibustión el único efecto adverso que se presentó fue la quemadura con una incidencia de 2.92 por 1.000. No hubo ningún efecto adverso mayor que requiriera intervención médica. En conclusión se puede considerar que la acupuntura en manos expertas es una práctica médica segura.
Secondhand smoke exposure among never-smoking youth in 168 countries.
Veeranki, Sreenivas P; Mamudu, Hadii M; Zheng, Shimin; John, Rijo M; Cao, Yan; Kioko, David; Anderson, James; Ouma, Ahmed E O
2015-02-01
To estimate the prevalence of secondhand smoke (SHS) exposure among never-smoking adolescents and identify key factors associated with such exposure. Data were obtained from nationally representative Global Youth Tobacco Surveys conducted in 168 countries during 1999-2008. SHS exposure was ascertained in relation to the location-exposure inside home, outside home, and both inside and outside home, respectively. Independent variables included parental and/or peer smoking, knowledge about smoke harm, attitudes toward smoking ban, age, sex, and World Health Organization region. Simple and multiple logistic regression analyses were conducted. Of 356,414 never-smoking adolescents included in the study, 30.4%, 44.2%, and 23.2% were exposed to SHS inside home, outside home, and both, respectively. Parental smoking, peer smoking, knowledge about smoke harm, and positive attitudes toward smoke ban were significantly associated with increased odds of SHS exposure. Approximately 14% of adolescents had both smoking parents and peers. Compared with never-smoking adolescents who did not have both smoking parents and peers, those who had both smoking parents and peers had 19 (adjusted odds ratio [aOR], 19.0; 95% confidence interval [CI], 16.86-21.41), eight (aOR, 7.71; 95% CI, 7.05-8.43), and 23 times (aOR, 23.16; 95% CI, 20.74-25.87) higher odds of exposure to SHS inside, outside, and both inside and outcome home, respectively. Approximately one third and two fifths of never-smoking adolescents were exposed to SHS inside or outside home, and smoking parents and/or peers are the key factors. Study findings highlight the need to develop and implement comprehensive smoke-free policies consistent with the World Health Organization Framework Convention on Tobacco Control. Copyright © 2015 Society for Adolescent Health and Medicine. Published by Elsevier Inc. All rights reserved.
Radiochemical separation of Tb-149 after tandem accelerator production
International Nuclear Information System (INIS)
Sarkar, S.R.
1996-01-01
Full text: Terbium-149 is produced by the heavy ion induced reaction of the type 142 Nd( 12 C,5n) 149 Dy→ 149 Tb. This work concerns the separation of terbium from neodymium target, and other lanthanides produced by secondary reactions on neodymium target. Firstly, anion-exchange separation is carried out at room temperature using acid-alcohol media (90% methanol-10% 5M nitric acid) as eluent. But the separation is not satisfactory. To achieve satisfactory separation, cation exchange separation is performed under pressure at room temperature using 0.1 6M α-hydroxyisobutyric acid of pH 5 as eluent. The pressure is exerted from a nitrogen gas cylinder. The simplicity and efficacy of this method for the separation of terbium are discussed in comparison with the commercially available high performance liquid chromatography system
International Nuclear Information System (INIS)
Stickle, W.F.; Coulman, D.
1987-01-01
The interfacial chemistry of magneto-optic structures of sputter deposited SiO, SiO 2 , Si 3 N 4 /FeCoTb/SiO, SiO 2 , and Si 3 N 4 was studied in detail by x-ray photoelectron spectroscopy (XPS) and Auger electron spectroscopy (AES). XPS and AES depth profiles have revealed a substantial amount of redox chemistry at the dielectric/rare-earth transition metal interfaces. The chemical reactions occur preferentially with the terbium as revealed in the XPS portion of the study by the formation of terbium oxide and terbium silicide. In the case of Si 3 N 4 evidence of TbN/sub x/ has also been observed. ''As deposited'' and annealed samples of the magneto-optic structures are compared and contrasted. It is concluded that Si 3 N 4 is a superior dielectric for magneto-optic media
Energy Technology Data Exchange (ETDEWEB)
Herskind, B; Dossing, T; Ninel, N; Atac, A; Jensen, H J; Hagemann, G B; Lieder, R M; Maj, A; Nyberg, J; Piiparinen, M; Sugawara, M; Virtanen, A [Niels Bohr Inst., Copenhagen (Denmark); Leoni, S; Vigezzi, E; Bosetti, P; Bracco, A; Broglia, R A; Million, B [Milan Univ. (Italy); Matsuo, M [Kyoto Univ., Uji (Japan). Uji Research Center of Yukawa Inst. for Theoretical Physics; Bergstrom, M; Brockstedt, A; Carlsson, H; Ekstrom, P; Nordlund, A; Ryde, H [Lund Univ. (Sweden). Dept. of Physics; Jongman, J [Rijksuniversiteit Groningen (Netherlands). Kernfysisch Versneller Inst.; Ingebretsen, F; Tjom, P O [Oslo Univ. (Norway); Lonnroth, T [Aabo Akademi, Turku (Finland). Dept. of Physics
1992-08-01
A new method has been developed for analyzing fluctuations of count in two-dimensional gamma ray energy coincidence spectra of deformed nuclei formed in heavy ion fusion reactions. Most of the gamma decay cascades flow through regions of high level density, and the method is based upon assumptions about average properties of the excited states. Transition energies along discrete rotational bands are viewed as randomly selected from a continuous distribution of rotational frequencies and moments of inertia. For damped rotational motion, implying a mixing of the rotational bands, a random matrix model is assumed, leading to smooth energy spectra, and strong fluctuations of the transition strengths. The method is illustrated for {sup 168}Yb and {sup 163}Tm. 4 refs., 4 figs.
Application of the RPA method based on the cranked Hartree-Fock-Bogolyubov model in 168Er and 158Dy
International Nuclear Information System (INIS)
Kvasil, J.; Khariev, M.M.; Cwiok, S.; Mikhajlov, I.N.; Khoriev, B.
1984-01-01
The Random Phase Approximation (RPA) based on the Cranked Hartree-Fock-Bogolyubov (CHFB) model is used for the study of low-lying nuclear states near the yrast line in 158 Dy and 168 Er. The relation of the spurious unphysical states connected with the nucleus centre of mass rotational motion to the solutions of RPA equations of motion is cleared up. The calculated level energies and reduced probabilities B(E2) are compared with experimental ones. The dependence of the residual interaction strength constants and the nucleus moment of inertia on the angular momentum is discussed. The experimental characteristics of low-lying states up to approx. 2 MeV are reproduced by the CHFB+RPA model. (author)
Luminescent materials based on Tb, Eu-containing layered double hydroxides
International Nuclear Information System (INIS)
Zhuravleva, N.G.; Eliseev, A.A.; Lukashin, A.V.; Kinast, U.; Tret'yakov, Yu.D.
2004-01-01
Luminescent materials on the basis of magnesium-aluminium layered double hydroxides with intercalated anionic complexes of terbium and europium picolinates were synthesized. Relying on data of spectroscopy, elementary and X-ray phase analyses, the change in the rare earth complex structure and metal/ligand ratio, depending on the hydroxide layer charge, determined by Mg/Al ratio in the double hydroxide, were ascertained. The values of quantum yields of luminescence for terbium-containing samples amounted to 30-50% [ru
Directory of Open Access Journals (Sweden)
Valentina V. Utochnikova
2012-01-01
Full Text Available The new reactive chemical vapor deposition (RCVD method has been proposed for thin film deposition of luminescent nonvolatile lanthanide aromatic carboxylates. This method is based on metathesis reaction between the vapors of volatile lanthanide dipivaloylmethanate (Ln(dpm3 and carboxylic acid (HCarb orH2Carb′ and was successfully used in case of HCarb. Advantages of the method were demonstrated on example of terbium benzoate (Tb(bz3 and o-phenoxybenzoate thin films, and Tb(bz3 thin films were successfully examined in the OLED with the following structure glass/ITO/PEDOT:PSS/TPD/Tb(bz3/Ca/Al. Electroluminescence spectra of Tb(bz3 showed only typical luminescent bands, originated from transitions of the terbium ion. Method peculiarities for deposition of compounds of dibasic acids H2Carb′ are established on example of terbium and europium terephtalates and europium 2,6-naphtalenedicarboxylate.
Heterologous expression and characterization of a new heme-catalase in Bacillus subtilis 168.
Philibert, Tuyishime; Rao, Zhiming; Yang, Taowei; Zhou, Junping; Huang, Genshu; Irene, Komera; Samuel, Niyomukiza
2016-06-01
Reactive oxygen species (ROS) is an inherent consequence to all aerobically living organisms that might lead to the cells being lethal and susceptible to oxidative stress. Bacillus pumilus is characterized by high-resistance oxidative stress that stimulated our interest to investigate the heterologous expression and characterization of heme-catalase as potential biocatalyst. Results indicated that recombinant enzyme significantly exhibited the high catalytic activity of 55,784 U/mg expressed in Bacillus subtilis 168 and 98.097 µmol/min/mg peroxidatic activity, the apparent K m of catalytic activity was 59.6 ± 13 mM with higher turnover rate (K cat = 322.651 × 10(3) s(-1)). The pH dependence of catalatic and peroxidatic activity was pH 7.0 and pH 4.5 respectively with temperature dependence of 40 °C and the recombinant heme-catalase exhibited a strong Fe(2+) preference. It was further revealed that catalase KatX2 improved the resistance oxidative stress of B. subtilis. These findings suggest that this B. pumilus heme-catalase can be considered among the industrially relevant biocatalysts due to its exceptional catalytic rate and high stability and it can be a potential candidate for the improvement of oxidative resistance of industrially produced strains.
Scanning Electron Microscope-Cathodoluminescence Analysis of Rare-Earth Elements in Magnets.
Imashuku, Susumu; Wagatsuma, Kazuaki; Kawai, Jun
2016-02-01
Scanning electron microscope-cathodoluminescence (SEM-CL) analysis was performed for neodymium-iron-boron (NdFeB) and samarium-cobalt (Sm-Co) magnets to analyze the rare-earth elements present in the magnets. We examined the advantages of SEM-CL analysis over conventional analytical methods such as SEM-energy-dispersive X-ray (EDX) spectroscopy and SEM-wavelength-dispersive X-ray (WDX) spectroscopy for elemental analysis of rare-earth elements in NdFeB magnets. Luminescence spectra of chloride compounds of elements in the magnets were measured by the SEM-CL method. Chloride compounds were obtained by the dropwise addition of hydrochloric acid on the magnets followed by drying in vacuum. Neodymium, praseodymium, terbium, and dysprosium were separately detected in the NdFeB magnets, and samarium was detected in the Sm-Co magnet by the SEM-CL method. In contrast, it was difficult to distinguish terbium and dysprosium in the NdFeB magnet with a dysprosium concentration of 1.05 wt% by conventional SEM-EDX analysis. Terbium with a concentration of 0.02 wt% in an NdFeB magnet was detected by SEM-CL analysis, but not by conventional SEM-WDX analysis. SEM-CL analysis is advantageous over conventional SEM-EDX and SEM-WDX analyses for detecting trace rare-earth elements in NdFeB magnets, particularly dysprosium and terbium.
International Nuclear Information System (INIS)
Janke, W.; Hueppe, M.
1987-01-01
A collective of 168 persons aged 18 to 59 were studied to assess the impact of the Chernobyl reactor accident on how they experience, and react to, incidents. Four groups were made up of 42 persons each (male/female; 18-39-year-olds/40-59-year-olds). As variables, the instantaneous psychic condition as a reaction to the accident, and strategies to cope with stress were studied by psychometric methods. Furthermore a questionnaire on attitudes and behaviour, specially drawn up for the study, was used, whose reliability was confirmed by analyses of the individual items. The Chernobyl nuclear accident, it is found, was felt to be a grave incident and led to a number of reactions in the attitudes and views of people. The very different response of the age and sex groups is considered to be the result of the highest significance. (orig./MG) [de
Maskalick, Nicholas J.
1988-08-30
Disclosed is a cermet electrode consisting of metal particles of nickel, cobalt, iron, or alloys or mixtures thereof immobilized by zirconia stabilized in cubic form which contains discrete deposits of about 0.1 to about 5% by weight of praseodymium, dysprosium, terbium, or a mixture thereof. The solid oxide electrode can be made by covering a substrate with particles of nickel, cobalt, iron, or mixtures thereof, growing a stabilized zirconia solid oxide skeleton around the particles thereby immobilizing them, contacting the skeleton with a compound of praseodymium, dysprosium, terbium, or a mixture thereof, and heating the skeleton to a temperature of at least 500.degree. C. The electrode can also be made by preparing a slurry of nickel, cobalt, iron, or mixture and a compound of praseodymium, dysprosium, terbium, or a mixture thereof, depositing the slurry on a substrate, heating the slurry to dryness, and growing a stabilized zirconia skeleton around the metal particles.
Buxton, R S; Ward, J B
1980-10-01
Three heat-sensitive mutants of Bacillus subtilis 168, which lysed at the non-permissive temperature, have been shown under these conditions to be defective in the synthesis of peptidoglycan. This was caused by lesions in three different stages of peptidoglycan synthesis.In one mutant (ddl), D-alanine: D-alanine ligase was defective, leading to the accumulation of UDP-MurAc-L-Ala-D-Glu-meso-A,pm ; the ddl mutation was closely linked(87 yo cotransducible) with dal, specifying alanine racemase. In a second mutant (dapE),the lesion was in N-acetyl-L-diaminopimelate deacylase, resulting in UDP-MurAc-L-Ala-D-Glu being accumulated, whilst in a third mutant (ptg-1435), UDP-MurAc-L-Ala-D-Glumeso-A,pm-D-Ala-D-Ala was the peptidoglycan precursor accumulated although the enzyme defect has not been ascertained. Both dapE and ptg-1435 were located between metC and pyr(AD), dapE being 25% cotransducible and ptg-1435 were located between metC and pyr(AD), dapE being 25% cotransducible with pyr(AD).
Cortesogno, L.; Gaggero, L.; Marescotti, P.
2003-04-01
Basalts, from around 0.8 to 3.5 Ma in age, were recovered during Leg 168 from nine sites (Sites 1023-1029 and 1031-1032), drilled across the eastern flank of the Juan de Fuca Ridge (JdFR). The sites are located from about 20 km to roughly 100 km east of the ridge axis and were subdivided into the Hydrothermal Transition (HT, Sites 1023-1025), Buried Basement (BB, Sites 1028-1031), and Rough Basement (RB, Sites 1026 and 1027) transects, described in the Leg 168 Initial Reports (Davis, Fisher, Firth, et al., 1997). The igneous rocks mainly consists of aphyric to moderately phyric pillow basalt (Sites 1023-1029 and 1031-1032), subordinate aphyric massive basalt (Site 1025), basalt-hyaloclastite breccia (Site 1026), and fine- to medium-grained diabase (Site 1027). On the whole, samples are weakly altered: the alteration style and intensity vary systematically from Site to Site being related to several factors, including the ageing of the igneous crust, the increase of temperatures from younger to older Sites (from 15.5 ^oC at the youngest 1023 Site to 62.8^oC at the oldest 1027 Site), the local and regional variations in lithology and primary porosity, and the degree of fracturing. Over 90 samples of basalts representative of the nine Sites were studied for mineralogy and petrography; 30 selected samples, representative of the igneous chemistry were analyzed for major, minor, trace and rare earth elements by XRF, ICP, ICP-MS, and INAA. An overall MORB high-Ti tholeiitic affinity arises from the Ti - LaN/SmN, Ti/Cr-Ni, Cr - Y diagrams. The sequence ranges from very primitive (Sites 1023, 1027: Mg# ≈ 70, Zr ≈ 60 ppm) to highly evolved Fe-basaltic compositions (Mg# up to 46). The FMM-normalized patterns of the most primitive compositions compared with the melting models for major oceans (Pearce & Parkinson, 1993) evidence a good analogy with magmas from 10-15% partial melting of a Fertile MORB Mantle source. The progressive decrease of compatible elements and the
Twin radio relics in the nearby low-mass galaxy cluster Abell 168
Dwarakanath, K. S.; Parekh, V.; Kale, R.; George, L. T.
2018-06-01
We report the discovery of twin radio relics in the outskirts of the low-mass merging galaxy cluster Abell 168 (redshift=0.045). One of the relics is elongated with a linear extent ˜800 kpc and projected width of ˜80 kpc and is located ˜900 kpc towards the north of the cluster centre, oriented roughly perpendicular to the major axis of the X-ray emission. The second relic is ring-shaped with a size ˜220 kpc and is located near the inner edge of the elongated relic at a distance of ˜600 kpc from the cluster centre. These radio sources were imaged at 323 and 608 MHz with the Giant Meterwave Radio Telescope and at 1520 MHz with the Karl G. Jansky Very Large Array (VLA). The elongated relic was detected at all frequencies, with a radio power of 1.38 ± 0.14 × 1023 W Hz-1 at 1.4 GHz and a power law in the frequency range 70-1500 MHz (S ∝ να, α = -1.1 ± 0.04). This radio power is in good agreement with that expected from the known empirical relation between the radio powers of relics and host cluster masses. This is the lowest mass (M500 = 1.24 × 1014 M⊙) cluster in which relics due to merger shocks are detected. The ring-shaped relic has a steeper spectral index (α) of -1.74 ± 0.29 in the frequency range 100-600 MHz. We propose this relic to be an old plasma, revived due to adiabatic compression by the outgoing shock that produced the elongated relic.
Energy Technology Data Exchange (ETDEWEB)
Motta, F.V., E-mail: fabiana@ct.ufrn.br [DEMAT, CT, UFRN, Av. Sen. Salgado Filho 3000, CEP 59072-970 Natal, RN (Brazil); Marques, A.P.A. [UNIFESP, Rua Prof. Artur Riedel 275, CEP 09972-270 Diadema, SP (Brazil); Li, M.S. [IFSC, USP, Av. Trabalhador São Carlense 400, CEP 13566-590 São Carlos, SP (Brazil); Abreu, M.F.C. [LIEC, DQ, UFSCar, Via Washington Luiz, km 235, CEP 13565-905 São Carlos, SP (Brazil); Paskocimas, C.A.; Bomio, M.R.D. [DEMAT, CT, UFRN, Av. Sen. Salgado Filho 3000, CEP 59072-970 Natal, RN (Brazil); Souza, R.P. [DEP, CT, UFRN, Av. Sen. Salgado Filho 3000, CEP 59072-970 Natal, RN (Brazil); Varela, J.A. [LIEC, IQ, UNESP, Rua Francisco Degni s/n, CEP 14801-907 Araraquara, SP (Brazil); Longo, E. [LIEC, DQ, UFSCar, Via Washington Luiz, km 235, CEP 13565-905 São Carlos, SP (Brazil)
2013-03-15
Highlights: ► We report the preparation by Microwave-Hydrothermal method of In(OH){sub 3}:xTb{sup 3+}. ► Nanostructures were obtained at a low temperature. ► The crystallite size decreased with terbium doping level. ► The nucleation–dissolution–recrystallization mechanism is promoted by processing. ► This material is a highly promising candidate for photoluminescent applications. -- Abstract: Crystalline terbium-doped indium hydroxide structures were prepared by a rapid and efficient Microwave-Assisted Hydrothermal (MAH) method. Nanostructures were obtained at a low temperature. FE-SEM images confirm that these samples are composed of 3D nanostructures. XRD, optical diffuse reflectance and photoluminescence (PL) measurements were used to characterize the products. Emission spectra of terbium-doped indium hydroxide (In(OH){sub 3}:xTb{sup 3+}) samples under excitation (350.7 nm) presented broad band emission referent to the indium hydroxide matrix and {sup 5}D{sub 4} → {sup 7}F{sub 6}, {sup 5}D{sub 4} → {sup 7}F{sub 5}, {sup 5}D{sub 4} → {sup 7}F{sub 4}, and {sup 5}D{sub 4} → {sup 7}F{sub 3} terbium transitions at 495, 550, 590 and 627 nm, respectively. Relative intensities of the Tb{sup 3+} emissions increased as the concentration of this ion increased from 0, 1, 2, 4 and 8 mol%, of Tb{sup 3+}, but the luminescence is drastically quenched for the In(OH){sub 3} matrix.
International Nuclear Information System (INIS)
Pyartman, A.K.; Kovalev, S.V.; Keskinov, V.A.; Kopyrin, A.A.
1997-01-01
A study was made on extraction of nitrates of lanthanoids (3) of the yttrium group (terbium-lutetium) and yttrium (3) by trialkylbensylammonium nitrate in toluene at T=298.15 K pH 2. Extraction isotherms are described with account of formation of compound of (R 4 N) 2 [Ln(NO 3 ) 5 ] composition in organic phase. Values of extraction constants decreasing in terbium (3)-lutetium (3) series, were calculated. Value of extraction constant for yttrium (3) is close to the value of extraction constant for ytterbium (3). 13 refs., 2 figs., 3 tabs
Kinetic study of Tb/sup 3 +/(/sup 5/D/sub 3/) luminescence in phosphate glasses
Energy Technology Data Exchange (ETDEWEB)
Anisimov, V.A.; Dmitryuk, A.V.; Karapetyan, G.O.
1986-01-01
This paper presents precise determinations of the kinetics of terbium luminescence over a broad dynamic range, in order to refine the mechanism of concentration quenching of the Tb/sup 3 +/(/sup 5/D/sub 3/) luminescence in glasses. After establishing the mechanism of Tb/sup 3 +/(/sup 5/D/sub 3/) luminescence quenching by the iteration method, the authors determine the value of the parameter for an arbitrary concentration of the activator. Results of this study show that the mechanism of concentration quenching of luminescence is static dipole-dipole interaction of terbium ions.
Synthesis of Tb_4O_7 complexed with reduced graphene oxide for Rhodamine-B absorption
International Nuclear Information System (INIS)
Gao, Hui; Zhou, Yang; Chen, Keqin; Li, Xiaolong
2016-01-01
Highlights: • Tb–rGO composite was fabricated via a facile thermally reduction process. • The green and blue emissions were both observed in the composite. • The composite exhibited efficient absorption capability for Rhodamine-B. - Abstract: Tb_4O_7 complexed with reduced graphene oxide composite (Tb–rGO) had been designed and fabricated by a facile thermal reduction method. The formation of Tb_4O_7 particles and reduction of graphene oxide (GO) occurred simultaneously, and partial terbium ions would be complexed with rGO via oxygen-containing function groups on rGO sheets. Introducing of terbium ions could effectively tune the photoluminescence properties of rGO, and the composite exhibited the typical green emission of terbium ions as well as the blue self-luminescence of graphene entered at 440 nm. Moreover, Tb–rGO had demonstrated its high capability as an organic dye (Rhodamine-B) scavenger with high speed and efficiency. The findings showed the promising applications for large-scale removal of organic dye contaminants, especially in the field of waste water treatment.
Synthesis of Tb{sub 4}O{sub 7} complexed with reduced graphene oxide for Rhodamine-B absorption
Energy Technology Data Exchange (ETDEWEB)
Gao, Hui, E-mail: hope@lzu.edu.cn [School of Physical Science and Technology, Key Laboratory for Magnetism and Magnetic Materials of Ministry of Education, Lanzhou University, Lanzhou 730000 (China); Zhou, Yang; Chen, Keqin [School of Physical Science and Technology, Key Laboratory for Magnetism and Magnetic Materials of Ministry of Education, Lanzhou University, Lanzhou 730000 (China); Li, Xiaolong, E-mail: lixiaolong@sinap.ac.cn [Shanghai Synchrotron Radiation Facility, Shanghai Institute of Applied Physics, Chinese Academy of Sciences, Shanghai 201204 (China)
2016-05-15
Highlights: • Tb–rGO composite was fabricated via a facile thermally reduction process. • The green and blue emissions were both observed in the composite. • The composite exhibited efficient absorption capability for Rhodamine-B. - Abstract: Tb{sub 4}O{sub 7} complexed with reduced graphene oxide composite (Tb–rGO) had been designed and fabricated by a facile thermal reduction method. The formation of Tb{sub 4}O{sub 7} particles and reduction of graphene oxide (GO) occurred simultaneously, and partial terbium ions would be complexed with rGO via oxygen-containing function groups on rGO sheets. Introducing of terbium ions could effectively tune the photoluminescence properties of rGO, and the composite exhibited the typical green emission of terbium ions as well as the blue self-luminescence of graphene entered at 440 nm. Moreover, Tb–rGO had demonstrated its high capability as an organic dye (Rhodamine-B) scavenger with high speed and efficiency. The findings showed the promising applications for large-scale removal of organic dye contaminants, especially in the field of waste water treatment.
Energy Technology Data Exchange (ETDEWEB)
Schwung, Sebastian [Fachbereich Chemieingenieurwesen, Fachhochschule Münster, Stegerwaldstraße 39, 48565 Steinfurt (Germany); Rytz, Daniel, E-mail: rytz@fee-io.de [Forschungsinstitut für mineralische und metallische Werkstoffe-Edelsteine/ Edelmetalle-GmbH (FEE), Struthstraße 2, 55743 Idar-Oberstein (Germany); Heying, Birgit; Rodewald, Ute Ch.; Niehaus, Oliver [Institut für Anorganische und Analytische Chemie, Universität Münster, Corrensstrasse 30 48149 Münster (Germany); Enseling, David [Fachbereich Chemieingenieurwesen, Fachhochschule Münster, Stegerwaldstraße 39, 48565 Steinfurt (Germany); Jüstel, Thomas, E-mail: tj@fh-muenster.de [Fachbereich Chemieingenieurwesen, Fachhochschule Münster, Stegerwaldstraße 39, 48565 Steinfurt (Germany); Pöttgen, Rainer, E-mail: pottgen@uni-muenster.de [Institut für Anorganische und Analytische Chemie, Universität Münster, Corrensstrasse 30 48149 Münster (Germany)
2015-10-15
Terbium-substituted KYW{sub 2}O{sub 8} single crystals of high optical quality were grown by the top seeded solution growth technique. The degree of yttrium–terbium mixed occupancy was determined for two samples through structure refinements on the basis of single crystal X-ray diffractometer data. Temperature dependent magnetic susceptibility data underline the paramagnetic nature of terbium doped crystals. No magnetic ordering is evident down to 2 K. Luminescence measurements yield the typical excitation and emission spectra as expected for Tb{sup 3+} activated materials. The decay time of Tb{sup 3+} decreases linearly with the Tb{sup 3+} concentration, while the excess of thermal quenching does not change significantly. At about 405 K the decay time is reduced by roughly 50% relative to the low-temperature value, both for the powders as for the single crystals. - Highlights: • Single crystalline and powder series of K(Y,Tb)W{sub 2}O{sub 8.} • Refined XRD data of high quality crystals. • Linear decrease of the decay time with Tb{sup 3+} content.
DEFF Research Database (Denmark)
Jensen, Sanne B.; Serre, Stephanie B. N.; Humes, Daryl G.
2015-01-01
to nine PIs (telaprevir, boceprevir, simeprevir, asunaprevir, vaniprevir, faldaprevir, paritaprevir, deldeprevir, and grazoprevir) in Huh7.5 cells. We found that most variants showed decreased fitness compared to original viruses. Overall, R155K-, A156G/S-, and D/Q168A/E/H/N/V-variants showed highest...... resistant. For the remaining PIs, most genotype 2-, 4-, 5-, and 6-, but not genotype 3-variants, showed varying resistance levels. Overall, grazoprevir (MK-5172) had the highest efficacy against original viruses and variants.This is the first comprehensive study revealing the impact of described key PI...
Measurements of the 169Tm(n,2n)168Tm cross section between 9.0 and 17.5 MeV
Soter, J.; Bhike, Megha; Krishichayan, Fnu; Finch, S. W.; Tornow, W.
2016-09-01
Measurements of the 169Tm(n,2n)168Tm cross section have been performed in 0.5 MeV intervals for neutron energies ranging from 9.0 MeV to 17.5 MeV in order to resolve discrepancies in the current literature data. The neutron activation technique was used with 90Zr and 197Au as monitor foils. After irradiation, de-excitation gamma rays were recorded off-line with High-Purity Germanium (HPGE) detectors in TUNL's Low-Background Counting Facility. In addition, data for the 169Tm(n,3n)167Tm reaction have also been obtained from 15.5 MeV to 17.5 MeV. The results of these measurements provide the basis for investigating properties of the interial confinement fusion plasma in deuterium-tritium (DT) capsules at the National Ignition Facility located at Lawrence Livermore National Laboratory.
Energy Technology Data Exchange (ETDEWEB)
Wickline, Alfred
2006-12-01
This Corrective Action Decision Document has been prepared for Corrective Action Unit (CAU) 168: Area 25 and 26, Contaminated Materials and Waste Dumps, Nevada Test Site, Nevada. The purpose of this Corrective Action Decision Document is to identify and provide a rationale for the selection of a recommended corrective action alternative for each corrective action site (CAS) within CAU 168. The corrective action investigation (CAI) was conducted in accordance with the ''Corrective Action Investigation Plan for Corrective Action Unit 168: Area 25 and 26, Contaminated Materials and Waste Dumps, Nevada Test Site, Nevada'', as developed under the ''Federal Facility Agreement and Consent Order'' (1996). Corrective Action Unit 168 is located in Areas 25 and 26 of the Nevada Test Site, Nevada and is comprised of the following 12 CASs: CAS 25-16-01, Construction Waste Pile; CAS 25-16-03, MX Construction Landfill; CAS 25-19-02, Waste Disposal Site; CAS 25-23-02, Radioactive Storage RR Cars; CAS 25-23-13, ETL - Lab Radioactive Contamination; CAS 25-23-18, Radioactive Material Storage; CAS 25-34-01, NRDS Contaminated Bunker; CAS 25-34-02, NRDS Contaminated Bunker; CAS 25-99-16, USW G3; CAS 26-08-01, Waste Dump/Burn Pit; CAS 26-17-01, Pluto Waste Holding Area; and CAS 26-19-02, Contaminated Waste Dump No.2. Analytes detected during the CAI were evaluated against preliminary action levels (PALs) to determine contaminants of concern (COCs) for CASs within CAU 168. Radiological measurements of railroad cars and test equipment were compared to unrestricted (free) release criteria. Assessment of the data generated from the CAI activities revealed the following: (1) Corrective Action Site 25-16-01 contains hydrocarbon-contaminated soil at concentrations exceeding the PAL. The contamination is at discrete locations associated with asphalt debris. (2) No COCs were identified at CAS 25-16-03. Buried construction waste is present in at least two
Fukuda, Takamitsu; Matsumura, Kazuya; Ishikawa, Naoto
2013-10-10
Nuclear spin driven quantum tunneling of magnetization (QTM) phenomena, which arise from admixture of more than two orthogonal electronic spin wave functions through the couplings with those of the nuclear spins, are one of the important magnetic relaxation processes in lanthanide single molecule magnets (SMMs) in the low temperature range. Although recent experimental studies have indicated that the presence of the intramolecular f-f interactions affects their magnetic relaxation processes, little attention has been given to their mechanisms and, to the best of our knowledge, no rational theoretical models have been proposed for the interpretations of how the nuclear spin driven QTMs are influenced by the f-f interactions. Since quadruple-decker phthalocyanine complexes with two terbium or dysprosium ions as the magnetic centers show moderate f-f interactions, these are appropriate to investigate the influence of the f-f interactions on the dynamic magnetic relaxation processes. In the present paper, a theoretical model including ligand field (LF) potentials, hyperfine, nuclear quadrupole, magnetic dipolar, and the Zeeman interactions has been constructed to understand the roles of the nuclear spins for the QTM processes, and the resultant Zeeman plots are obtained. The ac susceptibility measurements of the magnetically diluted quadruple-decker monoterbium and diterbium phthalocyanine complexes, [Tb-Y] and [Tb-Tb], have indicated that the presence of the f-f interactions suppresses the QTMs in the absence of the external magnetic field (H(dc)) being consistent with previous reports. On the contrary, the faster magnetic relaxation processes are observed for [Tb-Tb] than [Tb-Y] at H(dc) = 1000 Oe, clearly demonstrating that the QTMs are rather enhanced in the presence of the external magnetic field. Based on the calculated Zeeman diagrams, these observations can be attributed to the enhanced nuclear spin driven QTMs for [Tb-Tb]. At the H(dc) higher than 2000 Oe, the
Bala, Manju; Kumar, Satish; Devi, Rekha; Khatkar, Avni; Taxak, V B; Boora, Priti; Khatkar, S P
2018-06-04
A series of five new terbium(III) ion complexes with 4,4-difluoro-1-phenylbutane-1,3-dione (HDPBD) and anciliary ligands was synthesized. The composition and properties of complexes were analyzed by elemental analysis, IR, NMR, powder X-ray diffaraction, TG-DTG and photoluminescence spectroscopy. These complexes exhibited ligand sensitized green emission at 546 nm associated with 5 D 4 → 7 F 5 transitions of terbium ion in the emission spectra. The photoluminescence study manifested that the organic ligands act as antenna and facilitate the absorbed energy to emitting levels of Tb(III) ion efficiently. The enhanced luminescence intensity and decay time of ternary C2-C5 complexes observed due to synergistic effect of anciliary ligands. The CIE color coordinates of complexes came under the green region of chromaticity diagram. The mechanistic investigation of intramolecular energy transfer in the complexes was discussed in detail. These terbium(III) complexes can be thrivingly used as one of the green component in light emitting material and in display devices. Graphical Abstract Illustrate the sensitization process of the Tb ion and intramolecular energy transfer process in the Tb 3+ complex.
