
Sample records for terbium 164

  1. Elastic properties of terbium

    DEFF Research Database (Denmark)

    Spichkin, Y.I.; Bohr, Jakob; Tishin, A.M.


    The temperature dependence of the Young modulus along the crystallographic axes b and c (E(b) and E(c)), and the internal friction of a terbium single crystal have been measured. At 4.2 K, E(b) and E(c) are equal to 38 and 84.5 GPa, respectively. The lattice part of the Young modulus and the Debye...... temperature has been calculated. The origin of the Young modulus anomalies arising at the transition to the magnetically ordered state is discussed....

  2. Critical scattering of neutrons from terbium

    DEFF Research Database (Denmark)

    Als-Nielsen, Jens Aage; Dietrich, O.W.; Marshall, W.


    The inelasticity of the critical scattering of neutrons in terbium has been measured above the Neél temperature at the (0, 0, 2−Q) satellite position. The results show that dynamic slowing down of the fluctuations does occur in a second‐order phase transition in agreement with the general theory...

  3. Semiconductor composition containing iron, dysprosium, and terbium

    Energy Technology Data Exchange (ETDEWEB)

    Pooser, Raphael C.; Lawrie, Benjamin J.; Baddorf, Arthur P.; Malasi, Abhinav; Taz, Humaira; Farah, Annettee E.; Kalyanaraman, Ramakrishnan; Duscher, Gerd Josef Mansfred; Patel, Maulik K.


    An amorphous semiconductor composition includes 1 to 70 atomic percent iron, 15 to 65 atomic percent dysprosium, 15 to 35 atomic percent terbium, balance X, wherein X is at least one of an oxidizing element and a reducing element. The composition has an essentially amorphous microstructure, an optical transmittance of at least 50% in at least the visible spectrum and semiconductor electrical properties.

  4. Raman spectroscopy study of the doping effect of the encapsulated terbium halogenides on single-walled carbon nanotubes

    Energy Technology Data Exchange (ETDEWEB)

    Kharlamova, M.V.; Kramberger, C.; Mittelberger, A. [University of Vienna, Faculty of Physics, Vienna (Austria)


    In the present work, the doping effect of terbium chloride, terbium bromide, and terbium iodide on single-walled carbon nanotubes (SWCNTs) was compared by Raman spectroscopy. A precise investigation of the doping-induced alterations of the Raman modes of the filled SWCNTs was conducted. The shifts of the components of the Raman modes and modification of their profiles allowed concluding that the inserted terbium halogenides have acceptor doping effect on the SWCNTs, and the doping efficiency increases in the line with terbium iodide, terbium bromide, and terbium chloride. (orig.)

  5. Magnetocaloric effect of thin Terbium films (United States)

    Mello, V. D.; Anselmo, D. H. A. L.; Vasconcelos, M. S.; Almeida, N. S.


    We report a theoretical study of the magnetocaloric effect of Terbium (Tb) thin films due to finite size and surface effects in the helimagnetic phase, corresponding to a temperature range from TC=219 K to TN=231 K, for external fields of the order of kOe. For a Tb thin film of 6 monolayers submitted to an applied field (ΔH =30 kOe, ΔH =50 kOe and ΔH = 70 kOe) we report a significative change in adiabatic temperature, ΔT / ΔH , near the Néel temperature, of the order ten times higher than that observed for Tb bulk. On the other hand, for small values of the magnetic field, large thickness effects are found. For external field strength around few kOe, we have found that the thermal caloric efficiency increases remarkably for ultrathin films. For an ultrathin film with 6 monolayers, we have found ΔT / ΔH = 43 K/T while for thicker films, with 20 monolayers, ΔT / ΔH = 22 K/T. Our results suggest that thin films of Tb are a promising material for magnetocaloric effect devices for applications at intermediate temperatures.

  6. Femtosecond XUV spectroscopy of gadolinium and terbium

    Energy Technology Data Exchange (ETDEWEB)

    Carley, Robert; Frietsch, Bjoern; Doebrich, Kristian; Teichmann, Martin; Gahl, Cornelius; Noack, Frank [Max-Born-Institute, Berlin (Germany); Schwarzkopf, Olaf; Wernet, Philippe [Helmholtz-Zentrum fuer Materialien und Energie (BESSY II), Berlin (Germany); Weinelt, Martin [Max-Born-Institute, Berlin (Germany); Fachbereich Physik, Freie Universitaet, Berlin (Germany)


    We present recent results of time-resolved IR-pump-XUV-probe experiments on the ultrafast demagnetization of thin films of Gadolinium(0001) and Terbium(0001) on Tungsten(110). The experiments are the first to be done using a newly developed high-order harmonics (HHG) XUV beamline at the MBI. The beamline delivers monochromated XUV pulses of approximately 150 fs duration with a photon energy resolution of up to 150 meV. Following excitation by intense femtosecond infrared (IR) pulses, photoemission with 35 eV photons allows us to directly probe the 4f electrons and their interaction with the valence band, both in the bulk and at the surface, to follow the ultrafast magnetization dynamics in the Lanthanide metals. As signatures of ultrafast demagnetization of the metal by the IR pulse, we see for the first time, rapid strong reduction of the exchange splitting in the valence band. This is followed by a slower demagnetization due to the spin-lattice interaction.

  7. Green fluorescence of terbium ions in lithium fluoroborate glasses ...

    Indian Academy of Sciences (India)

    Glasses; terbium ion; oscillator strengths; fluorescence; lifetimes; fibre lasers. 1. Introduction. Today glasses are most favourable engineering materials for abundant applications due to the wide ability of property altering by compositional modifications. The considerable examination of glass science to achieve required ...

  8. Green fluorescence of terbium ions in lithium fluoroborate glasses ...

    Indian Academy of Sciences (India)

    Home; Journals; Bulletin of Materials Science; Volume 39; Issue 3. Green fluorescence of terbium ions in lithium fluoroborate glasses for fibre lasers and display devices. G R DILLIP C MADHUKAR REDDY M RAJESH SHIVANAND CHAURASIA B DEVA PRASAD RAJU S W JOO. Volume 39 Issue 3 June 2016 pp 711-717 ...

  9. Terahertz Cherenkov radiation from ultrafast magnetization in terbium gallium garnet (United States)

    Gorelov, S. D.; Mashkovich, E. A.; Tsarev, M. V.; Bakunov, M. I.


    We report an experimental observation of terahertz Cherenkov radiation from a moving magnetic moment produced in terbium gallium garnet by a circularly polarized femtosecond laser pulse via the inverse Faraday effect. Contrary to some existing theoretical predictions, the polarity of the observed radiation unambiguously demonstrates the paramagnetic, rather than diamagnetic, nature of the ultrafast inverse Faraday effect. From measurements of the radiation field, the Verdet constant in the subpicosecond regime is ˜3-10 times smaller than its table quasistatic value.

  10. 46 CFR 164.003-2 - Grades. (United States)


    ... 46 Shipping 6 2010-10-01 2010-10-01 false Grades. 164.003-2 Section 164.003-2 Shipping COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED) EQUIPMENT, CONSTRUCTION, AND MATERIALS: SPECIFICATIONS AND APPROVAL MATERIALS Kapok, Processed § 164.003-2 Grades. (a) Processed kapok shall be of but one grade as in...

  11. 40 CFR 164.31 - Intervention. (United States)


    ... 40 Protection of Environment 23 2010-07-01 2010-07-01 false Intervention. 164.31 Section 164.31... REGISTER, CANCELLATIONS OF REGISTRATIONS, CHANGES OF CLASSIFICATIONS, SUSPENSIONS OF REGISTRATIONS AND... (Other Than Expedited Hearings) Appearances, Intervention, and Consolidation § 164.31 Intervention. (a...

  12. 40 CFR 164.123 - Emergency order. (United States)


    ... 40 Protection of Environment 23 2010-07-01 2010-07-01 false Emergency order. 164.123 Section 164... Hearings § 164.123 Emergency order. (a) Whenever the Environmental Appeals Board determines that an emergency exists that does not permit him to hold a hearing before suspension, the Environmental Appeals...

  13. 32 CFR 935.164 - Boat operations. (United States)


    ... 32 National Defense 6 2010-07-01 2010-07-01 false Boat operations. 935.164 Section 935.164 National Defense Department of Defense (Continued) DEPARTMENT OF THE AIR FORCE TERRITORIAL AND INSULAR REGULATIONS WAKE ISLAND CODE Public Safety § 935.164 Boat operations. The operator of each boat used at Wake...

  14. 40 CFR 164.6 - Time. (United States)


    ... 40 Protection of Environment 23 2010-07-01 2010-07-01 false Time. 164.6 Section 164.6 Protection... OTHER HEARINGS CALLED PURSUANT TO SECTION 6 OF THE ACT General § 164.6 Time. (a) Computation. In computing any period of time prescribed or allowed by these rules, except as otherwise provided, the day of...

  15. 45 CFR 164.314 - Organizational requirements. (United States)


    ... 45 Public Welfare 1 2010-10-01 2010-10-01 false Organizational requirements. 164.314 Section 164.314 Public Welfare DEPARTMENT OF HEALTH AND HUMAN SERVICES ADMINISTRATIVE DATA STANDARDS AND RELATED... Information § 164.314 Organizational requirements. (a)(1) Standard: Business associate contracts or other...

  16. 45 CFR 164.105 - Organizational requirements. (United States)


    ... 45 Public Welfare 1 2010-10-01 2010-10-01 false Organizational requirements. 164.105 Section 164.105 Public Welfare DEPARTMENT OF HEALTH AND HUMAN SERVICES ADMINISTRATIVE DATA STANDARDS AND RELATED REQUIREMENTS SECURITY AND PRIVACY General Provisions § 164.105 Organizational requirements. (a)(1) Standard...

  17. 46 CFR 164.015-2 - Types. (United States)


    ... 46 Shipping 6 2010-10-01 2010-10-01 false Types. 164.015-2 Section 164.015-2 Shipping COAST GUARD... APPROVAL MATERIALS Plastic Foam, Unicellular, Buoyant, Sheet and Molded Shape § 164.015-2 Types. (a..., polymer or copolymer plastic foam shall be of three types as follows: Type A—for life preservers, buoyant...

  18. 46 CFR 164.012-10 - Requirements. (United States)


    ... 46 Shipping 6 2010-10-01 2010-10-01 false Requirements. 164.012-10 Section 164.012-10 Shipping COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED) EQUIPMENT, CONSTRUCTION, AND MATERIALS: SPECIFICATIONS AND APPROVAL MATERIALS Interior Finishes for Merchant Vessels § 164.012-10 Requirements. (a) For...

  19. 21 CFR 164.150 - Peanut butter. (United States)


    ... 21 Food and Drugs 2 2010-04-01 2010-04-01 false Peanut butter. 164.150 Section 164.150 Food and... § 164.150 Peanut butter. (a) Peanut butter is the food prepared by grinding one of the shelled and... preservatives, and color additives are not suitable ingredients in peanut butter. Oil products used as optional...

  20. Terbium luminescence in alumina xerogel fabricated in porous anodic alumina matrix under various excitation conditions

    Energy Technology Data Exchange (ETDEWEB)

    Gaponenko, N. V., E-mail: [Belarusian State University of Informatics and Radioelectronics (Belarus); Kortov, V. S. [Yeltsin Ural Federal University (Russian Federation); Orekhovskaya, T. I.; Nikolaenko, I. A. [Belarusian State University of Informatics and Radioelectronics (Belarus); Pustovarov, V. A.; Zvonarev, S. V.; Slesarev, A. I. [Yeltsin Ural Federal University (Russian Federation); Prislopski, S. Ya. [National Academy of Sciences of Belarus, Stepanov Institute of Physics (Belarus)


    Terbium-doped alumina xerogel layers are synthesized by the sol-gel method in pores of a porous anodic alumina film 1 {mu}m thick with a pore diameter of 150-180 nm; the film is grown on a silicon substrate. The fabricated structures exhibit terbium photoluminescence with bands typical of trivalent terbium terms. Terbium X-ray luminescence with the most intense band at 542 nm is observed for the first time for such a structure. Morphological analysis of the structure by scanning electron microscopy shows the presence of xerogel clusters in pore channels, while the main pore volume remains unfilled and pore mouths remain open. The data obtained confirm the promising applications of fabricated structures for developing matrix converters of X-rays and other ionizing radiations into visible light. The possibilities of increasing luminescence intensity in the matrix converter are discussed.

  1. Optical Properties of Lithium Terbium Fluoride and Implications for Performance in High Power Lasers (Postprint) (United States)



  2. 46 CFR 164.006-2 - Grades. (United States)


    ... 46 Shipping 6 2010-10-01 2010-10-01 false Grades. 164.006-2 Section 164.006-2 Shipping COAST GUARD... APPROVAL MATERIALS Deck Coverings for Merchant Vessels § 164.006-2 Grades. (a) Deck coverings shall be of but one grade as specified in this subpart, and shall be known as “an approved deck covering.” (b) ...

  3. Detection of biothiols in cells by a terbium chelate-Hg (II) system (United States)

    Tan, Hongliang; Chen, Yang


    Great efforts have been devoted to the development of sensitive and specific analysis methods for biothiols because of their important roles in biological systems. We present a new detection system for biothiols that is based on the reversible quenching and restoration of fluorescence of terbium chelate caused by Hg2+ and thiol species. In the presence of biothiols, a restoration of fluorescence of terbium chelate after quenching by Hg2+ was observed due to the interaction of Hg2+ with thiol groups, and the restored fluorescence increased with the concentration of biothiols. This method was sensitive and selective for biothiols. The detection limit was 80 nM for glutathione, 100 nM for Hcy, and 400 nM for Cysteine, respectively. The terbium chelate-Hg (II) system was successfully applied to determine the levels of biothiols in cancer cells and urine samples. Further, it was also shown to be comparable to Ellman's assay. Compared to other fluorescence methods, the terbium chelate probe is advantageous because interference from short-lived nonspecific fluorescence can be efficiently eliminated due to the long fluorescence lifetime of terbium chelate, which allows for detection by time-resolved fluorescence. The terbium chelate probe can serve as a diagnostic tool for the detection of abnormal levels of biothiols in disease.

  4. Cryogenic temperature characteristics of Verdet constant of terbium sesquioxide ceramics (United States)

    Snetkov, I. L.; Palashov, O. V.


    The dependence of the Verdet constant on temperature in the (80-300 K) range for a promising magneto-active material terbium sesquioxide Tb2O3 at the wavelengths of 405-1064 nm is considered. For each of the studied wavelengths, the Verdet constant of the material cooled down to the liquid nitrogen temperature increased by more than a factor of 3.2 as compared to the room temperature value. Similarly to the other paramagnetics, the increase follows the law ∼1/T. Approximations for the temperature dependence of the Verdet constant have been obtained and the value of 1/V·(dV/dT) has been estimated. This information is needed to determine the angle of rotation as well as the variation of the extinction ratio of a Faraday isolator with temperature and extremely important at creation a cryogenic Faraday devices.

  5. Biogenic terbium oxide nanoparticles as the vanguard against osteosarcoma (United States)

    Iram, Sana; Khan, Salman; Ansary, Abu Ayoobul; Arshad, Mohd; Siddiqui, Sahabjada; Ahmad, Ejaz; Khan, Rizwan H.; Khan, Mohd Sajid


    The synthesis of inner transition metal nanoparticles via an ecofriendly route is quite difficult. This study, for the first time, reports synthesis of terbium oxide nanoparticles using fungus, Fusarium oxysporum. The biocompatible terbium oxide nanoparticles (Tb2O3 NPs) were synthesized by incubating Tb4O7 with the biomass of fungus F. oxysporum. Multiple physical characterization techniques, such as UV-visible and photoluminescence spectroscopy, TEM, SAED, and zeta-potential were used to confirm the synthesis, purity, optical and surface characteristics, crystallinity, size, shape, distribution, and stability of the nanoemulsion of Tb2O3 NPs. The Tb2O3 NPs were found to inhibit the propagation of MG-63 and Saos-2 cell-lines (IC50 value of 0.102 μg/mL) and remained non-toxic up to a concentration of 0.373 μg/mL toward primary osteoblasts. Cell viability decreased in a concentration-dependent manner upon exposure to 10 nm Tb2O3 NPs in the concentration range 0.023-0.373 μg/mL. Cell toxicity was evaluated by observing changes in cell morphology, cell viability, oxidative stress parameters, and FACS analysis. Morphological examinations of cells revealed cell shrinkage, nuclear condensation, and formation of apoptotic bodies. The level of ROS within the cells-an indicator of oxidative stress was significantly increased. The induction of apoptosis at concentrations ≤ IC50 was corroborated by 4‧,6-diamidino-2-phenylindole dihydrochloride (DAPI) staining (DNA damage and nuclear fragmentation). Flow-cytometric studies indicated that the response was dose dependent with a threshold effect.

  6. 40 CFR 152.164 - Classification procedures. (United States)


    ... physical properties, in common. (b) Classification reviews. The Agency may conduct classification reviews... 40 Protection of Environment 23 2010-07-01 2010-07-01 false Classification procedures. 152.164... PESTICIDE REGISTRATION AND CLASSIFICATION PROCEDURES Classification of Pesticides § 152.164 Classification...

  7. 46 CFR 164.018-3 - Classification. (United States)


    ... 46 Shipping 6 2010-10-01 2010-10-01 false Classification. 164.018-3 Section 164.018-3 Shipping COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED) EQUIPMENT, CONSTRUCTION, AND MATERIALS... Classification. The following types of retroreflective material are approved under this specification: (a) Type I...

  8. 27 CFR 17.164 - Production record. (United States)


    ... 27 Alcohol, Tobacco Products and Firearms 1 2010-04-01 2010-04-01 false Production record. 17.164... PRODUCTS Records § 17.164 Production record. (a) General. Each manufacturer shall keep a production record for each batch of intermediate product and for each batch of nonbeverage product. The production...

  9. 45 CFR 164.312 - Technical safeguards. (United States)


    ... specifications: (i) Unique user identification (Required). Assign a unique name and/or number for identifying and...) Implementation specification: Mechanism to authenticate electronic protected health information (Addressable... Information § 164.312 Technical safeguards. A covered entity must, in accordance with § 164.306: (a)(1...

  10. Autofluorescence-free Live-cell Imaging Using Terbium Nanoparticles. (United States)

    Cardoso Dos Santos, Marcelina; Goetz, Joan; Bartenlian, Hortense; Wong, Ka-Leung; Charbonniere, Loïc Joanny; Hildebrandt, Niko


    Fluorescent nanoparticles (NPs) have become irreplaceable tools for advanced cellular and sub-cellular imaging. While very bright NPs require excitation with UV or visible light, which can create strong autofluorescence of biological components, NIR-excitable NPs without autofluorescence issues exhibit much lower brightness. Here, we show the application of a new type of surface-photosensitized terbium NPs (Tb-NPs) for autofluorescence-free intracellular imaging in live HeLa cells. Combination of exceptionally high brightness, high photostability, and long photoluminecence (PL) lifetimes for highly efficient suppression of the short-lived autofluorescence, allowed for time-gated PL imaging of intracellular vesicles over 72 h without toxicity and at extremely low Tb-NP concentrations down to 12 pM. Detection of highly resolved long-lifetime (ms) PL decay curves from small (~10 µm2) areas within single cells within a few seconds emphasized the unprecedented photophysical properties of Tb-NPs for live-cell imaging that extend well beyond currently available nanometric imaging agents.

  11. Solar Thermochemical Hydrogen Production via Terbium Oxide Based Redox Reactions

    Directory of Open Access Journals (Sweden)

    Rahul Bhosale


    Full Text Available The computational thermodynamic modeling of the terbium oxide based two-step solar thermochemical water splitting (Tb-WS cycle is reported. The 1st step of the Tb-WS cycle involves thermal reduction of TbO2 into Tb and O2, whereas the 2nd step corresponds to the production of H2 through Tb oxidation by water splitting reaction. Equilibrium compositions associated with the thermal reduction and water splitting steps were determined via HSC simulations. Influence of oxygen partial pressure in the inert gas on thermal reduction of TbO2 and effect of water splitting temperature (TL on Gibbs free energy related to the H2 production step were examined in detail. The cycle (ηcycle and solar-to-fuel energy conversion (ηsolar-to-fuel efficiency of the Tb-WS cycle were determined by performing the second-law thermodynamic analysis. Results obtained indicate that ηcycle and ηsolar-to-fuel increase with the decrease in oxygen partial pressure in the inert flushing gas and thermal reduction temperature (TH. It was also realized that the recuperation of the heat released by the water splitting reactor and quench unit further enhances the solar reactor efficiency. At TH=2280 K, by applying 60% heat recuperation, maximum ηcycle of 39.0% and ηsolar-to-fuel of 47.1% for the Tb-WS cycle can be attained.

  12. Folate Receptor Targeted Alpha-Therapy Using Terbium-149

    CERN Document Server

    Müller, Cristina; Haller, Stephanie; Dorrer, Holger; Köster, Ulli; Johnston, Karl; Zhernosekov, Konstantin; Türler, Andreas; Schibli, Roger


    Terbium-149 is among the most interesting therapeutic nuclides for medical applications. It decays by emission of short-range α-particles (Eα = 3.967 MeV) with a half-life of 4.12 h. The goal of this study was to investigate the anticancer efficacy of a 149Tb-labeled DOTA-folate conjugate (cm09) using folate receptor (FR)-positive cancer cells in vitro and in tumor-bearing mice. 149Tb was produced at the ISOLDE facility at CERN. Radiolabeling of cm09 with purified 149Tb resulted in a specific activity of ~1.2 MBq/nmol. In vitro assays performed with 149Tb-cm09 revealed a reduced KB cell viability in a FR-specific and activity concentration-dependent manner. Tumor-bearing mice were injected with saline only (group A) or with 149Tb-cm09 (group B: 2.2 MBq; group C: 3.0 MBq). A significant tumor growth delay was found in treated animals resulting in an increased average survival time of mice which received 149Tb-cm09 (B: 30.5 d; C: 43 d) compared to untreated controls (A: 21 d). Analysis of blood parameters rev...

  13. Hardness and dielectric characteristics of flux grown terbium aluminate crystals

    Energy Technology Data Exchange (ETDEWEB)

    Sharma, K.K.; Kotru, P.N. [Jammu Univ. (India). Dept. of Physics; Tandon, R.P. [National Physical Laboratory, New Delhi (India); Wanklyn, B.M. [Clarendon Laboratory, University of Oxford, Oxford (United Kingdom)


    Results of indentation induced Vickers hardness testing and dielectric studies conducted on flux-grown terbium aluminate crystals are presented. It is shown that the Vickers hardness value (H{sub v}) is independent of indentation time, but depends on the applied load. Applying the concept of Hays and Kendall, the load independent values are estimated for (110) and (001) planes. Differential behaviour in the crack formation of two different planes (110) and (001) is observed, while (001) plane develops Palmqvist cracks in the whole load range of 10-100 g, (110) plane shows a transition from Palmqvist to median cracks at 70 g. The fracture toughness, brittleness index and yield strength are determined for both the planes. The hardness anisotropy is reported. The dielectric constant, dielectric loss and conductivity are shown to be dependent on temperature and frequency of the applied a.c. field. The dielectric constant versus temperature shows a transition peak at 230 C, which remains independent of the frequency of the applied a.c. field in the range 1 kHz-13 MHz. (orig.) 36 refs.

  14. 45 CFR 164.406 - Notification to the media. (United States)


    ... 45 Public Welfare 1 2010-10-01 2010-10-01 false Notification to the media. 164.406 Section 164.406... § 164.406 Notification to the media. (a) Standard. For a breach of unsecured protected health... the discovery of the breach as provided in § 164.404(a)(2), notify prominent media outlets serving the...

  15. Non-Rotational States of 164Dy (United States)

    Běrziņš, J.; Bondarenko, V.; Krasta, T.; Hoyler, F.; Föhl, K.; Börner, H. G.; Krusche, B.; Robinson, S. J.; Schillenbeck, P.


    The level scheme of 164Dy up to about 2.6 MeV energy is analyzed, using experimental data obtained in (n, γ), (n, e-) and (n, nγγ) reaction measurements at the high-flux reactor ILL Grenoble, as well as the (n, n'γ) reaction data, measured at the IRT reactor in Salaspils. The structure of low-lying levels of 164Dy is interpreted in terms of two-quasiparticle states, interacting with collective excitations of axially-deformed core.

  16. Dicty_cDB: SLJ164 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLJ164 (Link to dictyBase) - - - Contig-U10711-1 SLJ164Z (Link... to Original site) - - SLJ164Z 229 - - - - Show SLJ164 Library SL (Link to library) Clone ID SLJ164 (Link Representative seq. ID SLJ16...4Z (Link to Original site) Representative DNA sequence >SLJ164 (SLJ164Q) /CSM/SL/SLJ1-C/SLJ164Q.Seq.d/ XXXXX...M-cDNA Score E Sequences producing significant alignments: (bits) Value VSE426 (VSE426Q) /CSM/VS/VSE4-B/VSE426Q.Seq.d/ 454 e-127 SLJ

  17. Thermoluminescence of cerium and terbium -doped calcium pyrophosphate

    Energy Technology Data Exchange (ETDEWEB)

    Roman L, J.; Cruz Z, E. [UNAM, Instituto de Ciencias Nucleares, Circuito Exterior, Ciudad Universitaria, 04510 Mexico D. F. (Mexico); Lozano R, I. B.; Diaz G, J. A. I., E-mail: [IPN, Centro de Investigacion en Ciencia Aplicada y Tecnologia Avanzada, Av. Legaria No. 694, 11500 Mexico D. F. (Mexico)


    The aim of this work is to report the thermoluminescence (Tl) response of Calcium Pyrophosphate phosphor doped with Cerium and Terbium impurities (Ca{sub 2}P{sub 2}O{sub 7}:Ce{sup 3+},Tb{sup 3+}). The phosphors were synthesized using the co-precipitation method and annealed at 900 degrees C by two hours for obtain the β phase. The intentional doping with Ce and Tb ions was 1 at.% and 0.1 at.%, whereas in the EDS results the concentration of impurities was 0.39 at.% and 0.05 at.%, respectively. The superficial morphology of phosphor is mainly composed by thin wafers of different size. All samples were exposed to gamma rays from {sup 60}Co in the Gammacell-200 irradiator. The Tl response of the phosphor was measured from Rt up to 350 degrees C and under nitrogen atmosphere in a Harshaw TLD 3500 reader. The glow curves of the Ca{sub 2}P{sub 2}O{sub 7}:Ce{sup 3+},Tb{sup 3+} powders showed a broad intense Tl peak centered at 165 degrees C and a shoulder at approximate 260 degrees C was observed. A linear Tl response in the range of absorbed dose of 0.2 to 10 Gy was obtained. Tl glow curves were analyzed using the initial rise (IR)and computerized glow curve deconvolution methods to evaluate the kinetics parameters such as activation energy (E), frequency factor (s) and kinetic order (b). (Author)

  18. Solvent polarity and oxygen sensitivity, rather than viscosity, determine lifetimes of biaryl-sensitised terbium luminescence. (United States)

    Walter, Edward R H; Williams, J A Gareth; Parker, David


    In a macrocyclic terbium complex incorporating a biaryl sensitiser, the observed variation of emission lifetime is shown to be determined by the solubility of oxygen in the solvent system and the relative energy of the chromophore excited state, rather than any dependence on solvent viscosity.

  19. 45 CFR 164.530 - Administrative requirements. (United States)


    ... by the notice required by § 164.520. (2) Implementation specification: Personnel designations. A... workforce on the policies and procedures with respect to protected health information required by this...) Implementation specification: Safeguards. A covered entity must reasonably safeguard protected health information...

  20. Brucellosis: a retrospective evaluation of 164 cases. (United States)

    Kazak, Esra; Akalın, Halis; Yılmaz, Emel; Heper, Yasemin; Mıstık, Reşit; Sınırtaş, Melda; Özakın, Cüneyt; Göral, Güher; Helvacı, Safiye


    Brucellosis is a public health problem that is prevalent in several developing countries. The clinical and laboratory characteristics of 164 cases of brucellosis in Bursa, Turkey, were retrospectively evaluated. The ages of the 164 patients ranged from 15-85 years. All of the patients underwent the Rose Bengal test and 163 (99.4%) patients tested positive. 122 (74.4%) patients were diagnosed with acute brucellosis, 31 (18.9%) with subacute brucellosis and 11 (6.7%) with chronic brucellosis. Focal involvement was found in 101 (61.6%) patients. Although patients with focal involvement had a higher white blood cell count (p = 0.002), those without focal involvement had higher aspartate transaminase and alanine transaminase values, and lower platelet values (p = 0.005, 0.007 and 0.039, respectively). Spondylodiscitis was observed on imaging in 58 (66.7%) of the 87 patients who presented with back pain. Among the 118 patients who were examined within the first month of treatment, 79 (66.9%) responded to treatment. The relapse rate was 11.6% among all 164 patients. Brucellosis should be considered as a differential diagnosis among patients who present with fever, and joint or back pain. Focal involvement should be investigated in the presence of leucocytosis, and subacute or chronic forms of brucellosis. To identify cases of spondylodiscitis, radiography should be performed in patients who present with back pain.

  1. 45 CFR 164.404 - Notification to individuals. (United States)


    ... 45 Public Welfare 1 2010-10-01 2010-10-01 false Notification to individuals. 164.404 Section 164... § 164.404 Notification to individuals. (a) Standard—(1) General rule. A covered entity shall, following the discovery of a breach of unsecured protected health information, notify each individual whose...

  2. 45 CFR 164.106 - Relationship to other parts. (United States)


    ... 45 Public Welfare 1 2010-10-01 2010-10-01 false Relationship to other parts. 164.106 Section 164.106 Public Welfare DEPARTMENT OF HEALTH AND HUMAN SERVICES ADMINISTRATIVE DATA STANDARDS AND RELATED REQUIREMENTS SECURITY AND PRIVACY General Provisions § 164.106 Relationship to other parts. In complying with...

  3. 33 CFR 164.41 - Electronic position fixing devices. (United States)


    ... 33 Navigation and Navigable Waters 2 2010-07-01 2010-07-01 false Electronic position fixing devices. 164.41 Section 164.41 Navigation and Navigable Waters COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED) PORTS AND WATERWAYS SAFETY NAVIGATION SAFETY REGULATIONS § 164.41 Electronic position...

  4. 19 CFR 191.164 - Return to Customs custody. (United States)


    ... 19 Customs Duties 2 2010-04-01 2010-04-01 false Return to Customs custody. 191.164 Section 191.164... to Sample or Specifications § 191.164 Return to Customs custody. There is no time limit for the return to Customs custody of distilled spirits, wine, or beer subject to refund of taxes under the...

  5. 46 CFR 164.008-4 - Test requirements. (United States)


    ...: SPECIFICATIONS AND APPROVAL MATERIALS Bulkhead Panels § 164.008-4 Test requirements. (a) Thermal insulation: The insulation value of the specimens for the full scale test shall be such that the average temperature of... 46 Shipping 6 2010-10-01 2010-10-01 false Test requirements. 164.008-4 Section 164.008-4 Shipping...

  6. Arginine-responsive terbium luminescent hybrid sensors triggered by two crown ether carboxylic acids

    Energy Technology Data Exchange (ETDEWEB)

    Jiang, Lasheng [Key Laboratory of Theoretical Chemistry of Environment, Ministry of Education, School of Chemistry and Environment, South China Normal University, Guangzhou 510006 (China); School of Chemistry and Environment, South China Normal University, Guangzhou 510006 (China); Tang, Ke; Ding, Xiaoping [School of Chemistry and Environment, South China Normal University, Guangzhou 510006 (China); Wang, Qianming, E-mail: [Key Laboratory of Theoretical Chemistry of Environment, Ministry of Education, School of Chemistry and Environment, South China Normal University, Guangzhou 510006 (China); School of Chemistry and Environment, South China Normal University, Guangzhou 510006 (China); Zhou, Zhan; Xiao, Rui [School of Chemistry and Environment, South China Normal University, Guangzhou 510006 (China)


    Crown ether carboxylic acids constitute main building blocks for the synthesis of terbium containing covalent cross-linked luminescent materials. Both the complexes and the hybrid nanomaterials could exhibit remarkable green emissions in pure water. More importantly, they were found to have a profound effect on the luminescence responses to arginine compared with glutamic acid, histidine, tryptophan, threonine, tyrosine and phenylalanine in aqueous environment. The present study provided the possibility of using a host–guest mechanism as a way of signal transduction based on lanthanide supramolecular hybrid materials. - Highlights: • Crown ether carboxylic acids were found to sensitize terbium ions among a group of ethers. • The complexes and silica hybrid materials were both prepared and characterized. • They could exhibit remarkable green emissions in pure water.

  7. Comparative analysis of conjugated alkynyl chromophore-triazacyclononane ligands for sensitized emission of europium and terbium. (United States)

    Soulié, Marine; Latzko, Frédéric; Bourrier, Emmanuel; Placide, Virginie; Butler, Stephen J; Pal, Robert; Walton, James W; Baldeck, Patrice L; Le Guennic, Boris; Andraud, Chantal; Zwier, Jurriaan M; Lamarque, Laurent; Parker, David; Maury, Olivier


    A series of europium and terbium complexes based on a functionalized triazacyclononane carboxylate or phosphinate macrocyclic ligand is described. The influence of the anionic group, that is, carboxylate, methylphosphinate, or phenylphosphinate, on the photophysical properties was studied and rationalized on the basis of DFT calculated structures. The nature, number, and position of electron-donating or electron-withdrawing aryl substituents were varied systematically within the same phenylethynyl scaffold in order to optimize the brightness of the corresponding europium complexes and investigate their two-photon absorption properties. Finally, the europium complexes were examined in cell-imaging applications, and selected terbium complexes were studied as potential oxygen sensors. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  8. Spectrofluorimetric Determination of Human Serum Albumin Using Terbium-Danofloxacin Probe


    Ramezani, Amir M.; Manzoori, Jamshid L.; Amjadi, Mohammad; Jouyban, Abolghasem


    A spectrofluorimetric method is proposed for the determination of human serum albumin (HSA) and bovine serum albumin (BSA) using terbium-danofloxacin (Tb3+-Dano) as a fluorescent probe. These proteins remarkably enhance the fluorescence intensity of the Tb3+-Dano complex at 545 nm, and the enhanced fluorescence intensity of Tb3+-Dano is proportional to the concentration of proteins (HSA and BSA). Optimum conditions for the determination of HSA were investigated and found that the maximum resp...

  9. Dicty_cDB: SHK164 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available (Link to library) SHK164 (Link to dictyBase) - G23215 DDB0235267 Contig-U15795-1 - (Link to Original site)...Show SHK164 Library SH (Link to library) Clone ID SHK164 (Link to dictyBase) Atlas ID - NBRP ID G23215 dictyBase...dictyBase ID DDB0235267 Link to Contig Contig-U15795-1 Original site URL Representative seq. ID - (Link to Original site) Representative DNA sequence >SHK164...XXXXXXXXXXGATCAGTAGCTCAGAATAAAACAATTGGATCAGGTAAAATGTTATCAATT AATATTGGTGCTAAAGAATACTTGGATTCTTATTCAACTAAATATCCATCGGTAGAAATC

  10. Genetically Encoded FRET-Sensor Based on Terbium Chelate and Red Fluorescent Protein for Detection of Caspase-3 Activity

    Directory of Open Access Journals (Sweden)

    Alexander S. Goryashchenko


    Full Text Available This article describes the genetically encoded caspase-3 FRET-sensor based on the terbium-binding peptide, cleavable linker with caspase-3 recognition site, and red fluorescent protein TagRFP. The engineered construction performs two induction-resonance energy transfer processes: from tryptophan of the terbium-binding peptide to Tb3+ and from sensitized Tb3+ to acceptor—the chromophore of TagRFP. Long-lived terbium-sensitized emission (microseconds, pulse excitation source, and time-resolved detection were utilized to eliminate directly excited TagRFP fluorescence and background cellular autofluorescence, which lasts a fraction of nanosecond, and thus to improve sensitivity of analyses. Furthermore the technique facilitates selective detection of fluorescence, induced by uncleaved acceptor emission. For the first time it was shown that fluorescence resonance energy transfer between sensitized terbium and TagRFP in the engineered construction can be studied via detection of microsecond TagRFP fluorescence intensities. The lifetime and distance distribution between donor and acceptor were calculated using molecular dynamics simulation. Using this data, quantum yield of terbium ions with binding peptide was estimated.

  11. 40 CFR 164.1 - Number of words. (United States)


    ... 40 Protection of Environment 23 2010-07-01 2010-07-01 false Number of words. 164.1 Section 164.1... OTHER HEARINGS CALLED PURSUANT TO SECTION 6 OF THE ACT General § 164.1 Number of words. As used in this part, a word in the singular form shall be deemed to import the plural, and vice versa, as the case may...

  12. Green light emission in aluminum oxide powders doped with different terbium concentrations

    Energy Technology Data Exchange (ETDEWEB)

    Mariscal B, L; Falcony, C. [IPN, Centro de Investigacion y de Estudios Avanzados, 07360 Ciudad de Mexico (Mexico); Carmona T, S.; Murrieta, H.; Sanchez A, M. A. [UNAM, Instituto de Fisica, 04510 Ciudad de Mexico (Mexico); Vazquez A, R. [IPN, Escuela Superior de Computo, 07738 Ciudad de Mexico (Mexico); Garcia R, C. M., E-mail: [UNAM, Facultad de Ciencias, 04510 Ciudad de Mexico (Mexico)


    Different emission intensities presented in aluminum oxide phosphors corresponding to different concentrations of doping performed with terbium are analyzed. The phosphors were synthesized by the evaporation technique and were characterized by photo and cathodoluminescence, X-ray diffraction and EDS techniques for different incorporation percentages of terbium as dopant; they show characteristic transitions in 494, 543, 587 and 622 nm, corresponding to {sup 5}D{sub 4} → {sup 7}F{sub 6}, {sup 5}D{sub 4} → {sup 7}F{sub 5}, {sup 5}D{sub 4} → {sup 7}F{sub 4} and {sup 5}D{sub 4} → {sup 7}F{sub 3}, respectively when they are excited with λ{sub exc} = 380 nm wavelength at room temperature. The results of X-ray diffraction show the presence of α-Al{sub 2}O{sub 3} phases with peaks located at 2θ = 25.78, 35.34, 37.96, 43.56, 45.8, 52.74, 57.7, 61.5, 66.74, 68.44, 77.12 and 80.94, and the δ-Al{sub 2}O-3 phase 2θ = 32.82, 45.8, 61.36 and 66.74. These compounds were heat treated for two hours at 1100 degrees Celsius. EDS analyzes indicate that these compounds have close to 60% oxygen around of 40% aluminum in the presence of terbium as dopant which indicates a stoichiometry close to the expected one for alumina. (Author)

  13. Graphene quantum dots-terbium ions as novel sensitive and selective time-resolved luminescent probes. (United States)

    Llorent-Martínez, Eulogio J; Durán, Gema M; Ríos, Ángel; Ruiz-Medina, Antonio


    We propose an alternative approach for the development of analytical methods based on terbium-sensitized luminescence (TSL). TSL is based on the complexation between Tb(III) ions and fluorescent organic compounds that have appropriate functional groups to complex with Tb(III). We report the use of graphene quantum dot (GQDs) nanoparticles to improve the sensitivity and selectivity of TSL detection. GQDs can react with terbium ions through the carboxylic groups present in their structure. These Tb(III)-GQD complexes, formed in situ in aqueous solution, can be used as time-resolved luminescent probes. Ascorbic acid was selected as a target analyte to demonstrate the suitability of the proposed method. The selectivity of the TSL method was highly improved for most of the interferences tested. Under the optimum conditions [Tb(III) concentration 5 × 10-4 mol L-1, GQD concentration 4 mg L-1], a minimum 100% increase in selectivity was observed for several vitamins and common cations that may be present in the samples to be analyzed. In addition, the analytical signal showed a 30% enhancement with the use of GQDs compared with the use of merely Tb(III) ions, with a detection limit of 0.12 μg mL-1. The repeatability and intermediate precision were lower than 3% and 5%, respectively. From the results obtained, the implementation of GQDs in TSL can lead to the development of novel time-resolved luminescent probes with high analytical potential. Graphical abstract Quenching of Tb(III)-graphene quantum dot (GQD) luminescence by ascorbic acid (AA). TBL terbium-sensitized luminescence.

  14. Fluorescence study of some terbium-oligopeptide complexes in methanolic solution. (United States)

    Rabouan, S; Delage, J; Durand, W; Prognon, P; Barthes, D


    This study concerned the use of lanthanide chelates to detect glycyl-leucyl-phenylalanine (GLF) and its homologues. Spectroscopic analysis of peptides without or with terbium complexation revealed the formation of (LF)(3)(Tb)(2), (GF)(3)(Tb)(2), (GLF)(3)(Tb)(2) and (FL)(4)Tb, (FG)(4)Tb complexes with high stability constants in methanolic solutions (pK(d)>13). Lanthanide chelate emission displayed a large Stokes shift (>270 nm), which allowed Tb chelates of GLF and its derivatives to be used for detection purposes. However, this preliminary study indicated some important limitations associated with lanthanide chelation, such as high methanolic content.

  15. Electromagnetic properties of terbium gallium garnet at millikelvin temperatures and low photon energy (United States)

    Kostylev, Nikita; Goryachev, Maxim; Bushev, Pavel; Tobar, Michael E.


    Electromagnetic properties of single crystal terbium gallium garnet are characterised from room down to millikelvin temperatures using the whispering gallery mode method. Microwave spectroscopy is performed at low powers equivalent to a few photons in energy and conducted as functions of the magnetic field and temperature. A phase transition is detected close to the temperature of 3.5 K. This is observed for multiple whispering gallery modes causing an abrupt negative frequency shift and a change in transmission due to extra losses in the new phase caused by a change in complex magnetic susceptibility.

  16. Nuclear excitation functions from 40 to 200 MeV proton irradiation of terbium

    Energy Technology Data Exchange (ETDEWEB)

    Engle, Jonathan W., E-mail:; Mashnik, Stepan G.; Parker, Lauren A.; Jackman, Kevin R.; Bitteker, Leo J.; Ullmann, John L.; Gulley, Mark S.; Pillai, Chandra; John, Kevin D.; Birnbaum, Eva R.; Nortier, Francois M.


    Nuclear formation cross sections are reported for 26 radionuclides, measured with 40–200 MeV proton irradiations of terbium foils. These data provide the basis for the production of medically relevant radionuclides (e.g., {sup 152}Tb, {sup 155}Tb, {sup 155}Eu, and {sup 156}Eu) and {sup 153}Gd, a potential source used in ongoing efforts to characterize stellar nucleosynthesis routes. Computational predictions from the ALICE2011, CEM03.03, Bertini, and INCL + ABLA codes are compared with newly measured data to contribute to the ongoing process of code development, and yields are calculated for selected radionuclides using measured data.

  17. 33 CFR 164.80 - Tests, inspections, and voyage planning. (United States)


    ... planning. 164.80 Section 164.80 Navigation and Navigable Waters COAST GUARD, DEPARTMENT OF HOMELAND..., and voyage planning. (a) The owner, master, or operator of each towing vessel of less than 1,600 GT... applicable; of chafing gear; and of the winch brake, if installed. (c)(1) The voyage-planning requirements...

  18. 46 CFR 164.009-17 - Density measurement. (United States)


    ... 46 Shipping 6 2010-10-01 2010-10-01 false Density measurement. 164.009-17 Section 164.009-17... measurement. (a) The measurements described in this section are made to determine the density of a sample. (b... the specimen. The average of at least four measurements of each dimension is determined. (c) If the...

  19. 33 CFR 164.03 - Incorporation by reference. (United States)


    ... Identification System (AIS), dated January 6, 2003 164.46 SOLAS, International Convention for Safety of Life at..., (SOLAS 2000 Amendments) 164.46 Conference resolution 1, Adoption of amendments to the Annex to the International Convention for the Safety of Life at Sea, 1974, and amendments to Chapter V of SOLAS 1974, adopted...

  20. 49 CFR 176.164 - Fire precautions and firefighting. (United States)


    ... 49 Transportation 2 2010-10-01 2010-10-01 false Fire precautions and firefighting. 176.164 Section... Detailed Requirements for Class 1 (Explosive) Materials Precautions During Loading and Unloading § 176.164 Fire precautions and firefighting. (a) Matches, lighters, fire, and other ignition sources are...

  1. 46 CFR 164.003-3 - Material and workmanship. (United States)


    ... 46 Shipping 6 2010-10-01 2010-10-01 false Material and workmanship. 164.003-3 Section 164.003-3 Shipping COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED) EQUIPMENT, CONSTRUCTION, AND MATERIALS... not permitted. Provision shall be made for trapping seeds and heavy objects in gravity traps and the...

  2. 7 CFR 457.164 - Nursery rehabilitation endorsement. (United States)


    ... 7 Agriculture 6 2010-01-01 2010-01-01 false Nursery rehabilitation endorsement. 457.164 Section... CORPORATION, DEPARTMENT OF AGRICULTURE COMMON CROP INSURANCE REGULATIONS § 457.164 Nursery rehabilitation endorsement. Nursery Crop Insurance Rehabilitation Endorsement If you elect this endorsement and pay the...

  3. 49 CFR 572.164 - Thorax assembly and test procedure. (United States)


    ... 49 Transportation 7 2010-10-01 2010-10-01 false Thorax assembly and test procedure. 572.164... Hybrid III Six-Year-Old Weighted Child Test Dummy § 572.164 Thorax assembly and test procedure. (a) Thorax (upper torso) assembly. The thorax consists of the part of the torso assembly shown in drawing 167...

  4. 27 CFR 22.164 - Filing and retention of records. (United States)


    ... 27 Alcohol, Tobacco Products and Firearms 1 2010-04-01 2010-04-01 false Filing and retention of records. 22.164 Section 22.164 Alcohol, Tobacco Products and Firearms ALCOHOL AND TOBACCO TAX AND TRADE BUREAU, DEPARTMENT OF THE TREASURY LIQUORS DISTRIBUTION AND USE OF TAX-FREE ALCOHOL Records of...

  5. 33 CFR 164.19 - Requirements for vessels at anchor. (United States)


    ... anchor. 164.19 Section 164.19 Navigation and Navigable Waters COAST GUARD, DEPARTMENT OF HOMELAND... vessels at anchor. The master or person in charge of each vessel that is anchored shall ensure that: (a) A proper anchor watch is maintained; (b) Procedures are followed to detect a dragging anchor; and (c...

  6. 46 CFR 164.006-3 - Construction, materials, and workmanship. (United States)


    ... 46 Shipping 6 2010-10-01 2010-10-01 false Construction, materials, and workmanship. 164.006-3..., CONSTRUCTION, AND MATERIALS: SPECIFICATIONS AND APPROVAL MATERIALS Deck Coverings for Merchant Vessels § 164.006-3 Construction, materials, and workmanship. (a) It is the intent of this specification to obtain a...

  7. 33 CFR 164.42 - Rate of turn indicator. (United States)


    ... 33 Navigation and Navigable Waters 2 2010-07-01 2010-07-01 false Rate of turn indicator. 164.42...) PORTS AND WATERWAYS SAFETY NAVIGATION SAFETY REGULATIONS § 164.42 Rate of turn indicator. Each vessel of... turn indicator. ...

  8. Micelle-enhanced and terbium-sensitized spectrofluorimetric determination of gatifloxacin and its interaction mechanism (United States)

    Guo, Changchuan; Wang, Lei; Hou, Zhun; Jiang, Wei; Sang, Lihong


    A terbium-sensitized spectrofluorimetric method using an anionic surfactant, sodium dodecyl benzene sulfonate (SDBS), was developed for the determination of gatifloxacin (GFLX). A coordination complex system of GFLX-Tb 3+-SDBS was studied. It was found that SDBS significantly enhanced the fluorescence intensity of the complex (about 11-fold). Optimal experimental conditions were determined as follows: excitation and emission wavelengths of 331 and 547 nm, pH 7.0, 2.0 × 10 -4 mol l -1 terbium (III), and 2.0 × 10 -4 mol l -1 SDBS. The enhanced fluorescence intensity of the system (Δ If) showed a good linear relationship with the concentration of GFLX over the range of 5.0 × 10 -10 to 5.0 × 10 -8 mol l -1 with a correlation coefficient of 0.9996. The detection limit (3 σ) was determined as 6.0 × 10 -11 mol l -1. This method has been successfully applied to the determination of GFLX in pharmaceuticals and human urine/serum samples. Compared with most of other methods reported, the rapid and simple procedure proposed in the text offers higher sensitivity, wider linear range, and better stability. The interaction mechanism of the system is also studied by the research of ultraviolet absorption spectra, surface tension, solution polarity and fluorescence polarization.

  9. Circularly Polarized Luminescence in Enantiopure Europium and Terbium Complexes with Modular, All-Oxygen Donor Ligands (United States)

    Seitz, Michael; Do, King; Ingram, Andrew J.; Moore, Evan G.; Muller, Gilles; Raymond, Kenneth N.


    Abstract: Circulaly polarized luminescence from terbium(III) complexed and excited by chiral antenna ligands gives strong emission The modular synthesis of three new octadentate, enantiopure ligands are reported - one with the bidentate chelating unit 2-hydroxyisophthalamide (IAM) and two with 1-hydroxy-2-pyridinone (1,2-HOPO) units. A new design principle is introduced for the chiral, non-racemic hexamines which constitute the central backbones for the presented class of ligands. The terbium(III) complex of the IAM ligand, as well as the europium(III) complexes of the 1,2-HOPO ligands are synthesized and characterized by various techniques (NMR, UV, CD, luminescence spectroscopy). All species exhibit excellent stability and moderate to high luminescence efficiency (quantum yields ΦEu = 0.05–0.08 and ΦTb = 0.30–0.57) in aqueous solution at physiological pH. Special focus is put onto the properties of the complexes in regard to circularly polarized luminescence (CPL). The maximum luminescence dissymmetry factors (glum) in aqueous solution are high with |glum|max = 0.08 – 0.40. Together with the very favorable general properties (good stability, high quantum yields, long lifetimes), the presented lanthanide complexes can be considered as good candidates for analytical probes based on CPL in biologically relevant environments. PMID:19639983

  10. Luminescent method of determination of composition of europium and terbium complexes in solution by change of intensity ratio of luminescence bands

    Energy Technology Data Exchange (ETDEWEB)

    Bel' tyukova, S.V.; Nazarenko, N.A.; Poluehktov, N.S.


    The complexes of europium and terbium with phenanthroline, ethylenediaminetetraacetate, nitrilotriacetate, some acids-phenol derivatives and ..beta..-diketones series have been used as an example to demonstrate that the value of the ratio of intensities on the two bands of europium(terbium) luminescence spectra - the one corresponding to the hypersensitive'' transition and the other, to the magnetic dipole one - can be used for determination of the complexes composition in solutions.

  11. Shell closure at {ital N}=164: Spherical or deformed?

    Energy Technology Data Exchange (ETDEWEB)

    Rigol, J. [Joint Institute for Nuclear Research, 141980 Dubna (Russia)


    Brenner {ital et al}. [1] recently reported the apparent evidence for a spherical shell at {ital N}=164. Some arguments are given which may make it necessary to reconsider this conclusion. {copyright} {ital 1997} {ital The American Physical Society}

  12. Thermo-transferred thermoluminescence (TTTl) in potassium-yttrium double fluoride doped with terbium

    Energy Technology Data Exchange (ETDEWEB)

    Gallegos, A.; Rivera, T.; Diaz G, J. A. [IPN, Centro de Investigacion en Ciencia Aplicada y Tecnologia Avanzada, Legaria 694, Col. Irrigacion, 11500 Mexico D. F. (Mexico); Azorin, J. [Universidad Autonoma Metropolitana, Unidad Iztapalapa, San Rafael Atlixco No. 186, Col. Vicentina, 09340 Mexico D. F. (Mexico); Azorin, J. C. [Universidad de Guanajuato, Division de Ciencias e Ingenierias-Campus Leon, Lomas del Bosque No. 103, Col. Lomas del Campestre, 37000 Leon, Guanajuato (Mexico); Licona, R.; Rivas, F.; Hernandez C, G. [Benemerita Universidad Autonoma de Puebla, Facultad de Ciencias Quimicas, 14 Sur y San Claudio, Ciudad Universitaria, Puebla de Zaragoza, Puebla (Mexico); Khaidukov, N. [Institute of General and Inorganic Chemistry, Lenin SK 11 Prospect 31, Moscow 117907 (Russian Federation)


    This paper presents results of studying the thermo-transferred thermoluminescence (TTTl) phenomenon in potassium-yttrium double fluoride doped with terbium (K{sub 2}YF{sub 5:}Tb) at different impurity concentrations (0.8%, 0.95% and 0.99%). Previously to study the TTTl phenomenon, structural characterization and chemical composition of the materials were determined. The structural studies were conducted using a scanning electron microscope; meanwhile, chemical composition was analyzed using energy dispersive X-ray spectroscopy. Thermoluminescence kinetics was studied irradiating the samples with {sup 137}Cs gamma rays as well as with {sup 90}Sr/{sup 90}Y beta rays, analyzing the glow curves by the deconvolution method for obtaining the kinetic parameters. (Author)

  13. The influence of pressure on the photoluminescence properties of a terbium-adipate framework (United States)

    Spencer, Elinor C.; Zhao, Jing; Ross, Nancy L.; Andrews, Michael B.; Surbella, Robert G.; Cahill, Christopher L.


    The influence of pressure (over the 0-4.7 GPa range) on the photoluminescence emissions and crystal structure of the known 3D terbium-adipate metal-organic framework material Tb-GWMOF6 has been evaluated by high-pressure single-crystal X-ray diffraction and spectroscopic techniques. The results from this study show that this complex lanthanide framework structure undergoes three phase transitions within the 0-4 GPa pressure range that involve alterations in the number of symmetry independent Tb3+ ion sites within the crystal lattice. These pressure induced modifications to the structure of Tb-GWMOF6 lead to pronounced changes in the profiles of the 5D4→7F5 emission spectra of this complex.

  14. Terbium Radionuclides for Theranostics Applications: A Focus On MEDICIS-PROMED (United States)

    Cavaier, R. Formento; Haddad, F.; Sounalet, T.; Stora, T.; Zahi, I.

    A new facility, named CERN-MEDICIS, is under construction at CERN to produce radionuclides for medical applications. In parallel, the MEDICIS-PROMED, a Marie Sklodowska-Curie innovative training network of the Horizon 2020 European Commission's program, is being coordinated by CERN to train young scientists on the production and use of innovative radionuclides and develop a network of experts within Europe. One program within MEDICIS-PROMED is to determine the feasibility of producing innovative radioisotopes for theranostics using a commercial middle-sized high-current cyclotron and the mass separation technology developed at CERN-MEDICIS. This will allow the production of high specific activity radioisotopes not achievable with the common post-processing by chemical separation. Radioisotopes of scandium, copper, arsenic and terbium have been identified. Preliminary studies of activation yield and irradiation parameters optimization for the production of Tb-149 will be described.

  15. Dielectric and conducting behavior of gadolinium-terbium fumarate heptahydrate crystals (United States)

    Shah, M. D.; Want, B.


    Gadolinium-terbium fumarate heptahydrate crystals were grown in silica gel by using single gel diffusion technique. The crystals were characterized by different physico-chemical techniques of characterization. Powder X-ray diffraction results showed that the grown material is purely crystalline in nature. Elemental analyses suggested the chemical formula of the compound to be Gd Tb (C4H2O4)3ṡ7H2O. Energy dispersive X-ray analysis confirmed the presence of Gd and Tb in the title compound. The dielectric and conductivity studies of the grown compound were carried as function of frequency of applied field and the temperature. The grown material showed a dielectric anomaly which was correlated with its thermal behavior. The ac conductivity of the material showed Jonscher's power law behavior: σ(ω)=σo+Aωs, with a temperature-dependent power exponent s(<1). The conductivity was found to be a function of temperature and frequency.