International Nuclear Information System (INIS)
An Baoli; Gong Menglian; Cheah, Kok-Wai; Wong, Wai-Kwok; Zhang Jiming
2004-01-01
A novel organic ligand, 6-diphenylamine carbonyl 2-pyridine carboxylic acid (HDPAP), and the corresponding lanthanide complexes, tris(6-diphenylamine carbonyl 2-pyridine carboxylato) terbium(III) (Tb-DPAP) and tris(6-diphenylamine carbonyl 2-pyridine carboxylato) gadolinium(III) (Gd-DPAP) have been designed and synthesized. The crystal structure and photoluminescence of Tb-DPAP and Gd-DPAP have been studied. The results showed that the lanthanide complexes have electroneutral structures, and the solid terbium complex emits characteristic green fluorescence of Tb(III) ions at room temperature while the gadolinium complex emits the DPAP ligand phosphorescence. The lowest triplet level of DPAP ligand was calculated from the phosphorescence spectrum of Gd-DPAP in N,N-dimethyl formamide (DMF) dilute solution determined at 77 K, and the energy transfer mechanisms in the lanthanide complexes were discussed. The lifetimes of the 5 D 4 levels of Tb 3+ ions in the terbium complex were examined using time-resolved spectroscopy, and the values are 0.0153±0.0001 ms for solid Tb(DPAP) 3 ·11.5H 2 O and 0.074±0.007 ms for 2.5x10 -5 mol/l Tb-DPAP ethanol solution
Direct two-photon excitation of Sm3+, Eu3+, Tb3+, Tb.DOTA-, and Tb.propargylDO3A in solution
Sørensen, Thomas Just; Blackburn, Octavia A.; Tropiano, Manuel; Faulkner, Stephen
2012-07-01
We have observed direct two-photon excitation of samarium, europium and terbium ions in solution upon near IR excitation using a tuneable pulsed light source, and have also studied two-photon processes in a pair of related terbium complexes, namely [Tb.DOTA]- and Tb.propargylDO3A. Direct two-photon excitation of lanthanides is observed in simple systems in the absence of sensitizing chromophores. Where even simple chromophores such as a triple bond are present in the complex, then single and two-photon excitation of chromophore excited states competes with direct two-photon excitation of the ions and is the dominant pathway for sensitizing formation of the lanthanide excited state.
Directory of Open Access Journals (Sweden)
Sonia G. Andrade
1981-09-01
Full Text Available Fifteen albino (Sprague Dawley rats with subcutaneous transplanted fibromas was used in the present study. The tumour was formed by typical fibroblasts in a dense collagen matrix and was provenient from a fibroma that appeared spontaneously in an albino rat of the same strain. Ultrastructurally collagen disclosed normal periodicity and the fibroblasts showed irregular notched nuclei with irregular distribution of chromatin, that suggests transitional aspects to fibrosarcoma. The 15 animals, from different passage groups, were divided into: 8 animals submitted to treatment with the drug acexamic acid (CY-168F - N acetyl-amino-6-hexanoic acid (plastenan and 7 untreated control animals. Three of the treated animals showed a malignant transformation to fibrosarcoma. transitional histological features from typical fibroma to highly indifferentiated fibrosarcoma could be detected in come animal subjected to repeated biopsies. Ultrastructural study disclosed nuclear alterations and hyperactive ergastoplasm and collagen containing inclusions into the cytoplasm of fibroblasts. In the group of 7 untreated naimals, no malignant transformation could be detected histologically. Two aspects deserve attention: the malignant potential of a typical fibroma and the apparent effect of an antifibrosing drug in inducing malignization of this tumour.Foram utilizados no presente estudo, quinze ratos albinos (Sprague Dawley portadores de fibronas transplantados no tecido subcutâneo da parede abdominal. O tumor era constituído por fibroblastos típicos, em uma densa matriz colagênica e eram provenientes de um fibroma que apareceu espontaneamente em um rato albino da mesma linhagem. Ultraestruturalmente o colágeno mostrava periodicidade normal e os fibroblastos mostravam núcleo irregularmente denteado, com cromatina irregularmente distribuída, sugerindo aspectos transicionais para um fibrossarcoma. Os quinze animais, de diferentes grupos de passagem do tumor, foram
Ara, Ferdous; Qi, Zhi Kun; Hou, Jie; Komeda, Tadahiro; Katoh, Keiichi; Yamashita, Masahiro
2016-10-25
In this article, we investigate a single molecule magnet bis(phthalocyaninato)terbium(iii) (TbPc 2 ) molecule film by using low temperature STM. In order to investigate the effect of molecule-substrate interaction on the electronic and spin properties of the adsorbed molecule, we tune the molecule-substrate coupling by switching the substrate between Au(111) and Ag(111), the latter of which provides stronger interaction with the molecule than the former. Despite the enhanced chemical reactivity of the Ag(111) surface compared with Au(111), a well-organized pseudo-square film is formed. In addition, a checker-board type contrast variation is identified, which is well explained by the existence of two types of molecules whose rotational angle between the top and bottom Pc is θ = 45° (bright molecule) and θ = 30° (dark molecule). The expected stronger molecule-substrate interaction, however, appears as an intriguing dI/dV mapping image which reveals the spatial distribution of the density of states (DOS). We identify the contrast reversal in the dI/dV mapping for the molecules of θ = 45° and θ = 30° at the sample voltages of V = 0.7 eV and 1.1 eV. Combined with the density functional theory (DFT) calculation, we attribute this change to the shift of an electronic state due to the rotation of the mutual angle between the top and bottom Pc. For the spin behavior, we previously observed a Kondo resonance for the TbPc 2 molecule adsorbed on the Au(111) surface. On the Ag(111) surface, the Kondo resonance is hardly observed, which is due to the annihilation of the π radical spin by the charge transfer from the substrate to the molecule. Instead we observe a Kondo peak for the molecule on the second layer, for which the spin recovers due to the reduction of the coupling with the substrate. In addition, when a magnetic field of 2 T normal to the surface is applied, the second layer molecule shows a sharp dip at the Fermi level. We attribute this to the inelastic
RETRACTED: Granular and intergranular conduction in La1.32Sr1.68Mn2O7 layered manganite system
International Nuclear Information System (INIS)
Narjis, A.; El kaaouachi, A.; Dlimi, S.; Biskupski, G.; Daoudi, E.; Errai, M.; Sybous, A.; Limouny, L.
2013-01-01
This article has been retracted: please see Elsevier Policy on Article Withdrawal ( (http://www.elsevier.com/locate/withdrawalpolicy)). This article has been retracted at the request of the Editors. The authors have plagiarized part of a paper that had already appeared in J. Appl. Phys. 106, 093709 (2009); (10.1063/1.3256182) (6 pages): Title: Effects of pressure on charge transport and magnetic properties of La1.32Sr1.68Mn2O7 layered manganite by M. Kumaresavanji, M. S. Reis, Y. T. Xing, and M. B. Fontes. One of the conditions of submission of a paper for publication is that authors declare explicitly that their work is original and has not appeared in a publication elsewhere. Re-use of any data should be appropriately cited. As such this article represents a severe abuse of the scientific publishing system. The scientific community takes a very strong view on this matter and apologies are offered to readers of the journal that this was not detected during the submission process
Magnon Interactions in Terbium
DEFF Research Database (Denmark)
Nielsen, Mourits; Bjerrum Møller, Hans; Mackintosh, Allan
1970-01-01
Magnon energies and lifetimes have been studied in Tb and Tb-10% Ho single crystals by inelastic neutron scattering. The lifetimes of magnons propagating in the c-direction have been measured in the ferromagnetic phase of Tb, and are found to decrease with increasing temperature and wave......-vector, probably principally due to magnon-magnon interactions. The interaction of magnons with phonons has also been observed and the effect of Ho impurities on this interaction studied. In addition, excitations which are ascribed to local modes associated with the Ho ions have been observed. The dependence...... of the indirect exchange interaction on temperature in the alloy gives information on the mechanisms responsible for the transition from the helical to ferromagnetic structures. The dependence of the magnon energies on magnetic field at low temperatures gives detailed information on the role of magnetoelastic...
DEFF Research Database (Denmark)
Jensen, J.; Houmann, Jens Christian Gylden; Bjerrum Møller, Hans
1975-01-01
with the symmetry, we deduce the dispersion relation for the spin waves in a basal-plane ferromagnet. This phenomenological spin-wave theory accounts for the observed behavior of the magnon energies in Tb. The two q⃗-dependent Bogoliubov components of the magnon energies are derived from the experimental results......, which are corrected for the effect of the direct coupling between the magnons and the phonons, and for the field dependence of the relative magnetization at finite temperatures. A large q⃗-dependent difference between the two energy components is observed, showing that the anisotropy of the two...
DEFF Research Database (Denmark)
Jensen, J.; Houmann, Jens Christian Gylden
1975-01-01
The selection rules for the linear couplings between magnons and phonons propagating in the c direction of a simple basal-plane hcp ferromagnet are determined by general symmetry considerations. The acoustic-optical magnon-phonon interactions observed in the heavy-rare-earth metals have been...... explained by Liu as originating from the mixing of the spin states of the conduction electrons due to the spin-orbit coupling. We find that this coupling mechanism introduces interactions which violate the selection rules for a simple ferromagnet. The interactions between the magnons and phonons propagating...... in the c direction of Tb have been studied experimentally by means of inelastic neutron scattering. The magnons are coupled to both the acoustic- and optical-transverse phonons. By studying the behavior of the acoustic-optical coupling, we conclude that it is a spin-mixed-induced coupling as proposed...
Combination of photosensitive elements for use in radiography
International Nuclear Information System (INIS)
Bollen, R.H.; Vandenabeele, H.
1976-01-01
A new and improved combination of photosensitive elements is proposed that can be used in radiography. The combination according to the invention is composed of an X-ray fluorescence intensifying screen and a photographic halide of silver containing a color coupler. The color coupler causes a negative silver image and a color image to be formed in the material. The fluorescent layer of the fluorescence screen contains a mixture of lanthanum oxychloride or lanthanum oxybromide activated with terbium or terbium and ytterbium. Detailed information about variants in the composition of the fluorescent substance, the grain sizes of the silver halides, variations of the color couplers and about the coating of the single layers is given. (UWI) [de
Energy Technology Data Exchange (ETDEWEB)
Wang Qiang [Department of Mechanical and Aerospace Engineering, Princeton University, Princeton, NJ 08544 (United States); You Yumin; Ludescher, Richard D. [Department of Food Science, Rutgers University, New Brunswick, NJ 08901 (United States); Ju Yiguang, E-mail: yju@princeton.ed [Department of Mechanical and Aerospace Engineering, Princeton University, Princeton, NJ 08544 (United States)
2010-06-15
Optically efficient cerium and terbium doped lanthanide fluoride (La{sub 1-x-y}Ce{sub x}Tb{sub y})F{sub 3} nanocrystals with different doping concentrations have been synthesized by a hydrothermal route in the presence of ethylenediamine tetraacetic acid disodium salt (EDTA). The results showed that the formation of nanocrystals with different morphologies depends on terbium ion Tb{sup 3+} doping concentration, but independent of cerium ion Ce{sup 3+} doping concentration. With increase in Tb{sup 3+} doping concentration, the morphologies of nanocrystals evolved from a spherical shape to a plated-like one. In addition, both the photoluminescence quantum yield (PL QY) and the fluorescence lifetime of nanocrystals increased with the increase in Ce{sup 3+} doping concentration in cerium and terbium co-doped system. The PL QY reached up to 55%, and the lifetime up to 7.3 ms. Transmission electron microscopy (TEM), X-ray diffraction (XRD), selected area electron diffraction (SAED), X-ray fluorescence (XRF), energy dispersive spectroscopy (EDS), ultraviolet-visible (UV-vis) absorption, photoluminescence (PL) and infrared (IR) spectroscopies were employed to characterize the properties of nanocrystals. The growth mechanism of nanocrystals with different morphologies and optical properties of nanocrystals with different doping concentrations were investigated.
Energy Technology Data Exchange (ETDEWEB)
Li, Minhong; Wang, LiLi; Ran, Weiguang; Ren, Chunyan; Song, Zeling; Shi, Jinsheng, E-mail: jsshiqn@aliyun.com
2017-04-15
Currently, the key change for white-LED is to improve the luminescence efficiency of red phosphor. Sm{sup 3+} activated phosphor was considered due to suitable emission position of red light. However, the luminescence intensity in the red region is weak. For enhancing red-emitting of Sm{sup 3+}, Bi{sup 3+} and Tb{sup 3+} ions were introduced into Ca{sub 2}Al{sub 2}SiO{sub 7}:Sm{sup 3+} phosphors based on the concept of energy transfer. For Ca{sub 2}Al{sub 2}SiO{sub 7}:Bi{sup 3+}, Sm{sup 3+} samples, it can be observed that the energy transfer process was blocked. Hence, Tb{sup 3+} was introduced into Ca{sub 2}Al{sub 2}SiO{sub 7}:Bi{sup 3+}, Sm{sup 3+} samples to increase Sm{sup 3+} luminescence intensity based on Bi{sup 3+}→Tb{sup 3+}→Sm{sup 3+} energy transfer process. Compared with Sm{sup 3+} single-doped Ca{sub 2}Al{sub 2}SiO{sub 7} phosphor, the luminescence intensity of Sm{sup 3+} was enhanced by 2.6 times. It can be found that Tb{sup 3+} ions play a role of storing the energy or transfer bridge from Bi{sup 3+}→ Sm{sup 3+} by investigating the Ca{sub 2}Al{sub 2}SiO{sub 7}:Bi{sup 3+}, Tb{sup 3+} and Ca{sub 2}Al{sub 2}SiO{sub 7}:Tb{sup 3+}, Sm{sup 3+} energy transfer mechanism. All these results suggest that terbium branch mechanism plays an important role on enhancing activators luminescence intensity.
Anisotropic bonded Sm2.3Fe16.8Zr0.2Ny magnets prepared by milling of as cast material
International Nuclear Information System (INIS)
Gebel, B.; Kubis, M.; Roessler, U.K.; Mueller, K.H.
2001-01-01
As cast Sm 2.3 Fe 16.8 Zr 0.2 material was milled for 100 min ≤ t ≤ 900 min. After annealing at 800 C for 1 h and subsequent nitrogenation, the samples were cold compacted in a magnetic field and resin bonded. The coercivity μ 0J H C of the samples increased from 0.59 T (t = 100 min) to 2.18 T (t = 900 min). On the other hand, the remanence along the texture axis decreased monotonically with increasing milling time due to the decrease of the degree of texture of the aligned powders. Prolonged milling leads finally to the formation of a soft magnetic phase as indicated by a shoulder in the demagnetization curve for t > 600 min. The highest energy product (BH) max of 50 kJm -3 (136 kJm -3 for the theoretical density of 7.7 gcm -3 ) was obtained for an intermediate milling time of 400 min. Zn bonding of the powders resulted in magnets with lower energy products but improved coercivities. (orig.)
Low temperature magnetoresistance in La1.32Sr1.68Mn2O7 layered manganite under hydrostatic pressure
International Nuclear Information System (INIS)
Kumaresavanji, M.; Fontes, M.B.
2010-01-01
The La 1.32 Sr 1.68 Mn 2 O 7 layered manganite system has been studied by the low temperature electrical resistance and magnetoresistance under hydrostatic pressure up to 25 kbar. We have observe both, a Curie temperature (T C ) and a metal-insulator transition (T MI ) at 118 K in the ambient pressure. The applied pressure shifts the T MI to higher temperature values and induces a second metal-insulator transition (T 2 MI ) at 90 K, in the temperature dependence of resistivity measurements. Also, the pressure suppresses the peak resistance abruptly at T C . When an external field of 5 T is applied, we have observed a large negative magnetoresistance of 300% at the transition temperature and a 128% at 4.5 K. However, the increased pressure decreases the magnetoresistance ratio gradually. When the pressure reaches its maximum available value of 25 kbar, the magnetoresistance ratio decreases at a rate of 1.3%/kbar. From our experimental results, the decrease of magnetoresistance ratio with pressure is explained by the pressure induced canted spin state which is not favor for the spin polarized intergrain tunneling in layered manganites.
Directory of Open Access Journals (Sweden)
Marzieh tavanaei
2017-02-01
Full Text Available Introduction: Heavy metals contamination due to natural and anthropogenic sources is a global environmental concern. Lead (Pb is one of the very toxic heavy metals. Industrial production processes and their emissions, mining operation, smelting, combustion sources and solid waste incinerators are the primary sources of lead. This heavy metal has aberrant effects on the environment and living organisms. Hence, proper treatment of lead from soil and industrial wastewaters is very important. In order to remove toxic heavy metals from contaminated water systems, conventional methods such as chemical precipitation, coagulation, ion exchange, solvent extraction and filtration, evaporation and membrane methods are being used. These conventional methods generally have high costs and technical problems. Therefore, biosorption processes, in which microorganisms are used as sorbents, have been considered as economical and environmentally friendly options for removal of heavy metals from aqueous solution. Clay minerals are another group of sorbents used in removal of heavy metals from polluted environments. Furthermore, bacterial cells can be attached on clay mineral surfaces and form bacteria-mineral composites. These composites adsorb heavy metals and convert them into forms with low mobility and bioavailability. Pseudomonas putida is a unique microorganism with a high tendency to sorb and/or degrade certain environmental pollutants. Palygorskite and sepiolite are the fibrous clay minerals of arid and semiarid regions; their structures consist of ribbons and channels. These fibrous minerals have various applications in industry and the environment because of its large surface area and high adsorption capacity. The present study was conducted in order to determine the ability of Pseudomonas putida (P168, and its composites with palygorskite and sepiolite in lead sorption. Materials and Methods: The bacterial strain used in the present study was Pseudomonas
International Nuclear Information System (INIS)
Klassen, Nikolay V.; Shmurak, Semion Z.; Shmyt'ko, Ivan M.; Strukova, Galina K.; Derenzo, Stephen E.; Weber, Marvin J.
2005-01-01
Lutetium and yttrium borates doped with europium, terbium, gadolinium, etc. have been synthesized by dissolving initial oxides and nitrates in ammonium nitrate melt and thermal decomposition of the solvent. Annealings in the range of 500-1100 deg. C modified the dimensions of the grains from 2 to 3 nm to more than 100 nm. Significant dependence of the structure of lutetium borate on slight doping with rare earth ions has been found: terbium makes high-temperature vaterite phase preferential at room temperature, whereas europium stabilizes low-temperature calcite phase. Influence of the structure of the borates on the pattern of the luminescence spectra of europium dopant was observed. Possibilities for manufacturing of scintillating lutetium borate ceramics by means of this method of synthesis are discussed
Klassen, Nikolay V.; Shmurak, Semion Z.; Shmyt'ko, Ivan M.; Strukova, Galina K.; Derenzo, Stephen E.; Weber, Marvin J.
2005-01-01
Lutetium and yttrium borates doped with europium, terbium, gadolinium, etc. have been synthesized by dissolving initial oxides and nitrates in ammonium nitrate melt and thermal decomposition of the solvent. Annealings in the range of 500-1100°C modified the dimensions of the grains from 2 to 3 nm to more than 100 nm. Significant dependence of the structure of lutetium borate on slight doping with rare earth ions has been found: terbium makes high-temperature vaterite phase preferential at room temperature, whereas europium stabilizes low-temperature calcite phase. Influence of the structure of the borates on the pattern of the luminescence spectra of europium dopant was observed. Possibilities for manufacturing of scintillating lutetium borate ceramics by means of this method of synthesis are discussed.
Hyperfine interactions measured by nuclear orientation technique
International Nuclear Information System (INIS)
Brenier, R.
1982-01-01
This report concerns the use of hyperfine interaction to magnetism measurements and to the determination of the nuclear structure of Terbium isotopes by the low temperature nuclear orientation technique. In the first part we show that the rhodium atom does not support any localized moment in the chromium matrix. The hyperfine magnetic field at the rhodium nuclear site follows the Overhauser distribution, and the external applied magnetic field supports a negative Knight shift of 16%. In the second part we consider the structure of neutron deficient Terbium isotopes. We introduce a coherent way of evaluation and elaborate a new nuclear thermometer. The magnetic moments allows to strike on the studied states configuration. The analysis of our results shows a decrease of the nuclear deformation for the lighter isotopes [fr
Directory of Open Access Journals (Sweden)
A. Rouillard
2004-12-01
Full Text Available An understanding of how the heliosphere modulates galactic cosmic ray (GCR fluxes and spectra is important, not only for studies of their origin, acceleration and propagation in our galaxy, but also for predicting their effects (on technology and on the Earth's environment and organisms and for interpreting abundances of cosmogenic isotopes in meteorites and terrestrial reservoirs. In contrast to the early interplanetary measurements, there is growing evidence for a dominant role in GCR shielding of the total open magnetic flux, which emerges from the solar atmosphere and enters the heliosphere. In this paper, we relate a strong 1.68-year oscillation in GCR fluxes to a corresponding oscillation in the open solar magnetic flux and infer cosmic-ray propagation paths confirming the predictions of theories in which drift is important in modulating the cosmic ray flux. Key words. Interplanetary physics (Cosmic rays, Interplanetary magnetic fields
García-Caballero, Tomás; Grabau, Dorthe; Green, Andrew R; Gregory, John; Schad, Arno; Kohlwes, Elke; Ellis, Ian O; Watts, Sarah; Mollerup, Jens
2010-01-01
García-Caballero T, Grabau D, Green A R, Gregory J, Schad A, Kohlwes E, Ellis I O, Watts S & Mollerup J (2010) Histopathology56, 472–480 Determination of HER2 amplification in primary breast cancer using dual-colour chromogenic in situ hybridization is comparable to fluorescence in situ hybridization: a European multicentre study involving 168 specimens Aims: Fluorescence in situ hybridization (FISH) can be used to reveal several genomic imbalances relevant to proper cancer diagnosis and to the correct treatment regime. However, FISH requires expensive and advanced fluorescence microscopes in addition to expertise in fluorescence microscopy. To determine whether a newly developed dual-colour chromogenic in situ hybridization (CISH) method is a suitable alternative to FISH, we analysed the human epidermal growth factor receptor 2 gene (HER2) amplification level of 168 breast cancer specimens using dual-colour CISH and FISH and compared the results. Methods and results: We found 100% agreement between HER2 status determined by FISH and dual-colour CISH. Furthermore, we observed that the time used to score slides was significantly reduced by 28% in dual-colour CISH compared with the FISH protocol. Concordance between HER2 protein status and dual-colour CISH or FISH was equally good with an overall agreement of 96.8%. Correlation between the HER2/centromere 17 gene ratios obtained with dual-colour CISH and FISH was highly significant with an overall correlation coefficient (ρ) of 0.96. Conclusions: We conclude that dual-colour CISH and bright field microscopy are excellent alternatives to FISH when analysing the HER2 status of primary breast cancer. PMID:20459554
Neutron and X-ray small angle scattering (S.A.S.) study of the amorphous alloy Tbsub(.25)Cusub(.75)
International Nuclear Information System (INIS)
Boucher, B.
1980-07-01
The magnetic properties of amorphous alloys REsub(x) Msub(x-1) (R.E.=heavy rare earths, M=Cu, Ag, Au) have been widely studied. They are of the speromagnetic type for x>=0.33 and are mictomagnetic for x -12 cm). Also the atomic volume of Terbium (approximately 33 A 3 ) is almost three times that of Copper (11.8 A 3 ) and Cu is less absorbant than Ag or Au. Tb alloys exhibit high magnetic ordering temperatures and important moments in contrast to the majority of other alloys of the same family. One inconvenience with Terbium, however, is the large (X-ray) fluorescence (lambda Cu). In order to confirm some interpretations of S.A.S., we were obliged to determine some physical parameters such as the density and porosity and to examine the sample with microscope. These results are also given here
Energy Technology Data Exchange (ETDEWEB)
Esparza G, A.E.; Garcia, M.; Falcony, C.; Azorin N, J. [CICATA-IPN, Legaria 694, Col. Irrigacion, 11500 Mexico D.F. (Mexico)
2000-07-01
In this work the photo luminescent and cathode luminescent characteristics of aluminium oxide (Al{sub 2}O{sub 3}) powders impurified with terbium (Tb) were studied for their use in dosimetry. The optical, structural, morphological characteristics of the powders as function of variation in the impurity concentration and the annealing temperature will be presented. As regards the optical properties of powders (photoluminescence and cathode luminescence) it was observed a characteristic emission associated with radiative transitions between electron energy levels of terbium, the spectra associated with this emission consists of several peaks associated with such transitions. In the structural and morphological characterization (X-ray diffraction and scanning electron microscopy) it was appreciated that in accordance the annealing temperature of powders is augmented it is evident the apparition of certain crystalline phases. The results show that this is a promissory material for radiation dosimetry. (Author)
Luminescent properties of Al2O3: Tb powders
International Nuclear Information System (INIS)
Esparza G, A.E.; Garcia, M.; Falcony, C.; Azorin N, J.
2000-01-01
In this work the photo luminescent and cathode luminescent characteristics of aluminium oxide (Al 2 O 3 ) powders impurified with terbium (Tb) were studied for their use in dosimetry. The optical, structural, morphological characteristics of the powders as function of variation in the impurity concentration and the annealing temperature will be presented. As regards the optical properties of powders (photoluminescence and cathode luminescence) it was observed a characteristic emission associated with radiative transitions between electron energy levels of terbium, the spectra associated with this emission consists of several peaks associated with such transitions. In the structural and morphological characterization (X-ray diffraction and scanning electron microscopy) it was appreciated that in accordance the annealing temperature of powders is augmented it is evident the apparition of certain crystalline phases. The results show that this is a promissory material for radiation dosimetry. (Author)
Are LOD and LOQ Reliable Parameters for Sensitivity Evaluation of Spectroscopic Methods?
Ershadi, Saba; Shayanfar, Ali
2018-03-22
The limit of detection (LOD) and the limit of quantification (LOQ) are common parameters to assess the sensitivity of analytical methods. In this study, the LOD and LOQ of previously reported terbium sensitized analysis methods were calculated by different methods, and the results were compared with sensitivity parameters [lower limit of quantification (LLOQ)] of U.S. Food and Drug Administration guidelines. The details of the calibration curve and standard deviation of blank samples of three different terbium-sensitized luminescence methods for the quantification of mycophenolic acid, enrofloxacin, and silibinin were used for the calculation of LOD and LOQ. A comparison of LOD and LOQ values calculated by various methods and LLOQ shows a considerable difference. The significant difference of the calculated LOD and LOQ with various methods and LLOQ should be considered in the sensitivity evaluation of spectroscopic methods.
On possibility of transuranium element by the method of transport reactions
International Nuclear Information System (INIS)
Sinitsyna, G.S.; Krashenitsyn, G.N.; Shestakov, B.I.
1983-01-01
A possibility to use chemical transport reaction for separation of uranium, plutonium and some transplutonium elements is shown. The method is based on the use of the known plutonium property to form tetrachloride existing only in the gaseous phase in chlorine atmosphere, which is transported ever the temperature gradiept. Two ways of transport reaction realization - the method of flow and the method of diffusion in closed volume are tested. The experiments are made using specially synthesized plutonium dioxide, containing uranium, americium, curium, lanthanum, terbium, barium. Chlorination is realized by the mixture of chlorine and carbon tetrachloride at temperatures 723-953 K. Plutonium trichloride is deposited in the range 613-653 K, uranium - in the range 473-523 K, curium, americium, lanthanum, terbium, barium remain in the start zone if its temperature does not exceed 873 K
Radio-luminescence efficiency and rare-earth dispersion in Tb-doped silica glasses
Czech Academy of Sciences Publication Activity Database
Fasoli, M.; Moretti, F.; Lauria, A.; Chiodini, N.; Vedda, A.; Nikl, Martin
2007-01-01
Roč. 42, - (2007), s. 784-787 ISSN 1350-4487 Institutional research plan: CEZ:AV0Z10100521 Keywords : sol-gel * scintillators * silica * rare earths * terbium Subject RIV: BM - Solid Matter Physics ; Magnetism Impact factor: 1.054, year: 2007
African Journals Online (AJOL)
USER
2014-12-02
Dec 2, 2014 ... 2Applied Plant Anatomy and Wood Technology Laboratory, Department Of Plant Biology, University Of Ilorin, ... Fresh flowers of five species of Amaranthus were studied and documented in detail using light ... problems related to the origin and evolution of many taxa (Nair, 1980) and provide classification of.
Performance of 20 Ci 137Cs γ-ray Compton spectrometer for the ...
Indian Academy of Sciences (India)
of the machine is assessed using aluminum, terbium and mercury samples and the exper- imental data from ... keV) are used. This is particularly true in the case of heavy elements ... In this paper, a design with optimum choice of experimental.
Energy Technology Data Exchange (ETDEWEB)
Narjis, A., E-mail: NARJIS78@gmail.com [Research Group ESNPS, Physics department, University Ibn Zohr, Faculty of Sciences, B.P 8106, Hay Dakhla, 80000 Agadir (Morocco); El kaaouachi, A.; Dlimi, S. [Research Group ESNPS, Physics department, University Ibn Zohr, Faculty of Sciences, B.P 8106, Hay Dakhla, 80000 Agadir (Morocco); Biskupski, G. [Laboratoire de Spectroscopie Hertzienne LSH, Bâtiment P5, Université des Sciences et Technologies, de Lille I 59 655 Villeneuve d’Ascq Cedex (France); Daoudi, E.; Errai, M.; Sybous, A.; Limouny, L. [Research Group ESNPS, Physics department, University Ibn Zohr, Faculty of Sciences, B.P 8106, Hay Dakhla, 80000 Agadir (Morocco)
2013-06-15
This article has been retracted: please see Elsevier Policy on Article Withdrawal ( (http://www.elsevier.com/locate/withdrawalpolicy)). This article has been retracted at the request of the Editors. The authors have plagiarized part of a paper that had already appeared in J. Appl. Phys. 106, 093709 (2009); (10.1063/1.3256182) (6 pages): Title: Effects of pressure on charge transport and magnetic properties of La1.32Sr1.68Mn2O7 layered manganite by M. Kumaresavanji, M. S. Reis, Y. T. Xing, and M. B. Fontes. One of the conditions of submission of a paper for publication is that authors declare explicitly that their work is original and has not appeared in a publication elsewhere. Re-use of any data should be appropriately cited. As such this article represents a severe abuse of the scientific publishing system. The scientific community takes a very strong view on this matter and apologies are offered to readers of the journal that this was not detected during the submission process.
Starobor, Aleksey; Palashov, Oleg
2018-04-01
Thermal effects in terbium aluminum garnet (TAG) ceramics (thermal lens and thermally induced depolarization) doped with silicon and titanium were investigated in temperature range of 79-293K. Samples with low dopant concentrations shows decreasing of negative thermal effects with cooling to 79 K. However for most part of samples thermal depolarization starts increasing after initial decreasing with cooling. Apparently it is connected with defects in media. Best sample (0.4 at% of Si) as pure TAG shows monotonous decreasing of thermally induced depolarization and 3.5 times Verdet constant increasing with cooling to 79 K, that leads to 1.8-times advantage over common magnetooptical media - terbium gallium garnet. It allows to provide an isolation of 30 dB at a radiation power of more than 6 kW as estimated. However, the procedure for creating ceramics samples obviously needs improvement because of the large scatter in the quality of the samples.
Cerium fluoride nanoparticles protect cells against oxidative stress
International Nuclear Information System (INIS)
Shcherbakov, Alexander B.; Zholobak, Nadezhda M.; Baranchikov, Alexander E.; Ryabova, Anastasia V.; Ivanov, Vladimir K.
2015-01-01
A novel facile method of non-doped and fluorescent terbium-doped cerium fluoride stable aqueous sols synthesis is proposed. Intense green luminescence of CeF 3 :Tb nanoparticles can be used to visualize these nanoparticles' accumulation in cells using confocal laser scanning microscopy. Cerium fluoride nanoparticles are shown for the first time to protect both organic molecules and living cells from the oxidative action of hydrogen peroxide. Both non-doped and terbium-doped CeF 3 nanoparticles are shown to provide noteworthy protection to cells against the vesicular stomatitis virus. - Highlights: • Facile method of CeF 3 and CeF 3 :Tb stable aqueous sols synthesis is proposed. • Naked CeF 3 nanoparticles are shown to be non-toxic and to protect cells from the action of H 2 O 2 . • CeF 3 and CeF 3 :Tb nanoparticles are shown to protect living cells against the vesicular stomatitis virus
The use of rare earth radiotracers in the study of solvent extraction kinetics
International Nuclear Information System (INIS)
Lim, T.M.; Tran, T.
1993-01-01
The suitability of rare earth radionuclides as tracers in research and industry are assessed. In general, the most desirable characteristics of radiotracers for process studies are a half-life in the range 5-200 days, a high yield, high energy γ-emission and low cost of production. The majority of rare earths have at least one radionuclide with acceptable characteristics. The application of radiotracers to the study of kinetics of rare earth solvent extraction have been studied using a modified Lewis cell. Terbium-160 was selected as the most suitable rare earth radionuclide for our experiments. Samples of both aqueous and organic phases were continuous withdrawn, monitored using an automated γ-counting system based on two sodium iodide detectors and then pumped back to the Lewis cell. Excellent results were obtained and the rate of extraction was shown to be first order with respect to the terbium concentration. 6 refs., 1 tab., 7 figs
International Nuclear Information System (INIS)
Galand, E.; Niezette, J.; Vanderschueren, J.
1993-01-01
Lyoluminescence (LL) of several carbohydrates and amino acids has been measured in water for a γ dose of respectively, 20 Gy and 50 Gy. It has been demonstrated that the LL yield depends markedly not only on the nature of the LL material but also on its commercial origin. By using solutions of organic dyes such as eosin B, rhodamine B or fluorescein, a substantial enhancement of LL has been observed with carbohydrates. Concentration effect has been investigated and maximum LL yields have been observed in the range 10 -5 -10 -4 mol. On the other hand, LL of amino acids has been increased by the use of rare earth ion solutions. Dysprosium, europium and terbium solutions have been used, but it has been proved that terbium nitrate is the most appropriate solution. Concentration effect has been studied for several amino acids and dosimetric response of glutamine has been investigated with different rare earth ions solutions. (Author)
Cerium fluoride nanoparticles protect cells against oxidative stress
Energy Technology Data Exchange (ETDEWEB)
Shcherbakov, Alexander B.; Zholobak, Nadezhda M. [Zabolotny Institute of Microbiology and Virology, National Academy of Sciences of Ukraine, Kyiv D0368 (Ukraine); Baranchikov, Alexander E. [Kurnakov Institute of General and Inorganic Chemistry of the Russian Academy of Sciences, Moscow 119991 (Russian Federation); Ryabova, Anastasia V. [Prokhorov General Physics Institute of the Russian Academy of Sciences, Moscow 119991 (Russian Federation); National Research Nuclear University MEPhI (Moscow Engineering Physics Institute), Moscow 115409 (Russian Federation); Ivanov, Vladimir K., E-mail: van@igic.ras.ru [Kurnakov Institute of General and Inorganic Chemistry of the Russian Academy of Sciences, Moscow 119991 (Russian Federation); National Research Tomsk State University, Tomsk 634050 (Russian Federation)
2015-05-01
A novel facile method of non-doped and fluorescent terbium-doped cerium fluoride stable aqueous sols synthesis is proposed. Intense green luminescence of CeF{sub 3}:Tb nanoparticles can be used to visualize these nanoparticles' accumulation in cells using confocal laser scanning microscopy. Cerium fluoride nanoparticles are shown for the first time to protect both organic molecules and living cells from the oxidative action of hydrogen peroxide. Both non-doped and terbium-doped CeF{sub 3} nanoparticles are shown to provide noteworthy protection to cells against the vesicular stomatitis virus. - Highlights: • Facile method of CeF{sub 3} and CeF{sub 3}:Tb stable aqueous sols synthesis is proposed. • Naked CeF{sub 3} nanoparticles are shown to be non-toxic and to protect cells from the action of H{sub 2}O{sub 2}. • CeF{sub 3} and CeF{sub 3}:Tb nanoparticles are shown to protect living cells against the vesicular stomatitis virus.
Energy Technology Data Exchange (ETDEWEB)
Gebel, B.; Kubis, M.; Roessler, U.K.; Mueller, K.H. [Institut fuer Festkoerper- und Werkstofforschung Dresden e.V. (Germany). Inst. fuer Metallische Werkstoffe
2001-07-01
As cast Sm{sub 2.3}Fe{sub 16.8}Zr{sub 0.2} material was milled for 100 min {<=} t {<=} 900 min. After annealing at 800 C for 1 h and subsequent nitrogenation, the samples were cold compacted in a magnetic field and resin bonded. The coercivity {mu}{sub 0J}H{sub C} of the samples increased from 0.59 T (t = 100 min) to 2.18 T (t = 900 min). On the other hand, the remanence along the texture axis decreased monotonically with increasing milling time due to the decrease of the degree of texture of the aligned powders. Prolonged milling leads finally to the formation of a soft magnetic phase as indicated by a shoulder in the demagnetization curve for t > 600 min. The highest energy product (BH){sub max} of 50 kJm{sup -3} (136 kJm{sup -3} for the theoretical density of 7.7 gcm{sup -3}) was obtained for an intermediate milling time of 400 min. Zn bonding of the powders resulted in magnets with lower energy products but improved coercivities. (orig.)
Tuning the activity of Pt alloy electrocatalysts by means of the lanthanide contraction
DEFF Research Database (Denmark)
Escribano, Maria Escudero; Malacrida, Paolo; Hansen, Martin Hangaard
2016-01-01
is lanthanum, cerium, samarium, gadolinium, terbium, dysprosium, thulium, or calcium. The materials are among the most active polycrystalline Pt-based catalysts reported, presenting activity enhancement by a factor of 3 to 6 over Pt. The active phase consists of a Pt overlayer formed by acid leaching. The ORR...
Spin-glass transition in disordered terbium
International Nuclear Information System (INIS)
Hauser, J.J.
1985-01-01
While crystalline Tb is a helix antiferromagnet with a Neel temperature of 229 K which becomes ferromagnetic at 222 K, disordered Tb exhibits a spin-glass transition. The spin-glass freezing temperature ranges from 183 to 53 K, the lowest temperatures corresponding to the greatest degree of atomic disorder. These experiments constitute the first evidence for an elemental spin-glass. (author)
Spectroscopic analysis of lithium terbium tetrafluoride
DEFF Research Database (Denmark)
Christensen, H.P.
1978-01-01
The absorption spectra of Tb3+ in LiTbF4 have been recorded in the spectral interval from 4000 to 25000 cm-1 and for temperatures between 2.3 and 150 K. This covers the transitions from the ground multiplet 7F6 to the multiplets 7F3, 7F2, 7F1, 7F0, and 5D4. The transitions were predominantly of e...
Indian Academy of Sciences (India)
Recently there has been a spurt in studies on heavy rare earth metals because of the magnon-phonon interactions observed in them. The phonon dispersion relations in terbium have been investigated by Houmann and Nicklow (1970) and by Menon and. Rao (1972). The magnon dispersion relations have been measured ...
Rare earth oxyhalogenide base thermoluminescent material
International Nuclear Information System (INIS)
Rabatin, J.G.
1976-01-01
A process is described that consists to expose a thermoluminescent material to ionizing radiations, the material being a rare earth oxyhalogenide with terbium additions, to heat this material up to the emission of visible radiations and to measure the emitted radiations which are proportional to the ionizing radiation dose [fr
International Nuclear Information System (INIS)
Nettles, W.G.
1979-01-01
Alpha scattering measurements were performed at center-of-mass energies near the Coulomb barrier. These energies allow for nuclear as well as pure Coulomb forces to play a significant role in the excitation process. The interference of these two forces is very sensitive to the sign of the E4 ground-state moment, whereas pure Coulomb excitation is not. Systematics of the E4 moments of the rare earth mass region indicate a transition in the magnitude and sign of the reduced matrix element of the M(E4) operator between 0 + and 4 + states from small and positive to large and negative between Yb and W. Previous Coulomb-nuclear interference measurements show that this reduced matrix element for 180 Hf is large and negative. The present results agree with that conclusion. It is also shown that the above reduced matrix element for 178 Hf, like that of 180 Hf, is large and negative. The small and positive moment (matrix element) for 168 Yb is seen to be consistent with the experimental data. No conclusions are drawn for the E4 moment in 176 Hf. The measurement of nuclear lifetimes shorter than 500 ps requires the use of plastic scintilltor detectors. These detectors, however have very poor energy resolution. A system is described that uses plastic scintillators with a magnetic lens spectrometer for energy selection. The system was used to measure the lifetime of the 522-keV 0 + sate in 186 Hf. A data analysis method using higher-order distribution moments is also presented
Energy Technology Data Exchange (ETDEWEB)
U.S. Department of Energy, National Nuclear Security Administration Nevada
2001-11-21
This Corrective Action Investigation Plan contains the U.S. Department of Energy, National Nuclear Security Administration Nevada Operations Office's approach to collect data necessary to evaluate corrective action alternatives appropriate for the closure of Corrective Action Unit 168 under the Federal Facility Agreement and Consent Order. Corrective Action Unit 168 consists of a group of twelve relatively diverse Corrective Action Sites (CASs 25-16-01, Construction Waste Pile; 25-16-03, MX Construction Landfill; 25-19-02, Waste Disposal Site; 25-23-02, Radioactive Storage RR Cars; 25-23-18, Radioactive Material Storage; 25-34-01, NRDS Contaminated Bunker; 25-34-02, NRDS Contaminated Bunker; CAS 25-23-13, ETL - Lab Radioactive Contamination; 25-99-16, USW G3; 26-08-01, Waste Dump/Burn Pit; 26-17-01, Pluto Waste Holding Area; 26-19-02, Contaminated Waste Dump No.2). These CASs vary in terms of the sources and nature of potential contamination. The CASs are located and/or associated wit h the following Nevada Test Site (NTS) facilities within three areas. The first eight CASs were in operation between 1958 to 1984 in Area 25 include the Engine Maintenance, Assembly, and Disassembly Facility; the Missile Experiment Salvage Yard; the Reactor Maintenance, Assembly, and Disassembly Facility; the Radioactive Materials Storage Facility; and the Treatment Test Facility Building at Test Cell A. Secondly, the three CASs located in Area 26 include the Project Pluto testing area that operated from 1961 to 1964. Lastly, the Underground Southern Nevada Well (USW) G3 (CAS 25-99-16), a groundwater monitoring well located west of the NTS on the ridgeline of Yucca Mountain, was in operation during the 1980s. Based on site history and existing characterization data obtained to support the data quality objectives process, contaminants of potential concern (COPCs) for CAU 168 are primarily radionuclide; however, the COPCs for several CASs were not defined. To address COPC
Viscosity measurements of molten refractory metals using an electrostatic levitator
International Nuclear Information System (INIS)
Ishikawa, Takehiko; Paradis, Paul-François; Okada, Junpei T; Watanabe, Yuki
2012-01-01
Viscosities of several refractory metals (titanium, nickel, zirconium, niobium, ruthenium, rhodium, hafnium, iridium and platinum) and terbium have been measured by the oscillation drop method with an improved procedure. The measured data were less scattered than our previous measurements. Viscosities at their melting temperatures showed good agreement with literature values and some predicted values. (paper)
Dezi, Anna; Monachesi, Elenasophie; D'Ignazio, Michela; Scalise, Lorenzo; Montalto, Luigi; Paone, Nicola; Rinaldi, Daniele; Mengucci, Paolo; Loudos, George; Bakas, Athanasios; Michail, Christos; Valais, Ioannis; Fountzoula, Christine; Fountos, George; David, Stratos
2017-11-01
Rare earth activators are impurities added in the phosphor material to enhance probability of visible photon emission during the luminescence process. The main activators employed are rare earth trivalent ions such as Ce+3, Tb+3, Pr3+ and Eu+3. In this work, four terbium-activated Gd2O2S (GOS) powder screens with different thicknesses (1049 mg/cm2, 425.41 mg/cm2, 313 mg/cm2 and 187.36 mg/cm2) and one europium-activated GOS powder screen (232.18 mg/cm2) were studied to investigate possible applications for general radiology detectors. Results presented relevant differences in crystallinity between the GOS:Tb doped screens and GOS:Eu screens in respect to the dopant agent present. The AE (Absolute efficiency) was found to rise (i) with the increase of the X-ray tube voltage with the highest peaking at 110kVp and (ii) with the decrease of the thickness among the four GOS:Tb. Comparing similar thickness values, the europium-activated powder screen showed lower AE than the corresponding terbium-activated.
International Nuclear Information System (INIS)
2010-01-01
AREVA generated consolidated revenue of 6.168 billion euros over the first nine months of 2010 for growth of 6.3% (+5.2% like-for-like) compared with the same period in 2009. The main revenue growth engines were the Reactors and Services Business Group and the Back End Business Group, with growth of 11.5% and 7.1% respectively. Foreign exchange had a positive impact of 82 million euros over the period, while changes in consolidation scope had negligible impact. Third quarter 2010 revenue amounted to 2.011 billion euros for growth of 6.1% (+4.4% LFL) compared with the third quarter of 2009. The Reactors and Services Business Group and the Back End Business Group, posting increases of 11.2% and 9.0% respectively, continued to lead this growth. Foreign exchange had a positive impact of 39 million euros, while changes in consolidation scope had negligible impact. The group's backlog came to 42.7 billion euros at September 30, 2010, an increase of 2.2% compared with September 30, 2009 (41.8 billion euros). For the full year of 2010, the group confirms its outlook for significant revenue and backlog growth, increased operating performance excluding particular items, negative operating income, and strong growth in net income attributable to owners of the group with the contribution of the gain on the sale of the Transmission and Distribution business
International Nuclear Information System (INIS)
Huray, P.G.; Nave, S.E.
1984-01-01
Measurements of the magnetic properties of dhcp californium-249 metal indicated the presence of three regions of differing magnetic character. Additional measurements are also reported. Magnetic moments and valence states of terbium in TbF 3 , BaTbO 3 , and TbO 1 8 are discussed. Progress on high-field operation of the micro-magnetic susceptometer is reported
Charge Carrier Trapping Processes in RE2O2S (RE = La, Gd, Y, and Lu)
Luo, H.; Bos, A.J.J.; Dorenbos, P.
2017-01-01
Two different charge carrier trapping processes have been investigated in RE2O2S:Ln3+ (RE = La, Gd, Y, and Lu; Ln = Ce, Pr, and Tb) and RE2O2S:M (M = Ti4+ and Eu3+). Cerium, praseodymium and terbium act as recombination centers and hole trapping centers while host intrinsic defects provide the
Wong, Martin Chi-Sang; Chan, Chun-Hei; Cheung, Wilson; Fung, Din-Hei; Liang, Miaoyin; Huang, Jason Li-Wen; Wang, Yan-Hong; Jiang, Johnny Yu; Yu, Chun-Pong; Wang, Harry Haoxiang; Wu, Justin Che-Yuen; Chan, Francis Ka-Leung; Sung, Joseph Jao-Yiu
2018-01-01
The objective of this meta-analysis is to evaluate the odds of colorectal adenoma (CRA) in colorectal cancer screening participants with different body mass index (BMI) levels, and examine if this association was different according to gender and ethnicity. The EMBASE and MEDLINE were searched to enroll high quality observational studies that examined the association between investigator-measured BMI and colonoscopy-diagnosed CRA. Data were independently extracted by two reviewers. A random-effects meta-analysis was conducted to estimate the summary odds ratio (SOR) for the association between BMI and CRA. The Cochran's Q statistic and I 2 analyses were used to assess the heterogeneity. A total of 17 studies (168,201 subjects) were included. When compared with subjects having BMI CRA (SOR 1.44, 95% CI 1.30-1.61; I 2 = 43.0%). Subjects with BMI ≥ 30 had similarly higher risk of CRA (SOR 1.42, 95% CI 1.24-1.63; I 2 = 18.5%). The heterogeneity was mild to moderate among studies. The associations were significantly higher than estimates by previous meta-analyses. There was no publication bias detected (Egger's regression test, p = 0.584). Subgroup analysis showed that the magnitude of association was significantly higher in female than male subjects (SOR 1.43, 95% CI 1.30-1.58 vs. SOR 1.16, 95% CI 1.07-1.24; different among different ethnic groups (SOR 1.72, 1.44 and 0.88 in White, Asians and Africans, respectively) being insignificant in Africans; and no difference exists among different study designs. In summary, the risk conferred by BMI for CRA was significantly higher than that reported previously. These findings bear implications in CRA risk estimation.
International Nuclear Information System (INIS)
Bohle, D.
1985-01-01
By inelastic electron scattering with high energy resolution a new magnetic dipole mode in heavy, deformed nuclei could be detected. For this the nuclei 154 Sm, 156 Gd, 158 Gd, 164 Dy, 168 Er, and 174 Yb were studied at the Darmstadt electron linear accelerator (DALINAC) at small momentum transfer q ≤ 0.6 fm -1 and low excitation energies. A collective magnetic dipole excitation could be discovered in all nuclei at an excitation energy of E x ≅ 66 δA -1/3 MeV whereby δ means the mass deformation. The transition strength extends in the mean to B(M1)↑ ≅ 1.3 μ N 2 . A systematic study of the nucleus 156 Gd yielded hints to a strong fragmentation of the magnetic dipole strength. A comparison of electron scattering, proton scattering, and nuclear resonance fluorescence experiments shows that the new mode is a pure orbital mode. (orig./HSI) [de
Feng, Yue; Liu, Song; Jiao, Yun; Gao, Hui; Wang, Miao; Du, Guocheng; Chen, Jian
2017-02-01
L-asparaginase (EC 3.5.1.1, ASN) exhibits great commercial value due to its uses in the food and medicine industry. In this study, we reported the enhanced expression of type II ASN from Bacillus subtilis 168 in B. subtilis WB600 through a combined strategy. First, eight signal peptides (the signal peptide of the ASN, ywbN, yvgO, amyE, oppA, vpr, lipA, and wapA) were used for ASN secretion in B. subtilis by using Hpa II promoter, respectively. The signal peptide wapA achieved the highest extracellular ASN activity (28.91 U/mL). Second, Hpa II promoter was replaced by a strong promoter, P43 promoter, resulting in 38.1 % enhanced ASN activity. By two rounds of error-prone PCR mutation, the P43 promoter variants with remarkably enhanced strength (D7, E2, H6, B2, and F3) were identified. B2 (-28: A → G, -13: A → G) achieved ASN activity up to 51.13 U/mL. Third, after deletion of the N-terminal 25-residues, ASN activity reached 102.41 U/mL, which was 100 % higher than that of the intact ASN. At last, the extracellular ASN of the B. subtilis arrived at 407.6 U/mL (2.5 g/L of ASN protein) in a 3-L bioreactor by using a fed-batch strategy. The purified ASN showed maximal activity at 65 °C and its half-life at 65 °C was 61 min. The K m and k cat of the ASN were 5.29 mM and 54.4 s -1 , respectively. To the best of our knowledge, we obtained the highest yield of ASN in a food-grade host ever reported, which may benefit the industrial production and application of ASN.
Coherent magnetic structures in terbium/holmium superlattices
DEFF Research Database (Denmark)
Bryn-Jacobsen, C.; Cowley, R.A.; McMorrow, D.F.
1997-01-01
to 230 K, two samples retain this magnetic structure while the third undergoes a transition first to a mixed phase of helically and ferromagnetically ordered Tb moments, then to a phase with only helically ordered To moments. Ln all cases, the magnetic ordering is found to be long ranged, with coherence...
Magnon energies and exchange interactions in terbium
DEFF Research Database (Denmark)
Houmann, Jens Christian Gylden
1968-01-01
The magnon density of states, and hence the magnetic contribution to the specific heat, and also the exchange interaction between ions in the same sublattice have been calculated for Tb at 90°K, using experimental results obtained by inelastic neutron scattering.......The magnon density of states, and hence the magnetic contribution to the specific heat, and also the exchange interaction between ions in the same sublattice have been calculated for Tb at 90°K, using experimental results obtained by inelastic neutron scattering....
Magnon lifetimes in terbium at low temperatures
International Nuclear Information System (INIS)
Bjerrum Moeller, H.; Mackintosh, A.R.
1979-01-01
The lifetimes of magnons propagating in the c-direction of Tb at 4.2 K have been measured by inelastic neutron scattering. In contrast to the behaviour at higher temperatures, where magnon-magnon scattering predominates, the broadening of the magnons increases towards the boundary of the single Brillouin zone, both in the acoustic and optical branches. This suggests that the scattering of the magnons by conduction electrons is important, and the observed lifetimes are consistent with a recent estimate of the magnitude of this effect. The acoustic magnons of very long wavelength behave anomalously, presumably due to dipolar interactions
Test plan for air monitoring during the Cryogenic Retrieval Demonstration
International Nuclear Information System (INIS)
Yokuda, E.
1992-06-01
This report presents a test plan for air monitoring during the Cryogenic Retrieval Demonstration (CRD). Air monitors will be used to sample for the tracer elements neodymium, terbium, and ytterbium, and dysprosium. The results from this air monitoring will be used to determine if the CRD is successful in controlling dust and minimizing contamination. Procedures and equipment specifications for the test are included
International Nuclear Information System (INIS)
Rabatin, J.G.
1984-01-01
Oxyhalides of lanthanum, gadolinium and lutetium coactivated with a first activator selected from bismuth and samarium to provide the color of light emission and a second coactivator (e.g. terbium or praseodymium) which increases the amount of stored energy in a stored radiographic latent image are found to be superior in their conversion efficiency of x-rays to visible light. (author)
International Nuclear Information System (INIS)
Paganini, Paula Pinheiro
2012-01-01
This work presents the synthesis, characterization and photo luminescent study of tin and titanium mixed oxide nanoparticles doped with europium, terbium and neodymium to be used with luminescent markers on biological systems. The syntheses were done by co-precipitation, protein sol-gel and Pechini methods and the nanoparticles were characterized by infrared spectroscopy, thermogravimetric analysis, scanning electron microscopy, X-ray diffraction and X-ray absorption spectroscopy. The photo luminescent properties studies were conducted for luminophores doped with europium, terbium and neodymium synthesized by coprecipitation method. For luminophore doped with europium it was possible to calculate the intensity parameters and quantum yield and it showed satisfactory results. In the case of biological system marking it was necessary the functionalization of these particles to allow them to bind to the biological part to be studied. So the nanoparticles were functionalized by microwave and Stöber methods and characterized by infrared spectroscopy, scanning electron microscopy, energy dispersive X-ray spectroscopy and X-ray diffraction obtaining qualitative response of functionalization efficacy. The ninhydrin spectroscopic method was used for quantification of luminophores functionalization. The photo luminescent studies of functionalized particles demonstrate the potential applying of these luminophores as luminescent markers. (author)
Fabrication of Tb3Al5O12 transparent ceramics using co-precipitated nanopowders
Dai, Jiawei; Pan, Yubai; Wang, Wei; Luo, Wei; Xie, Tengfei; Kou, Huamin; Li, Jiang
2017-11-01
Terbium aluminum garnet (TAG) precursor was synthesized by a co-precipitation method from a mixed solution of terbium and aluminum nitrates using ammonium hydrogen carbonate (AHC) as the precipitant. The powders calcined at different temperatures were investigated by XRD, FTIR and FESEM in order to choose the optimal calcination temperature. Fine and low-agglomerated TAG powders with average particle size of 88 nm were obtained by calcining the precursor at 1100 °C for 4 h. Using this powder as starting material, TAG transparent ceramics were fabricated by vacuum sintering combined with hot isostatic pressing (HIP) sintering. For the sample pre-sintered at 1700 °C for 20 h with HIP post-treated at 1700 °C for 3 h, the average grain size is about 3.9 μm and the in-line transmittance is beyond 55% in the region of 500-1600 nm, reaching a maximum transmittance of 64.2% at the wavelength of 1450 nm. The Verdet constant at 633 nm is measured to be -178.9 rad T-1 m-1, which is 33% larger than that of the commercial TGG single crystal (-134 rad T-1 m-1).
Energy Technology Data Exchange (ETDEWEB)
Paganini, Paula Pinheiro
2012-07-01
This work presents the synthesis, characterization and photo luminescent study of tin and titanium mixed oxide nanoparticles doped with europium, terbium and neodymium to be used with luminescent markers on biological systems. The syntheses were done by co-precipitation, protein sol-gel and Pechini methods and the nanoparticles were characterized by infrared spectroscopy, thermogravimetric analysis, scanning electron microscopy, X-ray diffraction and X-ray absorption spectroscopy. The photo luminescent properties studies were conducted for luminophores doped with europium, terbium and neodymium synthesized by coprecipitation method. For luminophore doped with europium it was possible to calculate the intensity parameters and quantum yield and it showed satisfactory results. In the case of biological system marking it was necessary the functionalization of these particles to allow them to bind to the biological part to be studied. So the nanoparticles were functionalized by microwave and Stoeber methods and characterized by infrared spectroscopy, scanning electron microscopy, energy dispersive X-ray spectroscopy and X-ray diffraction obtaining qualitative response of functionalization efficacy. The ninhydrin spectroscopic method was used for quantification of luminophores functionalization. The photo luminescent studies of functionalized particles demonstrate the potential applying of these luminophores as luminescent markers. (author)
Czech Academy of Sciences Publication Activity Database
Bartosiewicz, Karol; Babin, Vladimir; Nikl, Martin; Mareš, Jiří A.; Zorenko, Yu.; Gorbenko, V.
2016-01-01
Roč. 173, May (2016), s. 141-148 ISSN 0022-2313 R&D Projects: GA ČR GA16-15569S; GA ČR GAP204/12/0805 EU Projects: European Commission(XE) 316906 - LUMINET Institutional support: RVO:68378271 Keywords : lutetium terbium aluminum garnets * Ce 3+ * energy transfer * luminescence * single crystalline films Subject RIV: BH - Optics, Masers, Lasers Impact factor: 2.686, year: 2016
Directory of Open Access Journals (Sweden)
M. S. Attia
2007-01-01
Full Text Available The efficiency of excited-states interactions between lanthanide ions Tb3+ and Eu3+ and some new cyclophanes (I, II, and III has been studied in different media. High luminescence quantum yield values for terbium and europium complexes in DMSO and PMMA were obtained. The photophysical properties of the green and red emissive Tb3+ and Eu3+ complexes have been elucidated, respectively.
Preparation of thermoluminescent materials
International Nuclear Information System (INIS)
1976-01-01
Thermoluminescent materials have been found to be suitable for measuring long term exposures to low level ionizing radiation. Oxyhalides of lanthanum, gadolinium and yttrium, including the oxychlorides and oxybromides are activated with terbium and have been found to be most efficient oxygendominated phosphors having thermoradiant efficiencies with excitation by low level ionizing radiation. Thermoluminescence response increases when the previous materials have hafnium and zirconium additives
African Journals Online (AJOL)
Fr. Ikenga
situations, civilians have suffered loss of property, life and limb and it would seem that the civilian population is not ... conflict thus ensuring that in the midst of hostilities, the dignity of the human person is and shall be respected. ..... Funding and human resource development efforts should be improved for the military trainers.
2010-07-01
... birth through 26). (Approved by the Office of Management and Budget under control number 1820-0030... with disabilities (ages birth through 26); (2) Individuals with disabilities; (3) Teachers; (4... of private schools and public charter schools; (9) Not less than one representative of a vocational...
The age of fathers in the USA is rising: an analysis of 168 867 480 births from 1972 to 2015.
Khandwala, Yash S; Zhang, Chiyuan A; Lu, Ying; Eisenberg, Michael L
2017-10-01
How has the mean paternal age in the USA changed over the past 4 decades? The age at which men are fathering children in the USA has been increasing over time, although it varies by race, geographic region and paternal education level. While the rise in mean maternal age and its implications for fertility, birth outcomes and public health have been well documented, little is known about paternal characteristics of births within the USA. A retrospective data analysis of paternal age and reporting patterns for 168 867 480 live births within the USA since 1972 was conducted. All live births within the USA collected through the National Vital Statistics System (NVSS) of the Centers for Disease Control and Prevention (CDC) were evaluated. Inverse probability weighting (IPW) was used to reduce bias due to missing paternal records. Mean paternal age has increased over the past 44 years from 27.4 to 30.9 years. College education and Northeastern birth states were associated with higher paternal age. Racial/ethnic differences were also identified, whereby Asian fathers were the oldest and Black fathers were the youngest. The parental age difference (paternal age minus maternal age) has decreased over the past 44 years. Births to Black and Native American mothers were most often lacking paternal data, implying low paternal reporting. Paternal reporting was higher for older and more educated women. Although we utilized IPW to reduce the impact of paternal reporting bias, our estimates may still be influenced by the missing data in the NVSS. Paternal age is rising within the USA among all regions, races and education levels. Given the implications for offspring health and demographic patterns, further research on this trend is warranted. No funding was received for this study and there are no competing interests. N/A. © The Author 2017. Published by Oxford University Press on behalf of the European Society of Human Reproduction and Embryology. All rights reserved. For
Directory of Open Access Journals (Sweden)
Sabyasachi Mishra
2018-06-01
Full Text Available Reseña de Lo divino y lo humano: poetas místicos de India y de España en la modernidad temprana, ed. Meenakshi Sundriyal y Juan Manuel Escudero Baztán, New Delhi/Pamplona, CSPILAS-Jawaharlal Nehru University/GRISO-Universidad de Navarra (Friends Digital Color Solutions, 2017, 168 pp., ISBN 181-901849-9-7.
Energy Technology Data Exchange (ETDEWEB)
Cruz B, C.C. de la; Monroy G, F. [ININ, 52750 La Marquesa, Estado de Mexico (Mexico)]. e-mail: delacruzbc@hotmail.com
2008-07-01
The present work presents the methodology that was developed for the preparation of one extractant resin with the aim of HDEHP, to separate radio lanthanides with serial atomic numbers. In this case it is exemplified with the separation of the following elements: Gadolinium-161 and the Terbium-161; this last radioisotope it is a beta emitting ({beta}{sup -}) that has a great potential to be used in therapy, also in nuclear medicine and in oncology, this is due to the high penetration power of their {beta}{sup -} particles that can kill to the cancerous cells and to inhibit the growth of the same ones. To be able to separate them it is necessary to appeal to extremely selective separation techniques, since the chemical properties of these elements are very similar. The chromatography is one of the more used analytical tools, this is due to its great sensibility and the selectivity in the compounds separation, in particular the use of the extractive chromatography has shown the feasibility of carrying out this type of separations for this type of elements. The resin with base of HDEHP was absorbed in an inert support under diverse preparation conditions. The extractant properties of the resin, in relation to the elements Gd and Tb (distribution coefficients), its were determined by means of the dynamic method, using as eluent solutions of nitric acid. The Gd-159 was prepared by irradiation of Gd-168 with thermal neutrons and the Tb-161 it is the result of the radioactive decay of the Gd-161 that is produced in turn with the irradiation with neutrons of Gd-160. The coefficients of distribution of Gd and Tb, using the prepared resin under diverse conditions are presented. (Author)
Energy Technology Data Exchange (ETDEWEB)
Hoffman, R. D. [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States)
2013-09-06
We have developed a set of modeled nuclear reaction cross sections for use in radiochemical diagnostics. Systematics for the input parameters required by the Hauser-Feshbach statistical model were developed and used to calculate neutron induced nuclear reaction cross sections for targets ranging from Terbium (Z = 65) to Rhenium (Z = 75). Of particular interest are the cross sections on Tm, Lu, and Ta including reactions on isomeric targets.
Czech Academy of Sciences Publication Activity Database
Bartosiewicz, Karol; Babin, Vladimir; Mareš, Jiří A.; Beitlerová, Alena; Zorenko, Yu.; Iskaliyeva, A.; Gorbenko, V.; Bryknar, Z.; Nikl, Martin
2017-01-01
Roč. 188, Aug (2017), s. 60-66 ISSN 0022-2313 R&D Projects: GA ČR GA16-15569S; GA MŠk LO1409 EU Projects: European Commission(XE) 316906 - LUMINET Institutional support: RVO:68378271 Keywords : gadolinium terbium aluminum garnets * Ce 3+ * energy transfer * luminescence * single crystalline flms Subject RIV: BH - Optics, Masers, Lasers OBOR OECD: Optics (including laser optics and quantum optics) Impact factor: 2.686, year: 2016
Neutron resonance spins of 159Tb from experiments with polarized neutrons and polarized nuclei
International Nuclear Information System (INIS)
Alfimenkov, V.P.; Ivanenko, A.I.; Lason', L.; Mareev, Yu.D.; Ovchinnikov, O.N.; Pikel'ner, L.B.; Sharapov, Eh.I.
1976-01-01
Spins of 27 neutron resonances of 159 Tb with energies up to 114 eV have been measured using polarized neutrons and nuclei beams in the modernized time-of-flight spectrometer of the IBR-30 pulse reator. The direct measurements of the terbium resonances spins performed using polarized neutrons reaffirm the conclusion that there are no unstationary effects in the behaviour of 159 Tb neutron resonances in the energy range
Giant onsite electronic entropy enhances the performance of ceria for water splitting
DEFF Research Database (Denmark)
Naghavi, S. Shahab; Emery, Antoine A.; Hansen, Heine Anton
2017-01-01
lanthanides, and reaches a maximum value of ≈4.7 kB per oxygen vacancy for Ce4+/Ce3+ reduction. This unique and large positive entropy source in ceria explains its excellent performance for high-temperature catalytic redox reactions such as water splitting. Our calculations also show that terbium dioxide has...... a high electronic entropy and thus could also be a potential candidate for solar thermochemical reactions....
International Nuclear Information System (INIS)
Hussein, Belal H.M.; Azab, Hassan A.; Fathalla, Walid; Ali, Sherin A.M.
2013-01-01
New fluorescent probe Tb(III) (7-carboxymethoxy-4-methylcoumarin)2(SCN) (C2H5OH)(H2O) was synthesized and characterized by spectroscopy and thermal analysis. The absorption and fluorescence spectra of 7-carboxymethoxy-4-methylcoumarin (CMMC) and Tb(III)–CMMC complex have been measured in different solvents. The interactions of Tb(III)–CMMC complex with calf thymus nucleic acid (CT-DNA) have been investigated using steady state fluorescence measurements. The changes in the fluorescence intensity have been used for the quantitative determination of DNA with LOD of 3.45 ng in methanol–water (9:1, v/v). The association constants of DNA with Tb(III)–CMMC complex was found to be 2.62×1010 M −1 . - Highlights: ► New fluorescent probe Terbium (III)-7-carboxy methoxy-4-methylcoumarin complex has been synthesized and characterized. ► FTIR spectrum of Tb(III)-complex shows a characteristic band for thiocyanate group. ► DNA interaction with Terbium (III)-7-carboxy methoxy-4-methylcoumarin has been studied by fluorescence techniques. ► The change in the fluorescence intensity has been used for the quantitative determination of DNA. ► The result was better than most of the well-known methods including the ethidium bromide method.