  16. Highly sensitive detection of dipicolinic acid with a water-dispersible terbium-metal organic framework. (United States)

    Bhardwaj, Neha; Bhardwaj, Sanjeev; Mehta, Jyotsana; Kim, Ki-Hyun; Deep, Akash


    The sensitive detection of dipicolinic acid (DPA) is strongly associated with the sensing of bacterial organisms in food and many types of environmental samples. To date, the demand for a sensitive detection method for bacterial toxicity has increased remarkably. Herein, we investigated the DPA detection potential of a water-dispersible terbium-metal organic framework (Tb-MOF) based on the fluorescence quenching mechanism. The Tb-MOF showed a highly sensitive ability to detect DPA at a limit of detection of 0.04nM (linear range of detection: 1nM to 5µM) and also offered enhanced selectivity from other commonly associated organic molecules. The present study provides a basis for the application of Tb-MOF for direct, convenient, highly sensitive, and specific detection of DPA in the actual samples. Copyright © 2016 Elsevier B.V. All rights reserved.

  17. A New Bis(phthalocyaninato) Terbium Single-Ion Magnet with an Overall Excellent Magnetic Performance. (United States)

    Chen, Yuxiang; Ma, Fang; Chen, Xiaoxiang; Dong, Bowei; Wang, Kang; Jiang, Shangda; Wang, Chiming; Chen, Xin; Qi, Dongdong; Sun, Haoling; Wang, Bingwu; Gao, Song; Jiang, Jianzhuang


    Bulky and strong electron-donating dibutylamino groups were incorporated onto the peripheral positions of one of the two phthalocyanine ligands in the bis(phthalocyaninato) terbium complex, resulting in the isolation of heteroleptic double-decker (Pc)Tb{Pc[N(C4H9)2]8} {Pc = phthalocyaninate; Pc[N(C4H9)2]8 = 2,3,9,10,16,17,23,24-octakis(dibutylamino)phthalocyaninate} with the nature of an unsymmetrical molecular structure, a square-antiprismatic coordination geometry, an intensified coordination field strength, and the presence of organic radical-f interaction. As a total result of all these factors, this sandwich-type tetrapyrrole lanthanide single-ion magnet (SIM) exhibits an overall enhanced magnetic performance including a high blocking temperature (TB) of 30 K and large effective spin-reversal energy barrier of Ueff = 939 K, rendering it the best sandwich-type tetrapyrrole lanthanide SIM reported thus far.

  18. Ultralarge magneto-optic rotations and rotary dispersion in terbium gallium garnet single crystal. (United States)

    Shaheen, Amrozia; Majeed, Hassaan; Anwar, Muhammad Sabieh


    We report systematically acquired data on the Verdet constant of terbium gallium garnet for wavelengths ranging from visible to near-infrared (405-830 nm) regime. Our experimental method of Stokes polarimetry is based on the Fourier decomposition of the received light intensity and allows unambiguous determination of both the Faraday rotation and the ellipticity of the emergent light. Temperature-dependent investigations in the range of 8-300 K extend earlier reports and verify the Verdet's constant direct dependence on the magnetization, whose first-order approximation is simply a manifestation of the Curie's law. Further, a least-squares fitting of the experimental data correlates well with theoretical predictions. At a wavelength of 405 nm and temperature of 8 K, the rotation is approximately 500°.

  19. Terbium fluorescence as a sensitive, inexpensive probe for UV-induced damage in nucleic acids

    Energy Technology Data Exchange (ETDEWEB)

    El-Yazbi, Amira F.; Loppnow, Glen R., E-mail:


    Graphical abstract: -- Highlights: •Simple, inexpensive, mix-and-read assay for positive detection of DNA damage. •Recognition of undamaged DNA via hybridization to a hairpin probe. •Terbium(III) fluorescence reports the amount of damage by binding to ssDNA. •Tb/hairpin is a highly selective and sensitive fluorescent probe for DNA damage. -- Abstract: Much effort has been focused on developing methods for detecting damaged nucleic acids. However, almost all of the proposed methods consist of multi-step procedures, are limited, require expensive instruments, or suffer from a high level of interferences. In this paper, we present a novel simple, inexpensive, mix-and-read assay that is generally applicable to nucleic acid damage and uses the enhanced luminescence due to energy transfer from nucleic acids to terbium(III) (Tb{sup 3+}). Single-stranded oligonucleotides greatly enhance the Tb{sup 3+} emission, but duplex DNA does not. With the use of a DNA hairpin probe complementary to the oligonucleotide of interest, the Tb{sup 3+}/hairpin probe is applied to detect ultraviolet (UV)-induced DNA damage. The hairpin probe hybridizes only with the undamaged DNA. However, the damaged DNA remains single-stranded and enhances the intrinsic fluorescence of Tb{sup 3+}, producing a detectable signal directly proportional to the amount of DNA damage. This allows the Tb{sup 3+}/hairpin probe to be used for sensitive quantification of UV-induced DNA damage. The Tb{sup 3+}/hairpin probe showed superior selectivity to DNA damage compared to conventional molecular beacons probes (MBs) and its sensitivity is more than 2.5 times higher than MBs with a limit of detection of 4.36 ± 1.2 nM. In addition, this probe is easier to synthesize and more than eight times cheaper than MBs, which makes its use recommended for high-throughput, quantitative analysis of DNA damage.

  20. Fine- and hyperfine structure investigations of even configuration system of atomic terbium (United States)

    Stefanska, D.; Elantkowska, M.; Ruczkowski, J.; Furmann, B.


    In this work a parametric study of the fine structure (fs) and the hyperfine structure (hfs) for the even-parity configurations of atomic terbium (Tb I) is presented, based in considerable part on the new experimental results. Measurements on 134 spectral lines were performed by laser induced fluorescence (LIF) in a hollow cathode discharge lamp; on this basis, the hyperfine structure constants A and B were determined for 52 even-parity levels belonging to the configurations 4f85d6s2, 4f85d26s or 4f96s6p; in all the cases those levels were involved in the transitions investigated as the lower levels. For 40 levels the hfs was examined for the first time, and for the remaining 12 levels the new measurements supplement our earlier results. As a by-product, also preliminary values of the hfs constants for 84 odd-parity levels were determined (the investigations of the odd-parity levels system in the terbium atom are still in progress). This huge amount of new experimental data, supplemented by our earlier published results, were considered for the fine and hyperfine structure analysis. A multi-configuration fit of 7 configurations was performed, taking into account second-order of perturbation theory, including the effects of closed shell-open shell excitations. Predicted values of the level energies, as well as of magnetic dipole and electric quadrupole hyperfine structure constants A and B, are quoted in cases when no experimental values are available. By combining our experimental data with our own semi-empirical procedure it was possible to identify correctly the lower and upper level of the line 544.1440 nm measured by Childs with the use of the atomic-beam laser-rf double-resonance technique (Childs, J Opt Soc Am B 9;1992:191-6).

  1. Structural and optical characterization of terbium doped ZnGa2O4 thin films deposited by RF magnetron sputtering (United States)

    Somasundaram, K.; Girija, K. G.; Sudarsan, V.; Selvin, P. Christopher; Vatsa, R. K.


    Tb3+ doped ZnGa2O4 nanophosphor (21 nm) has been synthesized via low temperature polyol route and subsequently thin films of the same were deposited on glass and ITO substrates by RF magnetron sputtering. The films were characterized by X-ray Diffraction and luminescence measurements. The XRD pattern showed that Tb3+ doped ZnGa2O4 nanophosphor has a cubic spinel phase. Luminescence behavior of the nanophosphor and as deposited sputtered film was investigated. The PL emission spectra of nanophosphor gave a broad ZnGa2O4 host emission band along with a strong terbium emission and the thin films showed only broad host emission band and there was no terbium ion emission.

  2. Determination of fluoxetine in pharmaceutical and biological samples based on the silver nanoparticle enhanced fluorescence of fluoxetine-terbium complex. (United States)

    Lotfi, Ali; Manzoori, Jamshid L


    In this study, a simple and sensitive spectrofluorimetric method is presented for the determination of fluoxetine based on the enhancing effect of silver nanoparticles (AgNPs) on the terbium-fluoxetine fluorescence emission. The AgNPs were prepared by a simple reduction method and characterized by UV-Vis spectroscopy and transmission electron microscopy. It was indicated that these AgNPs have a remarkable amplifying effect on the terbium-sensitized fluorescence of fluoxetine. The effects of various parameters such as AgNP and Tb(3+) concentration and the pH of the media were investigated. Under obtained optimal conditions, the fluorescence intensity of the terbium-fluoxetine-AgNP system was enhanced linearly by increasing the concentration of fluoxetine in the range of 0.008 to 19 mg/L. The limit of detection (b + 3s) was 8.3 × 10(-4) mg/L. The interference effects of common species found in real samples were also studied. The method had good linearity, recovery, reproducibility and sensitivity, and was satisfactorily applied for the determination of fluoxetine in tablet formulations, human urine and plasma samples. Copyright © 2016 John Wiley & Sons, Ltd. Copyright © 2016 John Wiley & Sons, Ltd.

  3. Neutron Diffraction and Electrical Transport Studies on Magnetic Transition in Terbium at High Pressures and Low Temperatures (United States)

    Thomas, Sarah; Montgomery, Jeffrey; Tsoi, Georgiy; Vohra, Yogesh; Weir, Samuel; Tulk, Christopher; Moreira Dos Santos, Antonio


    Neutron diffraction and electrical transport measurements have been carried out on the heavy rare earth metal terbium at high pressures and low temperatures in order to elucidate its transition from a helical antiferromagnetic to a ferromagnetic ordered phase as a function of pressure. The electrical resistance measurements using designer diamonds show a change in slope as the temperature is lowered through the ferromagnetic Curie temperature. The temperature of the ferromagnetic transition decreases at a rate of -16.7 K/GPa till 3.6 GPa, where terbium undergoes a structural transition from hexagonal close packed (hcp) to an α-Sm phase. Above this pressure, the electrical resistance measurements no longer exhibit a change in slope. In order to confirm the change in magnetic phase suggested by the electrical resistance measurements, neutron diffraction measurements were conducted at the SNAP beamline at the Oak Ridge National Laboratory. Measurements were made at pressures to 5.3 GPa and temperatures as low as 90 K. An abrupt increase in peak intensity in the neutron diffraction spectra signaled the onset of magnetic order below the Curie temperature. A magnetic phase diagram of rare earth metal terbium will be presented to 5.3 GPa and 90 K based on these studies.

  4. Study of Silver Nanoparticles Sensitized Fluorescence and Second-Order Scattering of Terbium(III-Pefloxacin Mesylate Complex and Determination of Pefloxacin Mesylate

    Directory of Open Access Journals (Sweden)

    Aiyun Li


    Full Text Available α-Keto acid of pefloxacin mesylate (PFLX can form the complex with Terbium(III. The intramolecular energy from PFLX to Terbium(III ion takes place when excited, and thus Terbium(III excited state is formed and then emits the characteristic fluorescence of Terbium(III, locating at 490, 545, 580, and 620 nm. The second-order scattering (SOS peak at 545 nm also appears for the complex with the exciting wavelength of 273 nm. When the silver nanoparticles are added to the system, the luminescence intensity at 545 nm greatly increased. So, with the adding of nanoparticles to the Terbium(III-PFLX complex, not only is the intramolecular energy promoted but also the SOS intensity is enhanced. The experimental results show that it is the silver nanoparticles with certain size and certain concentration which can greatly enhance the fluorescence-SOS intensity, and the relative intensity at 545 nm is proportional to the amount of PFLX. Based on this phenomenon, a novel method for the determination of PFLX has been developed and applied to the determination of PFLX in capsule and serum samples.

  5. Influence of crystalline structure on the luminescence properties of terbium orthotantalates

    Energy Technology Data Exchange (ETDEWEB)

    Siqueira, Kisla P.F. [Departamento de Química, Universidade Federal de Ouro Preto, Campus Morro do Cruzeiro, ICEB II, Ouro Preto 35400-000, Minas Gerais (Brazil); Carmo, Alexandre P. [Instituto Federal Fluminense, Campus Cabo Frio, RJ 28909-971 (Brazil); Bell, Maria J.V. [Departamento de Física, Universidade Federal de Juiz de Fora, Juiz de Fora 36036-330, MG (Brazil); Dias, Anderson, E-mail: [Departamento de Química, Universidade Federal de Ouro Preto, Campus Morro do Cruzeiro, ICEB II, Ouro Preto 35400-000, Minas Gerais (Brazil)


    Terbium orthotantalate powders were produced with M-fergusonite type (I2/a) and M′-fergusonite type (P2/a) structures. The samples were studied by X-ray diffraction, Raman scattering, and photoluminescence measurements (emission and decay curves). The results showed that crystalline materials were obtained with all the 18 Raman-active modes predicted by group theory calculations. Also, it was observed through photoluminescence decay curves that the Tb{sup 3+} ions occupies only one-symmetry site in both crystallographic arrangements. Photoluminescence emission curves exhibited some variation in spectral shape, peak position, and relative intensity as a consequence of their different crystalline arrangements. The dominated emission of Tb{sup 3+} ({sup 5}D{sub 4}→{sup 7}F{sub 5}) is centered with a maximum intensity at 549.2 nm (M-type) and 543.0 nm (M′-type). Fluorescence lifetimes for M-TbTaO{sub 4} and M′-TbTaO{sub 4} were determined as 33.4 μs and 1.25 ms, respectively. M′-type materials seems to be the most suitable for luminescent devices and could be a potential green luminescent material due to the strongest emission if compared with the M-fergusonite type. -- Highlights: ► Terbium orthotantalates were prepared in two different crystalline structures: I2/a and P2/a. ► XRD and Raman scattering showed that the different space groups obtained were exhibited all the 18 Raman-active modes. ► PL decay curves that the Tb{sup 3+} ions occupies only one-symmetry site in both crystallographic arrangements. ► Dominated emission of Tb{sup 3+} ({sup 5}D{sub 4}→{sup 7}F{sub 5}) is centered with a maximum intensity at 549 nm (M-type) and 543 nm (M′-type). ► Fluorescence lifetimes for M-TbTaO{sub 4} and M′-TbTaO{sub 4} were determined as 33.4 μs and 1.25 ms, respectively.

  6. Phenotype abnormality: 164 [Arabidopsis Phenome Database[Archive

    Lifescience Database Archive (English)

    Full Text Available 164 decreased efficiency... in organ named whole plant during process named 0 seed germination stage ... whole plant ... decreased efficiency ... 0 seed germination stage ...

  7. Image collection: 164 [Togo Picture Gallery[Archive

    Lifescience Database Archive (English)

    Full Text Available 164 Cynocephalus_volans_NL.png フィリピンヒヨケザル Philippine flying lemur Cynocephalus volans 110931 生物アイコン,脊索動物門,脊椎動物亜門,哺乳綱,獣亜綱,真獣下綱

  8. Tilted axis rotation in odd-odd {sup 164}Tm

    Energy Technology Data Exchange (ETDEWEB)

    Reviol, W.; Riedinger, L.L.; Wang, X.Z.; Zhang, J.Y. [Univ. of Tennessee, Knoxville, TN (United States)] [and others


    Ten band structures are observed in {sup 164}Tm, among them sets of parallel and anti-parallel couplings of the proton and neutron spins. The Tilted Axis Cranking scheme is applied for the first time to an odd-odd nucleus in a prominent region of nuclear deformation.

  9. Laser control and temperature switching of luminescence intensity in photostable transparent film based on terbium(III) β-diketonate complex (United States)

    Lapaev, Dmitry V.; Nikiforov, Victor G.; Safiullin, Georgy M.; Lobkov, Vladimir S.; Salikhov, Kev M.; Knyazev, Andrey A.; Galyametdinov, Yury G.


    The study of the terbium(III) and gadolinium(III) β-diketonate complexes by photoluminescence spectroscopy reveals considerable changes of the photophysical properties of the complexes under the UV laser irradiation. The measurements show the enhancement of the luminescence intensities in the vitrified transparent film of the terbium(III) complex as well as the gadolinium(III) complex under the 337 nm laser irradiation at room temperature. The irradiated film of the terbium(III) complex restores the initial photophysical properties after heating close to the melting temperature (∼353 K) and cooling. We observe no change of the luminescent properties of the irradiated film for months. These features can be used for the design of new lanthanide-based photostable systems with laser control of the luminescence intensity.

  10. Development of functionalized terbium fluorescent nanoparticles for antibody labeling and time-resolved fluoroimmunoassay application. (United States)

    Ye, Zhiqiang; Tan, Mingqian; Wang, Guilan; Yuan, Jingli


    Silica-based functionalized terbium fluorescent nanoparticles were prepared, characterized and developed as a fluorescence probe for antibody labeling and time-resolved fluoroimmunoassay. The nanoparticles were prepared in a water-in-oil (W/O) microemulsion containing a strongly fluorescent Tb(3+) chelate, N,N,N(1),N(1)-[2,6-bis(3'-aminomethyl-1'-pyrazolyl)phenylpyridine] tetrakis(acetate)-Tb(3+) (BPTA-Tb(3+)), Triton X-100, octanol, and cyclohexane by controlling copolymerization of tetraethyl orthosilicate (TEOS) and 3-[2-(2-aminoethylamino)ethylamino]propyl-trimethoxysilane (AEPS) with ammonia water. The characterizations by transmission electron microscopy and fluorometric methods show that the nanoparticles are spherical and uniform in size, 45 +/- 3nm in diameter, strongly fluorescent with fluorescence quantum yield of 10% and a long fluorescence lifetime of 2.0ms. The amino groups directly introduced to the nanoparticle's surface by using AEPS in the preparation made the surface modification and bioconjugation of the nanoparticles easier. The nanoparticle-labeled anti-human alpha-fetoprotein antibody was prepared and used for time-resolved fluoroimmunoassay of alpha-fetoprotein (AFP) in human serum samples. The assay response is linear from 0.10ngml(-1) to about 100ngml(-1) with the detection limit of 0.10ngml(-1). The coefficient variations (CVs) of the method are less than 9.0%, and the recoveries are in the range of 84-98% for human serum sample measurements.

  11. Highly efficient precipitation of phosphoproteins using trivalent europium, terbium, and erbium ions

    Energy Technology Data Exchange (ETDEWEB)

    Guezel, Yueksel; Rainer, Matthias; Mirza, Munazza Raza; Bonn, Guenther K. [Leopold-Franzens University, Institute of Analytical Chemistry and Radiochemistry, Innsbruck (Austria)


    This study describes a highly efficient method for the selective precipitation of phosphoproteins by trivalent europium, terbium, and erbium metal ions. These metal cations belong to the group of lanthanides and are known to be hard acceptors with an overwhelming preference for oxygen-containing anions such as phosphates to which they form very tight ionic bonds. The method could be successfully applied to specifically precipitate phosphoproteins from complex samples including milk and egg white by forming solid metal-protein complexes. Owing to the low solubility product of the investigated lanthanide salts, the produced metal-protein complexes showed high stability. The protein pellets were extensively washed to remove nonphosphorylated proteins and contaminants. For the analysis of proteins the pellets were first dissolved in 30 % formic acid and subjected to matrix-assisted laser desorption/ionization-time of flight (MALDI-TOF) MS. For peptide mass-fingerprint analysis the precipitated phosphoproteins were enzymatically digested using microwave-assisted digestion. The method was found to be highly specific for the isolation and purification of phosphoproteins. Protein quantification was performed by colorimetric detection of total precipitated phosphoproteins and revealed more than 95 % protein recovery for each lanthanide salt. (orig.)

  12. A Terbium Sensitized Luminescence Method for the Assay of Flubiprofen in Pharmaceutical Formulations

    Directory of Open Access Journals (Sweden)

    Salma M.Z. Al-Kindy


    Full Text Available A sensitive time-resolved luminescence method for the determination of flubiprofen (FLP in methanol and in aqueous solution is described. The method is based on the luminescence sensitization of terbium (Tb3+ by the formation of a ternary complex with FLP in the presence of 4,7 diphenyl 1,10 phenanthroline (DPP as co-ligand, and Tween-20 as surfactant. The signal for Tb-FLP-DPP was monitored at λex  = 285 nm and λem  = 552 nm. Optimum conditions for the formation of the complex in an aqueous system were TRIS buffer, pH 8.0, DPP (2.5Å~10−7  M, Tween-20 (0.30% and 4Å~10-5  mol L-1  of Tb3+  which allowed the determination of 20–1000 ng mL-1  of FLP with a limit of detection (LOD of 10 ng mL-1 . The relative standard deviations of the method ranged between 0.6 and 1.4% indicating excellent reproducibility of the method. The proposed method was successfully applied for the assays of FLP in pharmaceutical formulations and spiked tap water samples with average recoveries of 87% – 95%.

  13. Sensitization effects of supramolecular assemblies on the luminescence of terbium-ion prulifloxacin complexes

    Energy Technology Data Exchange (ETDEWEB)

    Wang Hong; Yi Chongyue; Li Xue; Fang Fang [School of Chemistry and Chemical Engineering, Huazhong University of Science and Technology, Wuhan 430074 (China); Yang Yajiang, E-mail: [School of Chemistry and Chemical Engineering, Huazhong University of Science and Technology, Wuhan 430074 (China)


    Luminescence enhancement of terbium-ion prulifloxacin complexes (Tb(III)-PUFX) in supramolecular hydrogels formed by assembly of 1,3:2,4-di-O-benzylidene-D-sorbitol (DBS) was investigated by steady-state fluorescence, varying temperature fluorescence and time-resolved fluorescence. The luminescence images show that Tb(III)-PUFX were dispersed in the DBS gels. The luminescence intensity of Tb(III)-PUFX in the DBS gels was significantly increased in comparison with that in corresponding aqueous solutions. The varying temperature fluorescent spectra show that the luminescence intensity of Tb(III)-PUFX decreased with an increase in the temperature. This implies that the luminescence enhancement of Tb(III)-PUFX is related to the dissociation and the formation of the DBS assemblies. Time-resolved fluorescence measurements show slower rotational motion in DBS gels in comparison with that in the corresponding aqueous solutions. This may be ascribed to a unique microstructure of three-dimensional network formed by DBC aggregates, resulting in deactivation of the nonradiative relaxation. The images of field emission scanning electron microscopy and polarized optical microscopy indicate that the morphology of the DBS assemblies was not influenced upon addition of Tb(III)-PUFX to the DBS gels.

  14. A Nanoscale Multiresponsive Luminescent Sensor Based on a Terbium(III) Metal-Organic Framework. (United States)

    Dang, Song; Wang, Ting; Yi, Feiyan; Liu, Qinghui; Yang, Weiting; Sun, Zhong-Ming


    A nanoscale terbium-containing metal-organic framework (nTbL), with a layer-like structure and [H2 NMe2 ](+) cations located in the framework channels, was synthesized under hydrothermal conditions. The structure of the as-prepared sample was systematically confirmed by powder XRD and elemental analysis; the morphology was characterized by field-emission SEM and TEM. The photoluminescence studies revealed that rod-like nTbL exhibited bright-green emission, corresponding to (5)D4 →(7)FJ (J=6-3) transitions of the Tb(3+) ion under excitation. Further sensing measurements revealed that as-prepared nTbL could be utilized as a multiresponsive luminescent sensor, which showed significant and exclusive detection ability for Fe(3+) ions and phenylmethanol. These results highlight the practical applications of lanthanide-containing metal-organic frameworks as fluorescent probes. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  15. Terbium-Doped VO2 Thin Films: Reduced Phase Transition Temperature and Largely Enhanced Luminous Transmittance. (United States)

    Wang, Ning; Duchamp, Martial; Dunin-Borkowski, Rafal E; Liu, Shiyu; Zeng, XianTing; Cao, Xun; Long, Yi


    Vanadium dioxide (VO2) is a well-known thermochromic material with large IR modulating ability, promising for energy-saving smart windows. The main drawbacks of VO2 are its high phase transition temperature (τ(c) = 68°C), low luminous transmission (T(lum)), and weak solar modulating ability (ΔT(sol)). In this paper, the terbium cation (Tb(3+)) doping was first reported to reduce τ(c) and increase T(lum) of VO2 thin films. Compared with pristine VO2, 2 at. % doping level gives both enhanced T(lum) and ΔT(sol) from 45.8% to 54.0% and 7.7% to 8.3%, respectively. The T(lum) increases with continuous Tb(3+) doping and reaches 79.4% at 6 at. % doping level, representing ∼73.4% relative increment compared with pure VO2. This has surpassed the best reported doped VO2 thin films. The enhanced thermochromic properties is meaningful for smart window applications of VO2 materials.

  16. Luminescent investigations of terbium(III) biosorption as a surrogate for heavy metals and radionuclides. (United States)

    Achyuthan, Komandoor E; Arango, Dulce C; Carles, Elizabeth L; Cutler, Christopher E; Meyer, Lauren A; Brozik, Susan M


    We describe a metal transport system for investigating the interfacial interactions between the anionic surface charge of a gram-negative bacterium (Escherichia coli) and a trivalent cationic metal, Tb3+. We believe this is the first description of the uptake kinetics, sub- and intracellular distribution, and temporal fate of Tb3+ ion in E. coli. We used the luminescence of the terbium-dipicolinic acid chelate to study metal ion transport. The bacteria had a high tolerance for the metal (IC(50) = 4 mM Tb3+). Metal ion transport was passive and metabolism independent. The uptake kinetics rapidly reached a maximum within 15 min, followed by a stasis for 60 min, and declining thereafter between 120 and 240 min, resulting in a biphasic curve. During this period, greater than one-third of the metal ion was sequestered within the cell. Our choice of a safe Biosafety Level I E. coli bacteria and the relatively non-toxic Tb3+ metal represents a model system for luminescent investigations of biosorption, for studying bacterial-water interfacial chemistry and for the bioremediation of heavy metals and radionuclides.

  17. Construction of the energy matrix for complex atoms. Part VIII: Hyperfine structure HPC calculations for terbium atom (United States)

    Elantkowska, Magdalena; Ruczkowski, Jarosław; Sikorski, Andrzej; Dembczyński, Jerzy


    A parametric analysis of the hyperfine structure (hfs) for the even parity configurations of atomic terbium (Tb I) is presented in this work. We introduce the complete set of 4fN-core states in our high-performance computing (HPC) calculations. For calculations of the huge hyperfine structure matrix, requiring approximately 5000 hours when run on a single CPU, we propose the methods utilizing a personal computer cluster or, alternatively a cluster of Microsoft Azure virtual machines (VM). These methods give a factor 12 performance boost, enabling the calculations to complete in an acceptable time.

  18. Spectrofluorimetric determination of human serum albumin using terbium-danofloxacin probe. (United States)

    Ramezani, Amir M; Manzoori, Jamshid L; Amjadi, Mohammad; Jouyban, Abolghasem


    A spectrofluorimetric method is proposed for the determination of human serum albumin (HSA) and bovine serum albumin (BSA) using terbium-danofloxacin (Tb(3+)-Dano) as a fluorescent probe. These proteins remarkably enhance the fluorescence intensity of the Tb(3+)-Dano complex at 545 nm, and the enhanced fluorescence intensity of Tb(3+)-Dano is proportional to the concentration of proteins (HSA and BSA). Optimum conditions for the determination of HSA were investigated and found that the maximum response was observed at: pH = 7.8, [Tb(3+)] = 8.5 × 10(-5) mol L(-1), [Dano] = 1.5 × 10(-4) mol L(-1). The calibration graphs for standard solutions of BSA, HSA, and plasma samples of HSA were linear in the range of 0.2 × 10(-6) - 1.3 × 10(-6) mol L(-1), 0.2 × 10(-6) - 1.4 × 10(-6) mol L(-1), and 0.2 × 10(-6) - 1 × 10(-6) mol L(-1), respectively. The detection limits (S/N = 3) for BSA, HSA, and plasma sample of HSA were 8.7 × 10(-8) mol L(-1), 6.2 × 10(-8) mol L(-1), and 8.1 × 10(-8) mol L(-1), respectively. The applicability of the method was checked using a number of real biological plasma samples and was compared with the UV spectrometric reference method. The results was showed that the method could be regarded as a simple, practical, and sensitive alternative method for determination of albumin in biological samples.

  19. Spectrofluorimetric Determination of Human Serum Albumin Using Terbium-Danofloxacin Probe

    Directory of Open Access Journals (Sweden)

    Amir M. Ramezani


    Full Text Available A spectrofluorimetric method is proposed for the determination of human serum albumin (HSA and bovine serum albumin (BSA using terbium-danofloxacin (Tb3+-Dano as a fluorescent probe. These proteins remarkably enhance the fluorescence intensity of the Tb3+-Dano complex at 545 nm, and the enhanced fluorescence intensity of Tb3+-Dano is proportional to the concentration of proteins (HSA and BSA. Optimum conditions for the determination of HSA were investigated and found that the maximum response was observed at: pH=7.8, [Tb3+] =8.5×10−5 mol L−1, [Dano] =1.5×10−4 mol L−1. The calibration graphs for standard solutions of BSA, HSA, and plasma samples of HSA were linear in the range of 0.2×10−6−1.3×10−6 mol L−1, 0.2×10−6−1.4×10−6 mol L−1, and 0.2×10−6−1×10−6 mol L−1, respectively. The detection limits (S/N = 3 for BSA, HSA, and plasma sample of HSA were 8.7×10−8 mol L−1, 6.2×10−8 mol L−1, and 8.1×10−8 mol L−1, respectively. The applicability of the method was checked using a number of real biological plasma samples and was compared with the UV spectrometric reference method. The results was showed that the method could be regarded as a simple, practical, and sensitive alternative method for determination of albumin in biological samples.

  20. Determination of flavonoids in pharmaceutical preparations using Terbium sensitized fluorescence method

    Directory of Open Access Journals (Sweden)

    M Shaghaghi


    Full Text Available "nBackground and the Purpose of the Study: The aim of this study was development and validation of a simple, rapid and sensitive spectrofluorimetric method for determination of total flavonoids in two topical formulations of Calendula officinalis, Ziziphus Spina-christi and an oral drop of Hypiran perforatum L. The proposed method is based on the formation of terbium (Tb3+ "n-flavonoids (quercetin as a reference standard complex at pH 7.0, which has fluorescence intensely with maximum emission at 545 nm when excited at 310 nm. "nMethod "n: For ointments masses of topical formulations were weighed and added to ethanol-aqueous buffer (pH 10.0 and the resulting mixtures were shaken and then two phases were separated by centrifugation. Aqueous phases were filtered and then diluted with water. For Hypiran drops an appropriate portion was diluted with ethanol and then aliquots of sample or standard solutions were determined according to the experimental procedure. "nResults "n: Under the optimum conditions, total concentrations of flavonoids (as quercetin equivalent in three tested formulations were found to be 0.204 mg/g (for Dermatin cream, 0.476 mg/g (for Calendula ointment and 13.50 μg/ml (for Hypiran drops. Analytical recoveries from samples spiked with different amounts of quercetin were 96.1-104.0 % with RSD % of less than 3.5. Conclusion : The proposed method which requires a simple dissolution step without any matrix interferences provided high sensitivity and selectivity and was easily applied to determine total flavonoids in real samples of three investigated formulations with excellent reproducibility.

  1. TOF SIMS analysis and generation of white photoluminescence from strontium silicate codoped with europium and terbium

    Energy Technology Data Exchange (ETDEWEB)

    Tshabalala, Modiehi A.; Swart, Hendrik C.; Ntwaeaborwa, Odireleng M., E-mail: [Department of Physics, University of the Free State, P.O Box 339, Bloemfontein 9300 South Africa (South Africa)


    White light emitting terbium (Tb{sup 3+}) and europium (Eu{sup 3+}) codoped strontium silicate (Sr{sub 2}SiO{sub 4}) phosphors were prepared by a solid state reaction process. The structure, particle morphology, chemical composition, ion distribution, photoluminescence (PL), and decay characteristics of the phosphors were analyzed by x-ray diffraction (XRD), scanning electron microscopy (SEM), time-of-flight secondary ion mass spectrometry (TOF-SIMS), and PL spectroscopy, respectively. The XRD data showed that our Sr{sub 2}SiO{sub 4} composed of two phases, namely, β-Sr{sub 2}SiO{sub 4} and α′-Sr{sub 2}SiO{sub 4}, and the α′-Sr{sub 2}SiO{sub 4} phase was more prominent than the β-Sr{sub 2}SiO{sub 4} phase. The SEM micrographs showed that the particles were agglomerated together and they did not have definite shapes. All ions (i.e., negative and positive) present in our materials were identified by TOF-SIMS. In addition, the chemical imaging performed with the TOF-SIMS demonstrated how the individual ions including the dopants (Eu{sup 3+} and Tb{sup 3+}) were distributed in the host lattice. White photoluminescence was observed when the Sr{sub 2}SiO{sub 4}:Tb{sup 3+}, Eu{sup 3+} phosphor was excited at 239 nm using a monochromatized xenon lamp as the excitation source. The phosphor exhibited fast decay lifetimes implying that it is not a good candidate for long afterglow applications.

  2. Synthesis, crystal structure and photophysical properties of europium(III) and terbium(III) complexes with pyridine-2,6-dicarboxamide

    NARCIS (Netherlands)

    Tanase, S.; Gallego, P.M.; Gelder, R. de; Fu, W.T.


    The reactions of pyridine-2,6-dicarboxamide with europium(III) and terbium(III) triflates led to the formation of mononuclear complexes of formula [Ln(pcam)(3)](CF3SO3)(3) (Ln = Eu 1, Tb 2; pcam stands for pyridine-2,6-dicarboxamide). From single-crystal X-ray diffraction analysis, the complexes

  3. 40 CFR 164.24 - Response to the Administrator's notice of intention to hold a hearing. (United States)


    ... of intention to hold a hearing. 164.24 Section 164.24 Protection of Environment ENVIRONMENTAL...) Commencement of Proceeding § 164.24 Response to the Administrator's notice of intention to hold a hearing. Any... intention to hold a hearing, shall file with the hearing clerk, within the time set by the Administrator in...

  4. Zinc sulfide and terbium-doped zinc sulfide films grown by traveling wave reactor atomic layer epitaxy

    CERN Document Server

    Yun, S J; Nam, K S


    Zinc sulfide (ZnS) and terbium-doped ZnS (ZnS:Tb) thin films were grown by traveling wave reactor atomic layer epitaxy (ALE). In the present work, ZnCl sub 2 , H sub 2 S, and tris (2,2,6,6-tetramethyl-3,5-heptandionato) terbium (Tb(tmhd) sub 3) were used as the precursors. The dependence of crystallinity and Cl content of ZnS films was investigated on the growth temperature. ZnS and ZnS:Tb films grown at temperatures ranging from 400 to 500 .deg. C showed a hexagonal-2H crystalline structure. The crystallinity of ZnS film was greatly enhanced as the temperature increased. At growth temperatures higher than 450.deg.C, the films showed preferred orientation with mainly (002) diffraction peak. The Cl content decreased from approximately 9 to 1 at.% with the increase in growth temperature from 400 to 500 .deg. C. The segregation of Cl near the surface region and the incorporation of O from Tb(tmhd) sub 3 during ALE process were also observed using Auger electron spectroscopy. The ALE-grown ZnS and ZnS:Tb films re...

  5. Commercializing potassium terbium fluoride, KTF (KTb3F10) faraday crystals for high laser power optical isolator applications (United States)

    Schlichting, Wolfgang; Stevens, Kevin; Foundos, Greg; Payne, Alexis


    Many scientific lasers and increasingly industrial laser systems operate in power regime, require high-performance optical isolators to prevent disruptive light feedback into the laser cavity. The optically active Faraday material is the key optical element inside the isolator. SYNOPTICS has been supplying the laser market with Terbium Gallium Garnet (TGG - Tb3Ga5O12) for many years. It is the most commonly used material for the 650-1100nm range and the key advantages for TGG include its cubic crystal structure for alignment free processing, little to no intrinsic birefringence, and ease of manufacture. However, for high-power laser applications TGG is limited by its absorption at 1064nm and its thermo-optic coefficient, dn/dT. Specifically, thermal lensing and depolarization effects become a limiting factor at high laser powers. While TGG absorption has improved significantly over the past few years, there is an intrinsic limit. Now, SYNOPTICS is commercializing the enhanced new crystal Potassium Terbium Fluoride KTF (KTb3F10) that exhibits much smaller nonlinear refractive index and thermo-optic coefficients, and still exhibits a Verdet constant near that of TGG. This cubic crystal has relatively low absorption and thermo-optic coefficients. It is now fully characterized and available for select production orders. At OPTIFAB in October 2017 we present recent results comparing the performance of KTF to TGG in optical isolators and show SYNOPTICS advances in large volume crystal growth and the production ramp up.

  6. Preparation and photoluminescence enhancement in terbium(III ternary complexes with β-diketone and monodentate auxiliary ligands

    Directory of Open Access Journals (Sweden)

    Devender Singh


    Full Text Available A series of new solid ternary complexes of terbium(III ion based on β-diketone ligand acetylacetone (acac and monodentate auxiliary ligands (aqua/urea/triphenylphosphineoxide/pyridine-N-oxide had been prepared. The structural characterizations of synthesized ternary compounds were studied by means of elemental analysis, infrared (IR, and proton nuclear magnetic resonance (NMR spectral techniques. The optical characteristics were investigated with absorption as well as photoluminescence spectroscopy. Thermal behavior of compounds was examined by TGA/DTA analysis and all metal complexes were found to have good thermal stability. The luminescence decay time of complexes were also calculated by monitoring at emission wavelength corresponding to 5D4 → 7F5 transition. A comparative inspection of the luminescent behavior of prepared ternary compounds was performed in order to determine the function of auxiliary ligands in the enhancement of luminescence intensity produced by central terbium(III ion. The color coordinates values suggested that compounds showed bright green emission in visible region in electromagnetic spectrum. Complexes producing green light could play a significant role in the fabrication of efficient light conversion molecular devices for display purposes and lightning systems.

  7. Synthesis and luminescent study of Ce{sup 3+}-doped terbium-yttrium aluminum garnet

    Energy Technology Data Exchange (ETDEWEB)

    Dotsenko, V.P., E-mail: [A.V. Bogatsky Physico-Chemical Institute, National Academy of Sciences of Ukraine, Lustdorfskaya doroga 86, 65080 Odessa (Ukraine); Berezovskaya, I.V.; Zubar, E.V.; Efryushina, N.P. [A.V. Bogatsky Physico-Chemical Institute, National Academy of Sciences of Ukraine, Lustdorfskaya doroga 86, 65080 Odessa (Ukraine); Poletaev, N.I.; Doroshenko, Yu.A. [Institute of Combustion and Advanced Technologies, Mechnikov Odessa National University, Dvoryanskaya 2, 65082 Odessa (Ukraine); Stryganyuk, G.B. [Ivan Franko National University of Lviv, Kirilo i Mefodii 8, 79005 Lviv (Ukraine); HASYLAB at DESY, Notkestrasse 85, 22607 Hamburg (Germany); Voloshinovskii, A.S. [Ivan Franko National University of Lviv, Kirilo i Mefodii 8, 79005 Lviv (Ukraine)


    Highlights: Black-Right-Pointing-Pointer Ce{sup 3+}-doped garnets (TYAG) were prepared using nanostructured reagents. Black-Right-Pointing-Pointer The Ce{sup 3+} ions cause a very efficient yellow emission of the samples. Black-Right-Pointing-Pointer The reasons for the long wavelength position of this emission are discussed. Black-Right-Pointing-Pointer Contribution from Al atoms to the conduction band of TYAG is quite essential. - Abstract: Terbium-yttrium aluminum garnets (TYAG) doped with Ce{sup 3+} ions have been prepared by solid state reactions between nanostructured oxides of aluminum and rare earths. The luminescent properties of Ce{sup 3+} ions in (Tb{sub 0.8}Y{sub 0.2}){sub 3(1-x)}Ce{sub 3x}Al{sub 5}O{sub 12} (x = 0.03) have been studied upon excitation in the 2-20 eV region. The substitution of Tb{sup 3+} for Y{sup 3+} in the garnet structure results in broadening the emission band and shifting its maximum towards the longer wavelengths. It was found that in addition to the 4f{sup n} {yields} 4f{sup n-1}5d excitation bands of Ce{sup 3+} and Tb{sup 3+} ions, the excitation spectra for the Ce{sup 3+} emission contain broad bands at 6.73 and {approx}9.5 eV. These bands are attributed to the Ce{sup 3+}-bound exciton formation and O 2p {yields} Al 3s, 3p transitions, respectively. In contrast to the predictions based on the results of electronic structure calculations on Y{sub 3}Al{sub 5}O{sub 12} and Tb{sub 4}Al{sub 2}O{sub 9}, the threshold of interband transitions in TYAG is at high energies ( Greater-Than-Or-Slanted-Equal-To 7.3 eV), and contributions from Al{sub tetr} and Al{sub oct} atoms to the conduction-band density of states are evaluated as quite essential.

  8. Structural variations in terbium(III) complexes with 1,3-adamantanedicarboxylate and diverse co-ligands

    Energy Technology Data Exchange (ETDEWEB)

    Thuéry, Pierre, E-mail:


    Terbium nitrate was reacted with 1,3-adamantanedicarboxylic acid (LH{sub 2}) under solvo-hydrothermal conditions with either N,N-dimethylformamide (DMF) or N,N-dimethylacetamide (DMA) as organic solvents. Hydrolysation of the latter co-solvents resulted in the formation of formate or acetate ions, which are present as co-ligands in the 1D coordination polymer [Tb(L)(HCOO)(H{sub 2}O){sub 2}] (1) and the 2D assembly [Tb(L)(CH{sub 3}COO)(H{sub 2}O)] (2). The increase in dimensionality in the latter arises from the higher connectivity provided by acetate versus formate, the L{sup 2−} ligand being bis-chelating in both cases. The complex [Tb{sub 2}(L){sub 3}(H{sub 2}O){sub 5}][Tb{sub 2}(L){sub 3}(H{sub 2}O){sub 4}]·3H{sub 2}O (3), another 1D species, crystallizes alongside crystals of 2. Further addition of cucurbit[6]uril (CB6), with DMF as co-solvent, gave the two complexes [Tb{sub 2}(L){sub 2}(CB6)(H{sub 2}O){sub 6}](NO{sub 3}){sub 2}·6H{sub 2}O (4) and [H{sub 2}NMe{sub 2}]{sub 2}[Tb(L)(HCOO){sub 2}]{sub 2}·CB6·3H{sub 2}O (5). Complex 4 crystallizes as a 3D framework in which Tb(L){sup +} chains are connected by tetradentate CB6 molecules, while 5 unites a carboxylate-bridged anionic 2D planar assembly and layers of CB6 molecules with counter-cations held at both portals. - Graphical abstract: One- to three-dimensional assemblies are formed in terbium(III) complexes with 1,3-adamantanedicarboxylate obtained under solvo-hydrothermal conditions, these species including formate or acetate co-ligands formed in situ, or additional cucurbit[6]uril molecules. - Highlights: • We report structures of terbium(III) complexes with 1,3-adamantanedicarboxylate. • Solvents able to generate co-ligands or counter-ions in situ have been used. • A 3D species including additional cucurbituril molecules is decribed. • One species displays an alternation of metal–organic and organic sheets.

  9. Complete Stokes polarimetry of magneto-optical Faraday effect in a terbium gallium garnet crystal at cryogenic temperatures. (United States)

    Majeed, Hassaan; Shaheen, Amrozia; Anwar, Muhammad Sabieh


    We report the complete determination of the polarization changes caused in linearly polarized incident light due to propagation in a magneto-optically active terbium gallium garnet (TGG) single crystal, at temperatures ranging from 6.3 to 300 K. A 28-fold increase in the Verdet constant of the TGG crystal is seen as its temperature decreases to 6.3 K. In contrast with polarimetry of light emerging from a Faraday material at room temperature, polarimetry at cryogenic temperatures cannot be carried out using the conventional fixed polarizer-analyzer technique because the assumption that ellipticity is negligible becomes increasingly invalid as temperature is lowered. It is shown that complete determination of light polarization in such a case requires the determination of its Stokes parameters, otherwise inaccurate measurements will result with negative implications for practical devices.

  10. Development of Optical Isolators for Visible Light Using Terbium Aluminum Garnet (Tb3Al5O12) Single Crystals (United States)

    Geho, Mikio; Takagi, Takashi; Chiku, Shinichiro; Fujii, Takashi


    We have recently reported the successful growth of incongruently melting terbium aluminum garnet (Tb3Al5O12; TAG) single crystals by the hybrid laser FZ (floating zone) method. Optical property evaluations confirmed a high transmittance and a larger Verdet constant than conventional Tb3Ga5O12 (TGG) crystals and/or Faraday glasses. In this study, we attempted to design, fabricate, and evaluate optical isolators in visible light through near-infrared (NIR) regions using TAG crystals. A finite element method (FEM) simulation of possible models led us to the preferable one based on a radially magnetized magnet. To realize this, we employed a pseudo-radially magnetized magnet. The target wavelengths of the prototype device were 408, 808, and 1064 nm. The typical extinction ratio was more than 30 dB and the insertion loss was less than 0.3 dB for AR-coated devices.

  11. Electroexcitation of rotational vibrations in sup 164 Dy

    Energy Technology Data Exchange (ETDEWEB)

    Scholtz, F.G.; Nojarov, R.; Faessler, A. (Institut fur Theoretische Physik, Universitat Tubingen, Auf der Morgenstelle 14, D-7400 Tubingen 1, Federal Republic of Germany (DE))


    We calculate the {ital M}1 spectrum and the distorted-wave Born-approximation ({ital e},{ital e}{prime}) form factors of the strong {ital K}{sup {pi}}=1{sup +} states in {sup 164}Dy, using a deformed Woods-Saxon potential and the quasiparticle random-phase approximation with quadrupole, spin, and spin-quadrupole interactions. A residual rotation-vibrational coupling ensures the exclusion of the spurious state. We find strongly orbital {ital M}1 states at 3.1 MeV which fit the experimental spectrum very well and exhaust 40% of the collectivity of the 1{sup +} mode. The form factor of the lowest one of these states is also in a good agreement with the experimental form factor.

  12. Recombinant Goat VEGF164 Increases Hair Growth by Painting Process on the Skin of Shaved Mouse

    Directory of Open Access Journals (Sweden)

    Wenlei Bao


    Full Text Available To detect goat vascular endothelial growth factor (VEGF-mediated regrowth of hair, full-length VEGF164 cDNA was cloned from Inner Mongolia cashmere goat (Capra hircus into the pET-his prokaryotic expression vector, and the recombinant plasmid was transferred into E. coli BL21 cells. The expression of recombinant 6×his-gVEGF164 protein was induced by 0.5 mM isopropyl thio-β-D-galactoside at 32°C. Recombinant goat VEGF164 (rgVEGF164 was purified and identi ed by western blot using monoclonal anti-his and anti-VEGF antibodies. The rgVEGF164 was smeared onto the dorsal area of a shaved mouse, and we noted that hair regrowth in this area was faster than in the control group. Thus, rgVEGF164 increases hair growth in mice.

  13. The high power engine of the Bugatti Veyron 16.4; Der Hochleistungsmotor des Bugatti Veyron 16.4

    Energy Technology Data Exchange (ETDEWEB)

    Neumann, K.H.; Kurowski, A. [Bugatti Engineering GmbH, Wolfsburg (Germany)


    With the Bugatti brand, a significant traditional name among the automobile manufacturers awakens to new life. The traditional maxims of the company philosophy such as workmanship and technological perfection into the smallest detail as well as aesthetic design are carried on in the new high power Bugatti Veyron 16.4 sports car concept, even if in a new, modern interpretation. From the technical point of view, the highlight of the vehicle is undoubtedly once again set by the drive system. An adequate, innovative drive concept is used as a completely newly developed 8.0 liter, 16-cylinder mid-mounted engine with a performance of 736 kW/1001 PS, following the style of the 16-cylinder idea realized for the first time over 70 years ago. The article at hand first describes the selected engine concept in detail, contemplated under the presented general conceptual framework. Through the selection of the W-design as an extraordinarily compact manufacturing basis-construction, a supercharged aggregate with four turbochargers and an effective charge-air cooling could be realized in spite of the strict installation specifications pre-determined by the vehicle. In the following descriptions, the finer points of the W16 motor's detailed solutions will be more closely dealt with using selected examples. Along with the short-block assembly and the complex, highly loaded crank mechanism, characteristics on the oil circulation system with its innovative modular shaft oil pump will be more closely inspected. In order to fulfill the lofty goals regarding sovereign, instantaneous power development, the turbocharger concept was given special attention. Its specific layout systematic and thermodynamic design will be comprehensively portrayed. The engine parameters, reached in sum through the explained measures, help the new Bugatti Veyron 16.4 to outstanding road performance that is superior to the competition. (orig.) [German] Mit der Marke Bugatti erwacht ein bedeutender

  14. A hydrometallurgical process for the recovery of terbium from fluorescent lamps: Experimental design, optimization of acid leaching process and process analysis. (United States)

    Innocenzi, Valentina; Ippolito, Nicolò Maria; De Michelis, Ida; Medici, Franco; Vegliò, Francesco


    Terbium and rare earths recovery from fluorescent powders of exhausted lamps by acid leaching with hydrochloric acid was the objective of this study. In order to investigate the factors affecting leaching a series of experiments was performed in according to a full factorial plan with four variables and two levels (4 2 ). The factors studied were temperature, concentration of acid, pulp density and leaching time. Experimental conditions of terbium dissolution were optimized by statistical analysis. The results showed that temperature and pulp density were significant with a positive and negative effect, respectively. The empirical mathematical model deducted by experimental data demonstrated that terbium content was completely dissolved under the following conditions: 90 °C, 2 M hydrochloric acid and 5% of pulp density; while when the pulp density was 15% an extraction of 83% could be obtained at 90 °C and 5 M hydrochloric acid. Finally a flow sheet for the recovery of rare earth elements was proposed. The process was tested and simulated by commercial software for the chemical processes. The mass balance of the process was calculated: from 1 ton of initial powder it was possible to obtain around 160 kg of a concentrate of rare earths having a purity of 99%. The main rare earths elements in the final product was yttrium oxide (86.43%) following by cerium oxide (4.11%), lanthanum oxide (3.18%), europium oxide (3.08%) and terbium oxide (2.20%). The estimated total recovery of the rare earths elements was around 70% for yttrium and europium and 80% for the other rare earths. Copyright © 2016 Elsevier Ltd. All rights reserved.

  15. Investigation of the luminescent properties of terbium-anthranilate complexes and application to the determination of anthranilic acid derivatives in aqueous solutions

    Energy Technology Data Exchange (ETDEWEB)

    Arnaud, N.; Georges, J


    The luminescent properties of terbium complexes with furosemide (FR), flufenamic (FF) acid, tolfenamic (TF) acid and mefenamic (MF) acid have been investigated in aqueous solutions. For all four compounds, complexation occurs when the carboxylic acid of the aminobenzoic group is dissociated and is greatly favoured in the presence of trioctylphosphine oxide as co-ligand and Triton X-100 as surfactant. Under optimum conditions, luminescence of the lanthanide ion is efficiently sensitised and the lifetime of the {sup 5}D{sub 4} resonance level of terbium in the complex is ranging between 1 and 1.9 ms, against 0.4 ms for the aqua ion. The sensitivity of the method for the determination of anthranilic acid derivatives is improved by one to two orders of magnitude with respect to that achieved using native fluorescence or terbium-sensitised luminescence in methanol. The limits of detection are 2x10{sup -10}, 5x10{sup -10} and 2x10{sup -9} mol l{sup -1} for flufenamic acid, furosemide and tolfenamic acid, and mefenamic acid, respectively, with within-run RSD values of less than 1%. The method has been applied to the determination of flufenamic acid in spiked calf sera with and without sample pretreatment. Depending on the method and the analyte concentration, the recovery was ranging between 83 and 113% and the lowest concentration attainable in serum samples was close to 1x10{sup -7} mol l{sup -1}.

  16. 40 CFR 98.164 - Monitoring and QA/QC requirements. (United States)


    ... feedstock flow meters, and other measurement devices. The estimated accuracy of measurements made with these....164 Section 98.164 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) AIR PROGRAMS.... The GHG emissions data for hydrogen production process units must be quality-assured as specified in...

  17. 46 CFR 164.023-3 - Specifications and standards incorporated by reference. (United States)


    ... Thread and Yarn; Single Strand—164.023-7. (3) Method 5804, Weathering Resistance of Cloth; Accelerated..., Polyester Core: Cotton-, Rayon-, or Polyester-Covered, September 30, 1986—164.023-5. (7) MIL-T-43624A—Thread...

  18. 9 CFR 381.164 - “(Kind) barbecued.” (United States)


    ... 9 Animals and Animal Products 2 2010-01-01 2010-01-01 false â(Kind) barbecued.â 381.164 Section 381.164 Animals and Animal Products FOOD SAFETY AND INSPECTION SERVICE, DEPARTMENT OF AGRICULTURE... INSPECTION AND CERTIFICATION POULTRY PRODUCTS INSPECTION REGULATIONS Definitions and Standards of Identity or...

  19. 46 CFR 164.009-19 - Measurement of moisture and volatile matter content. (United States)


    ... stopper is inserted in the bottle and the bottle and sample are cooled and weighed. (c) The content of... 46 Shipping 6 2010-10-01 2010-10-01 false Measurement of moisture and volatile matter content. 164... Vessels § 164.009-19 Measurement of moisture and volatile matter content. (a) The measurements described...

  20. 33 CFR 164.43 - Automatic Identification System Shipborne Equipment-Prince William Sound. (United States)


    ... 33 Navigation and Navigable Waters 2 2010-07-01 2010-07-01 false Automatic Identification System Shipborne Equipment-Prince William Sound. 164.43 Section 164.43 Navigation and Navigable Waters COAST GUARD... Automatic Identification System Shipborne Equipment—Prince William Sound. (a) Until December 31, 2004, each...

  1. [Treatment of patella fractures of 164 patients with 5 methods]. (United States)

    Xie, Feng; Fang, Guo-Hua; Zhou, Yi


    To investigate the effects of different treatments for different patella fractures, and analyze the clinical outcome. One hundred and sixty-four patients with patella fracture were treated between July 2005 and December 2009, 113 males and 51 females with an average age of 38.5 years old, ranging from 21 to 72 years. There were 21 cases of linear fracture or separation of the patella patella separation > 0.5 cm and for the pure horizontal type or vertical-type fractures, 34 cases were separated into three block, 46 cases were separated into four and above. Of 164 cases, 21 patients accepted traditional treatment, 39 patients were fixed with cerclage wire and tension band wire, 43 with cannulated screws and tension band wire fixation, 29 with cannulated screws for the minimally invasive treatment, 32 patients with fixation of NT-PC RESULTS: One hundred and sixty-four cases were followed up with a mean period of 14 months (3 to 36 months). By Lysholm knee score criteria: 19 cases in traditional treatment were excellent and good, 36 cases in cerclage wire and tension band wire technique cases were excellent and good, 40 cases in cannulated screws and tension band wire fixation, 27 cases in cannulated screws for the minimally invasive treatment were excellent and good, 30 cases in NT-PC were excellent and good. The surgery should be avoided if the patients can be treated with manipulation and fixation. Those who need surgical treatment should be based on the type of fracture to select a different surgical operation. Percutaneous reduction can be fixed, and try to minimally invasive surgery. Whether traditional treatment or internal fixation, the appropriate functional exercise need to make as early as possible.

  2. Structural investigation and photoluminescent properties of gadolinium(III), europium(III) and terbium(III) 3-mercaptopropionate complexes. (United States)

    Souza, E R; Mazali, I O; Sigoli, F A


    This work reports on the synthesis, crystallographic determination and spectroscopic characterization of gadolinium(III), terbium(III) and europium(III) 3-mercaptopropionate complexes, aqua-tris(3-mercaptopropionate)lanthanide(III)--[Ln(mpa)3(H2O)]. The Judd-Ofelt intensity parameters were experimentally determined from emission spectrum of the [Eu(mpa)3(H2O)]complex and they were also calculated from crystallographic data. The complexes are coordination polymers, where the units of each complex are linked together by carboxylate groups leading to an unidimensional and parallel chains that by chemical interactions form a tridimensional framework. The emission spectrum profile of the [Eu(mpa)3(H2O)] complex is discussed based on point symmetry of the europium(III) ion, that explains the bands splitting observed in its emission spectrum. Photoluminescent analysis of the [Gd(mpa)3(H2O)] complex show no efficient ligand excitation but an intense charge transfer band. The excitation spectra of the [Eu(mpa)3(H2O)] and [Tb(mpa)3(H2O)] complexes do not show evidence of energy transfer from the ligand to the excited levels of these trivalent ions. Therefore the emission bands are originated only by direct f-f intraconfigurational excitation of the lantanide(III) ions.

  3. Fluorometric determination of proteins using the terbium (III)-2-thenoyltrifluoroacetone-sodium dodecyl benzene sulfonate-protein system

    Energy Technology Data Exchange (ETDEWEB)

    Jia Zhen [Key Laboratory of Colloid and Interface Chemistry of Education Ministry, School of Chemistry and Chemical Engineering, Shandong University, Jinan 250100 (China); Department of Chemistry, Dezhou University, Dezhou 253023 (China); Yang Jinghe [Key Laboratory of Colloid and Interface Chemistry of Education Ministry, School of Chemistry and Chemical Engineering, Shandong University, Jinan 250100 (China)]. E-mail:; Wu Xia [Key Laboratory of Colloid and Interface Chemistry of Education Ministry, School of Chemistry and Chemical Engineering, Shandong University, Jinan 250100 (China); Wang Fei [Key Laboratory of Colloid and Interface Chemistry of Education Ministry, School of Chemistry and Chemical Engineering, Shandong University, Jinan 250100 (China); Guo Changying [Key Laboratory of Colloid and Interface Chemistry of Education Ministry, School of Chemistry and Chemical Engineering, Shandong University, Jinan 250100 (China); Liu Shufang [Key Laboratory of Colloid and Interface Chemistry of Education Ministry, School of Chemistry and Chemical Engineering, Shandong University, Jinan 250100 (China)


    It is found that in hexamethylene tetramine (HMTA)-HCl buffer of pH=8.00, proteins can enhance the fluorescence of terbium (III) (Tb{sup 3+})-2-thenoyltrifluoroacetone (TTA)-sodium dodecyl benzene sulfonate (SDBS) system. Based on this, a sensitive method for the determination of proteins is proposed. The experiments indicate that under the optimum conditions, the enhanced fluorescence intensity is in proportion to the concentration of proteins in the range of 4.0x10{sup -9}-7.5x10{sup -6}g/mL for bovine serum albumin (BSA), 5.0x10{sup -9}-1.5x10{sup -5}g/mL for human serum albumin (HSA), 1.0x10{sup -8}-7.5x10{sup -6}g/mL for egg albumin (EA). Their detection limits (S/N=3) are 0.5, 0.8 and 2.0ng/mL, respectively. The interaction mechanism is also studied.

  4. Terbium to Quantum Dot FRET Bioconjugates for Clinical Diagnostics: Influence of Human Plasma on Optical and Assembly Properties

    Directory of Open Access Journals (Sweden)

    Niko Hildebrandt


    Full Text Available Förster resonance energy transfer (FRET from luminescent terbium complexes (LTC as donors to semiconductor quantum dots (QDs as acceptors allows extraordinary large FRET efficiencies due to the long Förster distances afforded. Moreover, time-gated detection permits an efficient suppression of autofluorescent background leading to sub-picomolar detection limits even within multiplexed detection formats. These characteristics make FRET-systems with LTC and QDs excellent candidates for clinical diagnostics. So far, such proofs of principle for highly sensitive multiplexed biosensing have only been performed under optimized buffer conditions and interactions between real-life clinical media such as human serum or plasma and LTC-QD-FRET-systems have not yet been taken into account. Here we present an extensive spectroscopic analysis of absorption, excitation and emission spectra along with the luminescence decay times of both the single components as well as the assembled FRET-systems in TRIS-buffer, TRIS-buffer with 2% bovine serum albumin, and fresh human plasma. Moreover, we evaluated homogeneous LTC-QD FRET assays in QD conjugates assembled with either the well-known, specific biotin-streptavidin biological interaction or, alternatively, the metal-affinity coordination of histidine to zinc. In the case of conjugates assembled with biotin-streptavidin no significant interference with the optical and binding properties occurs whereas the histidine-zinc system appears to be affected by human plasma.

  5. Evidence of mass exchange between inside and outside of sonoluminescing bubble in aqueous solution of terbium chloride

    Energy Technology Data Exchange (ETDEWEB)

    Liang, Jinfu, E-mail: [School of Physics and Electronic Science, Guizhou Normal University, Guiyang 550001 (China); Chen, Weizhong, E-mail: [The Key Laboratory of Modern Acoustics, Ministry of Education, Institution of Acoustics, Nanjing University, Nanjing 210093 (China); Wang, Xun; Yang, Jing; Chen, Zhan [The Key Laboratory of Modern Acoustics, Ministry of Education, Institution of Acoustics, Nanjing University, Nanjing 210093 (China)


    Highlights: • Time-resolved spectra of SBSL were obtained for Tb{sup 3+} ions emission lines. • Mass exchange between inside and outside of SL bubble was probed via Tb{sup 3+} ions lines. • The argon rectification hypothesis was tested by time-resolved spectra of SBSL. • The rate of mass exchange inside an SBSL bubble increases with increasing sound pressure. - Abstract: Spectra of single-bubble sonoluminescence (SBSL) were obtained for Tb{sup 3+} ions emission lines from bubbles in an aqueous solution of terbium chloride (TbCl{sub 3}). The spectra provide experimental evidence to prove that an air bubble driven by strong ultrasound will not eventually become a rectified pure argon bubble, which is not as predicted by the argon rectification hypothesis. The time-resolved spectra of SBSL show a mass exchange of material such as Tb{sup 3+} ions between the inside and outside of the bubble. With increasing sound pressure, the rate of mass exchange and the SBSL intensity increases.

  6. Optical properties and electrical transport of thin films of terbium(III bis(phthalocyanine on cobalt

    Directory of Open Access Journals (Sweden)

    Peter Robaschik


    Full Text Available The optical and electrical properties of terbium(III bis(phthalocyanine (TbPc2 films on cobalt substrates were studied using variable angle spectroscopic ellipsometry (VASE and current sensing atomic force microscopy (cs-AFM. Thin films of TbPc2 with a thickness between 18 nm and 87 nm were prepared by organic molecular beam deposition onto a cobalt layer grown by electron beam evaporation. The molecular orientation of the molecules on the metallic film was estimated from the analysis of the spectroscopic ellipsometry data. A detailed analysis of the AFM topography shows that the TbPc2 films consist of islands which increase in size with the thickness of the organic film. Furthermore, the cs-AFM technique allows local variations of the organic film topography to be correlated with electrical transport properties. Local current mapping as well as local I–V spectroscopy shows that despite the granular structure of the films, the electrical transport is uniform through the organic films on the microscale. The AFM-based electrical measurements allow the local charge carrier mobility of the TbPc2 thin films to be quantified with nanoscale resolution.

  7. Highly luminescent charge-neutral europium(iii) and terbium(iii) complexes with tridentate nitrogen ligands. (United States)

    Senthil Kumar, Kuppusamy; Schäfer, Bernhard; Lebedkin, Sergei; Karmazin, Lydia; Kappes, Manfred M; Ruben, Mario


    We report on the synthesis of tridentate-nitrogen pyrazole-pyridine-tetrazole (L(1)H) and pyrazole-pyridine-triazole (L(2)H) ligands and their complexation with lanthanides (Ln = Gd(iii), Eu(iii) and Tb(iii)) resulting in stable, charge-neutral complexes Ln(L(1))3 and Ln(L(2))3, respectively. X-ray crystallographic analysis of the complexes with L(1) ligands revealed tricapped trigonal coordination geometry around the lanthanide ions. All complexes show bright photoluminescence (PL) in the solid state, indicating efficient sensitization of the lanthanide emission via the triplet states of the ligands. In particular, the terbium complexes show high PL quantum yields of 65 and 59% for L(1) and L(2), respectively. Lower PL efficiencies of the europium complexes (7.5 and 9%, respectively) are attributed to large energy gaps between the triplet states of the ligands and accepting levels of Eu(iii). The triplet state energy can be reduced by introducing an electron withdrawing (EW) group at the 4 position of the pyridine ring. Such substitution of L(1)H with a carboxylic ester (COOMe) EW group leads to a europium complex with increased PL quantum yield of 31%. A comparatively efficient PL of the complexes dissolved in ethanol indicates that the lanthanide ions are shielded against nonradiative deactivation via solvent molecules.

  8. Micelle enhanced and terbium sensitized spectrofluorimetric determination of danofloxacin in milk using molecularly imprinted solid phase extraction (United States)

    Kaur, Kuldeep; Saini, Shivender Singh; Malik, Ashok Kumar; Singh, Baldev


    An efficient molecularly imprinted solid phase extraction (MISPE)-spectrofluorimetric method was developed to sensitively determine danofloxacin (DAN) in milk samples. Solid phase extraction procedure using MISPE cartridges was first performed on milk samples and then spectrofluorimetric determination was done at 546 nm using an excitation wavelength of 285 nm in presence of terbium and sodium dodecyl benzene sulfonate (SDBS). It was found that SDBS significantly enhanced the fluorescence intensity of the DAN-Tb3+ complex. Various factors affecting the fluorescence intensity of DAN-Tb3+-SDBS system were studied and conditions were optimized. The enhanced fluorescence intensity of the system (ΔF) showed a good linear relationship with the concentration of DAN over the range of 8.4 × 10-9-3.4 × 10-7 mol L-1 with a correlation coefficient of 0.9996. The detection limit was determined as 2.0 × 10-9 mol L-1 and the limit of quantification was determined as 6.5 × 10-9 mol L-1. The MISPE-spectrofluorimetric procedure was successfully applied to the determination of DAN in milk samples. The method is simple, rapid, sensitive and allows interference free determination of DAN in complex fluorescent matrices like milk. The method can be used to determine whether the DAN residues in milk exceed MRLs or not.

  9. Study of quantum dot based on tin/yttrium mixed oxide doped with terbium to be used as biomarker

    Energy Technology Data Exchange (ETDEWEB)

    Paganini, Paula P.; Felinto, Maria Claudia F.C.; Kodaira, Claudia A., E-mail: paulapaganini@usp.b, E-mail: mfelinto@ipen.b, E-mail: [Instituto de Pesquisas Energeticas e Nucleares (IPEN/CNEN-SP), Sao Paulo, SP (Brazil); Brito, Hermi F., E-mail: hefbrito@iq.usp.b [Universidade de Sao Paulo (USP), SP (Brazil). Inst. de Quimica. Lab. de Elementos do Bloco f; Nunes, Luiz Antonio O., E-mail: luizant@ifsc.usp.b [Universidade de Sao Paulo (USP), Sao Carlos, SP (Brazil). Inst. de Fisica. Dept. de Fisica e Informatica


    Quantum dots (semiconductors nanocrystals) have brought a promising field to develop a new generation of luminescent biomarkers. The use of lanthanides ions as luminescent markers has many advantages, for example a security method, low cost, high specificity and also the luminescence can be promptly measured with high sensibility and accuracy. These luminescent dots are functionalized with biomolecules. For the luminophore particle to be connect with biologicals molecules (for example covalent antibody) is necessary a previous chemical treatment to modify luminophore particle surface and this process is called functionalization. A prior chemical treatment with changes on the surface luminophore particle is necessary to couple the luminophore to biological molecules. This process can be used as coating which can protect these particles from being dissolved by acid as well as provide functional groups for biological conjugation. This work presents a photoluminescence study of nanoparticles based on tin/yttrium mixed oxides doped with terbium (SnO{sub 2}/Y{sub 2}O{sub 3}:Tb{sup 3+}), synthesized by coprecipitation method. The nanoparticles were submitted to thermal treatment and characterized by X-Ray Powder Diffraction (XRD) that showed cassiterite phase formation and the influence of thermal treatment on nanoparticles structures. These nanoparticles going to be functionalized with a natural polysaccharide (chitosan) in order to form microspheres. These microspheres going to be irradiated with gamma radiation to sterilization and it can be evaluated if the nanoparticles are resistant to irradiation and they do not lose functionality with this process. (author)

  10. 33 CFR 165.164 - Security Zones: Dignitary Arrival/Departure and United Nations Meetings, New York, NY. (United States)


    ... 33 Navigation and Navigable Waters 2 2010-07-01 2010-07-01 false Security Zones: Dignitary Arrival/Departure and United Nations Meetings, New York, NY. 165.164 Section 165.164 Navigation and Navigable Waters... Guard District § 165.164 Security Zones: Dignitary Arrival/Departure and United Nations Meetings, New...

  11. 33 CFR 164.72 - Navigational-safety equipment, charts or maps, and publications required on towing vessels. (United States)


    ..., charts or maps, and publications required on towing vessels. 164.72 Section 164.72 Navigation and... NAVIGATION SAFETY REGULATIONS § 164.72 Navigational-safety equipment, charts or maps, and publications... navigation of the areas possible. (ii) The charts or maps must be either— (A) Current editions or currently...

  12. Terbium-doped gadolinium oxysulfide (Gd2O2S:Tb) scintillation-based polymer optical fibre sensor for real time monitoring of radiation dose in oncology (United States)

    Lewis, E.; O'Keeffe, S.; Grattan, M.; Hounsell, A.; McCarthy, D.; Woulfe, P.; Cronin, J.; Mihai, L.; Sporea, D.; Santhanam, A.; Agazaryan, N.


    A PMMA based plastic optical fibre sensor for use in real time radiotherapy dosimetry is presented. The optical fibre tip is coated with a scintillation material, terbium-doped gadolinium oxysulfide (Gd2O2S:Tb), which fluoresces when exposed to ionising radiation (X-Ray). The emitted visible light signal penetrates the sensor optical fibre and propagates along the transmitting fibre at the end of which it is remotely monitored using a fluorescence spectrometer. The results demonstrate good repeatability, with a maximum percentage error of 0.5% and the response is independent of dose rate.

  13. Compact all-fiber optical Faraday components using 65-wt%-terbium-doped fiber with a record Verdet constant of -32 rad/(Tm). (United States)

    Sun, L; Jiang, S; Marciante, J R


    A compact all-fiber Faraday isolator and a Faraday mirror are demonstrated. At the core of each of these components is an all-fiber Faraday rotator made of a 4-cm-long, 65-wt%-terbium-doped silicate fiber. The effective Verdet constant of the terbium-doped fiber is measured to be -32 rad/(Tm), which is 27 x larger than that of silica fiber. This effective Verdet constant is the largest value measured to date in any fiber and is 83% of the Verdet constant of commercially available crystal used in bulk optics-based isolators. Combining the all-fiber Faraday rotator with fiber polarizers results in a fully fusion spliced all-fiber isolator whose isolation is measured to be 19 dB. Combining the all-fiber Faraday rotator with a fiber Bragg grating results in an all-fiber Faraday mirror that rotates the polarization state of the reflected light by 88 +/- 4 degrees .

  14. Picomolar Traces of Americium(III) Introduce Drastic Changes in the Structural Chemistry of Terbium(III): A Break in the "Gadolinium Break". (United States)

    Welch, Jan M; Müller, Danny; Knoll, Christian; Wilkovitsch, Martin; Giester, Gerald; Ofner, Johannes; Lendl, Bernhard; Weinberger, Peter; Steinhauser, Georg


    The crystallization of terbium 5,5'-azobis[1H-tetrazol-1-ide] (ZT) in the presence of trace amounts (ca. 50 Bq, ca. 1.6 pmol) of americium results in 1) the accumulation of the americium tracer in the crystalline solid and 2) a material that adopts a different crystal structure to that formed in the absence of americium. Americium-doped [Tb(Am)(H 2 O) 7 ZT] 2 ZT⋅10 H 2 O is isostructural to light lanthanide (Ce-Gd) 5,5'-azobis[1H-tetrazol-1-ide] compounds, rather than to the heavy lanthanide (Tb-Lu) 5,5'-azobis[1H-tetrazol-1-ide] (e.g., [Tb(H 2 O) 8 ] 2 ZT 3 ⋅6 H 2 O) derivatives. Traces of Am seem to force the Tb compound into a structure normally preferred by the lighter lanthanides, despite a 10 8 -fold Tb excess. The americium-doped material was studied by single-crystal X-ray diffraction, vibrational spectroscopy, radiochemical neutron activation analysis, and scanning electron microcopy. In addition, the inclusion properties of terbium 5,5'-azobis[1H-tetrazol-1-ide] towards americium were quantified, and a model for the crystallization process is proposed. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  15. Crystal structures of two mononuclear complexes of terbium(III) nitrate with the tripodal alcohol 1,1,1-tris-(hy-droxy-meth-yl)propane. (United States)

    Gregório, Thaiane; Giese, Siddhartha O K; Nunes, Giovana G; Soares, Jaísa F; Hughes, David L


    Two new mononuclear cationic complexes in which the TbIII ion is bis-chelated by the tripodal alcohol 1,1,1-tris-(hy-droxy-meth-yl)propane (H3LEt, C6H14O3) were prepared from Tb(NO3)3·5H2O and had their crystal and mol-ecular structures solved by single-crystal X-ray diffraction analysis after data collection at 100 K. Both products were isolated in reasonable yields from the same reaction mixture by using different crystallization conditions. The higher-symmetry complex dinitratobis[1,1,1-tris-(hy-droxy-meth-yl)propane]-terbium(III) nitrate di-meth-oxy-ethane hemisolvate, [Tb(NO3)2(H3LEt)2]NO3·0.5C4H10O2, 1, in which the lanthanide ion is 10-coordinate and adopts an s-bicapped square-anti-prismatic coordination geometry, contains two bidentate nitrate ions bound to the metal atom; another nitrate ion functions as a counter-ion and a half-mol-ecule of di-meth-oxy-ethane (completed by a crystallographic twofold rotation axis) is also present. In product aqua-nitratobis[1,1,1-tris-(hy-droxy-meth-yl)propane]-terbium(III) dinitrate, [Tb(NO3)(H3LEt)2(H2O)](NO3)2, 2, one bidentate nitrate ion and one water mol-ecule are bound to the nine-coordinate terbium(III) centre, while two free nitrate ions contribute to charge balance outside the tricapped trigonal-prismatic coordination polyhedron. No free water mol-ecule was found in either of the crystal structures and, only in the case of 1, di-meth-oxy-ethane acts as a crystallizing solvent. In both mol-ecular structures, the two tripodal ligands are bent to one side of the coordination sphere, leaving room for the anionic and water ligands. In complex 2, the methyl group of one of the H3LEt ligands is disordered over two alternative orientations. Strong hydrogen bonds, both intra- and inter-molecular, are found in the crystal structures due to the number of different donor and acceptor groups present.

  16. β2-adrenergic receptor Thr164Ile polymorphism, obesity, and diabetes

    DEFF Research Database (Denmark)

    Thomsen, Mette; Dahl, Morten; Tybjærg-Hansen, Anne


    The β(2)-adrenergic receptor (ADRB2) influences regulation of energy balance by stimulating catecholamine-induced lipolysis in adipose tissue. The rare functional ADRB2rs1800888(Thr164Ile) polymorphism could therefore influence risk of obesity and subsequently diabetes....

  17. 26 CFR 1.164-5 - Certain retail sales taxes and gasoline taxes. (United States)


    ... 26 Internal Revenue 2 2010-04-01 2010-04-01 false Certain retail sales taxes and gasoline taxes. 1....164-5 Certain retail sales taxes and gasoline taxes. For taxable years beginning before January 1...) and tax on the sale of gasoline, diesel fuel or other motor fuel paid by the consumer (other than in...

  18. 49 CFR 173.164 - Mercury (metallic and articles containing mercury). (United States)


    ... 49 Transportation 2 2010-10-01 2010-10-01 false Mercury (metallic and articles containing mercury... Than Class 1 and Class 7 § 173.164 Mercury (metallic and articles containing mercury). (a) For transportation by aircraft, mercury must be packaged in packagings which meet the requirements of part 178 of...

  19. 33 CFR 164.37 - Equipment: Vessels of 10,000 gross tons or more. (United States)


    ... will not render the other system inoperative. (b) On each tanker of 10,000 gross tons or more that is... to the radar system under § 164.35(a), a second marine radar system that operates independently of the first. Note: Independent operation means two completely separate systems, from separate branch...

  20. 45 CFR 164.522 - Rights to request privacy protection for protected health information. (United States)


    ... 45 Public Welfare 1 2010-10-01 2010-10-01 false Rights to request privacy protection for protected... ADMINISTRATIVE DATA STANDARDS AND RELATED REQUIREMENTS SECURITY AND PRIVACY Privacy of Individually Identifiable Health Information § 164.522 Rights to request privacy protection for protected health information. (a)(1...

  1. Beta2-adrenoceptor Thr164Ile polymorphism is associated with markedly decreased vasodilator and increased vasoconstrictor sensitivity in vivo. (United States)

    Dishy, Victor; Landau, Ruth; Sofowora, Gbenga G; Xie, Hong-Guang; Smiley, Richard M; Kim, Richard B; Byrne, Daniel W; Wood, Alastair J J; Stein, C Michael


    The uncommon Thr164Ile polymorphism of the beta2-adrenoceptor is associated with profoundly altered responses to agonist in vitro; however its effects on vascular responses in vivo are not known. Altered adrenergic vascular sensitivity may contribute to the decreased survival observed in patients with congestive heart failure carrying the Ile164 allele. We used the linear variable differential transformer dorsal hand vein technique to compare vasodilation in response to the beta-adrenergic receptor agonist, isoproterenol, and vasoconstriction in response to the alpha-adrenergic receptor agonist, phenylephrine, in healthy homozygous (Thr164/Thr164) (n = 21) and heterozygous Thr164/Ile164 (n = 5) women. The dose of isoproterenol required to achieve 50% venodilation (geometric mean; 95% CI) was significantly higher in women with the Ile164 allele (82.5 ng/min; 17.3-394 ng/min) than those without (15.8 ng/min; 11-25 ng/min; P = 0.004). The maximum response to isoproterenol was not different (102 +/- 1% and 102 +/- 3%, respectively, P = 0.9). The dose of phenylephrine needed to induce 50% venoconstriction was significantly lower in women with the Ile164 allele (151 ng/min; 42-543 ng/min) than those without (540 ng/min; 350-835 ng/min; P = 0.02). The Thr164Ile polymorphism of the beta2-adrenergic receptor is associated with a five-fold reduction in sensitivity to beta2 receptor agonist-mediated vasodilation; vasoconstrictor sensitivity is increased. The overall effect of the Thr164Ile polymorphism is to shift the balance of adrenergic vascular tone toward vasoconstriction. This suggests a mechanistic explanation for the clinical observation of decreased survival in patients with congestive heart failure heterozygous for the Thr164Ile polymorphism.

  2. The response behavior of PPy-DB18C6 electrode to terbium(III in acetonitrile and its thermodynamic application

    Directory of Open Access Journals (Sweden)

    Mohammad Hossein Arbab Zavar


    Full Text Available Polypyrrole modified electrode prepared by electropolymerization of pyrrole in the presence of a complexing ligand, dibenzo-18-crown-6(DB18C6, was prepared and investigated as a Tb3+-selective electrode in acetonitrile. The potentiometric response of the electrode was linear within the Tb3+ concentration range 1 × 10−5–1 × 10−2 M with a Nernstian slope of 20.9 mVdecade−1 in AN. The electrode was applied to study the complexation of the terbium(III ion in acetonitrile with such other basic aprotic solvent molecules (D as dimethyl sulfoxide, N,N-dimethyl formamide, propylene carbonate and pyridine. The successive complex formation constant (βi and Gibbs energies of transfer (ΔGtr of Tb3+ in AN in relation to such D were obtained.

  3. Luminescence and Magnetic Properties of Two Three-Dimensional Terbium and Dysprosium MOFs Based on Azobenzene-4,4′-Dicarboxylic Linker

    Directory of Open Access Journals (Sweden)

    Belén Fernández


    Full Text Available We report the in situ formation of two novel metal-organic frameworks based on terbium and dysprosium ions using azobenzene-4,4′-dicarboxylic acid (H2abd as ligand, synthesized by soft hydrothermal routes. Both materials show isostructural three-dimensional networks with channels along a axis and display intense photoluminescence properties in the solid state at room temperature. Textural properties of the metal-organic frameworks (MOFs have been fully characterized although no appreciable porosity was obtained. Magnetic properties of these materials were studied, highlighting the dysprosium material displays slightly frequency-dependent out of phase signals when measured under zero external field and under an applied field of 1000 Oe.

  4. Redundancy and specialization among plant microRNAs: role of the MIR164 family in developmental robustness. (United States)

    Sieber, Patrick; Wellmer, Frank; Gheyselinck, Jacqueline; Riechmann, José Luis; Meyerowitz, Elliot M


    In plants, members of microRNA (miRNA) families are often predicted to target the same or overlapping sets of genes. It has thus been hypothesized that these miRNAs may act in a functionally redundant manner. This hypothesis is tested here by studying the effects of elimination of all three members of the MIR164 family from Arabidopsis. It was found that a loss of miR164 activity leads to a severe disruption of shoot development, in contrast to the effect of mutation in any single MIR164 gene. This indicates that these miRNAs are indeed functionally redundant. Differences in the expression patterns of the individual MIR164 genes imply, however, that redundancy among them is not complete, and that these miRNAs show functional specialization. Furthermore, the results of molecular and genetic analyses of miR164-mediated target regulation indicate that miR164 miRNAs function to control the transcript levels, as well as the expression patterns, of their targets, suggesting that they might contribute to developmental robustness. For two of the miR164 targets, namely CUP-SHAPED COTYLEDON1 (CUC1) and CUC2, we provide evidence for their involvement in the regulation of growth and show that their derepression in miR164 loss-of-function mutants is likely to account for most of the mutant phenotype.

  5. 45 CFR 164.510 - Uses and disclosures requiring an opportunity for the individual to agree or to object. (United States)


    ... persons who ask for the individual by name. (2) Opportunity to object. A covered health care provider must... the individual to agree or to object. 164.510 Section 164.510 Public Welfare DEPARTMENT OF HEALTH AND... individual to agree or to object. A covered entity may use or disclose protected health information, provided...

  6. 27 CFR 70.164 - Surrender of property subject to levy in the case of life insurance and endowment contracts. (United States)


    ... subject to levy in the case of life insurance and endowment contracts. 70.164 Section 70.164 Alcohol... the case of life insurance and endowment contracts. (a) In general. This section provides special rules relating to the surrender of property subject to levy in the case of life insurance and endowment...

  7. Luminescent europium and terbium complexes of dipyridoquinoxaline and dipyridophenazine ligands as photosensitizing antennae: structures and biological perspectives. (United States)

    Dasari, Srikanth; Patra, Ashis K


    The europium(III) and terbium(III) complexes, namely [Eu(dpq)(DMF)2(NO3)3] (1), [Eu(dppz)2(NO3)3] (2), [Tb(dpq)(DMF)2Cl3] (3), and [Tb(dppz)(DMF)2Cl3] (4), where dipyrido[3,2-d:2',3'-f]quinoxaline (dpq in 1 and 3), dipyrido[3,2-a:2',3'-c]phenazine (dppz in 2 and 4) and N,N'-dimethylformamide (DMF) have been isolated, characterized from their physicochemical data, luminescence studies and their interaction with DNA, serum albumin protein and photo-induced DNA cleavage activity are studied. The X-ray crystal structures of complexes 1-4 show discrete mononuclear Ln(3+)-based structures. The Eu(3+) in [Eu(dpq)(DMF)2(NO3)3] (1) and [Eu(dppz)2(NO3)3] (2) as [Eu(dppz)2(NO3)3]·dppz (2a) adopts a ten-coordinated bicapped dodecahedron structure with a bidentate N,N-donor dpq ligand, two DMF and three NO3(-) anions in 1 and two bidentate N,N-donor dppz ligands and three NO3(-) anions in 2. Complexes 3 and 4 show a seven-coordinated mono-capped octahedron structure where Tb(3+) contains bidentate dpq/dppz ligands, two DMF and three Cl(-) anions. The complexes are highly luminescent in nature indicating efficient photo-excited energy transfer from the dpq/dppz antenna to Ln(3+) to generate long-lived emissive excited states for characteristic f → f transitions. The time-resolved luminescence spectra of complexes 1-4 show typical narrow emission bands attributed to the (5)D0 → (7)F(J) and (5)D4 → (7)F(J) f-f transitions of Eu(3+) and Tb(3+) ions respectively. The number of inner-sphere water molecules (q) was determined from luminescence lifetime measurements in H2O and D2O confirming ligand-exchange reactions with water in solution. The complexes display significant binding propensity to the CT-DNA giving binding constant values in the range of 1.0 × 10(4)-6.1 × 10(4) M(-1) in the order 2, 4 (dppz) > 1, 3 (dpq). DNA binding data suggest DNA groove binding with the partial intercalation nature of the complexes. All the complexes also show binding propensity (K(BSA)

  8. Spin Waves in Terbium

    DEFF Research Database (Denmark)

    Jensen, J.; Houmann, Jens Christian Gylden


    The selection rules for the linear couplings between magnons and phonons propagating in the c direction of a simple basal-plane hcp ferromagnet are determined by general symmetry considerations. The acoustic-optical magnon-phonon interactions observed in the heavy-rare-earth metals have been expl...... by Liu. The coupled magnon—transverse-phonon system for the c direction of Tb is analyzed in detail, and the strengths of the couplings are deduced as a function of wave vector by combining the experimental studies with the theory....

  9. Spin Waves in Terbium

    DEFF Research Database (Denmark)

    Jensen, J.; Houmann, Jens Christian Gylden; Bjerrum Møller, Hans


    The energies of spin waves propagating in the c direction of Tb have been studied by inelastic neutron scattering, as a function of a magnetic field applied along the easy and hard directions in the basal plane, and as a function of temperature. From a general spin Hamiltonian, consistent...... with the symmetry, we deduce the dispersion relation for the spin waves in a basal-plane ferromagnet. This phenomenological spin-wave theory accounts for the observed behavior of the magnon energies in Tb. The two q⃗-dependent Bogoliubov components of the magnon energies are derived from the experimental results...

  10. Acidente vascular cerebral em pacientes jovens: análise de 164 casos Stroke in young adults: analysis of 164 patients

    Directory of Open Access Journals (Sweden)

    Viviane H. Flumignan Zétola


    Full Text Available Realizamos análise epidemiológica de 164 pacientes com AVC, cujo primeiro episódio ocorreu entre 15 e 49 anos de idade através de um estudo retrospectivo de pacientes ambulatoriais. O principal tipo de apresentação foi AVC isquêmico (AVCI em 141 pacientes, ocorrendo AVC hemorrágico (AVCH em16 casos e 7 pacientes com trombose venosa. A presença de fatores de risco aterotrombóticos foi prevalente, em 48,22% dos pacientes com AVCI sendo que a hipertensão arterial sistêmica (HAS, nos casos de AVCH, foi a etiologia mais frequente. Em 32% dos casos não se pode determinar a sua causa. Embora a população jovem possua determinantes diferentes e geralmente deva ter uma investigação etiológica mais abrangente, no grupo estudado foram prevalentes os fatores de risco conhecidos e potencialmente controláveis, sugerindo que campanhas de prevenção e detecção precoce devam ser incentivados.We retrospectively analyzed the epidemiological features of 164 out-clinic patients with a first-onset stroke between 15 and 49 years old. Ischemic stroke occurred in 141 patients, hemorrhagic stroke in 16 patients, and venous thrombosis in 7 patients. Forty-eight percent of ischemic strokes were atherothrombotic, but no etiology was found in 32% of patients with ischemic stroke. Systemic arterial hypertension was the most frequent etiology in the hemorrhagic stroke group. The most frequent risk factors were systemic arterial hypertension, smoking, hypercholesterolemia, alcoholism and diabetes mellitus. Although stroke in young adults deserves some specific etiological investigation, we found that ordinary risk factors such as hypertension, tabacco use, hypercolesteremia and diabetes were prevalent in our population. It seems that prevention campaigns should be the target of our work.

  11. Synthesis and crystal structure of terbium(III) meta-oxoborate Tb(BO{sub 2}){sub 3} ({identical_to} TbB{sub 3}O{sub 6}); Synthese und Kristallstruktur von Terbium(III)-meta-Oxoborat Tb(BO{sub 2}){sub 3} ({identical_to} TbB{sub 3}O{sub 6})

    Energy Technology Data Exchange (ETDEWEB)

    Nikelski, Tanja; Schleid, Thomas [Institut fuer Anorganische Chemie der Universitaet Stuttgart (Germany)


    The terbium meta-oxoborate Tb(BO{sub 2}){sub 3} ({identical_to} TbB{sub 3}O{sub 6}) is obtained as single crystals by the reaction of terbium, Tb{sub 4}O{sub 7} and TbCl{sub 3} with an excess of B{sub 2}O{sub 3} in gastight sealed platinum ampoules at 950 C after three weeks. The compound appears to be air- and water-resistant and crystallizes as long, thin, colourless needles which tend to growth-twinning due to their marked fibrous habit. The crystal structure of Tb(BO{sub 2}){sub 3} (orthorhombic, Pnma; a = 1598.97(9), b = 741.39(4), c = 1229.58(7) pm; Z = 16) contains strongly corrugated oxoborate layers {sub {infinity}}{sup 2}{l_brace}(BO{sub 2}){sup -}{r_brace} built of vertex-linked [BO{sub 4}]{sup 5-} tetrahedra (d(B-O) = 143 - 154 pm, and angsph;(O-B-O) = 102-115 ) which spread out parallel (100). The four crystallographically different Tb{sup 3+} cations all exhibit coordination numbers of eight towards the oxygen atoms (d(Tb-O) = 228-287 pm). The corresponding metal cation polyhedra [TbO{sub 8}]{sup 13+} too convene to layers (composition: {sub {infinity}}{sup 2}{l_brace}(Tb{sub 2}O{sub 11}){sup 16-}{r_brace}) which are likewise oriented parallel to the (100) plane. (Abstract Copyright [2003], Wiley Periodicals, Inc.) [German] Das Terbium-meta-Oxoborat Tb(BO{sub 2}){sub 3} ({identical_to} TbB{sub 3}O{sub 6}) entsteht einkristallin bei der Reaktion von Terbium, Tb{sub 4}O{sub 7} und TbCl{sub 3} mit einem Ueberschuss von B{sub 2}O{sub 3} in gasdicht verschlossenen Platinampullen nach drei Wochen bei 950 C. Die Verbindung ist luft- und wasserstabil und faellt in langen, duennen, farblosen Nadeln an, die aufgrund ihres ausgepraegt faserigen Habitus zur Wachstumsverzwillingung neigen. Die Kristallstruktur von Tb(BO{sub 2}){sub 3} (orthorhombisch, Pnma; a = 1598, 97(9), b = 741, 39(4), c = 1229, 58(7) pm; Z = 16) enthaelt parallel (100) verlaufende, stark gewellte Oxoborat-Schichten {sub {infinity}}{sup 2}{l_brace}(BO{sub 2}){sup -}{r_brace} aus

  12. 77 FR 59420 - 164th Meeting of the Advisory Council on Employee Welfare and Pension Benefit Plans; Notice of... (United States)


    ... Advisory Council on Employee Welfare and Pension Benefit Plans; Notice of Meeting Pursuant to the authority... 164th open meeting of the Advisory Council on Employee Welfare and Pension Benefit Plans (also known as...

  13. Exome capture reveals ZNF423 and CEP164 mutations, linking renal ciliopathies to DNA damage response signaling

    DEFF Research Database (Denmark)

    Chaki, Moumita; Airik, Rannar; Ghosh, Amiya K


    identify by whole-exome resequencing, mutations of MRE11, ZNF423, and CEP164 as causing NPHP-RC. All three genes function within the DNA damage response (DDR) pathway. We demonstrate that, upon induced DNA damage, the NPHP-RC proteins ZNF423, CEP164, and NPHP10 colocalize to nuclear foci positive for TIP60......, known to activate ATM at sites of DNA damage. We show that knockdown of CEP164 or ZNF423 causes sensitivity to DNA damaging agents and that cep164 knockdown in zebrafish results in dysregulated DDR and an NPHP-RC phenotype. Our findings link degenerative diseases of the kidney and retina, disorders......Nephronophthisis-related ciliopathies (NPHP-RC) are degenerative recessive diseases that affect kidney, retina, and brain. Genetic defects in NPHP gene products that localize to cilia and centrosomes defined them as "ciliopathies." However, disease mechanisms remain poorly understood. Here, we...

  14. ß2 -adrenergic receptor Thr164IIe polymorphism, blood pressure and ischaemic heart disease in 66¿750 individuals

    DEFF Research Database (Denmark)

    Thomsen, M; Dahl, Morten; Tybjaerg-Hansen, A


    The ß(2) -adrenergic receptor (ADRB2) is located on smooth muscle cells and is an important regulator of smooth muscle tone. The Thr164Ile polymorphism (rs1800888) in the ADRB2 gene is rare but has profound functional consequences on receptor function and could cause lifelong elevated smooth musc...... tone. We tested the hypothesis that Thr164Ile is associated with increased blood pressure, increased frequency of hypertension and increased risk of cardiovascular disease (CVD)....

  15. Analysis of factor VIII gene inversions in 164 unrelated hemophilia A families

    Energy Technology Data Exchange (ETDEWEB)

    Vnencak-Jones, L.; Phillips, J.A. III; Janco, R.L. [Vanderbilt Univ. School of Medicine, Nashville, TN (United States)] [and others


    Hemophilia A is an X-linked recessive disease with variable phenotype and both heterogeneous and wide spread mutations in the factor VIII (F8) gene. As a result, diagnostic carrier or prenatal testing often relies upon laborious DNA linkage analysis. Recently, inversion mutations resulting from an intrachromosomal recombination between DNA sequences in one of two A genes {approximately}500 kb upstream from the F8 gene and a homologous A gene in intron 22 of the F8 gene were identified and found in 45% of severe hemophiliacs. We have analyzed banked DNA collected since 1986 from affected males or obligate carrier females representing 164 unrelated hemophilia A families. The disease was sporadic in 37%, familial in 54% and in 10% of families incomplete information was given. A unique deletion was identified in 1/164, a normal pattern was observed in 110/164 (67%), and 53/164 (32%) families had inversion mutations with 43/53 (81%) involving the distal A gene (R3 pattern) and 10/53 (19%) involving the proximal A gene (R2 pattern). While 19% of all rearrangements were R2, in 35 families with severe disease (< 1% VIII:C activity) all 16 rearrangements seen were R3. In 18 families with the R3 pattern and known activities, 16 (89%) had levels < 1%, with the remaining 2 families having {le} 2.4% activity. Further, 18 referrals specifically noted the production of inhibitors and 8/18 (45%) had the R3 pattern. Our findings demonstrate that the R3 inversion mutation patterns is (1) only seen with VIII:C activity levels of {le} 2.4%, (2) seen in 46% of families with severe hemophilia, (3) seen in 45% of hemophiliacs known to have inhibitors, (4) not correlated with sporadic or familial disease and (5) not in disequilibrium with the Bcl I or Taq I intron 18 or ST14 polymorphisms. Finally, in families positive for an inversion mutation, direct testing offers a highly accurate and less expensive alternative to DNA linkage analysis.

  16. An integrated logic system for time-resolved fluorescent "turn-on" detection of cysteine and histidine base on terbium (III) coordination polymer-copper (II) ensemble. (United States)

    Xue, Shi-Fan; Lu, Ling-Fei; Wang, Qi-Xian; Zhang, Shengqiang; Zhang, Min; Shi, Guoyue


    Cysteine (Cys) and histidine (His) both play indispensable roles in many important biological activities. An enhanced Cys level can result in Alzheimer's and cardiovascular diseases. Likewise, His plays a significant role in the growth and repair of tissues as well as in controlling the transmission of metal elements in biological bases. Therefore, it is meaningful to detect Cys and His simultaneously. In this work, a novel terbium (III) coordination polymer-Cu (II) ensemble (Tb(3+)/GMP-Cu(2+)) was proposed. Guanosine monophosphate (GMP) can self-assemble with Tb(3+) to form a supramolecular Tb(3+) coordination polymer (Tb(3+)/GMP), which can be suited as a time-resolved probe. The fluorescence of Tb(3+)/GMP would be quenched upon the addition of Cu(2+), and then the fluorescence of the as-prepared Tb(3+)/GMP-Cu(2+) ensemble would be restored again in the presence of Cys or His. By incorporating N-Ethylmaleimide and Ni(2+) as masking agents, Tb(3+)/GMP-Cu(2+) was further exploited as an integrated logic system and a specific time-resolved fluorescent "turn-on" assay for simultaneously sensing His and Cys was designed. Meanwhile it can also be used in plasma samples, showing great potential to meet the need of practical application. Copyright © 2016 Elsevier B.V. All rights reserved.

  17. Synthesis and photoluminescence properties of cerium-doped terbium-yttrium aluminum garnet phosphor for white light-emitting diodes applications (United States)

    Wang, Jun; Han, Tao; Lang, Tianchun; Tu, Mingjing; Peng, Lingling


    Cerium-doped terbium-yttrium aluminum garnet phosphors were synthesized using the solid-state reaction method. The crystalline phase, morphology, and photoluminescence properties were characterized by x-ray diffraction (XRD), scanning electron microscope (SEM), and fluorescence spectrophotometer, respectively. The XRD results indicate that with an increase of the amount of x (Tb3+), all of the samples have a pure garnet crystal structure without secondary phases. The SEM images reveal that the samples are composed of sphere-like crystallites, which exhibit different degrees of agglomeration. The luminescent properties of Ce ions in )Al5O12∶Ce0.1 have been studied, and it was found that the emission band shifted toward a longer wavelength. The redshift is attributed to the lowering of the 5d energy level centroid of Ce, which can be explained by the nephelauxetic effect and compression effect. These phosphors were coated on blue light-emitting diode (LED) chips to fabricate white light-emitting diodes (WLEDs), and their color-rendering indices, color temperatures, and luminous efficiencies were measured. As a consequence of the addition of Tb, the blue LED pumped )Al5O12∶Ce0.1 phosphors WLEDs showed good optical properties.

  18. Study on the fluorescent enhancement effect in terbium-gadolinium-protein-sodium dodecyl benzene sulfonate system and its application on sensitive detection of protein at nanogram level. (United States)

    Sun, Changxia; Yang, Jinghe; Wu, Xia; Liu, Shufang; Su, Benyu


    The co-luminescence effect in a terbium-gadolinium-protein-sodium dodecyl benzene sulfonate (SDBS) system is reported here. Based on it, the sensitive quantitative analysis of protein at nanogram levels is established. The co-luminescence mechanism is studied using fluorescence, resonance light scattering (RLS), absorption spectroscopy and NMR measurement. It is considered that protein could be unfolded by SDBS, then a efficacious intramolecular fluorescent energy transfer occurs from unfolded protein to rare earth ions through SDBS acting as a "transfer bridge" to enhance the emission fluorescence of Tb3+ in this ternary complex of Tb-SDBS-BSA, where energy transfer from protein to SDBS by aromatic ring stacking is the most important step. Cooperating with the intramolecular energy transfer above is the intermolecular energy transfer between the simultaneous existing complexes of both Tb3+ and Gd3+. The fluorescence quantum yield is increased by an energy-insulating sheath, which is considered to be another reason for the resulting enhancement of the fluorescence. Förster theory is used to calculate the distribution of enhancing factors and has led to a greater understanding of the mechanisms of energy transfer.

  19. [Studies on luminescence properties of seven ternary complexes of terbium with 1,10-phenanthroline and benzoic acid and its derivatives]. (United States)

    Gao, Zhi-hua; Wang, Shu-ping; Liu, Cui-ge; Ma, Rui-xia; Wang, Rui-fen


    Seven ternary complexes of Tb(III) were synthesized with benzoic acid (BA), o-, m-, p-methylbenzoic acid (o-MBA, m-MBA, p-MBA), and o-, m-, p-methoxybenzoic acid (o-MOBA, m-MOBA, p-MOBA) as the first ligand, and 1,10-phenanthroline (phen) as the second ligand. The content of C, H and N were measured by using a Flash-EA model 1112 elemental analyzer. Excitation and luminescence spectra of the title solid complexes were recorded by using a Hitachi F-4500 fluorescence spectrophotometer at room temperature. The effects of different varieties and different positions of replacing benzoic acid as the first ligand on fluorescence properties of the ternary complexes of terbium were discussed. The results indicated that the intensity of 5D4-->7F6 (489 nm) and 5D4-->7F5 (545 nm) of substituting benzoic acid complexes was stronger than benzoic acid. Three ternary complexes of Tb(III) with o-, m-, p-methylbenzoic acid showed emission intensity in the consecution: Tb(o-MBA)3 phenMOBA)3phen x H2O>Tb(m-MOBA)3phen x H2O>Tb(p-MOBA)3 phen.

  20. Exome capture reveals ZNF423 and CEP164 mutations, linking renal ciliopathies to DNA damage response signaling (United States)

    Chaki, Moumita; Airik, Rannar; Ghosh, Amiya K.; Giles, Rachel H.; Chen, Rui; Slaats, Gisela G.; Wang, Hui; Hurd, Toby W.; Zhou, Weibin; Cluckey, Andrew; Gee, Heon-Yung; Ramaswami, Gokul; Hong, Chen-Jei; Hamilton, Bruce A.; Červenka, Igor; Ganji, Ranjani Sri; Bryja, Vitezslav; Arts, Heleen H.; van Reeuwijk, Jeroen; Oud, Machteld M.; Letteboer, Stef J.F.; Roepman, Ronald; Husson, Hervé; Ibraghimov-Beskrovnaya, Oxana; Ysunaga, Takayuki; Walz, Gerd; Eley, Lorraine; Sayer, John A.; Schermer, Bernhard; Liebau, Max C.; Benzing, Thomas; Le Corre, Stephanie; Drummond, Iain; Joles, Jaap A.; Janssen, Sabine; Allen, Susan J.; Natarajan, Sivakumar; O Toole, John F.; Attanasio, Massimo; Saunier, Sophie; Antignac, Corinne; Koenekoop, Robert K.; Ren, Huanan; Lopez, Irma; Nayir, Ahmet; Stoetzel, Corinne; Dollfus, Helene; Massoudi, Rustin; Gleeson, Joseph G.; Andreoli, Sharon P.; Doherty, Dan G.; Lindstrad, Anna; Golzio, Christelle; Katsanis, Nicholas; Pape, Lars; Abboud, Emad B.; Al-Rajhi, Ali A.; Lewis, Richard A.; Lupski, James R.; Omran, Heymut; Lee, Eva; Wang, Shaohui; Sekiguchi, JoAnn M.; Saunders, Rudel; Johnson, Colin A.; Garner, Elizabeth; Vanselow, Katja; Andersen, Jens S.; Shlomai, Joseph; Nurnberg, Gudrun; Nurnberg, Peter; Levy, Shawn; Smogorzewska, Agata; Otto, Edgar A.; Hildebrandt, Friedhelm


    SUMMARY Nephronophthisis-related ciliopathies (NPHP-RC) are degenerative recessive diseases that affect kidney, retina and brain. Genetic defects in NPHP gene products that localize to cilia and centrosomes defined them as ‘ciliopathies’. However, disease mechanisms remain poorly understood. Here we identify by whole exome resequencing, mutations of MRE11, ZNF423, and CEP164 as causing NPHP-RC. All three genes function within the DNA damage response (DDR) pathway, hitherto not implicated in ciliopathies. We demonstrate that, upon induced DNA damage, the NPHP-RC proteins ZNF423, CEP164 and NPHP10 colocalize to nuclear foci positive for TIP60, known to activate ATM at sites of DNA damage. We show that knockdown of CEP164 or ZNF423 causes sensitivity to DNA damaging agents, and that cep164 knockdown in zebrafish results in dysregulated DDR and an NPHP-RC phenotype. We identify TTBK2, CCDC92, NPHP3 and DVL3 as novel CEP164 interaction partners. Our findings link degenerative diseases of kidney and retina, disorders of increasing prevalence, to mechanisms of DDR. PMID:22863007

  1. G333.466-0.164, An EGO That Is Not Aligned With Its Disk Axis (United States)

    Simpson, Janet P.; Burton, Michael; Cotera, Angela; Cunningham, Maria; Lo, Nadia


    The infrared source G333.466-0.164 (IRAS 16175-5002) was discovered to contain a 4.5 micron emission feature (extended green object, EGO) in images taken with Spitzer's Infrared Array Camera in 2004. EGOs appear to define the location of outflows from massive young stellar objects (MYSOs) and have been attributed to both emission from molecular hydrogen or CO in the shocked outflow and to scattered light from the outflow cavity. We confirmed that there is a MYSO at the south end of the 15'' long, thin EGO from spectra taken with Spitzer's Infrared Spectrograph in 2009 (Simpson et al. 2012, MNRAS, 419, 211). To further characterize G333.466-0.164 we obtained 12.3 and 24.5 micron images with T-ReCS on Gemini South. Although the MYSO itself is not detected at 12.3 micron, we clearly resolve an elongated source at the location of the MYSO at 24.5 micron with the 0.76" FWHM resolution of Gemini. The elongated region has major and minor axes 2.5'' and 1.5'', respectively, where the position angle of the major axis is 147 pm 5 degrees east of north. For a distance of 3.6 kpc, this corresponds to a size of 9000 AU by 5400 AU. We contrast the position angle of the source to that of the EGO, which is approximately -10 degrees east of north measured from the MYSO. Methanol masers have been measured in G333.466-0.164 by Caswell et al. (2011, MNRAS, 417, 1964) and Voronkov et al. (2014, MNRAS, 439, 258). The 6.7 GHz Class II maser is found at the position of the MYSO and the 36 and 44 GHz Class I masers, which are excited by shocks, are found in positions coinciding with the EGO and also in a line perpendicular to the EGO, in an area obscured by an optically thick dust lane. Voronkov et al. suggest that the actual outflow lies between the two lines of Class I masers in the northeast direction; this is in excellent agreement with the northeast-oriented minor axis of the elongated feature that we observe at 24.5 micron. Thus we identify the 24.5 micron source as the disk of the

  2. miRNA164-directed cleavage of ZmNAC1 confers lateral root development in maize (Zea mays L.). (United States)

    Li, Jing; Guo, Guanghui; Guo, Weiwei; Guo, Ganggang; Tong, Dan; Ni, Zhongfu; Sun, Qixin; Yao, Yingyin


    MicroRNAs are a class of small, non-coding RNAs that regulate gene expression by binding target mRNA, which leads to cleavage or translational inhibition. The NAC proteins, which include NAM, ATAF, and CUC, are a plant-specific transcription factor family with diverse roles in development and stress regulation. It has been reported that miR164 negatively regulates NAC1 expression, which in turn affects lateral root development in Arabidopsis; however, little is known about the involvement of the maize NAC family and miR164 in lateral root development. We collected 175 maize transcripts with NAC domains. Of these, 7 ZmNACs were putative targets for regulation by miR164. We isolated one gene, called TC258020 (designated ZmNAC1) from 2 maize inbred lines, 87-1 and Zong3. ZmNAC1 had a high expression level in roots and showed higher abundance (1.8 fold) in Zong3 relative to 87-1, which had less lateral roots than Zong3. There was a significant correlation between the expression level of ZmNAC1 and the lateral root density in the recombinant inbred line (RIL) population. Transgenic Arabidopsis that overexpressed ZmNAC1 had increased lateral roots in comparison to the wild type. These findings suggest that ZmNAC1 played a significant role in lateral root development. An allelic expression assay showed that trans-regulatory elements were the dominant mediators of ZmNAC1 differential expression in 87-1 and Zong3, and further analysis revealed that miR164 was a trans-element that guided the cleavage of endogenous ZmNAC1 mRNA. Both mature miR164 and miR164 precursors had higher expression in 87-1 than Zong3, which was the opposite of the expression pattern of ZmNAC1. Additionally, the allelic assay showed that the cis-regulatory element most likely affected Zm-miR164b's expression pattern. A β-glucuronidase (GUS) assay showed that the Zm-miR164b promoter had higher GUS activity in 87-1 than in Zong3. In addition, we detected miR164b expression in the RIL population, and the

  3. miRNA164-directed cleavage of ZmNAC1 confers lateral root development in maize (Zea mays L.

    Directory of Open Access Journals (Sweden)

    Li Jing


    Full Text Available Abstract Background MicroRNAs are a class of small, non-coding RNAs that regulate gene expression by binding target mRNA, which leads to cleavage or translational inhibition. The NAC proteins, which include NAM, ATAF, and CUC, are a plant-specific transcription factor family with diverse roles in development and stress regulation. It has been reported that miR164 negatively regulates NAC1 expression, which in turn affects lateral root development in Arabidopsis; however, little is known about the involvement of the maize NAC family and miR164 in lateral root development. Results We collected 175 maize transcripts with NAC domains. Of these, 7 ZmNACs were putative targets for regulation by miR164. We isolated one gene, called TC258020 (designated ZmNAC1 from 2 maize inbred lines, 87-1 and Zong3. ZmNAC1 had a high expression level in roots and showed higher abundance (1.8 fold in Zong3 relative to 87-1, which had less lateral roots than Zong3. There was a significant correlation between the expression level of ZmNAC1 and the lateral root density in the recombinant inbred line (RIL population. Transgenic Arabidopsis that overexpressed ZmNAC1 had increased lateral roots in comparison to the wild type. These findings suggest that ZmNAC1 played a significant role in lateral root development. An allelic expression assay showed that trans-regulatory elements were the dominant mediators of ZmNAC1 differential expression in 87-1 and Zong3, and further analysis revealed that miR164 was a trans-element that guided the cleavage of endogenous ZmNAC1 mRNA. Both mature miR164 and miR164 precursors had higher expression in 87-1 than Zong3, which was the opposite of the expression pattern of ZmNAC1. Additionally, the allelic assay showed that the cis-regulatory element most likely affected Zm-miR164b's expression pattern. A β-glucuronidase (GUS assay showed that the Zm-miR164b promoter had higher GUS activity in 87-1 than in Zong3. In addition, we detected mi

  4. Self-diffusion coefficients of the trivalent f-element ion series in dilute and moderately dilute aqueous solutions: A comparative study between europium, gadolinium, terbium and berkelium (United States)

    Rafik, Besbes; Noureddine, Ouerfelli; Abderabbou, Abdelmanef; Habib, Latrous


    We have continued the studies on the trivalent ions of the 4f and 5f elements. In this paper, we compare the transport properties (self-diffusion coefficient) of the trivalent aquo ions over two ranges of concentrations (0 — 2×10-3M) and (2×10-3 — 1.5M). Self-diffusion coefficients, D, of the trivalent f-element aquo ion series have been determined in aqueous background electrolytes of Gd(NO3)3 and Nd(ClO4)3, at pH=2.5 (HNO3, HClO4) and at 25°C using the open-end capillary method (O.E.C.M.). This method measures the transportation time of ions across a fixed distance. In this paper, we complete a measurement of self-diffusion coefficient for terbium. We optimized the pH to avoid hydrolysis, ion-pairing and complexation of the trivalent 4f and 5f ions. The variation of D versus √C is not linear for dilute solutions (0 — 2×10-3M) and quasi-linear in moderate concentrations (C<=1.5 M). Similar behavior was observed for Tb, as compared with those for Bk, Eu and Gd. We complete the comparison variation of D/D° versus √C for all studied 4f and 5f elements from concentration 0 to 1.5M and we obtained the same variation with √C for all studied elements. All 4f and 5f elements studied follow the Nernst-Hartley expression.