International Nuclear Information System (INIS)
Tran Thu Huong; Tran Kim Anh; Le Quoc Minh
2009-01-01
Luminescent nanomaterials with one-dimensional (1D) structures have attracted much attention due to their unique properties and potential applications in nanophotonics and nanobiophotonics. In this paper, we report a synthesis of terbium - hydroxide - at - silica Tb(OH) 3 -SiO 2 and Tb(OH) 3 -SiO 2 :Eu 3+ nanotubes. Terbium - hydroxide tubes were synthesized by soft template method. The size of the tubes can be controlled precisely and have outer diameters ranging from 80 to 120 nm, wall thickness of about 30 nm, and lengths ranging from 300 to 800 nm. To fabricate core/shell materials, the seed growth method is used. FESEM, X-ray diffraction, Raman spectra of Tb(OH) 3 and Tb(OH) 3 -SiO 2 nanotubes were investigated. The photoluminescence (PL) spectrum of Tb(OH) 3 under 325 nm excitation consists of four main peaks at 488, 542, 582, and 618 nm. Furthermore, a preliminary suggestion for the mechanism of growth of the Tb(OH) 3 nanotubes using the soft - template synthesis technique has been proposed. The PL intensity from Tb(OH) 3 -SiO 2 or Tb(OH) 3 -SiO 2 :Eu 3+ nanotubes is much stronger than that of Tb(OH) 3 .
Simulation of the magnetocaloric effect in Tb nanofilms
Energy Technology Data Exchange (ETDEWEB)
Anselmo, Dory Hélio A. L., E-mail: doryh@dfte.ufrn.br [Departamento de Física Teórica e Experimental (DFTE), Universidade Federal do Rio Grande do Norte (UFRN), Natal-RN (Brazil); Mello, Vamberto D. [Departamento de Física,Universidade do Estado do Rio Grande do Norte (UERN), Mossoró-RN (Brazil); Vasconcelos, Manoel S. [Escola de Ciência e Tecnologia (ECT), Universidade Federal do Rio Grande do Norte (UFRN), Natal-RN (Brazil)
2014-03-31
Rare-earth (RE) metals have different magnetic structures resulting from the competition between the crystal-field and exchange interactions. When a magnetic field is applied it creates a third interaction and the magnetic structures are more complicated. In thin films, it is expected that even the magnetic arrangement itself can be strongly modified. Rare-earth helimagnets such as Terbium (Tb), Holmium (Ho) and Dysprosium (Dy) represent the best candidates to evidence such finite-size effects. This finite-size effect is caused by the reduced number of atoms in the direction perpendicular to the film plane that leads to a decrease of the total magnetic exchange energy. We report this contribution to the investigation of magnetocaloric effect (MCE) of thin Terbium films in the helimagnetic temperature range, from T{sub C} = 219 K to T{sub N} = 231 K, for external fields of the order of 1 kOe. We find that for strong fields, H = 50 kOe, the adiabatic temperature change ΔT near the Néel temperature is around 15 K for any thickness of Tb films. However large thickness effects are found for small values of the magnetic field. For field strength of the order of a few kOe, the thermocaloric efficiency increases significantly for ultrathin (nanomagnetic) films.
Line emissions from sonoluminescence in aqueous solutions of halide salts without noble gases
Energy Technology Data Exchange (ETDEWEB)
Liang, Jinfu, E-mail: liang.shi2007@163.com [The Key Laboratory of Modern Acoustics, Ministry of Education, Institution of Acoustics, Nanjing University, Nanjing 210093 (China); School of Physics and Electronic Science, Guizhou Normal University, Guiyang 550001 (China); Chen, Weizhong, E-mail: wzchen@nju.edu.cn [The Key Laboratory of Modern Acoustics, Ministry of Education, Institution of Acoustics, Nanjing University, Nanjing 210093 (China); Zhou, Chao; Cui, Weicheng; Chen, Zhan [The Key Laboratory of Modern Acoustics, Ministry of Education, Institution of Acoustics, Nanjing University, Nanjing 210093 (China)
2015-02-20
Line emissions of trivalent terbium (Tb{sup 3+}) ion were observed from single-bubble sonoluminescence (SL) in an aqueous solution of terbium chloride (TbCl{sub 3}) that contained no noble gas. In addition, sodium (Na) lines were observed in multi-bubble SL in aqueous solutions of various halide salts that contained no noble gas. These observations show that the halide ions, such as Cl{sup −}, Br{sup −}, and I{sup −}, help for line emissions as the noble gases. The intensity of a line emission depends on both the chemical species produced by cavitation bubbles and the temperature of SL bubble that responds to the driving ultrasound pressure. With the increase of driving pressure, some line emissions attached to the continuous spectrum may become increasingly clear, while other line emissions gradually become indistinct. - Highlights: • Line emissions of Tb(III) ions were observed without the presence of noble gases. • The halide ions help to generate a line emission during sonoluminescence. • The intensity of a line emission mainly depends on the bubble's temperature. • The definition of a line emission is related to the temperature of caviation bubble and the kind of host liquid.
Preparation of extractive resins for producing terbium-161
International Nuclear Information System (INIS)
De la Cruz B, C. C.; Monroy G, F.
2009-10-01
This paper presents the development of a methodology for extractive resins preparation to base of HDEHP, which allows to separation of Tb from Gd generating an own technology of preparation of these resins. The study included the extractive resins preparation from 6 different supports: kieselguhr Dg, alumina, red volcanic rock, chiluca, quarry and fluorite; two treatment types of of supports and varied concentrations of HDEHP extractant (di(2-etil hexyl) orthophosphoric acid), in order to determine which resin has improved efficiency of Gd and Tb separation, and radionuclide purity of 161 Tb. Resins were prepared to base of kieselguhr to determine the most appropriate silicon deposition process. Two silicon deposition treatments were realized: treatment I , by contact with silicon deposition solution (dimethyldichlorosilane / heptane 1:30) and treatment II by contact with vapors of dimethyldichlorosilane in vacuum. The extractant retention was carried out to different concentrations of HDEHP / acetone: 1:4, 1:8, 1:15, 1:20, 1:30 and 1:40. According to the results, there is not direct relation of HDEHP concentration used in extractive resins preparation to base of kieselguhr over the efficiency of Gd and Tb separation and of radionuclide purity of 161 Tb. The effect of support in the efficiency of Gd and Tb separation was studied to prepare resins with the supports kieselguhr, alumina, quarry, chiluca, volcanic rock and fluorite, using the silicon deposition treatment II for the supports and a concentration of HDEHP / acetone 1:20, for extractant retention. Only resins based on kieselguhr could separate to Gd from Tb quantitatively, the resin at a concentration of HDEHP / Acetone 1:20 was the best results obtained in Gd and Tb separation, achieving a separation efficiency greater than 90% and a radionuclide purity higher than 99%. (Author)
The systems terbium (holmium) nitrate-piperidine nitrate-water
International Nuclear Information System (INIS)
Khisaeva, D.A.; Zhuravlev, E.F.; Semenova, Eh.B.
1982-01-01
Using the method of cross sections at 25 and 50 deg C solubility in the systems Tb(NO 3 ) 2 -C 5 H 10 NHxHNO 3 -H 2 O and Ho(NO 3 ) 3 -C 5 H 10 NHxHNO 3 -H 2 O has been studied. The systems are characterized by chemical interaction of components. Solubility isotherms have crystallization fields of solid phases of the composition Tb(NO 3 ) 3 x3[C 5 H 10 NHxHNO 3 ]x3H 2 O and Ho(NO 3 ) 3 x2[C 5 H 10 NHxHNO 3 ]. The compounds detected are singled out preparatively, their IR spectra are studied, their thermogravimetric analysis is carried out. Investigation results are compared with similar systems formed by nitrates of other representatives of rare earth group
Spin waves in terbium. II. Magnon-phonon interaction
International Nuclear Information System (INIS)
Jensen, J.; Houmann, J.G.
1975-01-01
The selection rules for the linear couplings between magnons and phonons propagating in the c direction of a simple basal-plane hcp ferromagnet are determined by general symmetry considerations. The acoustic-optical magnon-phonon interactions observed in the heavy-rare-earth metals have been explained by Liu as originating from the mixing of the spin states of the conduction electrons due to the spin-orbit coupling. We find that this coupling mechanism introduces interactions which violate the selection rules for a simple ferromagnet. The interactions between the magnons and phonons propagating in the c direction of Tb have been studied experimentally by means of inelastic neutron scatttering. The magnons are coupled to both the acoustic- and optical-transverse phonons. By studying the behavior of the acoustic-optical coupling, we conclude that it is a spin-mixed-induced coupling as proposed by Liu. The coupled magnon--transverse-phonon system for the c direction of Tb is analyzed in detail, and the strengths of the couplings are deduced as a function of wave vector by combining the experimental studies with the theory
Voltammetric determination of zirconium using azo compounds
International Nuclear Information System (INIS)
Orshulyak, O.O.; Levitskaya, G.D.
2008-01-01
The optimum conditions for zirconium complexation with azo compounds are found. The applicability of Eriochrome Red B, Calcon, and Calcion to the voltammetric determination of zirconium, total Zr(IV) and Hf(IV), and Zr(IV) in the presence of Zn(II), Cu(II), Cd(II), Ni(II), or Ti(IV) is demonstrated. The developed procedures are used to determine zirconium in a terbium alloy and in an alloy for airplane wheel drums [ru
2010-04-01
...), the Director of Personnel and Manpower (AID), and the Chief, Employee-Management Relations Division... correspondence under § 16.7(a), any documentary evidence readily available to the grievant on which the grievance... documentary evidence, and, in that official's discretion, interview persons having knowledge of the facts. The...
Publications | Page 168 | IDRC - International Development ...
International Development Research Centre (IDRC) Digital Library (Canada)
Filipino women migrant domestic workers' access to sexual and reproductive health services in Hong Kong, Singapore and Qatar (open access) ... to disadvantaged populations, national health policies such as universal health coverage risk ...
2010-04-01
... percent soluble sweetener solids by weight and is prepared with or without added water. It may contain one.... (5) Natural and artificial flavorings, either fruit or nonfruit, alone or in carriers. (6) Color...
Chilton, Nicholas F; Deacon, Glen B; Gazukin, Olga; Junk, Peter C; Kersting, Berthold; Langley, Stuart K; Moubaraki, Boujemaa; Murray, Keith S; Schleife, Frederik; Shome, Mahasish; Turner, David R; Walker, Julia A
2014-03-03
Three complexes of the form [Ln(III)3(OQ)9] (Ln = Gd, Tb, Dy; OQ = 8-quinolinolate) have been synthesized and their magnetic properties studied. The trinuclear complexes adopt V-shaped geometries with three bridging 8-quinolinolate oxygen atoms between the central and peripheral eight-coordinate metal atoms. The magnetic properties of these three complexes differ greatly. Variable-temperature direct-current (dc) magnetic susceptibility measurements reveal that the gadolinium and terbium complexes display weak antiferromagnetic nearest-neighbor magnetic exchange interactions. This was quantified in the isotropic gadolinium case with an exchangecoupling parameter of J = -0.068(2) cm(-1). The dysprosium compound displays weak ferromagnetic exchange. Variable-frequency and -temperature alternating-current magnetic susceptibility measurements on the anisotropic cases reveal that the dysprosium complex displays single-molecule-magnet behavior, in zero dc field, with two distinct relaxation modes of differing time scales within the same molecule. Analysis of the data revealed anisotropy barriers of Ueff = 92 and 48 K for the two processes. The terbium complex, on the other hand, displays no such behavior in zero dc field, but upon application of a static dc field, slow magnetic relaxation can be observed. Ab initio and electrostatic calculations were used in an attempt to explain the origin of the experimentally observed slow relaxation of the magnetization for the dysprosium complex.
Energy Technology Data Exchange (ETDEWEB)
Hussein, Belal H.M., E-mail: belalhussein102@yahoo.com [Department of Chemistry, Faculty of Science, Suez Canal University, Ismailia (Egypt); Azab, Hassan A. [Department of Chemistry, Faculty of Science, Suez Canal University, Ismailia (Egypt); Fathalla, Walid [Department of Mathematical and Physical Sciences, Faculty of Engineering, Port-Said University, Port-Said (Egypt); Ali, Sherin A.M. [Department of Mathematical and Physical Sciences, Faculty of Engineering, Suez Canal University, Ismailia (Egypt)
2013-02-15
New fluorescent probe Tb(III) (7-carboxymethoxy-4-methylcoumarin)2(SCN) (C2H5OH)(H2O) was synthesized and characterized by spectroscopy and thermal analysis. The absorption and fluorescence spectra of 7-carboxymethoxy-4-methylcoumarin (CMMC) and Tb(III)-CMMC complex have been measured in different solvents. The interactions of Tb(III)-CMMC complex with calf thymus nucleic acid (CT-DNA) have been investigated using steady state fluorescence measurements. The changes in the fluorescence intensity have been used for the quantitative determination of DNA with LOD of 3.45 ng in methanol-water (9:1, v/v). The association constants of DNA with Tb(III)-CMMC complex was found to be 2.62 Multiplication-Sign 1010 M{sup -1}. - Highlights: Black-Right-Pointing-Pointer New fluorescent probe Terbium (III)-7-carboxy methoxy-4-methylcoumarin complex has been synthesized and characterized. Black-Right-Pointing-Pointer FTIR spectrum of Tb(III)-complex shows a characteristic band for thiocyanate group. Black-Right-Pointing-Pointer DNA interaction with Terbium (III)-7-carboxy methoxy-4-methylcoumarin has been studied by fluorescence techniques. Black-Right-Pointing-Pointer The change in the fluorescence intensity has been used for the quantitative determination of DNA. Black-Right-Pointing-Pointer The result was better than most of the well-known methods including the ethidium bromide method.
International Nuclear Information System (INIS)
Wontcheu, Joseph; Schleid, Thomas
2005-01-01
Orthorhombic Tb 3 O 2 Cl[SeO 3 ] 2 (Pnma; a = 535.16(4), b = 1530.51(9), c = 1081.72(7) pm; Z = 4) is formed by reacting a stoichiometric mixture of Tb 4 O 7 , Tb, TbCl 3 , and SeO 2 in a suitable molar ratio (12: 8: 7: 42) within seven days in an evacuated sealed silica tube at 850 C. The needle-shaped, colourless single crystals (light, water and air stable) exhibit one-dimensional strands [(Tb1) 3/3 (Tb2) 2/1 O 4/2 ] 5+ [O 2 Tb 3 ] 5+ along [100] formed by two parallel chains [OTb 4/2 ] 4+ of trans-edge connected [OTb 4 ] 10+ tetrahedra (d(O-Tb) = 220 - 231 pm) which share an extra edge per chain link. The crystal structure contains two crystallographically different Tb 3+ cations: Tb1 is coordinated as bicapped trigonal prism, while Tb2 resides in square antiprismatic coordination. The Se 4+ coordination is best described as Ψ 1 tetrahedral ([SeO 3 E] 2- ; E: non-binding electron pair). The non-binding ''lone-pair'' electrons of four [SeO 3 ] 2- groups and two Cl - anions form pseudo-hexagonal empty channels along [100] between four cationic double chains. Tb 5 O 4 Cl 3 [SeO 3 ] 2 was prepared likewise as plate-like, colourless single crystals by solid-state reaction of an admixture of Tb 4 O 7 , Tb, TbOCl, TbCl 3 , and SeO 2 (molar ratio: 9: 6: 21: 7: 28) in an evacuated sealed silica tube during seven days at 850 C. This compound crystallizes in the monoclinic system (C2/m; a = 1229.13(9), b = 546.17(4), c = 978.79(7) pm, β = 90.485(6) ; Z = 2) and contains three crystallographically different Tb 3+ cations in seven- and eightfold coordination of O 2- and Cl - anions, respectively. The crystal structure of Tb 5 O 4 Cl 3 [SeO 3 ] 2 is layered and built up of corrugated terbium-oxygen sheets [O 4 Tb 5 ] 7+ formed by edge- and vertex-shared [OTb 4 ] 10+ tetrahedra (d(O-Tb) = 226-232 pm) spreading parallel (001). The structure is strongly related to the ''lone-pair'' channel structures of Tb 2 O[SeO 3 ] 2 and Tb 3 O 2 Cl[SeO 3 ] 2 , where single ([OTb 2 ] 4
Cundiff, David K; Agutter, Paul S
2016-08-24
Nutrition researchers recently recognized that deficiency of vitamin K2 (menaquinone: MK-4-MK-13) is widespread and contributes to cardiovascular disease (CVD). The deficiency of vitamin K2 or vitamin K inhibition with warfarin leads to calcium deposition in the arterial blood vessels. Using publicly available sources, we collected food commodity availability data and derived nutrient profiles including vitamin K2 for people from 168 countries. We also collected female and male cohort data on early death from CVD (ages 15-64 years), insufficient physical activity, tobacco, biometric CVD risk markers, socioeconomic risk factors for CVD, and gender. The outcome measures included (1) univariate correlations of early death from CVD with each risk factor, (2) a multiple regression-derived formula relating early death from CVD (dependent variable) to macronutrient profile, vitamin K1 and K2 and other risk factors (independent variables), (3) for each risk factor appearing in the multiple regression formula, the portion of CVD risk attributable to that factor, and (4) similar univariate and multivariate analyses of body mass index (BMI), fasting blood sugar (FBS) (simulated from diabetes prevalence), systolic blood pressure (SBP), and cholesterol/ HDL-C ratio (simulated from serum cholesterol) (dependent variables) and dietary and other risk factors (independent variables). Female and male cohorts in countries that have vitamin K2 24 µg/day of vitamin K2 per 2000 kcal/day (n = 72). A multiple regression-derived formula relating early death from CVD to dietary nutrients and other risk factors accounted for about 50% of the variance between cohorts in early CVD death. The attributable risks of the variables in the CVD early death formula were: too much alcohol (0.38%), too little vitamin K2 (6.95%), tobacco (6.87%), high blood pressure (9.01%), air pollution (9.15%), early childhood death (3.64%), poverty (7.66%), and male gender (6.13%). Worldwide dietary vitamin K2
Green fluorescence of terbium ions in lithium fluoroborate glasses ...
Indian Academy of Sciences (India)
tion and solid-state lasers attracted remarkable attention in the last few decades. .... Figure 1. Vis absorption spectrum of 1.0 mol% Tb3+-doped. LBZLFB glass. Figure 2. .... both ions quickly decay non-radiatively to the ground level. The energy ...
Analysis of the fourth spectrum of terbium (Tb IV)
International Nuclear Information System (INIS)
Spector, N.; Sugar, J.
1976-01-01
The low-energy level structure of Tb 3+ has been derived from spectra obtained with a sliding spark light source. The 7 F ground term of the 4f 8 configuration was found as well as all levels of the configurations 4f 7 5d, 6s, and 6p built on the 8 S 7 / 2 core state of 4f 7 . Of the possible 51 lines connecting these levels, 48 were observed. Optimized radial parameters are given for the observed configurations. A value for the ionization energy of 39.37(0.10) eV is derived for Tb 3+
Inelastic scattering of neutrons by spin waves in terbium
DEFF Research Database (Denmark)
Bjerrum Møller, Hans; Houmann, Jens Christian Gylden
1966-01-01
Measurements of spin-wave dispersion relations for magnons propagating in symmetry directions in ferromagnetic Tb; it is first experiment to give detailed information on magnetic excitations in heavy rare earths; Tb was chosen for these measurements because it is one of few rare-earth metals which...... does not have very high thermal-neutron capture cross section, so that inelastic neutron scattering experiments can give satisfactory information on magnon dispersion relations....
Tumor specific lung cancer diagnostics with multiplexed FRET immunoassays
Geißler, D.; Hill, D.; Löhmannsröben, H.-G.; Thomas, E.; Lavigne, A.; Darbouret, B.; Bois, E.; Charbonnière, L. J.; Ziessel, R. F.; Hildebrandt, N.
2010-02-01
An optical multiplexed homogeneous (liquid phase) immunoassay based on FRET from a terbium complex to eight different fluorescent dyes is presented. We achieved highly sensitive parallel detection of four different lung cancer specific tumor markers (CEA, NSE, SCC and CYFRA21-1) within a single assay and show a proof-of-principle for 5- fold multiplexing. The method is well suited for fast and low-cost miniaturized point-of-care testing as well as for highthroughput screening in a broad range of in-vitro diagnostic applications.
Energy Technology Data Exchange (ETDEWEB)
Matlokaa, K.; Saha, A.K.; Srinivasan, P.; Scott, M.J. [Florida Univ., Dept. of Chemistry, FL (United States)
2007-10-15
C{sub 3}-symmetric tri-phenoxy-methane platforms were substituted with carbamoyl-methyl-phosphine sulfide arms and these tris-CMPS compounds were evaluated as extractants for f-element metal ions from 1 M nitric acid solution. Their properties were compared to the carbamoyl-methyl-phosphine oxide derivatives on the same tri-phenoxy-methane platform (tris-CMPO). The terbium complex of tris-CMPS was crystallized and examined via X-ray structural analysis to provide valuable insight into the binding properties of the soft tripodal chelate. (authors)
Energy Technology Data Exchange (ETDEWEB)
Potter, M.W.
1981-10-01
The relationships between the lanthanide complex formation equilibria and the lanthanide-actinide separation application of three radius sensitive ligands have been studied. The consecutive stepwise formation constants of the 1:1, 2:1, and 3:1 chelate species formed by the interaction of DHDMB and the tripositive lanthanides and yttrium were determined potentiometrically at 0.1 M ionic strength and 25/sup 0/C. Results indicate that three different coordination modes, one tridentate and two bidentate are in evidence. Tracer level /sup 241/Am - /sup 155/Eu cation-exchange experiments utilizing DHDMB eluents indicate that this dihydroxycarboxylate does not form a sufficiently strong americium complex to elute that actinide ahead of europium. The overall stability of the americium 3:1 complex appears intermediate between samarium and europium. Cation-exchange elutions of /sup 241/Am, /sup 155/Eu, and /sup 160/Tb mixtures with EEDTA solutions prove that the EEDTA ligand is capable of eluting americium ahead of all of the tripositive lanthanide cations. The minimum separation occurs with terbium, where the Am-Tb separation factor is 1.71. 1,5-diaminopentane-N,N,N',N'-tetraacetic acid (PMDTA) was synthesized using cation exchange. A mathematical method was developed for the formation constants of the protonated and unprotonated lanthanide-PMDTA complexes from potentiometry. Cation-exchange elutions of tracer quantities of Am, Eu, and Tb revealed that terbium is eluted ahead of both americium and europium.
International Nuclear Information System (INIS)
Kovacs, Thelma Antunes Rodrigues
2014-01-01
This work was synthesized and characterized ferrite magnetic nanoparticles manganese, using the chemical coprecipitation method. By varying the heating time under 98°C (0, 10,20,40,60 3 80 minutes), the molar percentage of doping (1, 3, 5, 7, and 10%), gadolinium, europium, terbium and holmium. Magnetic ferrite nanoparticles and manganese ferrite doped with manganese were synthesized by coprecipitation method starting with chloride solutions of metals (iron (III), manganese (II), europium (III), gadolinium (III), terbium (III) and holmium (III)) and NaOH 5mol.L -1 as precipitating agent. The magnetic nanoparticles were characterized by scanning electron microscopy, infrared spectroscopy, X-ray diffraction, magnetization curves, and thermal analysis. Most of manganese ferrite particles showed superparamagnetic behavior. After the characterization it was found that the samples synthesized manganese ferrite with more than 40 minutes heating time, crystal structure showed the characteristic pattern of the inverted manganese ferrite spinel type. The stabilization of the samples in oleic acid nanoparticles produced with a hydrophobic outer layer and facilitated by coating chitosan biopolymer, since this has a positive charge. Among the doped samples there was no significant change in the magnetic behavior. Several techniques for characterizing these materials have been used such as X-ray diffraction spectrum in the infrared region, magnetization curves and thermal analysis. The resins were tested as magnetic material for the separation of biological materials. In this paper, are used as biological targets separation of bovine serum albumin. (author)
Energy Technology Data Exchange (ETDEWEB)
Kovacs, Thelma Antunes Rodrigues
2014-07-01
This work was synthesized and characterized ferrite magnetic nanoparticles manganese, using the chemical coprecipitation method. By varying the heating time under 98°C (0, 10,20,40,60 3 80 minutes), the molar percentage of doping (1, 3, 5, 7, and 10%), gadolinium, europium, terbium and holmium. Magnetic ferrite nanoparticles and manganese ferrite doped with manganese were synthesized by coprecipitation method starting with chloride solutions of metals (iron (III), manganese (II), europium (III), gadolinium (III), terbium (III) and holmium (III)) and NaOH 5mol.L{sup -1} as precipitating agent. The magnetic nanoparticles were characterized by scanning electron microscopy, infrared spectroscopy, X-ray diffraction, magnetization curves, and thermal analysis. Most of manganese ferrite particles showed superparamagnetic behavior. After the characterization it was found that the samples synthesized manganese ferrite with more than 40 minutes heating time, crystal structure showed the characteristic pattern of the inverted manganese ferrite spinel type. The stabilization of the samples in oleic acid nanoparticles produced with a hydrophobic outer layer and facilitated by coating chitosan biopolymer, since this has a positive charge. Among the doped samples there was no significant change in the magnetic behavior. Several techniques for characterizing these materials have been used such as X-ray diffraction spectrum in the infrared region, magnetization curves and thermal analysis. The resins were tested as magnetic material for the separation of biological materials. In this paper, are used as biological targets separation of bovine serum albumin. (author)
Temperature and concentration quenching of Tb3+ emissions in Y4Al2O9 crystals
International Nuclear Information System (INIS)
Boruc, Z.; Fetlinski, B.; Kaczkan, M.; Turczynski, S.; Pawlak, D.; Malinowski, M.
2012-01-01
Highlights: ► Spectroscopic properties of Tb 3+ :Y 4 Al 2 O 9 crystals are studied. ► Concentration and temperature dependencies of fluorescence are investigated. ► The cross-relaxation transfer rates are experimentally determined. ► Strong influence of cross relaxation process on 5 D 3 emission quenching is observed. ► Decays are modelled using Inokuti–Hirayama approach. - Abstract: Spectroscopic properties of trivalent terbium (Tb 3+ ) activated Y 4 Al 2 O 9 (abbreviated YAM) crystals were studied. Concentration and temperature dependent emission spectra and fluorescence dynamics profiles have been investigated in YAM:Tb 3+ in order to understand better processes responsible for quenching of the terbium 5 D 3 and 5 D 4 emissions. Decays were modelled using Inokuti–Hirayama approach to obtain information on the energy transfer mechanism. The cross-relaxation transfer rates were experimentally determined as a function of temperature and Tb 3+ concentration. The investigation revealed strong influence of cross-relaxation process on 5 D 3 emission quenching. The two different processes responsible for the increase of fluorescence quenching with growing temperature were observed, both related to thermal activation energy. For temperatures above 700 K, the temperature dependence of the emission intensity ratio ( 5 D 3 / 5 D 4 ) becomes linear and the decay times are rapidly decreasing monotonously with increasing temperature, what is confirming the potential of Y 4 Al 2 O 9 :Tb 3+ material in high temperature luminescence thermometry.
International Nuclear Information System (INIS)
Chuveleva, Eh.A.; Kharitonov, O.V.; Firsova, L.A.
1994-01-01
Certain heavy rare earths, curium and americium were separated by the method of displacement complexing chromatography using DTPA solutions and solutions containing DTPA and citric acid as eluents. Separation factors of rare earths and curium (americium) were calculated. Imitators for curium and americium separation were suggested: thulium for curium elution using 0.025 mol/l DTPA, holmium-for curium elution using 0.025 mol/l DTPA in the presence of 0.025 mol/l citric acid; terbium can serve as the imitator in both cases. 5 refs., 5 figs
Size matters: nanoparticles in cancer therapy
International Nuclear Information System (INIS)
Khullar, Bhavya; Iqbal, Sarah
2016-01-01
Scientists at the CSIR-National Chemical Laboratory, Pune, in collaboration with universities in Lucknow and Aligarh, synthesized terbium oxide (Tb_2O_3) nanoparticles by putting a naturally occurring fungus into action. Commercially available Tb_4O_7 is reduced to Tb_2O_3 by incubating it with a suspension of Fusarium oxysporum in controlled conditions of pH and temperature. The aqueous crystals of Tb_2O_3, isolated from the fungal suspension, were stable and did not form aggregates or clumps. Hence, they could be isolated as crystals with long-term stability
Neutron activation analysis of the rare earth elements in Nasu hot springs
International Nuclear Information System (INIS)
Ikeda, Nagao; Takahashi, Naruto.
1978-01-01
Eleven rare earth elements (lanthanum, cerium, neodymium, samarium, europium, gadolinium, terbium, holmium, thulium, ytterbium and lutetium) in hot spring waters and sinter deposits in the Nasu area were determined by the neutron activation method. The rare earth elements in hot spring water were preconcentrated in ferric hydroxide precipitate and neutron-irradiated. The rare earth elements were chemically separated into lighter and heavier groups and the activity of each group was measured with a Ge(Li) detector. Distribution of the rare earth elements between the hot spring water and the sinter deposit was also discussed. (auth.)
Energy Technology Data Exchange (ETDEWEB)
Saarma, M Yu; Yarvekyul' g, L V; Andreeva, E G; Siniyarv, R K
1989-01-01
Monoclonal antibodies (MAbs) to potato viruses were labelled with lanthanides and used for time-resolved fluoroimmunoassay (TRFIA) of these viruses. TRFIA of potato leafroll virus (PLRV) had the sensitivity less than 1 ng/ml and was therefore approx 10 times more sensitive than ELISA. Possibility of simultaneous quantitative detection of several viruses by different MAbs labelled with europium, samarium and terbium provides TRFIA of fundamental advantage. Data on simultaneous sensitive detection of two viruses - PLRV and PVX (0,5 ng/ml of both) and three viruses - PLRV, PVX and PVM are given.
Costa, José M.; Loper, Joyce E.
1994-01-01
Erwinia carotovora subsp. betavasculorum Ecb168 produces an antibiotic(s) that suppresses growth of the related bacterium Erwinia carotovora subsp. carotovora in culture and in wounds of potato tubers. Strain Ecb168 also produces and secretes pectolytic enzymes and causes a vascular necrosis and root rot of sugar beet. Genes (out) involved in secretion of pectolytic enzymes by Ecb168 were localized to two HindIII fragments (8.5 and 10.5 kb) of Ecb168 genomic DNA by hybridization to the cloned out region of E. carotovora subsp. carotovora and by complementation of Out- mutants of E. carotovora subsp. carotovora. Out- mutants of Ecb168, which did not secrete pectate lyase into the culture medium, were obtained when deletions internal to either HindIII fragment were introduced into the genome of Ecb168 through marker exchange mutagenesis. Out- mutants of Ecb168 were complemented to the Out+ phenotype by introduction of the corresponding cloned HindIII fragment. Out- mutants of Ecb168 were less virulent than the Out+ parental strain on potato tubers. Strain Ecb168 and Out- derivatives inhibited the growth of E. carotovora subsp. carotovora in culture, indicating that the uncharacterized antibiotic(s) responsible for antagonism was exported through an out-independent mechanism. Strain Ecb168 and Out- derivatives reduced the establishment of large populations of E. carotovora subsp. carotovora in wounds of potato tubers and suppressed tuber soft rot caused by E. carotovora subsp. carotovora. PMID:16349316
Search Results | Page 168 | IDRC - International Development ...
International Development Research Centre (IDRC) Digital Library (Canada)
... (sub-Saharan Africa), consisted of a study of the risk of diarrheal diseases or their resurgence in the ... Microfinance and reducing poverty in Central Africa ... The business process outsourcing (BPO) sector, worth over $130 billion worldwide, ...
26 CFR 1.168-5 - Special rules.
2010-04-01
...) Retirement-replacement-betterment (RRB) property—(1) RRB replacement property placed in service before... for the taxable year for retirement-replacement-betterment (RRB) replacement property (as defined in...
47 CFR 90.168 - Equal employment opportunities.
2010-10-01
... encourage referral of qualified minority or female applicants. (F) Encouraging present employees to refer... who make decisions on placement and promotion that minority employees and females are to be considered... groups and female employees equal opportunity for positions which lead to higher positions. Inquiring as...
Search Results | Page 168 | IDRC - International Development ...
International Development Research Centre (IDRC) Digital Library (Canada)
Tax policies in developing countries, and indeed around the world, are under continued reform. ... ICTs, Economic Growth and Poverty ... a research network on the theme of equal access to health services in West Africa under project 101160.
Glacial Features (Point) - Quad 168 (EPPING, NH)
University of New Hampshire — The Glacial Features (Point) layer describes point features associated with surficial geology. These glacial features include, but are not limited to, delta forsets,...
Fisheries Restoration Grant Program Projects [ds168
California Natural Resource Agency — This shapefile (FRGP_All_020209.shp) represents the locations of all ongoing and completed salmonid restoration projects in California with existing records in the...
15 CFR 16.8 - Termination of participation.
2010-01-01
... written decision to the participant in the event such participant does not appeal the proposed termination... responsibilities under this program with regard to a specific type of product by giving written notice to the... products of the type involved. ...