  5. Terbium-based time-gated Förster resonance energy transfer imaging for evaluating protein-protein interactions on cell membranes. (United States)

    Lindén, Stina; Singh, Manish Kumar; Wegner, K David; Regairaz, Marie; Dautry, François; Treussart, François; Hildebrandt, Niko


    Fluorescence imaging of cells and subcellular compartments is an essential tool to investigate biological processes and to evaluate the development and progression of diseases. In particular, protein-protein interactions can be monitored by Förster resonance energy transfer (FRET) between two proximal fluorophores that are attached to specific recognition biomolecules such as antibodies. We investigated the membrane expression of E- and N-cadherins in three different cell lines used as model systems to study epithelial to mesenchymal transition (EMT) and a possible detection of circulating tumour cells (CTCs). EMT is a key process in cancer metastasis, during which epithelial markers (such as E-cadherin) are down-regulated in the primary tumour whereas mesenchymal markers (such as N-cadherin) are up-regulated, leading to enhanced cell motility, intravasation, and appearance of CTCs. Various FRET donor-acceptor pairs and protein recognition strategies were utilized, in which Lumi4-Tb terbium complexes (Tb) and different organic dyes were conjugated to several distinct E- and N-cadherin-specific antibodies. Pulsed excitation of Tb at low repetition rates (100 Hz) and time-gated (TG) imaging of both the Tb-donor and the dye-acceptor photoluminescence (PL) allowed efficient detection of the EMT markers as well as FRET in the case of sufficient donor-acceptor proximity. Efficient FRET was observed only between two E-cadherin-specific antibodies and further experiments indicated that these antibodies recognized the same E-cadherin molecule, suggesting a limited accessibility of cadherins when they are clustered at adherens junctions. The investigated Tb-to-dye FRET systems provided reduced photobleaching compared to the AlexaFluor 488-568 donor-acceptor pair. Our results demonstrate the applicability and advantages of Tb-based TG FRET for efficient and stable imaging of antibody-antibody interactions on different cell lines. They also reveal the limitations of

  6. A broad G protein-coupled receptor internalization assay that combines SNAP-tag labeling, diffusion-enhanced resonance energy transfer, and a highly emissive terbium cryptate acceptor

    Directory of Open Access Journals (Sweden)

    Angélique eLEVOYE


    Full Text Available Although G protein-coupled receptor (GPCR internalization has long been considered a major aspect of the desensitization process that tunes ligand responsiveness, internalization is also involved in receptor resensitization and signaling, as well as the ligand scavenging function of some atypical receptors. Internalization thus contributes to the diversity of GPCR-dependent signaling, and its dynamics and quantification in living cells has generated considerable interest. We developed a robust and sensitive assay to follow and quantify ligand-induced and constitutive GPCR internalization but also receptor recycling in living cells. This assay is based on diffusion-enhanced resonance energy transfer (DERET between cell surface GPCRs labeled with a luminescent terbium cryptate donor and a fluorescein acceptor present in the culture medium. GPCR internalization results in a quantifiable reduction of energy transfer. This method yields a high signal-to-noise ratio due to time-resolved measurements. For various GPCRs belonging to different classes, we demonstrated that constitutive and ligand-induced internalization could be monitored as a function of time and ligand concentration, thus allowing accurate quantitative determination of kinetics of receptor internalization but also half-maximal effective or inhibitory concentrations of compounds. In addition to its selectivity and sensitivity, we provided evidence that DERET-based internalization assay is particularly suitable for characterizing biased ligands. Furthermore, the determination of a Z’-factor value of 0.45 indicates the quality and suitability of DERET-based internalization assay for high-throughput screening (HTS of compounds that may modulate GPCRs internalization.

  7. Transfer and breakup reactions in 16O + CsI at 16.4 MeV/n

    Directory of Open Access Journals (Sweden)

    M.J. Murphy


    Full Text Available A streamer-chamber particle-telescope system has been used to observe ejectile charge, energy, and associated charged particle multiplicity in the reaction of 16O + CsI at 16.4 MeV/n. The measurement provides relative probabilities for transfer and projectile breakup as a function of ejectile charge, and spectra for the heavy ejectiles from transfer and breakup events. The results show that the interaction energy of 16.4 MeV/n is near the threshold for breakup reactions in heavy-ion collisions.

  8. Crystal structure of an eight-coordinate terbium(III ion chelated by N,N′-bis(2-hydroxybenzyl-N,N′-bis(pyridin-2-ylmethylethylenediamine (bbpen2− and nitrate

    Directory of Open Access Journals (Sweden)

    Thaiane Gregório


    Full Text Available The reaction of terbium(III nitrate pentahydrate in acetonitrile with N,N′-bis(2-hydroxybenzyl-N,N′-bis(pyridin-2-ylmethylethylenediamine (H2bbpen, previously deprotonated with triethylamine, produced the mononuclear compound [N,N′-bis(2-oxidobenzyl-κO-N,N′-bis(pyridin-2-ylmethyl-κNethylenediamine-κ2N,N′](nitrato-κ2O,O′terbium(III, [Tb(C28H28N4O2(NO3]. The molecule lies on a twofold rotation axis and the TbIII ion is eight-coordinate with a slightly distorted dodecahedral coordination geometry. In the symmetry-unique part of the molecule, the pyridine and benzene rings are both essentially planar and form a dihedral angle of 61.42 (7°. In the molecular structure, the N4O4 coordination environment is defined by the hexadentate bbpen ligand and the bidentate nitrate anion. In the crystal, a weak C—H...O hydrogen bond links molecules into a two-dimensional network parallel to (001.

  9. 17 CFR 1.64 - Composition of various self-regulatory organization governing boards and major disciplinary... (United States)


    ... 17 Commodity and Securities Exchanges 1 2010-04-01 2010-04-01 false Composition of various self... ACT Miscellaneous § 1.64 Composition of various self-regulatory organization governing boards and... organization and is otherwise consistent with this regulation's composition requirements; (c) Each self...

  10. 77 FR 66186 - 164th Meeting of the Advisory Council on Employee Welfare and Pension Benefit Plans; Notice of... (United States)


    ... From the Federal Register Online via the Government Publishing Office DEPARTMENT OF LABOR Employee Benefits Security Administration 164th Meeting of the Advisory Council on Employee Welfare and Pension... Council on Employee Welfare and Pension Benefit Plans (also known as the ERISA Advisory Council) will be...

  11. Lysine residue 185 of Rad1 is a topological but not a functional counterpart of lysine residue 164 of PCNA.

    Directory of Open Access Journals (Sweden)

    Niek Wit

    Full Text Available Monoubiquitylation of the homotrimeric DNA sliding clamp PCNA at lysine residue 164 (PCNA(K164 is a highly conserved, DNA damage-inducible process that is mediated by the E2/E3 complex Rad6/Rad18. This ubiquitylation event recruits translesion synthesis (TLS polymerases capable of replicating across damaged DNA templates. Besides PCNA, the Rad6/Rad18 complex was recently shown in yeast to ubiquitylate also 9-1-1, a heterotrimeric DNA sliding clamp composed of Rad9, Rad1, and Hus1 in a DNA damage-inducible manner. Based on the highly similar crystal structures of PCNA and 9-1-1, K185 of Rad1 (Rad1(K185 was identified as the only topological equivalent of PCNA(K164. To investigate a potential role of posttranslational modifications of Rad1(K185 in DNA damage management, we here generated a mouse model with a conditional deletable Rad1(K185R allele. The Rad1(K185 residue was found to be dispensable for Chk1 activation, DNA damage survival, and class switch recombination of immunoglobulin genes as well as recruitment of TLS polymerases during somatic hypermutation of immunoglobulin genes. Our data indicate that Rad1(K185 is not a functional counterpart of PCNA(K164.

  12. Production of a nisin-like bacteriocin by Lactococcus lactis subsp. lactis A164 isolated from Kimchi. (United States)

    Choi, H J; Cheigh, C I; Kim, S B; Pyun, Y R


    Lactococcus lactis subsp. lactis A164 was isolated from Kimchi (Korean traditional fermented vegetables). The bacteriocin produced by strain A164 was active against closely related lactic acid bacteria and some food-borne pathogens including Staphylococcus aureus, Listeria monocytogenes and Salmonella typhimurium. The antimicrobial spectrum was nearly identical to that of nisin. Bacteriocin activity was not destroyed by exposure to elevated temperatures at low pH values, but the activity was lost at high pH values. This bacteriocin was inactivated by pronase E and alpha, beta-chymotrypsin, but not by trypsin, pepsin, and alpha-amylase. Cultures of L. lactis subsp. lactis A164 maintained at a constant pH of 6.0 exhibited maximum production of the bacteriocin. It was purified to homogeneity by ammonium sulphate precipitation, sequential ion exchange chromatography, and ultrafiltration. Tricine-SDS-PAGE of purified bacteriocin gave the same molecular weight of 3.5 kDa as that of nisin. The gene encoding this bacteriocin was amplified by PCR with nisin gene-specific primers and sequenced. It showed identical sequences to the nisin gene. These results indicate that bacteriocin produced by Lactococcus lactis A164 is a nisin-like bacteriocin.

  13. The Effects of Isosorbide Dinitrate on in Vitro Proliferation of WEHI-164 Cells and Peripheral Blood Mononuclear Cells

    Directory of Open Access Journals (Sweden)

    Resvan Madani FZ


    Full Text Available Background: Isosorbide dinitrate has been broadly used in the treatment of various ischemic heart diseases. Isosorbide is a nitric oxide donor which increases blood flow to tumors through vasodilatation and consequently accelerates the access of chemo-drugs to them. Furthermore, this drug has inhibitory effects on angiogenesis, tumor growth and metastasis in vivo. Moreover, its ant-inflammatory effects have also been reported. In the present study we evaluated the effects of isosorbide on the proliferative activity of fibrosarcoma WEHI-164 cell line and peripheral blood mononuclear cells (PBMCs. Methods: WEHI-164 fibrosarcoma cells and human PBMCs were cultured in complete Roswell Park Memorial Institute (RPMI 1640 medium with 10% fetal bovine serum and 2×104 cells/mL for WEHI-164 and 2×105 cells/mL for PBMCs. The cells were then incubated at the exponential growth phase with different concentrations of isosorbide (4×10-6-1.6×10-3 M for 24, 48 and 72 hours. Subsequently, isosorbide effects on proliferation of the cells were evaluated by trypan blue dye exclusion (TB test and MTT assay. Statistical comparisons between groups were made by analysis of variance. Results: The proliferative activity of WEHI-164 fibrosarcoma cells and human PBMCs treated with different concentrations of isosorbide, did not show any significant difference with untreated control cells. Conclusion: The results of this study showed that isosorbide neither had any significant effects on the proliferative activity of fibrosarcoma WEHI-164 cells nor on human PBMCs. Our findings suggest that anti-tumoral effects of isosorbide reported by other investigators may be mediated through non-cytotoxic mechanisms.

  14. The early extra petals1 mutant uncovers a role for microRNA miR164c in regulating petal number in Arabidopsis. (United States)

    Baker, Catherine C; Sieber, Patrick; Wellmer, Frank; Meyerowitz, Elliot M


    MicroRNAs (miRNAs) are small 20-25 nucleotide non-protein-coding RNAs that negatively regulate expression of genes in many organisms, ranging from plants to humans. The MIR164 family of miRNAs in Arabidopsis consists of three members that share sequence complementarity to transcripts of NAC family transcription factors, including CUP-SHAPED COTYLEDON1 (CUC1) and CUC2. CUC1 and CUC2 are redundantly required for the formation of boundaries between organ primordia. The analysis of transgenic plants that either overexpress miR164a or miR164b or express a miRNA-resistant version of CUC1 or CUC2 has shown that miRNA regulation of CUC1 and CUC2 is necessary for normal flower development. A loss-of-function allele of MIR164b did not result in a mutant phenotype, possibly because of functional redundancy among the three members of the MIR164 family. In this study, we describe the characterization of the early extra petals1 (eep1) Arabidopsis mutant, whose predominant phenotype is the formation of extra petals in early-arising flowers. We demonstrate that eep1 is a loss-of-function allele of MIR164c, one of three known members of the MIR164 family. Our analyses of miR164c function and eep1 mir164b double mutants reveal that miR164c controls petal number in a nonredundant manner by regulating the transcript accumulation of the transcription factors CUC1 and CUC2. The data presented in this study indicate that closely related miRNA family members that are predicted to target the same set of genes can have different functions during development, possibly because of nonoverlapping expression patterns.

  15. The extreme blazar AO 0235+164 as seen by extensive ground and space radio observations (United States)

    Kutkin, A. M.; Pashchenko, I. N.; Lisakov, M. M.; Voytsik, P. A.; Sokolovsky, K. V.; Kovalev, Y. Y.; Lobanov, A. P.; Ipatov, A. V.; Aller, M. F.; Aller, H. D.; Lahteenmaki, A.; Tornikoski, M.; Gurvits, L. I.


    Clues to the physical conditions in radio cores of blazars come from measurements of brightness temperatures as well as effects produced by intrinsic opacity. We study the properties of the ultra compact blazar AO 0235+164 with RadioAstron ground-space radio interferometer, multi-frequency VLBA, EVN and single-dish radio observations. We employ visibility modeling and image stacking for deriving structure and kinematics of the source, and use Gaussian process regression to find the relative multi-band time delays of the flares. The multi-frequency core size and time lags support prevailing synchrotron self absorption. The intrinsic brightness temperature of the core derived from ground-based VLBI is close to the equipartition regime value. In the same time, there is evidence for ultra-compact features of the size of less than 10 μas in the source, which might be responsible for the extreme apparent brightness temperatures of up to 1014 K as measured by RadioAstron. In 2007-2016 the VLBI components in the source at 43 GHz are found predominantly in two directions, suggesting a bend of the outflow from southern to northern direction. The apparent opening angle of the jet seen in the stacked image at 43 GHz is two times wider than that at 15 GHz, indicating a collimation of the flow within the central 1.5 mas. We estimate the Lorentz factor Γ = 14, the Doppler factor δ = 21, and the viewing angle θ = 1.7° of the apparent jet base, derive the gradients of magnetic field strength and electron density in the outflow, and the distance between jet apex and the core at each frequency.

  16. Selective Sensing of Fe(3+) and Al(3+) Ions and Detection of 2,4,6-Trinitrophenol by a Water-Stable Terbium-Based Metal-Organic Framework. (United States)

    Cao, Li-Hui; Shi, Fang; Zhang, Wen-Min; Zang, Shuang-Quan; Mak, Thomas C W


    A water-stable luminescent terbium-based metal-organic framework (MOF), {[Tb(L1 )1.5 (H2 O)]⋅3 H2 O}n (Tb-MOF), with rod-shaped secondary building units (SBUs) and honeycomb-type tubular channels has been synthesized and structurally characterized by single-crystal X-ray diffraction. The high green emission intensity and the microporous nature of the Tb-MOF indicate that it can potentially be used as a luminescent sensor. In this work, we show that Tb-MOF can selectively sense Fe(3+) and Al(3+) ions from mixed metal ions in water through different detection mechanisms. In addition, it also exhibits high sensitivity for 2,4,6-trinitrophenol (TNP) in the presence of other nitro aromatic compounds in aqueous solution by luminescence quenching experiments. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  17. Picomolar traces of americium(III) introduce drastic changes in the structural chemistry of terbium(III). A break in the ''gadolinium break''

    Energy Technology Data Exchange (ETDEWEB)

    Welch, Jan M. [TU Wien, Atominstitut, Vienna (Austria); Mueller, Danny; Knoll, Christian; Wilkovitsch, Martin; Weinberger, Peter [TU Wien, Institute of Applied Synthetic Chemistry, Vienna (Austria); Giester, Gerald [University of Vienna, Institute of Mineralogy and Crystallography, Vienna (Austria); Ofner, Johannes; Lendl, Bernhard [TU Wien, Institute of Chemical Technologies and Analytics, Vienna (Austria); Steinhauser, Georg [Leibniz Universitaet Hannover, Institute of Radioecology and Radiation Protection (Germany)


    The crystallization of terbium 5,5{sup '}-azobis[1H-tetrazol-1-ide] (ZT) in the presence of trace amounts (ca. 50 Bq, ca. 1.6 pmol) of americium results in 1) the accumulation of the americium tracer in the crystalline solid and 2) a material that adopts a different crystal structure to that formed in the absence of americium. Americium-doped [Tb(Am)(H{sub 2}O){sub 7}ZT]{sub 2} ZT.10 H{sub 2}O is isostructural to light lanthanide (Ce-Gd) 5,5{sup '}-azobis[1H-tetrazol-1-ide] compounds, rather than to the heavy lanthanide (Tb-Lu) 5,5{sup '}-azobis[1H-tetrazol-1-ide] (e.g., [Tb(H{sub 2}O){sub 8}]{sub 2}ZT{sub 3}.6 H{sub 2}O) derivatives. Traces of Am seem to force the Tb compound into a structure normally preferred by the lighter lanthanides, despite a 10{sup 8}-fold Tb excess. The americium-doped material was studied by single-crystal X-ray diffraction, vibrational spectroscopy, radiochemical neutron activation analysis, and scanning electron microscopy. In addition, the inclusion properties of terbium 5,5{sup '}-azobis[1H-tetrazol-1-ide] towards americium were quantified, and a model for the crystallization process is proposed. (copyright 2017 Wiley-VCH Verlag GmbH and Co. KGaA, Weinheim)

  18. A Novel Locus Harbouring a Functional CD164 Nonsense Mutation Identified in a Large Danish Family with Nonsyndromic Hearing Impairment

    DEFF Research Database (Denmark)

    Nyegaard, Mette; Rendtorff, Nanna D; Nielsen, Morten S


    -based linkage analysis and follow up microsatellite markers to identify a novel locus (DFNA66) on chromosome 6q15-21 (LOD 5.1) in a large Danish family with dominantly inherited NSHI. By locus specific capture and next-generation sequencing, we identified a c.574C>T heterozygous nonsense mutation (p.R192......*) in CD164. This gene encodes a 197 amino acid transmembrane sialomucin (known as endolyn, MUC-24 or CD164), which is widely expressed and involved in cell adhesion and migration. The mutation segregated with the phenotype and was absent in 1200 Danish control individuals and in databases with whole......-genome and exome sequence data. The predicted effect of the mutation was a truncation of the last six C-terminal residues of the cytoplasmic tail of CD164, including a highly conserved canonical sorting motif (YXX phi). In whole blood from an affected individual, we found by RT-PCR both the wild...


    DEFF Research Database (Denmark)

    Rasmussen, Søren; Vægter, Christian Bjerggaard; Cha, J

    In this study we have established methods for visualization and tracking of the dopamine transporter (DAT) in cultured dopaminergic neurons in real time using a fluorescent cocaine analogue JHC 1-64 and confocal fluorescence microscopy. The initial binding experiments in HEK 293 cells stably...... 1-64 was prevented by excess concentrations of dopamine, cocaine, mazindol, or RTI-55, whereas the norepinephrine and/or serotonin transporter specific inhibitors desmethylimipramine and citalopram did not affect fluorescent labeling of the neurons. This strongly supports that JHC 1-64 specifically...

  20. Internal corrosion of EK164 and CHS68 fuel pin cladding steels of uranium dioxide fast power reactor

    Directory of Open Access Journals (Sweden)

    E.A. Kinev


    Full Text Available Austenitic chromium-nickel steel EK-164 is the promising material for manufacturing claddings of fuel pins of fast nuclear reactors. Physical and chemical compatibility with typical nuclear fuel compositions on the basis of uranium dioxide pellets is an important aspect of ensuring fuel cladding operability. Post-irradiation examination of irradiated combined fuel assembly with maximum burnup 9.1% FIMA and damaging dose of 77.3dpa equipped with fuel pins with claddings made of CHS-68 and EK-164 steels in cold-worked state was performed. Gamma-scanning, electric potential resistometry and optical metallography methods were applied in the examination. According to the gamma-scanning and resistometry data high-temperature sections of fuel pins are the potential centers of development of fuel pin cladding corrosion. Comparative analysis of internal corrosion of fuel pin claddings made of EK-164 and CHS-68 steels along the reactor core height was performed. In the section with maximum power density at operational temperatures below 540°С depth of corrosion of CHS-68 steel from the side of fuel did not exceed 15µm. On similar sections of fuel pin cladding made of EK-164 steel depth of internal corrosion amounted to 10µm. Maximum of corrosion damage for both steel types was registered at temperatures in the range from 600°С to 650°С. In this case depth of corrosion damages in the form of intercrystalline and general corrosion did not exceed 20µm. No significant differences in the corrosion mechanism between the steels were found. Local exacerbation of corrosion at the junctions between fuel pellets and in places of concentration of cesium fission fragments was detected. And contrariwise in place of narrowing residual gap between fuel and cladding, where cesium is not present, corrosion of EK-164 steel is minimal. Maximum thinning of cladding of the investigated fuel pins with maximum burnup of 9% FIMA amounted to not more than 5% of the

  1. Sodium terbium(III polyphosphate

    Directory of Open Access Journals (Sweden)

    Abdelghani Oudahmane


    Full Text Available Single crystals of the title compound, NaTb(PO34, were obtained by solid-state reaction. This compound belongs to type II of long-chain polyphosphates with the general formula AIBIII(PO34. It is isotypic with the NaNd(PO34 and NaEr(PO34 homologues. The crystal structure is built up of infinite crenelated chains of corner-sharing PO4 tetrahedra with a repeating unit of four tetrahedra. These chains, extending parallel to [100], are linked by isolated TbO8 square antiprisms, forming a three-dimensional framework. The Na+ ions are located in channels running along [010] and are surrounded by six oxygen atoms in a distorted octahedral environment within a cut-off distance <2.9 Å.

  2. Long-lasting fibrin matrices ensure stable and functional angiogenesis by highly tunable, sustained delivery of recombinant VEGF164. (United States)

    Sacchi, Veronica; Mittermayr, Rainer; Hartinger, Joachim; Martino, Mikaël M; Lorentz, Kristen M; Wolbank, Susanne; Hofmann, Anna; Largo, Remo A; Marschall, Jeffrey S; Groppa, Elena; Gianni-Barrera, Roberto; Ehrbar, Martin; Hubbell, Jeffrey A; Redl, Heinz; Banfi, Andrea


    Clinical trials of therapeutic angiogenesis by vascular endothelial growth factor (VEGF) gene delivery failed to show efficacy. Major challenges include the need to precisely control in vivo distribution of growth factor dose and duration of expression. Recombinant VEGF protein delivery could overcome these issues, but rapid in vivo clearance prevents the stabilization of induced angiogenesis. Here, we developed an optimized fibrin platform for controlled delivery of recombinant VEGF, to robustly induce normal, stable, and functional angiogenesis. Murine VEGF164 was fused to a sequence derived from α2-plasmin inhibitor (α2-PI1-8) that is a substrate for the coagulation factor fXIIIa, to allow its covalent cross-linking into fibrin hydrogels and release only by enzymatic cleavage. An α2-PI1-8-fused variant of the fibrinolysis inhibitor aprotinin was used to control the hydrogel degradation rate, which determines both the duration and effective dose of factor release. An optimized aprotinin-α2-PI1-8 concentration ensured ideal degradation over 4 wk. Under these conditions, fibrin-α2-PI1-8-VEGF164 allowed exquisitely dose-dependent angiogenesis: concentrations ≥25 μg/mL caused widespread aberrant vascular structures, but a 500-fold concentration range (0.01-5.0 μg/mL) induced exclusively normal, mature, nonleaky, and perfused capillaries, which were stable after 3 mo. Optimized delivery of fibrin-α2-PI1-8-VEGF164 was therapeutically effective both in ischemic hind limb and wound-healing models, significantly improving angiogenesis, tissue perfusion, and healing rate. In conclusion, this optimized platform ensured (i) controlled and highly tunable delivery of VEGF protein in ischemic tissue and (ii) stable and functional angiogenesis without introducing genetic material and with a limited and controllable duration of treatment. These findings suggest a strategy to improve safety and efficacy of therapeutic angiogenesis.

  3. Multi-center experience of 164 consecutive Hemodialysis Reliable Outflow [HeRO] graft implants for hemodialysis treatment. (United States)

    Gage, S M; Katzman, H E; Ross, J R; Hohmann, S E; Sharpe, C A; Butterly, D W; Lawson, J H


    To report a multi-center experience with the novel Hemodialysis Reliable Outflow (HeRO) vascular access graft. Four centers conducted a retrospective review of end stage renal disease patients who received the HeRO device from implant to last available follow-up. Data is available on 164 patients with an accumulated 2092.1 HeRO implant months. At 6 months, HeRO primary and secondary patency is 60% and 90.8%, respectively and at 12 months, 48.8% and 90.8%, respectively. At 24 months, HeRO had a primary patency of 42.9% and secondary patency was 86.7%. Interventions to maintain or re-establish patency have been required in 71.3% of patients (117/164) resulting in an intervention rate of 1.5/year. Access related infections have been reported in 4.3% patients resulting in a rate of 0.14/1000 implant days. In our experience the HeRO device has performed comparably to standard AVGs and has proven superior to TDCs in terms of patency, intervention, and infection rates when compared to the peer-reviewed literature. As an alternative to catheter dependence as a means for hemodialysis access, this graft could reduce the morbidity and mortality associated with TDCs and have a profound impact on the costs associated with catheter related infections and interventions. Copyright © 2012 European Society for Vascular Surgery. Published by Elsevier Ltd. All rights reserved.

  4. The 164-d period in SS433 as precessional motion - The massive black hole and pulsar models

    Energy Technology Data Exchange (ETDEWEB)

    Shaham, J.


    The geometries predicted by black hole ring and neutron star precession models for SS 433 are examined in relation to the recently observed 164-d periodicity in wavelength shifts from this object. In the first model, a Keplerian ring of matter exists surrounding a black hole of approximately 1,000,000 solar masses and radiates predominantly from its nodes, which are the ring sections closest to the black hole accretion disk and precess around the rotation axis of the hole with a period of approximately 160 days due to the Lense-Thirring effect. The free precession of a rapidly rotating neutron star emitting a double jet of matter can also bring about the observed wavelength variation. It should be possible to decide between the models by determining the change with time of the precession period, as the massive black hole model predicts its decrease and the rapidly rotating pulsar model predicts its increase.

  5. 40 CFR 164.21 - Contents of a denial of registration, notice of intent to cancel a registration, or notice of... (United States)


    ... classification. (a) Contents. The denial of registration or a notice of intent to cancel a registration or to... 40 Protection of Environment 23 2010-07-01 2010-07-01 false Contents of a denial of registration, notice of intent to cancel a registration, or notice of intent to change a classification. 164.21 Section...

  6. 164Ile allele in the beta2-Adrenergic receptor gene is associated with risk of elevated blood pressure in women. The Copenhagen City Heart Study

    DEFF Research Database (Denmark)

    Sethi, Amar A; Tybjaerg-Hansen, Anne; Jensen, Gorm B


    Since beta2-adrenergic receptors are important regulators of blood pressure, genetic variation in this receptor could explain risk of elevated blood pressure in selected individuals. We tested the hypothesis that Gly16Arg, Gln27Glu, and Thr164Ile in the beta2-adrenergic receptor gene associated...... with elevated blood pressure....

  7. A whole-genome scan in 164 Dutch sib pairs with attention-deficit/hyperactivity disorder : Suggestive evidence for linkage on chromosomes 7p and 15q

    NARCIS (Netherlands)

    Bakker, SC; van der Meulen, EM; Buitelaar, JK; Sandkuijl, LA; Pauls, DL; Monsuur, AJ; van't Slot, R; Minderaa, RB; Gunning, WB; Pearson, PL; Sinke, RJ

    A genome scan was performed on 164 Dutch affected sib pairs (ASPs) with attention-deficit/hyperactivity disorder (ADHD). All subjects were white and of Dutch descent and were phenotyped according to criteria set out in the Diagnostic and Statistical Manual Of Mental Disorders, 4th edition.

  8. A whole-genome scan in 164 Dutch sib pairs with attention-deficit/hyperactivity disorder: suggestive evidence for linkage on chromosomes 7p and 15q.

    NARCIS (Netherlands)

    Bakker, S.C.; Meulen, E.M. van der; Sandkuijl, L.A.; Pauls, D.L.; Monsuur, A.J.; Slot, R. van 't; Minderaa, R.B.; Gunning, W.B.; Pearson, P.L.; Sinke, R.J.


    A genome scan was performed on 164 Dutch affected sib pairs (ASPs) with attention-deficit/hyperactivity disorder (ADHD). All subjects were white and of Dutch descent and were phenotyped according to criteria set out in the Diagnostic and Statistical Manual Of Mental Disorders, 4th edition.

  9. Blood loss in orthotopic liver transplantation : a retrospective analysis of transfusion requirements and the effects of autotransfusion of cell saver blood in 164 consecutive patients

    NARCIS (Netherlands)

    Hendriks, HGD; van der Meer, J; Klompmaker, IJ; Choudhury, N; Hagenaars, JAM; Porte, RJ; de Kam, PJ; Sloof, MJH; de Wolf, JTM

    Liver transplantation is associated with excessive blood loss. In order to identify factors influencing blood loss and to provide a basis for a pilot study to evaluate recombinant activated factor VII as a haemostatic agent, a retrospective study was performed in 164 consecutive patients with

  10. In vivo high angular resolution diffusion-weighted imaging of mouse brain at 16.4 Tesla.

    Directory of Open Access Journals (Sweden)

    Othman I Alomair

    Full Text Available Magnetic Resonance Imaging (MRI of the rodent brain at ultra-high magnetic fields (> 9.4 Tesla offers a higher signal-to-noise ratio that can be exploited to reduce image acquisition time or provide higher spatial resolution. However, significant challenges are presented due to a combination of longer T1 and shorter T2/T2* relaxation times and increased sensitivity to magnetic susceptibility resulting in severe local-field inhomogeneity artefacts from air pockets and bone/brain interfaces. The Stejskal-Tanner spin echo diffusion-weighted imaging (DWI sequence is often used in high-field rodent brain MRI due to its immunity to these artefacts. To accurately determine diffusion-tensor or fibre-orientation distribution, high angular resolution diffusion imaging (HARDI with strong diffusion weighting (b >3000 s/mm2 and at least 30 diffusion-encoding directions are required. However, this results in long image acquisition times unsuitable for live animal imaging. In this study, we describe the optimization of HARDI acquisition parameters at 16.4T using a Stejskal-Tanner sequence with echo-planar imaging (EPI readout. EPI segmentation and partial Fourier encoding acceleration were applied to reduce the echo time (TE, thereby minimizing signal decay and distortion artefacts while maintaining a reasonably short acquisition time. The final HARDI acquisition protocol was achieved with the following parameters: 4 shot EPI, b = 3000 s/mm2, 64 diffusion-encoding directions, 125×150 μm2 in-plane resolution, 0.6 mm slice thickness, and 2h acquisition time. This protocol was used to image a cohort of adult C57BL/6 male mice, whereby the quality of the acquired data was assessed and diffusion tensor imaging (DTI derived parameters were measured. High-quality images with high spatial and angular resolution, low distortion and low variability in DTI-derived parameters were obtained, indicating that EPI-DWI is feasible at 16.4T to study animal models of white

  11. In vivo high angular resolution diffusion-weighted imaging of mouse brain at 16.4 Tesla. (United States)

    Alomair, Othman I; Brereton, Ian M; Smith, Maree T; Galloway, Graham J; Kurniawan, Nyoman D


    Magnetic Resonance Imaging (MRI) of the rodent brain at ultra-high magnetic fields (> 9.4 Tesla) offers a higher signal-to-noise ratio that can be exploited to reduce image acquisition time or provide higher spatial resolution. However, significant challenges are presented due to a combination of longer T1 and shorter T2/T2* relaxation times and increased sensitivity to magnetic susceptibility resulting in severe local-field inhomogeneity artefacts from air pockets and bone/brain interfaces. The Stejskal-Tanner spin echo diffusion-weighted imaging (DWI) sequence is often used in high-field rodent brain MRI due to its immunity to these artefacts. To accurately determine diffusion-tensor or fibre-orientation distribution, high angular resolution diffusion imaging (HARDI) with strong diffusion weighting (b >3000 s/mm2) and at least 30 diffusion-encoding directions are required. However, this results in long image acquisition times unsuitable for live animal imaging. In this study, we describe the optimization of HARDI acquisition parameters at 16.4T using a Stejskal-Tanner sequence with echo-planar imaging (EPI) readout. EPI segmentation and partial Fourier encoding acceleration were applied to reduce the echo time (TE), thereby minimizing signal decay and distortion artefacts while maintaining a reasonably short acquisition time. The final HARDI acquisition protocol was achieved with the following parameters: 4 shot EPI, b = 3000 s/mm2, 64 diffusion-encoding directions, 125×150 μm2 in-plane resolution, 0.6 mm slice thickness, and 2h acquisition time. This protocol was used to image a cohort of adult C57BL/6 male mice, whereby the quality of the acquired data was assessed and diffusion tensor imaging (DTI) derived parameters were measured. High-quality images with high spatial and angular resolution, low distortion and low variability in DTI-derived parameters were obtained, indicating that EPI-DWI is feasible at 16.4T to study animal models of white matter (WM

  12. A europium- and terbium-coated magnetic nanocomposite as sorbent in dispersive solid phase extraction coupled with ultra-high performance liquid chromatography for antibiotic determination in meat samples. (United States)

    Castillo-García, M L; Aguilar-Caballos, M P; Gómez-Hens, A


    A new magnetic dispersive solid-phase extraction approach based on Eu- and Tb-coated magnetic nanocomposites, combined with ultra-high performance liquid chromatography with fluorometric detection, is reported for the extraction and simultaneous determination of veterinary antibiotics. The method is aimed at monitoring of potential residues of three tetracyclines, namely oxytetracycline, tetracycline, chlortetracycline and three acidic quinolones, such as oxolinic acid, nalidixic acid and flumequine, chosen as model analytes, in animal muscle samples. The nanocomposites were obtained by synthesizing magnetic nanoparticles by a co-precipitation method and their coating with terbium and europium ions. The limits of detection obtained using standard solutions were: 1.0, 1.5, 3.8, 0.25, 0.7 and 1.2ngmL(-1), which corresponds to 3.3, 5.0, 12.7, 0.8, 2.3 and 4.0μgkg(-1) for oxytetracycline, tetracycline, chlortetracycline, oxolinic acid, nalidixic acid and flumequine, respectively, in meat samples. The precision values, obtained in the presence of the sample matrix, were in the ranges 0.12-2.0% and 2.6-15.4% for retention times and areas, respectively. The selectivity of the method was checked by assaying different veterinary drugs, finding that most of them did not interfere at the same concentration levels as that of analytes. A recovery study was performed in the presence of chicken and pork muscle samples, which provided values in the range of 61.5-102.6%. Copyright © 2015 Elsevier B.V. All rights reserved.


    Energy Technology Data Exchange (ETDEWEB)

    Ackermann, M. [Deutsches Elektronen Synchrotron DESY, D-15738 Zeuthen (Germany); Ajello, M.; Blandford, R. D.; Bloom, E. D.; Borgland, A. W.; Bottacini, E.; Buehler, R.; Cameron, R. A. [W. W. Hansen Experimental Physics Laboratory, Kavli Institute for Particle Astrophysics and Cosmology, Department of Physics and SLAC National Accelerator Laboratory, Stanford University, Stanford, CA 94305 (United States); Ballet, J.; Casandjian, J. M. [Laboratoire AIM, CEA-IRFU/CNRS/Universite Paris Diderot, Service d' Astrophysique, CEA Saclay, 91191 Gif sur Yvette (France); Barbiellini, G. [Istituto Nazionale di Fisica Nucleare, Sezione di Trieste, I-34127 Trieste (Italy); Bastieri, D.; Buson, S. [Istituto Nazionale di Fisica Nucleare, Sezione di Padova, I-35131 Padova (Italy); Bellazzini, R.; Bregeon, J. [Istituto Nazionale di Fisica Nucleare, Sezione di Pisa, I-56127 Pisa (Italy); Bonamente, E. [Istituto Nazionale di Fisica Nucleare, Sezione di Perugia, I-06123 Perugia (Italy); Brigida, M. [Dipartimento di Fisica ' M. Merlin' dell' Universita e del Politecnico di Bari, I-70126 Bari (Italy); Bruel, P. [Laboratoire Leprince-Ringuet, Ecole polytechnique, CNRS/IN2P3, Palaiseau (France); Caliandro, G. A. [Institut de Ciencies de l' Espai (IEEE-CSIC), Campus UAB, 08193 Barcelona (Spain); Caraveo, P. A., E-mail:, E-mail:, E-mail:, E-mail:, E-mail:, E-mail:, E-mail: [INAF-Istituto di Astrofisica Spaziale e Fisica Cosmica, I-20133 Milano (Italy); Collaboration: Fermi-LAT Collaboration; GASP-WEBT consortium; F-GAMMA; Iram-PdBI; Kanata; RXTE; SMARTS; Swift-XRT; and others


    The blazar AO 0235+164 (z = 0.94) has been one of the most active objects observed by Fermi Large Area Telescope (LAT) since its launch in Summer 2008. In addition to the continuous coverage by Fermi, contemporaneous observations were carried out from the radio to {gamma}-ray bands between 2008 September and 2009 February. In this paper, we summarize the rich multi-wavelength data collected during the campaign (including F-GAMMA, GASP-WEBT, Kanata, OVRO, RXTE, SMARTS, Swift, and other instruments), examine the cross-correlation between the light curves measured in the different energy bands, and interpret the resulting spectral energy distributions in the context of well-known blazar emission models. We find that the {gamma}-ray activity is well correlated with a series of near-IR/optical flares, accompanied by an increase in the optical polarization degree. On the other hand, the X-ray light curve shows a distinct 20 day high state of unusually soft spectrum, which does not match the extrapolation of the optical/UV synchrotron spectrum. We tentatively interpret this feature as the bulk Compton emission by cold electrons contained in the jet, which requires an accretion disk corona with an effective covering factor of 19% at a distance of 100 R{sub g}. We model the broadband spectra with a leptonic model with external radiation dominated by the infrared emission from the dusty torus.

  14. Jets and Outflows from Young Stellar Objects in the Carina Nebula Observed in [Fe II] 1.64 um (United States)

    Shinn, Jong-Ho; Pyo, Tae-Soo; Lee, Jae-Joon; Lee, Ho-Gyu; Kim, Hyun-Jeong; Koo, Bon-Chul; Sung, Hwankyung; Chun, Moo Young; Lyo, A.-Ran; Moon, Dae-Sik; Kyeong, Jaemann; Park, Byeong-Gon; Hur, Hyeonoh; Lee, Yong-Hyun


    We present [Fe II] 1.64 um imaging observations for jets and outflows from young stellar objects (YSOs) over the northern part (~24'x45') of the Carina Nebula, a massive star forming region. The observations were performed with IRIS2 of Anglo-Autralian Telescope and the seeing was ~1.5". Several jets and outflows features are detected at eight different regions, and named as forbidden emission line regions (FELRs). One new candidate for Herbig-Haro Object is identified comparing our [Fe II] images to H_alpha images of Hubble Space Telescope. FELRs have knotty or longish shapes, and distribute around the triangular area formed by three star clusters Tr 14, Tr 15, and Tr 16, which contain many massive stars. The detection rate of FELRs against previously identified YSOs is 1.4 %. We estimate the outflow rate from the [Fe II] flux based on some assumptions. The jet-driving objects are identified for three FELRs (FELR-2, -4, and -7), for which we study the relations between the outflow rate and the YSO physical parameters from the radiative transfer model fitting. The ratios of the outflow rate over the disk accretion rate are consistent for FELR-4 and -7 with the previously reported values, while it is higher for FELR-2. The masses of jet-driving objects are low or intermediate, and they are not likely to become massive stars (> 8 Ms). Other YSO physical parameters, such as luminosity and age, show reasonable relations or trends.

  15. Impaired angiogenesis and endochondral bone formation in mice lacking the vascular endothelial growth factor isoforms VEGF164 and VEGF188. (United States)

    Maes, Christa; Carmeliet, Peter; Moermans, Karen; Stockmans, Ingrid; Smets, Nico; Collen, Désiré; Bouillon, Roger; Carmeliet, Geert


    Vascular endothelial growth factor (VEGF)-mediated angiogenesis is an important part of bone formation. To clarify the role of VEGF isoforms in endochondral bone formation, we examined long bone development in mice expressing exclusively the VEGF120 isoform (VEGF120/120 mice). Neonatal VEGF120/120 long bones showed a completely disturbed vascular pattern, concomitant with a 35% decrease in trabecular bone volume, reduced bone growth and a 34% enlargement of the hypertrophic chondrocyte zone of the growth plate. Surprisingly, embryonic hindlimbs at a stage preceding capillary invasion exhibited a delay in bone collar formation and hypertrophic cartilage calcification. Expression levels of marker genes of osteoblast and hypertrophic chondrocyte differentiation were significantly decreased in VEGF120/120 bones. Furthermore, inhibition of all VEGF isoforms in cultures of embryonic cartilaginous metatarsals, through the administration of a soluble receptor chimeric protein (mFlt-1/Fc), retarded the onset and progression of ossification, suggesting that osteoblast and/or hypertrophic chondrocyte development were impaired. The initial invasion by osteoclasts and endothelial cells into VEGF120/120 bones was retarded, associated with decreased expression of matrix metalloproteinase-9. Our findings indicate that expression of VEGF164 and/or VEGF188 is important for normal endochondral bone development, not only to mediate bone vascularization but also to allow normal differentiation of hypertrophic chondrocytes, osteoblasts, endothelial cells and osteoclasts.

  16. Multi-wavelength Observations of Blazar AO 0235+164 in the 2008-2009 Flaring State (United States)

    Ackermann, M.; Ajello, M.; Ballet, J.; Barbiellini, G.; Bastieri, D.; Bellazzini, R.; Blandford, R. D.; Bloom, E. D.; Bonamente, E.; Borgland, A. W.; Bottacini, E.; Bregeon, J.; Brigida, M.; Bruel, P.; Buehler, R.; Buson, S.; Caliandro, G. A.; Cameron, R. A.; Caraveo, P. A.; Casandjian, J. M.; Cavazzuti, E.; Cecchi, C.; Charles, E.; Chekhtman, A.; Chiang, J.; Ciprini, S.; Claus, R.; Cohen-Tanugi, J.; Cutini, S.; D'Ammando, F.; de Palma, F.; Dermer, C. D.; Silva, E. do Couto e.; Drell, P. S.; Drlica-Wagner, A.; Dubois, R.; Favuzzi, C.; Fegan, S. J.; Ferrara, E. C.; Focke, W. B.; Fortin, P.; Fuhrmann, L.; Fukazawa, Y.; Fusco, P.; Gargano, F.; Gasparrini, D.; Gehrels, N.; Germani, S.; Giglietto, N.; Giommi, P.; Giordano, F.; Giroletti, M.; Glanzman, T.; Godfrey, G.; Grenier, I. A.; Guiriec, S.; Hadasch, D.; Hayashida, M.; Hughes, R. E.; Itoh, R.; Jóhannesson, G.; Johnson, A. S.; Katagiri, H.; Kataoka, J.; Knödlseder, J.; Kuss, M.; Lande, J.; Larsson, S.; Lee, S.-H.; Longo, F.; Loparco, F.; Lott, B.; Lovellette, M. N.; Lubrano, P.; Madejski, G. M.; Mazziotta, M. N.; McEnery, J. E.; Mehault, J.; Michelson, P. F.; Mitthumsiri, W.; Mizuno, T.; Monte, C.; Monzani, M. E.; Morselli, A.; Moskalenko, I. V.; Murgia, S.; Naumann-Godo, M.; Nishino, S.; Norris, J. P.; Nuss, E.; Ohsugi, T.; Okumura, A.; Omodei, N.; Orlando, E.; Ozaki, M.; Paneque, D.; Panetta, J. H.; Pelassa, V.; Pesce-Rollins, M.; Pierbattista, M.; Piron, F.; Pivato, G.; Porter, T. A.; Rainò, S.; Rando, R.; Rastawicki, D.; Razzano, M.; Readhead, A.; Reimer, A.; Reimer, O.; Reyes, L. C.; Richards, J. L.; Sbarra, C.; Sgrò, C.; Siskind, E. J.; Spandre, G.; Spinelli, P.; Szostek, A.; Takahashi, H.; Tanaka, T.; Thayer, J. G.; Thayer, J. B.; Thompson, D. J.; Tinivella, M.; Torres, D. F.; Tosti, G.; Troja, E.; Usher, T. L.; Vandenbroucke, J.; Vasileiou, V.; Vianello, G.; Vitale, V.; Waite, A. P.; Winer, B. L.; Wood, K. S.; Yang, Z.; Zimmer, S.; Fermi-LAT Collaboration; Moderski, R.; Nalewajko, K.; Sikora, M.; Villata, M.; Raiteri, C. M.; Aller, H. D.; Aller, M. F.; Arkharov, A. A.; Benítez, E.; Berdyugin, A.; Blinov, D. A.; Boettcher, M.; Bravo Calle, O. J. A.; Buemi, C. S.; Carosati, D.; Chen, W. P.; Diltz, C.; Di Paola, A.; Dolci, M.; Efimova, N. V.; Forné, E.; Gurwell, M. A.; Heidt, J.; Hiriart, D.; Jordan, B.; Kimeridze, G.; Konstantinova, T. S.; Kopatskaya, E. N.; Koptelova, E.; Kurtanidze, O. M.; Lähteenmäki, A.; Larionova, E. G.; Larionova, L. V.; Larionov, V. M.; Leto, P.; Lindfors, E.; Lin, H. C.; Morozova, D. A.; Nikolashvili, M. G.; Nilsson, K.; Oksman, M.; Roustazadeh, P.; Sievers, A.; Sigua, L. A.; Sillanpää, A.; Takahashi, T.; Takalo, L. O.; Tornikoski, M.; Trigilio, C.; Troitsky, I. S.; Umana, G.; GASP-WEBT Consortium; Angelakis, E.; Krichbaum, T. P.; Nestoras, I.; Riquelme, D.; F-GAMMA; Krips, M.; Trippe, S.; Iram-PdBI; Arai, A.; Kawabata, K. S.; Sakimoto, K.; Sasada, M.; Sato, S.; Uemura, M.; Yamanaka, M.; Yoshida, M.; Kanata; Belloni, T.; Tagliaferri, G.; RXTE; Bonning, E. W.; Isler, J.; Urry, C. M.; SMARTS; Hoversten, E.; Falcone, A.; Pagani, C.; Stroh, M.; (Swift-XRT


    The blazar AO 0235+164 (z = 0.94) has been one of the most active objects observed by Fermi Large Area Telescope (LAT) since its launch in Summer 2008. In addition to the continuous coverage by Fermi, contemporaneous observations were carried out from the radio to γ-ray bands between 2008 September and 2009 February. In this paper, we summarize the rich multi-wavelength data collected during the campaign (including F-GAMMA, GASP-WEBT, Kanata, OVRO, RXTE, SMARTS, Swift, and other instruments), examine the cross-correlation between the light curves measured in the different energy bands, and interpret the resulting spectral energy distributions in the context of well-known blazar emission models. We find that the γ-ray activity is well correlated with a series of near-IR/optical flares, accompanied by an increase in the optical polarization degree. On the other hand, the X-ray light curve shows a distinct 20 day high state of unusually soft spectrum, which does not match the extrapolation of the optical/UV synchrotron spectrum. We tentatively interpret this feature as the bulk Compton emission by cold electrons contained in the jet, which requires an accretion disk corona with an effective covering factor of 19% at a distance of 100 R g. We model the broadband spectra with a leptonic model with external radiation dominated by the infrared emission from the dusty torus.

  17. 164 -168_Zhigila

    African Journals Online (AJOL)



    Dec 2, 2014 ... PALYNOMORPHS AND FLORAL BLOOM AS TAXONOMIC CHARACTERS IN. SOME SPECIES OF THE GENUS ... microscope to examine their morphology and pollen characteristics in relation to taxonomy. These species include ... as part of the taxonomic revision at species level on a worldwide basis ...


    African Journals Online (AJOL)


    The cost of all non-collected or delivered reports was N1, 442,560 or 29.3% of the cost of the total requests ... Donc il est nécessaire d'instituer et de mettre en œuvre un system de gestion de laboratoire de bonne qualité et .... than the 13 % recorded in a similar study in Pakistan.8 This constitutes a huge economic loss to the ...

  19. New K isomers in the neutron-rich N =100 isotones 162Sm, 163Eu, and 164Gd (United States)

    Yokoyama, R.; Go, S.; Kameda, D.; Kubo, T.; Inabe, N.; Fukuda, N.; Takeda, H.; Suzuki, H.; Yoshida, K.; Kusaka, K.; Tanaka, K.; Yanagisawa, Y.; Ohtake, M.; Sato, H.; Shimizu, Y.; Baba, H.; Kurokawa, M.; Nishimura, D.; Ohnishi, T.; Iwasa, N.; Chiba, A.; Yamada, T.; Ideguchi, E.; Fujii, T.; Nishibata, H.; Ieki, K.; Murai, D.; Momota, S.; Sato, Y.; Hwang, J. W.; Kim, S.; Tarasov, O. B.; Morrissey, D. J.; Sherrill, B. M.; Simpson, G.; Praharaj, C. R.


    Very neutron-rich Z ˜60 isotopes produced by in-flight fission of a 345 MeV/nucleon 238U beam at the RI Beam Factory, RIKEN Nishina Center, have been studied by delayed γ -ray spectroscopy. New isomers were discovered in the neutron-rich N =100 isotones 162Sm, 163Eu, and 164Gd. Half-lives, γ -ray energies, and relative intensities of these isomers were obtained. Level schemes were proposed for these nuclei and the first 2+ and 4+ states were assigned for the even-even nuclei. The first 2+ and 4+ state energies decrease as the proton numbers get smaller. The energies and the half-lives of the new isomers are very similar to those of 4- isomers known in less neutron-rich N =100 isotones 168Er and 170Yb. A deformed Hartree-Fock with angular momentum projection model suggests Kπ=4- two-quasiparticle states with ν 7 /2 [633 ]⊗ν 1 /2 [521 ] configurations with similar excitation energy. The results suggest that neutron-rich N =100 nuclei are well deformed and the deformation gets larger as Z decreases to 62. The onset of K isomers with the same configuration at almost the same energy in N =100 isotones indicates that the neutron single-particle structures of neutron-rich isotones down to Z =62 do not change significantly from those of the Z =70 stable nuclei. Systematics of the excitation energies of new isomers can be explained without the predicted N =100 shell gap.

  20. Fatty acid 16:4(n-3) stimulates a GPR120-induced signaling cascade in splenic macrophages to promote chemotherapy resistance

    DEFF Research Database (Denmark)

    Houthuijzen, Julia M; Oosterom, Ilse; Hudson, Brian D


    Although chemotherapy is designed to eradicate tumor cells, it also has significant effects on normal tissues. The platinum-induced fatty acid 16:4(n-3) (hexadeca-4,7,10,13-tetraenoic acid) induces systemic resistance to a broad range of DNA-damaging chemotherapeutics. We show that 16:4(n-3) exerts...... its effect by activating splenic F4/80(+)/CD11b(low) macrophages, which results in production of chemoprotective lysophosphatidylcholines (LPCs). Pharmacologic studies, together with analysis of expression patterns, identified GPR120 on F4/80(+)/CD11b(low) macrophages as the relevant receptor for 16...... identify a novel and unexpected function for GPR120 and suggest that antagonists of this receptor might be effective agents to limit development of chemotherapy resistance.-Houthuijzen, J. M., Oosterom, I., Hudson, B. D., Hirasawa, A., Daenen, L. G. M., McLean, C. M., Hansen, S. V. F., van Jaarsveld, M. T...

  1. Study of the blazar AO 0235+164 during the multi-wavelength observation period from October 2008 to February 2009

    Energy Technology Data Exchange (ETDEWEB)

    Rainò, S. [INFN – Sezione di Bari (Italy); Madejski, G.; Couto e Silva, E. do [W.W. Hansen Experimental Physics Laboratory, Kavli Institute for Particle Astrophysics and Cosmology, Department of Physics and SLAC National Accelerator Laboratory, Stanford University, Stanford, CA 94305 (United States); Gargano, F. [INFN – Sezione di Bari (Italy); Reyes, L. [Department of Physics, California Polytechnic State University, San Luis Obispo, CA 93401 (United States); Nalewajko, K. [Nicolaus Copernicus Astronomical Center, 00-716 Warsaw (Poland); University of Colorado, 440 UCB, Boulder, CO 80309 (United States); Sikora, M. [Nicolaus Copernicus Astronomical Center, 00-716 Warsaw (Poland)


    AO 0235+164 is one of the most studied and monitored BL Lac objects in the sky. Since the launch of Fermi, the source has been monitored in the gamma-ray band by Fermi Large Area Telescope. Starting in October 2008, AO 0235+164 showed an increasing activity in gamma-rays that led to a multi-wavelength campaign with instruments in the radio, near-infrared, optical, UV and X-ray bands. We present here the results of the analysis of the multi-wavelength data collected during the flaring period: the high variability properties of this source and the SED built from radio frequencies to gamma-rays are shown, and are interpreted in the context of well-known blazar emission models [Ackermann, M. et al. 2012, ApJ 751, 159].

  2. Overexpression of OsmiR164b-resistant OsNAC2 improves plant architecture and grain yield in rice. (United States)

    Jiang, Dagang; Chen, Weiting; Dong, Jingfang; Li, Jing; Yang, Fen; Wu, Zhichao; Zhou, Hai; Wang, Wensheng; Zhuang, Chuxiong


    Plant architecture is a major target of rice (Oryza sativa) breeding and selection, but the underlying regulatory networks remain unclear. Here, we overexpressed a OsNAC2 mutant (OErN) that cannot be cleaved by the microRNA miR164b. OErN plants had better plant architecture, longer panicles, and produced more grains. The parental line averaged 12.2 primary and 31.5 secondary branches in the main panicles; two OErN lines averaged 15.0 and 15.2 primary, and 41.5 and 44.3 secondary branches. In large-scale field trials, OErN plants produced at least 58.62% more total grain (by weight) compared with the parental line. They also had more large and small vascular bundles in the stem internodes and leaves. Overexpression of miR164b or down-regulation of OsNAC2 led to decreased panicle length and grain yield in the main panicle. The OErN plants showed significant up-regulation of the grain number and plant architecture related genes IPA1 and DEP1. A survey of more than 3,000 rice varieties found no natural mutations in the miR164b binding site of OsNAC2. OErN increased yield in Nipponbare and the commonly grown Yangyujing 3 cultivars. In summary, we identified an efficient new strategy to substantially increase rice yield and improve plant architecture through over-expression of OsmiR164b-resistant OsNAC2. © The Author(s) 2018. Published by Oxford University Press on behalf of the Society for Experimental Biology.

  3. Smac mimetic SM-164 potentiates APO2L/TRAIL- and doxorubicin-mediated anticancer activity in human hepatocellular carcinoma cells.

    Directory of Open Access Journals (Sweden)

    Shuijun Zhang

    Full Text Available BACKGROUND: The members of inhibitor of apoptosis proteins (IAPs family are key negative regulators of apoptosis. Overexpression of IAPs are found in hepatocellular carcinoma (HCC, and can contribute to chemotherapy resistance and recurrence of HCC. Small-molecule Second mitochondria-derived activator of caspases (Smac mimetics have recently emerged as novel anticancer drugs through targeting IAPs. The specific aims of this study were to 1 examine the anticancer activity of Smac mimetics as a single agent and in combination with chemotherapy in HCC cells, and 2 investigate the mechanism of anticancer action of Smac mimetics. METHODS: Four HCC cell lines, including SMMC-7721, BEL-7402, HepG2 and Hep3B, and 12 primary HCC cells were used in this study. Smac mimetic SM-164 was used to treat HCC cells. Cell viability, cell death induction and clonal formation assays were used to evaluate the anticancer activity. Western blotting analysis and a pancaspase inhibitor were used to investigate the mechanisms. RESULTS: Although SM-164 induced complete cIAP-1 degradation, it displayed weak inhibitory effects on the viability of HCC cells. Nevertheless, SM-164 considerably potentiated Apo2 ligand or TNF-related apoptosis-inducing ligand (APO2L/TRAIL- and Doxorubicin-mediated anticancer activity in HCC cells. Mechanistic studies demonstrated that SM-164 in combination with chemotherapeutic agents resulted in enhanced activation of caspases-9, -3 and cleavage of poly ADP-ribose polymerase (PARP, and also led to decreased AKT activation. CONCLUSIONS: Smac mimetics can enhance chemotherapeutic-mediated anticancer activity by enhancing apoptosis signaling and suppressing survival signaling in HCC cells. This study suggests Smac mimetics are potential therapeutic agents for HCC.