7 CFR 1.168 - Procedure for hearing.
2010-01-01
... surprise. (2) The parties shall not be required to exchange testimony in accordance with this paragraph if... with the Hearing Clerk a notice of the change, which notice shall be served on the parties, unless it... notice is given to the parties. (2)(i) Any party may move that the hearing be conducted by telephone or...
Directory of Open Access Journals (Sweden)
A. Hussain Syed Rehan
2012-06-01
Full Text Available Título en ingles: Characterization of a Mutant Bacillus thuringiensis d-endotoxin With Enhanced Stability and Toxicity SummaryThe centrally located a-helix 5 of Bacillus thuringiensis d-endotoxins is critical for insect toxicity through ion-channel formation. We analyzed the role of the highly conserved residue Histidine 168 (H168 using molecular biology, electrophysiology and biophysical techniques. Toxin H168R was ~3-fold more toxic than the wild type (wt protein whereas H168Q was 3 times less toxic against Manduca sexta. Spectroscopic analysis revealed that the H168Q and H168R mutations did not produce gross structural alterations, and that H168R (Tm= 59 °C was more stable than H168Q (Tm= 57.5 °C or than the wt (Tm= 56 °C toxins. These three toxins had similar binding affinities for larval midgut vesicles (Kcom suggesting that the differences in toxicity did not result from changes in initial receptor binding. Dissociation binding assays and voltage clamping analysis suggest that the reduced toxicity of the H168Q toxin may result from reduced insertion and/or ion channel formation. In contrast, the H168R toxin had a greater inhibition of the short circuit current than the wt toxin and an increased rate of irreversible binding (kobs, consistent with its lower LC50 value. Molecular modeling analysis suggested that both the H168Q and H168R toxins could form additional hydrogen bonds that could account for their greater thermal stability. In addition to this, it is likely that H168R has an extra positive charge exposed to the surface which could increase its rate of insertion into susceptible membranes. Key words: a-helix 5; Circular dichroism; molecular modeling; site-directed mutagenesis; thermal stability; Bacillus thuringiensis ResumenLa a-Hélice 5 del domino I de las d-endotoxinas de Bacillus thuringiensis, es crítica para la toxicidad de las toxinas contra insectos al participar en la formación de canales iónicos. La
Field-impressed anisotropy of susceptibility in iron-terbium thin films
International Nuclear Information System (INIS)
Stephenson, A.; Booth, N.A.
1995-01-01
Two thin films of Fe 1-x Tb x where x=0.17 and 0.23 are shown to exhibit the effect of field-impressed anisotropy. After application of a direct field of 80 mT, which gives them an isothermal remanent magnetization (IRM) in their plane, the anisotropy of initial susceptibility differs from that measured after the films have been tumble-demagnetized. By subtracting the susceptibility results of the tumble-demagnetized state from those obtained after the application of the 80 mT direct field, it is shown that the effect of this field is to decrease the susceptibility measured along the former applied field direction and to increase the susceptibility at right angles to this. The effect is almost certainly due to changes in domain alignment. Even though these films contain many domains, the above results are similar to those previously obtained for single-domain γFe 2 O 3 and magnetite particles. The sense of the effect is opposite to that for multi-domain magnetite particles where the susceptibility has been found to increase along the previously applied field direction. ((orig.))
Optical lines in europium-terbium double activated calcium tungstate phosphor
Energy Technology Data Exchange (ETDEWEB)
Nazarov, M.V. [Department of Material Science and Engineering, Korea Advanced Institute of Science and Technology, 373-1 Guseong-dong, Yuseong-gu, Daejeon 305-701 (Korea, Republic of); Tsukerblat, B.S. [Department of Chemistry, Ben-Gurion University of the Negev, 84105 Beer-Sheva (Israel)]. E-mail: tsuker@bgumail.bgu.ac.il; Popovici, E.-J. [' Raluca Ripan' Institute for Research in Chemistry, Cluj-Napoca (Romania); Jeon, D.Y. [Department of Material Science and Engineering, Korea Advanced Institute of Science and Technology, 373-1 Guseong-dong, Yuseong-gu, Daejeon 305-701 (Korea, Republic of)
2004-09-20
The Letter is devoted to the problem of the optical anisotropy of the rare-earth ions occupying low-symmetry positions in crystals. The crystal field multiplets arising from LSJ terms of Eu{sup 3+} and Tb{sup 3+} ions in the crystal field of calcium tungstate scheelite (CaWO{sub 4}) are analyzed with regard to the experimental data on the low temperature photoluminescence and cathodoluminescence spectra. The selection rules as well as an angular (polarization) dependence of the two-photon absorption are discussed.
High pressure phases of terbium: Possibility of a thcp phase
International Nuclear Information System (INIS)
Staun Olsen, J.; Steenstrup, S.; Gerward, L.
1985-01-01
High pressure phases of trivalent Tb studied by energy dispersive X-ray diffraction with synchrotron radiation exhibits the closed packed sequence (hcp -> Sm -> dhcp -> fcc) typical of the trivalent rare earth metals. Furthermore, a phase consistent with a triple hexagonal closed packed (thcp) structure was observed in a narrow pressure range around 30 GPa. (orig.)
A luminescence-based probe for sensitive detection of hydrogen peroxide in seconds
International Nuclear Information System (INIS)
Zscharnack, Kristin; Kreisig, Thomas; Prasse, Agneta A.; Zuchner, Thole
2014-01-01
Highlights: • We describe a novel probe for the sensitive detection of H 2 O 2 . • H 2 O 2 quenches the luminescence of a complex consisting of phthalic acid and terbium ions. • A stable fluorescence signal is generated immediately after mixing probe and sample. • The PATb probe detects H 2 O 2 over four orders of magnitude. - Abstract: Here, we present a fast and simple hydrogen peroxide assay that is based on time-resolved fluorescence. The emission intensity of a complex consisting of terbium ions (Tb 3+ ) and phthalic acid (PA) in HEPES buffer is quenched in the presence of H 2 O 2 and this quenching is concentration-dependent. The novel PATb assay detects hydrogen peroxide at a pH range from 7.5 to 8.5 and with a detection limit of 150 nmol L −1 at pH 8.5. The total assay time is less than 1 min. The linear range of the assay can be adapted by a pH adjustment of the aqueous buffer and covers a concentration range from 310 nmol L −1 to 2.56 mmol L −1 in total which encompasses four orders of magnitude. The assay is compatible with high concentrations of all 47 tested inorganic and organic compounds. The PATb assay was applied to quantify H 2 O 2 in polluted river water samples. In conclusion, this fast and easy-to-use assay detects H 2 O 2 with high sensitivity and precision
International Nuclear Information System (INIS)
Mayolet, A.
1995-01-01
In order to find a green emitting phosphor showing high quantum efficiency and a short decay time which can be used in the color Plasma Display Panels developed by Thomson-TTE-TIV company, a VUV spectrophotometer built at IPN Orsay, using the synchrotron radiation from the SUPER-ACO storage ring as an excitation source, allow us the simultaneous recording of the luminescence excitation and diffuse reflectivity spectra of the inorganic compounds in the UV-VUV range. In addition, this experimental set-up enable us to determine the luminescence quantum efficiency of phosphors in the whole energy range of investigation. The chemical synthesis of rare-earth ortho-- and metaborate and rare-earth ortho- and metaphosphate doped with trivalent lanthanide ions cerium, praseodymium, europium and terbium have been made. The energy variation of the thresholds of the luminescence excitation mechanisms in function of the nature and the structure of the host matrix is discussed. We have determined the influence of the nephelauxetic effect and the crystal field intensity on the energy of the f-d inter-configuration transitions. The variation of the luminescence quantum efficiency of the dopant ion is interpreted through the 'impurity bound exciton' model. The systematic comparison of the cerium and terbium trivalent ions spectroscopic properties in the Y(AG)G host lattice series stands to reason that the self-ionized state of the luminescent center plays an important role in the rate of the non radiative relaxation. It is the redox power of the host matrix which imposes to the luminescent center, the energy of this state. (author)
Energy Technology Data Exchange (ETDEWEB)
Mayolet, A
1995-11-29
In order to find a green emitting phosphor showing high quantum efficiency and a short decay time which can be used in the color Plasma Display Panels developed by Thomson-TTE-TIV company, a VUV spectrophotometer built at IPN Orsay, using the synchrotron radiation from the SUPER-ACO storage ring as an excitation source, allow us the simultaneous recording of the luminescence excitation and diffuse reflectivity spectra of the inorganic compounds in the UV-VUV range. In addition, this experimental set-up enable us to determine the luminescence quantum efficiency of phosphors in the whole energy range of investigation. The chemical synthesis of rare-earth ortho-- and metaborate and rare-earth ortho- and metaphosphate doped with trivalent lanthanide ions cerium, praseodymium, europium and terbium have been made. The energy variation of the thresholds of the luminescence excitation mechanisms in function of the nature and the structure of the host matrix is discussed. We have determined the influence of the nephelauxetic effect and the crystal field intensity on the energy of the f-d inter-configuration transitions. The variation of the luminescence quantum efficiency of the dopant ion is interpreted through the `impurity bound exciton` model. The systematic comparison of the cerium and terbium trivalent ions spectroscopic properties in the Y(AG)G host lattice series stands to reason that the self-ionized state of the luminescent center plays an important role in the rate of the non radiative relaxation. It is the redox power of the host matrix which imposes to the luminescent center, the energy of this state. (author) 134 refs.
Heterosis in some crosses of bread wheat under irrigation and drought conditions.
Abdel-Moneam, M A
2009-03-15
Five bread wheat varieties with different characteristics were crossed in a half-diallel model in 2005/2006 season. The five parents and their 10 F1 hybrids were evaluated under normal and water stress conditions during 2006/2007 season, to estimate heterosis of some wheat crosses for drought tolerance and selecting the crosses which could be useful in breeding programs for drought tolerance. The results indicated that, the best crosses over their mid parents at water stress condition for days to heading was Sakha-61 x Sakha-93; for flag leaf area were Giza-168 x Gemmeiza-9 and Sakha-61 x Gemmeiza-9 and for plant height was Sakha-61 x Sakha-93. The best crosses over their mid parents at both normal and stress conditions for days to maturity was Sakha-61 x Gemmeiza-9; for flag leaf area were Giza-168 x Sakha-61, Sakha-8 x Gemmeiza-9 and Sakha-93 x Gemmeiza-9; for spikes/plant were Sakha-8 x Sakha-61, Sakha-8 x Gemmeiza-9 and Sakha-61 x Sakha-93; for kernels/spike were Giza-168 x Sakha-8, Giza-168 x Sakha-61, Giza-168 x Sakha-93 and Sakha-8 x Gemmeiza-9; for 100-kernel weight were Giza-168 x Gemmeiza-9, Sakha-61 x Sakha-93 and Sakha-93 x Gemmeiza-9 and for grain yield/plant were Giza-168 x Sakha-93, Sakha-8 x Gemmeiza-9 and Sakha-93 x Gemmeiza-9. The best crosses over their better parents at water stress condition for flag leaf area were Giza-168 x Sakha-8, Giza-168 x Gemmeiza-9 and Sakha-8 x Gemmeiza-9; for plant height were Giza-168 x Gemmeiza-9 and Sakha-8 x Sakha-61. The best crosses over better parents at both normal and stress conditions for plant height were Giza-168 x Sakha-8, Sakha-8 x Gemmeiza-9 and Sakha-93 x Gemmeiza-9; for spikes/plant were Sakha-8xSakha-61, Sakha-61 x Sakha-93 and Sakha-8 x Gemmeiza-9; forkernels/spike were Giza-168 x Sakha-61 and Giza-168 x Sakha-93 and for grain yield/plant were Sakha-61 x Sakha-93 and Sakha-93 x Gemmeiza-9. Estimation of useful heterosis over better parent for grain yield/plant proved that it never exceeds 10.16% at
Polarized neutron study of TbNi2
International Nuclear Information System (INIS)
Givord, D.; Givord, F.; Gignoux, D.; Koehler, W.C.; Moon, R.M.
1976-01-01
Neutron diffraction experiments have been carried out on a TbNi 2 single crystal. Below the Curie temperature, 42 K, a magnetic contribution is observed only on nuclear scattering peaks. Therefore, the terbium atoms form a ferromagnetic structure. Polarized neutron measurements performed in the paramagnetic state, in an applied magnetic field of 57 kOe, reveal a non-uniform polarization of the conduction band. Within the experimental accuracy, no 3d magnetic moment is observed on nickel atoms. This result is consistent with the assumption of rare earth magnetic ordering occurring through the polarization of conduction electrons. (author)
Determination of Rare Earth Elements in plants by neutron activation analysis
International Nuclear Information System (INIS)
Figueiredo, Ana M.G.; Maria, Sheila P.; Ceccantini, Gregorio C.T.
1996-01-01
In the present work, instrumental neutron activation analysis was employed to the determination of rare earth elements (La, Ce, Nd, Eu, Tb, Yb e Lu) in plants, aiming biogeochemical studies. The precision and accuracy of the method were verified by the analysis of the reference materials Citrus Leaves (NIST 1572) and Pine Needles (NIST 1575). With exception of terbium, the results obtained agreed with reference values, giving relative errors less than 25%. The method was applied to different species of plants growing in the alkaline-ultramafic complex of Salitre, MG and the obtained data were compared to the average content in plants. (author)
The condition for electroplex emission from an europium complex doped poly( N-vinylcarbazole)
Zhang, T.; Xu, Z.; Qian, L.; Tao, D. L.; Teng, F.; Gao, X.; Xu, X. R.
2005-10-01
Spectral characteristics of photoluminescence (PL) and electroluminescence (EL) of poly( N-vinylcarbazole) (PVK) matrices doped with a novel europium complex Eu(aspirin) 3phen were investigated. A red-shift and broadening were observed in the EL spectra but not in the PL ones. However, neither red-shift nor broadening were observed in the EL spectra of PVK doped with a similar complex with the same ligand, terbium complex (Tb(aspirin) 3phen). This result suggests the formation of electroplexes in blend systems, which is likely due to inefficient energy transfer from host molecules to dopant molecules.
Virtualisasi Server Sederhana Menggunakan Proxmox
Directory of Open Access Journals (Sweden)
Teguh Prasandy
2015-05-01
Penggunaan proxmox sebagai virtual server bahwa proxmox menyediakan sebuah desktop local dan beberapa node. Di dalam node tersebut sistem operasi akan diinstal sesuai dengan kebutuhan dari user. Routing IP supaya sistem operasi yang berada di dalam proxmox dapat terkoneksi ke internet dengan IP Desktop Virtual box 192.168.56.102 IP ini digunakan sebagai gateway proxmox dan sistem operasi di dalamnya, IP Proxmox 192.168.56.105, IP Linux Ubuntu 192.168.56.109, IP Linux Debian 192.168.56.108.
Quality of information accompanying on-line marketing of home diagnostic tests.
Datta, Adrija K; Selman, Tara J; Kwok, Tony; Tang, Teresa; Khan, Khalid S
2008-01-01
To assess the quality of information provided to consumers by websites marketing medical home diagnostic tests. A cross-sectional analysis of a database developed from searching targeted websites. Data sources were websites written in English which marketed medical home diagnostic tests. A meta-search engine was used to identify the first 20 citations for each type of home diagnostic medical test. Relevant websites limited to those written in English were reviewed independently and in triplicate, with disputes resolved by two further reviewers. Information on the quality of these sites was extracted using a pre-piloted performer. 168 websites were suitable for inclusion in the review. The quality of these sites showed marked variation. Only 24 of 168 (14.2%) complied with at least three-quarters of the quality items and just over half (95 of 168, 56.5%) reported official approval or certification of the test. Information on accuracy of the test marketed was reported by 87 of 168 (51.7%) websites, with 15 of 168 (8.9%) providing a scientific reference. Instructions for use of the product were found in 97 of 168 (57.9%). However, the course of action to be taken after obtaining the test result was stated in only 63 of 168 (37.5%) for a positive result and 43 of 168 (25.5%) for a negative result. The quality of information posted on commercial websites marketing home tests online is unsatisfactory and potentially misleading for consumers.
Quinolone Amides as Antitrypanosomal Lead Compounds with In Vivo Activity.
Hiltensperger, Georg; Hecht, Nina; Kaiser, Marcel; Rybak, Jens-Christoph; Hoerst, Alexander; Dannenbauer, Nicole; Müller-Buschbaum, Klaus; Bruhn, Heike; Esch, Harald; Lehmann, Leane; Meinel, Lorenz; Holzgrabe, Ulrike
2016-08-01
Human African trypanosomiasis (HAT) is a major tropical disease for which few drugs for treatment are available, driving the need for novel active compounds. Recently, morpholino-substituted benzyl amides of the fluoroquinolone-type antibiotics were identified to be compounds highly active against Trypanosoma brucei brucei Since the lead compound GHQ168 was challenged by poor water solubility in previous trials, the aim of this study was to introduce structural variations to GHQ168 as well as to formulate GHQ168 with the ultimate goal to increase its aqueous solubility while maintaining its in vitro antitrypanosomal activity. The pharmacokinetic parameters of spray-dried GHQ168 and the newly synthesized compounds GHQ242 and GHQ243 in mice were characterized by elimination half-lives ranging from 1.5 to 3.5 h after intraperitoneal administration (4 mice/compound), moderate to strong human serum albumin binding for GHQ168 (80%) and GHQ243 (45%), and very high human serum albumin binding (>99%) for GHQ242. For the lead compound, GHQ168, the apparent clearance was 112 ml/h and the apparent volume of distribution was 14 liters/kg of body weight (BW). Mice infected with T. b. rhodesiense (STIB900) were treated in a stringent study scheme (2 daily applications between days 3 and 6 postinfection). Exposure to spray-dried GHQ168 in contrast to the control treatment resulted in mean survival durations of 17 versus 9 days, respectively, a difference that was statistically significant. Results that were statistically insignificantly different were obtained between the control and the GHQ242 and GHQ243 treatments. Therefore, GHQ168 was further profiled in an early-treatment scheme (2 daily applications at days 1 to 4 postinfection), and the results were compared with those obtained with a control treatment. The result was statistically significant mean survival times exceeding 32 days (end of the observation period) versus 7 days for the GHQ168 and control treatments
Lifescience Database Archive (English)
Full Text Available IVFXNXMXXKKXXFKNXXKSSXKXXIXIXXGNSXLNNXSNNX*xxnpfgxxxff nxkxxxxxixxxixiixiiiiiiiitxixivxxi* Translated Amino ...Acid sequence (All Frames) Frame A: kkkysihtyiyiyiyi*nnik*afiilifillkkk--- ---lxkx*fxkixcxxkxqxlkxxqnqvxkxx*...xfxkxivf*ixkvixfkxxtllexxxf lixkxxxxx*xxxlx**x********xx*x*lxxyn Frame B: kkniqyihiytyiyiykii*nkhl*f*ylfy*kk--- ---xxx...nsfxkxnvxxkxnx*kxxkikxxxvnnxxxrx*xfk*xk**xlxxkpfwkxxif *xknxxxxxnxxxyxn...nxnnnnnnnnxxnxsyxxi Frame C: kkifntyiyihiyiyik*YKISIYNFNIYFIKKK--- ---XKXIVFXNXMXXKKXXFKNXXKSSXKXXIXIXXGNSXLNNXSNNX*xxnpfgxxx
What we do | Page 168 | IDRC - International Development ...
International Development Research Centre (IDRC) Digital Library (Canada)
This knowledge can be used as a tool for addressing pressing global challenges. ... for face-to-face dialogue on development issues of mutual concern through a variety of ... A communication system that can provide health managers with timely ... marketing - to boost agricultural productivity and enhance rural livelihoods.
South of Sahara | Page 168 | IDRC - International Development ...
International Development Research Centre (IDRC) Digital Library (Canada)
Language French. Read more about Action multisectorielle en matière de prévention des maladies non transmissibles en Afrique subsaharienne. Language French. Read more about Chaire en écosanté sur la pollution urbaine de l'air et les maladies respiratoires non transmissibles (Afrique de l'Ouest). Language French.
46 CFR 168.01-1 - Purpose of regulations.
2010-10-01
... Shipping COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED) NAUTICAL SCHOOLS CIVILIAN NAUTICAL SCHOOL... this part is to set forth uniform minimum requirements for vessels, whether being navigated or not, which are used by or in connection with any civilian nautical school, except vessels of the Navy or...
What we do | Page 168 | IDRC - International Development ...
International Development Research Centre (IDRC) Digital Library (Canada)
... sharing our knowledge with policymakers, researchers, and communities around the world;; fostering new talent by offering fellowships and awards; and; putting new knowledge into the hands of those who can use it best to address global challenges. Part of Canada's foreign affairs and development efforts, IDRC invests ...
7 CFR 457.168 - Mustard crop insurance provisions.
2010-01-01
... amount of production delivered, and the processor contract provides for delivery of the mustard under... that are identified by the Food and Drug Administration or other public health organizations of the... FCIC including, but not limited to, protein and oil will not be considered. (e) Any production...
168 Indigenous Language Implementation and Nation Building: The ...
African Journals Online (AJOL)
of Nigerian indigenous language implementation and use in the ... Nigeria, it will become obvious that language is central to ... major indigenous languages. .... personality and thought pattern would be given as credit to the ... (13) The purpose of pre-primary education shall be to: .... Ado-Ekiti and sampled the five of them.
Energy Technology Data Exchange (ETDEWEB)
Boruc, Z., E-mail: z.boruc@stud.elka.pw.edu.pl [Institute of Microelectronics and Optoelectronics, Warsaw University of Technology, ul. Koszykowa 75, 00-662 Warsaw (Poland); Fetlinski, B.; Kaczkan, M. [Institute of Microelectronics and Optoelectronics, Warsaw University of Technology, ul. Koszykowa 75, 00-662 Warsaw (Poland); Turczynski, S.; Pawlak, D. [Institute of Electronic Materials Technology, ul. Wolczynska 133, 01-919 Warsaw (Poland); Malinowski, M. [Institute of Microelectronics and Optoelectronics, Warsaw University of Technology, ul. Koszykowa 75, 00-662 Warsaw (Poland)
2012-08-15
Highlights: Black-Right-Pointing-Pointer Spectroscopic properties of Tb{sup 3+}:Y{sub 4}Al{sub 2}O{sub 9} crystals are studied. Black-Right-Pointing-Pointer Concentration and temperature dependencies of fluorescence are investigated. Black-Right-Pointing-Pointer The cross-relaxation transfer rates are experimentally determined. Black-Right-Pointing-Pointer Strong influence of cross relaxation process on {sup 5}D{sub 3} emission quenching is observed. Black-Right-Pointing-Pointer Decays are modelled using Inokuti-Hirayama approach. - Abstract: Spectroscopic properties of trivalent terbium (Tb{sup 3+}) activated Y{sub 4}Al{sub 2}O{sub 9} (abbreviated YAM) crystals were studied. Concentration and temperature dependent emission spectra and fluorescence dynamics profiles have been investigated in YAM:Tb{sup 3+} in order to understand better processes responsible for quenching of the terbium {sup 5}D{sub 3} and {sup 5}D{sub 4} emissions. Decays were modelled using Inokuti-Hirayama approach to obtain information on the energy transfer mechanism. The cross-relaxation transfer rates were experimentally determined as a function of temperature and Tb{sup 3+} concentration. The investigation revealed strong influence of cross-relaxation process on {sup 5}D{sub 3} emission quenching. The two different processes responsible for the increase of fluorescence quenching with growing temperature were observed, both related to thermal activation energy. For temperatures above 700 K, the temperature dependence of the emission intensity ratio ({sup 5}D{sub 3}/{sup 5}D{sub 4}) becomes linear and the decay times are rapidly decreasing monotonously with increasing temperature, what is confirming the potential of Y{sub 4}Al{sub 2}O{sub 9}:Tb{sup 3+} material in high temperature luminescence thermometry.
Quality of information accompanying on-line marketing of home diagnostic tests
Datta, Adrija K; Selman, Tara J; Kwok, Tony; Tang, Teresa; Khan, Khalid S
2008-01-01
Objective To assess the quality of information provided to consumers by websites marketing medical home diagnostic tests. Design A cross-sectional analysis of a database developed from searching targeted websites. Setting Data sources were websites written in English which marketed medical home diagnostic tests. Main outcome measures A meta-search engine was used to identify the first 20 citations for each type of home diagnostic medical test. Relevant websites limited to those written in English were reviewed independently and in triplicate, with disputes resolved by two further reviewers. Information on the quality of these sites was extracted using a pre-piloted performer. Results 168 websites were suitable for inclusion in the review. The quality of these sites showed marked variation. Only 24 of 168 (14.2%) complied with at least three-quarters of the quality items and just over half (95 of 168, 56.5%) reported official approval or certification of the test. Information on accuracy of the test marketed was reported by 87 of 168 (51.7%) websites, with 15 of 168 (8.9%) providing a scientific reference. Instructions for use of the product were found in 97 of 168 (57.9%). However, the course of action to be taken after obtaining the test result was stated in only 63 of 168 (37.5%) for a positive result and 43 of 168 (25.5%) for a negative result. Conclusions The quality of information posted on commercial websites marketing home tests online is unsatisfactory and potentially misleading for consumers. PMID:18263912
Directory of Open Access Journals (Sweden)
Camilo Méndez
2014-12-01
Full Text Available Rare (Earth Elements is a cycle of works for solo piano. The cycle was inspired by James Dillon’s Book of Elements (Vol. I-V. The complete cycle will consist of 14 pieces; one for each selected rare (earth element. The chosen elements are Neodymium, Erbium, Tellurium, Hafnium, Tantalum, Technetium, Indium, Dysprosium, Lanthanium, Cerium, Europium, Terbium, Yttrium and Darmstadtium. These elements were selected due to their special atomic properties that in many cases make them extremely valuable for the development of new technologies, and also because of their scarcity. To date, only 4 works have been completed Yttrium, Technetium, Indium and Tellurium.
Observation of soft phonon mode in TbFe3(BO3)4 by inelastic neutron scattering
Pavlovskiy, M. S.; Shaykhutdinov, K. A.; Wu, L. S.; Ehlers, G.; Temerov, V. L.; Gudim, I. A.; Shinkorenko, A. S.; Podlesnyak, A.
2018-02-01
The phonon dispersion in terbium iron borate TbFe3(BO3)4 has been measured by inelastic neutron scattering in a temperature range 180
Energy Technology Data Exchange (ETDEWEB)
Yan Bing [Department of Chemistry, Tongji University, Siping Road 1239, Shanghai 200092 (China)]. E-mail: byan@tongji.edu.cn; Chen Xi [Department of Chemistry, Tongji University, Siping Road 1239, Shanghai 200092 (China); Wu Jianhua [Department of Chemistry, Tongji University, Siping Road 1239, Shanghai 200092 (China)
2007-08-31
Some novel kinds of hybrid phosphors were assembled with lanthanum (Tb, Eu, Dy) complexes (with four kinds of terbium complexes is 2,4-dihydroxybenzonic acid (DHBA), 1,10-phenanthroline (phen), acetylacetone (AA) and nicotinic acid (Nic), respectively) doped ZnO/PEG particles by co-precipitation approach derived from Zn(CH{sub 3}COO){sub 2} (Zn(AC){sub 2}), NaOH, PEG as precursors at room temperature. The characteristic luminescence spectra for f-f transitions of Tb{sup 3+}, Eu{sup 3+}, Dy{sup 3+} were observed. It is worthy to point out that ZnO is the excellent host for lanthanum ions by the assembly of PEG matrices.
International Nuclear Information System (INIS)
Ma Zhiya; Dosev, Dosi; Nichkova, Mikaela; Dumas, Randy K.; Gee, Shirley J.; Hammock, Bruce D.; Liu Kai; Kennedy, Ian M.
2009-01-01
Multifunctional core-shell nanocomposites with a magnetic core and a silica shell doped with lanthanide chelate have been prepared by a simple method. First, citric acid-modified magnetite nanoparticles were synthesized by a chemical coprecipitation method. Then the magnetite nanoparticles were coated with silica shells doped with terbium (Tb 3+ ) complex by a modified Stoeber method based on hydrolyzing and condensation of tetraethyl orthosilicate (TEOS) and a silane precursor. These multifunctional nanocomposites are potentially useful in a variety of biological areas such as bio-imaging, bio-labeling and bioassays because they can be simultaneously manipulated with an external magnetic field and exhibit unique phosphorescence properties.
Alaska's rare earth deposits and resource potential
Barker, James C.; Van Gosen, Bradley S.
2012-01-01
Alaska’s known mineral endowment includes some of the largest and highest grade deposits of various metals, including gold, copper and zinc. Recently, Alaska has also been active in the worldwide search for sources of rare earth elements (REE) to replace exports now being limitedby China. Driven by limited supply of the rare earths, combined with their increasing use in new ‘green’ energy, lighting, transportation, and many other technological applications, the rare earth metals neodymium, europium and, in particular, the heavy rare earth elements terbium, dysprosium and yttrium are forecast to soon be in critical short supply (U.S. Department of Energy, 2010).
Reversed-phase thin-layer chromatography of the rare earth elements
International Nuclear Information System (INIS)
Kuroda, R.; Adachi, M.; Oguma, K.
1988-01-01
Partition chromatographic behaviour of the rare earth elements on C 18 bonded silica reversed-phase material has been investigated by thin-layer chromatography in methanol - lactate media. The rare earth lactato complexes are distributed and fractionated on bonded silica layers without ion-interaction reagents. The concentration and pH of lactate solution, methanol concentration and temperature have effects on the migration and resolution of the rare earth elements. The partition system is particularly suited to separate adjacent rare earths of middle atomic weight groups, allowing the separation of gadolinium, terbium, dysprosium, holmium, erbium and thulium to be achieved by development to 18 cm distance. (orig.)
International Nuclear Information System (INIS)
Neveshkin, A.A.; Rusanova, T.Yu.; Rumyantseva, S.S.; Serdobintsev, A.A.; Podkosov, K.V.; Shtykov, S.N.; Klimov, B.N.; Gorin, D.A.; Ryzhkina, I.S.
2008-01-01
The behavior of the monolayers of three diphilic aminomethylated calix[4]resorcinarene (CRA) derivatives on the surface of a pure aqueous subphase and subphase containing copper(II), nickel(II), europium(III), terbium(III), and lanthanum(III) ions was investigated. The monolayer transfer to the quartz and single-crystal silicon substrates was accomplished by the Langmuir-Blodgett (LB) technique. The films were studied by ellipsometry and mass-spectrometry. Metal ions were found to exert effect on the limit area per one CRA molecule in the monolayer, on the surface collapse pressure and transfer coefficient of monolayer, and on the thickness and refractive index of the CRA-based LB films [ru
LLE Review 120 (July-September 2009)
Energy Technology Data Exchange (ETDEWEB)
Edgell, D.H., editor
2001-02-19
This issue has the following articles: (1) The Omega Laser Facility Users Group Workshop; (2) The Effect of Condensates and Inner Coatings on the Performance of Vacuum Hohlraum Targets; (3) Zirconia-Coated-Carbonyl-Iron-Particle-Based Magnetorheological Fluid for Polishing Optical Glasses and Ceramics; (4) All-Fiber Optical Magnetic Field Sensor Based on Faraday Rotation in Highly Terbium Doped Fiber; (5) Femtosecond Optical Pump-Probe Characterization of High-Pressure-Grown Al{sub 0.86}Ga{sub 0.14}N Single Crystals; (6) LLE's Summer High School Research Program; (7) Laser Facility Report; and (8) National Laser Users Facility and External Users Programs.
Luminescence properties of terbium-doped Li 3 PO 4 phosphor for ...
Indian Academy of Sciences (India)
A polycrystalline sample of Li 3 PO 4 :Tb 3 + phosphor was successfully synthesized using solid-state diffusion method. This synthesis method is of low cost, low temperature and does not require any other atmospheres for the synthesis. The powder X-ray diffraction (PXRD), photoluminescence (PL) emission and excitation ...
Spin waves in terbium. III. Magnetic anisotropy at zero wave vector
DEFF Research Database (Denmark)
Houmann, Jens Christian Gylden; Jensen, J.; Touborg, P.
1975-01-01
The energy gap at zero wave vector in the spin-wave dispersion relation of ferromagnetic. Tb has been studied by inelastic neutron scattering. The energy was measured as a function of temperature and applied magnetic field, and the dynamic anisotropy parameters were deduced from the results...... the effects of zero-point deviations from the fully aligned ground state, and we tentatively propose polarization-dependent two-ion couplings as their origin........ The axial anisotropy is found to depend sensitively on the orientation of the magnetic moments in the basal plane. This behavior is shown to be a convincing indication of considerable two-ion contributions to the magnetic anisotropy at zero wave vector. With the exception of the sixfold basal...
Selective Sensing of Tyrosine Phosphorylation in Peptides Using Terbium(III Complexes
Directory of Open Access Journals (Sweden)
Jun Sumaoka
2016-01-01
Full Text Available Phosphorylation of tyrosine residues in proteins, as well as their dephosphorylation, is closely related to various diseases. However, this phosphorylation is usually accompanied by more abundant phosphorylation of serine and threonine residues in the proteins and covers only 0.05% of the total phosphorylation. Accordingly, highly selective detection of phosphorylated tyrosine in proteins is an urgent subject. In this review, recent developments in this field are described. Monomeric and binuclear TbIII complexes, which emit notable luminescence only in the presence of phosphotyrosine (pTyr, have been developed. There, the benzene ring of pTyr functions as an antenna and transfers its photoexcitation energy to the TbIII ion as the emission center. Even in the coexistence of phosphoserine (pSer and phosphothreonine (pThr, pTyr can be efficintly detected with high selectivity. Simply by adding these TbIII complexes to the solutions, phosphorylation of tyrosine in peptides by protein tyrosine kinases and dephosphorylation by protein tyrosine phosphatases can be successfully visualized in a real-time fashion. Furthermore, the activities of various inhibitors on these enzymes are quantitatively evaluated, indicating a strong potential of the method for efficient screening of eminent inhibitors from a number of candidates.