    Directory of Open Access Journals (Sweden)

    Sergiu BRÎNZA


    Full Text Available Analiza efectuată în cadrul acestui articol are ca obiect caracteristicile juridico-penale ale infracţiunilor specificate la art.164 şi 166 CP RM. Se argumentează că, în cazul infracţiunii specificate la art.164 CP RM, constrângerea fizică se poate concretiza în: 1 vătămarea intenţionată gravă, medie sau uşoară a integrităţii corporale ori a sănătăţii; 2 violenţa care nu implică un prejudiciu cauzat sănătăţii. În continuare, se arată că oricare din tipurile de arme menţionate în Legea privind regimul armelor şi al muniţiilor cu destinaţie civilă pot fi aplicate ca mijloace de săvârşire a infracţiunii prevă-zute la lit.g alin.(2 art.164 CP RM. Or, legiuitorul nu a stabilit nicio limitare a tipurilor de arme ce pot fi aplicate la răpirea unei persoane. Contează doar ca armele să fie utilizabile în vederea anihilării unei persoane. Nu în ultimul rând, în legătură cu infracţiunile prevăzute la art.166 CP RM, se relevă că, în condiţiile Republicii Moldova, care se confruntă cu fenomenul separatismului, restrângerea libertăţii persoanei are un caracter ilegal şi atunci când este exercitată de autorităţile neconstituţionale care controlează partea de est a ţării.THE OFFENCES REFERRED TO AT ART.164. AND 166 PC RM: THEORETICAL AND PRACTICAL ASPECTS The analysis performed in this article covers the legal-penal characteristics of the offences specified in art.164 and 166 PC RM. It is argued that, with regard to the offence specified in art.164 PC RM, the physical constraint may result in: 1 intentional grave, ordinary or easy battery or health harm; 2 violence without any health harm. Further, it is shown that any of the types of weapons mentioned in Law on weapons and ammunition destined for civil usage can be applied as means of committing the offence referred to at lett.g par.(2 art.164 PC RM. Or, the legislature did not set any limitation on the types of weapons that can be

  5. An Integrated Organic-Inorganic Geochemical Study of the 1.64 Ga Barney Creek Formation in Australia (Invited) (United States)

    Kelly, A. E.; Love, G. D.; Lyons, T. W.; Anbar, A. D.


    The chemistry and redox structure of the ancient ocean played a key role in influencing the evolution of life throughout Earth’s history. Surface waters in the mid-Proterozoic ocean (~1.0-1.7 billion years old [Ga]) were likely oxygenated, while deeper anoxic waters contained metastable sulfidic (euxinic) zones at intermediate depths, which constitute a hostile aquatic environment for eukaryotes. Hydrocarbon biomarkers provide a means of analyzing both microbial communities and paleoenvironmental redox conditions. Iron (Fe) proxies are the most effective inorganic proxy for delineating ancient euxinia on the local scale and do not require photic-zone depths for the sulfidic waters. Additionally, Fe proxies allow us to distinguish between anoxic and oxic waters and Fe-rich (ferruginous) from euxinic conditions, the latter characterized by free sulfide in the water column. Viewing these parameters in an integrated fashion for the first time, we can explore the backdrop of ocean redox during the evolution of eukaryotes, fully revealing the complex redox structure and paleoecology. A suite of thermally well-preserved mid-Proterozoic sedimentary rocks collected from drill core of the 1.64 Ga Barney Creek Formation, spanning a range of depositional facies, has been studied using detailed biomarker and inorganic geochemical redox proxies. Iron speciation data indicate burial of the sediments under periodically euxinic conditions. Our biomarker data clearly show the presence of two organic facies and include bacterially-derived hopanes and much lower concentrations of dinosteranes with an absence of detectable regular steranes. In addition, in both the free bitumens and corresponding kerogen hydropyrolysates, the pattern of dinosterane isomers to 4α-methyl-24-ethylcholestane abundance is markedly different in the Barney Creek samples compared to typical Phanerozoic methylsterane patterns. Though both dinosteranes and 4α-methyl-24-ethylcholestane are diagnostic of

  6. Microsomal triglyceride transfer protein -164 T > C gene polymorphism and risk of cardiovascular disease: results from the EPIC-Potsdam case-cohort study (United States)


    Background The microsomal triglyceride transfer protein (MTTP) is encoded by the MTTP gene that is regulated by cholesterol in humans. Previous studies investigating the effect of MTTP on ischemic heart disease have produced inconsistent results. Therefore, we have tested the hypothesis that the rare allele of the -164T > C polymorphism in MTTP alters the risk of cardiovascular disease (CVD), depending on the cholesterol levels. Methods The -164T > C polymorphism was genotyped in a case-cohort study (193 incident myocardial infarction (MI) and 131 incident ischemic stroke (IS) cases and 1 978 non-cases) nested within the European Prospective Investigation into Cancer and Nutrition (EPIC)–Potsdam study, comprising 27 548 middle-aged subjects. The Heinz Nixdorf Recall study (30 CVD cases and 1 188 controls) was used to replicate our findings. Results Genotype frequencies were not different between CVD and CVD free subjects (P = 0.79). We observed an interaction between the -164T > C polymorphism and total cholesterol levels in relation to future CVD. Corresponding stratified analyses showed a significant increased risk of CVD (HRadditve = 1.38, 95% CI: 1.07 to 1.78) for individuals with cholesterol levels Potsdam study. HRadditive was 1.06, 95% CI: 0.33 to 3.40 for individuals in the Heinz Nixdorf Recall study. A borderline significant decrease in CVD risk was observed in subjects with cholesterol levels ≥200 mg/dL (HRadditve = 0.77, 95% CI: 0.58 to 1.03) in the EPIC-Potsdam study. A similar trend was observed in the independent cohort (HRadditve = 0.60, 95% CI: 0.29 to 1.25). Conclusions Our study suggests an interaction between MTTP -164T > C functional polymorphism with total cholesterol levels. Thereby risk allele carriers with low cholesterol levels may be predisposed to an increased risk of developing CVD, which seems to be abolished among risk allele carriers with high cholesterol levels. PMID:23356586

  7. Microsomal triglyceride transfer protein -164 T > C gene polymorphism and risk of cardiovascular disease: results from the EPIC-Potsdam case-cohort study. (United States)

    di Giuseppe, Romina; Pechlivanis, Sonali; Fisher, Eva; Arregui, Maria; Weikert, Beate; Knüppel, Sven; Buijsse, Brian; Fritsche, Andreas; Willich, Stefan N; Joost, Hans-Georg; Boeing, Heiner; Moebus, Susanne; Weikert, Cornelia


    The microsomal triglyceride transfer protein (MTTP) is encoded by the MTTP gene that is regulated by cholesterol in humans. Previous studies investigating the effect of MTTP on ischemic heart disease have produced inconsistent results. Therefore, we have tested the hypothesis that the rare allele of the -164T > C polymorphism in MTTP alters the risk of cardiovascular disease (CVD), depending on the cholesterol levels. The -164T > C polymorphism was genotyped in a case-cohort study (193 incident myocardial infarction (MI) and 131 incident ischemic stroke (IS) cases and 1 978 non-cases) nested within the European Prospective Investigation into Cancer and Nutrition (EPIC)-Potsdam study, comprising 27 548 middle-aged subjects. The Heinz Nixdorf Recall study (30 CVD cases and 1 188 controls) was used to replicate our findings. Genotype frequencies were not different between CVD and CVD free subjects (P = 0.79). We observed an interaction between the -164T > C polymorphism and total cholesterol levels in relation to future CVD. Corresponding stratified analyses showed a significant increased risk of CVD (HR(additve) = 1.38, 95% CI: 1.07 to 1.78) for individuals with cholesterol levels Potsdam study. HR(additive) was 1.06, 95% CI: 0.33 to 3.40 for individuals in the Heinz Nixdorf Recall study. A borderline significant decrease in CVD risk was observed in subjects with cholesterol levels ≥ 200 mg/dL (HR(additve) = 0.77, 95% CI: 0.58 to 1.03) in the EPIC-Potsdam study. A similar trend was observed in the independent cohort (HR(additve) = 0.60, 95% CI: 0.29 to 1.25). Our study suggests an interaction between MTTP -164T > C functional polymorphism with total cholesterol levels. Thereby risk allele carriers with low cholesterol levels may be predisposed to an increased risk of developing CVD, which seems to be abolished among risk allele carriers with high cholesterol levels.

  8. Spectroscopic analysis of lithium terbium tetrafluoride

    DEFF Research Database (Denmark)

    Christensen, H.P.


    . The rare-earth site in LiTbF4 possesses S4 symmetry, which allows six crystal-field parameters. ζ and the six Bim were varied to obtain the best agreement with the experimentally observed levels. Keeping F2=434 cm-1 fixed, a fit with a standard deviation of 12 cm-1 was obtained at 10 K with the following...... were calculated by diagonalizing an effective spin-orbit and crystal-field Hamiltonian in an LS basis. H=Σλi(L→·S→)i+ΣαiΣBimOim, where the parameters λi are functions of the spin-orbit parameter ζ and the Slater parameter F2. The Oim and αi are Racah operators and reduced matrix elements, respectively...

  9. Inelastic critical scattering of neutrons from terbium

    DEFF Research Database (Denmark)

    Als-Nielsen, Jens Aage; Dietrich, O.W.; Marshall, W.


    We have measured the inelasticity of the critical neutron scattering in Tb above the Néel temperature. The results show that dynamical slowing down of fluctuations does occur at a second order phase transition.......We have measured the inelasticity of the critical neutron scattering in Tb above the Néel temperature. The results show that dynamical slowing down of fluctuations does occur at a second order phase transition....

  10. Gene Therapy Using Plasmid DNA Encoding Vascular Endothelial Growth Factor 164 and Fibroblast Growth Factor 2 Genes for the Treatment of Horse Tendinitis and Desmitis: Case Reports

    Directory of Open Access Journals (Sweden)

    Milomir Kovac


    Full Text Available In this clinical study, for the first time we used the direct gene therapy to restore severe injuries of the suspensory ligament branch and superficial digital flexor tendon in horses (Equus caballus. We injected the plasmid DNA encoding two therapeutic species-specific growth factors: vascular endothelial growth factor 164 and fibroblast growth factor 2 at the site of injury in the suspensory ligament branch and tendon. Treatment effects were evaluated with the use of clinical observation and ultrasound imaging during a period of a few months. We showed that gene therapy used within a period of 2–3 months after the injury resulted in the complete recovery of functions and full restoration of the severely damaged suspensory ligament and superficial digital flexor tendon.

  11. Comment on ‘To stack or not to stack: Performance of a new density functional for the uracil and thymine dimers’ [Chem. Phys. Lett. 459 (2008) 164 (United States)

    van Mourik, Tanja


    A Letter by Gu et al. [J. Gu, J. Wang, J. Leszczynski, Y. Xie, H.F. Schaefer III, Chem. Phys. Lett. 459 (2008) 164] presented MP2/6-31+G(d) and MP2/TZVPP stacking energies for the uracil and thymine dimers, with the aim to assess the performance of the new M06-2X density functional. However, the stacking energies were not corrected for the basis set superposition error (BSSE). Here we show that correction for this error dramatically changes the results. BSSE correction severely reduces the stacking energy of the thymine dimer, whereas the stacked uracil dimer structure considered by Gu et al. is not even a minimum on the MP2/6-31+G(d) potential energy surface.

  12. Molecular surveillance of the antifolate-resistant mutation I164L in imported African isolates of Plasmodium falciparum in Europe: sentinel data from TropNetEurop

    DEFF Research Database (Denmark)

    Wichmann, Ole; Jelinek, Tomas; Peyerl-Hoffmann, Gabriele


    BACKGROUND: Malaria parasites that carry the DHFR-mutation I164L are not only highly resistant to sulfadoxine-pyrimethamine but also to the new antimalarial drug chlorproguanil-dapsone. The spread of this mutation in Africa would result in a public health disaster since there is a lack of effective...

  13. Incidence and predictors of dural venous sinus pressure gradient in idiopathic intracranial hypertension and non-idiopathic intracranial hypertension headache patients: results from 164 cerebral venograms. (United States)

    Levitt, Michael R; Hlubek, Randall J; Moon, Karam; Kalani, M Yashar S; Nakaji, Peter; Smith, Kris A; Little, Andrew S; Knievel, Kerry; Chan, Jane W; McDougall, Cameron G; Albuquerque, Felipe C


    OBJECTIVE Cerebral venous pressure gradient (CVPG) from dural venous sinus stenosis is implicated in headache syndromes such as idiopathic intracranial hypertension (IIH). The incidence of CVPG in headache patients has not been reported. METHODS The authors reviewed all cerebral venograms with manometry performed for headache between January 2008 and May 2015. Patient demographics, headache etiology, intracranial pressure (ICP) measurements, and radiographic and manometric results were recorded. CVPG was defined as a difference ≥ 8 mm Hg by venographic manometry. RESULTS One hundred sixty-four venograms were performed in 155 patients. There were no procedural complications. Ninety-six procedures (58.5%) were for patients with IIH. The overall incidence of CVPG was 25.6% (42 of 164 procedures): 35.4% (34 of 96 procedures) in IIH patients and 11.8% (8 of 68 procedures) in non-IIH patients. Sixty procedures (36.6%) were performed in patients with preexisting shunts. Seventy-seven patients (49.7%) had procedures preceded by an ICP measurement within 4 weeks of venography, and in 66 (85.7%) of these patients, the ICP had been found to be elevated. CVPG was seen in 8.3% (n = 5) of the procedures in the 60 patients with a preexisting shunt and in 0% (n = 0) of the 11 procedures in the 77 patients with normal ICP (p < 0.001 for both). Noninvasive imaging (MR venography, CT venography) was assessed prior to venography in 112 (68.3%) of 164 cases, and dural venous sinus abnormalities were demonstrated in 73 (65.2%) of these cases; there was a trend toward CVPG (p = 0.07). Multivariate analysis demonstrated an increased likelihood of CVPG in patients with IIH (OR 4.97, 95% CI 1.71-14.47) and a decreased likelihood in patients with a preexisting shunt (OR 0.09, 95% CI 0.02-0.44). CONCLUSIONS CVPG is uncommon in IIH patients, rare in those with preexisting shunts, and absent in those with normal ICP.

  14. Radio and γ-Ray Variability in the BL Lac PKS 0219-164: Detection of Quasi-periodic Oscillations in the Radio Light Curve (United States)

    Bhatta, Gopal


    In this work, we explore the long-term variability properties of the blazar PKS 0219-164 in the radio and the γ-ray regime, utilizing the OVRO 15 GHz and the Fermi/LAT observations from the period 2008-2017. We found that γ-ray emission is more variable than the radio emission implying that γ-ray emission possibly originated in more compact regions while the radio emission represented continuum emission from the large-scale jets. Also, in the γ-ray, the source exhibited spectral variability, characterized by the softer-when-brighter trend, a less frequently observed feature in the high-energy emission by BL Lacs. In radio, using Lomb-Scargle periodogram and weighted wavelet z-transform, we detected a strong signal of quasi-periodic oscillation (QPO) with a periodicity of 270 ± 26 days with possible harmonics of 550 ± 42 and 1150 ± 157 day periods. At a time when detections of QPOs in blazars are still under debate, the observed QPO with high statistical significance (˜97%-99% global significance over underlying red-noise processes) and persistent over nearly 10 oscillations could make one of the strongest cases for the detection of QPOs in blazar light curves. We discuss various blazar models that might lead to the γ-ray and radio variability, QPO, and the achromatic behavior seen in the high-energy emission from the source.

  15. Urgent segmental resection as the primary strategy in management of benign tracheal stenosis. A single center experience in 164 consecutive cases. (United States)

    Krajc, Tibor; Janik, Miroslav; Benej, Roman; Lucenic, Martin; Majer, Ivan; Demian, Juraj; Harustiak, Svetozar


    The report is a retrospective review of 238 benign tracheal stenoses of various etiologies treated between 1995 and 2008. To show that urgent segmental resection has complication rates similar to elective resection and, therefore, preoperative dilation is not necessary, we analysed records of patients who underwent either standard segmental resections with anterolateral mediastinal tracheal mobilization, single-suture anastomosis and neck flexion; or insertion of T-tube with oval-shaped horizontal arm. Primary segmental resection was performed in 164 patients (68.9%), including 14 cases with concomitant tracheo-esophageal fistula (TEF). T-tube as an initial treatment suited 74 (31.1%) patients. We encountered two partial and one complete anastomotic disruptions following subglottic resections treated by T-tube insertion and costal cartilage tracheoplasty or permanent tracheostomy. Restenosis rate in segmental resection was 3.1%. No difference in complication rate between urgent and elective segmental resections was experienced. We treated a small number of patients by endotracheal stent insertion but the results were discouraging. Urgent segmental resection without prior rigid bronchoscopy dilation is our strategy of choice whenever possible. As an alternative to dilation we prefer temporary insertion of modified T-tube. Stand-alone endoluminal dilation and stenting has yet to prove its safety and long-term efficacy.

  16. High-Quality (CH3NH3)3Bi2I9 Film-Based Solar Cells: Pushing Efficiency up to 1.64. (United States)

    Zhang, Zheng; Li, Xiaowei; Xia, Xiaohong; Wang, Zhuo; Huang, Zhongbing; Lei, Binglong; Gao, Yun


    Bismuth-based solar cells have exhibited some advantages over lead perovskite solar cells for nontoxicity and superior stability, which are currently two main concerns in the photovoltaic community. As for the perovskite-related compound (CH3NH3)3Bi2I9 applied for solar cells, the conversion efficiency is severely restricted by the unsatisfactory photoactive film quality. Herein we report a novel two-step approach- high-vacuum BiI3 deposition and low-vacuum homogeneous transformation of BiI3 to (CH3NH3)3Bi2I9-for highly compact, pinhole-free, large-grained films, which are characterized with absorption coefficient, trap density of states, and charge diffusion length comparable to those of some lead perovskite analogues. Accordingly, the solar cells have realized a record power conversion of efficiency of 1.64% and also a high external quantum efficiency approaching 60%. Our work demonstrates the potential of (CH3NH3)3Bi2I9 for highly efficient and long-term stable solar cells.

  17. Ringo 155-164.pmd

    African Journals Online (AJOL)

    Prof. Adipala Ekwamu

    5.5. In fact, in some parts, Al saturation is high (4-55%) and dramatically affects the availability of phosphorus (Kanyanjua et al., 2002). Acid soils cover more than 15% of the agricultural land in. Tanzania (MARI, 2006), and over 7.5% in Kenya.

  18. On the Location of the gamma-Ray Outburst Emission in the BL Lacertae Object AO 0235 + 164 Through Observations Across the Electromagnetic Spectrum (United States)

    Agudo, Ivan; Marscher, Alan P.; Jorstad, Svetlana G.; Larionov, Valeri M.; Gomez, Jose L.; Laehteenmaeki, Anne; Smith, Paul S.; Nilsson, Kari; Readhead, Anthony C. S.; Aller, Margo F.; hide


    We present observations of a major outburst at centimeter, millimeter, optical, X-ray, and gamma-ray wavelengths of the BL Lacertae object AO 0235+164. We analyze the timing of multi-waveband variations in the flux and linear polarization, as well as changes in Very Long Baseline Array images at A = 7 mm with approx.0.15 milliarcsec resolution. The association of the events at different wavebands is confirmed at high statistical significance by probability arguments and Monte Carlo simulations. A series of sharp peaks in optical linear polarization, as well as a pronounced maximum in the 7 mm polarization of a superluminal jet knot, indicate rapid fluctuations in the degree of ordering of the magnetic field. These results lead us to conclude that the outburst occurred in the jet both in the quasi-stationary "core" and in the superluminal knot, both parsecs downstream of the supermassive black hole. We interpret the outburst as a consequence of the propagation of a disturbance, elongated along the line of sight by light-travel time delays, that passes through a standing recollimation shock in the core and propagates down the jet to create the superluminal knot. The multi-wavelength light curves vary together on long timescales (months/ years), but the correspondence is poorer on shorter timescales. This, as well as the variability of the polarization and the dual location of the outburst, agrees with the expectations of a multi-zone emission model in which turbulence plays a major role in modulating the synchrotron and inverse Compton fluxes.

  19. KIC 8462852 Faded at an Average Rate of 0.164 ± 0.013 Magnitudes per Century from 1890 to 1989 (United States)

    Schaefer, Bradley E.


    KIC 8462852 is a completely ordinary F3 main-sequence star, except that the light curve from Kepler shows episodes of unique and inexplicable day-long dips with up to 20% dimming. Here, I provide a light curve of 1338 Johnson B-band magnitudes from 1890 to 1989 taken from archival photographic plates at Harvard. KIC 8462852 displays a secular dimming at an average rate of 0.164 ± 0.013 mag per century. From the early-1890s to the late-1980s, KIC 8462852 faded by 0.193 ± 0.030 mag. The decline is not an artifact because nearby check stars have closely flat light curves. This century-long dimming is unprecedented for any F-type main-sequence star. Thus, the Harvard light curve provides the first confirmation (past the several dips seen in the Kepler light curve alone) that KIC 8462852 has anything unusual. The century-long dimming and the day-long dips are both just extreme ends of a spectrum of timescales for unique dimming events. By Ockham’s Razor, two such unique and similar effects are very likely produced by one physical mechanism. This one mechanism does not appear as any isolated catastrophic event in the last century, but rather must be some ongoing process with continuous effects. Within the context of dust-occultation models, the century-long dimming trend requires 104-107 times as much dust as for the deepest Kepler dip. Within the context of the comet-family idea, the century-long dimming trend requires an estimated 648,000 giant comets (each with 200 km diameter) all orchestrated to pass in front of the star within the last century.

  20. Shortening of the Lactobacillus paracasei subsp. paracasei BGNJ1-64 AggLb protein switches its activity from auto-aggregation to biofilm formation

    Directory of Open Access Journals (Sweden)

    Marija Miljković


    Full Text Available AggLb is the largest (318.6 kDa aggregation-promoting protein of Lactobacillus paracasei subsp. paracasei BGNJ1-64 responsible for forming large cell aggregates, which causes auto-aggregation, collagen binding and pathogen exclusion in vitro. It contains an N-terminus leader peptide, followed by six successive collagen binding domains, 20 successive repeats (CnaB-like domains and an LPXTG sorting signal at the C-terminus for cell wall anchoring. Experimental information about the roles of the domains of AggLb is currently unknown. To define the domain that confers cell aggregation and the key domains for interactions of specific affinity between AggLb and components of the extracellular matrix (ECM, we constructed a series of variants of the aggLb gene and expressed them in Lactococcus lactis subsp. lactis BGKP1-20 using a lactococcal promoter. All of the variants contained a leader peptide, an inter collagen binding-CnaB domain region (used to raise an anti-AggLb antibody, an anchor domain and a different number of collagen binding and CnaB-like domains. The role of the collagen binding repeats of the N-terminus in auto-aggregation and binding to collagen and fibronectin was confirmed. Deletion of the collagen binding repeats II, III and IV resulted in a loss of the strong auto-aggregation, collagen and fibronectin binding abilities whereas the biofilm formation capability was increased. The strong auto-aggregation, collagen and fibronectin binding abilities of AggLb were negatively correlated to biofilm formation.

  1. [Fe II] 1.64 μm Features of Jets and Outflows from Young Stellar Objects in the Carina Nebula (United States)

    Shinn, Jong-Ho; Pyo, Tae-Soo; Lee, Jae-Joon; Lee, Ho-Gyu; Kim, Hyun-Jeong; Koo, Bon-Chul; Sung, Hwankyung; Chun, Moo-Young; Lyo, A.-Ran; Moon, Dae-Sik; Kyeong, Jaemann; Park, Byeong-Gon; Hur, Hyeonoh; Lee, Yong-Hyun


    We present [Fe II] 1.64 μm imaging observations for jets and outflows from young stellar objects (YSOs) over the northern part (~24' × 45') of the Carina Nebula, a massive star-forming region. The observations were performed with IRIS2 of the Anglo-Australian Telescope and the seeing was ~1.''5 ± 0.''5. Eleven jet and outflow features are detected at eight different regions and are termed ionized Fe objects (IFOs). One Herbig-Haro candidate that was missed in Hubble Space Telescope Hα observations is newly identified as HHc-16, referring to our [Fe II] images. IFOs have knotty or longish shapes, and the detection rate of IFOs against previously identified YSOs is 1.4%, which should be treated as a lower limit. Four IFOs show anti-correlated peak intensities in [Fe II] and Hα, where the ratio I([Fe II])/I(Hα) is higher for longish IFOs than for knotty IFOs. We estimate the outflow mass loss rate from the [Fe II] flux using two different methods. The jet-driving objects are identified for three IFOs (IFO-2, -4, and -7) for which we study the relations between the outflow mass loss rate and the YSO physical parameters from the radiative transfer model fitting. The ratios of the outflow mass loss rate over the disk accretion rate for IFO-4 and -7 are consistent with the previously reported values (10-2-10+1), while the ratio is higher for IFO-2. This excess may result from underestimating the disk accretion rate. The jet-driving objects are likely to be low- or intermediate-mass stars. Other YSO physical parameters, such as luminosity and age, show reasonable relations or trends.

  2. Anvendelsen af sammenligningslejemål i sager om fastsættelse af det lejedesværdi- med udgangspunkt i en analyse af T:BB 2009.164 V

    DEFF Research Database (Denmark)

    Juul-Sandberg, Jakob


    I T:BB 2009.164 V tog Vestre Landsret i en tvist om størrelsen af det lejedes værdi stilling til den bevismæssige betydning af, om størrelsen af lejen i et sammenligningslejemål havde været prøvet i huslejenævnet, ligesom boligretten afgrænsede de relevante sammenligningslejemål med forskellige...

  3. 1.92 Tb/s coherent DWDM-OFDMA-PON with no high-speed ONU-side electronics over 100 km SSMF and 1:64 passive split. (United States)

    Cvijetic, Neda; Huang, Ming-Fang; Ip, Ezra; Shao, Yin; Huang, Yue-Kai; Cvijetic, Milorad; Wang, Ting


    Record 1.92-Tb/s (40λ × 48 Gb/s/λ) coherent DWDM-OFDMA-PON without high-speed ONU-side ADCs/DACs/DSP/RF clock sources is demonstrated over 100 km straight SSMF with a 1:64 passive split. Novel optical-domain OFDMA sub-band selection, coherent detection, and simple RF components are exploited. As the first experimental verification of a next-generation optical platform capable of delivering 1 Gb/s to 1000(+) users over 100 km, the new architecture is promising for future optical access/metro systems. © 2011 Optical Society of America

  4. Cervical carcinoma and sexual behavior: collaborative reanalysis of individual data on 15,461 women with cervical carcinoma and 29,164 women without cervical carcinoma from 21 epidemiological studies

    DEFF Research Database (Denmark)

    Kjær, Susanne Krüger


    High-risk human papillomavirus (HPV) types cause most cervical carcinomas and are sexually transmitted. Sexual behavior therefore affects HPV exposure and its cancer sequelae. The International Collaboration of Epidemiological Studies of Cervical Cancer has combined data on lifetime number...... for invasive cancer and CIN3 were estimated by conditional logistic regression. Risk of invasive cervical carcinoma increased with lifetime number of sexual partners (P for linear trend or =6 versus 1 partner, conditioned on age, study, and age at first intercourse, was 2...... of sexual partners and age at first sexual intercourse from 21 studies, or groups of studies, including 10,773 women with invasive cervical carcinoma, 4,688 women with cervical intraepithelial neoplasia grade 3 (CIN3)/carcinoma in situ, and 29,164 women without cervical carcinoma. Relative risks...

  5. Inelastic scattering of neutrons by spin waves in terbium

    DEFF Research Database (Denmark)

    Bjerrum Møller, Hans; Houmann, Jens Christian Gylden


    Measurements of spin-wave dispersion relations for magnons propagating in symmetry directions in ferromagnetic Tb; it is first experiment to give detailed information on magnetic excitations in heavy rare earths; Tb was chosen for these measurements because it is one of few rare-earth metals whic...... does not have very high thermal-neutron capture cross section, so that inelastic neutron scattering experiments can give satisfactory information on magnon dispersion relations....

  6. Coherent magnetic structures in terbium/holmium superlattices

    DEFF Research Database (Denmark)

    Bryn-Jacobsen, C.; Cowley, R.A.; McMorrow, D.F.


    Neutron-scattering techniques have been used to investigate the magnetic properties of three Tb/Ho superlattices grown by molecular-beam epitaxy. It is revealed that for temperatures in the range T = 10 to T-N(Ho)approximate to 130 K, there is a basal-plane ferromagnetic alignment of Tb moments w...

  7. Partial pressure (or fugacity) of carbon dioxide, salinity and other variables collected from time series observations using Bubble type equilibrator for autonomous carbon dioxide (CO2) measurement, Carbon dioxide (CO2) gas analyzer and other instruments from MOORING_M2_164W_57N in the Bering Sea from 2013-05-06 to 2014-10-19 (NCEI Accession 0157599) (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — NCEI Accession 0157599 includes chemical, meteorological, physical and time series data collected from MOORING_M2_164W_57N in the Bering Sea from 2013-05-06 to...

  8. Magnetic field cycling effect on the non-linear current-voltage characteristics and magnetic field induced negative differential resistance in α-Fe1.64Ga0.36O3 oxide

    Directory of Open Access Journals (Sweden)

    R. N. Bhowmik


    Full Text Available We have studied current-voltage (I-V characteristics of α-Fe1.64Ga0.36O3, a typical canted ferromagnetic semiconductor. The sample showed a transformation of the I-V curves from linear to non-linear character with the increase of bias voltage. The I-V curves showed irreversible features with hysteresis loop and bi-stable electronic states for up and down modes of voltage sweep. We report positive magnetoresistance and magnetic field induced negative differential resistance as the first time observed phenomena in metal doped hematite system. The magnitudes of critical voltage at which I-V curve showed peak and corresponding peak current are affected by magnetic field cycling. The shift of the peak voltage with magnetic field showed a step-wise jump between two discrete voltage levels with least gap (ΔVP 0.345(± 0.001 V. The magnetic spin dependent electronic charge transport in this new class of magnetic semiconductor opens a wide scope for tuning large electroresistance (∼500-700%, magnetoresistance (70-135 % and charge-spin dependent conductivity under suitable control of electric and magnetic fields. The electric and magnetic field controlled charge-spin transport is interesting for applications of the magnetic materials in spintronics, e.g., magnetic sensor, memory devices and digital switching.

  9. Crystal structure of a silver-, cobalt- and iron-based phosphate with an alluaudite-like structure: Ag1.655Co1.64Fe1.36(PO43

    Directory of Open Access Journals (Sweden)

    Adam Bouraima


    Full Text Available The new silver-, cobalt- and iron-based phosphate, silver cobalt iron tris(orthophosphate, Ag1.655Co1.64Fe1.36(PO43, was synthesized by solid-state reactions. Its structure is isotypic to that of Na2Co2Fe(PO43, and belongs to the alluaudite family, with a partial cationic disorder, the AgI atoms being located on an inversion centre and twofold rotation axis sites (Wyckoff positions 4a and 4e, with partial occupancies of 0.885 (2 and 0.7688 (19, respectively. One of the two P atoms in the asymmetric unit completely fills one 4e site while the Co and Fe atoms fill another 4e site, with partial occupancies of 0.86 (5 and 0.14 (5, respectively. The remaining Co2+ and Fe3+ cations are distributed on a general position, 8f, in a 0.39 (4:0.61 (4 ratio. All O atoms and the other P atoms are in general positions. The structure is built up from zigzag chains of edge-sharing [MO6] (M = Fe/Co octahedra stacked parallel to [101]. These chains are linked together through PO4 tetrahedra, forming polyhedral sheets perpendicular to [010]. The resulting framework displays two types of channels running along [001], in which the AgI atoms (coordination number eight are located.

  10. Publications | Page 164 | IDRC - International Development ...

    International Development Research Centre (IDRC) Digital Library (Canada)

    Protecting rights and reducing stigma against Vietnamese women married overseas (open access). Since the mid-1990s, marriage has gained significance among the reasons for migration from Vietnam, with large numbers of women leaving the country and becoming foreign brides for East Asian men, particularly in ...

  11. 46 CFR 164.012-5 - Scope. (United States)


    ... “Interior Finish” means any coating, overlay, or veneer except standard paint which is applied for decorative or other purpose. It includes not only the visible finish, but all material used in its...) With the exception of nitrocellulose or other highly inflammable or noxious fume-producing paints or...

  12. 33 CFR 164.70 - Definitions. (United States)


    ... alongside, or any combination of pulling, pushing, or hauling alongside. Western Rivers means the... Allen-Morgan City Alternative Route, and that part of the Atchafalaya River above its junction with the Port Allen-Morgan City Alternative Route including the Old River and the Red River and those waters...

  13. 42 CFR 460.164 - Involuntary disenrollment. (United States)


    ...) Documentation of disruptive or threatening behavior. If a PACE organization proposes to disenroll a participant... remedy the situation. (d) Noncompliant behavior. (1) A PACE organization may not disenroll a PACE... the PACE organization after a 30-day grace period. (2) The participant engages in disruptive or...

  14. 45 CFR 164.103 - Definitions. (United States)


    ...) Whose business activities include both covered and non-covered functions; and (3) That designates health... criminal, civil, or administrative proceeding arising from an alleged violation of law. Plan sponsor is defined as defined at section 3(16)(B) of ERISA, 29 U.S.C. 1002(16)(B). Required by law means a mandate...

  15. 45 CFR 164.308 - Administrative safeguards. (United States)


    ... business processes for protection of the security of electronic protected health information while... REQUIREMENTS SECURITY AND PRIVACY Security Standards for the Protection of Electronic Protected Health... confidentiality, integrity, and availability of electronic protected health information held by the covered entity...

  16. Publications | Page 164 | IDRC - International Development ...

    International Development Research Centre (IDRC) Digital Library (Canada)

    ... d'Ivoire (open access). When a system loses resilience it becomes vulnerable. Assessing the vulnerability of an ecosystem facing multiple hazards is problematic for researchers. The White Bandama Basin (WBB) in Northern Côte d''Ivoire is one of the most vulnerable areas to climate change with drought as the most.

  17. Reference: 164 [Arabidopsis Phenome Database[Archive

    Lifescience Database Archive (English)

    Full Text Available stel C et al. 2005 Mar. Development 132(5):897-911. The higher-plant shoot apical meristem is a dynamic structure...wo antagonistic processes: self-renewal of the stem cell population and initiation of the lateral organs. coordination is stringently controlled by gene networks that contain both positive and negative components. We have pre...viously defined the ULTRAPETALA1 (ULT1) gene as a key negative regu...lator of cell accumulation in Arabidopsis shoot and floral meristems, because mutations in ULT1 cause the enlargement of inflore

  18. 21 CFR 164.110 - Mixed nuts. (United States)


    ... CONSUMPTION TREE NUT AND PEANUT PRODUCTS Requirements for Specific Standardized Tree Nut and Peanut Products... and not more than 80 percent by weight of the finished food. For purposes of this section, each kind... to in paragraph (a) of this section are: (1) Almonds, black walnuts, Brazil nuts, cashews, English...

  19. Publications | Page 164 | IDRC - International Development ...

    International Development Research Centre (IDRC) Digital Library (Canada)

    Once achieved, UHC became an entitlement for the population and now enjoys broad public support. This paper explores... Physiological and biochemical response of local landrace and chickpea varieties to rhizobium inoculation and planting dates under different agro-ecological zones of Ethiopia (restricted access).

  20. 45 CFR 164.501 - Definitions. (United States)


    ... items: Diagnosis, functional status, the treatment plan, symptoms, prognosis, and progress to date... and is maintained, collected, used, or disseminated by or for a covered entity. Direct treatment relationship means a treatment relationship between an individual and a health care provider that is not an...

  1. 12 CFR 250.164 - Bankers' acceptances. (United States)


    .... The legislative history of the BESA indicates no intent to change this domestic acceptance limitation... financial statements prepared in accordance with local accounting practices and an explanation of the accounting terminology and the major features of the accounting standards used in the preparation of the...

  2. Environmental Radiation Data (ERD) Journal Report 164 (United States)

    RadNet environmental radiation monitoring data report for the period of October - December 2015. The report includes results for air, drinking water and precipitation samples collected as part of EPA's RadNet monitoring program.

  3. 32 CFR 552.164 - General. (United States)


    ...), and Director of Engineering and Housing (DEH). If the event can be supported, DPTM will advise the organization to contact the Director of Engineering and Housing Real Property Branch. Requests for such... the appropriate Installation Range Regulations. (f) Non-DoD personnel in transit. Individuals in...

  4. 21 CFR 133.164 - Nuworld cheese. (United States)


    ...-white mold, a white mutant of Penicillium roquefortii, throughout the cheese. The minimum milkfat... forms, spores of a white mutant of the mold Penicillium roquefortii are added. The forms are turned..., used alone or in combination. (2) Clotting enzymes. Rennet and/or other clotting enzymes of animal...

  5. 45 CFR 164.304 - Definitions. (United States)


    .... Malicious software means software, for example, a virus, designed to damage or disrupt a system. Password... laptop or desktop computer, or any other device that performs similar functions, and electronic media...

  6. Atypical juvenile presentation of GM2 gangliosidosis AB in a patient compound-heterozygote for c.259G>T and c.164C>T mutations in the GM2A gene

    Directory of Open Access Journals (Sweden)

    Carla Martins


    Full Text Available GM2-gangliosidosis, AB variant is an extremely rare autosomal recessive inherited disorder caused by mutations in the GM2A gene that encodes GM2 ganglioside activator protein (GM2AP. GM2AP is necessary for solubilisation of GM2 ganglioside in endolysosomes and its presentation to β-hexosaminidase A. Conversely GM2AP deficiency impairs lysosomal catabolism of GM2 ganglioside, leading to its storage in cells and tissues. We describe a 9-year-old child with an unusual juvenile clinical onset of GM2-gangliosidosis AB. At the age of 3 years he presented with global developmental delay, progressive epilepsy, intellectual disability, axial hypertonia, spasticity, seizures and ataxia, but without the macular cherry-red spots typical for GM2 gangliosidosis. Brain MRI detected a rapid onset of diffuse atrophy, whereas whole exome sequencing showed that the patient is a compound heterozygote for two mutations in GM2A: a novel nonsense mutation, c.259G>T (p.E87X and a missense mutation c.164C>T (p.P55L that was recently identified in homozygosity in patients of a Saudi family with a progressive chorea-dementia syndrome. Western blot analysis showed an absence of GM2AP in cultured fibroblasts from the patient, suggesting that both mutations interfere with the synthesis and/or folding of the protein. Finally, impaired catabolism of GM2 ganglioside in the patient's fibroblasts was demonstrated by metabolic labeling with fluorescently labeled GM1 ganglioside and by immunohistochemistry with anti-GM2 and anti-GM3 antibodies. Our observation expands the molecular and clinical spectrum of molecular defects linked to GM2-gangliosidosis and suggests novel diagnostic approach by whole exome sequencing and perhaps ganglioside analysis in cultured patient's cells.

  7. 164 Meaning and Thematic Roles in the Igbo Language Chukwuma ...

    African Journals Online (AJOL)

    Ike Odimegwu

    Chika, chair, goat, dog, pen, etc. The theory excludes sentences. It also excludes adjectives because they have no ..... Ejima borrow-PAST money that he take save life nna ya father him. 'Ejima borrowed money in order to save his father's life'. In example (26) above, the reason why 'Ibe' married is that he loves 'Amaka.

  8. 45 CFR 164.504 - Uses and disclosures: Organizational requirements. (United States)


    ... other law (including regulations adopted by the covered entity or its business associate) contains... section. (ii) If a business associate is required by law to perform a function or activity on behalf of a...) The disclosure is required by law; or (B)(1) The business associate obtains reasonable assurances from...

  9. Dicty_cDB: CFJ164 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available AGGCTTA sequence update 2001.11.22 Translated Amino Acid sequence yfiflsfinthlynnyiln*tih*il*KKKKXXSXXFLKXKN...ftxxfnc*cwyfincrcskyfysnfkvsitxxsf nfi*xfkfttaiynckysfskstttttiik*inkflaitksxrxqxirl Frame B: yfiflsfinthlynn

  10. 2012 December_ Edition_Vol 16_4_article_17

    African Journals Online (AJOL)

    AJRH Managing Editor

    Nous avons donc mis au point une technique d'insémination intra-utérine assez simple qui peut être effectuée dans les pays en développement, sans avoir recours aux équipements sophistiqués, aux matériaux coûteux, aux médias, ou aux cathéters d'insémination jetables. Il est assez bon marché et peut être réalisé par le ...

  11. 164 original article profile of institutional infrastructure for ...

    African Journals Online (AJOL)

    Dr Oboro VO

    Methods: The objectives of this study were to assess the universal precaution profile of primary health care facilities and determine those factors that inform their prevailing safety status. Using a structured checklist, 23 representative primary health care facilities from the 23 local government areas in Sokoto State were ...

  12. Dicty_cDB: CFD164 [Dicty_cDB

    Lifescience Database Archive (English)


  13. Publications | Page 164 | CRDI - Centre de recherches pour le ...

    International Development Research Centre (IDRC) Digital Library (Canada)

    De septembre à novembre 1997, les incendies qui ont fait rage en Indonésie ont rejeté suffisamment de fumée dans l'atmosphère pour recouvrir toutes les régions d'un brouillard qui a atteint le sud de la Thaïlande et les Philippines au nord, la Malaisie et Singapour étant particulièrement touchés... En quoi est-ce que cela ...

  14. 33 CFR 164.39 - Steering gear: Foreign tankers. (United States)


    ... foreign vessel mean the same as in 46 U.S.C. 2101. SOLAS 74 means the International Convention for the... the same as in Chapter II-1, Regulations 1.1.2 and, of SOLAS 74. Existing tanker means a... September 1, 1984, must meet the applicable requirements of Chapter II-1, Regulations 29 and 30, of SOLAS 74...

  15. 33 CFR 164.11 - Navigation under way: General. (United States)


    ... passenger vessel meeting the requirements of the International Convention for the Safety of Life at Sea, 1960 (SOLAS 60) and on each cargo vessel meeting the requirements of SOLAS 74 as amended in 1981, the...

  16. 164 Causes and Architectural Solution to Heat and Non- conducive ...

    African Journals Online (AJOL)

    Nekky Umera

    design is one fraction of green building design and does not consist of active systems such as mechanical ... infiltration from poor weatherization can contribute up to 60% of heat gain during summer and 40% of heat ..... This will completely eliminate thermal transmission of any sort from the heat conducting roofing sheets.

  17. 26 CFR 1.164-3 - Definitions and special rules. (United States)


    ..., tobacco, admissions, luxury items, and a few other items is not general. Similarly, a tax imposed solely.... For purposes of this section, the term “food” means food for human consumption off the premises where... “compensating use tax” means, in respect of any item, a tax which is imposed on the use, storage, or consumption...

  18. 29 CFR 1952.164 - Final approval determination. (United States)


    ... and contractor-operated facilities engaged in USPS mail operations; bridge construction projects... engaged in egg, poultry, or red meat production, or the post-harvest processing of agricultural or...

  19. 27 CFR 25.164 - Quarterly and semimonthly returns. (United States)


    ... file a return on Form 5000.24 for each return period even though no beer was removed for consumption or... required to be determined (and which has not been prepaid) on all beer removed for consumption or sale... BUREAU, DEPARTMENT OF THE TREASURY LIQUORS BEER Tax on Beer Preparation and Remittance of Tax Returns...

  20. Dicty_cDB: CHS164 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available utrients Pinus taeda cDNA clone RTMNUT1_37_B06_A029 5', mRNA sequence. 54 2e-11 4 C...icon esculentum cDNA clone cLEG49G24 5' end, mRNA sequence. 58 7e-12 2 DR181209 |DR181209.1 RTMNUT1_37_B06.g2_A029 Roots minus micron

  1. What we do | Page 164 | IDRC - International Development ...

    International Development Research Centre (IDRC) Digital Library (Canada)

    Equity Gauge Zambia : Enhancing Governance, Equity and Health. Like most African countries, Zambia has undertaken a series of reforms to improve the quality and equity of its health services through greater involvement of community organizations, health workers and other actors in the health system. Zambia, North Of ...

  2. Dicty_cDB: SSL164 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available LV (Nsf Xylem Late wood Vertical) Pinus taeda cDNA clone NXLV105_F05 5', mRNA sequence. 62 9e-06 1 BU777208 ...24 |AL865124.1 Xenopus tropicalis EST, clone TEgg076m08 5'. 52 2e-08 2 BQ196812 |BQ196812.1 NXLV105_F05_F NX

  3. Dicty_cDB: VFO164 [Dicty_cDB

    Lifescience Database Archive (English)


  4. Dicty_cDB: CHP164 [Dicty_cDB

    Lifescience Database Archive (English)


  5. Dicty_cDB: SHH164 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available sequence. 62 3e-05 1 CK808839 |CK808839.1 Rasgsc1686 Salivary Gland 4th instar 3rd period (spinning cocoon)...sequence. 34 4e-05 3 CK808739 |CK808739.1 Rasgsc1529 Salivary Gland 4th instar 3rd period (spinning cocoon)...sequence. 58 5e-04 1 CK808037 |CK808037.1 Rasgsc0316 Salivary Gland 4th instar 3rd period (spinning cocoon)

  6. 164 original article profile of institutional infrastructure for ...

    African Journals Online (AJOL)

    Dr Oboro VO

    planning, general medical and emergency, laboratory, school health, housekeeping, community-based, waste and instrument management are associated with infection transmission requiring adequate provision of enabling environment for effective control of infectious agents capable of been transmitted through them.

  7. 33 CFR 164.46 - Automatic Identification System (AIS). (United States)


    ... 33 Navigation and Navigable Waters 2 2010-07-01 2010-07-01 false Automatic Identification System... Identification System (AIS). (a) The following vessels must have a properly installed, operational, type approved...) Passenger vessels, of 150 gross tonnage or more, not later than July 1, 2003; (ii) Tankers, regardless of...

  8. Dicty_cDB: SLD164 [Dicty_cDB

    Lifescience Database Archive (English)


  9. 33 CFR 164.35 - Equipment: All vessels. (United States)


    ... must have the following: (a) A marine radar system for surface navigation. (b) An illuminated magnetic... a fixed propeller, a table of shaft revolutions per minute for a representative range of speeds. (4) For each vessel with a controllable pitch propeller, a table of control settings for a representative...

  10. 46 CFR 164.006-4 - Inspection and testing. (United States)


    ... rejection. (d) Organic carbon content test. (1) The organic carbon content shall be determined and shall not... the certificate of approval, but the Coast Guard also reserves the right to make spot-check tests of...

  11. Dicty_cDB: VHB164 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available |DY889811.1 CeleSEQ6761 Cunninghamella elegans pBluescript (EcoRI-XhoI) Cunninghamella elegans cDNA clone...|DY889772.1 CeleSEQ11980 Cunninghamella elegans pBluescript (EcoRI-XhoI) Cunninghamella elegans cDNA clone...|DY890935.1 CeleSEQ7425 Cunninghamella elegans pBluescript (EcoRI-XhoI) Cunninghamella elegans cDNA clone...|DY887441.1 CeleSEQ3766 Cunninghamella elegans pBluescript (EcoRI-XhoI) Cunninghamella elegans cDNA clone...|DY888936.1 CeleSEQ6366 Cunninghamella elegans pBluescript (EcoRI-XhoI) Cunninghamella elegans cDNA clone

  12. Dicty_cDB: AFI164 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available sing malaria and immune antigen for suppressing growth of plasmodium. 62 1e-29 6 BD183625 |BD183625.1 for diagnosing malaria and immune antigen for suppressing growth of plasmodium

  13. 46 CFR 164.015-4 - Inspections and tests. (United States)


    ... foam. A marine inspector shall be admitted to any place in the factory where production or partial... dimension forms a 45° angle with the horizontal and with the widths in a vertical position. A bunsen burner...

  14. 46 CFR 164.007-4 - Testing procedure. (United States)


    ...) Preparation of fire test specimens. (1) The fire test specimens shall be conditioned to approximately constant... appreciable volumes of smoke or noxious vapors from the unexposed side of the test specimen. The specimen..., including the retests, shall be conducted at the National Bureau of Standards or other laboratories...

  15. 164th Symposium of the International Astronomical Union

    CERN Document Server

    Gilmore, G


    The concept of Stellar Populations has played a fundamental role in astronomy in the last few decades. It was introduced by Walter Baade after he was able to resolve the Andromeda Nebula and its companions into stars when he used red-sensitive plates and realised that there were two fundamentally different Herzsprung-Russell diagrams in our and these nearby galaxies (common stars in the solar neighborhood versus globular clusters). This result was published in two papers in 1944 in volume 100 of the Astrophysical Journal. Subsequent research gave the concept a much firmer basis and at the famous Vatican Symposium of 1957 resulted in a general scheme of the concept and a working hypothesis for idea's on the formation and evolution of the Galaxy. This has been a guiding principle of studies of our and other galaxies for decades. Some years ago it seemed to us appropriate to commemorate Baade's seminal work in 1994, when it would have its 50-th anniversary, and to review its present status and also its role in c...

  16. 2012 December_ Edition_Vol 16_4._article_2

    African Journals Online (AJOL)

    AJRH Managing Editor

    insemination with husband sperm, embryo donation from couples who have been verified to be HIV negative, insemination with donor sperm, timed unprotected intercourse (TUI) and sperm washing combined with intrauterine insemination (IUI) and assisted reproductive ..... c) Cryopreservation in separate cryostorage tanks.

  17. 46 CFR 164.009-9 - Procedure for approval. (United States)


    ... approval. (a) An application for approval of a material under this subpart must be sent to the Commandant (CG-521), U.S. Coast Guard, Washington, DC 20593-0001. (b) The application is examined by the Coast Guard to determine the probability that the material meets the requirements for approval. The Coast...

  18. 2012 December_ Edition_Vol 16_4_article_16

    African Journals Online (AJOL)

    AJRH Managing Editor

    of marriage. Economic and social deprivation appears to expose Ethiopian adolescents to early and unsafe sexual relations resulting in teen motherhood. As indicated above, adolescents' decision to have children is partly dependent upon their family status, the environment in which they were raised, the economic and ...


    African Journals Online (AJOL)

    run off and infiltration activities, use of galvanized materials in handpump construction and agricultural landuse activities. Although iron concentrations at objectionable level were noted in some of the boreholes villagers were found using them ...

  20. 45 CFR 164.306 - Security standards: General rules. (United States)


    ... all electronic protected health information. (d) Implementation specifications. In this subpart: (1) Implementation specifications are required or addressable. If an implementation specification is required, the word “Required” appears in parentheses after the title of the implementation specification. If an...

  1. Dicty_cDB: AFK164 [Dicty_cDB

    Lifescience Database Archive (English)


  2. Dicty_cDB: CHR164 [Dicty_cDB

    Lifescience Database Archive (English)


  3. What we do | Page 164 | IDRC - International Development ...

    International Development Research Centre (IDRC) Digital Library (Canada)

    providing developing-country researchers with financial resources, advice, and training to find solutions to local problems;; sharing our knowledge with policymakers, researchers, and ... Managing Agricultural Biodiversity for Nutrition, Health, Livelihoods and Sustainable Production Systems (Sub-Saharan Africa).

  4. All projects related to | Page 164 | IDRC - International Development ...

    International Development Research Centre (IDRC) Digital Library (Canada)


    Total Funding: CA$ 497,200.00. Phenomenology of criminal violence and challenges for local urban governance in Côte d'Ivoire. Project. This research focuses on the changes in criminal urban violence that have accompanied the sociopolitical developments in Côte d'Ivoire since the 1990s. Start Date: December 21, 2012.

  5. 33 CFR 164.38 - Automatic radar plotting aids (ARPA). (United States)


    ... present in a period of not more than one minute an indication of the target's motion trend and display... state tracking the relative motion trend of a target with the following accuracy values (95 percent... present in a period of not more than one minute an indication of the target's motion trend, and display...

  6. Dicty_cDB: SFH164 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available fniix*fkkkkn*kknnkq Frame C: ---xsxnltxfhflq*qgixr*lcxssr**fnrsr*x*x*ncpxkltssxtx...rhxfgfrc xhsfsr*xxtklyngtxsfhxccqsxnwxkxlslrslsxrwxkxcpxcw*sls*sikskq lvxxccw*rxarrssrftpnxwxxinlillxnlkkkki

  7. What we do | Page 164 | IDRC - International Development ...

    International Development Research Centre (IDRC) Digital Library (Canada)

    Public Accountability Institutions in Pakistan and their Macroeconomic Impacts. Corruption is the single most important impediment to governance and the functioning of the economy in Pakistan. Central Asia, Far East Asia, South Asia, Pakistan. PROJECT ...

  8. Photoluminescence studies of a Terbium(III) complex as a fluorescent probe for DNA detection

    Energy Technology Data Exchange (ETDEWEB)

    Khorasani-Motlagh, Mozhgan, E-mail:; Noroozifar, Meissam; Niroomand, Sona; Moodi, Asieh


    The photoluminescence properties of a Tb(III) complex of the form [Tb(phen){sub 2}Cl{sub 3}·OH{sub 2}] (phen=1,10-phenanthroline) in different solvents are presented. It shows the characteristic luminescence of the corresponding Ln{sup 3+} ion in the visible region. The emission intensity of this complex in coordinating solvent is higher than non-coordinating one. The suggested mechanism for the energy transfer between the ligand and Tb{sup 3+} ion is the intramolecular energy transfer mechanism. The interactions of the Tb(III) complex with fish salmon DNA are studied by fluorescence spectroscopy, circular dichroism study and viscosity measurements. The results of fluorescence titration reveal that DNA strongly quenches the intrinsic fluorescence of the complex through a static quenching procedure. The binding constant (K{sub b}) of the above metal complex at 25 °C is determined by the fluorescence titration method and it is found to be (8.06±0.01)×10{sup 3} M{sup −1}. The thermodynamic parameters (ΔH{sup 0}>0, ΔS{sup 0}>0 and ΔG{sup 0}<0) indicate that the hydrophobic interactions play a major role in DNA–Tb complex association. The results support the claim that the title complex bonds to FS-DNA by a groove mode. -- Highlights: • Photoluminescence of [Tb(phen){sub 2}Cl{sub 3}·OH{sub 2}] in different solvents are studied. • Tb(III) complex shows good binding affinity to FS DNA with K{sub b}=(8.06±0.01)×10{sup 3} M{sup −1}. • Viscosity of DNA almost unchanged by increasing amount of Tb complex. • CD spectrum of DNA has a little change with increasing amount of Tb complex. • Thermodynamic parameters indicate that the binding reaction is entropically driven.

  9. Lanthanides in Nuclear Medicine. The Production of Terbium-149 by Heavy Ion Beams

    CERN Document Server

    Dmitriev, S N; Zaitseva, N G; Maslov, O D; Molokanova, L G; Starodub, G Ya; Shishkin, S V; Shishkina, T V


    Among radioactive isotopes of lanthanide series elements, finding the increasing using in nuclear medicine, alpha-emitter {149}Tb (T_{1/2} = 4.118 h; EC 76.2 %; beta^+ 7.1 %; alpha 16.7 %) is considered as a perspective radionuclide for radioimmunotherapy. The aim of the present work is to study experimental conditions of the {149}Tb production in reactions Nd({12}C, xn){149}Dy (4.23 min; beta^+, EC)\\to {149}Tb when the Nd targets have been irradiated by heavy ions of carbon. On the basis of results of formation and decay of {149}Dy\\to{149}Tb evaluation of the {149}Tb activity, is made which can be received under optimum conditions (enriched {142}Nd target, {12}C ions with the energy 120 MeV and up to current 100 mu A, time of irradiating 8-10 hours). Under these conditions {149}Tb can be obtained up to 30 GBq (up to 0.8 Ci).

  10. Poly[[aqua-?3-picolinato-?2-picolinato-dipicolinatopotassium(I)terbium(III)] 2.5-hydrate


    Filipe A. Almeida Paz; João Rocha; Jacek Klinowski; Tito Trindade; Nogueira,Helena I. S.; Soares-Santos, Paula C. R.; Cunha-Silva, Lu?s


    In the title compound, [KTb(C6H4NO2)4(H2O)]·2.5H2O, each Tb3+ centre is coordinated by four N and five O atoms from five distinct picolinate ligands in a geometry resembling a highly distorted tricapped trigonal prism. One of the ligands establishes a skew bridge between neighbouring Tb3+ centres, leading to the formation of one-dimensional anionic polymeric chains, {[(C6H4NO2)4Tb]−}n, running along the direction [010]. Each K+ cation is seven-coordinated by six O atoms from one an...