Luminescence properties of terbium-doped Li3PO4 phosphor for ...
Indian Academy of Sciences (India)
... of faster and multiple readout, very high sensitivity, absence of thermal quenching and possible use of phosphor in plastic binders [3–15]. ... synthesis technique was developed to reduce the time required for the synthesis, which was about.
Influence of dysprosium and terbium additions on aluminium structure and properties
International Nuclear Information System (INIS)
Fridlyander, I.N.; Sokolovskaya, E.M.; Zimina, E.N.; Tkachenko, E.A.; Artemova, M.S.
1992-01-01
The influence of 0.3%Dy and 0.3%Tb additions were investigated on grain size in aluminium ingots and on recrystallization and mechanical properties in 1.5 mm thick sheets. Grain refinement in ingots was revealed along with an increase of sheet recrystallization temperature and grain growth retardation in the process of secondary recrystallization. Ultimate strength was found to rise at some decrease of specific elongation
Magneto-optical studies of valence instability in europium and terbium phosphors
Energy Technology Data Exchange (ETDEWEB)
Rodrigues, Lucas C.V. [Department of Chemistry, University of Turku, FI-20014 Turku (Finland); Instituto de Química, Universidade de São Paulo, São Paulo, -SP (Brazil); Hölsä, Jorma [Department of Chemistry, University of Turku, FI-20014 Turku (Finland); Instituto de Química, Universidade de São Paulo, São Paulo, -SP (Brazil); Turku University Centre for Materials and Surfaces (MatSurf) (Finland); University of the Free State, Department of Physics, Bloemfontein (South Africa); Brito, Hermi F. [Instituto de Química, Universidade de São Paulo, São Paulo, -SP (Brazil); Maryško, Miroslav [Institute of Physics, The Academy of Sciences of the Czech Republic, Cukrovarnická 10, CZ-162 53 Praha 6 (Czech Republic); Matos, Jivaldo R. [Instituto de Química, Universidade de São Paulo, São Paulo, -SP (Brazil); Paturi, Petriina [Wihuri Physical Laboratory, Department of Physics and Astronomy, University of Turku, FI-20014 Turku (Finland); Rodrigues, Rodrigo V. [Instituto de Química, Universidade de São Paulo, São Paulo, -SP (Brazil); Lastusaari, Mika, E-mail: miklas@utu.fi [Department of Chemistry, University of Turku, FI-20014 Turku (Finland); Turku University Centre for Materials and Surfaces (MatSurf) (Finland)
2016-02-15
The impurities and dopants' inappropriate valences may deteriorate the performance of luminescent materials, cause waste of the precious rare earth (R) material and thus incur financial losses. The usual methods to detect the valence of rare earths; XPS, Mössbauer and XANES spectroscopies, are not sensitive enough for low concentrations and the EPR methods are not very suitable for powders. In this work, the comparison between the theoretical and experimental temperature-dependent paramagnetic susceptibilities was used to obtain quantitatively the concentrations of the impurity valence in Eu{sub 2}O{sub 2}S and Tb{sub 2}O{sub 2}SO{sub 4}, both containing nominally only R{sup 3+}. Minute (ppm level) Eu{sup 2+} impurities could be analyzed because of the huge difference in the paramagnetic susceptibility between Eu{sup 2+} and Eu{sup 3+} at low temperatures. However, temperatures below 50 K are then needed whilst the Tb{sup IV} impurity in a Tb{sup 3+} matrix can be observed already at higher temperatures. The latter method based on comparing the slopes of the Tb{sup 3+}/Tb{sup IV} paramagnetic susceptibility vs temperature curves for the Tb{sup 3+}/Tb{sup IV} couple is less sensitive than for the Eu{sup 2+}/Eu{sup 3+} one. Finally, the host independent temperature evolution of the paramagnetic susceptibility was calculated for Gd{sup 3+} (or Eu{sup 2+} or Tb{sup IV}) to yield a simple analytical expression to be used universally. - Highlights: • Wave functions for Eu{sup 3+}/Tb{sup 3+} with crystal field effect calculated for oxysulfide/sulfate. • Paramagnetic susceptibility between 4 and 300 K simulated for 4f{sup 6/7/8} configurations. • Amount of valence impurities (Eu{sup 2+} and Tb{sup IV}) evaluated from susceptibility data. • Waste of raw materials and loss of luminescence intensity of phosphors can be avoided.
Goryashchenko, Alexander S.; Khrenova, Maria G.; Savitsky, Alexander P.
2018-04-01
Förster resonance energy transfer (FRET) sensors are widely used for the detection of protease activity in vitro and in vivo. Usually they consist of a FRET pair connected with a polypeptide linker containing a specific cleavage site for the relevant protease. Use of the fluorescent proteins as components of the FRET pair allows genetic encoding of such sensors and solves the problem of their delivery into live cells and animals. There are several ways to improve the properties of such sensors, mainly to increase FRET efficiency and therefore the dynamic range. One of the ways to achieve this is to use a non-fluorescent chromoprotein as an acceptor. Molecular dynamic simulations may assist in the construction of linker structures connecting donor and acceptor molecules. Estimation of the orientation factor κ 2 can be obtained by methods based on quantum theory and combined quantum mechanics/molecular mechanics approaches. The linker can be structured by hydrophobic interactions, bringing it into a closed conformation that shortens the distance between donor and acceptor and, consequently, increases FRET efficiency. We analyzed the effects of different linker structures on the detection of caspase-3 activity using a non-fluorescent acceptor. Also we have constructed the Tb3+- TagRFP sensor in which a complex of the terbium ion and terbium-binding peptide is used as a donor. This allowed us to use the unique property of lanthanide ions—fluorescence lifetime up to milliseconds—to perform measurements with time delay and exclude the nanosecond-order fluorescence. Using our systems as a starting point, by changing the recognition site in the linker it is possible to perform imaging of different protease activity in vitro or in vivo.
Tse, Pui-Kwan
2011-01-01
Introduction China's dominant position as the producer of over 95 percent of the world output of rare-earth minerals and rapid increases in the consumption of rare earths owing to the emergence of new clean-energy and defense-related technologies, combined with China's decisions to restrict exports of rare earths, have resulted in heightened concerns about the future availability of rare earths. As a result, industrial countries such as Japan, the United States, and countries of the European Union face tighter supplies and higher prices for rare earths. This paper briefly reviews China's rare-earth production, consumption, and reserves and the important policies and regulations regarding the production and trade of rare earths, including recently announced export quotas. The 15 lanthanide elements-lanthanum, cerium, praseodymium, neodymium, promethium, samarium, europium, gadolinium, terbium, dysprosium, holmium, erbium, thulium, ytterbium, and lutetium (atomic numbers 57-71)-were originally known as the rare earths from their occurrence in oxides mixtures. Recently, some researchers have included two other elements-scandium and yttrium-in their discussion of rare earths. Yttrium (atomic number 39), which lies above lanthanum in transition group III of the periodic table and has a similar 3+ ion with a noble gas core, has both atomic and ionic radii similar in size to those of terbium and dysprosium and is generally found in nature with lanthanides. Scandium (atomic number 21) has a smaller ionic radius than yttrium and the lanthanides, and its chemical behavior is intermediate between that of aluminum and the lanthanides. It is found in nature with the lanthanides and yttrium. Rare earths are used widely in high-technology and clean-energy products because they impart special properties of magnetism, luminescence, and strength. Rare earths are also used in weapon systems to obtain the same properties.
Energy Technology Data Exchange (ETDEWEB)
Alarcón-Flores, G., E-mail: alar_fbeto@yahoo.com [Centro de Investigación en Ciencia Aplicada y Tecnología Avanzada, IPN, Legaría 694, Irrigación, C.P. 11500, México D.F. (Mexico); García-Hipólito, M. [Instituto de Investigaciones en Materiales, UNAM, Apdo. Postal 70-360, Delegación Coyoacán, C.P. 04150, México D.F. (Mexico); Aguilar-Frutis, M. [Centro de Investigación en Ciencia Aplicada y Tecnología Avanzada, IPN, Legaría 694, Irrigación, C.P. 11500, México D.F. (Mexico); Carmona-Téllez, S. [Instituto de Física, UNAM, Coyoacán, C.P. 04150, México D.F. (Mexico); Martinez-Martinez, R. [Universidad Tecnológica de la Mixteca, Carretera Acatlima Km 2.5, Huajuapan de León Oaxaca, C.P. 69000, México (Mexico); Campos-Arias, M.P. [Centro de Investigación en Ciencia Aplicada y Tecnología Avanzada, IPN, Legaría 694, Irrigación, C.P. 11500, México D.F. (Mexico); Zaleta-Alejandre, E. [Universidad Autónoma del Estado de Hidalgo-Escuela Superior de Apan, Carretera Apan-Calpulalpan Km. 8, C.P. 43920, Apan, Hidalgo (Mexico); and others
2015-01-15
Terbium, europium and yttrium β diketonates have been synthesized from acetylacetone and inorganic metal salts and used as precursors for the deposition of Tb{sup 3+} or Eu{sup 3+} doped Y{sub 2}O{sub 3} polycrystalline films by the ultrasonic spray pyrolysis technique. The films were deposited on c-Si substrates at temperatures in the 400–550 °C range. The optical and structural characterization of these films as a function of substrate temperature and Tb{sup 3+} and Eu{sup 3+} concentration was carried out by means of photoluminescence (PL), cathodoluminescence (CL), infrared (IR), ellipsometry, and UV–visible spectroscopy and atomic force microscopy (AFM), energy dispersive spectroscopy (EDS) and X ray diffraction (XRD) measurements respectively. The PL intensity from these films was found to depend on deposition temperature. Films deposited above 450 °C exhibited the characteristic PL peaks associated with either Tb{sup 3+} or Eu{sup 3+} intra electronic energy levels transitions. The most intense PL emission was found for dopant concentration of 10 at% for Tb{sup 3+} and at 8 at% for Eu{sup 3+} ions into precursor solution. In both cases concentration quenching of the PL emission was observed for concentrations above these values. The films had a refractive index (1.81), low average surface roughness (∼62 Å) and a UV–Vis. transmission of the order of 90 %T. - Highlights: • Terbium, europium and yttrium β diketonates have been synthesized. • Luminescent thin films of Y{sub 2}O{sub 3}:Tb{sup 3+} and Y{sub 2}O{sub 3}:Eu{sup 3+} were obtained. • Optical and structural characteristics of these thin films are presented. • The films had a refractive index (1.81) and low average surface roughness (∼62 Å)
Radical-lanthanide ferromagnetic interaction in a T bIII bis-phthalocyaninato complex
Komijani, Dorsa; Ghirri, Alberto; Bonizzoni, Claudio; Klyatskaya, Svetlana; Moreno-Pineda, Eufemio; Ruben, Mario; Soncini, Alessandro; Affronte, Marco; Hill, Stephen
2018-02-01
Recent studies have highlighted the importance of organic ligands in the field of molecular spintronics, via which delocalized electron-spin density can mediate magnetic coupling to otherwise localized 4 f moments of lanthanide ions, which show tremendous potential for single-molecule device applications. To this end, high-field/high-frequency electron paramagnetic resonance (EPR) spectroscopy is employed to study a neutral terbium bis-phthalocyaninato metalorganic complex, [TbPc2 ] 0, with the aim of understanding the magnetic interaction between the Ising-like moment of the lanthanide ion and the unpaired spin density on the coordinating organic radical ligand. The measurements were performed on a previously unknown [TbPc2 ] 0 structural phase crystallizing in the Pnma space group. EPR measurements on powder samples of [TbPc2 ] 0 reveal an anisotropic spectrum, which is attributed to the spin-1/2 radical coupled weakly to the EPR-silent T bIII ion. Extensive double-axis rotation studies on a single crystal reveal two independent spin-1/2 signals with differently oriented (albeit identical) uniaxial g -tensors, in complete agreement with x-ray structural studies that indicate two molecular orientations within the unit cell. The easy-axis nature of the radical EPR spectra thus reflects the coupling to the Ising-like T bIII moment. This is corroborated by studies of the isostructural [YPc2 ] 0 analog (where Y is nonmagnetic yttrium), which gives a completely isotropic radical EPR signal. The experimental results for the terbium complex are well explained on the basis of an effective model that introduces a weak ferromagnetic Heisenberg coupling between an isotropic spin-1/2 and an anisotropic spin-orbital moment, J =6 , that mimics the known, strong easy-axis Tb ⋯P c2 crystal-field interaction.
Design and Development of a Magneto-Optic Sensor for Magnetic Field Measurements
Directory of Open Access Journals (Sweden)
Sarbani CHAKRABORTY
2015-01-01
Full Text Available A magneto-optic sensor is developed using a Terbium Doped Glass (TDG element as a Faraday rotation sensor and optical fiber as light transmitting and receiving medium. Online LabView based application software is developed to process the sensor output. The system is used to sense the magnetic field of a DC motor field winding in industrial environment. The sensor output is compared with the magnetic flux density variation obtained with a calibrated Hall Magnetic sensor (Gauss Meter. A linear variation of sensor output over wide range of current passing through the field winding is obtained. Further the results show an improved sensitivity of magneto-optic sensor over the Hall sensor.
Measurement of 160Tb and 161Tb in nuclear forensics samples
International Nuclear Information System (INIS)
Jiang, J.; Davies, A.V.; Britton, R.E.
2017-01-01
160 Tb and 161 Tb are important radionuclides to measure when analysing a Nuclear Forensics sample. An analytical method for the measurement of both 160 Tb and 161 Tb was developed in this study. Terbium was separated and purified using exchange resin and TrisKem LN Resin. The purified fraction containing 160 Tb and 161 Tb was measured by gamma spectrometry and liquid scintillation counting. The counting efficiencies of 160 Tb and 161 Tb were determined using the CIEMAT/NIST efficiency tracing method. The LSC count rate ratio, R160 Tb /R161 Tb , on the reference date was determined by sequential counting and calculated using a custom script based on their half-lives. (author)
Solvent extraction of rare earth nitrates by Versatic Acid 911
Energy Technology Data Exchange (ETDEWEB)
Kazuoka, K; Tanabe, T; Kondo, Y [Kyoto Univ. (Japan)
1975-07-01
The extraction equilibria of cerous, terbium and yttrium nitrates into Versatic Acid 911 were studied. The organic phase was diluted with benzene, and the ionic strength of the aqueous solutions was maintained at unity by adding NaNO/sub 3/. Radioactive isotopes of these elements were used as the tracer. The compositions of the extracted species were CeR/sub 3/.4RH.H/sub 2/O, TbR/sub 3/.4RH.H/sub 2/O and YR/sub 3/.4RH.H/sub 2/o, and the apparent equilibrium constants of extraction were 9.14x10/sup -15/, 3.90x10/sup -14/ and 1.70x10/sup -14/, respectively.
Complex logic functions implemented with quantum dot bionanophotonic circuits.
Claussen, Jonathan C; Hildebrandt, Niko; Susumu, Kimihiro; Ancona, Mario G; Medintz, Igor L
2014-03-26
We combine quantum dots (QDs) with long-lifetime terbium complexes (Tb), a near-IR Alexa Fluor dye (A647), and self-assembling peptides to demonstrate combinatorial and sequential bionanophotonic logic devices that function by time-gated Förster resonance energy transfer (FRET). Upon excitation, the Tb-QD-A647 FRET-complex produces time-dependent photoluminescent signatures from multi-FRET pathways enabled by the capacitor-like behavior of the Tb. The unique photoluminescent signatures are manipulated by ratiometrically varying dye/Tb inputs and collection time. Fluorescent output is converted into Boolean logic states to create complex arithmetic circuits including the half-adder/half-subtractor, 2:1 multiplexer/1:2 demultiplexer, and a 3-digit, 16-combination keypad lock.
Optical and EPR spectra of γ-irradiated glasses of the Ba(PO3)2-LiF system
International Nuclear Information System (INIS)
Bocharova, T.V.; Karapetyan, G.O.; Khalilev, V.D.; Yashchurzhinskaya, O.A.
1985-01-01
EPR and optical absorption spectra of the Be(PO 3 ) 2 -LiF system glasses are obtained. Introduction of LiF up to 60 mol. % doesn't lead to occurrence of an additional absorption band (AAB) and EPR signals connected with F-centers formed under γ-irradiation in the LiF monocrystal. As a result of γ-irradiation of glasses activated by terbium, radiation color centers (RCC) are formed, which are, probably, the centers of electron capture and possess no unambiguous correlation with the known paramagnetic centers (PMC). Parallel investigation into the thermal decolouration kinetics by the EPR and optical spectroscopy method is reliable for establishing correlation between AAB and PMC signals in EPR spectra
Solid state chemistry of rare earth oxides. Final report, September 1, 1950--July 31, 1977
International Nuclear Information System (INIS)
Eyring, L.
1977-07-01
Work under Contract E(11-1)-1109 and its antecedents has been primarily for the purpose of obtaining detailed thermodynamic, kinetic and structural information on the complex rare earth oxides of praseodymium and terbium. These systems exhibit homologous series of ordered phases, order-disorder transformations, wide-range nonstoichiometric phases, chemical hysteresis in two-phase regions and many other solid state reaction phenomena. Fluorite-related materials of importance to ERDA occur as nuclear fuels, radiation power sources, insulators and solid electrolytes. The rare earth oxides serve directly as model systems for such similar materials and, in a more general sense, they serve as models of solids in general since they exhibit nearly the full range of solid state properties
Lanthanides-clay nanocomposites: Synthesis, characterization and optical properties
International Nuclear Information System (INIS)
Celedon, Salvador; Quiroz, Carolina; Gonzalez, Guillermo; Sotomayor Torres, Clivia M.; Benavente, Eglantina
2009-01-01
Complexes of Europium(III) and Terbium(III) with 2,2-bipyridine and 1,10-phenanthroline were inserted into Na-bentonite by ion exchange reactions at room temperature. The products display interlaminar distances and stoichiometries in agreement with the ion exchange capacity and the interlayer space available in the clay. The optical properties of the intercalates, being qualitatively similar to those of the free complexes, are additionally improved with respect to exchange processes with the medium, especially in a moist environment. The protection again hydrolysis, together with the intensity of the optical transition 5 D 0 - 5 F 2 observed in the nanocomposite, makes these products promising for the development of novel optical materials
Submicron, soft x-ray fluorescence imaging
International Nuclear Information System (INIS)
La Fontaine, B.; MacDowell, A.A.; Tan, Z.; White, D.L.; Taylor, G.N.; Wood, O.R. II; Bjorkholm, J.E.; Tennant, D.M.; Hulbert, S.L.
1995-01-01
Submicron fluorescence imaging of soft x-ray aerial images, using a high resolution fluorescent crystal is reported. Features as small as 0.1 μm were observed using a commercially available single-crystal phosphor, STI-F10G (Star Tech Instruments Inc. P. O. Box 2536, Danbury, CT 06813-2536), excited with 139 A light. Its quantum efficiency was estimated to be 5--10 times that of sodium salicylate and to be constant over a broad spectral range from 30 to 400 A. A comparison with a terbium-activated yttrium orthosilicate fluorescent crystal is also presented. Several applications, such as the characterization of the aerial images produced by deep ultraviolet or extreme ultraviolet lithographic exposure tools, are envisaged
40 CFR 152.168 - Advertising of restricted use products.
2010-07-01
... advertising. (5) Billboards and posters. (c) The requirement may be satisfied for printed material by... in the broadcast of the spoken words “Restricted use pesticide,” or a statement of the terms of...
Engineering of Bacillus subtilis 168 for increased nisin resistance
DEFF Research Database (Denmark)
Hansen, Mette; Wangari, Romilda; Hansen, Egon Bech
2009-01-01
. Bacillus subtilis had been suggested as a potential host for the biosynthesis of nisin but was discarded due to its sensitivity to the lethal action of nisin. In this study, we have reevaluated the potential of B. subtilis as a host organism for the heterologous production of nisin. We applied...... transcriptome and proteome analyses of B. subtilis and identified eight genes upregulated in the presence of nisin. We demonstrated that the overexpression of some of these genes boosts the natural defenses of B. subtilis, which allows it to sustain higher levels of nisin in the medium. We also attempted...... to overcome the nisin sensitivity of B. subtilis by introducing the nisin resistance genes nisFEG and nisI from L. lactis under the control of a synthetic promoter library....
40 CFR 205.168-11 - Order to cease distribution.
2010-07-01
... order will not be issued if the manufacturer has made a good faith attempt to properly production verify the category and can establish such good faith. (b) Any such order shall be issued after notice and...
76 FR 168 - Heavy Forged Hand Tools From China
2011-01-03
.... (12) Identify significant changes, if any, in the supply and demand conditions or business cycle for..., Deputy Agency Ethics Official, at 202-205-3088. Limited disclosure of business proprietary information... Subject Merchandise, a U.S. or foreign trade or business association, or another interested party...
32 CFR 552.168 - Fort Lewis Area Access Office.
2010-07-01
... must be sponsored and accompanied by a parent or legal guardian. Individual registration requires: (1... event. It is the responsibility of each permit holder to inform a friend or relative of the area being...
All projects related to | Page 168 | IDRC - International Development ...
International Development Research Centre (IDRC) Digital Library (Canada)
Topic: ACCESS TO EDUCATION, EDUCATIONAL COSTS, EDUCATIONAL DEVELOPMENT, DEVELOPING COUNTRIES, POLICY MAKING, LABOUR SHORTAGE, RESEARCH CAPACITY, RESEARCH NETWORKS, EDUCATIONAL EQUIPMENT. Region: Central Asia, Far East Asia, South Asia, North and Central America ...
26 CFR 1.168(i)-1 - General asset accounts.
2010-04-01
... residual) is a multiple category asset (as defined in § 1.861-9T(g)(3)(ii)), and the income yield from the... for Salt Lake City, Utah facility”) that identify the assets included in each general asset account...
Spallation of terbium by 170 MeV protons. First part: qualitative study
International Nuclear Information System (INIS)
Olkowsky, J.; Le Pape, M.; Gratot, I.; Cohen, L.
1959-01-01
The products of the reaction Tb+p (170 MeV) have been studied by radiochemical methods. For each element, α, β, γ and X rays have been studied and results compared to literature data. The cross sections will be given in a further work. We observe a new alpha emitter of gadolinium, half-life 7 h, with the following γ-rays: X (43 keV), 220 keV, 340 keV, 550 keV, 720 keV. New γ-rays are given: 155 Tb: 480 keV; 880 keV 146 Eu (38 h): 125 keV; 570 keV 147 Eu: 570 keV 145 Eu: 180 keV. Reprint of a paper published in 'Le journal de physique et le radium', tome 20, N. 5, may 1959, p. 549-556 [fr
Novel Luminescent Probe Based on a Terbium(III) Complex for Hemoglobin Determination
Yegorova, A. V.; Leonenko, I. I.; Aleksandrova, D. I.; Scrypynets, Yu. V.; Antonovich, V. P.; Ukrainets, I. V.
2014-09-01
We have studied the spectral luminescent properties of Tb(III) and Eu(III) complexes with a number of novel derivatives of oxoquinoline-3-carboxylic acid amides (L1-L5 ). We have observed quenching of the luminescence of 1:1 Tb(III)-L1-5 complexes by hemoglobin (Hb), which is explained by resonance energy transfer of electronic excitation from the donor (Tb(III)-L1-5 ) to the acceptor (Hb). Using the novel luminescent probe Tb(III)-L1, we have developed a method for determining Hb in human blood. The calibration Stern-Volmer plot is linear in the Hb concentration range 0.6-36.0 μg/mL, detection limit 0.2 μg/mL (3·10-9 mol/L).
Luminescent properties of terbium complexes with catecholamines and their application in analysis
International Nuclear Information System (INIS)
Kravchenko, T.B.; Bel'tyukova, S.V.; Kononenko, L.I.; Poluehktov, N.S.
1982-01-01
Tb complexing with a representative of catecholamines - adrenaline - is studied using the luminescence method. It is found, that the complexing takes place in alkaline medium (pH 12.0). To prevent from compound oxidation with air oxygen and to create the necessary pH in solution sodium borohydride is used. The highest luminescence intensity is achieved when the reaction occurs in aqueous-isopropanol solutions. It is established that in the complexes formed the ratio of components is the following: Tb:adrenaline=1:3. Luminescent properties of Tb complex with adrenaline are used to determine the latter. The least detectable amount of adrenaline constitutes 0.02 μg, the determination error does not exceed 5.5% [ru
Omagari, Shun; Nakanishi, Takayuki; Seki, Tomohiro; Kitagawa, Yuichi; Takahata, Yumie; Fushimi, Koji; Ito, Hajime; Hasegawa, Yasuchika
2015-03-12
The photophysical properties of the novel nonanuclear Tb(III) clusters Tb-L1 and Tb-L2 involving the ligands methyl 4-methylsalicylate (L1) and methyl 5-methylsalicylate (L2) are reported. The position of the methyl group has an effect on their photophysical properties. The prepared nonanuclear Tb(III) clusters were identified by fast atom bombardment mass spectrometry and powder X-ray diffraction. Characteristic photophysical properties, including photoluminescence spectra, emission lifetimes, and emission quantum yields, were determined. The emission quantum yield of Tb-L1 (Φ(ππ*) = 31%) was found to be 13 times larger than that of Tb-L2 (Φ(ππ*) = 2.4%). The photophysical characterization and DFT calculations reveal the effect of the methyl group on the electronic structure of methylsalicylate ligand. In this study, the photophysical properties of the nonanuclear Tb(III) clusters are discussed in relation to the methyl group on the aromatic ring of the methylsalicylate ligand.
Directory of Open Access Journals (Sweden)
Salvador Escorcia García
2014-01-01
Full Text Available Si un expediente clínico no se encuentra completo un prestador de servicios médicos no contará con la información necesaria para ofrecer una mejor atención al paciente. Actualmente existen esfuerzos para contar con un expediente clínico completo y de acceso rápido, pero en situaciones de emergencia la principal fuente de información para brindar una mejor atención es el paciente, pero este no siempre se encuentra disponible para proporcionar información. En el presente artículo se propone una metodología para el manejo de información clínica por medio de la tecnología inalámbrica NFC y los dispositivos móviles. Como producto final de dicha metodología se obtuvo una aplicación móvil Android. La información clínica que fue manejada en dicha metodología, se obtuvo a partir de la NOM-168 que establece los datos mínimos por los que se debe componer un expediente clínico. Dicha información clínica fue comparada con el estándar HL7 CDA Versión 2 para obtener un documento XML, el cual fue utilizado como una plantilla para crear documentos clínicos electrónicos. La incorporación de la tecnología NFC en dicha metodología fue necesaria para almacenar y recuperar la información clínica en la memoria de tags NFC. La ventaja de lo anterior es que un tag NFC tiene distintas presentaciones como puede ser un calcomanía o una tarjeta de identificación, por lo que los pacientes pueden fácilmente transportar información clínica. Y además dicha información puede ser accedida por medio de un dispositivo móvil con NFC incluso si los pacientes se encuentran en un estado que no puedan facilitar información.
International Nuclear Information System (INIS)
Ukraintseva, Eh.A.; Sokolova, N.P.; Logvinenko, V.A.
1991-01-01
Temperature dependence of water vapour equilibrium pressure over the compounds of ErCl 3 ·6H-2O, TmCl 3 ·6H 2 O and LuCl 3 ·6H 2 O is studied by membrane method within the temperature range of 309-403 K. Dehydration process stoichiometry is determined thermogravimetrically under quasi-equilibrium conditions. All three compounds split off three molecules at the first stage of dehydration. ErCl 3 ·6H 2 O and TmCl 2 ·6H 2 O are very similar to terbium and disprosium chloride hexahydrates by vapour pressure value and dehydration enthalpy; enthalpy of the first dehydration stage is of the same character as those of nedymium, gadolinium and holmium chloride haxahydrates
Fluorescence yield in rare-earth-doped sol-gel silicate glasses
Energy Technology Data Exchange (ETDEWEB)
Silversmith, A.J., E-mail: asilvers@hamilton.ed [Physics Department, Hamilton College, 198 College Hill Road, Clinton, NY 13323 (United States); Nguyen, Nguyen T.T.; Campbell, D.L. [Physics Department, Hamilton College, 198 College Hill Road, Clinton, NY 13323 (United States); Boye, D.M.; Ortiz, C.P. [Davidson College, Davidson, NC 28035 (United States); Hoffman, K.R. [Whitman College, Walla Walla, WA 99362 (United States)
2009-12-15
We have used trivalent terbium to investigate the mechanism behind fluorescence enhancement by Al{sup 3+} co-doping. Our results indicate that rare-earth (RE) ions cluster together in aluminum-rich regions of the glass, and behave as if they were dispersed uniformly throughout these regions when the ratio of Al to RE is {approx}10 or greater. We also studied the effects of adding chemical drying agents to the precursor solution for the synthesis of sol-gel-derived silicate glasses. Such glasses can be treated at significantly higher annealing temperatures without degradation of optical quality, and have the density of melt glass. Fluorescence yield from doped RE ions improves markedly with the addition of the drying agents, and the denser glasses are not subject to rehydration.
TbNb6Sn6: the first ternary compound from the rare earth–niobium–tin system
Directory of Open Access Journals (Sweden)
Viktor Hlukhyy
2010-12-01
Full Text Available The title compound, terbium hexaniobium hexastannide, TbNb6Sn6, is the first ternary compound from the rare earth–niobium–tin system. It has the HfFe6Ge6 structure type, which can be analysed as an intergrowth of the Zr4Al3 and CaCu5 structures. All the atoms lie on special positions; their coordination geometries and site symmetries are: Tb (dodecahedron 6/mmm; Nb (distorted icosahedron 2mm; Sn (Frank–Caspar polyhedron, CN = 14–15 6mm and overline{6}m2; Sn (distorted icosahedron overline{6}m2. The structure contains a graphite-type Sn network, Kagome nets of Nb atoms, and Tb atoms alternating with Sn2 dumbbells in the channels.
[Trace elements of bone tumors].
Kalashnikov, V M; Zaĭchik, V E; Bizer, V A
1983-01-01
Due to activation analysis involving the use of neutrons from a nuclear reactor, the concentrations of 11 trace elements: scandium, iron, cobalt, mercury, rubidium, selenium, silver, antimony, chrome, zinc and terbium in intact bone and skeletal tumors were measured. 76 specimens of bioptates and resected material of operations for bone tumors and 10 specimens of normal bone tissue obtained in autopsies of cases of sudden death were examined. The concentrations of trace elements and their dispersion patterns in tumor tissue were found to be significantly higher than those in normal bone tissue. Also, the concentrations of some trace elements in tumor differed significantly from those in normal tissue; moreover, they were found to depend on the type and histogenesis of the neoplasm.
Energy Technology Data Exchange (ETDEWEB)
Elwert, Tobias; Schwarz, Sabrina; Goldmann, Daniel [TU Clausthal, Clausthal-Zellerfeld (Germany). Lehrstuhl fuer Rohstoffaufbereitung und Recycling
2016-01-15
The aim of this study was to investigate the applicability of three organophosphorus acid derivates (D2EHPA, EHEHPA and Cyanex 572) for the separation of terbium and dysprosium from praseodymium and neodymium from NdFeB magnets in chloride solution. A special focus was put on the effect of phase modifiers. The investigations revealed that all extractants show in general a similar extraction behavior but the extraction is shifted to higher pH values in the order D2EHPA < EHEHPA < Cyanex 572. Therefore, and due to higher realizable loadings, EHEHPA and Cyanex 572 are more suitable for the investigated separation problem than D2EHPA. Whereas EHEHPA requires 1-decanol as phase modifier, Cyanex 572 can be employed without modifier addition.
Energy Technology Data Exchange (ETDEWEB)
Tukhbatullin, A.A., E-mail: adiska0501@gmail.ru; Sharipov, G.L.; Bagautdinova, A.R.
2016-05-15
Excited radicals {sup *}CH and {sup *}C{sub 2} have been registered as light-emitting products of the mechanochemical decomposition of hydrocarbon gases (natural gas, CH{sub 4}, and C{sub 2}H{sub 2}) occurring at decomposition of the hydrated cerium and terbium sulfates under atmosphere of these gases, followed by triboluminescence. The inlet of hydrocarbons almost does not affect the intensity of the solid-state components of triboluminescence, viz., the luminescence of the excited ions Ln{sup 3+}. However, these gases completely suppress the luminescence of molecular nitrogen observed in air (a gas component of triboluminescence). The mechanism of decomposition of methane and acetylene by electrical discharges generated by the destruction of the crystals (the main source of gas component triboluminescence) have been discussed.
Luminescent Lanthanide Metal Organic Frameworks for cis-Selective Isoprene Polymerization Catalysis
Directory of Open Access Journals (Sweden)
Samantha Russell
2015-11-01
Full Text Available In this study, we are combining two areas of chemistry; solid-state coordination polymers (or Metal-Organic Framework—MOF and polymerization catalysis. MOF compounds combining two sets of different lanthanide elements (Nd3+, Eu3+/Tb3+ were used for that purpose: the use of neodymium was required due to its well-known catalytic properties in dienes polymerization. A second lanthanide, europium or terbium, was included in the MOF structure with the aim to provide luminescent properties. Several lanthanides-based MOF meeting these criteria were prepared according to different approaches, and they were further used as catalysts for the polymerization of isoprene. Stereoregular cis-polyisoprene was received, which in some cases exhibited luminescent properties in the UV-visible range.
A new ion source for fission-yield measurements of rare-earth isotopes
International Nuclear Information System (INIS)
Pilzer, E.H.; Engler, G.
1987-01-01
A new integrated target-ion source for fission-yield measurements of rare-earth isotopes has been developed for the Soreq on-line isotope separator (SOLIS). The source is heated by electron bombardment to a temperature of 2400 0 C and ionization takes place in a rhenium hot cavity. To overcome the problem of impurities which reduce the ionization efficiency, a ZrC disk was inserted in the cavity. Calculations show that because of its high thermionic emission, ZrC enhances ionization performance considerably. For example, in the presence of 10 -5 mbar of cesium impurity, the ionization efficiency of a rhenium hot cavity for the rare-earth terbium is 6%. However, with a ZrC disk, the efficiency increases to 97%. (orig.)
International Nuclear Information System (INIS)
Godart, Estelle
2017-01-01
This book details all the research work that has been done during three years of Ph-D. After a chapter dedicated to the general principles of supramolecular chemistry, and some of its applications, we focalize on the use of cage-shapes molecules (cryptophanes and hemi-cryptophanes) in order to build probes for biological imaging. We successively mention the way toward the synthesis of a hemi-cryptophane able to complex Gadolinium(III), to use it it as a proton-MRI contrast agent, then toward the elaboration of hydrosoluble cryptophanes adapted to 129 Xe NMR and MRI. This PhD manuscript ends with the synthesis of a new hemi-cryptophane functionalized to form complexes with Terbium(III) and Europium(III), whose fluorescence properties are promising. (author)
UV induced photoluminescence and thermally stimulated luminescence of ThO{sub 2}:Tb{sup 3+} phosphor
Energy Technology Data Exchange (ETDEWEB)
Godbole, S.V.; Nagpal, J.S.; Page, A.G. E-mail: agpage@magnum.barc.ernet.in
2000-08-15
Thorium oxide doped with trivalent terbium ions offers itself as a novel phosphor with its photo- and thermally-stimulated luminescence (PL and TSL) characteristics showing a marked change on sustained exposure to 254 and 365 nm ultraviolet (UV) radiation. The reduction in luminescence intensity of Tb{sup 3+} ions, on irradiation with 254 nm photons and subsequent restoration on exposure to 365 nm, has been correlated with the complimentary behaviour in UV-induced TSL. These changes are, in turn, ascribed to inter-configurational (f-d) transitions and e-h formation and recombination processes. UV radiation induced TSL output increases linearly with incident UV radiant energy at a constant radiation flux; however, for a fixed exposure, TSL output increases with increase in radiant flux.
UV induced photoluminescence and thermally stimulated luminescence of ThO2:Tb3+ phosphor
International Nuclear Information System (INIS)
Godbole, S.V.; Nagpal, J.S.; Page, A.G.
2000-01-01
Thorium oxide doped with trivalent terbium ions offers itself as a novel phosphor with its photo- and thermally-stimulated luminescence (PL and TSL) characteristics showing a marked change on sustained exposure to 254 and 365 nm ultraviolet (UV) radiation. The reduction in luminescence intensity of Tb 3+ ions, on irradiation with 254 nm photons and subsequent restoration on exposure to 365 nm, has been correlated with the complimentary behaviour in UV-induced TSL. These changes are, in turn, ascribed to inter-configurational (f-d) transitions and e-h formation and recombination processes. UV radiation induced TSL output increases linearly with incident UV radiant energy at a constant radiation flux; however, for a fixed exposure, TSL output increases with increase in radiant flux
International Nuclear Information System (INIS)
Singh, B.; Singh, Praveen K.
1998-01-01
The reaction of 2-acetylfuran-2-thenoylhydrazone(afth) with Ln(III) trichlorides yields complexes of the type [Ln(afth)Cl 2 (H 2 O)(EtOH)]Cl, [Ln(III) = La, Pr, Nd, Sm, Eu, Gd, Tb and Dy]. The complexes have been characterized by molar conductance, magnetic susceptibility and TGA and DTA measurements, magnetic susceptibility and TGA and DTA measurements, FAB mass, infrared, proton NMR, electronic absorption and emission spectra. The terbium complex is found to be monomer from the FAB mass spectrum. The IR and NMR spectra suggest neutral tridentate behaviour of the Schiff base. A coordination number seven is proposed around the metal ions. Emission spectra suggest C 3v , symmetry around the metal ion with capped octahedron geometry for the europium complex. (author)
Ceramic component for M.H.D electrode
International Nuclear Information System (INIS)
Marchant, D.D.; Bates, J.L.
1980-01-01
A ceramic component which exhibits electrical conductivity down to near room temperatures has the formula: Hfsub(x)Insub(y)Asub(z)O 2 where x = 0.1 to 0.4, y = 0.3 to 0.6, z = 0.1 to 0.4 and A is a rare earth or yttrium. The rare earth may be Yb, Tb, Pr or Ce. The component is suitable for use in the fabrication of MHD electrodes or as the current lead-out portion of a composite electrode with other ceramic components. An MHD electrode comprises a cap of a known ceramic, e.g. stabilised zirconium or hafnium oxide or terbium stabilised hafnium, a current lead-out ceramic according to the invention, and a copper frame. (author)
Dicty_cDB: Contig-U15645-1 [Dicty_cDB
Lifescience Database Archive (English)
Full Text Available D021940 ) Packaging cell systems for use in promotion of th... 168 6e-78 2 ( AX35... BD021943 ) Packaging cell systems for use in promotion of th... 168 8e-78 2 ( AX356044 ) Sequence 15 from P
76 FR 33814 - Proposed Collection; Comment Request for Regulation Project
2011-06-09
... collection requirements related to Additional First Year Depreciation Deduction. DATES: Written comments... . SUPPLEMENTARY INFORMATION: Title: Additional First Year Depreciation Deduction. OMB Number: 1545-2207... year depreciation deduction. Section 401(b) of the TRUIRJCA amends Sec. 168(k) by adding Sec. 168(k)(5...
Separation device of radio lanthanides (DISER)
International Nuclear Information System (INIS)
Vera T, A.L.; Monroy G, F.; Vazquez M, J.C.; Jimenez B, F.
2008-01-01
At the present time the cancer is one of the main causes of mortality in our country, therefore, its prevention, diagnostic and treatment is of vital importance for those health systems. The treatment of the cancer and other illnesses, starting from monoclonal antibodies, peptides, macro aggregates or marked aminoacids with beta particles emitting radioisotopes, it is an extremely promising field. The radioactive lanthanides: Promethium 149, Terbium 161, Holmium 166 and Lutetium 177 are beta emitting (β), which possess nuclear and chemical properties that have shown their feasibility like radioisotopes of radiotherapeutic use. However, these radioisotopes are not commercially available; to this respect, the Radioactive Materials Research Laboratory (LIMR) of the National Institute of Nuclear Research (ININ), it has developed the methodology of production of these radioisotopes and based on these works, there is designed, built and mounted the Radio lanthanides Separation Device (DISER) able to carry out the radioisotopes production in a routine way. This device is content in a cell that has an auxiliary air service, an extraction system and it is protected with a lead armor-plating of 10 cm. The DISER it is manual and easy of managing. The main function of this equipment is the radio lanthanides separation starting from the extractive chromatography by means of packed columns with a commercial resin (LnSPS) and recovered in the superior and inferior part by fiber glass. The DISER is composed by a main carrousel where the separation columns and the elution recipients are mounted. Also counts with an opening system of irradiation vials, port samples for columns and glass material. The present work presents a detailed description of the DISER, as well as its handling that allows to produce the radioisotopes Promethium-149, Terbium-161, Holmium-166 and Lutetium-177 starting from the separation of its parent elements Neodymium-149, Gadolinium-161, Dysprosium-166 and
Separation device of radio lanthanides (DISER); Dispositivo de separacion de radiolantanidos (DISER)
Energy Technology Data Exchange (ETDEWEB)
Vera T, A.L. [FES-Zaragoza, UNAM, 09000 Mexico D.F. (Mexico); Monroy G, F.; Vazquez M, J.C.; Jimenez B, F. [ININ, 52750 La Marquesa, Estado de Mexico (Mexico)]. e-mail: veratrevino@hotmail.com
2008-07-01
At the present time the cancer is one of the main causes of mortality in our country, therefore, its prevention, diagnostic and treatment is of vital importance for those health systems. The treatment of the cancer and other illnesses, starting from monoclonal antibodies, peptides, macro aggregates or marked aminoacids with beta particles emitting radioisotopes, it is an extremely promising field. The radioactive lanthanides: Promethium 149, Terbium 161, Holmium 166 and Lutetium 177 are beta emitting ({beta}), which possess nuclear and chemical properties that have shown their feasibility like radioisotopes of radiotherapeutic use. However, these radioisotopes are not commercially available; to this respect, the Radioactive Materials Research Laboratory (LIMR) of the National Institute of Nuclear Research (ININ), it has developed the methodology of production of these radioisotopes and based on these works, there is designed, built and mounted the Radio lanthanides Separation Device (DISER) able to carry out the radioisotopes production in a routine way. This device is content in a cell that has an auxiliary air service, an extraction system and it is protected with a lead armor-plating of 10 cm. The DISER it is manual and easy of managing. The main function of this equipment is the radio lanthanides separation starting from the extractive chromatography by means of packed columns with a commercial resin (LnSPS) and recovered in the superior and inferior part by fiber glass. The DISER is composed by a main carrousel where the separation columns and the elution recipients are mounted. Also counts with an opening system of irradiation vials, port samples for columns and glass material. The present work presents a detailed description of the DISER, as well as its handling that allows to produce the radioisotopes Promethium-149, Terbium-161, Holmium-166 and Lutetium-177 starting from the separation of its parent elements Neodymium-149, Gadolinium-161, Dysprosium-166
Algeria: the illusions of oil wealth - CERI Studies No. 168
International Nuclear Information System (INIS)
Martinez, Luis
2010-09-01
Thirty years after the nationalisation of hydrocarbons Algeria's oil wealth seems to have disappeared judging by its absence in the country's indicators of well-being. In Algeria oil led to happiness for a few and sadness for many. The absence of controls over oil revenue led to the industries downfall. Since 2002 Algeria is again seeing oil wealth. The increase in the price per barrel from 30 to 147 dollars between 2002 and 2008 provided the country with unexpected revenue permitting it to accumulate funds estimated, in 2009, at 150 billion dollars. Abdelaziz Bouteflika, returned to a devastated Algeria to restore civil order, unexpectedly benefited from this price increase. Thus, in addition to national reconciliation he was able to offer Algeria renewed economic growth. However, given that the wounds of the 1990's are not entirely healed and the illusions of oil wealth have evaporated this unexpected return of financial abundance raises concerns. To what ends will this manna be put? Who will control it? Will it provoke new violence and conflict? (author)
Modulation of Rhamm (CD168) for selective adipose tissue development
Turley, Eva A; Bissell, Mina J
2014-05-06
Herein is described the methods and compositions for modulation of Rhamm, also known as CD 186, and its effects on wound repair, muscle differentiation, bone density and adipogeneisis through its ability to regulate mesenchymal stem cell differentiation. Compositions and methods are provided for blocking Rhamm function for selectively increasing subcutaneous, but not, visceral fat. Compositions and methods for modulating Rhamm in wound repair are also described.
FCJ-168 Do objects dream of an internet of things?
Directory of Open Access Journals (Sweden)
Teodor Mitew
2014-12-01
Full Text Available This paper develops the notion of heteroclite sociable objects in the context of the emerging internet of things, and examines their transformative effect for understandings of sociability and agency. The notion of sociable objects attempts to capture the heterogeneous identity-shift occurring when heretofore obscure and mute objects ranging from toasters to thermostats acquire the agencies to leave semantically distinct traces online, and detour their human interlocutors into an object-mediated entanglement. Using a toolkit drawn from actor network theory and object oriented ontology, the paper discusses several examples illustrating the case for new parameters of sociability, better suited to a materiality acquiring conversational and anticipatory agencies.
40 CFR 168.65 - Pesticide export label and labeling requirements.
2010-07-01
... graphic matter on or attached to the immediate container of the pesticide, device, or active ingredient...). Every exported pesticide, device, and active ingredient used in producing a pesticide (see § 152.3 of this chapter for the definition of “active ingredient” and “pesticide”) must bear a label or labeling...
Intrinsic Levanase Activity of Bacillus subtilis 168 Levansucrase (SacB.
Directory of Open Access Journals (Sweden)
Luz Méndez-Lorenzo
Full Text Available Levansucrase catalyzes the synthesis of fructose polymers through the transfer of fructosyl units from sucrose to a growing fructan chain. Levanase activity of Bacillus subtilis levansucrase has been described since the very first publications dealing with the mechanism of levan synthesis. However, there is a lack of qualitative and quantitative evidence regarding the importance of the intrinsic levan hydrolysis of B. subtilis levansucrase and its role in the levan synthesis process. Particularly, little attention has been paid to the long-term hydrolysis products, including its participation in the final levan molecules distribution. Here, we explored the hydrolytic and transferase activity of the B. subtilis levansucrase (SacB when levans produced by the same enzyme are used as substrate. We found that levan is hydrolyzed through a first order exo-type mechanism, which is limited to a conversion extent of around 30% when all polymer molecules reach a structure no longer suitable to SacB hydrolysis. To characterize the reaction, Isothermal Titration Calorimetry (ITC was employed and the evolution of the hydrolysis products profile followed by HPLC, GPC and HPAEC-PAD. The ITC measurements revealed a second step, taking place at the end of the reaction, most probably resulting from disproportionation of accumulated fructo-oligosaccharides. As levanase, levansucrase may use levan as substrate and, through a fructosyl-enzyme complex, behave as a hydrolytic enzyme or as a transferase, as demonstrated when glucose and fructose are added as acceptors. These reactions result in a wide variety of oligosaccharides that are also suitable acceptors for fructo-oligosaccharide synthesis. Moreover, we demonstrate that SacB in the presence of levan and glucose, through blastose and sucrose synthesis, results in the same fructooligosaccharides profile as that observed in sucrose reactions. We conclude that SacB has an intrinsic levanase activity that contributes to the final levan profile in reactions with sucrose as substrate.
Nicholson, Wayne L.; McCoy, Lashelle E.; Kerney, Krystal R.; Ming, Douglas W.; Golden, D. C.; Schuerger, Andrew C.
2012-08-01
Because Mars is a primary target for life detection and habitability assessment missions, its exploration is also by necessity a Planetary Protection issue. The recent finding of significant levels of perchlorate (ClO4-) in regolith sampled from the Phoenix landing site raises the question of its potential biotoxicity to putative indigenous martian life, microbial forward contaminants from Earth, or future human visitors. To address this issue, an analogue regolith was constructed based on regolith chemistry data from the Phoenix landing site. A Mars Aqueous Regolith Extract (MARE) was prepared from the Phoenix analogue regolith and analyzed by ion chromatography. The MARE contained (mg/L) the cations Na+ (1411 ± 181), Mg2+ (1051 ± 160), Ca2+ (832 ± 125), and K+ (261 ± 29), and the anions SO42-(5911±993), ClO4-(5316±1767), Cl(171±25) and F- (2.0 ± 0.4). Nitrogen-containing species NO3-(773±113) and NO2-(6.9±2.3) were also present as a result of regolith preparation procedures, but their relevance to Mars is at present unknown. The MARE was tested for potential toxic effects on two model spacecraft contaminants, the spore-forming bacteria Bacillus subtilis strain 168 and Bacillus pumilus strain SAFR-032. In B. subtilis, spore germination and initial vegetative growth (up to ˜5 h) was not inhibited in a rich complex medium prepared with the MARE, but growth after 5 h was significantly suppressed in medium prepared using the MARE. Both B. subtilis and B. pumilus exhibited significantly higher rates of spore germination and growth in the MARE vs. DW with no additions (likely due to endogenous spore nutrients), but germination and growth was further stimulated by addition of glucose and a combination of buffered inorganic salts (K2HPO4, KH2PO4, (NH4)2SO4, and MgSO4). The data indicate that the aqueous environment in the regolith from the Phoenix landing site containing high levels of perchlorate does not pose a significant barrier to growth of putative
Increased chemical weathering during the deglacial to mid-Holocene summer monsoon intensification
Digital Repository Service at National Institute of Oceanography (India)
Miriyala, P.; Sukumaran, N.P.; Nath, B.N.; Ramamurty, P.B.; Sijinkumar, A.V.; Vijayagopal, B.; Ramaswamy, V.; Sebastian, T.
by Myanmar Rivers. Figure 2. Downcore variations of (a) ε Nd of SK168 of Alcock seamount (this study - with 2sd error bars) and MD169 of Sewell seamount12 in the Central Andaman Trough (CAT); (b) 87Sr/86Sr of SK168 (this study); the 2sd errors of Sr... in the Central Andaman basin. The isotopic data of core SK168 (this work - northern half of the Central Andaman Trough - CAT) exhibits a narrow range of Nd isotopes (ε Nd − 11.24 to − 9.24; average − 10.15 ± 0.46) (Fig. 3) which fall very close to other...
Berger, K L; Scherer, J; Ranga, M; Sha, N; Stern, J O; Quinson, A-M; Kukolj, G
2015-10-01
Analysis of data pooled from multiple phase 2 (SILEN-C1 to 3) and phase 3 studies (STARTVerso1 to 4) of the hepatitis C virus (HCV) nonstructural protein 3/4A (NS3/4A) protease inhibitor faldaprevir plus pegylated interferon alpha/ribavirin (PR) provides a comprehensive evaluation of baseline and treatment-emergent NS3/4A amino acid variants among HCV genotype-1 (GT-1)-infected patients. Pooled analyses of GT-1a and GT-1b NS3 population-based pretreatment sequences (n = 3,124) showed that faldaprevir resistance-associated variants (RAVs) at NS3 R155 and D168 were rare (<1%). No single, noncanonical NS3 protease or NS4A cofactor baseline polymorphism was associated with a reduced sustained virologic response (SVR) to faldaprevir plus PR, including Q80K. The GT-1b NS3 helicase polymorphism T344I was associated with reduced SVR to faldaprevir plus PR (P < 0.0001) but was not faldaprevir specific, as reduced SVR was also observed with placebo plus PR. Among patients who did not achieve SVR and had available NS3 population sequences (n = 507 GT-1a; n = 349 GT-1b), 94% of GT-1a and 83% of GT-1b encoded faldaprevir treatment-emergent RAVs. The predominant GT-1a RAV was R155K (88%), whereas GT-1b encoded D168 substitutions (78%) in which D168V was predominant (67%). The novel GT-1b NS3 S61L substitution emerged in 7% of virologic failures as a covariant with D168V, most often among the faldaprevir breakthroughs; S61L in combination with D168V had a minimal impact on faldaprevir susceptibility compared with that for D168V alone (1.5-fold difference in vitro). The median time to loss of D168 RAVs among GT-1b-infected patients who did not have a sustained virologic response at 12 weeks posttreatment (non-SVR12) after virologic failure was 5 months, which was shorter than the 14 months for R155 RAVs among GT-1a-infected non-SVR12 patients, suggesting that D168V is less fit than R155K in the absence of faldaprevir selective pressure. Copyright © 2015, American Society for
Responsive hybrid inorganic-organic system derived from lanthanide luminescence
Energy Technology Data Exchange (ETDEWEB)
Zhou, Zhan [School of Chemistry and Environment, South China Normal University, Guangzhou 510006 (China); Zheng, Yuhui, E-mail: yhzheng78@scnu.edu.cn [School of Chemistry and Environment, South China Normal University, Guangzhou 510006 (China); Jiang, Lasheng; Yang, Jinglian [School of Chemistry and Environment, South China Normal University, Guangzhou 510006 (China); Wang, Qianming, E-mail: qmwang@scnu.edu.cn [Key Laboratory of Theoretical Chemistry of Environment, Ministry of Education, School of Chemistry and Environment, South China Normal University, Guangzhou 510006 (China); School of Chemistry and Environment, South China Normal University, Guangzhou 510006 (China); Guangzhou Key Laboratory of Materials for Energy Conversion and Storage, Guangzhou 510006 (China)
2016-05-15
Highlights: • A novel covalent hybrid material was used to detect hemoglobin. • All the recognition experiments were performed in buffer solution. • Porous nano-structures was extensively studied for the recognition. - Abstract: Terbium ions were incorporated into new organic-inorganic matrices to achieve intense green emissions. Hemoglobin (HB) interactions lead to dramatic changes in the luminescence emission intensities. Infrared spectra, morphological studies and photoluminescence give information for the speciation and process of hemoglobin additions. The porous material has a large specific surface area of 351 cm{sup 2}/g and the detection limit for HB (0.7 μM) was much lower than its physical doped material (8 μM). This promising hybrid material will lead to the design of versatile optical probes that are efficiently responding to the external targets.
International Nuclear Information System (INIS)
1975-01-01
This invention relates to phosphors that can be used in fluorescent lamps and display devices. The phosphor is comprised of a halophosphate of calcium and/or strontium of apatite crystal structure activated with trivalent cerium and trivalent terbium. The phosphor can further include manganese. Preferably, the phosphor includes up to 10% by weight of one or more of the alkali metals lithium, sodium and potassium in the form of a compound or compounds thereof. The emissions appear as a number of fairly narrow discrete bands. The temperature of preparation is 1000degC (as opposed to the usual 1450degC), therefore reducing costs (less energy is needed, more crucibles are readily obtainable and there is no need for special conditions to enable crucibles to overcome thermal shock)
Khanna, Rohit; Ip, K.; Allums, K. K.; Baik, K.; Abernathy, C. R.; Pearton, S. J.; Heo, Y. W.; Norton, D. P.; Ren, F.; Dwivedi, R.; Fogarty, T. N.; Wilkins, R.
2004-09-01
The preparation and characterization of terbium doped zinc aluminate photoluminescent films obtained by ultrasonic spray pyrolysis deposition process are described. Variations on doping concentrations in the start spraying solution and substrate temperatures were studied. XRD measurements on these films showed that the crystalline structure depends on the substrate temperature. For an excitation wavelength of 242 nm, all the photoluminescence spectra show peaks located at 488 nm, 546 nm, 589 nm and 621 nm. The photoluminescence intensity reaches values practically constant for the samples deposited at substrate temperatures higher than 400 °C. In this case, concentration quenching of the photoluminescence appears at doping concentrations greater than 0.93 atomic percent into the films. The surface morphology characteristics of the films deposited on glass and silicon substrates, as a function of the deposition temperature, are presented.
Directory of Open Access Journals (Sweden)
Hideo Honma
2012-10-01
Full Text Available (1 The photo-induced solubility and positive-tone direct photo-patterning of iron, copper and lanthanides chelated with 4-(2-nitrobenzyloxycarbonylcatechol (NBOC or 4-(6-nitroveratryloxycarbonylcatechol (NVOC was investigated. Photo-patterning of iron, copper, cerium, samarium, europium, terbium, dysprosium, holmium, erbium and lutetium complexes was accomplished. Continuous films were formed by the pyrolysis of metal complex films at 500 °C. (2 Based on the difference in the photo-reaction excitation wavelength profile of NBOC and NVOC complexes, a short and simple method for simultaneous micro-patterning of two independent films on each side of a transparent glass substrate was developed. Using the developed procedure, indium tin oxide and/or titanium oxide films were formed on each side of a quartz substrate without use of resist or etching.
Dynamics of trivalent rare earth molecular vapor lasers
International Nuclear Information System (INIS)
Krupke, W.F.
1976-01-01
Radiative transition probabilities in neodymium bearing vapors are reviewed and calculations are extended to visible laser transitions in terbium bearing vapor. Nonradiative relaxation processes in the pure and complexed halides are treated in greater detail. While precise, quantitative relaxation probabilities cannot be calculated on the basis of information presently available, plausibility arguments can be established which indicate the order of magnitude of relevant nonradiative decay probabilities. Reference to solid and liquid state nonradiative relaxation data for rare earth ions is reviewed to support the plausibility arguments for the vapor state. Having established the likelihood of high fluorescence yields in the vapor phase, various methods of laser pumping are discussed: optical pumping via parity allowed 4f-5d transitions; optical pumping via charge transfer bands of the vapor complex; and direct electron beam pumping
Radioluminescence of rare-earth doped aluminum oxide
Energy Technology Data Exchange (ETDEWEB)
Santiago, M.; Molina, P. [Universidad Nacional del Centro de la Provincia de Buenos Aires, Instituto de Fisica Arroyo Seco, Pinto 399, 7000 Tandil (Argentina); Barros, V. S.; Khoury, H. J.; Elihimas, D. R., E-mail: msantiag@exa.unicen.edu.ar [Universidade Federal de Pernambuco, Departamento de Energia Nuclear, Av. Prof. Luiz Freire 1000, Recife, PE 50740-540 (Brazil)
2011-10-15
Carbon-doped aluminum oxide (Al{sub 2}O{sub 3}:C) is one of the most used radioluminescence (Rl) materials for fiberoptic dosimetry due to its high efficiency and commercial availability. However, this compound presents the drawback of emitting in the spectral region, where the spurious radioluminescence of fibers is also important. In this work, the radioluminescence response of rare-earth doped Al{sub 2}O{sub 3} samples has been evaluated. The samples were prepared by mixing stoichiometric amounts of aluminum nitrate, urea and dopants with different amounts of terbium, samarium, cerium and thulium nitrates varying from 0 to 0.15 mo 1%. The influence of the different activators on the Rl spectra has been investigated in order to determine the feasibility of using these compounds for Rl fiberoptic dosimetry. (Author)
Radioluminescence of rare-earth doped aluminum oxide
International Nuclear Information System (INIS)
Santiago, M.; Molina, P.; Barros, V. S.; Khoury, H. J.; Elihimas, D. R.
2011-10-01
Carbon-doped aluminum oxide (Al 2 O 3 :C) is one of the most used radioluminescence (Rl) materials for fiberoptic dosimetry due to its high efficiency and commercial availability. However, this compound presents the drawback of emitting in the spectral region, where the spurious radioluminescence of fibers is also important. In this work, the radioluminescence response of rare-earth doped Al 2 O 3 samples has been evaluated. The samples were prepared by mixing stoichiometric amounts of aluminum nitrate, urea and dopants with different amounts of terbium, samarium, cerium and thulium nitrates varying from 0 to 0.15 mo 1%. The influence of the different activators on the Rl spectra has been investigated in order to determine the feasibility of using these compounds for Rl fiberoptic dosimetry. (Author)
Vanderhoef, Laura R.
Erbium arsenide nanoparticles epitaxially grown within III-V semiconductors have been shown to improve the performance of devices for applications ranging from thermoelectrics to THz pulse generation. The small size of rare-earth nanoparticles suggests that interesting electronic properties might emerge as a result of both spatial confinement and surface states. However, ErAs nanoparticles do not exhibit any signs of quantum confinement or an emergent bandgap, and these experimental observations are understood from theory. The incorporation of other rare-earth monopnictide nanoparticles into III-V hosts is a likely path to engineering carrier excitation, relaxation and transport dynamics for optoelectronic device applications. However, the electronic structure of these other rare-earth monopnictide nanoparticles remains poorly understood. The objective of this research is to explore the electronic structure and optical properties of III-V materials containing novel rare-earth monopnictides. We use ultrafast pump-probe spectroscopy to investigate the electronic structure of TbAs nanoparticles in III-V hosts. We start with TbAs:GaAs, which was expected to be similar to ErAs:GaAs. We study the dynamics of carrier relaxation into the TbAs states using optical pump terahertz probe transient absorption spectroscopy. By analyzing how the carrier relaxation rates depend on pump fluence and sample temperature, we conclude that the TbAs states are saturable. Saturable traps suggest the existence of a bandgap for TbAs nanoparticles, in sharp contrast with previous results for ErAs. We then apply the same experimental technique to two samples of TbAs nanoparticles in InGaAs with different concentrations of TbAs. We observe similar relaxation dynamics associated with trap saturation, though the ability to resolve these processes is contingent upon a high enough TbAs concentration in the sample. We have also constructed an optical pump optical probe transient absorption spectroscopy system to allow complimentary measurements to be taken on these materials in the near future.
Czech Academy of Sciences Publication Activity Database
Slezák, Ondřej; Yasuhara, R.; Lucianetti, Antonio; Vojna, David; Mocek, Tomáš
2015-01-01
Roč. 17, č. 6 (2015), s. 1-8, č. článku 065610. ISSN 2040-8978 R&D Projects: GA MŠk ED2.1.00/01.0027; GA MŠk EE2.3.20.0143; GA MŠk EE2.3.30.0057 Grant - others:HILASE(XE) CZ.1.05/2.1.00/01.0027; OP VK 6(XE) CZ.1.07/2.3.00/20.0143; OP VK 4 POSTDOK(XE) CZ.1.07/2.3.00/30.0057 Institutional support: RVO:68378271 Keywords : stress-induced birefringence * thermal depolarization * high-power lasers Subject RIV: BH - Optics, Masers, Lasers OBOR OECD: Optics (including laser optics and quantum optics) Impact factor: 1.847, year: 2015
Zhang, Junjiao; Zhao, Xiangying; Zhang, Jiaxiang; Zhao, Chen; Liu, Jianjun; Tian, Yanjun; Yang, Liping
2017-09-14
The present work aims to block 2,3-butanediol synthesis in acetoin fermentation of Bacillus subtilis. First, we constructed a recombinant strain BS168D by deleting the 2,3-butanediol dehydrogenase gene bdhA of the B. subtilis168, and there was almost no 2,3-butanediol production in 20 g/L of glucose media. The acetoin yield of BS168D reached 6.61 g/L, which was about 1.5 times higher than that of the control B. subtilis168 (4.47 g/L). Then, when the glucose concentration was increased to 100 g/L, the acetoin yield reached 24.6 g/L, but 2.4 g/L of 2,3-butanediol was detected at the end of fermentation. The analysis of 2,3-butanediol chiral structure indicated that the main 2,3-butanediol production of BS168D was meso-2,3-butanediol, and the bdhA gene was only responsible for (2R,3R)-2,3-butanediol synthesis. Therefore, we speculated that there may exit another pathway relating to the meso-2,3-butanediol synthesis in the B. subtilis. In addition, the results of low oxygen condition fermentation showed that deletion of bdhA gene successfully blocked the reversible transformation between acetoin and 2,3-butanediol and eliminated the effect of dissolved oxygen on the transformation.
Lee, Sang-Hee; Park, Choon-Keun
2015-03-01
The objective of this study was to evaluate the effect of a magnetized extender on sperm membrane damage and development of oocytes in vitro fertilized with liquid storage boar semen. Before semen dilution, extender was flowed through a neodymium magnet (0, 2000, 4000 and 6000G) for 5min and collected semen was preserved for 168h at 18°C. In results, plasma membrane integrity with live sperm was significantly higher in semen treated with extenders magnetized at 4000G than sperm treated with extenders magnetized at 0G during semen preservation for 120-168h (psemen treated with extenders magnetized at 4000 and 6000G compared to 0 and 2000G during semen preservation for 168h (psemen treated with extenders magnetized at 2000G than other groups during semen preservation for 168h. The ability of semen to achieve successful in vitro fertilization was also not significantly different among the groups during preservation. However, when the semen was preserved for 168h, the blastocyst formation rates were significantly higher at 6000G compared to 0 and 2000G (psemen extender could protect the sperm membrane from damage, and improve the ability of rates of in vitro blastocyst development and magnetized semen diluter is beneficial for long liquid preservation of boar semen. Copyright © 2014 Elsevier B.V. All rights reserved.
26 CFR 1.861-9 - Allocation and apportionment of interest expense.
2010-04-01
... characterized on the basis of the fair market value of the taxpayer's pro rata share of assets held by the... remained in effect. (iv) The tax book value of section 168 property shall be determined without regard to... of determining the tax book value of its section 168 property, the taxpayer's depreciation deduction...
Directory of Open Access Journals (Sweden)
David Wifling
Full Text Available In contrast to the corresponding mouse and rat orthologs, the human histamine H4 receptor (hH4R shows extraordinarily high constitutive activity. In the extracellular loop (ECL, replacement of F169 by V as in the mouse H4R significantly reduced constitutive activity. Stabilization of the inactive state was even more pronounced for a double mutant, in which, in addition to F169V, S179 in the ligand binding site was replaced by M. To study the role of the FF motif in ECL2, we generated the hH4R-F168A mutant. The receptor was co-expressed in Sf9 insect cells with the G-protein subunits Gαi2 and Gβ1γ2, and the membranes were studied in [3H]histamine binding and functional [35S]GTPγS assays. The potency of various ligands at the hH4R-F168A mutant decreased compared to the wild-type hH4R, for example by 30- and more than 100-fold in case of the H4R agonist UR-PI376 and histamine, respectively. The high constitutive activity of the hH4R was completely lost in the hH4R-F168A mutant, as reflected by neutral antagonism of thioperamide, a full inverse agonist at the wild-type hH4R. By analogy, JNJ7777120 was a partial inverse agonist at the hH4R, but a partial agonist at the hH4R-F168A mutant, again demonstrating the decrease in constitutive activity due to F168A mutation. Thus, F168 was proven to play a key role not only in ligand binding and potency, but also in the high constitutive activity of the hH4R.