  11. Spin waves in terbium. III. Magnetic anisotropy at zero wave vector

    DEFF Research Database (Denmark)

    Houmann, Jens Christian Gylden; Jensen, J.; Touborg, P.


    The energy gap at zero wave vector in the spin-wave dispersion relation of ferromagnetic. Tb has been studied by inelastic neutron scattering. The energy was measured as a function of temperature and applied magnetic field, and the dynamic anisotropy parameters were deduced from the results....... The axial anisotropy is found to depend sensitively on the orientation of the magnetic moments in the basal plane. This behavior is shown to be a convincing indication of considerable two-ion contributions to the magnetic anisotropy at zero wave vector. With the exception of the sixfold basal...... the effects of zero-point deviations from the fully aligned ground state, and we tentatively propose polarization-dependent two-ion couplings as their origin....

  12. Structural and Magnetic Anisotropy in Amorphous Terbium-Iron Thin Films (United States)

    Hufnagel, Todd Clayton


    High density, removable media magnetooptic disk drives have recently begun to make significant gains in the information mass storage market. The media in these disks are amorphous rare-earth/transition-metal (RE-TM) alloys. One vital property of these materials is a large perpendicular magnetic anisotropy; that is, an easy axis of magnetization which is perpendicular to the plane of the film. A variety of theories, sometimes contradictory, have been proposed to account for this surprising presence of an anisotropic property in an amorphous material. Recent research indicates that there is an underlying atomic-scale structural anisotropy which is responsible for the observed magnetic anisotropy. Several different types of structural anisotropy have been proposed to account for the observed magnetic anisotropy, including pair-ordering anisotropy (anisotropic chemical short-range order) and bond orientation anisotropy (an anisotropy in coordination number or distances independent of chemical ordering). We have studied the structural origins of perpendicular magnetic anisotropy in amorphous Tb-Fe thin films by employing high-energy and anomalous dispersion x-ray scattering. The as-deposited films show a clear structural anisotropy, with a preference for Tb-Fe near neighbors to align in the out-of-plane direction. These films also have a large perpendicular magnetic anisotropy. Upon annealing, the magnetic anisotropy energy drops significantly, and we see a corresponding reduction in the structural anisotropy. The radial distribution functions indicate that the number of Tb-Fe near-neighbors increases in the in-plane direction, but does not change in the out-of-plane direction. Therefore, the distribution of Tb-Fe near-neighbors becomes more uniform upon annealing. We propose that the observed reduction in perpendicular magnetic anisotropy energy is a result of this change in structure. Our results support the pair -ordering anisotropy model of the structural anisotropy in amorphous Tb-Fe thin films. We see no evidence to support the bond orientation anisotropy model.

  13. Luminescence properties of terbium-doped Li3PO4 phosphor for ...

    Indian Academy of Sciences (India)

    Antonov-Romanovskii et al [2] firstly suggested applications of OSL for personal dosime- try. This technique got momentum for personnel dosime- try after the development of α-Al2O3:C. OSL properties of α-Al2O3:C have been investigated for personnel dosimetry, environmental dosimetry, medical dosimetry and space.

  14. Luminescence properties of terbium-doped Li3PO4 phosphor for ...

    Indian Academy of Sciences (India)

    The powder X-ray diffraction (PXRD), photoluminescence (PL) emission and excitation spectra, thermoluminescence (TL) and optically stimulated luminescence (OSL) were measured. The particle size was calculated using the Debye Scherrer formula and found to be 79.42 nm. PL emission spectra of Li 3 PO 4 :Tb 3 + ...

  15. Charge-transfer-based terbium MOF nanoparticles as fluorescent pH sensor for extreme acidity. (United States)

    Qi, Zewan; Chen, Yang


    Newly emerged metal organic frameworks (MOFs) have aroused the great interest in designing functional materials by means of its flexible structure and component. In this study, we used lanthanide Tb 3+ ions and small molecular ligands to design and assemble a kind of pH-sensitive MOF nanoparticle based on intramolecular-charge-transfer effect. This kind of made-to-order MOF nanoparticle for H + is highly specific and sensitive and could be used to fluorescently indicate pH value of strong acidic solution via preset mechanism through luminescence of Tb 3+ . The long luminescence lifetime of Tb 3+ allows eliminating concomitant non-specific fluorescence by time-revised fluorescence techniques, processing an advantage in sensing H + in biological media with strong autofluorescence. Our method showed a great potential of MOF structures in designing and constructing sensitive sensing materials for specific analytes directly via the assembly of functional ions/ligands. Copyright © 2016 Elsevier B.V. All rights reserved.

  16. Assessment of terbium (III) as a luminescent probe for the detection of tuberculosis biomarkers

    Energy Technology Data Exchange (ETDEWEB)

    Bamogo, W. [CNRS, IRAMIS, UMR 3685 NIMBE/LEDNA, F-91191 Gif-sur-Yvette (France); Mugherli, L. [CEA, IRAMIS, UMR 3685 NIMBE/LEDNA, F-91191 Gif-sur-Yvette (France); Banyasz, A. [CNRS, IRAMIS, LIDyL/Laboratoire Francis Perrin, URA 2453, F-91191 Gif-sur-Yvette (France); Novelli-Rousseau, A.; Mallard, F. [BioMérieux SA, F-38000 Grenoble (France); Tran-Thi, T.-H., E-mail: [CNRS, IRAMIS, UMR 3685 NIMBE/LEDNA, F-91191 Gif-sur-Yvette (France)


    A detection method for nicotinic acid, a specific metabolite marker of Mycobacterium tuberculosis present in cultures and patients' breath, is studied in complex solutions containing other metabolites and in biological media such as urine, saliva and breath condensate. The method is based on the analysis of the luminescence increase of Tb{sup 3+} complexes in the presence of nicotinic acid due to the energy transfer from the excited ligand to the lanthanide ion. It is shown that other potential markers found in M. tuberculosis culture supernatant, such as methyl phenylacetate, p-methyl anisate, methyl nicotinate and 2-methoxy biphenyl, can interfere with nicotinic acid via a competitive absorption of the excitation photons. A new strategy to circumvent these interferences is proposed with an upstream trapping of volatile markers preceding the detection of nicotinic acid in the liquid phase via the luminescence of Tb{sup 3+} complexes. The cost of the method is evaluated and compared with the Xpert MTB/RIF test endorsed by the World Health Organization. - Highlights: • Nicotinic acid, a specific marker of M. tuberculosis, can be detected via luminescence. • The detection limit with a commercial phosphorimeter is 0.4 µmol·L{sup -1}. • Other metabolites of M. tuberculosis can interfere via absorbed excitation light. • The interference can be removed via trapping of the most volatile metabolites. • A breath analysis procedure's cost is compared with the Xpert TBM/RIF test.

  17. A highly porous luminescent terbium-organic framework for reversible anion sensing

    Energy Technology Data Exchange (ETDEWEB)

    Wong, K.L.; Law, G.L.; Wong, W.T. [Department of Chemistry, The University of Hong Kong, Pokfulam Road, Hong Kong (China); Yang, Y.Y. [School of Chemistry and Chemical Engineering, Sun Yat-Sen University, Guangzhou 510275 (China)


    Unique tailored porous frameworks incorporating a lanthanide metal center have been designed to function as chemical detectors. A flexible multidentate ligand, mucic acid, is used to differentiate between several anions, thus creating an organic framework that is ideally suited for applications in gas separation, sensors, and chemical switches. (Abstract Copyright [2006], Wiley Periodicals, Inc.)

  18. Synthesis and characterization of wide bandgap semiconductors doped with terbium for electroluminescent devices


    Montañez Huamán, Liz Margarita


    En el presente trabajo de investigación se ha estudiado propiedades estequiometrias, estructurales y de emisión de luz de semiconductor de amplio ancho de banda dopados con terbio. La difracción de rayos-X en ángulo rasante confirma el estado amorfo de las películas. Los espectros de absorción infrarroja muestran la formación de óxidos en las películas y la espectroscopia de foto-electrones de rayos-X revela la formación de oxinitruro de aluminio y oxicarburo de silicio. Las pe...

  19. Synthesis and characterization of terbium-doped SrSnO3 pigments

    Czech Academy of Sciences Publication Activity Database

    Dohnalová, Ž.; Gorodylova, N.; Šulcová, P.; Vlček, Milan


    Roč. 40, č. 8 (2014), s. 12637-12645 ISSN 0272-8842 Institutional support: RVO:61389013 Keywords : pigments * solid state reaction * perovskites Subject RIV: CA - Inorganic Chemistry Impact factor: 2.605, year: 2014

  20. An optical material for the detection of β-hydroxybutyrate based on a terbium complex (United States)

    Wang, Xiaomiao; Chen, Huili; Li, Hua


    A novel Tb3+ complex (Tb(C14H10O4)ṡCl, TbL2) based on benzoic acid (L+H) was successfully synthesized, and gave a weak green emission in methanol-water (V:V, 4:1, pH 4.49). With the addition of β-hydroxybutyrate (β-HB) to a semi-aqueous solution of TbL2, an increment of the luminescent intensity at 545 nm assigned to 5D4 → 7F5 transition of Tb3+ was measured, which was evident to the naked eye. The response showed high selectivity for β-HB compared with other common anions including Cl-, NO3-, CO32-, PO43-, HPO42-, HPO4-, CO42-, PO74-, SO42-, lactate, AcO-, citrate, malate therefore it has the potential to be applied as a luminescent sensor for β-HB.

  1. Structures of Pseudomonas aeruginosa β-ketoacyl-(acyl-carrier-protein) synthase II (FabF) and a C164Q mutant provide templates for antibacterial drug discovery and identify a buried potassium ion and a ligand-binding site that is an artefact of the crystal form

    Energy Technology Data Exchange (ETDEWEB)

    Baum, Bernhard [Johannes Gutenberg-Universität, Staudinger Weg 5, 55128 Mainz (Germany); Lecker, Laura S. M.; Zoltner, Martin [University of Dundee, Dundee DD1 4EH, Scotland (United Kingdom); Jaenicke, Elmar [Johannes Gutenberg-Universität, Jakob Welder Weg 26, 55128 Mainz (Germany); Schnell, Robert [Karolinska Institutet, 17 177 Stockholm (Sweden); Hunter, William N., E-mail: [University of Dundee, Dundee DD1 4EH, Scotland (United Kingdom); Brenk, Ruth, E-mail: [Johannes Gutenberg-Universität, Staudinger Weg 5, 55128 Mainz (Germany)


    Three crystal structures of recombinant P. aeruginosa FabF are reported: the apoenzyme, an active-site mutant and a complex with a fragment of a natural product inhibitor. The characterization provides reagents and new information to support antibacterial drug discovery. Bacterial infections remain a serious health concern, in particular causing life-threatening infections of hospitalized and immunocompromised patients. The situation is exacerbated by the rise in antibacterial drug resistance, and new treatments are urgently sought. In this endeavour, accurate structures of molecular targets can support early-stage drug discovery. Here, crystal structures, in three distinct forms, of recombinant Pseudomonas aeruginosa β-ketoacyl-(acyl-carrier-protein) synthase II (FabF) are presented. This enzyme, which is involved in fatty-acid biosynthesis, has been validated by genetic and chemical means as an antibiotic target in Gram-positive bacteria and represents a potential target in Gram-negative bacteria. The structures of apo FabF, of a C164Q mutant in which the binding site is altered to resemble the substrate-bound state and of a complex with 3-(benzoylamino)-2-hydroxybenzoic acid are reported. This compound mimics aspects of a known natural product inhibitor, platensimycin, and surprisingly was observed binding outside the active site, interacting with a symmetry-related molecule. An unusual feature is a completely buried potassium-binding site that was identified in all three structures. Comparisons suggest that this may represent a conserved structural feature of FabF relevant to fold stability. The new structures provide templates for structure-based ligand design and, together with the protocols and reagents, may underpin a target-based drug-discovery project for urgently needed antibacterials.

  2. pH dependent photophysical studies of new europium and terbium complexes of tripodal ligand: Experimental and semiempirical approach

    Energy Technology Data Exchange (ETDEWEB)

    Akbar, Rifat [Department of Chemistry, Sant Longowal Institute of Engineering & Technology, Longowal, Punjab 148106 (India); Baral, Minati [Department of Chemistry, National Institute of Technology Kurukshetra, Haryana 136119 (India); Kanungo, B K, E-mail: [Department of Chemistry, Sant Longowal Institute of Engineering & Technology, Longowal, Punjab 148106 (India)


    The photophysical properties of adduct of a novel nonadentate tripodal ligand, 5,5′-(2-(((8-hydroxyquinolin-5-yl)methylamino)methyl)-2-methylpropane-1, 3-diyl)bis(azanediyl)bis(methylene diquinolin-8-ol, (TAME5OX), with Eu{sup 3+} and Tb{sup 3+} metal ions have been probed for photonics applications. The absorption spectroscopy of these complexes show remarkable spectral changes due to characteristic lanthanide transitions, which support the use of TAME5OX as a sensitive optical pH based sensor to detect Ln{sup 3+} metal ions in biological systems. In addition, these complexes have also been shown to exhibit strong green fluorescence allowing simultaneous sensing within the visible region under physiological pH in competitive medium for both Eu{sup 3+} and Tb{sup 3+} ions. The intense fluorescence from these compounds were revealed to intermittently get quenched under acidic as well as basic conditions due to the photoinduced intramolecular electron transfer from excited 8-hydroxyquinoline (8-HQ) moiety to metal ion, just an opposite process. This renders these compounds the OFF–ON–OFF type of pH-dependent fluorescent sensor. The thermodynamic stability and aqueous coordination chemistry of the chelator with the said lanthanide ions have also been probed by potentiometric, UV–visible and fluorescence spectrophotometric method. TAME5OX has been found to form two protonated complexes [Ln(H{sub 5}L)]{sup 5+} and [Ln(H{sub 4}L)]{sup 4+} below pH 2.5 with both metal ions, which consecutively deprotonates through one proton process with rise of pH. The formation constants (log β{sub 11n}) of neutral complexes have been determined to be 33.51 and 32.16 with pLn (pLn=−log[Ln{sup 3+}]) values of 16.14 and 19.48 for Eu{sup 3+} and Tb{sup 3+} ions, respectively, calculated at pH 7.4, indicating TAME5OX is a good lanthanide synthetic chelator. The emission lifetimes of the Eu{sup 3+} and Tb{sup 3+} complexes recorded in D{sub 2}O and H{sub 2}O suggest the presence of water molecules in the first coordination sphere of the metal ions. NMR titrations were carried out to determine the stoichiometry of chelates. The complexe's coordination geometries were optimized by using PM7 as sparkle/PM7 model. The theoretical electronic behavior was evaluated to support the experimental findings, based on ZINDO/S methodology at configuration interaction with single excitations (CIS) level. These results emphasize the capability of the use of the theoretical models in prediction of geometries and all other calculations of compounds containing lanthanide ions and create new interesting possibilities for the design in-silico of novel and highly efficient lanthanide–organic edifice. - Highlights: • Photophysical behavior of Eu{sup 3+} and Tb{sup 3+} complexes of TAME5OX has been investigated. • This tripodal ligand forms thermodynamically stable Ln{sup 3+} complexes. • These compounds exhibit strong green fluorescence under physiological pH. • Green fluorescence gets quenched under acidic and basic conditions, due to PET process. • This renders these compounds the OFF–ON–OFF type of pH-dependent fluorescent sensors.

  3. Visible photoluminescence in polycrystalline terbium doped aluminum nitride (Tb:AlN) ceramics with high thermal conductivity (United States)

    Wieg, A. T.; Kodera, Y.; Wang, Z.; Imai, T.; Dames, C.; Garay, J. E.


    Thermal management continues to be one of the major challenges in the development of high powered light sources such as solid state lasers. In particular, the relatively low thermal conductivity of standard photoluminescent (PL) materials limits the overall power output and/or duty cycle. We present a method based on current activated pressure assisted densification for the fabrication of high thermal conductivity PL materials: rare earth doped polycrystalline bulk aluminum nitride. Specifically, the ceramics are translucent and are doped with Tb3+, allowing for emission in the visible. Remarkably, the ceramics have a room temperature thermal conductivity of 94 W/(m K) which is almost seven times higher than that of the state of the art host material, Nd-doped yttrium aluminum garnet. These light emitting properties coupled with very high thermal conductivity should enable the development of a wide variety of more powerful light sources.

  4. Preparation of extractive resins for producing terbium-161; Preparacion de resinas extractivas para produccion de terbio-161

    Energy Technology Data Exchange (ETDEWEB)

    De la Cruz B, C. C.; Monroy G, F. [ININ, Carretera Mexico-Toluca s/n, 52750 Ocoyoacac, Estado de Mexico (Mexico)], e-mail:


    This paper presents the development of a methodology for extractive resins preparation to base of HDEHP, which allows to separation of Tb from Gd generating an own technology of preparation of these resins. The study included the extractive resins preparation from 6 different supports: kieselguhr Dg, alumina, red volcanic rock, chiluca, quarry and fluorite; two treatment types of of supports and varied concentrations of HDEHP extractant (di(2-etil hexyl) orthophosphoric acid), in order to determine which resin has improved efficiency of Gd and Tb separation, and radionuclide purity of {sup 161}Tb. Resins were prepared to base of kieselguhr to determine the most appropriate silicon deposition process. Two silicon deposition treatments were realized: treatment I , by contact with silicon deposition solution (dimethyldichlorosilane / heptane 1:30) and treatment II by contact with vapors of dimethyldichlorosilane in vacuum. The extractant retention was carried out to different concentrations of HDEHP / acetone: 1:4, 1:8, 1:15, 1:20, 1:30 and 1:40. According to the results, there is not direct relation of HDEHP concentration used in extractive resins preparation to base of kieselguhr over the efficiency of Gd and Tb separation and of radionuclide purity of {sup 161}Tb. The effect of support in the efficiency of Gd and Tb separation was studied to prepare resins with the supports kieselguhr, alumina, quarry, chiluca, volcanic rock and fluorite, using the silicon deposition treatment II for the supports and a concentration of HDEHP / acetone 1:20, for extractant retention. Only resins based on kieselguhr could separate to Gd from Tb quantitatively, the resin at a concentration of HDEHP / Acetone 1:20 was the best results obtained in Gd and Tb separation, achieving a separation efficiency greater than 90% and a radionuclide purity higher than 99%. (Author)

  5. Synthesis and Characterization of Europium(III) and Terbium(III) Complexes: An Advanced Undergraduate Inorganic Chemistry Experiment (United States)

    Swavey, Shawn


    Undergraduate laboratories rarely involve lanthanide coordination chemistry. This is unfortunate in light of the ease with which many of these complexes are made and the interesting and instructive photophysical properties they entail. The forbidden nature of the 4f transitions associated with the lanthanides is overcome by incorporation of…

  6. Sensitized green emission of terbium with dibenzoylmethane and 1, 10 phenanthroline in polyvinyl alcohol and polyvinyl pyrrolidone blends (United States)

    Kumar, Brijesh; Kaur, Gagandeep; Rai, S. B.


    Tb doped polyvinyl alcohol: polyvinyl pyrrolidone blends with dibenzoylmethane (DBM) and 1, 10 Phenanthroline (Phen) have been prepared by solution cast technique. Bond formation amongst the ligands and Tb3 + ions in the doped polymer has been confirmed employing Fourier Transform Infrared (FTIR) techniques. Optical properties of the Tb3 + ions have been investigated using UV-Vis absorption, excitation and fluorescence studies excited by different radiations. Addition of dimethylbenzoate and 1, 10 Phenanthroline to the polymer blend increases the luminescence from Tb3 + ions along with energy transfer from the polymer blend itself. Luminescence decay curve analysis affirms the non-radiative energy transfer from DBM and Phen to Tb3 + ions, which is identified as the reason behind this enhancement. The fluorescence decay time of PVA-PVP host decreases from 6.02 ns to 2.31 ns showing an evidence of energy transfer from the host blend to the complexed Tb ions. Similarly the lifetime of DBM and Phen and both in the blend reduces in the complexed system showing the feasibility of energy transfer from these excited DBM and Phen to Tb3 + and is proposed as the cause of the above observations. These entire phenomena have been explained by the energy level diagram.

  7. A Terbium Metal-Organic Framework for Highly Selective and Sensitive Luminescence Sensing of Hg2+Ions in Aqueous Solution. (United States)

    Xia, Tifeng; Song, Tao; Zhang, Gege; Cui, Yuanjing; Yang, Yu; Wang, Zhiyu; Qian, Guodong


    A series of isomorphic lanthanide metal-organic frameworks (MOFs) Ln(TATAB)⋅(DMF) 4 (H 2 O)(MeOH) 0.5 (LnTATAB, Ln=Eu, Tb, Sm, Dy, Gd; H 3 TATAB=4,4',4''-s-triazine-1,3,5-triyltri-p-aminobenzoic acid) have been solvothermally synthesized and structurally characterized. Among these MOFs, TbTATAB exhibits good water stability and a high fluorescence quantum yield. Because mercury ions (Hg 2+ ) have a high affinity to nitrogen atoms, and the space between multiple nitrogen atoms from triazine and imino groups is suitable for interacting with Hg 2+ ions, TbTATAB shows highly selective and sensitive detection of Hg 2+ in aqueous solution with a detection limit of 4.4 nm. Furthermore, it was successfully applied to detect Hg 2+ ions in natural water samples. © 2016 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  8. KN164L01: WHOI cruise 164 leg 01 aboard the R/V Knorr from 2001-10-05 - 2001-10-08 (NODC Accession 0067236) (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — Post-cruise download of raw data from shipboard computer(s) as furnished by the Woods Hole Oceanographic Institution Shipboard Scientific Support Group and archived...

  9. KN164L02: WHOI cruise 164 leg 02 aboard the R/V Knorr from 2001-10-08 - 2001-10-23 (NODC Accession 0070535) (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — Post-cruise download of raw data from shipboard computer(s) as furnished by the Woods Hole Oceanographic Institution Shipboard Scientific Support Group and archived...

  10. Selected Economic Translations on Eastern Europe (164th in the Series) (United States)


    however, only if we cooperate more closely with our workers by drawing them into our collective. The Textile Research Institutes in the GBR ...supplying industries» for example the magnet and membrane plants* In socialist joint work above the plant level, pro- ducer and processing plants must

  11. Ce que nous faisons | Page 164 | CRDI - Centre de recherches pour ...

    International Development Research Centre (IDRC) Digital Library (Canada)

    Amélioration des moyens de subsistance agropastoraux dans le nord-ouest du Yunnan (Chine) - phase II. Sujet(s): Herbages, Terres Communales, Utilisation Du Sol, Gestion Des Terres, Résolution De Conflits, Participation Communautaire, Création D'institutions, Gouvernance. Région(s): Asie, Chine, Extrême-Orient.

  12. Clinics in diagnostic imaging (164). Morel-Lavallée lesion. (United States)

    Cheong, Sook Chuei Wendy; Wong, Bak Siew Steven


    A 31-year-old male motorcyclist presented with prepatellar swelling of the left knee after a collision with a car. Magnetic resonance imaging of the knee showed no bony or ligamentous injury to the knee. Instead, a well-defined, thin-walled, T2-weighted hyperintense fluid collection with internal septations was identified in a prefascial location overlying the left patella and patellar tendon. The findings were in keeping with those of a Morel-Lavallée lesion, a closed internal degloving injury. Morel-Lavallée lesions are occasionally encountered after a blunt soft-tissue trauma. The presentation and imaging features are discussed. Copyright © Singapore Medical Association.

  13. 40 CFR 164.22 - Contents of document setting forth objections. (United States)


    ... 40 Protection of Environment 23 2010-07-01 2010-07-01 false Contents of document setting forth... Contents of document setting forth objections. (a) Concise statement required. Any document containing... registration, or change the classification of a pesticide, shall clearly and concisely set forth such...

  14. FCJ-164 ‘Don’t be Rude on the Road’: Cycle Blogging, Trolling and Lifestyle

    Directory of Open Access Journals (Sweden)

    Steve Jones


    Full Text Available This article examines hostile noise on the UK Guardian’s Bike Blog. Like the Internet, the bicycle has been framed as a redemptive technology at the heart of new forms of urbanity and citizenship. The article examines these struggles, concentrating on how accusations of trolling police the boundaries between cycling as a sphere of autonomous play and a more ‘ethical’ disposition that links cycling to environmental and social responsibility. It argues that a sense of community is established through the embattled relationship with a ‘petrolhead’ mode of online writing which asserts the pleasures of unrestrained lifestyle-as-fun and contests the claims to good citizenship made by pro-cycle bloggers. The article asks whether cycle blogging is constituted by its games of taste and its defensive response to trolling, or if conjoined strategies of netiquette and on-road etiquette framed in terms of ‘responsibility’, offer a route to legitimacy.

  15. 164 antitrypanosomal activity of senna villosa in infected balb/c mice ...

    African Journals Online (AJOL)


    Inhibition of Trypanosoma cruzi growth in mammalian cells by purine and pyrimidine analogs. Antimicrob Agents Chemother. 40:2455-2458. 23. Organización Mundial de la Salud. (2007). Reporte sobre la enfermedad de Chagas. Programa Especial de. Investigaciones y Enseñanzas sobre Enfermedades Tropicales (TDR) ...

  16. Analysis of Optical Variations of BL Lac Object AO 0235+164 Wang ...

    Indian Academy of Sciences (India)

    The author would like to thank Dr. Liu Wenpo from Civil Aviation University of. China for a constructive discussion. He acknowledges the archive data from the. Whole Earth Blazar Telescope (WEBT) consortium. This work is supported by the LangFang Municipal Science and Technology Research and Development Pro-.

  17. : tous les projets | Page 164 | CRDI - Centre de recherches pour le ...

    International Development Research Centre (IDRC) Digital Library (Canada)

    Ce projet concerté examinera le rôle que pourrait jouer le modèle intégré de coopératives pour réduire la pauvreté et favoriser le développement dans les collectivités rurales de l'Afrique. End Date: 16 janvier 2017. Sujet: COOPERATIVES. Région: Canada, South of Sahara, Rwanda, Uganda, Tanzania. Programme: ...


    Directory of Open Access Journals (Sweden)



    Full Text Available Así pues, juega papel importante el maestro de Ciencias Naturales en el proceso de formación de los estudiantes, en tanto mediador simbólico e interpretador de las diferentes variables que convergen e interactúan en los procesos de enseñanza y aprendizaje, como lo son: características socioculturales; en las cuales se lleva a cabo dichos procesos, los intereses y motivaciones de los estudiantes y la organización de la práctica educativa como tal, en donde se encuentran combinadas las intenciones del maestro, el currículo de la institución y los objetivos planteados por los estándares curriculares, fundándose de esta manera, la meta por la calidad educativa. La formación en Biología, es pues, un proceso sutil, ya que se encuentra enmarcada dentro de las ciencias experimentales, pero sobre todo, dentro de las ciencias humanas, aquellas que dan cuenta del valor agregado que adquiere el estudiante como principal actor social, como ser humano en constante interacción con su entorno natural. El maestro debe convertirse en mediador, artista o creativo, al intentar buscar esa interrelación sistémica y armónica entre la acción educativa y el contexto cultural-ambiental, es decir lograr contextualizar los diferentes conocimientos teóricos con la realidad de cada uno de los estudiantes. La formación debe orientarse no sólo al conocimiento

  19. Selected translated abstracts of Russian-language climate-change publications, III aerosols: Issue 164

    Energy Technology Data Exchange (ETDEWEB)

    Razuvaev, V.N.; Ssivachok, S.G. [All-Russian Research Inst. of Hydrometeorological Information-World Data Center, Obninsk (Russian Federation)


    This report presents abstracts in Russian and translated into English of important Russian-language literature concerning aerosols as they relate to climate change. In addition to the bibliographic citations and abstracts translated into English, this report presents the original citations and abstracts in Russian. Author and title indexes are included to assist the reader in locating abstracts of particular interest.

  20. 45 CFR 164.508 - Uses and disclosures for which an authorization is required. (United States)


    ... which students, trainees, or practitioners in mental health learn under supervision to practice or... of the research study,” “none,” or similar language is sufficient if the authorization is for a use... maintenance of a research database or research repository. (vi) Signature of the individual and date. If the...

  1. 40 CFR 65.164 - Performance test and flare compliance determination notifications and reports. (United States)


    ..., record of operating conditions during the test, record of preparation of standards, record of calibrations, raw data sheets for field sampling, raw data sheets for field and laboratory analyses... as the technical or economic infeasibility, or the impracticality, of the source performing the test. ...

  2. 45 CFR 164.524 - Access of individuals to protected health information. (United States)


    ... inmates, or the safety of any officer, employee, or other person at the correctional institution or... paragraph (a)(1) of this section. (ii) A covered entity that is a correctional institution or a covered health care provider acting under the direction of the correctional institution may deny, in whole or in...

  3. Ce que nous faisons | Page 164 | CRDI - Centre de recherches pour ...

    International Development Research Centre (IDRC) Digital Library (Canada)

    Amélioration des moyens de subsistance agropastoraux dans le nord-ouest du Yunnan (Chine) - phase II. On trouve, dans le nord-ouest de la province du Yunnan, une importante ethnie tibétaine minoritaire qui vit principalement dans les régions rurales montagneuses et gère des systèmes de production complexes et ...

  4. 15 CFR 922.164 - Additional activity regulations by Sanctuary area. (United States)


    ... defense, law enforcement, or responses to emergencies that threaten life, property, or the environment... through without interruption or for law enforcement purposes: pole spears, air rifles, bows and arrows, slings, Hawaiian slings, rubber powered arbaletes, pneumatic and spring-loaded guns or similar devices...

  5. 46 CFR 164.018-5 - Specifications and standards incorporated by reference. (United States)


    ... (August 12, 1970), entitled “Cloth, Drill, Cotton.” (4) Federal Specification CCC-C-443 E (December 2, 1974), entitled “Cloth, Duck, Cotton (Single and Plied Filling Yarns, Flat).” (5) Federal Test Method... Inspection, Sampling and Testing.” (Method 6141 “Washability of Paints”, and Method 6142 “Scrub Resistance...

  6. Yeast Interacting Proteins Database: YEL043W, YOR164C [Yeast Interacting Proteins Database

    Lifescience Database Archive (English)

    Full Text Available on quantitative analysis of protein-protein interaction maps; may interact with ribosomes, based on co-purification based on quantitative analysis of protein-protein interaction maps; may interact with ribosomes, based on co-purification studies

  7. 45 CFR 164.520 - Notice of privacy practices for protected health information. (United States)


    ... purposes: treatment, payment, and health care operations. (B) A description of each of the other purposes....526; (E) The right to receive an accounting of disclosures of protected health information as provided... covered health care providers. A covered health care provider that has a direct treatment relationship...

  8. 46 CFR 164.009-3 - Noncombustible materials not requiring specific approval. (United States)


    ... subpart: (a) Sheet glass, block glass, clay, ceramics, and uncoated fibers. (b) All metals, except magnesium and magnesium alloys. (c) Portland cement, gypsum, and magnesite concretes having aggregates of... pumice. (d) Woven, knitted or needle punched glass fabric containing no additives other than lubricants...

  9. General Systems Theory, Systems Analysis, and Regional Planning: An Introductory Bibliography. Exchange Bibliography No. 164. (United States)

    Williams, Hugh E.

    This bibliography suggests a number of introductory readings that will enable regional and urban planners to understand the systems approach. The main focus of the research study that gave rise to this review of the literature was on establishing ways in which decisionmakers in regional planning could be helped in making their choices. The…

  10. 45 CFR 164.514 - Other requirements relating to uses and disclosures of protected health information. (United States)


    ... Locators (URLs); (O) Internet Protocol (IP) address numbers; (P) Biometric identifiers, including finger... covered entity must identify: (A) Those persons or classes of persons, as appropriate, in its workforce... to limit the access of such persons or classes identified in paragraph (d)(2)(i)(A) of this section...

  11. SU-E-J-164: Verification of Commercial Respiratory Tracking System Using Scintillation Screen. (United States)

    Lim, S


    The accuracy of the tracking system is critical for the result of four-dimensional radiation therapy. The objective of this study is to propose the method of verifying the accuracy of respiratory tracking system. The scintillation screen and the light marker between the transparent acrylic plates were designed to move according to the prerecorded respiratory organ motion of volunteers. A vertical circle photon beam with 3 cm diameters from the cyberknife unit was planned to track the motion of the scintillation screen with the plates. In dark room, the CCD camera outside of the phantom captured the scintillation from the screen and the light marker in 30 frames per second when the photon beam was incident. The pictures were captured by the CCD camera were analyzed frame by frame, and the discrepancy between the scintillating circle on the scintillation screen and the light marker depending on the time was measured. The discrepancy of the motions of the delivered photon beam and the light marker was analyzed. In the preliminary study, the maximum discrepancy was measured less than 1.5 mm in normal breathing pattern as the manufacturer specified it. As the speed of the motion was increased, the discrepancy between the position of the beam and internal marker increased. However, the error was clinically acceptable. The further study will be performed for the irregular respiratory motion patterns. This research was supported by Basic Science Research Program through the National Research Foundation of Korea (NRF) funded by the Ministry of Education, Science and Technology (20110004848). © 2012 American Association of Physicists in Medicine.

  12. Yeast Interacting Proteins Database: YJL164C, YIL033C [Yeast Interacting Proteins Database

    Lifescience Database Archive (English)

    Full Text Available tein kinase (PKA), a component of a signaling pathway that controls a variety of cellular processes, includi...dependent protein kinase (PKA), a component of a signaling pathway that controls a variety of cellular processes

  13. 33 CFR 164.74 - Towline and terminal gear for towing astern. (United States)


    ...) Appropriate for exposure to the marine environment and to any chemicals used or carried on board the vessel... bollard pull of the vessel; (ii) Appropriate for the static loads and dynamic loads expected during the... the strength and anticipated loading of the towline and for the environment; (2) Each connection is...

  14. Evaluation of serum cobalamin concentrations in dogs of 164 dog breeds (2006-2010). (United States)

    Grützner, Niels; Cranford, Shannon M; Norby, Bo; Suchodolski, Jan S; Steiner, Jörg M


    Altered serum cobalamin concentrations have been observed in dogs with gastrointestinal disorders such as exocrine pancreatic insufficiency (EPI) or gastrointestinal inflammation. The aims of the current study were 1) to identify breeds with a higher proportion of dogs with a decreased serum cobalamin concentration, 2) to determine whether dogs with such decreased concentrations tend to have serum canine trypsin-like immunoreactivity (cTLI) concentrations diagnostic for EPI, and 3) to compare the number of submissions for serum cobalamin analysis by breed to the American Kennel Club (AKC) breed ranking list of 2009. In this retrospective study, results of 28,675 cobalamin tests were reviewed. Akitas, Chinese Shar-Peis, German Shepherd Dogs, Greyhounds, and Labrador Retrievers had increased proportions of serum cobalamin concentrations below the lower limit of the reference interval (Dogs, and Border Collies had increased proportions of serum cobalamin concentrations below the detection limit of the assay (Dogs with serum cobalamin concentrations <150 ng/l were more likely to have a serum cTLI concentration considered diagnostic for EPI (≤2.5 µg/l; all P ≤ 0.001). The breed with the highest proportion of samples submitted for serum cobalamin analysis in comparison with the AKC ranking list was the Greyhound (odds ratio: 84.6; P < 0.0001). In Akitas and Border Collies, further investigations are warranted to clarify if a potentially breed-specific gastrointestinal disorder is responsible for the increased frequency of decreased serum cobalamin and cTLI concentrations.

  15. SU-E-T-164: Characterization of Breast Deformation During Accuboost TM Treatment

    Energy Technology Data Exchange (ETDEWEB)

    Garcia-Cobian, J; Liu, F [Rhode Island Hospital / Warren Alpert Medical, Providence, RI (United States)


    Purpose: During treatment using AccuboostTM (Advanced Radiation Therapy, Tyngsboro, MA) applicators the breast is compressed between two paddles in order to immobilize it. This causes the breast tissue to expand. The purpose of this study was to analyze the nature of this deformation. Methods: CT scans of a breast phantom (Computerized Imaging Reference Systems, Norfolk, VA) were acquired at different compressions in the cranial-caudal (CC) direction. These were performed by placing the phantom between two plates whose position is controlled by a manual crank. The phantom masses were contoured in order to simulate the clips placed after surgery. For all scans the mean distance between the masses was computed. Additionally, deformable registration was performed between two scans using the Velocity software (Varian Medical Systems, Palo Alto, CA) to assess the shifts of each of these masses. Results: As the compression increases so does the average distance between the masses. The relationship between deformation and compression is not linear. Additionally, the largest displacements are in the direction of compression. The mean shift is 1.8mm. The shifts in the RT-LT direction and ANT-POST direction are 1.1 mm and 0.7 mm respectively Conclusion: When treating patients the clips shift their position as a Result of the plate compression. For CC compressions this is not a problem if they shift their position primarily in the superior-inferior direction. The problem of not being able to cover all clips (target area) can arise when they shift position on a plane perpendicular to the patient. For clips which are already near the chest wall, care should be exercised not to compress the breast in such a way as to move those clips out of the treatable area.These preliminary results show a larger shift in the RT-LT direction than the ANT-POST one. Further research will seek to either confirm or infirm this.

  16. Dugway Proving Ground: Closure Plan Module 2, for SWMUs 20, 164, 166 and 170 (United States)


    PAGE wApme Pubiner soll Moo"" NtIso doem~ me soW N mq Va S amoay uaggm 8=0 "porn soV b~ Someo a a" motra~ioofso -.,,d I, bi~mn bainowi amemminea fr...cross the placenta and accumulate in the amniotic fluid (Danielsson and others, 1986). Associated developmental effects of high doses of chloroform in...inhalation exposure to chromium (VI) compounds. Other effects observed following chromium (VI) exposure include effects on the immune system, nervous

  17. Anti-L1CAM radioimmunotherapy is more effective with the radiolanthanide terbium-161 compared to lutetium-177 in an ovarian cancer model

    Energy Technology Data Exchange (ETDEWEB)

    Gruenberg, Juergen; Lindenblatt, Dennis; Cohrs, Susan; Fischer, Eliane [Paul Scherrer Institute, Center for Radiopharmaceutical Sciences ETH-PSI-USZ, Villigen (Switzerland); Dorrer, Holger [Paul Scherrer Institute, Laboratory of Radiochemistry and Environmental Chemistry, Villigen (Switzerland); Zhernosekov, Konstantin [ITG Isotope Technologies Garching GmbH, Garching (Germany); Koester, Ulli [Institut Laue-Langevin, Grenoble (France); Tuerler, Andreas [Paul Scherrer Institute, Laboratory of Radiochemistry and Environmental Chemistry, Villigen (Switzerland); University of Bern, Department of Chemistry and Biochemistry, Berne (Switzerland); Schibli, Roger [Paul Scherrer Institute, Center for Radiopharmaceutical Sciences ETH-PSI-USZ, Villigen (Switzerland); ETH Zurich, Department of Chemistry and Applied Biosciences, Zurich (Switzerland)


    The L1 cell adhesion molecule (L1CAM) is considered a valuable target for therapeutic intervention in different types of cancer. Recent studies have shown that anti-L1CAM radioimmunotherapy (RIT) with {sup 67}Cu- and {sup 177}Lu-labelled internalising monoclonal antibody (mAb) chCE7 was effective in the treatment of human ovarian cancer xenografts. In this study, we directly compared the therapeutic efficacy of anti-L1CAM RIT against human ovarian cancer under equitoxic conditions with the radiolanthanide {sup 177}Lu and the potential alternative {sup 161}Tb in an ovarian cancer therapy model. Tb was produced by neutron bombardment of enriched {sup 160}Gd targets. {sup 161}Tb and {sup 177}Lu were used for radiolabelling of DOTA-conjugated antibodies. The in vivo behaviour of the radioimmunoconjugates (RICs) was assessed in IGROV1 tumour-bearing nude mice using biodistribution experiments and SPECT/CT imaging. After ascertaining the maximal tolerated doses (MTD) the therapeutic impact of 50 % MTD of {sup 177}Lu- and {sup 161}Tb-DOTA-chCE7 was evaluated in groups of ten mice by monitoring the tumour size of subcutaneous IGROV1 tumours. The average number of DOTA ligands per antibody was 2.5 and maximum specific activities of 600 MBq/mg were achieved under identical radiolabelling conditions. RICs were stable in human plasma for at least 48 h. {sup 177}Lu- and {sup 161}Tb-DOTA-chCE7 showed high tumour uptake (37.8-39.0 %IA/g, 144 h p.i.) with low levels in off-target organs. SPECT/CT images confirmed the biodistribution data. {sup 161}Tb-labelled chCE7 revealed a higher radiotoxicity in nude mice (MTD: 10 MBq) than the {sup 177}Lu-labelled counterpart (MTD: 12 MBq). In a comparative therapy study with equitoxic doses, tumour growth inhibition was better by 82.6 % for the {sup 161}Tb-DOTA-chCE7 than the {sup 177}Lu-DOTA-chCE7 RIT. Our study is the first to show that anti-L1CAM {sup 161}Tb RIT is more effective compared to {sup 177}Lu RIT in ovarian cancer xenografts. These results suggest that {sup 161}Tb is a promising candidate for future clinical applications in combination with internalising antibodies. (orig.)

  18. CCDC 954774: Experimental Crystal Structure Determination : Dimethylammonium tri-terbium tris(4'-(tetrazol-2-id-5-yl)biphenyl-4-carboxylate) tetrahydroxide trihydrate unknown solvate

    KAUST Repository

    Xue, Dongxu


    An entry from the Cambridge Structural Database, the world’s repository for small molecule crystal structures. The entry contains experimental data from a crystal diffraction study. The deposited dataset for this entry is freely available from the CCDC and typically includes 3D coordinates, cell parameters, space group, experimental conditions and quality measures.

  19. CCDC 959634: Experimental Crystal Structure Determination : octakis(mu~3~-Hydroxo)-undecakis(mu~2~-2-fluorobenzoato)-(N,N-dimethylformamide)-nitrato-hexa-aqua-hexa-terbium

    KAUST Repository

    Guillerm, Vincent


    An entry from the Cambridge Structural Database, the world’s repository for small molecule crystal structures. The entry contains experimental data from a crystal diffraction study. The deposited dataset for this entry is freely available from the CCDC and typically includes 3D coordinates, cell parameters, space group, experimental conditions and quality measures.

  20. CCDC 954773: Experimental Crystal Structure Determination : Dimethylammonium tri-terbium tris(4-(tetrazol-2-id-5-yl)benzoate) tetrahydroxide trihydrate unknown solvate

    KAUST Repository

    Xue, Dongxu


    An entry from the Cambridge Structural Database, the world’s repository for small molecule crystal structures. The entry contains experimental data from a crystal diffraction study. The deposited dataset for this entry is freely available from the CCDC and typically includes 3D coordinates, cell parameters, space group, experimental conditions and quality measures.

  1. CCDC 954775: Experimental Crystal Structure Determination : Dimethylammonium tri-terbium tris(2-fluoro-4-(1H-tetrazol-5-yl)benzoate) tetrahydroxide tetradecahydrate

    KAUST Repository

    Xue, Dongxu


    An entry from the Cambridge Structural Database, the world’s repository for small molecule crystal structures. The entry contains experimental data from a crystal diffraction study. The deposited dataset for this entry is freely available from the CCDC and typically includes 3D coordinates, cell parameters, space group, experimental conditions and quality measures.

  2. CCDC 1411423: Experimental Crystal Structure Determination : catena-[dimethylammonium hexakis(mu-fumarato)-octakis(mu-hydroxo)-hexa-terbium N,N-dimethylformamide solvate hexahydrate

    KAUST Repository

    Assen, Ayalew H.


    An entry from the Cambridge Structural Database, the world’s repository for small molecule crystal structures. The entry contains experimental data from a crystal diffraction study. The deposited dataset for this entry is freely available from the CCDC and typically includes 3D coordinates, cell parameters, space group, experimental conditions and quality measures.

  3. CCDC 1410946: Experimental Crystal Structure Determination : catena-[dimethylammonium tris(mu-naphthalene-1,4-dicarboxylato)-tetrakis(mu-hydroxo)-triaqua-tri-terbium(iii) unknown solvate

    KAUST Repository

    Xue, Dongxu


    An entry from the Cambridge Structural Database, the world’s repository for small molecule crystal structures. The entry contains experimental data from a crystal diffraction study. The deposited dataset for this entry is freely available from the CCDC and typically includes 3D coordinates, cell parameters, space group, experimental conditions and quality measures.

  4. Phthalimides: Supramolecular Interactions in Crystals, Hypersensitive Solution 1H-NMR Dynamics and Energy Transfer to Europium(III and Terbium(III States

    Directory of Open Access Journals (Sweden)

    David J. Williams


    Full Text Available Detailed crystal structures and 1H-NMR characteristics of some alkylaminephthalimides, including dendritic polyphthalimides, are reported. These investigations were undertaken in order to obtain a better understanding of the relationship between solid-state supramolecular interactions, their persistence in solution and associated dynamics of magnetically hypersensitive phthalimide aromatic AA'BB'-AA'XX' proton NMR resonances. Some alkylamine phthalimides feature folded molecular geometries, which we attribute to n-π interactions among proximal amine-phthalimide sites; those alkylamine-phthalimides that have no possibility for such interactions feature fully extended phthalimide functionalities. Accordingly, alkylamine phthalimide compounds with folded solid-state geometries feature solvent and temperature dependent hypersensitive AA'BB'-AA'XX' 1H-NMR line profiles, which we attribute to the n-π interactions. Luminescence of Eu3+(5D0 and Tb3+(5D4 states show well defined metal ion environments in their complexes with dendritic phthalimides, as well as relatively weak phthalimide-lanthanide(III interactions.

  5. Analysis of tryptophan at nmoll(-1) level based on the fluorescence enhancement of terbium-gadolinium-tryptophan-sodium dodecyl benzene sulfonate system. (United States)

    Liu, Shufang; Yang, Jinghe; Wu, Xia; Su, Benyu; Sun, Changxia; Wang, Feng


    It is found that Tb(3+) can react with tryptophan (Trp) and sodium dodecyl benzene sulfonate (SDBS), and emits the intrinsic fluoresence of Tb(3+). The fluorescence intensity can be enhanced by La(3+), Gd(3+), Lu(3+), Sc(3+) and Y(3+), among which Gd(3+) has the greatest enhancement. This is a new co-luminescence system. The studies indicate that in the Tb-Gd-Trp-SDBS system, there is both Tb-Trp-SDBS and Gd-Trp-SDBS complexes, and they aggregate together and form a large congeries. The fluorescence enhancement of the Tb-Gd-Trp-SDBS system is considered to originate from intramolecular and intermolecular energy transfers, and the energy-insulating sheath effect of Gd-Trp-SDBS complex. Under the optimum conditions, the enhanced intensity of fluorescence is in proportion to the concentration of Trp in the range from 4x10(-8) to 4x10(-5)moll(-1). The detection limit is 10(-9)moll(-1). The proposed method is one of the most sensitive fluoremetries of Trp.

  6. Preparation, characterization, and properties of PMMA-doped polymer film materials: a study on the effect of terbium ions on luminescence and lifetime enhancement. (United States)

    Zhang, Hui-Jie; Fan, Rui-Qing; Wang, Xin-Ming; Wang, Ping; Wang, Yu-Lei; Yang, Yu-Lin


    Poly(methylmethacrylate) (PMMA) doped with Tb-based imidazole derivative coordination polymer {[Tb(3)(L)(μ(3)-OH)(7)]·H(2)O}(n) (1) (L = N,N'-bis(acetoxy)biimidazole) was synthesized and its photophysical properties were studied. The L'(L' = N,N'-bis(ethylacetate)biimidazole) ligand was synthesized by an N-alkylation reaction process followed by ester hydrolysis to produce ligand L. Polymer 1 and ligand L' have been characterized by (1)H NMR and IR spectroscopy, elemental analysis, PXRD and X-ray single-crystal diffraction. Coordination polymer 1 is the first observation of a CdCl(2) structure constructed with hydroxy groups and decorated by ligand L in lanthanide N-heterocyclic coordination polymers. In the 2D layered structure of 1, each Tb3 metal center is connected with three Tb1 and three Tb2 metal centers by seven hydroxyl groups in different directions, resulting in a six-membered ring. After doping, not only the luminescence intensity and lifetime enhanced, but also their thermal stability was increased in comparison with 1. When 1 was doped into poly(methylmethacrylate) (1@PMMA), polymer film materials were formed with the PMMA polymer matrix (w/w = 2.5%-12.5%) acting as a co-sensitizer for Tb(3+) ions. The luminescence intensity of the Tb(3+) emission at 544 nm increases when the content of Tb(3+) was 10%. The lifetime of 1@PMMA (914.88 μs) is more than four times longer than that of 1 (196.24 μs). All τ values for the doped polymer systems are higher than coordination polymer 1, indicating that radiative processes are operative in all the doped polymer films. This is because PMMA coupling with the O-H oscillators from {[Tb(3)(L)(μ(3)-OH)(7)]·H(2)O}(n) can suppress multiphonon relaxation. According to the variable-temperature luminescence (VT-luminescence) investigation, 1@PMMA was confirmed to be a stable green luminescent polymer film material.

  7. Changing Single-Molecule Magnet Properties of a Windmill-Like Distorted Terbium(III) α-Butoxy-Substituted Phthalocyaninato Double-Decker Complex by Protonation/Deprotonation. (United States)

    Horii, Yoji; Horie, Yusuke; Katoh, Keiichi; Breedlove, Brian K; Yamashita, Masahiro


    Synthesis, structures, and magnetic properties of α-butoxy-substituted phthalocyaninato double-decker complexes Tb(α-obPc)2 (1-) (α-obPc: dianion of 1,4,8,11,15,18,22,25-octa(n-butoxy)phthalocyaninato) with protonated (1H), deprotonated (1[HDBU]), and diprotonated forms (1H2+) are discussed. X-ray analysis was used to confirm the position of the proton in 1H, and it was revealed that the protonation induced asymmetric distortion in 1H. In contrast, 1[HDBU] was distorted in a highly symmetric windmill-like fashion. 1H is arranged in a slipped column array in the crystal packing, whereas 1[HDBU] is arranged in a one-dimensional fashion, in which the magnetic easy axes of 1[HDBU] lie along the same line. From direct-current (dc) magnetic measurements, ferromagnetic Tb-Tb interactions occur in both 1H and 1[HDBU], and magnetic hysteresis was observed. However, the area of the magnetic hysteresis in 1[HDBU] is larger than that in 1H, meaning that magnetic relaxation time (τ) is longer in 1[HDBU]. In addition, the results of alternating-current magnetic measurements in a zero dc magnetic field indicate that τ of 1[HDBU] is longer as compared to 1H. In other words, protonation/deprotonation affects not only the molecular structures and crystal packing but also the single-molecule magnet properties.

  8. A Water-Stable Dual-Channel Luminescence Sensor for UO22+Ions Based on an Anionic Terbium(III) Metal-Organic Framework. (United States)

    Ye, Junwei; Bogale, Raji F; Shi, Yangwei; Chen, Yanzhen; Liu, Xigang; Zhang, Siqi; Yang, Yaoyao; Zhao, Jianzhang; Ning, Guiling


    A stable 3D Tb III -based metal-organic framework [Tb(BPDC) 2 ]⋅(CH 3 ) 2 NH 2 (DUT-101) was synthesized, and it is the first efficient dual-channel luminescence sensor for aqueous UO 2 2+ ions. DUT-101 contains an anionic three-dimensional framework and protonated dimethylamine molecules embedded within the channels. The intense green emission of DUT-101 could be highly selectively and sensitively quenched by UO 2 2+ ions even in the presence of other competing metal ions. A possible sensing mechanism was proposed based on both suppression of luminescence resonance energy transfer and enhancement of intermolecular electron transfer. Furthermore, visual green fluorescent test papers based on DUT-101 were fabricated and could be used to discriminate UO 2 2+ ions among various metal ions. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  9. [?-N,N?-Bis(3-meth?oxy-2-oxidobenzyl?idene)propane-1,3-diamine]trinitratocopper(II)terbium(III) acetone solvate


    Zhang Fang; Liu Fei


    In the title complex, [CuTb(C19H20N2O4)(NO3)3]·CH3COCH3, the CuII atom is four-coordinated by two O atoms and two N atoms from the deprotonated Schiff base in a square-planar geometry, while the TbIII atom is ten-coordinated by four O atoms from the deprotonated Schiff base and six O atoms from three bidentate nitrate anions. The compound is isostructural with the previously reported GdIII analogue [Elmali & Elerman (2004). Z. Naturforsch. Teil B, 59, 535–540], which was described ...

  10. Crystal structure of a mixed-ligand terbium(III coordination polymer containing oxalate and formate ligands, having a three-dimensional fcu topology

    Directory of Open Access Journals (Sweden)

    Chainok Kittipong


    Full Text Available The title compound, poly[(μ3-formato(μ4-oxalatoterbium(III], [Tb(CHO2(C2O4]n, is a three-dimensional coordination polymer, and is isotypic with the LaIII, CeIII and SmIII analogues. The asymmetric unit contains one TbIII ion, one formate anion (CHO2− and half of an oxalate anion (C2O42−, the latter being completed by application of inversion symmetry. The TbIII ion is nine-coordinated in a distorted tricapped trigonal–prismatic manner by two chelating carboxylate groups from two C2O42− ligands, two carboxylate oxygen atoms from another two C2O42− ligands and three oxygen atoms from three CHO2− ligands, with the Tb—O bond lengths and the O—Tb—O bond angles ranging from 2.4165 (19 to 2.478 (3 Å and 64.53 (6 to 144.49 (4°, respectively. The CHO2− and C2O42− anions adopt μ3-bridging and μ4-chelating-bridging coordination modes, respectively, linking adjacent TbIII ions into a three-dimensional 12-connected fcu topology with point symbol (324.436.56. The title compound exhibits thermal stability up to 623 K, and also displays strong green photoluminescence in the solid state at room temperature.

  11. CCDC 1410822: Experimental Crystal Structure Determination : heptakis(dimethylammonium) dodecakis(mu-hydroxo)-bis(mu-oxo)-nonaaqua-nona-terbium tris(octakis(mu-hydroxo)-triaqua-bis(2-fluorobenzoato)-bis(formato)-hexa-terbium) dodecakis(5-[(4-carboxylatophenyl)methoxy]benzene-1,3-dicarboxylate) unknown solvate

    KAUST Repository

    Alezi, Dalal


    An entry from the Cambridge Structural Database, the world’s repository for small molecule crystal structures. The entry contains experimental data from a crystal diffraction study. The deposited dataset for this entry is freely available from the CCDC and typically includes 3D coordinates, cell parameters, space group, experimental conditions and quality measures.

  12. Risk behaviors for the health of adolescents from High School - doi:10.5020/18061230.2009.p164

    Directory of Open Access Journals (Sweden)

    Eliane Denise da Silveira Araújo


    Full Text Available Objective: To investigate the risk behaviors (smoking addiction, alcoholism, drug use and sexual risk behavior of adolescents from High School. Methods: It was an analytical and cross-sectional study. The sample consisted of 720 scholars (252 boys and 468 girls from the age group of 16 to 17 years-old, from three public schools in Florianopolis/SC. The data was collected through two types of self administrated questionnaires; one for the parents and another one for the students, from March to December, 2005. The studied variables were legal and illegal drug use and sexual risk behavior. The descriptive statistics and the chi- squared test were used to carry out the data analysis Results: The beginning of risk behaviors occurred between 14 and 15 years old, for both genders. It was observed that 26 (3.6% scholars drank alcohol regularly; 38 (5.3% smoked daily; 66 (9.2 % were drug users or had used drugs several times and 14 (2% were drug dependents. Concerning to sexual risk behavior, 318 (44.5% scholars had sexual risk behavior and from those, 97 (13.6% did not always use condom. From the studied sample, 545 (76.5% scholars did not present any risk behavior. Among risk behaviors, sexual risk prevailed (42.5%. Conclusion: The number of adolescents with risk behavior was not high. Nevertheless, there is a small proportion of adolescents that smoke, drink and do drugs and have sexual risk behavior. Thispoints out to the need of a bigger supervision and guidance for these students.

  13. Precise methane absorption measurements in the 1.64 μm spectral region for the MERLIN mission (United States)

    Delahaye, T.; Maxwell, S. E.; Reed, Z. D.; Lin, H.; Hodges, J. T.; Sung, K.; Devi, V. M.; Warneke, T.; Spietz, P.; Tran, H.


    In this article we describe a high-precision laboratory measurement targeting the R(6) manifold of the 2ν3 band of 12CH4. High-fidelity modeling of this absorption spectrum for atmospheric temperature and pressure conditions will be required by the Franco-German, Methane Remote Sensing LIDAR (MERLIN) space mission for retrievals of atmospheric methane. The analysis uses the Hartmann-Tran profile for modeling line shape and also includes line-mixing effects. To this end, six high-resolution and high signal-to-noise ratio absorption spectra of air-broadened methane were recorded using a frequency-stabilized cavity ring-down spectroscopy apparatus. Sample conditions corresponded to room temperature and spanned total sample pressures of 40 hPa-1013 hPa with methane molar fractions between 1 µmol mol-1 and 12 µmol mol-1. All spectroscopic model parameters were simultaneously adjusted in a multispectrum nonlinear least squares fit to the six measured spectra. Comparison of the fitted model to the measured spectra reveals the ability to calculate the room temperature, methane absorption coefficient to better than 0.1% at the online position of the MERLIN mission. This is the first time that such fidelity has been reached in modeling methane absorption in the investigated spectral region, fulfilling the accuracy requirements of the MERLIN mission. We also found excellent agreement when comparing the present results with measurements obtained over different pressure conditions and using other laboratory techniques. Finally, we also evaluated the impact of these new spectral parameters on atmospheric transmissions spectra calculations.

  14. School Feeding Analysis in the context of a Food and Nutrition Program - doi:10.5020/18061230.2006.p164

    Directory of Open Access Journals (Sweden)

    Dixis Figueroa Pedraza


    Full Text Available The diversity of standards related to school feeding makes it a complex topic and difficult to lead with. This research aimed at reflecting on the essential aspects of the subject, in a bibliographical revision of global proposal that was based on what the term “program” represents. The School Feeding Program means a combination of projects addressed to bring meals to keep students nourished, independent of their condition. This concept implies that all School Feeding Program should consist of three stages: design, carrying out and evaluation. The design includes important controversial aspects, related to school feeding, such as: the program objectives, their relationship with starvation, malnutrition and school failure; and the distinction of treating this matter from the perspective of breeding right. There are significant differences among experiences in running School Feeding Programs in developed and in developing countries, as well as within the last ones. The evaluation stage usually is not well designed or it is not considered. This stage is really important and it is addressed to determine if the outcomes are corresponding to planned objectives. In order to complete a useful evaluation stage, the use of proper indicators is a main point. Finally, a whole analysis of the Program is carried out in order to obtain unquestionable results. The School Feeding Program is discussed as a Public Policy, into the context of Food Security and the other complementary activities included in it. The proposed view considers school feeding as a right that must be satisfied in the implementation of organized projects.

  15. rm. J. Biol. Chem. Sci. 1(2); 158-164, 2007 “1mm;“m“f

    African Journals Online (AJOL)

    were prepared at various dilutions and plated on selective media for Coryneforrns, Escherichia coli,. Enterococcus faeoalis and ... Keywords: Escherichia coli, Pseudomonas, Coryneforms, Enterococcus faecalis, chicken, ostrich, faeces. INTRODUCTION .... Colony Description Species AFRC ACC A0. Dark yellow centered ...

  16. The Transfer of HRM Policies and Practices in American Multinational Hotels in Saudi Arabia (P.155-164

    Directory of Open Access Journals (Sweden)

    Amal Hatem Alkhaldi


    Full Text Available Global   competition   in   the   international   business   environment has   pushed companies to achieve competitive advantage through mergers, acquisitions and through locating their subsidiaries in less developed counties for cost effectiveness. Consequently, the competitive pressure has increased the significance of human resource management (HRM in multinational companies (MNCs, and MNCs have recognised the significance of the transfer HRM process across borders. This study examines the transfer of HRM policies and practices of US MNCs to their subsidiaries in Saudi Arabia. The aim of the study is to determine the extent to which US MNCs transfer HRM policies and practices from their Headquarters to their subsidiaries in Saudi Arabia; and identify the factors that facilitate and inhibit HRM transfer. The paper is based on an investigation of the interaction between home-country and host-country effects in determining HRM policies and practices in MNCs in the context of the Middle East. The study adopts a mixed methods approach of documentary analysis, focus group interviews of employees and in depth interviews of key informants in four subsidiaries of US owned international hotel chains located in Riyadh, Saudi Arabia.Keywords: Home  country, host  country, human  resource  managem transfer,Institutional theory, culture conditions.

  17. Long-lasting fibrin matrices ensure stable and functional angiogenesis by highly tunable, sustained delivery of recombinant VEGF164


    Sacchi, Veronica; Mittermayr, Rainer; Hartinger, Joachim; Martino, Mikaël M.; Lorentz, Kristen M.; Wolbank, Susanne; Hofmann, Anna; Largo, Remo A.; Marschall, Jeffrey S.; Groppa, Elena; Gianni-Barrera, Roberto; Ehrbar, Martin; Hubbell, Jeffrey A.; Redl, Heinz; Banfi, Andrea


    Inducing the growth of new blood vessels by specific factors is an attractive strategy to restore blood flow in ischemic tissues. Vascular endothelial growth factor (VEGF) is the master regulator of angiogenesis, yet clinical trials of VEGF gene delivery failed. Major challenges include the need to control the tissue distribution of factor dose and the duration of expression. Here, we developed a highly tunable fibrin-based platform to precisely control the dose and duration of VEGF protein d...

  18. 15 CFR 16.4 - Finding of need to establish a specification for labeling a consumer product. (United States)


    ... writing and will, to the extent practicable, include the following information: (1) Identification of the... difficulty experienced by consumers in making informed purchase decisions because of a lack of knowledge... requests and shall notify the requester of her decision in writing. If the Secretary determines that there...

  19. SU-E-T-164: Clinical Implementation of ASi EPID Panels for QA of IMRT/VMAT Plans. (United States)

    Hosier, K; Wu, C; Beck, K; Radevic, M; Asche, D; Bareng, J; Kroner, A; Lehmann, J; Logsdon, M; Dutton, S; Rosenthal, S


    To investigate various issues for clinical implementation of aSi EPID panels for IMRT/VMAT QA. Six linacs are used in our clinic for EPID-based plan QA; two Varian Truebeams, two Varian 2100 series, two Elekta Infiniti series. Multiple corrections must be accounted for in the calibration of each panel for dosimetric use. Varian aSi panels are calibrated with standard dark field, flood field, and 40×40 diagonal profile for beam profile correction. Additional corrections to account for off-axis and support arm backscatter are needed for larger field sizes. Since Elekta iViewGT system does not export gantry angle with images, a third-party inclinometer must be physically mounted to back of linac gantry and synchronized with data acquisition via iViewGT PC clock. A T/2 offset correctly correlates image and gantry angle for arc plans due to iView image time stamp at the end of data acquisition for each image. For both Varian and Elekta panels, a 5 MU 10×10 calibration field is used to account for the nonlinear MU to dose response at higher energies. Acquired EPID images are deconvolved via a high pass filter in Fourier space and resultant fluence maps are used to reconstruct a 3D dose 'delivered' to patient using DosimetryCheck. Results are compared to patient 3D dose computed by TPS using a 3D-gamma analysis. 120 IMRT and 100 VMAT cases are reported. Two 3D gamma quantities (Gamma(V10) and Gamma(PTV)) are proposed for evaluating QA results. The Gamma(PTV) is sensitive to MLC offsets while Gamma(V10) is sensitive to gantry rotations. When a 3mm/3% criteria and 90% or higher 3D gamma pass rate is used, all IMRT and 90% of VMAT QA pass QA. After appropriate calibration of aSi panels and setup of image acquisition systems, EPID based 3D dose reconstruction method is found clinically feasible. © 2012 American Association of Physicists in Medicine.



  1. A validated spectrofluorimetric method for the determination of citalopram in bulk and pharmaceutical preparations based on the measurement of the silver nanoparticles-enhanced fluorescence of citalopram/terbium complexes. (United States)

    Khan, Muhammad Naeem; Shah, Jasmin; Jan, Muhammad Rasul; Lee, Sang Hak


    A simple, sensitive, and accurate spectrofluorimetric method was developed for the determination of citalopram in bulk and pharmaceutical preparations. The method is based on the enhancement of the weak fluorescence signal (FL) of the Tb (III)-citalopram system in the presence of silver nanoparticles. Fluorescence intensities were measured at 555 nm after excitation at 281 nm. Prepared silver nanoparticles (AgNPs) were characterized by UV-Visible spectra and transmission electron microscopy (TEM). Various factors affecting the formation of citalopram-Tb (III)-AgNPs complexes were studied and optimized. The fluorescence intensity versus concentration plot was linear over the range 0.02-14 μg mL(-1), with an excellent correlation coefficient of 0.9978. The limit of detection (LOD) and limit of quantification (LOQ) were found to be 7.15 × 10(-6) μg mL(-1) and 2.38 × 10(-5) μg mL(-1) respectively. The proposed method was found to have good reproducibility with a relative standard deviation of 3.66% (n = 6). The interference effects of common excipients found in pharmaceutical preparations were studied. The developed method was validated statistically by performing recoveries studies and successfully applied for the assay of citalopram in bulk powder and pharmaceutical preparations. Percent recoveries were found to range from 98.98% to 100.97% for bulk powder and from 96.57% to 101.77% for pharmaceutical preparations.

  2. A "plug-and-play" approach to the preparation of transparent luminescent hybrid materials based on poly(methyl methacrylate), a calix[4]arene cross-linking agent, and terbium ions. (United States)

    Driscoll, Christopher R; Reid, Brodie L; McIldowie, Matthew J; Muzzioli, Sara; Nealon, Gareth L; Skelton, Brian W; Stagni, Stefano; Brown, David H; Massi, Massimiliano; Ogden, Mark I


    A novel methodology to prepare transparent luminescent hybrid materials is reported. Using a calixarene ionophore as a PMMA cross-linker avoids problems, such as phase segregation, and produces a polymer monolith that can be loaded with the metal ion required for luminescence post-synthesis. This approach is versatile and will simplify the production of such materials.

  3. CCDC 954772: Experimental Crystal Structure Determination : catena-(Dimethylammonium tris(mu~4~-3-fluorobiphenyl-4,4'-dicarboxylato)-tetrakis(mu~3~-hydroxo)-triaqua-tri-terbium unknown solvate)

    KAUST Repository

    Xue, Dongxu


    An entry from the Cambridge Structural Database, the world’s repository for small molecule crystal structures. The entry contains experimental data from a crystal diffraction study. The deposited dataset for this entry is freely available from the CCDC and typically includes 3D coordinates, cell parameters, space group, experimental conditions and quality measures.

  4. CCDC 1410820: Experimental Crystal Structure Determination : heptakis(dimethylammonium) heptacosa-terbium dodecakis((1,1'-biphenyl)-3,4',5-tricarboxylate) hexakis(2-fluorobenzoate) hexakis(formate) hexatriacontakis(hydroxide) bis(oxide) unknown solvate hydrate

    KAUST Repository

    Alezi, Dalal


    An entry from the Cambridge Structural Database, the world’s repository for small molecule crystal structures. The entry contains experimental data from a crystal diffraction study. The deposited dataset for this entry is freely available from the CCDC and typically includes 3D coordinates, cell parameters, space group, experimental conditions and quality measures.

  5. Terbium doped SnO2 nanoparticles as white emitters and SnO2:5Tb/Fe3O4 magnetic luminescent nanohybrids for hyperthermia application and biocompatibility with HeLa cancer cells. (United States)

    Singh, Laishram Priyobarta; Singh, Ningthoujam Premananda; Srivastava, Sri Krishna


    SnO2:5Tb (SnO2 doped with 5 at% Tb(3+)) nanoparticles were synthesised by a polyol method and their luminescence properties at different annealing temperatures were studied. Characterization of nanomaterials was done by X-ray diffraction (XRD), Fourier transformation infrared spectroscopy (FTIR), transmission electron microscopy (TEM) and vibrating sample magnetometry (VSM). XRD studies indicate that the prepared nanoparticles were of tetragonal structures. Upon Tb(3+) ion incorporation into SnO2, Sn(4+) changes to Sn(2+) and, on annealing again at higher temperature, Sn(2+) changes to Sn(4+). The prepared nanoparticles were spherical in shape. Sn-O vibrations were found from the FTIR studies. In photoluminescence studies, the intensity of the emission peaks of Tb(3+) ions increases with the increase of annealing temperature, and emission spectra lie in the region of white emission in the CIE diagram. CCT calculations show that the SnO2:5Tb emission lies in cold white emission. Quantum yields up to 38% can be obtained for 900 °C annealed samples. SnO2:5Tb nanoparticles were well incorporated into the PVA polymer and such a material incorporated into the polymer can be used for display devices. The SnO2:5Tb/Fe3O4 nanohybrid was prepared and investigated for hyperthermia applications at different concentrations of the nanohybrid. This achieves a hyperthermia temperature (42 °C) under an AC magnetic field. The hybrid nanomaterial SnO2:5Tb/Fe3O4 was found to exhibit biocompatibility with HeLa cells (human cervical cancer cells) at concentrations up to 74% for 100 μg L(-1). Also, this nanohybrid shows green emission and thus it will be helpful in tracing magnetic nanoparticles through optical imaging in vivo and in vitro application.

  6. Filmes delgados luminescentes obtidos a partir de hidroxicarbonatos de ítrio ativados por európio ou térbio Luminescent thin films obtained from ytrium hydroxycarbonates activated by terbium or europium

    Directory of Open Access Journals (Sweden)

    Emy Niyama


    Full Text Available These films were obtained by dip coating. Parameters like dislocation velocity; number of deposits, suspension concentration, and number of deposits followed or not by heat treatment between each deposit and calcination temperature were evaluated for establishing the best homogeneity. The obtained films were characterized in terms of their morphology, optical quality and photoluminescence by scanning electron microscopy (SEM, UV-vis absorption spectrophotometry and luminescence spectroscopy, respectively. The morphologic and luminescent characteristics showed dip coating as good laboratory technique for development of thin films for optical applications.

  7. Long-term safety and stability of angiogenesis induced by balanced single-vector co-expression of PDGF-BB and VEGF164 in skeletal muscle (United States)

    Gianni-Barrera, Roberto; Burger, Maximilian; Wolff, Thomas; Heberer, Michael; Schaefer, Dirk J.; Gürke, Lorenz; Mujagic, Edin; Banfi, Andrea


    Therapeutic angiogenesis by growth factor delivery is an attractive treatment strategy for ischemic diseases, yet clinical efficacy has been elusive. The angiogenic master regulator VEGF-A can induce aberrant angiogenesis if expressed above a threshold level. Since VEGF remains localized in the matrix around expressing cells, homogeneous dose distribution in target tissues is required, which is challenging. We found that co-expression of the pericyte-recruiting factor PDGF-BB at a fixed ratio with VEGF from a single bicistronic vector ensured normal angiogenesis despite heterogeneous high VEGF levels. Taking advantage of a highly controlled gene delivery platform, based on monoclonal populations of transduced myoblasts, in which every cell stably produces the same amount of each factor, here we rigorously investigated a) the dose-dependent effects, and b) the long-term safety and stability of VEGF and PDGF-BB co-expression in skeletal muscle. PDGF-BB co-expression did not affect the normal angiogenesis by low and medium VEGF doses, but specifically prevented vascular tumors by high VEGF, yielding instead normal and mature capillary networks, accompanied by robust arteriole formation. Induced angiogenesis persisted unchanged up to 4 months, while no tumors appeared. Therefore, PDGF-BB co-expression is an attractive strategy to improve safety and efficacy of therapeutic angiogenesis by VEGF gene delivery. PMID:26882992

  8. Effect of SCH55700, a humanized anti-human interleukin-5 antibody, in severe persistent asthma - A pilot study 164/rccm.200206-5250C

    NARCIS (Netherlands)

    Kips, JC; O'Connor, BJ; Langley, SJ; Woodcock, A; Kerstjens, HAM; Postma, DS; Danzig, M; Cuss, F; Pauwels, RA


    Antagonizing the effect of interleukin (IL)-5 is a potential new treatment strategy in allergic disorders. We evaluated the safety, biological activity, and pharmacokinetics of SCH55700, a humanized anti-human IL-5 antibody, in subjects with severe persistent asthma treated with oral or high doses

  9. 164. Abordaje híbrido de patología compleja de arco aórtico y aorta torácica

    Directory of Open Access Journals (Sweden)

    V.X. Mosquera Rodríguez


    Conclusiones: Nuestro estudio destaca cómo las estrategias híbridas incorporando un abordaje quirúrgico abierto y endovascular pueden ser empleadas con éxito en el tratamiento de patología compleja de arco y aorta torácica. Este abordaje combinado expande potencialmente el uso de las técnicas endovasculares aórticas y es una solución atractiva para pacientes quirúrgicos de alto riesgo.

  10. [Fe II] 1.64 μm Imaging Observations of the Outflow Features around Ultracompact H II Regions in the First Galactic Quadrant (United States)

    Shinn, Jong-Ho; Kim, Kee-Tae; Lee, Jae-Joon; Lee, Yong-Hyun; Kim, Hyun-Jeong; Pyo, Tae-Soo; Koo, Bon-Chul; Kyeong, Jaemann; Hwang, Narae; Park, Byeong-Gon


    We present [Fe II] 1.644 μm features around ultracompact H II regions (UCHIIs) found on a quest for the "footprint" outflow features of UCHIIs—the features produced by outflowing materials ejected during an earlier, active accretion phase of massive young stellar objects (MYSOs). We surveyed 237 UCHIIs in the first Galactic quadrant, employing the CORNISH UCHII catalog and UWIFE data, which is an imaging survey in [Fe II] 1.644 μm performed with UKIRT-WFCAM under ~0.''8 seeing conditions. The [Fe II] features were found around five UCHIIs, one of which was less plausible. We interpret the [Fe II] features to be shock-excited by outflows from YSOs and estimate the outflow mass-loss rates from the [Fe II] flux which are ~1 × 10-6-4 × 10-5 M ⊙ yr-1. We propose that the [Fe II] features might be the "footprint" outflow features, but more studies are required to clarify whether or not this is the case. This is based on the morphological relation between the [Fe II] and 5 GHz radio features, the outflow mass-loss rate, the travel time of the [Fe II] features, and the existence of several YSO candidates near the UCHIIs. The UCHIIs accompanying the [Fe II] features have relatively higher peak flux densities. The fraction of UCHIIs accompanying the [Fe II] features, 5/237, is small when compared to the ~90% detection rate of high-velocity CO gas around UCHIIs. We discuss some possible explanations for the low detection rate.

  11. Microstructure of Welded Joints of X5CrNiCuNb16-4 (17-4 PH Martensitic Stainlees Steel After Heat Treatment

    Directory of Open Access Journals (Sweden)

    Ziewiec A.


    Full Text Available The paper presents rezults of microstructure (LM, TEM investigation and hardness measurments of welded joints in martensitic precipitation hardened stainless steel containing copper, subjected to heat treatment. For the aging temperature up to 540 °C even for the very long times, the microstructure of the welded joints is similar to this one at lower temerature aging. After aging at 620 °C a distinct change of the microstructure was observed. Non-equilibrium solidification conditions of the weld metal, segregation and the diffusion of copper and the elements stablilizing the austenite cause the occurrence of the reverse transformation of the martensite into austenite as fast as just 1 hour at 620 °C. TEM investigations revealed the differences in dispersion of hardening copper precipitates after aging at temperature 620 °C for 1 and 4 hours.

  12. Dynamics of ionospheric irregularities in increasing phase of 24th solar cycle at Kolhapur [16.4°N, 74.2°E (United States)

    Sharma, A. K.; Chavan, G. A.; Gurav, O. B.; Gaikwad, H. P.; Ghodpage, R. N.; Nade, D. P.


    In this paper we have focused on drift of irregularities using amplitude scintillations for period January 2011 to December 2015. The data of VHF amplitude scintillations and all sky imager at Kolhapur has been used to obtain the drift of ionospheric irregularities. The drift is compared with velocities of thermospheric wind obtained by HWM-07 (Horizontal Wind Model-07) and of EPBs (Equatorial Plasma Bubbles). The results are in good agreement with model data. Also, the pattern of drift in scintillation data matches well with velocity of EPBs, mainly during equinoctial months. To examine the possible effect of magnetospheric disturbance on the dynamics of the irregularities we have compared the drift on magnetically disturbed nights with the monthly averaged quiet nights drift. Zonal velocity pattern on magnetically disturbed nights shows reversal in the direction of eastward zonal drift around midnight. The deviation of plasma drift on disturbed nights from monthly averaged quiet night drift shows maximum effect of magnetic activity around midnight. The monthly averaged peaks of the zonal drift increases with increasing 10.7 cm solar flux.

  13. MODIS-Derived 1.64 micron white-sky albedo on a global, 1-minute equal angle grid (Collection 004 and 005) (United States)

    National Aeronautics and Space Administration — The Filled Land Surface Albedo Product is a global data set of spatially complete albedo maps. It was derived from the MODIS MOD43B3 Land product and includes both...

  14. 45 CFR 164.512 - Uses and disclosures for which an authorization or opportunity to agree or object is not required. (United States)


    ... types of wounds or other physical injuries, except for laws subject to paragraph (b)(1)(ii) or (c)(1)(i... or receive such information for the purpose of preventing or controlling disease, injury, or disability, including, but not limited to, the reporting of disease, injury, vital events such as birth or...

  15. Clinicopathological evaluation of 164 dental follicles and dentigerous cysts with emphasis on the presence of odontogenic epithelium in the connective tissue. The hypothesis of "focal ameloblastoma"

    NARCIS (Netherlands)

    Meleti, M.; van der Waal, I.


    Objectives: Some ameloblastomas presumably originate from odontogenic epithelium within the connective tissue of dental follicles and dentigerous cysts. Therefore, it would seem reasonable to discuss as whether odontogenic epithelium proliferations, frankly displaying ameloblastomatous features

  16. Fat phenotype, associated factors and rs9939609 polymorphism of the FTO gene DOI:10.5007/1980-0037.2010v12n2p164

    Directory of Open Access Journals (Sweden)

    William Alves Lima


    Full Text Available The purpose of this work was to review the main results of studies that have analysed the relationship between the rs9939609 single nucleotide polymorphism (SNP of the FTO gene and the manifestation of overweight/obesity with its associated co-morbidity, and to discuss the interaction of this polymorphism with the other factors which cause obesity. The search was performed using the MEDLINE, Highwire, Science Direct and SciELO databases, applying the following key words: FTO rs9939609, obesity genetic, gene associated obesity, FTO contributes obesity. Inclusion criteria were: original articles where the search was performed in humans and including the rs9939609. Articles that analysed the FTO gene associated with preinstalled hormonal diseases were excluded. Of the several SNP associated with the FTO gene, rs9939609 has been the most researched (studied. This SNP comprises the A and T alleles, with the A homozygote being most susceptible to the development of overweight/obesity in all age ranges, especially in the caucasian population. In this situation, the control of environmental factors (alimentation and physical activity can prevent the excessive build up of fats. Obesity is related to the development of non-transmissible chronic illnesses. Association of rs9939609 polymorphism with the lipidic profile and glycemia were observed. The practicing of physical exercise and feeding habits seem to be the main contributors in the development of overweight/obesity and its resulting co-morbidity.

  17. Local Control in Action: Learning from the CORE Districts' Focus on Measurement, Capacity Building, and Shared Accountability. Policy Brief 16-4 (United States)

    Marsh, Julie; Bush-Mecenas, Susan; Hough, Heather


    California and the nation are at the crossroads of a major shift in school accountability policy. At the state level, California's Local Control and Accountability Plan (LCAP) encourages the use of multiple measures of school performance used locally to support continuous improvement and strategic resource allocation. Similarly, the federal Every…

  18. CRED Subsurface Temperature Recorder (STR); NWHI, NEC; Long: -164.69775, Lat: 23.57152 (WGS84); Sensor Depth: 17.07m; Data Range: 20050414-20060904. (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — Data from Coral Reef Ecosystem Division (CRED), NOAA Pacific Islands Fisheries Science Center (PIFSC) Subsurface Temperature Recorders (STR) provide a time series of...

  19. Synthesis and characterization of spherical Tb-MCM-41

    Energy Technology Data Exchange (ETDEWEB)

    Pires, Luiza H.O., E-mail: [Universidade Federal do Para, Instituto de Ciencias Exatas e Naturais, Laboratorio de Catalise e Oleoquimica, CP 479, CEP 66075-110, Belem, PA (Brazil); Queiroz, Renan M.; Souza, Ruth P.; Costa, Carlos E.F. da; Zamian, Jose R. [Universidade Federal do Para, Instituto de Ciencias Exatas e Naturais, Laboratorio de Catalise e Oleoquimica, CP 479, CEP 66075-110, Belem, PA (Brazil); Weber, Ingrid T. [Universidade Federal de Pernambuco, Centro de Ciencias Exatas e da Natureza, Av. Prof. Luis Barros Freire, s/n, Cidade Universitaria, 50670-901 Recife, PE (Brazil); Filho, Geraldo N. da Rocha [Universidade Federal do Para, Instituto de Ciencias Exatas e Naturais, Laboratorio de Catalise e Oleoquimica, CP 479, CEP 66075-110, Belem, PA (Brazil)


    Spherical MCM-41 was synthesized at room temperature and functionalized by means of direct synthesis method. Evidence for the terbium presence in the silica matrix was obtained by means of EDX. Scanning electron microscopy (SEM) micrographs showed that terbium incorporation did not change significantly MCM-41 morphology. The maintenance of the hexagonal structure was confirmed by X-ray diffraction (XRD) pattern analysis. The cell parameter increase and the surface area decrease, observed by N{sub 2} adsorption-desorption technique, were taken as evidence of terbium introduction inside the MCM-41 framework. By FT-IR spectra it was found that the main features of the silica framework were maintained. The presence of a strong absorption band centered at ca. 220 nm in the diffuse reflectance UV-vis spectra could indicate the presence of tetra-coordinated terbium in the silica network of Tb-MCM-41 samples.

  20. Therapeutic use of radioactive isotopes

    CERN Multimedia

    Caroline Duc


    In December, researchers from ISOLDE-CERN, the Paul Scherrer Institute (PSI) and the Institut Laue-Langevin (ILL) published the results of an in vivo study which successfully proved the effectiveness of four terbium isotopes for diagnosing and treating cancerous tumours.   Four terbium isotopes suitable for clinical purposes. “ISOLDE is the only installation capable of supplying terbium isotopes of such purity and intensity in the case of three out of the four types used in this study,” explains Karl Johnson, a physicist at ISOLDE.  “Producing over a thousand different isotopes, our equipment offers the widest choice of isotopes in the world!” Initially intended for fundamental physics research, ISOLDE has diversified its activities over time to invest in various projects in the materials science, biochemistry and nuclear medicine fields. The proof-of-concept study has confirmed that the four terbium isotopes 149Tb, 152Tb, 155Tb produ...

  1. Thermal History Using Microparticle Trap Luminescence (United States)


    and thermoluminescence of terbium-activated silicates and aluminates " . Radiat. Meas. 43, 323-326 (2008). HDTRA1-07-1-0016 University of...of terbium-activated silicates and aluminates " . 15th Solid State Dosimetry Conference, Delft, The Netherlands, July 8-13 (2007). 2 INTRODUCTION...increased to 500°C until combustion occurred (- 7 min). The remaining powder was collected, crushed in a agate mortar, and annealed (typically at 900

  2. The dynamics of questing ticks collected for 164 consecutive months off the vegetation of two landscape zones in the Kruger National Park (1988–2002. Part III. The less commonly collected species

    Directory of Open Access Journals (Sweden)

    Gordon J. Gallivan


    Full Text Available Despite many studies regarding tick ecology, limited information on long-term changes in tick populations exist. This study assessed the long-term population dynamics of the less frequently collected questing ixodid ticks in the Kruger National Park (KNP. From 1988 to 2002, monthly dragging of the vegetation was performed in three habitats (grassland, woodland and gully at two sites in the KNP (Nhlowa Road, Landscape Zone 17, and Skukuza, Landscape Zone 4. Amblyomma marmoreum and Rhipicephalus evertsi evertsi were collected as larvae most commonly. Most A. marmoreum larvae were collected at Skukuza and numbers peaked from March to July. More R. evertsi evertsi larvae were collected at Nhlowa Road and numbers peaked in summer and in winter, while at Skukuza there was a single peak in spring. Haemaphysalis elliptica, Rhipicephalus simus and Rhipicephalus turanicus were collected as adults most commonly. More Ha. elliptica and R. turanicus were collected at Nhlowa Road than at Skukuza, while R. simus numbers from the two sites were approximately equal. Ha. elliptica were collected most often between February and June, and R. simus and R. turanicus during February and March. All three species were collected more frequently in gullies than in grassland or woodland. Their numbers increased in 1994/1995 following an eruption of rodents, the preferred hosts of the immature stages. The different host-seeking strategies of ticks largely determine the development stage at which they are likely to be collected during vegetation dragging and reflect a complex interaction between ticks, their hosts and the environment.

  3. The dynamics of questing ticks collected for 164 consecutive months off the vegetation of two landscape zones in the Kruger National Park (1988–2002. Part II. Rhipicephalus appendiculatus and Rhipicephalus zambeziensis

    Directory of Open Access Journals (Sweden)

    Arthur M. Spickett


    Full Text Available The study aimed to assess the long-term population dynamics of questing Rhipicephalus appendiculatus and Rhipicephalus zambeziensis in two landscape zones of the Kruger National Park (KNP. Ticks were collected by dragging the vegetation monthly in three habitats (grassland, woodland and gully at two sites in the KNP (Nhlowa Road and Skukuza from August 1988 to March 2002. Larvae were the most commonly collected stage of both species. More R. appendiculatus were collected at Nhlowa Road than at Skukuza, with larvae being most abundant from May to August, while nymphs were most abundant from August to December. Larvae were most commonly collected in the gullies from 1991 to 1994, but in the grassland and woodland habitats from 1998 onwards. Nymphs were most commonly collected in the grassland and woodland. More R. zambeziensis were collected at Skukuza than at Nhlowa Road, with larvae being most abundant from May to September, while nymphs were most abundant from August to November. Larvae and nymphs were most commonly collected in the woodland and gullies and least commonly in the grassland (p < 0.01. The lowest numbers of R. appendiculatus were collected in the mid-1990s after the 1991/1992 drought. Rhipicephalus zambeziensis numbers declined after 1991 and even further after 1998, dropping to their lowest levels during 2002. The changes in numbers of these two species reflected changes in rainfall and the populations of several of their large herbivore hosts, as well as differences in the relative humidity between the two sites over time.

  4. CRED Ocean Data Platform (ODP), Temperature and Conductivity Recorder (SBE37); NWHI, NEC; Long: -164.71215, Lat: 23.56792 (WGS84); Sensor Depth: 24.90m; Data Range: 20050416-20060903. (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — The Ocean Data Platform (ODP) is placed on the sea floor to measure water current profiles, waves, temperature and conductivity. The ODP consists of an upward...

  5. Compte rendu de : La vallée électrique,Foëx E. (photographies) et Broennimann T. (textes), 2006, Paris, InFolio éditions, 164 p., 210 photographies en noir et blanc


    Buisson, André


    Réunies sous le titre La vallée électrique, 210 photographies en noir et blanc du photographe Emmanuel Foëx illustrent l’architecture industrielle, l’urbanisme et le paysage dans l’Arc alpin. Comme un ouvrage classique, l’album est divisé en trois parties : La centrale, le réseau, le transformateur. L’auteur est parti de l’évidence qu’à travers l’arc alpin, les sillons des vallées sont constellés d’usines consacrées à la fabrication de l’électricité (La centrale). La montagne, telle un châtea...

  6. CRED Sea Surface Temperature (SST) Buoy; NWHI, NEC; Long: -164.69775, Lat: 23.57152 (WGS84); Sensor Depth: 0.33m; Data Range: 20030714-20030825. (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — Data from Coral Reef Ecosystem Division (CRED), NOAA Pacific Islands Fisheries Science Center (PIFSC) Sea Surface Temperature (SST) Buoys provide a time series of...

  7. CRED Sea Surface Temperature (SST) Buoy; NWHI, NEC; Long: -164.69775, Lat: 23.57152 (WGS84); Sensor Depth: 0.33m; Data Range: 20050410-20060108. (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — Data from Coral Reef Ecosystem Division (CRED), NOAA Pacific Islands Fisheries Science Center (PIFSC) Sea Surface Temperature (SST) Buoys provide a time series of...

  8. CRED Sea Surface Temperature (SST) Buoy; NWHI, NEC; Long: -164.69775, Lat: 23.57152 (WGS84); Sensor Depth: 0.33m; Data Range: 20020911-20030713. (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — Data from Coral Reef Ecosystem Division (CRED), NOAA Pacific Islands Fisheries Science Center (PIFSC) Sea Surface Temperature (SST) Buoys provide a time series of...

  9. O câncer na perspectiva de cuidadores familiares e suas representações sociais doi: 10.12662/2317-3076jhbs.v3i3.159.p159-164.2015

    Directory of Open Access Journals (Sweden)

    Silvio Eder Dias da Silva


    Full Text Available Introdução: O câncer presente no indivíduo pode gerar diversas sensações na família, como medo, angústia e dor. O familiar cuidador em geral não está preparado para assumir tal dever, porém exerce um papel essencial na prática de cuidados ao paciente. Objetivo: A pesquisa objetivou identificar as representações sociais de cuidadores familiares de pacientes com câncer fora de possibilidades terapêuticas; e analisar suas implicações para o cuidado à saúde. Métodos: Trata-se de uma pesquisa descritiva com abordagem qualitativa. Foram entrevistados 30 cuidadores familiares que acompanhavam seus parentes internados na clínica de cuidados paliativos no Hospital Ophir Loyola, em Belém do Pará. Os dados foram obtidos por meio de uma entrevista semiestruturada e associação livre de palavras. Na análise do material, aplicou-se a análise temática. A pesquisa foi submetida ao Comitê de Ética da Escola de Enfermagem “Magalhães Barata” da Universidade do Estado do Pará sob protocolo CAAE–0048.0.321.000.11 de acordo com os preceitos da Resolução nº 196/96/CNS/MS. Resultados: Da análise das entrevistas emergiram quatro temas: Câncer uma doença silenciosa; A prevenção do câncer por exames; O câncer no cotidiano do cuidador; A experiência do familiar com câncer influenciando a maneira do cuidador ver a doença: o cuidado com a saúde. Conclusão: O cuidado ao indivíduo em estado terminal foi apresentado como uma tarefa árdua e exaustiva pelos cuidadores. Logo, a Enfermagem tem papel relevante nessa relação com esses cuidadores, seja na realização de orientações, seja proporcionando-lhes um cuidado mais adequado.

  10. Samia Naïm (dir., Yemen, d’un itinéraire à l’autre. Paris : Maison Neuve et Larose, 2001, 164p. + 16 p. de photos.

    Directory of Open Access Journals (Sweden)

    Catherine Miller


    Full Text Available Voici un petit livre érudit et élégant qui, tel un carnet de voyage savant, choisit de nous faire partager des itinéraires à travers quelques villes yéménites (Sana‘a, Zabîd, Aden, Shihr en partant de descriptions ethnographiques contemporaines, de récits historiques ou littéraires. Le thème central étant la ville parcourue, perçue et décrite dans ses mutations, son quotidien, ses rythmes masculins et féminins, ses évocations littéraires. Quelques objets et plantes hautement symboliques ponc...

  11. Mangrove cover in the Red Sea (1972-2013), supplement to: Almahasheer, Hanan; Aljowair, Abdulaziz; Duarte, Carlos M; Irigoien, Xabier (2016): Decadal Stability of Red Sea Mangroves. Estuarine, Coastal and Shelf Science, 169, 164-172

    KAUST Repository

    Almahasheer, Hanan


    Across the Earth, mangroves play an important role in coastal protection, both as nurseries and carbon sinks. However, due to various human and environmental impacts, the coverage of mangroves is declining on a global scale. The Red Sea is in the northern-most area of the distribution range of mangroves. Little is known about the surface covered by mangroves at this northern limit or about the changes experienced by Red Sea mangroves. We sought to study changes in the coverage of Red Sea mangroves by using multi-temporal Landsat data (1972, 2000 and 2013). Interestingly, our results show that there has been no decline in mangrove stands in the Red Sea but rather a slight increase. The area covered by mangroves is about 69 km**2 along the African shore and 51 km**2 along the Arabian Peninsula shore. From 1972 to 2013, the area covered by mangroves increased by about 0.29%/y. We conclude that the trend exhibited by Red Sea mangroves departs from the general global decline of mangroves. Along the Red Sea, mangroves expanded by 12% over the 41 years from 1972 to 2013. Losses to Red Sea mangroves, mostly due to coastal development, have been compensated by afforestation projects.

  12. CRED Ocean Data Platform (ODP), Acoustic Doppler Profiler (ADP); NWHI, NEC; Long: -164.71215, Lat: 23.56792 (WGS84); Sensor Depth: 24.90m; Data Range: 20050411-20060903. (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — The Ocean Data Platform (ODP) is placed on the sea floor to measure water current profiles, waves, temperature and conductivity. The ODP consists of an upward...

  13. Aurélien Bernier, 2008, Le climat otage de la finance ou comment le marché boursicote avec les droits à polluer, Essai, Mille et une nuits, Paris, 164 p.

    Directory of Open Access Journals (Sweden)

    Béatrice Quenault


    Full Text Available Dans cet essai, au titre provocateur « Le climat otage de la finance ou comment le marché boursicote avec les droits à polluer », l’auteur, Aurélien Bernier, ancien membre d’Attac France et chargé de mission dans le domaine de l’environnement, décrypte le fonctionnement d’un nouveau compartiment de la finance internationale, la « finance carbone » constituée d’un ensemble de marchés où s’échangent les permis d’émission négociables ou les unités de réduction d’émissions, communément appelés « ...

  14. Reply to ‘Comment on ‘To stack or not to stack: Performance of a new density functional for the uracil and thymine dimers’ [Chem. Phys. Lett. 459 (2008) 164]’ (United States)

    Gu, Jiande; Wang, Jing; Leszczynski, Jerzy; Xie, Yaoming; Schaefer, Henry F., III


    In this Letter, we want to address that the conclusions of the letter by Gu et al. have been misunderstood by Mourik in the comment. In our Letter (CPLETT-08-419R1), the good performance of the new functional M06-2X is concluded based on the comparison with the results based on the CCSD(T) studies. Also, we confirm here our previous assumption related to the nature of the stationary points on the MP2 potential energy surface.

  15. On the quenching of trivalent terbium luminescence by ligand low lying triplet state energy and the role of the {sup 7}F{sub 5} level: The [Tb(tta){sub 3} (H{sub 2}O){sub 2}] case

    Energy Technology Data Exchange (ETDEWEB)

    Souza, A.S., E-mail: [Departamento de Química Fundamental, Universidade Federal de Pernambuco, 50670-901 Recife, PE (Brazil); Nunes, L.A. [Instituto de Física de São Carlos, Universidade de São Paulo, 13560-970 São Carlos, SP (Brazil); Felinto, M.C.F.C. [Instituto de Pesquisas Energéticas e Nucleares-IPEN, 05505-800 São Paulo, SP (Brazil); Brito, H.F. [Instituto de Química, Universidade de São Paulo, 05508-900 São Paulo, SP (Brazil); Malta, O.L. [Departamento de Química Fundamental, Universidade Federal de Pernambuco, 50670-901 Recife, PE (Brazil)


    In this work we discuss the observed Tb{sup 3+} ion luminescence quenching, due to the relative ligand low lying triplet state energy, in the [Tb(tta){sub 3} (H{sub 2}O){sub 2}] compound at low and room temperature (tta=thenoyltrifluoroacetonate). Theoretical energy transfer rates, for both multipolar and exchange mechanisms, were calculated and discussed on the basis of selection rules and energy mismatch conditions from the [Tb(tta){sub 3} (H{sub 2}O){sub 2}] emission spectra. We have concluded that the exchange mechanism by far dominates, in the present case, and that the long first excited state {sup 7}F{sub 5} lifetime (in the millisecond scale) plays a crucial role in the Tb{sup 3+} luminescence quenching. - Highlights: • The energy exchange between the ligand T{sub 1} and Tb{sup 3+5}D{sub 4} levels occur by the exchange interaction. • The Tb{sup 3+} first excited {sup 7}F{sub 5} level plays a crucial role in this process due to its long lifetime. • At room temperature the energy exchanged between the {sup 5}D{sub 4} level of the Tb{sup 3+} ion and the T{sub 1} of the ligand is lost via the intersystem crossing T{sub 1} → S{sub 0} channel.

  16. Synthesis, structure, and magnetic properties of a new family of tetra-nuclear {Mn2(III)Ln2}(Ln = Dy, Gd, Tb, Ho) clusters with an arch-type topology: single-molecule magnetism behavior in the dysprosium and terbium analogues. (United States)

    Chandrasekhar, Vadapalli; Bag, Prasenjit; Speldrich, Manfred; van Leusen, Jan; Kögerler, Paul


    Sequential reaction of Mn(II) and lanthanide(III) salts with a new multidentate ligand, 2,2'-(2-hydroxy-3-methoxy-5-methylbenzylazanediyl)diethanol (LH3), containing two flexible ethanolic arms, one phenolic oxygen, and a methoxy group afforded heterometallic tetranuclear complexes [Mn2Dy2(LH)4(μ-OAc)2](NO3)2·2CH3OH·3H2O (1), [Mn2Gd2(LH)4(μ-OAc)2](NO3)2·2CH3OH·3H2O (2), [Mn2Tb2(LH)4(μ-OAc)2](NO3)2·2H2O·2CH3OH·Et2O (3), and [Mn2Ho2(LH)4(μ-OAc)2]Cl2·5CH3OH (4). All of these dicationic complexes possess an arch-like structural topology containing a central Mn(III)-Ln-Ln-Mn(III) core. The two central lanthanide ions are connected via two phenolate oxygen atoms. The remaining ligand manifold assists in linking the central lanthanide ions with the peripheral Mn(III) ions. Four doubly deprotonated LH(2-) chelating ligands are involved in stabilizing the tetranuclear assembly. A magnetochemical analysis reveals that single-ion effects dominate the observed susceptibility data for all compounds, with comparably weak Ln···Ln and very weak Ln···Mn(III) couplings. The axial, approximately square-antiprismatic coordination environment of the Ln(3+) ions in 1-4 causes pronounced zero-field splitting for Tb(3+), Dy(3+), and Ho(3+). For 1 and 3, the onset of a slowing down of the magnetic relaxation was observed at temperatures below approximately 5 K (1) and 13 K (3) in frequency-dependent alternating current (AC) susceptibility measurements, yielding effective relaxation energy barriers of ΔE = 16.8 cm(-1) (1) and 33.8 cm(-1) (3).

  17. Reactive Chemical Vapor Deposition Method as New Approach for Obtaining Electroluminescent Thin Film Materials

    Directory of Open Access Journals (Sweden)

    Valentina V. Utochnikova


    Full Text Available The new reactive chemical vapor deposition (RCVD method has been proposed for thin film deposition of luminescent nonvolatile lanthanide aromatic carboxylates. This method is based on metathesis reaction between the vapors of volatile lanthanide dipivaloylmethanate (Ln(dpm3 and carboxylic acid (HCarb orH2Carb′ and was successfully used in case of HCarb. Advantages of the method were demonstrated on example of terbium benzoate (Tb(bz3 and o-phenoxybenzoate thin films, and Tb(bz3 thin films were successfully examined in the OLED with the following structure glass/ITO/PEDOT:PSS/TPD/Tb(bz3/Ca/Al. Electroluminescence spectra of Tb(bz3 showed only typical luminescent bands, originated from transitions of the terbium ion. Method peculiarities for deposition of compounds of dibasic acids H2Carb′ are established on example of terbium and europium terephtalates and europium 2,6-naphtalenedicarboxylate.

  18. ORF Alignment: NC_006449 [GENIUS II[Archive

    Lifescience Database Archive (English)


  19. ORF Alignment: NC_004463 [GENIUS II[Archive

    Lifescience Database Archive (English)


  20. ORF Alignment: NC_005296 [GENIUS II[Archive

    Lifescience Database Archive (English)


  1. ORF Alignment: NC_004463 [GENIUS II[Archive

    Lifescience Database Archive (English)


  2. Spatial resolution in X-ray imaging with scintillating glass optical fiber plates (United States)

    Pavan, P.; Zanella, G.; Zannoni, R.; Marigo, A.


    Some scintillating optical fiber plates, fabricated with terbium glasses are tested for their intrinsic spatial resolution under X-ray irradiation and the result is compared with a typical phosphor screen. The spatial resolution (CTF and MTF) is measured as a function of spatial frequency and the standard deviation of the corresponding Gaussian PSF is derived.


    DEFF Research Database (Denmark)


    The present invention concerns a chemical process for preparing nanoparticles of an alloy comprising both a noble metal, such as platinum, and a non-noble transition or lanthanide metal, such as yttrium, gadolinium or terbium. The process is carried out by reduction with hydrogen and removal...

  4. Multiplet effects in the electronic structure of heavy rare-earth metals

    NARCIS (Netherlands)

    Lebegue, S.; Svane, A.; Katsnelson, M.I.; Lichtenstein, A.I.; Eriksson, O.


    The spectroscopic properties of elemental terbium, dysprosium, holmium, and erbium are investigated using first-principles calculations taking into account intra-atomic correlation effects. In order to describe the strongly localized f electrons together with the conduction bands, we have used the

  5. Performance of 20 Ci 137Cs γ-ray Compton spectrometer for the ...

    Indian Academy of Sciences (India)

    The in-house 137Cs spectrometer is very useful for the measurement of momentum densities of heavy materials. The performance of the machine is assessed using aluminum, terbium and mercury samples and the exper- imental data from comparable apparatus. Keywords. Compton scattering; electron momentum density; ...

  6. Author Details

    African Journals Online (AJOL)

    Pengkiliya, P. Vol 67 (2014) - Articles Interaction of 3-Hydroxypicolinamide with TbIII and its Sensitizing Effect on Terbium Luminescence as a Function of pH and Medium Abstract PDF. ISSN: 0379-4350. AJOL African Journals Online. HOW TO USE AJOL... for Researchers · for Librarians · for Authors · FAQ's · More about ...

  7. Author Details

    African Journals Online (AJOL)

    Devi, TP. Vol 67 (2014) - Articles Interaction of 3-Hydroxypicolinamide with TbIII and its Sensitizing Effect on Terbium Luminescence as a Function of pH and Medium Abstract PDF. ISSN: 0379-4350. AJOL African Journals Online. HOW TO USE AJOL... for Researchers · for Librarians · for Authors · FAQ's · More about AJOL ...

  8. THz near-field Faraday imaging in hybrid metamaterials

    NARCIS (Netherlands)

    Kumar, N.; Strikwerda, A.C.; Fan, K.; Zhang, X.; Averitt, R.D.; Planken, P.C.M.; Adam, A.J.L.


    We report on direct measurements of the magnetic near-field of metamaterial split ring resonators at terahertz frequencies using a magnetic field sensitive material. Specifically, planar split ring resonators are fabricated on a single magneto-optically active terbium gallium garnet crystal.

  9. Synthesis and photoluminescence properties of CaSixOy:Tb3+ phosphors prepared using solution-combustion method

    CSIR Research Space (South Africa)

    Dejene, FB


    Full Text Available to Ca3Si2O7 as the terbium concentration increase. Broad band excitations peaking between 280 - 360 nm derived from excited states of Tb3+ ions were observed for all powders grown from various Tb compositions. The green emission peak at 545 nm due...

  10. Scanning Electron Microscope-Cathodoluminescence Analysis of Rare-Earth Elements in Magnets. (United States)

    Imashuku, Susumu; Wagatsuma, Kazuaki; Kawai, Jun


    Scanning electron microscope-cathodoluminescence (SEM-CL) analysis was performed for neodymium-iron-boron (NdFeB) and samarium-cobalt (Sm-Co) magnets to analyze the rare-earth elements present in the magnets. We examined the advantages of SEM-CL analysis over conventional analytical methods such as SEM-energy-dispersive X-ray (EDX) spectroscopy and SEM-wavelength-dispersive X-ray (WDX) spectroscopy for elemental analysis of rare-earth elements in NdFeB magnets. Luminescence spectra of chloride compounds of elements in the magnets were measured by the SEM-CL method. Chloride compounds were obtained by the dropwise addition of hydrochloric acid on the magnets followed by drying in vacuum. Neodymium, praseodymium, terbium, and dysprosium were separately detected in the NdFeB magnets, and samarium was detected in the Sm-Co magnet by the SEM-CL method. In contrast, it was difficult to distinguish terbium and dysprosium in the NdFeB magnet with a dysprosium concentration of 1.05 wt% by conventional SEM-EDX analysis. Terbium with a concentration of 0.02 wt% in an NdFeB magnet was detected by SEM-CL analysis, but not by conventional SEM-WDX analysis. SEM-CL analysis is advantageous over conventional SEM-EDX and SEM-WDX analyses for detecting trace rare-earth elements in NdFeB magnets, particularly dysprosium and terbium.

  11. Performance of 20 Ci 137Cs γ-ray Compton spectrometer for the ...

    Indian Academy of Sciences (India)

    ... than the conventional 241Am Compton spectrometers. The in-house 137Cs spectrometer is very useful for the measurement of momentum densities of heavy materials. The performance of the machine is assessed using aluminum, terbium and mercury samples and the experimental data from comparable apparatus.

  12. Faraday isolator based on TSAG crystal for high power lasers. (United States)

    Mironov, E A; Palashov, O V


    A Faraday isolator based on a new magneto-optical medium, TSAG (terbium scandium aluminum garnet) crystal, has been constructed and investigated experimentally. The device provides an isolation ratio of more than 30 dB at 500 W laser power. It is shown that this medium can be used in Faraday isolators for kilowatt-level laser powers.

  13. 1. Novel Dopants in Silica Based Fibers. 2. Applications of Embedded Optical Fiber Sensors in Reinforced Concrete Buildings and Structures (United States)


    effects in fibers, and nonlinear phenomena in fibers. We also use NMR, ESR and Raman techniques to study incorporation of novel as well as...neodymium, erbium, holmium or terbium. These products can be vacuum dried at elevated temperature. The acac-compound is less expensive since the hfa

  14. Time-gated FRET nanoassemblies for rapid and sensitive intra- and extracellular fluorescence imaging

    NARCIS (Netherlands)

    Afsari, Hamid Samareh; Cardoso Dos Santos, Marcelina; Lindén, Stina; Chen, Ting; Qiu, Xue; van Bergen En Henegouwen, Paul M P|info:eu-repo/dai/nl/071919481; Jennings, Travis L; Susumu, Kimihiro; Medintz, Igor L; Hildebrandt, Niko; Miller, Lawrence W

    Time-gated Förster resonance energy transfer (FRET) using the unique material combination of long-lifetime terbium complexes (Tb) and semiconductor quantum dots (QDs) provides many advantages for highly sensitive and multiplexed biosensing. Although time-gated detection can efficiently suppress

  15. Bulletin of Materials Science | Indian Academy of Sciences

    Indian Academy of Sciences (India)

    Home; Journals; Bulletin of Materials Science; Volume 39; Issue 7. Issue front cover thumbnail. Volume 39, Issue 7. December 2016, pages 1619-1889. pp 1619-1623. Luminescence properties of terbium-doped Li 3 PO 4 phosphor for radiation dosimetry · C B PALAN N S BAJAJ S K OMANWAR · More Details Abstract ...

  16. Interaction of 3-Hydroxypicolinamide with Tb III and its Sensitizing ...

    African Journals Online (AJOL)

    Interaction of 3-Hydroxypicolinamide with Tb III and its Sensitizing Effect on Terbium Luminescence as a Function of pH and Medium. ... The complex formed exists asML2 species in which HPA behaves as anO,O,N,N-chelating ligand. The solid complex is isolated from aqueous medium and characterized employing ...

  17. Lanthanide Enhanced Luminescence (LEL) with One and Two Photon Excitation of Quantum Dyes(copyright) Lanthanide(III)-Macrocycles

    National Research Council Canada - National Science Library

    Leif, Robert C; Becker, Margie C; Bromm Jr., Al; Chen, Nanguang; Cowan, Ann E; Vallarino, Lidia M; Yang, Sean; Zucker, Robert M


    .... Preliminary studies indicate that cells stained with the europium Quantum Dye can be observed both by conventional UV laser excitation and by infrared two-photon confocal microscopy. An enhancer has been found that enables the observation of simultaneous emissions from both the europium and terbium Quantum Dyes.

  18. Kinetically inert lanthanide complexes as reporter groups for binding of potassium by 18-crown-6

    DEFF Research Database (Denmark)

    Junker, Anne Kathrine Ravnsborg; Tropiano, Manuel; Faulkner, Stephen


    in a copper(I)-catalyzed alkyne-azide cycloaddition (CuAAC) “click” reaction with azide-functionalized crown ethers. The resulting complexes were investigated using NMR and optical methods. Titrations with potassium chloride in methanol observing the sensititzed europium- and terbium-centered emissions were...

  19. Acute and Short-Term Inhalation Toxicity Study of FT Fuel (United States)


    diameter ( MMAD ) of 2.7 µm with a geometric standard deviation (GSD) of 1.6. The aerosol was respirable, and well within the target range of 1 to 4 µm MMAD ...114 1.32 1.64 158 1.32 1.64 169 1.32 1.64 211 1.33 1.64 222 1.32 1.64 Average 1.31 1.64 SD 0.02 0.00 MMAD 2.7 GSD 1.6 Notes: GSD...geometric standard deviation; min = minutes; MMAD = mass median aerodynamic diameter; SD=standard deviation; MMAD was calculated from the geometric

  20. Luminescent properties of Al{sub 2}O{sub 3}: Tb powders; Propiedades luminiscentes de polvos de Al{sub 2}O{sub 3}: Tb

    Energy Technology Data Exchange (ETDEWEB)

    Esparza G, A.E.; Garcia, M.; Falcony, C.; Azorin N, J. [CICATA-IPN, Legaria 694, Col. Irrigacion, 11500 Mexico D.F. (Mexico)


    In this work the photo luminescent and cathode luminescent characteristics of aluminium oxide (Al{sub 2}O{sub 3}) powders impurified with terbium (Tb) were studied for their use in dosimetry. The optical, structural, morphological characteristics of the powders as function of variation in the impurity concentration and the annealing temperature will be presented. As regards the optical properties of powders (photoluminescence and cathode luminescence) it was observed a characteristic emission associated with radiative transitions between electron energy levels of terbium, the spectra associated with this emission consists of several peaks associated with such transitions. In the structural and morphological characterization (X-ray diffraction and scanning electron microscopy) it was appreciated that in accordance the annealing temperature of powders is augmented it is evident the apparition of certain crystalline phases. The results show that this is a promissory material for radiation dosimetry. (Author)

  1. Plastic optical fibre sensor for in-vivo radiation monitoring during brachytherapy (United States)

    Woulfe, P.; Sullivan, F. J.; Lewis, E.; O'Keeffe, S.


    An optical fibre sensor is presented for applications in real-time in-vivo monitoring of the radiation dose a cancer patient receives during seed implantation in Brachytherapy. The sensor is based on radioluminescence whereby radiation sensitive scintillation material is embedded in the core of a 1mm plastic optical fibre. Three scintillation materials are investigated: thallium-doped caesium iodide (CsI:Tl), terbium-doped gadolinium oxysulphide (Gd2O2S:Tb) and europium-doped lanthanum oxysulphide (La2O2S:Eu). Terbium-doped gadolinium oxysulphide was identified as being the most suitable scintillator and further testing demonstrates its measureable response to different activities of Iodine-125, the radio-active source commonly used in Brachytherapy for treating prostate cancer.