Review of monolete-producing Carboniferous-Permian sphenophylls
Czech Academy of Sciences Publication Activity Database
Libertín, M.; Bek, Jiří
2008-01-01
Roč. 2008, č. 2 (2008), s. 168-168 ISSN 0946-8978. [International Palynological Congress /12./ ; International Organisation of Palaeobotany Conference /8./. 30.08.2008-05.09.2008, Bonn] R&D Projects: GA AV ČR IAA300130503 Institutional research plan: CEZ:AV0Z30130516 Keywords : Carboniferous * Permian * sphenophylls Subject RIV: DB - Geology ; Mineralogy
Lifescience Database Archive (English)
Full Text Available tolB OS=Rhizobium leguminosarum bv.... 38 0.042 sp|A8F168|TOLB_RICM5 Protein tolB OS=Rickettsia massiliae (s...PDGARVSFES 309 >sp|A8F168|TOLB_RICM5 Protein tolB OS=Rickettsia massiliae (strain Mtu5) GN=tolB PE=3 SV=1 Le
Czech Academy of Sciences Publication Activity Database
Šlancarová, Jana; Vrba, Pavel; Plátek, Michal; Zapletal, Michal; Spitzer, Lukáš; Konvička, Martin
2015-01-01
Roč. 49, 29-30 (2015), s. 1825-1848 ISSN 0022-2933 R&D Projects: GA ČR GAP505/10/2167 Grant - others:GA JU(CZ) 04-168/2013/P; MŠMT(CZ) 168/2013/P Institutional support: RVO:60077344 Keywords : butterfly demography * dispersal * oviposition Subject RIV: EH - Ecology, Behaviour Impact factor: 1.010, year: 2015
Kunstneren mellem kald og afkald
DEFF Research Database (Denmark)
Sapiro, Gisèle
2008-01-01
Oversættelse af artiklen "La Vocation artistique entre don et don de soi" fra Actes de la recherche en sciences sociales, nr. 168, juni 2007, s. 4-11......Oversættelse af artiklen "La Vocation artistique entre don et don de soi" fra Actes de la recherche en sciences sociales, nr. 168, juni 2007, s. 4-11...
Czech Academy of Sciences Publication Activity Database
Tomková, V.; Ovčačík, F.; Vlček, J.; Ovčačíková, H.; Topinková, M.; Vavro, M.; Martinec, Petr
2012-01-01
Roč. 56, č. 2 (2012), s. 168-176 ISSN 0862-5468 R&D Projects: GA ČR GA106/09/0588 Institutional support: RVO:68145535 Keywords : alkali-activated materials * blast furnace slag * mechanical activation * fly ash Subject RIV: DD - Geochemistry Impact factor: 0.418, year: 2012 http://www.ceramics-silikaty.cz/2012/pdf/2012_02_168.pdf
Nishito, Yukari; Osana, Yasunori; Hachiya, Tsuyoshi; Popendorf, Kris; Toyoda, Atsushi; Fujiyama, Asao; Itaya, Mitsuhiro; Sakakibara, Yasubumi
2010-04-16
Bacillus subtilis natto is closely related to the laboratory standard strain B. subtilis Marburg 168, and functions as a starter for the production of the traditional Japanese food "natto" made from soybeans. Although re-sequencing whole genomes of several laboratory domesticated B. subtilis 168 derivatives has already been attempted using short read sequencing data, the assembly of the whole genome sequence of a closely related strain, B. subtilis natto, from very short read data is more challenging, particularly with our aim to assemble one fully connected scaffold from short reads around 35 bp in length. We applied a comparative genome assembly method, which combines de novo assembly and reference guided assembly, to one of the B. subtilis natto strains. We successfully assembled 28 scaffolds and managed to avoid substantial fragmentation. Completion of the assembly through long PCR experiments resulted in one connected scaffold for B. subtilis natto. Based on the assembled genome sequence, our orthologous gene analysis between natto BEST195 and Marburg 168 revealed that 82.4% of 4375 predicted genes in BEST195 are one-to-one orthologous to genes in 168, with two genes in-paralog, 3.2% are deleted in 168, 14.3% are inserted in BEST195, and 5.9% of genes present in 168 are deleted in BEST195. The natto genome contains the same alleles in the promoter region of degQ and the coding region of swrAA as the wild strain, RO-FF-1. These are specific for gamma-PGA production ability, which is related to natto production. Further, the B. subtilis natto strain completely lacked a polyketide synthesis operon, disrupted the plipastatin production operon, and possesses previously unidentified transposases. The determination of the whole genome sequence of Bacillus subtilis natto provided detailed analyses of a set of genes related to natto production, demonstrating the number and locations of insertion sequences that B. subtilis natto harbors but B. subtilis 168 lacks
Whole genome assembly of a natto production strain Bacillus subtilis natto from very short read data
Directory of Open Access Journals (Sweden)
Fujiyama Asao
2010-04-01
Full Text Available Abstract Background Bacillus subtilis natto is closely related to the laboratory standard strain B. subtilis Marburg 168, and functions as a starter for the production of the traditional Japanese food "natto" made from soybeans. Although re-sequencing whole genomes of several laboratory domesticated B. subtilis 168 derivatives has already been attempted using short read sequencing data, the assembly of the whole genome sequence of a closely related strain, B. subtilis natto, from very short read data is more challenging, particularly with our aim to assemble one fully connected scaffold from short reads around 35 bp in length. Results We applied a comparative genome assembly method, which combines de novo assembly and reference guided assembly, to one of the B. subtilis natto strains. We successfully assembled 28 scaffolds and managed to avoid substantial fragmentation. Completion of the assembly through long PCR experiments resulted in one connected scaffold for B. subtilis natto. Based on the assembled genome sequence, our orthologous gene analysis between natto BEST195 and Marburg 168 revealed that 82.4% of 4375 predicted genes in BEST195 are one-to-one orthologous to genes in 168, with two genes in-paralog, 3.2% are deleted in 168, 14.3% are inserted in BEST195, and 5.9% of genes present in 168 are deleted in BEST195. The natto genome contains the same alleles in the promoter region of degQ and the coding region of swrAA as the wild strain, RO-FF-1. These are specific for γ-PGA production ability, which is related to natto production. Further, the B. subtilis natto strain completely lacked a polyketide synthesis operon, disrupted the plipastatin production operon, and possesses previously unidentified transposases. Conclusions The determination of the whole genome sequence of Bacillus subtilis natto provided detailed analyses of a set of genes related to natto production, demonstrating the number and locations of insertion sequences that B
ORF Alignment: NC_000964 [GENIUS II[Archive
Lifescience Database Archive (English)
Full Text Available NC_000964 gi|16079742 >1chkA 2 232 35 273 9e-71 ... ref|NP_390566.1| chitosanase [Bac...illus subtilis subsp. subtilis str. 168] ... emb|CAB14630.1| chitosanase [Bacillus subtilis subsp. ... ... ... subtilis str. 168] emb|CAA63455.1| chitosanase precursor ... [Bacillus subtilis] sp|O07921|C...HIS_BACSU Chitosanase ... precursor gb|AAB80882.1| chitosanase precursor [
International Nuclear Information System (INIS)
Kunz, P.F.
1976-01-01
The problems of data analysis with hardware processors are reviewed and a description is given of a programmable processor. This processor, the 168/E, has been designed for use in the LASS multi-processor system; it has an execution speed comparable to the IBM 370/168 and uses the subset of IBM 370 instructions appropriate to the LASS analysis task. (Auth.)
International Nuclear Information System (INIS)
Hakuta, Yukiya; Haganuma, Tsukasa; Sue, Kiwamu; Adschiri, Tadafumi; Arai, Kunio
2003-01-01
Phosphor YAG:Tb ((Y 2.7 Tb 0.3 )Al 5 O 12 ) nano particles were synthesized by a hydrothermal method at supercritical conditions (400 deg. C and 30 MPa) using a flow reactor. Hydroxide sol solutions formed by stoichiometric aluminum nitrate, yttrium nitrate, terbium nitrate and potassium hydroxide solutions. The relationship between particle size and experimental variables including pH, concentration of coexistent ions and hydroxide sol were investigated. Particles were characterized by XRD, TEM and photo-luminescence measurements. Particle size of YAG:Tb became finer as pH was increased or potassium nitrate concentration of the starting metal salt solution was increased. By removing the coexisting ions (NO 3 - , K + ) from the metal salt solution, single phase YAG:Tb particles with 20 nm particle size were obtained. The emission spectra of YAG:Tb particles of 14 nm shows a blue shift
Kinetically inert lanthanide complexes as reporter groups for binding of potassium by 18-crown-6
DEFF Research Database (Denmark)
Junker, Anne Kathrine Ravnsborg; Tropiano, Manuel; Faulkner, Stephen
2016-01-01
in a copper(I)-catalyzed alkyne-azide cycloaddition (CuAAC) “click” reaction with azide-functionalized crown ethers. The resulting complexes were investigated using NMR and optical methods. Titrations with potassium chloride in methanol observing the sensititzed europium- and terbium-centered emissions were......-centered emission to report on the binding of potassium in an 18-crown-6 binding pocket. The responsive systems were made by linking a crown ether to a kinetically inert lanthanide binding pocket using a molecular building block approach. Specifically, an alkyne-appended Ln.DO3A was used as a building block...... used to investigate the response of the systems. The molecular reporters based on aliphatic crown ethers were found to have strongly inhibited binding of potassium, while the benzo-18-crown-6 derived systems had essentially the same association constants as the native crown ethers. The shape...
Advanced lasers for fusion applications
International Nuclear Information System (INIS)
Krupke, W.F.
1978-11-01
Projections indicate that MJ/MW laser systems, operating with efficiencies in escess of 1 percent, are required to drive laser fusion power reactors. Moreover, a premium in pellet performance is anticipated as the wavelength of the driver laser system is decreased. Short wavelength laser systems based on atomic selenium (lambda = 0.49μ), terbium molcular vapors (0.55μ), thulium doped dielectric solids (0.46μ), and on pulse compressions of KrF excimer laser radiaton (0.27μ) have been proposed and studied for this purpose. The technological scalability and efficiency of each of these systems is examined in this paper. All of these systems are projected to meet minimum systems requirements. Amont them, the pulse-compressed KrF system is projected to have the highest potential efficiency (6%) and the widest range of systems design options
International Nuclear Information System (INIS)
Kanias, G.D.
1985-01-01
Some trace elements exist in cosmetics due to the mineral origin of their raw materials and there is no information about their concentration levels in these products. Instrumental neutron activation analysis was applied to determine the elements: cerium, cesium, europium, hafnium, lanthanum, lutetium, potassium, rubidium, samarium, scandium, sodium, tantalum, terbium, tungsten and ytterbium in eyeshadow, face powder and rouge make-up cosmetic products from the Greek market. According to the results, a wide range of values was found between the three examined cosmetics as well as between the different samples belonging to the same kind of cosmetics. This probably could be attributed to the various manufacturers of the analyzed samples. Moreover, the use of neutron activation analysis as a suitable routine method is discussed for the control of some elements which must not be contained in cosmetics. (author)
Polycrystalline (TbXY1-X)2O3 Faraday rotator.
Ikesue, Akio; Aung, Yan Lin; Makikawa, Shinji; Yahagi, Akira
2017-11-01
We have succeeded for the first time in synthesizing an optical grade (Tb X Y 1-X ) 2 O 3 (X=0.5-1.0) ceramic Faraday rotator, which greatly exceeds the basic characteristics of the commercial terbium gallium garnet (TGG) (Tb 3 Ga 5 O 12 ) crystal. The Faraday rotation angle increased as the Tb concentration increased, and the Verdet constant increased from 2.1 (82 rad T -1 m -1 at X=0.5) to 3.8 times (154 rad T -1 m -1 at X=1.0) than the TGG single crystal, which is regarded as highest class. Therefore, it is possible to minimize the Faraday rotator length and the magnet in building an optical isolator. It was also confirmed that its optical quality was very comparable to the commercial TGG crystal.
Determination of active oxygen content in rare earth peroxides
International Nuclear Information System (INIS)
Queiroz, Carlos A.S.; Abrao, Alcidio
1993-01-01
The content of active oxygen in rare earth peroxides have been determined after the dissolution of the samples with hydrocloridic acid in the presence of potassium iodide. The free generated iodine is titrated with sodium thiosulfate using starch as indicator. The oxidation of iodide to the free iodine indicates the presence of a higher valence state rare earth oxide, until now specifically recognized for the oxides of cerium (Ce O 2 ), praseodymium (Pr 6 O 1 1) and terbium (TB 4 O 7 ). recently the authors synthesized a new series of rare earth compounds, the peroxides. These new compounds were prepared by precipitating the rare earth elements complexed with carbonate ion by addition of hydrogen peroxide. the authors demonstrated that all rare earth elements, once solubilized by complexing with carbonate ion, are quantitatively precipitated as peroxide by addition of hydrogen peroxide. (author)
Virulence of viral haemorrhagic septicaemia virus (VHSV) genotype III in rainbow trout
DEFF Research Database (Denmark)
Ito, Takafumi; Kurita, Jun; Mori, Koh-Ichiro
2016-01-01
with the genotype III VHSV isolate 4p168 for 1 and 6 h. The viral titre in organs from fish challenged with NO-2007-50-385 for 6 h increased more rapidly than those exposed for 1 h. By in vitro studies it was demonstrated that the final titres of VHSV DK-3592B (GI), NO-2007-50-385 and 4p168 inoculated on EPC cells...... were very similar, whereas when inoculated on the rainbow trout cell line RTG-2 the titre of the non-virulent 4p168 isolate was 3-4 logs below the two other VHSV isolates. Based on a comparative analysis of the entire genome of the genotype III isolates, we suggest that substitutions of amino acids...
International Nuclear Information System (INIS)
Zolotarev, K.I.
2010-11-01
Evaluations of cross sections and their associated covariance matrices have been carried out for five dosimetry reactions: excitation functions were re-evaluated for the 89 Y(n,2n) 88 Y, 93 Nb(n,2n) 92 mNb and 169 Tm(n,2n) 168 Tm reactions over the neutron energy range from threshold up to 40 MeV; excitation functions were re-evaluated for the 59 Co(n,3n) 57 Co and 209 Bi(n,3n) 207 Bi reactions over the neutron energy range from threshold to 85 and 45 MeV, respectively. Uncertainties in the cross sections for all of those reactions were also derived in the form of relative covariance matrices. Benchmark calculations performed for 235 U thermal fission and 252 Cf spontaneous fission neutron spectra show that the integral cross sections calculated from the newly evaluated excitation functions exhibit improved agreement with related experimental data when compared with the equivalent data from the IRDF-2002 library. (author)
: tous les projets | Page 168 | CRDI - Centre de recherches pour le ...
International Development Research Centre (IDRC) Digital Library (Canada)
Financement total : CA$ 1,499,300.00. Établissement d'une gouvernance efficace de l'eau dans les hautes terres d'Asie. Projet. La plupart des grandes rivières d'Asie, qui alimentent près de trois milliards de personnes en aval, prennent leur source dans les hautes terres d'Asie, y compris l'Himalaya et le plateau tibétain.
Ce que nous faisons | Page 168 | CRDI - Centre de recherches pour ...
International Development Research Centre (IDRC) Digital Library (Canada)
Sujet(s): Sida, Pénurie De Main D'oeuvre, Travailleurs Agricoles, Petites Exploitations Agricoles, Agroindustrie, Sécurité Alimentaire. Région(s): Afrique, Afrique Du Sud, Sud Du Sahara. Un nombre croissant d'études font état des éventuels effets dévastateurs du VIH-sida sur l'agriculture et sur la production alimentaire ...
Programming portlets from JSR 168 to IBM WebSphere portal extensions
Bernal, Joey; Lynn, Ron; Marston, Cayce; Memon, Usman
2012-01-01
Portals have evolved from simple Web applications with multiple links to an enterprise application delivery platform that serves composite applications. In a world where organizations are gearing up with service-oriented architecture (SOA) strategies and re-working existing apps to fit the Web 2.0 programming model, portals are strategic infrastructure components on every CIO's radar. As companies move toward SOA, portlets become an even hotter topic. Portlets provide the user interface for these services. IBM's unwavering commitment to open standards such as Java Specification Request (JSR 16
26 CFR 5c.168(f)(8)-6 - Qualified leased property.
2010-04-01
.... (ii) For purposes of this paragraph (a)(2) and paragraph (b)(3)(ii) of this section, transactional... (b)(3) applies is not required to file an information return or a statement concerning its election... city Y's rapid rail transit system. None of the funds relating to this UMTA-funded project, provided...
26 CFR 5c.168(f)(8)-5 - Term of lease.
2010-04-01
... the property. Any option to extend the term of the lease, whether or not at fair market value rent..., or (2) 150 percent of the asset depreciation range (ADR) present class life (“midpoint”) of such property, applicable as of January 1, 1981 (without regard to section 167(m)(4)), published in Rev. Proc...
SU-E-J-168: Automated Pancreas Segmentation Based On Dynamic MRI
International Nuclear Information System (INIS)
Gou, S; Rapacchi, S; Hu, P; Sheng, K
2014-01-01
Purpose: MRI guided radiotherapy is particularly attractive for abdominal targets with low CT contrast. To fully utilize this modality for pancreas tracking, automated segmentation tools are needed. A hybrid gradient, region growth and shape constraint (hGReS) method to segment 2D upper abdominal dynamic MRI is developed for this purpose. Methods: 2D coronal dynamic MR images of 2 healthy volunteers were acquired with a frame rate of 5 f/second. The regions of interest (ROIs) included the liver, pancreas and stomach. The first frame was used as the source where the centers of the ROIs were annotated. These center locations were propagated to the next dynamic MRI frame. 4-neighborhood region transfer growth was performed from these initial seeds for rough segmentation. To improve the results, gradient, edge and shape constraints were applied to the ROIs before final refinement using morphological operations. Results from hGReS and 3 other automated segmentation methods using edge detection, region growth and level set were compared to manual contouring. Results: For the first patient, hGReS resulted in the organ segmentation accuracy as measure by the Dices index (0.77) for the pancreas. The accuracy was slightly superior to the level set method (0.72), and both are significantly more accurate than the edge detection (0.53) and region growth methods (0.42). For the second healthy volunteer, hGReS reliably segmented the pancreatic region, achieving a Dices index of 0.82, 0.92 and 0.93 for the pancreas, stomach and liver, respectively, comparing to manual segmentation. Motion trajectories derived from the hGReS, level set and manual segmentation methods showed high correlation to respiratory motion calculated using a lung blood vessel as the reference while the other two methods showed substantial motion tracking errors. hGReS was 10 times faster than level set. Conclusion: We have shown the feasibility of automated segmentation of the pancreas anatomy based on dynamic MRI
Dicty_cDB: Contig-U16278-1 [Dicty_cDB
Lifescience Database Archive (English)
Full Text Available Ridge pineapple sweet orange entire ... 172 9e-48 3 ( CV715589 ) UCRCS08_0005P18_f Parent Washington Navel O...cte... 165 6e-44 3 ( DN619374 ) UCRCS11_03N09_r Parent Washington Navel Orange Sc... 168 6e-44 2 ( DR908461 ...08013E01SK PhyRootSw1 Citrus sinensis cDNA clone... 168 6e-44 2 ( DN617852 ) UCRCS11_01M10_r Parent Washingt...abr00225 Antheraea assama fifth instar larval br... 190 7e-44 1 ( CX074876 ) UCRCS08_41B06_g Parent Washingt... ( CV717911 ) UCRCS08_0009L22_r Parent Washington Navel Orange ... 168 7e-44 2 ( CV717910 ) UCRCS08_0009L22_f Parent
International Nuclear Information System (INIS)
Kunz, P.F.; Gravina, M.; Oxoby, G.; Trang, Q.; Fucci, A.; Jacobs, D.; Martin, B.; Storr, K.
1983-03-01
Since the introduction of the 168//sub E/, emulating processors have been successful over an amazingly wide range of applications. This paper will describe a second generation processor, the 3081//sub E/. This new processor, which is being developed as a collaboration between SLAC and CERN, goes beyond just fixing the obvious faults of the 168//sub E/. Not only will the 3081//sub E/ have much more memory space, incorporate many more IBM instructions, and have much more memory space, incorporate many more IBM instructions, and have full double precision floating point arithmetic, but it will also have faster execution times and be much simpler to build, debug, and maintain. The simple interface and reasonable cost of the 168//sub E/ will be maintained for the 3081//sub E/
Development and simulation of RF components for high power millimeter wave gyrotrons
Energy Technology Data Exchange (ETDEWEB)
Pereyaslavets, M.; Sato, M.; Shimozuma, T.; Takita, Y.; Idei, H.; Kubo, S.; Ohkubo, K.; Hayashi, K.
1996-11-01
To test gyrotron RF components, efficient low-power generators for rotating high-order modes of high purity are necessary. Designs of generators for the TE{sub 15,3} mode at 84 GHz and for the TE{sub 31,8} mode at 168 GHz are presented and some preliminary test results are discussed. In addition, Toshiba gyrotron cavities at 168 GHz were analyzed for leakage of RF power in the beam tunnel. To decrease RF power leakage, the declination angle of the cut-off cavity cross section has to be decreased. A TE{sub 15,3} waveguide nonlinear uptaper is analyzed at 84 GHz as well as 168 GHz uptapers. Since the calculated conversion losses are slightly higher than designed value, an optimization of those uptapers may be required. (author)
Charge-transfer-based terbium MOF nanoparticles as fluorescent pH sensor for extreme acidity.
Qi, Zewan; Chen, Yang
2017-01-15
Newly emerged metal organic frameworks (MOFs) have aroused the great interest in designing functional materials by means of its flexible structure and component. In this study, we used lanthanide Tb 3+ ions and small molecular ligands to design and assemble a kind of pH-sensitive MOF nanoparticle based on intramolecular-charge-transfer effect. This kind of made-to-order MOF nanoparticle for H + is highly specific and sensitive and could be used to fluorescently indicate pH value of strong acidic solution via preset mechanism through luminescence of Tb 3+ . The long luminescence lifetime of Tb 3+ allows eliminating concomitant non-specific fluorescence by time-revised fluorescence techniques, processing an advantage in sensing H + in biological media with strong autofluorescence. Our method showed a great potential of MOF structures in designing and constructing sensitive sensing materials for specific analytes directly via the assembly of functional ions/ligands. Copyright © 2016 Elsevier B.V. All rights reserved.
Photoluminescence studies of a Terbium(III) complex as a fluorescent probe for DNA detection
Energy Technology Data Exchange (ETDEWEB)
Khorasani-Motlagh, Mozhgan, E-mail: mkhorasani@chem.usb.ac.ir; Noroozifar, Meissam; Niroomand, Sona; Moodi, Asieh
2013-11-15
The photoluminescence properties of a Tb(III) complex of the form [Tb(phen){sub 2}Cl{sub 3}·OH{sub 2}] (phen=1,10-phenanthroline) in different solvents are presented. It shows the characteristic luminescence of the corresponding Ln{sup 3+} ion in the visible region. The emission intensity of this complex in coordinating solvent is higher than non-coordinating one. The suggested mechanism for the energy transfer between the ligand and Tb{sup 3+} ion is the intramolecular energy transfer mechanism. The interactions of the Tb(III) complex with fish salmon DNA are studied by fluorescence spectroscopy, circular dichroism study and viscosity measurements. The results of fluorescence titration reveal that DNA strongly quenches the intrinsic fluorescence of the complex through a static quenching procedure. The binding constant (K{sub b}) of the above metal complex at 25 °C is determined by the fluorescence titration method and it is found to be (8.06±0.01)×10{sup 3} M{sup −1}. The thermodynamic parameters (ΔH{sup 0}>0, ΔS{sup 0}>0 and ΔG{sup 0}<0) indicate that the hydrophobic interactions play a major role in DNA–Tb complex association. The results support the claim that the title complex bonds to FS-DNA by a groove mode. -- Highlights: • Photoluminescence of [Tb(phen){sub 2}Cl{sub 3}·OH{sub 2}] in different solvents are studied. • Tb(III) complex shows good binding affinity to FS DNA with K{sub b}=(8.06±0.01)×10{sup 3} M{sup −1}. • Viscosity of DNA almost unchanged by increasing amount of Tb complex. • CD spectrum of DNA has a little change with increasing amount of Tb complex. • Thermodynamic parameters indicate that the binding reaction is entropically driven.
Assessment of terbium (III) as a luminescent probe for the detection of tuberculosis biomarkers
International Nuclear Information System (INIS)
Bamogo, W.; Mugherli, L.; Banyasz, A.; Novelli-Rousseau, A.; Mallard, F.; Tran-Thi, T.-H.
2015-01-01
A detection method for nicotinic acid, a specific metabolite marker of Mycobacterium tuberculosis present in cultures and patients' breath, is studied in complex solutions containing other metabolites and in biological media such as urine, saliva and breath condensate. The method is based on the analysis of the luminescence increase of Tb 3+ complexes in the presence of nicotinic acid due to the energy transfer from the excited ligand to the lanthanide ion. It is shown that other potential markers found in M. tuberculosis culture supernatant, such as methyl phenylacetate, p-methyl anisate, methyl nicotinate and 2-methoxy biphenyl, can interfere with nicotinic acid via a competitive absorption of the excitation photons. A new strategy to circumvent these interferences is proposed with an upstream trapping of volatile markers preceding the detection of nicotinic acid in the liquid phase via the luminescence of Tb 3+ complexes. The cost of the method is evaluated and compared with the Xpert MTB/RIF test endorsed by the World Health Organization. - Highlights: • Nicotinic acid, a specific marker of M. tuberculosis, can be detected via luminescence. • The detection limit with a commercial phosphorimeter is 0.4 µmol·L -1 . • Other metabolites of M. tuberculosis can interfere via absorbed excitation light. • The interference can be removed via trapping of the most volatile metabolites. • A breath analysis procedure's cost is compared with the Xpert TBM/RIF test.
White- and blue-light-emitting dysprosium(III) and terbium(III)-doped gadolinium titanate phosphors.
Antić, Ž; Kuzman, S; Đorđević, V; Dramićanin, M D; Thundat, T
2017-06-01
Here we report the synthesis and structural, morphological, and photoluminescence analysis of white- and blue-light-emitting Dy 3 + - and Tm 3 + -doped Gd 2 Ti 2 O 7 nanophosphors. Single-phase cubic Gd 2 Ti 2 O 7 nanopowders consist of compact, dense aggregates of nanoparticles with an average size of ~25 nm for Dy 3 + -doped and ~50 nm for Tm 3 + -doped samples. The photoluminescence results indicated that ultraviolet (UV) light excitation of the Dy 3 + -doped sample resulted in direct generation of white light, while a dominant yellow emission was obtained under blue-light excitation. Intense blue light was obtained for Tm 3 + -doped Gd 2 Ti 2 O 7 under UV excitation suggesting that this material could be used as a blue phosphor. Copyright © 2016 John Wiley & Sons, Ltd.
Assessment of terbium (III) as a luminescent probe for the detection of tuberculosis biomarkers
Energy Technology Data Exchange (ETDEWEB)
Bamogo, W. [CNRS, IRAMIS, UMR 3685 NIMBE/LEDNA, F-91191 Gif-sur-Yvette (France); Mugherli, L. [CEA, IRAMIS, UMR 3685 NIMBE/LEDNA, F-91191 Gif-sur-Yvette (France); Banyasz, A. [CNRS, IRAMIS, LIDyL/Laboratoire Francis Perrin, URA 2453, F-91191 Gif-sur-Yvette (France); Novelli-Rousseau, A.; Mallard, F. [BioMérieux SA, F-38000 Grenoble (France); Tran-Thi, T.-H., E-mail: thu-hoa.tran-thi@cea.fr [CNRS, IRAMIS, UMR 3685 NIMBE/LEDNA, F-91191 Gif-sur-Yvette (France)
2015-10-08
A detection method for nicotinic acid, a specific metabolite marker of Mycobacterium tuberculosis present in cultures and patients' breath, is studied in complex solutions containing other metabolites and in biological media such as urine, saliva and breath condensate. The method is based on the analysis of the luminescence increase of Tb{sup 3+} complexes in the presence of nicotinic acid due to the energy transfer from the excited ligand to the lanthanide ion. It is shown that other potential markers found in M. tuberculosis culture supernatant, such as methyl phenylacetate, p-methyl anisate, methyl nicotinate and 2-methoxy biphenyl, can interfere with nicotinic acid via a competitive absorption of the excitation photons. A new strategy to circumvent these interferences is proposed with an upstream trapping of volatile markers preceding the detection of nicotinic acid in the liquid phase via the luminescence of Tb{sup 3+} complexes. The cost of the method is evaluated and compared with the Xpert MTB/RIF test endorsed by the World Health Organization. - Highlights: • Nicotinic acid, a specific marker of M. tuberculosis, can be detected via luminescence. • The detection limit with a commercial phosphorimeter is 0.4 µmol·L{sup -1}. • Other metabolites of M. tuberculosis can interfere via absorbed excitation light. • The interference can be removed via trapping of the most volatile metabolites. • A breath analysis procedure's cost is compared with the Xpert TBM/RIF test.
50 CFR Table 1 to Part 226 - Major Stellar Sea Lion Rookery Sites
2010-10-01
... 50 Wildlife and Fisheries 7 2010-10-01 2010-10-01 false Major Stellar Sea Lion Rookery Sites 1... Table 1 to Part 226—Major Stellar Sea Lion Rookery Sites Major Steller sea lion rookery sites are... 168 02.0W Ogchul I.1 53 00.0N 168 24.0W Sea Lion Rocks. (Amak) 1 55 28.0N 163 12.0W Ugamak I.1 54 14...
Magnetic properties of rare earth oxides with perovskite structure
International Nuclear Information System (INIS)
Hinatsu, Yukio
2008-01-01
A perovskite composite oxide is represented by the general formula of ABO 3 . Cations at the B site characterize magnetic properties of the oxide. Many studies have been accumulated for transition metal elements at the B sites. In this report the studies of rare earth elements at the B sites are reviewed. In rare elements, tetravalent ions such as Ce 4+ , Pr 4+ and Tb 4+ can occupy the B sites with Ba and Sr ions at the A sites. Both the SrTbO 3 and BaTbO 3 have an orthorhombic structure and show the antiferromagnetic transition at about 33 K, which is originated from terbium ions coupled antiferromagnetically with the six neighboring terbium ions. A tetravalent praseodymium perovskite SrPrO 3 shows no existence of the magnetic ordering down to 2.0 K. This is in contrast to the result of isomorphous BaPrO 3 , which shows an antiferromagnetic transition at 11.5 K. A double perovskite structure is represented by the formula A 2 LnMO 6 (A=Ba, Sr, Ca; M=Ru, Ir). In a double perovskite compound Ba 2 PrRuO 6 , the Pr 3+ and Ru 5+ ions are arranged with regularity over the six-coordinate B sites. This compound transforms to an antiferromagnetic state below 117 K. Antiferromagnetic transition temperatures T N for isomorphous Sr and Ca show a clear tendency, T N (A=Ba)>T N (Sr)>T N (Ca), in the compounds with the same rare earth elements (Ln). The 6H-perovskite structure Ba 3 LnRu 2 O 9 consists of linkages between LnO 6 octahedra and Ru 2 O 9 dimers made from face-shared RuO 6 octahedra. The 6H-perovskite structure Ba 3 MRu 2 O 9 (M=Sc, Y, La, Nd-Gd, Dy-Lu) have the valence state of Ba 3 M 3+ Ru 2 4.5+ O 9 . The magnetic susceptibilities show a broad maximum at 135-370 K. This magnetic behavior is ascribed to the antiferromagnetic coupling between two Ru ions in a Ru 2 O 9 dimer and to the magnetic interaction between the Ru 2 O 9 dimers. (author)
Directory of Open Access Journals (Sweden)
Ravely Casarotti Orlandelli
2016-06-01
Full Text Available Endophytic fungi have been described as producers of important bioactive compounds; however, they remain under-exploited as exopolysaccharides (EPS sources. Therefore, this work reports on EPS production by submerged cultures of eight endophytes isolated from Piper hispidum Sw., belonging to genera Diaporthe, Marasmius, Phlebia, Phoma, Phyllosticta and Schizophyllum. After fermentation for 96 h, four endophytes secreted EPS: Diaporthe sp. JF767000, Diaporthe sp. JF766998, Diaporthe sp. JF767007 and Phoma herbarum JF766995. The EPS from Diaporthe sp. JF766998 differed statistically from the others, with a higher percentage of carbohydrate (91% and lower amount of protein (8%. Subsequently, this fungus was grown under submerged culture for 72, 96 and 168 h (these EPS were designated EPSD1-72, EPSD1-96 and EPSD1-168 and the differences in production, monosaccharide composition and apparent molecular were compared. The EPS yields in mg/100 mL of culture medium were: 3.0 ± 0.4 (EPSD1-72, 15.4 ± 2.2 (EPSD1-96 and 14.8 ± 1.8 (EPSD1-168. The EPSD1-72 had high protein content (28.5% and only 71% of carbohydrate; while EPSD1-96 and EPSD1-168 were composed mainly of carbohydrate (≈95 and 100%, respectively, with low protein content (≈5% detected at 96 h. Galactose was the main monosaccharide component (30% of EPSD1-168. Differently, EPSD1-96 was rich in glucose (51%, with molecular weight of 46.6 kDa. It is an important feature for future investigations, because glucan-rich EPS are reported as effective antitumor agents.