  2. ORF Alignment: NC_002936 [GENIUS II[Archive

    Lifescience Database Archive (English)


  3. PDB: CBRC-MMUR-01-1549 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-MMUR-01-1549 1HLL,1HO9,1HOD,1HOF, Region:133-164(Identity=100%) PDB:1HLL Chain:A (NMR...),Region:133-164(Identity=100%) PDB:1HO9 Chain:A (NMR),Region:133-164(Identity=100%) PDB:1HOD Chain:A (NMR),Region:133-164(Identity=100%) PDB:1HOF Chain:A (NMR), ...

  4. 40 CFR 161.290 - Environmental fate data requirements. (United States)


    ... adsorption/desorption R R R R R TGAI or PAIRA TGAI or PAIRA 163-1 Volatility: (Lab) (2) CR CR CR TEP TEP 163-2 (Field) (2) CR CR CR TEP TEP 163-3 Dissipation studies-field Soil R R R TEP TEP 164-1 Aquatic (sediment) R R TEP TEP 164-2 Forestry R TEP TEP 164-3 Combination and tank mixes (2) 164-4 Soil, long-term...

  5. ORF Alignment: NC_005823 [GENIUS II[Archive

    Lifescience Database Archive (English)


  6. [Luminescent cytochemical methods of detecting microorganisms]. (United States)

    Ivanovskaia, N P; Osin, N S; Khramov, E N; Zlobin, V N


    The paper shows that the luminescence cytochemical technique can be used for identification of microorganisms and microbiological synthesis products. The method is based on the interaction of specific fluorescence probes (ANS, terbium ions, and beta-diketonate complexes of europium, as well as metal-containing porphyrines) with major microbial intracellular components and toxins. Unlike classical microbiological, immunochemical or biochemical methods of detection, the proposed method has a reasonable versatility, specificity, sensitivity, rapid action, and possible automation.

  7. Radiotherapy dosimetry based on plastic optical fibre sensors (United States)

    O'Keeffe, S.; Grattan, M.; Hounsell, A.; McCarthy, D.; Woulfe, P.; Cronin, J.; Lewis, E.


    The use of a PMMA based plastic optical fibre in radiotherapy dosimetry is presented. The optical fibre tip is coated with a scintillation material, terbium-doped gadolinium oxysulfide (Gd2O2S:Tb), which fluoresces under ionising radiation. The emitted signal penetrates the fibre and propagates along the fibre where it is remotely monitored using a fluorescence spectrometer. The results demonstrate good repeatability, with a maximum percentage error of 0.59% and the response is independent of dose rate.

  8. Luminescent Lanthanide Metal Organic Frameworks for cis-Selective Isoprene Polymerization Catalysis


    Samantha Russell; Thierry Loiseau; Christophe Volkringer; Marc Visseaux


    In this study, we are combining two areas of chemistry; solid-state coordination polymers (or Metal-Organic Framework—MOF) and polymerization catalysis. MOF compounds combining two sets of different lanthanide elements (Nd3+, Eu3+/Tb3+) were used for that purpose: the use of neodymium was required due to its well-known catalytic properties in dienes polymerization. A second lanthanide, europium or terbium, was included in the MOF structure with the aim to provide luminescent properties. Sev...

  9. Modeled Neutron Induced Nuclear Reaction Cross Sections for Radiochemsitry in the region of Thulium, Lutetium, and Tantalum I. Results of Built in Spherical Symmetry in a Deformed Region

    Energy Technology Data Exchange (ETDEWEB)

    Hoffman, R. D. [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States)


    We have developed a set of modeled nuclear reaction cross sections for use in radiochemical diagnostics. Systematics for the input parameters required by the Hauser-Feshbach statistical model were developed and used to calculate neutron induced nuclear reaction cross sections for targets ranging from Terbium (Z = 65) to Rhenium (Z = 75). Of particular interest are the cross sections on Tm, Lu, and Ta including reactions on isomeric targets.

  10. Factors Affecting the Efficiency of Excited-States Interactions of Complexes between Some Visible Light-Emitting Lanthanide Ions and Cyclophanes Containing Spirobiindanol Phosphonates

    Directory of Open Access Journals (Sweden)

    M. S. Attia


    Full Text Available The efficiency of excited-states interactions between lanthanide ions Tb3+ and Eu3+ and some new cyclophanes (I, II, and III has been studied in different media. High luminescence quantum yield values for terbium and europium complexes in DMSO and PMMA were obtained. The photophysical properties of the green and red emissive Tb3+ and Eu3+ complexes have been elucidated, respectively.

  11. The effect of core and lanthanide ion dopants in sodium fluoride-based nanocrystals on phagocytic activity of human blood leukocytes (United States)

    Sojka, Bartlomiej; Liskova, Aurelia; Kuricova, Miroslava; Banski, Mateusz; Misiewicz, Jan; Dusinska, Maria; Horvathova, Mira; Ilavska, Silvia; Szabova, Michaela; Rollerova, Eva; Podhorodecki, Artur; Tulinska, Jana


    Sodium fluoride-based β-NaLnF4 nanoparticles (NPs) doped with lanthanide ions are promising materials for application as luminescent markers in bio-imaging. In this work, the effect of NPs doped with yttrium (Y), gadolinium (Gd), europium (Eu), thulium (Tm), ytterbium (Yb) and terbium (Tb) ions on phagocytic activity of monocytes and granulocytes and the respiratory burst was examined. The surface functionalization of leukocytes and respiratory burst of cells was observed for limited number of samples.

  12. The effect of metal distribution on the luminescence properties of mixed-lanthanide metal-organic frameworks. (United States)

    Cadman, Laura K; Mahon, Mary F; Burrows, Andrew D


    A series of lanthanide metal-organic frameworks (MOFs) of the general formula [Ln(Hodip)(H 2 O)]·nH 2 O (Sm, 1; Eu, 2; Gd, 3; Tb, 4; Dy, 5; Er, 6; H 4 odip = 5,5'-oxydiisophthalic acid) have been prepared and shown crystallographically to have isostructural three-dimensional frameworks. The fluorescence emission spectra of the europium compound 2, which is red, and the terbium compound 4, which is green, show characteristic peaks for transitions involving the metal centres, whereas that for the gadolinium compound 3 is dominated by transitions involving Hodip. Using a 1 : 1 : 1 mixture of europium, gadolinium and terbium nitrates in the synthesis resulted in the mixed-metal MOF [Gd 0.17 Tb 0.19 Eu 0.64 (Hodip)(H 2 O)]·nH 2 O 7, for which the ratio of the metal ions was determined using EDX spectroscopy. The fluorescence emission spectrum of 7 is dominated by europium emission bands reflecting the higher proportion of Eu 3+ centres and quenching of the terbium fluorescence by metal-to-metal energy transfer. A series of core-shell MOF materials based on the Ln(Hodip)(H 2 O) framework have been prepared in order to isolate the lanthanides in different domains within the crystals. The emission spectra for materials with Gd@Tb@Eu (8) and Tb@Eu@Gd (9) are dominated by terbium emissions, suggesting that physical separation from europium suppresses quenching. In contrast, the material with Eu@Gd@Tb (10) shows only broad ligand bands and europium emissions. This confirms that core-shell MOFs have different fluorescence properties to simple mixed-metal MOFs, demonstrating that the spatial distribution of the metals within a mixed-lanthanide MOF affects the fluorescence behaviour.

  13. Synthesis and stimulated luminescence property of Zn(BO2)2:Tb(3). (United States)

    Del Rosario, G Cedillo; Cruz-Zaragoza, E; Hipólito, M García; Marcazzó, J; Hernández A, J M; Murrieta S, H


    Zinc borate, Zn(BO2)2, doped with different concentrations of terbium (0.5-8mol%) was synthesized and polycrystalline samples were characterized by Scanning Electron Microscopy and X-Ray Diffraction. The Zn(BO2)2 was formed in the pure samples sintered at 750 and 800°C which has the body centered cubic structure, and a ZnB4O7 primitive orthorhombic phase was present. The thermoluminescent intensity was dependents on the thermal treatment (250-500°C) and also on the impurity concentration. The linear dose-response was obtained between 0.022-27.7Gy and 0.5-50Gy when the samples were exposed to beta and gamma radiation, respectively. The complex structure of the glow curves was analyzed by the Computerized Glow Curve Deconvolution method. The kinetics parameters were calculated assuming the general order kinetics model describing accurately the TL process. The glow curves of Tb(3+)-doped zinc borate phosphor were well deconvolved by six glow peaks. Zinc borate with 8mol% of impurity concentration exhibited an intense radioluminescent emission. The radioluminescent spectra show their maximum bands at 370, 490, 545 and 700nm related to the terbium ion in the zinc borate. These obtained results suggest that the terbium doped zinc borate is a promising phosphor for use in radiation dosimetry because of its high TL sensitivity to the ionizing radiation. Copyright © 2017 Elsevier Ltd. All rights reserved.

  14. Effect of Ising-type Tb3+ ions on the low-temperature magnetism of La, Ca cobaltite. (United States)

    Knížek, K; Jirák, Z; Hejtmánek, J; Veverka, M; Kaman, O; Maryško, M; Santavá, E; André, G


    Crystal and magnetic structures of the x = 0.2 member of the La0.8-xTbxCa0.2CoO3 perovskite series have been determined from powder neutron diffraction. Enhancement of the diffraction peaks due to ferromagnetic or cluster glass ordering is observed below TC = 55 K. The moments first evolve on Co sites, and ordering of Ising-type Tb(3+) moments is induced at lower temperatures by a molecular field due to Co ions. The final magnetic configuration is collinear Fx for the cobalt subsystem, while it is canted FxCy for terbium ions. The rare-earth moments align along local Ising axes within the ab-plane of the orthorhombic Pbnm structure. The behavior in external fields up to 70-90 kOe has been probed by magnetization and heat capacity measurements. The dilute terbium ions contribute to significant coercivity and remanence that both steeply increase with decreasing temperature. A remarkable manifestation of the Tb(3+) Ising character is the observation of a low-temperature region with an anomalously large linear term of heat capacity and its field dependence. Similar behaviors are detected also for other terbium dopings x = 0.1 and 0.3.

  15. Luminescence enhancement by energy transfer in melamine-Y{sub 2}O{sub 3}:Tb{sup 3+} nanohybrids

    Energy Technology Data Exchange (ETDEWEB)

    Stagi, Luigi, E-mail:; Chiriu, Daniele; Carbonaro, Carlo M.; Ricci, Pier Carlo [Dipartimento di Fisica, Università degli Studi di Cagliari, S.P. Monserrato-Sestu Km 0,700, 09042 Monserrato (Italy); Ardu, Andrea; Cannas, Carla [Departimento di Scienze Chimiche e Geologiche and INSTM, Università d Cagliari, SS 554 bivio Sestu, I-09042 Monserrato (Italy)


    The phenomenon of luminescence enhancement was studied in melamine-Y{sub 2}O{sub 3}:Tb hybrids. Terbium doped Y{sub 2}O{sub 3} mesoporous nanowires were synthesized by hydrothermal method. X-ray diffraction patterns and Raman scattering spectra testified the realization of a cubic crystal phase. Organic-inorganic melamine-Y{sub 2}O{sub 3}:Tb{sup 3+} hybrid system was successfully obtained by vapour deposition method. Vibration Raman active modes of the organic counterpart were investigated in order to verify the achievement of hybrid system. Photoluminescence excitation and photoluminescence spectra, preformed in the region between 250 and 350 nm, suggest a strong interaction among melamine and Terbium ions. In particular, a remarkable improvement of {sup 5}D{sub 4}→ F{sub J} Rare Earth emission (at about 542 nm) of about 10{sup 2} fold was observed and attributed to an efficient organic-Tb energy transfer. The energy transfer mechanism was studied by the use of time resolved photoluminescence measurements. The melamine lifetime undergoes to a significant decrease when adsorbed to oxide surfaces and it was connected to a sensitization mechanism. The detailed analysis of time decay profile of Terbium radiative recombination shows a variation of double exponential law toward a single exponential one. Its correlation with surface defects and non-radiative recombination was thus discussed.

  16. Functional analysis of promoter variants in the microsomal triglyceride transfer protein (MTTP) gene. (United States)

    Rubin, Diana; Schneider-Muntau, Alexandra; Klapper, Maja; Nitz, Inke; Helwig, Ulf; Fölsch, Ulrich R; Schrezenmeir, Jürgen; Döring, Frank


    The microsomal triglyceride transfer protein (MTTP) is required for the assembly and secretion of apolipoprotein B (apoB)-containing lipoproteins from the intestine and liver. According to this function, polymorphic sites in the MTTP gene showed associations to low-density lipoprotein (LDL) cholesterol and related traits of the metabolic syndrome. Here we studied the functional impact of common MTTP promoter polymorphisms rs1800804:T>C (-164T>C), rs1800803:A>T (-400A>T), and rs1800591:G>T (-493G>T) using gene-reporter assays in intestinal Caco-2 and liver Huh-7 cells. Significant results were obtained in Huh-7 cells. The common MTTP promoter haplotype -164T/-400A/-493G showed about two-fold lower activity than the rare haplotype -164C/-400T/-493T. MTTP promoter mutant constructs -164T/-400A/-493T and -164T/-400T/-493T exhibited similar activity than the common haplotype. Activities of mutants -164C/-400A/-493G and -164C/-400A/-493T resembled the rare MTTP promoter haplotype. Electrophoretic mobility shift assays (EMSAs) revealed higher binding capacity of the transcriptional factor Sterol regulatory element binding protein1a (SREBP1a) to the -164T probe in comparison to the -164C probe. In conclusion, our study indicates that the polymorphism -164T>C mediates different activities of common MTTP promoter haplotypes via SREBP1a. This suggested that the already described SREBP-dependent modulation of MTTP expression by diet is more effective in -164T than in -164C carriers. (c) 2007 Wiley-Liss, Inc.

  17. ORF Alignment: NC_005296 [GENIUS II[Archive

    Lifescience Database Archive (English)


  18. ORF Alignment: NC_002678 [GENIUS II[Archive

    Lifescience Database Archive (English)


  19. ORF Alignment: NC_006274 [GENIUS II[Archive

    Lifescience Database Archive (English)


  20. LLE Review 120 (July-September 2009)

    Energy Technology Data Exchange (ETDEWEB)

    Edgell, D.H., editor


    This issue has the following articles: (1) The Omega Laser Facility Users Group Workshop; (2) The Effect of Condensates and Inner Coatings on the Performance of Vacuum Hohlraum Targets; (3) Zirconia-Coated-Carbonyl-Iron-Particle-Based Magnetorheological Fluid for Polishing Optical Glasses and Ceramics; (4) All-Fiber Optical Magnetic Field Sensor Based on Faraday Rotation in Highly Terbium Doped Fiber; (5) Femtosecond Optical Pump-Probe Characterization of High-Pressure-Grown Al{sub 0.86}Ga{sub 0.14}N Single Crystals; (6) LLE's Summer High School Research Program; (7) Laser Facility Report; and (8) National Laser Users Facility and External Users Programs.

  1. Luminescent trimethoprim-polyaminocarboxylate lanthanide complex conjugates for selective protein labeling and time-resolved bioassays (United States)

    Reddy, D. Rajasekhar; Pedró Rosa, Laura E.; Miller, Lawrence W.


    Labeling proteins with long-lifetime emitting lanthanide (III) chelate reporters enables sensitive, time-resolved luminescence bioaffinity assays. Heterodimers of trimethoprim (TMP) covalently linked to various cs124-sensitized, polyaminocarboxylate chelates stably retain lanthanide ions and exhibit quantum yields of europium emission up to 20% in water. A time-resolved, luminescence resonance energy transfer (LRET) assay showed that TMP-polyaminocarboxylates bind to Escherichia coli dihydrofolate reductase (eDHFR) fusion proteins with nanomolar affinity in purified solutions and in bacterial lysates. The ability to selectively impart terbium or europium luminescence to fusion proteins in complex physiological mixtures bypasses the need for specific antibodies and simplifies sample preparation. PMID:21619068

  2. Micro-meter size organogelator with tri-color luminescence (blue, green and red) activated by Dy3+, Tb3+ and Eu3+ ions. (United States)

    Wang, QianMing


    The preparation of a novel type of low-molecular-weight amphiphilic organogelator bearing three long 14-alkyl chains and hydrophilic oligo(oxyethylene) groups was described. Ultra-violet absorption and fluorescence spectra give evidence of the energy transfer between organic ligands to lanthanide ions. Characteristic green, blue and red luminescence of the organogels were obtained and interesting emission properties of terbium, dysprosium and europium ions were unexpectedly observed at the first time during the order-disorder phase transition point (29 degrees C).

  3. Giant onsite electronic entropy enhances the performance of ceria for water splitting

    DEFF Research Database (Denmark)

    Naghavi, S. Shahab; Emery, Antoine A.; Hansen, Heine Anton


    lanthanides, and reaches a maximum value of ≈4.7 kB per oxygen vacancy for Ce4+/Ce3+ reduction. This unique and large positive entropy source in ceria explains its excellent performance for high-temperature catalytic redox reactions such as water splitting. Our calculations also show that terbium dioxide has......Previous studies have shown that a large solid-state entropy of reduction increases the thermodynamic efficiency of metal oxides, such as ceria, for two-step thermochemical water splitting cycles. In this context, the configurational entropy arising from oxygen off-stoichiometry in the oxide, has...

  4. Surface-Modified Gold Nanoparticles Possessing Two-Channel Responsive Eu(III) /Tb(III) Cyclen Complexes as Luminescent Logic Gate Mimics. (United States)

    Truman, Laura K; Bradberry, Samuel J; Comby, Steve; Kotova, Oxana; Gunnlaugsson, Thorfinnur


    The development of material-supported molecular logic gate mimics (MGLMs) for contained application and device fabrication has become of increasing interest. Herein, we present the formation of ≈5 nm gold nanoparticles (AuNPs) that have been surface-modified (via a thiol linkage) with heptadentate cyclen-based complexes of europium and terbium for sensing applications using delayed lanthanide luminescence and as integrated logic gate mimics within competitive media. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  5. Synthesis and characterization of multifunctional silica core-shell nanocomposites with magnetic and fluorescent functionalities

    Energy Technology Data Exchange (ETDEWEB)

    Ma Zhiya; Dosev, Dosi [Department of Mechanical and Aeronautical Engineering, University of California-Davis, One Shields Avenue, Davis CA 95616 (United States); Nichkova, Mikaela [Department of Entomology, University of California-Davis, One Shields Avenue, Davis CA 95616 (United States); Dumas, Randy K. [Department of Physics, University of California-Davis, One Shields Avenue, Davis CA 95616 (United States); Gee, Shirley J.; Hammock, Bruce D. [Department of Entomology, University of California-Davis, One Shields Avenue, Davis CA 95616 (United States); Liu Kai [Department of Physics, University of California-Davis, One Shields Avenue, Davis CA 95616 (United States); Kennedy, Ian M. [Department of Mechanical and Aeronautical Engineering, University of California-Davis, One Shields Avenue, Davis CA 95616 (United States)], E-mail:


    Multifunctional core-shell nanocomposites with a magnetic core and a silica shell doped with lanthanide chelate have been prepared by a simple method. First, citric acid-modified magnetite nanoparticles were synthesized by a chemical coprecipitation method. Then the magnetite nanoparticles were coated with silica shells doped with terbium (Tb{sup 3+}) complex by a modified Stoeber method based on hydrolyzing and condensation of tetraethyl orthosilicate (TEOS) and a silane precursor. These multifunctional nanocomposites are potentially useful in a variety of biological areas such as bio-imaging, bio-labeling and bioassays because they can be simultaneously manipulated with an external magnetic field and exhibit unique phosphorescence properties.

  6. Luminescent probing of the simplest chiral α-amino acid-alanine in an enantiopure and racemic state. (United States)

    Tarasevych, Arkadii V; Kostyukov, Anton I; Baronskiy, Mark G; Rastorguev, Alexander A; Guillemin, Jean-Claude; Snytnikov, Valeriy N


    Luminescent spectroscopy combined with the technique of luminescent probing with rare earth ions (europium, gadolinium, terbium) and an actinide ion (uranyl) was used to differentiate enantiopure and racemic alanine, the simplest chiral proteinogenic amino acid. Using the achiral luminescent probes, small differences between pure L and DL alanine in the solid state were strongly amplified. Based on the observed electronic transitions of the probes, the position of the triplet level of the coordinated alanine was estimated. Formation of homo- and heterochiral complexes between enantiomers of alanine and the metal ions is discussed as a possible mechanism of chiral self-discrimination. © 2017 Wiley Periodicals, Inc.

  7. Investigation of magnon dispersion relations and neutron scattering cross sections with special attention to anisotropy effects

    DEFF Research Database (Denmark)

    Lindgård, Per-Anker; Kowalska, A.; Laut, Peter


    -helical structure. A numerical calculation is performed for terbium on the basis of the Kaplan-Lyons Hamiltonian with added crystalline anisotropy. The non-istropic exchange part is shown to have a small effect on the dispersion curves, and it turns out that radical changes of the Ruderman-Kittel-type functions...... for the exchange interaction seem to be necessary for agreement with experimental dispersion curves be obtained. The effect of the anisotropy in the cross section is estimated and shown to be important for small magnon energies....

  8. Rare (Earth Elements [score

    Directory of Open Access Journals (Sweden)

    Camilo Méndez


    Full Text Available Rare (Earth Elements is a cycle of works for solo piano. The cycle was inspired by James Dillon’s Book of Elements (Vol. I-V. The complete cycle will consist of 14 pieces; one for each selected rare (earth element. The chosen elements are Neodymium, Erbium, Tellurium, Hafnium, Tantalum, Technetium, Indium, Dysprosium, Lanthanium, Cerium, Europium, Terbium, Yttrium and Darmstadtium. These elements were selected due to their special atomic properties that in many cases make them extremely valuable for the development of new technologies, and also because of their scarcity. To date, only 4 works have been completed Yttrium, Technetium, Indium and Tellurium.

  9. Alaska's rare earth deposits and resource potential (United States)

    Barker, James C.; Van Gosen, Bradley S.


    Alaska’s known mineral endowment includes some of the largest and highest grade deposits of various metals, including gold, copper and zinc. Recently, Alaska has also been active in the worldwide search for sources of rare earth elements (REE) to replace exports now being limitedby China. Driven by limited supply of the rare earths, combined with their increasing use in new ‘green’ energy, lighting, transportation, and many other technological applications, the rare earth metals neodymium, europium and, in particular, the heavy rare earth elements terbium, dysprosium and yttrium are forecast to soon be in critical short supply (U.S. Department of Energy, 2010).

  10. Sol-Gel Electrolytes Incorporated by Lanthanide Luminescent Materials and Their Photophysical Properties (United States)

    Yu, Chufang; Zhang, Zhengyang; Fu, Meizhen; Gao, Jinwei; Zheng, Yuhui


    A group of silica gel electrolytes with lanthanide luminescent hybrid materials were assembled and investigated. Photophysical studies showed that terbium and europium hybrids displayed characteristic green and red emissions within the electrolytes. The influence of different concentration of the lanthanide hybrids on the electrochemical behavior of a gelled electrolyte valve-regulated lead-acid battery were studied through cyclic voltammograms, electrochemical impedance spectroscopy, water holding experiments and mobility tests. The morphology and particle size were analyzed by scanning electron microscopy. The results proved that lanthanide (Tb3+/Eu3+) luminescent materials are effective additives which will significantly improve the electrochemical properties of lead-acid batteries.


    Directory of Open Access Journals (Sweden)

    Sergiy Smola


    Full Text Available Four new heteronuclear lanthanide complexes with general formula [Ge(OH(μ-HDTPALnGe(OH (μ-DTPA] (Ln = Sm – Dy were synthesized and subsequently characterized by different physico- chemical methods. The structures of new compounds have been proposed. In considered complexes the 4f-luminescence of three-charged ions of samarium, europium, terbium and dysprosium is realized at UV-excitation. It is noteworthy that it is the first observation of 4f-luminescence in water solutions of heteronuclear f-p-complexes. The comparison of luminescent characteristics of hetero- and homonuclear landthanide complexes is described and discussed as well.

  12. Tetrakis(μ-2-phenoxypropionato-κ3O,O′:O′;κ3O:O,O′,κ4O:O′-bis[(1,10-phenanthroline-κ2N,N′(2-phenoxypropionato-κ2O,O′praseodymium(III

    Directory of Open Access Journals (Sweden)

    Jin-Bei Shen


    Full Text Available In the centrosymmetric binuclear title complex, [Pr2(C9H9O36(C12H8N22], the two PrIII ions are linked by four 2-phenoxypropionate (L groups through their bi- and tridentate bridging modes. Each PrIII ion is nine-coordinated by one 1,10-phenanthroline molecule, one bidentate carboxylate group and four bridging carboxylate groups in a distorted PrN2O7 monocapped square-antiprismatic geometry. The title compound is isotypic with its terbium- and dysprosium-containing analogues.

  13. Detection of rare earth elements in Powder River Basin sub-bituminous coal ash using laser-induced breakdown spectroscopy (LIBS)

    Energy Technology Data Exchange (ETDEWEB)

    Tran, Phuoc [National Energy Technology Lab. (NETL), Pittsburgh, PA, (United State; Mcintyre, Dustin [National Energy Technology Lab. (NETL), Pittsburgh, PA, (United State


    We reported our preliminary results on the use of laser-induced breakdown spectroscopy to analyze the rare earth elements contained in ash samples from Powder River Basin sub-bituminous coal (PRB-coal). We have identified many elements in the lanthanide series (cerium, europium, holmium, lanthanum, lutetium, praseodymium, promethium, samarium, terbium, ytterbium) and some elements in the actinide series (actinium, thorium, uranium, plutonium, berkelium, californium) in the ash samples. In addition, various metals were also seen to present in the ash samples

  14. Faraday rotator based on TSAG crystal with orientation. (United States)

    Yasuhara, Ryo; Snetkov, Ilya; Starobor, Aleksey; Mironov, Evgeniy; Palashov, Oleg


    A Faraday isolator (FI) for high-power lasers with kilowatt-level average power and 1-µm wavelength was demonstrated using a terbium scandium aluminum garnet (TSAG) with its crystal axis aligned in the direction. Furthermore, no compensation scheme for thermally induced depolarization in a magnetic field was used. An isolation ratio of 35.4 dB (depolarization ratio γ of 2.9 × 10-4) was experimentally observed at a maximum laser power of 1470 W. This result for room-temperature FIs is the best reported, and provides a simple, practical solution for achieving optical isolation in high-power laser systems.

  15. The Shock and Vibration Digest. Volume 18, Number 10 (United States)


    plained. 86-1865 Random Vibration of Rotating Machine« under Earthquake Excitations B, Samali, K.B. Kim, J.N. Yang George Washington Univ...AD-A164 207/3/GAR KEY WORDS: Soils, Constitutive equations Topics in these appendices to An-A164 206 include: stress analysis; Cayley -Hamilton

  16. Eesti Raamatukoguhoidjate Ühingu tegevusest 2002. aastal / Krista Talvi

    Index Scriptorium Estoniae

    Talvi, Krista, 1948-


    Ka EARis 2002. a. toimunust; mainitud ka EARi töötajaid : lk. 155, 157, 167 K. Kaugver; lk. 155 J. Kaps; lk. 160, 165 T. Reimo, lk. 164 A.-M. Kirsel; lk. 164, 167 M. Aasmets; lk. 165 A. Valmas; lk. 165 A. Kruus

  17. 75 FR 49454 - Submission for OMB Review; Comment Request (United States)


    ... products being exported. Form VS-16-4 and VS- 16-4A, Export Certificate for Animal Products and Export... agency #0;statements of organization and functions are examples of documents #0;appearing in this section... collection of information is necessary for the proper performance of the functions of the agency, including...

  18. The Fate of Malathion on Copper and Iron Piping Within a Water Distribution System (United States)


    Acknowledgements I would like first and foremost to express gratitude to my Lord and Savior Jesus Christ for the faith, passion and energy to persevere to the...AFIT-ENV-MS-15-M-164 v To my Jesus , Wife, and Family AFIT-ENV-MS-15-M-164 vi

  19. 76 FR 20412 - Self-Regulatory Organizations; National Stock Exchange, Inc.; Notice of Filing and Immediate... (United States)


    ... daily volume (as such term is defined in Endnote 3 of the Fee Schedule, ``Liquidity Adding ADV'') is less than 20 basis points of Total Consolidated Average Daily Volume (as defined in Endnote 13 of the... with Endnote 8), and NSX Rule 16.4 would be deleted in its entirety. \\5\\ NSX Rule 16.4(b). To the...

  20. 77 FR 22562 - Non-Malleable Cast Iron Pipe Fittings From the People's Republic of China: Initiation and... (United States)


    ... ``gray iron pipe fittings.'' These cast iron pipe fittings are normally produced to ASTM A-126 and ASME B.16.4 specifications and are threaded to ASME B1.20.1 specifications. Most building codes require that... which have the same physical characteristics and are produced to ASME B.16.3, ASME B.16.4, or ASTM A-395...

  1. 77 FR 31577 - Non-Malleable Cast Iron Pipe Fittings From the People's Republic of China: Final Results of... (United States)


    ...-126 and ASME B.16.4 specifications and are threaded to ASME B1.20.1 specifications. Most building... to the scope above or which have the same physical characteristics and are produced to ASME B.16.3, ASME B.16.4, or ASTM A-395 specifications, threaded to ASME B1.20.1 specifications and UL certified...

  2. 76 FR 31936 - Non-Malleable Cast Iron Pipe Fittings From the People's Republic of China: Final Results of... (United States)


    ... are normally produced to ASTM A-126 and ASME B.16.4 specifications and are threaded to ASME B1.20.1... ASME B.16.3, ASME B.16.4, or ASTM A-395 specifications, threaded to ASME B1.20.1 specifications and UL...

  3. Experiment list: SRX014765 [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available ROGENITOR CELLS) in the bone marrow and other sites. 9180677,92.2,5.7,109 GSM468195: H3K27me3 ChIP-seq APL164 48hours...ATRA JM16 source_name=APL cells _pz164 || agent=48 hours ATRA || antibod

  4. 78 FR 54467 - Agency Information Collection Activities; Submission to OMB for Review and Approval; Public... (United States)


    ... used by covered entities and business associates for treatment, payment, and health care operations. In... (health care providers--diss emination and acknowledgement ). 164.522 Rights to 150,000 1 3/60 7,500... (denials). 164.528 Accounting for 70,000 1 3/60 5,833 Disclosures of Protected Health Information. Total 32...

  5. 78 FR 56232 - Agency Information Collection Activities; Submission to OMB for Review and Approval; Public... (United States)


    ... used by covered entities and business associates for treatment, payment, and health care operations. In... Privacy 613,000,000 1 3/60 30,650,000 Practices for Protected Health Information (health care providers...). 164.526 Amendment of 50,000 1 3/60 2,500 Protected Health Information (denials). 164.528 Accounting...

  6. Early development of the African catfish Clarias gariepinus (Burchell, 1822), focusing on the ontogeny of selected organs

    NARCIS (Netherlands)

    Osman, A.G.M.; Wuertz, S.; Mekkawy, Imam A.; Verreth, J.A.J.; Kirschbaum, Frank


    Embryonic development of Clarias gariepinus was studied from oocyte activation to the end of endogenous feeding (164 h post-fertilization, 164 h-PF). The ontogeny of the eyes, the ear, the heart, the digestive tract and the notochord were described histologically: (i) eyes were not pigmented at

  7. 46 CFR 160.049-3 - Materials. (United States)


    ...: SPECIFICATIONS AND APPROVAL LIFESAVING EQUIPMENT Specification for a Buoyant Cushion Plastic Foam § 160.049-3... requirements of subpart 164.019. (b) Unicellular plastic foam. The unicellular plastic foam shall be all new material complying with the requirements of Specification subpart 164.015 for Type A or B foam. (c) Cover...

  8. Dicty_cDB: Contig-U15323-1 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available _1( EU737901 |pid:none) Psittacus erithacus aldolase B fru... 164 6e-39 EU737783_...1( EU737783 |pid:none) Tinamus guttatus aldolase B fructo... 164 8e-39 EU737833_1( EU737833 |pid:none) Daptr

  9. What's new@CERN, episode 2

    CERN Multimedia

    CERN Video productions


    On Monday 7 November at 4pm in English and 4.20pm in French, watch "What's new@CERN" on In this second episode: LHC performance, a journey to the particle source and this past month's news.   var flash_video_player=get_video_player_path(); insert_player_for_external('Video/Public/Movies/2011/CERN-MOVIE-2011-164/CERN-MOVIE-2011-164-0753-kbps-640x360-25-fps-audio-64-kbps-44-kHz-stereo', 'mms://', 'false', 480, 360, '', '1394250', true, 'Video/Public/Movies/2011/CERN-MOVIE-2011-164/CERN-MOVIE-2011-164-0600-kbps-maxH-360-25-fps-audio-128-kbps-48-kHz-stereo.mp4');

  10. EST Table: FS866549 [KAIKOcDNA[Archive

    Lifescience Database Archive (English)

    Full Text Available 164 aa ref|NP_001040385.1| pelota-like protein [Bombyx mori] gb|ABF51295.1| pelota-like protein [Bombyx mori...10 76 %/164 aa gi|91095145|ref|XP_967126.1| PREDICTED: similar to pelota [Tribolium castaneum] FS866549 fner ...

  11. The right to just administrative action in the context of suspending ...

    African Journals Online (AJOL)

    The objective of this article is to apply the right to just administrative action to the manner in which the decision in terms of section 164(3) of the TAA is taken. This is achieved by adopting an explanatory research approach and performing a literature review of the process in terms of section 164(3) of the TAA and the ...

  12. Detection of bacterial spores with lanthanide-macrocycle binary complexes. (United States)

    Cable, Morgan L; Kirby, James P; Levine, Dana J; Manary, Micah J; Gray, Harry B; Ponce, Adrian


    The detection of bacterial spores via dipicolinate-triggered lanthanide luminescence has been improved in terms of detection limit, stability, and susceptibility to interferents by use of lanthanide-macrocycle binary complexes. Specifically, we compared the effectiveness of Sm, Eu, Tb, and Dy complexes with the macrocycle 1,4,7,10-tetraazacyclododecane-1,7-diacetate (DO2A) to the corresponding lanthanide aquo ions. The Ln(DO2A)(+) binary complexes bind dipicolinic acid (DPA), a major constituent of bacterial spores, with greater affinity and demonstrate significant improvement in bacterial spore detection. Of the four luminescent lanthanides studied, the terbium complex exhibits the greatest dipicolinate binding affinity (100-fold greater than Tb(3+) alone, and 10-fold greater than other Ln(DO2A)(+) complexes) and highest quantum yield. Moreover, the inclusion of DO2A extends the pH range over which Tb-DPA coordination is stable, reduces the interference of calcium ions nearly 5-fold, and mitigates phosphate interference 1000-fold compared to free terbium alone. In addition, detection of Bacillus atrophaeus bacterial spores was improved by the use of Tb(DO2A)(+), yielding a 3-fold increase in the signal-to-noise ratio over Tb(3+). Out of the eight cases investigated, the Tb(DO2A)(+) binary complex is best for the detection of bacterial spores.

  13. Structural Characterization and Absolute Luminescence Efficiency Evaluation of Gd2O2S High Packing Density Ceramic Screens Doped with Tb3+ and Eu3+ for further Applications in Radiology (United States)

    Dezi, Anna; Monachesi, Elenasophie; D’Ignazio, Michela; Scalise, Lorenzo; Montalto, Luigi; Paone, Nicola; Rinaldi, Daniele; Mengucci, Paolo; Loudos, George; Bakas, Athanasios; Michail, Christos; Valais, Ioannis; Fountzoula, Christine; Fountos, George; David, Stratos


    Rare earth activators are impurities added in the phosphor material to enhance probability of visible photon emission during the luminescence process. The main activators employed are rare earth trivalent ions such as Ce+3, Tb+3, Pr3+ and Eu+3. In this work, four terbium-activated Gd2O2S (GOS) powder screens with different thicknesses (1049 mg/cm2, 425.41 mg/cm2, 313 mg/cm2 and 187.36 mg/cm2) and one europium-activated GOS powder screen (232.18 mg/cm2) were studied to investigate possible applications for general radiology detectors. Results presented relevant differences in crystallinity between the GOS:Tb doped screens and GOS:Eu screens in respect to the dopant agent present. The AE (Absolute efficiency) was found to rise (i) with the increase of the X-ray tube voltage with the highest peaking at 110kVp and (ii) with the decrease of the thickness among the four GOS:Tb. Comparing similar thickness values, the europium-activated powder screen showed lower AE than the corresponding terbium-activated.

  14. Synthesis and characterization of magnetic nanoparticles of oxides for dual MnFe{sub 2}O{sub 4} bioseparation, stabilized in fatty acid and the system chitosan - Eu(TTA){sub 3}(TPPO){sub 2}. Studies on the influence of doping with Gd{sup 3+}, Tb{sup 3+}, Ho{sup 3+} e Eu{sup 3+} in structural and magnetic properties; Sintese e caracterizacao de nanoparticulas magneticas de oxidos duplos de MnFe{sub 2}O{sub 4} para biosseparacao, estabilizadas em acido graxo e recobertas pelo sistema quitosana - Eu(TTA){sub 3}(TPPO){sub 2}. Estudo da influencia da dopagem com Gd{sup 3+}, Tb{sup 3+}, Ho{sup 3+} e Eu{sup 3+} nas propriedades estruturais e magneticas

    Energy Technology Data Exchange (ETDEWEB)

    Kovacs, Thelma Antunes Rodrigues


    This work was synthesized and characterized ferrite magnetic nanoparticles manganese, using the chemical coprecipitation method. By varying the heating time under 98°C (0, 10,20,40,60 3 80 minutes), the molar percentage of doping (1, 3, 5, 7, and 10%), gadolinium, europium, terbium and holmium. Magnetic ferrite nanoparticles and manganese ferrite doped with manganese were synthesized by coprecipitation method starting with chloride solutions of metals (iron (III), manganese (II), europium (III), gadolinium (III), terbium (III) and holmium (III)) and NaOH 5mol.L{sup -1} as precipitating agent. The magnetic nanoparticles were characterized by scanning electron microscopy, infrared spectroscopy, X-ray diffraction, magnetization curves, and thermal analysis. Most of manganese ferrite particles showed superparamagnetic behavior. After the characterization it was found that the samples synthesized manganese ferrite with more than 40 minutes heating time, crystal structure showed the characteristic pattern of the inverted manganese ferrite spinel type. The stabilization of the samples in oleic acid nanoparticles produced with a hydrophobic outer layer and facilitated by coating chitosan biopolymer, since this has a positive charge. Among the doped samples there was no significant change in the magnetic behavior. Several techniques for characterizing these materials have been used such as X-ray diffraction spectrum in the infrared region, magnetization curves and thermal analysis. The resins were tested as magnetic material for the separation of biological materials. In this paper, are used as biological targets separation of bovine serum albumin. (author)

  15. Cerium fluoride nanoparticles protect cells against oxidative stress

    Energy Technology Data Exchange (ETDEWEB)

    Shcherbakov, Alexander B.; Zholobak, Nadezhda M. [Zabolotny Institute of Microbiology and Virology, National Academy of Sciences of Ukraine, Kyiv D0368 (Ukraine); Baranchikov, Alexander E. [Kurnakov Institute of General and Inorganic Chemistry of the Russian Academy of Sciences, Moscow 119991 (Russian Federation); Ryabova, Anastasia V. [Prokhorov General Physics Institute of the Russian Academy of Sciences, Moscow 119991 (Russian Federation); National Research Nuclear University MEPhI (Moscow Engineering Physics Institute), Moscow 115409 (Russian Federation); Ivanov, Vladimir K., E-mail: [Kurnakov Institute of General and Inorganic Chemistry of the Russian Academy of Sciences, Moscow 119991 (Russian Federation); National Research Tomsk State University, Tomsk 634050 (Russian Federation)


    A novel facile method of non-doped and fluorescent terbium-doped cerium fluoride stable aqueous sols synthesis is proposed. Intense green luminescence of CeF{sub 3}:Tb nanoparticles can be used to visualize these nanoparticles' accumulation in cells using confocal laser scanning microscopy. Cerium fluoride nanoparticles are shown for the first time to protect both organic molecules and living cells from the oxidative action of hydrogen peroxide. Both non-doped and terbium-doped CeF{sub 3} nanoparticles are shown to provide noteworthy protection to cells against the vesicular stomatitis virus. - Highlights: • Facile method of CeF{sub 3} and CeF{sub 3}:Tb stable aqueous sols synthesis is proposed. • Naked CeF{sub 3} nanoparticles are shown to be non-toxic and to protect cells from the action of H{sub 2}O{sub 2}. • CeF{sub 3} and CeF{sub 3}:Tb nanoparticles are shown to protect living cells against the vesicular stomatitis virus.

  16. Synthesis and characterization of Tin / Titanium mixed oxide nanoparticles doped with lanthanide for biomarking; Sintese e caracterizacao de nanoparticulas de oxido misto de estanho/titanio dopadas com lantanideos para marcacao biologica

    Energy Technology Data Exchange (ETDEWEB)

    Paganini, Paula Pinheiro


    This work presents the synthesis, characterization and photo luminescent study of tin and titanium mixed oxide nanoparticles doped with europium, terbium and neodymium to be used with luminescent markers on biological systems. The syntheses were done by co-precipitation, protein sol-gel and Pechini methods and the nanoparticles were characterized by infrared spectroscopy, thermogravimetric analysis, scanning electron microscopy, X-ray diffraction and X-ray absorption spectroscopy. The photo luminescent properties studies were conducted for luminophores doped with europium, terbium and neodymium synthesized by coprecipitation method. For luminophore doped with europium it was possible to calculate the intensity parameters and quantum yield and it showed satisfactory results. In the case of biological system marking it was necessary the functionalization of these particles to allow them to bind to the biological part to be studied. So the nanoparticles were functionalized by microwave and Stoeber methods and characterized by infrared spectroscopy, scanning electron microscopy, energy dispersive X-ray spectroscopy and X-ray diffraction obtaining qualitative response of functionalization efficacy. The ninhydrin spectroscopic method was used for quantification of luminophores functionalization. The photo luminescent studies of functionalized particles demonstrate the potential applying of these luminophores as luminescent markers. (author)

  17. Fabrication of Tb3Al5O12 transparent ceramics using co-precipitated nanopowders (United States)

    Dai, Jiawei; Pan, Yubai; Wang, Wei; Luo, Wei; Xie, Tengfei; Kou, Huamin; Li, Jiang


    Terbium aluminum garnet (TAG) precursor was synthesized by a co-precipitation method from a mixed solution of terbium and aluminum nitrates using ammonium hydrogen carbonate (AHC) as the precipitant. The powders calcined at different temperatures were investigated by XRD, FTIR and FESEM in order to choose the optimal calcination temperature. Fine and low-agglomerated TAG powders with average particle size of 88 nm were obtained by calcining the precursor at 1100 °C for 4 h. Using this powder as starting material, TAG transparent ceramics were fabricated by vacuum sintering combined with hot isostatic pressing (HIP) sintering. For the sample pre-sintered at 1700 °C for 20 h with HIP post-treated at 1700 °C for 3 h, the average grain size is about 3.9 μm and the in-line transmittance is beyond 55% in the region of 500-1600 nm, reaching a maximum transmittance of 64.2% at the wavelength of 1450 nm. The Verdet constant at 633 nm is measured to be -178.9 rad T-1 m-1, which is 33% larger than that of the commercial TGG single crystal (-134 rad T-1 m-1).

  18. Incorporation of Ln-Doped LaPO4 Nanocrystals as Luminescent Markers in Silica Nanoparticles. (United States)

    van Hest, Jacobine J H A; Blab, Gerhard A; Gerritsen, Hans C; Donega, Celso de Mello; Meijerink, Andries


    Lanthanide ions are promising for the labeling of silica nanoparticles with a specific luminescent fingerprint due to their sharp line emission at characteristic wavelengths. With the increasing use of silica nanoparticles in consumer products, it is important to label silica nanoparticles in order to trace the biodistribution, both in the environment and living organisms.In this work, we synthesized LaPO4 nanocrystals (NCs) with sizes ranging from 4 to 8 nm doped with europium or cerium and terbium. After silica growth using an inverse micelle method, monodisperse silica spheres were obtained with a single LaPO4 NC in the center. We demonstrate that the size of the silica spheres can be tuned in the 25-55 nm range by addition of small volumes of methanol during the silica growth reaction. Both the LaPO4 core and silica nanocrystal showed sharp line emission characteristic for europium and terbium providing unique optical labels in silica nanoparticles of variable sizes.

  19. Magnetic phase transitions in TbFe sub 2 Al sub 1 sub 0 , HoFe sub 2 Al sub 1 sub 0 and ErFe sub 2 Al sub 1 sub 0

    CERN Document Server

    Reehuis, M; Krimmel, A; Scheidt, E W; Stüsser, N; Loidl, A; Jeitschko, W


    The magnetic order of the orthorhombic aluminides TbFe sub 2 Al sub 1 sub 0 , HoFe sub 2 Al sub 1 sub 0 and ErFe sub 2 Al sub 1 sub 0 (space group Cmcm) has been studied by specific heat and magnetic measurements, as well as by neutron powder diffraction down to 100 mK and in external fields up to 5 T. Only the rare-earth ions carry a magnetic moment. At T = 1.5 K the terbium moments in TbFe sub 2 Al sub 1 sub 0 show a square-wave modulated magnetic order with wavevector k = (0, 0.7977, 0) and a moment direction parallel to the a-axis. At a critical field of H sub c sub 1 = 0.9 T one of ten spins is forced to flip, going into an intermediate ferrimagnetic phase that is stable up to the critical field H sub c sub 2 = 1.8 T. Above this field finally all the rest of the spins flip, resulting in a ferromagnetic order of the terbium moments. ErFe sub 2 Al sub 1 sub 0 orders antiferromagnetically below T sub N 1.77(7) K with a similar magnetic structure characterized by a wavevector k (0, approx 0.8, 0). In contras...

  20. Deuteron induced Tb-155 production, a theranostic isotope for SPECT imaging and auger therapy. (United States)

    Duchemin, C; Guertin, A; Haddad, F; Michel, N; Métivier, V


    Several terbium isotopes are suited for diagnosis or therapy in nuclear medicine. Tb-155 is of interest for SPECT imaging and/or Auger therapy. High radionuclide purity is mandatory for many applications in medicine. The quantification of the activity of the produced contaminants is therefore as important as that of the radionuclide of interest. The experiments performed at the ARRONAX cyclotron (Nantes, France), using the deuteron beam delivered up to 34MeV, provide an additional measurement of the excitation function of the Gd-nat(d,x)Tb-155 reaction and of the produced terbium and gadolinium contaminants. In this study, we investigate the achievable yield for each radionuclide produced in natural gadolinium as a function of the deuteron energy. Other reactions are discussed in order to define the production route that could provide Tb-155 with a high yield and a high radionuclide purity. This article aims to improve data for the Gd-nat(d,x) reaction and to optimize the irradiation conditions required to produce Tb-155. Copyright © 2016 Elsevier Ltd. All rights reserved.

  1. Casting core for a cooling arrangement for a gas turbine component (United States)

    Lee, Ching-Pang; Heneveld, Benjamin E


    A ceramic casting core, including: a plurality of rows (162, 166, 168) of gaps (164), each gap (164) defining an airfoil shape; interstitial core material (172) that defines and separates adjacent gaps (164) in each row (162, 166, 168); and connecting core material (178) that connects adjacent rows (170, 174, 176) of interstitial core material (172). Ends of interstitial core material (172) in one row (170, 174, 176) align with ends of interstitial core material (172) in an adjacent row (170, 174, 176) to form a plurality of continuous and serpentine shaped structures each including interstitial core material (172) from at least two adjacent rows (170, 174, 176) and connecting core material (178).

  2. Indsigter og udfordringer i danske Lynch-syndrom-familier

    DEFF Research Database (Denmark)

    Therkildsen, Christina; Timshel, Susanne; Nilbert, Mef


    identified 88 unique mutations in 164 Danish families delineated as Lynch syndrome families. Predictive genetic diagnostics enables the identification of high risk individuals, who are offered participation in surveillance programmes that effectively reduce morbidity and mortality in colorectal cancer....

  3. Magnetic Properties of the DNA-Quaternary Ammonium Surfactant Complexes Studied by EMR Spectroscopy and SQUID Measurement (United States)


    261– , Academic Press, New York(1960). 83. Nechtschein, M. ”Electron Spin Dynamics,” Handbook of Conducting Poly- mers, T. Skotheim , R. L. Elsenbaumer, J. R. Reynolds, Eds., pp 141–164, Marcel Dekker, New York(1998).

  4. Assessment of undiscovered oil and gas resources in the Lower Indus Basin, Pakistan, 2017 (United States)

    Schenk, Christopher J.; Tennyson, Marilyn E.; Klett, Timothy R.; Finn, Thomas M.; Mercier, Tracey J.; Gaswirth, Stephanie B.; Marra, Kristen R.; Le, Phuong A.; Hawkins, Sarah J.; Leathers-Miller, Heidi M.


    Using a geology-based assessment methodology, the U.S. Geological Survey estimated mean undiscovered, technically recoverable resources of 164 million barrels of oil and 24.6 trillion cubic feet of gas in the Lower Indus Basin, Pakistan.

  5. DMA Antarctic Gravity Data (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — The gravity station data (65,164 records) were gathered by various governmental organizations (and academia) using a variety of methods. The data base was received...

  6. Iris Murdoch armastusest / Udo uibo

    Index Scriptorium Estoniae

    Uibo, Udo, 1956-


    Londoni Kingstoni ülikool omandas 50 000 naesterlingi eest 164 Iris Murdochi kirja prantsuse kirjanikule, keeleeksperimentaatorile Raymond Quenaule, millest selgub Murdochi ühepoolne ning vastamata jäänud tunne Quenau suhtes.

  7. AFRREV STECH: An International Journal of Science and ...

    African Journals Online (AJOL)

    Design, Fabrication and Performance Evaluation of a Domestic Dish Washing Machine · EMAIL FREE FULL TEXT EMAIL FREE FULL TEXT · DOWNLOAD FULL TEXT DOWNLOAD FULL TEXT. I F Odesola, A O Adigun, 164-173 ...

  8. Risk factors for invasive squamous cell carcinoma of the vulva and vagina - Population-based case-control study in Denmark

    National Research Council Canada - National Science Library

    Madsen, B.S; Jensen, H.L; Brule, van den, A.J.C; Woldfalurt, J; Frisch, M


    .... A total of 182 women with invasive VV‐SCC (116 with VV‐SCC vulva , 66 with VV‐SCC vagina ), 164 uterine corpus cancer controls and 518 population controls were interviewed in a population...

  9. Surface-Enhanced Raman Spectroscopy

    Indian Academy of Sciences (India)

    Home; Journals; Resonance – Journal of Science Education; Volume 15; Issue 2. Surface-Enhanced Raman Spectroscopy - Recent Advancement of Raman Spectroscopy. Ujjal Kumar Sur. General Article Volume 15 Issue 2 February 2010 pp 154-164 ...

  10. Lesotho - Rural Water Supply and Sanitation (United States)

    Millennium Challenge Corporation — The Millennium Challenge Corporation (MCC), through its Compact with the government of Lesotho (GoL), awarded $164-million over five years for investment in improved...

  11. Trends in market share of leading cigarette brands in the USA: national survey on drug use and health 2002-2013

    National Research Council Canada - National Science Library

    Sharma, Anushree; Fix, Brian V; Delnevo, Cristine; Cummings, K Michael; O'Connor, Richard J


    .... Our analysis is restricted to 164,343 current cigarette smokers who were at least 12 years of age or older, had smoked at least one cigarette in the 30 days prior to the survey, and reported a usual...

  12. Rusíni v československých vojenských jednotkách ve Francii 1939-1940

    Czech Academy of Sciences Publication Activity Database

    Maršálek, Zdenko


    Roč. 23, č. 2 (2015), s. 141-164 ISSN 1211-9768 Institutional support: RVO:68378114 Keywords : quantitative approaches * Czechoslovak resistance-in-exile * Ruthenians in France Subject RIV: AB - History

  13. Dagga (cannabis) usage among medical students in Johannesburg

    National Research Council Canada - National Science Library

    Levin, S M; Berman, C; Cobb, H; McIlraith, J


    Of 1 020 undergraduate medical students at the University of the Witwatersrand surveyed in 1981 as regards attitudes to and patterns of illicit drug use 868 completed the questionnaire; 32,4% had tried dagga (cannabis) and 16,4...

  14. The Roles of Employee Engagement as Organization Culture Mediator in Hospital Pharmacy Employees

    Directory of Open Access Journals (Sweden)

    Indah L. Hilmi


    Full Text Available The aims of the study are to analyze the relationship of organization culture on individual performance, customer satisfaction and employee engagement as mediation role in the installation of the hospital pharmacy. A total of 100 employees and 100 customers of the hospital pharmacy become participants in this study. The study used questioner and partial least square techniques. The study results show that there are significance between the organization culture and employee engagement (t value (18.16>t table (1.64, organization culture and customer satisfaction (t values (2.37>t-table (1.64, employee engagement and customer satisfaction (t value (3.26>t-table (1.64. In addition, the results show that there is no significant influence between organization culture and individual performance (t values (1.171.64. Employee engagement mediates the relationship between organization culture and individual performance.

  15. Dicty_cDB: Contig-U11344-1 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available Patent WO2008... 165 6e-39 S25197( S25197 ;S30329) transitional endoplasmic reticulum ATPase ... 165 6e-39...RecName: Full=Transitional endoplasmic reticulum ATPase... 165 6e-39 (Q3ZBT1) RecName: Full=Transitional endoplasmic...reticulum ATPase... 165 6e-39 VPPG( A26360 ;A01627)transitional endoplasmic reticulum ATPase - pig 165 6e-39...cDNA c... 164 8e-39 B71196( B71196 ) probable transitional endoplasmic reticulum ATPas... 164 8e-39 DQ515925_1(...division cy... 164 1e-38 ( P03974 ) RecName: Full=Transitional endoplasmic reticulum ATPase... 164 1e-38 AJ248284_97(

  16. Der Thesaurusgedanke im Grimmschen Worterbuch

    African Journals Online (AJOL)

    Michael Schlaefer, Deutsches Worterbuch,. Akademie der Wissenschaften zu Gottingen, Deutschland .... 164 Michael Schlaefer. Grimmschen Worterbuchs mit einem Thesaurus Linguae ..... keineswegs der gedanke entscheidend, es musse mit gewalt ein ende gemacht werden, um platz fur einen neubau zu schaffen. R ep.

  17. 77 FR 55813 - Meeting of the Board of Visitors of Marine Corps University (United States)


    ... Marine Corps Research Center in room 164. The address is: 2040 Broadway Street, Quantico, Virginia 22134... Board of Visitors, 2076 South Street, Quantico, Virginia 22134, telephone number 703-784-4037. Dated...

  18. 78 FR 48422 - 36(b)(1) Arms Sales Notification (United States)


    ... 155 of Public Law 104-164 dated July 21, 1996. FOR FURTHER INFORMATION CONTACT: Ms. B. English, DSCA... sovereignty by providing a critical component to building its Air Force and achieving air sovereignty. This...

  19. A Reaction Sphere for High Performance Attitude Control Project (United States)

    National Aeronautics and Space Administration — Our innovative reaction sphere (Doty pending patent application serial number 61/164,868) has the potential to provide much higher performance than a conventional...

  20. 76 FR 60469 - 36(b)(1) Arms Sales Notification (United States)


    ... 155 of Public Law 104-164 dated July 21, 1996. FOR FURTHER INFORMATION CONTACT: Ms. B. English, DSCA... Anti-Surface Warfare (ASuW), Search and Rescue, Naval Gun Fire Support, Surveillance, Communications...